Sample records for bacterial trp operons

  1. Positions of Trp Codons in the Leader Peptide-Coding Region of the at Operon Influence Anti-Trap Synthesis and trp Operon Expression in Bacillus licheniformis▿

    PubMed Central

    Levitin, Anastasia; Yanofsky, Charles

    2010-01-01

    Tryptophan, phenylalanine, tyrosine, and several other metabolites are all synthesized from a common precursor, chorismic acid. Since tryptophan is a product of an energetically expensive biosynthetic pathway, bacteria have developed sensing mechanisms to downregulate synthesis of the enzymes of tryptophan formation when synthesis of the amino acid is not needed. In Bacillus subtilis and some other Gram-positive bacteria, trp operon expression is regulated by two proteins, TRAP (the tryptophan-activated RNA binding protein) and AT (the anti-TRAP protein). TRAP is activated by bound tryptophan, and AT synthesis is increased upon accumulation of uncharged tRNATrp. Tryptophan-activated TRAP binds to trp operon leader RNA, generating a terminator structure that promotes transcription termination. AT binds to tryptophan-activated TRAP, inhibiting its RNA binding ability. In B. subtilis, AT synthesis is upregulated both transcriptionally and translationally in response to the accumulation of uncharged tRNATrp. In this paper, we focus on explaining the differences in organization and regulatory functions of the at operon's leader peptide-coding region, rtpLP, of B. subtilis and Bacillus licheniformis. Our objective was to correlate the greater growth sensitivity of B. licheniformis to tryptophan starvation with the spacing of the three Trp codons in its at operon leader peptide-coding region. Our findings suggest that the Trp codon location in rtpLP of B. licheniformis is designed to allow a mild charged-tRNATrp deficiency to expose the Shine-Dalgarno sequence and start codon for the AT protein, leading to increased AT synthesis. PMID:20061467

  2. Influence of the feedback loops in the trp operon of B. subtilis on the system dynamic response and noise amplitude.

    PubMed

    Zamora-Chimal, Criseida; Santillán, Moisés; Rodríguez-González, Jesús

    2012-10-07

    In this paper we introduce a mathematical model for the tryptophan operon regulatory pathway in Bacillus subtilis. This model considers the transcription-attenuation, and the enzyme-inhibition regulatory mechanisms. Special attention is paid to the estimation of all the model parameters from reported experimental data. With the aid of this model we investigate, from a mathematical-modeling point of view, whether the existing multiplicity of regulatory feedback loops is advantageous in some sense, regarding the dynamic response and the biochemical noise in the system. The tryptophan operon dynamic behavior is studied by means of deterministic numeric simulations, while the biochemical noise is analyzed with the aid of stochastic simulations. The model feasibility is tested comparing its stochastic and deterministic results with experimental reports. Our results for the wildtype and for a couple of mutant bacterial strains suggest that the enzyme-inhibition feedback loop, dynamically accelerates the operon response, and plays a major role in the reduction of biochemical noise. Also, the transcription-attenuation feedback loop makes the trp operon sensitive to changes in the endogenous tryptophan level, and increases the amplitude of the biochemical noise. Copyright © 2012 Elsevier Ltd. All rights reserved.

  3. Operon-mapper: A Web Server for Precise Operon Identification in Bacterial and Archaeal Genomes.

    PubMed

    Taboada, Blanca; Estrada, Karel; Ciria, Ricardo; Merino, Enrique

    2018-06-19

    Operon-mapper is a web server that accurately, easily, and directly predicts the operons of any bacterial or archaeal genome sequence. The operon predictions are based on the intergenic distance of neighboring genes as well as the functional relationships of their protein-coding products. To this end, Operon-mapper finds all the ORFs within a given nucleotide sequence, along with their genomic coordinates, orthology groups, and functional relationships. We believe that Operon-mapper, due to its accuracy, simplicity and speed, as well as the relevant information that it generates, will be a useful tool for annotating and characterizing genomic sequences. http://biocomputo.ibt.unam.mx/operon_mapper/.

  4. Problem-Solving Test: Tryptophan Operon Mutants

    ERIC Educational Resources Information Center

    Szeberenyi, Jozsef

    2010-01-01

    This paper presents a problem-solving test that deals with the regulation of the "trp" operon of "Escherichia coli." Two mutants of this operon are described: in mutant A, the operator region of the operon carries a point mutation so that it is unable to carry out its function; mutant B expresses a "trp" repressor protein unable to bind…

  5. Teaching the Big Ideas of Biology with Operon Models

    ERIC Educational Resources Information Center

    Cooper, Robert A.

    2015-01-01

    This paper presents an activity that engages students in model-based reasoning, requiring them to predict the behavior of the trp and lac operons under different environmental conditions. Students are presented six scenarios for the "trp" operon and five for the "lac" operon. In most of the scenarios, specific mutations have…

  6. Sequence and features of the tryptophan operon of Vibrio parahemolyticus.

    PubMed

    Crawford, I P; Han, C Y; Silverman, M

    1991-01-01

    The nucleotide sequence of the trp operon of the marine enteric bacterium Vibrio parahemolyticus is presented. The gene order E, G, D, C(F), B, A is identical to that of other enterics. The structural genes of the operon are preceded by a long leader region encoding a 41-residue peptide containing five tryptophan residues. The organization of the leader region suggests that transcription of the operon is subject to attenuation control. The promoter-operator region of the V. parahemolyticus trp operon is almost identical to the corresponding promoter-operator of E. coli. The similarities suggest that promoter strength and operator function are identical in the two species, and that transcription initiation is regulated by repression. The operon appears to lack the internal promoter within trpD that is common in terrestrial enteric species.

  7. Interplay of Noisy Gene Expression and Dynamics Explains Patterns of Bacterial Operon Organization

    NASA Astrophysics Data System (ADS)

    Igoshin, Oleg

    2011-03-01

    Bacterial chromosomes are organized into operons -- sets of genes co-transcribed into polycistronic messenger RNA. Hypotheses explaining the emergence and maintenance of operons include proportional co-regulation, horizontal transfer of intact ``selfish'' operons, emergence via gene duplication, and co-production of physically interacting proteins to speed their association. We hypothesized an alternative: operons can reduce or increase intrinsic gene expression noise in a manner dependent on the post-translational interactions, thereby resulting in selection for or against operons in depending on the network architecture. We devised five classes of two-gene network modules and show that the effects of operons on intrinsic noise depend on class membership. Two classes exhibit decreased noise with co-transcription, two others reveal increased noise, and the remaining one does not show a significant difference. To test our modeling predictions we employed bioinformatic analysis to determine the relationship gene expression noise and operon organization. The results confirm the overrepresentation of noise-minimizing operon architectures and provide evidence against other hypotheses. Our results thereby suggest a central role for gene expression noise in selecting for or maintaining operons in bacterial chromosomes. This demonstrates how post-translational network dynamics may provide selective pressure for organizing bacterial chromosomes, and has practical consequences for designing synthetic gene networks. This work is supported by National Institutes of Health grant 1R01GM096189-01.

  8. Ancient Origin of the Tryptophan Operon and the Dynamics of Evolutionary Change†

    PubMed Central

    Xie, Gary; Keyhani, Nemat O.; Bonner; Jensen, Roy A.

    2003-01-01

    The seven conserved enzymatic domains required for tryptophan (Trp) biosynthesis are encoded in seven genetic regions that are organized differently (whole-pathway operons, multiple partial-pathway operons, and dispersed genes) in prokaryotes. A comparative bioinformatics evaluation of the conservation and organization of the genes of Trp biosynthesis in prokaryotic operons should serve as an excellent model for assessing the feasibility of predicting the evolutionary histories of genes and operons associated with other biochemical pathways. These comparisons should provide a better understanding of possible explanations for differences in operon organization in different organisms at a genomics level. These analyses may also permit identification of some of the prevailing forces that dictated specific gene rearrangements during the course of evolution. Operons concerned with Trp biosynthesis in prokaryotes have been in a dynamic state of flux. Analysis of closely related organisms among the Bacteria at various phylogenetic nodes reveals many examples of operon scission, gene dispersal, gene fusion, gene scrambling, and gene loss from which the direction of evolutionary events can be deduced. Two milestone evolutionary events have been mapped to the 16S rRNA tree of Bacteria, one splitting the operon in two, and the other rejoining it by gene fusion. The Archaea, though less resolved due to a lesser genome representation, appear to exhibit more gene scrambling than the Bacteria. The trp operon appears to have been an ancient innovation; it was already present in the common ancestor of Bacteria and Archaea. Although the operon has been subjected, even in recent times, to dynamic changes in gene rearrangement, the ancestral gene order can be deduced with confidence. The evolutionary history of the genes of the pathway is discernible in rough outline as a vertical line of descent, with events of lateral gene transfer or paralogy enriching the analysis as interesting

  9. A method for constructing single-copy lac fusions in Salmonella typhimurium and its application to the hemA-prfA operon.

    PubMed

    Elliott, T

    1992-01-01

    This report describes a set of Escherichia coli and Salmonella typhimurium strains that permits the reversible transfer of lac fusions between a plasmid and either bacterial chromosome. The system relies on homologous recombination in an E. coli recD host for transfer from plasmid to chromosome. This E. coli strain carries the S. typhimurium put operon inserted into trp, and the resulting fusions are of the form trp::put::[Kanr-X-lac], where X is the promoter or gene fragment under study. The put homology flanks the lac fusion segment, so that fusions can be transduced into S. typhimurium, replacing the resident put operon. Subsequent transduction into an S. typhimurium strain with a large chromosomal deletion covering put allows selection for recombinants that inherit the fusion on a plasmid. A transposable version of the put operon was constructed and used to direct lac fusions to novel locations, including the F plasmid and the ara locus. Transductional crosses between strains with fusions bearing different segments of the hemA-prfA operon were used to determine the contribution of the hemA promoter region to expression of the prfA gene and other genes downstream of hemA in S. typhimurium.

  10. Screening a wide host-range, waste-water metagenomic library in tryptophan auxotrophs of Rhizobium leguminosarum and of Escherichia coli reveals different classes of cloned trp genes.

    PubMed

    Li, Youguo; Wexler, Margaret; Richardson, David J; Bond, Philip L; Johnston, Andrew W B

    2005-12-01

    A metagenomic cosmid library was constructed, in which the insert DNA was derived from bacteria in a waste-water treatment plant and the vector was the wide host-range cosmid pLAFR3. The library was screened for clones that could correct defined tryptophan auxotrophs of the alpha-proteobacterium Rhizobium leguminosarum and of Escherichia coli. A total of 26 different cosmids that corrected at least one trp mutant in one or both of these species were obtained. Several cosmids corrected the auxotrophy of one or more R. leguminosarum trp mutants, but not the corresponding mutants in E. coli. Conversely, one cosmid corrected trpA, B, C, D and E mutants of E. coli but none of the trp mutants of R. leguminosarum. Two of the Trp+ cosmids were examined in more detail. One contained a trp operon that resembled that of the pathogen Chlamydophila caviae, containing the unusual kynU gene, which specifies kynureninase. The other, whose trp genes functioned in R. leguminosarum but not in E. coli, contained trpDCFBA in an operon that is likely co-transcribed with five other genes, most of which had no known link with tryptophan synthesis. The sequences of these TRP proteins, and the products of nine other genes encoded by this cosmid, failed to affiliate them with any known bacterial lineage. For one metagenomic cosmid, lac reporter fusions confirmed that its cloned trp genes were transcribed in R. leguminosarum, but not in E. coli. Thus, rhizobia, with their many sigma-factors, may be well-suited hosts for metagenomic libraries, cloned in wide host-range vectors.

  11. The construction of a synthetic Escherichia coli trp promoter and its use in the expression of a synthetic interferon gene.

    PubMed Central

    Windass, J D; Newton, C R; De Maeyer-Guignard, J; Moore, V E; Markham, A F; Edge, M D

    1982-01-01

    An 82 base pair DNA fragment has been synthesised which contains the E. coli trp promoter and operator sequences and also encodes the first Shine Dalgarno sequence of the trp operon. This DNA fragment is flanked by EcoRI and ClaI/TaqI cohesive ends and is thus easy to clone, transfer between vector systems and couple to genes to drive their expression. It has been cloned into plasmid pAT153, producing a convenient trp promoter vector. We have also joined the fragment to a synthetic IFN-alpha 1 gene, using synthetic oligonucleotides to generate a completely natural, highly efficient bacterial translation initiation signal on the promoter proximal side of the IFN gene. Plasmids carrying this construction enable E. coli cells to express IFN-alpha 1 almost constitutively and with significantly higher efficiency than from a lacUV5 promoter based system. Images PMID:6184675

  12. A predictive biophysical model of translational coupling to coordinate and control protein expression in bacterial operons

    PubMed Central

    Tian, Tian; Salis, Howard M.

    2015-01-01

    Natural and engineered genetic systems require the coordinated expression of proteins. In bacteria, translational coupling provides a genetically encoded mechanism to control expression level ratios within multi-cistronic operons. We have developed a sequence-to-function biophysical model of translational coupling to predict expression level ratios in natural operons and to design synthetic operons with desired expression level ratios. To quantitatively measure ribosome re-initiation rates, we designed and characterized 22 bi-cistronic operon variants with systematically modified intergenic distances and upstream translation rates. We then derived a thermodynamic free energy model to calculate de novo initiation rates as a result of ribosome-assisted unfolding of intergenic RNA structures. The complete biophysical model has only five free parameters, but was able to accurately predict downstream translation rates for 120 synthetic bi-cistronic and tri-cistronic operons with rationally designed intergenic regions and systematically increased upstream translation rates. The biophysical model also accurately predicted the translation rates of the nine protein atp operon, compared to ribosome profiling measurements. Altogether, the biophysical model quantitatively predicts how translational coupling controls protein expression levels in synthetic and natural bacterial operons, providing a deeper understanding of an important post-transcriptional regulatory mechanism and offering the ability to rationally engineer operons with desired behaviors. PMID:26117546

  13. Selfish operons: the evolutionary impact of gene clustering in prokaryotes and eukaryotes.

    PubMed

    Lawrence, J

    1999-12-01

    The Selfish Operon Model postulates that the organization of bacterial genes into operons is beneficial to the constituent genes in that proximity allows horizontal cotransfer of all genes required for a selectable phenotype; eukaryotic operons formed for very different reasons. Horizontal transfer of selfish operons most probably promotes bacterial diversification.

  14. TRP and rhodopsin transport depends on dual XPORT ER chaperones encoded by an operon

    PubMed Central

    Chen, Zijing; Chen, Hsiang-Chin; Montell, Craig

    2015-01-01

    Summary TRP channels and G protein-coupled receptors (GPCR) play critical roles in sensory reception. However, the identities of the chaperones that assist GPCRs in translocating from the endoplasmic reticulum (ER) are limited, and TRP ER chaperones are virtually unknown. The one exception for TRPs is Drosophila XPORT. Here, we show that the xport locus is bicistronic, and encodes unrelated transmembrane proteins, which enable the signaling proteins that initiate and culminate phototransduction, rhodopsin 1 (Rh1) and TRP, to traffic to the plasma membrane. XPORT-A and XPORT-B are ER proteins, and loss of either has a profound impact on TRP and Rh1 targeting to the light-sensing compartment of photoreceptor cells. XPORT-B complexed in vivo with the Drosophila homolog of the mammalian HSP70 protein, GRP78/BiP, which in turn associated with Rh1. Our work highlights a coordinated network of chaperones required for the biosynthesis of the TRP channel and rhodopsin in Drosophila photoreceptor cells. PMID:26456832

  15. Development and validation of an rDNA operon based primer walking strategy applicable to de novo bacterial genome finishing

    PubMed Central

    Eastman, Alexander W.; Yuan, Ze-Chun

    2015-01-01

    Advances in sequencing technology have drastically increased the depth and feasibility of bacterial genome sequencing. However, little information is available that details the specific techniques and procedures employed during genome sequencing despite the large numbers of published genomes. Shotgun approaches employed by second-generation sequencing platforms has necessitated the development of robust bioinformatics tools for in silico assembly, and complete assembly is limited by the presence of repetitive DNA sequences and multi-copy operons. Typically, re-sequencing with multiple platforms and laborious, targeted Sanger sequencing are employed to finish a draft bacterial genome. Here we describe a novel strategy based on the identification and targeted sequencing of repetitive rDNA operons to expedite bacterial genome assembly and finishing. Our strategy was validated by finishing the genome of Paenibacillus polymyxa strain CR1, a bacterium with potential in sustainable agriculture and bio-based processes. An analysis of the 38 contigs contained in the P. polymyxa strain CR1 draft genome revealed 12 repetitive rDNA operons with varied intragenic and flanking regions of variable length, unanimously located at contig boundaries and within contig gaps. These highly similar but not identical rDNA operons were experimentally verified and sequenced simultaneously with multiple, specially designed primer sets. This approach also identified and corrected significant sequence rearrangement generated during the initial in silico assembly of sequencing reads. Our approach reduces the required effort associated with blind primer walking for contig assembly, increasing both the speed and feasibility of genome finishing. Our study further reinforces the notion that repetitive DNA elements are major limiting factors for genome finishing. Moreover, we provided a step-by-step workflow for genome finishing, which may guide future bacterial genome finishing projects. PMID

  16. An operon for production of bioactive gibberellin A4 phytohormone with wide distribution in the bacterial rice leaf streak pathogen Xanthomonas oryzae pv. oryzicola

    PubMed Central

    Nagel, Raimund; Turrini, Paula C. G.; Nett, Ryan S.; Leach, Jan E.; Verdier, Valérie; Van Sluys, Marie-Anne; Peters, Reuben J.

    2016-01-01

    Summary Phytopathogens have developed elaborate mechanisms to attenuate the defense response of their host plants, including convergent evolution of complex pathways for production of the gibberellin (GA) phytohormones, which were actually first isolated from the rice fungal pathogen Gibberella fujikuroi. The rice bacterial pathogen Xanthomonas oryzae pv. oryzicola (Xoc) has been demonstrated to contain a biosynthetic operon with cyclases capable of producing the universal GA precursor ent-kaurene. Genetic (knock-out) studies indicate that the derived diterpenoid serves as a virulence factor for this rice leaf streak pathogen, serving to reduce the jasmonic acid (JA) mediated defense response.Here the function of the remaining genes in the Xoc operon are elucidated and the distribution of the operon in X. oryzae investigated in over 100 isolates.The Xoc operon leads to production of the bioactive GA4, an additional step beyond production of the penultimate precursor GA9 mediated by the homologous operons recently characterized from rhizobia. Moreover, this GA biosynthetic operon was found to be widespread in Xoc (>90%), but absent in the other major oryzae pathovar.These results indicate selective pressure for production of GA4 in the distinct lifestyle of Xoc, and the importance of GA to both fungal and bacterial pathogens of rice. PMID:28134995

  17. Evolutionary differences in chromosomal locations of four early genes of the tryptophan pathway in fluorescent pseudomonads: DNA sequences and characterization of Pseudomonas putida trpE and trpGDC.

    PubMed

    Essar, D W; Eberly, L; Crawford, I P

    1990-02-01

    Pseudomonas putida possesses seven structural genes for enzymes of the tryptophan pathway. All but one, trpG, which encodes the small (beta) subunit of anthranilate synthase, have been mapped on the circular chromosome. This report describes the cloning and sequencing of P. putida trpE, trpG, trpD, and trpC. In P. putida and Pseudomonas aeruginosa, DNA sequence analysis as well as growth and enzyme assays of insertionally inactivated strains indicated that trpG is the first gene in a three-gene operon that also contains trpD and trpC. In P. putida, trpE is 2.2 kilobases upstream from the trpGDC cluster, whereas in P. aeruginosa, they are separated by at least 25 kilobases (T. Shinomiya, S. Shiga, and M. Kageyama, Mol. Gen. Genet., 189:382-389, 1983). The DNA sequence in P. putida shows an open reading frame on the opposite strand between trpE and trpGDC; this putative gene was not characterized. Evidence is also presented for sequence similarities in the 5' untranslated regions of trpE and trpGDC in both pseudomonads; the function of these regions is unknown, but it is possible that they play some role in regulation of these genes, since all the genes respond to repression by tryptophan. The sequences of the anthranilate synthase genes in the fluorescent pseudomonads resemble those of p-aminobenzoate synthase genes of the enteric bacteria more closely than the anthranilate synthase genes of those organisms; however, no requirement for p-aminobenzoate was found in the Pseudomonas mutants created in this study.

  18. An operon for production of bioactive gibberellin A4 phytohormone with wide distribution in the bacterial rice leaf streak pathogen Xanthomonas oryzae pv. oryzicola.

    PubMed

    Nagel, Raimund; Turrini, Paula C G; Nett, Ryan S; Leach, Jan E; Verdier, Valérie; Van Sluys, Marie-Anne; Peters, Reuben J

    2017-05-01

    Phytopathogens have developed elaborate mechanisms to attenuate the defense response of their host plants, including convergent evolution of complex pathways for production of the GA phytohormones, which were actually first isolated from the rice fungal pathogen Gibberella fujikuroi. The rice bacterial pathogen Xanthomonas oryzae pv. oryzicola (Xoc) has been demonstrated to contain a biosynthetic operon with cyclases capable of producing the universal GA precursor ent-kaurene. Genetic (knock-out) studies indicate that the derived diterpenoid serves as a virulence factor for this rice leaf streak pathogen, serving to reduce the jasmonic acid-mediated defense response. Here the functions of the remaining genes in the Xoc operon are elucidated and the distribution of the operon in X. oryzae is investigated in over 100 isolates. The Xoc operon leads to production of the bioactive GA 4 , an additional step beyond production of the penultimate precursor GA 9 mediated by the homologous operons recently characterized from rhizobia. Moreover, this GA biosynthetic operon was found to be widespread in Xoc (> 90%), but absent in the other major X. oryzae pathovar. These results indicate selective pressure for production of GA 4 in the distinct lifestyle of Xoc, and the importance of GA to both fungal and bacterial pathogens of rice. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

  19. Bacterial cellulose biosynthesis: diversity of operons, subunits, products, and functions.

    PubMed

    Römling, Ute; Galperin, Michael Y

    2015-09-01

    Recent studies of bacterial cellulose biosynthesis, including structural characterization of a functional cellulose synthase complex, provided the first mechanistic insight into this fascinating process. In most studied bacteria, just two subunits, BcsA and BcsB, are necessary and sufficient for the formation of the polysaccharide chain in vitro. Other subunits - which differ among various taxa - affect the enzymatic activity and product yield in vivo by modulating (i) the expression of the biosynthesis apparatus, (ii) the export of the nascent β-D-glucan polymer to the cell surface, and (iii) the organization of cellulose fibers into a higher-order structure. These auxiliary subunits play key roles in determining the quantity and structure of resulting biofilms, which is particularly important for the interactions of bacteria with higher organisms - leading to rhizosphere colonization and modulating the virulence of cellulose-producing bacterial pathogens inside and outside of host cells. We review the organization of four principal types of cellulose synthase operon found in various bacterial genomes, identify additional bcs genes that encode components of the cellulose biosynthesis and secretion machinery, and propose a unified nomenclature for these genes and subunits. We also discuss the role of cellulose as a key component of biofilms and in the choice between acute infection and persistence in the host. Copyright © 2015 Elsevier Ltd. All rights reserved.

  20. Bacterial cellulose biosynthesis: diversity of operons, subunits, products and functions

    PubMed Central

    Römling, Ute; Galperin, Michael Y.

    2015-01-01

    Summary Recent studies of bacterial cellulose biosynthesis, including structural characterization of a functional cellulose synthase complex, provided the first mechanistic insight into this fascinating process. In most studied bacteria, just two subunits, BcsA and BcsB, are necessary and sufficient for the formation of the polysaccharide chain in vitro. Other subunits – which differ among various taxa – affect the enzymatic activity and product yield in vivo by modulating expression of biosynthesis apparatus, export of the nascent β-D-glucan polymer to the cell surface, and the organization of cellulose fibers into a higher-order structure. These auxiliary subunits play key roles in determining the quantity and structure of the resulting biofilm, which is particularly important for interactions of bacteria with higher organisms that lead to rhizosphere colonization and modulate virulence of cellulose-producing bacterial pathogens inside and outside of host cells. Here we review the organization of four principal types of cellulose synthase operons found in various bacterial genomes, identify additional bcs genes that encode likely components of the cellulose biosynthesis and secretion machinery, and propose a unified nomenclature for these genes and subunits. We also discuss the role of cellulose as a key component of biofilms formed by a variety of free-living and pathogenic bacteria and, for the latter, in the choice between acute infection and persistence in the host. PMID:26077867

  1. Unprecedented high-resolution view of bacterial operon architecture revealed by RNA sequencing.

    PubMed

    Conway, Tyrrell; Creecy, James P; Maddox, Scott M; Grissom, Joe E; Conkle, Trevor L; Shadid, Tyler M; Teramoto, Jun; San Miguel, Phillip; Shimada, Tomohiro; Ishihama, Akira; Mori, Hirotada; Wanner, Barry L

    2014-07-08

    We analyzed the transcriptome of Escherichia coli K-12 by strand-specific RNA sequencing at single-nucleotide resolution during steady-state (logarithmic-phase) growth and upon entry into stationary phase in glucose minimal medium. To generate high-resolution transcriptome maps, we developed an organizational schema which showed that in practice only three features are required to define operon architecture: the promoter, terminator, and deep RNA sequence read coverage. We precisely annotated 2,122 promoters and 1,774 terminators, defining 1,510 operons with an average of 1.98 genes per operon. Our analyses revealed an unprecedented view of E. coli operon architecture. A large proportion (36%) of operons are complex with internal promoters or terminators that generate multiple transcription units. For 43% of operons, we observed differential expression of polycistronic genes, despite being in the same operons, indicating that E. coli operon architecture allows fine-tuning of gene expression. We found that 276 of 370 convergent operons terminate inefficiently, generating complementary 3' transcript ends which overlap on average by 286 nucleotides, and 136 of 388 divergent operons have promoters arranged such that their 5' ends overlap on average by 168 nucleotides. We found 89 antisense transcripts of 397-nucleotide average length, 7 unannotated transcripts within intergenic regions, and 18 sense transcripts that completely overlap operons on the opposite strand. Of 519 overlapping transcripts, 75% correspond to sequences that are highly conserved in E. coli (>50 genomes). Our data extend recent studies showing unexpected transcriptome complexity in several bacteria and suggest that antisense RNA regulation is widespread. Importance: We precisely mapped the 5' and 3' ends of RNA transcripts across the E. coli K-12 genome by using a single-nucleotide analytical approach. Our resulting high-resolution transcriptome maps show that ca. one-third of E. coli operons are

  2. Exploiting rRNA operon copy number to investigate bacterial reproductive strategies.

    PubMed

    Roller, Benjamin R K; Stoddard, Steven F; Schmidt, Thomas M

    2016-09-12

    The potential for rapid reproduction is a hallmark of microbial life, but microbes in nature must also survive and compete when growth is constrained by resource availability. Successful reproduction requires different strategies when resources are scarce and when they are abundant 1,2 , but a systematic framework for predicting these reproductive strategies in bacteria has not been available. Here, we show that the number of ribosomal RNA operons (rrn) in bacterial genomes predicts two important components of reproduction-growth rate and growth efficiency-which are favoured under contrasting regimes of resource availability 3,4 . We find that the maximum reproductive rate of bacteria doubles with a doubling of rrn copy number, and the efficiency of carbon use is inversely related to maximal growth rate and rrn copy number. We also identify a feasible explanation for these patterns: the rate and yield of protein synthesis mirror the overall pattern in maximum growth rate and growth efficiency. Furthermore, comparative analysis of genomes from 1,167 bacterial species reveals that rrn copy number predicts traits associated with resource availability, including chemotaxis and genome streamlining. Genome-wide patterns of orthologous gene content covary with rrn copy number, suggesting convergent evolution in response to resource availability. Our findings imply that basic cellular processes adapt in contrasting ways to long-term differences in resource availability. They also establish a basis for predicting changes in bacterial community composition in response to resource perturbations using rrn copy number measurements 5 or inferences 6,7 .

  3. TRAP binding to the Bacillus subtilis trp leader region RNA causes efficient transcription termination at a weak intrinsic terminator

    PubMed Central

    Potter, Kristine D.; Merlino, Natalie M.; Jacobs, Timothy; Gollnick, Paul

    2011-01-01

    The Bacillus subtilis trpEDCFBA operon is regulated by a transcription attenuation mechanism controlled by the trp RNA-binding attenuation protein (TRAP). TRAP binds to 11 (G/U)AG repeats in the trp leader transcript and prevents formation of an antiterminator, which allows formation of an intrinsic terminator (attenuator). Previously, formation of the attenuator RNA structure was believed to be solely responsible for signaling RNA polymerase (RNAP) to halt transcription. However, base substitutions that prevent formation of the antiterminator, and thus allow the attenuator structure to form constitutively, do not result in efficient transcription termination. The observation that the attenuator requires the presence of TRAP bound to the nascent RNA to cause efficient transcription termination suggests TRAP has an additional role in causing termination at the attenuator. We show that the trp attenuator is a weak intrinsic terminator due to low GC content of the hairpin stem and interruptions in the U-stretch following the hairpin. We also provide evidence that termination at the trp attenuator requires forward translocation of RNA polymerase and that TRAP binding to the nascent transcript can induce this activity. PMID:21097886

  4. TRAP binding to the Bacillus subtilis trp leader region RNA causes efficient transcription termination at a weak intrinsic terminator.

    PubMed

    Potter, Kristine D; Merlino, Natalie M; Jacobs, Timothy; Gollnick, Paul

    2011-03-01

    The Bacillus subtilis trpEDCFBA operon is regulated by a transcription attenuation mechanism controlled by the trp RNA-binding attenuation protein (TRAP). TRAP binds to 11 (G/U)AG repeats in the trp leader transcript and prevents formation of an antiterminator, which allows formation of an intrinsic terminator (attenuator). Previously, formation of the attenuator RNA structure was believed to be solely responsible for signaling RNA polymerase (RNAP) to halt transcription. However, base substitutions that prevent formation of the antiterminator, and thus allow the attenuator structure to form constitutively, do not result in efficient transcription termination. The observation that the attenuator requires the presence of TRAP bound to the nascent RNA to cause efficient transcription termination suggests TRAP has an additional role in causing termination at the attenuator. We show that the trp attenuator is a weak intrinsic terminator due to low GC content of the hairpin stem and interruptions in the U-stretch following the hairpin. We also provide evidence that termination at the trp attenuator requires forward translocation of RNA polymerase and that TRAP binding to the nascent transcript can induce this activity.

  5. High accuracy operon prediction method based on STRING database scores.

    PubMed

    Taboada, Blanca; Verde, Cristina; Merino, Enrique

    2010-07-01

    We present a simple and highly accurate computational method for operon prediction, based on intergenic distances and functional relationships between the protein products of contiguous genes, as defined by STRING database (Jensen,L.J., Kuhn,M., Stark,M., Chaffron,S., Creevey,C., Muller,J., Doerks,T., Julien,P., Roth,A., Simonovic,M. et al. (2009) STRING 8-a global view on proteins and their functional interactions in 630 organisms. Nucleic Acids Res., 37, D412-D416). These two parameters were used to train a neural network on a subset of experimentally characterized Escherichia coli and Bacillus subtilis operons. Our predictive model was successfully tested on the set of experimentally defined operons in E. coli and B. subtilis, with accuracies of 94.6 and 93.3%, respectively. As far as we know, these are the highest accuracies ever obtained for predicting bacterial operons. Furthermore, in order to evaluate the predictable accuracy of our model when using an organism's data set for the training procedure, and a different organism's data set for testing, we repeated the E. coli operon prediction analysis using a neural network trained with B. subtilis data, and a B. subtilis analysis using a neural network trained with E. coli data. Even for these cases, the accuracies reached with our method were outstandingly high, 91.5 and 93%, respectively. These results show the potential use of our method for accurately predicting the operons of any other organism. Our operon predictions for fully-sequenced genomes are available at http://operons.ibt.unam.mx/OperonPredictor/.

  6. TRP Channels

    NASA Astrophysics Data System (ADS)

    Voets, Thomas; Owsianik, Grzegorz; Nilius, Bernd

    The TRP superfamily represents a highly diverse group of cation-permeable ion channels related to the product of the Drosophila trp (transient receptor potential) gene. The cloning and characterization of members of this cation channel family has experienced a remarkable growth during the last decade, uncovering a wealth of information concerning the role of TRP channels in a variety of cell types, tissues, and species. Initially, TRP channels were mainly considered as phospholipase C (PLC)-dependent and/or store-operated Ca2+-permeable cation channels. More recent research has highlighted the sensitivity of TRP channels to a broad array of chemical and physical stimuli, allowing them to function as dedicated biological sensors involved in processes ranging from vision to taste, tactile sensation, and hearing. Moreover, the tailored selectivity of certain TRP channels enables them to play key roles in the cellular uptake and/or transepithelial transport of Ca2+, Mg2+, and trace metal ions. In this chapter we give a brief overview of the TRP channel superfamily followed by a survey of current knowledge concerning their structure and activation mechanisms.

  7. Regulation of Drosophila transient receptor potential-like (TrpL) channels by phospholipase C-dependent mechanisms.

    PubMed

    Estacion, M; Sinkins, W G; Schilling, W P

    2001-01-01

    Patch clamp and fura-2 fluorescence were employed to characterize receptor-mediated activation of recombinant Drosophila TrpL channels expressed in Sf9 insect cells. TrpL was activated by receptor stimulation and by exogenous application of diacylglycerol (DAG) or poly-unsaturated fatty acids (PUFAs). Activation of TrpL was blocked more than 70% by U73122, suggesting that the effect of these agents was dependent upon phospholipase C (PLC). In fura-2 assays, extracellular application of bacterial phosphatidylinositol (PI)-PLC or phosphatidylcholine (PC)-PLC caused a transient increase in TrpL channel activity, the magnitude of which was significantly less than that observed following receptor stimulation. TrpL channels were also activated in excised inside-out patches by cytoplasmic application of mammalian PLC-b2, bacterial PI-PLC and PC-PLC, but not by phospholipase D (PLD). The phospholipases had little or no effect when examined in either whole-cell or cell-attached configurations.TrpL activity was inhibited by addition of phosphatidylinositol-4,5-bisphosphate (PIP2) to excised inside-out membrane patches exhibiting spontaneous channel activity or to patches pre-activated by treatment with PLC. The effect was reversible, specific for PIP2, and was not observed with phosphatidylethanolamine (PE), PI, PC or phosphatidylserine (PS). However, antibodies against PIP2 consistently failed to activate TrpL in inside-out patches. It is concluded that both the hydrolysis of PIP2 and the generation of DAG are required to rapidly activate TrpL following receptor stimulation, or that some other PLC-dependent mechanism plays a crucial role in the activation process.

  8. Problem-Solving Test: Attenuation--A Mechanism to Regulate Bacterial Tryptophan Biosynthesis

    ERIC Educational Resources Information Center

    Szeberenyi, Jozsef

    2010-01-01

    Terms to be familiar with before you start to solve the test: tryptophan, transcription unit, operon, "trp" repressor, corepressor, operator, promoter, palindrome, initiation, elongation, and termination of transcription, open reading frame, coupled transcription/translation, chromosome-polysome complex. (Contains 2 figures and 1 footnote.)

  9. Extrachromosomal Nucleolus-Like Compartmentalization by a Plasmid-Borne Ribosomal RNA Operon and Its Role in Nucleoid Compaction.

    PubMed

    Mata Martin, Carmen; Sun, Zhe; Zhou, Yan Ning; Jin, Ding Jun

    2018-01-01

    In the fast-growing Escherichia coli cells, RNA polymerase (RNAP) molecules are concentrated and form foci at clusters of ribosomal RNA (rRNA) operons resembling eukaryotic nucleolus. The bacterial nucleolus-like organization, spatially compartmentalized at the surface of the compact bacterial chromosome (nucleoid), serves as transcription factories for rRNA synthesis and ribosome biogenesis, which influences the organization of the nucleoid. Unlike wild type that has seven rRNA operons in the genome in a mutant that has six (Δ6 rrn ) rRNA operons deleted in the genome, there are no apparent transcription foci and the nucleoid becomes uncompacted, indicating that formation of RNAP foci requires multiple copies of rRNA operons clustered in space and is critical for nucleoid compaction. It has not been determined, however, whether a multicopy plasmid-borne rRNA operon (p rrnB ) could substitute the multiple chromosomal rRNA operons for the organization of the bacterial nucleolus-like structure in the mutants of Δ6 rrn and Δ7 rrn that has all seven rRNA operons deleted in the genome. We hypothesized that extrachromosomal nucleolus-like structures are similarly organized and functional in trans from p rrnB in these mutants. In this report, using multicolor images of three-dimensional superresolution Structured Illumination Microscopy (3D-SIM), we determined the distributions of both RNAP and NusB that are a transcription factor involved in rRNA synthesis and ribosome biogenesis, p rrnB clustering, and nucleoid structure in these two mutants in response to environmental cues. Our results found that the extrachromosomal nucleolus-like organization tends to be spatially located at the poles of the mutant cells. In addition, formation of RNAP foci at the extrachromosomal nucleolus-like structure condenses the nucleoid, supporting the idea that active transcription at the nucleolus-like organization is a driving force in nucleoid compaction.

  10. Variability of rRNA Operon Copy Number and Growth Rate Dynamics of Bacillus Isolated from an Extremely Oligotrophic Aquatic Ecosystem

    PubMed Central

    Valdivia-Anistro, Jorge A.; Eguiarte-Fruns, Luis E.; Delgado-Sapién, Gabriela; Márquez-Zacarías, Pedro; Gasca-Pineda, Jaime; Learned, Jennifer; Elser, James J.; Olmedo-Alvarez, Gabriela; Souza, Valeria

    2016-01-01

    The ribosomal RNA (rrn) operon is a key suite of genes related to the production of protein synthesis machinery and thus to bacterial growth physiology. Experimental evidence has suggested an intrinsic relationship between the number of copies of this operon and environmental resource availability, especially the availability of phosphorus (P), because bacteria that live in oligotrophic ecosystems usually have few rrn operons and a slow growth rate. The Cuatro Ciénegas Basin (CCB) is a complex aquatic ecosystem that contains an unusually high microbial diversity that is able to persist under highly oligotrophic conditions. These environmental conditions impose a variety of strong selective pressures that shape the genome dynamics of their inhabitants. The genus Bacillus is one of the most abundant cultivable bacterial groups in the CCB and usually possesses a relatively large number of rrn operon copies (6–15 copies). The main goal of this study was to analyze the variation in the number of rrn operon copies of Bacillus in the CCB and to assess their growth-related properties as well as their stoichiometric balance (N and P content). We defined 18 phylogenetic groups within the Bacilli clade and documented a range of from six to 14 copies of the rrn operon. The growth dynamic of these Bacilli was heterogeneous and did not show a direct relation to the number of operon copies. Physiologically, our results were not consistent with the Growth Rate Hypothesis, since the copies of the rrn operon were decoupled from growth rate. However, we speculate that the diversity of the growth properties of these Bacilli as well as the low P content of their cells in an ample range of rrn copy number is an adaptive response to oligotrophy of the CCB and could represent an ecological mechanism that allows these taxa to coexist. These findings increase the knowledge of the variability in the number of copies of the rrn operon in the genus Bacillus and give insights about the

  11. Detecting uber-operons in prokaryotic genomes

    PubMed Central

    Che, Dongsheng; Li, Guojun; Mao, Fenglou; Wu, Hongwei; Xu, Ying

    2006-01-01

    We present a study on computational identification of uber-operons in a prokaryotic genome, each of which represents a group of operons that are evolutionarily or functionally associated through operons in other (reference) genomes. Uber-operons represent a rich set of footprints of operon evolution, whose full utilization could lead to new and more powerful tools for elucidation of biological pathways and networks than what operons have provided, and a better understanding of prokaryotic genome structures and evolution. Our prediction algorithm predicts uber-operons through identifying groups of functionally or transcriptionally related operons, whose gene sets are conserved across the target and multiple reference genomes. Using this algorithm, we have predicted uber-operons for each of a group of 91 genomes, using the other 90 genomes as references. In particular, we predicted 158 uber-operons in Escherichia coli K12 covering 1830 genes, and found that many of the uber-operons correspond to parts of known regulons or biological pathways or are involved in highly related biological processes based on their Gene Ontology (GO) assignments. For some of the predicted uber-operons that are not parts of known regulons or pathways, our analyses indicate that their genes are highly likely to work together in the same biological processes, suggesting the possibility of new regulons and pathways. We believe that our uber-operon prediction provides a highly useful capability and a rich information source for elucidation of complex biological processes, such as pathways in microbes. All the prediction results are available at our Uber-Operon Database: , the first of its kind. PMID:16682449

  12. Detecting uber-operons in prokaryotic genomes.

    PubMed

    Che, Dongsheng; Li, Guojun; Mao, Fenglou; Wu, Hongwei; Xu, Ying

    2006-01-01

    We present a study on computational identification of uber-operons in a prokaryotic genome, each of which represents a group of operons that are evolutionarily or functionally associated through operons in other (reference) genomes. Uber-operons represent a rich set of footprints of operon evolution, whose full utilization could lead to new and more powerful tools for elucidation of biological pathways and networks than what operons have provided, and a better understanding of prokaryotic genome structures and evolution. Our prediction algorithm predicts uber-operons through identifying groups of functionally or transcriptionally related operons, whose gene sets are conserved across the target and multiple reference genomes. Using this algorithm, we have predicted uber-operons for each of a group of 91 genomes, using the other 90 genomes as references. In particular, we predicted 158 uber-operons in Escherichia coli K12 covering 1830 genes, and found that many of the uber-operons correspond to parts of known regulons or biological pathways or are involved in highly related biological processes based on their Gene Ontology (GO) assignments. For some of the predicted uber-operons that are not parts of known regulons or pathways, our analyses indicate that their genes are highly likely to work together in the same biological processes, suggesting the possibility of new regulons and pathways. We believe that our uber-operon prediction provides a highly useful capability and a rich information source for elucidation of complex biological processes, such as pathways in microbes. All the prediction results are available at our Uber-Operon Database: http://csbl.bmb.uga.edu/uber, the first of its kind.

  13. Fluorescence kinetics of Trp-Trp dipeptide and its derivatives in water via ultrafast fluorescence spectroscopy.

    PubMed

    Jia, Menghui; Yi, Hua; Chang, Mengfang; Cao, Xiaodan; Li, Lei; Zhou, Zhongneng; Pan, Haifeng; Chen, Yan; Zhang, Sanjun; Xu, Jianhua

    2015-08-01

    Ultrafast fluorescence dynamics of Tryptophan-Tryptophan (Trp-Trp/Trp2) dipeptide and its derivatives in water have been investigated using a picosecond resolved time correlated single photon counting (TCSPC) apparatus together with a femtosecond resolved upconversion spectrophotofluorometer. The fluorescence decay profiles at multiple wavelengths were fitted by a global analysis technique. Nanosecond fluorescence kinetics of Trp2, N-tert-butyl carbonyl oxygen-N'-aldehyde group-l-tryptophan-l-tryptophan (NBTrp2), l-tryptophan-l-tryptophan methyl ester (Trp2Me), and N-acetyl-l-tryptophan-l-tryptophan methyl ester (NATrp2Me) exhibit multi-exponential decays with the average lifetimes of 1.99, 3.04, 0.72 and 1.22ns, respectively. Due to the intramolecular interaction between two Trp residues, the "water relaxation" lifetime was observed around 4ps, and it is noticed that Trp2 and its derivatives also exhibit a new decay with a lifetime of ∼100ps, while single-Trp fluorescence decay in dipeptides/proteins shows 20-30ps. The intramolecular interaction lifetime constants of Trp2, NBTrp2, Trp2Me and NATrp2Me were then calculated to be 3.64, 0.93, 11.52 and 2.40ns, respectively. Candidate mechanisms (including heterogeneity, solvent relaxation, quasi static self-quenching or ET/PT quenching) have been discussed. Copyright © 2015. Published by Elsevier B.V.

  14. Molecular Mechanism of TRP Channels

    PubMed Central

    Zheng, Jie

    2013-01-01

    Transient receptor potential (TRP) channels are cellular sensors for a wide spectrum of physical and chemical stimuli. They are involved in the formation of sight, hearing, touch, smell, taste, temperature, and pain sensation. TRP channels also play fundamental roles in cell signaling and allow the host cell to respond to benign or harmful environmental changes. As TRP channel activation is controlled by very diverse processes and, in many cases, exhibits complex polymodal properties, understanding how each TRP channel responds to its unique forms of activation energy is both crucial and challenging. The past two decades witnessed significant advances in understanding the molecular mechanisms that underlie TRP channels activation. This review focuses on our current understanding of the molecular determinants for TRP channel activation. PMID:23720286

  15. Evidence against the selfish operon theory.

    PubMed

    Pál, Csaba; Hurst, Laurence D

    2004-06-01

    According to the selfish operon hypothesis, the clustering of genes and their subsequent organization into operons is beneficial for the constituent genes because it enables the horizontal gene transfer of weakly selected, functionally coupled genes. The majority of these are expected to be non-essential genes. From our analysis of the Escherichia coli genome, we conclude that the selfish operon hypothesis is unlikely to provide a general explanation for clustering nor can it account for the gene composition of operons. Contrary to expectations, essential genes with related functions have an especially strong tendency to cluster, even if they are not in operons. Moreover, essential genes are particularly abundant in operons.

  16. Heteromerization and colocalization of TrpV1 and TrpV2 in mammalian cell lines and rat dorsal root ganglia.

    PubMed

    Rutter, A Richard; Ma, Qing-Ping; Leveridge, Mathew; Bonnert, Timothy P

    2005-11-07

    Coassociation of the vanilloid transient receptor potential (Trp) ion channels, TrpV1 and TrpV2, was investigated by immunoprecipitation and immunofluorescence in transfected mammalian cell lines, rat dorsal root ganglia and spinal cord. TrpV1/TrpV2 heteromeric complexes were coimmunoprecipitated from human embryonic kidney cells and F-11 dorsal root ganglion hybridoma cells following their transient coexpression. Immunofluorescent labelling of transfected F-11 cells revealed colocalization of TrpV1 and TrpV2 at the cell surface. Immunoprecipitation from rat dorsal root ganglion lysates identified a minor population of receptor complexes composed of TrpV1/TrpV2 heteromers, consistent with a small proportion of cells double-labelled with TrpV1 and TrpV2 antibodies in rat dorsal root ganglion sections. TrpV1/TrpV2 receptor complexes may represent a functionally distinct ion channel complex that may increase the diversity observed within the Trp ion channel family.

  17. Biphenyl-Metabolizing Microbial Community and a Functional Operon Revealed in E-Waste-Contaminated Soil.

    PubMed

    Jiang, Longfei; Luo, Chunling; Zhang, Dayi; Song, Mengke; Sun, Yingtao; Zhang, Gan

    2018-05-18

    Primitive electronic waste (e-waste) recycling activities release massive amounts of persistent organic pollutants (POPs) and heavy metals into surrounding soils, posing a major threat to the ecosystem and human health. Microbes capable of metabolizing POPs play important roles in POPs remediation in soils, but their phylotypes and functions remain unclear. Polychlorinated biphenyls (PCBs), one of the main pollutants in e-waste contaminated soils, have drawn increasing attention due to their high persistence, toxicity, and bioaccumulation. In the present study, we employed the culture-independent method of DNA stable-isotope probing to identify active biphenyl and PCB degraders in e-waste-contaminated soil. A total of 19 rare operational taxonomic units and three dominant bacterial genera ( Ralstonia, Cupriavidus, and uncultured bacterium DA101) were enriched in the 13 C heavy DNA fraction, confirming their functions in PCBs metabolism. Additionally, a 13.8 kb bph operon was amplified, containing a bphA gene labeled by 13 C that was concentrated in the heavy DNA fraction. The tetranucleotide signature characteristics of the bph operon suggest that it originated from Ralstonia. The bph operon may be shared by horizontal gene transfer because it contains a transposon gene and is found in various bacterial species. This study gives us a deeper understanding of PCB-degrading mechanisms and provides a potential resource for the bioremediation of PCBs-contaminated soils.

  18. TRP channel proteins and signal transduction.

    PubMed

    Minke, Baruch; Cook, Boaz

    2002-04-01

    TRP channel proteins constitute a large and diverse family of proteins that are expressed in many tissues and cell types. This family was designated TRP because of a spontaneously occurring Drosophila mutant lacking TRP that responded to a continuous light with a transient receptor potential (hence TRP). In addition to responses to light, TRPs mediate responses to nerve growth factor, pheromones, olfaction, mechanical, chemical, temperature, pH, osmolarity, vasorelaxation of blood vessels, and metabolic stress. Furthermore, mutations in several members of TRP-related channel proteins are responsible for several diseases, such as several tumors and neurodegenerative disorders. TRP-related channel proteins are found in a variety of organisms, tissues, and cell types, including nonexcitable, smooth muscle, and neuronal cells. The large functional diversity of TRPs is also reflected in their diverse permeability to ions, although, in general, they are classified as nonselective cationic channels. The molecular domains that are conserved in all members of the TRP family constitute parts of the transmembrane domains and in most members also the ankyrin-like repeats at the NH2 terminal of the protein and a "TRP domain" at the COOH terminal, which is a highly conserved 25-amino acid stretch with still unknown function. All of the above features suggest that members of the TRP family are "special assignment" channels, which are recruited to diverse signaling pathways. The channels' roles and characteristics such as gating mechanism, regulation, and permeability are determined by evolution according to the specific functional requirements.

  19. Evolutionary dynamics of nematode operons: easy come, slow go.

    PubMed

    Qian, Wenfeng; Zhang, Jianzhi

    2008-03-01

    Operons are widespread in prokaryotes, but are uncommon in eukaryotes, except nematode worms, where approximately 15% of genes reside in over 1100 operons in the model organism Caenorhabditis elegans. It is unclear how operons have become abundant in nematode genomes. The "one-way street" hypothesis asserts that once formed by chance, operons are very difficult to break, because the breakage would leave downstream genes in an operon without a promoter, and hence, unexpressed. To test this hypothesis, we analyzed the presence and absence of C. elegans operons in Caenorhabditis briggsae, Caenorhabditis remanei, and Caenorhabditis brenneri, using Pristionchus pacificus and Brugia malayi as outgroups, and identified numerous operon gains and losses. Coupled with experimental examination of trans-splicing patterns, our comparative genomic analysis revealed diverse molecular mechanisms of operon losses, including inversion, insertion, and relocation, but the presence of internal promoters was not found to facilitate operon losses. In several cases, the data allowed inference of mechanisms by which downstream genes are expressed after operon breakage. We found that the rate of operon gain is approximately 3.3 times that of operon loss. Thus, the evolutionary dynamics of nematode operons is better described as "easy come, slow go," rather than a "one-way street." Based on a mathematic model of operon gains and losses and additional assumptions, we projected that the number of operons in C. elegans will continue to rise by 6%-18% in future evolution before reaching equilibrium between operon gains and losses.

  20. TRP channels in the skin

    PubMed Central

    Tóth, Balázs I; Oláh, Attila; Szöllősi, Attila Gábor; Bíró, Tamás

    2014-01-01

    Emerging evidence suggests that transient receptor potential (TRP) ion channels not only act as ‘polymodal cellular sensors’ on sensory neurons but are also functionally expressed by a multitude of non-neuronal cell types. This is especially true in the skin, one of the largest organs of the body, where they appear to be critically involved in regulating various cutaneous functions both under physiological and pathophysiological conditions. In this review, we focus on introducing the roles of several cutaneous TRP channels in the regulation of the skin barrier, skin cell proliferation and differentiation, and immune functions. Moreover, we also describe the putative involvement of several TRP channels in the development of certain skin diseases and identify future TRP channel-targeted therapeutic opportunities. Linked Articles This article is part of a themed section on the pharmacology of TRP channels. To view the other articles in this section visit http://dx.doi.org/10.1111/bph.2014.171.issue-10 PMID:24372189

  1. TRP channels in the skin.

    PubMed

    Tóth, Balázs I; Oláh, Attila; Szöllősi, Attila Gábor; Bíró, Tamás

    2014-05-01

    Emerging evidence suggests that transient receptor potential (TRP) ion channels not only act as 'polymodal cellular sensors' on sensory neurons but are also functionally expressed by a multitude of non-neuronal cell types. This is especially true in the skin, one of the largest organs of the body, where they appear to be critically involved in regulating various cutaneous functions both under physiological and pathophysiological conditions. In this review, we focus on introducing the roles of several cutaneous TRP channels in the regulation of the skin barrier, skin cell proliferation and differentiation, and immune functions. Moreover, we also describe the putative involvement of several TRP channels in the development of certain skin diseases and identify future TRP channel-targeted therapeutic opportunities. © 2013 The British Pharmacological Society.

  2. Plasmid ColE1 as a Molecular Vehicle for Cloning and Amplification of DNA

    PubMed Central

    Hershfield, Vickers; Boyer, Herbert W.; Yanofsky, Charles; Lovett, Michael A.; Helinski, Donald R.

    1974-01-01

    DNA fragments obtained from EcoRI endonuclease digestion of bacteriophage ϕ80pt190 (trp+) and the plasmid ColE1 were covalently joined with polynucleotide ligase. Transformation of Escherichia coli trp- strains to tryptophan independence with the recombined DNA selected for reconstituted ColE1 plasmids containing the tryptophan operon and the ϕ80 immunity region. Similarly, an EcoRI endonuclease generated fragment of plasmid pSC105 DNA containing the genetic determinant of kanamycin resistance was inserted into the ColE1 plasmid and recovered in E. coli. The plasmids containing the trp operon (ColE1-trp) and the kanamycin resistance gene were maintained under logarithmic growth conditions at a level of 25-30 copies per cell and accumulate to the extent of several hundred copies per cell in the presence of chloramphenicol. Cells carrying the ColE1-trp plasmid determined the production of highly elevated levels of trp operon-specific mRNA and tryptophan biosynthetic enzymes. Images PMID:4610576

  3. The rec A operon: a novel stress response gene cluster in Bacteroides fragilis

    PubMed Central

    Nicholson, Samantha A; Smalley, Darren; Smith, C. Jeffrey; Abratt, Valerie R

    2014-01-01

    Bacteroides fragilis, an opportunistic pathogen of humans, is a leading cause of bacteraemias and anaerobic abscesses which are often treated with metronidazole, a drug which damages DNA. This study investigated the responses of the B. fragilis recA three gene operon to the stress experienced during metronidazole treatment and exposure to reactive oxygen species simulating those generated by the host immune system during infection. A transcriptionally regulated response was observed using quantitative RT-PCR after metronidazole and hydrogen peroxide treatment, with all three genes being upregulated under stress conditions. In vivo and in vitro analysis of the functional role of the second gene of the operon was done using heterologous complementation and protein expression (in Escherichia coli), with subsequent biochemical assay. This gene encoded a functional bacterioferritin co-migratory protein (BCP) which was thiol-specific and had antioxidant properties, including protection of the glutamine synthetase III enzyme. This in vitro data supports the hypothesis that the genes of the operon may be involved in protection of the bacteria from the oxidative burst during tissue invasion and may play a significant role in bacterial survival and metronidazole resistance during treatment of B. fragilis infections. PMID:24703997

  4. Evidence of mercury trapping in biofilm-EPS and mer operon-based volatilization of inorganic mercury in a marine bacterium Bacillus cereus BW-201B.

    PubMed

    Dash, Hirak R; Basu, Subham; Das, Surajit

    2017-04-01

    Biofilm-forming mercury-resistant marine bacterium Bacillus cereus BW-201B has been explored to evident that the bacterial biofilm-EPS (exopolymers) trap inorganic mercury but subsequently release EPS-bound mercury for induction of mer operon-mediated volatilization of inorganic mercury. The isolate was able to tolerate 50 ppm of mercury and forms biofilm in presence of mercury. mer operon-mediated volatilization was confirmed, and -SH was found to be the key functional group of bacterial EPS responsible for mercury binding. Biofilm-EPS-bound mercury was found to be internalized to the bacterial system as confirmed by reversible conformational change of -SH group and increased expression level of merA gene in a timescale experiment. Biofilm-EPS trapped Hg after 24 h of incubation, and by 96 h, the volatilization process reaches to its optimum confirming the internalization of EPS-bound mercury to the bacterial cells. Biofilm disintegration at the same time corroborates the results.

  5. Role of TRP Channels in Dinoflagellate Mechanotransduction.

    PubMed

    Lindström, J B; Pierce, N T; Latz, M I

    2017-10-01

    Transient receptor potential (TRP) ion channels are common components of mechanosensing pathways, mainly described in mammals and other multicellular organisms. To gain insight into the evolutionary origins of eukaryotic mechanosensory proteins, we investigated the involvement of TRP channels in mechanosensing in a unicellular eukaryotic protist, the dinoflagellate Lingulodinium polyedra. BLASTP analysis of the protein sequences predicted from the L. polyedra transcriptome revealed six sequences with high similarity to human TRPM2, TRPM8, TRPML2, TRPP1, and TRPP2; and characteristic TRP domains were identified in all sequences. In a phylogenetic tree including all mammalian TRP subfamilies and TRP channel sequences from unicellular and multicellular organisms, the L. polyedra sequences grouped with the TRPM, TPPML, and TRPP clades. In pharmacological experiments, we used the intrinsic bioluminescence of L. polyedra as a reporter of mechanoresponsivity. Capsaicin and RN1734, agonists of mammalian TRPV, and arachidonic acid, an agonist of mammalian TRPV, TRPA, TRPM, and Drosophila TRP, all stimulated bioluminescence in L. polyedra. Mechanical stimulation of bioluminescence, but not capsaicin-stimulated bioluminescence, was inhibited by gadolinium (Gd 3+ ), a general inhibitor of mechanosensitive ion channels, and the phospholipase C (PLC) inhibitor U73122. These pharmacological results are consistent with the involvement of TRP-like channels in mechanosensing by L. polyedra. The TRP channels do not appear to be mechanoreceptors but rather are components of the mechanotransduction signaling pathway and may be activated via a PLC-dependent mechanism. The presence and function of TRP channels in a dinoflagellate emphasize the evolutionary conservation of both the channel structures and their functions.

  6. Functional Analysis of the Magnetosome Island in Magnetospirillum gryphiswaldense: The mamAB Operon Is Sufficient for Magnetite Biomineralization

    PubMed Central

    Lohße, Anna; Ullrich, Susanne; Katzmann, Emanuel; Borg, Sarah; Wanner, Gerd; Richter, Michael; Voigt, Birgit; Schweder, Thomas; Schüler, Dirk

    2011-01-01

    Bacterial magnetosomes are membrane-enveloped, nanometer-sized crystals of magnetite, which serve for magnetotactic navigation. All genes implicated in the synthesis of these organelles are located in a conserved genomic magnetosome island (MAI). We performed a comprehensive bioinformatic, proteomic and genetic analysis of the MAI in Magnetospirillum gryphiswaldense. By the construction of large deletion mutants we demonstrate that the entire region is dispensable for growth, and the majority of MAI genes have no detectable function in magnetosome formation and could be eliminated without any effect. Only <25% of the region comprising four major operons could be associated with magnetite biomineralization, which correlated with high expression of these genes and their conservation among magnetotactic bacteria. Whereas only deletion of the mamAB operon resulted in the complete loss of magnetic particles, deletion of the conserved mms6, mamGFDC, and mamXY operons led to severe defects in morphology, size and organization of magnetite crystals. However, strains in which these operons were eliminated together retained the ability to synthesize small irregular crystallites, and weakly aligned in magnetic fields. This demonstrates that whereas the mamGFDC, mms6 and mamXY operons have crucial and partially overlapping functions for the formation of functional magnetosomes, the mamAB operon is the only region of the MAI, which is necessary and sufficient for magnetite biomineralization. Our data further reduce the known minimal gene set required for magnetosome formation and will be useful for future genome engineering approaches. PMID:22043287

  7. Differential effects of lipopolysaccharide on mouse sensory TRP channels.

    PubMed

    Boonen, Brett; Alpizar, Yeranddy A; Sanchez, Alicia; López-Requena, Alejandro; Voets, Thomas; Talavera, Karel

    2018-04-14

    Acute neurogenic inflammation and pain associated to bacterial infection have been traditionally ascribed to sensitization and activation of sensory nerve afferents secondary to immune cell stimulation. However, we recently showed that lipopolysaccharides (LPS) directly activate the Transient Receptor Potential channels TRPA1 in sensory neurons and TRPV4 in airway epithelial cells. Here we investigated whether LPS activates other sensory TRP channels expressed in sensory neurons. Using intracellular Ca 2+ imaging and patch-clamp we determined the effects of LPS on recombinant TRPV1, TRPV2, TRPM3 and TRPM8, heterologously expressed in HEK293T cells. We found that LPS activates TRPV1, although with lower potency than for TRPA1. Activation of TRPV1 by LPS was not affected by mutations of residues required for activation by electrophilic agents or by diacylglycerol and capsaicin. On the other hand, LPS weakly activated TRPM3, activated TRPM8 at 25 °C, but not at 35 °C, and was ineffective on TRPV2. Experiments performed in mouse dorsal root ganglion (DRG) neurons revealed that genetic ablation of Trpa1 did not abolish the responses to LPS, but remain detected in 30% of capsaicin-sensitive cells. The population of neurons responding to LPS was dramatically lower in double Trpa1/Trpv1 KO neurons. Our results show that, in addition to TRPA1, other TRP channels in sensory neurons can be targets of LPS, suggesting that they may contribute to trigger and regulate innate defenses against gram-negative bacterial infections. Copyright © 2018 Elsevier Ltd. All rights reserved.

  8. A global analysis of adaptive evolution of operons in cyanobacteria.

    PubMed

    Memon, Danish; Singh, Abhay K; Pakrasi, Himadri B; Wangikar, Pramod P

    2013-02-01

    Operons are an important feature of prokaryotic genomes. Evolution of operons is hypothesized to be adaptive and has contributed significantly towards coordinated optimization of functions. Two conflicting theories, based on (i) in situ formation to achieve co-regulation and (ii) horizontal gene transfer of functionally linked gene clusters, are generally considered to explain why and how operons have evolved. Furthermore, effects of operon evolution on genomic traits such as intergenic spacing, operon size and co-regulation are relatively less explored. Based on the conservation level in a set of diverse prokaryotes, we categorize the operonic gene pair associations and in turn the operons as ancient and recently formed. This allowed us to perform a detailed analysis of operonic structure in cyanobacteria, a morphologically and physiologically diverse group of photoautotrophs. Clustering based on operon conservation showed significant similarity with the 16S rRNA-based phylogeny, which groups the cyanobacterial strains into three clades. Clade C, dominated by strains that are believed to have undergone genome reduction, shows a larger fraction of operonic genes that are tightly packed in larger sized operons. Ancient operons are in general larger, more tightly packed, better optimized for co-regulation and part of key cellular processes. A sub-clade within Clade B, which includes Synechocystis sp. PCC 6803, shows a reverse trend in intergenic spacing. Our results suggest that while in situ formation and vertical descent may be a dominant mechanism of operon evolution in cyanobacteria, optimization of intergenic spacing and co-regulation are part of an ongoing process in the life-cycle of operons.

  9. Role of Tellurite Resistance Operon in Filamentous Growth of Yersinia pestis in Macrophages.

    PubMed

    Ponnusamy, Duraisamy; Clinkenbeard, Kenneth D

    2015-01-01

    Yersinia pestis initiates infection by parasitism of host macrophages. In response to macrophage infections, intracellular Y. pestis can assume a filamentous cellular morphology which may mediate resistance to host cell innate immune responses. We previously observed the expression of Y. pestis tellurite resistance proteins TerD and TerE from the terZABCDE operon during macrophage infections. Others have observed a filamentous response associated with expression of tellurite resistance operon in Escherichia coli exposed to tellurite. Therefore, in this study we examine the potential role of Y. pestis tellurite resistance operon in filamentous cellular morphology during macrophage infections. In vitro treatment of Y. pestis culture with sodium tellurite (Na2TeO3) caused the bacterial cells to assume a filamentous phenotype similar to the filamentous phenotype observed during macrophage infections. A deletion mutant for genes terZAB abolished the filamentous morphologic response to tellurite exposure or intracellular parasitism, but without affecting tellurite resistance. However, a terZABCDE deletion mutant abolished both filamentous morphologic response and tellurite resistance. Complementation of the terZABCDE deletion mutant with terCDE, but not terZAB, partially restored tellurite resistance. When the terZABCDE deletion mutant was complemented with terZAB or terCDE, Y. pestis exhibited filamentous morphology during macrophage infections as well as while these complemented genes were being expressed under an in vitro condition. Further in E. coli, expression of Y. pestis terZAB, but not terCDE, conferred a filamentous phenotype. These findings support the role of Y. pestis terZAB mediation of the filamentous response phenotype; whereas, terCDE confers tellurite resistance. Although the beneficial role of filamentous morphological responses by Y. pestis during macrophage infections is yet to be fully defined, it may be a bacterial adaptive strategy to macrophage

  10. A phylogenomic analysis of the Actinomycetales mce operons.

    PubMed

    Casali, Nicola; Riley, Lee W

    2007-02-26

    The genome of Mycobacterium tuberculosis harbors four copies of a cluster of genes termed mce operons. Despite extensive research that has demonstrated the importance of these operons on infection outcome, their physiological function remains obscure. Expanding databases of complete microbial genome sequences facilitate a comparative genomic approach that can provide valuable insight into the role of uncharacterized proteins. The M. tuberculosis mce loci each include two yrbE and six mce genes, which have homology to ABC transporter permeases and substrate-binding proteins, respectively. Operons with an identical structure were identified in all Mycobacterium species examined, as well as in five other Actinomycetales genera. Some of the Actinomycetales mce operons include an mkl gene, which encodes an ATPase resembling those of ABC uptake transporters. The phylogenetic profile of Mkl orthologs exactly matched that of the Mce and YrbE proteins. Through topology and motif analyses of YrbE homologs, we identified a region within the penultimate cytoplasmic loop that may serve as the site of interaction with the putative cognate Mkl ATPase. Homologs of the exported proteins encoded adjacent to the M. tuberculosis mce operons were detected in a conserved chromosomal location downstream of the majority of Actinomycetales operons. Operons containing linked mkl, yrbE and mce genes, resembling the classic organization of an ABC importer, were found to be common in Gram-negative bacteria and appear to be associated with changes in properties of the cell surface. Evidence presented suggests that the mce operons of Actinomycetales species and related operons in Gram-negative bacteria encode a subfamily of ABC uptake transporters with a possible role in remodeling the cell envelope.

  11. A phylogenomic analysis of the Actinomycetales mce operons

    PubMed Central

    Casali, Nicola; Riley, Lee W

    2007-01-01

    Background The genome of Mycobacterium tuberculosis harbors four copies of a cluster of genes termed mce operons. Despite extensive research that has demonstrated the importance of these operons on infection outcome, their physiological function remains obscure. Expanding databases of complete microbial genome sequences facilitate a comparative genomic approach that can provide valuable insight into the role of uncharacterized proteins. Results The M. tuberculosis mce loci each include two yrbE and six mce genes, which have homology to ABC transporter permeases and substrate-binding proteins, respectively. Operons with an identical structure were identified in all Mycobacterium species examined, as well as in five other Actinomycetales genera. Some of the Actinomycetales mce operons include an mkl gene, which encodes an ATPase resembling those of ABC uptake transporters. The phylogenetic profile of Mkl orthologs exactly matched that of the Mce and YrbE proteins. Through topology and motif analyses of YrbE homologs, we identified a region within the penultimate cytoplasmic loop that may serve as the site of interaction with the putative cognate Mkl ATPase. Homologs of the exported proteins encoded adjacent to the M. tuberculosis mce operons were detected in a conserved chromosomal location downstream of the majority of Actinomycetales operons. Operons containing linked mkl, yrbE and mce genes, resembling the classic organization of an ABC importer, were found to be common in Gram-negative bacteria and appear to be associated with changes in properties of the cell surface. Conclusion Evidence presented suggests that the mce operons of Actinomycetales species and related operons in Gram-negative bacteria encode a subfamily of ABC uptake transporters with a possible role in remodeling the cell envelope. PMID:17324287

  12. Role of TRP channels in the cardiovascular system

    PubMed Central

    Yue, Zhichao; Xie, Jia; Yu, Albert S.; Stock, Jonathan; Du, Jianyang

    2014-01-01

    The transient receptor potential (TRP) superfamily consists of a large number of nonselective cation channels with variable degree of Ca2+-permeability. The 28 mammalian TRP channel proteins can be grouped into six subfamilies: canonical, vanilloid, melastatin, ankyrin, polycystic, and mucolipin TRPs. The majority of these TRP channels are expressed in different cell types including both excitable and nonexcitable cells of the cardiovascular system. Unlike voltage-gated ion channels, TRP channels do not have a typical voltage sensor, but instead can sense a variety of other stimuli including pressure, shear stress, mechanical stretch, oxidative stress, lipid environment alterations, hypertrophic signals, and inflammation products. By integrating multiple stimuli and transducing their activity to downstream cellular signal pathways via Ca2+ entry and/or membrane depolarization, TRP channels play an essential role in regulating fundamental cell functions such as contraction, relaxation, proliferation, differentiation, and cell death. With the use of targeted deletion and transgenic mouse models, recent studies have revealed that TRP channels are involved in numerous cellular functions and play an important role in the pathophysiology of many diseases in the cardiovascular system. Moreover, several TRP channels are involved in inherited diseases of the cardiovascular system. This review presents an overview of current knowledge concerning the physiological functions of TRP channels in the cardiovascular system and their contributions to cardiovascular diseases. Ultimately, TRP channels may become potential therapeutic targets for cardiovascular diseases. PMID:25416190

  13. Role of TRP channels in the cardiovascular system.

    PubMed

    Yue, Zhichao; Xie, Jia; Yu, Albert S; Stock, Jonathan; Du, Jianyang; Yue, Lixia

    2015-02-01

    The transient receptor potential (TRP) superfamily consists of a large number of nonselective cation channels with variable degree of Ca(2+)-permeability. The 28 mammalian TRP channel proteins can be grouped into six subfamilies: canonical, vanilloid, melastatin, ankyrin, polycystic, and mucolipin TRPs. The majority of these TRP channels are expressed in different cell types including both excitable and nonexcitable cells of the cardiovascular system. Unlike voltage-gated ion channels, TRP channels do not have a typical voltage sensor, but instead can sense a variety of other stimuli including pressure, shear stress, mechanical stretch, oxidative stress, lipid environment alterations, hypertrophic signals, and inflammation products. By integrating multiple stimuli and transducing their activity to downstream cellular signal pathways via Ca(2+) entry and/or membrane depolarization, TRP channels play an essential role in regulating fundamental cell functions such as contraction, relaxation, proliferation, differentiation, and cell death. With the use of targeted deletion and transgenic mouse models, recent studies have revealed that TRP channels are involved in numerous cellular functions and play an important role in the pathophysiology of many diseases in the cardiovascular system. Moreover, several TRP channels are involved in inherited diseases of the cardiovascular system. This review presents an overview of current knowledge concerning the physiological functions of TRP channels in the cardiovascular system and their contributions to cardiovascular diseases. Ultimately, TRP channels may become potential therapeutic targets for cardiovascular diseases. Copyright © 2015 the American Physiological Society.

  14. Watch out for your TRP1 marker: the effect of TRP1 gene on the growth at high and low temperatures in budding yeast.

    PubMed

    Leng, Gang; Song, Kiwon

    2016-05-01

    TRP1 is a frequently used auxotrophic marker for genetic modifications and selections in trp(-) budding yeast strains, including the commonly used wild-type strain W303a. However, we found that introduction of the TRP1 gene into a trp(-) strain significantly affected vegetative growth at low and high temperatures. Therefore, caution should be needed when working in a trp(-) background strain and using the TRP1 marker to study stress response phenotypes, particularly when analyzing temperature sensitivities. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  15. A stationary-phase protein of Escherichia coli that affects the mode of association between the trp repressor protein and operator-bearing DNA.

    PubMed

    Yang, W; Ni, L; Somerville, R L

    1993-06-15

    Highly purified preparations of trp repressor (TrpR) protein derived from Escherichia coli strains that were engineered to overexpress this material were found to contain another protein, of 21 kDa. The second protein, designated WrbA [for tryptophan (W) repressor-binding protein] remained associated with its namesake through several sequential protein fractionation steps. The N-terminal amino acid sequence of the WrbA protein guided the design of two degenerate oligonucleotides that were used as probes in the cloning of the wrbA gene (198 codons). The WrbA protein, in purified form, was found by several criteria to enhance the formation and/or stability of noncovalent complexes between TrpR holorepressor and its primary operator targets. The formation of an operator-holorepressor-WrbA ternary complex was demonstrated by gel mobility-shift analysis. The WrbA protein alone does not interact with the trp operator. During the stationary phase, cells deficient in the WrbA protein were less efficient than wild type in their ability to repress the trp promoter. It is proposed that the WrbA protein functions as an accessory element in blocking TrpR-specific transcriptional processes that might be physiologically disadvantageous in the stationary phase of the bacterial life cycle.

  16. Silencing of Essential Genes within a Highly Coordinated Operon in Escherichia coli

    PubMed Central

    Hohmeier, Angela; Stone, Timothy C.; Offord, Victoria; Sarabia, Francisco; Garcia-Ruiz, Cristina; Good, Liam

    2015-01-01

    Essential bacterial genes located within operons are particularly challenging to study independently because of coordinated gene expression and the nonviability of knockout mutants. Essentiality scores for many operon genes remain uncertain. Antisense RNA (asRNA) silencing or in-frame gene disruption of genes may help establish essentiality but can lead to polar effects on genes downstream or upstream of the target gene. Here, the Escherichia coli ribF-ileS-lspA-fkpB-ispH operon was used to evaluate the possibility of independently studying an essential gene using expressed asRNA and target gene overexpression to deregulate coupled expression. The gene requirement for growth in conditional silencing strains was determined by the relationship of target mRNA reduction with growth inhibition as the minimum transcript level required for 50% growth (MTL50). Mupirocin and globomycin, the protein inhibitors of IleS and LspA, respectively, were used in sensitization assays of strains containing both asRNA-expressing and open reading frame-expressing plasmids to examine deregulation of the overlapping ileS-lspA genes. We found upstream and downstream polar silencing effects when either ileS or lspA was silenced, indicating coupled expression. Weighted MTL50 values (means and standard deviations) of ribF, ileS, and lspA were 0.65 ± 0.18, 0.64 ± 0.06, and 0.76 ± 0.10, respectively. However, they were not significantly different (P = 0.71 by weighted one-way analysis of variance). The gene requirement for ispH could not be determined due to insufficient growth reduction. Mupirocin and globomycin sensitization experiments indicated that ileS-lspA expression could not be decoupled. The results highlight the inherent challenges associated with genetic analyses of operons; however, coupling of essential genes may provide opportunities to improve RNA-silencing antimicrobials. PMID:26070674

  17. Hypermutation in derepressed operons of Escherichia coli K12

    PubMed Central

    Wright, Barbara E.; Longacre, Angelika; Reimers, Jacqueline M.

    1999-01-01

    This article presents evidence that starvation for leucine in an Escherichia coli auxotroph triggers metabolic activities that specifically target the leu operon for derepression, increased rates of transcription, and mutation. Derepression of the leu operon was a prerequisite for its activation by the signal nucleotide, guanosine tetraphosphate, which accumulates in response to nutritional stress (the stringent response). A quantitative correlation was established between leuB mRNA abundance and leuB− reversion rates. To further demonstrate that derepression increased mutation rates, the chromosomal leu operon was placed under the control of the inducible tac promoter. When the leu operon was induced by isopropyl-d-thiogalactoside, both leuB mRNA abundance and leuB− reversion rates increased. These investigations suggest that guanosine tetraphosphate may contribute as much as attenuation in regulating leu operon expression and that higher rates of mutation are specifically associated with the derepressed leu operon. PMID:10220423

  18. Bioluminescent symbionts of the Caribbean flashlight fish (Kryptophanaron alfredi) have a single rRNA operon.

    PubMed

    Wolfe, C J; Haygood, M G

    1993-08-01

    Ribosomal RNA (rRNA) operon copy number and gene order were determined for the luminous bacterial symbiont of Kryptophanaron alfredi, an anomalopid (flashlight) fish, and estimated for the luminous symbionts of 3 other fish families and of 3 luminous seawater isolates. Compared with the seawater isolates and other fish symbionts, the copy number of rRNA genes in the K. alfredi symbiont was radically reduced, although gene order appeared conserved among all the strains. The K. alfredi symbiont possesses only a single rRNA operon, whereas the other strains examined have minimum copy numbers ranging from 8 to 11. No difference in copy number was observed between light organ and seawater isolates of the same species, or between isolates of the same species from the light organs of 2 different host families. Thus, the anomalopid symbiosis appears unique among characterized light organ symbioses.

  19. Drosophila TRP and TRPL are assembled as homomultimeric channels in vivo.

    PubMed

    Katz, Ben; Oberacker, Tina; Richter, David; Tzadok, Hanan; Peters, Maximilian; Minke, Baruch; Huber, Armin

    2013-07-15

    Family members of the cationic transient receptor potential (TRP) channels serve as sensors and transducers of environmental stimuli. The ability of different TRP channel isoforms of specific subfamilies to form heteromultimers and the structural requirements for channel assembly are still unresolved. Although heteromultimerization of different mammalian TRP channels within single subfamilies has been described, even within a subfamily (such as TRPC) not all members co-assemble with each other. In Drosophila photoreceptors two TRPC channels, TRP and TRP-like protein (TRPL) are expressed together in photoreceptors where they generate the light-induced current. The formation of functional TRP-TRPL heteromultimers in cell culture and in vitro has been reported. However, functional in vivo assays have shown that each channel functions independently of the other. Therefore, the issue of whether TRP and TRPL form heteromultimers in vivo is still unclear. In the present study we investigated the ability of TRP and TRPL to form heteromultimers, and the structural requirements for channel assembly, by studying assembly of GFP-tagged TRP and TRPL channels and chimeric TRP and TRPL channels, in vivo. Interaction studies of tagged and native channels as well as native and chimeric TRP-TRPL channels using co-immunoprecipitation, immunocytochemistry and electrophysiology, critically tested the ability of TRP and TRPL to interact. We found that TRP and TRPL assemble exclusively as homomultimeric channels in their native environment. The above analyses revealed that the transmembrane regions of TRP and TRPL do not determine assemble specificity of these channels. However, the C-terminal regions of both TRP and TRPL predominantly specify the assembly of homomeric TRP and TRPL channels.

  20. Gene context conservation of a higher order than operons.

    PubMed

    Lathe, W C; Snel, B; Bork, P

    2000-10-01

    Operons, co-transcribed and co-regulated contiguous sets of genes, are poorly conserved over short periods of evolutionary time. The gene order, gene content and regulatory mechanisms of operons can be very different, even in closely related species. Here, we present several lines of evidence which suggest that, although an operon and its individual genes and regulatory structures are rearranged when comparing the genomes of different species, this rearrangement is a conservative process. Genomic rearrangements invariably maintain individual genes in very specific functional and regulatory contexts. We call this conserved context an uber-operon.

  1. Metabolic activation of 2-amino-1-methyl-6-phenylimidazo [4,5-b]pyridine and DNA adduct formation depends on p53: Studies in Trp53(+/+),Trp53(+/-) and Trp53(-/-) mice.

    PubMed

    Krais, Annette M; Speksnijder, Ewoud N; Melis, Joost P M; Singh, Rajinder; Caldwell, Anna; Gamboa da Costa, Gonçalo; Luijten, Mirjam; Phillips, David H; Arlt, Volker M

    2016-02-15

    The expression of the tumor suppressor p53 can influence the bioactivation of, and DNA damage induced by, the environmental carcinogen benzo[a]pyrene, indicating a role for p53 in its cytochrome P450 (CYP)-mediated biotransformation. The carcinogen 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP), which is formed during the cooking of food, is also metabolically activated by CYP enzymes, particularly CYP1A2. We investigated the potential role of p53 in PhIP metabolism in vivo by treating Trp53(+/+), Trp53(+/-) and Trp53(-/-) mice with a single oral dose of 50 mg/kg body weight PhIP. N-(Deoxyguanosin-8-yl)-2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP-C8-dG) levels in DNA, measured by liquid chromatography-tandem mass spectrometry, were significantly lower in liver, colon, forestomach and glandular stomach of Trp53(-/-) mice compared to Trp53(+/+) mice. Lower PhIP-DNA adduct levels in the livers of Trp53(-/-) mice correlated with lower Cyp1a2 enzyme activity (measured by methoxyresorufin-O-demethylase activity) in these animals. Interestingly, PhIP-DNA adduct levels were significantly higher in kidney and bladder of Trp53(-/-) mice compared to Trp53(+/+) mice, which was accompanied by higher sulfotransferase (Sult) 1a1 protein levels and increased Sult1a1 enzyme activity (measured by 2-naphthylsulfate formation from 2-naphthol) in kidneys of these animals. Our study demonstrates a role for p53 in the metabolism of PhIP in vivo, extending previous results on a novel role for p53 in xenobiotic metabolism. Our results also indicate that the impact of p53 on PhIP biotransformation is tissue-dependent and that in addition to Cyp1a enzymes, Sult1a1 can contribute to PhIP-DNA adduct formation. © 2015 The Authors International Journal of Cancer published by John Wiley & Sons Ltd on behalf of UICC.

  2. A stationary-phase protein of Escherichia coli that affects the mode of association between the trp repressor protein and operator-bearing DNA.

    PubMed Central

    Yang, W; Ni, L; Somerville, R L

    1993-01-01

    Highly purified preparations of trp repressor (TrpR) protein derived from Escherichia coli strains that were engineered to overexpress this material were found to contain another protein, of 21 kDa. The second protein, designated WrbA [for tryptophan (W) repressor-binding protein] remained associated with its namesake through several sequential protein fractionation steps. The N-terminal amino acid sequence of the WrbA protein guided the design of two degenerate oligonucleotides that were used as probes in the cloning of the wrbA gene (198 codons). The WrbA protein, in purified form, was found by several criteria to enhance the formation and/or stability of noncovalent complexes between TrpR holorepressor and its primary operator targets. The formation of an operator-holorepressor-WrbA ternary complex was demonstrated by gel mobility-shift analysis. The WrbA protein alone does not interact with the trp operator. During the stationary phase, cells deficient in the WrbA protein were less efficient than wild type in their ability to repress the trp promoter. It is proposed that the WrbA protein functions as an accessory element in blocking TrpR-specific transcriptional processes that might be physiologically disadvantageous in the stationary phase of the bacterial life cycle. Images Fig. 1 Fig. 3 Fig. 4 Fig. 5 PMID:8516330

  3. Drosophila TRP and TRPL are assembled as homomultimeric channels in vivo

    PubMed Central

    Katz, Ben; Oberacker, Tina; Richter, David; Tzadok, Hanan; Peters, Maximilian; Minke, Baruch; Huber, Armin

    2013-01-01

    Summary Family members of the cationic transient receptor potential (TRP) channels serve as sensors and transducers of environmental stimuli. The ability of different TRP channel isoforms of specific subfamilies to form heteromultimers and the structural requirements for channel assembly are still unresolved. Although heteromultimerization of different mammalian TRP channels within single subfamilies has been described, even within a subfamily (such as TRPC) not all members co-assemble with each other. In Drosophila photoreceptors two TRPC channels, TRP and TRP-like protein (TRPL) are expressed together in photoreceptors where they generate the light-induced current. The formation of functional TRP–TRPL heteromultimers in cell culture and in vitro has been reported. However, functional in vivo assays have shown that each channel functions independently of the other. Therefore, the issue of whether TRP and TRPL form heteromultimers in vivo is still unclear. In the present study we investigated the ability of TRP and TRPL to form heteromultimers, and the structural requirements for channel assembly, by studying assembly of GFP-tagged TRP and TRPL channels and chimeric TRP and TRPL channels, in vivo. Interaction studies of tagged and native channels as well as native and chimeric TRP–TRPL channels using co-immunoprecipitation, immunocytochemistry and electrophysiology, critically tested the ability of TRP and TRPL to interact. We found that TRP and TRPL assemble exclusively as homomultimeric channels in their native environment. The above analyses revealed that the transmembrane regions of TRP and TRPL do not determine assemble specificity of these channels. However, the C-terminal regions of both TRP and TRPL predominantly specify the assembly of homomeric TRP and TRPL channels. PMID:23687378

  4. Selected topics from classical bacterial genetics.

    PubMed

    Raleigh, Elisabeth A; Elbing, Karen; Brent, Roger

    2002-08-01

    Current cloning technology exploits many facts learned from classical bacterial genetics. This unit covers those that are critical to understanding the techniques described in this book. Topics include antibiotics, the LAC operon, the F factor, nonsense suppressors, genetic markers, genotype and phenotype, DNA restriction, modification and methylation and recombination.

  5. Hypothesis Formation and Qualitative Reasoning in Molecular Biology

    DTIC Science & Technology

    1989-06-01

    presents studies of the trp operon in the bacterium S . Marcescens . In vitro transcription studies showed that transcription termination does occur in...observed was that there are two 4.4. ANNOTATED CHRONOLOGY OF THE RESEARCH 135 translation-start codons in the S . marcescens leader region. The authors...of leader-region mRNA secondary structures in attenuation in the S . marcescens trp operon. A different bac- terium was used because it included

  6. TRP channels: sensors and transducers of gasotransmitter signals

    PubMed Central

    Takahashi, Nobuaki; Kozai, Daisuke; Mori, Yasuo

    2012-01-01

    The transient receptor potential (trp) gene superfamily encodes cation channels that act as multimodal sensors for a wide variety of stimuli from outside and inside the cell. Upon sensing, they transduce electrical and Ca2+ signals via their cation channel activities. These functional features of TRP channels allow the body to react and adapt to different forms of environmental changes. Indeed, members of one class of TRP channels have emerged as sensors of gaseous messenger molecules that control various cellular processes. Nitric oxide (NO), a vasoactive gaseous molecule, regulates TRP channels directly via cysteine (Cys) S-nitrosylation or indirectly via cyclic GMP (cGMP)/protein kinase G (PKG)-dependent phosphorylation. Recent studies have revealed that changes in the availability of molecular oxygen (O2) also control the activation of TRP channels. Anoxia induced by O2-glucose deprivation and severe hypoxia (1% O2) activates TRPM7 and TRPC6, respectively, whereas TRPA1 has recently been identified as a novel sensor of hyperoxia and mild hypoxia (15% O2) in vagal and sensory neurons. TRPA1 also detects other gaseous molecules such as hydrogen sulfide (H2S) and carbon dioxide (CO2). In this review, we focus on how signaling by gaseous molecules is sensed and integrated by TRP channels. PMID:22934072

  7. Operon Formation is Driven by Co-Regulation and Not by Horizontal Gene Transfer

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Price, Morgan N.; Huang, Katherine H.; Arkin, Adam P.

    Although operons are often subject to horizontal gene transfer (HGT), non-HGT genes are particularly likely to be in operons. To resolve this apparent discrepancy and to determine whether HGT is involved in operon formation, we examined the evolutionary history of the genes and operons in Escherichia coli K12. We show that genes that have homologs in distantly related bacteria but not in close relatives of E. coli (indicating HGTi) form new operons at about the same rates as native genes. Furthermore, genes in new operons are no more likely than other genes to have phylogenetic trees that are inconsistent withmore » the species tree. In contrast, essential genes and ubiquitous genes without paralogs (genes believed to undergo HGT rarely) often form new operons. We conclude that HGT is not associated with operon formation, but instead promotes the prevalence of pre-existing operons. To explain operon formation, we propose that new operons reduce the amount of regulatory information required to specify optimal expression patterns. Consistent with this hypothesis, operons have greater amounts of conserved regulatory sequences than do individually transcribed genes.« less

  8. Long range Trp-Trp interaction initiates the folding pathway of a pro-angiogenic β-hairpin peptide

    NASA Astrophysics Data System (ADS)

    Diana, Donatella; De Rosa, Lucia; Palmieri, Maddalena; Russomanno, Anna; Russo, Luigi; La Rosa, Carmelo; Milardi, Danilo; Colombo, Giorgio; D'Andrea, Luca D.; Fattorusso, Roberto

    2015-11-01

    HPLW, a designed VEGF (Vascular Endothelium Growth Factor) receptor-binding peptide, assumes a well folded β-hairpin conformation in water and is able to induce angiogenesis in vivo. In this study, we investigated at atomic resolution the thermal folding/unfolding pathway of HPLW by means of an original multi-technique approach combining DSC, NMR, MD and mutagenesis analyses. In particular, careful NMR investigation of the single proton melting temperatures together with DSC analysis accurately delineate the peptide folding mechanism, which is corroborated by computational folding/unfolding simulations. The HPLW folding process consists of two main events, which are successive but do not superimpose. The first folding step initiates at 320 K upon the hydrophobic collapse of the Trp5 and Trp13 side-chains which stabilizes the concurrent β-turn formation, whose COi-HNi + 3 hydrogen bond (Asp10 → Arg7) appears particularly stable. At 316 K, once the β-turn is completely formed, the two β-strands pair, very likely starting by Trp5 and Trp13, which thus play a key role also in the final step of the β-hairpin folding. Overall, here we describe a multi-state hierarchical folding pathway of a highly structured β-hairpin, which can be classified as a broken-zipper mechanism.

  9. Participation of S. Typhimurium cysJIH Operon in the H2S-mediated Ciprofloxacin Resistance in Presence of Sulfate as Sulfur Source

    PubMed Central

    Álvarez, Ricardo; Frávega, Jorge; Rodas, Paula I.; Fuentes, Juan A.; Paredes-Sabja, Daniel; Calderón, Iván L.; Gil, Fernando

    2015-01-01

    H2S production has been proposed as a mechanism to explain bacterial resistance to antibiotics. In this work, we present evidence for the role of the cysJIH operon in resistance to ciprofloxacin mediated by H2S production with different sulfate as the only sulfur source. We found that the products of the cysJIH operon are involved in ciprofloxacin resistance by increasing both, the levels of H2S and reduced thiols apparently counteracting antimicrobial-induced reactive oxygen species (ROS). This protective effect was observed only when bacteria were cultured in the presence of sulfate, but not with cysteine, as the sole sulfur source.

  10. TRP channels in the digestive system

    PubMed Central

    Holzer, Peter

    2011-01-01

    Several of the 28 mammalian transient receptor potential (TRP) channel subunits are expressed throughout the alimentary canal where they play important roles in taste, chemo- and mechanosensation, thermoregulation, pain and hyperalgesia, mucosal function and homeostasis, control of motility by neurons, interstitial cells of Cajal and muscle cells, and vascular function. While the implications of some TRP channels, notably TRPA1, TRPC4, TRPM5, TRPM6, TRPM7, TRPV1, TRPV4, and TRPV6, have been investigated in much detail, the understanding of other TRP channels in their relevance to digestive function lags behind. The polymodal chemo- and mechanosensory function of TRPA1, TRPM5, TRPV1 and TRPV4 is particularly relevant to the alimentary canal whose digestive and absorptive function depends on the surveillance and integration of many chemical and physical stimuli. TRPV5 and TRPV6 as well as TRPM6 and TRPM7 appear to be essential for the absorption of Ca2+ and Mg2+, respectively, while TRPM7 appears to contribute to the pacemaker activity of the interstitial cells of Cajal, and TRPC4 transduces smooth muscle contraction evoked by muscarinic acetylcholine receptor activation. The implication of some TRP channels in pathological processes has raised enormous interest in exploiting them as a therapeutic target. This is particularly true for TRPV1, TRPV4 and TRPA1, which may be targeted for the treatment of several conditions of chronic abdominal pain. Consequently, blockers of these TRP channels have been developed, and their clinical usefulness has yet to be established. PMID:20932260

  11. Evolutionary conservation and changes in insect TRP channels.

    PubMed

    Matsuura, Hironori; Sokabe, Takaaki; Kohno, Keigo; Tominaga, Makoto; Kadowaki, Tatsuhiko

    2009-09-10

    TRP (Transient Receptor Potential) channels respond to diverse stimuli and thus function as the primary integrators of varied sensory information. They are also activated by various compounds and secondary messengers to mediate cell-cell interactions as well as to detect changes in the local environment. Their physiological roles have been primarily characterized only in mice and fruit flies, and evolutionary studies are limited. To understand the evolution of insect TRP channels and the mechanisms of integrating sensory inputs in insects, we have identified and compared TRP channel genes in Drosophila melanogaster, Bombyx mori, Tribolium castaneum, Apis mellifera, Nasonia vitripennis, and Pediculus humanus genomes as part of genome sequencing efforts. All the insects examined have 2 TRPV, 1 TRPN, 1 TRPM, 3 TRPC, and 1 TRPML subfamily members, demonstrating that these channels have the ancient origins in insects. The common pattern also suggests that the mechanisms for detecting mechanical and visual stimuli and maintaining lysosomal functions may be evolutionarily well conserved in insects. However, a TRPP channel, the most ancient TRP channel, is missing in B. mori, A. mellifera, and N. vitripennis. Although P. humanus and D. melanogaster contain 4 TRPA subfamily members, the other insects have 5 TRPA subfamily members. T. castaneum, A. mellifera, and N. vitripennis contain TRPA5 channels, which have been specifically retained or gained in Coleoptera and Hymenoptera. Furthermore, TRPA1, which functions for thermotaxis in Drosophila, is missing in A. mellifera and N. vitripennis; however, they have other Hymenoptera-specific TRPA channels (AmHsTRPA and NvHsTRPA). NvHsTRPA expressed in HEK293 cells is activated by temperature increase, demonstrating that HsTRPAs function as novel thermal sensors in Hymenoptera. The total number of insect TRP family members is 13-14, approximately half that of mammalian TRP family members. As shown for mammalian TRP channels, this

  12. Thermally activated TRP channels: molecular sensors for temperature detection.

    PubMed

    Castillo, Karen; Diaz-Franulic, Ignacio; Canan, Jonathan; Gonzalez-Nilo, Fernando; Latorre, Ramon

    2018-01-24

    Temperature sensing is one of the oldest capabilities of living organisms, and is essential for sustaining life, because failure to avoid extreme noxious temperatures can result in tissue damage or death. A subset of members of the transient receptor potential (TRP) ion channel family is finely tuned to detect temperatures ranging from extreme cold to noxious heat, giving rise to thermoTRP channels. Structural and functional experiments have shown that thermoTRP channels are allosteric proteins, containing different domains that sense changes in temperature, among other stimuli, triggering pore opening. Although temperature-dependence is well characterized in thermoTRP channels, the molecular nature of temperature-sensing elements remains unknown. Importantly, thermoTRP channels are involved in pain sensation, related to pathological conditions. Here, we provide an overview of thermoTRP channel activation. We also discuss the structural and functional evidence supporting the existence of an intrinsic temperature sensor in this class of channels, and we explore the basic thermodynamic principles for channel activation. Finally, we give a view of their role in painful pathophysiological conditions.

  13. Glycopeptide Resistance vanA Operons in Paenibacillus Strains Isolated from Soil

    PubMed Central

    Guardabassi, Luca; Perichon, Bruno; van Heijenoort, Jean; Blanot, Didier; Courvalin, Patrice

    2005-01-01

    The sequence and gene organization of the van operons in vancomycin (MIC of >256 μg/ml)- and teicoplanin (MIC of ≥32 μg/ml)-resistant Paenibacillus thiaminolyticus PT-2B1 and Paenibacillus apiarius PA-B2B isolated from soil were determined. Both operons had regulatory (vanR and vanS), resistance (vanH, vanA, and vanX), and accessory (vanY, vanZ, and vanW) genes homologous to the corresponding genes in enterococcal vanA and vanB operons. The vanAPT operon in P. thiaminolyticus PT-2B1 had the same gene organization as that of vanA operons whereas vanAPA in P. apiarius PA-B2B resembled vanB operons due to the presence of vanW upstream from the vanHAX cluster but was closer to vanA operons in sequence. Reference P. apiarius strains NRRL B-4299 and NRRL B-4188 were found to harbor operons indistinguishable from vanAPA by PCR mapping, restriction fragment length polymorphism, and partial sequencing, suggesting that this operon was species specific. As in enterococci, resistance was inducible by glycopeptides and associated with the synthesis of pentadepsipeptide peptidoglycan precursors ending in d-Ala-d-Lac, as demonstrated by d,d-dipeptidase activities, high-pressure liquid chromatography, and mass spectrometry. The precursors differed from those in enterococci by the presence of diaminopimelic acid instead of lysine in the peptide chain. Altogether, the results are compatible with the notion that van operons in soil Paenibacillus strains and in enterococci have evolved from a common ancestor. PMID:16189102

  14. Glycopeptide resistance vanA operons in Paenibacillus strains isolated from soil.

    PubMed

    Guardabassi, Luca; Perichon, Bruno; van Heijenoort, Jean; Blanot, Didier; Courvalin, Patrice

    2005-10-01

    The sequence and gene organization of the van operons in vancomycin (MIC of >256 microg/ml)- and teicoplanin (MIC of > or =32 microg/ml)-resistant Paenibacillus thiaminolyticus PT-2B1 and Paenibacillus apiarius PA-B2B isolated from soil were determined. Both operons had regulatory (vanR and vanS), resistance (vanH, vanA, and vanX), and accessory (vanY, vanZ, and vanW) genes homologous to the corresponding genes in enterococcal vanA and vanB operons. The vanA(PT) operon in P. thiaminolyticus PT-2B1 had the same gene organization as that of vanA operons whereas vanA(PA) in P. apiarius PA-B2B resembled vanB operons due to the presence of vanW upstream from the vanHAX cluster but was closer to vanA operons in sequence. Reference P. apiarius strains NRRL B-4299 and NRRL B-4188 were found to harbor operons indistinguishable from vanA(PA) by PCR mapping, restriction fragment length polymorphism, and partial sequencing, suggesting that this operon was species specific. As in enterococci, resistance was inducible by glycopeptides and associated with the synthesis of pentadepsipeptide peptidoglycan precursors ending in D-Ala-D-Lac, as demonstrated by D,D-dipeptidase activities, high-pressure liquid chromatography, and mass spectrometry. The precursors differed from those in enterococci by the presence of diaminopimelic acid instead of lysine in the peptide chain. Altogether, the results are compatible with the notion that van operons in soil Paenibacillus strains and in enterococci have evolved from a common ancestor.

  15. Silencing of Essential Genes within a Highly Coordinated Operon in Escherichia coli.

    PubMed

    Goh, Shan; Hohmeier, Angela; Stone, Timothy C; Offord, Victoria; Sarabia, Francisco; Garcia-Ruiz, Cristina; Good, Liam

    2015-08-15

    Essential bacterial genes located within operons are particularly challenging to study independently because of coordinated gene expression and the nonviability of knockout mutants. Essentiality scores for many operon genes remain uncertain. Antisense RNA (asRNA) silencing or in-frame gene disruption of genes may help establish essentiality but can lead to polar effects on genes downstream or upstream of the target gene. Here, the Escherichia coli ribF-ileS-lspA-fkpB-ispH operon was used to evaluate the possibility of independently studying an essential gene using expressed asRNA and target gene overexpression to deregulate coupled expression. The gene requirement for growth in conditional silencing strains was determined by the relationship of target mRNA reduction with growth inhibition as the minimum transcript level required for 50% growth (MTL50). Mupirocin and globomycin, the protein inhibitors of IleS and LspA, respectively, were used in sensitization assays of strains containing both asRNA-expressing and open reading frame-expressing plasmids to examine deregulation of the overlapping ileS-lspA genes. We found upstream and downstream polar silencing effects when either ileS or lspA was silenced, indicating coupled expression. Weighted MTL50 values (means and standard deviations) of ribF, ileS, and lspA were 0.65 ± 0.18, 0.64 ± 0.06, and 0.76 ± 0.10, respectively. However, they were not significantly different (P = 0.71 by weighted one-way analysis of variance). The gene requirement for ispH could not be determined due to insufficient growth reduction. Mupirocin and globomycin sensitization experiments indicated that ileS-lspA expression could not be decoupled. The results highlight the inherent challenges associated with genetic analyses of operons; however, coupling of essential genes may provide opportunities to improve RNA-silencing antimicrobials. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  16. Altered sexual and social behaviors in trp2 mutant mice

    PubMed Central

    Leypold, Bradley G.; Yu, C. Ron; Leinders-Zufall, Trese; Kim, Michelle M.; Zufall, Frank; Axel, Richard

    2002-01-01

    We have used gene targeting to generate mice with a homozygous deficiency in trp2, a cation channel expressed in the vomeronasal organ (VNO). Trp2 mutant animals reveal a striking reduction in the electrophysiological response to pheromones in the VNO, suggesting that trp2 plays a central role in mediating the pheromone response. These mutants therefore afford the opportunity to examine the role of the VNO in the generation of innate sexual and social behaviors in mice. Trp2 mutant males and nursing females are docile and fail to initiate aggressive attacks on intruder males. Male–female sexual behavior appears normal, but trp2 mutant males also vigorously mount other males. These results suggest that the cation channel trp2 is required in the VNO to detect male-specific pheromones that elicit aggressive behaviors and dictate the choice of sexual partners. PMID:11972034

  17. Dynamic Folding Pathway Models of the Trp-Cage Protein

    PubMed Central

    Kim, Seung-Yeon

    2013-01-01

    Using action-derived molecular dynamics (ADMD), we study the dynamic folding pathway models of the Trp-cage protein by providing its sequential conformational changes from its initial disordered structure to the final native structure at atomic details. We find that the numbers of native contacts and native hydrogen bonds are highly correlated, implying that the native structure of Trp-cage is achieved through the concurrent formations of native contacts and native hydrogen bonds. In early stage, an unfolded state appears with partially formed native contacts (~40%) and native hydrogen bonds (~30%). Afterward, the folding is initiated by the contact of the side chain of Tyr3 with that of Trp6, together with the formation of the N-terminal α-helix. Then, the C-terminal polyproline structure docks onto the Trp6 and Tyr3 rings, resulting in the formations of the hydrophobic core of Trp-cage and its near-native state. Finally, the slow adjustment processes of the near-native states into the native structure are dominant in later stage. The ADMD results are in agreement with those of the experimental folding studies on Trp-cage and consistent with most of other computational studies. PMID:23865078

  18. Characterization of two trpE genes encoding anthranilate synthase {alpha}-subunit in Azospirillum brasilense

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ge Shimei; Xie Baoen; Chen Sanfeng

    2006-03-10

    The previous report from our laboratory has recently identified a new trpE gene (termed trpE {sub 2}) which exists independently in Azospirillum brasilense Yu62. In this study, amplification of trpE(G) (termed trpE {sub 1}(G) here) confirmed that there are two copies of trpE gene, one trpE being fused into trpG while the other trpE existed independently. This is First report to suggest that two copies of the trpE gene exist in this bacterium. Comparison of the nucleotide sequence demonstrated that putative leader peptide, terminator, and anti-terminator were found upstream of trpE {sub 1}(G) while these sequence features did not existmore » in front of trpE {sub 2}. The {beta}-galactosidase activity of an A. brasilense strain carrying a trpE {sub 2}-lacZ fusion remained constant at different tryptophan concentrations, but the {beta}-galactosidase activity of the same strain carrying a trpE {sub 1}(G)-lacZ fusion decreased as the tryptophan concentration increased. These data suggest that the expression of trpE {sub 1}(G) is regulated at the transcriptional level by attenuation while trpE {sub 2} is constantly expressed. The anthranilate synthase assays with trpE {sub 1}(G){sup -} and trpE {sub 2} {sup -} mutants demonstrated that TrpE{sub 1}(G) fusion protein is feedback inhibited by tryptophan while TrpE{sub 2} protein is not. We also found that both trpE {sub 1}(G) and trpE {sub 2} gene products were involved in IAA synthesis.« less

  19. A brief history of trp: commentary and personal perspective.

    PubMed

    Hardie, Roger C

    2011-05-01

    The history of the discovery of the transient receptor potential (TRP) cation channel superfamily began in 1969 with Cosens and Manning's isolation of the Drosophila transient receptor potential mutant, in which the photoreceptor response decays during continuous illumination. Early studies from Minke found that the elementary light response was unaffected in trp mutants, and he attributed the defect to an intermediate stage of phototransduction. Montell and Rubin cloned the trp gene in 1989: they recognised it as a transmembrane protein, but also concluded that it did not encode the light-sensitive channels. In 1991, Minke and Selinger proposed that TRP represented a Ca2+ transporter required for refilling intracellular InsP3-sensitive Ca2+ stores, in turn required for activation of the light-sensitive channels. Also in 1991, after developing a photoreceptor patch clamp preparation, I showed that the light-sensitive channels themselves were highly permeable to Ca2+, questioning the need for such a dedicated Ca2+ transporter. In 1992, in collaboration with Minke, I resolved this paradox by showing there were two classes of light-sensitive channels, one highly Ca2+ permeable and eliminated in trp mutants. This represented the first and compelling evidence that TRP represented a light-sensitive channel and was supported by the cloning of the second light-sensitive channel, TRPL, by Kelly's lab. Three years later, in 1995, the labs of Montell and Birnbaumer independently cloned TRPC1, the first of 29 vertebrate TRP isoforms distributed amongst seven subfamilies.

  20. Role of TRP ion channels in cancer and tumorigenesis.

    PubMed

    Shapovalov, George; Ritaine, Abigael; Skryma, Roman; Prevarskaya, Natalia

    2016-05-01

    Transient receptor potential (TRP) channels are recently identified proteins that form a versatile family of ion channels, the majority of which are calcium permeable and exhibit complex regulatory patterns with sensitivity to multiple environmental factors. While this sensitivity has captured early attention, leading to recognition of TRP channels as environmental and chemical sensors, many later studies concentrated on the regulation of intracellular calcium by TRP channels. Due to mutations, dysregulation of ion channel gating or expression levels, normal spatiotemporal patterns of local Ca(2+) distribution become distorted. This causes deregulation of downstream effectors sensitive to changes in Ca(2+) homeostasis that, in turn, promotes pathophysiological cancer hallmarks, such as enhanced survival, proliferation and invasion. These observations give rise to the appreciation of the important contributions that TRP channels make to many cellular processes controlling cell fate and positioning these channels as important players in cancer regulation. This review discusses the accumulated scientific knowledge focused on TRP channel involvement in regulation of cell fate in various transformed tissues.

  1. Novel Accurate Bacterial Discrimination by MALDI-Time-of-Flight MS Based on Ribosomal Proteins Coding in S10-spc-alpha Operon at Strain Level S10-GERMS

    NASA Astrophysics Data System (ADS)

    Tamura, Hiroto; Hotta, Yudai; Sato, Hiroaki

    2013-08-01

    Matrix-assisted laser-desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) is one of the most widely used mass-based approaches for bacterial identification and classification because of the simple sample preparation and extremely rapid analysis within a few minutes. To establish the accurate MALDI-TOF MS bacterial discrimination method at strain level, the ribosomal subunit proteins coded in the S 10-spc-alpha operon, which encodes half of the ribosomal subunit protein and is highly conserved in eubacterial genomes, were selected as reliable biomarkers. This method, named the S10-GERMS method, revealed that the strains of genus Pseudomonas were successfully identified and discriminated at species and strain levels, respectively; therefore, the S10-GERMS method was further applied to discriminate the pathovar of P. syringae. The eight selected biomarkers (L24, L30, S10, S12, S14, S16, S17, and S19) suggested the rapid discrimination of P. syringae at the strain (pathovar) level. The S10-GERMS method appears to be a powerful tool for rapid and reliable bacterial discrimination and successful phylogenetic characterization. In this article, an overview of the utilization of results from the S10-GERMS method is presented, highlighting the characterization of the Lactobacillus casei group and discrimination of the bacteria of genera Bacillus and Sphingopyxis despite only two and one base difference in the 16S rRNA gene sequence, respectively.

  2. "TRP inflammation" relationship in cardiovascular system.

    PubMed

    Numata, Tomohiro; Takahashi, Kiriko; Inoue, Ryuji

    2016-05-01

    Despite considerable advances in the research and treatment, the precise relationship between inflammation and cardiovascular (CV) disease remains incompletely understood. Therefore, understanding the immunoinflammatory processes underlying the initiation, progression, and exacerbation of many cardiovascular diseases is of prime importance. The innate immune system has an ancient origin and is well conserved across species. Its activation occurs in response to pathogens or tissue injury. Recent studies suggest that altered ionic balance, and production of noxious gaseous mediators link to immune and inflammatory responses with altered ion channel expression and function. Among plausible candidates for this are transient receptor potential (TRP) channels that function as polymodal sensors and scaffolding proteins involved in many physiological and pathological processes. In this review, we will first focus on the relevance of TRP channel to both exogenous and endogenous factors related to innate immune response and transcription factors related to sustained inflammatory status. The emerging role of inflammasome to regulate innate immunity and its possible connection to TRP channels will also be discussed. Secondly, we will discuss about the linkage of TRP channels to inflammatory CV diseases, from a viewpoint of inflammation in a general sense which is not restricted to the innate immunity. These knowledge may serve to provide new insights into the pathogenesis of various inflammatory CV diseases and their novel therapeutic strategies.

  3. Operon Conservation and the Evolution of trans-Splicing in the Phylum Nematoda

    PubMed Central

    Guiliano, David B; Blaxter, Mark L

    2006-01-01

    The nematode Caenorhabditis elegans is unique among model animals in that many of its genes are cotranscribed as polycistronic pre-mRNAs from operons. The mechanism by which these operonic transcripts are resolved into mature mRNAs includes trans-splicing to a family of SL2-like spliced leader exons. SL2-like spliced leaders are distinct from SL1, the major spliced leader in C. elegans and other nematode species. We surveyed five additional nematode species, representing three of the five major clades of the phylum Nematoda, for the presence of operons and the use of trans-spliced leaders in resolution of polycistronic pre-mRNAs. Conserved operons were found in Pristionchus pacificus, Nippostrongylus brasiliensis, Strongyloides ratti, Brugia malayi, and Ascaris suum. In nematodes closely related to the rhabditine C. elegans, a related family of SL2-like spliced leaders is used for operonic transcript resolution. However, in the tylenchine S. ratti operonic transcripts are resolved using a family of spliced leaders related to SL1. Non-operonic genes in S. ratti may also receive these SL1 variants. In the spirurine nematodes B. malayi and A. suum operonic transcripts are resolved using SL1. Mapping these phenotypes onto the robust molecular phylogeny for the Nematoda suggests that operons evolved before SL2-like spliced leaders, which are an evolutionary invention of the rhabditine lineage. PMID:17121468

  4. Glu-Trp-ONa or its acylated analogue (R-Glu-Trp-ONa) administration enhances the wound healing in the model of chronic skin wounds in rabbits.

    PubMed

    Shevtsov, Maxim A; Smagina, Larisa V; Kudriavtceva, Tatiana A; Petlenko, Sergey V; Voronkina, Irina V

    2015-01-01

    The management of chronic skin wounds represents a major therapeutic challenge. The synthesized dipeptide (Glu-Trp-ONa) and its acylated analogue (R-Glu-Trp-ONa) were assessed in the model of nonhealing dermal wounds in rabbits in relation to their healing properties in wound closure. Following wound modeling, the rabbits received a course of intraperitoneal injections of Glu-Trp-ONa or R-Glu-Trp-ONa. Phosphate-buffered saline and Solcoseryl® were applied as negative and positive control agents, respectively. An injection of Glu-Trp-ONa and R-Glu-Trp-ONa decreased the period of wound healing in animals in comparison to the control and Solcoseryl-treated groups. Acylation of Glu-Trp-ONa proved to be beneficial as related to the healing properties of the dipeptide. Subsequent zymography analyses showed that the applied peptides decreased the proteolytic activity of matrix metalloproteinases MMP-9, MMP-8, and MMP-2 in the early inflammatory phase and reversely increased the activity of MMP-9, MMP-8, and MMP-1 in the remodeling phase. Histological analyses of the wound sections (hematoxylin-eosin, Mallory's staining) confirmed the enhanced formation of granulation tissue and re-epithelialization in the experimental groups. By administering the peptides, wound closures increased significantly through the modulation of the MMPs' activity, indicating their role in wound healing.

  5. High l-Trp affinity of indoleamine 2,3-dioxygenase 1 is attributed to two residues located in the distal heme pocket.

    PubMed

    Yuasa, Hajime J

    2016-10-01

    Indoleamine 2, 3-dioxygenase (IDO) catalyzes the oxidative cleavage of the pyrrole ring of l-Trp to generate N-formyl-kynurenine. Two IDO genes, IDO1 and IDO2, are found in vertebrates. Mammalian IDO1s are high-affinity, l-Trp-degrading enzymes, whereas IDO2s generally have a relatively low affinity. It has been suggested that the distal-Ser (corresponding to Ser167 of human IDO1) was crucial for improvement in the affinity for l-Trp but this idea was insufficient to explain the high affinity shown by mammalian IDO1. In this study, the amino acid sequences of vertebrate ancestral IDO1 and ancestral IDO2 were inferred, and bacterially expressed ancestral IDOs were characterized. Although the amino acid sequences of the enzymes shared high identity (86%) with each other, they showed distinct enzymatic properties. In analyses of a series of ancestral IDO1/IDO2 chimeric enzymes and their variants, the distal-Tyr (corresponding to Tyr126 of human IDO1) was detected as another and was probably the most crucial residue for high l-Trp affinity. The two amino acid substitutions (distal-Ser to Thr and distal-Tyr to His) drastically decreased the l-Trp affinity and catalytic efficiency of IDO1s. Conversely, two substitutions (distal-Thr to Ser and distal-His to Tyr) were sufficient to bestow IDO1-like high affinity on ancestral and chicken IDO2. © 2016 Federation of European Biochemical Societies.

  6. The Metarhizium anisopliae trp1 gene: cloning and regulatory analysis.

    PubMed

    Staats, Charley Christian; Silva, Marcia Suzana Nunes; Pinto, Paulo Marcos; Vainstein, Marilene Henning; Schrank, Augusto

    2004-07-01

    The trp1 gene from the entomopathogenic fungus Metarhizium anisopliae, cloned by heterologous hybridization with the plasmid carrying the trpC gene from Aspergillus nidulans, was sequence characterized. The predicted translation product has the conserved catalytic domains of glutamine amidotransferase (G domain), indoleglycerolphosphate synthase (C domain), and phosphoribosyl anthranilate isomerase (F domain) organized as NH2-G-C-F-COOH. The ORF is interrupted by a single intron of 60 nt that is position conserved in relation to trp genes from Ascomycetes and length conserved in relation to Basidiomycetes species. RT-PCR analysis suggests constitutive expression of trp1 gene in M. anisopliae.

  7. Application of amphipols for structure-functional analysis of TRP channels.

    PubMed

    Huynh, Kevin W; Cohen, Matthew R; Moiseenkova-Bell, Vera Y

    2014-10-01

    Amphipathic polymers (amphipols), such as A8-35 and SApol, are a new tool for stabilizing integral membrane proteins in detergent-free conditions for structural and functional studies. Transient receptor potential (TRP) ion channels function as tetrameric protein complexes in a diverse range of cellular processes including sensory transduction. Mammalian TRP channels share ~20 % sequence similarity and are categorized into six subfamilies: TRPC (canonical), TRPV (vanilloid), TRPA (ankyrin), TRPM (melastatin), TRPP (polycystin), and TRPML (mucolipin). Due to the inherent difficulties in purifying eukaryotic membrane proteins, structural studies of TRP channels have been limited. Recently, A8-35 was essential in resolving the molecular architecture of the nociceptor TRPA1 and led to the determination of a high-resolution structure of the thermosensitive TRPV1 channel by cryo-EM. Newly developed maltose-neopentyl glycol (MNG) detergents have also proven to be useful in stabilizing TRP channels for structural analysis. In this review, we will discuss the impacts of amphipols and MNG detergents on structural studies of TRP channels by cryo-EM. We will compare how A8-35 and MNG detergents interact with the hydrophobic transmembrane domains of TRP channels. In addition, we will discuss what these cryo-EM studies reveal on the importance of screening different types of surfactants toward determining high-resolution structures of TRP channels.

  8. Application of amphipols for structure-functional analysis of TRP channels

    PubMed Central

    Huynh, Kevin W.; Cohen, Matthew R.; Moiseenkova-Bell, Vera Y.

    2014-01-01

    Amphipathic polymers (amphipols), such as A8-35 and SApol, are a new tool for stabilizing integral membrane proteins in detergent-free conditions for structural and functional studies. Transient receptor potential (TRP) ion channels function as tetrameric protein complexes in a diverse range of cellular processes including sensory transduction. Mammalian TRP channels share ~20% sequence similarity and are categorized into six subfamilies: TRPC (canonical), TRPV (vanilloid), TRPA (ankyrin), TRPM (melastatin), TRPP (polycystin), and TRPML (mucolipin). Due to the inherent difficulties in purifying eukaryotic membrane proteins, structural studies of TRP channels have been limited. Recently, A8-35 was essential in resolving the molecular architecture of the nociceptor TRPA1 and led to the determination of a high resolution structure of the thermosensitive TRPV1 channel by cryo-EM. Newly developed maltose-neopentyl glycol (MNG) detergents have also proven useful in stabilizing TRP channels for structural analysis. In this review, we will discuss the impact of amphipols and MNG detergents on structural studies of TRP channels by cryo-EM. We will compare how A8-35 and MNG detergents interact with the hydrophobic transmembrane (TM) domains of TRP channels. In addition, we will discuss what these cryo-EM studies reveal on the importance of screening different types of surfactants towards determining high resolution structures of TRP channels. PMID:24894720

  9. Solving a discrete model of the lac operon using Z3

    NASA Astrophysics Data System (ADS)

    Gutierrez, Natalia A.

    2014-05-01

    A discrete model for the Lcac Operon is solved using the SMT-solver Z3. Traditionally the Lac Operon is formulated in a continuous math model. This model is a system of ordinary differential equations. Here, it was considerated as a discrete model, based on a Boolean red. The biological problem of Lac Operon is enunciated as a problem of Boolean satisfiability, and it is solved using an STM-solver named Z3. Z3 is a powerful solver that allows understanding the basic dynamic of the Lac Operon in an easier and more efficient way. The multi-stability of the Lac Operon can be easily computed with Z3. The code that solves the Boolean red can be written in Python language or SMT-Lib language. Both languages were used in local version of the program as online version of Z3. For future investigations it is proposed to solve the Boolean red of Lac Operon using others SMT-solvers as cvc4, alt-ergo, mathsat and yices.

  10. Evolution of E. coli tRNA(Trp)

    NASA Technical Reports Server (NTRS)

    Staves, Mark P.; Lacey, James C., Jr.; Bloch, David P.

    1988-01-01

    It has been shown by Lacey et al. (1985) that, in general, the hydrophobicity ranking of an amino acid correlates with that of its anticodonic nucleotide, with tryptophan being one of the four amino acids for which this rule does not apply. It was proposed that this failure to correlate was due to the fact that the anticodon assignments for the four amino acids were made late, after the mutation of existing tRNAs. In this paper, the evolution of E. coli tRNA(Trp) is examined by comparing its homology with other E. coli tRNAs. The results demonstrate the presence of an evolutionary relationship between E. coli tRNA(Trp) and tRNA(Gly) or tRNA(Arg) molecules, and support the idea of the late assignment of anticodon to Trp.

  11. Contributions of Torpedo nicotinic acetylcholine receptor gamma Trp-55 and delta Trp-57 to agonist and competitive antagonist function.

    PubMed

    Xie, Y; Cohen, J B

    2001-01-26

    Results of affinity-labeling studies and mutational analyses provide evidence that the agonist binding sites of the nicotinic acetylcholine receptor (nAChR) are located at the alpha-gamma and alpha-delta subunit interfaces. For Torpedo nAChR, photoaffinity-labeling studies with the competitive antagonist d-[(3)H]tubocurarine (dTC) identified two tryptophans, gammaTrp-55 and deltaTrp-57, as the primary sites of photolabeling in the non-alpha subunits. To characterize the importance of gammaTrp-55 and deltaTrp-57 to the interactions of agonists and antagonists, Torpedo nAChRs were expressed in Xenopus oocytes, and equilibrium binding assays and electrophysiological recordings were used to examine the functional consequences when either or both tryptophans were mutated to leucine. Neither substitution altered the equilibrium binding of dTC. However, the deltaW57L and gammaW55L mutations decreased acetylcholine (ACh) binding affinity by 20- and 7,000-fold respectively. For the wild-type, gammaW55L, and deltaW57L nAChRs, the concentration dependence of channel activation was characterized by Hill coefficients of 1.8, 1.1, and 1.7. For the gammaW55L mutant, dTC binding at the alpha-gamma site acts not as a competitive antagonist but as a coactivator or partial agonist. These results establish that interactions with gamma Trp-55 of the Torpedo nAChR play a crucial role in agonist binding and in the agonist-induced conformational changes that lead to channel opening.

  12. Comparative sequence analysis suggests a conserved gating mechanism for TRP channels

    PubMed Central

    Palovcak, Eugene; Delemotte, Lucie; Klein, Michael L.

    2015-01-01

    The transient receptor potential (TRP) channel superfamily plays a central role in transducing diverse sensory stimuli in eukaryotes. Although dissimilar in sequence and domain organization, all known TRP channels act as polymodal cellular sensors and form tetrameric assemblies similar to those of their distant relatives, the voltage-gated potassium (Kv) channels. Here, we investigated the related questions of whether the allosteric mechanism underlying polymodal gating is common to all TRP channels, and how this mechanism differs from that underpinning Kv channel voltage sensitivity. To provide insight into these questions, we performed comparative sequence analysis on large, comprehensive ensembles of TRP and Kv channel sequences, contextualizing the patterns of conservation and correlation observed in the TRP channel sequences in light of the well-studied Kv channels. We report sequence features that are specific to TRP channels and, based on insight from recent TRPV1 structures, we suggest a model of TRP channel gating that differs substantially from the one mediating voltage sensitivity in Kv channels. The common mechanism underlying polymodal gating involves the displacement of a defect in the H-bond network of S6 that changes the orientation of the pore-lining residues at the hydrophobic gate. PMID:26078053

  13. Mutation of a Broadly Conserved Operon (RL3499-RL3502) from Rhizobium leguminosarum Biovar viciae Causes Defects in Cell Morphology and Envelope Integrity▿†

    PubMed Central

    Vanderlinde, Elizabeth M.; Magnus, Samantha A.; Tambalo, Dinah D.; Koval, Susan F.; Yost, Christopher K.

    2011-01-01

    The bacterial cell envelope is of critical importance to the function and survival of the cell; it acts as a barrier against harmful toxins while allowing the flow of nutrients into the cell. It also serves as a point of physical contact between a bacterial cell and its host. Hence, the cell envelope of Rhizobium leguminosarum is critical to cell survival under both free-living and symbiotic conditions. Transposon mutagenesis of R. leguminosarum strain 3841 followed by a screen to isolate mutants with defective cell envelopes led to the identification of a novel conserved operon (RL3499-RL3502) consisting of a putative moxR-like AAA+ ATPase, a hypothetical protein with a domain of unknown function (designated domain of unknown function 58), and two hypothetical transmembrane proteins. Mutation of genes within this operon resulted in increased sensitivity to membrane-disruptive agents such as detergents, hydrophobic antibiotics, and alkaline pH. On minimal media, the mutants retain their rod shape but are roughly 3 times larger than the wild type. On media containing glycine or peptides such as yeast extract, the mutants form large, distorted spheres and are incapable of sustained growth under these culture conditions. Expression of the operon is maximal during the stationary phase of growth and is reduced in a chvG mutant, indicating a role for this sensor kinase in regulation of the operon. Our findings provide the first functional insight into these genes of unknown function, suggesting a possible role in cell envelope development in Rhizobium leguminosarum. Given the broad conservation of these genes among the Alphaproteobacteria, the results of this study may also provide insight into the physiological role of these genes in other Alphaproteobacteria, including the animal pathogen Brucella. PMID:21357485

  14. Interaction of recombinant human epidermal growth factor with phospholipid vesicles. A steady-state and time-resolved fluorescence study of the bis-tryptophan sequence (Trp49-Trp50).

    PubMed

    Li De La Sierra, I M; Vincent, M; Padron, G; Gallay, J

    1992-01-01

    The interaction of recombinant human epidermal growth factor with small unilamellar phospholipid vesicles was studied by steady-state and time-resolved fluorescence of the bis-tryptophan sequence (Trp49-Trp50). Steady-state anisotropy measurements demonstrate that strong binding occurred with small unilamellar vesicles made up of acidic phospholipids at acidic pH only (pH < or = 4.7). An apparent stoichiometry for 1,2-dimyristoyl-sn-phosphoglycerol of about 12 phospholipid molecules per molecule of human epidermal growth factor was estimated. The binding appears to be more efficient at temperatures above the gel to liquid-crystalline phase transition. The conformation and the environment of the Trp-Trp sequence are not greatly modified after binding, as judged from the invariance of the excited state lifetime distribution and from that of the fast processes affecting the anisotropy decay. This suggests that the Trp-Trp sequence is not embedded within the bilayer, in contrast to the situation in surfactant micelles (Mayo et al. 1987; Kohda and Inigaki 1992).

  15. Hair-Cell Mechanotransduction Persists in TRP Channel Knockout Mice

    PubMed Central

    Niksch, Paul D.; Webber, Roxanna M.; Garcia-Gonzalez, Miguel; Watnick, Terry; Zhou, Jing; Vollrath, Melissa A.; Corey, David P.

    2016-01-01

    Members of the TRP superfamily of ion channels mediate mechanosensation in some organisms, and have been suggested as candidates for the mechanotransduction channel in vertebrate hair cells. Some TRP channels can be ruled out based on lack of an inner ear phenotype in knockout animals or pore properties not similar to the hair-cell channel. Such studies have excluded Trpv4, Trpa1, Trpml3, Trpm1, Trpm3, Trpc1, Trpc3, Trpc5, and Trpc6. However, others remain reasonable candidates. We used data from an RNA-seq analysis of gene expression in hair cells as well as data on TRP channel conductance to narrow the candidate group. We then characterized mice lacking functional Trpm2, Pkd2, Pkd2l1, Pkd2l2 and Pkd1l3, using scanning electron microscopy, auditory brainstem response, permeant dye accumulation, and single-cell electrophysiology. In all of these TRP-deficient mice, and in double and triple knockouts, mechanotransduction persisted. Together with published studies, these results argue against the participation of any of the 33 mouse TRP channels in hair cell transduction. PMID:27196058

  16. Sub-cellular distribution and translocation of TRP channels.

    PubMed

    Toro, Carlos A; Arias, Luis A; Brauchi, Sebastian

    2011-01-01

    Cellular electrical activity is the result of a highly complex processes that involve the activation of ion channel proteins. Ion channels make pores on cell membranes that rapidly transit between conductive and non-conductive states, allowing different ions to flow down their electrochemical gradients across cell membranes. In the case of neuronal cells, ion channel activity orchestrates action potentials traveling through axons, enabling electrical communication between cells in distant parts of the body. Somatic sensation -our ability to feel touch, temperature and noxious stimuli- require ion channels able to sense and respond to our peripheral environment. Sensory integration involves the summing of various environmental cues and their conversion into electrical signals. Members of the Transient Receptor Potential (TRP) family of ion channels have emerged as important mediators of both cellular sensing and sensory integration. The regulation of the spatial and temporal distribution of membrane receptors is recognized as an important mechanism for controlling the magnitude of the cellular response and the time scale on which cellular signaling occurs. Several studies have shown that this mechanism is also used by TRP channels to modulate cellular response and ultimately fulfill their physiological function as sensors. However, the inner-working of this mode of control for TRP channels remains poorly understood. The question of whether TRPs intrinsically regulate their own vesicular trafficking or weather the dynamic regulation of TRP channel residence on the cell surface is caused by extrinsic changes in the rates of vesicle insertion or retrieval remain open. This review will examine the evidence that sub-cellular redistribution of TRP channels plays an important role in regulating their activity and explore the mechanisms that control the trafficking of vesicles containing TRP channels.

  17. TRP ion channels in thermosensation, thermoregulation and metabolism

    PubMed Central

    Wang, Hong; Siemens, Jan

    2015-01-01

    In humans, the TRP superfamily of cation channels includes 27 related molecules that respond to a remarkable variety of chemical and physical stimuli. While physiological roles for many TRP channels remain unknown, over the past years several have been shown to function as molecular sensors in organisms ranging from yeast to humans. In particular, TRP channels are now known to constitute important components of sensory systems, where they participate in the detection or transduction of osmotic, mechanical, thermal, or chemosensory stimuli. We here summarize our current understanding of the role individual members of this versatile receptor family play in thermosensation and thermoregulation, and also touch upon their immerging role in metabolic control. PMID:27227022

  18. Role of Ca++ Influx via Epidermal TRP Ion Channels

    DTIC Science & Technology

    2014-10-01

    determine the epidermis’ response to activation of TRP channels. 2 Keywords Amputation stump, irritant dermatitis , epidermis, skin barrier function, TRP...the personnel who is in contact with subjects. All these requirements were addressed satisfactorily. Impact We view the pilot finding that

  19. Nucks1 synergizes with Trp53 to promote radiation lymphomagenesis in mice

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yue, Yangbo; Leung, Stanley G.; Liu, Yueyong

    NUCKS1 is a 27 kD vertebrate-specific protein, with a role in the DNA damage response. Here, we show that after 4 Gy total-body X-irradiation, Trp53+/- Nucks1+/- mice more rapidly developed tumors, particularly thymic lymphoma (TL), than Trp53+/- mice. TLs in both cohorts showed loss of heterozygosity (LOH) of the Trp53+ allele in essentially all cases. In contrast, LOH of the Nucks1+ allele was rare. Nucks1 expression correlated well with Nucks1 gene dosage in normal thymi, but was increased in the majority of TLs from Trp53+/- Nucks1+/- mice, suggesting that elevated Nucks1 message may be associated with progression towards malignancy inmore » vivo. Trp53+/- Nucks1+/- mice frequently succumbed to CD4- CD8- TLs harboring translocations involving Igh but not Tcra/d, indicating TLs in Trp53+/- Nucks1+/- mice mostly originated prior to the double positive stage and at earlier lineage than TLs in Trp53+/- mice. Monoclonal rearrangements at Tcrb were more prevalent in TLs from Trp53+/- Nucks1+/- mice, as was infiltration of primary TL cells to distant organs (liver, kidney and spleen). We propose that, in the context of Trp53 deficiency, wild type levels of Nucks1 are required to suppress radiation-induced TL, likely through the role of the NUCKS1 protein in the DNA damage response.« less

  20. Nucks1 synergizes with Trp53 to promote radiation lymphomagenesis in mice

    DOE PAGES

    Yue, Yangbo; Leung, Stanley G.; Liu, Yueyong; ...

    2016-08-16

    NUCKS1 is a 27 kD vertebrate-specific protein, with a role in the DNA damage response. Here, we show that after 4 Gy total-body X-irradiation, Trp53+/- Nucks1+/- mice more rapidly developed tumors, particularly thymic lymphoma (TL), than Trp53+/- mice. TLs in both cohorts showed loss of heterozygosity (LOH) of the Trp53+ allele in essentially all cases. In contrast, LOH of the Nucks1+ allele was rare. Nucks1 expression correlated well with Nucks1 gene dosage in normal thymi, but was increased in the majority of TLs from Trp53+/- Nucks1+/- mice, suggesting that elevated Nucks1 message may be associated with progression towards malignancy inmore » vivo. Trp53+/- Nucks1+/- mice frequently succumbed to CD4- CD8- TLs harboring translocations involving Igh but not Tcra/d, indicating TLs in Trp53+/- Nucks1+/- mice mostly originated prior to the double positive stage and at earlier lineage than TLs in Trp53+/- mice. Monoclonal rearrangements at Tcrb were more prevalent in TLs from Trp53+/- Nucks1+/- mice, as was infiltration of primary TL cells to distant organs (liver, kidney and spleen). We propose that, in the context of Trp53 deficiency, wild type levels of Nucks1 are required to suppress radiation-induced TL, likely through the role of the NUCKS1 protein in the DNA damage response.« less

  1. Nucks1 synergizes with Trp53 to promote radiation lymphomagenesis in mice

    PubMed Central

    Yue, Yangbo; Leung, Stanley G.; Liu, Yueyong; Huang, Yurong; Grundt, Kirsten; Østvold, Anne-Carine; Jen, Kuang-Yu; Schild, David; Mao, Jian-Hua; Wiese, Claudia

    2016-01-01

    NUCKS1 is a 27 kD vertebrate-specific protein, with a role in the DNA damage response. Here, we show that after 4 Gy total-body X-irradiation, Trp53+/− Nucks1+/− mice more rapidly developed tumors, particularly thymic lymphoma (TL), than Trp53+/− mice. TLs in both cohorts showed loss of heterozygosity (LOH) of the Trp53+ allele in essentially all cases. In contrast, LOH of the Nucks1+ allele was rare. Nucks1 expression correlated well with Nucks1 gene dosage in normal thymi, but was increased in the majority of TLs from Trp53+/− Nucks1+/− mice, suggesting that elevated Nucks1 message may be associated with progression towards malignancy in vivo. Trp53+/− Nucks1+/− mice frequently succumbed to CD4- CD8- TLs harboring translocations involving Igh but not Tcra/d, indicating TLs in Trp53+/− Nucks1+/− mice mostly originated prior to the double positive stage and at earlier lineage than TLs in Trp53+/- mice. Monoclonal rearrangements at Tcrb were more prevalent in TLs from Trp53+/− Nucks1+/− mice, as was infiltration of primary TL cells to distant organs (liver, kidney and spleen). We propose that, in the context of Trp53 deficiency, wild type levels of Nucks1 are required to suppress radiation-induced TL, likely through the role of the NUCKS1 protein in the DNA damage response. PMID:27542204

  2. Herbal Compounds and Toxins Modulating TRP Channels

    PubMed Central

    Vriens, Joris; Nilius, Bernd; Vennekens, Rudi

    2008-01-01

    Although the benefits are sometimes obvious, traditional or herbal medicine is regarded with skepticism, because the mechanism through which plant compounds exert their powers are largely elusive. Recent studies have shown however that many of these plant compounds interact with specific ion channels and thereby modulate the sensing mechanism of the human body. Especially members of the Transient Receptor Potential (TRP) channels have drawn large attention lately as the receptors for plant-derived compounds such as capsaicin and menthol. TRP channels constitute a large and diverse family of channel proteins that can serve as versatile sensors that allow individual cells and entire organisms to detect changes in their environment. For this family, a striking number of empirical views have turned into mechanism-based actions of natural compounds. In this review we will give an overview of herbal compounds and toxins, which modulate TRP channels. PMID:19305789

  3. A Novel Method for Accurate Operon Predictions in All SequencedProkaryotes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Price, Morgan N.; Huang, Katherine H.; Alm, Eric J.

    2004-12-01

    We combine comparative genomic measures and the distance separating adjacent genes to predict operons in 124 completely sequenced prokaryotic genomes. Our method automatically tailors itself to each genome using sequence information alone, and thus can be applied to any prokaryote. For Escherichia coli K12 and Bacillus subtilis, our method is 85 and 83% accurate, respectively, which is similar to the accuracy of methods that use the same features but are trained on experimentally characterized transcripts. In Halobacterium NRC-1 and in Helicobacterpylori, our method correctly infers that genes in operons are separated by shorter distances than they are in E.coli, andmore » its predictions using distance alone are more accurate than distance-only predictions trained on a database of E.coli transcripts. We use microarray data from sixphylogenetically diverse prokaryotes to show that combining intergenic distance with comparative genomic measures further improves accuracy and that our method is broadly effective. Finally, we survey operon structure across 124 genomes, and find several surprises: H.pylori has many operons, contrary to previous reports; Bacillus anthracis has an unusual number of pseudogenes within conserved operons; and Synechocystis PCC6803 has many operons even though it has unusually wide spacings between conserved adjacent genes.« less

  4. The groESL Chaperone Operon of Lactobacillus johnsonii†

    PubMed Central

    Walker, D. Carey; Girgis, Hany S.; Klaenhammer, Todd R.

    1999-01-01

    The Lactobacillus johnsonii VPI 11088 groESL operon was localized on the chromosome near the insertion element IS1223. The operon was initially cloned as a series of three overlapping PCR fragments, which were sequenced and used to design primers to amplify the entire operon. The amplified fragment was used as a probe to recover the chromosomal copy of the groESL operon from a partial library of L. johnsonii VPI 11088 (NCK88) DNA, cloned in the shuttle vector pTRKH2. The 2,253-bp groESL fragment contained three putative open reading frames, two of which encoded the ubiquitous GroES and GroEL chaperone proteins. Analysis of the groESL promoter region revealed three transcription initiation sites, as well as three sets of inverted repeats (IR) positioned between the transcription and translation start sites. Two of the three IR sets bore significant homology to the CIRCE elements, implicated in negative regulation of the heat shock response in many bacteria. Northern analysis and primer extension revealed that multiple temperature-sensitive promoters preceded the groESL chaperone operon, suggesting that stress protein production in L. johnsonii is strongly regulated. Maximum groESL transcription activity was observed following a shift to 55°C, and a 15 to 30-min exposure of log-phase cells to this temperature increased the recovery of freeze-thawed L. johnsonii VPI 11088. These results suggest that a brief, preconditioning heat shock can be used to trigger increased chaperone production and provide significant cross-protection from the stresses imposed during the production of frozen culture concentrates. PMID:10388700

  5. Transcriptional activation of the tad type IVb pilus operon by PypB in Yersinia enterocolitica.

    PubMed

    Schilling, Jennifer; Wagner, Karin; Seekircher, Stephanie; Greune, Lilo; Humberg, Verena; Schmidt, M Alexander; Heusipp, Gerhard

    2010-07-01

    Type IV pili are virulence factors in various bacteria and mediate, among other functions, the colonization of diverse surfaces. Various subclasses of type IV pili have been identified, but information on pilus expression, biogenesis, and the associated phenotypes is sparse for the genus Yersinia. We recently described the identification of PypB as a transcriptional regulator in Yersinia enterocolitica. Here we show that the pypB gene is associated with the tad locus, a genomic island that is widespread among bacterial and archaeal species. The genetic linkage of pypB with the tad locus is conserved throughout the yersiniae but is not found among other bacteria carrying the tad locus. We show that the genes of the tad locus form an operon in Y. enterocolitica that is controlled by PypB and that pypB is part of this operon. The tad genes encode functions necessary for the biogenesis of the Flp subfamily of type IVb pili initially described for Aggregatibacter actinomycetemcomitans to mediate a tight-adherence phenotype. In Y. enterocolitica, the Flp pilin protein shows some peculiarities in its amino acid sequence that imply similarities as well as differences compared to typical motifs found in the Flp subtype of type IVb pili. Flp is expressed and processed after PypB overproduction, resulting in microcolony formation but not in increased adherence to biotic or abiotic surfaces. Our data describe the transcriptional regulation of the tad type IVb pilus operon by PypB in Y. enterocolitica but fail to show most previously described phenotypes associated with this type of pilus in other bacteria.

  6. Insights into arsenic multi-operons expression and resistance mechanisms in Rhodopseudomonas palustris CGA009

    PubMed Central

    Zhao, Chungui; Zhang, Yi; Chan, Zhuhua; Chen, Shicheng; Yang, Suping

    2015-01-01

    Arsenic (As) is widespread in the environment and causes numerous health problems. Rhodopseudomonas palustris has been regarded as a good model organism for studying arsenic detoxification since it was first demonstrated to methylate environmental arsenic by conversion to soluble or gaseous methylated species. However, the detailed arsenic resistance mechanisms remain unknown though there are at least three arsenic-resistance operons (ars1, ars2, and ars3) in R. palustris. In this study, we investigated how arsenic multi-operons contributed to arsenic detoxification in R. palustris. The expression of ars2 or ars3 operons increased with increasing environmental arsenite (As(III)) concentrations (up to 1.0 mM) while transcript of ars1 operon was not detected in the middle log-phase (55 h). ars2 operon was actively expressed even at the low concentration of As(III) (0.01 μM), whereas the ars3 operon was expressed at 1.0 μM of As(III), indicating that there was a differential regulation mechanism for the three arsenic operons. Furthermore, ars2 and ars3 operons were maximally transcribed in the early log-phase where ars2 operon was 5.4-fold higher than that of ars3 operon. A low level of ars1 transcript was only detected at 43 h (early log-phase). Arsenic speciation analysis demonstrated that R. palustris could reduce As(V) to As(III). Collectively, strain CGA009 detoxified arsenic by using arsenic reduction and methylating arsenic mechanism, while the latter might occur with the presence of higher concentrations of arsenic. PMID:26441915

  7. mar Operon Involved in Multidrug Resistance of Enterobacter aerogenes

    PubMed Central

    Chollet, Renaud; Bollet, Claude; Chevalier, Jacqueline; Malléa, Monique; Pagès, Jean-Marie; Davin-Regli, Anne

    2002-01-01

    We determined the sequence of the entire marRAB operon in Enterobacter aerogenes. It is functionally and structurally analogous to the Escherichia coli operon. The overexpression of E. aerogenes MarA induces a multidrug resistance phenotype in a susceptible strain, demonstrated by a noticeable resistance to various antibiotics, a decrease in immunodetected porins, and active efflux of norfloxacin. PMID:11897595

  8. TrpM8-mediated somatosensation in mouse neocortex.

    PubMed

    Beukema, Patrick; Cecil, Katherine L; Peterson, Elena; Mann, Victor R; Matsushita, Megumi; Takashima, Yoshio; Navlakha, Saket; Barth, Alison L

    2018-06-15

    Somatosensation is a complex sense mediated by more than a dozen distinct neural subtypes in the periphery. Although pressure and touch sensation have been mapped to primary somatosensory cortex in rodents, it has been controversial whether pain and temperature inputs are also directed to this area. Here we use a well-defined somatosensory modality, cool sensation mediated by peripheral TrpM8-receptors, to investigate the neural substrate for cool perception in the mouse neocortex. Using activation of cutaneous TrpM8 receptor-expressing neurons, we identify candidate neocortical areas responsive for cool sensation. Initially, we optimized TrpM8 stimulation and determined that menthol, a selective TrpM8 agonist, was more effective than cool stimulation at inducing expression of the immediate-early gene c-fos in the spinal cord. We developed a broad-scale brain survey method for identification of activated brain areas, using automated methods to quantify c-fos immunoreactivity (fos-IR) across animals. Brain areas corresponding to the posterior insular cortex and secondary somatosensory (S2) show elevated fos-IR after menthol stimulation, in contrast to weaker activation in primary somatosensory cortex (S1). In addition, menthol exposure triggered fos-IR in piriform cortex, the amygdala, and the hypothalamus. Menthol-mediated activation was absent in TrpM8-knock-out animals. Our results indicate that cool somatosensory input broadly drives neural activity across the mouse brain, with neocortical signal most elevated in the posterior insula, as well as S2 and S1. These findings are consistent with data from humans indicating that the posterior insula is specialized for somatosensory information encoding temperature, pain, and gentle touch. © 2018 Wiley Periodicals, Inc.

  9. Distinct modes of perimembrane TRP channel turnover revealed by TIR-FRAP.

    PubMed

    Ghosh, Debapriya; Segal, Andrei; Voets, Thomas

    2014-11-19

    Transient Receptor Potential (TRP) channels form a broadly expressed and functionally diverse family of cation channels involved in various (patho)physiological processes. Whereas the mechanisms that control opening of TRP channels have been extensively studied, little is known about the transport processes of TRP channels to and within the plasma membrane. Here we used Total Internal Reflection--Fluorescence Recovery after Photobleaching (TIR-FRAP) to selectively visualize and bleach the fluorescently labeled TRP channels TRPV2 and TRPM4 in close proximity of the glass-plasma membrane interface, allowing detailed analysis of their perimembrane dynamics. We show that recovery of TRPM4 occurs via 200-nm diameter transport vesicles, and demonstrate the full fusion of such vesicles with the plasma membrane. In contrast, TRPV2 recovery proceeded mainly via lateral diffusion from non-bleached areas of the plasma membrane. Analysis of the two-dimensional channel diffusion kinetics yielded 2D diffusion coefficients ranging between 0.1 and 0.3 μm(2)/s, suggesting that these TRP channels move relatively unrestricted within the plasma membrane. These data demonstrate distinct modes of TRP channel turnover at the plasma membrane and illustrate the usefulness of TIR-FRAP to monitor these processes with high resolution.

  10. Trade-offs with stability modulate innate and mutationally acquired drug-resistance in bacterial dihydrofolate reductase enzymes.

    PubMed

    Matange, Nishad; Bodkhe, Swapnil; Patel, Maitri; Shah, Pooja

    2018-06-05

    Structural stability is a major constraint on the evolution of protein sequences. However, under strong directional selection, mutations that confer novel phenotypes but compromise structural stability of proteins may be permissible. During the evolution of antibiotic resistance, mutations that confer drug resistance often have pleiotropic effects on the structure and function of antibiotic-target proteins, usually essential metabolic enzymes. In this study, we show that trimethoprim-resistant alleles of dihydrofolate reductase from Escherichia coli (EcDHFR) harbouring the Trp30Gly, Trp30Arg or Trp30Cys mutations are significantly less stable than the wild type making them prone to aggregation and proteolysis. This destabilization is associated with lower expression level resulting in a fitness cost and negative epistasis with other TMP-resistant mutations in EcDHFR. Using structure-based mutational analysis we show that perturbation of critical stabilizing hydrophobic interactions in wild type EcDHFR enzyme explains the phenotypes of Trp30 mutants. Surprisingly, though crucial for the stability of EcDHFR, significant sequence variation is found at this site among bacterial DHFRs. Mutational and computational analyses in EcDHFR as well as in DHFR enzymes from Staphylococcus aureus and Mycobacterium tuberculosis demonstrate that natural variation at this site and its interacting hydrophobic residues, modulates TMP-resistance in other bacterial DHFRs as well, and may explain the different susceptibilities of bacterial pathogens to trimethoprim. Our study demonstrates that trade-offs between structural stability and function can influence innate drug resistance as well as the potential for mutationally acquired drug resistance of an enzyme. ©2018 The Author(s).

  11. Mechanisms of Thermosensation in TRP Channels

    NASA Astrophysics Data System (ADS)

    Talavera, Karel; Voets, Thomas; Nilius, Bernd

    The transient receptor potential (TRP) superfamily encompasses a large number of cationic channels that are modulated by a wide variety of physical and chemical stimuli. A notorious subgroup of TRP channels, dubbed thermoTRPs, shows a dramatic dependence on temperature, which can be up to tenfold higher than that of classical ionic channels. Consequently, some thermoTRPs are thought to have a prominent role in the mechanisms of thermosensation and thermoregulation. However, the mechanisms underlying the high temperature sensitivity of thermoTRP activation are, for the most part, obscure. Only four out of the nine thermoTRPs known so far are sufficiently well characterised to allow a comprehensive model to be put forward. Temperature modulates the gating of TRPM8, TRPV1, TRPM4 and TRPM5 by shifting the voltage dependence of channel activation towards more negative potentials, which can be accounted for by a model in which voltage-dependent gating is directly affected by temperature. Heat activation of TRPV3 seems to be consistent with this mechanism, although a modification of the pore may also take place. For TRPV4, it has been proposed that an, as yet unidentified, diffusible ligand mediates activation by heat. The mechanisms for TRPV2, TRPA1 and TRPM2 are still unknown.

  12. Genome sequence and plasmid transformation of the model high-yield bacterial cellulose producer Gluconacetobacter hansenii ATCC 53582

    NASA Astrophysics Data System (ADS)

    Florea, Michael; Reeve, Benjamin; Abbott, James; Freemont, Paul S.; Ellis, Tom

    2016-03-01

    Bacterial cellulose is a strong, highly pure form of cellulose that is used in a range of applications in industry, consumer goods and medicine. Gluconacetobacter hansenii ATCC 53582 is one of the highest reported bacterial cellulose producing strains and has been used as a model organism in numerous studies of bacterial cellulose production and studies aiming to increased cellulose productivity. Here we present a high-quality draft genome sequence for G. hansenii ATCC 53582 and find that in addition to the previously described cellulose synthase operon, ATCC 53582 contains two additional cellulose synthase operons and several previously undescribed genes associated with cellulose production. In parallel, we also develop optimized protocols and identify plasmid backbones suitable for transformation of ATCC 53582, albeit with low efficiencies. Together, these results provide important information for further studies into cellulose synthesis and for future studies aiming to genetically engineer G. hansenii ATCC 53582 for increased cellulose productivity.

  13. Mechanism for pH-dependent gene regulation by amino-terminus-mediated homooligomerization of Bacillus subtilis anti-trp RNA-binding attenuation protein

    PubMed Central

    Sachleben, Joseph R.; McElroy, Craig A.; Gollnick, Paul; Foster, Mark P.

    2010-01-01

    Anti-TRAP (AT) is a small zinc-binding protein that regulates tryptophan biosynthesis in Bacillus subtilis by binding to tryptophan-bound trp RNA-binding attenuation protein (TRAP), thereby preventing it from binding RNA, and allowing transcription and translation of the trpEDCFBA operon. Crystallographic and sedimentation studies have shown that AT can homooligomerize to form a dodecamer, AT12, composed of a tetramer of trimers, AT3. Structural and biochemical studies suggest that only trimeric AT is active for binding to TRAP. Our chromatographic and spectroscopic data revealed that a large fraction of recombinantly overexpressed AT retains the N-formyl group (fAT), presumably due to incomplete N-formyl-methionine processing by peptide deformylase. Hydrodynamic parameters from NMR relaxation and diffusion measurements showed that fAT is exclusively trimeric (AT3), while (deformylated) AT exhibits slow exchange between both trimeric and dodecameric forms. We examined this equilibrium using NMR spectroscopy and found that oligomerization of active AT3 to form inactive AT12 is linked to protonation of the amino terminus. Global analysis of the pH dependence of the trimer-dodecamer equilibrium revealed a near physiological pKa for the N-terminal amine of AT and yielded a pH-dependent oligomerization equilibrium constant. Estimates of excluded volume effects due to molecular crowding suggest the oligomerization equilibrium may be physiologically important. Because deprotonation favors “active” trimeric AT and protonation favors “inactive” dodecameric AT, our findings illuminate a possible mechanism for sensing and responding to changes in cellular pH. PMID:20713740

  14. Thermodynamics of the Trp-cage Miniprotein Unfolding in Urea

    PubMed Central

    Wafer, Lucas N. R.; Streicher, Werner W.; Makhatadze, George I.

    2010-01-01

    The thermodynamic properties of unfolding of the Trp-cage mini protein in the presence of various concentrations of urea have been characterized using temperature-induced unfolding monitored by far-UV circular dichroism spectroscopy. Analysis of the data using a two-state model allowed the calculation of the Gibbs energy of unfolding at 25°C as a function of urea concentration. This in turn was analyzed by the linear extrapolation model that yielded the dependence of Gibbs energy on urea concentration, i.e. the m-value for Trp-cage unfolding. The m-value obtained from the experimental data, as well as the experimental heat capacity change upon unfolding, were correlated with the structural parameters derived from the three dimensional structure of Trp-cage. It is shown that the m-value can be predicted well using a transfer model, while the heat capacity changes are in very good agreement with the empirical models based on model compounds studies. These results provide direct evidence that Trp-cage, despite its small size, is an excellent model for studies of protein unfolding and provide thermodynamic data that can be used to compare with atomistic computer simulations. PMID:20112418

  15. The TRP channel superfamily: insights into how structure, protein-lipid interactions and localization influence function.

    PubMed

    Reaves, B J; Wolstenholme, A J

    2007-02-01

    TRP (transient receptor potential) cationic channels are key molecules that are involved in a variety of diverse biological processes ranging from fertility to osmosensation and nociception. Increasing our knowledge of these channels will help us to understand a range of physiological and pathogenic processes, as well as highlighting potential therapeutic drug targets. The founding members of the TRP family, Drosophila TRP and TRPL (TRP-like) proteins, were identified within the last two decades and there has been a subsequent explosion in the number and type of TRP channel described. Although information is accumulating as to the function of some of the TRP channels, the activation and inactivation mechanisms, structure, and interacting proteins of many, if not most, are awaiting elucidation. The Cell and Molecular Biology of TRP Channels Meeting held at the University of Bath included speakers working on a number of the different subfamilies of TRP channels and provided a basis for highlighting both similarities and differences between these groups. As the TRP channels mediate diverse functions, this meeting also brought together an audience with wide-ranging research interests, including biochemistry, cell biology, physiology and neuroscience, and inspired lively discussion on the issues reviewed herein.

  16. Immunolocalization and distribution of functional temperature-sensitive TRP channels in salivary glands.

    PubMed

    Sobhan, Ubaidus; Sato, Masaki; Shinomiya, Takashi; Okubo, Migiwa; Tsumura, Maki; Muramatsu, Takashi; Kawaguchi, Mitsuru; Tazaki, Masakazu; Shibukawa, Yoshiyuki

    2013-11-01

    Transient receptor potential (TRP) cation channels are unique cellular sensors involved in multiple cellular functions. Their role in salivary secretion remains to be elucidated. The expression and localization of temperature-sensitive TRP channels in salivary (submandibular, sublingual and parotid) glands were analyzed by immunohistochemistry and quantitative real-time reverse transcription plus the polymerase chain reaction (RT-PCR). The effects of various TRP channel agonists on carbachol (CCh)-induced salivary secretion in the submandibular gland and on the intracellular Ca(2+) concentration ([Ca(2+)]i) in a submandibular epithelial cell line were also investigated. Immunohistochemistry revealed the expression of TRP-melastatin subfamily member 8 (TRPM8) and TRP-ankyrin subfamily member 1 (TRPA1) in myoepithelial, acinar and ductal cells in the sublingual, submandibular and parotid glands. In addition, TRP-vanilloid subfamily member 1 (TRPV1), TRPV3 and TRPV4 were also expressed in myoepithelial, acinar and ductal cells in all three types of gland. Quantitative real-time RT-PCR results demonstrated the mRNA expression of TRPV1, TRPV3, TRPV4, TRPM8 and TRPA1 in acinar and ductal cells in these salivary glands. Perfusion of the entire submandibular gland with the TRPV1 agonist capsaicin (1 μM) via the submandibular artery significantly increased CCh-induced salivation, whereas perfusion with TRPM8 and TRPA1 agonists (0.5 μM WS12 and 100 μM allyl isothiocyanate) decreased it. Application of agonists for each of the thermosensitive TRP channels increased [Ca(2+)]i in a submandibular epithelial cell line. These results indicate that temperature-sensitive TRP channels are localized and distributed in acinar, ductal and myoepithelial cells in salivary glands and that they play a functional role in the regulation and/or modulation of salivary secretion.

  17. rrndb: the Ribosomal RNA Operon Copy Number Database

    PubMed Central

    Klappenbach, Joel A.; Saxman, Paul R.; Cole, James R.; Schmidt, Thomas M.

    2001-01-01

    The Ribosomal RNA Operon Copy Number Database (rrndb) is an Internet-accessible database containing annotated information on rRNA operon copy number among prokaryotes. Gene redundancy is uncommon in prokaryotic genomes, yet the rRNA genes can vary from one to as many as 15 copies. Despite the widespread use of 16S rRNA gene sequences for identification of prokaryotes, information on the number and sequence of individual rRNA genes in a genome is not readily accessible. In an attempt to understand the evolutionary implications of rRNA operon redundancy, we have created a phylogenetically arranged report on rRNA gene copy number for a diverse collection of prokaryotic microorganisms. Each entry (organism) in the rrndb contains detailed information linked directly to external websites including the Ribosomal Database Project, GenBank, PubMed and several culture collections. Data contained in the rrndb will be valuable to researchers investigating microbial ecology and evolution using 16S rRNA gene sequences. The rrndb web site is directly accessible on the WWW at http://rrndb.cme.msu.edu. PMID:11125085

  18. Phenotypical Analysis of the Lactobacillus rhamnosus GG Fimbrial spaFED Operon: Surface Expression and Functional Characterization of Recombinant SpaFED Pili in Lactococcus lactis

    PubMed Central

    Kant, Ravi; Palva, Airi; von Ossowski, Ingemar

    2014-01-01

    A noticeable genomic feature of many piliated Gram-positive bacterial species is the presence of more than one pilus-encoding operon. Paradigmatically, the gut-adapted Lactobacillus rhamnosus GG strain contains two different fimbrial operons in its genome. However, whereas one of these operons (called spaCBA) is encoding for the functionally mucus-/collagen-binding SpaCBA pilus, for the other operon (called spaFED) any native expression of the SpaFED-called pili is still the subject of some uncertainty. Irrespective of such considerations, we decided it would be of relevance or interest to decipher the gross structure of this pilus type, and as well assess its functional capabilities for cellular adhesion and immunostimulation. For this, and by following the approach we had used previously to explicate the immuno-properties of SpaCBA pili, we constructed nisin-inducible expression clones producing either wild-type or SpaF pilin-deleted surface-assembled L. rhamnosus GG SpaFED pili on Lactococcus lactis cells. Using these piliated lactococcal constructs, we found that the pilin-polymerized architecture of a recombinant-produced SpaFED pilus coincides with sequence-based functional predictions of the related pilins, and in fact is prototypical of those other sortase-dependent pilus-like structures thus far characterized for piliated Gram-positive bacteria. Moreover, we confirmed that among the different pilin subunits encompassing spaFED operon-encoded pili, the SpaF pilin is a main adhesion determinant, and when present in the assembled structure can mediate pilus binding to mucus, certain extracellular matrix proteins, and different gut epithelial cell lines. However, somewhat unexpectedly, when recombinant SpaFED pili are surface-attached, we found that they could not potentiate the existing lactococcal cell-induced immune responses so elicited from intestinal- and immune-related cells, but rather instead, they could dampen them. Accordingly, we have now provided

  19. Phenotypical analysis of the Lactobacillus rhamnosus GG fimbrial spaFED operon: surface expression and functional characterization of recombinant SpaFED pili in Lactococcus lactis.

    PubMed

    Rintahaka, Johanna; Yu, Xia; Kant, Ravi; Palva, Airi; von Ossowski, Ingemar

    2014-01-01

    A noticeable genomic feature of many piliated Gram-positive bacterial species is the presence of more than one pilus-encoding operon. Paradigmatically, the gut-adapted Lactobacillus rhamnosus GG strain contains two different fimbrial operons in its genome. However, whereas one of these operons (called spaCBA) is encoding for the functionally mucus-/collagen-binding SpaCBA pilus, for the other operon (called spaFED) any native expression of the SpaFED-called pili is still the subject of some uncertainty. Irrespective of such considerations, we decided it would be of relevance or interest to decipher the gross structure of this pilus type, and as well assess its functional capabilities for cellular adhesion and immunostimulation. For this, and by following the approach we had used previously to explicate the immuno-properties of SpaCBA pili, we constructed nisin-inducible expression clones producing either wild-type or SpaF pilin-deleted surface-assembled L. rhamnosus GG SpaFED pili on Lactococcus lactis cells. Using these piliated lactococcal constructs, we found that the pilin-polymerized architecture of a recombinant-produced SpaFED pilus coincides with sequence-based functional predictions of the related pilins, and in fact is prototypical of those other sortase-dependent pilus-like structures thus far characterized for piliated Gram-positive bacteria. Moreover, we confirmed that among the different pilin subunits encompassing spaFED operon-encoded pili, the SpaF pilin is a main adhesion determinant, and when present in the assembled structure can mediate pilus binding to mucus, certain extracellular matrix proteins, and different gut epithelial cell lines. However, somewhat unexpectedly, when recombinant SpaFED pili are surface-attached, we found that they could not potentiate the existing lactococcal cell-induced immune responses so elicited from intestinal- and immune-related cells, but rather instead, they could dampen them. Accordingly, we have now provided

  20. Induction of the Nitrate Assimilation nirA Operon and Protein-Protein Interactions in the Maturation of Nitrate and Nitrite Reductases in the Cyanobacterium Anabaena sp. Strain PCC 7120.

    PubMed

    Frías, José E; Flores, Enrique

    2015-07-01

    Nitrate is widely used as a nitrogen source by cyanobacteria, in which the nitrate assimilation structural genes frequently constitute the so-called nirA operon. This operon contains the genes encoding nitrite reductase (nirA), a nitrate/nitrite transporter (frequently an ABC-type transporter; nrtABCD), and nitrate reductase (narB). In the model filamentous cyanobacterium Anabaena sp. strain PCC 7120, which can fix N2 in specialized cells termed heterocysts, the nirA operon is expressed at high levels only in media containing nitrate or nitrite and lacking ammonium, a preferred nitrogen source. Here we examined the genes downstream of the nirA operon in Anabaena and found that a small open reading frame of unknown function, alr0613, can be cotranscribed with the operon. The next gene in the genome, alr0614 (narM), showed an expression pattern similar to that of the nirA operon, implying correlated expression of narM and the operon. A mutant of narM with an insertion mutation failed to produce nitrate reductase activity, consistent with the idea that NarM is required for the maturation of NarB. Both narM and narB mutants were impaired in the nitrate-dependent induction of the nirA operon, suggesting that nitrite is an inducer of the operon in Anabaena. It has previously been shown that the nitrite reductase protein NirA requires NirB, a protein likely involved in protein-protein interactions, to attain maximum activity. Bacterial two-hybrid analysis confirmed possible NirA-NirB and NarB-NarM interactions, suggesting that the development of both nitrite reductase and nitrate reductase activities in cyanobacteria involves physical interaction of the corresponding enzymes with their cognate partners, NirB and NarM, respectively. Nitrate is an important source of nitrogen for many microorganisms that is utilized through the nitrate assimilation system, which includes nitrate/nitrite membrane transporters and the nitrate and nitrite reductases. Many cyanobacteria

  1. A Homologue of an Operon Required for DNA Transfer in Agrobacterium Is Required in Brucella abortus for Virulence and Intracellular Multiplication

    PubMed Central

    Sieira, Rodrigo; Comerci, Diego J.; Sánchez, Daniel O.; Ugalde, Rodolfo A.

    2000-01-01

    As part of a Brucella abortus 2308 genome project carried out in our laboratory, we identified, cloned, and sequenced a genomic DNA fragment containing a locus (virB) highly homologous to bacterial type IV secretion systems. The B. abortus virB locus is a collinear arrangement of 13 open reading frames (ORFs). Between virB1 and virB2 and downstream of ORF12, two degenerated, palindromic repeat sequences characteristic of Brucella intergenic regions were found. Gene reporter studies demonstrated that the B. abortus virB locus constitutes an operon transcribed from virB1 which is turned on during the stationary phase of growth. A B. abortus polar virB1 mutant failed to replicate in HeLa cells, indicating that the virB operon plays a critical role in intracellular multiplication. Mutants with polar and nonpolar mutations introduced in virB10 showed different behaviors in mice and in the HeLa cell infection assay, suggesting that virB10 per se is necessary for the correct function of this type IV secretion apparatus. Mouse infection assays demonstrated that the virB operon constitutes a major determinant of B. abortus virulence. It is suggested that putative effector molecules secreted by this type IV secretion system determine routing of B. abortus to an endoplasmic reticulum-related replication compartment. PMID:10940027

  2. cea-kil operon of the ColE1 plasmid.

    PubMed Central

    Sabik, J F; Suit, J L; Luria, S E

    1983-01-01

    We isolated a series of Tn5 transposon insertion mutants and chemically induced mutants with mutations in the region of the ColE1 plasmid that includes the cea (colicin) and imm (immunity) genes. Bacterial cells harboring each of the mutant plasmids were tested for their response to the colicin-inducing agent mitomycin C. All insertion mutations within the cea gene failed to bring about cell killing after mitomycin C treatment. A cea- amber mutation exerted a polar effect on killing by mitomycin C. Two insertions beyond the cea gene but within or near the imm gene also prevented the lethal response to mitomycin C. These findings suggest the presence in the ColE1 plasmid of an operon containing the cea and kil genes whose product is needed for mitomycin C-induced lethality. Bacteria carrying ColE1 plasmids with Tn5 inserted within the cea gene produced serologically cross-reacting fragments of the colicin E1 molecule, the lengths of which were proportional to the distance between the insertion and the promoter end of the cea gene. Images PMID:6298187

  3. Inactivation of the sapA to sapF locus of Erwinia chrysanthemi reveals common features in plant and animal bacterial pathogenesis.

    PubMed

    López-Solanilla, E; García-Olmedo, F; Rodríguez-Palenzuela, P

    1998-06-01

    We investigated the role in pathogenesis of bacterial resistance to plant antimicrobial peptides. The sapA to sapF (for sensitive to antimicrobial peptides) operon from the pathogenic bacterium Erwinia chrysanthemi has been characterized. It has five open reading frames that are closely related (71% overall amino acid identity) and are in the same order as those of the sapA to sapF operon from Salmonella typhimurium. An E. chrysanthemi sap mutant strain was constructed by marker exchange. This mutant was more sensitive than was the wild type to wheat alpha-thionin and to snakin-1, which is the most abundant antimicrobial peptide from potato tubers. This mutant was also less virulent than was the wild-type strain in potato tubers: lesion area was 37% that of the control, and growth rate was two orders of magnitude lower. These results indicate that the interaction of antimicrobial peptides from the host with the sapA to sapF operon from the pathogen plays a similar role in animal and in plant bacterial pathogenesis.

  4. Light-induced Conversion of Trp to Gly and Gly Hydroperoxide in IgG1

    PubMed Central

    Haywood, Jessica; Mozziconacci, Olivier; Allegre, Kevin M.; Kerwin, Bruce A.; Schöneich, Christian

    2013-01-01

    The exposure of IgG1 in aqueous solution to light with λ = 254 nm or λ > 295 nm yields products consistent with Trp radical cation formation followed by αC-βC cleavage of the Trp side chain. The resulting glycyl radicals are either reduced to Gly, or add oxygen prior to reduction to Gly hydroperoxide. Photoirradiation at λ = 254 nm targets Trp at positions 191 (light chain), 309 and 377 (heavy chain) while photoirradiation at λ > 295 nm targets Trp at position 309 (heavy chain). Mechanistically, the formation of Trp radical cations likely proceeds via photo-induced electron- or hydrogen-transfer to disulfide bonds, yielding thiyl radicals and thiols, where thiols may serve as reductants for the intermediary glycyl or glycylperoxyl radicals. PMID:23363477

  5. Incorporation of a horizontally transferred gene into an operon during cnidarian evolution.

    PubMed

    Dana, Catherine E; Glauber, Kristine M; Chan, Titus A; Bridge, Diane M; Steele, Robert E

    2012-01-01

    Genome sequencing has revealed examples of horizontally transferred genes, but we still know little about how such genes are incorporated into their host genomes. We have previously reported the identification of a gene (flp) that appears to have entered the Hydra genome through horizontal transfer. Here we provide additional evidence in support of our original hypothesis that the transfer was from a unicellular organism, and we show that the transfer occurred in an ancestor of two medusozoan cnidarian species. In addition we show that the gene is part of a bicistronic operon in the Hydra genome. These findings identify a new animal phylum in which trans-spliced leader addition has led to the formation of operons, and define the requirements for evolution of an operon in Hydra. The identification of operons in Hydra also provides a tool that can be exploited in the construction of transgenic Hydra strains.

  6. Escherichia coli mutant with altered respiratory control of the frd operon.

    PubMed Central

    Iuchi, S; Kuritzkes, D R; Lin, E C

    1985-01-01

    In wild-type Escherichia coli, fumarate reductase encoded by the frd operon is inducible by its substrate in the absence of molecular oxygen and nitrate. Synthesis of this enzyme under permissive conditions requires the fnr+ gene product, which is believed to be a pleiotropic regulatory protein that activates transcription. A spontaneous mutant was isolated in which the expression of the frd operon no longer depended on the presence of fumarate or the fnr+ gene product. Aerobic repression of the operon was abolished, but nitrate repression remained intact. Transductional analysis showed that the mutation was closely linked to the frd locus. The mutant phenotype strongly suggests that repression by molecular oxygen and nitrate is mediated by different mechanisms. PMID:3882660

  7. Frameshifting in the expression of the Escherichia coli trpR gene is modulated by translation initiation.

    PubMed Central

    Benhar, I; Miller, C; Engelberg-Kulka, H

    1993-01-01

    The Escherichia coli trpR gene encodes the 108-amino-acid-long Trp repressor. We have shown previously that a +1 frameshifting event occurs during the expression of trpR, resulting in the synthesis of an additional (+1 frame) polypeptide. Using trpR-lac'Z fusions, we have recently found that the transition from the 0 to the +1 frame occurs via the bypassing of a 55-nucleotide-long segment of the trpR+1-lac'Z mRNA (I. Benhar, and H. Engelberg-Kulka, Cell 72:121-130, 1993). Here we show that the frequency of trpR frameshifting (or bypassing) can be regulated both in vivo and in vitro. This frequency is inversely proportional to the rate of initiation of translation of the trpR gene. Hence, modulating the level of translation initiation affects the frequency of frameshifting. Images PMID:8491735

  8. Transcriptional Activation of Pyoluteorin Operon Mediated by the LysR-Type Regulator PltR Bound at a 22 bp lys Box in Pseudomonas aeruginosa M18

    PubMed Central

    Wang, Guohao; Xu, Yuquan

    2012-01-01

    Pseudomonas aeruginosa M18, a rhizosphere-isolated bacterial strain showing strong antifungal activity, can produce secondary metabolites such as phenazine-1-carboxylic acid and pyoluteorin (Plt). The LysR-type transcriptional regulator PltR activates the Plt biosynthesis operon pltLABCDEFG, the expression of which is induced by Plt. Here, we identified and characterized the non-conserved pltL promoter (pltLp) specifically activated by PltR and its upstream neighboring lys box from the complicated pltR–pltL intergenic sequence. The 22 bp palindromic lys box, which consists of two 9 bp complementary inverted repeats interrupted by 4 bp, was found to contain the conserved, GC-rich LysR-binding motif (T-N11-A). Evidence obtained in vivo from mutational and lacZ report analyses and in vitro from electrophoretic mobility shift assays reveals that the PltR protein directly bound to the pltLp region as the indispensable binding motif “lys box”, thereby transcriptionally activating the pltLp-driven plt operon expression. Plt, as a potential non-essential coinducer of PltR, specifically induced the pltLp expression and thus strengthened its biosynthetic plt operon expression. PMID:22761817

  9. A Heat-Sensitive TRP Channel Expressed in Keratinocytes

    NASA Astrophysics Data System (ADS)

    Peier, Andrea M.; Reeve, Alison J.; Andersson, David A.; Moqrich, Aziz; Earley, Taryn J.; Hergarden, Anne C.; Story, Gina M.; Colley, Sian; Hogenesch, John B.; McIntyre, Peter; Bevan, Stuart; Patapoutian, Ardem

    2002-06-01

    Mechanical and thermal cues stimulate a specialized group of sensory neurons that terminate in the skin. Three members of the transient receptor potential (TRP) family of channels are expressed in subsets of these neurons and are activated at distinct physiological temperatures. Here, we describe the cloning and characterization of a novel thermosensitive TRP channel. TRPV3 has a unique threshold: It is activated at innocuous (warm) temperatures and shows an increased response at noxious temperatures. TRPV3 is specifically expressed in keratinocytes; hence, skin cells are capable of detecting heat via molecules similar to those in heat-sensing neurons.

  10. Multiple regulatory elements for the glpA operon encoding anaerobic glycerol-3-phosphate dehydrogenase and the glpD operon encoding aerobic glycerol-3-phosphate dehydrogenase in Escherichia coli: further characterization of respiratory control.

    PubMed

    Iuchi, S; Cole, S T; Lin, E C

    1990-01-01

    In Escherichia coli, sn-glycerol-3-phosphate can be oxidized by two different flavo-dehydrogenases, an anaerobic enzyme encoded by the glpACB operon and an aerobic enzyme encoded by the glpD operon. These two operons belong to the glp regulon specifying the utilization of glycerol, sn-glycerol-3-phosphate, and glycerophosphodiesters. In glpR mutant cells grown under conditions of low catabolite repression, the glpA operon is best expressed anaerobically with fumarate as the exogenous electron acceptor, whereas the glpD operon is best expressed aerobically. Increased anaerobic expression of glpA is dependent on the fnr product, a pleiotropic activator of genes involved in anaerobic respiration. In this study we found that the expression of a glpA1(Oxr) (oxygen-resistant) mutant operon, selected for increased aerobic expression, became less dependent on the FNR protein but more dependent on the cyclic AMP-catabolite gene activator protein complex mediating catabolite repression. Despite the increased aerobic expression of glpA1(Oxr), a twofold aerobic repressibility persisted. Moreover, anaerobic repression by nitrate respiration remained normal. Thus, there seems to exist a redox control apart from the FNR-mediated one. We also showed that the anaerobic repression of the glpD operon was fully relieved by mutations in either arcA (encoding a presumptive DNA recognition protein) or arcB (encoding a presumptive redox sensor protein). The arc system is known to mediate pleiotropic control of genes of aerobic function.

  11. Role of P27 -P55 operon from Mycobacterium tuberculosis in the resistance to toxic compounds

    PubMed Central

    2011-01-01

    Background The P27-P55 (lprG-Rv1410c) operon is crucial for the survival of Mycobacterium tuberculosis, the causative agent of human tuberculosis, during infection in mice. P55 encodes an efflux pump that has been shown to provide Mycobacterium smegmatis and Mycobacterium bovis BCG with resistance to several drugs, while P27 encodes a mannosylated glycoprotein previously described as an antigen that modulates the immune response against mycobacteria. The objective of this study was to determine the individual contribution of the proteins encoded in the P27-P55 operon to the resistance to toxic compounds and to the cell wall integrity of M. tuberculosis. Method In order to test the susceptibility of a mutant of M. tuberculosis H37Rv in the P27-P55 operon to malachite green, sodium dodecyl sulfate, ethidium bromide, and first-line antituberculosis drugs, this strain together with the wild type strain and a set of complemented strains were cultivated in the presence and in the absence of these drugs. In addition, the malachite green decolorization rate of each strain was obtained from decolorization curves of malachite green in PBS containing bacterial suspensions. Results The mutant strain decolorized malachite green faster than the wild type strain and was hypersensitive to both malachite green and ethidium bromide, and more susceptible to the first-line antituberculosis drugs: isoniazid and ethambutol. The pump inhibitor reserpine reversed M. tuberculosis resistance to ethidium bromide. These results suggest that P27-P55 functions through an efflux-pump like mechanism. In addition, deletion of the P27-P55 operon made M. tuberculosis susceptible to sodium dodecyl sulfate, suggesting that the lack of both proteins causes alterations in the cell wall permeability of the bacterium. Importantly, both P27 and P55 are required to restore the wild type phenotypes in the mutant. Conclusions The results clearly indicate that P27 and P55 are functionally connected in

  12. Quantitative approaches to the study of bistability in the lac operon of Escherichia coli.

    PubMed

    Santillán, Moisés; Mackey, Michael C

    2008-08-06

    In this paper, the history and importance of the lac operon in the development of molecular and systems biology are briefly reviewed. We start by presenting a description of the regulatory mechanisms in this operon, taking into account the most recent discoveries. Then we offer a survey of the history of the lac operon, including the discovery of its main elements and the subsequent influence on the development of molecular and systems biology. Next the bistable behaviour of the operon is discussed, both with respect to its discovery and its molecular origin. A review of the literature in which this bistable phenomenon has been studied from a mathematical modelling viewpoint is then given. We conclude with some brief remarks.

  13. Stochastic Switching Induced Adaptation in a Starved Escherichia coli Population

    PubMed Central

    Ito, Yoichiro; Ying, Bei-Wen; Yomo, Tetsuya

    2011-01-01

    Population adaptation can be determined by stochastic switching in living cells. To examine how stochastic switching contributes to the fate decision for a population under severe stress, we constructed an Escherichia coli strain crucially dependent on the expression of a rewired gene. The gene essential for tryptophan biosynthesis, trpC, was removed from the native regulatory unit, the Trp operon, and placed under the extraneous control of the lactose utilisation network. Bistability of the network provided the cells two discrete phenotypes: the induced and suppressed level of trpC. The two phenotypes permitted the cells to grow or not, respectively, under conditions of tryptophan depletion. We found that stochastic switching between the two states allowed the initially suppressed cells to form a new population with induced trpC in response to tryptophan starvation. However, the frequency of the transition from suppressed to induced state dropped off dramatically in the starved population, in comparison to that in the nourished population. This reduced switching rate was compensated by increasing the initial population size, which probably provided the cell population more chances to wait for the rarely appearing fit cells from the unfit cells. Taken together, adaptation of a starved bacterial population because of stochasticity in the gene rewired from the ancient regulon was experimentally confirmed, and the nutritional status and the population size played a great role in stochastic adaptation. PMID:21931628

  14. Drosophila TRP channels and animal behavior

    PubMed Central

    Fowler, Melissa A.; Montell, Craig

    2012-01-01

    Multiple classes of cell surface receptors and ion channels participate in the detection of changes in environmental stimuli, and thereby influence animal behavior. Among the many classes of ion channels, Transient Receptor Potential (TRP) cation channels are notable in contributing to virtually every sensory modality, and in controlling a daunting array of behaviors. TRP channels appear to be conserved in all metazoan organisms including worms, insects and humans. Flies encode 13 TRPs, most of which are expressed and function in sensory neurons, and impact behaviors ranging from phototaxis to thermotaxis, gravitaxis, the avoidance of noxious tastants and smells and proprioception. Multiple diseases result from defects in TRPs, and flies provide an excellent animal model for dissecting the mechanisms underlying “TRPopathies.” Drosophila TRPs also function in the sensation of botanically derived insect repellents, and related TRPs in insect pests are potential targets for the development of improved repellents to combat insect-borne diseases. PMID:22877650

  15. Identification and characterization of transcripts from the biotin biosynthetic operon of Bacillus subtilis.

    PubMed

    Perkins, J B; Bower, S; Howitt, C L; Yocum, R R; Pero, J

    1996-11-01

    Northern (RNA) blot analysis of the Bacillus subtilis biotin operon, bioWAFDBIorf2, detected at least two steady-state polycistronic transcripts initiated from a putative vegetative (Pbio) promoter that precedes the operon, i.e., a full-length 7.2-kb transcript covering the entire operon and a more abundant 5.1-kb transcript covering just the first five genes of the operon. Biotin and the B. subtilis birA gene product regulated synthesis of the transcripts. Moreover, replacing the putative Pbio promoter and regulatory sequence with a constitutive SP01 phage promoter resulted in higher-level constitutive synthesis. Removal of a rho-independent terminator-like sequence located between the fifth (bioB) and sixth (bioI) genes prevented accumulation of the 5.1-kb transcript, suggesting that the putative terminator functions to limit expression of bioI, which is thought to be involved in an early step in biotin synthesis.

  16. Influence of Trp flipping on carbohydrate binding in lectins. An example on Aleuria aurantia lectin AAL.

    PubMed

    Houser, Josef; Kozmon, Stanislav; Mishra, Deepti; Mishra, Sushil K; Romano, Patrick R; Wimmerová, Michaela; Koča, Jaroslav

    2017-01-01

    Protein-carbohydrate interactions are very often mediated by the stacking CH-π interactions involving the side chains of aromatic amino acids such as tryptophan (Trp), tyrosine (Tyr) or phenylalanine (Phe). Especially suitable for stacking is the Trp residue. Analysis of the PDB database shows Trp stacking for 265 carbohydrate or carbohydrate like ligands in 5 208 Trp containing motives. An appropriate model system to study such an interaction is the AAL lectin family where the stacking interactions play a crucial role and are thought to be a driving force for carbohydrate binding. In this study we present data showing a novel finding in the stacking interaction of the AAL Trp side chain with the carbohydrate. High resolution X-ray structure of the AAL lectin from Aleuria aurantia with α-methyl-l-fucoside ligand shows two possible Trp side chain conformations with the same occupation in electron density. The in silico data shows that the conformation of the Trp side chain does not influence the interaction energy despite the fact that each conformation creates interactions with different carbohydrate CH groups. Moreover, the PDB data search shows that the conformations are almost equally distributed across all Trp-carbohydrate complexes, which would suggest no substantial preference for one conformation over another.

  17. RtcB is the RNA ligase component of an Escherichia coli RNA repair operon.

    PubMed

    Tanaka, Naoko; Shuman, Stewart

    2011-03-11

    RNA 2',3'-cyclic phosphate ends play important roles in RNA metabolism as substrates for RNA ligases during tRNA restriction-repair and tRNA splicing. Diverse bacteria from multiple phyla encode a two-component RNA repair cassette, comprising Pnkp (polynucleotide kinase-phosphatase-ligase) and Hen1 (RNA 3'-terminal ribose 2'-O-methyltransferase), that heals and then seals broken tRNAs with 2',3'-cyclic phosphate and 5'-OH ends. The Pnkp-Hen1 repair operon is absent in the majority of bacterial species, thereby raising the prospect that other RNA repair systems might be extant. A candidate component is RNA 3'-phosphate cyclase, a widely distributed enzyme that transforms RNA 3'-monophosphate termini into 2',3'-cyclic phosphates but cannot seal the ends it produces. Escherichia coli RNA cyclase (RtcA) is encoded in a σ(54)-regulated operon with RtcB, a protein of unknown function. Taking a cue from Pnkp-Hen1, we purified E. coli RtcB and tested it for RNA ligase activity. We report that RtcB per se seals broken tRNA-like stem-loop structures with 2',3'-cyclic phosphate and 5'-OH ends to form a splice junction with a 2'-OH, 3',5'-phosphodiester. We speculate that: (i) RtcB might afford bacteria a means to recover from stress-induced RNA damage; and (ii) RtcB homologs might catalyze tRNA repair or splicing reactions in archaea and eukarya.

  18. Functional analysis of aromatic biosynthetic pathways in Pseudomonas putida KT2440

    PubMed Central

    Molina‐Henares, M. Antonia; García‐Salamanca, Adela; Molina‐Henares, A. Jesús; De La Torre, Jesús; Herrera, M. Carmen; Ramos, Juan L.; Duque, Estrella

    2009-01-01

    Summary Pseudomonas putida KT2440 is a non‐pathogenic prototrophic bacterium with high potential for biotechnological applications. Despite all that is known about this strain, the biosynthesis of essential chemicals has not been fully analysed and auxotroph mutants are scarce. We carried out massive mini‐Tn5 random mutagenesis and screened for auxotrophs that require aromatic amino acids. The biosynthesis of aromatic amino acids was analysed in detail including physical and transcriptional organization of genes, complementation assays and feeding experiments to establish pathway intermediates. There is a single pathway from chorismate leading to the biosynthesis of tryptophan, whereas the biosynthesis of phenylalanine and tyrosine is achieved through multiple convergent pathways. Genes for tryptophan biosynthesis are grouped in unlinked regions with the trpBA and trpGDE genes organized as operons and the trpI, trpE and trpF genes organized as single transcriptional units. The pheA and tyrA gene‐encoding multifunctional enzymes for phenylalanine and tyrosine biosynthesis are linked in the chromosome and form an operon with the serC gene involved in serine biosynthesis. The last step in the biosynthesis of these two amino acids requires an amino transferase activity for which multiple tyrB‐like genes are present in the host chromosome. PMID:21261884

  19. Identification of an operon, Pil-Chp, that controls twitching motility and virulence in Xylella fastidiosa.

    PubMed

    Cursino, Luciana; Galvani, Cheryl D; Athinuwat, Dusit; Zaini, Paulo A; Li, Yaxin; De La Fuente, Leonardo; Hoch, Harvey C; Burr, Thomas J; Mowery, Patricia

    2011-10-01

    Xylella fastidiosa is an important phytopathogenic bacterium that causes many serious plant diseases, including Pierce's disease of grapevines. Disease manifestation by X. fastidiosa is associated with the expression of several factors, including the type IV pili that are required for twitching motility. We provide evidence that an operon, named Pil-Chp, with genes homologous to those found in chemotaxis systems, regulates twitching motility. Transposon insertion into the pilL gene of the operon resulted in loss of twitching motility (pilL is homologous to cheA genes encoding kinases). The X. fastidiosa mutant maintained the type IV pili, indicating that the disrupted pilL or downstream operon genes are involved in pili function, and not biogenesis. The mutated X. fastidiosa produced less biofilm than wild-type cells, indicating that the operon contributes to biofilm formation. Finally, in planta the mutant produced delayed and less severe disease, indicating that the Pil-Chp operon contributes to the virulence of X. fastidiosa, presumably through its role in twitching motility.

  20. Transcription-coupled repair of UV damage in the halophilic archaea.

    PubMed

    Stantial, Nicole; Dumpe, Jarrod; Pietrosimone, Kathryn; Baltazar, Felicia; Crowley, David J

    2016-05-01

    Transcription-coupled repair (TCR) is a subpathway of nucleotide excision repair (NER) in which excision repair proteins are targeted to RNA polymerase-arresting lesions located in the transcribed strand of active genes. TCR has been documented in a variety of bacterial and eukaryotic organisms but has yet to be observed in the Archaea. We used Halobacterium sp. NRC-1 and Haloferax volcanii to determine if TCR occurs in the halophilic archaea. Following UV irradiation of exponentially growing cultures, we quantified the rate of repair of cyclobutane pyrimidine dimers in the two strands of the rpoB2B1A1A2 and the trpDFEG operons of Halobacterium sp. NRC-1 and the pts operon of H. volcanii through the use of a Southern blot assay and strand-specific probes. TCR was observed in all three operons and was dependent on the NER gene uvrA in Halobacterium sp. NRC-1, but not in H. volcanii. The halophilic archaea likely employ a novel mechanism for TCR in which an as yet unknown coupling factor recognizes the arrested archaeal RNA polymerase complex and recruits certain NER proteins to complete the process. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. Identification and characterization of transcripts from the biotin biosynthetic operon of Bacillus subtilis.

    PubMed Central

    Perkins, J B; Bower, S; Howitt, C L; Yocum, R R; Pero, J

    1996-01-01

    Northern (RNA) blot analysis of the Bacillus subtilis biotin operon, bioWAFDBIorf2, detected at least two steady-state polycistronic transcripts initiated from a putative vegetative (Pbio) promoter that precedes the operon, i.e., a full-length 7.2-kb transcript covering the entire operon and a more abundant 5.1-kb transcript covering just the first five genes of the operon. Biotin and the B. subtilis birA gene product regulated synthesis of the transcripts. Moreover, replacing the putative Pbio promoter and regulatory sequence with a constitutive SP01 phage promoter resulted in higher-level constitutive synthesis. Removal of a rho-independent terminator-like sequence located between the fifth (bioB) and sixth (bioI) genes prevented accumulation of the 5.1-kb transcript, suggesting that the putative terminator functions to limit expression of bioI, which is thought to be involved in an early step in biotin synthesis. PMID:8892842

  2. Significance of the Centrally Expressed TRP Channel "Painless" in "Drosophila" Courtship Memory

    ERIC Educational Resources Information Center

    Sakai, Takaomi; Sato, Shoma; Ishimoto, Hiroshi; Kitamoto, Toshihiro

    2013-01-01

    Considerable evidence has demonstrated that transient receptor potential (TRP) channels play vital roles in sensory neurons, mediating responses to various environmental stimuli. In contrast, relatively little is known about how TRP channels exert their effects in the central nervous system to control complex behaviors. This is also true for the…

  3. Thermotaxis, circadian rhythms, and TRP channels in Drosophila

    PubMed Central

    Bellemer, Andrew

    2015-01-01

    The fruit fly Drosophila melanogaster is a poikilothermic organism that must detect and respond to both fine and coarse changes in environmental temperature in order maintain optimal body temperature, synchronize behavior to daily temperature fluctuations, and to avoid potentially injurious environmental hazards. Members of the Transient Receptor Potential (TRP) family of cation channels are well known for their activation by changes in temperature and their essential roles in sensory transduction in both invertebrates and vertebrates. The Drosophila genome encodes 13 TRP channels, and several of these have key sensory transduction and modulatory functions in allowing larval and adult flies to make fine temperature discriminations to attain optimal body temperature, detect and avoid large environmental temperature fluctuations, and make rapid escape responses to acutely noxious stimuli. Drosophila use multiple, redundant signaling pathways and neural circuits to execute these behaviors in response to both increases and decreases in temperature of varying magnitudes and time scales. A plethora of powerful molecular and genetic tools and the fly's simple, well-characterized nervous system have given Drosophila neurobiologists a powerful platform to study the cellular and molecular mechanisms of TRP channel function and how these mechanisms are conserved in vertebrates, as well as how these channels function within sensorimotor circuits to generate both simple and complex thermosensory behaviors. PMID:27227026

  4. Spontaneous mutations in the flhD operon generate motility heterogeneity in Escherichia coli biofilm.

    PubMed

    Horne, Shelley M; Sayler, Joseph; Scarberry, Nicholas; Schroeder, Meredith; Lynnes, Ty; Prüß, Birgit M

    2016-11-08

    Heterogeneity and niche adaptation in bacterial biofilm involve changes to the genetic makeup of the bacteria and gene expression control. We hypothesized that i) spontaneous mutations in the flhD operon can either increase or decrease motility and that ii) the resulting motility heterogeneity in the biofilm might lead to a long-term increase in biofilm biomass. We allowed the highly motile E. coli K-12 strain MC1000 to form seven- and fourteen-day old biofilm, from which we recovered reduced motility isolates at a substantially greater frequency (5.4 %) than from a similar experiment with planktonic bacteria (0.1 %). Biofilms formed exclusively by MC1000 degraded after 2 weeks. In contrast, biofilms initiated with a 1:1 ratio of MC1000 and its isogenic flhD::kn mutant remained intact at 4 weeks and the two strains remained in equilibrium for at least two weeks. These data imply that an 'optimal' biofilm may contain a mixture of motile and non-motile bacteria. Twenty-eight of the non-motile MC1000 isolates contained an IS1 element in proximity to the translational start of FlhD or within the open reading frames for FlhD or FlhC. Two isolates had an IS2 and one isolate had an IS5 in the open reading frame for FlhD. An additional three isolates contained deletions that included the RNA polymerase binding site, five isolates contained point mutations and small deletions in the open reading frame for FlhC. The locations of all these mutations are consistent with the lack of motility and further downstream within the flhD operon than previously published IS elements that increased motility. We believe that the location of the mutation within the flhD operon determines whether the effect on motility is positive or negative. To test the second part of our hypothesis where motility heterogeneity in a biofilm may lead to a long-term increase in biofilm biomass, we quantified biofilm biomass by MC1000, MC1000 flhD::kn, and mixtures of the two strains at ratios of 1:1, 10

  5. Structure-activity relationship of linear peptide Bu-His6-DPhe7-Arg8-Trp9-Gly10-NH2 at the human melanocortin-1 and -4 receptors: DPhe7 and Trp9 substitution.

    PubMed

    Danho, Waleed; Swistok, Joseph; Cheung, Adrian Wai-Hing; Kurylko, Grazyna; Franco, Lucia; Chu, Xin-Jie; Chen, Li; Yagaloff, Keith

    2003-02-24

    A series of pentapeptides, based on hMC4R pentapeptide agonist (Bu-His(6)-DPhe(7)-Arg(8)-Trp(9)-Gly(10)-NH(2)), was prepared in which either DPhe(7) or Trp(9) residue was systematically substituted. A number of interesting DPhe surrogates (D-Thi, D-3-CF(3)Phe, D-2-Nal and D-3,4-diClPhe) as well as Trp surrogates (2-Nal and Bta) were identified in this study.

  6. Regulation of the glv Operon in Bacillus subtilis: YfiA (GlvR) Is a Positive Regulator of the Operon That Is Repressed through CcpA and cre

    PubMed Central

    Yamamoto, Hiroki; Serizawa, Masakuni; Thompson, John; Sekiguchi, Junichi

    2001-01-01

    Maltose metabolism and the regulation of the glv operon of Bacillus subtilis, comprising three genes, glvA (6-phospho-α-glucosidase), yfiA (now designated glvR), and glvC (EIICB transport protein), were investigated. Maltose dissimilation was dependent primarily upon the glv operon, and insertional inactivation of either glvA, glvR, or glvC markedly inhibited growth on the disaccharide. A second system (MalL) contributed to a minor extent to maltose metabolism. Northern blotting revealed two transcripts corresponding to a monocistronic mRNA of glvA and a polycistronic mRNA of glvA-glvR-glvC. Primer extension analysis showed that both transcripts started at the same base (G) located 26 bp upstream of the 5′ end of glvA. When glvR was placed under control of the spac promoter, expression of the glv operon was dependent upon the presence of isopropyl-β-d-thiogalactopyranoside (IPTG). In regulatory studies, the promoter sequence of the glv operon was fused to lacZ and inserted into the amyE locus, and the resultant strain (AMGLV) was then transformed with a citrate-controlled glvR plasmid, pHYCM2VR. When cultured in Difco sporulation medium containing citrate, this transformant [AMGLV(pHYCM2VR)] expressed LacZ activity, but synthesis of LacZ was repressed by glucose. In an isogenic strain, [AMGLVCR(pHYCM2VR)], except for a mutation in the sequence of a catabolite-responsive element (cre), LacZ activity was expressed in the presence of citrate and glucose. Insertion of a citrate-controlled glvR plasmid at the amyE locus of ccpA+ and ccpA mutant organisms yielded strains AMCMVR and AMCMVRCC, respectively. In the presence of both glucose and citrate, AMCMVR failed to express the glv operon, whereas under the same conditions high-level expression of both mRNA transcripts was found in strain AMCMVRCC. Collectively, our findings suggest that GlvR (the product of the glvR gene) is a positive regulator of the glv operon and that glucose exerts its effect via catabolite

  7. Prevalence of transcription promoters within archaeal operons and coding sequences

    PubMed Central

    Koide, Tie; Reiss, David J; Bare, J Christopher; Pang, Wyming Lee; Facciotti, Marc T; Schmid, Amy K; Pan, Min; Marzolf, Bruz; Van, Phu T; Lo, Fang-Yin; Pratap, Abhishek; Deutsch, Eric W; Peterson, Amelia; Martin, Dan; Baliga, Nitin S

    2009-01-01

    Despite the knowledge of complex prokaryotic-transcription mechanisms, generalized rules, such as the simplified organization of genes into operons with well-defined promoters and terminators, have had a significant role in systems analysis of regulatory logic in both bacteria and archaea. Here, we have investigated the prevalence of alternate regulatory mechanisms through genome-wide characterization of transcript structures of ∼64% of all genes, including putative non-coding RNAs in Halobacterium salinarum NRC-1. Our integrative analysis of transcriptome dynamics and protein–DNA interaction data sets showed widespread environment-dependent modulation of operon architectures, transcription initiation and termination inside coding sequences, and extensive overlap in 3′ ends of transcripts for many convergently transcribed genes. A significant fraction of these alternate transcriptional events correlate to binding locations of 11 transcription factors and regulators (TFs) inside operons and annotated genes—events usually considered spurious or non-functional. Using experimental validation, we illustrate the prevalence of overlapping genomic signals in archaeal transcription, casting doubt on the general perception of rigid boundaries between coding sequences and regulatory elements. PMID:19536208

  8. Prevalence of transcription promoters within archaeal operons and coding sequences.

    PubMed

    Koide, Tie; Reiss, David J; Bare, J Christopher; Pang, Wyming Lee; Facciotti, Marc T; Schmid, Amy K; Pan, Min; Marzolf, Bruz; Van, Phu T; Lo, Fang-Yin; Pratap, Abhishek; Deutsch, Eric W; Peterson, Amelia; Martin, Dan; Baliga, Nitin S

    2009-01-01

    Despite the knowledge of complex prokaryotic-transcription mechanisms, generalized rules, such as the simplified organization of genes into operons with well-defined promoters and terminators, have had a significant role in systems analysis of regulatory logic in both bacteria and archaea. Here, we have investigated the prevalence of alternate regulatory mechanisms through genome-wide characterization of transcript structures of approximately 64% of all genes, including putative non-coding RNAs in Halobacterium salinarum NRC-1. Our integrative analysis of transcriptome dynamics and protein-DNA interaction data sets showed widespread environment-dependent modulation of operon architectures, transcription initiation and termination inside coding sequences, and extensive overlap in 3' ends of transcripts for many convergently transcribed genes. A significant fraction of these alternate transcriptional events correlate to binding locations of 11 transcription factors and regulators (TFs) inside operons and annotated genes-events usually considered spurious or non-functional. Using experimental validation, we illustrate the prevalence of overlapping genomic signals in archaeal transcription, casting doubt on the general perception of rigid boundaries between coding sequences and regulatory elements.

  9. Synergic role of the two ars operons in arsenic tolerance in Pseudomonas putida KT2440.

    PubMed

    Fernández, Matilde; Udaondo, Zulema; Niqui, José-Luis; Duque, Estrella; Ramos, Juan-Luis

    2014-10-01

    The chromosome of Pseudomonas putida KT2440 carries two clusters of genes, denoted ars1 and ars2, that are annotated as putative arsenic resistance operons. In this work, we present evidence that both operons encode functional arsenic-response regulatory genes as well as arsenic extrusion systems that confer resistance to both arsenite [As(III)] and arsenate [As(V)]. Transcriptional fusions of P(ars1) and P(ars2) to lacZ revealed that expression of both operons was induced by arsenite and arsenate. We generated single mutants in ars1 and ars2, which showed lower resistance to arsenic than the wild-type strain. A double ars1/ars2 was found to be highly sensitive to arsenic. Minimum inhibitory concentrations (MICs) for single mutants decreased two- to fourfold with respect to the parental strain, while in the double mutant the MIC decreased 128-fold for arsenite and 32-fold for arsenate. Bioinformatic analysis revealed that the ars2 resistance operon is part of the core genome of P. putida, while the ars1 operon appears to only occur in the KT2440 strain, suggesting that ars1 was acquired by horizontal gene transfer. The presence of ars1 in KT2440 may explain why it exhibits higher resistance to arsenic than other P. putida strains, which bear only the ars2 operon.

  10. Membrane-tethered peptides patterned after the TRP domain (TRPducins) selectively inhibit TRPV1 channel activity.

    PubMed

    Valente, Pierluigi; Fernández-Carvajal, Asia; Camprubí-Robles, María; Gomis, Ana; Quirce, Susana; Viana, Félix; Fernández-Ballester, Gregorio; González-Ros, José M; Belmonte, Carlos; Planells-Cases, Rosa; Ferrer-Montiel, Antonio

    2011-05-01

    The transient receptor potential vanilloid 1 (TRPV1) channel is a thermosensory receptor implicated in diverse physiological and pathological processes. The TRP domain, a highly conserved region in the C terminus adjacent to the internal channel gate, is critical for subunit tetramerization and channel gating. Here, we show that cell-penetrating, membrane-anchored peptides patterned after this protein domain are moderate and selective TRPV1 antagonists both in vitro and in vivo, blocking receptor activity in intact rat primary sensory neurons and their peripheral axons with mean decline time of 30 min. The most potent lipopeptide, TRP-p5, blocked all modes of TRPV1 gating with micromolar efficacy (IC(50)<10 μM), without significantly affecting other thermoTRP channels. In contrast, its retrosequence or the corresponding sequences of other TRPV channels did not alter TRPV1 channel activity (IC(50)>100 μM). TRP-p5 did not affect the capsaicin sensitivity of the vanilloid receptor. Our data suggest that TRP-p5 interferes with protein-protein interactions at the level of the TRP domain that are essential for the "conformational" change that leads to gate opening. Therefore, these palmitoylated peptides, which we termed TRPducins, are noncompetitive, voltage-independent, sequence-specific TRPV1 blockers. Our findings indicate that TRPducin-like peptides may embody a novel molecular strategy that can be exploited to generate a selective pharmacological arsenal for the TRP superfamily of ion channels.

  11. Uterine deletion of Trp53 compromises antioxidant responses in mouse decidua

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Burnum, Kristin E.; Hirota, Yasushi; Baker, Erin Shammel

    2012-09-01

    Preterm birth is a global health issue impacting both mothers and children. However, the etiology of preterm birth is not clearly understood. From our recent finding that premature decidual senescence with terminal differentiation is a cause of preterm birth in mice with uterine Trp53 deletion, encoding p53 protein, led us to explore other potential factors that are related to preterm birth. Utilizing proteomics approaches, here we show that 183 candidate proteins cause significant changes in decidua with Trp53 deletion as compared to normal decidua. Functional categorization of these proteins unveiled new pathways that are influenced by p53. In particular, downregulationmore » of a cluster of antioxidant proteins in p53 deficient decidua suggests that increased oxidative stress could be one cause of preterm birth in mice with uterine deletion of Trp53.« less

  12. Structure and regulation of the Yersinia pestis yscBCDEF operon.

    PubMed Central

    Haddix, P L; Straley, S C

    1992-01-01

    We have investigated the physical and genetic structure and regulation of the Yersinia pestis yscBCDEF region, previously called lcrC. DNA sequence analysis showed that this region is homologous to the corresponding part of the ysc locus of Yersinia enterocolitica and suggested that the yscBCDEF cistrons belong to a single operon on the low-calcium response virulence plasmid pCD1. Promoter activity measurements of ysc subclones indicated that yscBCDEF constitutes a suboperon of the larger ysc region by revealing promoter activity in a clone containing the 3' end of yscD, intact yscE and yscF, and part of yscG. These experiments also revealed an additional weak promoter upstream of yscD. Northern (RNA) analysis with a yscD probe showed that operon transcription is thermally induced and downregulated in the presence of Ca2+. Primer extension of operon transcripts suggested that two promoters, a moderate-level constitutive one and a stronger, calcium-downregulated one, control full-length operon transcription at 37 degrees C. Primer extension provided additional support for the proposed designation of a yscBCDEF suboperon by identifying a 5' end within yscF, for which relative abundances in the presence and absence of Ca2+ revealed regulation that is distinct from that for transcripts initiating farther upstream. YscB and YscC were expressed in Escherichia coli by using a high-level transcription system. Attempts to express YscD were only partially successful, but they revealed interesting regulation at the translational level. Images PMID:1624469

  13. Spectroscopic evidence for an engineered, catalytically active Trp radical that creates the unique reactivity of lignin peroxidase.

    PubMed

    Smith, Andrew T; Doyle, Wendy A; Dorlet, Pierre; Ivancich, Anabella

    2009-09-22

    The surface oxidation site (Trp-171) in lignin peroxidase (LiP) required for the reaction with veratryl alcohol a high-redox-potential (1.4 V) substrate, was engineered into Coprinus cinereus peroxidase (CiP) by introducing a Trp residue into a heme peroxidase that has similar protein fold but lacks this activity. To create the catalytic activity toward veratryl alcohol in CiP, it was necessary to reproduce the Trp site and its negatively charged microenvironment by means of a triple mutation. The resulting D179W+R258E+R272D variant was characterized by multifrequency EPR spectroscopy. The spectra unequivocally showed that a new Trp radical [g values of g(x) = 2.0035(5), g(y) = 2.0027(5), and g(z) = 2.0022(1)] was formed after the [Fe(IV)=O Por(*+)] intermediate, as a result of intramolecular electron transfer between Trp-179 and the porphyrin. Also, the EPR characterization crucially showed that [Fe(IV)=O Trp-179(*)] was the reactive intermediate with veratryl alcohol. Accordingly, our work shows that it is necessary to take into account the physicochemical properties of the radical, fine-tuned by the microenvironment, as well as those of the preceding [Fe(IV)=O Por(*+)] intermediate to engineer a catalytically competent Trp site for a given substrate. Manipulation of the microenvironment of the Trp-171 site in LiP allowed the detection by EPR spectroscopy of the Trp-171(*), for which direct evidence has been missing so far. Our work also highlights the role of Trp residues as tunable redox-active cofactors for enzyme catalysis in the context of peroxidases with a unique reactivity toward recalcitrant substrates that require oxidation potentials not realized at the heme site.

  14. Structural Explanation for Allolactose (lac Operon Inducer) Synthesis by lacZ β-Galactosidase and the Evolutionary Relationship between Allolactose Synthesis and the lac Repressor

    PubMed Central

    Wheatley, Robert W.; Lo, Summie; Jancewicz, Larisa J.; Dugdale, Megan L.; Huber, Reuben E.

    2013-01-01

    β-Galactosidase (lacZ) has bifunctional activity. It hydrolyzes lactose to galactose and glucose and catalyzes the intramolecular isomerization of lactose to allolactose, the lac operon inducer. β-Galactosidase promotes the isomerization by means of an acceptor site that binds glucose after its cleavage from lactose and thus delays its exit from the site. However, because of its relatively low affinity for glucose, details of this site have remained elusive. We present structural data mapping the glucose site based on a substituted enzyme (G794A-β-galactosidase) that traps allolactose. Various lines of evidence indicate that the glucose of the trapped allolactose is in the acceptor position. The evidence includes structures with Bis-Tris (2,2-bis(hydroxymethyl)-2,2′,2″-nitrilotriethanol) and l-ribose in the site and kinetic binding studies with substituted β-galactosidases. The site is composed of Asn-102, His-418, Lys-517, Ser-796, Glu-797, and Trp-999. Ser-796 and Glu-797 are part of a loop (residues 795–803) that closes over the active site. This loop appears essential for the bifunctional nature of the enzyme because it helps form the glucose binding site. In addition, because the loop is mobile, glucose binding is transient, allowing the release of some glucose. Bioinformatics studies showed that the residues important for interacting with glucose are only conserved in a subset of related enzymes. Thus, intramolecular isomerization is not a universal feature of β-galactosidases. Genomic analyses indicated that lac repressors were co-selected only within the conserved subset. This shows that the glucose binding site of β-galactosidase played an important role in lac operon evolution. PMID:23486479

  15. The rpoE operon regulates heat stress response in Burkholderia pseudomallei.

    PubMed

    Vanaporn, Muthita; Vattanaviboon, Paiboon; Thongboonkerd, Visith; Korbsrisate, Sunee

    2008-07-01

    Burkholderia pseudomallei is a gram-negative bacterium and the causative agent of melioidosis, one of the important lethal diseases in tropical regions. In this article, we demonstrate the crucial role of the B. pseudomallei rpoE locus in the response to heat stress. The rpoE operon knockout mutant exhibited growth retardation and reduced survival when exposed to a high temperature. Expression analysis using rpoH promoter-lacZ fusion revealed that heat stress induction of rpoH, which encodes heat shock sigma factor (sigma(H)), was abolished in the B. pseudomallei rpoE mutant. Analysis of the rpoH promoter region revealed sequences sharing high homology to the consensus sequence of sigma(E)-dependent promoters. Moreover, the putative heat-induced sigma(H)-regulated heat shock proteins (i.e. GroEL and HtpG) were also absent in the rpoE operon mutant. Altogether, our data suggest that the rpoE operon regulates B. pseudomallei heat stress response through the function of rpoH.

  16. Down-regulation of tyrosinase, TRP-1, TRP-2 and MITF expressions by citrus press-cakes in murine B16 F10 melanoma.

    PubMed

    Kim, Sang Suk; Kim, Min-Jin; Choi, Young Hun; Kim, Byung Kok; Kim, Kwang Sik; Park, Kyung Jin; Park, Suk Man; Lee, Nam Ho; Hyun, Chang-Gu

    2013-08-01

    To investigate the suitability of citrus-press cakes, by-products of the juice industry as a source for the whitening agents for cosmetic industry. Ethylacetate extracts of citrus-press cakes (CCE) were examined for their anti-melanogenic potentials in terms of the inhibition of melanin production and mechanisim of melanogenesis by using Western Blot analysis with tyrosinese, tyrosinase-related protein-1 (TRP-1), TRP2, and microphthalmia-associated transcription factor (MITF) proteins. To apply the topical agents, citrus-press cakes was investigated the safety in human skin cell line. Finally flavonoid analysis of CCE was also determined by HPLC analysis. Results indicated that CCE were shown to down-regulate melanin content in a dose-dependent pattern. The CCE inhibited tyrosinase, TRP-2, and MITF expressions in a dose-dependent manner. To test the applicability of CCE to human skin, we used MTT assay to assess the cytotoxic effects of CCE on human keratinocyte HaCaT cells. The CCE exhibited low cytotoxicity at 50 µg/mL. Characterization of the citrus-press cakes for flavonoid contents using HPLC showed varied quantity of rutin, narirutin, and hesperidin. Considering the anti-melanogenic activity and human safety, CCE is considered as a potential anti-melanogenic agent and may be effective for topical application for treating hyperpigmentation disorders.

  17. Regulation of the Salmonella enterica std fimbrial operon by DNA adenine methylation, SeqA, and HdfR.

    PubMed

    Jakomin, Marcello; Chessa, Daniela; Bäumler, Andreas J; Casadesús, Josep

    2008-11-01

    DNA adenine methylase (dam) mutants of Salmonella enterica serovar Typhimurium grown under laboratory conditions express the std fimbrial operon, which is tightly repressed in the wild type. Here, we show that uncontrolled production of Std fimbriae in S. enterica serovar Typhimurium dam mutants contributes to attenuation in mice, as indicated by the observation that an stdA dam strain is more competitive than a dam strain upon oral infection. Dam methylation appears to regulate std transcription, rather than std mRNA stability or turnover. A genetic screen for std regulators showed that the GATC-binding protein SeqA directly or indirectly represses std expression, while the poorly characterized yifA gene product serves as an std activator. YifA encodes a putative LysR-like protein and has been renamed HdfR, like its Escherichia coli homolog. Activation of std expression by HdfR is observed only in dam and seqA backgrounds. These data suggest that HdfR directly or indirectly activates std transcription. Since SeqA is unable to bind nonmethylated DNA, it is possible that std operon derepression in dam and seqA mutants may result from unconstrained HdfR-mediated activation of std transcription. Derepression of std in dam and seqA mutants of S. enterica occurs in only a fraction of the bacterial population, suggesting the occurrence of either bistable expression or phase variation.

  18. TRP channel functions in the gastrointestinal tract.

    PubMed

    Yu, Xiaoyun; Yu, Mingran; Liu, Yingzhe; Yu, Shaoyong

    2016-05-01

    Transient receptor potential (TRP) channels are predominantly distributed in both somatic and visceral sensory nervous systems and play a crucial role in sensory transduction. As the largest visceral organ system, the gastrointestinal (GI) tract frequently accommodates external inputs, which stimulate sensory nerves to initiate and coordinate sensory and motor functions in order to digest and absorb nutrients. Meanwhile, the sensory nerves in the GI tract are also able to detect potential tissue damage by responding to noxious irritants. This nocifensive function is mediated through specific ion channels and receptors expressed in a subpopulation of spinal and vagal afferent nerve called nociceptor. In the last 18 years, our understanding of TRP channel expression and function in GI sensory nervous system has been continuously improved. In this review, we focus on the expressions and functions of TRPV1, TRPA1, and TRPM8 in primary extrinsic afferent nerves innervated in the esophagus, stomach, intestine, and colon and briefly discuss their potential roles in relevant GI disorders.

  19. Bacterial toxin-antitoxin systems: more than selfish entities?

    PubMed

    Van Melderen, Laurence; Saavedra De Bast, Manuel

    2009-03-01

    Bacterial toxin-antitoxin (TA) systems are diverse and widespread in the prokaryotic kingdom. They are composed of closely linked genes encoding a stable toxin that can harm the host cell and its cognate labile antitoxin, which protects the host from the toxin's deleterious effect. TA systems are thought to invade bacterial genomes through horizontal gene transfer. Some TA systems might behave as selfish elements and favour their own maintenance at the expense of their host. As a consequence, they may contribute to the maintenance of plasmids or genomic islands, such as super-integrons, by post-segregational killing of the cell that loses these genes and so suffers the stable toxin's destructive effect. The function of the chromosomally encoded TA systems is less clear and still open to debate. This Review discusses current hypotheses regarding the biological roles of these evolutionarily successful small operons. We consider the various selective forces that could drive the maintenance of TA systems in bacterial genomes.

  20. Bacterial Toxin–Antitoxin Systems: More Than Selfish Entities?

    PubMed Central

    Van Melderen, Laurence; Saavedra De Bast, Manuel

    2009-01-01

    Bacterial toxin–antitoxin (TA) systems are diverse and widespread in the prokaryotic kingdom. They are composed of closely linked genes encoding a stable toxin that can harm the host cell and its cognate labile antitoxin, which protects the host from the toxin's deleterious effect. TA systems are thought to invade bacterial genomes through horizontal gene transfer. Some TA systems might behave as selfish elements and favour their own maintenance at the expense of their host. As a consequence, they may contribute to the maintenance of plasmids or genomic islands, such as super-integrons, by post-segregational killing of the cell that loses these genes and so suffers the stable toxin's destructive effect. The function of the chromosomally encoded TA systems is less clear and still open to debate. This Review discusses current hypotheses regarding the biological roles of these evolutionarily successful small operons. We consider the various selective forces that could drive the maintenance of TA systems in bacterial genomes. PMID:19325885

  1. Effects of in vitro fertilization and embryo culture on TRP53 and Bax expression in B6 mouse embryos.

    PubMed

    Chandrakanthan, Vashe; Li, Aiqing; Chami, Omar; O'Neill, Christopher

    2006-11-21

    In the mouse, embryo culture results in a characteristic phenotype of retarded embryo preimplantation development and reduced numbers of cells within embryos. The expression of TRP53 is central to the regulation of the cell's capacity to proliferate and survive. In this study we found that Trp53 mRNA is expressed throughout the preimplantation stage of development. Levels of TRP53 protein expression were low during the cleavage stages and increased at the morula and blastocyst stages in B6 embryos collected from the reproductive tract. Embryos collected at the zygote stage and cultured for 96 h also showed low levels of TRP53 expression at precompaction stages. There were higher levels of TRP53 in cultured morula and the level in cultured blastocysts was clearly increased above blastocysts collected directly from the uterus. Immunolocalization of TRP53 showed that its increased expression in cultured blastocysts corresponded with a marked accumulation of TRP53 within the nuclei of embryonic cells. This pattern of expression was enhanced in embryos produced by in vitro fertilization and subjected to culture. The TRP53 was transcriptionally active since culture also induced increased expression of Bax, yet this did not occur in embryos lacking Trp53 (Trp53-/-). The rate of development of Trp53-/- zygotes to the blastocyst stage was not different to wildtype controls when embryos were cultured in groups of ten but was significantly faster when cultured individually. The results show that zygote culture resulted in the accumulation of transcription activity of TRP53 in the resulting blastocysts. This accounts for the adverse effects of culture of embryos individually, but does not appear to be the sole cause of the retarded preimplantation stage growth phenotype associated with culture in vitro.

  2. LOV Histidine Kinase Modulates the General Stress Response System and Affects the virB Operon Expression in Brucella abortus

    PubMed Central

    Sycz, Gabriela; Carrica, Mariela Carmen; Tseng, Tong-Seung; Bogomolni, Roberto A.; Briggs, Winslow R.; Goldbaum, Fernando A.; Paris, Gastón

    2015-01-01

    Brucella is the causative agent of the zoonotic disease brucellosis, and its success as an intracellular pathogen relies on its ability to adapt to the harsh environmental conditions that it encounters inside the host. The Brucella genome encodes a sensor histidine kinase containing a LOV domain upstream from the kinase, LOVHK, which plays an important role in light-regulated Brucella virulence. In this report we study the intracellular signaling pathway initiated by the light sensor LOVHK using an integrated biochemical and genetic approach. From results of bacterial two-hybrid assays and phosphotransfer experiments we demonstrate that LOVHK functionally interacts with two response regulators: PhyR and LovR, constituting a functional two-component signal-transduction system. LOVHK contributes to the activation of the General Stress Response (GSR) system in Brucella via PhyR, while LovR is proposed to be a phosphate-sink for LOVHK, decreasing its phosphorylation state. We also show that in the absence of LOVHK the expression of the virB operon is down-regulated. In conclusion, our results suggest that LOVHK positively regulates the GSR system in vivo, and has an effect on the expression of the virB operon. The proposed regulatory network suggests a similar role for LOVHK in other microorganisms. PMID:25993430

  3. International Union of Basic and Clinical Pharmacology. LXXVI. Current Progress in the Mammalian TRP Ion Channel Family

    PubMed Central

    Wu, Long-Jun; Sweet, Tara-Beth

    2010-01-01

    Transient receptor potential (TRP) channels are a large family of ion channel proteins, surpassed in number in mammals only by voltage-gated potassium channels. TRP channels are activated and regulated through strikingly diverse mechanisms, making them suitable candidates for cellular sensors. They respond to environmental stimuli such as temperature, pH, osmolarity, pheromones, taste, and plant compounds, and intracellular stimuli such as Ca2+ and phosphatidylinositol signal transduction pathways. However, it is still largely unknown how TRP channels are activated in vivo. Despite the uncertainties, emerging evidence using TRP channel knockout mice indicates that these channels have broad function in physiology. Here we review the recent progress on the physiology, pharmacology and pathophysiological function of mammalian TRP channels. PMID:20716668

  4. Role of Tryptophan Side Chain Dynamics on the Trp-Cage Mini-Protein Folding Studied by Molecular Dynamics Simulations

    PubMed Central

    Kannan, Srinivasaraghavan; Zacharias, Martin

    2014-01-01

    The 20 residue Trp-cage mini-protein is one of smallest proteins that adopt a stable folded structure containing also well-defined secondary structure elements. The hydrophobic core is arranged around a single central Trp residue. Despite several experimental and simulation studies the detailed folding mechanism of the Trp-cage protein is still not completely understood. Starting from fully extended as well as from partially folded Trp-cage structures a series of molecular dynamics simulations in explicit solvent and using four different force fields was performed. All simulations resulted in rapid collapse of the protein to on average relatively compact states. The simulations indicate a significant dependence of the speed of folding to near-native states on the side chain rotamer state of the central Trp residue. Whereas the majority of intermediate start structures with the central Trp side chain in a near-native rotameric state folded successfully within less than 100 ns only a fraction of start structures reached near-native folded states with an initially non-native Trp side chain rotamer state. Weak restraining of the Trp side chain dihedral angles to the state in the folded protein resulted in significant acceleration of the folding both starting from fully extended or intermediate conformations. The results indicate that the side chain conformation of the central Trp residue can create a significant barrier for controlling transitions to a near native folded structure. Similar mechanisms might be of importance for the folding of other protein structures. PMID:24563686

  5. The Anaerobe-Specific Orange Protein Complex of Desulfovibrio vulgaris Hildenborough Is Encoded by Two Divergent Operons Coregulated by σ54 and a Cognate Transcriptional Regulator▿†

    PubMed Central

    Fiévet, Anouchka; My, Laetitia; Cascales, Eric; Ansaldi, Mireille; Pauleta, Sofia R.; Moura, Isabel; Dermoun, Zorah; Bernard, Christophe S.; Dolla, Alain; Aubert, Corinne

    2011-01-01

    Analysis of sequenced bacterial genomes revealed that the genomes encode more than 30% hypothetical and conserved hypothetical proteins of unknown function. Among proteins of unknown function that are conserved in anaerobes, some might be determinants of the anaerobic way of life. This study focuses on two divergent clusters specifically found in anaerobic microorganisms and mainly composed of genes encoding conserved hypothetical proteins. We show that the two gene clusters DVU2103-DVU2104-DVU2105 (orp2) and DVU2107-DVU2108-DVU2109 (orp1) form two divergent operons transcribed by the σ54-RNA polymerase. We further demonstrate that the σ54-dependent transcriptional regulator DVU2106, located between orp1 and orp2, collaborates with σ54-RNA polymerase to orchestrate the simultaneous expression of the divergent orp operons. DVU2106, whose structural gene is transcribed by the σ70-RNA polymerase, negatively retrocontrols its own expression. By using an endogenous pulldown strategy, we identify a physiological complex composed of DVU2103, DVU2104, DVU2105, DVU2108, and DVU2109. Interestingly, inactivation of DVU2106, which is required for orp operon transcription, induces morphological defects that are likely linked to the absence of the ORP complex. A putative role of the ORP proteins in positioning the septum during cell division is discussed. PMID:21531797

  6. A mutation in a new gene bglJ, activates the bgl operon in Escherichia coli K-12

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Giel, M.; Desnoyer, M.; Lopilato, J.

    1996-06-01

    A new mutation , bglJ4, has been characterized that results in the expression of the silent bgl operon. The bgl operon encodes proteins necessary for the transport and utilization of the aromatic {beta}-glucosides arbutin and salicin. A variety of mutations activate the operon and result in a Bgl{sup +} phenotype. Activating mutations are located upstream of the bgl promoter and in genes located elsewhere on the chromosome. Mutations outside of the bgl operon occur in the genes encoding DNA gyrase and in the gene encoding the nucleoid associated protein H-NS. The mutation described here, bglJ4, has been mapped to amore » new locus at min 99 on the Escherichia coli K-12 genetic map. The putative protein encoded by the bglJ gene has homology to a family of transcriptional activators. Evidence is presented that increased expression of the bglJ product is needed for activation of the bgl operon. 56 refs., 3 figs., 3 tabs.« less

  7. Down-regulation of tyrosinase, TRP-1, TRP-2 and MITF expressions by citrus press-cakes in murine B16 F10 melanoma

    PubMed Central

    Kim, Sang Suk; Kim, Min-Jin; Choi, Young Hun; Kim, Byung Kok; Kim, Kwang Sik; Park, Kyung Jin; Park, Suk Man; Lee, Nam Ho; Hyun, Chang-Gu

    2013-01-01

    Objective To investigate the suitability of citrus-press cakes, by-products of the juice industry as a source for the whitening agents for cosmetic industry. Methods Ethylacetate extracts of citrus-press cakes (CCE) were examined for their anti-melanogenic potentials in terms of the inhibition of melanin production and mechanisim of melanogenesis by using Western Blot analysis with tyrosinese, tyrosinase-related protein-1 (TRP-1), TRP2, and microphthalmia-associated transcription factor (MITF) proteins. To apply the topical agents, citrus-press cakes was investigated the safety in human skin cell line. Finally flavonoid analysis of CCE was also determined by HPLC analysis. Results Results indicated that CCE were shown to down-regulate melanin content in a dose-dependent pattern. The CCE inhibited tyrosinase, TRP-2, and MITF expressions in a dose-dependent manner. To test the applicability of CCE to human skin, we used MTT assay to assess the cytotoxic effects of CCE on human keratinocyte HaCaT cells. The CCE exhibited low cytotoxicity at 50 µg/mL. Characterization of the citrus-press cakes for flavonoid contents using HPLC showed varied quantity of rutin, narirutin, and hesperidin. Conclusions Considering the anti-melanogenic activity and human safety, CCE is considered as a potential anti-melanogenic agent and may be effective for topical application for treating hyperpigmentation disorders. PMID:23905018

  8. Influence of the ionic liquid [C4mpy][Tf2N] on the structure of the miniprotein Trp-cage.

    PubMed

    Baker, Joseph L; Furbish, Jeffrey; Lindberg, Gerrick E

    2015-11-01

    We examine the effect of the ionic liquid [C4mpy][Tf2N] on the structure of the miniprotein Trp-cage and contrast these results with the behavior of Trp-cage in water. We find the ionic liquid has a dramatic effect on Trp-cage, though many similarities with aqueous Trp-cage are observed. We assess Trp-cage folding by monitoring root mean square deviation from the crystallographic structure, radius of gyration, proline cis/trans isomerization state, protein secondary structure, amino acid contact formation and distance, and native and non-native contact formation. Starting from an unfolded configuration, Trp-cage folds in water at 298 K in less than 500 ns of simulation, but has very little mobility in the ionic liquid at the same temperature, which can be ascribed to the higher ionic liquid viscosity. At 365 K, the mobility of the ionic liquid is increased and initial stages of Trp-cage folding are observed, however Trp-cage does not reach the native folded state in 2 μs of simulation in the ionic liquid. Therefore, in addition to conventional molecular dynamics, we also employ scaled molecular dynamics to expedite sampling, and we demonstrate that Trp-cage in the ionic liquid does closely approach the aqueous folded state. Interestingly, while the reduced mobility of the ionic liquid is found to restrict Trp-cage motion, the ionic liquid does facilitate proline cis/trans isomerization events that are not seen in our aqueous simulations. Copyright © 2015 Elsevier Inc. All rights reserved.

  9. Conditions for the Evolution of Gene Clusters in Bacterial Genomes

    PubMed Central

    Ballouz, Sara; Francis, Andrew R.; Lan, Ruiting; Tanaka, Mark M.

    2010-01-01

    Genes encoding proteins in a common pathway are often found near each other along bacterial chromosomes. Several explanations have been proposed to account for the evolution of these structures. For instance, natural selection may directly favour gene clusters through a variety of mechanisms, such as increased efficiency of coregulation. An alternative and controversial hypothesis is the selfish operon model, which asserts that clustered arrangements of genes are more easily transferred to other species, thus improving the prospects for survival of the cluster. According to another hypothesis (the persistence model), genes that are in close proximity are less likely to be disrupted by deletions. Here we develop computational models to study the conditions under which gene clusters can evolve and persist. First, we examine the selfish operon model by re-implementing the simulation and running it under a wide range of conditions. Second, we introduce and study a Moran process in which there is natural selection for gene clustering and rearrangement occurs by genome inversion events. Finally, we develop and study a model that includes selection and inversion, which tracks the occurrence and fixation of rearrangements. Surprisingly, gene clusters fail to evolve under a wide range of conditions. Factors that promote the evolution of gene clusters include a low number of genes in the pathway, a high population size, and in the case of the selfish operon model, a high horizontal transfer rate. The computational analysis here has shown that the evolution of gene clusters can occur under both direct and indirect selection as long as certain conditions hold. Under these conditions the selfish operon model is still viable as an explanation for the evolution of gene clusters. PMID:20168992

  10. Twin-screw extruded lipid implants containing TRP2 peptide for tumour therapy.

    PubMed

    Even, Marie-Paule; Bobbala, Sharan; Gibson, Blake; Hook, Sarah; Winter, Gerhard; Engert, Julia

    2017-05-01

    Much effort has been put in the development of specific anti-tumour immunotherapies over the last few years, and several studies report on the use of liposomal carriers for tumour-associated antigens. In this work, the use of lipid implants, prepared using two different extruders, was investigated for sustained delivery in tumour therapy. The implants consisted of cholesterol, soybean lecithin, Dynasan 114, trehalose, ovalbumin (OVA) or a TRP2 peptide, and Quil-A. Implants were first produced on a Haake Minilab extruder, and then a scale-down to minimal quantities of material on a small scale ZE mini extruder was performed. All formulations were characterised in terms of extrudability, implant properties and in vitro release behaviour of the model antigen ovalbumin. The type of extruder used to produce the implants had a major influence on implant properties and the release behaviour, demonstrating that extrusion parameters and lipid formulations have to be individually adapted to each extrusion device. Subsequently, lipid implants containing TRP-2 peptide were extruded on the ZE mini extruder and investigated in vitro and in vivo. The in vivo study showed that mice having received TRP2 loaded implants had delayed tumour growth for 3days compared to groups having received no TRP2. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Uterine Deletion of Trp53 Compromises Antioxidant Responses in the Mouse Decidua

    PubMed Central

    Burnum, Kristin E.; Hirota, Yasushi; Baker, Erin S.; Yoshie, Mikihiro; Ibrahim, Yehia M.; Monroe, Matthew E.; Anderson, Gordon A.; Smith, Richard D.; Daikoku, Takiko

    2012-01-01

    Preterm birth is a global health issue impacting millions of mothers and babies. However, the etiology of preterm birth is not clearly understood. Our recent finding that premature decidual senescence with terminal differentiation is a cause of preterm birth in mice with uterine Trp53 deletion, encoding p53 protein, led us to explore other potential factors that are related to preterm birth. Using proteomics approaches, here, we show that 183 candidate proteins show significant changes in deciduae with Trp53 deletion as compared with normal deciduae. Functional categorization of these proteins unveiled new pathways that are influenced by p53. In particular, down-regulation of a cluster of antioxidant enzymes in p53-deficient deciduae suggests that increased oxidative stress could be one cause of preterm birth in mice harboring uterine deletion of Trp53. PMID:22759378

  12. Structural domains required for channel function of the mouse transient receptor potential protein homologue TRP1beta.

    PubMed

    Engelke, Michael; Friedrich, Olaf; Budde, Petra; Schäfer, Christina; Niemann, Ursula; Zitt, Christof; Jüngling, Eberhard; Rocks, Oliver; Lückhoff, Andreas; Frey, Jürgen

    2002-07-17

    Transient receptor potential proteins (TRP) are supposed to participate in the formation of store-operated Ca(2+) influx channels by co-assembly. However, little is known which domains facilitate the interaction of subunits. Contribution of the N-terminal coiled-coil domain and ankyrin-like repeats and the putative pore region of the mouse TRP1beta (mTRP1beta) variant to the formation of functional cation channels were analyzed following overexpression in HEK293 (human embryonic kidney) cells. MTRP1beta expressing cells exhibited enhanced Ca(2+) influx and enhanced whole-cell membrane currents compared to mTRP1beta deletion mutants. Using a yeast two-hybrid assay only the coiled-coil domain facilitated homodimerization of the N-terminus. These results suggest that the N-terminus of mTRP1beta is required for structural organization thus forming functional channels.

  13. A four-gene operon in Bacillus cereus produces two rare spore-decorating sugars

    PubMed Central

    Li, Zi; Mukherjee, Thiya; Bowler, Kyle; Namdari, Sholeh; Snow, Zachary; Prestridge, Sarah; Carlton, Alexandra; Bar-Peled, Maor

    2017-01-01

    Bacterial glycan structures on cell surfaces are critical for cell-cell recognition and adhesion and in host-pathogen interactions. Accordingly, unraveling the sugar composition of bacterial cell surfaces can shed light on bacterial growth and pathogenesis. Here, we found that two rare sugars with a 3-C-methyl-6-deoxyhexose structure were linked to spore glycans in Bacillus cereus ATCC 14579 and ATCC 10876. Moreover, we identified a four-gene operon in B. cereus ATCC 14579 that encodes proteins with the following sequential enzyme activities as determined by mass spectrometry and one- and two-dimensional NMR methods: CTP:glucose-1-phosphate cytidylyltransferase, CDP-Glc 4,6-dehydratase, NADH-dependent SAM:C-methyltransferase, and NADPH-dependent CDP-3-C-methyl-6-deoxyhexose 4-reductase. The last enzyme predominantly yielded CDP-3-C-methyl-6-deoxygulose (CDP-cereose) and likely generated a 4-epimer CDP-3-C-methyl-6-deoxyallose (CDP-cillose). Some members of the B. cereus sensu lato group produce CDP-3-C-methyl-6-deoxy sugars for the formation of cereose-containing glycans on spores, whereas others such as Bacillus anthracis do not. Gene knockouts of the Bacillus C-methyltransferase and the 4-reductase confirmed their involvement in the formation of cereose-containing glycan on B. cereus spores. We also found that cereose represented 0.2–1% spore dry weight. Moreover, mutants lacking cereose germinated faster than the wild type, yet the mutants exhibited no changes in sporulation or spore resistance to heat. The findings reported here may provide new insights into the roles of the uncommon 3-C-methyl-6-deoxy sugars in cell-surface recognition and host-pathogen interactions of the genus Bacillus. PMID:28298443

  14. Parallel Evolution and Horizontal Gene Transfer of the pst Operon in Firmicutes from Oligotrophic Environments

    PubMed Central

    Moreno-Letelier, Alejandra; Olmedo, Gabriela; Eguiarte, Luis E.; Martinez-Castilla, Leon; Souza, Valeria

    2011-01-01

    The high affinity phosphate transport system (pst) is crucial for phosphate uptake in oligotrophic environments. Cuatro Cienegas Basin (CCB) has extremely low P levels and its endemic Bacillus are closely related to oligotrophic marine Firmicutes. Thus, we expected the pst operon of CCB to share the same evolutionary history and protein similarity to marine Firmicutes. Orthologs of the pst operon were searched in 55 genomes of Firmicutes and 13 outgroups. Phylogenetic reconstructions were performed for the pst operon and 14 concatenated housekeeping genes using maximum likelihood methods. Conserved domains and 3D structures of the phosphate-binding protein (PstS) were also analyzed. The pst operon of Firmicutes shows two highly divergent clades with no correlation to the type of habitat nor a phylogenetic congruence, suggesting horizontal gene transfer. Despite sequence divergence, the PstS protein had a similar 3D structure, which could be due to parallel evolution after horizontal gene transfer events. PMID:21461370

  15. Quantifying translational coupling in E. coli synthetic operons using RBS modulation and fluorescent reporters.

    PubMed

    Levin-Karp, Ayelet; Barenholz, Uri; Bareia, Tasneem; Dayagi, Michal; Zelcbuch, Lior; Antonovsky, Niv; Noor, Elad; Milo, Ron

    2013-06-21

    Translational coupling is the interdependence of translation efficiency of neighboring genes encoded within an operon. The degree of coupling may be quantified by measuring how the translation rate of a gene is modulated by the translation rate of its upstream gene. Translational coupling was observed in prokaryotic operons several decades ago, but the quantitative range of modulation translational coupling leads to and the factors governing this modulation were only partially characterized. In this study, we systematically quantify and characterize translational coupling in E. coli synthetic operons using a library of plasmids carrying fluorescent reporter genes that are controlled by a set of different ribosome binding site (RBS) sequences. The downstream gene expression level is found to be enhanced by the upstream gene expression via translational coupling with the enhancement level varying from almost no coupling to over 10-fold depending on the upstream gene's sequence. Additionally, we find that the level of translational coupling in our system is similar between the second and third locations in the operon. The coupling depends on the distance between the stop codon of the upstream gene and the start codon of the downstream gene. This study is the first to systematically and quantitatively characterize translational coupling in a synthetic E. coli operon. Our analysis will be useful in accurate manipulation of gene expression in synthetic biology and serves as a step toward understanding the mechanisms involved in translational expression modulation.

  16. High-Level Heat Resistance of Spores of Bacillus amyloliquefaciens and Bacillus licheniformis Results from the Presence of a spoVA Operon in a Tn1546 Transposon

    PubMed Central

    Berendsen, Erwin M.; Koning, Rosella A.; Boekhorst, Jos; de Jong, Anne; Kuipers, Oscar P.; Wells-Bennik, Marjon H. J.

    2016-01-01

    Bacterial endospore formers can produce spores that are resistant to many food processing conditions, including heat. Some spores may survive heating processes aimed at production of commercially sterile foods. Recently, it was shown that a spoVA operon, designated spoVA2mob, present on a Tn1546 transposon in Bacillus subtilis, leads to profoundly increased wet heat resistance of B. subtilis spores. Such Tn1546 transposon elements including the spoVA2mob operon were also found in several strains of Bacillus amyloliquefaciens and Bacillus licheniformis, and these strains were shown to produce spores with significantly higher resistances to wet heat than their counterparts lacking this transposon. In this study, the locations and compositions of Tn1546 transposons encompassing the spoVA2mob operons in B. amyloliquefaciens and B. licheniformis were analyzed. Introduction of these spoVA2mob operons into B. subtilis 168 (producing spores that are not highly heat resistant) rendered mutant 168 strains that produced high-level heat resistant spores, demonstrating that these elements in B. amyloliquefaciens and B. licheniformis are responsible for high level heat resistance of spores. Assessment of growth of the nine strains of each species between 5.2°C and 57.7°C showed some differences between strains, especially at lower temperatures, but all strains were able to grow at 57.7°C. Strains of B. amyloliquefaciens and B. licheniformis that contain the Tn1546 elements (and produce high-level heat resistant spores) grew at temperatures similar to those of their Tn1546-negative counterparts that produce low-level heat resistant spores. The findings presented in this study allow for detection of B. amyloliquefaciens and B. licheniformis strains that produce highly heat resistant spores in the food chain. PMID:27994575

  17. Chromosomal Organization of Rrna Operons in Bacillus Subtilis

    PubMed Central

    Jarvis, E. D.; Widom, R. L.; LaFauci, G.; Setoguchi, Y.; Richter, I. R.; Rudner, R.

    1988-01-01

    Integrative mapping with vectors containing ribosomal DNA sequences were used to complete the mapping of the 10 rRNA gene sets in the endospore forming bacterium Bacillus subtilis. Southern hybridizations allowed the assignment of nine operons to distinct BclI restriction fragments and their genetic locus identified by transductional crosses. Nine of the ten rRNA gene sets are located between 0 and 70° on the genomic map. In the region surrounding cysA14, two sets of closely spaced tandem clusters are present. The first (rrnJ and rrnW) is located between purA16 and cysA14 closely linked to the latter; the second (rrnI, rrnH and rrnG) previously mapped within this area is located between attSPO2 and glpT6. The operons at or near the origin of replication (rrnO,rrnA and rrnJ,rrnW) represent ``hot spots'' of plasmid insertion. PMID:2465199

  18. A quantitative study of the benefits of co-regulation using the spoIIA operon as an example

    PubMed Central

    Iber, Dagmar

    2006-01-01

    The distribution of most genes is not random, and functionally linked genes are often found in clusters. Several theories have been put forward to explain the emergence and persistence of operons in bacteria. Careful analysis of genomic data favours the co-regulation model, where gene organization into operons is driven by the benefits of coordinated gene expression and regulation. Direct evidence that coexpression increases the individual's fitness enough to ensure operon formation and maintenance is, however, still lacking. Here, a previously described quantitative model of the network that controls the transcription factor σF during sporulation in Bacillus subtilis is employed to quantify the benefits arising from both organization of the sporulation genes into the spoIIA operon and from translational coupling. The analysis shows that operon organization, together with translational coupling, is important because of the inherent stochastic nature of gene expression, which skews the ratios between protein concentrations in the absence of co-regulation. The predicted impact of different forms of gene regulation on fitness and survival agrees quantitatively with published sporulation efficiencies. PMID:16924264

  19. A quantitative study of the benefits of co-regulation using the spoIIA operon as an example.

    PubMed

    Iber, Dagmar

    2006-01-01

    The distribution of most genes is not random, and functionally linked genes are often found in clusters. Several theories have been put forward to explain the emergence and persistence of operons in bacteria. Careful analysis of genomic data favours the co-regulation model, where gene organization into operons is driven by the benefits of coordinated gene expression and regulation. Direct evidence that coexpression increases the individual's fitness enough to ensure operon formation and maintenance is, however, still lacking. Here, a previously described quantitative model of the network that controls the transcription factor sigma(F) during sporulation in Bacillus subtilis is employed to quantify the benefits arising from both organization of the sporulation genes into the spoIIA operon and from translational coupling. The analysis shows that operon organization, together with translational coupling, is important because of the inherent stochastic nature of gene expression, which skews the ratios between protein concentrations in the absence of co-regulation. The predicted impact of different forms of gene regulation on fitness and survival agrees quantitatively with published sporulation efficiencies.

  20. Comparison of the overlapping frd and ampC operons of Escherichia coli with the corresponding DNA sequences in other gram-negative bacteria.

    PubMed

    Bergström, S; Lindberg, F P; Olsson, O; Normark, S

    1983-09-01

    Specific DNA probes from Escherichia coli K-12 were used to analyze the sequence divergence of the frd and ampC operons in various species of gram-negative bacteria. These operons code for the fumarate reductase complex and the chromosomal beta-lactamase, respectively. We demonstrate that the two operons show the same general pattern of divergence, although the frd operon is considerably more conserved than is the ampC operon. The major exception is Salmonella typhimurium LT2, which shows a strong homology to the E. coli frd probe but none to the E. coli ampC probe. The operons from Citrobacter freundii and Shigella sonnei were cloned and characterized by physical mapping, Southern hybridization, and protein synthesis in minicells. In S. sonnei, as in E. coli K-12, the frd and ampC operons overlap (T. Grundström and B. Jaurin, Proc. Natl. Acad. Sci. U.S.A. 79:1111-1115, 1982). Only minor discrepancies between the two operons were found over the entire frd-ampC region. In C. freundii, the ampC and frd operons do not overlap, being separated by about 1,100 base pairs. Presumably the inducible property of the C. freundii chromosomal beta-lactamase is encoded by this 1,100-base-pair DNA segment.

  1. Structure of Salmonella FlhE, conserved member of a flagellar Type III secretion operon

    DOE PAGES

    Lee, Jaemin; Monzingo, Arthur F.; Keatinge-Clay, Adrian T.; ...

    2014-12-26

    In this paper, the bacterial flagellum is assembled by a multicomponent transport apparatus categorized as a type III secretion system. The secretion of proteins that assemble into the flagellum is driven by the proton motive force. The periplasmic protein FlhE is a member of the flhBAE operon in the majority of bacteria where FlhE is found. FlhA and FlhB are established components of the flagellar type III secretion system. The absence of FlhE results in a proton leak through the flagellar system, inappropriate secretion patterns, and cell death, indicating that FlhE regulates an important aspect of proper flagellar biosynthesis. Wemore » isolated FlhE from the periplasm of Salmonella and solved its structure to 1.5 Å resolution. The structure reveals a β-sandwich fold, with no close structural homologs. Finally, possible roles of FlhE, including that of a chaperone, are discussed.« less

  2. Structure of Salmonella FlhE, conserved member of a flagellar Type III secretion operon

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lee, Jaemin; Monzingo, Arthur F.; Keatinge-Clay, Adrian T.

    In this paper, the bacterial flagellum is assembled by a multicomponent transport apparatus categorized as a type III secretion system. The secretion of proteins that assemble into the flagellum is driven by the proton motive force. The periplasmic protein FlhE is a member of the flhBAE operon in the majority of bacteria where FlhE is found. FlhA and FlhB are established components of the flagellar type III secretion system. The absence of FlhE results in a proton leak through the flagellar system, inappropriate secretion patterns, and cell death, indicating that FlhE regulates an important aspect of proper flagellar biosynthesis. Wemore » isolated FlhE from the periplasm of Salmonella and solved its structure to 1.5 Å resolution. The structure reveals a β-sandwich fold, with no close structural homologs. Finally, possible roles of FlhE, including that of a chaperone, are discussed.« less

  3. Transcriptional and posttranscriptional regulation of Bacillus sp. CDB3 arsenic-resistance operon ars1

    PubMed Central

    Yu, Xuefei; Zheng, Wei; Bhat, Somanath; Aquilina, J. Andrew

    2015-01-01

    Bacillus sp. CDB3 possesses a novel eight-gene ars cluster (ars1, arsRYCDATorf7orf8) with some unusual features in regard to expression regulation. This study demonstrated that the cluster is a single operon but can also produce a short three-gene arsRYC transcript. A hairpin structure formed by internal inverted repeats between arsC and arsD was shown to diminish the expression of the full operon, thereby probably acting as a transcription attenuator. A degradation product of the arsRYC transcript was also identified. Electrophoretic mobility shift analysis demonstrated that ArsR interacts with the ars1 promoter forming a protein-DNA complex that could be impaired by arsenite. However, no interaction was detected between ArsD and the ars1 promoter, suggesting that the CDB3 ArsD protein may not play a regulatory role. Compared to other ars gene clusters, regulation of the Bacillus sp. CDB3 ars1 operon is more complex. It represents another example of specific mRNA degradation in the transporter gene region and possibly the first case of attenuator-mediated regulation of ars operons. PMID:26355338

  4. BAX and tumor suppressor TRP53 are important in regulating mutagenesis in spermatogenic cells in mice.

    PubMed

    Xu, Guogang; Vogel, Kristine S; McMahan, C Alex; Herbert, Damon C; Walter, Christi A

    2010-12-01

    During the first wave of spermatogenesis, and in response to ionizing radiation, elevated mutant frequencies are reduced to a low level by unidentified mechanisms. Apoptosis is occurring in the same time frame that the mutant frequency declines. We examined the role of apoptosis in regulating mutant frequency during spermatogenesis. Apoptosis and mutant frequencies were determined in spermatogenic cells obtained from Bax-null or Trp53-null mice. The results showed that spermatogenic lineage apoptosis was markedly decreased in Bax-null mice and was accompanied by a significantly increased spontaneous mutant frequency in seminiferous tubule cells compared to that of wild-type mice. Apoptosis profiles in the seminiferous tubules for Trp53-null were similar to control mice. Spontaneous mutant frequencies in pachytene spermatocytes and in round spermatids from Trp53-null mice were not significantly different from those of wild-type mice. However, epididymal spermatozoa from Trp53-null mice displayed a greater spontaneous mutant frequency compared to that from wild-type mice. A greater proportion of spontaneous transversions and a greater proportion of insertions/deletions 15 days after ionizing radiation were observed in Trp53-null mice compared to wild-type mice. Base excision repair activity in mixed germ cell nuclear extracts prepared from Trp53-null mice was significantly lower than that for wild-type controls. These data indicate that BAX-mediated apoptosis plays a significant role in regulating spontaneous mutagenesis in seminiferous tubule cells obtained from neonatal mice, whereas tumor suppressor TRP53 plays a significant role in regulating spontaneous mutagenesis between postmeiotic round spermatid and epididymal spermatozoon stages of spermiogenesis.

  5. The Rise and Fall of TRP-N, an Ancient Family of Mechanogated Ion Channels, in Metazoa

    PubMed Central

    Schüler, Andreas; Schmitz, Gregor; Reft, Abigail; Özbek, Suat; Thurm, Ulrich; Bornberg-Bauer, Erich

    2015-01-01

    Mechanoreception, the sensing of mechanical forces, is an ancient means of orientation and communication and tightly linked to the evolution of motile animals. In flies, the transient-receptor-potential N protein (TRP-N) was found to be a cilia-associated mechanoreceptor. TRP-N belongs to a large and diverse family of ion channels. Its unusually long N-terminal repeat of 28 ankyrin domains presumably acts as the gating spring by which mechanical energy induces channel gating. We analyzed the evolutionary origins and possible diversification of TRP-N. Using a custom-made set of highly discriminative sequence profiles we scanned a representative set of metazoan genomes and subsequently corrected several gene models. We find that, contrary to other ion channel families, TRP-N is remarkably conserved in its domain arrangements and copy number (1) in all Bilateria except for amniotes, even in the wake of several whole-genome duplications. TRP-N is absent in Porifera but present in Ctenophora and Placozoa. Exceptional multiplications of TRP-N occurred in Cnidaria, independently along the Hydra and the Nematostella lineage. Molecular signals of subfunctionalization can be attributed to different mechanisms of activation of the gating spring. In Hydra this is further supported by in situ hybridization and immune staining, suggesting that at least three paralogs adapted to nematocyte discharge, which is key for predation and defense. We propose that these new candidate proteins help explain the sensory complexity of Cnidaria which has been previously observed but so far has lacked a molecular underpinning. Also, the ancient appearance of TRP-N supports a common origin of important components of the nervous systems in Ctenophores, Cnidaria, and Bilateria. PMID:26100409

  6. The complete nucleotide sequence of the glnALG operon of Escherichia coli K12.

    PubMed Central

    Miranda-Ríos, J; Sánchez-Pescador, R; Urdea, M; Covarrubias, A A

    1987-01-01

    The nucleotide sequence of the E. coli glnALG operon has been determined. The glnL (ntrB) and glnG (ntrC) genes present a high homology, at the nucleotide and aminoacid levels, with the corresponding genes of Klebsiella pneumoniae. The predicted aminoacid sequence for glutamine synthetase allowed us to locate some of the enzyme domains. The structure of this operon is discussed. PMID:2882477

  7. The Phosphorylation State of the Drosophila TRP Channel Modulates the Frequency Response to Oscillating Light In Vivo

    PubMed Central

    Rhodes-Mordov, Elisheva; Katz, Ben; Oberegelsbacher, Claudia; Yasin, Bushra; Tzadok, Hanan; Huber, Armin

    2017-01-01

    Drosophila photoreceptors respond to oscillating light of high frequency (∼100 Hz), while the detected maximal frequency is modulated by the light rearing conditions, thus enabling high sensitivity to light and high temporal resolution. However, the molecular basis for this adaptive process is unclear. Here, we report that dephosphorylation of the light-activated transient receptor potential (TRP) ion channel at S936 is a fast, graded, light-dependent, and Ca2+-dependent process that is partially modulated by the rhodopsin phosphatase retinal degeneration C (RDGC). Electroretinogram measurements of the frequency response to oscillating lights in vivo revealed that dark-reared flies expressing wild-type TRP exhibited a detection limit of oscillating light at relatively low frequencies, which was shifted to higher frequencies upon light adaptation. Strikingly, preventing phosphorylation of the S936-TRP site by alanine substitution in transgenic Drosophila (trpS936A) abolished the difference in frequency response between dark-adapted and light-adapted flies, resulting in high-frequency response also in dark-adapted flies. In contrast, inserting a phosphomimetic mutation by substituting the S936-TRP site to aspartic acid (trpS936D) set the frequency response of light-adapted flies to low frequencies typical of dark-adapted flies. Light-adapted rdgC mutant flies showed relatively high S936-TRP phosphorylation levels and light–dark phosphorylation dynamics. These findings suggest that RDGC is one but not the only phosphatase involved in pS936-TRP dephosphorylation. Together, this study indicates that TRP channel dephosphorylation is a regulatory process that affects the detection limit of oscillating light according to the light rearing condition, thus adjusting dynamic processing of visual information under varying light conditions. SIGNIFICANCE STATEMENT Drosophila photoreceptors exhibit high temporal resolution as manifested in frequency response to oscillating

  8. Insertional Mutations in the Hydrogenase vhc and frc Operons Encoding Selenium-Free Hydrogenases in Methanococcus voltae

    PubMed Central

    Berghofer, Y.; Klein, A.

    1995-01-01

    Methanococcus voltae, which contains four different gene groups that encode [NiFe]-hydrogenases, was transformed with integration vectors to achieve polar inactivation of two of the four hydrogenase operons that encode the selenium-free enzymes Vhc and Frc. Transformants which were selected by their acquired puromycin resistance showed site-specific insertions in either the vhc or frc operon by single crossover events. Southern hybridization revealed tandem integrations of whole vectors in the vhc operon, whereas only one vector copy was found in the frc operon. Northern (RNA) hybridizations showed a pac transcript of defined size, indicating strong termination in front of the hydrogenase genes downstream. In spite of the apparent abolition of expression of selenium-free hydrogenases through these polar insertions, they were not lethal to cells upon growth in selenium-deprived minimal medium, which we had previously shown to strongly induce transcription of the respective operons in M. voltae. Instead, like wild-type control cultures, transformants responded to selenium deprivation only with a reduction in growth rate. We conclude that loss of the potential to express a selenium-free hydrogenase can nevertheless be balanced by very small amounts of selenium hydrogenases under laboratory conditions in which the hydrogen supply is not likely to be a limiting growth factor. PMID:16535019

  9. Cloning and Molecular Analysis of a Mannitol Operon of Phosphoenolpyruvate-dependent Phosphotransferase (PTS) type From Vibrio cholerae O395

    PubMed Central

    Kumar, Sanath; Smith, Kenneth P.; Floyd, Jody L.; Varela, Manuel F.

    2010-01-01

    A putative mannitol operon of the phosphoenolpyruvate phosphotransferase (PTS) type was cloned from Vibrio cholerae O395 and its activity studied in Escherichia coli. The 3.9 kb operon comprising of three genes is organized as mtlADR. Based on the sequence analysis, these were identified as genes encoding a putative mannitol-specific enzyme IICBA (EIIMtl) component (MtlA), a mannitol-1-phosphate dehydrogenase (MtlD) and a mannitol operon repressor (MtlR). The transport of [3H]mannitol by the cloned mannitol operon in E. coli was 13.8±1.4 nmol/min/mg protein. The insertional inactivation of EIIMtl abolished mannitol and sorbitol transport in V. cholerae O395. Comparison of the mannitol utilization apparatus of V. cholerae with those of Gram-negative and Gram positive bacteria suggests highly conserved nature of the system. MtlA and MtlD exhibit 75% similarity with corresponding sequences of E. coli mannitol operon genes, while MtlR has 63% similarity with MtlR of E. coli. The cloning of V. cholerae mannitol utilization system in an E. coli background will help in elucidating the functional properties of this operon. PMID:21184218

  10. Klebsiella pneumoniae yfiRNB operon affects biofilm formation, polysaccharide production and drug susceptibility.

    PubMed

    Huertas, Mónica G; Zárate, Lina; Acosta, Iván C; Posada, Leonardo; Cruz, Diana P; Lozano, Marcela; Zambrano, María M

    2014-12-01

    Klebsiella pneumoniae is an opportunistic pathogen important in hospital-acquired infections, which are complicated by the rise of drug-resistant strains and the capacity of cells to adhere to surfaces and form biofilms. In this work, we carried out an analysis of the genes in the K. pneumoniae yfiRNB operon, previously implicated in biofilm formation. The results indicated that in addition to the previously reported effect on type 3 fimbriae expression, this operon also affected biofilm formation due to changes in cellulose as part of the extracellular matrix. Deletion of yfiR resulted in enhanced biofilm formation and an altered colony phenotype indicative of cellulose overproduction when grown on solid indicator media. Extraction of polysaccharides and treatment with cellulase were consistent with the presence of cellulose in biofilms. The enhanced cellulose production did not, however, correlate with virulence as assessed using a Caenorhabditis elegans assay. In addition, cells bearing mutations in genes of the yfiRNB operon varied with respect to the WT control in terms of susceptibility to the antibiotics amikacin, ciprofloxacin, imipenem and meropenem. These results indicated that the yfiRNB operon is implicated in the production of exopolysaccharides that alter cell surface characteristics and the capacity to form biofilms--a phenotype that does not necessarily correlate with properties related with survival, such as resistance to antibiotics. © 2014 The Authors.

  11. Improved Synthesis of 4-Cyanotryptophan and Other Tryptophan Analogues in Aqueous Solvent Using Variants of TrpB from Thermotoga maritima.

    PubMed

    Boville, Christina E; Romney, David K; Almhjell, Patrick J; Sieben, Michaela; Arnold, Frances H

    2018-04-27

    The use of enzymes has become increasingly widespread in synthesis as chemists strive to reduce their reliance on organic solvents in favor of more environmentally benign aqueous media. With this in mind, we previously endeavored to engineer the tryptophan synthase β-subunit (TrpB) for production of noncanonical amino acids that had previously been synthesized through multistep routes involving water-sensitive reagents. This enzymatic platform proved effective for the synthesis of analogues of the amino acid tryptophan (Trp), which are frequently used in pharmaceutical synthesis as well as chemical biology. However, certain valuable compounds, such as the blue fluorescent amino acid 4-cyanotryptophan (4-CN-Trp), could only be made in low yield, even at elevated temperature (75 °C). Here, we describe the engineering of TrpB from Thermotoga maritima that improved synthesis of 4-CN-Trp from 24% to 78% yield. Remarkably, although the final enzyme maintains high thermostability ( T 50 = 93 °C), its temperature profile is shifted such that high reactivity is observed at ∼37 °C (76% yield), creating the possibility for in vivo 4-CN-Trp production. The improvements are not specific to 4-CN-Trp; a boost in activity at lower temperature is also demonstrated for other Trp analogues.

  12. Trp-cage: folding free energy landscape in explicit water.

    PubMed

    Zhou, Ruhong

    2003-11-11

    Trp-cage is a 20-residue miniprotein, which is believed to be the fastest folder known so far. In this study, the folding free energy landscape of Trp-cage has been explored in explicit solvent by using an OPLSAA force field with periodic boundary condition. A highly parallel replica exchange molecular dynamics method is used for the conformation space sampling, with the help of a recently developed efficient molecular dynamics algorithm P3ME/RESPA (particle-particle particle-mesh Ewald/reference system propagator algorithm). A two-step folding mechanism is proposed that involves an intermediate state where two correctly formed partial hydrophobic cores are separated by an essential salt-bridge between residues Asp-9 and Arg-16 near the center of the peptide. This metastable intermediate state provides an explanation for the superfast folding process. The free energy landscape is found to be rugged at low temperatures, and then becomes smooth and funnel-like above 340 K. The lowest free energy structure at 300 K is only 1.50 A Calpha-RMSD (Calpha-rms deviation) from the NMR structures. The simulated nuclear Overhauser effect pair distances are in excellent agreement with the raw NMR data. The temperature dependence of the Trp-cage population, however, is found to be significantly different from experiment, with a much higher melting transition temperature above 400 K (experimental 315 K), indicating that the current force fields, parameterized at room temperature, need to be improved to correctly predict the temperature dependence.

  13. Trp-cage: Folding free energy landscape in explicit water

    NASA Astrophysics Data System (ADS)

    Zhou, Ruhong

    2003-11-01

    Trp-cage is a 20-residue miniprotein, which is believed to be the fastest folder known so far. In this study, the folding free energy landscape of Trp-cage has been explored in explicit solvent by using an OPLSAA force field with periodic boundary condition. A highly parallel replica exchange molecular dynamics method is used for the conformation space sampling, with the help of a recently developed efficient molecular dynamics algorithm P3ME/RESPA (particle-particle particle-mesh Ewald/reference system propagator algorithm). A two-step folding mechanism is proposed that involves an intermediate state where two correctly formed partial hydrophobic cores are separated by an essential salt-bridge between residues Asp-9 and Arg-16 near the center of the peptide. This metastable intermediate state provides an explanation for the superfast folding process. The free energy landscape is found to be rugged at low temperatures, and then becomes smooth and funnel-like above 340 K. The lowest free energy structure at 300 K is only 1.50 Å C-RMSD (C-rms deviation) from the NMR structures. The simulated nuclear Overhauser effect pair distances are in excellent agreement with the raw NMR data. The temperature dependence of the Trp-cage population, however, is found to be significantly different from experiment, with a much higher melting transition temperature above 400 K (experimental 315 K), indicating that the current force fields, parameterized at room temperature, need to be improved to correctly predict the temperature dependence.

  14. Trp-cage: Folding free energy landscape in explicit water

    PubMed Central

    Zhou, Ruhong

    2003-01-01

    Trp-cage is a 20-residue miniprotein, which is believed to be the fastest folder known so far. In this study, the folding free energy landscape of Trp-cage has been explored in explicit solvent by using an OPLSAA force field with periodic boundary condition. A highly parallel replica exchange molecular dynamics method is used for the conformation space sampling, with the help of a recently developed efficient molecular dynamics algorithm P3ME/RESPA (particle–particle particle–mesh Ewald/reference system propagator algorithm). A two-step folding mechanism is proposed that involves an intermediate state where two correctly formed partial hydrophobic cores are separated by an essential salt-bridge between residues Asp-9 and Arg-16 near the center of the peptide. This metastable intermediate state provides an explanation for the superfast folding process. The free energy landscape is found to be rugged at low temperatures, and then becomes smooth and funnel-like above 340 K. The lowest free energy structure at 300 K is only 1.50 Å Cα-RMSD (Cα-rms deviation) from the NMR structures. The simulated nuclear Overhauser effect pair distances are in excellent agreement with the raw NMR data. The temperature dependence of the Trp-cage population, however, is found to be significantly different from experiment, with a much higher melting transition temperature above 400 K (experimental 315 K), indicating that the current force fields, parameterized at room temperature, need to be improved to correctly predict the temperature dependence. PMID:14581616

  15. Mutagenicity evaluation of metal oxide nanoparticles by the bacterial reverse mutation assay.

    PubMed

    Pan, Xiaoping; Redding, James E; Wiley, Patricia A; Wen, Lisa; McConnell, J Scott; Zhang, Baohong

    2010-03-01

    Nanomaterials have been emerging as a new group of contaminants in the environment. We reported the use of a bacterial reverse mutation assay (Ames assay) to evaluate the mutagenicity of five metal oxide nanoparticles Al(2)O(3), Co(3)O(4), CuO, TiO(2), and ZnO in this study. Results showed the mutagenicity was negative for four nanoparticles (Al(2)O(3), Co(3)O(4), TiO(2), and ZnO) up to 1000mug/plate to all three tested strains without S9 metabolic activation. Using a preincubation procedure and high S9 (9%) activation, TiO(2) and ZnO induced marginal mutagenesis to strain Escherichia coli WP2 trp uvrA. CuO displayed low mutagenic potential to Salmonella typhimurium TA97a and TA100 at specific concentrations. However, the colony inhibition effect of CuO was predominant to the strain E. coli WP2 trp uvrA. A dose-dependent inhibition of Escherichia coli WP2 colony was found under CuO exposure at concentration range of 100-1600mug/plate. No growth inhibition of tested bacterial strains by Al(2)O(3), Co(3)O(4), and ZnO was observed at the concentrations used. Published by Elsevier Ltd.

  16. Transit safety retrofit package development : TRP concept of operations.

    DOT National Transportation Integrated Search

    2014-05-01

    This document describes the Concept of Operations (ConOps) for the Transit Safety Retrofit Package (TRP). The ConOps describes the current state of operations with respect to the integration of Connected Vehicle technology in transit buses, establish...

  17. A four-gene operon in Bacillus cereus produces two rare spore-decorating sugars.

    PubMed

    Li, Zi; Mukherjee, Thiya; Bowler, Kyle; Namdari, Sholeh; Snow, Zachary; Prestridge, Sarah; Carlton, Alexandra; Bar-Peled, Maor

    2017-05-05

    Bacterial glycan structures on cell surfaces are critical for cell-cell recognition and adhesion and in host-pathogen interactions. Accordingly, unraveling the sugar composition of bacterial cell surfaces can shed light on bacterial growth and pathogenesis. Here, we found that two rare sugars with a 3- C -methyl-6-deoxyhexose structure were linked to spore glycans in Bacillus cereus ATCC 14579 and ATCC 10876. Moreover, we identified a four-gene operon in B. cereus ATCC 14579 that encodes proteins with the following sequential enzyme activities as determined by mass spectrometry and one- and two-dimensional NMR methods: CTP:glucose-1-phosphate cytidylyltransferase, CDP-Glc 4,6-dehydratase, NADH-dependent SAM: C -methyltransferase, and NADPH-dependent CDP-3- C -methyl-6-deoxyhexose 4-reductase. The last enzyme predominantly yielded CDP-3- C -methyl-6-deoxygulose (CDP-cereose) and likely generated a 4-epimer CDP-3- C -methyl-6-deoxyallose (CDP-cillose). Some members of the B. cereus sensu lato group produce CDP-3- C -methyl-6-deoxy sugars for the formation of cereose-containing glycans on spores, whereas others such as Bacillus anthracis do not. Gene knockouts of the Bacillus C -methyltransferase and the 4-reductase confirmed their involvement in the formation of cereose-containing glycan on B. cereus spores. We also found that cereose represented 0.2-1% spore dry weight. Moreover, mutants lacking cereose germinated faster than the wild type, yet the mutants exhibited no changes in sporulation or spore resistance to heat. The findings reported here may provide new insights into the roles of the uncommon 3- C -methyl-6-deoxy sugars in cell-surface recognition and host-pathogen interactions of the genus Bacillus . © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  18. Defense islands in bacterial and archaeal genomes and prediction of novel defense systems.

    PubMed

    Makarova, Kira S; Wolf, Yuri I; Snir, Sagi; Koonin, Eugene V

    2011-11-01

    The arms race between cellular life forms and viruses is a major driving force of evolution. A substantial fraction of bacterial and archaeal genomes is dedicated to antivirus defense. We analyzed the distribution of defense genes and typical mobilome components (such as viral and transposon genes) in bacterial and archaeal genomes and demonstrated statistically significant clustering of antivirus defense systems and mobile genes and elements in genomic islands. The defense islands are enriched in putative operons and contain numerous overrepresented gene families. A detailed sequence analysis of the proteins encoded by genes in these families shows that many of them are diverged variants of known defense system components, whereas others show features, such as characteristic operonic organization, that are suggestive of novel defense systems. Thus, genomic islands provide abundant material for the experimental study of bacterial and archaeal antivirus defense. Except for the CRISPR-Cas systems, different classes of defense systems, in particular toxin-antitoxin and restriction-modification systems, show nonrandom clustering in defense islands. It remains unclear to what extent these associations reflect functional cooperation between different defense systems and to what extent the islands are genomic "sinks" that accumulate diverse nonessential genes, particularly those acquired via horizontal gene transfer. The characteristics of defense islands resemble those of mobilome islands. Defense and mobilome genes are nonrandomly associated in islands, suggesting nonadaptive evolution of the islands via a preferential attachment-like mechanism underpinned by the addictive properties of defense systems such as toxins-antitoxins and an important role of horizontal mobility in the evolution of these islands.

  19. Discovery of an operon that participates in agmatine metabolism and regulates biofilm formation in Pseudomonas aeruginosa

    PubMed Central

    Williams, Bryan J.; Du, Rui-Hong; Calcutt, M. Wade; Abdolrasulnia, Rasul; Christman, Brian W.; Blackwell, Timothy S.

    2013-01-01

    Summary Agmatine is the decarboxylation product of arginine and a number of bacteria have devoted enzymatic pathways for its metabolism. Pseudomonas aeruginosa harbours the aguBA operon that metabolizes agmatine to putrescine, which can be subsequently converted into other polyamines or shunted into the TCA cycle for energy production. We discovered an alternate agmatine operon in the P. aeruginosa strain PA14 named agu2ABCA′ that contains two genes for agmatine deiminases (agu2A and agu2A′). This operon was found to be present in 25% of clinical P. aeruginosa isolates. Agu2A′ contains a twin-arginine translocation signal at its N-terminus and site-directed mutagenesis and cell fractionation experiments confirmed this protein is secreted to the periplasm. Analysis of the agu2ABCA′ promoter demonstrates that agmatine induces expression of the operon during the stationary phase of growth and during biofilm growth and agu2ABCA′ provides only weak complementation of aguBA, which is induced during log phase. Biofilm assays of mutants of all three agmatine deiminase genes in PA14 revealed that deletion of agu2ABCA′, specifically its secreted product Agu2A′, reduces biofilm production of PA14 following addition of exogenous agmatine. Together, these findings reveal a novel role for the agu2ABCA′ operon in the biofilm development of P. aeruginosa. PMID:20149107

  20. The copYAZ Operon Functions in Copper Efflux, Biofilm Formation, Genetic Transformation, and Stress Tolerance in Streptococcus mutans

    PubMed Central

    Singh, Kamna; Senadheera, Dilani B.; Lévesque, Céline M.

    2015-01-01

    ABSTRACT In bacteria, copper homeostasis is closely monitored to ensure proper cellular functions while avoiding cell damage. Most Gram-positive bacteria utilize the copYABZ operon for copper homeostasis, where copA and copB encode copper-transporting P-type ATPases, whereas copY and copZ regulate the expression of the cop operon. Streptococcus mutans is a biofilm-forming oral pathogen that harbors a putative copper-transporting copYAZ operon. Here, we characterized the role of copYAZ operon in the physiology of S. mutans and delineated the mechanisms of copper-induced toxicity in this bacterium. We observed that copper induced toxicity in S. mutans cells by generating oxidative stress and disrupting their membrane potential. Deletion of the copYAZ operon in S. mutans strain UA159 resulted in reduced cell viability under copper, acid, and oxidative stress relative to the viability of the wild type under these conditions. Furthermore, the ability of S. mutans to form biofilms and develop genetic competence was impaired under copper stress. Briefly, copper stress significantly reduced cell adherence and total biofilm biomass, concomitantly repressing the transcription of the gtfB, gtfC, gtfD, gbpB, and gbpC genes, whose products have roles in maintaining the structural and/or functional integrity of the S. mutans biofilm. Furthermore, supplementation with copper or loss of copYAZ resulted in significant reductions in transformability and in the transcription of competence-associated genes. Copper transport assays revealed that the ΔcopYAZ strain accrued significantly large amounts of intracellular copper compared with the amount of copper accumulation in the wild-type strain, thereby demonstrating a role for CopYAZ in the copper efflux of S. mutans. The complementation of the CopYAZ system restored copper expulsion, membrane potential, and stress tolerance in the copYAZ-null mutant. Taking these results collectively, we have established the function of the S. mutans

  1. Transient receptor potential (TRP) channels as drug targets for diseases of the digestive system

    PubMed Central

    Holzer, Peter

    2011-01-01

    Approximately 20 of the 30 mammalian transient receptor potential (TRP) channel subunits are expressed by specific neurons and cells within the alimentary canal. They subserve important roles in taste, chemesthesis, mechanosensation, pain and hyperalgesia and contribute to the regulation of gastrointestinal motility, absorptive and secretory processes, blood flow, and mucosal homeostasis. In a cellular perspective, TRP channels operate either as primary detectors of chemical and physical stimuli, as secondary transducers of ionotropic or metabotropic receptors, or as ion transport channels. The polymodal sensory function of TRPA1, TRPM5, TRPM8, TRPP2, TRPV1, TRPV3 and TRPV4 enables the digestive system to survey its physical and chemical environment, which is relevant to all processes of digestion. TRPV5 and TRPV6 as well as TRPM6 and TRPM7 contribute to the absorption of Ca2+ and Mg2+, respectively. TRPM7 participates in intestinal pacemaker activity, and TRPC4 transduces muscarinic acetylcholine receptor activation to smooth muscle contraction. Changes in TRP channel expression or function are associated with a variety of diseases/disorders of the digestive system, notably gastro-esophageal reflux disease, inflammatory bowel disease, pain and hyperalgesia in heartburn, functional dyspepsia and irritable bowel syndrome, cholera, hypomagnesemia with secondary hypocalcemia, infantile hypertrophic pyloric stenosis, esophageal, gastrointestinal and pancreatic cancer, and polycystic liver disease. These implications identify TRP channels as promising drug targets for the management of a number of gastrointestinal pathologies. As a result, major efforts are put into the development of selective TRP channel agonists and antagonists and the assessment of their therapeutic potential. PMID:21420431

  2. Genome-wide analysis of trans-splicing in the nematode Pristionchus pacificus unravels conserved gene functions for germline and dauer development in divergent operons.

    PubMed

    Sinha, Amit; Langnick, Claudia; Sommer, Ralf J; Dieterich, Christoph

    2014-09-01

    Discovery of trans-splicing in multiple metazoan lineages led to the identification of operon-like gene organization in diverse organisms, including trypanosomes, tunicates, and nematodes, but the functional significance of such operons is not completely understood. To see whether the content or organization of operons serves similar roles across species, we experimentally defined operons in the nematode model Pristionchus pacificus. We performed affinity capture experiments on mRNA pools to specifically enrich for transcripts that are trans-spliced to either the SL1- or SL2-spliced leader, using spliced leader-specific probes. We obtained distinct trans-splicing patterns from the analysis of three mRNA pools (total mRNA, SL1 and SL2 fraction) by RNA-seq. This information was combined with a genome-wide analysis of gene orientation and spacing. We could confirm 2219 operons by RNA-seq data out of 6709 candidate operons, which were predicted by sequence information alone. Our gene order comparison of the Caenorhabditis elegans and P. pacificus genomes shows major changes in operon organization in the two species. Notably, only 128 out of 1288 operons in C. elegans are conserved in P. pacificus. However, analysis of gene-expression profiles identified conserved functions such as an enrichment of germline-expressed genes and higher expression levels of operonic genes during recovery from dauer arrest in both species. These results provide support for the model that a necessity for increased transcriptional efficiency in the context of certain developmental processes could be a selective constraint for operon evolution in metazoans. Our method is generally applicable to other metazoans to see if similar functional constraints regulate gene organization into operons. © 2014 Sinha et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  3. A thermodynamic framework for understanding temperature sensing by transient receptor potential (TRP) channels

    PubMed Central

    Clapham, David E.; Miller, Christopher

    2011-01-01

    The exceptionally high temperature sensitivity of certain transient receptor potential (TRP) family ion channels is the molecular basis of hot and cold sensation in sensory neurons. The laws of thermodynamics dictate that opening of these specialized TRP channels must involve an unusually large conformational standard-state enthalpy, ΔHo: positive ΔHo for heat-activated and negative ΔHo for cold-activated TRPs. However, the molecular source of such high-enthalpy changes has eluded neurobiologists and biophysicists. Here we offer a general, unifying mechanism for both hot and cold activation that recalls long-appreciated principles of protein folding. We suggest that TRP channel gating is accompanied by large changes in molar heat capacity, ΔCP. This postulate, along with the laws of thermodynamics and independent of mechanistic detail, leads to the conclusion that hot- and cold-sensing TRPs operate by identical conformational changes. PMID:22109551

  4. A thermodynamic framework for understanding temperature sensing by transient receptor potential (TRP) channels.

    PubMed

    Clapham, David E; Miller, Christopher

    2011-12-06

    The exceptionally high temperature sensitivity of certain transient receptor potential (TRP) family ion channels is the molecular basis of hot and cold sensation in sensory neurons. The laws of thermodynamics dictate that opening of these specialized TRP channels must involve an unusually large conformational standard-state enthalpy, ΔH(o): positive ΔH(o) for heat-activated and negative ΔH(o) for cold-activated TRPs. However, the molecular source of such high-enthalpy changes has eluded neurobiologists and biophysicists. Here we offer a general, unifying mechanism for both hot and cold activation that recalls long-appreciated principles of protein folding. We suggest that TRP channel gating is accompanied by large changes in molar heat capacity, ΔC(P). This postulate, along with the laws of thermodynamics and independent of mechanistic detail, leads to the conclusion that hot- and cold-sensing TRPs operate by identical conformational changes.

  5. beta3-Adrenergic receptor Trp64Arg polymorphism and increased body mass index in sleep apnoea.

    PubMed

    Piérola, J; Barceló, A; de la Peña, M; Barbé, F; Soriano, J B; Sánchez Armengol, A; Martínez, C; Agustí, A

    2007-10-01

    Obesity is an important risk factor for obstructive sleep apnoea syndrome (OSAS), insulin resistance and cardiovascular disease. The substitution of tryptophan 64 with arginine (Trp64Arg) polymorphism (Arg variant) of the beta(3)-adrenergic receptor (ADRB3) has been associated with obesity. In this study, the prevalence of the Trp64Arg ADRB3 polymorphism in a large group of patients with OSAS and its association with body mass index (BMI), insulin resistance and hypertension were evaluated. ADRB3 genotype was determined in 387 patients with OSAS and 137 healthy subjects recruited from three Spanish tertiary hospitals. The distributions of the ADRB3 genotypes were similar in OSAS and controls, and, in a multivariate model, the risk of OSAS was not associated with the presence of the Arg variant of the ADRB3 gene. However, BMI was higher in those patients with OSAS who carried this genetic variant than in those with the Trp variant. Furthermore, a linear trend for higher BMI was found in those with the Arg variant (56, 75 and 100% for Trp/Trp, Trp/Arg and Arg/Arg, respectively). Insulin resistance, blood pressures and serum levels of lipids and glucose were not associated with the presence of the Arg variant of the ADRB3 gene. The presence of the arginine 64 allele of the beta(3)-adrenergic receptor gene does not increase the risk of obstructive sleep apnoea syndrome, but is associated with the development of obesity in those patients who suffer obstructive sleep apnoea syndrome.

  6. Cross-Regulation between the phz1 and phz2 Operons Maintain a Balanced Level of Phenazine Biosynthesis in Pseudomonas aeruginosa PAO1

    PubMed Central

    Jiang, Bei; Xiao, Bo; Liu, Linde; Ge, Yihe; Hu, Xiaomei

    2016-01-01

    Gene duplication often provides selective advantages for the survival of microorganisms in adapting to varying environmental conditions. P. aeruginosa PAO1 possesses two seven-gene operons [phz1 (phzA1B1C1D1E1F1G1) and phz2 (phzA2B2C2D2E2F2G2)] that are involved in the biosynthesis of phenazine-1-carboxylic acid and its derivatives. Although the two operons are highly homologous and their functions are well known, it is unclear how the two phz operons coordinate their expressions to maintain the phenazine biosynthesis. By constructing single and double deletion mutants of the two phz operons, we found that the phz1-deletion mutant produced the same or less amount of phenazine-1-carboxylic acid and pyocyanin in GA medium than the phz2-knockout mutant while the phz1-phz2 double knockout mutant did not produce any phenazines. By generating phzA1 and phzA2 translational and transcriptional fusions with a truncated lacZ reporter, we found that the expression of the phz1 operon increased significantly at the post-transcriptional level and did not alter at the transcriptional level in the absence of the phz2 operon. Surprisingly, the expression the phz2 operon increased significantly at the post-transcriptional level and only moderately at the transcriptional level in the absence of the phz1 operon. Our findings suggested that a complex cross-regulation existed between the phz1 and phz2 operons. By mediating the upregulation of one phz operon expression while the other was deleted, this crosstalk would maintain the homeostatic balance of phenazine biosynthesis in P. aeruginosa PAO1. PMID:26735915

  7. TrpC5 Mediates Acute Leptin and Serotonin Effects via Pomc Neurons.

    PubMed

    Gao, Yong; Yao, Ting; Deng, Zhuo; Sohn, Jong-Woo; Sun, Jia; Huang, Yiru; Kong, Xingxing; Yu, Kai-Jiang; Wang, Rui-Tao; Chen, Hong; Guo, Hongbo; Yan, Jianqun; Cunningham, Kathryn A; Chang, Yongsheng; Liu, Tiemin; Williams, Kevin W

    2017-01-17

    The molecular mechanisms underlying acute leptin and serotonin 2C receptor-induced hypophagia remain unclear. Here, we show that neuronal and pro-opiomelanocortin (Pomc)-specific loss of transient receptor potential cation 5 (TrpC5) subunits is sufficient to decrease energy expenditure and increase food intake resulting in elevated body weight. Deficiency of Trpc5 subunits in Pomc neurons is also sufficient to block the anorexigenic effects of leptin and serotonin 2C receptor (Ht2Cr) agonists. The loss of acute anorexigenic effects of these receptors is concomitant with a blunted electrophysiological response to both leptin and Ht2Cr agonists in arcuate Pomc neurons. We also demonstrate that the Ht2Cr agonist lorcaserin-induced improvements in glucose and insulin tolerance are blocked by TrpC5 deficiency in Pomc neurons. Together, our results link TrpC5 subunits in the brain with leptin- and serotonin 2C receptor-dependent changes in neuronal activity, as well as energy balance, feeding behavior, and glucose metabolism. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  8. Meta-analysis of the association between the Trp64Arg polymorphism of the beta-3 adrenergic receptor and susceptibility to gestational diabetes mellitus.

    PubMed

    Guan, Lianyue; Cui, Xiaofeng; Zhou, Hui

    2018-02-01

    The study aimed to explore the associations between Trp64Arg polymorphism of Beta-3 Adrenergic receptor (ADRB3) and susceptibility to gestational diabetes mellitus (GDM). Relevant studies till December 2013 were identified through searching electronic databases. A meta-analysis was conducted on associations between Trp64Arg polymorphism in ADRB3 and susceptibility to GDM. We found no association between Trp64Arg polymorphism in ADRB3 and susceptibility to GDM in overall population (Arg vs. Trp: OR = 1.20, 95%CI = 0.99-1.47, p = .16; Trp/Arg + Arg/Arg vs. Trp/Trp: OR = 1.22, 95%CI = 0.99-1.50, p = .11). In subgroup analysis on European Caucasian population, Trp64Arg in ADRB3 was associated with susceptibility to GDM. Trp64Arg polymorphism in ADRB3 had certain association with susceptibility to GDM in the European Caucasian population. Impact statement What is already known on this subject: Gestational diabetes mellitus (GDM) is recognised as carbohydrate intolerance of varied severity that begins or is first recognised during pregnancy. A missense mutation in the codon 64 of the Beta-3 adrenergic receptor (ADRB3), Trp64Arg, leads to the substitution of tryptophan by arginine in the first intracellular loop of the ADRB3 receptor. Trp64Arg Polymorphism has also been reportedly associated with increased body weight, type 2 diabetes mellitus, insulin resistance and obesity. However, other investigators have found that the Trp64Arg polymorphism of ADRB3 has no effect on insulin resistance, obesity or type 2 diabetes mellitus. What the results of the study add: Our present meta-analysis demonstrated that Trp64Arg polymorphism in ADRB3 was associated with susceptibility to GDM in the European Caucasian population. Trp64Arg polymorphism in ADRB3 may be able to predict the occurrence of GDM and used for the diagnosis of it in clinic. What the implications are of these findings for clinical practice and future research: The findings in this study

  9. The alpha-adducin Gly460Trp polymorphism and the antihypertensive effects of exercise among men with high blood pressure.

    PubMed

    Pescatello, Linda S; Blanchard, Bruce E; Tsongalis, Gregory J; Maresh, Carl M; O'Connell, Ann; Thompson, Paul D

    2007-09-01

    The alpha-adducin Gly460Trp polymorphism alters renal sodium transport and is associated with hypertension. Despite the immediate sodium- and volume-depleting effects of aerobic exercise, the influence of the alpha-adducin Gly460Trp polymorphism on PEH (postexercise hypotension) has not been studied. In the present study we examined the effects of the alpha-adducin Gly460Trp polymorphism on PEH among 48 men (42.6+/-1.6 years; mean+/-S.E.M.) with high BP (blood pressure; 144.0+/-1.7/84.7+/-1.1 mmHg). Subjects completed three experiments: non-exercise control and two cycle exercise sessions at 40% (light exercise) and 60% (moderate exercise) of maximal oxygen consumption. Subjects left the laboratory wearing an ambulatory BP monitor. PCR and restriction enzyme digestion determined the genotypes. No subjects had the Trp460Trp genotype due to the low frequency of 5% in the population. Repeated measure ANCOVA tested whether BP differed over time between experimental conditions and genotypes (Gly460Gly, n=36; Gly460Trp, n=12). Among Gly460Gly genotypes, SBP (systolic BP) was reduced by 5.2+/-1.4 mmHg after moderate exercise compared with non-exercise controls over 9 h (P<0.01). Among Gly460Trp genotypes, SBP was lowered by 7.8+/-2.3 mmHg; after light exercise compared with non-exercise controls over 9 h (P<0.05). The SBP reductions after light exercise (0.6+/-1.3 compared with 7.8+/-2.3 mmHg; P<0.05) but not moderate exercise (5.2+/-1.4 compared with 3.8+/-2.4 mmHg; P> or =0.05) differed between the Gly460Gly and Gly460Trp genotypes respectively. Men with Gly460Gly had a reduced SBP after moderate exercise, whereas men with Gly460Trp had a reduced SBP after light exercise. However, only the SBP reductions after light exercise differed between genotypes. Our findings indicate that the alpha-adducin Gly460Trp genotype may be useful in identifying men who have a reduced BP after lower intensity aerobic exercise.

  10. Leptin-induced spine formation requires TrpC channels and the CaM kinase cascade in the hippocampus.

    PubMed

    Dhar, Matasha; Wayman, Gary A; Zhu, Mingyan; Lambert, Talley J; Davare, Monika A; Appleyard, Suzanne M

    2014-07-23

    Leptin is a critical neurotrophic factor for the development of neuronal pathways and synaptogenesis in the hypothalamus. Leptin receptors are also found in other brain regions, including the hippocampus, and a postnatal surge in leptin correlates with a time of rapid growth of dendritic spines and synapses in the hippocampus. Leptin is critical for normal hippocampal dendritic spine formation as db/db mice, which lack normal leptin receptor signaling, have a reduced number of dendritic spines in vivo. Leptin also positively influences hippocampal behaviors, such as cognition, anxiety, and depression, which are critically dependent on dendritic spine number. What is not known are the signaling mechanisms by which leptin initiates spine formation. Here we show leptin induces the formation of dendritic protrusions (thin headless, stubby and mushroom shaped spines), through trafficking and activation of TrpC channels in cultured hippocampal neurons. Leptin-activation of the TrpC current is dose dependent and blocked by targeted knockdown of the leptin receptor. The nonselective TrpC channel inhibitors SKF96365 and 2-APB or targeted knockdown of TrpC1 or 3, but not TrpC5, channels also eliminate the leptin-induced current. Leptin stimulates the phosphorylation of CaMKIγ and β-Pix within 5 min and their activation is required for leptin-induced trafficking of TrpC1 subunits to the membrane. Furthermore, we show that CaMKIγ, CaMKK, β-Pix, Rac1, and TrpC1/3 channels are all required for both the leptin-sensitive current and leptin-induced spine formation. These results elucidate a critical pathway underlying leptin's induction of dendritic morphological changes that initiate spine and excitatory synapse formation. Copyright © 2014 the authors 0270-6474/14/3410022-12$15.00/0.

  11. Preparation of a Trp-BODIPY fluorogenic amino acid to label peptides for enhanced live-cell fluorescence imaging.

    PubMed

    Mendive-Tapia, Lorena; Subiros-Funosas, Ramon; Zhao, Can; Albericio, Fernando; Read, Nick D; Lavilla, Rodolfo; Vendrell, Marc

    2017-08-01

    Fluorescent peptides are valuable tools for live-cell imaging because of the high specificity of peptide sequences for their biomolecular targets. When preparing fluorescent versions of peptides, labels must be introduced at appropriate positions in the sequences to provide suitable reporters while avoiding any impairment of the molecular recognition properties of the peptides. This protocol describes the preparation of the tryptophan (Trp)-based fluorogenic amino acid Fmoc-Trp(C 2 -BODIPY)-OH and its incorporation into peptides for live-cell fluorescence imaging-an approach that is applicable to most peptide sequences. Fmoc-Trp(C 2 -BODIPY)-OH contains a BODIPY (4,4-difluoro-4-bora-3a,4a-diaza-s-indacene) fluorogenic core, which works as an environmentally sensitive fluorophore, showing high fluorescence in lipophilic conditions. It is attached to Trp via a spacer-free C-C linkage, resulting in a labeled amino acid that can mimic the molecular interactions of Trp, enabling wash-free imaging. This protocol covers the chemical synthesis of the fluorogenic amino acid Fmoc-Trp(C 2 -BODIPY)-OH (3-4 d), the preparation of the labeled antimicrobial peptide BODIPY-cPAF26 by solid-phase synthesis (6-7 d) and its spectral and biological characterization as a live-cell imaging probe for different fungal pathogens. As an example, we include a procedure for using BODIPY-cPAF26 for wash-free imaging of fungal pathogens, including real-time visualization of Aspergillus fumigatus (5 d for culturing, 1-2 d for imaging).

  12. A deeper analysis of the epitope/paratope of PLY-5, a mouse monoclonal antibody which recognises the conserved undecapeptide tryptophan-rich loop (ECTGLAWEWWR) of bacterial cholesterol-dependent cytolysins.

    PubMed

    González-Menéndez, Pedro; García-Ocaña, Marcos; de los Toyos, Juan R

    2013-01-04

    A previous study showed that the minimal epitope recognised by the PLY-5 mAb in the conserved undecapeptide Trp-rich loop of bacterial CDCs should consist of WEWWRT (Jacobs et al., 1999) [5]. Now, through immunoscreening of amino acid substitution analogues, it is concluded that the second Trp and the Arg residues are essential in the PLY-5 epitope. The E residue is an auxiliary epitope contributor. Antibody modelling and docking simulations provided support for these findings. For recognition by the antibody, the Trp-rich loop flipped out, mimicking the mechanism of membrane insertion. The displaced second Trp was seen to establish aromatic stacking interactions with aromatic residues of the antibody paratope and the notably extruded guanidium tip of the arginine residue mediated electrostatic interactions with well-exposed carboxylic groups of glutamic residues on the surface of the paratope. Thus, the epitope/paratope interaction is mainly mediated by aromatic and by ionic interactions. Copyright © 2012 Elsevier Inc. All rights reserved.

  13. Transient receptor potential (TRP) channels as drug targets for diseases of the digestive system.

    PubMed

    Holzer, Peter

    2011-07-01

    Approximately 20 of the 30 mammalian transient receptor potential (TRP) channel subunits are expressed by specific neurons and cells within the alimentary canal. They subserve important roles in taste, chemesthesis, mechanosensation, pain and hyperalgesia and contribute to the regulation of gastrointestinal motility, absorptive and secretory processes, blood flow, and mucosal homeostasis. In a cellular perspective, TRP channels operate either as primary detectors of chemical and physical stimuli, as secondary transducers of ionotropic or metabotropic receptors, or as ion transport channels. The polymodal sensory function of TRPA1, TRPM5, TRPM8, TRPP2, TRPV1, TRPV3 and TRPV4 enables the digestive system to survey its physical and chemical environment, which is relevant to all processes of digestion. TRPV5 and TRPV6 as well as TRPM6 and TRPM7 contribute to the absorption of Ca²⁺ and Mg²⁺, respectively. TRPM7 participates in intestinal pacemaker activity, and TRPC4 transduces muscarinic acetylcholine receptor activation to smooth muscle contraction. Changes in TRP channel expression or function are associated with a variety of diseases/disorders of the digestive system, notably gastro-esophageal reflux disease, inflammatory bowel disease, pain and hyperalgesia in heartburn, functional dyspepsia and irritable bowel syndrome, cholera, hypomagnesemia with secondary hypocalcemia, infantile hypertrophic pyloric stenosis, esophageal, gastrointestinal and pancreatic cancer, and polycystic liver disease. These implications identify TRP channels as promising drug targets for the management of a number of gastrointestinal pathologies. As a result, major efforts are put into the development of selective TRP channel agonists and antagonists and the assessment of their therapeutic potential. Copyright © 2011 Elsevier Inc. All rights reserved.

  14. Two Paralogous Families of a Two-Gene Subtilisin Operon Are Widely Distributed in Oral Treponemes

    PubMed Central

    Correia, Frederick F.; Plummer, Alvin R.; Ellen, Richard P.; Wyss, Chris; Boches, Susan K.; Galvin, Jamie L.; Paster, Bruce J.; Dewhirst, Floyd E.

    2003-01-01

    Certain oral treponemes express a highly proteolytic phenotype and have been associated with periodontal diseases. The periodontal pathogen Treponema denticola produces dentilisin, a serine protease of the subtilisin family. The two-gene operon prcA-prtP is required for expression of active dentilisin (PrtP), a putative lipoprotein attached to the treponeme's outer membrane or sheath. The purpose of this study was to examine the diversity and structure of treponemal subtilisin-like proteases in order to better understand their distribution and function. The complete sequences of five prcA-prtP operons were determined for Treponema lecithinolyticum, “Treponema vincentii,” and two canine species. Partial operon sequences were obtained for T. socranskii subsp. 04 as well as 450- to 1,000-base fragments of prtP genes from four additional treponeme strains. Phylogenetic analysis demonstrated that the sequences fall into two paralogous families. The first family includes the sequence from T. denticola. Treponemes possessing this operon family express chymotrypsin-like protease activity and can cleave the substrate N-succinyl-alanyl-alanyl-prolyl-phenylalanine-p-nitroanilide (SAAPFNA). Treponemes possessing the second paralog family do not possess chymotrypsin-like activity or cleave SAAPFNA. Despite examination of a range of protein and peptide substrates, the specificity of the second protease family remains unknown. Each of the fully sequenced prcA and prtP genes contains a 5′ hydrophobic leader sequence with a treponeme lipobox. The two paralogous families of treponeme subtilisins represent a new subgroup within the subtilisin family of proteases and are the only subtilisin lipoprotein family. The present study demonstrated that the subtilisin paralogs comprising a two-gene operon are widely distributed among treponemes. PMID:14617650

  15. Cloning, sequencing, and characterization of the Bacillus subtilis biotin biosynthetic operon.

    PubMed

    Bower, S; Perkins, J B; Yocum, R R; Howitt, C L; Rahaim, P; Pero, J

    1996-07-01

    A 10-kb region of the Bacillus subtilis genome that contains genes involved in biotin-biosynthesis was cloned and sequenced. DNA sequence analysis indicated that B. subtilis contains homologs of the Escherichia coli and Bacillus sphaericus bioA, bioB, bioD, and bioF genes. These four genes and a homolog of the B. sphaericus bioW gene are arranged in a single operon in the order bioWAFDR and are followed by two additional genes, bioI and orf2. bioI and orf2 show no similarity to any other known biotin biosynthetic genes. The bioI gene encodes a protein with similarity to cytochrome P-450s and was able to complement mutations in either bioC or bioH of E. coli. Mutations in bioI caused B. subtilis to grow poorly in the absence of biotin. The bradytroph phenotype of bioI mutants was overcome by pimelic acid, suggesting that the product of bioI functions at a step prior to pimelic acid synthesis. The B. subtilis bio operon is preceded by a putative vegetative promoter sequence and contains just downstream a region of dyad symmetry with homology to the bio regulatory region of B. sphaericus. Analysis of a bioW-lacZ translational fusion indicated that expression of the biotin operon is regulated by biotin and the B. subtilis birA gene.

  16. Cloning, sequencing, and characterization of the Bacillus subtilis biotin biosynthetic operon.

    PubMed Central

    Bower, S; Perkins, J B; Yocum, R R; Howitt, C L; Rahaim, P; Pero, J

    1996-01-01

    A 10-kb region of the Bacillus subtilis genome that contains genes involved in biotin-biosynthesis was cloned and sequenced. DNA sequence analysis indicated that B. subtilis contains homologs of the Escherichia coli and Bacillus sphaericus bioA, bioB, bioD, and bioF genes. These four genes and a homolog of the B. sphaericus bioW gene are arranged in a single operon in the order bioWAFDR and are followed by two additional genes, bioI and orf2. bioI and orf2 show no similarity to any other known biotin biosynthetic genes. The bioI gene encodes a protein with similarity to cytochrome P-450s and was able to complement mutations in either bioC or bioH of E. coli. Mutations in bioI caused B. subtilis to grow poorly in the absence of biotin. The bradytroph phenotype of bioI mutants was overcome by pimelic acid, suggesting that the product of bioI functions at a step prior to pimelic acid synthesis. The B. subtilis bio operon is preceded by a putative vegetative promoter sequence and contains just downstream a region of dyad symmetry with homology to the bio regulatory region of B. sphaericus. Analysis of a bioW-lacZ translational fusion indicated that expression of the biotin operon is regulated by biotin and the B. subtilis birA gene. PMID:8763940

  17. Loss of Cdh1 and Trp53 in the uterus induces chronic inflammation with modification of tumor microenvironment.

    PubMed

    Stodden, G R; Lindberg, M E; King, M L; Paquet, M; MacLean, J A; Mann, J L; DeMayo, F J; Lydon, J P; Hayashi, K

    2015-05-07

    Type II endometrial carcinomas (ECs) are estrogen independent, poorly differentiated tumors that behave in an aggressive manner. As TP53 mutation and CDH1 inactivation occur in 80% of human endometrial type II carcinomas, we hypothesized that mouse uteri lacking both Trp53 and Cdh1 would exhibit a phenotype indicative of neoplastic transformation. Mice with conditional ablation of Cdh1 and Trp53 (Cdh1(d/d)Trp53(d/d)) clearly demonstrate architectural features characteristic of type II ECs, including focal areas of papillary differentiation, protruding cytoplasm into the lumen (hobnailing) and severe nuclear atypia at 6 months of age. Further, Cdh1(d/d)Trp53(d/d) tumors in 12-month-old mice were highly aggressive, and metastasized to nearby and distant organs within the peritoneal cavity, such as abdominal lymph nodes, mesentery and peri-intestinal adipose tissues, demonstrating that tumorigenesis in this model proceeds through the universally recognized morphological intermediates associated with type II endometrial neoplasia. We also observed abundant cell proliferation and complex angiogenesis in the uteri of Cdh1(d/d)Trp53(d/d) mice. Our microarray analysis found that most of the genes differentially regulated in the uteri of Cdh1(d/d)Trp53(d/d) mice were involved in inflammatory responses. CD163 and Arg1, markers for tumor-associated macrophages, were also detected and increased in the uteri of Cdh1(d/d)Trp53(d/d) mice, suggesting that an inflammatory tumor microenvironment with immune cell recruitment is augmenting tumor development in Cdh1(d/d)Trp53(d/d) uteri. Further, inflammatory mediators secreted from CDH1-negative, TP53 mutant endometrial cancer cells induced normal macrophages to express inflammatory-related genes through activation of nuclear factor-κB signaling. These results indicate that absence of CDH1 and TP53 in endometrial cells initiates chronic inflammation, promotes tumor microenvironment development following the recruitment of macrophages

  18. Loss of Cdh1 and Trp53 in the uterus induces chronic inflammation with modification of tumor microenvironment

    PubMed Central

    Stodden, Genna R.; Lindberg, Mallory E.; King, Mandy L.; Paquet, Marilène; MacLean, James A.; Mann, Jordan L.; DeMayo, Francesco J.; Lydon, John P.; Hayashi, Kanako

    2015-01-01

    Type II endometrial carcinomas are estrogen independent, poorly differentiated tumors that behave in an aggressive manner. Since TP53 mutation and CDH1 inactivation occur in 80% of human endometrial type II carcinomas, we hypothesized that mouse uteri lacking both Trp53 and Cdh1 would exhibit a phenotype indicative of neoplastic transformation. Mice with conditional ablation of Cdh1 and Trp53 (Cdh1d/dTrp53d/d) clearly demonstrate architectural features characteristic of type II endometrial carcinomas, including focal areas of papillary differentiation, protruding cytoplasm into the lumen (hobnailing) and severe nuclear atypia at 6-mo of age. Further, Cdh1d/dTrp53d/d tumors in 12-mo old mice were highly aggressive, and metastasized to nearby and distant organs within the peritoneal cavity, such as abdominal lymph nodes, mesentery and peri-intestinal adipose tissues, demonstrating that tumorigenesis in this model proceeds through the universally recognized morphologic intermediates associated with type II endometrial neoplasia. We also observed abundant cell proliferation and complex angiogenesis in the uteri of Cdh1d/dTrp53d/d mice. Our microarray analysis found that most of the genes differentially regulated in the uteri of Cdh1d/dTrp53d/d mice were involved in inflammatory responses. CD163 and Arg1, markers for tumor-associated macrophages, were also detected and increased in the uteri of Cdh1d/dTrp53d/d mice, suggesting that an inflammatory tumor microenvironment with immune cell recruitment is augmenting tumor development in Cdh1d/dTrp53d/d uteri. Further, inflammatory mediators secreted from CDH1 negative, TP53 mutant endometrial cancer cells induced normal macrophages to express inflammatory related genes through activation of NFκB signaling. These results indicate that absence of CDH1 and TP53 in endometrial cells initiates chronic inflammation, promotes tumor microenvironment development following the recruitment of macrophages, and promotes aggressive

  19. Gustatory Receptor Neurons in Manduca sexta Contain a TrpA1-Dependent Signaling Pathway that Integrates Taste and Temperature

    PubMed Central

    2013-01-01

    Temperature modulates the peripheral taste response of many animals, in part by activating transient receptor potential (Trp) cation channels. We hypothesized that temperature would also modulate peripheral taste responses in larval Manduca sexta. We recorded excitatory responses of the lateral and medial styloconic sensilla to chemical stimuli at 14, 22, and 30 °C. The excitatory responses to 5 chemical stimuli—a salt (KCl), 3 sugars (sucrose, glucose, and inositol) and an alkaloid (caffeine)—were unaffected by temperature. In contrast, the excitatory response to the aversive compound, aristolochic acid (AA), increased robustly with temperature. Next, we asked whether TrpA1 mediates the thermally dependent taste response to AA. To this end, we 1) identified a TrpA1 gene in M. sexta; 2) demonstrated expression of TrpA1 in the lateral and medial styloconic sensilla; 3) determined that 2 TrpA1 antagonists (HC-030031 and mecamylamine) inhibit the taste response to AA, but not caffeine; and then 4) established that the thermal dependence of the taste response to AA is blocked by HC-030031. Taken together, our results indicate that TrpA1 serves as a molecular integrator of taste and temperature in M. sexta. PMID:23828906

  20. Coordination of genomic structure and transcription by the main bacterial nucleoid-associated protein HU

    PubMed Central

    Berger, Michael; Farcas, Anca; Geertz, Marcel; Zhelyazkova, Petya; Brix, Klaudia; Travers, Andrew; Muskhelishvili, Georgi

    2010-01-01

    The histone-like protein HU is a highly abundant DNA architectural protein that is involved in compacting the DNA of the bacterial nucleoid and in regulating the main DNA transactions, including gene transcription. However, the coordination of the genomic structure and function by HU is poorly understood. Here, we address this question by comparing transcript patterns and spatial distributions of RNA polymerase in Escherichia coli wild-type and hupA/B mutant cells. We demonstrate that, in mutant cells, upregulated genes are preferentially clustered in a large chromosomal domain comprising the ribosomal RNA operons organized on both sides of OriC. Furthermore, we show that, in parallel to this transcription asymmetry, mutant cells are also impaired in forming the transcription foci—spatially confined aggregations of RNA polymerase molecules transcribing strong ribosomal RNA operons. Our data thus implicate HU in coordinating the global genomic structure and function by regulating the spatial distribution of RNA polymerase in the nucleoid. PMID:20010798

  1. Assessment of Mycobacterium bovis deleted in p27-p55 virulence operon as candidate vaccine against tuberculosis in animal models.

    PubMed

    Bianco, María V; Clark, Simon; Blanco, Federico C; Garbaccio, Sergio; García, Elizabeth; Cataldi, Angel A; Williams, Ann; Bigi, Fabiana

    2014-01-01

    A Mycobacterium bovis knockout in p27-p55 operon was tested as an antituberculosis experimental vaccine in animal models. The mutant MbΔp27-p55 was significantly more attenuated in nude mice than its parental strain but more virulent than BCG Pasteur. Challenge experiments in mice and guinea pigs using M. bovis or M. tuberculosis strains showed similar protection conferred by MbΔp27-p55 mutant than BCG in terms of pathology and bacterial loads in spleen but lower protection than BCG in lungs. When tested in cattle, MbΔp27-p55 did not induce IL-2 expression and induced a very low production of IFNγ, suggesting that the lack of P27/P55 reduces the capacity of M. bovis of triggering an adequate Th1 response.

  2. An Exquisitely Specific PDZ/Target Recognition Revealed by the Structure of INAD PDZ3 in Complex with TRP Channel Tail.

    PubMed

    Ye, Fei; Liu, Wei; Shang, Yuan; Zhang, Mingjie

    2016-03-01

    The vast majority of PDZ domains are known to bind to a few C-terminal tail residues of target proteins with modest binding affinities and specificities. Such promiscuous PDZ/target interactions are not compatible with highly specific physiological functions of PDZ domain proteins and their targets. Here, we report an unexpected PDZ/target binding occurring between the scaffold protein inactivation no afterpotential D (INAD) and transient receptor potential (TRP) channel in Drosophila photoreceptors. The C-terminal 15 residues of TRP are required for the specific interaction with INAD PDZ3. The INAD PDZ3/TRP peptide complex structure reveals that only the extreme C-terminal Leu of TRP binds to the canonical αB/βB groove of INAD PDZ3. The rest of the TRP peptide, by forming a β hairpin structure, binds to a surface away from the αB/βB groove of PDZ3 and contributes to the majority of the binding energy. Thus, the INAD PDZ3/TRP channel interaction is exquisitely specific and represents a new mode of PDZ/target recognitions. Copyright © 2016 Elsevier Ltd. All rights reserved.

  3. The influence of TRP53 in the dose response of radiation-induced apoptosis, DNA repair and genomic stability in murine haematopoietic cells

    DOE PAGES

    Lemon, Jennifer A.; Taylor, Kristina; Verdecchia, Kyle; ...

    2014-01-01

    Apoptotic and DNA damage endpoints are frequently used as surrogate markers of cancer risk, and have been well-studied in the Trp53+/- mouse model. We report the effect of differing Trp53 gene status on the dose response of ionizing radiation exposures (0.01-2 Gy), with the unique perspective of determining if effects of gene status remain at extended time points. Here we report no difference in the dose response for radiation-induced DNA double-strand breaks in bone marrow and genomic instability (MN-RET levels) in peripheral blood, between wild-type ( Trp53+/+) and heterozygous ( Trp53+/-) mice. The dose response for Trp53+/+ mice showed highermore » initial levels of radiation-induced lymphocyte apoptosis relative to Trp53+/- between 0 and 1 Gy. Although this trend was observed up to 12 hours post-irradiation, both genotypes ultimately reached the same level of apoptosis at 14 hours, suggesting the importance of late-onset p53-independent apoptotic responses in this mouse model. Expected radiation-induced G1 cell cycle delay was observed in Trp53+/+ but not Trp53+/-. Although p53 has an important role in cancer risk, we have shown its influence on radiation dose response can be temporally variable. This research highlights the importance of caution when using haematopoietic endpoints as surrogates to extrapolate radiation-induced cancer risk estimation.« less

  4. The macrocyclic tetrapeptide [D-Trp]CJ-15,208 produces short-acting κ opioid receptor antagonism in the CNS after oral administration

    PubMed Central

    Eans, Shainnel O; Ganno, Michelle L; Reilley, Kate J; Patkar, Kshitij A; Senadheera, Sanjeewa N; Aldrich, Jane V; McLaughlin, Jay P

    2013-01-01

    Background and Purpose Cyclic peptides are resistant to proteolytic cleavage, therefore potentially exhibiting activity after systemic administration. We hypothesized that the macrocyclic κ opioid receptor (KOR)-selective antagonist [D-Trp]CJ-15,208 would demonstrate antagonist activity after systemic, that is, s.c. and oral (per os, p. o.), administration. Experimental Approach C57BL/6J mice were pretreated with [D-Trp]CJ-15,208 s.c. or p.o. before administration of the KOR-selective agonist U50,488 and the determination of antinociception in the warm-water tail-withdrawal assay. The locomotor activity of mice treated with [D-Trp]CJ-15,208 was determined by rotorod testing. Additional mice demonstrating cocaine conditioned place preference and subsequent extinction were pretreated daily with vehicle or [D-Trp]CJ-15,208 and then exposed to repeated forced swim stress or a single additional session of cocaine place conditioning before redetermining place preference. Key Results Pretreatment with [D-Trp]CJ-15,208 administered s.c. or p.o. dose-dependently antagonized the antinociception induced by i.p. administration of U50,488 in mice tested in the warm-water tail-withdrawal assay for less than 12 and 6 h respectively. [D-Trp]CJ-15,208 also produced limited (<25%), short-duration antinociception mediated through KOR agonism. Orally administered [D-Trp]CJ-15,208 dose-dependently antagonized centrally administered U50,488-induced antinociception, and prevented stress-, but not cocaine-induced, reinstatement of extinguished cocaine-seeking behaviour, consistent with its KOR antagonist activity, without affecting locomotor activity. Conclusions and Implications The macrocyclic tetrapeptide [D-Trp]CJ-15,208 is a short-duration KOR antagonist with weak KOR agonist activity that is active after oral administration and demonstrates blood–brain barrier permeability. These data validate the use of systemically active peptides such as [D-Trp]CJ-15,208 as potentially useful

  5. Differential desulfurization of dibenzothiophene by newly identified MTCC strains: Influence of Operon Array

    PubMed Central

    Bhanjadeo, Madhabi M.; Rath, Kalyani; Gupta, Dhirendra; Pradhan, Nilotpala; Biswal, Surendra K.; Mishra, Barada K.

    2018-01-01

    Since the sulfur specific cleavage is vital for the organic sulfur removal from fossil fuel, we explored potential bacterial strains of MTCC (Microbial Type Culture Collection) to desulfurize the Dibenzothiophene (DBT) through C-S bond cleavage (4-S pathway). MTCC strains Rhodococcus rhodochrous (3552), Arthrobacter sulfureus (3332), Gordonia rubropertincta (289), and Rhodococcus erythropolis (3951) capable of growing in 0.5 mM DBT were examined for their desulfurization ability. The presence of dsz genes as well as the metabolites was screened by polymerase chain reaction (PCR) and HPLC, respectively. All these strains showed > 99% DBT desulfurization with 10 days of incubation in minimal salt medium. From the HPLC analysis it was further revealed that these MTCC strains show differences in the end metabolites and desulfurize DBT differently following a variation in the regular 4-S pathway. These findings are also well corroborating with their respective organization of dszABC operons and their relative abundance. The above MTCC strains are capable of desulfurizing DBT efficiently and hence can be explored for biodesulfurization of petrochemicals and coal with an eco-friendly and energy economical process. PMID:29518089

  6. Arg753gln and Arg677 Trp Polymorphisms of Toll-Like Receptor 2 In Acute Apical Abscess.

    PubMed

    Miri-Moghaddam, Ebrahim; Farhad Mollashahi, Narges; Naghibi, Nava; Garme, Yasaman; Bazi, Ali

    2018-06-01

    Genetic polymorphisms can alter immunity response against pathogens, which in turn influence individuals' susceptibility to certain infections. Our aim was to determine the association of Arg753Gln (rs5743708) and Arg677Trp (rs12191786) polymorphisms of toll like receptor-2 gene with the two clinical forms of apical periodontitis: acute apical abscess (AAA) and asymptomatic apical periodontitis (AAP). There were 50 patients with AAA as case group and 50 with AAP as control group. Genotyping was done using Tetra-ARMS (amplification refractory mutation system) PCR. Heterozygous genotype of Arg677Trp polymorphism was associated with risk of AAA (OR=1.9, 95% CI: 0.7-5.5, p = 0.05). Although statistically insignificant, Arg677Trp polymorphism promoted the risk of AAA in dominant model (OR=2.1, 95% CI: 0.7-5.9, p > 0.05). The frequency of mutant allele (T) of Arg677Trp polymorphism was higher in AAA (14%) than AAP (7%) subjects (OR=1.7, 95% CI: 0.6-4.7). For Arg753Gln polymorphism, wild homozygous (GG) represented the dominant genotype in both cases (96%) and controls (100%). Variant allele (A) of Arg753Gln polymorphism was identified in 2% of AAA, while no individual represented with this allele in AAP subjects. Individuals with Arg753Gln; Arg677Trp (GG; TC) combination showed an elevated risk of AAA (OR=1.6, 95% CI: 0.5- 4.2, p > 0.05). Arg677Trp polymorphism of TLR-2 rendered a higher risk for the development of abscesses in apical periodontitis. It is recommended to explore role of this polymorphism in other populations.

  7. Defense Islands in Bacterial and Archaeal Genomes and Prediction of Novel Defense Systems ▿†‡

    PubMed Central

    Makarova, Kira S.; Wolf, Yuri I.; Snir, Sagi; Koonin, Eugene V.

    2011-01-01

    The arms race between cellular life forms and viruses is a major driving force of evolution. A substantial fraction of bacterial and archaeal genomes is dedicated to antivirus defense. We analyzed the distribution of defense genes and typical mobilome components (such as viral and transposon genes) in bacterial and archaeal genomes and demonstrated statistically significant clustering of antivirus defense systems and mobile genes and elements in genomic islands. The defense islands are enriched in putative operons and contain numerous overrepresented gene families. A detailed sequence analysis of the proteins encoded by genes in these families shows that many of them are diverged variants of known defense system components, whereas others show features, such as characteristic operonic organization, that are suggestive of novel defense systems. Thus, genomic islands provide abundant material for the experimental study of bacterial and archaeal antivirus defense. Except for the CRISPR-Cas systems, different classes of defense systems, in particular toxin-antitoxin and restriction-modification systems, show nonrandom clustering in defense islands. It remains unclear to what extent these associations reflect functional cooperation between different defense systems and to what extent the islands are genomic “sinks” that accumulate diverse nonessential genes, particularly those acquired via horizontal gene transfer. The characteristics of defense islands resemble those of mobilome islands. Defense and mobilome genes are nonrandomly associated in islands, suggesting nonadaptive evolution of the islands via a preferential attachment-like mechanism underpinned by the addictive properties of defense systems such as toxins-antitoxins and an important role of horizontal mobility in the evolution of these islands. PMID:21908672

  8. Characterization of the regulation of a plant polysaccharide utilization operon and its role in biofilm formation in Bacillus subtilis

    PubMed Central

    Habib, Cameron; Yu, Yiyang; Gozzi, Kevin; Ching, Carly; Shemesh, Moshe

    2017-01-01

    The soil bacterium Bacillus subtilis is often found in association with plants in the rhizosphere. Previously, plant polysaccharides have been shown to stimulate formation of root-associated multicellular communities, or biofilms, in this bacterium, yet the underlying mechanism is not fully understood. A five-gene gan operon (ganSPQAB) in B. subtilis has recently been shown to be involved in utilization of the plant-derived polysaccharide galactan. Despite these findings, molecular details about the regulation of the operon and the role of the operon in biofilm formation remain elusive. In this study, we performed comprehensive genetic analyses on the regulation of the gan operon. We show that this operon is regulated both by a LacI-like transcription repressor (GanR), which directly binds to pairs of inverted DNA repeats in the promoter region of the operon, and by the catabolite control protein A (CcpA). Derepression can be triggered by the presence of the inducer β-1,4-galactobiose, a hydrolysis product of galactan, or in situ when B. subtilis cells are associated with plant roots. In addition to the transcriptional regulation, the encoded ß-galactosidase GanA (by ganA), which hydrolyzes ß-1,4-galactobiose into galactose, is inhibited at the enzymatic level by the catalytic product galactose. Thus, the galactan utilization pathway is under complex regulation involving both positive and negative feedback mechanisms in B. subtilis. We discuss about the biological significance of such complex regulation as well as a hypothesis of biofilm induction by galactan via multiple mechanisms. PMID:28617843

  9. Protecting western redcedar from deer browsing—with a passing reference to TRP channels

    PubMed Central

    Romanovsky, Andrej A

    2015-01-01

    This editorial is about tree farming. It proposes to test in an experiment whether co-planting (in the same hole) western redcedar (WRC, Thuja plicata) with Sitka spruce (Picea sitchensis) protects WRC seedlings from wildlife browsing. This sustainable protection method is an alternative to the traditional use of mechanical devices and big-game repellents. Many repellents contain transient receptor potential (TRP) agonists, such as capsaicin, a TRP vanilloid-1 agonist. This editorial also delivers a puzzle: while herbivores avoid capsaicin, why do people living in hot climates consume large quantities of it (in chili peppers)? PMID:27227013

  10. Organization and post-transcriptional processing of the psb B operon from chloroplasts of Populus deltoides.

    PubMed

    Dixit, R; Trivedi, P K; Nath, P; Sane, P V

    1999-09-01

    Chloroplast genes are typically organized into polycistronic transcription units that give rise to complex sets of mono- and oligo-cistronic overlapping RNAs through a series of processing steps. The psbB operon contains genes for the PSII (psbB, psbT, psbH) and cytochrome b(6)f (petB and petD) complexes which are needed in different amounts during chloroplast biogenesis. The functional significance of gene organization in this polycistronic unit, containing information for two different complexes, is not known and is of interest. To determine the organization and expression of these complexes, studies have been carried out on crop plants by different groups, but not much information is known about trees. We present the nucleotide sequences of PSII genes and RNA profiles of the genes located in the psbB operon from Populus deltoides, a tree species. Although the gene organization of this operon in P. deltoides is similar to that in other species, a few variations have been observed in the processing scheme.

  11. Genetic map of the Bacillus stearothermophilus NUB36 chromosome

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vallier, H.; Welker, N.E.

    1990-02-01

    A circular genetic map of Bacillus stearothermophilus NUB36 was constructed by transduction with bacteriophage TP-42C and protoplast fusion. Sixty-four genes were tentatively assigned a cognate Bacillus subtilis gene based on growth response to intermediates or end products of metabolism, cross-feeding, accumulation of intermediates, or their relative order in a linkage group. Although the relative position of many genes on the Bacillus subtilis genetic map appears to be similar, some differences were detected. The tentative order of the genes in the Bacillus stearothermophilus aro region is aspB-aroBAFEC-tyra-hisH-(trp), whereas it is aspB-aroE-tyrA-hisH-(trp)-aroHBF in Bacillus subtilis. The aroA, aroC, and aroG genes inmore » Bacillus subtilis are located in another region. The tentative order of genes in the trp operon of Bacillus stearothermophilus is trpFCDABE, whereas it is trpABFCDE in Bacillus subtilis.« less

  12. Opioid, cannabinoid, and transient receptor potential (TRP) systems: effects on body temperature

    PubMed Central

    Rawls, Scott M.; Benamar, Khalid

    2014-01-01

    Cannabinoid and opioid drugs produce marked changes in body temperature. Recent findings have extended our knowledge about the thermoregulatory effects of cannabinoids and opioids, particularly as related to delta opioid receptors, endogenous systems, and transient receptor potential (TRP) channels. Although delta opioid receptors were originally thought to play only a minor role in thermoregulation compared to mu and kappa opioid receptors, their activation has been shown to produce hypothermia in multiple species. Endogenous opioids and cannabinoids also regulate body temperature. Mu and kappa opioid receptors are thought to be in tonic balance, with mu and kappa receptor activation producing hyperthermia and hypothermia, respectively. Endocannabinoids participate in the febrile response, but more studies are needed to determine if a cannabinoid CB1 receptor tone exerts control over basal body temperature. A particularly intense research focus is TRP channels, where TRPV1 channel activation produces hypothermia whereas TRPA1 and TRPM8 channel activation causes hyperthermia. The marked hyperthermia produced by TRPV1 channel antagonists suggests these warm channels tonically control body temperature. A better understanding of the roles of cannabinoid, opioid, and TRP systems in thermoregulation may have broad clinical implications and provide insights into interactions among neurotransmitter systems involved in thermoregulation. PMID:21622235

  13. Arg753gln and Arg677 Trp Polymorphisms of Toll-Like Receptor 2 In Acute Apical Abscess

    PubMed Central

    Miri-Moghaddam, Ebrahim; Farhad Mollashahi, Narges; Naghibi, Nava; Garme, Yasaman; Bazi, Ali

    2018-01-01

    Statement of the Problem: Genetic polymorphisms can alter immunity response against pathogens, which in turn influence individuals’ susceptibility to certain infections. Purpose: Our aim was to determine the association of Arg753Gln (rs5743708) and Arg677Trp (rs12191786) polymorphisms of toll like receptor-2 gene with the two clinical forms of apical periodontitis: acute apical abscess (AAA) and asymptomatic apical periodontitis (AAP). Materials and Method: There were 50 patients with AAA as case group and 50 with AAP as control group. Genotyping was done using Tetra-ARMS (amplification refractory mutation system) PCR. Results: Heterozygous genotype of Arg677Trp polymorphism was associated with risk of AAA (OR=1.9, 95% CI: 0.7-5.5, p= 0.05). Although statistically insignificant, Arg677Trp polymorphism promoted the risk of AAA in dominant model (OR=2.1, 95% CI: 0.7-5.9, p> 0.05). The frequency of mutant allele (T) of Arg677Trp polymorphism was higher in AAA (14%) than AAP (7%) subjects (OR=1.7, 95% CI: 0.6-4.7). For Arg753Gln polymorphism, wild homozygous (GG) represented the dominant genotype in both cases (96%) and controls (100%). Variant allele (A) of Arg753Gln polymorphism was identified in 2% of AAA, while no individual represented with this allele in AAP subjects. Individuals with Arg753Gln; Arg677Trp (GG; TC) combination showed an elevated risk of AAA (OR=1.6, 95% CI: 0.5- 4.2, p> 0.05). Conclusion: Arg677Trp polymorphism of TLR-2 rendered a higher risk for the development of abscesses in apical periodontitis. It is recommended to explore role of this polymorphism in other populations. PMID:29854884

  14. Prediction of operon-like gene clusters in the Arabidopsis thaliana genome based on co-expression analysis of neighboring genes.

    PubMed

    Wada, Masayoshi; Takahashi, Hiroki; Altaf-Ul-Amin, Md; Nakamura, Kensuke; Hirai, Masami Y; Ohta, Daisaku; Kanaya, Shigehiko

    2012-07-15

    Operon-like arrangements of genes occur in eukaryotes ranging from yeasts and filamentous fungi to nematodes, plants, and mammals. In plants, several examples of operon-like gene clusters involved in metabolic pathways have recently been characterized, e.g. the cyclic hydroxamic acid pathways in maize, the avenacin biosynthesis gene clusters in oat, the thalianol pathway in Arabidopsis thaliana, and the diterpenoid momilactone cluster in rice. Such operon-like gene clusters are defined by their co-regulation or neighboring positions within immediate vicinity of chromosomal regions. A comprehensive analysis of the expression of neighboring genes therefore accounts a crucial step to reveal the complete set of operon-like gene clusters within a genome. Genome-wide prediction of operon-like gene clusters should contribute to functional annotation efforts and provide novel insight into evolutionary aspects acquiring certain biological functions as well. We predicted co-expressed gene clusters by comparing the Pearson correlation coefficient of neighboring genes and randomly selected gene pairs, based on a statistical method that takes false discovery rate (FDR) into consideration for 1469 microarray gene expression datasets of A. thaliana. We estimated that A. thaliana contains 100 operon-like gene clusters in total. We predicted 34 statistically significant gene clusters consisting of 3 to 22 genes each, based on a stringent FDR threshold of 0.1. Functional relationships among genes in individual clusters were estimated by sequence similarity and functional annotation of genes. Duplicated gene pairs (determined based on BLAST with a cutoff of E<10(-5)) are included in 27 clusters. Five clusters are associated with metabolism, containing P450 genes restricted to the Brassica family and predicted to be involved in secondary metabolism. Operon-like clusters tend to include genes encoding bio-machinery associated with ribosomes, the ubiquitin/proteasome system, secondary

  15. High levels of bioplastic are produced in fertile transplastomic tobacco plants engineered with a synthetic operon for the production of polyhydroxybutyrate.

    PubMed

    Bohmert-Tatarev, Karen; McAvoy, Susan; Daughtry, Sean; Peoples, Oliver P; Snell, Kristi D

    2011-04-01

    An optimized genetic construct for plastid transformation of tobacco (Nicotiana tabacum) for the production of the renewable, biodegradable plastic polyhydroxybutyrate (PHB) was designed using an operon extension strategy. Bacterial genes encoding the PHB pathway enzymes were selected for use in this construct based on their similarity to the codon usage and GC content of the tobacco plastome. Regulatory elements with limited homology to the host plastome yet known to yield high levels of plastidial recombinant protein production were used to enhance the expression of the transgenes. A partial transcriptional unit, containing genes of the PHB pathway and a selectable marker gene encoding spectinomycin resistance, was flanked at the 5' end by the host plant's psbA coding sequence and at the 3' end by the host plant's 3' psbA untranslated region. This design allowed insertion of the transgenes into the plastome as an extension of the psbA operon, rendering the addition of a promoter to drive the expression of the transgenes unnecessary. Transformation of the optimized construct into tobacco and subsequent spectinomycin selection of transgenic plants yielded T0 plants that were capable of producing up to 18.8% dry weight PHB in samples of leaf tissue. These plants were fertile and produced viable seed. T1 plants producing up to 17.3% dry weight PHB in samples of leaf tissue and 8.8% dry weight PHB in the total biomass of the plant were also isolated.

  16. Novel opioid cyclic tetrapeptides: Trp isomers of CJ-15,208 exhibit distinct opioid receptor agonism and short-acting κ opioid receptor antagonism.

    PubMed

    Ross, Nicolette C; Reilley, Kate J; Murray, Thomas F; Aldrich, Jane V; McLaughlin, Jay P

    2012-02-01

    The κ opioid receptor antagonists demonstrate potential for maintaining abstinence from psychostimulant abuse, but existing non-peptide κ-receptor selective antagonists show exceptionally long activity. We hypothesized that the L- and D-Trp isomers of CJ-15,208, a natural cyclic tetrapeptide reported to be a κ-receptor antagonist in vitro, would demonstrate short-acting, dose-dependent antagonism in vivo, preventing reinstatement of cocaine-seeking behaviour. Affinity, selectivity and efficacy of the L-Trp and D-Trp isomers for opioid receptors were assessed in vitro in radioligand and GTPγS binding assays. Opioid receptor agonist and antagonist activities were characterized in vivo following i.c.v. administration with the 55°C warm water tail-withdrawal assay. The D-Trp isomer, which demonstrated primarily κ-receptor selective antagonist activity, was further evaluated for its prevention of stress- and drug-induced reinstatement of extinguished cocaine conditioned place preference (CPP). The two isomers showed similar affinity and selectivity for κ receptors (K(i)  30-35 nM) as well as κ receptor antagonism in vitro. As expected, the D-Trp cyclic tetrapeptide exhibited minimal agonist activity and induced dose-dependent κ-receptor selective antagonism lasting less than 18 h in vivo. Pretreatment with this peptide prevented stress-, but not cocaine-induced, reinstatement of extinguished cocaine CPP. In contrast, the L-Trp cyclic tetrapeptide unexpectedly demonstrated mixed opioid agonist/antagonist activity. The L-Trp and the D-Trp isomers of CJ-15,208 demonstrate stereospecific opioid activity in vivo. The relatively brief κ opioid receptor antagonism, coupled with the prevention of stress-induced reinstatement of extinguished cocaine-seeking behaviour, suggests the D-Trp isomer could be used therapeutically to maintain abstinence from psychostimulant abuse. © 2011 The Authors. British Journal of Pharmacology © 2011 The British Pharmacological

  17. Directed evolution of a synthetic phylogeny of programmable Trp repressors.

    PubMed

    Ellefson, Jared W; Ledbetter, Michael P; Ellington, Andrew D

    2018-04-01

    As synthetic regulatory programs expand in sophistication, an ever increasing number of biological components with predictable phenotypes is required. Regulators are often 'part mined' from a diverse, but uncharacterized, array of genomic sequences, often leading to idiosyncratic behavior. Here, we generate an entire synthetic phylogeny from the canonical allosteric transcription factor TrpR. Iterative rounds of positive and negative compartmentalized partnered replication (CPR) led to the exponential amplification of variants that responded with high affinity and specificity to halogenated tryptophan analogs and novel operator sites. Fourteen repressor variants were evolved with unique regulatory profiles across five operators and three ligands. The logic of individual repressors can be modularly programmed by creating heterodimeric fusions, resulting in single proteins that display logic functions, such as 'NAND'. Despite the evolutionarily limited regulatory role of TrpR, vast functional spaces exist around this highly conserved protein scaffold and can be harnessed to create synthetic regulatory programs.

  18. Evolutionarily Conserved, Multitasking TRP Channels: Lessons from Worms and Flies

    PubMed Central

    Venkatachalam, Kartik; Luo, Junjie; Montell, Craig

    2015-01-01

    The Transient Receptor Potential (TRP) channel family is comprised of a large group of cation-permeable channels, which display an extraordinary diversity of roles in sensory signaling. TRPs allow animals to detect chemicals, mechanical force, light, and changes in temperature. Consequently, these channels control a plethora of animal behaviors. Moreover, their functions are not limited to the classical senses, as they are cellular sensors, which are critical for ionic homeostasis and metabolism. Two genetically tractable invertebrate model organisms, Caenorhabditis elegans and Drosophila melanogaster, have led the way in revealing a wide array of sensory roles and behaviors that depend on TRP channels. Two overriding themes have emerged from these studies. First, TRPs are multitasking proteins, and second, many functions and modes of activation of these channels are evolutionarily conserved, including some that were formerly thought to be unique to invertebrates, such as phototransduction. Thus, worms and flies offer the potential to decipher roles for mammalian TRPs, which would otherwise not be suspected. PMID:24961975

  19. The macrocyclic tetrapeptide [D-Trp]CJ-15,208 produces short-acting κ opioid receptor antagonism in the CNS after oral administration.

    PubMed

    Eans, Shainnel O; Ganno, Michelle L; Reilley, Kate J; Patkar, Kshitij A; Senadheera, Sanjeewa N; Aldrich, Jane V; McLaughlin, Jay P

    2013-05-01

    Cyclic peptides are resistant to proteolytic cleavage, therefore potentially exhibiting activity after systemic administration. We hypothesized that the macrocyclic κ opioid receptor (KOR)-selective antagonist [D-Trp]CJ-15,208 would demonstrate antagonist activity after systemic, that is, s.c. and oral (per os, p. o.), administration. C57BL/6J mice were pretreated with [D-Trp]CJ-15,208 s.c. or p.o. before administration of the KOR-selective agonist U50,488 and the determination of antinociception in the warm-water tail-withdrawal assay. The locomotor activity of mice treated with [D-Trp]CJ-15,208 was determined by rotorod testing. Additional mice demonstrating cocaine conditioned place preference and subsequent extinction were pretreated daily with vehicle or [D-Trp]CJ-15,208 and then exposed to repeated forced swim stress or a single additional session of cocaine place conditioning before redetermining place preference. Pretreatment with [D-Trp]CJ-15,208 administered s.c. or p.o. dose-dependently antagonized the antinociception induced by i.p. administration of U50,488 in mice tested in the warm-water tail-withdrawal assay for less than 12 and 6 h respectively. [D-Trp]CJ-15,208 also produced limited (<25%), short-duration antinociception mediated through KOR agonism. Orally administered [D-Trp]CJ-15,208 dose-dependently antagonized centrally administered U50,488-induced antinociception, and prevented stress-, but not cocaine-induced, reinstatement of extinguished cocaine-seeking behaviour, consistent with its KOR antagonist activity, without affecting locomotor activity. The macrocyclic tetrapeptide [D-Trp]CJ-15,208 is a short-duration KOR antagonist with weak KOR agonist activity that is active after oral administration and demonstrates blood-brain barrier permeability. These data validate the use of systemically active peptides such as [D-Trp]CJ-15,208 as potentially useful therapeutics. © 2013 The Authors. British Journal of Pharmacology © 2013 The

  20. The “Gate Keeper” Role of Trp222 Determines the Enantiopreference of Diketoreductase toward 2-Chloro-1-Phenylethanone

    PubMed Central

    Lu, Zhuo; Liu, Nan; Chen, Yijun

    2014-01-01

    Trp222 of diketoreductase (DKR), an enzyme responsible for reducing a variety of ketones to chiral alcohols, is located at the hydrophobic dimeric interface of the C-terminus. Single substitutions at DKR Trp222 with either canonical (Val, Leu, Met, Phe and Tyr) or unnatural amino acids (UAAs) (4-cyano-L-phenylalanine, 4-methoxy-L-phenylalanine, 4-phenyl-L-phenyalanine, O-tert-butyl-L-tyrosine) inverts the enantiotope preference of the enzyme toward 2-chloro-1-phenylethanone with close side chain correlation. Analyses of enzyme activity, substrate affinity and ternary structure of the mutants revealed that substitution at Trp222 causes a notable change in the overall enzyme structure, and specifically in the entrance tunnel to the active center. The size of residue 222 in DKR is vital to its enantiotope preference. Trp222 serves as a “gate keeper” to control the direction of substrate entry into the active center. Consequently, opposite substrate-binding orientations produce respective alcohol enantiomers. PMID:25072248

  1. Transcription of the extended hyp-operon in Nostoc sp. strain PCC 7120

    PubMed Central

    Agervald, Åsa; Stensjö, Karin; Holmqvist, Marie; Lindblad, Peter

    2008-01-01

    Background The maturation of hydrogenases into active enzymes is a complex process and e.g. a correctly assembled active site requires the involvement of at least seven proteins, encoded by hypABCDEF and a hydrogenase specific protease, encoded either by hupW or hoxW. The N2-fixing cyanobacterium Nostoc sp. strain PCC 7120 may contain both an uptake and a bidirectional hydrogenase. The present study addresses the presence and expression of hyp-genes in Nostoc sp. strain PCC 7120. Results RT-PCRs demonstrated that the six hyp-genes together with one ORF may be transcribed as a single operon. Transcriptional start points (TSPs) were identified 280 bp upstream from hypF and 445 bp upstream of hypC, respectively, demonstrating the existence of several transcripts. In addition, five upstream ORFs located in between hupSL, encoding the small and large subunits of the uptake hydrogenase, and the hyp-operon, and two downstream ORFs from the hyp-genes were shown to be part of the same transcript unit. A third TSP was identified 45 bp upstream of asr0689, the first of five ORFs in this operon. The ORFs are annotated as encoding unknown proteins, with the exception of alr0692 which is identified as a NifU-like protein. Orthologues of the four ORFs asr0689-alr0692, with a highly conserved genomic arrangement positioned between hupSL, and the hyp genes are found in several other N2-fixing cyanobacteria, but are absent in non N2-fixing cyanobacteria with only the bidirectional hydrogenase. Short conserved sequences were found in six intergenic regions of the extended hyp-operon, appearing between 11 and 79 times in the genome. Conclusion This study demonstrated that five ORFs upstream of the hyp-gene cluster are co-transcribed with the hyp-genes, and identified three TSPs in the extended hyp-gene cluster in Nostoc sp. strain PCC 7120. This may indicate a function related to the assembly of a functional uptake hydrogenase, hypothetically in the assembly of the small subunit of

  2. Transcription attenuation is the major mechanism by which the leu operon of Salmonella typhimurium is controlled.

    PubMed

    Searles, L L; Wessler, S R; Calvo, J M

    1983-01-25

    Three mutations, each causing constitutive expression of the Salmonella typhimurium leu operon, were cloned into phage vector lambda gt4 on EcoRI DNA fragments carrying all of that operon except for part of the promoter-distal last gene. Sequence analysis of DNA from these phage demonstrated that each contains a single base change in the leu attenuator. Transcription of mutant DNA in vitro resulted in transcription beyond the usual site of termination. The level of beta-IPM dehydrogenase, the leuB enzyme, was elevated 40-fold in a strain carrying one of these mutations, and starvation of this strain for leucine had little effect on the amount of activity expressed. Using a strain with a wild-type promoter-leader region of the leu operon, the rates of synthesis and degradation of leu leader RNA and readthrough RNA (leu mRNA) were measured by DNA-RNA hybridizations with specific DNA probes. The rate of synthesis of the leu leader was about the same in cells grown with excess or with limiting leucine. On the other hand, the rate of synthesis of leu mRNA was 12-fold higher for cells grown in limiting leucine as opposed to excess leucine. The rate of degradation of these RNA species was the same under both conditions of growth. Thus, the variation in expression of the leu operon observed for cells grown in minimal medium is, for the most part, not caused by control over the frequency of initiation or by the differential stability of these RNA species. Rather, the variation is a direct result of the frequency of transcription termination at an attenuator site. These results taken together suggest that transcription attenuation is the major mechanism by which leucine regulates expression of the leu operon of S. typhimurium for cells growing in a minimal medium.

  3. An empirical strategy to detect bacterial transcript structure from directional RNA-seq transcriptome data.

    PubMed

    Wang, Yejun; MacKenzie, Keith D; White, Aaron P

    2015-05-07

    As sequencing costs are being lowered continuously, RNA-seq has gradually been adopted as the first choice for comparative transcriptome studies with bacteria. Unlike microarrays, RNA-seq can directly detect cDNA derived from mRNA transcripts at a single nucleotide resolution. Not only does this allow researchers to determine the absolute expression level of genes, but it also conveys information about transcript structure. Few automatic software tools have yet been established to investigate large-scale RNA-seq data for bacterial transcript structure analysis. In this study, 54 directional RNA-seq libraries from Salmonella serovar Typhimurium (S. Typhimurium) 14028s were examined for potential relationships between read mapping patterns and transcript structure. We developed an empirical method, combined with statistical tests, to automatically detect key transcript features, including transcriptional start sites (TSSs), transcriptional termination sites (TTSs) and operon organization. Using our method, we obtained 2,764 TSSs and 1,467 TTSs for 1331 and 844 different genes, respectively. Identification of TSSs facilitated further discrimination of 215 putative sigma 38 regulons and 863 potential sigma 70 regulons. Combining the TSSs and TTSs with intergenic distance and co-expression information, we comprehensively annotated the operon organization in S. Typhimurium 14028s. Our results show that directional RNA-seq can be used to detect transcriptional borders at an acceptable resolution of ±10-20 nucleotides. Technical limitations of the RNA-seq procedure may prevent single nucleotide resolution. The automatic transcript border detection methods, statistical models and operon organization pipeline that we have described could be widely applied to RNA-seq studies in other bacteria. Furthermore, the TSSs, TTSs, operons, promoters and unstranslated regions that we have defined for S. Typhimurium 14028s may constitute valuable resources that can be used for

  4. High-Temperature unfolding of a trp-Cage mini-protein: a molecular dynamics simulation study

    PubMed Central

    Seshasayee, Aswin Sai Narain

    2005-01-01

    Background Trp cage is a recently-constructed fast-folding miniprotein. It consists of a short helix, a 3,10 helix and a C-terminal poly-proline that packs against a Trp in the alpha helix. It is known to fold within 4 ns. Results High-temperature unfolding molecular dynamics simulations of the Trp cage miniprotein have been carried out in explicit water using the OPLS-AA force-field incorporated in the program GROMACS. The radius of gyration (Rg) and Root Mean Square Deviation (RMSD) have been used as order parameters to follow the unfolding process. Distributions of Rg were used to identify ensembles. Conclusion Three ensembles could be identified. While the native-state ensemble shows an Rg distribution that is slightly skewed, the second ensemble, which is presumably the Transition State Ensemble (TSE), shows an excellent fit. The denatured ensemble shows large fluctuations, but a Gaussian curve could be fitted. This means that the unfolding process is two-state. Representative structures from each of these ensembles are presented here. PMID:15760474

  5. Alternative SAIL-Trp for robust aromatic signal assignment and determination of the χ(2) conformation by intra-residue NOEs.

    PubMed

    Miyanoiri, Yohei; Takeda, Mitsuhiro; Jee, JunGoo; Ono, Akira M; Okuma, Kosuke; Terauchi, Tsutomu; Kainosho, Masatsune

    2011-12-01

    Tryptophan (Trp) residues are frequently found in the hydrophobic cores of proteins, and therefore, their side-chain conformations, especially the precise locations of the bulky indole rings, are critical for determining structures by NMR. However, when analyzing [U-(13)C,(15)N]-proteins, the observation and assignment of the ring signals are often hampered by excessive overlaps and tight spin couplings. These difficulties have been greatly alleviated by using stereo-array isotope labeled (SAIL) proteins, which are composed of isotope-labeled amino acids optimized for unambiguous side-chain NMR assignment, exclusively through the (13)C-(13)C and (13)C-(1)H spin coupling networks (Kainosho et al. in Nature 440:52-57, 2006). In this paper, we propose an alternative type of SAIL-Trp with the [ζ2,ζ3-(2)H(2); δ1,ε3,η2-(13)C(3); ε1-(15)N]-indole ring ([(12)C (γ,) ( 12) C(ε2)] SAIL-Trp), which provides a more robust way to correlate the (1)H(β), (1)H(α), and (1)H(N) to the (1)H(δ1) and (1)H(ε3) through the intra-residue NOEs. The assignment of the (1)H(δ1)/(13)C(δ1) and (1)H(ε3)/(13)C(ε3) signals can thus be transferred to the (1)H(ε1)/(15)N(ε1) and (1)H(η2)/(13)C(η2) signals, as with the previous type of SAIL-Trp, which has an extra (13)C at the C(γ) of the ring. By taking advantage of the stereospecific deuteration of one of the prochiral β-methylene protons, which was (1)H(β2) in this experiment, one can determine the side-chain conformation of the Trp residue including the χ(2) angle, which is especially important for Trp residues, as they can adopt three preferred conformations. We demonstrated the usefulness of [(12)C(γ),(12)C(ε2)] SAIL-Trp for the 12 kDa DNA binding domain of mouse c-Myb protein (Myb-R2R3), which contains six Trp residues.

  6. XRCC1 Arg194Trp and Arg399Gln polymorphisms and arsenic methylation capacity are associated with urothelial carcinoma

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chiang, Chien-I; Huang, Ya-Li; Chen, Wei-Jen

    The association between DNA repair gene polymorphisms and bladder cancer has been widely studied. However, few studies have examined the correlation between urothelial carcinoma (UC) and arsenic or its metabolites. The aim of this study was to examine the association between polymorphisms of the DNA repair genes, XRCC1 Arg194Trp, XRCC1 Arg399Gln, XRCC3 Thr241Met, and XPD Lys751Gln, with urinary arsenic profiles and UC. To this end, we conducted a hospital-based case–control study with 324 UC patients and 647 age- and gender-matched non-cancer controls. Genomic DNA was used to examine the genotype of XRCC1 Arg194Trp, XRCC1 Arg399Gln, XRCC3 Thr241Met, and XPD Lys751Glnmore » by PCR-restriction fragment length polymorphism analysis (PCR-RFLP). Urinary arsenic profiles were measured by high performance liquid chromatography (HPLC) linked with hydride generator and atomic absorption spectrometry. The XRCC1 399 Gln/Gln and 194 Arg/Trp and Trp/Trp genotypes were significantly related to UC, and the odds ratio (OR) and 95% confidence interval (95%CI) were 1.68 (1.03–2.75) and 0.66 (0.48–0.90), respectively. Participants with higher total urinary arsenic levels, a higher percentage of inorganic arsenic (InAs%) and a lower percentage of dimethylarsinic acid (DMA%) had a higher OR of UC. Participants carrying XRCC1 risk diplotypes G-C/G-C, A-C/A-C, and A-T/G-T, and who had higher total arsenic levels, higher InAs%, or lower DMA% compared to those with other XRCC1 diplotypes had a higher OR of UC. Our results suggest that the XRCC1 399 Gln/Gln and 194 Arg/Arg DNA repair genes play an important role in poor arsenic methylation capacity, thereby increasing the risk of UC in non-obvious arsenic exposure areas. - Highlights: • The XRCC1 399Gln/Gln genotype was significantly associated with increased OR of UC. • The XRCC1 194 Arg/Trp and Trp/Trp genotype had a significantly decreased OR of UC. • Combined effect of the XRCC1 genotypes and poor arsenic methylation

  7. Structural and physiological studies of the Escherichia coli histidine operon inserted into plasmid vectors.

    PubMed Central

    Bruni, C B; Musti, A M; Frunzio, R; Blasi, F

    1980-01-01

    A fragment of deoxyribonucleic acid 5,300 base paris long and containing the promoter-proximal portion of the histidine operon of Escherichia coli K-12, has been cloned in plasmid pBR313 (plasmids pCB2 and pCB3). Restriction mapping, partial nucleotide sequencing, and studies on functional expression in vivo and on protein synthesis in minicells have shown that the fragment contains the regulatory region of the operon, the hisG, hisD genes, and part of the hisC gene. Another plasmid (pCB5) contained the hisG gene and part of the hisD gene. Expression of the hisG gene in the latter plasmid was under control of the tetracycline promoter of the pBR313 plasmid. The in vivo expression of the two groups of plasmids described above, as well as their effect on the expression of the histidine genes not carried by the plasmids but present on the host chromosome, has been studied. The presence of multiple copies of pCB2 or pCB3, but not of pCB5, prevented derepression of the chromosomal histidine operon. Possible interpretations of this phenomenon are discussed. Images PMID:6246067

  8. Amplification of the groESL operon in Pseudomonas putida increases siderophore gene promoter activity.

    PubMed

    Venturi, V; Wolfs, K; Leong, J; Weisbeek, P J

    1994-10-17

    Pseudobactin 358 is the yellow-green fluorescent siderophore [microbial iron(III) transport agent] produced by Pseudomonas putida WCS358 under iron-limiting conditions. The genes encoding pseudobactin 358 biosynthesis are iron-regulated at the level of transcription. In this study, the molecular characterization is reported of a cosmid clone of WCS358 DNA that can stimulate, in an iron-dependent manner, the activity of a WCS358 siderophore gene promoter in the heterologous Pseudomonas strain A225. The functional region in the clone was identified by subcloning, transposon mutagenesis and DNA sequencing as the groESL operon of strain WCS358. This increase in promoter activity was not observed when the groESL genes of strain WCS358 were integrated via a transposon vector into the genome of Pseudomonas A225, indicating that multiple copies of the operon are necessary for the increase in siderophore gene promoter activity. Amplification of the Escherichia coli and WCS358 groESL genes also increased iron-regulated promoter activity in the parent strain WCS358. The groESL operon codes for the chaperone proteins GroES and GroEL, which are responsible for mediating the folding and assembly of many proteins.

  9. An Allelic Series of Trp63 Mutations Defines TAp63 as a Modifier of EEC Syndrome

    PubMed Central

    Lindahl, Emma Vernersson; Garcia, Elvin L.; Mills, Alea A.

    2014-01-01

    Human Ectrodactyly, Ectodermal dysplasia, Clefting (EEC) syndrome is an autosomal dominant developmental disorder defined by limb deformities, skin defects, and craniofacial clefting. Although associated with heterozygous missense mutations in TP63, the genetic basis underlying the variable expressivity and incomplete penetrance of EEC is unknown. Here we show that mice heterozygous for an allele encoding the Trp63 p.Arg318His mutation, which corresponds to the human TP63 p.Arg279His mutation found in patients with EEC, have features of human EEC. Using an allelic series, we discovered that whereas clefting and skin defects are caused by loss of Trp63 function, limb anomalies are due to gain- and/or dominant-negative effects of Trp63. Furthermore, we identify TAp63 as a strong modifier of EEC-associated phenotypes with regard to both penetrance and expressivity. PMID:23775923

  10. A Kinetic Model of Trp-Cage Folding from Multiple Biased Molecular Dynamics Simulations

    PubMed Central

    Marinelli, Fabrizio; Pietrucci, Fabio; Laio, Alessandro; Piana, Stefano

    2009-01-01

    Trp-cage is a designed 20-residue polypeptide that, in spite of its size, shares several features with larger globular proteins. Although the system has been intensively investigated experimentally and theoretically, its folding mechanism is not yet fully understood. Indeed, some experiments suggest a two-state behavior, while others point to the presence of intermediates. In this work we show that the results of a bias-exchange metadynamics simulation can be used for constructing a detailed thermodynamic and kinetic model of the system. The model, although constructed from a biased simulation, has a quality similar to those extracted from the analysis of long unbiased molecular dynamics trajectories. This is demonstrated by a careful benchmark of the approach on a smaller system, the solvated Ace-Ala3-Nme peptide. For the Trp-cage folding, the model predicts that the relaxation time of 3100 ns observed experimentally is due to the presence of a compact molten globule-like conformation. This state has an occupancy of only 3% at 300 K, but acts as a kinetic trap. Instead, non-compact structures relax to the folded state on the sub-microsecond timescale. The model also predicts the presence of a state at of 4.4 Å from the NMR structure in which the Trp strongly interacts with Pro12. This state can explain the abnormal temperature dependence of the and chemical shifts. The structures of the two most stable misfolded intermediates are in agreement with NMR experiments on the unfolded protein. Our work shows that, using biased molecular dynamics trajectories, it is possible to construct a model describing in detail the Trp-cage folding kinetics and thermodynamics in agreement with experimental data. PMID:19662155

  11. A kinetic model of trp-cage folding from multiple biased molecular dynamics simulations.

    PubMed

    Marinelli, Fabrizio; Pietrucci, Fabio; Laio, Alessandro; Piana, Stefano

    2009-08-01

    Trp-cage is a designed 20-residue polypeptide that, in spite of its size, shares several features with larger globular proteins.Although the system has been intensively investigated experimentally and theoretically, its folding mechanism is not yet fully understood. Indeed, some experiments suggest a two-state behavior, while others point to the presence of intermediates. In this work we show that the results of a bias-exchange metadynamics simulation can be used for constructing a detailed thermodynamic and kinetic model of the system. The model, although constructed from a biased simulation, has a quality similar to those extracted from the analysis of long unbiased molecular dynamics trajectories. This is demonstrated by a careful benchmark of the approach on a smaller system, the solvated Ace-Ala3-Nme peptide. For theTrp-cage folding, the model predicts that the relaxation time of 3100 ns observed experimentally is due to the presence of a compact molten globule-like conformation. This state has an occupancy of only 3% at 300 K, but acts as a kinetic trap.Instead, non-compact structures relax to the folded state on the sub-microsecond timescale. The model also predicts the presence of a state at Calpha-RMSD of 4.4 A from the NMR structure in which the Trp strongly interacts with Pro12. This state can explain the abnormal temperature dependence of the Pro12-delta3 and Gly11-alpha3 chemical shifts. The structures of the two most stable misfolded intermediates are in agreement with NMR experiments on the unfolded protein. Our work shows that, using biased molecular dynamics trajectories, it is possible to construct a model describing in detail the Trp-cage folding kinetics and thermodynamics in agreement with experimental data.

  12. Expression and distribution of transient receptor potential (TRP) channels in bladder epithelium.

    PubMed

    Yu, Weiqun; Hill, Warren G; Apodaca, Gerard; Zeidel, Mark L

    2011-01-01

    The urothelium is proposed to be a sensory tissue that responds to mechanical stress by undergoing dynamic membrane trafficking and neurotransmitter release; however, the molecular basis of this function is poorly understood. Transient receptor potential (TRP) channels are ideal candidates to fulfill such a role as they can sense changes in temperature, osmolarity, and mechanical stimuli, and several are reported to be expressed in the bladder epithelium. However, their complete expression profile is unknown and their cellular localization is largely undefined. We analyzed expression of all 33 TRP family members in mouse bladder and urothelium by RT-PCR and found 22 specifically expressed in the urothelium. Of the latter, 10 were chosen for closer investigation based on their known mechanosensory or membrane trafficking functions in other cell types. Western blots confirmed urothelial expression of TRPC1, TRPC4, TRPV1, TRPV2, TRPV4, TRPM4, TRPM7, TRPML1, and polycystins 1 and 2 (PKD1 and PKD2) proteins. We further defined the cellular and subcellular localization of all 10 TRP channels. TRPV2 and TRPM4 were prominently localized to the umbrella cell apical membrane, while TRPC4 and TRPV4 were identified on their abluminal surfaces. TRPC1, TRPM7, and TRPML1 were localized to the cytoplasm, while PKD1 and PKD2 were expressed on the apical and basolateral membranes of umbrella cells as well as in the cytoplasm. The cellular location of TRPV1 in the bladder has been debated, but colocalization with neuronal marker calcitonin gene-related peptide indicated clearly that it is present on afferent neurons that extend into the urothelium, but may not be expressed by the urothelium itself. These findings are consistent with the hypothesis that the urothelium acts as a sentinel and by expressing multiple TRP channels it is likely it can detect and presumably respond to a diversity of external stimuli and suggest that it plays an important role in urothelial signal

  13. Redundant phenazine operons in Pseudomonas aeruginosa exhibit environment-dependent expression and differential roles in pathogenicity

    PubMed Central

    Recinos, David A.; Sekedat, Matthew D.; Hernandez, Adriana; Cohen, Taylor Sitarik; Sakhtah, Hassan; Prince, Alice S.; Price-Whelan, Alexa; Dietrich, Lars E. P.

    2012-01-01

    Evolutionary biologists have postulated that several fitness advantages may be conferred by the maintenance of duplicate genes, including environmental adaptation resulting from differential regulation. We examined the expression and physiological contributions of two redundant operons in the adaptable bacterium Pseudomonas aeruginosa PA14. These operons, phzA1-G1 (phz1) and phzA2-G2 (phz2), encode nearly identical sets of proteins that catalyze the synthesis of phenazine-1-carboxylic acid, the precursor for several phenazine derivatives. Phenazines perform diverse roles in P. aeruginosa physiology and act as virulence factors during opportunistic infections of plant and animal hosts. Although reports have indicated that phz1 is regulated by the Pseudomonas quinolone signal, factors controlling phz2 expression have not been identified, and the relative contributions of these redundant operons to phenazine biosynthesis have not been evaluated. We found that in liquid cultures, phz1 was expressed at higher levels than phz2, although phz2 showed a greater contribution to phenazine production. In colony biofilms, phz2 was expressed at high levels, whereas phz1 expression was not detectable, and phz2 was responsible for virtually all phenazine production. Analysis of mutants defective in quinolone signal synthesis revealed a critical role for 4-hydroxy-2-heptylquinoline in phz2 induction. Finally, deletion of phz2, but not of phz1, decreased lung colonization in a murine model of infection. These results suggest that differential regulation of the redundant phz operons allows P. aeruginosa to adapt to diverse environments. PMID:23129634

  14. Properties of the intracellular transient receptor potential (TRP) channel in yeast, Yvc1.

    PubMed

    Chang, Yiming; Schlenstedt, Gabriel; Flockerzi, Veit; Beck, Andreas

    2010-05-17

    Transient receptor potential (TRP) channels are found among mammals, flies, worms, ciliates, Chlamydomonas, and yeast but are absent in plants. These channels are believed to be tetramers of proteins containing six transmembrane domains (TMs). Their primary structures are diverse with sequence similarities only in some short amino acid sequence motifs mainly within sequences covering TM5, TM6, and adjacent domains. In the yeast genome, there is one gene encoding a TRP-like sequence. This protein forms an ion channel in the vacuolar membrane and is therefore called Yvc1 for yeast vacuolar conductance 1. In the following we summarize its prominent features. Copyright 2009 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  15. Shifts in bacterial community structure during succession in a glacier foreland of the High Arctic.

    PubMed

    Kim, Mincheol; Jung, Ji Young; Laffly, Dominique; Kwon, Hye Young; Lee, Yoo Kyung

    2017-01-01

    Primary succession after glacier retreat has been widely studied in plant communities, but bacterial succession is still poorly understood. In particular, few studies of microbial succession have been performed in the Arctic. We investigated the shifts in bacterial community structure and soil physicochemical properties along a successional gradient in a 100-year glacier foreland of the High Arctic. Multivariate analyses revealed that time after glacier retreat played a key role in associated bacterial community structure during succession. However, environmental filtering (i.e. pH and soil temperature) also accounted for a different, but substantial, proportion of the bacterial community structure. Using the functional trait-based approach, we found that average rRNA operon (rrn) copy number of bacterial communities is high in earlier successional stages and decreased over time. This suggests that soil bacterial taxa with higher rrn copy number have a selective advantage in early successional stages due to their ability of rapidly responding to nutrient inputs in newly exposed soils after glacier retreat. Taken together, our results demonstrate that both deglaciation time and environmental filters play key roles in structuring bacterial communities and soil bacterial groups with different ecological strategies occur in different stages of succession in this glacier foreland. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  16. Cu(I)-mediated Allosteric Switching in a Copper-sensing Operon Repressor (CsoR)*

    PubMed Central

    Chang, Feng-Ming James; Coyne, H. Jerome; Cubillas, Ciro; Vinuesa, Pablo; Fang, Xianyang; Ma, Zhen; Ma, Dejian; Helmann, John D.; García-de los Santos, Alejandro; Wang, Yun-Xing; Dann, Charles E.; Giedroc, David P.

    2014-01-01

    The copper-sensing operon repressor (CsoR) is representative of a major Cu(I)-sensing family of bacterial metalloregulatory proteins that has evolved to prevent cytoplasmic copper toxicity. It is unknown how Cu(I) binding to tetrameric CsoRs mediates transcriptional derepression of copper resistance genes. A phylogenetic analysis of 227 DUF156 protein members, including biochemically or structurally characterized CsoR/RcnR repressors, reveals that Geobacillus thermodenitrificans (Gt) CsoR characterized here is representative of CsoRs from pathogenic bacilli Listeria monocytogenes and Bacillus anthracis. The 2.56 Å structure of Cu(I)-bound Gt CsoR reveals that Cu(I) binding induces a kink in the α2-helix between two conserved copper-ligating residues and folds an N-terminal tail (residues 12–19) over the Cu(I) binding site. NMR studies of Gt CsoR reveal that this tail is flexible in the apo-state with these dynamics quenched upon Cu(I) binding. Small angle x-ray scattering experiments on an N-terminally truncated Gt CsoR (Δ2–10) reveal that the Cu(I)-bound tetramer is hydrodynamically more compact than is the apo-state. The implications of these findings for the allosteric mechanisms of other CsoR/RcnR repressors are discussed. PMID:24831014

  17. Fnr, NarP, and NarL Regulation of Escherichia coli K-12 napF (Periplasmic Nitrate Reductase) Operon Transcription In Vitro

    PubMed Central

    Darwin, Andrew J.; Ziegelhoffer, Eva C.; Kiley, Patricia J.; Stewart, Valley

    1998-01-01

    The expression of several Escherichia coli operons is activated by the Fnr protein during anaerobic growth and is further controlled in response to nitrate and nitrite by the homologous response regulators, NarL and NarP. Among these operons, the napF operon, encoding a periplasmic nitrate reductase, has unique features with respect to its Fnr-, NarL-, and NarP-dependent regulation. First, the Fnr-binding site is unusually located compared to the control regions of most other Fnr-activated operons, suggesting different Fnr-RNA polymerase contacts during transcriptional activation. Second, nitrate and nitrite activation is solely dependent on NarP but is antagonized by the NarL protein. In this study, we used DNase I footprint analysis to confirm our previous assignment of the unusual location of the Fnr-binding site in the napF control region. In addition, the in vivo effects of Fnr-positive control mutations on napF operon expression indicate that the napF promoter is atypical with respect to Fnr-mediated activation. The transcriptional regulation of napF was successfully reproduced in vitro by using a supercoiled plasmid template and purified Fnr, NarL, and NarP proteins. These in vitro transcription experiments demonstrate that, in the presence of Fnr, the NarP protein causes efficient transcription activation whereas the NarL protein does not. This suggests that Fnr and NarP may act synergistically to activate napF operon expression. As observed in vivo, this activation by Fnr and NarP is antagonized by the addition of NarL in vitro. PMID:9696769

  18. Multidrug-Resistant CTX-M-(15, 9, 2)- and KPC-2-Producing Enterobacter hormaechei and Enterobacter asburiae Isolates Possessed a Set of Acquired Heavy Metal Tolerance Genes Including a Chromosomal sil Operon (for Acquired Silver Resistance).

    PubMed

    Andrade, Leonardo N; Siqueira, Thiago E S; Martinez, Roberto; Darini, Ana Lucia C

    2018-01-01

    Bacterial resistance to antibiotics is concern in healthcare-associated infections. On the other hand, bacterial tolerance to other antimicrobials, like heavy metals, has been neglected and underestimated in hospital pathogens. Silver has long been used as an antimicrobial agent and it seems to be an important indicator of heavy metal tolerance. To explore this perspective, we searched for the presence of acquired silver resistance genes ( sil operon: silE, silS, silR, silC, silF, silB, silA , and silP ) and acquired extended-spectrum cephalosporin and carbapenem resistance genes ( bla CTX-M and bla KPC ) in Enterobacter cloacae Complex (EcC) ( n = 27) and Enterobacter aerogenes ( n = 8) isolated from inpatients at a general hospital. Moreover, the genetic background of the silA (silver-efflux pump) and the presence of other acquired heavy metal tolerance genes, pcoD (copper-efflux pump), arsB (arsenite-efflux pump), terF (tellurite resistance protein), and merA (mercuric reductase) were also investigated. Outstandingly, 21/27 (78%) EcC isolates harbored silA gene located in the chromosome. Complete sil operon was found in 19/21 silA -positive EcC isolates. Interestingly, 8/20 (40%) E. hormaechei and 5/6 (83%) E. asburiae co-harbored silA/pcoD genes and bla CTX-M-(15,2,or9) and/or bla KPC-2 genes. Frequent occurrences of arsB, terF , and merA genes were detected, especially in silA/pcoD -positive, multidrug-resistant (MDR) and/or CTX-M-producing isolates. Our study showed co-presence of antibiotic and heavy metal tolerance genes in MDR EcC isolates. In our viewpoint, there are few studies regarding to bacterial heavy metal tolerance and we call attention for more investigations and discussion about this issue in different hospital pathogens.

  19. Multidrug-Resistant CTX-M-(15, 9, 2)- and KPC-2-Producing Enterobacter hormaechei and Enterobacter asburiae Isolates Possessed a Set of Acquired Heavy Metal Tolerance Genes Including a Chromosomal sil Operon (for Acquired Silver Resistance)

    PubMed Central

    Andrade, Leonardo N.; Siqueira, Thiago E. S.; Martinez, Roberto; Darini, Ana Lucia C.

    2018-01-01

    Bacterial resistance to antibiotics is concern in healthcare-associated infections. On the other hand, bacterial tolerance to other antimicrobials, like heavy metals, has been neglected and underestimated in hospital pathogens. Silver has long been used as an antimicrobial agent and it seems to be an important indicator of heavy metal tolerance. To explore this perspective, we searched for the presence of acquired silver resistance genes (sil operon: silE, silS, silR, silC, silF, silB, silA, and silP) and acquired extended-spectrum cephalosporin and carbapenem resistance genes (blaCTX−M and blaKPC) in Enterobacter cloacae Complex (EcC) (n = 27) and Enterobacter aerogenes (n = 8) isolated from inpatients at a general hospital. Moreover, the genetic background of the silA (silver-efflux pump) and the presence of other acquired heavy metal tolerance genes, pcoD (copper-efflux pump), arsB (arsenite-efflux pump), terF (tellurite resistance protein), and merA (mercuric reductase) were also investigated. Outstandingly, 21/27 (78%) EcC isolates harbored silA gene located in the chromosome. Complete sil operon was found in 19/21 silA-positive EcC isolates. Interestingly, 8/20 (40%) E. hormaechei and 5/6 (83%) E. asburiae co-harbored silA/pcoD genes and blaCTX−M−(15,2,or9) and/or blaKPC−2 genes. Frequent occurrences of arsB, terF, and merA genes were detected, especially in silA/pcoD-positive, multidrug-resistant (MDR) and/or CTX-M-producing isolates. Our study showed co-presence of antibiotic and heavy metal tolerance genes in MDR EcC isolates. In our viewpoint, there are few studies regarding to bacterial heavy metal tolerance and we call attention for more investigations and discussion about this issue in different hospital pathogens. PMID:29628916

  20. Energy landscape paving simulations of the trp-cage protein.

    PubMed

    Schug, Alexander; Wenzel, Wolfgang; Hansmann, Ulrich H E

    2005-05-15

    We evaluate the efficiency of multiple variants of energy landscape paving in all-atom simulations of the trp-cage protein using a recently developed new force field. Especially, we introduce a temperature-free variant of the method and demonstrate that it allows a fast scanning of the energy landscape. Nativelike structures are found in less time than by other techniques. The sampled low-energy configurations indicate a funnel-like energy landscape.

  1. Influence of heme-thiolate in shaping the catalytic properties of a bacterial nitric-oxide synthase.

    PubMed

    Hannibal, Luciana; Somasundaram, Ramasamy; Tejero, Jesús; Wilson, Adjele; Stuehr, Dennis J

    2011-11-11

    Nitric-oxide synthases (NOS) are heme-thiolate enzymes that generate nitric oxide (NO) from L-arginine. Mammalian and bacterial NOSs contain a conserved tryptophan (Trp) that hydrogen bonds with the heme-thiolate ligand. We mutated Trp(66) to His and Phe (W66H, W66F) in B. subtilis NOS to investigate how heme-thiolate electronic properties control enzyme catalysis. The mutations had opposite effects on heme midpoint potential (-302, -361, and -427 mV for W66H, wild-type (WT), and W66F, respectively). These changes were associated with rank order (W66H < WT < W66F) changes in the rates of oxygen activation and product formation in Arg hydroxylation and N-hydroxyarginine (NOHA) oxidation single turnover reactions, and in the O(2) reactivity of the ferrous heme-NO product complex. However, enzyme ferrous heme-O(2) autoxidation showed an opposite rank order. Tetrahydrofolate supported NO synthesis by WT and the mutant NOS. All three proteins showed similar extents of product formation (L-Arg → NOHA or NOHA → citrulline) in single turnover studies, but the W66F mutant showed a 2.5 times lower activity when the reactions were supported by flavoproteins and NADPH. We conclude that Trp(66) controls several catalytic parameters by tuning the electron density of the heme-thiolate bond. A greater electron density (as in W66F) improves oxygen activation and reactivity toward substrate, but decreases heme-dioxy stability and lowers the driving force for heme reduction. In the WT enzyme the Trp(66) residue balances these opposing effects for optimal catalysis.

  2. Trp64Arg polymorphism of the ADRB3 gene associated with maximal fat oxidation and LDL-C levels in non-obese adolescents.

    PubMed

    Jesus, Íncare Correa de; Alle, Lupe Furtado; Munhoz, Eva Cantalejo; Silva, Larissa Rosa da; Lopes, Wendell Arthur; Tureck, Luciane Viater; Purim, Katia Sheylla Malta; Titski, Ana Claudia Kapp; Leite, Neiva

    2017-09-21

    To analyze the association between the Trp64Arg polymorphism of the ADRB3 gene, maximal fat oxidation rates and the lipid profile levels in non-obese adolescents. 72 schoolchildren, of both genders, aged between 11 and 17 years, participated in the study. The anthropometric and body composition variables, in addition to total cholesterol, HDL-c, LDL-c, triglycerides, insulin, and basal glycemia, were evaluated. The sample was divided into two groups according to the presence or absence of the polymorphism: non-carriers of the Arg64 allele, i.e., homozygous (Trp64Trp: n=54), and carriers of the Arg64 allele (Trp64Arg+Arg64Arg: n=18), in which the frequency of the Arg64 allele was 15.2%. The maximal oxygen uptake and peak of oxygen uptake during exercise were obtained through the symptom-limited, submaximal treadmill test. Maximal fat oxidation was determined according to the ventilatory ratio proposed in Lusk's table. Adolescents carrying the less frequent allele (Trp64Arg and Arg64Arg) had higher LDL-c levels (p=0.031) and lower maximal fat oxidation rates (p=0.038) when compared with non-carriers (Trp64Trp). Although the physiological processes related to lipolysis and lipid metabolism are complex, the presence of the Arg 64 allele was associated with lower rates of FATMAX during aerobic exercise, as well as with higher levels of LDL-c in adolescents. Copyright © 2017 Sociedade Brasileira de Pediatria. Published by Elsevier Editora Ltda. All rights reserved.

  3. Decaffeination and measurement of caffeine content by addicted Escherichia coli with a refactored N-demethylation operon from Pseudomonas putida CBB5.

    PubMed

    Quandt, Erik M; Hammerling, Michael J; Summers, Ryan M; Otoupal, Peter B; Slater, Ben; Alnahhas, Razan N; Dasgupta, Aurko; Bachman, James L; Subramanian, Mani V; Barrick, Jeffrey E

    2013-06-21

    The widespread use of caffeine (1,3,7-trimethylxanthine) and other methylxanthines in beverages and pharmaceuticals has led to significant environmental pollution. We have developed a portable caffeine degradation operon by refactoring the alkylxanthine degradation (Alx) gene cluster from Pseudomonas putida CBB5 to function in Escherichia coli. In the process, we discovered that adding a glutathione S-transferase from Janthinobacterium sp. Marseille was necessary to achieve N 7 -demethylation activity. E. coli cells with the synthetic operon degrade caffeine to the guanine precursor, xanthine. Cells deficient in de novo guanine biosynthesis that contain the refactored operon are ″addicted″ to caffeine: their growth density is limited by the availability of caffeine or other xanthines. We show that the addicted strain can be used as a biosensor to measure the caffeine content of common beverages. The synthetic N-demethylation operon could be useful for reclaiming nutrient-rich byproducts of coffee bean processing and for the cost-effective bioproduction of methylxanthine drugs.

  4. Regulation of TRP channels by steroids: Implications in physiology and diseases.

    PubMed

    Kumar, Ashutosh; Kumari, Shikha; Majhi, Rakesh Kumar; Swain, Nirlipta; Yadav, Manoj; Goswami, Chandan

    2015-09-01

    While effects of different steroids on the gene expression and regulation are well established, it is proven that steroids can also exert rapid non-genomic actions in several tissues and cells. In most cases, these non-genomic rapid effects of steroids are actually due to intracellular mobilization of Ca(2+)- and other ions suggesting that Ca(2+) channels are involved in such effects. Transient Receptor Potential (TRP) ion channels or TRPs are the largest group of non-selective and polymodal ion channels which cause Ca(2+)-influx in response to different physical and chemical stimuli. While non-genomic actions of different steroids on different ion channels have been established to some extent, involvement of TRPs in such functions is largely unexplored. In this review, we critically analyze the literature and summarize how different steroids as well as their metabolic precursors and derivatives can exert non-genomic effects by acting on different TRPs qualitatively and/or quantitatively. Such effects have physiological repercussion on systems such as in sperm cells, immune cells, bone cells, neuronal cells and many others. Different TRPs are also endogenously expressed in diverse steroid-producing tissues and thus may have importance in steroid synthesis as well, a process which is tightly controlled by the intracellular Ca(2+) concentrations. Tissue and cell-specific expression of TRP channels are also regulated by different steroids. Understanding of the crosstalk between TRP channels and different steroids may have strong significance in physiological, endocrinological and pharmacological context and in future these compounds can also be used as potential biomedicine. Copyright © 2014 Elsevier Inc. All rights reserved.

  5. Evaluation of the Role of the opgGH Operon in Yersinia pseudotuberculosis and Its Deletion during the Emergence of Yersinia pestis

    PubMed Central

    Quintard, Kévin; Dewitte, Amélie; Reboul, Angéline; Madec, Edwige; Bontemps-Gallo, Sébastien; Dondeyne, Jacqueline; Marceau, Michaël; Simonet, Michel

    2015-01-01

    The opgGH operon encodes glucosyltransferases that synthesize osmoregulated periplasmic glucans (OPGs) from UDP-glucose, using acyl carrier protein (ACP) as a cofactor. OPGs are required for motility, biofilm formation, and virulence in various bacteria. OpgH also sequesters FtsZ in order to regulate cell size according to nutrient availability. Yersinia pestis (the agent of flea-borne plague) lost the opgGH operon during its emergence from the enteropathogen Yersinia pseudotuberculosis. When expressed in OPG-negative strains of Escherichia coli and Dickeya dadantii, opgGH from Y. pseudotuberculosis restored OPGs synthesis, motility, and virulence. However, Y. pseudotuberculosis did not produce OPGs (i) under various growth conditions or (ii) when overexpressing its opgGH operon, its galUF operon (governing UDP-glucose), or the opgGH operon or Acp from E. coli. A ΔopgGH Y. pseudotuberculosis strain showed normal motility, biofilm formation, resistance to polymyxin and macrophages, and virulence but was smaller. Consistently, Y. pestis was smaller than Y. pseudotuberculosis when cultured at ≥37°C, except when the plague bacillus expressed opgGH. Y. pestis expressing opgGH grew normally in serum and within macrophages and was fully virulent in mice, suggesting that small cell size was not advantageous in the mammalian host. Lastly, Y. pestis expressing opgGH was able to infect Xenopsylla cheopis fleas normally. Our results suggest an evolutionary scenario whereby an ancestral Yersinia strain lost a factor required for OPG biosynthesis but kept opgGH (to regulate cell size). The opgGH operon was presumably then lost because OpgH-dependent cell size control became unnecessary. PMID:26150539

  6. Mosaic Structure and Molecular Evolution of the Leukotoxin Operon (lktCABD) in Mannheimia (Pasteurella) haemolytica, Mannheimia glucosida, and Pasteurella trehalosi

    PubMed Central

    Davies, Robert L.; Campbell, Susan; Whittam, Thomas S.

    2002-01-01

    The mosaic structure and molecular evolution of the leukotoxin operon (lktCABD) was investigated by nucleotide sequence comparison of the lktC, lktB, and lktD genes in 23 Mannheimia (Pasteurella) haemolytica, 6 Mannheimia glucosida, and 4 Pasteurella trehalosi strains. Sequence variation in the lktA gene has been described previously (R. L. Davies et al., J. Bacteriol. 183:1394–1404, 2001). The leukotoxin operon of M. haemolytica has a complex mosaic structure and has been derived by extensive inter- and intraspecies horizontal DNA transfer and intragenic recombination events. However, the pattern of recombination varies throughout the operon and among the different evolutionary lineages of M. haemolytica. The lktA and lktB genes have the most complex mosaic structures with segments derived from up to four different sources, including M. glucosida and P. trehalosi. In contrast, the lktD gene is highly conserved in M. haemolytica. The lktC, lktA, and lktB genes of strains representing the major ovine lineages contain recombinant segments derived from bovine or bovine-like serotype A2 strains. These findings support the previous conclusion that host switching of bovine A2 strains from cattle to sheep has played a major role in the evolution of the leukotoxin operon in ovine strains of M. haemolytica. Homologous segments of donor and recipient alleles are identical, or nearly identical, indicating that the recombinational exchanges occurred relatively recent in evolutionary terms. The 5′ and 3′ ends of the operon are highly conserved in M. haemolytica, which suggests that multiple horizontal exchanges of the complete operon have occurred by a common mechanism such as transduction. Although the lktA and lktB genes both have complex mosaic structures and high nucleotide substitution rates, the amino acid diversity of LktB is significantly lower than that of LktA due to a higher degree of evolutionary constraint against amino acid replacement. The recombinational

  7. Bacterial cellulose synthesis mechanism of facultative anaerobe Enterobacter sp. FY-07.

    PubMed

    Ji, Kaihua; Wang, Wei; Zeng, Bing; Chen, Sibin; Zhao, Qianqian; Chen, Yueqing; Li, Guoqiang; Ma, Ting

    2016-02-25

    Enterobacter sp. FY-07 can produce bacterial cellulose (BC) under aerobic and anaerobic conditions. Three potential BC synthesis gene clusters (bcsI, bcsII and bcsIII) of Enterobacter sp. FY-07 have been predicted using genome sequencing and comparative genome analysis, in which bcsIII was confirmed as the main contributor to BC synthesis by gene knockout and functional reconstitution methods. Protein homology, gene arrangement and gene constitution analysis indicated that bcsIII had high identity to the bcsI operon of Enterobacter sp. 638; however, its arrangement and composition were same as those of BC synthesizing operon of G. xylinum ATCC53582 except for the flanking sequences. According to the BC biosynthesizing process, oxygen is not directly involved in the reactions of BC synthesis, however, energy is required to activate intermediate metabolites and synthesize the activator, c-di-GMP. Comparative transcriptome and metabolite quantitative analysis demonstrated that under anaerobic conditions genes involved in the TCA cycle were downregulated, however, genes in the nitrate reduction and gluconeogenesis pathways were upregulated, especially, genes in three pyruvate metabolism pathways. These results suggested that Enterobacter sp. FY-07 could produce energy efficiently under anaerobic conditions to meet the requirement of BC biosynthesis.

  8. Bacterial cellulose synthesis mechanism of facultative anaerobe Enterobacter sp. FY-07

    PubMed Central

    Ji, Kaihua; Wang, Wei; Zeng, Bing; Chen, Sibin; Zhao, Qianqian; Chen, Yueqing; Li, Guoqiang; Ma, Ting

    2016-01-01

    Enterobacter sp. FY-07 can produce bacterial cellulose (BC) under aerobic and anaerobic conditions. Three potential BC synthesis gene clusters (bcsI, bcsII and bcsIII) of Enterobacter sp. FY-07 have been predicted using genome sequencing and comparative genome analysis, in which bcsIII was confirmed as the main contributor to BC synthesis by gene knockout and functional reconstitution methods. Protein homology, gene arrangement and gene constitution analysis indicated that bcsIII had high identity to the bcsI operon of Enterobacter sp. 638; however, its arrangement and composition were same as those of BC synthesizing operon of G. xylinum ATCC53582 except for the flanking sequences. According to the BC biosynthesizing process, oxygen is not directly involved in the reactions of BC synthesis, however, energy is required to activate intermediate metabolites and synthesize the activator, c-di-GMP. Comparative transcriptome and metabolite quantitative analysis demonstrated that under anaerobic conditions genes involved in the TCA cycle were downregulated, however, genes in the nitrate reduction and gluconeogenesis pathways were upregulated, especially, genes in three pyruvate metabolism pathways. These results suggested that Enterobacter sp. FY-07 could produce energy efficiently under anaerobic conditions to meet the requirement of BC biosynthesis. PMID:26911736

  9. The Use of Amino Sugars by Bacillus subtilis: Presence of a Unique Operon for the Catabolism of Glucosamine

    PubMed Central

    Gaugué, Isabelle; Oberto, Jacques; Putzer, Harald; Plumbridge, Jacqueline

    2013-01-01

    B. subtilis grows more rapidly using the amino sugar glucosamine as carbon source, than with N-acetylglucosamine. Genes for the transport and metabolism of N-acetylglucosamine (nagP and nagAB) are found in all the sequenced Bacilli (except Anoxybacillus flavithermus). In B. subtilis there is an additional operon (gamAP) encoding second copies of genes for the transport and catabolism of glucosamine. We have developed a method to make multiple deletion mutations in B. subtilis employing an excisable spectinomycin resistance cassette. Using this method we have analysed the contribution of the different genes of the nag and gam operons for their role in utilization of glucosamine and N-acetylglucosamine. Faster growth on glucosamine is due to the presence of the gamAP operon, which is strongly induced by glucosamine. Although the gamA and nagB genes encode isozymes of GlcN6P deaminase, catabolism of N-acetylglucosamine relies mostly upon the gamA gene product. The genes for use of N-acetylglucosamine, nagAB and nagP, are repressed by YvoA (NagR), a GntR family regulator, whose gene is part of the nagAB yvoA(nagR) operon. The gamAP operon is repressed by YbgA, another GntR family repressor, whose gene is expressed divergently from gamAP. The nagAB yvoA synton is found throughout the Bacilli and most firmicutes. On the other hand the ybgA-gamAP synton, which includes the ybgB gene for a small protein of unknown provenance, is only found in B. subtilis (and a few very close relatives). The origin of ybgBA-gamAP grouping is unknown but synteny analysis suggests lateral transfer from an unidentified donor. The presence of gamAP has enabled B. subtilis to efficiently use glucosamine as carbon source. PMID:23667565

  10. High Levels of Bioplastic Are Produced in Fertile Transplastomic Tobacco Plants Engineered with a Synthetic Operon for the Production of Polyhydroxybutyrate1[C][OA

    PubMed Central

    Bohmert-Tatarev, Karen; McAvoy, Susan; Daughtry, Sean; Peoples, Oliver P.; Snell, Kristi D.

    2011-01-01

    An optimized genetic construct for plastid transformation of tobacco (Nicotiana tabacum) for the production of the renewable, biodegradable plastic polyhydroxybutyrate (PHB) was designed using an operon extension strategy. Bacterial genes encoding the PHB pathway enzymes were selected for use in this construct based on their similarity to the codon usage and GC content of the tobacco plastome. Regulatory elements with limited homology to the host plastome yet known to yield high levels of plastidial recombinant protein production were used to enhance the expression of the transgenes. A partial transcriptional unit, containing genes of the PHB pathway and a selectable marker gene encoding spectinomycin resistance, was flanked at the 5′ end by the host plant’s psbA coding sequence and at the 3′ end by the host plant’s 3′ psbA untranslated region. This design allowed insertion of the transgenes into the plastome as an extension of the psbA operon, rendering the addition of a promoter to drive the expression of the transgenes unnecessary. Transformation of the optimized construct into tobacco and subsequent spectinomycin selection of transgenic plants yielded T0 plants that were capable of producing up to 18.8% dry weight PHB in samples of leaf tissue. These plants were fertile and produced viable seed. T1 plants producing up to 17.3% dry weight PHB in samples of leaf tissue and 8.8% dry weight PHB in the total biomass of the plant were also isolated. PMID:21325565

  11. Improved vectors for transcriptional/translational signal screening in corynebacteria using the melC operon from Streptomyces glaucescens as reporter.

    PubMed

    Adham, Sirin A I; Rodríguez, Sonia; Ramos, Angelina; Santamaría, Ramón I; Gil, José A

    2003-07-01

    The tyrosinase operon ( melC) from Streptomyces glaucescens was cloned and functionally expressed in Brevibacterium lactofermentum and Corynebacterium glutamicum under the control of the promoter of the kan gene from Tn 5. Recombinant corynebacterial cells containing the tyrosinase operon produced melanin on agar plates and in liquid culture when supplemented with copper and tyrosine. A conjugative bifunctional replacement vector for transcriptional/translational signal screening (pEMel-1) was constructed using expression of the melC operon from S. glaucescens, which can be used for cloning promoter sequences as EcoRI- NdeI fragments. When the DNA fragments with promoter activity such as cspBp or trpp were inserted into pEMel-1, B. lactofermentum harboring the chimeric plasmids produced melanin at different stages of growth, allowing temporal detection of promoter activity. The vector was also used to detect the activity of a Streptomyces promoter ( xysAp), which was inactive in B. lactofermentum, after PCR mutagenesis. The melC operon can be used for the visual, inexpensive (compared to the high price of starch azure for amylase detection), and non-selective (in contrast to the kan or cat genes) screening of several thousand clones at high colony density without killing of the transformants due to the presence of iodine (as in the case of amylase assay).

  12. Regulation of nrf operon expression in pathogenic enteric bacteria: sequence divergence reveals new regulatory complexity

    PubMed Central

    Godfrey, Rita E.; Lee, David J.; Busby, Stephen J. W.

    2017-01-01

    Summary The Escherichia coli K‐12 nrf operon encodes a periplasmic nitrite reductase, the expression of which is driven from a single promoter, pnrf. Expression from pnrf is activated by the FNR transcription factor in response to anaerobiosis and further increased in response to nitrite by the response regulator proteins, NarL and NarP. FNR‐dependent transcription is suppressed by the binding of two nucleoid associated proteins, IHF and Fis. As Fis levels increase in cells grown in rich medium, the positioning of its binding site, overlapping the promoter −10 element, ensures that pnrf is sharply repressed. Here, we investigate the expression of the nrf operon promoter from various pathogenic enteric bacteria. We show that pnrf from enterohaemorrhagic E. coli is more active than its K‐12 counterpart, exhibits substantial FNR‐independent activity and is insensitive to nutrient quality, due to an improved −10 element. We also demonstrate that the Salmonella enterica serovar Typhimurium core promoter is more active than previously thought, due to differences around the transcription start site, and that its expression is repressed by downstream sequences. We identify the CsrA RNA binding protein as being responsible for this, and show that CsrA differentially regulates the E. coli K‐12 and Salmonella nrf operons. PMID:28211111

  13. Sampling the multiple folding mechanisms of Trp-cage in explicit solvent

    PubMed Central

    Juraszek, J.; Bolhuis, P. G.

    2006-01-01

    We investigate the kinetic pathways of folding and unfolding of the designed miniprotein Trp- cage in explicit solvent. Straightforward molecular dynamics and replica exchange methods both have severe convergence problems, whereas transition path sampling allows us to sample unbiased dynamical pathways between folded and unfolded states and leads to deeper understanding of the mechanisms of (un)folding. In contrast to previous predictions employing an implicit solvent, we find that Trp-cage folds primarily (80% of the paths) via a pathway forming the tertiary contacts and the salt bridge, before helix formation. The remaining 20% of the paths occur in the opposite order, by first forming the helix. The transition states of the rate-limiting steps are solvated native-like structures. Water expulsion is found to be the last step upon folding for each route. Committor analysis suggests that the dynamics of the solvent is not part of the reaction coordinate. Nevertheless, during the transition, specific water molecules are strongly bound and can play a structural role in the folding. PMID:17035504

  14. A Direct in Vivo Comparison of the Melanocortin Monovalent Agonist Ac-His-DPhe-Arg-Trp-NH2 versus the Bivalent Agonist Ac-His-DPhe-Arg-Trp-PEDG20-His-DPhe-Arg-Trp-NH2: A Bivalent Advantage.

    PubMed

    Lensing, Cody J; Adank, Danielle N; Wilber, Stacey L; Freeman, Katie T; Schnell, Sathya M; Speth, Robert C; Zarth, Adam T; Haskell-Luevano, Carrie

    2017-06-21

    Bivalent ligands targeting putative melanocortin receptor dimers have been developed and characterized in vitro; however, studies of their functional in vivo effects have been limited. The current report compares the effects of homobivalent ligand CJL-1-87, Ac-His-DPhe-Arg-Trp-PEDG20-His-DPhe-Arg-Trp-NH 2 , to monovalent ligand CJL-1-14, Ac-His-DPhe-Arg-Trp-NH 2 , on energy homeostasis in mice after central intracerebroventricular (ICV) administration into the lateral ventricle of the brain. Bivalent ligand CJL-1-87 had noteworthy advantages as an antiobesity probe over CJL-1-14 in a fasting-refeeding in vivo paradigm. Treatment with CJL-1-87 significantly decreased food intake compared to CJL-1-14 or saline (50% less intake 2-8 h after treatment). Furthermore, CJL-1-87 treatment decreased the respiratory exchange ratio (RER) without changing the energy expenditure indicating that fats were being burned as the primary fuel source. Additionally, CJL-1-87 treatment significantly lowered body fat mass percentage 6 h after administration (p < 0.05) without changing the lean mass percentage. The bivalent ligand significantly decreased insulin, C-peptide, leptin, GIP, and resistin plasma levels compared to levels after CJL-1-14 or saline treatments. Alternatively, ghrelin plasma levels were significantly increased. Serum stability of CJL-1-87 and CJL-1-14 (T 1/2 = 6.0 and 16.8 h, respectively) was sufficient to permit physiological effects. The differences in binding affinity of CJL-1-14 compared to CJL-1-87 are speculated as a possible mechanism for the bivalent ligand's unique effects. We also provide in vitro evidence for the formation of a MC3R-MC4R heterodimer complex, for the first time to our knowledge, that may be an unexploited neuronal molecular target. Regardless of the exact mechanism, the advantageous ability of CJL-1-87 compared to CJL-1-14 to increase in vitro binding affinity, increase the duration of action in spite of decreased serum stability, decrease

  15. Linearmycins Activate a Two-Component Signaling System Involved in Bacterial Competition and Biofilm Morphology

    PubMed Central

    2017-01-01

    ABSTRACT Bacteria use two-component signaling systems to adapt and respond to their competitors and changing environments. For instance, competitor bacteria may produce antibiotics and other bioactive metabolites and sequester nutrients. To survive, some species of bacteria escape competition through antibiotic production, biofilm formation, or motility. Specialized metabolite production and biofilm formation are relatively well understood for bacterial species in isolation. How bacteria control these functions when competitors are present is not well studied. To address fundamental questions relating to the competitive mechanisms of different species, we have developed a model system using two species of soil bacteria, Bacillus subtilis and Streptomyces sp. strain Mg1. Using this model, we previously found that linearmycins produced by Streptomyces sp. strain Mg1 cause lysis of B. subtilis cells and degradation of colony matrix. We identified strains of B. subtilis with mutations in the two-component signaling system yfiJK operon that confer dual phenotypes of specific linearmycin resistance and biofilm morphology. We determined that expression of the ATP-binding cassette (ABC) transporter yfiLMN operon, particularly yfiM and yfiN, is necessary for biofilm morphology. Using transposon mutagenesis, we identified genes that are required for YfiLMN-mediated biofilm morphology, including several chaperones. Using transcriptional fusions, we found that YfiJ signaling is activated by linearmycins and other polyene metabolites. Finally, using a truncated YfiJ, we show that YfiJ requires its transmembrane domain to activate downstream signaling. Taken together, these results suggest coordinated dual antibiotic resistance and biofilm morphology by a single multifunctional ABC transporter promotes competitive fitness of B. subtilis. IMPORTANCE DNA sequencing approaches have revealed hitherto unexplored diversity of bacterial species in a wide variety of environments that

  16. A distinct alleles and genetic recombination of pmrCAB operon in species of Acinetobacter baumannii complex isolates.

    PubMed

    Kim, Dae Hun; Ko, Kwan Soo

    2015-07-01

    To investigate pmrCAB sequence divergence in 5 species of Acinetobacter baumannii complex, a total of 80 isolates from a Korean hospital were explored. We evaluated nucleotide and amino acid polymorphisms of pmrCAB operon, and phylogenetic trees were constructed for each gene of prmCAB operon. Colistin and polymyxin B susceptibility was determined for all isolates, and multilocus sequence typing was also performed for A. baumannii isolates. Our results showed that each species of A. baumannii complex has divergent pmrCAB operon sequences. We identified a distinct pmrCAB allele allied with Acinetobacter nosocomialis in gene trees. Different grouping in each gene tree suggests sporadic recombination or emergence of pmrCAB genes among Acinetobacter species. Sequence polymorphisms among Acinetobacter species might not be associated with colistin resistance. We revealed that a distinct pmrCAB allele may be widespread across the continents such as North America and Asia and that sporadic genetic recombination or emergence of pmrCAB genes might occur. Copyright © 2015 Elsevier Inc. All rights reserved.

  17. The equilibrium properties and folding kinetics of an all-atom Go model of the Trp-cage.

    PubMed

    Linhananta, Apichart; Boer, Jesse; MacKay, Ian

    2005-03-15

    The ultrafast-folding 20-residue Trp-cage protein is quickly becoming a new benchmark for molecular dynamics studies. Already several all-atom simulations have probed its equilibrium and kinetic properties. In this work an all-atom Go model is used to accurately represent the side-chain packing and native atomic contacts of the Trp-cage. The model reproduces the hallmark thermodynamics cooperativity of small proteins. Folding simulations observe that in the fast-folding dominant pathway, partial alpha-helical structure forms before hydrophobic core collapse. In the slow-folding secondary pathway, partial core collapse occurs before helical structure. The slow-folding rate of the secondary pathway is attributed to the loss of side-chain rotational freedom, due to the early core collapse, which impedes the helix formation. A major finding is the observation of a low-temperature kinetic intermediate stabilized by a salt bridge between residues Asp-9 and Arg-16. Similar observations [R. Zhou, Proc. Natl. Acad. Sci. U.S.A. 100, 13280 (2003)] were reported in a recent study using an all-atom model of the Trp-cage in explicit water, in which the salt-bridge stabilized intermediate was hypothesized to be the origin of the ultrafast-folding mechanism. A theoretical mutation that eliminates the Asp-9-Arg-16 salt bridge, but leaves the residues intact, is performed. Folding simulations of the mutant Trp-cage observe a two-state free-energy landscape with no kinetic intermediate and a significant decrease in the folding rate, in support of the hypothesis.

  18. BadR and BadM Proteins Transcriptionally Regulate Two Operons Needed for Anaerobic Benzoate Degradation by Rhodopseudomonas palustris

    PubMed Central

    Hirakawa, Hidetada; Hirakawa, Yuko; Greenberg, E. Peter

    2015-01-01

    The bacterium Rhodopseudomonas palustris grows with the aromatic acid benzoate and the alicyclic acid cyclohexanecarboxylate (CHC) as sole carbon sources. The enzymatic steps in an oxygen-independent pathway for CHC degradation have been elucidated, but it was unknown how the CHC operon (badHI aliAB badK) encoding the enzymes for CHC degradation was regulated. aliA and aliB encode enzymes for the conversion of CHC to cyclohex-1-enecarboxyl–coenzyme A (CHene-CoA). At this point, the pathway for CHC degradation merges with the pathway for anaerobic benzoate degradation, as CHene-CoA is an intermediate in both degradation pathways. Three enzymes, encoded by badK, badH, and badI, prepare and cleave the alicyclic ring of CHene-CoA to yield pimelyl-CoA. Here, we show that the MarR transcription factor family member, BadR, represses transcription of the CHC operon by binding near the transcription start site of badH. 2-Ketocyclohexane-1-carboxyl–CoA, an intermediate of CHC and benzoate degradation, interacts with BadR to abrogate repression. We also present evidence that the transcription factor BadM binds to the promoter of the badDEFGAB (Bad) operon for the anaerobic conversion of benzoate to CHene-CoA to repress its expression. Contrary to previous reports, BadR does not appear to control expression of the Bad operon. These data enhance our view of the transcriptional regulation of anaerobic benzoate degradation by R. palustris. PMID:25888170

  19. Meteorological factors had more impact on airborne bacterial communities than air pollutants.

    PubMed

    Zhen, Quan; Deng, Ye; Wang, Yaqing; Wang, Xiaoke; Zhang, Hongxing; Sun, Xu; Ouyang, Zhiyun

    2017-12-01

    Airborne bacteria have gained increasing attention because they affect ecological balance and pose potential risks on human health. Recently, some studies have focused on the abundance and composition of airborne bacteria under heavy, hazy polluted weather in China, but they reached different conclusions about the comparisons with non-polluted days. In this study, we tested the hypothesis that meteorological factors could have a higher impact on shaping airborne bacterial communities than air pollutants by systematically monitoring the communities for 1year. Total suspended particles in Beijing were sampled for 20 consecutive days in each season of 2015. Bacterial abundance varied from 8.71×10 3 to 2.14×10 7 ribosomal operons per cubic meter according to the quantitative PCR analysis. There were relatively higher bacterial counts in spring and in autumn than in winter and summer. Airborne bacterial communities displayed a strong seasonality, according to the hierarchical cluster analysis. Only two exceptions overtook the seasonal trend, and both occurred in or after violent meteorological changes (sandstorm or rain). Aggregated boosted tree analysis performed on bacterial abundance showed that the dominant factors shaping bacterial communities were meteorological. They were air pressure in winter, air temperature and relative humidity in spring, RH in summer, and vapor pressure in autumn. Variation partition analysis on community structure showed that meteorological factors explained more variations than air pollutants. Therefore, both of the two models verified our hypothesis that the differences in airborne bacterial communities in polluted days or non-polluted days were mainly driven by the discrepancies of meteorological factors rather than by the presence of air pollutants. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. Modular Ligation Extension of Guide RNA Operons (LEGO) for Multiplexed dCas9 Regulation of Metabolic Pathways in Saccharomyces cerevisiae.

    PubMed

    Deaner, Matthew; Holzman, Allison; Alper, Hal S

    2018-04-16

    Metabolic engineering typically utilizes a suboptimal step-wise gene target optimization approach to parse a highly connected and regulated cellular metabolism. While the endonuclease-null CRISPR/Cas system has enabled gene expression perturbations without genetic modification, it has been mostly limited to small sets of gene targets in eukaryotes due to inefficient methods to assemble and express large sgRNA operons. In this work, we develop a TEF1p-tRNA expression system and demonstrate that the use of tRNAs as splicing elements flanking sgRNAs provides higher efficiency than both Pol III and ribozyme-based expression across a variety of single sgRNA and multiplexed contexts. Next, we devise and validate a scheme to allow modular construction of tRNA-sgRNA (TST) operons using an iterative Type IIs digestion/ligation extension approach, termed CRISPR-Ligation Extension of sgRNA Operons (LEGO). This approach enables facile construction of large TST operons. We demonstrate this utility by constructing a metabolic rewiring prototype for 2,3-butanediol production in 2 distinct yeast strain backgrounds. These results demonstrate that our approach can act as a surrogate for traditional genetic modification on a much shorter design-cycle timescale. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Protective effects of D-Trp6-luteinising hormone-releasing hormone microcapsules against cyclophosphamide-induced gonadotoxicity in female rats.

    PubMed

    Bokser, L; Szende, B; Schally, A V

    1990-06-01

    The possible protective effect of an agonist of luteinising hormone-releasing hormone (LH-RH) against the ovarian damage caused by cyclophosphamide was investigated in rats. D-Trp6-LH-RH microcapsules were injected once a month for 3 months, in a dose calculated to release 25 micrograms day-1. Control animals received the injection vehicle. Sixty days after the first injection of microcapsules, cyclophosphamide was given at a loading dose of 50 mg kg-1 followed by 5 mg kg-1 day-1 for 30 days, while the treatment with D-Trp6-LH-RH was continued. When the ovaries were examined 3 months and 5 months after discontinuation of treatment, a significant reduction in the total number of follicles (P less than 0.01) was found in non-pretreated animals given cyclophosphamide. This reduction affected mainly follicles larger than 100 microns. An irreversible disintegration and destruction of granulosa cells was also observed in this group. In animals pretreated with D-Trp6-LH-RH, administration of cyclophosphamide caused no reduction in the number and diameter of follicles. Thus, the treatment with D-Trp6-LH-RH microcapsules before and during chemotherapy prevented the ovarian injury inflicted by cyclophosphamide. The suppression of gonadal function by LH-RH analogues could be possibly utilised for the protection of the ovaries against damage caused by cytotoxic drugs.

  2. Protective effects of D-Trp6-luteinising hormone-releasing hormone microcapsules against cyclophosphamide-induced gonadotoxicity in female rats.

    PubMed Central

    Bokser, L.; Szende, B.; Schally, A. V.

    1990-01-01

    The possible protective effect of an agonist of luteinising hormone-releasing hormone (LH-RH) against the ovarian damage caused by cyclophosphamide was investigated in rats. D-Trp6-LH-RH microcapsules were injected once a month for 3 months, in a dose calculated to release 25 micrograms day-1. Control animals received the injection vehicle. Sixty days after the first injection of microcapsules, cyclophosphamide was given at a loading dose of 50 mg kg-1 followed by 5 mg kg-1 day-1 for 30 days, while the treatment with D-Trp6-LH-RH was continued. When the ovaries were examined 3 months and 5 months after discontinuation of treatment, a significant reduction in the total number of follicles (P less than 0.01) was found in non-pretreated animals given cyclophosphamide. This reduction affected mainly follicles larger than 100 microns. An irreversible disintegration and destruction of granulosa cells was also observed in this group. In animals pretreated with D-Trp6-LH-RH, administration of cyclophosphamide caused no reduction in the number and diameter of follicles. Thus, the treatment with D-Trp6-LH-RH microcapsules before and during chemotherapy prevented the ovarian injury inflicted by cyclophosphamide. The suppression of gonadal function by LH-RH analogues could be possibly utilised for the protection of the ovaries against damage caused by cytotoxic drugs. Images Figure 2 PMID:2142603

  3. Comprehensive Structural Characterization of the Bacterial Homospermidine Synthase–an Essential Enzyme of the Polyamine Metabolism

    PubMed Central

    Krossa, Sebastian; Faust, Annette; Ober, Dietrich; Scheidig, Axel J.

    2016-01-01

    The highly conserved bacterial homospermidine synthase (HSS) is a key enzyme of the polyamine metabolism of many proteobacteria including pathogenic strains such as Legionella pneumophila and Pseudomonas aeruginosa; The unique usage of NAD(H) as a prosthetic group is a common feature of bacterial HSS, eukaryotic HSS and deoxyhypusine synthase (DHS). The structure of the bacterial enzyme does not possess a lysine residue in the active center and thus does not form an enzyme-substrate Schiff base intermediate as observed for the DHS. In contrast to the DHS the active site is not formed by the interface of two subunits but resides within one subunit of the bacterial HSS. Crystal structures of Blastochloris viridis HSS (BvHSS) reveal two distinct substrate binding sites, one of which is highly specific for putrescine. BvHSS features a side pocket in the direct vicinity of the active site formed by conserved amino acids and a potential substrate discrimination, guiding, and sensing mechanism. The proposed reaction steps for the catalysis of BvHSS emphasize cation-π interaction through a conserved Trp residue as a key stabilizer of high energetic transition states. PMID:26776105

  4. Gene structure and transcriptional organization of the dnaK operon of Bifidobacterium breve UCC 2003 and application of the operon in bifidobacterial tracing.

    PubMed

    Ventura, Marco; Zink, Ralf; Fitzgerald, Gerald F; van Sinderen, Douwe

    2005-01-01

    The incorporation and delivery of bifidobacterial strains as probiotic components in many food preparations expose these microorganisms to a multitude of environmental insults, including heat and osmotic stresses. We characterized the dnaK gene region of Bifidobacterium breve UCC 2003. Sequence analysis of the dnaK locus revealed four genes with the organization dnaK-grpE-dnaJ-ORF1, whose deduced protein products display significant similarity to corresponding chaperones found in other bacteria. Northern hybridization and real-time LightCycler PCR analysis revealed that the transcription of the dnaK operon was strongly induced by osmotic shock but was not induced significantly by heat stress. A 4.4-kb polycistronic mRNA, which represented the transcript of the complete dnaK gene region, was detected. Many other small transcripts, which were assumed to have resulted from intensive processing or degradation of this polycistronic mRNA, were identified. The transcription start site of the dnaK operon was determined by primer extension. Phylogenetic analysis of the available bifidobacterial grpE and dnaK genes suggested that the evolutionary development of these genes has been similar. The phylogeny derived from the various bifidobacterial grpE and dnaK sequences is consistent with that derived from 16S rRNA. The use of these genes in bifidobacterial species as an alternative or complement to the 16S rRNA gene marker provides sequence signatures that allow a high level of discrimination between closely related species of this genus.

  5. The Mannitol Operon Repressor MTIR belongs to a new class of transcription regulators in bacteria.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tan, K.; Borovilos, M.; Zhou, M

    2009-12-25

    Many bacteria express phosphoenolpyruvate-dependent phosphotransferase systems (PTS). The mannitol-specific PTS catalyze the uptake and phosphorylation of d-mannitol. The uptake system comprises several genes encoded in the single operon. The expression of the mannitol operon is regulated by a proposed transcriptional factor, mannitol operon repressor (MtlR) that was first studied in Escherichia coli. Here we report the first crystal structures of MtlR from Vibrio parahemeolyticus (Vp-MtlR) and its homolog YggD protein from Shigella flexneri (Sf-YggD). MtlR and YggD belong to the same protein family (Pfam05068). Although Vp-MtlR and Sf-YggD share low sequence identity (22%), their overall structures are very similar, representingmore » a novel all {alpha}-helical fold, and indicate similar function. However, their lack of any known DNA-binding structural motifs and their unfavorable electrostatic properties imply that MtlR/YggD are unlikely to bind a specific DNA operator directly as proposed earlier. This structural observation is further corroborated by in vitro DNA-binding studies of E. coli MtlR (Ec-MtlR), which detected no interaction of Ec-MtlR with the well characterized mannitol operator/promoter region. Therefore, MtlR/YggD belongs to a new class of transcription factors in bacteria that may regulate gene expression indirectly as a part of a larger transcriptional complex.« less

  6. Cloning, sequencing, and expression of dnaK-operon proteins from the thermophilic bacterium Thermus thermophilus.

    PubMed

    Osipiuk, J; Joachimiak, A

    1997-09-12

    We propose that the dnaK operon of Thermus thermophilus HB8 is composed of three functionally linked genes: dnaK, grpE, and dnaJ. The dnaK and dnaJ gene products are most closely related to their cyanobacterial homologs. The DnaK protein sequence places T. thermophilus in the plastid Hsp70 subfamily. In contrast, the grpE translated sequence is most similar to GrpE from Clostridium acetobutylicum, a Gram-positive anaerobic bacterium. A single promoter region, with homology to the Escherichia coli consensus promoter sequences recognized by the sigma70 and sigma32 transcription factors, precedes the postulated operon. This promoter is heat-shock inducible. The dnaK mRNA level increased more than 30 times upon 10 min of heat shock (from 70 degrees C to 85 degrees C). A strong transcription terminating sequence was found between the dnaK and grpE genes. The individual genes were cloned into pET expression vectors and the thermophilic proteins were overproduced at high levels in E. coli and purified to homogeneity. The recombinant T. thermophilus DnaK protein was shown to have a weak ATP-hydrolytic activity, with an optimum at 90 degrees C. The ATPase was stimulated by the presence of GrpE and DnaJ. Another open reading frame, coding for ClpB heat-shock protein, was found downstream of the dnaK operon.

  7. Genomic analysis of a xylose operon and characterization of novel xylose isomerase and xylulokinase from Bacillus coagulans NL01.

    PubMed

    Zheng, Zhaojuan; Lin, Xi; Jiang, Ting; Ye, Weihua; Ouyang, Jia

    2016-08-01

    To investigate the xylose operon and properties of xylose isomerase and xylulokinase in Bacillus coagulans that can effectively ferment xylose to lactic acid. The xylose operon is widely present in B. coagulans. It is composed of four putative ORFs. Novel xylA and xylB from B. coagulans NL01 were cloned and expressed in Escherichia coli. Sequence of xylose isomerase was more conserved than that of xylulokinase. Both the enzymes exhibited maximum activities at pH 7-8 but with a high temperature maximum of 80-85 °C, divalent metal ion was prerequisite for their activation. Xylose isomerase and xylulokinase were most effectively activated by Ni(2+) and Co(2+), respectively. Genomic analysis of xylose operon has contributed to understanding xylose metabolism in B. coagulans and the novel xylose isomerase and xylulokinase might provide new alternatives for metabolic engineering of other strains to improve their fermentation performance on xylose.

  8. Induction of surfactin production in Bacillus subtilis by gsp, a gene located upstream of the gramicidin S operon in Bacillus brevis.

    PubMed Central

    Borchert, S; Stachelhaus, T; Marahiel, M A

    1994-01-01

    The deduced amino acid sequence of the gsp gene, located upstream of the 5' end of the gramicidin S operon (grs operon) in Bacillus brevis, showed a high degree of similarity to the sfp gene product, which is located downstream of the srfA operon in B. subtilis. The gsp gene complemented in trans a defect in the sfp gene (sfpO) and promoted production of the lipopeptide antibiotic surfactin. The functional homology of Gsp and Sfp and the sequence similarity of these two proteins to EntD suggest that the three proteins represent a new class of proteins involved in peptide secretion, in support of a hypothesis published previously (T. H. Grossman, M. Tuckman, S. Ellestad, and M. S. Osburne, J. Bacteriol. 175:6203-6211, 1993). Images PMID:7512553

  9. Structure-activity relationship of linear peptide Bu-His-DPhe-Arg-Trp-Gly-NH(2) at the human melanocortin-1 and -4 receptors: histidine substitution.

    PubMed

    Cheung, Adrian Wai-Hing; Danho, Waleed; Swistok, Joseph; Qi, Lida; Kurylko, Grazyna; Rowan, Karen; Yeon, Mitch; Franco, Lucia; Chu, Xin-Jie; Chen, Li; Yagaloff, Keith

    2003-01-06

    Systematic substitution of His(6) residue using non-selective hMC4R pentapeptide agonist (Bu-His(6)-DPhe(7)-Arg(8)-Trp(9)-Gly(10)-NH(2)) as the template led to the identification of Bu-Atc(6)(2-aminotetraline-2-carboxylic acid)-DPhe(7)-Arg(8)-Trp(9)-Gly(10)-NH(2) which showed moderate selectivity towards hMC4R over hMC1R. Further SAR studies resulted in the discovery of Penta-5-BrAtc(6)-DPhe(7)-Arg(8)-Trp(9)-Gly(10)-NH(2) and Penta-5-Me(2)NAtc(6)-DPhe(7)-Arg(8)-Trp(9)-Gly(10)-NH(2) which are potent hMC4R agonists and are inactive in hMC1R, hMC3R and hMC5R agonist assays.

  10. Inhibition of pituitary-gonadal axis in mice by long-term administration of D-Trp-6-LHRH microcapsules.

    PubMed

    Bokser, L; Zalatnai, A; Schally, A V

    1989-03-01

    Female mice were injected, every 30 days for 5 months, with a long-acting formulation of microcapsules liberating 2.5 micrograms D-Trp-6-LHRH/day. The control group was injected with vehicle only. At 30 days after the last injection mice were killed, ovaries, uteri and adrenals were weighed and fixed in formalin for histological studies. LH and oestradiol concentrations were measured by RIA. In the D-Trp-6-LHRH-treated group, the weights of the ovaries and uterus (P less than 0.01 and P less than 0.05, respectively), and LH and oestradiol values (P less than 0.02 and P less than 0.01, respectively) were reduced compared to controls. Histologically, the ovaries contained a large number of degenerated, atretic follicles, and corpora lutea had almost completely disappeared. These results indicate, contrary to the prevailing opinion, that mice are sensitive to inhibitory effects of LHRH agonists and that a suppression of the pituitary-gonadal axis can be obtained with long-term administration of D-Trp-6-LHRH microcapsules.

  11. An operon from Lactobacillus helveticus composed of a proline iminopeptidase gene (pepI) and two genes coding for putative members of the ABC transporter family of proteins.

    PubMed

    Varmanen, P; Rantanen, T; Palva, A

    1996-12-01

    A proline iminopeptidase gene (pepI) of an industrial Lactobacillus helveticus strain was cloned and found to be organized in an operon-like structure of three open reading frames (ORF1, ORF2 and ORF3). ORF1 was preceded by a typical prokaryotic promoter region, and a putative transcription terminator was found downstream of ORF3, identified as the pepI gene. Using primer-extension analyses, only one transcription start site, upstream of ORF1, was identifiable in the predicted operon. Although the size of mRNA could not be judged by Northern analysis either with ORF1-, ORF2- or pepI-specific probes, reverse transcription-PCR analyses further supported the operon structure of the three genes. ORF1, ORF2 and ORF3 had coding capacities for 50.7, 24.5 and 33.8 kDa proteins, respectively. The ORF3-encoded PepI protein showed 65% identity with the PepI proteins from Lactobacillus delbrueckii subsp. bulgaricus and Lactobacillus delbrueckii subsp. lactis. The ORF1-encoded protein had significant homology with several members of the ABC transporter family but, with two distinct putative ATP-binding sites, it would represent an unusual type among the bacterial ABC transporters. ORF2 encoded a putative integral membrane protein also characteristic of the ABC transporter family. The pepI gene was overexpressed in Escherichia coli. Purified PepI hydrolysed only di and tripeptides with proline in the first position. Optimum PepI activity was observed at pH 7.5 and 40 degrees C. A gel filtration analysis indicated that PepI is a dimer of M(r) 53,000. PepI was shown to be a metal-independent serine peptidase having thiol groups at or near the active site. Kinetic studies with proline-p-nitroanilide as substrate revealed Km and Vmax values of 0.8 mM and 350 mmol min-1 mg-1, respectively, and a very high turnover number of 135,000 s-1.

  12. Direct cloning from enrichment cultures, a reliable strategy for isolation of complete operons and genes from microbial consortia.

    PubMed

    Entcheva, P; Liebl, W; Johann, A; Hartsch, T; Streit, W R

    2001-01-01

    Enrichment cultures of microbial consortia enable the diverse metabolic and catabolic activities of these populations to be studied on a molecular level and to be explored as potential sources for biotechnology processes. We have used a combined approach of enrichment culture and direct cloning to construct cosmid libraries with large (>30-kb) inserts from microbial consortia. Enrichment cultures were inoculated with samples from five environments, and high amounts of avidin were added to the cultures to favor growth of biotin-producing microbes. DNA was extracted from three of these enrichment cultures and used to construct cosmid libraries; each library consisted of between 6,000 and 35,000 clones, with an average insert size of 30 to 40 kb. The inserts contained a diverse population of genomic DNA fragments isolated from the consortia organisms. These three libraries were used to complement the Escherichia coli biotin auxotrophic strain ATCC 33767 Delta(bio-uvrB). Initial screens resulted in the isolation of seven different complementing cosmid clones, carrying biotin biosynthesis operons. Biotin biosynthesis capabilities and growth under defined conditions of four of these clones were studied. Biotin measured in the different culture supernatants ranged from 42 to 3,800 pg/ml/optical density unit. Sequencing the identified biotin synthesis genes revealed high similarities to bio operons from gram-negative bacteria. In addition, random sequencing identified other interesting open reading frames, as well as two operons, the histidine utilization operon (hut), and the cluster of genes involved in biosynthesis of molybdopterin cofactors in bacteria (moaABCDE).

  13. Crosstalk between virulence loci: regulation of Salmonella enterica pathogenicity island 1 (SPI-1) by products of the std fimbrial operon.

    PubMed

    López-Garrido, Javier; Casadesús, Josep

    2012-01-01

    Invasion of intestinal epithelial cells is a critical step in Salmonella infection and requires the expression of genes located in Salmonella pathogenicity island 1 (SPI-1). A key factor for SPI-1 expression is DNA adenine (Dam) methylation, which activates synthesis of the SPI-1 transcriptional activator HilD. Dam-dependent regulation of hilD is postranscriptional (and therefore indirect), indicating the involvement of unknown cell functions under Dam methylation control. A genetic screen has identified the std fimbrial operon as the missing link between Dam methylation and SPI-1. We show that all genes in the std operon are part of a single transcriptional unit, and describe three previously uncharacterized ORFs (renamed stdD, stdE, and stdF). We present evidence that two such loci (stdE and stdF) are involved in Dam-dependent control of Salmonella SPI-1: in a Dam(-) background, deletion of stdE or stdF suppresses SPI-1 repression; in a Dam(+) background, constitutive expression of StdE and/or StdF represses SPI-1. Repression of SPI-1 by products of std operon explains the invasion defect of Salmonella Dam(-) mutants, which constitutively express the std operon. Dam-dependent repression of std in the ileum may be required to permit invasion, as indicated by two observations: constitutive expression of StdE and StdF reduces invasion of epithelial cells in vitro (1,000 fold) and attenuates Salmonella virulence in the mouse model (>60 fold). In turn, crosstalk between std and SPI-1 may play a role in intestinal infections by preventing expression of SPI-1 in the caecum, an intestinal compartment in which the std operon is known to be expressed.

  14. A Coarse-Grained Biophysical Model of E. coli and Its Application to Perturbation of the rRNA Operon Copy Number

    PubMed Central

    Tadmor, Arbel D.; Tlusty, Tsvi

    2008-01-01

    We propose a biophysical model of Escherichia coli that predicts growth rate and an effective cellular composition from an effective, coarse-grained representation of its genome. We assume that E. coli is in a state of balanced exponential steady-state growth, growing in a temporally and spatially constant environment, rich in resources. We apply this model to a series of past measurements, where the growth rate and rRNA-to-protein ratio have been measured for seven E. coli strains with an rRNA operon copy number ranging from one to seven (the wild-type copy number). These experiments show that growth rate markedly decreases for strains with fewer than six copies. Using the model, we were able to reproduce these measurements. We show that the model that best fits these data suggests that the volume fraction of macromolecules inside E. coli is not fixed when the rRNA operon copy number is varied. Moreover, the model predicts that increasing the copy number beyond seven results in a cytoplasm densely packed with ribosomes and proteins. Assuming that under such overcrowded conditions prolonged diffusion times tend to weaken binding affinities, the model predicts that growth rate will not increase substantially beyond the wild-type growth rate, as indicated by other experiments. Our model therefore suggests that changing the rRNA operon copy number of wild-type E. coli cells growing in a constant rich environment does not substantially increase their growth rate. Other observations regarding strains with an altered rRNA operon copy number, such as nucleoid compaction and the rRNA operon feedback response, appear to be qualitatively consistent with this model. In addition, we discuss possible design principles suggested by the model and propose further experiments to test its validity. PMID:18437222

  15. Water-mediated contacts in the trp-repressor operator complex recognition process.

    PubMed

    Wibowo, Fajar R; Rauch, Christine; Trieb, Michael; Wellenzohn, Bernd; Liedl, Klaus R

    2004-04-15

    Water-mediated contacts are known as an important recognition tool in trp-repressor operator systems. One of these contacts involves two conserved base pairs (G(6).C(-6) and A(5). T(-5)) and three amino acids (Lys 72, Ile 79, and Ala 80). To investigate the nature of these contacts, we analyzed the X-ray structure (PDB code: 1TRO) of the trp-repressor operator complex by means of molecular dynamics simulations. This X-ray structure contains two dimers that exhibit structural differences. From these two different starting structures, two 10 ns molecular dynamics simulations have been performed. Both of our simulations show an increase of water molecules in the major groove at one side of the dimer, while the other side remains unchanged compared to the X-ray structure. Though the maximum residence time of the concerned water molecules decreases with an increase of solvent at the interface, these water molecules continue to play an important role in mediating DNA-protein contacts. This is shown by new stable amino acids-DNA distances and a long water residence time compared to free DNA simulation. To maintain stability of the new contacts, the preferential water binding site on O6(G6) is extended. This extension agrees with mutation experiment data on A5 and G6, which shows different relative affinity due to mutation on these bases [A. Joachimiak, T. E. Haran, P. B. Sigler, EMBO Journal 1994, Vol. 13, No. (2) pp. 367-372]. Due to the rearrangements in the system, the phosphate of the base G6 is able to interconvert to the B(II) substate, which is not observed on the other half side of the complex. The decrease of the number of hydrogen bonds between protein and DNA backbone could be the initial step of the dissociation process of the complex, or in other words an intermediate complex conformation of the association process. Thus, we surmise that these features show the importance of water-mediated contacts in the trp-repressor operator recognition process. Copyright

  16. Coordination of the Arc Regulatory System and Pheromone-Mediated Positive Feedback in Controlling the Vibrio fischeri lux Operon

    PubMed Central

    Septer, Alecia N.; Stabb, Eric V.

    2012-01-01

    Bacterial pheromone signaling is often governed both by environmentally responsive regulators and by positive feedback. This regulatory combination has the potential to coordinate a group response among distinct subpopulations that perceive key environmental stimuli differently. We have explored the interplay between an environmentally responsive regulator and pheromone-mediated positive feedback in intercellular signaling by Vibrio fischeri ES114, a bioluminescent bacterium that colonizes the squid Euprymna scolopes. Bioluminescence in ES114 is controlled in part by N-(3-oxohexanoyl)-L-homoserine lactone (3OC6), a pheromone produced by LuxI that together with LuxR activates transcription of the luxICDABEG operon, initiating a positive feedback loop and inducing luminescence. The lux operon is also regulated by environmentally responsive regulators, including the redox-responsive ArcA/ArcB system, which directly represses lux in culture. Here we show that inactivating arcA leads to increased 3OC6 accumulation to initiate positive feedback. In the absence of positive feedback, arcA-mediated control of luminescence was only ∼2-fold, but luxI-dependent positive feedback contributed more than 100 fold to the net induction of luminescence in the arcA mutant. Consistent with this overriding importance of positive feedback, 3OC6 produced by the arcA mutant induced luminescence in nearby wild-type cells, overcoming their ArcA repression of lux. Similarly, we found that artificially inducing ArcA could effectively repress luminescence before, but not after, positive feedback was initiated. Finally, we show that 3OC6 produced by a subpopulation of symbiotic cells can induce luminescence in other cells co-colonizing the host. Our results suggest that even transient loss of ArcA-mediated regulation in a sub-population of cells can induce luminescence in a wider community. Moreover, they indicate that 3OC6 can communicate information about both cell density and the state of

  17. Increase methylmercury accumulation in Arabidopsis thaliana expressing bacterial broad-spectrum mercury transporter MerE

    PubMed Central

    2013-01-01

    The bacterial merE gene derived from the Tn21 mer operon encodes a broad-spectrum mercury transporter that governs the transport of methylmercury and mercuric ions across bacterial cytoplasmic membranes, and this gene is a potential molecular tool for improving the efficiency of methylmercury phytoremediation. A transgenic Arabidopsis engineered to express MerE was constructed and the impact of expression of MerE on methylmercury accumulation was evaluated. The subcellular localization of transiently expressed GFP-tagged MerE was examined in Arabidopsis suspension-cultured cells. The GFP-MerE was found to localize to the plasma membrane and cytosol. The transgenic Arabidopsis expressing MerE accumulated significantly more methymercury and mercuric ions into plants than the wild-type Arabidopsis did. The transgenic plants expressing MerE was significantly more resistant to mercuric ions, but only showed more resistant to methylmercury compared with the wild type Arabidopsis. These results demonstrated that expression of the bacterial mercury transporter MerE promoted the transport and accumulation of methylmercury in transgenic Arabidopsis, which may be a useful method for improving plants to facilitate the phytoremediation of methylmercury pollution. PMID:24004544

  18. Gadolinium and ruthenium red attenuate remote hind limb preconditioning-induced cardioprotection: possible role of TRP and especially TRPV channels.

    PubMed

    Randhawa, Puneet Kaur; Jaggi, Amteshwar Singh

    2016-08-01

    Remote ischemic preconditioning is a well reported therapeutic strategy that induces cardioprotective effects but the underlying intracellular mechanisms have not been widely explored. The current study was designed to investigate the involvement of TRP and especially TRPV channels in remote hind limb preconditioning-induced cardioprotection. Remote hind limb preconditioning stimulus (4 alternate cycles of inflation and deflation of 5 min each) was delivered using a blood pressure cuff tied on the hind limb of the anesthetized rat. Using Langendorff's system, the heart was perfused and subjected to 30-min ischemia and 120-min reperfusion. The myocardial injury was assessed by measuring infarct size, lactate dehydrogenase (LDH), creatine kinase (CK), LVDP, +dp/dtmax, -dp/dtmin, heart rate, and coronary flow rate. Gadolinium, TRP blocker, and ruthenium red, TRPV channel blocker, were employed as pharmacological tools. Remote hind limb preconditioning significantly reduced the infarct size, LDH release, CK release and improved coronary flow rate, hemodynamic parameters including LVDP, +dp/dtmax, -dp/dtmin, and heart rate. However, gadolinium (7.5 and 15 mg kg(-1)) and ruthenium red (4 and 8 mg kg(-1)) significantly attenuated the cardioprotective effects suggesting the involvement of TRP especially TRPV channels in mediating remote hind limb preconditioning-induced cardioprotection. Remote hind limb preconditioning stimulus possibly activates TRPV channels on the heart or sensory nerve fibers innervating the heart to induce cardioprotective effects. Alternatively, remote hind limb preconditioning stimulus may also activate the mechanosensitive TRP and especially TRPV channels on the sensory nerve fibers innervating the skeletal muscles to trigger cardioprotective neurogenic signaling cascade. The cardioprotective effects of remote hind limb preconditioning may be mediated via activation of mechanosensitive TRP and especially TRPV channels.

  19. Biometal binding-site mimicry with modular, hetero-bifunctionally modified architecture encompassing a Trp/His motif: insights into spatiotemporal noncovalent interactions from a comparative spectroscopic study.

    PubMed

    Yang, Chi Ming

    2011-03-28

    Metal-site Trp/His interactions are crucial to diverse metalloprotein functions. This paper presents a study using metal-motif mimicry to capture and dissect the static and transient components of physicochemical properties underlying the Trp/His aromatic side-chain noncovalent interactions across the first- and second-coordination spheres of biometal ions. Modular biomimetic constructs, EDTA-(L-Trp, L-His) or EWH and DTPA-(L-Trp, L-His) or DWH, featuring a function-significant Trp/His pair, enabled extracting the putative hydrophobic/hydrophilic aromatic interactions surrounding metal centers. Fluorescence, circular dichroism (CD) spectroscopic titrations and ESI mass spectrometry demonstrated that both the constructs stoichiometrically bind to Ca(2+), Co(2+), Cu(2+), Ni(2+), Mn(2+), Zn(2+), Cd(2+), and Fe(2+), and such binding was strongly coupled to stereospecific side-chain structure reorientations of the Trp indole and His imidazole rings. A mechanistic dichotomy corresponding to the participation of the indole unit in the binding event was revealed by a scaffold-platform correlation of steady-state fluorescence-response landscape, illuminating that secondary-coordination-sphere ligand cation-π interactions were immediately followed by subsequent transient physicochemical processes including through-space energy transfer, charge transfer and/or electron transfer, depending on the type of metals. The fluorescence quenching of Trp side chain by 3d metal ions can be ascribed to through-space d-π interactions. While the fluorescence titration was capable of illuminating a two-component energetic model, clean isosbestic/isodichroic points in the CD titration spectra indicated that the metallo-constructs, such as Cu(2+)-EWH complex, fold thermodynamically by means of a two-state equilibrium. Further, the metal-ion dependence of Trp conformational variation in the modular architecture of metal-bound scaffolds was evidenced unambiguously by the CD spectra and

  20. Transcriptional and Translational Plasticity in Rodent Urinary Bladder TRP Channels with Urinary Bladder Inflammation, Bladder Dysfunction or Postnatal Maturation

    PubMed Central

    Merrill, Liana; Girard, Beatrice M.; May, Victor; Vizzard, Margaret A.

    2013-01-01

    These studies examined transcriptional and translational plasticity of three transient receptor potential (TRP) channels (TRPA1, TRPV1, TRPV4) with established neuronal and non-neuronal expression and functional roles in the lower urinary tract. Mechanosensor and nociceptor roles in either physiological or pathological lower urinary tract states have been suggested for TRPA1, TRPV1 and TRPV4. We have previously demonstrated neurochemical, organizational and functional plasticity in micturition reflex pathways following induction of urinary bladder inflammation using the antineoplastic agent, cyclophosphamide (CYP). More recently, we have characterized similar plasticity in micturition reflex pathways in a transgenic mouse model with chronic urothelial overexpression (OE) of nerve growth factor (NGF) and in a transgenic mouse model with deletion of vasoactive intestinal polypeptide (VIP). In addition, the micturition reflex undergoes postnatal maturation that may also reflect plasticity in urinary bladder TRP channel expression. Thus, we examined plasticity in urinary bladder TRP channel expression in diverse contexts using a combination of quantitative, real-time PCR and western blotting approaches. We demonstrate transcriptional and translational plasticity of urinary bladder TRPA1, TRPV1 and TRVP4 expression. Although the functional significance of urinary bladder TRP channel plasticity awaits further investigation, these studies demonstrate context-(inflammation, postnatal development, NGF-OE, VIP deletion) and tissue-dependent (urothelium + suburothelium, detrusor) plasticity. PMID:22865090

  1. Mammalian cold TRP channels: impact on thermoregulation and energy homeostasis.

    PubMed

    Señarís, Rosa; Ordás, Purificación; Reimúndez, Alfonso; Viana, Félix

    2018-05-01

    Body temperature regulation is a fundamental homeostatic function in homeothermic animals. It is governed by the central nervous system that integrates temperature signals from internal body structures and the skin and provides efferent responses to adjust heat-exchange rates with the environment. Thermoregulation has a major influence on energy balance by regulating food intake as well as heat production and energy expenditure. Surprisingly, although almost 50% of our energy expenditure is dedicated to maintaining homeothermy, very little is yet known about the molecular aspects and the neural wiring involved in the intimate interrelationship between these two critical homeostatic systems. Some non-selective cation channels of the transient receptor potential (TRP) family work as molecular thermal sensors in sensory neurons and other cells. In this review, we discuss recent advances in our understanding of the basic mechanisms responsible for thermoregulation in the cold. We have focused our attention on the role of two cold-activated TRP channels (transient receptor potential melastatin 8 and transient receptor potential ankyrin 1) in body temperature regulation as well as their impact on energy balance and metabolism. A better understanding of the mechanisms coupling thermoregulation to energy homeostasis, including the involvement of thermosensitive TRPs, may uncover additional mechanisms underlying the pathogenesis of obesity and its metabolic consequences in humans, opening new strategies for the diagnosis, treatment, and prevention of this disease.

  2. Relationship between ADD1 Gly460Trp gene polymorphism and essential hypertension in Madeira Island.

    PubMed

    Sousa, Ana Célia; Palma Dos Reis, Roberto; Pereira, Andreia; Borges, Sofia; Freitas, Ana Isabel; Guerra, Graça; Góis, Teresa; Rodrigues, Mariana; Henriques, Eva; Freitas, Sónia; Ornelas, Ilídio; Pereira, Décio; Brehm, António; Mendonça, Maria Isabel

    2017-10-01

    Essential hypertension (EH) is a complex disease in which physiological, environmental, and genetic factors are involved in its genesis. The genetic variant of the alpha-adducin gene (ADD1) has been described as a risk factor for EH, but with controversial results.The objective of this study was to evaluate the association of ADD1 (Gly460Trp) gene polymorphism with the EH risk in a population from Madeira Island.A case-control study with 1614 individuals of Caucasian origin was performed, including 817 individuals with EH and 797 controls. Cases and controls were matched for sex and age, by frequency-matching method. All participants collected blood for biochemical and genotypic analysis for the Gly460Trp polymorphism. We further investigated which variables were independently associated to EH, and, consequently, analyzed their interactions.In our study, we found a significant association between the ADD1 gene polymorphism and EH (odds ratio 2.484, P = .01). This association remained statistically significant after the multivariate analysis (odds ratio 2.548, P = .02).The ADD1 Gly460Trp gene polymorphism is significantly and independently associated with EH risk in our population. The knowledge of genetic polymorphisms associated with EH is of paramount importance because it leads to a better understanding of the etiology and pathophysiology of this pathology.

  3. Relationship between ADD1 Gly460Trp gene polymorphism and essential hypertension in Madeira Island

    PubMed Central

    Sousa, Ana Célia; Palma dos Reis, Roberto; Pereira, Andreia; Borges, Sofia; Freitas, Ana Isabel; Guerra, Graça; Góis, Teresa; Rodrigues, Mariana; Henriques, Eva; Freitas, Sónia; Ornelas, Ilídio; Pereira, Décio; Brehm, António; Mendonça, Maria Isabel

    2017-01-01

    Abstract Essential hypertension (EH) is a complex disease in which physiological, environmental, and genetic factors are involved in its genesis. The genetic variant of the alpha-adducin gene (ADD1) has been described as a risk factor for EH, but with controversial results. The objective of this study was to evaluate the association of ADD1 (Gly460Trp) gene polymorphism with the EH risk in a population from Madeira Island. A case-control study with 1614 individuals of Caucasian origin was performed, including 817 individuals with EH and 797 controls. Cases and controls were matched for sex and age, by frequency-matching method. All participants collected blood for biochemical and genotypic analysis for the Gly460Trp polymorphism. We further investigated which variables were independently associated to EH, and, consequently, analyzed their interactions. In our study, we found a significant association between the ADD1 gene polymorphism and EH (odds ratio 2.484, P = .01). This association remained statistically significant after the multivariate analysis (odds ratio 2.548, P = .02). The ADD1 Gly460Trp gene polymorphism is significantly and independently associated with EH risk in our population. The knowledge of genetic polymorphisms associated with EH is of paramount importance because it leads to a better understanding of the etiology and pathophysiology of this pathology. PMID:29049185

  4. Direct Binding between Pre-S1 and TRP-like Domains in TRPP Channels Mediates Gating and Functional Regulation by PIP2.

    PubMed

    Zheng, Wang; Cai, Ruiqi; Hofmann, Laura; Nesin, Vasyl; Hu, Qiaolin; Long, Wentong; Fatehi, Mohammad; Liu, Xiong; Hussein, Shaimaa; Kong, Tim; Li, Jingru; Light, Peter E; Tang, Jingfeng; Flockerzi, Veit; Tsiokas, Leonidas; Chen, Xing-Zhen

    2018-02-06

    Transient receptor potential (TRP) channels are regulated by diverse stimuli comprising thermal, chemical, and mechanical modalities. They are also commonly regulated by phosphatidylinositol-4,5-bisphosphate (PIP2), with underlying mechanisms largely unknown. We here revealed an intramolecular interaction of the TRPP3 N and C termini (N-C) that is functionally essential. The interaction was mediated by aromatic Trp81 in pre-S1 domain and cationic Lys568 in TRP-like domain. Structure-function analyses revealed similar N-C interaction in TRPP2 as well as TRPM8/-V1/-C4 via highly conserved tryptophan and lysine/arginine residues. PIP2 bound to cationic residues in TRPP3, including K568, thereby disrupting the N-C interaction and negatively regulating TRPP3. PIP2 had similar negative effects on TRPP2. Interestingly, we found that PIP2 facilitates the N-C interaction in TRPM8/-V1, resulting in channel potentiation. The intramolecular N-C interaction might represent a shared mechanism underlying the gating and PIP2 regulation of TRP channels. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

  5. The perturbation of tryptophan fluorescence by phenylalanine to alanine mutations identifies the hydrophobic core in a subset of bacterial Ig-like domains.

    PubMed

    Raman, Rajeev; Ptak, Christopher P; Hsieh, Ching-Lin; Oswald, Robert E; Chang, Yung-Fu; Sharma, Yogendra

    2013-07-09

    Many host-parasite interactions are mediated via surface-exposed proteins containing bacterial immunoglobulin-like (Big) domains. Here, we utilize the spectral properties of a conserved Trp to provide evidence that, along with a Phe, these residues are positioned within the hydrophobic core of a subset of Big_2 domains. The mutation of the Phe to Ala decreases Big_2 domain stability and impairs the ability of LigBCen2 to bind to the host protein, fibronectin.

  6. Trp64Arg Polymorphism in Beta3-Adrenergic Receptor Gene Is Associated with Decreased Fat Oxidation Both in Resting and Aerobic Exercise in the Japanese Male

    PubMed Central

    Morita, Emiko; Taniguchi, Hiroshi; Sakaue, Motoyoshi

    2009-01-01

    The purpose of our study was to investigate whether the Trp64Arg polymorphism in β3-AR gene and the −3826A/G polymorphism in the UCP1 gene were associated with the reduction in energy expenditure and fat oxidation both in resting and aerobic exercise in Japanese. Eighty-six nonobese young healthy Japanese were recruited. Energy expenditure was measured using indirect calorimetry. The subjects performed an aerobic exercise program at 60% of their maximal heart rate for 30 minutes. The level of fat oxidation at rest and aerobic exercise of the male subjects with Trp/Arg of the β3-AR gene was significantly lower than that of the Trp/Trp genotype. No difference in FO0−30 was observed in the female subjects. There was no association between UCP-1 polymorphism and energy expenditure during aerobic exercise. It was revealed that the Trp64Arg polymorphism in β3-AR gene is associated with reduction of fat oxidation both in resting and aerobic exercise in healthy, young Japanese males. PMID:20069060

  7. Trp64Arg polymorphism in beta3-adrenergic receptor gene is associated with decreased fat oxidation both in resting and aerobic exercise in the Japanese male.

    PubMed

    Morita, Emiko; Taniguchi, Hiroshi; Sakaue, Motoyoshi

    2009-01-01

    The purpose of our study was to investigate whether the Trp64Arg polymorphism in beta3-AR gene and the -3826A/G polymorphism in the UCP1 gene were associated with the reduction in energy expenditure and fat oxidation both in resting and aerobic exercise in Japanese. Eighty-six nonobese young healthy Japanese were recruited. Energy expenditure was measured using indirect calorimetry. The subjects performed an aerobic exercise program at 60% of their maximal heart rate for 30 minutes. The level of fat oxidation at rest and aerobic exercise of the male subjects with Trp/Arg of the beta3-AR gene was significantly lower than that of the Trp/Trp genotype. No difference in FO(0-30) was observed in the female subjects. There was no association between UCP-1 polymorphism and energy expenditure during aerobic exercise. It was revealed that the Trp64Arg polymorphism in beta3-AR gene is associated with reduction of fat oxidation both in resting and aerobic exercise in healthy, young Japanese males.

  8. The Mercury Resistance Operon: From an Origin in a Geothermal Environment to an Efficient Detoxification Machine

    PubMed Central

    Boyd, Eric S.; Barkay, Tamar

    2012-01-01

    Mercuric mercury (Hg[II]) is a highly toxic and mobile element that is likely to have had a pronounced and adverse effect on biology since Earth’s oxygenation ∼2.4 billion years ago due to its high affinity for protein sulfhydryl groups, which upon binding destabilize protein structure and decrease enzyme activity, resulting in a decreased organismal fitness. The central enzyme in the microbial mercury detoxification system is the mercuric reductase (MerA) protein, which catalyzes the reduction of Hg(II) to volatile Hg(0). In addition to MerA, mer operons encode for proteins involved in regulation, Hg binding, and organomercury degradation. Mer-mediated approaches have had broad applications in the bioremediation of mercury-contaminated environments and industrial waste streams. Here, we examine the composition of 272 individual mer operons and quantitatively map the distribution of mer-encoded functions on both taxonomic SSU rRNA gene and MerA phylogenies. The results indicate an origin and early evolution of MerA among thermophilic bacteria and an overall increase in the complexity of mer operons through evolutionary time, suggesting continual gene recruitment and evolution leading to an improved efficiency and functional potential of the Mer detoxification system. Consistent with a positive relationship between the evolutionary history and topology of MerA and SSU rRNA gene phylogenies (Mantel R = 0.81, p < 0.01), the distribution of the majority of mer functions, when mapped on these phylograms, indicates an overall tendency to inherit mer-encoded functions through vertical descent. However, individual mer functions display evidence of a variable degree of vertical inheritance, with several genes exhibiting strong evidence for acquisition via lateral gene transfer and/or gene loss. Collectively, these data suggest that (i) mer has evolved from a simple system in geothermal environments to a widely distributed and more complex and efficient

  9. Replacement of the yeast TRP4 3' untranslated region by a hammerhead ribozyme results in a stable and efficiently exported mRNA that lacks a poly(A) tail.

    PubMed Central

    Düvel, Katrin; Valerius, Oliver; Mangus, David A; Jacobson, Allan; Braus, Gerhard H

    2002-01-01

    The mRNA poly(A) tail serves different purposes, including the facilitation of nuclear export, mRNA stabilization, efficient translation, and, finally, specific degradation. The posttranscriptional addition of a poly(A) tail depends on sequence motifs in the 3' untranslated region (3' UTR) of the mRNA and a complex trans-acting protein machinery. In this study, we have replaced the 3' UTR of the yeast TRP4 gene with sequences encoding a hammerhead ribozyme that efficiently cleaves itself in vivo. Expression of the TRP4-ribozyme allele resulted in the accumulation of a nonpolyadenylated mRNA. Cells expressing the TRP4-ribozyme mRNA showed a reduced growth rate due to a reduction in Trp4p enzyme activity. The reduction in enzyme activity was not caused by inefficient mRNA export from the nucleus or mRNA destabilization. Rather, analyses of mRNA association with polyribosomes indicate that translation of the ribozyme-containing mRNA is impaired. This translational defect allows sufficient synthesis of Trp4p to support growth of trp4 cells, but is, nevertheless, of such magnitude as to activate the general control network of amino acid biosynthesis. PMID:12003493

  10. The equilibrium properties and folding kinetics of an all-atom Go xAF model of the Trp-cage

    NASA Astrophysics Data System (ADS)

    Linhananta, Apichart; Boer, Jesse; MacKay, Ian

    2005-03-01

    The ultrafast-folding 20-residue Trp-cage protein is quickly becoming a new benchmark for molecular dynamics studies. Already several all-atom simulations have probed its equilibrium and kinetic properties. In this work an all-atom Go ¯ model is used to accurately represent the side-chain packing and native atomic contacts of the Trp-cage. The model reproduces the hallmark thermodynamics cooperativity of small proteins. Folding simulations observe that in the fast-folding dominant pathway, partial α-helical structure forms before hydrophobic core collapse. In the slow-folding secondary pathway, partial core collapse occurs before helical structure. The slow-folding rate of the secondary pathway is attributed to the loss of side-chain rotational freedom, due to the early core collapse, which impedes the helix formation. A major finding is the observation of a low-temperature kinetic intermediate stabilized by a salt bridge between residues Asp-9 and Arg-16. Similar observations [R. Zhou, Proc. Natl. Acad. Sci. U.S.A. 100, 13280 (2003)] were reported in a recent study using an all-atom model of the Trp-cage in explicit water, in which the salt-bridge stabilized intermediate was hypothesized to be the origin of the ultrafast-folding mechanism. A theoretical mutation that eliminates the Asp-9-Arg-16 salt bridge, but leaves the residues intact, is performed. Folding simulations of the mutant Trp-cage observe a two-state free-energy landscape with no kinetic intermediate and a significant decrease in the folding rate, in support of the hypothesis.

  11. Synthesis and Pharmacology of α/β(3)-Peptides Based on the Melanocortin Agonist Ac-His-dPhe-Arg-Trp-NH2 Sequence.

    PubMed

    Singh, Anamika; Tala, Srinivasa R; Flores, Viktor; Freeman, Katie; Haskell-Luevano, Carrie

    2015-05-14

    The melanocortin-3 and -4 receptors are expressed in the brain and play key roles in regulating feeding behavior, metabolism, and energy homeostasis. In the present study, incorporation of β(3)-amino acids into a melanocortin tetrapeptide template was investigated. Four linear α/β(3)-hybrid tetrapeptides were designed with the modifications at the Phe, Arg, and Trp residues in the agonist sequence Ac-His-dPhe-Arg-Trp-NH2. The most potent mouse melanocortin-4 receptor (mMC4R) agonist, Ac-His-dPhe-Arg-β(3)hTrp-NH2 (8) showed 35-fold selectivity versus the mMC3R. The study presented here has identified a new template with heterogeneous backbone for designing potent and selective melanocortin receptor ligands.

  12. Synthesis and Pharmacology of α/β3-Peptides Based on the Melanocortin Agonist Ac-His-dPhe-Arg-Trp-NH2 Sequence

    PubMed Central

    2015-01-01

    The melanocortin-3 and -4 receptors are expressed in the brain and play key roles in regulating feeding behavior, metabolism, and energy homeostasis. In the present study, incorporation of β3-amino acids into a melanocortin tetrapeptide template was investigated. Four linear α/β3-hybrid tetrapeptides were designed with the modifications at the Phe, Arg, and Trp residues in the agonist sequence Ac-His-dPhe-Arg-Trp-NH2. The most potent mouse melanocortin-4 receptor (mMC4R) agonist, Ac-His-dPhe-Arg-β3hTrp-NH2 (8) showed 35-fold selectivity versus the mMC3R. The study presented here has identified a new template with heterogeneous backbone for designing potent and selective melanocortin receptor ligands. PMID:26005535

  13. Role of the parCBA Operon of the Broad-Host-Range Plasmid RK2 in Stable Plasmid Maintenance

    PubMed Central

    Easter, Carla L.; Schwab, Helmut; Helinski, Donald R.

    1998-01-01

    The par region of the stably maintained broad-host-range plasmid RK2 is organized as two divergent operons, parCBA and parDE, and a cis-acting site. parDE encodes a postsegregational killing system, and parCBA encodes a resolvase (ParA), a nuclease (ParB), and a protein of unknown function (ParC). The present study was undertaken to further delineate the role of the parCBA region in the stable maintenance of RK2 by first introducing precise deletions in the three genes and then assessing the abilities of the different constructs to stabilize RK2 in three strains of Escherichia coli and two strains of Pseudomonas aeruginosa. The intact parCBA operon was effective in stabilizing a conjugation-defective RK2 derivative in E. coli MC1061K and RR1 but was relatively ineffective in E. coli MV10Δlac. In the two strains in which the parCBA operon was effective, deletions in parB, parC, or both parB and parC caused an approximately twofold reduction in the stabilizing ability of the operon, while a deletion in the parA gene resulted in a much greater loss of parCBA activity. For P. aeruginosa PAO1161Rifr, the parCBA operon provided little if any plasmid stability, but for P. aeruginosa PAC452Rifr, the RK2 plasmid was stabilized to a substantial extent by parCBA. With this latter strain, parA and res alone were sufficient for stabilization. The cer resolvase system of plasmid ColE1 and the loxP/Cre system of plasmid P1 were tested in comparison with the parCBA operon. We found that, not unlike what was previously observed with MC1061K, cer failed to stabilize the RK2 plasmid with par deletions in strain MV10Δlac, but this multimer resolution system was effective in stabilizing the plasmid in strain RR1. The loxP/Cre system, on the other hand, was very effective in stabilizing the plasmid in all three E. coli strains. These observations indicate that the parA gene, along with its res site, exhibits a significant level of plasmid stabilization in the absence of the parC and

  14. The XRCC1 Arg194Trp polymorphism is significantly associated with lung adenocarcinoma: a case-control study in an Eastern European Caucasian group.

    PubMed

    Cătană, Andreea; Pop, Monica; Hincu, Bianca Domokos; Pop, Ioan V; Petrişor, Felicia M; Porojan, Mihai D; Popp, Radu A

    2015-01-01

    DNA repair plays an important role in maintaining the integrity of the genome by repairing DNA damage induced by carcinogens. Certain genetic polymorphisms that occur in DNA-repair genes may affect the ability to repair DNA defects, and may represent a risk factor in carcinogenesis. The gene XRCC1 is involved in DNA repair. The purpose of our study was to investigate the association between XRCC1 Arg194Trp and Arg399Gln polymorphisms and the risk of lung cancer in a Romanian population. We recruited 222 healthy controls and 102 patients with lung cancer. Genotypes were determined by multiplex polymerase chain-reaction restriction fragment-length polymorphism. Statistical analysis (odds ratio, recessive model) revealed an increased risk for lung cancer for the homozygous 194Trp genotype (χ (2)=0.186, odds ratio 10.667, 95% confidence interval 1.309-86.933; P=0.007). Also, we found an association between the 194Trp allele and women with lung adenocarcinoma. In conclusion, the results of the study place the XRCC1 Arg194Trp polymorphism among independent risk factors for developing lung cancer.

  15. Impact of the Gut Microbiota on Intestinal Immunity Mediated by Tryptophan Metabolism

    PubMed Central

    Gao, Jing; Xu, Kang; Liu, Hongnan; Liu, Gang; Bai, Miaomiao; Peng, Can; Li, Tiejun; Yin, Yulong

    2018-01-01

    The gut microbiota influences the health of the host, especially with regard to gut immune homeostasis and the intestinal immune response. In addition to serving as a nutrient enhancer, L-tryptophan (Trp) plays crucial roles in the balance between intestinal immune tolerance and gut microbiota maintenance. Recent discoveries have underscored that changes in the microbiota modulate the host immune system by modulating Trp metabolism. Moreover, Trp, endogenous Trp metabolites (kynurenines, serotonin, and melatonin), and bacterial Trp metabolites (indole, indolic acid, skatole, and tryptamine) have profound effects on gut microbial composition, microbial metabolism, the host's immune system, the host-microbiome interface, and host immune system–intestinal microbiota interactions. The aryl hydrocarbon receptor (AhR) mediates the regulation of intestinal immunity by Trp metabolites (as ligands of AhR), which is beneficial for immune homeostasis. Among Trp metabolites, AhR ligands consist of endogenous metabolites, including kynurenine, kynurenic acid, xanthurenic acid, and cinnabarinic acid, and bacterial metabolites, including indole, indole propionic acid, indole acetic acid, skatole, and tryptamine. Additional factors, such as aging, stress, probiotics, and diseases (spondyloarthritis, irritable bowel syndrome, inflammatory bowel disease, colorectal cancer), which are associated with variability in Trp metabolism, can influence Trp–microbiome–immune system interactions in the gut and also play roles in regulating gut immunity. This review clarifies how the gut microbiota regulates Trp metabolism and identifies the underlying molecular mechanisms of these interactions. Increased mechanistic insight into how the microbiota modulates the intestinal immune system through Trp metabolism may allow for the identification of innovative microbiota-based diagnostics, as well as appropriate nutritional supplementation of Trp to prevent or alleviate intestinal inflammation

  16. Structure-activity relationship studies on a Trp dendrimer with dual activities against HIV and enterovirus A71. Modifications on the amino acid.

    PubMed

    Martínez-Gualda, Belén; Sun, Liang; Rivero-Buceta, Eva; Flores, Aida; Quesada, Ernesto; Balzarini, Jan; Noppen, Sam; Liekens, Sandra; Schols, Dominique; Neyts, Johan; Leyssen, Pieter; Mirabelli, Carmen; Camarasa, María-José; San-Félix, Ana

    2017-03-01

    We have recently described a new class of dendrimers with tryptophan (Trp) on the surface that show dual antiviral activities against HIV and EV71 enterovirus. The prototype compound of this family is a pentaerythritol derivative with 12 Trps on the periphery. Here we complete the structure-activity relationship studies of this family to identify key features that might be significant for the antiviral activity. With this aim, novel dendrimers containing different amino acids (aromatic and non-aromatic), tryptamine (a "decarboxylated" analogue of Trp) and N-methyl Trp on the periphery have been prepared. Dendrimer with N-Methyl Trp was the most active against HIV-1 and HIV-2 while dendrimer with tyrosine was endowed with the most potent antiviral activity against EV71. This tyrosine dendrimer proved to inhibit a large panel of EV71 clinical isolates (belonging to different clusters) in the low nanomolar/high picomolar range. In addition, a new synthetic procedure (convergent approach) has been developed for the synthesis of the prototype and some other dendrimers. This convergent approach proved more efficient (higher yields, easier purification) than the divergent approach previously reported. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  17. Association of XRCC1 Trp194 allele with risk of breast cancer, and Ki67 protein status in breast tumor tissues

    PubMed Central

    Jalali, Chiya; Ghaderi, Bayazid; Amini, Sabrieh; Abdi, Mohammad; Roshani, Daem

    2016-01-01

    Objectives: To evaluate the role of this polymorphism as a risk factor for breast cancer in Kurdish patients and to investigate the possible association between Arg194Trp x-ray repair cross-complementing group 1 (XRCC1) gene polymorphisms with clinical and histopathological outcomes of patients with breast cancer. Methods: A total of 100 breast cancer patients and 200 cancer-free controls in Kurdish population of Kurdistan state admitted to Tohid Hospital, Sanandaj, Kurdistan, Iran between January 2012 and May 2015 were enrolled in this cross-sectional study. Tissue expression of estrogen receptor (ER), progesteron receptor (PR), human epidermal growth factor receptor 2 (Her2/neu), and Ki67 were evaluated by immunohistochemistry (IHC). The Arg194Trp genotypes were determined by polymerase chain reaction- restriction fragment length polymorphism method. Results: Our data showed that the risk for breast cancer increased significantly among the Trp variant of XRCC1. Statistically significant association was found between codon 194 polymorphisms and tissue expression of Ki67. Conclusion: The Trp allele of codon 194 XRCC1 is a potential risk factor for breast cancer in Kurdish ethnicity. Furthermore, effect of this polymorphism on clinical and histological features of breast cancer was significant. PMID:27279507

  18. TRP channels and traffic-related environmental pollution-induced pulmonary disease

    PubMed Central

    Akopian, Armen N.; Fanick, E. Robert

    2016-01-01

    Environmental pollutant exposures are major risk factors for adverse health outcomes, with increased morbidity and mortality in humans. Diesel exhaust (DE) is one of the major harmful components of traffic-related air pollution. Exposure to DE affects several physiological systems, including the airways, and pulmonary diseases are increased in highly populated urban areas. Hence, there are urgent needs to (1) create newer and lesser polluting fuels, (2) improve exhaust aftertreatments and reduce emissions, and (3) understand mechanisms of actions for toxic effects of both conventional and cleaner diesel fuels on the lungs. These steps could aid the development of diagnostics and interventions to prevent the negative impact of traffic-related air pollution on the pulmonary system. Exhaust from conventional, and to a lesser extent, clean fuels, contains particulate matter (PM) and more than 400 additional chemical constituents. The major toxic constituents are nitrogen oxides (NOx) and polycyclic aromatic hydrocarbons (PAHs). PM and PAHs could potentially act via transient receptor potential (TRP) channels. In this review, we will first discuss the associations between DE from conventional as well as clean fuel technologies and acute and chronic airway inflammation. We will then review possible activation and/or potentiation of TRP vanilloid type 1 (TRPV1) and ankyrin 1 (TRPA1) channels by PM and PAHs. Finally, we will discuss and summarize recent findings on the mechanisms whereby TRPs could control the link between DE and airway inflammation, which is a primary determinant leading to pulmonary disease. PMID:26837756

  19. TRP channels and traffic-related environmental pollution-induced pulmonary disease.

    PubMed

    Akopian, Armen N; Fanick, E Robert; Brooks, Edward G

    2016-05-01

    Environmental pollutant exposures are major risk factors for adverse health outcomes, with increased morbidity and mortality in humans. Diesel exhaust (DE) is one of the major harmful components of traffic-related air pollution. Exposure to DE affects several physiological systems, including the airways, and pulmonary diseases are increased in highly populated urban areas. Hence, there are urgent needs to (1) create newer and lesser polluting fuels, (2) improve exhaust aftertreatments and reduce emissions, and (3) understand mechanisms of actions for toxic effects of both conventional and cleaner diesel fuels on the lungs. These steps could aid the development of diagnostics and interventions to prevent the negative impact of traffic-related air pollution on the pulmonary system. Exhaust from conventional, and to a lesser extent, clean fuels, contains particulate matter (PM) and more than 400 additional chemical constituents. The major toxic constituents are nitrogen oxides (NOx) and polycyclic aromatic hydrocarbons (PAHs). PM and PAHs could potentially act via transient receptor potential (TRP) channels. In this review, we will first discuss the associations between DE from conventional as well as clean fuel technologies and acute and chronic airway inflammation. We will then review possible activation and/or potentiation of TRP vanilloid type 1 (TRPV1) and ankyrin 1 (TRPA1) channels by PM and PAHs. Finally, we will discuss and summarize recent findings on the mechanisms whereby TRPs could control the link between DE and airway inflammation, which is a primary determinant leading to pulmonary disease.

  20. A Fluorescent Bioreporter for Acetophenone and 1-Phenylethanol derived from a Specifically Induced Catabolic Operon.

    PubMed

    Muhr, Enrico; Leicht, Oliver; González Sierra, Silvia; Thanbichler, Martin; Heider, Johann

    2015-01-01

    The β-proteobacterium Aromatoleum aromaticum degrades the aromatic ketone acetophenone, a key intermediate of anaerobic ethylbenzene metabolism, either aerobically or anaerobically via a complex ATP-dependent acetophenone carboxylase and a benzoylacetate-CoA ligase. The genes coding for these enzymes (apcABCDE and bal) are organized in an apparent operon and are expressed in the presence of the substrate acetophenone. To study the conditions under which this operon is expressed in more detail, we constructed a reporter strain by inserting a gene fusion of apcA, the first gene of the apc-bal operon, with the gene for the fluorescent protein mCherry into the chromosome of A. aromaticum. The fusion protein indeed accumulated consistently with the expression pattern of the acetophenone-metabolic enzymes under various growth conditions. After evaluating and quantifying the data by fluorescence microscopy, fluorescence-based flow cytometry and immunoblot analysis, mCherry production was found to be proportional to the applied acetophenone concentrations. The reporter strain allowed quantification of acetophenone within a concentration range of 50 μM (detection limit) to 250 μM after 12 and 24 h. Moreover, production of the Apc-mCherry fusion protein in the reporter strain was highly specific and responded to acetophenone and both enantiomers of 1-phenylethanol, which are easily converted to acetophenone. Other analogous substrates showed either a significantly weaker response or none at all. Therefore, the reporter strain provides a basis for the development of a specific bioreporter system for acetophenone with an application potential reaching from environmental monitoring to petroleum prospecting.

  1. A Fluorescent Bioreporter for Acetophenone and 1-Phenylethanol derived from a Specifically Induced Catabolic Operon

    PubMed Central

    Muhr, Enrico; Leicht, Oliver; González Sierra, Silvia; Thanbichler, Martin; Heider, Johann

    2016-01-01

    The β-proteobacterium Aromatoleum aromaticum degrades the aromatic ketone acetophenone, a key intermediate of anaerobic ethylbenzene metabolism, either aerobically or anaerobically via a complex ATP-dependent acetophenone carboxylase and a benzoylacetate-CoA ligase. The genes coding for these enzymes (apcABCDE and bal) are organized in an apparent operon and are expressed in the presence of the substrate acetophenone. To study the conditions under which this operon is expressed in more detail, we constructed a reporter strain by inserting a gene fusion of apcA, the first gene of the apc-bal operon, with the gene for the fluorescent protein mCherry into the chromosome of A. aromaticum. The fusion protein indeed accumulated consistently with the expression pattern of the acetophenone-metabolic enzymes under various growth conditions. After evaluating and quantifying the data by fluorescence microscopy, fluorescence-based flow cytometry and immunoblot analysis, mCherry production was found to be proportional to the applied acetophenone concentrations. The reporter strain allowed quantification of acetophenone within a concentration range of 50 μM (detection limit) to 250 μM after 12 and 24 h. Moreover, production of the Apc-mCherry fusion protein in the reporter strain was highly specific and responded to acetophenone and both enantiomers of 1-phenylethanol, which are easily converted to acetophenone. Other analogous substrates showed either a significantly weaker response or none at all. Therefore, the reporter strain provides a basis for the development of a specific bioreporter system for acetophenone with an application potential reaching from environmental monitoring to petroleum prospecting. PMID:26858693

  2. Cation-induced transcriptional regulation of the dlt operon of Staphylococcus aureus.

    PubMed

    Koprivnjak, Tomaz; Mlakar, Vid; Swanson, Lindsey; Fournier, Benedicte; Peschel, Andreas; Weiss, Jerrold P

    2006-05-01

    Lipoteichoic and wall teichoic acids (TA) are highly anionic cell envelope-associated polymers containing repeating polyglycerol/ribitol phosphate moieties. Substitution of TA with D-alanine is important for modulation of many cell envelope-dependent processes, such as activity of autolytic enzymes, binding of divalent cations, and susceptibility to innate host defenses. D-Alanylation of TA is diminished when bacteria are grown in medium containing increased NaCl concentrations, but the effects of increased salt concentration on expression of the dlt operon encoding proteins mediating D-alanylation of TA are unknown. We demonstrate that Staphylococcus aureus transcriptionally represses dlt expression in response to high concentrations of Na(+) and moderate concentrations of Mg(2+) and Ca(2+) but not sucrose. Changes in dlt mRNA are induced within 15 min and sustained for several generations of growth. Mg(2+)-induced dlt repression depends on the ArlSR two-component system. Northern blotting, reverse transcription-PCR, and SMART-RACE analyses suggest that the dlt transcript begins 250 bp upstream of the dltA start codon and includes an open reading frame immediately upstream of dltA. Chloramphenicol transacetylase transcriptional fusions indicate that a region encompassing the 171 to 325 bp upstream of dltA is required for expression and Mg(2+)-induced repression of the dlt operon in S. aureus.

  3. Cation-Induced Transcriptional Regulation of the dlt Operon of Staphylococcus aureus

    PubMed Central

    Koprivnjak, Tomaz; Mlakar, Vid; Swanson, Lindsey; Fournier, Benedicte; Peschel, Andreas; Weiss, Jerrold P.

    2006-01-01

    Lipoteichoic and wall teichoic acids (TA) are highly anionic cell envelope-associated polymers containing repeating polyglycerol/ribitol phosphate moieties. Substitution of TA with d-alanine is important for modulation of many cell envelope-dependent processes, such as activity of autolytic enzymes, binding of divalent cations, and susceptibility to innate host defenses. d-Alanylation of TA is diminished when bacteria are grown in medium containing increased NaCl concentrations, but the effects of increased salt concentration on expression of the dlt operon encoding proteins mediating d-alanylation of TA are unknown. We demonstrate that Staphylococcus aureus transcriptionally represses dlt expression in response to high concentrations of Na+ and moderate concentrations of Mg2+ and Ca2+ but not sucrose. Changes in dlt mRNA are induced within 15 min and sustained for several generations of growth. Mg2+-induced dlt repression depends on the ArlSR two-component system. Northern blotting, reverse transcription-PCR, and SMART-RACE analyses suggest that the dlt transcript begins 250 bp upstream of the dltA start codon and includes an open reading frame immediately upstream of dltA. Chloramphenicol transacetylase transcriptional fusions indicate that a region encompassing the 171 to 325 bp upstream of dltA is required for expression and Mg2+-induced repression of the dlt operon in S. aureus. PMID:16672616

  4. Molecular Characterization and Regulation of the aguBA Operon, Responsible for Agmatine Utilization in Pseudomonas aeruginosa PAO1

    PubMed Central

    Nakada, Yuji; Jiang, Ying; Nishijyo, Takayuki; Itoh, Yoshifumi; Lu, Chung-Dar

    2001-01-01

    Pseudomonas aeruginosa PAO1 utilizes agmatine as the sole carbon and nitrogen source via two reactions catalyzed successively by agmatine deiminase (encoded by aguA; also called agmatine iminohydrolase) and N-carbamoylputrescine amidohydrolase (encoded by aguB). The aguBA and adjacent aguR genes were cloned and characterized. The predicted AguB protein (Mr 32,759; 292 amino acids) displayed sequence similarity (≤60% identity) to enzymes of the β-alanine synthase/nitrilase family. While the deduced AguA protein (Mr 41,190; 368 amino acids) showed no significant similarity to any protein of known function, assignment of agmatine deiminase to AguA in this report discovered a new family of carbon-nitrogen hydrolases widely distributed in organisms ranging from bacteria to Arabidopsis. The aguR gene encoded a putative regulatory protein (Mr 24,424; 221 amino acids) of the TetR protein family. Measurements of agmatine deiminase and N-carbamoylputrescine amidohydrolase activities indicated the induction effect of agmatine and N-carbamoylputrescine on expression of the aguBA operon. The presence of an inducible promoter for the aguBA operon in the aguR-aguB intergenic region was demonstrated by lacZ fusion experiments, and the transcription start of this promoter was localized 99 bp upstream from the initiation codon of aguB by S1 nuclease mapping. Experiments with knockout mutants of aguR established that expression of the aguBA operon became constitutive in the aguR background. Interaction of AguR overproduced in Escherichia coli with the aguBA regulatory region was demonstrated by gel retardation assays, supporting the hypothesis that AguR serves as the negative regulator of the aguBA operon, and binding of agmatine and N-carbamoylputrescine to AguR would antagonize its repressor function. PMID:11673419

  5. Can the Society for Assisted Reproductive Technology Clinic Outcome Reporting System (SART CORS) be used to accurately report clinic total reproductive potential (TRP)?

    PubMed

    Stern, Judy E; Hickman, Timothy N; Kinzer, Donna; Penzias, Alan S; Ball, G David; Gibbons, William E

    2012-04-01

    To assess whether total reproductive potential (TRP), the chance of a live birth from each fresh cycle (fresh cycle plus frozen transfers), could be calculated from the national Society for Assisted Reproductive Technology Clinic Outcome Reporting System (SART CORS) database and whether information not available in SART CORS resulted in significant changes to the TRP calculation. Retrospective study using SART CORS and clinic data. Three assisted reproductive technology clinics. Women undergoing ART. None. Two- and three-year TRPs for 2005 and 2006 were calculated according to patient age at cycle start by linking fresh to frozen cycles up to first live birth. Clinic records were used to adjust for (remove) frozen cycles that used more than one fresh cycle as a source of embryos and for any embryos donated to other patients or research or shipped to another facility before a live birth. TRP was higher than fresh per-cycle rates for most ages at all clinics, although accuracy was compromised when there were fewer than 20 cycles per category. Two- and 3-year TRPs differed in only 2 of 24 calculations. Adjusted TRPs differed less than three percentage points from unadjusted TRPs when volume was sufficient. Clinic TRP can be calculated from SART CORS. Data suggest that calculations of clinic TRP from the national dataset would be meaningful. Copyright © 2012 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  6. The transcriptional terminator sequences downstream of the covR gene terminate covR/S operon transcription to generate covR monocistronic transcripts in Streptococcus pyogenes.

    PubMed

    Chiang-Ni, Chuan; Tsou, Chih-Cheng; Lin, Yee-Shin; Chuang, Woei-Jer; Lin, Ming-T; Liu, Ching-Chuan; Wu, Jiunn-Jong

    2008-12-31

    CovR/S is an important two component regulatory system, which regulates about 15% of the gene expression in Streptococcus pyogenes. The covR/S locus was identified as an operon generating an RNA transcript around 2.5-kb in size. In this study, we found the covR/S operon produced three RNA transcripts (around 2.5-, 1.0-, and 0.8-kb in size). Using RNA transcriptional terminator sequence prediction and transcriptional terminator analysis, we identified two atypical rho-independent terminator sequences downstream of the covR gene and showed these terminator sequences terminate RNA transcription efficiently. These results indicate that covR/S operon generates covR/S transcript and monocistronic covR transcripts.

  7. Effect of osmolytes on the thermal stability of proteins: replica exchange simulations of Trp-cage in urea and betaine solutions.

    PubMed

    Adamczak, Beata; Kogut, Mateusz; Czub, Jacek

    2018-04-25

    Although osmolytes are known to modulate the folding equilibrium, the molecular mechanism of their effect on thermal denaturation of proteins is still poorly understood. Here, we simulated the thermal denaturation of a small model protein (Trp-cage) in the presence of denaturing (urea) and stabilizing (betaine) osmolytes, using the all-atom replica exchange molecular dynamics simulations. We found that urea destabilizes Trp-cage by enthalpically-driven association with the protein, acting synergistically with temperature to induce unfolding. In contrast, betaine is sterically excluded from the protein surface thereby exerting entropic depletion forces that contribute to the stabilization of the native state. In fact, we find that while at low temperatures betaine slightly increases the folding free energy of Trp-cage by promoting another near-native conformation, it protects the protein against temperature-induced denaturation. This, in turn, can be attributed to enhanced exclusion of betaine at higher temperatures that arises from less attractive interactions with the protein surface.

  8. Differential Substrate Specificity and Kinetic Behavior of Escherichia coli YfdW and Oxalobacter formigenes Formyl Coenzyme A Transferase▿ †

    PubMed Central

    Toyota, Cory G.; Berthold, Catrine L.; Gruez, Arnaud; Jónsson, Stefán; Lindqvist, Ylva; Cambillau, Christian; Richards, Nigel G. J.

    2008-01-01

    The yfdXWUVE operon appears to encode proteins that enhance the ability of Escherichia coli MG1655 to survive under acidic conditions. Although the molecular mechanisms underlying this phenotypic behavior remain to be elucidated, findings from structural genomic studies have shown that the structure of YfdW, the protein encoded by the yfdW gene, is homologous to that of the enzyme that mediates oxalate catabolism in the obligate anaerobe Oxalobacter formigenes, O. formigenes formyl coenzyme A transferase (FRC). We now report the first detailed examination of the steady-state kinetic behavior and substrate specificity of recombinant, wild-type YfdW. Our studies confirm that YfdW is a formyl coenzyme A (formyl-CoA) transferase, and YfdW appears to be more stringent than the corresponding enzyme (FRC) in Oxalobacter in employing formyl-CoA and oxalate as substrates. We also report the effects of replacing Trp-48 in the FRC active site with the glutamine residue that occupies an equivalent position in the E. coli protein. The results of these experiments show that Trp-48 precludes oxalate binding to a site that mediates substrate inhibition for YfdW. In addition, the replacement of Trp-48 by Gln-48 yields an FRC variant for which oxalate-dependent substrate inhibition is modified to resemble that seen for YfdW. Our findings illustrate the utility of structural homology in assigning enzyme function and raise the question of whether oxalate catabolism takes place in E. coli upon the up-regulation of the yfdXWUVE operon under acidic conditions. PMID:18245280

  9. Induction of therapeutic hypothermia by pharmacological modulation of temperature-sensitive TRP channels: theoretical framework and practical considerations.

    PubMed

    Feketa, Viktor V; Marrelli, Sean P

    2015-01-01

    Therapeutic hypothermia has emerged as a remarkably effective method of neuroprotection from ischemia and is being increasingly used in clinics. Accordingly, it is also a subject of considerable attention from a basic scientific research perspective. One of the fundamental problems, with which current studies are concerned, is the optimal method of inducing hypothermia. This review seeks to provide a broad theoretical framework for approaching this problem, and to discuss how a novel promising strategy of pharmacological modulation of the thermosensitive ion channels fits into this framework. Various physical, anatomical, physiological and molecular aspects of thermoregulation, which provide the foundation for this text, have been comprehensively reviewed and will not be discussed exhaustively here. Instead, the first part of the current review, which may be helpful for a broader readership outside of thermoregulation research, will build on this existing knowledge to outline possible opportunities and research directions aimed at controlling body temperature. The second part, aimed at a more specialist audience, will highlight the conceptual advantages and practical limitations of novel molecular agents targeting thermosensitive Transient Receptor Potential (TRP) channels in achieving this goal. Two particularly promising members of this channel family, namely TRP melastatin 8 (TRPM8) and TRP vanilloid 1 (TRPV1), will be discussed in greater detail.

  10. A Numbers Game: Ribosome Densities, Bacterial Growth, and Antibiotic-Mediated Stasis and Death

    PubMed Central

    McCall, Ingrid C.; Perrot, Véronique; Weiss, Howard; Ovesepian, Armen; Baquero, Fernando

    2017-01-01

    ABSTRACT We postulate that the inhibition of growth and low rates of mortality of bacteria exposed to ribosome-binding antibiotics deemed bacteriostatic can be attributed almost uniquely to these drugs reducing the number of ribosomes contributing to protein synthesis, i.e., the number of effective ribosomes. We tested this hypothesis with Escherichia coli K-12 MG1655 and constructs that had been deleted for 1 to 6 of the 7 rRNA (rrn) operons. In the absence of antibiotics, constructs with fewer rrn operons have lower maximum growth rates and longer lag phases than those with more ribosomal operons. In the presence of the ribosome-binding “bacteriostatic” antibiotics tetracycline, chloramphenicol, and azithromycin, E. coli strains with 1 and 2 rrn operons are killed at a substantially higher rate than those with more rrn operons. This increase in the susceptibility of E. coli with fewer rrn operons to killing by ribosome-targeting bacteriostatic antibiotics is not reflected in their greater sensitivity to killing by the bactericidal antibiotic ciprofloxacin, which does not target ribosomes, but also to killing by gentamicin, which does. Finally, when such strains are exposed to these ribosome-targeting bacteriostatic antibiotics, the time before these bacteria start to grow again when the drugs are removed, referred to as the post-antibiotic effect (PAE), is markedly greater for constructs with fewer rrn operons than for those with more rrn operons. We interpret the results of these other experiments reported here as support for the hypothesis that the reduction in the effective number of ribosomes due to binding to these structures provides a sufficient explanation for the action of bacteriostatic antibiotics that target these structures. PMID:28174311

  11. A bacterial Argonaute with noncanonical guide RNA specificity

    PubMed Central

    Kaya, Emine; Doxzen, Kevin W.; Knoll, Kilian R.; Wilson, Ross C.; Strutt, Steven C.; Kranzusch, Philip J.; Doudna, Jennifer A.

    2016-01-01

    Eukaryotic Argonaute proteins induce gene silencing by small RNA-guided recognition and cleavage of mRNA targets. Although structural similarities between human and prokaryotic Argonautes are consistent with shared mechanistic properties, sequence and structure-based alignments suggested that Argonautes encoded within CRISPR-cas [clustered regularly interspaced short palindromic repeats (CRISPR)-associated] bacterial immunity operons have divergent activities. We show here that the CRISPR-associated Marinitoga piezophila Argonaute (MpAgo) protein cleaves single-stranded target sequences using 5′-hydroxylated guide RNAs rather than the 5′-phosphorylated guides used by all known Argonautes. The 2.0-Å resolution crystal structure of an MpAgo–RNA complex reveals a guide strand binding site comprising residues that block 5′ phosphate interactions. Using structure-based sequence alignment, we were able to identify other putative MpAgo-like proteins, all of which are encoded within CRISPR-cas loci. Taken together, our data suggest the evolution of an Argonaute subclass with noncanonical specificity for a 5′-hydroxylated guide. PMID:27035975

  12. Swarming differentiation and swimming motility in Bacillus subtilis are controlled by swrA, a newly identified dicistronic operon.

    PubMed

    Calvio, Cinzia; Celandroni, Francesco; Ghelardi, Emilia; Amati, Giuseppe; Salvetti, Sara; Ceciliani, Fabrizio; Galizzi, Alessandro; Senesi, Sonia

    2005-08-01

    The number and disposition of flagella harbored by eubacteria are regulated by a specific trait successfully maintained over generations. The genes governing the number of flagella in Bacillus subtilis have never been identified, although the ifm locus has long been recognized to influence the motility phenotype of this microorganism. The characterization of a spontaneous ifm mutant of B. subtilis, displaying diverse degrees of cell flagellation in both liquid and solid media, raised the question of how the ifm locus governs the number and assembly of functional flagella. The major finding of this investigation is the characterization of a newly identified dicistronic operon, named swrA, that controls both swimming motility and swarming differentiation in B. subtilis. Functional analysis of the swrA operon allowed swrAA (previously named swrA [D. B. Kearns, F. Chu, R. Rudner, and R. Losick, Mol. Microbiol. 52:357-369, 2004]) to be the first gene identified in B. subtilis that controls the number of flagella in liquid environments and the assembly of flagella in response to cell contact with solid surfaces. Evidence is given that the second gene of the operon, swrAB, is essential for enabling the surface-adhering cells to undergo swarming differentiation. Preliminary data point to a molecular interaction between the two gene products.

  13. [Regional features of obesity-associated gene polymorphism (rs9939609 FTO gene and gene Trp64Arg ADRB3) in Russian population].

    PubMed

    Baturin, A K; Sorokina, E Iu; Pogozheva, A V; Peskova, E V; Makurina, O N; Tutel'ian, V A

    2014-01-01

    Recent studies have shown a significant association with obesity polymorphisms: rs9939609 gene due to fat mass and obesity FTO in European and some Asian and African American populations Trp64Arg ADRB3 gene in several European populations. Association of variants rs9939609 and Trp64Arg obesity was studied in 1244 the inhabitants of Moscow and Sverdlovsk regions. Genotyping was performed using allele-specific amplification, detection results in real time using TaqMan-probes complementary DNA polymorphic sites. The frequency of the mutant allele of the FTO gene in the population of Moscow and Sverdlovsk region was 45.1%, with the TT genotype was detected in 30.2% of cases, AT--49.5%, AA--20.3%. Women had the presence of the mutant allele more likely than men (48.4 vs. 42.5%). People with obesity were more genotypes AA (26.3%) and AT (52.8%) compared to the surveyed with a BMI of less than 30 kg/m2 (respectively 18.1 and 50.7%). A significantly higher incidence of risk allele A was found in individuals with obesity (52.6 and 43.4%). The presence of the mutant allele of the gene ADRB3 among the population of Moscow and Sverdlovsk regions was noted in 7.4% of cases. While 15.5% of patients had a heterozygous genotype Trp64Arg ADRB3, that is consistent with international research. The frequency of the risk allele and genotype Arg64 Trp64Arg in women (9.3 and 18.5%) was significantly higher than men (6.2 and 12.2%). The presence of the mutant allele and genotype Trp64Arg ADRB3 (respectively, 9.1 and 18.1%) were significantly more marked in the examined obese compared with those with a body mass index less than 30 kg/m2 (7.4 and 14.9%), but these differences were not statistically significant. The results of these studies suggest that genetic variants of the FTO gene rs9939609 genotype and Trp64Arg ADRB3 contribute to the development of obesity among residents of Moscow and Sverdlovsk Region of Russia. The risk of obesity increases in the case of combined polymorphisms in

  14. Difficulty in losing weight by behavioral intervention for women with Trp64Arg polymorphism of the beta3-adrenergic receptor gene.

    PubMed

    Shiwaku, K; Nogi, A; Anuurad, E; Kitajima, K; Enkhmaa, B; Shimono, K; Yamane, Y

    2003-09-01

    Trp64Arg mutation in the beta(3)-adrenergic receptor (beta(3)AR) gene is relatively common in Japanese people. However, it has not been clear whether persons with Trp64Arg mutation in the beta(3)AR gene tend to have obesity and difficulty in losing weight even with a restricted diet and exercise. We investigated the response of body weight and metabolic factors to behavioral intervention in Japanese women with Trp64Arg mutation in the beta(3)AR gene. A 3-month behavioral intervention study using a combination of diet and exercise programs. A total of 76 perimenopausal women with no clinical symptoms (age: 54.7+/-7.7 y, body mass index (BMI): 21.0-33.0 kg/m(2)). Anthropometric measurements (weight, height, body fat, waist circumference, hip circumference, skin fold, resting energy expenditure and blood pressure) and metabolic measurements (serum levels of cholesterol, triglyceride, phospholipid, nonesterified fatty acid, glucose, insulin and leptin) and determination of the beta(3)AR genotype by polymerase chain reaction followed by BstNI digestion. At the baseline of BMI, body weight, body fat, waist circumference, hip circumference, the arm skin fold, resting energy expenditure, or blood lipid and glucose profiles, there was no significant difference in participants with/without mutation of the beta(3)AR gene. The intervention yielded a body weight reduction in 69 and 48%, and induced a significant difference in weight loss (-0.74 and -0.01 kg) for women with wild-type and Trp64Arg mutation, respectively. Significant differences of anthropometric parameters were found in body weight, BMI, waist and hip circumferences and blood pressure of wild type by the intervention. However, women with Trp64Arg mutation did not show significant changes in these anthropometric parameters, except for hip circumference. A significant difference was found in high-density lipoprotein cholesterol (HDL-C) and in the low-density lipoprotein cholesterol/HDL-C ratio in both genotypes

  15. The fruRBA Operon Is Necessary for Group A Streptococcal Growth in Fructose and for Resistance to Neutrophil Killing during Growth in Whole Human Blood

    PubMed Central

    Valdes, Kayla M.; Sundar, Ganesh S.; Vega, Luis A.; Belew, Ashton T.; Islam, Emrul; Binet, Rachel; El-Sayed, Najib M.

    2016-01-01

    Bacterial pathogens rely on the availability of nutrients for survival in the host environment. The phosphoenolpyruvate-phosphotransferase system (PTS) is a global regulatory network connecting sugar uptake with signal transduction. Since the fructose PTS has been shown to impact virulence in several streptococci, including the human pathogen Streptococcus pyogenes (the group A Streptococcus [GAS]), we characterized its role in carbon metabolism and pathogenesis in the M1T1 strain 5448. Growth in fructose as a sole carbon source resulted in 103 genes affected transcriptionally, where the fru locus (fruRBA) was the most induced. Reverse transcriptase PCR showed that fruRBA formed an operon which was repressed by FruR in the absence of fructose, in addition to being under carbon catabolic repression. Growth assays and carbon utilization profiles revealed that although the entire fru operon was required for growth in fructose, FruA was the main transporter for fructose and also was involved in the utilization of three additional PTS sugars: cellobiose, mannitol, and N-acetyl-d-galactosamine. The inactivation of sloR, a fruA homolog that also was upregulated in the presence of fructose, failed to reveal a role as a secondary fructose transporter. Whereas the ability of both ΔfruR and ΔfruB mutants to survive in the presence of whole human blood or neutrophils was impaired, the phenotype was not reproduced in murine whole blood, and those mutants were not attenuated in a mouse intraperitoneal infection. Since the ΔfruA mutant exhibited no phenotype in the human or mouse assays, we propose that FruR and FruB are important for GAS survival in a human-specific environment. PMID:26787724

  16. Glucose & sodium chloride induced biofilm production & ica operon in clinical isolates of staphylococci.

    PubMed

    Agarwal, Astha; Jain, Amita

    2013-01-01

    All colonizing and invasive staphylococcal isolates may not produce biofilm but may turn biofilm producers in certain situations due to change in environmental factors. This study was done to test the hypothesis that non biofilm producing clinical staphylococci isolates turn biofilm producers in presence of sodium chloride (isotonic) and high concentration of glucose, irrespective of presence or absence of ica operon. Clinical isolates of 100 invasive, 50 colonizing and 50 commensal staphylococci were tested for biofilm production by microtiter plate method in different culture media (trypticase soy broth alone or supplemented with 0.9% NaCl/ 5 or 10% glucose). All isolates were tested for the presence of ica ADBC genes by PCR. Biofilm production significantly increased in the presence of glucose and saline, most, when both glucose and saline were used together. All the ica positive staphylococcal isolates and some ica negative isolates turned biofilm producer in at least one of the tested culture conditions. Those remained biofilm negative in different culture conditions were all ica negative. The present results showed that the use of glucose or NaCl or combination of both enhanced biofilm producing capacity of staphylococcal isolates irrespective of presence or absence of ica operon.

  17. An Inducible Operon Is Involved in Inulin Utilization in Lactobacillus plantarum Strains, as Revealed by Comparative Proteogenomics and Metabolic Profiling.

    PubMed

    Buntin, Nirunya; Hongpattarakere, Tipparat; Ritari, Jarmo; Douillard, François P; Paulin, Lars; Boeren, Sjef; Shetty, Sudarshan A; de Vos, Willem M

    2017-01-15

    The draft genomes of Lactobacillus plantarum strains isolated from Asian fermented foods, infant feces, and shrimp intestines were sequenced and compared to those of well-studied strains. Among 28 strains of L. plantarum, variations in the genomic features involved in ecological adaptation were elucidated. The genome sizes ranged from approximately 3.1 to 3.5 Mb, of which about 2,932 to 3,345 protein-coding sequences (CDS) were predicted. The food-derived isolates contained a higher number of carbohydrate metabolism-associated genes than those from infant feces. This observation correlated to their phenotypic carbohydrate metabolic profile, indicating their ability to metabolize the largest range of sugars. Surprisingly, two strains (P14 and P76) isolated from fermented fish utilized inulin. β-Fructosidase, the inulin-degrading enzyme, was detected in the supernatants and cell wall extracts of both strains. No activity was observed in the cytoplasmic fraction, indicating that this key enzyme was either membrane-bound or extracellularly secreted. From genomic mining analysis, a predicted inulin operon of fosRABCDXE, which encodes β-fructosidase and many fructose transporting proteins, was found within the genomes of strains P14 and P76. Moreover, pts1BCA genes, encoding sucrose-specific IIBCA components involved in sucrose transport, were also identified. The proteomic analysis revealed the mechanism and functional characteristic of the fosRABCDXE operon involved in the inulin utilization of L. plantarum The expression levels of the fos operon and pst genes were upregulated at mid-log phase. FosE and the LPXTG-motif cell wall anchored β-fructosidase were induced to a high abundance when inulin was present as a carbon source. Inulin is a long-chain carbohydrate that may act as a prebiotic, which provides many health benefits to the host by selectively stimulating the growth and activity of beneficial bacteria in the colon. While certain lactobacilli can catabolize

  18. An Inducible Operon Is Involved in Inulin Utilization in Lactobacillus plantarum Strains, as Revealed by Comparative Proteogenomics and Metabolic Profiling

    PubMed Central

    Buntin, Nirunya; Hongpattarakere, Tipparat; Ritari, Jarmo; Douillard, François P.; Paulin, Lars; Boeren, Sjef; Shetty, Sudarshan A.

    2016-01-01

    ABSTRACT The draft genomes of Lactobacillus plantarum strains isolated from Asian fermented foods, infant feces, and shrimp intestines were sequenced and compared to those of well-studied strains. Among 28 strains of L. plantarum, variations in the genomic features involved in ecological adaptation were elucidated. The genome sizes ranged from approximately 3.1 to 3.5 Mb, of which about 2,932 to 3,345 protein-coding sequences (CDS) were predicted. The food-derived isolates contained a higher number of carbohydrate metabolism-associated genes than those from infant feces. This observation correlated to their phenotypic carbohydrate metabolic profile, indicating their ability to metabolize the largest range of sugars. Surprisingly, two strains (P14 and P76) isolated from fermented fish utilized inulin. β-Fructosidase, the inulin-degrading enzyme, was detected in the supernatants and cell wall extracts of both strains. No activity was observed in the cytoplasmic fraction, indicating that this key enzyme was either membrane-bound or extracellularly secreted. From genomic mining analysis, a predicted inulin operon of fosRABCDXE, which encodes β-fructosidase and many fructose transporting proteins, was found within the genomes of strains P14 and P76. Moreover, pts1BCA genes, encoding sucrose-specific IIBCA components involved in sucrose transport, were also identified. The proteomic analysis revealed the mechanism and functional characteristic of the fosRABCDXE operon involved in the inulin utilization of L. plantarum. The expression levels of the fos operon and pst genes were upregulated at mid-log phase. FosE and the LPXTG-motif cell wall anchored β-fructosidase were induced to a high abundance when inulin was present as a carbon source. IMPORTANCE Inulin is a long-chain carbohydrate that may act as a prebiotic, which provides many health benefits to the host by selectively stimulating the growth and activity of beneficial bacteria in the colon. While certain

  19. Eukaryotic acquisition of a bacterial operon

    USDA-ARS?s Scientific Manuscript database

    The yeast Saccharomyces cerevisiae is one of the champions of basic biomedical research due to its compact eukaryotic genome and ease of experimental manipulation. Despite these immense strengths, its impact on understanding the genetic basis of natural phenotypic variation has been limited by strai...

  20. The XRCC1 Arg194Trp polymorphism is significantly associated with lung adenocarcinoma: a case-control study in an Eastern European Caucasian group

    PubMed Central

    Cătană, Andreea; Pop, Monica; Hincu, Bianca Domokos; Pop, Ioan V; Petrişor, Felicia M; Porojan, Mihai D; Popp, Radu A

    2015-01-01

    DNA repair plays an important role in maintaining the integrity of the genome by repairing DNA damage induced by carcinogens. Certain genetic polymorphisms that occur in DNA-repair genes may affect the ability to repair DNA defects, and may represent a risk factor in carcinogenesis. The gene XRCC1 is involved in DNA repair. The purpose of our study was to investigate the association between XRCC1 Arg194Trp and Arg399Gln polymorphisms and the risk of lung cancer in a Romanian population. We recruited 222 healthy controls and 102 patients with lung cancer. Genotypes were determined by multiplex polymerase chain-reaction restriction fragment-length polymorphism. Statistical analysis (odds ratio, recessive model) revealed an increased risk for lung cancer for the homozygous 194Trp genotype (χ2=0.186, odds ratio 10.667, 95% confidence interval 1.309–86.933; P=0.007). Also, we found an association between the 194Trp allele and women with lung adenocarcinoma. In conclusion, the results of the study place the XRCC1 Arg194Trp polymorphism among independent risk factors for developing lung cancer. PMID:26664136

  1. TRP channels in brown and white adipogenesis from human progenitors: new therapeutic targets and the caveats associated with the common antibiotic, streptomycin.

    PubMed

    Goralczyk, Anna; van Vijven, Marc; Koch, Mathilde; Badowski, Cedric; Yassin, M Shabeer; Toh, Sue-Anne; Shabbir, Asim; Franco-Obregón, Alfredo; Raghunath, Michael

    2017-08-01

    Transient receptor potential (TRP) channels are polymodal cell sensors responding to diverse stimuli and widely implicated in the developmental programs of numerous tissues. The evidence for an involvement of TRP family members in adipogenesis, however, is scant. We present the first comprehensive expression profile of all known 27 human TRP genes in mesenchymal progenitors cells during white or brown adipogenesis. Using positive trilineage differentiation as an exclusion criterion, TRP polycystic (P)3, and TPR melastatin (M)8 were found to be uniquely adipospecific. Knockdown of TRPP3 repressed the expression of the brown fat signature genes uncoupling protein (UCP)-1 and peroxisome proliferator-activated receptor γ coactivator (PGC)-1α as well as attenuated forskolin-stimulated uncoupled respiration. However, indices of generalized adipogenesis, such as lipid droplet morphology and fatty acid binding protein (FAPB)-4 expression, were not affected, indicating a principal mitochondrial role of TRPP3. Conversely, activating TRPM8 with menthol up-regulated UCP-1 expression and augmented uncoupled respiration predominantly in white adipocytes (browning), whereas streptomycin antagonized TRPM8-mediated calcium entry, downregulated UCP-1 expression, and mitigated uncoupled respiration; menthol was less capable of augmenting uncoupled respiration (thermogenesis) in brown adipocytes. TRPP3 and TRPM8 hence appear to be involved in the priming of mitochondria to perform uncoupled respiration downstream of adenylate cyclase. Our results also underscore the developmental caveats of using antibiotics in adipogenic studies.-Goralczyk, A., van Vijven, M., Koch, M., Badowski, C., Yassin, M. S., Toh, S.-A., Shabbir, A., Franco-Obregón, A., Raghunath, M. TRP channels in brown and white adipogenesis from human progenitors: new therapeutic targets and the caveats associated with the common antibiotic, streptomycin. © FASEB.

  2. Development of a novel lysosome-targetable time-gated luminescence probe for ratiometric and luminescence lifetime detection of nitric oxide in vivo † †Electronic supplementary information (ESI) available: Experimental details for the syntheses of TRP-Tb3+ and TRP-NO, and supplementary figures. See DOI: 10.1039/c6sc03667h Click here for additional data file.

    PubMed Central

    Dai, Zhichao; Tian, Lu; Liu, Xiangli

    2017-01-01

    Rapid, multiplexed, sensitive and specific identification and quantitative detection of nitric oxide (NO) are in great demand in biomedical science. Herein, a novel multifunctional probe based on the intramolecular LRET (luminescence resonance energy transfer) strategy, TRP-NO, was designed for the highly sensitive and selective ratiometric and luminescence lifetime detection of lysosomal NO. Before reaction with NO, the emission of the rhodamine moiety in TRP-NO is switched off, which prevents the LRET process, so that the probe emits only the long-lived Tb3+ luminescence. However, upon reaction with NO, accompanied by the turn-on of rhodamine emission, the LRET from the Tb3+-complex moiety to rhodamine moiety occurs, which results in a remarkable increase of the rhodamine emission and decrease of the Tb3+ emission. After the reaction, the intensity ratio of the rhodamine emission to the Tb3+ emission, I 565/I 540, was found to be 28.8-fold increased, and the dose-dependent enhancement of the I 565/I 540 value showed a good linearity upon the increase of NO concentration. In addition, a dose-dependent luminescence lifetime decrease was distinctly observed between the average luminescence lifetime of the probe and NO concentration, which provides a ∼10-fold contrast window for the detection of NO. These unique properties allowed TRP-NO to be conveniently used as a time-gated luminescence probe for the quantitative detection of NO using both luminescence intensity ratio and luminescence lifetime as signals. The applicability of TRP-NO for ratiometric time-gated luminescence imaging of NO in living cells was investigated. Meanwhile, dye co-localization studies confirmed a quite precise distribution of TRP-NO in lysosomes by confocal microscopy imaging. Furthermore, the practical applicability of TRP-NO was demonstrated by the visualization of NO in Daphnia magna. All of the results demonstrated that TRP-NO could serve as a useful tool for exploiting and elucidating

  3. Awakening sleeping beauty: production of propionic acid in Escherichia coli through the sbm operon requires the activity of a methylmalonyl-CoA epimerase.

    PubMed

    Gonzalez-Garcia, Ricardo Axayacatl; McCubbin, Tim; Wille, Annalena; Plan, Manuel; Nielsen, Lars Keld; Marcellin, Esteban

    2017-07-17

    Propionic acid is used primarily as a food preservative with smaller applications as a chemical building block for the production of many products including fabrics, cosmetics, drugs, and plastics. Biological production using propionibacteria would be competitive against chemical production through hydrocarboxylation of ethylene if native producers could be engineered to reach near-theoretical yield and good productivity. Unfortunately, engineering propionibacteria has proven very challenging. It has been suggested that activation of the sleeping beauty operon in Escherichia coli is sufficient to achieve propionic acid production. Optimising E. coli production should be much easier than engineering propionibacteria if tolerance issues can be addressed. Propionic acid is produced in E. coli via the sleeping beauty mutase operon under anaerobic conditions in rich medium via amino acid degradation. We observed that the sbm operon enhances amino acids degradation to propionic acid and allows E. coli to degrade isoleucine. However, we show here that the operon lacks an epimerase reaction that enables propionic acid production in minimal medium containing glucose as the sole carbon source. Production from glucose can be restored by engineering the system with a methylmalonyl-CoA epimerase from Propionibacterium acidipropionici (0.23 ± 0.02 mM). 1-Propanol production was also detected from the promiscuous activity of the native alcohol dehydrogenase (AdhE). We also show that aerobic conditions are favourable for propionic acid production. Finally, we increase titre 65 times using a combination of promoter engineering and process optimisation. The native sbm operon encodes an incomplete pathway. Production of propionic acid from glucose as sole carbon source is possible when the pathway is complemented with a methylmalonyl-CoA epimerase. Although propionic acid via the restored succinate dissimilation pathway is considered a fermentative process, the engineered pathway

  4. Regulation of ciaXRH Operon Expression and Identification of the CiaR Regulon in Streptococcus mutans▿

    PubMed Central

    Wu, Chenggang; Ayala, Eduardo A.; Downey, Jennifer S.; Merritt, Justin; Goodman, Steven D.; Qi, Fengxia

    2010-01-01

    The ciaRH operon in Streptococcus mutans contains 3 contiguous genes, ciaXRH. Unlike the CiaRH system in other streptococci, only the ciaH-null mutant displays defective phenotypes, while the ciaR-null mutant behaves like the wild type. The objective of this study was to determine the mechanism of this unusual property. We demonstrate that the ciaH mutation caused a >20-fold increase in ciaR transcript synthesis. A ciaRH double deletion reversed the ciaH phenotype, suggesting that overexpressed ciaR might be responsible for the observed ciaH phenotypes. When ciaR was forced to be overexpressed by a transcriptional fusion to the ldh promoter in the wild-type background, the same ciaH phenotypes were restored, confirming the involvement of overexpressed ciaR in the ciaH phenotypes. The ciaH mutation and ciaR overexpression also caused transcriptional alterations in 100 genes, with 15 genes upregulated >5-fold. Bioinformatics analysis identified a putative CiaR regulon consisting of 8 genes/operons, including the ciaXRH operon itself, all of which were upregulated. In vitro footprinting on 4 of the 8 promoters revealed a protected region of 26 to 28 bp encompassing two direct repeats, NTTAAG-n5-WTTAAG, 10 bp upstream of the −10 region, indicating direct binding of the CiaR protein to these promoters. Taken together, we conclude that overexpressed CiaR, as a result of either ciaH deletion or forced expression from a constitutive promoter, is a mediator in the CiaH-regulated phenotypes. PMID:20639331

  5. Transcript analysis of the extended hyp-operon in the cyanobacteria Nostoc sp. strain PCC 7120 and Nostoc punctiforme ATCC 29133

    PubMed Central

    2011-01-01

    Background Cyanobacteria harbor two [NiFe]-type hydrogenases consisting of a large and a small subunit, the Hup- and Hox-hydrogenase, respectively. Insertion of ligands and correct folding of nickel-iron hydrogenases require assistance of accessory maturation proteins (encoded by the hyp-genes). The intergenic region between the structural genes encoding the uptake hydrogenase (hupSL) and the accessory maturation proteins (hyp genes) in the cyanobacteria Nostoc PCC 7120 and N. punctiforme were analysed using molecular methods. Findings The five ORFs, located in between the uptake hydrogenase structural genes and the hyp-genes, can form a transcript with the hyp-genes. An identical genomic localization of these ORFs are found in other filamentous, N2-fixing cyanobacterial strains. In N. punctiforme and Nostoc PCC 7120 the ORFs upstream of the hyp-genes showed similar transcript level profiles as hupS (hydrogenase structural gene), nifD (nitrogenase structural gene), hypC and hypF (accessory hydrogenase maturation genes) after nitrogen depletion. In silico analyzes showed that these ORFs in N. punctiforme harbor the same conserved regions as their homologues in Nostoc PCC 7120 and that they, like their homologues in Nostoc PCC 7120, can be transcribed together with the hyp-genes forming a larger extended hyp-operon. DNA binding studies showed interactions of the transcriptional regulators CalA and CalB to the promoter regions of the extended hyp-operon in N. punctiforme and Nostoc PCC 7120. Conclusions The five ORFs upstream of the hyp-genes in several filamentous N2-fixing cyanobacteria have an identical genomic localization, in between the genes encoding the uptake hydrogenase and the maturation protein genes. In N. punctiforme and Nostoc PCC 7120 they are transcribed as one operon and may form transcripts together with the hyp-genes. The expression pattern of the five ORFs within the extended hyp-operon in both Nostoc punctiforme and Nostoc PCC 7120 is similar to

  6. Dissection of the components for PIP2 activation and thermosensation in TRP channels

    PubMed Central

    Brauchi, Sebastian; Orta, Gerardo; Mascayano, Carolina; Salazar, Marcelo; Raddatz, Natalia; Urbina, Hector; Rosenmann, Eduardo; Gonzalez-Nilo, Fernando; Latorre, Ramon

    2007-01-01

    Phosphatidylinositol 4,5-bisphosphate (PIP2) plays a central role in the activation of several transient receptor potential (TRP) channels. The role of PIP2 on temperature gating of thermoTRP channels has not been explored in detail, and the process of temperature activation is largely unexplained. In this work, we have exchanged different segments of the C-terminal region between cold-sensitive (TRPM8) and heat-sensitive (TRPV1) channels, trying to understand the role of the segment in PIP2 and temperature activation. A chimera in which the proximal part of the C-terminal of TRPV1 replaces an equivalent section of TRPM8 C-terminal is activated by PIP2 and confers the phenotype of heat activation. PIP2, but not temperature sensitivity, disappears when positively charged residues contained in the exchanged region are neutralized. Shortening the exchanged segment to a length of 11 aa produces voltage-dependent and temperature-insensitive channels. Our findings suggest the existence of different activation domains for temperature, PIP2, and voltage. We provide an interpretation for channel–PIP2 interaction using a full-atom molecular model of TRPV1 and PIP2 docking analysis. PMID:17548815

  7. The sim Operon Facilitates the Transport and Metabolism of Sucrose Isomers in Lactobacillus casei ATCC 334▿

    PubMed Central

    Thompson, John; Jakubovics, Nicholas; Abraham, Bindu; Hess, Sonja; Pikis, Andreas

    2008-01-01

    Inspection of the genome sequence of Lactobacillus casei ATCC 334 revealed two operons that might dissimilate the five isomers of sucrose. To test this hypothesis, cells of L. casei ATCC 334 were grown in a defined medium supplemented with various sugars, including each of the five isomeric disaccharides. Extracts prepared from cells grown on the sucrose isomers contained high levels of two polypeptides with Mrs of ∼50,000 and ∼17,500. Neither protein was present in cells grown on glucose, maltose or sucrose. Proteomic, enzymatic, and Western blot analyses identified the ∼50-kDa protein as an NAD+- and metal ion-dependent phospho-α-glucosidase. The oligomeric enzyme was purified, and a catalytic mechanism is proposed. The smaller polypeptide represented an EIIA component of the phosphoenolpyruvate-dependent sugar phosphotransferase system. Phospho-α-glucosidase and EIIA are encoded by genes at the LSEI_0369 (simA) and LSEI_0374 (simF) loci, respectively, in a block of seven genes comprising the sucrose isomer metabolism (sim) operon. Northern blot analyses provided evidence that three mRNA transcripts were up-regulated during logarithmic growth of L. casei ATCC 334 on sucrose isomers. Internal simA and simF gene probes hybridized to ∼1.5- and ∼1.3-kb transcripts, respectively. A 6.8-kb mRNA transcript was detected by both probes, which was indicative of cotranscription of the entire sim operon. PMID:18310337

  8. Nonhemolytic Streptococcus pyogenes Isolates That Lack Large Regions of the sag Operon Mediating Streptolysin S Production▿

    PubMed Central

    Yoshino, Miho; Murayama, Somay Y.; Sunaoshi, Katsuhiko; Wajima, Takeaki; Takahashi, Miki; Masaki, Junko; Kurokawa, Iku; Ubukata, Kimiko

    2010-01-01

    Among nonhemolytic Streptococcus pyogenes (group A streptococcus) strains (n = 9) isolated from patients with pharyngitis or acute otitis media, we identified three deletions in the region from the epf gene, encoding the extracellular matrix binding protein, to the sag operon, mediating streptolysin S production. PMID:20018818

  9. Genome analysis of the freshwater planktonic Vulcanococcus limneticus sp. nov. reveals horizontal transfer of nitrogenase operon and alternative pathways of nitrogen utilization.

    PubMed

    Di Cesare, Andrea; Cabello-Yeves, Pedro J; Chrismas, Nathan A M; Sánchez-Baracaldo, Patricia; Salcher, Michaela M; Callieri, Cristiana

    2018-04-16

    Many cyanobacteria are capable of fixing atmospheric nitrogen, playing a crucial role in biogeochemical cycling. Little is known about freshwater unicellular cyanobacteria Synechococcus spp. at the genomic level, despite being recognised of considerable ecological importance in aquatic ecosystems. So far, it has not been shown whether these unicellular picocyanobacteria have the potential for nitrogen fixation. Here, we present the draft-genome of the new pink-pigmented Synechococcus-like strain Vulcanococcus limneticus. sp. nov., isolated from the volcanic Lake Albano (Central Italy). The novel species Vulcanococcus limneticus sp. nov. falls inside the sub-cluster 5.2, close to the estuarine/marine strains in a maximum-likelihood phylogenetic tree generated with 259 marker genes with representatives from marine, brackish, euryhaline and freshwater habitats. V.limneticus sp. nov. possesses a complete nitrogenase and nif operon. In an experimental setup under nitrogen limiting and non-limiting conditions, growth was observed in both cases. However, the nitrogenase genes (nifHDK) were not transcribed, i.e., V.limneticus sp. nov. did not fix nitrogen, but instead degraded the phycobilisomes to produce sufficient amounts of ammonia. Moreover, the strain encoded many other pathways to incorporate ammonia, nitrate and sulphate, which are energetically less expensive for the cell than fixing nitrogen. The association of the nif operon to a genomic island, the relatively high amount of mobile genetic elements (52 transposases) and the lower observed GC content of V.limneticus sp. nov. nif operon (60.54%) compared to the average of the strain (68.35%) support the theory that this planktonic strain may have obtained, at some point of its evolution, the nif operon by horizontal gene transfer (HGT) from a filamentous or heterocystous cyanobacterium. In this study, we describe the novel species Vulcanococcus limneticus sp. nov., which possesses a complete nif operon for

  10. (S)-3-hydroxy-3-methylglutaryl coenzyme A reductase, a product of the mva operon of Pseudomonas mevalonii, is regulated at the transcriptional level.

    PubMed Central

    Wang, Y L; Beach, M J; Rodwell, V W

    1989-01-01

    We have cloned and sequenced a 505-base-pair (bp) segment of DNA situated upstream of mvaA, the structural gene for (S)-3-hydroxy-3-methylglutaryl coenzyme A reductase (EC 1.1.1.88) of Pseudomonas mevalonii. The DNA segment that we characterized includes the promoter region for the mva operon. Nuclease S1 mapping and primer extension analysis showed that mvaA is the promoter-proximal gene of the mva operon. Transcription initiates at -56 bp relative to the first A (+1) of the translation start site. Transcription in vivo was induced by mevalonate. Structural features of the mva promoter region include an 80-bp A + T-rich region, and -12, -24 consensus sequences that resemble sequences of sigma 54 promoters in enteric organisms. The relative amplitudes of catalytic activity, enzyme protein, and mvaA mRNA are consistent with a model of regulation of this operon at the transcriptional level. Images PMID:2477360

  11. When the most potent combination of antibiotics selects for the greatest bacterial load: the smile-frown transition.

    PubMed

    Pena-Miller, Rafael; Laehnemann, David; Jansen, Gunther; Fuentes-Hernandez, Ayari; Rosenstiel, Philip; Schulenburg, Hinrich; Beardmore, Robert

    2013-01-01

    Conventional wisdom holds that the best way to treat infection with antibiotics is to 'hit early and hit hard'. A favoured strategy is to deploy two antibiotics that produce a stronger effect in combination than if either drug were used alone. But are such synergistic combinations necessarily optimal? We combine mathematical modelling, evolution experiments, whole genome sequencing and genetic manipulation of a resistance mechanism to demonstrate that deploying synergistic antibiotics can, in practice, be the worst strategy if bacterial clearance is not achieved after the first treatment phase. As treatment proceeds, it is only to be expected that the strength of antibiotic synergy will diminish as the frequency of drug-resistant bacteria increases. Indeed, antibiotic efficacy decays exponentially in our five-day evolution experiments. However, as the theory of competitive release predicts, drug-resistant bacteria replicate fastest when their drug-susceptible competitors are eliminated by overly-aggressive treatment. Here, synergy exerts such strong selection for resistance that an antagonism consistently emerges by day 1 and the initially most aggressive treatment produces the greatest bacterial load, a fortiori greater than if just one drug were given. Whole genome sequencing reveals that such rapid evolution is the result of the amplification of a genomic region containing four drug-resistance mechanisms, including the acrAB efflux operon. When this operon is deleted in genetically manipulated mutants and the evolution experiment repeated, antagonism fails to emerge in five days and antibiotic synergy is maintained for longer. We therefore conclude that unless super-inhibitory doses are achieved and maintained until the pathogen is successfully cleared, synergistic antibiotics can have the opposite effect to that intended by helping to increase pathogen load where, and when, the drugs are found at sub-inhibitory concentrations.

  12. Regulation of His-dTrp-Ala-Trp-dPhe-Lys-NH2 (GHRP-6)-induced GH secretion in the rat.

    PubMed

    Mallo, F; Alvarez, C V; Benitez, L; Burguera, B; Coya, R; Casanueva, F F; Dieguez, C

    1993-01-01

    His-dTrp-Ala-Trp-dPhe,Lys-NH2(GHRP-6) is a synthetic compound that releases GH in a dose-response and specific manner in several species and that may well be related to an endogenous compound of similar structure. The aim of this study was to investigate the in vivo GH responses to GHRP-6 in pentobarbital anesthetized rats. Specifically and in order to avoid the influence of endogenous GHRH and somatostatin secretion we studied the GH responses to GHRP-6 in animals with surgical ablation of the hypothalamus, confirmed by histological assessment, as well as in hypophysectomyzed-transplanted rats bearing two hypophyses under the renal capsule. Since it has been previously reported that rats pretreated with GHRH (10 micrograms/kg i.p. every 12 h for 15 days) rather than saline-treated rats have greater GH responses to acutely administered GHRH, we compared the self-potentiating effect of chronic GH pretreatment with GHRP-6 (10 micrograms/kg i.p. every 12 h). Furthermore we also studied the influence of estrogens, glucocorticoids, free fatty acids (FFA) and bombesin on somatotroph responsiveness to GHRP-6 in intact rats. We found a greater GH response to GHRP-6 in rats that underwent a surgical ablation of the hypothalamus 36 h prior to the test than in sham-operated rats. A direct stimulatory effect of GHRP-6 on in vivo GH secretion was demonstrated by a clear GH response to GHRP-6 in hypophysectomyzed-transplanted rats. In addition, we found a similar response whether the animals were pretreated with GHRH or GHRP-6 over the previous 2 weeks. Finally, we found that both estrogen- and testosterone-treated rats have greater GH responses to GHRP-6 than untreated rats. On the other hand, chronic dexamethasone administration, acute elevation of circulating FFA levels and bombesin administration markedly inhibited GH responses to GHRP-6. In contrast to the effects exerted on GH responses to GHRP-6 estrogen administration led to a decrease in GH responses to GHRH while

  13. OperomeDB: A Database of Condition-Specific Transcription Units in Prokaryotic Genomes.

    PubMed

    Chetal, Kashish; Janga, Sarath Chandra

    2015-01-01

    Background. In prokaryotic organisms, a substantial fraction of adjacent genes are organized into operons-codirectionally organized genes in prokaryotic genomes with the presence of a common promoter and terminator. Although several available operon databases provide information with varying levels of reliability, very few resources provide experimentally supported results. Therefore, we believe that the biological community could benefit from having a new operon prediction database with operons predicted using next-generation RNA-seq datasets. Description. We present operomeDB, a database which provides an ensemble of all the predicted operons for bacterial genomes using available RNA-sequencing datasets across a wide range of experimental conditions. Although several studies have recently confirmed that prokaryotic operon structure is dynamic with significant alterations across environmental and experimental conditions, there are no comprehensive databases for studying such variations across prokaryotic transcriptomes. Currently our database contains nine bacterial organisms and 168 transcriptomes for which we predicted operons. User interface is simple and easy to use, in terms of visualization, downloading, and querying of data. In addition, because of its ability to load custom datasets, users can also compare their datasets with publicly available transcriptomic data of an organism. Conclusion. OperomeDB as a database should not only aid experimental groups working on transcriptome analysis of specific organisms but also enable studies related to computational and comparative operomics.

  14. Insight on specificity of uracil permeases of the NAT/NCS2 family from analysis of the transporter encoded in the pyrimidine utilization operon of Escherichia coli.

    PubMed

    Botou, Maria; Lazou, Panayiota; Papakostas, Konstantinos; Lambrinidis, George; Evangelidis, Thomas; Mikros, Emmanuel; Frillingos, Stathis

    2018-04-01

    The uracil permease UraA of Escherichia coli is a structurally known prototype for the ubiquitous Nucleobase-Ascorbate Transporter (NAT) or Nucleobase-Cation Symporter-2 (NCS2) family and represents a well-defined subgroup of bacterial homologs that remain functionally unstudied. Here, we analyze four of these homologs, including RutG of E. coli which shares 35% identity with UraA and is encoded in the catabolic rut (pyrimidine utilization) operon. Using amplified expression in E. coli K-12, we show that RutG is a high-affinity permease for uracil, thymine and, at low efficiency, xanthine and recognizes also 5-fluorouracil and oxypurinol. In contrast, UraA and the homologs from Acinetobacter calcoaceticus and Aeromonas veronii are permeases specific for uracil and 5-fluorouracil. Molecular docking indicates that thymine is hindered from binding to UraA by a highly conserved Phe residue which is absent in RutG. Site-directed replacement of this Phe with Ala in the three uracil-specific homologs allows high-affinity recognition and/or transport of thymine, emulating the RutG profile. Furthermore, all RutG orthologs from enterobacteria retain an Ala at this position, implying that they can use both uracil and thymine and, possibly, xanthine as substrates and provide the bacterial cell with a range of catabolizable nucleobases. © 2018 John Wiley & Sons Ltd.

  15. Spatial organization of transcription machinery and its segregation from the replisome in fast-growing bacterial cells

    PubMed Central

    Cagliero, Cedric; Zhou, Yan Ning; Jin, Ding Jun

    2014-01-01

    In a fast-growing Escherichia coli cell, most RNA polymerase (RNAP) is allocated to rRNA synthesis forming transcription foci at clusters of rrn operons or bacterial nucleolus, and each of the several nascent nucleoids contains multiple pairs of replication forks. The composition of transcription foci has not been determined. In addition, how the transcription machinery is three-dimensionally organized to promote cell growth in concord with replication machinery in the nucleoid remains essentially unknown. Here, we determine the spatial and functional landscapes of transcription and replication machineries in fast-growing E. coli cells using super-resolution-structured illumination microscopy. Co-images of RNAP and DNA reveal spatial compartmentation and duplication of the transcription foci at the surface of the bacterial chromosome, encompassing multiple nascent nucleoids. Transcription foci cluster with NusA and NusB, which are the rrn anti-termination system and are associated with nascent rRNAs. However, transcription foci tend to separate from SeqA and SSB foci, which track DNA replication forks and/or the replisomes, demonstrating that transcription machinery and replisome are mostly located in different chromosomal territories to maintain harmony between the two major cellular functions in fast-growing cells. Our study suggests that bacterial chromosomes are spatially and functionally organized, analogous to eukaryotes. PMID:25416798

  16. The Antisense RNA As1_flv4 in the Cyanobacterium Synechocystis sp. PCC 6803 Prevents Premature Expression of the flv4-2 Operon upon Shift in Inorganic Carbon Supply*

    PubMed Central

    Eisenhut, Marion; Georg, Jens; Klähn, Stephan; Sakurai, Isamu; Mustila, Henna; Zhang, Pengpeng; Hess, Wolfgang R.; Aro, Eva-Mari

    2012-01-01

    The functional relevance of natural cis-antisense transcripts is mostly unknown. Here we have characterized the association of three antisense RNAs and one intergenically encoded noncoding RNA with an operon that plays a crucial role in photoprotection of photosystem II under low carbon conditions in the cyanobacterium Synechocystis sp. PCC 6803. Cyanobacteria show strong gene expression dynamics in response to a shift of cells from high carbon to low levels of inorganic carbon (Ci), but the regulatory mechanisms are poorly understood. Among the most up-regulated genes in Synechocystis are flv4, sll0218, and flv2, which are organized in the flv4-2 operon. The flavodiiron proteins encoded by this operon open up an alternative electron transfer route, likely starting from the QB site in photosystem II, under photooxidative stress conditions. Our expression analysis of cells shifted from high carbon to low carbon demonstrated an inversely correlated transcript accumulation of the flv4-2 operon mRNA and one antisense RNA to flv4, designated as As1_flv4. Overexpression of As1_flv4 led to a decrease in flv4-2 mRNA. The promoter activity of as1_flv4 was transiently stimulated by Ci limitation and negatively regulated by the AbrB-like transcription regulator Sll0822, whereas the flv4-2 operon was positively regulated by the transcription factor NdhR. The results indicate that the tightly regulated antisense RNA As1_flv4 establishes a transient threshold for flv4-2 expression in the early phase after a change in Ci conditions. Thus, it prevents unfavorable synthesis of the proteins from the flv4-2 operon. PMID:22854963

  17. Acrylonitrile Quenching of Trp Phosphorescence in Proteins: A Probe of the Internal Flexibility of the Globular Fold

    PubMed Central

    Strambini, Giovanni B.; Gonnelli, Margherita

    2010-01-01

    Quenching of Trp phosphorescence in proteins by diffusion of solutes of various molecular sizes unveils the frequency-amplitude of structural fluctuations. To cover the sizes gap between O2 and acrylamide, we examined the potential of acrylonitrile to probe conformational flexibility of proteins. The distance dependence of the through-space acrylonitrile quenching rate was determined in a glass at 77 K, with the indole analog 2-(3-indoyl) ethyl phenyl ketone. Intensity and decay kinetics data were fitted to a rate, k(r) = k0 exp[−(r − r0)/re], with an attenuation length re = 0.03 nm and a contact rate k0 = 3.6 × 1010 s−1. At ambient temperature, the bimolecular quenching rate constant (kq) was determined for a series of proteins, appositely selected to test the importance of factors such as the degree of Trp burial and structural rigidity. Relative to kq = 1.9 × 109 M−1s−1 for free Trp in water, in proteins kq ranged from 6.5 × 106 M−1s−1 for superficial sites to 1.3 × 102 M−1s−1 for deep cores. The short-range nature of the interaction and the direct correlation between kq and structural flexibility attest that in the microsecond-second timescale of phosphorescence acrylonitrile readily penetrates even compact protein cores and exhibits significant sensitivity to variations in dynamical structure of the globular fold. PMID:20682273

  18. Long-range transcriptional control of an operon necessary for virulence-critical ESX-1 secretion in Mycobacterium tuberculosis.

    PubMed

    Hunt, Debbie M; Sweeney, Nathan P; Mori, Luisa; Whalan, Rachael H; Comas, Iñaki; Norman, Laura; Cortes, Teresa; Arnvig, Kristine B; Davis, Elaine O; Stapleton, Melanie R; Green, Jeffrey; Buxton, Roger S

    2012-05-01

    The ESX-1 secretion system of Mycobacterium tuberculosis has to be precisely regulated since the secreted proteins, although required for a successful virulent infection, are highly antigenic and their continued secretion would alert the immune system to the infection. The transcription of a five-gene operon containing espACD-Rv3613c-Rv3612c, which is required for ESX-1 secretion and is essential for virulence, was shown to be positively regulated by the EspR transcription factor. Thus, transcription from the start site, found to be located 67 bp upstream of espA, was dependent upon EspR enhancer-like sequences far upstream (between 884 and 1,004 bp), which we term the espA activating region (EAR). The EAR contains one of the known binding sites for EspR, providing the first in vivo evidence that transcriptional activation at the espA promoter occurs by EspR binding to the EAR and looping out DNA between this site and the promoter. Regulation of transcription of this operon thus takes place over long regions of the chromosome. This regulation may differ in some members of the M. tuberculosis complex, including Mycobacterium bovis, since deletions of the intergenic region have removed the upstream sequence containing the EAR, resulting in lowered espA expression. Consequent differences in expression of ESX-1 in these bacteria may contribute to their various pathologies and host ranges. The virulence-critical nature of this operon means that transcription factors controlling its expression are possible drug targets.

  19. Mutation of I696 and W697 in the TRP box of vanilloid receptor subtype I modulates allosteric channel activation.

    PubMed

    Gregorio-Teruel, Lucia; Valente, Pierluigi; González-Ros, José Manuel; Fernández-Ballester, Gregorio; Ferrer-Montiel, Antonio

    2014-03-01

    The transient receptor potential vanilloid receptor subtype I (TRPV1) channel acts as a polymodal sensory receptor gated by chemical and physical stimuli. Like other TRP channels, TRPV1 contains in its C terminus a short, conserved domain called the TRP box, which is necessary for channel gating. Substitution of two TRP box residues-I696 and W697-with Ala markedly affects TRPV1's response to all activating stimuli, which indicates that these two residues play a crucial role in channel gating. We systematically replaced I696 and W697 with 18 native l-amino acids (excluding cysteine) and evaluated the effect on voltage- and capsaicin-dependent gating. Mutation of I696 decreased channel activation by either voltage or capsaicin; furthermore, gating was only observed with substitution of hydrophobic amino acids. Substitution of W697 with any of the 18 amino acids abolished gating in response to depolarization alone, shifting the threshold to unreachable voltages, but not capsaicin-mediated gating. Moreover, vanilloid-activated responses of W697X mutants showed voltage-dependent gating along with a strong voltage-independent component. Analysis of the data using an allosteric model of activation indicates that mutation of I696 and W697 primarily affects the allosteric coupling constants of the ligand and voltage sensors to the channel pore. Together, our findings substantiate the notion that inter- and/or intrasubunit interactions at the level of the TRP box are critical for efficient coupling of stimulus sensing and gate opening. Perturbation of these interactions markedly reduces the efficacy and potency of the activating stimuli. Furthermore, our results identify these interactions as potential sites for pharmacological intervention.

  20. Replica exchange simulation of reversible folding/unfolding of the Trp-cage miniprotein in explicit solvent: on the structure and possible role of internal water.

    PubMed

    Paschek, Dietmar; Nymeyer, Hugh; García, Angel E

    2007-03-01

    We simulate the folding/unfolding equilibrium of the 20-residue miniprotein Trp-cage. We use replica exchange molecular dynamics simulations of the AMBER94 atomic detail model of the protein explicitly solvated by water, starting from a completely unfolded configuration. We employ a total of 40 replicas, covering the temperature range between 280 and 538 K. Individual simulation lengths of 100 ns sum up to a total simulation time of about 4 micros. Without any bias, we observe the folding of the protein into the native state with an unfolding-transition temperature of about 440 K. The native state is characterized by a distribution of root mean square distances (RMSD) from the NMR data that peaks at 1.8A, and is as low as 0.4A. We show that equilibration times of about 40 ns are required to yield convergence. A folded configuration in the entire extended ensemble is found to have a lifetime of about 31 ns. In a clamp-like motion, the Trp-cage opens up during thermal denaturation. In line with fluorescence quenching experiments, the Trp-residue sidechain gets hydrated when the protein opens up, roughly doubling the number of water molecules in the first solvation shell. We find the helical propensity of the helical domain of Trp-cage rather well preserved even at very high temperatures. In the folded state, we can identify states with one and two buried internal water molecules interconnecting parts of the Trp-cage molecule by hydrogen bonds. The loss of hydrogen bonds of these buried water molecules in the folded state with increasing temperature is likely to destabilize the folded state at elevated temperatures.

  1. Insulin/phosphoinositide 3-kinase pathway accelerates the glucose-induced first-phase insulin secretion through TrpV2 recruitment in pancreatic β-cells.

    PubMed

    Aoyagi, Kyota; Ohara-Imaizumi, Mica; Nishiwaki, Chiyono; Nakamichi, Yoko; Nagamatsu, Shinya

    2010-12-01

    Functional insulin receptor and its downstream effector PI3K (phosphoinositide 3-kinase) have been identified in pancreatic β-cells, but their involvement in the regulation of insulin secretion from β-cells remains unclear. In the present study, we investigated the physiological role of insulin and PI3K in glucose-induced biphasic insulin exocytosis in primary cultured β-cells and insulinoma Min6 cells using total internal reflection fluorescent microscopy. The pretreatment of β-cells with insulin induced the rapid increase in intracellular Ca2+ levels and accelerated the exocytotic response without affecting the second-phase insulin secretion. The inhibition of PI3K not only abolished the insulin-induced rapid development of the exocytotic response, but also potentiated the second-phase insulin secretion. The rapid development of Ca2+ and accelerated exocytotic response induced by insulin were accompanied by the translocation of the Ca2+-permeable channel TrpV2 (transient receptor potential V2) in a PI3K-dependent manner. Inhibition of TrpV2 by the selective blocker tranilast, or the expression of shRNA (short-hairpin RNA) against TrpV2 suppressed the effect of insulin in the first phase, but the second phase was not affected. Thus our results demonstrate that insulin treatment induced the acceleration of the exocytotic response during the glucose-induced first-phase response by the insertion of TrpV2 into the plasma membrane in a PI3K-dependent manner.

  2. The dev Operon Regulates the Timing of Sporulation during Myxococcus xanthus Development

    PubMed Central

    Rajagopalan, Ramya

    2017-01-01

    ABSTRACT Myxococcus xanthus undergoes multicellular development when starved. Thousands of rod-shaped cells coordinate their movements and aggregate into mounds in which cells differentiate into spores. Mutations in the dev operon impair development. The dev operon encompasses a clustered regularly interspaced short palindromic repeat-associated (CRISPR-Cas) system. Null mutations in devI, a small gene at the beginning of the dev operon, suppress the developmental defects caused by null mutations in the downstream devR and devS genes but failed to suppress defects caused by a small in-frame deletion in devT. We provide evidence that the original mutant has a second-site mutation. We show that devT null mutants exhibit developmental defects indistinguishable from devR and devS null mutants, and a null mutation in devI suppresses the defects of a devT null mutation. The similarity of DevTRS proteins to components of the CRISPR-associated complex for antiviral defense (Cascade), together with our molecular characterization of dev mutants, support a model in which DevTRS form a Cascade-like subcomplex that negatively autoregulates dev transcript accumulation and prevents DevI overproduction that would strongly inhibit sporulation. Our results also suggest that DevI transiently inhibits sporulation when regulated normally. The mechanism of transient inhibition may involve MrpC, a key transcription factor, whose translation appears to be weakly inhibited by DevI. Finally, our characterization of a devI devS mutant indicates that very little exo transcript is required for sporulation, which is surprising since Exo proteins help form the polysaccharide spore coat. IMPORTANCE CRISPR-Cas systems typically function as adaptive immune systems in bacteria. The dev CRISPR-Cas system of M. xanthus has been proposed to prevent bacteriophage infection during development, but how dev controls sporulation has been elusive. Recent evidence supported a model in which DevR and Dev

  3. Synergy between Prkdc and Trp53 regulates stem cell proliferation and GI-ARS after irradiation.

    PubMed

    Gurley, Kay E; Ashley, Amanda K; Moser, Russell D; Kemp, Christopher J

    2017-11-01

    Ionizing radiation (IR) is one of the most widely used treatments for cancer. However, acute damage to the gastrointestinal tract or gastrointestinal acute radiation syndrome (GI-ARS) is a major dose-limiting side effect, and the mechanisms that underlie this remain unclear. Here we use mouse models to explore the relative roles of DNA repair, apoptosis, and cell cycle arrest in radiation response. IR induces DNA double strand breaks and DNA-PK mutant Prkdc scid/scid mice are sensitive to GI-ARS due to an inability to repair these breaks. IR also activates the tumor suppressor p53 to trigger apoptotic cell death within intestinal crypt cells and p53 deficient mice are resistant to apoptosis. To determine if DNA-PK and p53 interact to govern radiosensitivity, we compared the response of single and compound mutant mice to 8 Gy IR. Compound mutant Prkdc scid/scid /Trp53 -/- mice died earliest due to severe GI-ARS. While both Prkdc scid/scid and Prkdc scid/scid /Trp53 -/- mutant mice had higher levels of IR-induced DNA damage, particularly within the stem cell compartment of the intestinal crypt, in Prkdc scid/scid /Trp53 -/- mice these damaged cells abnormally progressed through the cell cycle resulting in mitotic cell death. This led to a loss of Paneth cells and a failure to regenerate the differentiated epithelial cells required for intestinal function. IR-induced apoptosis did not correlate with radiosensitivity. Overall, these data reveal that DNA repair, mediated by DNA-PK, and cell cycle arrest, mediated by p53, cooperate to protect the stem cell niche after DNA damage, suggesting combination approaches to modulate both pathways may be beneficial to reduce GI-ARS. As many cancers harbor p53 mutations, this also suggests targeting DNA-PK may be effective to enhance sensitivity of p53 mutant tumors to radiation.

  4. [Mutation in the beta3-adrenergic receptor gene (Trp64Arg) does not influence insulin resistence, energy metabolism, fat distribution and lipid spectrum in young people. Pilot study].

    PubMed

    Bendlová, B; Mazura, I; Vcelák, J; Pelikánová, T; Kunesová, M; Hainer, V; Obenberger, J; Palyzová, D

    1999-05-01

    A missence mutation Trp64Arg in the beta3-adrenergic receptor gene is associated with obesity, insulin resistance, a lower metabolic rate and the earlier onset of NIDDM but the published results are controversial. We investigated the effect of this mutation on insulin resistance (euglycemic hyperinsulinemic clamp), on fat mass and fat distribution (anthropometry, bioimpedance, CT) and resting metabolic rate (indirect calorimetry), lipid spectrum and other metabolic disturbances in Czech juveniles recruited from juvenile hypertensives (H, n = 68) and controls (C, n = 81). The frequency of this mutation (determined by digestion of 210 bp PCR product with MvaI) was double in H than in C (14.7%, vs. 7.4%) and the carriers of Arg64 allele had sig. higher fasting glucose (H: p = 0.002. C: p = 0.025). Four Trp64/Arg64 and six Trp64/Trp64 men (age 23 +/- 4.2, vs. 22.5 +/- 1.9 y, BMI 26 +/- 5.5, vs. 22.9 +/- 5.1 kg/m2) took part in a detailed pilot study. But no signif. differences (Horn's method) in fasting glucose (4.6 +/- 0.6, vs. 4.9 +/- 0.4 mmol/l), in parameters of insulin resistance (M-value150-180 min. 9.1 +/- 1.1, vs. 8.9 +/- 1.5 mg glucose/kg.min(-1)), resting metabolic rate/lean body mass (RMR/kg LBM: 78.6 +/- 4.6, vs. 85.6 +/- 23.2 kJ/kg), lipid spectrum and other screened parameters were found. The lowest resting metabolic rate (RMR/kg LBM 55.4; 62.6 kJ/kg) was found in brothers (both C, Trp64/Trp64) who highly differ in body constitution (BMI 19.0 resp. 32.4 kg/m2). We suppose that in this case the energy metabolism is probably determined by other genetic loci and does not correlate with body fat mass. Our pilot study does not confirm the influence of Trp64Arg mutation in heterozygous carriers on insulin resistance, energy metabolism and lipid spectrum.

  5. Tumor Trp53 status and genotype affect the bone marrow microenvironment in acute myeloid leukemia

    PubMed Central

    Jacamo, Rodrigo; Davis, R. Eric; Ling, Xiaoyang; Sonnylal, Sonali; Wang, Zhiqiang; Ma, Wencai; Zhang, Min; Ruvolo, Peter; Ruvolo, Vivian; Wang, Rui-Yu; McQueen, Teresa; Lowe, Scott; Zuber, Johannes; Kornblau, Steven M.; Konopleva, Marina; Andreeff, Michael

    2017-01-01

    The genetic heterogeneity of acute myeloid leukemia (AML) and the variable responses of individual patients to therapy suggest that different AML genotypes may influence the bone marrow (BM) microenvironment in different ways. We performed gene expression profiling of bone marrow mesenchymal stromal cells (BM-MSC) isolated from normal C57BL/6 mice or mice inoculated with syngeneic murine leukemia cells carrying different human AML genotypes, developed in mice with Trp53 wild-type or nullgenetic backgrounds. We identified a set of genes whose expression in BM-MSC was modulated by all four AML genotypes tested. In addition, there were sets of differentially-expressed genes in AML-exposed BM-MSC that were unique to the particular AML genotype or Trp53 status. Our findings support the hypothesis that leukemia cells alter the transcriptome of surrounding BM stromal cells, in both common and genotype-specific ways. These changes are likely to be advantageous to AML cells, affecting disease progression and response to chemotherapy, and suggest opportunities for stroma-targeting therapy, including those based on AML genotype. PMID:29137349

  6. Bioinformatic Analysis Reveals Archaeal tRNATyr and tRNATrp Identities in Bacteria

    PubMed Central

    Mukai, Takahito; Reynolds, Noah M.; Crnković, Ana; Söll, Dieter

    2017-01-01

    The tRNA identity elements for some amino acids are distinct between the bacterial and archaeal domains. Searching in recent genomic and metagenomic sequence data, we found some candidate phyla radiation (CPR) bacteria with archaeal tRNA identity for Tyr-tRNA and Trp-tRNA synthesis. These bacteria possess genes for tyrosyl-tRNA synthetase (TyrRS) and tryptophanyl-tRNA synthetase (TrpRS) predicted to be derived from DPANN superphylum archaea, while the cognate tRNATyr and tRNATrp genes reveal bacterial or archaeal origins. We identified a trace of domain fusion and swapping in the archaeal-type TyrRS gene of a bacterial lineage, suggesting that CPR bacteria may have used this mechanism to create diverse proteins. Archaeal-type TrpRS of bacteria and a few TrpRS species of DPANN archaea represent a new phylogenetic clade (named TrpRS-A). The TrpRS-A open reading frames (ORFs) are always associated with another ORF (named ORF1) encoding an unknown protein without global sequence identity to any known protein. However, our protein structure prediction identified a putative HIGH-motif and KMSKS-motif as well as many α-helices that are characteristic of class I aminoacyl-tRNA synthetase (aaRS) homologs. These results provide another example of the diversity of molecular components that implement the genetic code and provide a clue to the early evolution of life and the genetic code. PMID:28230768

  7. fbpABC gene cluster in Neisseria meningitidis is transcribed as an operon.

    PubMed

    Khun, H H; Deved, V; Wong, H; Lee, B C

    2000-12-01

    The neisserial fbpABC locus has been proposed to constitute a single transcriptional unit. To confirm this operonic arrangement, transcription assays using reverse transcriptase PCR amplification were conducted with Neisseria meningitidis. The presence of fbpAB and fbpBC transcripts obtained by priming cDNA synthesis with an fbpC-sequence-specific oligonucleotide indicates that fbpABC is organized as a single expression unit. The ratio of fbpA to fbpABC mRNA was approximately between 10- to 20-fold, as determined by real-time quantitative PCR.

  8. fbpABC Gene Cluster in Neisseria meningitidis Is Transcribed as an Operon

    PubMed Central

    Khun, Heng H.; Deved, Vinay; Wong, Howard; Lee, B. Craig

    2000-01-01

    The neisserial fbpABC locus has been proposed to constitute a single transcriptional unit. To confirm this operonic arrangement, transcription assays using reverse transcriptase PCR amplification were conducted with Neisseria meningitidis. The presence of fbpAB and fbpBC transcripts obtained by priming cDNA synthesis with an fbpC-sequence-specific oligonucleotide indicates that fbpABC is organized as a single expression unit. The ratio of fbpA to fbpABC mRNA was approximately between 10- to 20-fold, as determined by real-time quantitative PCR. PMID:11083849

  9. Transcription of the pst Operon of Clostridium acetobutylicum Is Dependent on Phosphate Concentration and pH

    PubMed Central

    Fischer, Ralf-Jörg; Oehmcke, Sonja; Meyer, Uta; Mix, Maren; Schwarz, Katrin; Fiedler, Tomas; Bahl, Hubert

    2006-01-01

    The pst operon of Clostridium acetobutylicum ATCC 824 comprises five genes, pstS, pstC, pstA, pstB, and phoU, and shows a gene architecture identical to that of Escherichia coli. Deduced proteins are predicted to represent a high-affinity phosphate-specific ABC (ATP-binding cassette) transport system (Pst) and a protein homologous to PhoU, a negative phosphate regulon regulator. We analyzed the expression patterns of the pst operon in Pi-limited chemostat cultures during acid production at pH 5.8 or solvent production at pH 4.5 and in response to Pi pulses. Specific mRNA transcripts were found only when external Pi concentrations had dropped below 0.2 mM. Two specific transcripts were detected, a 4.7-kb polycistronic mRNA spanning the whole operon and a quantitatively dominating 1.2-kb mRNA representing the first gene, pstS. The mRNA levels clearly differed depending on the external pH. The amounts of the full-length mRNA detected were about two times higher at pH 5.8 than at pH 4.5. The level of pstS mRNA increased by a factor of at least 8 at pH 5.8 compared to pH 4.5 results. Primer extension experiments revealed only one putative transcription start point 80 nucleotides upstream of pstS. Thus, additional regulatory sites are proposed in the promoter region, integrating two different extracellular signals, namely, depletion of inorganic phosphate and the pH of the environment. After phosphate pulses were applied to a phosphate-limited chemostat we observed faster phosphate consumption at pH 5.8 than at pH 4.5, although higher optical densities were recorded at pH 4.5. PMID:16855236

  10. Consistent changes in the taxonomic structure and functional attributes of bacterial communities during primary succession.

    PubMed

    Ortiz-Álvarez, Rüdiger; Fierer, Noah; de Los Ríos, Asunción; Casamayor, Emilio O; Barberán, Albert

    2018-02-20

    Ecologists have long studied primary succession, the changes that occur in biological communities after initial colonization of an environment. Most of this work has focused on succession in plant communities, laying the conceptual foundation for much of what we currently know about community assembly patterns over time. Because of their prevalence and importance in ecosystems, an increasing number of studies have focused on microbial community dynamics during succession. Here, we conducted a meta-analysis of bacterial primary succession patterns across a range of distinct habitats, including the infant gut, plant surfaces, soil chronosequences, and aquatic environments, to determine whether consistent changes in bacterial diversity, community composition, and functional traits are evident over the course of succession. Although these distinct habitats harbor unique bacterial communities, we were able to identify patterns in community assembly that were shared across habitat types. We found an increase in taxonomic and functional diversity with time while the taxonomic composition and functional profiles of communities became less variable (lower beta diversity) in late successional stages. In addition, we found consistent decreases in the rRNA operon copy number and in the high-efficient phosphate assimilation process (Pst system) suggesting that reductions in resource availability during succession select for taxa adapted to low-resource conditions. Together, these results highlight that, like many plant communities, microbial communities also exhibit predictable patterns during primary succession.

  11. The excludon: a new concept in bacterial antisense RNA-mediated gene regulation.

    PubMed

    Sesto, Nina; Wurtzel, Omri; Archambaud, Cristel; Sorek, Rotem; Cossart, Pascale

    2013-02-01

    In recent years, non-coding RNAs have emerged as key regulators of gene expression. Among these RNAs, the antisense RNAs (asRNAs) are particularly abundant, but in most cases the function and mechanism of action for a particular asRNA remains elusive. Here, we highlight a recently discovered paradigm termed the excludon, which defines a genomic locus encoding an unusually long asRNA that spans divergent genes or operons with related or opposing functions. Because these asRNAs can inhibit the expression of one operon while functioning as an mRNA for the adjacent operon, they act as fine-tuning regulatory switches in bacteria.

  12. Acid-base titration of melanocortin peptides: evidence of Trp rotational conformers interconversion.

    PubMed

    Fernandez, Roberto M; Vieira, Renata F F; Nakaie, Clóvis R; Lamy, M Teresa; Ito, Amando S

    2005-01-01

    Tryptophantime-resolved fluorescence was used to monitor acid-base titration properties of alpha-melanocyte stimulating hormone (alpha-MSH) and the biologically more potent analog [Nle4, D-Phe7]alpha -MSH (NDP-MSH), labeled or not with the paramagnetic amino acid probe 2,2,6,6-tetramthylpiperidine-N-oxyl-4-amino-4-carboxylic acid (Toac). Global analysis of fluorescence decay profiles measured in the pH range between 2.0 and 11.0 showed that, for each peptide, the data could be well fitted to three lifetimes whose values remained constant. The less populated short lifetime component changed little with pH and was ascribed to Trp g+ chi1 rotamer, in which electron transfer deactivation predominates over fluorescence. The long and intermediate lifetime preexponential factors interconverted along that pH interval and the result was interpreted as due to interconversion between Trp g- and trans chi1 rotamers, driven by conformational changes promoted by modifications in the ionization state of side-chain residues. The differences in the extent of interconversion in alpha-MSH and NDP-MSH are indicative of structural differences between the peptides, while titration curves suggest structural similarities between each peptide and its Toac-labeled species, in aqueous solution. Though less sensitive than fluorescence, the Toac electron spin resonance (ESR) isotropic hyperfine splitting parameter can also monitor the titration of side-chain residues located relatively far from the probe. Copyright (c) 2005 Wiley Periodicals, Inc.

  13. Identification of the Operon for the Sorbitol (Glucitol) Phosphoenolpyruvate:Sugar Phosphotransferase System in Streptococcus mutans

    PubMed Central

    Boyd, David A.; Thevenot, Tracy; Gumbmann, Markus; Honeyman, Allen L.; Hamilton, Ian R.

    2000-01-01

    Transposon mutagenesis and marker rescue were used to isolate and identify an 8.5-kb contiguous region containing six open reading frames constituting the operon for the sorbitol P-enolpyruvate phosphotransferase transport system (PTS) of Streptococcus mutans LT11. The first gene, srlD, codes for sorbitol-6-phosphate dehydrogenase, followed downstream by srlR, coding for a transcriptional regulator; srlM, coding for a putative activator; and the srlA, srlE, and srlB genes, coding for the EIIC, EIIBC, and EIIA components of the sorbitol PTS, respectively. Among all sorbitol PTS operons characterized to date, the srlD gene is found after the genes coding for the EII components; thus, the location of the gene in S. mutans is unique. The SrlR protein is similar to several transcriptional regulators found in Bacillus spp. that contain PTS regulator domains (J. Stülke, M. Arnaud, G. Rapoport, and I. Martin-Verstraete, Mol. Microbiol. 28:865–874, 1998), and its gene overlaps the srlM gene by 1 bp. The arrangement of these two regulatory genes is unique, having not been reported for other bacteria. PMID:10639465

  14. Bistable behavior of the lac operon in E. coli when induced with a mixture of lactose and TMG.

    PubMed

    Díaz-Hernández, Orlando; Santillán, Moisés

    2010-01-01

    In this work we investigate multistability in the lac operon of Escherichia coli when it is induced by a mixture of lactose and the non-metabolizable thiomethyl galactoside (TMG). In accordance with previously published experimental results and computer simulations, our simulations predict that: (1) when the system is induced by TMG, the system shows a discernible bistable behavior while, (2) when the system is induced by lactose, bistability does not disappear but excessively high concentrations of lactose would be required to observe it. Finally, our simulation results predict that when a mixture of lactose and TMG is used, the bistability region in the extracellular glucose concentration vs. extracellular lactose concentration parameter space changes in such a way that the model predictions regarding bistability could be tested experimentally. These experiments could help to solve a recent controversy regarding the existence of bistability in the lac operon under natural conditions.

  15. Bistable Behavior of the Lac Operon in E. Coli When Induced with a Mixture of Lactose and TMG

    PubMed Central

    Díaz-Hernández, Orlando; Santillán, Moisés

    2010-01-01

    In this work we investigate multistability in the lac operon of Escherichia coli when it is induced by a mixture of lactose and the non-metabolizable thiomethyl galactoside (TMG). In accordance with previously published experimental results and computer simulations, our simulations predict that: (1) when the system is induced by TMG, the system shows a discernible bistable behavior while, (2) when the system is induced by lactose, bistability does not disappear but excessively high concentrations of lactose would be required to observe it. Finally, our simulation results predict that when a mixture of lactose and TMG is used, the bistability region in the extracellular glucose concentration vs. extracellular lactose concentration parameter space changes in such a way that the model predictions regarding bistability could be tested experimentally. These experiments could help to solve a recent controversy regarding the existence of bistability in the lac operon under natural conditions. PMID:21423364

  16. Rhizobium meliloti anthranilate synthase gene: cloning, sequence, and expression in Escherichia coli.

    PubMed Central

    Bae, Y M; Holmgren, E; Crawford, I P

    1989-01-01

    We determined the DNA sequence of the Rhizobium meliloti gene encoding anthranilate synthase, the first enzyme of the tryptophan pathway. Sequences similar to those seen for the two subunits of the enzyme as found in all other procaryotic species studied are present in a single open reading frame of 729 codons. This apparent gene fusion joins the C terminus of the large subunit (TrpE) to the N terminus of the small subunit (TrpG) through a short connecting segment. We designate the fused gene trpE(G). The gene is flanked by a typical rho-independent terminator at the 3' end and a complex regulatory region at the 5' end resembling those of operons under transcriptional attenuation control. The location of the promoter was determined by S1 nuclease protection, using Rhizobium mRNA. Although this promoter was inactive in Escherichia coli, mutations eliciting activity were easily obtained. One of these was a C----T change at position -9 in the -10 region. The +1 position of the mRNA is the first base of the initiation codon of the leader peptide, implying that unlike trpE(G), which has a normal Shine-Dalgarno sequence, the leader peptide gene lacks a ribosome-binding site. Images PMID:2656657

  17. Associations between Dietary Patterns, ADRβ2 Gln27Glu and ADRβ3 Trp64Arg with Regard to Serum Triglyceride Levels: J-MICC Study

    PubMed Central

    Nanri, Hinako; Nishida, Yuichiro; Nakamura, Kazuyo; Tanaka, Keitaro; Naito, Mariko; Yin, Guang; Hamajima, Nobuyuki; Takashima, Naoyuki; Suzuki, Sadao; Nindita, Yora; Kohno, Michiko; Uemura, Hirokazu; Koyama, Teruhide; Hosono, Satoyo; Mikami, Haruo; Kubo, Michiaki; Tanaka, Hideo

    2016-01-01

    Interactions between dietary patterns and 2 β-adrenergic receptor (ADRβ) gene polymorphisms (ADRβ2 Gln27Glu and ADRβ3 Trp64Arg) were examined with regard to the effects on serum triglyceride levels. The cross-sectional study comprised 1720 men and women (aged 35–69 years) enrolled in the Japan Multi-Institutional Collaborative Cohort (J-MICC) Study. Genotyping was conducted using a multiplex polymerase chain reaction-based invader assay. We used 46 items from a validated short food frequency questionnaire and examined major dietary patterns by factor analysis. We identified four dietary patterns: healthy, Western, seafood and bread patterns. There was no significant association between any dietary pattern and serum triglyceride levels. After a separate genotype-based analysis, significant interactions between ADRβ3 Trp64Arg genotype and the bread pattern (p for interaction = 0.01) were associated with serum triglyceride levels; specifically, after adjusting for confounding factors, Arg allele carriers with the bread pattern had lower serum triglycerides (p for trend = 0.01). However, the Trp/Trp homozygous subjects with the bread pattern showed no association with serum triglycerides (p for trend = 0.55). Interactions between other dietary patterns and ADRβ polymorphisms were not significant for serum triglyceride levels. Our findings suggest that ADRβ3 polymorphism modifies the effects of the bread pattern on triglyceride levels. PMID:27608039

  18. Pathovars of Pseudomonas syringae Causing Bacterial Brown Spot and Halo Blight in Phaseolus vulgaris L. Are Distinguishable by Ribotyping

    PubMed Central

    González, Ana J.; Landeras, Elena; Mendoza, M. Carmen

    2000-01-01

    Ribotyping was evaluated as a method to differentiate between Pseudomonas syringae pv. phaseolicola and pv. syringae strains causing bacterial brown spot and halo blight diseases in Phaseolus vulgaris L. Ribotyping, with restriction enzymes BglI and SalI and using the Escherichia coli rrnB operon as the probe, differentiated 11 and 14 ribotypes, respectively, and a combination of data from both procedures yielded 19 combined ribotypes. Cluster analysis of the combined ribotypes differentiated the pathovars phaseolicola and syringae, as well as different clonal lineages within these pathovars. The potential of ribotyping to screen for correlations between lineages and factors such as geographical region and/or bean varieties is also reported. PMID:10653764

  19. Identification and Characterization of lpfABCC′DE, a Fimbrial Operon of Enterohemorrhagic Escherichia coli O157:H7

    PubMed Central

    Torres, Alfredo G.; Giron, Jorge A.; Perna, Nicole T.; Burland, Valerie; Blattner, Fred R.; Avelino-Flores, Fabiola; Kaper, James B.

    2002-01-01

    The mechanisms underlying the adherence of Escherichia coli O157:H7 and other enterohemorrhagic E. coli (EHEC) strains to intestinal epithelial cells are poorly understood. We have identified a chromosomal region (designated lpfABCC′DE) in EHEC O157:H7 containing six putative open reading frames that was found to be closely related to the long polar (LP) fimbria operon (lpf) of Salmonella enterica serovar Typhimurium, both in gene order and in conservation of the deduced amino acid sequences. We show that lpfABCC′DE is organized as an operon and that its expression is induced during the exponential growth phase. The lpf genes from EHEC strain EDL933 were introduced into a nonfimbriated (Fim−) E. coli K-12 strain, and the transformed strain produced fimbriae as visualized by electron microscopy and adhered to tissue culture cells. Anti-LpfA antiserum recognized a ca. 16-kDa LpfA protein when expressed under regulation of the T7 promoter system. The antiserum also cross-reacted with the LP fimbriae in immunogold electron microscopy and Western blot experiments. Isogenic E. coli O157:H7 lpf mutants derived from strains 86-24 and AGT300 showed slight reductions in adherence to tissue culture cells and formed fewer microcolonies compared with their wild-type parent strains. The adherence and microcolony formation phenotypes were restored when the lpf operon was introduced on a plasmid. We propose that LP fimbriae participate in the interaction of E. coli O157:H7 with eukaryotic cells by assisting in microcolony formation. PMID:12228266

  20. Interplay of protein and DNA structure revealed in simulations of the lac operon.

    PubMed

    Czapla, Luke; Grosner, Michael A; Swigon, David; Olson, Wilma K

    2013-01-01

    The E. coli Lac repressor is the classic textbook example of a protein that attaches to widely spaced sites along a genome and forces the intervening DNA into a loop. The short loops implicated in the regulation of the lac operon suggest the involvement of factors other than DNA and repressor in gene control. The molecular simulations presented here examine two likely structural contributions to the in-vivo looping of bacterial DNA: the distortions of the double helix introduced upon association of the highly abundant, nonspecific nucleoid protein HU and the large-scale deformations of the repressor detected in low-resolution experiments. The computations take account of the three-dimensional arrangements of nucleotides and amino acids found in crystal structures of DNA with the two proteins, the natural rest state and deformational properties of protein-free DNA, and the constraints on looping imposed by the conformation of the repressor and the orientation of bound DNA. The predicted looping propensities capture the complex, chain-length-dependent variation in repression efficacy extracted from gene expression studies and in vitro experiments and reveal unexpected chain-length-dependent variations in the uptake of HU, the deformation of repressor, and the folding of DNA. Both the opening of repressor and the presence of HU, at levels approximating those found in vivo, enhance the probability of loop formation. HU affects the global organization of the repressor and the opening of repressor influences the levels of HU binding to DNA. The length of the loop determines whether the DNA adopts antiparallel or parallel orientations on the repressor, whether the repressor is opened or closed, and how many HU molecules bind to the loop. The collective behavior of proteins and DNA is greater than the sum of the parts and hints of ways in which multiple proteins may coordinate the packaging and processing of genetic information.

  1. The core domain as the force sensor of the yeast mechanosensitive TRP channel.

    PubMed

    Su, Zhenwei; Anishkin, Andriy; Kung, Ching; Saimi, Yoshiro

    2011-12-01

    Stretch-activated conductances are commonly encountered in careful electric recordings. Those of known proteins (TRP, MscL, MscS, K(2p), Kv, etc.) all share a core, which houses the ion pathway and the gate, but no recognizable force-sensing domain. Like animal TRPs, the yeast TRPY1 is polymodal, activated by stretch force, Ca(2+), etc. To test whether its S5-S6 core senses the stretch force, we tried to uncouple it from the peripheral domains by strategic peptide insertions to block the covalent core-periphery interactions. Insertion of long unstructured peptides should distort, if not disrupt, protein structures that transmit force. Such insertions between S6 and the C-terminal tail largely removed Ca(2+) activation, showing their effectiveness. However, such insertions as well as those between S5 and the N-terminal region, which includes S1-S4, did not significantly alter mechanosensitivity. Even insertions at both locations flanking the S5-S6 core did not much alter mechanosensitivity. Tryptophan scanning mutations in S5 were also constructed to perturb possible noncovalent core-periphery contacts. The testable tryptophan mutations also have little or no effects on mechanosensitivity. Boltzmann fits of the wild-type force-response curves agree with a structural homology model for a stretch-induced core expansion of ~2 nm(2) upon opening. We hypothesize that membrane tension pulls on S5-S6, expanding the core and opening the TRPY1 gate. The core being the major force sensor offers the simplest, though not the only, explanation of why so many channels of disparate designs are mechanically sensitive. Compared with the bacterial MscL, TRPY1 is much less sensitive to force, befitting a polymodal channel that relies on multiple stimuli.

  2. Preparation, Imaging, and Quantification of Bacterial Surface Motility Assays

    PubMed Central

    Morales-Soto, Nydia; Anyan, Morgen E.; Mattingly, Anne E.; Madukoma, Chinedu S.; Harvey, Cameron W.; Alber, Mark; Déziel, Eric; Kearns, Daniel B.; Shrout, Joshua D.

    2015-01-01

    Bacterial surface motility, such as swarming, is commonly examined in the laboratory using plate assays that necessitate specific concentrations of agar and sometimes inclusion of specific nutrients in the growth medium. The preparation of such explicit media and surface growth conditions serves to provide the favorable conditions that allow not just bacterial growth but coordinated motility of bacteria over these surfaces within thin liquid films. Reproducibility of swarm plate and other surface motility plate assays can be a major challenge. Especially for more “temperate swarmers” that exhibit motility only within agar ranges of 0.4%-0.8% (wt/vol), minor changes in protocol or laboratory environment can greatly influence swarm assay results. “Wettability”, or water content at the liquid-solid-air interface of these plate assays, is often a key variable to be controlled. An additional challenge in assessing swarming is how to quantify observed differences between any two (or more) experiments. Here we detail a versatile two-phase protocol to prepare and image swarm assays. We include guidelines to circumvent the challenges commonly associated with swarm assay media preparation and quantification of data from these assays. We specifically demonstrate our method using bacteria that express fluorescent or bioluminescent genetic reporters like green fluorescent protein (GFP), luciferase (lux operon), or cellular stains to enable time-lapse optical imaging. We further demonstrate the ability of our method to track competing swarming species in the same experiment. PMID:25938934

  3. No effect of the Trp64Arg beta(3)-adrenoceptor gene variant on weight loss, body composition, or energy expenditure in obese, caucasian postmenopausal women.

    PubMed

    Rawson, Eric S; Nolan, Amy; Silver, Kristi; Shuldiner, Alan R; Poehlman, Eric T

    2002-06-01

    The Trp64Arg polymorphism in the beta(3)-adrenoceptor gene has been associated with increased prevalence of obesity, type 2 diabetes, and low rates of energy expenditure, although these findings are not unanimous. It is currently unknown if the presence of the Trp64Arg gene variant impedes the loss of body weight in obese, postmenopausal women via a reducing effect on energy expenditure. The objective of this study was to compare body composition and energy expenditure in carriers and noncarriers of the Trp64Arg variant in the beta(3)-adrenoceptor before and after weight loss. We measured body composition, total daily energy expenditure (TEE), resting metabolic rate (RMR), physical activity energy expenditure (PAEE), thermic effect of feeding (TEF), and respiratory quotient (RQ) in 34 obese, postmenopausal women (19 carriers and 15 noncarriers for the Trp64Arg variant) before and after a weight loss intervention. There were no differences in body composition or daily energy expenditure and its components between the 2 groups at baseline. There were significant reductions in body mass, body mass index (BMI), percent body fat, fat-free mass, and fat mass (main effect, all P <.0001) when analyzed with the 2 genotypes combined, but no significant differences between carriers and noncarriers with respect to change in these variables (group x time interaction term, all P >.05). Total energy expenditure tended to be reduced (490 kJ x d(-1), P =.13) in both groups following weight loss, but there was no significant group x time interaction term (P =.78), indicating no difference in the response of the 2 genotypes. There was a 9% reduction in RMR (611 kJ x d(-1), P <.001) when both groups were considered together, but no significant group x time interaction term (P =.84), suggesting that both groups responded in a similar manner to the weight loss intervention. PAEE and the TEF were not different following weight loss (both P >.60). There was a trend for RQ to be reduced

  4. Independent saturation of three TrpRS subsites generates a partially assembled state similar to those observed in molecular simulations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Laowanapiban, Poramaet; Kapustina, Maryna; Vonrhein, Clemens

    2009-03-05

    Two new crystal structures of Bacillus stearothermophilus tryptophanyl-tRNA synthetase (TrpRS) afford evidence that a closed interdomain hinge angle requires a covalent bond between AMP and an occupant of either pyrophosphate or tryptophan subsite. They also are within experimental error of a cluster of structures observed in a nonequilibrium molecular dynamics simulation showing partial active-site assembly. Further, the highest energy structure in a minimum action pathway computed by using elastic network models for Open and Pretransition state (PreTS) conformations for the fully liganded TrpRS monomer is intermediate between that simulated structure and a partially disassembled structure from a nonequilibrium molecular dynamicsmore » trajectory for the unliganded PreTS. These mutual consistencies provide unexpected validation of inferences drawn from molecular simulations.« less

  5. Indole-3-acetic acid biosynthetic pathway and aromatic amino acid aminotransferase activities in Pantoea dispersa strain GPK.

    PubMed

    Kulkarni, G B; Nayak, A S; Sajjan, S S; Oblesha, A; Karegoudar, T B

    2013-05-01

    This investigation deals with the production of IAA by a bacterial isolate Pantoea dispersa strain GPK (PDG) identified by 16S rRNA gene sequence analysis. HPLC and Mass spectral analysis of metabolites from bacterial spent medium revealed that, IAA production by PDG is Trp-dependent and follows indole-3-pyruvic acid (IPyA) pathway. Substrate specificity study of aromatic amino acid aminotransferase (AAT) showed high activities, only when tryptophan (Trp) and α-ketoglutarate (α-kg) were used as substrates. AAT is highly specific for Trp and α-kg as amino group donor and acceptor, respectively. The effect of exogenous IAA on bacterial growth was established. Low concentration of exogenous IAA induced the growth, whereas high concentration decreased the growth of bacterium. PDG treatment significantly increased the root length, shoot length and dry mass of the chickpea and pigeon pea plants. © 2013 The Society for Applied Microbiology.

  6. Tolerance to the hypothermic but not to the analgesic effect of [D-Trp11]neurotensin during the semichronic intracerebroventricular infusion of the peptide in rats.

    PubMed

    Dubuc, I; Pain, C; Suaudeau, C; Costentin, J

    1994-01-01

    The peptidase-resistant derivative of neurotensin, [D-Trp11]neurotensin, has been continuously infused intracerebroventricularly (75 ng/h) with an osmotic minipump for 10 days. On several days during this infusion the locomotor activity, the body temperature, the food intake, the body weight, and the nociceptive response in the plantar test were measured. A nonsignificant decrease of body temperature and a sustained analgesic effect were observed at each time considered. The response to a test dose of [D-Trp11]neurotensin (75 ng per rat) injected intracerebroventricularly at the 10th day of the chronic infusion revealed a complete tolerance to its hypothermic effect. Thus, it appears that the analgesic effect of [D-Trp11]neurotensin is independent of a hypothermic or an incapacitating effect of the peptide and does not give rise to tolerance after a 10-day continuous administration, in contrast to the hypothermic effect.

  7. The dev Operon Regulates the Timing of Sporulation during Myxococcus xanthus Development.

    PubMed

    Rajagopalan, Ramya; Kroos, Lee

    2017-05-15

    Myxococcus xanthus undergoes multicellular development when starved. Thousands of rod-shaped cells coordinate their movements and aggregate into mounds in which cells differentiate into spores. Mutations in the dev operon impair development. The dev operon encompasses a clustered regularly interspaced short palindromic repeat-associated (CRISPR-Cas) system. Null mutations in devI , a small gene at the beginning of the dev operon, suppress the developmental defects caused by null mutations in the downstream devR and devS genes but failed to suppress defects caused by a small in-frame deletion in devT We provide evidence that the original mutant has a second-site mutation. We show that devT null mutants exhibit developmental defects indistinguishable from devR and devS null mutants, and a null mutation in devI suppresses the defects of a devT null mutation. The similarity of DevTRS proteins to components of the CRISPR-associated complex for antiviral defense (Cascade), together with our molecular characterization of dev mutants, support a model in which DevTRS form a Cascade-like subcomplex that negatively autoregulates dev transcript accumulation and prevents DevI overproduction that would strongly inhibit sporulation. Our results also suggest that DevI transiently inhibits sporulation when regulated normally. The mechanism of transient inhibition may involve MrpC, a key transcription factor, whose translation appears to be weakly inhibited by DevI. Finally, our characterization of a devI devS mutant indicates that very little exo transcript is required for sporulation, which is surprising since Exo proteins help form the polysaccharide spore coat. IMPORTANCE CRISPR-Cas systems typically function as adaptive immune systems in bacteria. The dev CRISPR-Cas system of M. xanthus has been proposed to prevent bacteriophage infection during development, but how dev controls sporulation has been elusive. Recent evidence supported a model in which DevR and DevS prevent

  8. Study of Staphylococcus aureus N315 Pathogenic Genes by Text Mining and Enrichment Analysis of Pathways and Operons.

    PubMed

    Yang, Chun-Feng; Gou, Wei-Hui; Dai, Xin-Lun; Li, Yu-Mei

    2018-06-01

    Staphylococcus aureus (S. aureus) is a versatile pathogen found in many environments and can cause nosocomial infections in the community and hospitals. S. aureus infection is an increasingly serious threat to global public health that requires action across many government bodies, medical and health sectors, and scientific research institutions. In the present study, S. aureus N315 genes that have been shown in the literature to be pathogenic were extracted using a bibliometric method for functional enrichment analysis of pathways and operons to statistically discover novel pathogenic genes associated with S. aureus N315. A total of 383 pathogenic genes were mined from the literature using bibliometrics, and subsequently a few new pathogenic genes of S. aureus N315 were identified by functional enrichment analysis of pathways and operons. The discovery of these novel S. aureus N315 pathogenic genes is of great significance to treat S. aureus induced diseases and identify potential diagnostic markers, thus providing theoretical fundamentals for epidemiological prevention.

  9. Breathtaking TRP Channels: TRPA1 and TRPV1 in Airway Chemosensation and Reflex Control

    PubMed Central

    Bessac, Bret F.; Jordt, Sven-Eric

    2009-01-01

    New studies have revealed an essential role for TRPA1, a sensory neuronal TRP ion channel, in airway chemosensation and inflammation. TRPA1 is activated by chlorine, reactive oxygen species and noxious constituents of smoke and smog, initiating irritation and airway reflex responses. Together with TRPV1, the capsaicin receptor, TRPA1 may contribute to chemical hypersensitivity, chronic cough and airway inflammation in asthma, COPD and reactive airway dysfunction syndrome. PMID:19074743

  10. Sensitivity and Specificity of an Operon Immunochromatographic Test in Serum and Whole-Blood Samples for the Diagnosis of Trypanosoma cruzi Infection in Spain, an Area of Nonendemicity

    PubMed Central

    Flores-Chavez, María; Cruz, Israel; Nieto, Javier; Gárate, Teresa; Navarro, Miriam; Pérez-Ayala, Ana; López-Vélez, Rogelio

    2012-01-01

    Trypanosoma cruzi infection is an imported parasitic disease in Spain, and the majority of infected individuals are in the chronic phase of the disease. This study evaluated the sensitivity and specificity of the Operon immunochromatographic test (ICT-Operon; Simple Stick Chagas and Simple Chagas WB [whole blood]; Operon S.A., Spain) for different biological samples. Well-characterized serum samples were obtained from chagasic patients (n = 63), nonchagasic individuals (n = 95), visceral leishmaniasis patients (n = 38), and malaria patients (n = 55). Noncharacterized specimens were obtained from Latin American immigrants and individuals at risk with a clinical and/or epidemiological background: these specimens were recovered serum or plasma samples (n = 450), whole peripheral blood (n = 94), and capillary blood (n = 282). The concordance of the results by enzyme-linked immunosorbent assay and indirect immunofluorescence test was considered to be the “gold standard” for diagnosis. Serum and plasma samples were analyzed by Stick Chagas, and whole blood was analyzed by Simple Chagas WB. The sensitivity and specificity of the ICT-Operon in well-characterized samples were 100% and 97.9%, respectively. No cross-reactivity was found with samples obtained from visceral leishmaniasis patients. In contrast, a false-positive result was obtained in 27.3% of samples from malaria patients. The sensitivities of the rapid test in noncharacterized serum or plasma, peripheral blood, and capillary blood samples were 100%, 92.1%, and 86.4%, respectively, while the specificities were 91.6%, 93.6%, and 95% in each case. ICT-Operon showed variable sensitivity, depending on the kind of sample, performing better when serum or plasma samples were used. It could therefore be used for serological screening combined with any other conventional test. PMID:22761296

  11. Relating Trp-Glu dipeptide fluorescence to molecular conformation: the role of the discrete Chi 1 and Chi 2 angles.

    PubMed

    Eisenberg, Azaria Solomon; Juszczak, Laura J

    2013-07-05

    Molecular dynamics (MD), coupled with fluorescence data for charged dipeptides of tryptophanyl glutamic acid (Trp-Glu), reveal a detailed picture of how specific conformation affects fluorescence. Fluorescence emission spectra and time-resolved emission measurements have been collected for all four charged species. MD simulations 20 to 30 ns in length have also been carried out for the Trp-Glu species, as simulation provides aqueous phase conformational data that can be correlated with the fluorescence data. The calculations show that each dipeptide species is characterized by a similar set of six, discrete Chi 1, Chi 2 dihedral angle pairs. The preferred Chi 1 angles--60°, 180°, and 300°--play the significant role in positioning the terminal amine relative to the indole ring. A Chi 1 angle of 60° results in the arching of the backbone over the indole ring and no interaction of the ring with the terminal amine. Chi 1 values of 180° and 300° result in an extension of the backbone away from the indole ring and a NH3 cation-π interaction with indole. This interaction is believed responsible for charge transfer quenching. Two fluorescence lifetimes and their corresponding amplitudes correlate with the Chi 1 angle probability distribution for all four charged Trp-Glu dipeptides. Fluorescence emission band maxima are also consistent with the proposed pattern of terminal amine cation quenching of fluorescence. Copyright © 2013 Wiley Periodicals, Inc.

  12. Identification of Surprisingly Diverse Type IV Pili, across a Broad Range of Gram-Positive Bacteria

    PubMed Central

    Roos, David S.; Pohlschröder, Mechthild

    2011-01-01

    Background In Gram-negative bacteria, type IV pili (TFP) have long been known to play important roles in such diverse biological phenomena as surface adhesion, motility, and DNA transfer, with significant consequences for pathogenicity. More recently it became apparent that Gram-positive bacteria also express type IV pili; however, little is known about the diversity and abundance of these structures in Gram-positives. Computational tools for automated identification of type IV pilins are not currently available. Results To assess TFP diversity in Gram-positive bacteria and facilitate pilin identification, we compiled a comprehensive list of putative Gram-positive pilins encoded by operons containing highly conserved pilus biosynthetic genes (pilB, pilC). A surprisingly large number of species were found to contain multiple TFP operons (pil, com and/or tad). The N-terminal sequences of predicted pilins were exploited to develop PilFind, a rule-based algorithm for genome-wide identification of otherwise poorly conserved type IV pilins in any species, regardless of their association with TFP biosynthetic operons (http://signalfind.org). Using PilFind to scan 53 Gram-positive genomes (encoding >187,000 proteins), we identified 286 candidate pilins, including 214 in operons containing TFP biosynthetic genes (TBG+ operons). Although trained on Gram-positive pilins, PilFind identified 55 of 58 manually curated Gram-negative pilins in TBG+ operons, as well as 53 additional pilin candidates in operons lacking biosynthetic genes in ten species (>38,000 proteins), including 27 of 29 experimentally verified pilins. False positive rates appear to be low, as PilFind predicted only four pilin candidates in eleven bacterial species (>13,000 proteins) lacking TFP biosynthetic genes. Conclusions We have shown that Gram-positive bacteria contain a highly diverse set of type IV pili. PilFind can be an invaluable tool to study bacterial cellular processes known to involve type IV

  13. Redundancy of primary RNA-binding functions of the bacterial transcription terminator Rho

    PubMed Central

    Shashni, Rajesh; Qayyum, M. Zuhaib; Vishalini, V.; Dey, Debashish; Sen, Ranjan

    2014-01-01

    The bacterial transcription terminator, Rho, terminates transcription at half of the operons. According to the classical model derived from in vitro assays on a few terminators, Rho is recruited to the transcription elongation complex (EC) by recognizing specific sites (rut) on the nascent RNA. Here, we explored the mode of in vivo recruitment process of Rho. We show that sequence specific recognition of the rut site, in majority of the Rho-dependent terminators, can be compromised to a great extent without seriously affecting the genome-wide termination function as well as the viability of Escherichia coli. These terminators function optimally only through a NusG-assisted recruitment and activation of Rho. Our data also indicate that at these terminators, Rho-EC-bound NusG interaction facilitates the isomerization of Rho into a translocase-competent form by stabilizing the interactions of mRNA with the secondary RNA binding site, thereby overcoming the defects of the primary RNA binding functions. PMID:25081210

  14. Evidence for the generation of myristylated FMN by bacterial luciferase.

    PubMed

    Tabib, Chaitanya R; Brodl, Eveline; Macheroux, Peter

    2017-06-01

    The genes responsible for the light production in bioluminescent bacteria are present as an operon, luxCDABEG. Many strains of Photobacteria carry an additional gene, termed luxF. X-ray crystallographic analysis of LuxF revealed the presence of four molecules of a flavin derivative, i.e. 6-(3'-(R)-myristyl) flavin adenine mononucleotide (myrFMN) non-covalently bound to the homodimer. In the present study, we exploited the binding of myrFMN to recombinant apo-LuxF to explore the occurrence of myrFMN in various bioluminescent bacteria. MyrFMN was detected in all bacterial strains tested including Vibrio and Aliivibrio indicating that it is more widely occurring in bioluminescent bacteria than previously assumed. We also show that apo-LuxF captures myrFMN and thereby relieves the inhibitory effect on luciferase activity. Thus our results provide support for the hypothesis that LuxF acts as a scavenger of myrFMN in bioluminescent bacteria. However, the source of myrFMN remained obscure. To address this issue, we established a cofactor regeneration enzyme-catalyzed cascade reaction that supports luciferase activity in vitro for up to 3 days. This approach enabled us to unambiguously demonstrate that myrFMN is generated in the bacterial bioluminescent reaction. Based on this finding we postulate a reaction mechanism for myrFMN generation that is based on the luciferase reaction. © 2017 The Authors Molecular Microbiology Published by John Wiley & Sons Ltd.

  15. Analysis of the cellulose synthase operon genes, bcsA, bcsB, and bcsC in Cronobacter species: Prevalence among species and their roles in biofilm formation and cell-cell aggregation.

    PubMed

    Hu, Lan; Grim, Christopher J; Franco, Augusto A; Jarvis, Karen G; Sathyamoorthy, Vengopal; Kothary, Mahendra H; McCardell, Barbara A; Tall, Ben D

    2015-12-01

    Cronobacter species are emerging food-borne pathogens that cause severe sepsis, meningitis, and necrotizing entercolitis in neonates and infants. Bacterial pathogens such as Escherichia coli and Salmonella species produce extracellular cellulose which has been shown to be involved in rugosity, biofilm formation, and host colonization. In this study the distribution and prevalence of cellulose synthase operon genes (bcsABZC) were determined by polymerase chain reaction (PCR) analysis in 231 Cronobacter strains isolated from clinical, food, environmental, and unknown sources. Furthermore, bcsA and bcsB isogenic mutants were constructed in Cronobacter sakazakii BAA894 to determine their roles. In calcofluor binding assays bcsA and bcsB mutants did not produce cellulose, and their colonial morphotypes were different to that of the parent strain. Biofilm formation and bacterial cell-cell aggregation were significantly reduced in bcsA and bcsB mutants compared to the parental strain. bcsA or bcsAB PCR-negative strains of C. sakazakii did not bind calcofluor, and produced less biofilm and cell-cell aggregation compared to strains possessing bcsAB genes. These data indicated that Cronobacter bcsABZC were present in all clinical isolates and most of food and environmental isolates. bcsA and bcsB genes of Cronobacter were necessary to produce cellulose, and were involved in biofilm formation and cell-cell aggregation. Published by Elsevier Ltd.

  16. Phylogenetic analysis of the lux operon distinguishes two evolutionarily distinct clades of Photobacterium leiognathi.

    PubMed

    Ast, Jennifer C; Dunlap, Paul V

    2004-05-01

    The luminous marine bacterium Photobacterium mandapamensis was synonymized several years ago with Photobacterium leiognathi based on a high degree of phenotypic and genetic similarity. To test the possibility that P. leiognathi as now formulated, however, actually contains two distinct bacterial groups reflecting the earlier identification of P. mandapamensis and P. leiognathi as separate species, we compared P. leiognathi strains isolated from light-organ symbiosis with leiognathid fishes (i.e., ATCC 25521(T), ATCC 25587, lequu.1.1 and lleuc.1.1) with strains from seawater originally described as P. mandapamensis and later synonymized as P. leiognathi (i.e., ATCC 27561(T) and ATCC 33981) and certain strains initially identified as P. leiognathi (i.e., PL-721, PL-741, 554). Analysis of the 16S rRNA and gyrB genes did not resolve distinct clades, affirming a close relationship among these strains. However, strains ATCC 27561(T), ATCC 33981, PL-721, PL-741 and 554 were found to bear a luxF gene in the lux operon ( luxABFE), whereas ATCC 25521(T), ATCC 25587, lequu.1.1 and lleuc.1.1 lack this gene ( luxABE). Phylogenetic analysis of the luxAB(F)E region confirmed this distinction. Furthermore, ATCC 27561(T), ATCC 33981, PL-721, PL-741 and 554 all produced a higher level of luminescence on high-salt medium, as previously described for PL-721, whereas ATCC 25521(T), ATCC 25587, lequu.1.1 and lleuc.1.1 all produced a higher level of luminescence on low-salt medium, a characteristic of P. leiognathi from leiognathid fish light organs. These results demonstrate that P. leiognathi contains two evolutionarily and phenotypically distinct clades, P. leiognathi subsp. leiognathi (strains ATCC 25521(T), ATCC 25587, lequu.1.1 and lleuc.1.1), and P. leiognathi subsp. mandapamensis (strains ATCC 27561(T), ATCC 33981, PL-721, PL-741 and 554).

  17. Two groups of phenylalanine biosynthetic operon leader peptides genes: a high level of apparently incidental frameshifting in decoding Escherichia coli pheL

    PubMed Central

    Gurvich, Olga L.; Näsvall, S. Joakim; Baranov, Pavel V.; Björk, Glenn R.; Atkins, John F.

    2011-01-01

    The bacterial pheL gene encodes the leader peptide for the phenylalanine biosynthetic operon. Translation of pheL mRNA controls transcription attenuation and, consequently, expression of the downstream pheA gene. Fifty-three unique pheL genes have been identified in sequenced genomes of the gamma subdivision. There are two groups of pheL genes, both of which are short and contain a run(s) of phenylalanine codons at an internal position. One group is somewhat diverse and features different termination and 5′-flanking codons. The other group, mostly restricted to Enterobacteria and including Escherichia coli pheL, has a conserved nucleotide sequence that ends with UUC_CCC_UGA. When these three codons in E. coli pheL mRNA are in the ribosomal E-, P- and A-sites, there is an unusually high level, 15%, of +1 ribosomal frameshifting due to features of the nascent peptide sequence that include the penultimate phenylalanine. This level increases to 60% with a natural, heterologous, nascent peptide stimulator. Nevertheless, studies with different tRNAPro mutants in Salmonella enterica suggest that frameshifting at the end of pheL does not influence expression of the downstream pheA. This finding of incidental, rather than utilized, frameshifting is cautionary for other studies of programmed frameshifting. PMID:21177642

  18. PMMW Camera TRP. Phase 1

    NASA Technical Reports Server (NTRS)

    1997-01-01

    Passive millimeter wave (PMMW) sensors have the ability to see through fog, clouds, dust and sandstorms and thus have the potential to support all-weather operations, both military and commercial. Many of the applications, such as military transport or commercial aircraft landing, are technologically stressing in that they require imaging of a scene with a large field of view in real time and with high spatial resolution. The development of a low cost PMMW focal plane array camera is essential to obtain real-time video images to fulfill the above needs. The overall objective of this multi-year project (Phase 1) was to develop and demonstrate the capabilities of a W-band PMMW camera with a microwave/millimeter wave monolithic integrated circuit (MMIC) focal plane array (FPA) that can be manufactured at low cost for both military and commercial applications. This overall objective was met in July 1997 when the first video images from the camera were generated of an outdoor scene. In addition, our consortium partner McDonnell Douglas was to develop a real-time passive millimeter wave flight simulator to permit pilot evaluation of a PMMW-equipped aircraft in a landing scenario. A working version of this simulator was completed. This work was carried out under the DARPA-funded PMMW Camera Technology Reinvestment Project (TRP), also known as the PMMW Camera DARPA Joint Dual-Use Project. In this final report for the Phase 1 activities, a year by year description of what the specific objectives were, the approaches taken, and the progress made is presented, followed by a description of the validation and imaging test results obtained in 1997.

  19. Versatile Picklocks To Access All Opioid Receptors: Tuning the Selectivity and Functional Profile of the Cyclotetrapeptide c[Phe-d-Pro-Phe-Trp] (CJ-15,208).

    PubMed

    De Marco, Rossella; Bedini, Andrea; Spampinato, Santi; Cavina, Lorenzo; Pirazzoli, Edoardo; Gentilucci, Luca

    2016-10-13

    Recently, the tryptophan-containing noncationizable opioid peptides emerged with atypical structure and unexpected in vivo activity. Herein, we describe analogs of the naturally occurring mixed κ/μ-ligand c[Phe-d-Pro-Phe-Trp] 1 (CJ-15,208). Receptor affinity, selectivity, and agonism/antagonism varied upon enlarging macrocycle size, giving the μ-agonist 9 or the δ-antagonist 10 characterized by low nanomolar affinity. In particular, the μ-agonist c[β-Ala-d-Pro-Phe-Trp] 9 was shown to elicit potent antinociception in a mouse model of visceral pain upon systemic administration.

  20. A Novel β-Globin Chain Hemoglobin Variant, Hb Allentown [β137(H15)Val→Trp (GTG>TGG) HBB: c.412_413delinsTG, p.Val138Trp], Associated with Low Oxygen Saturation, Intermittent Aplastic Crises and Splenomegaly.

    PubMed

    Collier, Anderson B; Coon, Lea M; Monteleone, Philip; Umaru, Samuel; Swanson, Kenneth C; Hoyer, James D; Oliveira, Jennifer L

    2016-01-01

    Hemoglobin (Hb) variants may be associated with low oxygen saturation and exacerbated episodes of anemia from common stressors such as viral infections. These attributes frequently cause increased clinical concern and unnecessary and expensive testing if not considered early in the evaluation of the patient. Some clinically significant Hb variants result in a normal Hb electrophoresis result, which can be method-dependent. Herein we describe a patient with low oxygen saturation and a history of hemolytic anemia who was subsequently found to carry a novel, unstable β-globin variant that we have named Hb Allentown [β137(H15)Val→Trp (GTG>TGG) HBB: c.412_413delinsTG, p.Val138Trp] for the place of identification of the variant. Hb Allentown is formed by a rare double nucleotide substitution within the same codon. Additionally, positive identification of rare Hb variants characterized by a single method is discouraged, as the Hb variant was misclassified as Hb S-South End or β6(A3)Glu→Val;β132(H10)Lys→Asn (HBB: c.[20A > T;399A > C]) by the initial laboratory.

  1. Organization of tcp, acf, and toxT genes within a ToxT-dependent operon.

    PubMed

    Brown, R C; Taylor, R K

    1995-05-01

    The toxin coregulated pilus (TCP) is required for Vibrio cholerae to colonize the human intestine. The expression of the pilin gene, tcpA, is dependent upon ToxR and upon ToxT. The toxT gene was recently mapped within the TCP biogenesis gene cluster and shown to be capable of activating a tcpA::TnphoA fusion when cloned in Escherichia coli. In this study, we determined that ToxR/ToxT activation occurs at the level of tcpA transcription. ToxT expressed in E. coli could activate a tcp operon fusion, while ToxR, ToxR with ToxS, or a ToxR-PhoA fusion failed to activate the tcp operon fusion and we could not demonstrate binding of a ToxR extract to the tcpA promoter region in DNA mobility-shift assays. The start site for the regulated promoter was shown by primer extension to lie 75 bp upstream of the first codon of tcpA. An 800-base tcpA message was identified, by Northern analysis, that correlates by size to the distance between the transcriptional start and a hairpin-loop sequence between tcpA and tcpB. The more-sensitive assay of RNase protection analysis demonstrated that a regulated transcript probably extends through the rest of the downstream tcp genes, including toxT and the adjacent accessory colonization factor (acf) genes. An in-frame tcpA deletion, but not a polar tcpA::TnphoA fusion, could be complemented for pilus surface expression by providing tcpA in trans. This evidence suggests that the tcp genes, including toxT, are organized in an operon directly activated by ToxT in a ToxR-dependent manner. Most of the toxT expression under induced conditions requires transcription of the tcpA promoter. Further investigation of how tcp::TnphoA insertions that are polar on toxT expression retain regulation showed that a low basal level of toxT expression is present in toxR and tcp::TnphoA strains. Overall, these observations support the ToxR/ToxT cascade of regulation for tcp. Once induced, toxT expression becomes autoregulatory via the tcp promoter, linking tcp

  2. Role of the ganSPQAB Operon in Degradation of Galactan by Bacillus subtilis.

    PubMed

    Watzlawick, Hildegard; Morabbi Heravi, Kambiz; Altenbuchner, Josef

    2016-10-15

    Bacillus subtilis possesses different enzymes for the utilization of plant cell wall polysaccharides. This includes a gene cluster containing galactan degradation genes (ganA and ganB), two transporter component genes (ganQ and ganP), and the sugar-binding lipoprotein-encoding gene ganS (previously known as cycB). These genes form an operon that is regulated by GanR. The degradation of galactan by B. subtilis begins with the activity of extracellular GanB. GanB is an endo-β-1,4-galactanase and is a member of glycoside hydrolase (GH) family 53. This enzyme was active on high-molecular-weight arabinose-free galactan and mainly produced galactotetraose as well as galactotriose and galactobiose. These galacto-oligosaccharides may enter the cell via the GanQP transmembrane proteins of the galactan ABC transporter. The specificity of the galactan ABC transporter depends on the sugar-binding lipoprotein, GanS. Purified GanS was shown to bind galactotetraose and galactotriose using thermal shift assay. The energy for this transport is provided by MsmX, an ATP-binding protein. The transported galacto-oligosaccharides are further degraded by GanA. GanA is a β-galactosidase that belongs to GH family 42. The GanA enzyme was able to hydrolyze short-chain β-1,4-galacto-oligosaccharides as well as synthetic β-galactopyranosides into galactose. Thermal shift assay as well as electrophoretic mobility shift assay demonstrated that galactobiose is the inducer of the galactan operon regulated by GanR. DNase I footprinting revealed that the GanR protein binds to an operator overlapping the -35 box of the σ(A)-type promoter of Pgan, which is located upstream of ganS IMPORTANCE: Bacillus subtilis is a Gram-positive soil bacterium that utilizes different types of carbohydrates, such as pectin, as carbon sources. So far, most of the pectin degradation systems and enzymes have been thoroughly studied in B. subtilis Nevertheless, the B. subtilis utilization system of galactan, which is

  3. Characterization of Folding Mechanisms of Trp-cage and WW-domain by Network Analysis of Simulations with a Hybrid-resolution Model

    PubMed Central

    Han, Wei; Schulten, Klaus

    2013-01-01

    In this study, we apply a hybrid-resolution model, namely PACE, to characterize the free energy surfaces (FESs) of trp-cage and a WW domain variant along with the respective folding mechanisms. Unbiased, independent simulations with PACE are found to achieve together multiple folding and unfolding events for both proteins, allowing us to perform network analysis of the FESs to identify folding pathways. PACE reproduces for both proteins expected complexity hidden in the folding FESs, in particular, meta-stable non-native intermediates. Pathway analysis shows that some of these intermediates are, actually, on-pathway folding intermediates and that intermediates kinetically closest to the native states can be either critical on-pathway or off-pathway intermediates, depending on the protein. Apart from general insights into folding, specific folding mechanisms of the proteins are resolved. We find that trp-cage folds via a dominant pathway in which hydrophobic collapse occurs before the N-terminal helix forms; full incorporation of Trp6 into the hydrophobic core takes place as the last step of folding, which, however, may not be the rate-limiting step. For the WW domain variant studied we observe two main folding pathways with opposite orders of formation of the two hairpins involved in the structure; for either pathway, formation of hairpin 1 is more likely to be the rate-limiting step. Altogether, our results suggest that PACE combined with network analysis is a computationally efficient and valuable tool for the study of protein folding. PMID:23915394

  4. Nonlinear vs. linear biasing in Trp-cage folding simulations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Spiwok, Vojtěch, E-mail: spiwokv@vscht.cz; Oborský, Pavel; Králová, Blanka

    2015-03-21

    Biased simulations have great potential for the study of slow processes, including protein folding. Atomic motions in molecules are nonlinear, which suggests that simulations with enhanced sampling of collective motions traced by nonlinear dimensionality reduction methods may perform better than linear ones. In this study, we compare an unbiased folding simulation of the Trp-cage miniprotein with metadynamics simulations using both linear (principle component analysis) and nonlinear (Isomap) low dimensional embeddings as collective variables. Folding of the mini-protein was successfully simulated in 200 ns simulation with linear biasing and non-linear motion biasing. The folded state was correctly predicted as the free energymore » minimum in both simulations. We found that the advantage of linear motion biasing is that it can sample a larger conformational space, whereas the advantage of nonlinear motion biasing lies in slightly better resolution of the resulting free energy surface. In terms of sampling efficiency, both methods are comparable.« less

  5. Nonlinear vs. linear biasing in Trp-cage folding simulations

    NASA Astrophysics Data System (ADS)

    Spiwok, Vojtěch; Oborský, Pavel; Pazúriková, Jana; Křenek, Aleš; Králová, Blanka

    2015-03-01

    Biased simulations have great potential for the study of slow processes, including protein folding. Atomic motions in molecules are nonlinear, which suggests that simulations with enhanced sampling of collective motions traced by nonlinear dimensionality reduction methods may perform better than linear ones. In this study, we compare an unbiased folding simulation of the Trp-cage miniprotein with metadynamics simulations using both linear (principle component analysis) and nonlinear (Isomap) low dimensional embeddings as collective variables. Folding of the mini-protein was successfully simulated in 200 ns simulation with linear biasing and non-linear motion biasing. The folded state was correctly predicted as the free energy minimum in both simulations. We found that the advantage of linear motion biasing is that it can sample a larger conformational space, whereas the advantage of nonlinear motion biasing lies in slightly better resolution of the resulting free energy surface. In terms of sampling efficiency, both methods are comparable.

  6. Nonlinear vs. linear biasing in Trp-cage folding simulations.

    PubMed

    Spiwok, Vojtěch; Oborský, Pavel; Pazúriková, Jana; Křenek, Aleš; Králová, Blanka

    2015-03-21

    Biased simulations have great potential for the study of slow processes, including protein folding. Atomic motions in molecules are nonlinear, which suggests that simulations with enhanced sampling of collective motions traced by nonlinear dimensionality reduction methods may perform better than linear ones. In this study, we compare an unbiased folding simulation of the Trp-cage miniprotein with metadynamics simulations using both linear (principle component analysis) and nonlinear (Isomap) low dimensional embeddings as collective variables. Folding of the mini-protein was successfully simulated in 200 ns simulation with linear biasing and non-linear motion biasing. The folded state was correctly predicted as the free energy minimum in both simulations. We found that the advantage of linear motion biasing is that it can sample a larger conformational space, whereas the advantage of nonlinear motion biasing lies in slightly better resolution of the resulting free energy surface. In terms of sampling efficiency, both methods are comparable.

  7. Structure-activity relationship of cyclic peptide penta-c[Asp-His(6)-DPhe(7)-Arg(8)-Trp(9)-Lys]-NH(2) at the human melanocortin-1 and -4 receptors: His(6) substitution.

    PubMed

    Cheung, Adrian Wai-Hing; Danho, Waleed; Swistok, Joseph; Qi, Lida; Kurylko, Grazyna; Rowan, Karen; Yeon, Mitch; Franco, Lucia; Chu, Xin-Jie; Chen, Li; Yagaloff, Keith

    2003-04-07

    A series of MT-II related cyclic peptides, based on potent but non-selective hMC4R agonist (Penta-c[Asp-His(6)-DPhe(7)-Arg(8)-Trp(9)-Lys]-NH(2)) was prepared in which His(6) residue was systematically substituted. Two of the most interesting peptides identified in this study are Penta-c[Asp-5-ClAtc-DPhe-Arg-Trp-Lys]-NH(2) and Penta-c[Asp-5-ClAtc-DPhe-Cit-Trp-Lys]-NH(2) which are potent hMC4R agonists and are either inactive or weak partial agonists (not tested for their antagonist activities) in hMC1R, hMC3R and hMC5R agonist assays.

  8. A functional glycogen biosynthesis pathway in Lactobacillus acidophilus: expression and analysis of the glg operon

    PubMed Central

    Goh, Yong Jun; Klaenhammer, Todd R

    2013-01-01

    Glycogen metabolism contributes to energy storage and various physiological functions in some prokaryotes, including colonization persistence. A role for glycogen metabolism is proposed on the survival and fitness of Lactobacillus acidophilus, a probiotic microbe, in the human gastrointestinal environment. L. acidophilus NCFM possesses a glycogen metabolism (glg) operon consisting of glgBCDAP-amy-pgm genes. Expression of the glg operon and glycogen accumulation were carbon source- and growth phase-dependent, and were repressed by glucose. The highest intracellular glycogen content was observed in early log-phase cells grown on trehalose, which was followed by a drastic decrease of glycogen content prior to entering stationary phase. In raffinose-grown cells, however, glycogen accumulation gradually declined following early log phase and was maintained at stable levels throughout stationary phase. Raffinose also induced an overall higher temporal glg expression throughout growth compared with trehalose. Isogenic ΔglgA (glycogen synthase) and ΔglgB (glycogen-branching enzyme) mutants are glycogen-deficient and exhibited growth defects on raffinose. The latter observation suggests a reciprocal relationship between glycogen synthesis and raffinose metabolism. Deletion of glgB or glgP (glycogen phosphorylase) resulted in defective growth and increased bile sensitivity. The data indicate that glycogen metabolism is involved in growth maintenance, bile tolerance and complex carbohydrate utilization in L. acidophilus. PMID:23879596

  9. Inhibition of growth of PC-82 human prostate cancer line xenografts in nude mice by bombesin antagonist RC-3095 or combination of agonist [D-Trp6]-luteinizing hormone-releasing hormone and somatostatin analog RC-160.

    PubMed

    Milovanovic, S R; Radulovic, S; Groot, K; Schally, A V

    1992-01-01

    The effects of treatment with a bombesin receptor antagonist [D-Tpi6, Leu13 psi (CH2NH) Leu14]BN(6-14)(RC-3095) and the combination of an agonist of luteinizing hormone-releasing hormone [D-Trp6]-LH-RH and somatostatin analog D-Phe-Cys-Tyr-D-Trp-Lys-Val- Cys-Trp-NH2 (RC-160) were studied in nude mice bearing xenografts of the hormone-dependent human prostate tumor PC-82. During the 5 weeks of treatment, tumor growth was decreased in all treated groups compared with controls. Bombesin antagonist RC-3095 and the combination of [D-Trp6]-LH-RH and RC-160 caused a greater inhibition of tumor growth than [D-Trp6]-LH-RH or RC-160 alone as based on measurement of tumor volume and percentage change in tumor volume. The largest decrease in tumor weight was also seen in the groups treated with the bombesin antagonist and with the combination of RC-160 and [D-Trp6]-LH-RH. Serum prostatic-specific antigen levels were greatly decreased, and insulin-like growth factor I (IGF-I) as well as growth hormone levels were reduced in all treated groups. Specific binding sites for [D-Trp6]-LH-RH, epidermal growth factor (EGF), IGF-I, and somatostatin (SS-14) were found in the tumor membranes. Receptors for EGF were significantly down-regulated by treatment with the bombesin antagonist or RC-160. Combination of LH-RH agonists with somatostatin analog RC-160 might be considered for improvement of hormonal therapy for prostate cancer. The finding that bombesin antagonist RC-3095 inhibits the growth of PC-82 prostate cancer suggests the merit of further studies to evaluate the possible usefulness of antagonists of bombesin in the management of prostatic carcinoma.

  10. Alanine analogues of [D-Trp]CJ-15,208: novel opioid activity profiles and prevention of drug- and stress-induced reinstatement of cocaine-seeking behaviour.

    PubMed

    Aldrich, J V; Senadheera, S N; Ross, N C; Reilley, K A; Ganno, M L; Eans, S E; Murray, T F; McLaughlin, J P

    2014-07-01

    The novel macrocyclic peptide cyclo[Phe-D-Pro-Phe-D-Trp] ([D-Trp]CJ-15,208) exhibits κ opioid (KOP) receptor antagonist activity in both in vitro and in vivo assays. The four alanine analogues of this peptide were synthesized and characterized both in vitro and in vivo to assess the contribution of different amino acid residues to the activity of [D-Trp]CJ-15,208. The peptides were synthesized by a combination of solid phase peptide synthesis and cyclization in solution. The analogues were evaluated in vitro in receptor binding and functional assays, and in vivo with mice using a tail-withdrawal assay for antinociceptive and opioid antagonist activity. Mice demonstrating extinction of cocaine conditioned-place preference (CPP) were pretreated with selected analogues to evaluate prevention of stress or cocaine-induced reinstatement of CPP. The alanine analogues displayed pharmacological profiles in vivo distinctly different from [D-Trp]CJ-15,208. While the analogues exhibited varying opioid receptor affinities and κ and μ opioid receptor antagonist activity in vitro, they produced potent opioid receptor-mediated antinociception (ED50 = 0.28-4.19 nmol, i.c.v.) in vivo. Three of the analogues also displayed KOP receptor antagonist activity in vivo. Pretreatment with an analogue exhibiting both KOP receptor agonist and antagonist activity in vivo prevented both cocaine- and stress-induced reinstatement of cocaine-seeking behaviour in the CPP assay in a time-dependent manner. These unusual macrocyclic peptides exhibit in vivo opioid activity profiles different from the parent compound and represent novel compounds for potential development as therapeutics for drug abuse and possibly as analgesics. © 2014 The British Pharmacological Society.

  11. Alanine analogues of [D-Trp]CJ-15,208: novel opioid activity profiles and prevention of drug- and stress-induced reinstatement of cocaine-seeking behaviour

    PubMed Central

    Aldrich, J V; Senadheera, S N; Ross, N C; Reilley, K A; Ganno, M L; Eans, S E; Murray, T F; McLaughlin, J P

    2014-01-01

    BACKGROUND AND PURPOSE The novel macrocyclic peptide cyclo[Phe-D-Pro-Phe-D-Trp] ([D-Trp]CJ-15,208) exhibits κ opioid (KOP) receptor antagonist activity in both in vitro and in vivo assays. The four alanine analogues of this peptide were synthesized and characterized both in vitro and in vivo to assess the contribution of different amino acid residues to the activity of [D-Trp]CJ-15,208. EXPERIMENTAL APPROACH The peptides were synthesized by a combination of solid phase peptide synthesis and cyclization in solution. The analogues were evaluated in vitro in receptor binding and functional assays, and in vivo with mice using a tail-withdrawal assay for antinociceptive and opioid antagonist activity. Mice demonstrating extinction of cocaine conditioned-place preference (CPP) were pretreated with selected analogues to evaluate prevention of stress or cocaine-induced reinstatement of CPP. KEY RESULTS The alanine analogues displayed pharmacological profiles in vivo distinctly different from [D-Trp]CJ-15,208. While the analogues exhibited varying opioid receptor affinities and κ and μ opioid receptor antagonist activity in vitro, they produced potent opioid receptor-mediated antinociception (ED50 = 0.28–4.19 nmol, i.c.v.) in vivo. Three of the analogues also displayed KOP receptor antagonist activity in vivo. Pretreatment with an analogue exhibiting both KOP receptor agonist and antagonist activity in vivo prevented both cocaine- and stress-induced reinstatement of cocaine-seeking behaviour in the CPP assay in a time-dependent manner. CONCLUSIONS AND IMPLICATIONS These unusual macrocyclic peptides exhibit in vivo opioid activity profiles different from the parent compound and represent novel compounds for potential development as therapeutics for drug abuse and possibly as analgesics. PMID:24588614

  12. Resistance mutations of Pro197, Asp376 and Trp574 in the acetohydroxyacid synthase (AHAS) affect pigments, growths, and competitiveness of Descurainia sophia L.

    PubMed

    Zhang, Yongzhi; Xu, Yufang; Wang, Shipeng; Li, Xuefeng; Zheng, Mingqi

    2017-11-27

    D. Sophia is one of the most problematic weed species infesting winter wheat in China, and has evolved high resistance to tribenuron-methyl. Amino acid substitutions at site of Pro197, Asp376 and Trp574 in acetohydroxyacid synthase (AHAS) were mainly responsible for D. sophia resistance to tribenuron-methyl. In this study, D. sophia plant individually homozygous for specific AHAS mutation (Pro197Leu, Pro197His, Pro197Ser, Pro197Thr, Asp376Glu and Trp574Leu) were generated. In addition, the effects of resistance mutations on pigments, growths and competitiveness of susceptible (S) and resistant (R) plants of D. sophia were investigated. The results indicated the R plants carrying Pro197Leu or Pro197His or Asp376Glu or Trp574Leu displayed stronger competitiveness than S plants. The adverse effects on R plants aggravated with the increase of R plants proportion, which made the R plants against domination the weed community in absent of herbicide selection. Therefore, these resistance mutation have no obvious adverse effects on the pigments (chlorophyll a, chlorophyll b and carotenoid), relative growth rates (RGR), leaf area ratio (LAR) and net assimilation rate (NAR) of R plants.

  13. Transient Receptor Potential channels: What's happening? Reflections in the wake of the 2009 TRP Meeting, Karolinska Institutet, Stockholm.

    PubMed

    Goswami, Chandan; Islam, Md Shahidul

    2010-01-01

    More than 150 participants from 25 countries gathered in Stockholm during 25(th) to 27(th) Sept 2009 to attend the meeting "TRP channels: from sensory signaling to human disease" and enjoyed an international, intensive and vibrant meeting. This meeting shed lights on the recent advances made in this field of research in different sectors of biology, and identified directions for future research and the areas where TRP channels could be used as potential targets for prevention and treatment of human diseases. The participants of this meeting shared their recent largely unpublished data, state-of-the-art techniques and their critical views which would push research in this field forward in the new decade. Another major outcome of this meeting was the realization that extensive work remains to be done to develop the necessary tools and enhance the quality of research in this area so that the prevailing controversies can be resolved. In this report we summarize the latest scientific excitements, some critical issues, as well as some future directions for research that were addressed and discussed in this meeting.

  14. Comparison of stochastic optimization methods for all-atom folding of the Trp-Cage protein.

    PubMed

    Schug, Alexander; Herges, Thomas; Verma, Abhinav; Lee, Kyu Hwan; Wenzel, Wolfgang

    2005-12-09

    The performances of three different stochastic optimization methods for all-atom protein structure prediction are investigated and compared. We use the recently developed all-atom free-energy force field (PFF01), which was demonstrated to correctly predict the native conformation of several proteins as the global optimum of the free energy surface. The trp-cage protein (PDB-code 1L2Y) is folded with the stochastic tunneling method, a modified parallel tempering method, and the basin-hopping technique. All the methods correctly identify the native conformation, and their relative efficiency is discussed.

  15. Pseudomonas fluorescens ATCC 13525 Containing an Artificial Oxalate Operon and Vitreoscilla Hemoglobin Secretes Oxalic Acid and Solubilizes Rock Phosphate in Acidic Alfisols

    PubMed Central

    Archana, G.; Naresh Kumar, G.

    2014-01-01

    Oxalate secretion was achieved in Pseudomonas fluorescens ATCC 13525 by incorporation of genes encoding Aspergillus niger oxaloacetate acetyl hydrolase (oah), Fomitopsis plaustris oxalate transporter (FpOAR) and Vitreoscilla hemoglobin (vgb) in various combinations. Pf (pKCN2) transformant containing oah alone accumulated 19 mM oxalic acid intracellularly but secreted 1.2 mM. However, in the presence of an artificial oxalate operon containing oah and FpOAR genes in plasmid pKCN4, Pf (pKCN4) secreted 13.6 mM oxalate in the medium while 3.6 mM remained inside. This transformant solubilized 509 μM of phosphorus from rock phosphate in alfisol which is 4.5 fold higher than the Pf (pKCN2) transformant. Genomic integrants of P. fluorescens (Pf int1 and Pf int2) containing artificial oxalate operon (plac-FpOAR-oah) and artificial oxalate gene cluster (plac-FpOAR-oah, vgb, egfp) secreted 4.8 mM and 5.4 mM oxalic acid, released 329 μM and 351 μM P, respectively, in alfisol. The integrants showed enhanced root colonization, improved growth and increased P content of Vigna radiata plants. This study demonstrates oxalic acid secretion in P. fluorescens by incorporation of an artificial operon constituted of genes for oxalate synthesis and transport, which imparts mineral phosphate solubilizing ability to the organism leading to enhanced growth and P content of V. radiata in alfisol soil. PMID:24705024

  16. Cloning and identification of Group 1 mrp operon encoding a novel monovalent cation/proton antiporter system from the moderate halophile Halomonas zhaodongensis.

    PubMed

    Meng, Lin; Hong, Shan; Liu, Henan; Huang, Haipeng; Sun, Hao; Xu, Tong; Jiang, Juquan

    2014-11-01

    The novel species Halomonas zhaodongensis NEAU-ST10-25(T) recently identified by our group is a moderate halophile which can grow at the range of 0-2.5 M NaCl (optimum 0.5 M) and pH 6-12 (optimum pH 9). To explore its halo-alkaline tolerant mechanism, genomic DNA was screened from NEAU-ST10-25(T) in this study for Na(+)(Li(+))/H(+) antiporter genes by selection in Escherichia coli KNabc lacking three major Na(+)(Li(+))/H(+) antiporters. One mrp operon could confer tolerance of E. coli KNabc to 0.8 M NaCl and 100 mM LiCl, and an alkaline pH. This operon was previously mainly designated mrp (also mnh, pha or sha) due to its multiple resistance and pH-related activity. Here, we will also use mrp to designate the homolog from H. zhaodongensis (Hz_mrp). Sequence analysis and protein alignment showed that Hz_mrp should belong to Group 1 mrp operons. Further phylogenetic analysis reveals that Hz_Mrp system should represent a novel sub-class of Group 1 Mrp systems. This was confirmed by a significant difference in pH-dependent activity profile or the specificity and affinity for the transported monovalent cations between Hz_Mrp system and all the known Mrp systems. Therefore, we propose that Hz_Mrp should be categorized as a novel Group 1 Mrp system.

  17. Polymorphism of Trp64Arg in beta3-adrenergic receptor gene among Bolivian people in rural areas at high and low altitudes.

    PubMed

    Karasaki, Yuji; Kashiwazaki, Hiroshi

    2004-01-01

    To investigate whether population differences in food and/or lifestyle could affect the distribution frequencies of polymorphism in the gene for beta3-adrenergic receptor (beta3-AR), the frequency of Trp64Arg polymorphism was studied among Bolivian people living in rural areas of high (about 4000 m above sea level) and low (about 300 m above sea level) altitudes. Genomic DNA samples of Bolivian subjects (n=508) were amplified by polymerase chain reaction (PCR) for part of the beta3-AR gene. The amplified PCR products were digested with restriction enzyme NciI and analysed by agarose gel electrophoresis. We found no significant difference in the frequency of Arg allele in the beta3-AR gene between 331 native low-altitude Bolivian subjects (18.1%) and 177 native high-altitude Bolivian subjects (17.5%). Body mass index was not associated with Trp64Arg polymorphism among native Bolivian adults. The frequency of this allele in the complete Bolivian population (18%) was lower than that reported in Pima Indians (32%), is comparable to the Japanese (19%) and is higher than several ethnic groups, including Finns (12%) and French (4%). Our data indicate that the altitude-related lifestyle of a population has had little influence on the frequency of Trp64Arg polymorphism and obesity in Bolivian natives.

  18. Lack of correlation between the amplitudes of TRP channel-mediated responses to weak and strong stimuli in intracellular Ca(2+) imaging experiments.

    PubMed

    Alpizar, Yeranddy A; Sanchez, Alicia; Radwan, Ahmed; Radwan, Islam; Voets, Thomas; Talavera, Karel

    2013-11-01

    It is often observed in intracellular Ca(2+) imaging experiments that the amplitudes of the Ca(2+) signals elicited by newly characterized TRP agonists do not correlate with the amplitudes of the responses evoked subsequently by a specific potent agonist. We investigated this rather controversial phenomenon by first testing whether it is inherent to the comparison of the effects of weak and strong stimuli. Using five well-characterized TRP channel agonists in commonly used heterologous expression systems we found that the correlation between the amplitudes of the Ca(2+) signals triggered by two sequentially applied stimuli is only high when both stimuli are strong. Using mathematical simulations of intracellular Ca(2+) dynamics we illustrate that the innate heterogeneity in expression and functional properties of Ca(2+) extrusion (e.g. plasma membrane Ca(2+) ATPase) and influx (TRP channels) pathways across a cellular population is a sufficient condition for low correlation between the amplitude of Ca(2+) signals elicited by weak and strong stimuli. Taken together, our data demonstrate that this phenomenon is an expected outcome of intracellular Ca(2+) imaging experiments that cannot be taken as evidence for lack of specificity of low-efficacy stimuli, or as an indicator of the need of other cellular components for channel stimulation. Copyright © 2013 Elsevier Ltd. All rights reserved.

  19. Evidence for a common gene pool and frequent recombinational exchange of the tbpBA operon in Mannheimia haemolytica, Mannheimia glucosida and Bibersteinia trehalosi

    PubMed Central

    Lee, Inkyoung; Davies, Robert L.

    2012-01-01

    SUMMARY The tbpBA operon was sequenced in 42 representative isolates of Mannheimia haemolytica (32), Mannheimia glucosida (6) and Bibersteinia trehalosi (4). A total of 27 tbpB and 20 tbpA alleles were identified whilst the tbpBA operon was represented by 28 unique alleles that could be assigned to seven classes. There were 1566 (34.8% variation) polymorphic nucleotide sites and 482 (32.1% variation) variable inferred amino acid positions among the 42 tbpBA sequences. The tbpBA operons of serotype A2 M. haemolytica isolates are, with one exception, substantially more diverse than those of the other M. haemolytica serotypes and most likely have a different ancestral origin. The tbpBA phylogeny has been severely disrupted by numerous small- and large-scale intragenic recombination events. In addition, assortative (entire gene) recombination events, involving either the entire tbpBA operon or the individual tbpB and tbpA genes, have played a major role in shaping tbpBA structure and it’s distribution in the three species. Our findings indicate that a common gene pool exists for tbpBA in M. haemolytica, M. glucosida and B. trehalosi. In particular, B. trehalosi, M. glucosida and ovine M. haemolytica isolates share a large portion of the tbpA gene and this probably reflects selection for a conserved TbpA protein that provides effective iron-uptake in sheep. Bovine and ovine serotype A2 lineages have very different tbpBA alleles. Bovine-like tbpBA alleles have been partially, or completely, replaced by ovine-like tbpBA alleles in ovine serotype A2 isolates suggesting that different transferrin receptors are required by serotype A2 isolates for optimum iron uptake in cattle and sheep. Conversely, the tbpBA alleles of bovine-pathogenic serotype A1 and A6 isolates are very similar to those of closely related ovine isolates suggesting a recent and common evolutionary origin. PMID:20884693

  20. TrpA1 activation in peripheral sensory neurons underlies the ionic basis of pain hypersensitivity in response to vinca alkaloids

    PubMed Central

    Boiko, Nina; Medrano, Geraldo; Montano, Elizabeth; Jiang, Nan; Williams, Claire R.; Madungwe, Ngonidzashe B.; Bopassa, Jean C.; Kim, Charles C.; Parrish, Jay Z.; Hargreaves, Kenneth M.

    2017-01-01

    Chemotherapy induced peripheral neuropathy (CIPN), a side effect of many anti-cancer drugs including the vinca alkaloids, is characterized by a severe pain syndrome that compromises treatment in many patients. Currently there are no effective treatments for this pain syndrome except for the reduction of anti-cancer drug dose. Existing data supports the model that the pain associated with CIPN is the result of anti-cancer drugs augmenting the function of the peripheral sensory nociceptors but the cellular mechanisms underlying the effects of anti-cancer drugs on sensory neuron function are not well described. Studies from animal models have suggested a number of disease etiologies including mitotoxicity, axonal degeneration, immune signaling, and reduced sensory innervations but these outcomes are the result of prolonged treatment paradigms and do not necessarily represent the early formative events associated with CIPN. Here we show that acute exposure to vinca alkaloids results in an immediate pain syndrome in both flies and mice. Furthermore, we demonstrate that exposure of isolated sensory neurons to vinca alkaloids results in the generation of an inward sodium current capable of depolarizing these neurons to threshold resulting in neuronal firing. These neuronal effects of vinca alkaloids require the transient receptor potential ankyrin-1 (TrpA1) channel, and the hypersensitization to painful stimuli in response to the acute exposure to vinca alkaloids is reduced in TrpA1 mutant flies and mice. These findings demonstrate the direct excitation of sensory neurons by CIPN-causing chemotherapy drugs, and identify TrpA1 as an important target during the pathogenesis of CIPN. PMID:29084244

  1. A monomeric TIM-barrel structure from Pyrococcus furiosus is optimized for extreme temperatures.

    PubMed

    Repo, Heidi; Oeemig, Jesper S; Djupsjöbacka, Janica; Iwaï, Hideo; Heikinheimo, Pirkko

    2012-11-01

    The structure of phosphoribosyl anthranilate isomerase (TrpF) from the hyperthermophilic archaeon Pyrococcus furiosus (PfTrpF) has been determined at 1.75 Å resolution. The PfTrpF structure has a monomeric TIM-barrel fold which differs from the dimeric structures of two other known thermophilic TrpF proteins. A comparison of the PfTrpF structure with the two known bacterial thermophilic TrpF structures and the structure of a related mesophilic protein from Escherichia coli (EcTrpF) is presented. The thermophilic TrpF structures contain a higher proportion of ion pairs and charged residues compared with the mesophilic EcTrpF. These residues contribute to the closure of the central barrel and the stabilization of the barrel and the surrounding α-helices. In the monomeric PfTrpF conserved structural water molecules are mostly absent; instead, the structural waters are replaced by direct side-chain-main-chain interactions. As a consequence of these combined mechanisms, the P. furiosus enzyme is a thermodynamically stable and entropically optimized monomeric TIM-barrel enzyme which defines a good framework for further protein engineering for industrial applications.

  2. Stable zymomonas mobilis xylose and arabinose fermenting strains

    DOEpatents

    Zhang, Min [Lakewood, CO; Chou, Yat-Chen [Taipei, TW

    2008-04-08

    The present invention briefly includes a transposon for stable insertion of foreign genes into a bacterial genome, comprising at least one operon having structural genes encoding enzymes selected from the group consisting of xylAxylB, araBAD and tal/tkt, and at least one promoter for expression of the structural genes in the bacterium, a pair of inverted insertion sequences, the operons contained inside the insertion sequences, and a transposase gene located outside of the insertion sequences. A plasmid shuttle vector for transformation of foreign genes into a bacterial genome, comprising at least one operon having structural genes encoding enzymes selected from the group consisting of xylAxylB, araBAD and tal/tkt, at least one promoter for expression of the structural genes in the bacterium, and at least two DNA fragments having homology with a gene in the bacterial genome to be transformed, is also provided.The transposon and shuttle vectors are useful in constructing significantly different Zymomonas mobilis strains, according to the present invention, which are useful in the conversion of the cellulose derived pentose sugars into fuels and chemicals, using traditional fermentation technology, because they are stable for expression in a non-selection medium.

  3. Homo-D-lactic acid production from mixed sugars using xylose-assimilating operon-integrated Lactobacillus plantarum.

    PubMed

    Yoshida, Shogo; Okano, Kenji; Tanaka, Tsutomu; Ogino, Chiaki; Kondo, Akihiko

    2011-10-01

    In order to achieve efficient D-lactic acid fermentation from a mixture of xylose and glucose, the xylose-assimilating xylAB operon from Lactobacillus pentosus (PXylAB) was introduced into an L-lactate dehydrogenase gene (ldhL1)-deficient Lactobacillus plantarum (ΔldhL1-xpk1::tkt-Δxpk2) strain in which the phosphoketolase 1 gene (xpk1) was replaced with the transketolase gene (tkt) from Lactococcus lactis, and the phosphoketolase 2 (xpk2) gene was deleted. Two copies of xylAB introduced into the genome significantly improved the xylose fermentation ability, raising it to the same level as that of ΔldhL1-xpk1::tkt-Δxpk2 harboring a xylAB operon-expressing plasmid. Using the two-copy xylAB integrated strain, successful homo-D-lactic acid production was achieved from a mixture of 25 g/l xylose and 75 g/l glucose without carbon catabolite repression. After 36-h cultivation, 74.2 g/l of lactic acid was produced with a high yield (0.78 g per gram of consumed sugar) and an optical purity of D-lactic acid of 99.5%. Finally, we successfully demonstrated homo-D-lactic acid fermentation from a mixture of three kinds of sugar: glucose, xylose, and arabinose. This is the first report that describes homo-D-lactic acid fermentation from mixed sugars without carbon catabolite repression using the xylose-assimilating pathway integrated into lactic acid bacteria.

  4. Characterization of the orf1glnKamtB operon of Herbaspirillum seropedicae.

    PubMed

    Noindorf, Lilian; Rego, Fabiane G M; Baura, Valter A; Monteiro, Rose A; Wassem, Roseli; Cruz, Leonardo M; Rigo, Liu U; Souza, Emanuel M; Steffens, Maria B R; Pedrosa, Fabio O; Chubatsu, Leda S

    2006-03-01

    Herbaspirillum seropedicae is an endophytic nitrogen-fixing bacterium that colonizes economically important grasses. In this organism, the amtB gene is co-transcribed with two other genes: glnK that codes for a PII-like protein and orf1 that codes for a probable periplasmatic protein of unknown function. The expression of the orf1glnKamtB operon is increased under nitrogen-limiting conditions and is dependent on NtrC. An amtB mutant failed to transport methylammonium. Post-translational control of nitrogenase was also partially impaired in this mutant, since a complete switch-off of nitrogenase after ammonium addition was not observed. This result suggests that the AmtB protein is involved in the signaling pathway for the reversible inactivation of nitrogenase in H. seropedicae.

  5. Redundancy of primary RNA-binding functions of the bacterial transcription terminator Rho.

    PubMed

    Shashni, Rajesh; Qayyum, M Zuhaib; Vishalini, V; Dey, Debashish; Sen, Ranjan

    2014-09-01

    The bacterial transcription terminator, Rho, terminates transcription at half of the operons. According to the classical model derived from in vitro assays on a few terminators, Rho is recruited to the transcription elongation complex (EC) by recognizing specific sites (rut) on the nascent RNA. Here, we explored the mode of in vivo recruitment process of Rho. We show that sequence specific recognition of the rut site, in majority of the Rho-dependent terminators, can be compromised to a great extent without seriously affecting the genome-wide termination function as well as the viability of Escherichia coli. These terminators function optimally only through a NusG-assisted recruitment and activation of Rho. Our data also indicate that at these terminators, Rho-EC-bound NusG interaction facilitates the isomerization of Rho into a translocase-competent form by stabilizing the interactions of mRNA with the secondary RNA binding site, thereby overcoming the defects of the primary RNA binding functions. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  6. Cleavage Specificity of Mycobacterium tuberculosis ClpP1P2 Protease and Identification of Novel Peptide Substrates and Boronate Inhibitors with Anti-bacterial Activity*

    PubMed Central

    Akopian, Tatos; Kandror, Olga; Tsu, Christopher; Lai, Jack H.; Wu, Wengen; Liu, Yuxin; Zhao, Peng; Park, Annie; Wolf, Lisa; Dick, Lawrence R.; Rubin, Eric J.; Bachovchin, William; Goldberg, Alfred L.

    2015-01-01

    The ClpP1P2 protease complex is essential for viability in Mycobacteria tuberculosis and is an attractive drug target. Using a fluorogenic tripeptide library (Ac-X3X2X1-aminomethylcoumarin) and by determining specificity constants (kcat/Km), we show that ClpP1P2 prefers Met ≫ Leu > Phe > Ala in the X1 position, basic residues or Trp in the X2 position, and Pro ≫ Ala > Trp in the X3 position. We identified peptide substrates that are hydrolyzed up to 1000 times faster than the standard ClpP substrate. These positional preferences were consistent with cleavage sites in the protein GFPssrA by ClpXP1P2. Studies of ClpP1P2 with inactive ClpP1 or ClpP2 indicated that ClpP1 was responsible for nearly all the peptidase activity, whereas both ClpP1 and ClpP2 contributed to protein degradation. Substrate-based peptide boronates were synthesized that inhibit ClpP1P2 peptidase activity in the submicromolar range. Some of them inhibited the growth of Mtb cells in the low micromolar range indicating that cleavage specificity of Mtb ClpP1P2 can be used to design novel anti-bacterial agents. PMID:25759383

  7. The Transient Receptor Potential (TRP) Channel Family in Colletotrichum graminicola: A Molecular and Physiological Analysis

    PubMed Central

    Lange, Mario; Weihmann, Fabian; Schliebner, Ivo; Horbach, Ralf; Deising, Holger B.; Wirsel, Stefan G. R.

    2016-01-01

    Calcium (Ca2+) is a universal second messenger in all higher organisms and centrally involved in the launch of responses to environmental stimuli. Ca2+ signals in the cytosol are initiated by the activation of Ca2+ channels in the plasma membrane and/or in endomembranes. Yeast (Saccharomyces cerevisiae) contains a Ca2+-permeable channel of the TRP family, TRPY1, which is localized in the vacuolar membrane and contributes to cytosolic free Ca2+ ([Ca2+]cyt) elevations, for example in response to osmotic upshock. A TRPY1 homologue in the rice blast fungus is known to be important for growth and pathogenicity. To determine the role of the TRP channel family in the maize pathogen Colletotrichum graminicola, proteins homologous to TRPY1 were searched. This identified not one, but four genes in the C. graminicola genome, which had putative orthologs in other fungi, and which we named CgTRPF1 through 4. The topology of the CgTRPF proteins resembled that of TRPY1, albeit with a variable number of transmembrane (TM) domains additional to the six-TM-domain core and a diverse arrangement of putatively Ca2+-binding acidic motifs. All CgTRPF genes were expressed in axenic culture and throughout the infection of maize. Like TRPY1, all TRPF proteins of C. graminicola were localized intracellularly, albeit three of them were found not in large vacuoles, but co-localized in vesicular structures. Deletion strains for the CgTRPF genes were not altered in processes thought to involve Ca2+ release from internal stores, i.e. spore germination, the utilization of complex carbon sources, and the generation of tip-focussed [Ca2+]cyt spikes. Heterologous expression of CgTRPF1 through 4 in a tryp1Δ yeast mutant revealed that none of the channels mediated the release of Ca2+ in response to osmotic upshock. Accordingly, aequorin-based [Ca2+]cyt measurements of C. graminicola showed that in this fungus, osmotic upshock-triggered [Ca2+]cyt elevations were generated entirely by influx of Ca2

  8. The Transient Receptor Potential (TRP) Channel Family in Colletotrichum graminicola: A Molecular and Physiological Analysis.

    PubMed

    Lange, Mario; Weihmann, Fabian; Schliebner, Ivo; Horbach, Ralf; Deising, Holger B; Wirsel, Stefan G R; Peiter, Edgar

    2016-01-01

    Calcium (Ca2+) is a universal second messenger in all higher organisms and centrally involved in the launch of responses to environmental stimuli. Ca2+ signals in the cytosol are initiated by the activation of Ca2+ channels in the plasma membrane and/or in endomembranes. Yeast (Saccharomyces cerevisiae) contains a Ca2+-permeable channel of the TRP family, TRPY1, which is localized in the vacuolar membrane and contributes to cytosolic free Ca2+ ([Ca2+]cyt) elevations, for example in response to osmotic upshock. A TRPY1 homologue in the rice blast fungus is known to be important for growth and pathogenicity. To determine the role of the TRP channel family in the maize pathogen Colletotrichum graminicola, proteins homologous to TRPY1 were searched. This identified not one, but four genes in the C. graminicola genome, which had putative orthologs in other fungi, and which we named CgTRPF1 through 4. The topology of the CgTRPF proteins resembled that of TRPY1, albeit with a variable number of transmembrane (TM) domains additional to the six-TM-domain core and a diverse arrangement of putatively Ca2+-binding acidic motifs. All CgTRPF genes were expressed in axenic culture and throughout the infection of maize. Like TRPY1, all TRPF proteins of C. graminicola were localized intracellularly, albeit three of them were found not in large vacuoles, but co-localized in vesicular structures. Deletion strains for the CgTRPF genes were not altered in processes thought to involve Ca2+ release from internal stores, i.e. spore germination, the utilization of complex carbon sources, and the generation of tip-focussed [Ca2+]cyt spikes. Heterologous expression of CgTRPF1 through 4 in a tryp1Δ yeast mutant revealed that none of the channels mediated the release of Ca2+ in response to osmotic upshock. Accordingly, aequorin-based [Ca2+]cyt measurements of C. graminicola showed that in this fungus, osmotic upshock-triggered [Ca2+]cyt elevations were generated entirely by influx of Ca2

  9. Dechlorination of lindane by the cyanobacterium Anabaena sp. strain PCC7120 depends on the function of the nir operon.

    PubMed Central

    Kuritz, T; Bocanera, L V; Rivera, N S

    1997-01-01

    Nitrate is essential for lindane dechlorination by the cyanobacteria Anabaena sp. strain PCC7120 and Nostoc ellipsosporum, as it is for dechlorination of other organic compounds by heterotrophic microorganisms. Based on analyses of mutants and effects of environmental factors, we conclude that lindane dechlorination by Anabaena sp. requires a functional nir operon that encodes the enzymes for nitrate utilization. PMID:9150239

  10. Discovery of melanocortin ligands via a double simultaneous substitution strategy based on the Ac-His-DPhe-Arg-Trp-NH2 template.

    PubMed

    Todorovic, Aleksandar; Lensing, Cody J; Holder, Jerry Ryan; Scott, Joseph W; Sorensen, Nicholas B; Haskell-Luevano, Carrie

    2018-05-21

    The melanocortin system regulates an array of diverse physiological functions including pigmentation, feeding behavior, energy homeostasis, cardiovascular regulation, sexual function, and steroidogenesis. Endogenous melanocortin agonist ligands all possess the minimal messaging tetrapeptide sequence His-Phe-Arg-Trp. Based on this endogenous sequence, the Ac-His1-DPhe2-Arg3-Trp4-NH 2 tetrapeptide has previously been shown to be a useful scaffold when utilizing traditional positional scanning approaches to modify activity at the various melanocortin receptors (MC1-5R). The study reported herein was undertaken to evaluate a double simultaneous substitution strategy as an approach to further diversify the Ac-His1-DPhe2-Arg3-Trp4-NH 2 tetrapeptide with concurrent introduction of natural and unnatural amino acids at positions 1, 2, or 4 as well as an octanoyl residue at the N-terminus. The designed library includes the following combinations: (A) double simultaneous substitution at capping group position (Ac) together with position 1, 2, or 4, (B) double simultaneous substitution at position 1 and 2, (C) double simultaneous substitution at position 1 and 4, and (D) double simultaneous substitution at position 2 and 4. Several lead ligands with unique pharmacologies were discovered in the current study including antagonists targeting the neuronal mMC3R with minimal agonist activity and ligands with selective profiles for the various melanocortin subtypes. The results suggest that the double simultaneous substitution strategy is a suitable approach in altering melanocortin receptor potency, selectivity, or converting agonists into antagonists and vice versa.

  11. Newer systems for bacterial resistances to toxic heavy metals.

    PubMed Central

    Silver, S; Ji, G

    1994-01-01

    Bacterial plasmids contain specific genes for resistances to toxic heavy metal ions including Ag+, AsO2-, AsO4(3-), Cd2+, Co2+, CrO4(2-), Cu2+, Hg2+, Ni2+, Pb2+, Sb3+, and Zn2+. Recent progress with plasmid copper-resistance systems in Escherichia coli and Pseudomonas syringae show a system of four gene products, an inner membrane protein (PcoD), an outer membrane protein (PcoB), and two periplasmic Cu(2+)-binding proteins (PcoA and PcoC). Synthesis of this system is governed by two regulatory proteins (the membrane sensor PcoS and the soluble responder PcoR, probably a DNA-binding protein), homologous to other bacterial two-component regulatory systems. Chromosomally encoded Cu2+ P-type ATPases have recently been recognized in Enterococcus hirae and these are closely homologous to the bacterial cadmium efflux ATPase and the human copper-deficiency disease Menkes gene product. The Cd(2+)-efflux ATPase of gram-positive bacteria is a large P-type ATPase, homologous to the muscle Ca2+ ATPase and the Na+/K+ ATPases of animals. The arsenic-resistance system of gram-negative bacteria functions as an oxyanion efflux ATPase for arsenite and presumably antimonite. However, the structure of the arsenic ATPase is fundamentally different from that of P-type ATPases. The absence of the arsA gene (for the ATPase subunit) in gram-positive bacteria raises questions of energy-coupling for arsenite efflux. The ArsC protein product of the arsenic-resistance operons of both gram-positive and gram-negative bacteria is an intracellular enzyme that reduces arsenate [As(V)] to arsenite [As(III)], the substrate for the transport pump. Newly studied cation efflux systems for Cd2+, Zn2+, and Co2+ (Czc) or Co2+ and Ni2+ resistance (Cnr) lack ATPase motifs in their predicted polypeptide sequences. Therefore, not all plasmid-resistance systems that function through toxic ion efflux are ATPases. The first well-defined bacterial metallothionein was found in the cyanobacterium Synechococcus

  12. X-Prolyl Dipeptidyl Aminopeptidase Gene (pepX) Is Part of the glnRA Operon in Lactobacillus rhamnosus

    PubMed Central

    Varmanen, Pekka; Savijoki, Kirsi; Åvall, Silja; Palva, Airi; Tynkkynen, Soile

    2000-01-01

    A peptidase gene expressing X-prolyl dipeptidyl aminopeptidase (PepX) activity was cloned from Lactobacillus rhamnosus 1/6 by using the chromogenic substrate l-glycyl-l-prolyl-β-naphthylamide for screening of a genomic library in Escherichia coli. The nucleotide sequence of a 3.5-kb HindIII fragment expressing the peptidase activity revealed one complete open reading frame (ORF) of 2,391 nucleotides. The 797-amino-acid protein encoded by this ORF was shown to be 40, 39, and 36% identical with PepXs from Lactobacillus helveticus, Lactobacillus delbrueckii, and Lactococcus lactis, respectively. By Northern analysis with a pepX-specific probe, transcripts of 4.5 and 7.0 kb were detected, indicating that pepX is part of a polycistronic operon in L. rhamnosus. Cloning and sequencing of the upstream region of pepX revealed the presence of two ORFs of 360 and 1,338 bp that were shown to be able to encode proteins with high homology to GlnR and GlnA proteins, respectively. By multiple primer extension analyses, the only functional promoter in the pepX region was located 25 nucleotides upstream of glnR. Northern analysis with glnA- and pepX-specific probes indicated that transcription from glnR promoter results in a 2.0-kb dicistronic glnR-glnA transcript and also in a longer read-through polycistronic transcript of 7.0 kb that was detected with both probes in samples from cells in exponential growth phase. The glnA gene was disrupted by a single-crossover recombinant event using a nonreplicative plasmid carrying an internal part of glnA. In the disruption mutant, glnRA-specific transcription was derepressed 10-fold compared to the wild type, but the 7.0-kb transcript was no longer detectable with either the glnA- or pepX-specific probe, demonstrating that pepX is indeed part of glnRA operon in L. rhamnosus. Reverse transcription-PCR analysis further supported this operon structure. An extended stem-loop structure was identified immediately upstream of pepX in the gln

  13. X-prolyl dipeptidyl aminopeptidase gene (pepX) is part of the glnRA operon in Lactobacillus rhamnosus.

    PubMed

    Varmanen, P; Savijoki, K; Avall, S; Palva, A; Tynkkynen, S

    2000-01-01

    A peptidase gene expressing X-prolyl dipeptidyl aminopeptidase (PepX) activity was cloned from Lactobacillus rhamnosus 1/6 by using the chromogenic substrate L-glycyl-L-prolyl-beta-naphthylamide for screening of a genomic library in Escherichia coli. The nucleotide sequence of a 3.5-kb HindIII fragment expressing the peptidase activity revealed one complete open reading frame (ORF) of 2,391 nucleotides. The 797-amino-acid protein encoded by this ORF was shown to be 40, 39, and 36% identical with PepXs from Lactobacillus helveticus, Lactobacillus delbrueckii, and Lactococcus lactis, respectively. By Northern analysis with a pepX-specific probe, transcripts of 4.5 and 7.0 kb were detected, indicating that pepX is part of a polycistronic operon in L. rhamnosus. Cloning and sequencing of the upstream region of pepX revealed the presence of two ORFs of 360 and 1,338 bp that were shown to be able to encode proteins with high homology to GlnR and GlnA proteins, respectively. By multiple primer extension analyses, the only functional promoter in the pepX region was located 25 nucleotides upstream of glnR. Northern analysis with glnA- and pepX-specific probes indicated that transcription from glnR promoter results in a 2.0-kb dicistronic glnR-glnA transcript and also in a longer read-through polycistronic transcript of 7.0 kb that was detected with both probes in samples from cells in exponential growth phase. The glnA gene was disrupted by a single-crossover recombinant event using a nonreplicative plasmid carrying an internal part of glnA. In the disruption mutant, glnRA-specific transcription was derepressed 10-fold compared to the wild type, but the 7.0-kb transcript was no longer detectable with either the glnA- or pepX-specific probe, demonstrating that pepX is indeed part of glnRA operon in L. rhamnosus. Reverse transcription-PCR analysis further supported this operon structure. An extended stem-loop structure was identified immediately upstream of pepX in the gln

  14. Preparation of human Melanocortin-4 receptor agonist libraries: linear peptides X-Y-DPhe7-Arg8-Trp(or 2-Nal)9-Z-NH2.

    PubMed

    Cheung, Adrian Wai-Hing; Qi, Lida; Gore, Vijay; Chu, Xin-Jie; Bartkovitz, David; Kurylko, Grazyna; Swistok, Joseph; Danho, Waleed; Chen, Li; Yagaloff, Keith

    2005-12-15

    Two libraries of hMC4R agonists, X-Y-DPhe(7)-Arg(8)-2-Nal(9)-Z-NH(2) and X-Y-DPhe(7)-Arg(8)-Trp(9)-Z-NH(2), totaling 185 peptides were prepared using Irori radiofrequency tagging technology and Argonaut Quest 210 Synthesizer, where X stands for N-caps, Y for His(6) surrogates and Z for Gly(10) surrogates. As a result of this study, His-modified pentapeptides with Trp were found to be more hMC4R potent than the corresponding 2-Nal analogs, novel N-caps and Gly surrogates were identified and 19 new peptides which are potent hMC4R agonists (EC(50) 1-15nM) and selective against hMC1R were discovered.

  15. A Conserved UDP-Glucose Dehydrogenase Encoded outside the hasABC Operon Contributes to Capsule Biogenesis in Group A Streptococcus

    PubMed Central

    Cole, Jason N.; Aziz, Ramy K.; Kuipers, Kirsten; Timmer, Anjuli M.; Nizet, Victor

    2012-01-01

    Group A Streptococcus (GAS) is a human-specific bacterial pathogen responsible for serious morbidity and mortality worldwide. The hyaluronic acid (HA) capsule of GAS is a major virulence factor, contributing to bloodstream survival through resistance to neutrophil and antimicrobial peptide killing and to in vivo pathogenicity. Capsule biosynthesis has been exclusively attributed to the ubiquitous hasABC hyaluronan synthase operon, which is highly conserved across GAS serotypes. Previous reports indicate that hasA, encoding hyaluronan synthase, and hasB, encoding UDP-glucose 6-dehydrogenase, are essential for capsule production in GAS. Here, we report that precise allelic exchange mutagenesis of hasB in GAS strain 5448, a representative of the globally disseminated M1T1 serotype, did not abolish HA capsule synthesis. In silico whole-genome screening identified a putative HasB paralog, designated HasB2, with 45% amino acid identity to HasB at a distant location in the GAS chromosome. In vitro enzymatic assays demonstrated that recombinant HasB2 is a functional UDP-glucose 6-dehydrogenase enzyme. Mutagenesis of hasB2 alone slightly decreased capsule abundance; however, a ΔhasB ΔhasB2 double mutant became completely acapsular. We conclude that HasB is not essential for M1T1 GAS capsule biogenesis due to the presence of a newly identified HasB paralog, HasB2, which most likely resulted from gene duplication. The identification of redundant UDP-glucose 6-dehydrogenases underscores the importance of HA capsule expression for M1T1 GAS pathogenicity and survival in the human host. PMID:22961854

  16. Development of a robust, sensitive and selective liquid chromatography-tandem mass spectrometry assay for the quantification of the novel macrocyclic peptide kappa opioid receptor antagonist [D-Trp]CJ-15,208 in plasma and application to an initial pharmacokinetic study.

    PubMed

    Khaliq, Tanvir; Williams, Todd D; Senadheera, Sanjeewa N; Aldrich, Jane V

    2016-08-15

    Selective kappa opioid receptor (KOR) antagonists may have therapeutic potential as treatments for substance abuse and mood disorders. Since [D-Trp]CJ-15,208 (cyclo[Phe-d-Pro-Phe-d-Trp]) is a novel potent KOR antagonist in vivo, it is imperative to evaluate its pharmacokinetic properties to assist the development of analogs as potential therapeutic agents, necessitating the development and validation of a quantitative method for determining its plasma levels. A method for quantifying [D-Trp]CJ-15,208 was developed employing high performance liquid chromatography-tandem mass spectrometry in mouse plasma. Sample preparation was accomplished through a simple one-step protein precipitation method with acetonitrile, and [D-Trp]CJ-15,208 analyzed following HPLC separation on a Hypersil BDS C8 column. Multiple reaction monitoring (MRM), based on the transitions m/z 578.1→217.1 and 245.0, was specific for [D-Trp]CJ-15,208, and MRM based on the transition m/z 566.2→232.9 was specific for the internal standard without interference from endogenous substances in blank mouse plasma. The assay was linear over the concentration range 0.5-500ng/mL with a mean r(2)=0.9987. The mean inter-day accuracy and precision for all calibration standards were 93-118% and 8.9%, respectively. The absolute recoveries were 85±6% and 81±9% for [D-Trp]CJ-15,208 and the internal standard, respectively. The analytical method had excellent sensitivity with a lower limit of quantification of 0.5ng/mL using a sample volume of 20μL. The method was successfully applied to an initial pharmacokinetic study of [D-Trp]CJ-15,208 following intravenous administration to mice. Copyright © 2016 Elsevier B.V. All rights reserved.

  17. Development of a robust, sensitive and selective liquid chromatography-tandem mass spectrometry assay for the quantification of the novel macrocyclic peptide kappa opioid receptor antagonist [D-Trp]CJ-15,208 in plasma and application to an initial pharmacokinetic study

    PubMed Central

    Khaliq, Tanvir; Williams, Todd D.; Senadheera, Sanjeewa N.; Aldrich, Jane V.

    2016-01-01

    Selective kappa opioid receptor (KOR) antagonists may have therapeutic potential as treatments for substance abuse and mood disorders. Since [D-Trp]CJ-15,208 (cyclo[Phe-D-Pro-Phe-D-Trp]) is a novel potent KOR antagonist in vivo, it is imperative to evaluate its pharmacokinetic properties to assist the development of analogs as potential therapeutic agents, necessitating the development and validation of a quantitative method for determining its plasma levels. A method for quantifying [D-Trp]CJ-15,208 was developed employing high performance liquid chromatography-tandem mass spectrometry in mouse plasma. Sample preparation was accomplished through a simple one-step protein precipitation method with acetonitrile, and [D-Trp]CJ-15,208 analyzed following HPLC separation on a Hypersil BDS C8 column. Multiple reaction monitoring (MRM), based on the transitions m/z 578.1 → 217.1 and 245.0, was specific for [D-Trp]CJ-15,208, and MRM based on the transition m/z 566.2 → 232.9 was specific for the internal standard without interference from endogenous substances in blank mouse plasma. The assay was linear over the concentration range 0.5–500 ng/mL with a mean r2 = 0.9987. The mean inter-day accuracy and precision for all calibration standards was 93–118% and 8.9%, respectively. The absolute recoveries were 85±6% and 81±9% for [D-Trp]CJ-15,208 and the internal standard, respectively. The analytical method had excellent sensitivity with a lower limit of quantification of 0.5 ng/mL using a sample volume of 20 μL. The method was successfully applied to an initial pharmacokinetic study of [D-Trp]CJ-15,208 following intravenous administration to mice. PMID:27318293

  18. Structure-activity relationship of linear tetrapeptides Tic-DPhe-Arg-Trp-NH2 at the human melanocortin-4 receptor and effects on feeding behaviors in rat.

    PubMed

    Ye, Zhixiong; MacNeil, Tanya; Weinberg, David H; Kalyani, Rubana N; Tang, Rui; Strack, Alison M; Murphy, Beth A; Mosley, Ralph T; Euan MacIntyre, D; Van der Ploeg, Lex H T; Patchett, Arthur A; Wyvratt, Matthew J; Nargund, Ravi P

    2005-10-01

    The melanocortin subtype-4 receptor (MC4R) has been implicated in the control of feeding behavior and body weight regulation. A series of tetrapeptides, based on Tic-DPhe-Arg-Trp-NH2-a mimic of the putative message sequence "His-Phe-Arg-Trp" and modified at the DPhe position, were prepared and pharmacologically characterized for potency and selectivity. Substitution of His with Tic gave peptides with significant increases in selectivity. The effects of the substitution pattern of DPhe were investigated and it has significant influences on potency and the level of the maximum cAMP accumulation. Intracerebroventricular administration of peptide 10 induced significant inhibition of cumulative overnight food intake and feeding duration in rats.

  19. Origin and Evolution of the Sodium -Pumping NADH: Ubiquinone Oxidoreductase

    PubMed Central

    Reyes-Prieto, Adrian; Barquera, Blanca; Juárez, Oscar

    2014-01-01

    The sodium -pumping NADH: ubiquinone oxidoreductase (Na+-NQR) is the main ion pump and the primary entry site for electrons into the respiratory chain of many different types of pathogenic bacteria. This enzymatic complex creates a transmembrane gradient of sodium that is used by the cell to sustain ionic homeostasis, nutrient transport, ATP synthesis, flagellum rotation and other essential processes. Comparative genomics data demonstrate that the nqr operon, which encodes all Na+-NQR subunits, is found in a large variety of bacterial lineages with different habitats and metabolic strategies. Here we studied the distribution, origin and evolution of this enzymatic complex. The molecular phylogenetic analyses and the organizations of the nqr operon indicate that Na+-NQR evolved within the Chlorobi/Bacteroidetes group, after the duplication and subsequent neofunctionalization of the operon that encodes the homolog RNF complex. Subsequently, the nqr operon dispersed through multiple horizontal transfer events to other bacterial lineages such as Chlamydiae, Planctomyces and α, β, γ and δ -proteobacteria. Considering the biochemical properties of the Na+-NQR complex and its physiological role in different bacteria, we propose a detailed scenario to explain the molecular mechanisms that gave rise to its novel redox- dependent sodium -pumping activity. Our model postulates that the evolution of the Na+-NQR complex involved a functional divergence from its RNF homolog, following the duplication of the rnf operon, the loss of the rnfB gene and the recruitment of the reductase subunit of an aromatic monooxygenase. PMID:24809444

  20. Association of Arg194Trp, Arg280His and Arg399Gln Polymorphisms in X-ray Repair Cross-Complementing Group 1 Gene and Risk of Differentiated Thyroid Carcinoma in Iran

    PubMed Central

    Fard-Esfahani, Pezhman; Fard-Esfahani, Armaghan; Fayaz, Shima; Ghanbarzadeh, Bahareh; Saidi, Parinaz; Mohabati, Reyhaneh; Bidoki, Seyed Kazem; Majdi, Mina

    2011-01-01

    Background: X-ray repair cross-complementing group 1 (XRCC1) gene is a DNA repair gene and its non-synonymous single nucleotide polymorphisms (SNP) may influence DNA repair capacity which has been considered as a modifying risk factor for cancer development. Methods: A case-control study was conducted to investigate impact of three frequently studied polymorphisms (Arg194Trp, Arg280His and Arg399Gln) on developing differentiated thyroid carcinoma (DTC). Results: Increased risks for DTC were shown in homozygous (odds ratio [OR]: 3.66, 95% confidence interval [CI]: 0.38-35.60) and in dominant trait (OR: 1.22, 95% CI: 1.64-2.32) of Arg194Trp genotype. Also, for Arg280His genotype, an increased risk for DTC was shown in dominant trait (OR: 1.42, 95% confidence interval [CI]: 0.76-2.68), while a mildly reduction of risk for DTC (OR: 0.77, 95% [CI]: 0.50-1.17) was estimated in dominant Gln genotype of Arg399Gln. Considering combinatory effects of Arg194Trp and Arg280His genotypes on DTC, the calculated OR and 95% CI for being heterozygous for one of Arg194Trp or Arg280His genotypes were 1.57 and 0.90-2.74, respectively. Conclusion: Genotyping of codons 194, 280 and 399 in XRCC1 gene may use in risk assessment of DTC. PMID:21987112

  1. Whole-Transcriptome Shotgun Sequencing (RNA-seq) Screen Reveals Upregulation of Cellobiose and Motility Operons of Lactobacillus ruminis L5 during Growth on Tetrasaccharides Derived from Barley β-Glucan

    PubMed Central

    Lawley, Blair; Sims, Ian M.

    2013-01-01

    Lactobacillus ruminis is an inhabitant of human bowels and bovine rumens. None of 10 isolates (three from bovine rumen, seven from human feces) of L. ruminis that were tested could utilize barley β-glucan for growth. Seven of the strains of L. ruminis were, however, able to utilize tetrasaccharides (3-O-β-cellotriosyl-d-glucose [LDP4] or 4-O-β-laminaribiosyl-d-cellobiose [CDP4]) present in β-glucan hydrolysates for growth. The tetrasaccharides were generated by the use of lichenase or cellulase, respectively. To learn more about the utilization of tetrasaccharides by L. ruminis, whole-transcriptome shotgun sequencing (RNA-seq) was tested as a transcriptional screen to detect altered gene expression when an autochthonous human strain (L5) was grown in medium containing CDP4. RNA-seq results were confirmed and extended by reverse transcription-quantitative PCR assays of selected genes in two upregulated operons when cells were grown as batch cultures in medium containing either CDP4 or LDP4. The cellobiose utilization operon had increased transcription, particularly in early growth phase, whereas the chemotaxis/motility operon was upregulated in late growth phase. Phenotypic changes were seen in relation to upregulation of chemotaxis/flagellar operons: flagella were rarely seen by electron microscopy on glucose-grown cells but cells cultured in tetrasaccharide medium were commonly flagellated. Chemotactic movement toward tetrasaccharides was demonstrated in capillary cultures. L. ruminis utilized 3-O-β-cellotriosyl-d-glucose released by β-glucan hydrolysis due to bowel commensal Coprococcus sp., indicating that cross feeding of tetrasaccharide between bacteria could occur. Therefore, the RNA-seq screen and subsequent experiments had utility in revealing foraging attributes of gut commensal Lactobacillus ruminis. PMID:23851085

  2. Regulation of the yjjQ-bglJ Operon, Encoding LuxR-Type Transcription Factors, and the Divergent yjjP Gene by H-NS and LeuO▿ †

    PubMed Central

    Stratmann, Thomas; Madhusudan, S.; Schnetz, Karin

    2008-01-01

    The yjjQ and bglJ genes encode LuxR-type transcription factors conserved in several enterobacterial species. YjjQ is a potential virulence factor in avian pathogenic Escherichia coli. BglJ counteracts the silencing of the bgl (β-glucoside) operon by H-NS in E. coli K-12. Here we show that yjjQ and bglJ form an operon carried by E. coli K-12, whose expression is repressed by the histone-like nucleoid structuring (H-NS) protein. The LysR-type transcription factor LeuO counteracts this repression. Furthermore, the yjjP gene, encoding a membrane protein of unknown function and located upstream in divergent orientation to the yjjQ-bglJ operon, is likewise repressed by H-NS. Mapping of the promoters as well as the H-NS and LeuO binding sites within the 555-bp intergenic region revealed that H-NS binds to the center of the AT-rich regulatory region and distal to the divergent promoters. LeuO sites map to the center and to positions distal to the yjjQ promoters, while one LeuO binding site overlaps with the divergent yjjP promoter. This latter LeuO site is required for full derepression of the yjjQ promoters. The arrangement of regulatory sites suggests that LeuO restructures the nucleoprotein complex formed by H-NS. Furthermore, the data support the conclusion that LeuO, whose expression is likewise repressed by H-NS and which is a virulence factor in Salmonella enterica, is a master regulator that among other loci, also controls the yjjQ-bglJ operon and thus indirectly the presumptive targets of YjjQ and BglJ. PMID:18055596

  3. Common Distribution of gad Operon in Lactobacillus brevis and its GadA Contributes to Efficient GABA Synthesis toward Cytosolic Near-Neutral pH

    PubMed Central

    Wu, Qinglong; Tun, Hein Min; Law, Yee-Song; Khafipour, Ehsan; Shah, Nagendra P.

    2017-01-01

    Many strains of lactic acid bacteria (LAB) and bifidobacteria have exhibited strain-specific capacity to produce γ-aminobutyric acid (GABA) via their glutamic acid decarboxylase (GAD) system, which is one of amino acid-dependent acid resistance (AR) systems in bacteria. However, the linkage between bacterial AR and GABA production capacity has not been well established. Meanwhile, limited evidence has been provided to the global diversity of GABA-producing LAB and bifidobacteria, and their mechanisms of efficient GABA synthesis. In this study, genomic survey identified common distribution of gad operon-encoded GAD system in Lactobacillus brevis for its GABA production among varying species of LAB and bifidobacteria. Importantly, among four commonly distributed amino acid-dependent AR systems in Lb. brevis, its GAD system was a major contributor to maintain cytosolic pH homeostasis by consuming protons via GABA synthesis. This highlights that Lb. brevis applies GAD system as the main strategy against extracellular and intracellular acidification demonstrating its high capacity of GABA production. In addition, the abundant GadA retained its activity toward near-neutral pH (pH 5.5–6.5) of cytosolic acidity thus contributing to efficient GABA synthesis in Lb. brevis. This is the first global report illustrating species-specific characteristic and mechanism of efficient GABA synthesis in Lb. brevis. PMID:28261168

  4. Structure-activity relationships of the unique and potent agouti-related protein (AGRP)-melanocortin chimeric Tyr-c[beta-Asp-His-DPhe-Arg-Trp-Asn-Ala-Phe-Dpr]-Tyr-NH2 peptide template.

    PubMed

    Wilczynski, Andrzej; Wilson, Krista R; Scott, Joseph W; Edison, Arthur S; Haskell-Luevano, Carrie

    2005-04-21

    The melanocortin receptor system consists of endogenous agonists, antagonists, G-protein coupled receptors, and auxiliary proteins that are involved in the regulation of complex physiological functions such as energy and weight homeostasis, feeding behavior, inflammation, sexual function, pigmentation, and exocrine gland function. Herein, we report the structure-activity relationship (SAR) of a new chimeric hAGRP-melanocortin agonist peptide template Tyr-c[beta-Asp-His-DPhe-Arg-Trp-Asn-Ala-Phe-Dpr]-Tyr-NH(2) that was characterized using amino acids previously reported in other melanocortin agonist templates. Twenty peptides were examined in this study, and six peptides were selected for (1)H NMR and computer-assisted molecular modeling structural analysis. The most notable results include the identification that modification of the chimeric template at the His position with Pro and Phe resulted in ligands that were nM mouse melanocortin-3 receptor (mMC3R) antagonists and nM mouse melanocortin-4 receptor (mMC4R) agonists. The peptides Tyr-c[beta-Asp-His-DPhe-Ala-Trp-Asn-Ala-Phe-Dpr]-Tyr-NH(2) and Tyr-c[beta-Asp-His-DNal(1')-Arg-Trp-Asn-Ala-Phe-Dpr]-Tyr-NH(2) resulted in 730- and 560-fold, respectively, mMC4R versus mMC3R selective agonists that also possessed nM agonist potency at the mMC1R and mMC5R. Structural studies identified a reverse turn occurring in the His-DPhe-Arg-Trp domain, with subtle differences observed that may account for the differences in melanocortin receptor pharmacology. Specifically, a gamma-turn secondary structure involving the DPhe(4) in the central position of the Tyr-c[beta-Asp-Phe-DPhe-Arg-Trp-Asn-Ala-Phe-Dpr]-Tyr-NH(2) peptide may differentiate the mixed mMC3R antagonist and mMC4R agonist pharmacology.

  5. Participation of the arcRACME protein in self-activation of the arc operon located in the arginine catabolism mobile element in pandemic clone USA300.

    PubMed

    Rozo, Zayda Lorena Corredor; Márquez-Ortiz, Ricaurte Alejandro; Castro, Betsy Esperanza; Gómez, Natasha Vanegas; Escobar-Pérez, Javier

    2017-07-01

    Staphylococcus aureus pandemic clone USA300 has, in addition to its constitutive arginine catabolism (arc) gene cluster, an arginine catabolism mobile element (ACME) carrying another such cluster, which gives this clone advantages in colonisation and infection. Gene arcR, which encodes an oxygen-sensitive transcriptional regulator, is inside ACME and downstream of the constitutive arc gene cluster, and this situation may have an impact on its activation. Different relative expression behaviours are proven here for arcRACME and the arcACME operon compared to the constitutive ones. We also show that the artificially expressed recombinant ArcRACME protein binds to the promoter region of the arcACME operon; this mechanism can be related to a positive feedback model, which may be responsible for increased anaerobic survival of the USA300 clone during infection-related processes.

  6. A novel amino acid substitution Trp574Arg in acetolactate synthase (ALS) confers broad resistance to ALS-inhibiting herbicides in crabgrass (Digitaria sanguinalis).

    PubMed

    Li, Jian; Li, Mei; Gao, Xingxiang; Fang, Feng

    2017-12-01

    Crabgrass (Digitaria sanguinalis) is an annual monocotyledonous weed. In recent years, field applications of nicosulfuron have been ineffective in controlling crabgrass populations in Shandong Province, China. To investigate the mechanisms of resistance to nicosulfuron in crabgrass populations, the acetolactate synthase (ALS) gene fragment covering known resistance-confering mutation sites was amplified and sequenced. Dose-response experiments suggested that the resistant population SD13 (R) was highly resistant to nicosulfuron (resistance index R/S = 43.7) compared with the sensitive population SD22 (S). ALS gene sequencing revealed a Trp574Arg substitution in the SD13 population, and no other known resistance-conferring mutations were found. In vitro ALS enzyme assays further confirmed that the SD13 population was resistant to all tested ALS-inhibiting herbicides. The resistance pattern experiments revealed that, compared with SD22, the SD13 population exhibited broad-spectrum resistance to nicosulfuron (43.7-fold), imazethapyr (11.4-fold) and flumetsulam (16.1-fold); however, it did not develop resistance to atrazine, mesotrione and topramezone. This study demonstrated that Trp574Arg substitution was the main reason for crabgrass resistance to ALS-inhibiting herbicides. To our knowledge, this is the first report of Trp574Arg substitution in a weed species, and is the first report of target-site mechanisms of herbicide resistance for crabgrass. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  7. Spore Heat Activation Requirements and Germination Responses Correlate with Sequences of Germinant Receptors and with the Presence of a Specific spoVA2mob Operon in Foodborne Strains of Bacillus subtilis.

    PubMed

    Krawczyk, Antonina O; de Jong, Anne; Omony, Jimmy; Holsappel, Siger; Wells-Bennik, Marjon H J; Kuipers, Oscar P; Eijlander, Robyn T

    2017-04-01

    Spore heat resistance, germination, and outgrowth are problematic bacterial properties compromising food safety and quality. Large interstrain variation in these properties makes prediction and control of spore behavior challenging. High-level heat resistance and slow germination of spores of some natural Bacillus subtilis isolates, encountered in foods, have been attributed to the occurrence of the spoVA 2mob operon carried on the Tn 1546 transposon. In this study, we further investigate the correlation between the presence of this operon in high-level-heat-resistant spores and their germination efficiencies before and after exposure to various sublethal heat treatments (heat activation, or HA), which are known to significantly improve spore responses to nutrient germinants. We show that high-level-heat-resistant spores harboring spoVA 2mob required higher HA temperatures for efficient germination than spores lacking spoVA 2mob The optimal spore HA requirements additionally depended on the nutrients used to trigger germination, l-alanine (l-Ala), or a mixture of l-asparagine, d-glucose, d-fructose, and K + (AGFK). The distinct HA requirements of these two spore germination pathways are likely related to differences in properties of specific germinant receptors. Moreover, spores that germinated inefficiently in AGFK contained specific changes in sequences of the GerB and GerK germinant receptors, which are involved in this germination response. In contrast, no relation was found between transcription levels of main germination genes and spore germination phenotypes. The findings presented in this study have great implications for practices in the food industry, where heat treatments are commonly used to inactivate pathogenic and spoilage microbes, including bacterial spore formers. IMPORTANCE This study describes a strong variation in spore germination capacities and requirements for a heat activation treatment, i.e., an exposure to sublethal heat that increases

  8. Spore Heat Activation Requirements and Germination Responses Correlate with Sequences of Germinant Receptors and with the Presence of a Specific spoVA2mob Operon in Foodborne Strains of Bacillus subtilis

    PubMed Central

    Krawczyk, Antonina O.; de Jong, Anne; Omony, Jimmy; Holsappel, Siger; Wells-Bennik, Marjon H. J.; Eijlander, Robyn T.

    2017-01-01

    ABSTRACT Spore heat resistance, germination, and outgrowth are problematic bacterial properties compromising food safety and quality. Large interstrain variation in these properties makes prediction and control of spore behavior challenging. High-level heat resistance and slow germination of spores of some natural Bacillus subtilis isolates, encountered in foods, have been attributed to the occurrence of the spoVA2mob operon carried on the Tn1546 transposon. In this study, we further investigate the correlation between the presence of this operon in high-level-heat-resistant spores and their germination efficiencies before and after exposure to various sublethal heat treatments (heat activation, or HA), which are known to significantly improve spore responses to nutrient germinants. We show that high-level-heat-resistant spores harboring spoVA2mob required higher HA temperatures for efficient germination than spores lacking spoVA2mob. The optimal spore HA requirements additionally depended on the nutrients used to trigger germination, l-alanine (l-Ala), or a mixture of l-asparagine, d-glucose, d-fructose, and K+ (AGFK). The distinct HA requirements of these two spore germination pathways are likely related to differences in properties of specific germinant receptors. Moreover, spores that germinated inefficiently in AGFK contained specific changes in sequences of the GerB and GerK germinant receptors, which are involved in this germination response. In contrast, no relation was found between transcription levels of main germination genes and spore germination phenotypes. The findings presented in this study have great implications for practices in the food industry, where heat treatments are commonly used to inactivate pathogenic and spoilage microbes, including bacterial spore formers. IMPORTANCE This study describes a strong variation in spore germination capacities and requirements for a heat activation treatment, i.e., an exposure to sublethal heat that

  9. Nonencapsulated or nontypeable Haemophilus influenzae are more likely than their encapsulated or serotypeable counterparts to have mutations in their fucose operon.

    PubMed

    Shuel, Michelle L; Karlowsky, Kathleen E; Law, Dennis K S; Tsang, Raymond S W

    2011-12-01

    Population biology of Haemophilus influenzae can be studied by multilocus sequence typing (MLST), and isolates are assigned sequence types (STs) based on nucleotide sequence variations in seven housekeeping genes, including fucK. However, the ST cannot be assigned if one of the housekeeping genes is absent or cannot be detected by the current protocol. Occasionally, strains of H. influenzae have been reported to lack the fucK gene. In this study, we examined the prevalence of this mutation among our collection of H. influenzae isolates. Of the 704 isolates studied, including 282 encapsulated and 422 nonencapsulated isolates, nine were not typeable by MLST owing to failure to detect the fucK gene. All nine fucK-negative isolates were nonencapsulated and belonged to various biotypes. DNA sequencing of the fucose operon region confirmed complete deletion of genes in the operon in seven of the nine isolates, while in the remaining two isolates, some of the genes were found intact or in parts. The significance of these findings is discussed.

  10. Conjugative Plasmid Transfer in Xylella fastidiosa Is Dependent on tra and trb Operon Functions.

    PubMed

    Burbank, Lindsey P; Van Horn, Christopher R

    2017-11-01

    The insect-transmitted plant pathogen Xylella fastidiosa is capable of efficient horizontal gene transfer (HGT) and recombination. Natural transformation occurs at high rates in X. fastidiosa , but there also is evidence that certain strains of X. fastidiosa carry native plasmids equipped with transfer and mobilization genes, suggesting conjugation as an additional mechanism of HGT in some instances. Two operons, tra and trb , putatively encoding a conjugative type IV secretion system, are found in some but not all X. fastidiosa isolates, often on native plasmids. X. fastidiosa strains that carry the conjugative transfer genes can belong to different subspecies and frequently differ in host ranges. Using X. fastidiosa strain M23 ( X. fastidiosa subsp. fastidiosa ) or Dixon ( X. fastidiosa subsp. multiplex ) as the donor strain and Temecula ( X. fastidiosa subsp. fastidiosa ) as the recipient strain, plasmid transfer was characterized using the mobilizable broad-host-range vector pBBR5pemIK. Transfer of plasmid pBBR5pemIK was observed under in vitro conditions with both donor strains and was dependent on both tra and trb operon functions. A conjugative mechanism likely contributes to gene transfer between diverse strains of X. fastidiosa , possibly facilitating adaptation to new environments or different hosts. IMPORTANCE Xylella fastidiosa is an important plant pathogen worldwide, infecting a wide range of different plant species. The emergence of new diseases caused by X. fastidiosa , or host switching of existing strains, is thought to be primarily due to the high frequency of HGT and recombination in this pathogen. Transfer of plasmids by a conjugative mechanism enables movement of larger amounts of genetic material at one time, compared with other routes of gene transfer such as natural transformation. Establishing the prevalence and functionality of this mechanism in X. fastidiosa contributes to a better understanding of HGT, adaptation, and disease emergence

  11. Conjugative Plasmid Transfer in Xylella fastidiosa Is Dependent on tra and trb Operon Functions

    PubMed Central

    Van Horn, Christopher R.

    2017-01-01

    ABSTRACT The insect-transmitted plant pathogen Xylella fastidiosa is capable of efficient horizontal gene transfer (HGT) and recombination. Natural transformation occurs at high rates in X. fastidiosa, but there also is evidence that certain strains of X. fastidiosa carry native plasmids equipped with transfer and mobilization genes, suggesting conjugation as an additional mechanism of HGT in some instances. Two operons, tra and trb, putatively encoding a conjugative type IV secretion system, are found in some but not all X. fastidiosa isolates, often on native plasmids. X. fastidiosa strains that carry the conjugative transfer genes can belong to different subspecies and frequently differ in host ranges. Using X. fastidiosa strain M23 (X. fastidiosa subsp. fastidiosa) or Dixon (X. fastidiosa subsp. multiplex) as the donor strain and Temecula (X. fastidiosa subsp. fastidiosa) as the recipient strain, plasmid transfer was characterized using the mobilizable broad-host-range vector pBBR5pemIK. Transfer of plasmid pBBR5pemIK was observed under in vitro conditions with both donor strains and was dependent on both tra and trb operon functions. A conjugative mechanism likely contributes to gene transfer between diverse strains of X. fastidiosa, possibly facilitating adaptation to new environments or different hosts. IMPORTANCE Xylella fastidiosa is an important plant pathogen worldwide, infecting a wide range of different plant species. The emergence of new diseases caused by X. fastidiosa, or host switching of existing strains, is thought to be primarily due to the high frequency of HGT and recombination in this pathogen. Transfer of plasmids by a conjugative mechanism enables movement of larger amounts of genetic material at one time, compared with other routes of gene transfer such as natural transformation. Establishing the prevalence and functionality of this mechanism in X. fastidiosa contributes to a better understanding of HGT, adaptation, and disease emergence

  12. Deregulation of the arginine deiminase (arc) operon in penicillin-tolerant mutants of Streptococcus gordonii.

    PubMed

    Caldelari, I; Loeliger, B; Langen, H; Glauser, M P; Moreillon, P

    2000-10-01

    Penicillin tolerance is an incompletely understood phenomenon that allows bacteria to resist drug-induced killing. Tolerance was studied with independent Streptococcus gordonii mutants generated by cyclic exposure to 500 times the MIC of penicillin. Parent cultures lost 4 to 5 log(10) CFU/ml of viable counts/24 h. In contrast, each of four independent mutant cultures lost < or =2 log(10) CFU/ml/24 h. The mutants had unchanged penicillin-binding proteins but contained increased amounts of two proteins with respective masses of ca. 50 and 45 kDa. One mutant (Tol1) was further characterized. The two proteins showing increased levels were homologous to the arginine deiminase and ornithine carbamoyl transferase of other gram-positive bacteria and were encoded by an operon that was >80% similar to the arginine-deiminase (arc) operon of these organisms. Partial nucleotide sequencing and insertion inactivation of the S. gordonii arc locus indicated that tolerance was not a direct consequence of arc alteration. On the other hand, genetic transformation of tolerance by Tol1 DNA always conferred arc deregulation. In nontolerant recipients, arc was repressed during exponential growth and up-regulated during postexponential growth. In tolerant transformants, arc was constitutively expressed. Tol1 DNA transformed tolerance at the same rate as transformation of a point mutation (10(-2) to 10(-3)). The tolerance mutation mapped on a specific chromosomal fragment but was physically distant from arc. Importantly, arc deregulation was observed in most (6 of 10) of additional independent penicillin-tolerant mutants. Thus, although not exclusive, the association between arc deregulation and tolerance was not fortuitous. Since penicillin selection mimicked the antibiotic pressure operating in the clinical environment, arc deregulation might be an important correlate of naturally occurring tolerance and help in understanding the mechanism(s) underlying this clinically problematic

  13. The glycoprotein TRP36 of Ehrlichia sp. UFMG-EV and related cattle pathogen Ehrlichia sp. UFMT-BV evolved from a highly variable clade of E. canis under adaptive diversifying selection.

    PubMed

    Cabezas-Cruz, Alejandro; Valdés, James J; de la Fuente, José

    2014-12-10

    A new species of Ehrlichia, phylogenetically distant from E. ruminantium, was found in 2010 infecting cattle in Canada. In 2012 and 2013, we reported the in vitro propagation, molecular and ultrastructural characterization of Ehrlichia sp. UFMG-EV (E. mineirensis), a new species of Ehrlichia isolated from the haemolymph of Brazilian Rhipicephalus (Boophilus) microplus ticks. A new organism, named Ehrlichia sp. UFMT-BV, closely related to Ehrlichia sp. UFMG-EV, was recently described in Brazil and after experimental infection it was shown to be pathogenic for cattle. This new emerging clade of cattle Ehrlichia pathogens is closely related to E. canis. The major immunogenic Tandem Repeat Protein (TRP36; also known as gp36) is extensively used to characterize the genetic diversity of E. canis. Homologs of TRP36 were found in both Ehrlichia sp. UFMG-EV and Ehrlichia sp. UFMT-BV. Herein, we characterized the evolution of this new Ehrlichia clade using TRP36 sequences. Our working hypothesis is that Ehrlichia sp. UFMG-EV and related microorganisms evolved from a highly variable E. canis clade. In support of our hypothesis we found that Ehrlichia sp. UFMG-EV and Ehrlichia sp. UFMT-BV TRP36 evolved from a highly divergent and variable clade within E. canis and this clade evolved under episodic diversifying selection with a high proportion of sites under positive selection. Our results suggest that Ehrlichia sp. UFMG-EV and Ehrlichia sp. UFMT-BV evolved from a variable clade within E. canis.

  14. Following Easy Slope Paths on a Free Energy Landscape: The Case Study of the Trp-Cage Folding Mechanism

    PubMed Central

    Marinelli, Fabrizio

    2013-01-01

    In this work a new method for the automatic exploration and calculation of multidimensional free energy landscapes is proposed. Inspired by metadynamics, it uses several collective variables that are relevant for the investigated process and a bias potential that discourages the sampling of already visited configurations. The latter potential allows escaping a local free energy minimum following the direction of slow motions. This is different from metadynamics in which there is no specific direction of the biasing force and the computational effort increases significantly with the number of collective variables. The method is tested on the Ace-Ala3-Nme peptide, and then it is applied to investigate the Trp-cage folding mechanism. For this protein, within a few hundreds of nanoseconds, a broad range of conformations is explored, including nearly native ones, initiating the simulation from a completely unfolded conformation. Finally, several folding/unfolding trajectories give a systematic description of the Trp-cage folding pathways, leading to a unified view for the folding mechanisms of this protein. The proposed mechanism is consistent with NMR chemical shift data at increasing temperature and recent experimental observations pointing to a pivotal role of secondary structure elements in directing the folding process toward the native state. PMID:24010667

  15. Preparation of stable isotope-labeled peripheral cannabinoid receptor CB2 by bacterial fermentation

    PubMed Central

    Berger, Christian; Ho, Jenny T.C.; Kimura, Tomohiro; Hess, Sonja; Gawrisch, Klaus; Yeliseev, Alexei

    2010-01-01

    We developed a bacterial fermentation protocol for production of a stable isotope-labeled cannabinoid receptor CB2 for subsequent structural studies of this protein by nuclear magnetic resonance spectroscopy. The human peripheral cannabinoid receptor was expressed in Escherichia coli as a fusion with maltose binding protein and two affinity tags. The fermentation was performed in defined media comprised of mineral salts, glucose and 15N2-L-tryptophan to afford incorporation of the labeled amino acid into the protein. Medium, growth and expression conditions were optimized so that the fermentation process produced about 2 mg of purified, labeled CB2 per liter of culture medium. By performing a mass spectroscopic characterization of the purified CB2, we determined that one of the two 15N atoms in tryptophan was incorporated into the recombinant protein. NMR analysis of 15N chemical shifts strongly suggests that the 15N atoms are located in Trp-indole rings. Importantly, analysis of the peptides derived from the CNBr cleavage of the purified protein confirmed a minimum of 95% incorporation of the labeled tryptophan into the CB2 sequence. The labeled CB2, purified and reconstituted into liposomes at a protein-to-lipid molar ratio of 1:500, was functional as confirmed by activation of cognate G proteins in an in vitro coupled assay. To our knowledge, this is the first reported production of a biologically active, stable isotope-labeled G protein-coupled receptor by bacterial fermentation. PMID:20044006

  16. Nasal chemosensory cells use bitter taste signaling to detect irritants and bacterial signals.

    PubMed

    Tizzano, Marco; Gulbransen, Brian D; Vandenbeuch, Aurelie; Clapp, Tod R; Herman, Jake P; Sibhatu, Hiruy M; Churchill, Mair E A; Silver, Wayne L; Kinnamon, Sue C; Finger, Thomas E

    2010-02-16

    The upper respiratory tract is continually assaulted with harmful dusts and xenobiotics carried on the incoming airstream. Detection of such irritants by the trigeminal nerve evokes protective reflexes, including sneezing, apnea, and local neurogenic inflammation of the mucosa. Although free intra-epithelial nerve endings can detect certain lipophilic irritants (e.g., mints, ammonia), the epithelium also houses a population of trigeminally innervated solitary chemosensory cells (SCCs) that express T2R bitter taste receptors along with their downstream signaling components. These SCCs have been postulated to enhance the chemoresponsive capabilities of the trigeminal irritant-detection system. Here we show that transduction by the intranasal solitary chemosensory cells is necessary to evoke trigeminally mediated reflex reactions to some irritants including acyl-homoserine lactone bacterial quorum-sensing molecules, which activate the downstream signaling effectors associated with bitter taste transduction. Isolated nasal chemosensory cells respond to the classic bitter ligand denatonium as well as to the bacterial signals by increasing intracellular Ca(2+). Furthermore, these same substances evoke changes in respiration indicative of trigeminal activation. Genetic ablation of either G alpha-gustducin or TrpM5, essential elements of the T2R transduction cascade, eliminates the trigeminal response. Because acyl-homoserine lactones serve as quorum-sensing molecules for gram-negative pathogenic bacteria, detection of these substances by airway chemoreceptors offers a means by which the airway epithelium may trigger an epithelial inflammatory response before the bacteria reach population densities capable of forming destructive biofilms.

  17. Nasal chemosensory cells use bitter taste signaling to detect irritants and bacterial signals

    PubMed Central

    Tizzano, Marco; Gulbransen, Brian D.; Vandenbeuch, Aurelie; Clapp, Tod R.; Herman, Jake P.; Sibhatu, Hiruy M.; Churchill, Mair E. A.; Silver, Wayne L.; Kinnamon, Sue C.; Finger, Thomas E.

    2010-01-01

    The upper respiratory tract is continually assaulted with harmful dusts and xenobiotics carried on the incoming airstream. Detection of such irritants by the trigeminal nerve evokes protective reflexes, including sneezing, apnea, and local neurogenic inflammation of the mucosa. Although free intra-epithelial nerve endings can detect certain lipophilic irritants (e.g., mints, ammonia), the epithelium also houses a population of trigeminally innervated solitary chemosensory cells (SCCs) that express T2R bitter taste receptors along with their downstream signaling components. These SCCs have been postulated to enhance the chemoresponsive capabilities of the trigeminal irritant-detection system. Here we show that transduction by the intranasal solitary chemosensory cells is necessary to evoke trigeminally mediated reflex reactions to some irritants including acyl–homoserine lactone bacterial quorum-sensing molecules, which activate the downstream signaling effectors associated with bitter taste transduction. Isolated nasal chemosensory cells respond to the classic bitter ligand denatonium as well as to the bacterial signals by increasing intracellular Ca2+. Furthermore, these same substances evoke changes in respiration indicative of trigeminal activation. Genetic ablation of either Gα-gustducin or TrpM5, essential elements of the T2R transduction cascade, eliminates the trigeminal response. Because acyl–homoserine lactones serve as quorum-sensing molecules for Gram-negative pathogenic bacteria, detection of these substances by airway chemoreceptors offers a means by which the airway epithelium may trigger an epithelial inflammatory response before the bacteria reach population densities capable of forming destructive biofilms. PMID:20133764

  18. Characterisation of the novel deleterious RAD51C p.Arg312Trp variant and prioritisation criteria for functional analysis of RAD51C missense changes.

    PubMed

    Gayarre, Javier; Martín-Gimeno, Paloma; Osorio, Ana; Paumard, Beatriz; Barroso, Alicia; Fernández, Victoria; de la Hoya, Miguel; Rojo, Alejandro; Caldés, Trinidad; Palacios, José; Urioste, Miguel; Benítez, Javier; García, María J

    2017-09-26

    Despite a high prevalence of deleterious missense variants, most studies of RAD51C ovarian cancer susceptibility gene only provide in silico pathogenicity predictions of missense changes. We identified a novel deleterious RAD51C missense variant (p.Arg312Trp) in a high-risk family, and propose a criteria to prioritise RAD51C missense changes qualifying for functional analysis. To evaluate pathogenicity of p.Arg312Trp variant we used sequence homology, loss of heterozygosity (LOH) and segregation analysis, and a comprehensive functional characterisation. To define a functional-analysis prioritisation criteria, we used outputs for the known functionally confirmed deleterious and benign RAD51C missense changes from nine pathogenicity prediction algorithms. The p.Arg312Trp variant failed to correct mitomycin and olaparib hypersensitivity and to complement abnormal RAD51C foci formation according to functional assays, which altogether with LOH and segregation data demonstrated deleteriousness. Prioritisation criteria were based on the number of predictors providing a deleterious output, with a minimum of 5 to qualify for testing and a PredictProtein score greater than 33 to assign high-priority indication. Our study points to a non-negligible number of RAD51C missense variants likely to impair protein function, provides a guideline to prioritise and encourage their selection for functional analysis and anticipates that reference laboratories should have available resources to conduct such assays.

  19. hisT is part of a multigene operon in Escherichia coli K-12.

    PubMed Central

    Marvel, C C; Arps, P J; Rubin, B C; Kammen, H O; Penhoet, E E; Winkler, M E

    1985-01-01

    The Escherichia coli K-12 hisT gene has been cloned, and its organization and expression have been analyzed on multicopy plasmids. The hisT gene, which encodes tRNA pseudouridine synthase I (PSUI), was isolated on a Clarke-Carbon plasmid known to contain the purF gene. The presence of the hisT gene on this plasmid was suggested by its ability to restore both production of PSUI enzymatic activity and suppression of amber mutations in a hisT mutant strain. A 2.3-kilobase HindIII-ClaI restriction fragment containing the hisT gene was subcloned into plasmid pBR322, and the resulting plasmid (designated psi 300) was mapped with restriction enzymes. Complementation analysis with different kinds of hisT mutations and tRNA structural analysis confirmed that plasmid psi 300 contained the hisT structural gene. Enzyme assays showed that plasmid psi 300 overproduced PSUI activity by ca. 20-fold compared with the wild-type level. Subclones containing restriction fragments from plasmid psi 300 inserted downstream from the lac promoter established that the hisT gene is oriented from the HindIII site toward the ClaI site. Other subclones and derivatives of plasmid psi 300 containing insertion or deletion mutations were constructed and assayed for production of PSUI activity and production of proteins in minicells. These experiments showed that: (i) the proximal 1.3-kilobase HindIII-BssHII restriction fragment contains a promoter for the hisT gene and encodes a 45,000-dalton polypeptide that is not PSUI; (ii) the distal 1.0-kilobase BssHII-ClaI restriction fragment encodes the 31,000-dalton PSUI polypeptide; (iii) the 45,000-dalton polypeptide is synthesized in an approximately eightfold excess compared with PSUI; and (iv) synthesis of the two polypeptides is coupled, suggesting that the two genes are part of an operon. Insertion of mini-Mu d1 (lac Km) phage into plasmid psi 300 confirmed that the hisT gene is the downstream gene in the operon. Images PMID:2981810

  20. Transcriptional Regulation of Aggregatibacter actinomycetemcomitans lsrACDBFG and lsrRK Operons and Their Role in Biofilm Formation

    PubMed Central

    Torres-Escobar, Ascención; Juárez-Rodríguez, María Dolores; Lamont, Richard J.

    2013-01-01

    Autoinducer-2 (AI-2) is required for biofilm formation and virulence of the oral pathogen Aggregatibacter actinomycetemcomitans, and we previously showed that lsrB codes for a receptor for AI-2. The lsrB gene is expressed as part of the lsrACDBFG operon, which is divergently transcribed from an adjacent lsrRK operon. In Escherichia coli, lsrRK encodes a repressor and AI-2 kinase that function to regulate lsrACDBFG. To determine if lsrRK controls lsrACDBFG expression and influences biofilm growth of A. actinomycetemcomitans, we first defined the promoters for each operon. Transcriptional reporter plasmids containing the 255-bp lsrACDBFG-lsrRK intergenic region (IGR) fused to lacZ showed that essential elements of lsrR promoter reside 89 to 255 bp upstream from the lsrR start codon. Two inverted repeat sequences that represent potential binding sites for LsrR and two sequences resembling the consensus cyclic AMP receptor protein (CRP) binding site were identified in this region. Using electrophoretic mobility shift assay (EMSA), purified LsrR and CRP proteins were shown to bind probes containing these sequences. Surprisingly, the 255-bp IGR did not contain the lsrA promoter. Instead, a fragment encompassing nucleotides +1 to +159 of lsrA together with the 255-bp IGR was required to promote lsrA transcription. This suggests that a region within the lsrA coding sequence influences transcription, or alternatively that the start codon of A. actinomycetemcomitans lsrA has been incorrectly annotated. Transformation of ΔlsrR, ΔlsrK, ΔlsrRK, and Δcrp deletion mutants with lacZ reporters containing the lsrA or lsrR promoter showed that LsrR negatively regulates and CRP positively regulates both lsrACDBFG and lsrRK. However, in contrast to what occurs in E. coli, deletion of lsrK had no effect on the transcriptional activity of the lsrA or lsrR promoters, suggesting that another kinase may be capable of phosphorylating AI-2 in A. actinomycetemcomitans. Finally, biofilm

  1. Novel Twin Streptolysin S-Like Peptides Encoded in the sag Operon Homologue of Beta-Hemolytic Streptococcus anginosus

    PubMed Central

    Tabata, Atsushi; Nakano, Kota; Ohkura, Kazuto; Tomoyasu, Toshifumi; Kikuchi, Ken; Whiley, Robert A.

    2013-01-01

    Streptococcus anginosus is a member of the anginosus group streptococci, which form part of the normal human oral flora. In contrast to the pyogenic group streptococci, our knowledge of the virulence factors of the anginosus group streptococci, including S. anginosus, is not sufficient to allow a clear understanding of the basis of their pathogenicity. Generally, hemolysins are thought to be important virulence factors in streptococcal infections. In the present study, a sag operon homologue was shown to be responsible for beta-hemolysis in S. anginosus strains by random gene knockout. Interestingly, contrary to pyogenic group streptococci, beta-hemolytic S. anginosus was shown to have two tandem sagA homologues, encoding streptolysin S (SLS)-like peptides, in the sag operon homologue. Gene deletion and complementation experiments revealed that both genes were functional, and these SLS-like peptides were essential for beta-hemolysis in beta-hemolytic S. anginosus. Furthermore, the amino acid sequence of these SLS-like peptides differed from that of the typical SLS of S. pyogenes, especially in their propeptide domain, and an amino acid residue indicated to be important for the cytolytic activity of SLS in S. pyogenes was deleted in both S. anginosus homologues. These data suggest that SLS-like peptides encoded by two sagA homologues in beta-hemolytic S. anginosus may be potential virulence factors with a different structure essential for hemolytic activity and/or the maturation process compared to the typical SLS present in pyogenic group streptococci. PMID:23292771

  2. Lack of association between the Trp719Arg polymorphism in kinesin-like protein 6 and coronary artery disease in 19 case-control studies

    PubMed Central

    Assimes, Themistocles L; Hólm, Hilma; Kathiresan, Sekar; Reilly, Muredach P; Thorleifsson, Gudmar; Voight, Benjamin F; Erdmann, Jeanette; Willenborg, Christina; Vaidya, Dhananjay; Xie, Changchun; Patterson, Chris C; Morgan, Thomas M; Burnett, Mary Susan; Li, Mingyao; Hlatky, Mark A; Knowles, Joshua W; Thompson, John R; Absher, Devin; Iribarren, Carlos; Go, Alan; Fortmann, Stephen P; Sidney, Stephen; Risch, Neil; Tang, Hua; Myers, Richard M; Berger, Klaus; Stoll, Monika; Shah, Svati H.; Thorgeirsson, Gudmundur; Andersen, Karl; Havulinna, Aki S; Herrera, J. Enrique; Faraday, Nauder; Kim, Yoonhee; Kral, Brian G.; Mathias, Rasika; Ruczinski, Ingo; Suktitipat, Bhoom; Wilson, Alexander F; Yanek, Lisa R.; Becker, Lewis C; Linsel-Nitschke, Patrick; Lieb, Wolfgang; König, Inke R; Hengstenberg, Christian; Fischer, Marcus; Stark, Klaus; Reinhard, Wibke; Winogradow, Janina; Grassl, Martina; Grosshennig, Anika; Preuss, Michael; Eifert, Sandra; Schreiber, Stefan; Wichmann, H-Erich; Meisinger, Christa; Yee, Jean; Friedlander, Yechiel; Do, Ron; Meigs, James B; Williams, Gordon; Nathan, David M; MacRae, Calum A; Qu, Liming; Wilensky, Robert L; Matthai, William H.; Qasim, Atif N; Hakonarson, Hakon; Pichard, Augusto D; Kent, Kenneth M; Satler, Lowell; Lindsay, Joseph M; Waksman, Ron; Knouff, Christopher W; Waterworth, Dawn M; Walker, Max C; Mooser, Vincent; Marrugat, Jaume; Lucas, Gavin; Subirana, Isaac; Sala, Joan; Ramos, Rafael; Martinelli, Nicola; Olivieri, Oliviero; Trabetti, Elisabetta; Malerba, Giovanni; Pignatti, Pier Franco; Guiducci, Candace; Mirel, Daniel; Parkin, Melissa; Hirschhorn, Joel N; Asselta, Rosanna; Duga, Stefano; Musunuru, Kiran; Daly, Mark J; Purcell, Shaun; Braund, Peter S; Wright, Benjamin J; Balmforth, Anthony J; Ball, Stephen G; Ouwehand, Willem H; Deloukas, Panos; Scholz, Michael; Cambien, Francois; Huge, Andreas; Scheffold, Thomas; Salomaa, Veikko; Girelli, Domenico; Granger, Christopher B.; Peltonen, Leena; McKeown, Pascal P; Altshuler, David; Melander, Olle; Devaney, Joseph M; Epstein, Stephen E; Rader, Daniel J; Elosua, Roberto; Engert, James C; Anand, Sonia S; Hall, Alistair S; Ziegler, Andreas; O’Donnell, Christopher J; Spertus, John A; Siscovick, David; Schwartz, Stephen M; Becker, Diane; Thorsteinsdottir, Unnur; Stefansson, Kari; Schunkert, Heribert; Samani, Nilesh J; Quertermous, Thomas

    2011-01-01

    Objectives We sought to replicate the association between the kinesin-like protein 6 (KIF6) Trp719Arg polymorphism (rs20455) and clinical coronary artery disease (CAD). Background Recent prospective studies suggest that carriers of the 719Arg allele in KIF6 are at increased risk of clinical CAD compared with non-carriers. Methods The KIF6 Trp719Arg polymorphism (rs20455) was genotyped in nineteen case-control studies of non-fatal CAD either as part of a genome-wide association study or in a formal attempt to replicate the initial positive reports. Results Over 17 000 cases and 39 000 controls of European descent as well as a modest number of South Asians, African Americans, Hispanics, East Asians, and admixed cases and controls were successfully genotyped. None of the nineteen studies demonstrated an increased risk of CAD in carriers of the 719Arg allele compared with non-carriers. Regression analyses and fixed effect meta-analyses ruled out with high degree of confidence an increase of ≥2% in the risk of CAD among European 719Arg carriers. We also observed no increase in the risk of CAD among 719Arg carriers in the subset of Europeans with early onset disease (<50 years of age for males and <60 years for females) compared with similarly aged controls as well as all non-European subgroups. Conclusions The KIF6 Trp719Arg polymorphism was not associated with the risk of clinical CAD in this large replication study. PMID:20933357

  3. Kinetic network study of the diversity and temperature dependence of Trp-Cage folding pathways: combining transition path theory with stochastic simulations.

    PubMed

    Zheng, Weihua; Gallicchio, Emilio; Deng, Nanjie; Andrec, Michael; Levy, Ronald M

    2011-02-17

    We present a new approach to study a multitude of folding pathways and different folding mechanisms for the 20-residue mini-protein Trp-Cage using the combined power of replica exchange molecular dynamics (REMD) simulations for conformational sampling, transition path theory (TPT) for constructing folding pathways, and stochastic simulations for sampling the pathways in a high dimensional structure space. REMD simulations of Trp-Cage with 16 replicas at temperatures between 270 and 566 K are carried out with an all-atom force field (OPLSAA) and an implicit solvent model (AGBNP). The conformations sampled from all temperatures are collected. They form a discretized state space that can be used to model the folding process. The equilibrium population for each state at a target temperature can be calculated using the weighted-histogram-analysis method (WHAM). By connecting states with similar structures and creating edges satisfying detailed balance conditions, we construct a kinetic network that preserves the equilibrium population distribution of the state space. After defining the folded and unfolded macrostates, committor probabilities (P(fold)) are calculated by solving a set of linear equations for each node in the network and pathways are extracted together with their fluxes using the TPT algorithm. By clustering the pathways into folding "tubes", a more physically meaningful picture of the diversity of folding routes emerges. Stochastic simulations are carried out on the network, and a procedure is developed to project sampled trajectories onto the folding tubes. The fluxes through the folding tubes calculated from the stochastic trajectories are in good agreement with the corresponding values obtained from the TPT analysis. The temperature dependence of the ensemble of Trp-Cage folding pathways is investigated. Above the folding temperature, a large number of diverse folding pathways with comparable fluxes flood the energy landscape. At low temperature

  4. The cell wall and cell division gene cluster in the Mra operon of Pseudomonas aeruginosa: cloning, production, and purification of active enzymes.

    PubMed

    Azzolina, B A; Yuan, X; Anderson, M S; El-Sherbeini, M

    2001-04-01

    We have cloned the Pseudomonas aeruginosa cell wall biosynthesis and cell division gene cluster that corresponds to the mra operon in the 2-min region of the Escherichia coli chromosome. The organization of the two chromosomal regions in P. aeruginosa and E. coli is remarkably similar with the following gene order: pbp3/pbpB, murE, murF, mraY, murD, ftsW, murG, murC, ddlB, ftsQ, ftsA, ftsZ, and envA/LpxC. All of the above P. aeruginosa genes are transcribed from the same strand of DNA with very small, if any, intragenic regions, indicating that these genes may constitute a single operon. All five amino acid ligases, MurC, MurD, MurE, MurF, and DdlB, in addition to MurG and MraY were cloned in expression vectors. The four recombinant P. aeruginosa Mur ligases, MurC, MurD, MurE, and MurF were overproduced in E. coli and purified as active enzymes. Copyright 2001 Academic Press.

  5. The Dickeya dadantii biofilm matrix consists of cellulose nanofibres, and is an emergent property dependent upon the type III secretion system and the cellulose synthesis operon.

    PubMed

    Jahn, Courtney E; Selimi, Dija A; Barak, Jeri D; Charkowski, Amy O

    2011-10-01

    Dickeya dadantii is a plant-pathogenic bacterium that produces cellulose-containing biofilms, called pellicles, at the air-liquid interface of liquid cultures. D. dadantii pellicle formation appears to be an emergent property dependent upon at least three gene clusters, including cellulose synthesis, type III secretion system (T3SS) and flagellar genes. The D. dadantii cellulose synthesis operon is homologous to that of Gluconacetobacter xylinus, which is used for industrial cellulose production, and the cellulose nanofibres produced by D. dadantii were similar in diameter and branching pattern to those produced by G. xylinus. Salmonella enterica, an enterobacterium closely related to D. dadantii, encodes a second type of cellulose synthesis operon, and it produced biofilm strands that differed in width and branching pattern from those of D. dadantii and G. xylinus. Unlike any previously described cellulose fibre, the D. dadantii cellulose nanofibres were decorated with bead-like structures. Mutation of the cellulose synthesis operon genes resulted in loss of cellulose synthesis and production of a cellulase-resistant biofilm. Mutation of other genes required for pellicle formation, including those encoding FliA (a sigma factor that regulates flagella production), HrpL (a sigma factor that regulates the T3SS), and AdrA, a GGDEF protein, affected both biofilm and cell morphology. Mutation of the cellulose synthase bcsA or of bcsC resulted in decreased accumulation of the T3SS-secreted protein HrpN.

  6. Cytotoxic chromosomal targeting by CRISPR/Cas systems can reshape bacterial genomes and expel or remodel pathogenicity islands.

    PubMed

    Vercoe, Reuben B; Chang, James T; Dy, Ron L; Taylor, Corinda; Gristwood, Tamzin; Clulow, James S; Richter, Corinna; Przybilski, Rita; Pitman, Andrew R; Fineran, Peter C

    2013-04-01

    In prokaryotes, clustered regularly interspaced short palindromic repeats (CRISPRs) and their associated (Cas) proteins constitute a defence system against bacteriophages and plasmids. CRISPR/Cas systems acquire short spacer sequences from foreign genetic elements and incorporate these into their CRISPR arrays, generating a memory of past invaders. Defence is provided by short non-coding RNAs that guide Cas proteins to cleave complementary nucleic acids. While most spacers are acquired from phages and plasmids, there are examples of spacers that match genes elsewhere in the host bacterial chromosome. In Pectobacterium atrosepticum the type I-F CRISPR/Cas system has acquired a self-complementary spacer that perfectly matches a protospacer target in a horizontally acquired island (HAI2) involved in plant pathogenicity. Given the paucity of experimental data about CRISPR/Cas-mediated chromosomal targeting, we examined this process by developing a tightly controlled system. Chromosomal targeting was highly toxic via targeting of DNA and resulted in growth inhibition and cellular filamentation. The toxic phenotype was avoided by mutations in the cas operon, the CRISPR repeats, the protospacer target, and protospacer-adjacent motif (PAM) beside the target. Indeed, the natural self-targeting spacer was non-toxic due to a single nucleotide mutation adjacent to the target in the PAM sequence. Furthermore, we show that chromosomal targeting can result in large-scale genomic alterations, including the remodelling or deletion of entire pre-existing pathogenicity islands. These features can be engineered for the targeted deletion of large regions of bacterial chromosomes. In conclusion, in DNA-targeting CRISPR/Cas systems, chromosomal interference is deleterious by causing DNA damage and providing a strong selective pressure for genome alterations, which may have consequences for bacterial evolution and pathogenicity.

  7. A taxonomy of bacterial microcompartment loci constructed by a novel scoring method

    DOE PAGES

    Axen, Seth D.; Erbilgin, Onur; Kerfeld, Cheryl A.; ...

    2014-10-23

    Bacterial microcompartments (BMCs) are proteinaceous organelles involved in both autotrophic and heterotrophic metabolism. All BMCs share homologous shell proteins but differ in their complement of enzymes; these are typically encoded adjacent to shell protein genes in genetic loci, or operons. To enable the identification and prediction of functional (sub)types of BMCs, we developed LoClass, an algorithm that finds putative BMC loci and inventories, weights, and compares their constituent pfam domains to construct a locus similarity network and predict locus (sub)types. In addition to using LoClass to analyze sequences in the Non-redundant Protein Database, we compared predicted BMC loci found inmore » seven candidate bacterial phyla (six from single-cell genomic studies) to the LoClass taxonomy. Together, these analyses resulted in the identification of 23 different types of BMCs encoded in 30 distinct locus (sub)types found in 23 bacterial phyla. These include the two carboxysome types and a divergent set of metabolosomes, BMCs that share a common catalytic core and process distinct substrates via specific signature enzymes. Furthermore, many Candidate BMCs were found that lack one or more core metabolosome components, including one that is predicted to represent an entirely new paradigm for BMC-associated metabolism, joining the carboxysome and metabolosome. By placing these results in a phylogenetic context, we provide a framework for understanding the horizontal transfer of these loci, a starting point for studies aimed at understanding the evolution of BMCs. This comprehensive taxonomy of BMC loci, based on their constituent protein domains, foregrounds the functional diversity of BMCs and provides a reference for interpreting the role of BMC gene clusters encoded in isolate, single cell, and metagenomic data. Many loci encode ancillary functions such as transporters or genes for cofactor assembly; this expanded vocabulary of BMC-related functions should

  8. A Taxonomy of Bacterial Microcompartment Loci Constructed by a Novel Scoring Method

    PubMed Central

    Kerfeld, Cheryl A.

    2014-01-01

    Bacterial microcompartments (BMCs) are proteinaceous organelles involved in both autotrophic and heterotrophic metabolism. All BMCs share homologous shell proteins but differ in their complement of enzymes; these are typically encoded adjacent to shell protein genes in genetic loci, or operons. To enable the identification and prediction of functional (sub)types of BMCs, we developed LoClass, an algorithm that finds putative BMC loci and inventories, weights, and compares their constituent pfam domains to construct a locus similarity network and predict locus (sub)types. In addition to using LoClass to analyze sequences in the Non-redundant Protein Database, we compared predicted BMC loci found in seven candidate bacterial phyla (six from single-cell genomic studies) to the LoClass taxonomy. Together, these analyses resulted in the identification of 23 different types of BMCs encoded in 30 distinct locus (sub)types found in 23 bacterial phyla. These include the two carboxysome types and a divergent set of metabolosomes, BMCs that share a common catalytic core and process distinct substrates via specific signature enzymes. Furthermore, many Candidate BMCs were found that lack one or more core metabolosome components, including one that is predicted to represent an entirely new paradigm for BMC-associated metabolism, joining the carboxysome and metabolosome. By placing these results in a phylogenetic context, we provide a framework for understanding the horizontal transfer of these loci, a starting point for studies aimed at understanding the evolution of BMCs. This comprehensive taxonomy of BMC loci, based on their constituent protein domains, foregrounds the functional diversity of BMCs and provides a reference for interpreting the role of BMC gene clusters encoded in isolate, single cell, and metagenomic data. Many loci encode ancillary functions such as transporters or genes for cofactor assembly; this expanded vocabulary of BMC-related functions should be useful

  9. Evolutionary analysis and lateral gene transfer of two-component regulatory systems associated with heavy-metal tolerance in bacteria.

    PubMed

    Bouzat, Juan L; Hoostal, Matthew J

    2013-05-01

    Microorganisms have adapted intricate signal transduction mechanisms to coordinate tolerance to toxic levels of metals, including two-component regulatory systems (TCRS). In particular, both cop and czc operons are regulated by TCRS; the cop operon plays a key role in bacterial tolerance to copper, whereas the czc operon is involved in the efflux of cadmium, zinc, and cobalt from the cell. Although the molecular physiology of heavy metal tolerance genes has been extensively studied, their evolutionary relationships are not well-understood. Phylogenetic relationships among heavy-metal efflux proteins and their corresponding two-component regulatory proteins revealed orthologous and paralogous relationships from species divergences and ancient gene duplications. The presence of heavy metal tolerance genes on bacterial plasmids suggests these genes may be prone to spread through horizontal gene transfer. Phylogenetic inferences revealed nine potential examples of lateral gene transfer associated with metal efflux proteins and two examples for regulatory proteins. Notably, four of the examples suggest lateral transfer across major evolutionary domains. In most cases, differences in GC content in metal tolerance genes and their corresponding host genomes confirmed lateral gene transfer events. Three-dimensional protein structures predicted for the response regulators encoded by cop and czc operons showed a high degree of structural similarity with other known proteins involved in TCRS signal transduction, which suggests common evolutionary origins of functional phenotypes and similar mechanisms of action for these response regulators.

  10. Effects of guanosine tetraphosphate on cell-free synthesis of Escherichia coli ribosomal RNA and other gene products.

    PubMed Central

    Reiness, G; Yang, H L; Zubay, G; Cashel, M

    1975-01-01

    A cell-free system derived from E. coli is described in which mature-sized 16S and 23S ribosomal RNAs (rRNA) are synthesized at a high relative rate, comprising 17-25% of the total transcription. The addition of guanosine tetraphosphate (ppGpp) to this system results in up to a 5-fold selective inhibition of rRNA accumulation. This effect is exerted at the level of synthesis rather than degradation. It is concluded that ppGpp, which is produced in large amounts by E. coli during amino-acid deprivation, could mediate the decrease in rRNA synthesis that accompanies such deprivation. The expression of other genes has also been investigated. No selective reduction of transfer RNA synthesis by ppGpp is observed. The trp and lac operons are found to be stimulated at the transcriptional level by the presence of this nucleotide. It is hypothesized that ppGpp interacts with the RNA polymerase in such a manner as to alter the affinity of the enzyme for promoters in an operon-specific fashion. PMID:1103124

  11. Molecular dynamics studies of a DNA-binding protein: 2. An evaluation of implicit and explicit solvent models for the molecular dynamics simulation of the Escherichia coli trp repressor.

    PubMed Central

    Guenot, J.; Kollman, P. A.

    1992-01-01

    Although aqueous simulations with periodic boundary conditions more accurately describe protein dynamics than in vacuo simulations, these are computationally intensive for most proteins. Trp repressor dynamic simulations with a small water shell surrounding the starting model yield protein trajectories that are markedly improved over gas phase, yet computationally efficient. Explicit water in molecular dynamics simulations maintains surface exposure of protein hydrophilic atoms and burial of hydrophobic atoms by opposing the otherwise asymmetric protein-protein forces. This properly orients protein surface side chains, reduces protein fluctuations, and lowers the overall root mean square deviation from the crystal structure. For simulations with crystallographic waters only, a linear or sigmoidal distance-dependent dielectric yields a much better trajectory than does a constant dielectric model. As more water is added to the starting model, the differences between using distance-dependent and constant dielectric models becomes smaller, although the linear distance-dependent dielectric yields an average structure closer to the crystal structure than does a constant dielectric model. Multiplicative constants greater than one, for the linear distance-dependent dielectric simulations, produced trajectories that are progressively worse in describing trp repressor dynamics. Simulations of bovine pancreatic trypsin were used to ensure that the trp repressor results were not protein dependent and to explore the effect of the nonbonded cutoff on the distance-dependent and constant dielectric simulation models. The nonbonded cutoff markedly affected the constant but not distance-dependent dielectric bovine pancreatic trypsin inhibitor simulations. As with trp repressor, the distance-dependent dielectric model with a shell of water surrounding the protein produced a trajectory in better agreement with the crystal structure than a constant dielectric model, and the physical

  12. In vivo bacterial imaging without engineering; A novel probe-based strategy facilitated by endogenous nitroreductase enzymes.

    PubMed

    Stanton, Michael; Cronin, Michelle; Lehouritis, Panos; Tangney, Mark

    2015-01-01

    The feasibility of utilising bacteria as vectors for gene therapy is becoming increasingly recognised. This is primarily due to a number of intrinsic properties of bacteria such as their tumour targeting capabilities, their ability to carry large genetic or protein loads and the availability of well-established genetic engineering tools for a range of common lab strains. However, a number of issues relating to the use of bacteria as vectors for gene therapy need to be addressed in order for the field to progress. Amongst these is the need for the development of non-invasive detection/imaging systems for bacteria within a living host. In vivo optical imaging has advanced preclinical research greatly, and typically involves engineering of bacteria with genetic expression constructs for luminescence (e.g. the lux operon) or fluorescent proteins (GFP etc.). This requirement for genetic modification can be restrictive, where engineering is not experimentally appropriate or technologically feasible (e.g. due to lack of suitable engineering tools). We describe a novel strategy exploiting endogenous bacterial enzymatic activity to specifically activate an exogenously administered fluorescent imaging probe. The red shifted, quenched fluorophore CytoCy5S is reduced to a fluorescent form by bacterial-specific nitroreductase (NTR) enzymes. NTR enzymes are present in a wide range of bacterial genera and absent in mammalian systems, permitting highly specific detection of Gram-negative and Gram-positive bacteria in vivo. In this study, dose-responsive bacterial-specific signals were observed in vitro from all genera examined - E. coli, Salmonella, Listeria, Bifidobacterium and Clostridium difficile. Examination of an NTR-knockout strain validated the enzyme specificity of the probe. In vivo whole-body imaging permitted specific, dose-responsive monitoring of bacteria over time in various infection models, and no toxicity to bacteria or host was observed. This study demonstrates

  13. Harnessing the Flow of Excitation: TRP, Voltage-Gated Na(+), and Voltage-Gated Ca(2+) Channels in Contemporary Medicine.

    PubMed

    Frolov, Roman V; Weckström, Matti

    2016-01-01

    Cellular signaling in both excitable and nonexcitable cells involves several classes of ion channels. Some of them are of minor importance, with very specialized roles in physiology, but here we concentrate on three major channel classes: TRP (transient receptor potential channels), voltage-gated sodium channels (Nav), and voltage-gated calcium channels (Cav). Here, we first propose a conceptual framework binding together all three classes of ion channels, a "flow-of-excitation model" that takes into account the inputs mediated by TRP and other similar channels, the outputs invariably provided by Cav channels, and the regenerative transmission of signals in the neural networks, for which Nav channels are responsible. We use this framework to examine the function, structure, and pharmacology of these channel classes both at cellular and also at whole-body physiological level. Building on that basis we go through the pathologies arising from the direct or indirect malfunction of the channels, utilizing ion channel defects, the channelopathies. The pharmacological interventions affecting these channels are numerous. Part of those are well-established treatments, like treatment of hypertension or some forms of epilepsy, but many other are deeply problematic due to poor drug specificity, ion channel diversity, and widespread expression of the channels in tissues other than those actually targeted. © 2016 Elsevier Inc. All rights reserved.

  14. The atlA operon of Streptococcus mutans: role in autolysin maturation and cell surface biogenesis.

    PubMed

    Ahn, Sang-Joon; Burne, Robert A

    2006-10-01

    The Smu0630 protein (AtlA) was recently shown to be involved in cell separation, biofilm formation, and autolysis. Here, transcriptional studies revealed that atlA is part of a multigene operon under the control of at least three promoters. The morphology and biofilm-forming capacity of a nonpolar altA mutant could be restored to that of the wild-type strain by adding purified AtlA protein to the medium. A series of truncated derivatives of AtlA revealed that full activity required the C terminus and repeat regions. AtlA was cell associated and readily extractable from with sodium dodecyl sulfate. Of particular interest, the surface protein profile of AtlA-deficient strains was dramatically altered compared to the wild-type strain, as was the nature of the association of the multifunctional adhesin P1 with the cell wall. In addition, AtlA-deficient strains failed to develop competence as effectively as the parental strain. Mutation of thmA, which can be cotranscribed with atlA and encodes a putative pore-forming protein, resulted in a phenotype very similar to that of the AtlA-deficient strain. ThmA was also shown to be required for efficient processing of AtlA to its mature form, and treatment of the thmA mutant strain with full-length AtlA protein did not restore normal cell separation and biofilm formation. The effects of mutating other genes in the operon on cell division, biofilm formation, or AtlA biogenesis were not as profound. This study reveals that AtlA is a surface-associated protein that plays a critical role in the network connecting cell surface biogenesis, biofilm formation, genetic competence, and autolysis.

  15. Mutagens in cooked foods - metabolism and genetic toxicity

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Felton, J.S.; Bjeldanes, L.F.; Hatch, F.T.

    1984-02-17

    Recently developed in our laboratories is an efficient extraction procedure incorporating XAD resin adsorption which yields from 200/sup 0/C grilled ground beef an extract containing 230 Salmonella TA1538 revertants per g fresh weight of original ground beef. These mutagenic components are specific for frameshift-sensitive Salmonella strains and have an absolute requirement for metabolic activation. Normal-phase HPLC separation of methanol-extractable metabolites generated from reaction of 2-amino-3-methylimidazo (4,5-f)quinoline (IQ), a mutagenic component of broiled food with rat liver microsomes resulted in one direct-acting mutagenic peak and a second more polar peak still requiring metabolic activation. Two potent thermally-produced bacterial mutagens, 3-amino-1-methyl-5H-pyrido (4,3-b)more » indole (Trp-P-2) and IQ, were examined in mammalian cells. In excision repair-deficient CHO cells, Trp-P-2 exposure caused cytotoxicity, mutagenicity, sister chromatid exchange, and chromosomal aberrations at concentrations more than 30-fold lower than those for IQ. In normal repair-proficient CHO cells Trp-P-2 was one-half as active and IQ was inactive. Relative to Trp-P-2, IQ is much more potent in the Salmonella bacterial system than in mammalian CHO cells.« less

  16. A mutant crp allele that differentially activates the operons of the fuc regulon in Escherichia coli.

    PubMed

    Zhu, Y; Lin, E C

    1988-05-01

    L-Fucose is used by Escherichia coli through an inducible pathway mediated by a fucP-encoded permease, a fucI-encoded isomerase, a fucK-encoded kinase, and a fucA-encoded aldolase. The adolase catalyzes the formation of dihydroxyacetone phosphate and L-lactaldehyde. Anaerobically, lactaldehyde is converted by a fucO-encoded oxidoreductase to L-1,2-propanediol, which is excreted. The fuc genes belong to a regulon comprising four linked operons: fucO, fucA, fucPIK, and fucR. The positive regulator encoded by fucR responds to fuculose 1-phosphate as the effector. Mutants serially selected for aerobic growth on propanediol became constitutive in fucO and fucA [fucO(Con) fucA(Con)], but noninducible in fucPIK [fucPIK(Non)]. An external suppressor mutation that restored growth on fucose caused constitutive expression of fucPIK. Results from this study indicate that this suppressor mutation occurred in crp, which encodes the cyclic AMP-binding (or receptor) protein. When the suppressor allele (crp-201) was transduced into wild-type strains, the recipient became fucose negative and fucose sensitive (with glycerol as the carbon and energy source) because of impaired expression of fucA. The fucPIK operon became hyperinducible. The growth rate on maltose was significantly reduced, but growth on L-rhamnose, D-galactose, L-arabinose, glycerol, or glycerol 3-phosphate was close to normal. Lysogenization of fuc+ crp-201 cells by a lambda bacteriophage bearing crp+ restored normal growth ability on fucose. In contrast, lysogenization of [fucO(Con)fucA(Con)fucPIK(Non)crp-201] cells by the same phage retarded their growth on fucose.

  17. A mutant crp allele that differentially activates the operons of the fuc regulon in Escherichia coli.

    PubMed Central

    Zhu, Y; Lin, E C

    1988-01-01

    L-Fucose is used by Escherichia coli through an inducible pathway mediated by a fucP-encoded permease, a fucI-encoded isomerase, a fucK-encoded kinase, and a fucA-encoded aldolase. The adolase catalyzes the formation of dihydroxyacetone phosphate and L-lactaldehyde. Anaerobically, lactaldehyde is converted by a fucO-encoded oxidoreductase to L-1,2-propanediol, which is excreted. The fuc genes belong to a regulon comprising four linked operons: fucO, fucA, fucPIK, and fucR. The positive regulator encoded by fucR responds to fuculose 1-phosphate as the effector. Mutants serially selected for aerobic growth on propanediol became constitutive in fucO and fucA [fucO(Con) fucA(Con)], but noninducible in fucPIK [fucPIK(Non)]. An external suppressor mutation that restored growth on fucose caused constitutive expression of fucPIK. Results from this study indicate that this suppressor mutation occurred in crp, which encodes the cyclic AMP-binding (or receptor) protein. When the suppressor allele (crp-201) was transduced into wild-type strains, the recipient became fucose negative and fucose sensitive (with glycerol as the carbon and energy source) because of impaired expression of fucA. The fucPIK operon became hyperinducible. The growth rate on maltose was significantly reduced, but growth on L-rhamnose, D-galactose, L-arabinose, glycerol, or glycerol 3-phosphate was close to normal. Lysogenization of fuc+ crp-201 cells by a lambda bacteriophage bearing crp+ restored normal growth ability on fucose. In contrast, lysogenization of [fucO(Con)fucA(Con)fucPIK(Non)crp-201] cells by the same phage retarded their growth on fucose. PMID:2834341

  18. Coordinated Regulation of the EIIMan and fruRKI Operons of Streptococcus mutans by Global and Fructose-Specific Pathways.

    PubMed

    Zeng, Lin; Chakraborty, Brinta; Farivar, Tanaz; Burne, Robert A

    2017-11-01

    The glucose/mannose-phosphotransferase system (PTS) permease EII Man encoded by manLMN in the dental caries pathogen Streptococcus mutans has a dominant influence on sugar-specific, CcpA-independent catabolite repression (CR). Mutations in manL affect energy metabolism and virulence-associated traits, including biofilm formation, acid tolerance, and competence. Using promoter::reporter fusions, expression of the manLMN and the fruRKI operons, encoding a transcriptional regulator, a fructose-1-phosphate kinase and a fructose-PTS permease EII Fru , respectively, was monitored in response to carbohydrate source and in mutants lacking CcpA, FruR, and components of EII Man Expression of genes for EII Man and EII Fru was directly regulated by CcpA and CR, as evinced by in vivo and in vitro methods. Unexpectedly, not only was the fruRKI operon negatively regulated by FruR, but also so was manLMN Carbohydrate transport by EII Man had a negative influence on expression of manLMN but not fruRKI In agreement with the proposed role of FruR in regulating these PTS operons, loss of fruR or fruK substantially altered growth on a number of carbohydrates, including fructose. RNA deep sequencing revealed profound changes in gene regulation caused by deletion of fruK or fruR Collectively, these findings demonstrate intimate interconnection of the regulation of two major PTS permeases in S. mutans and reveal novel and important contributions of fructose metabolism to global regulation of gene expression. IMPORTANCE The ability of Streptococcus mutans and other streptococcal pathogens to survive and cause human diseases is directly dependent upon their capacity to metabolize a variety of carbohydrates, including glucose and fructose. Our research reveals that metabolism of fructose has broad influences on the regulation of utilization of glucose and other sugars, and mutants with changes in certain genes involved in fructose metabolism display profoundly different abilities to grow and

  19. Coordinated Regulation of the EIIMan and fruRKI Operons of Streptococcus mutans by Global and Fructose-Specific Pathways

    PubMed Central

    Zeng, Lin; Chakraborty, Brinta; Farivar, Tanaz

    2017-01-01

    ABSTRACT The glucose/mannose-phosphotransferase system (PTS) permease EIIMan encoded by manLMN in the dental caries pathogen Streptococcus mutans has a dominant influence on sugar-specific, CcpA-independent catabolite repression (CR). Mutations in manL affect energy metabolism and virulence-associated traits, including biofilm formation, acid tolerance, and competence. Using promoter::reporter fusions, expression of the manLMN and the fruRKI operons, encoding a transcriptional regulator, a fructose-1-phosphate kinase and a fructose-PTS permease EIIFru, respectively, was monitored in response to carbohydrate source and in mutants lacking CcpA, FruR, and components of EIIMan. Expression of genes for EIIMan and EIIFru was directly regulated by CcpA and CR, as evinced by in vivo and in vitro methods. Unexpectedly, not only was the fruRKI operon negatively regulated by FruR, but also so was manLMN. Carbohydrate transport by EIIMan had a negative influence on expression of manLMN but not fruRKI. In agreement with the proposed role of FruR in regulating these PTS operons, loss of fruR or fruK substantially altered growth on a number of carbohydrates, including fructose. RNA deep sequencing revealed profound changes in gene regulation caused by deletion of fruK or fruR. Collectively, these findings demonstrate intimate interconnection of the regulation of two major PTS permeases in S. mutans and reveal novel and important contributions of fructose metabolism to global regulation of gene expression. IMPORTANCE The ability of Streptococcus mutans and other streptococcal pathogens to survive and cause human diseases is directly dependent upon their capacity to metabolize a variety of carbohydrates, including glucose and fructose. Our research reveals that metabolism of fructose has broad influences on the regulation of utilization of glucose and other sugars, and mutants with changes in certain genes involved in fructose metabolism display profoundly different abilities to

  20. Effects of anti-cancer drug doxorubicin on endogenous biomarkers NAD(P)H, FAD and Trp in prostate cancer cells: a FLIM Study

    NASA Astrophysics Data System (ADS)

    Rehman Alam, Shagufta; Wallrabe, Horst; Svindrych, Zdenek; Christopher, Kathryn G.; Chandra, Dhyan; Periasamy, Ammasi

    2017-02-01

    Fluorescence Lifetime Imaging Microscopy (FLIM) can be used to identify changes in metabolic activity during cancer progression and upon anti-cancer drug treatment. Prostate cancer (PCa) is one of the leading cancers in men in the USA. This research focusses on understanding the lifetime changes of endogenous biomarkers: NAD(P)H, FAD and Trp in LNCaP cells upon treatment with doxorubicin using our 3-channel FLIM approach. The LNCaP cells were treated with doxorubicin for 24hr. Images using FLIM of LNCaP control and treated cells were acquired on Zeiss 780 multiphoton confocal microscope coupled with B and H TCSPC FLIM board. After FLIM data fitting and processing we observed increase in the mean fluorescence lifetime of Trp, NAD(P)H and FAD with doxorubicin treatment. Additionally, we saw reduction in the NAD(P)H/FAD redox ratio with doxorubicin treatment. Our results identify the changes in the lifetime of these endogenous biomarkers and in the cellular redox state as a metabolic response with doxorubicin treatment in prostate cancer cells.

  1. Rough energy landscapes in protein folding: dimeric E. coli Trp repressor folds through three parallel channels.

    PubMed

    Gloss, L M; Simler, B R; Matthews, C R

    2001-10-05

    The folding mechanism of the dimeric Escherichia coli Trp repressor (TR) is a kinetically complex process that involves three distinguishable stages of development. Following the formation of a partially folded, monomeric ensemble of species, within 5 ms, folding to the native dimer is controlled by three kinetic phases. The rate-limiting step in each phase is either a non-proline isomerization reaction or a dimerization reaction, depending on the final denaturant concentration. Two approaches have been employed to test the previously proposed folding mechanism of TR through three parallel channels: (1) unfolding double-jump experiments demonstrate that all three folding channels lead directly to native dimer; and (2) the differential stabilization of the transition state for the final step in folding and the native dimer, by the addition of salt, shows that all three channels involve isomerization of a dimeric species. A refined model for the folding of Trp repressor is presented, in which all three channels involve a rapid dimerization reaction between partially folded monomers followed by the isomerization of the dimeric intermediates to yield native dimer. The ensemble of partially folded monomers can be captured at equilibrium by low pH; one-dimensional proton NMR spectra at pH 2.5 demonstrate that monomers exist in two distinct, slowly interconverting conformations. These data provide a potential structural explanation for the three-channel folding mechanism of TR: random association of two different monomeric forms, which are distinguished by alternative packing modes of the core dimerization domain and the DNA-binding, helix-turn-helix, domain. One, perhaps both, of these packing modes contains non-native contacts. Copyright 2001 Academic Press.

  2. Structure and Dynamics of End-to-End Loop Formation of the Penta-Peptide Cys-Ala-Gly-Gln-Trp in Implicit Solvents

    DTIC Science & Technology

    2009-01-01

    implicit solvents on peptide structure and dynamics , we performed extensive molecular dynamics simulations on the penta-peptide Cys-Ala-Gly-Gln-Trp. Two...end-to-end distances and dihedral angles obtained from molecular dynamics simulations with implicit solvent models were in a good agreement with those...to maintain the temperature of the systems. Introduction Molecular dynamics (MD) simulation techniques are widely used to study structure and

  3. Fastidian gum: the Xylella fastidiosa exopolysaccharide possibly involved in bacterial pathogenicity.

    PubMed

    da Silva, F R; Vettore, A L; Kemper, E L; Leite, A; Arruda, P

    2001-09-25

    The Gram-negative bacterium Xylella fastidiosa was the first plant pathogen to be completely sequenced. This species causes several economically important plant diseases, including citrus variegated chlorosis (CVC). Analysis of the genomic sequence of X. fastidiosa revealed a 12 kb DNA fragment containing an operon closely related to the gum operon of Xanthomonas campestris. The presence of all genes involved in the synthesis of sugar precursors, existence of exopolysaccharide (EPS) production regulators in the genome, and the absence of three of the X. campestris gum genes suggested that X. fastidiosa is able to synthesize an EPS different from that of xanthan gum. This novel EPS probably consists of polymerized tetrasaccharide repeating units assembled by the sequential addition of glucose-1-phosphate, glucose, mannose and glucuronic acid on a polyprenol phosphate carrier.

  4. Ac-Trp-DPhe(p-I)-Arg-Trp-NH2, a 250-Fold Selective Melanocortin-4 Receptor (MC4R) Antagonist over the Melanocortin-3 Receptor (MC3R), Affects Energy Homeostasis in Male and Female Mice Differently.

    PubMed

    Lensing, Cody J; Adank, Danielle N; Doering, Skye R; Wilber, Stacey L; Andreasen, Amy; Schaub, Jay W; Xiang, Zhimin; Haskell-Luevano, Carrie

    2016-09-21

    The melanocortin-4 receptor (MC4R) has been indicated as a therapeutic target for metabolic disorders such as anorexia, cachexia, and obesity. The current study investigates the in vivo effects on energy homeostasis of a 15 nM MC4R antagonist SKY2-23-7, Ac-Trp-DPhe(p-I)-Arg-Trp-NH2, that is a 3700 nM melanocortin-3 receptor (MC3R) antagonist with minimal MC3R and MC4R agonist activity. When monitoring both male and female mice in TSE metabolic cages, sex-specific responses were observed in food intake, respiratory exchange ratio (RER), and energy expenditure. A 7.5 nmol dose of SKY2-23-7 increased food intake, increased RER, and trended toward decreasing energy expenditure in male mice. However, this compound had minimal effect on female mice's food intake and RER at the 7.5 nmol dose. A 2.5 nmol dose of SKY2-23-7 significantly increased female food intake, RER, and energy expenditure while having a minimal effect on male mice at this dose. The observed sex differences of SKY2-23-7 administration result in the discovery of a novel chemical probe for elucidating the molecular mechanisms of the sexual dimorphism present within the melanocortin pathway. To further explore the melanocortin sexual dimorphism, hypothalamic gene expression was examined. The mRNA expression of the MC3R and proopiomelanocortin (POMC) were not significantly different between sexes. However, the expression of agouti-related peptide (AGRP) was significantly higher in female mice which may be a possible mechanism for the sex-specific effects observed with SKY2-23-7.

  5. Kinetic Network Study of the Diversity and Temperature Dependence of Trp-Cage Folding Pathways: Combining Transition Path Theory with Stochastic Simulations

    PubMed Central

    Zheng, Weihua; Gallicchio, Emilio; Deng, Nanjie; Andrec, Michael; Levy, Ronald M.

    2011-01-01

    We present a new approach to study a multitude of folding pathways and different folding mechanisms for the 20-residue mini-protein Trp-Cage using the combined power of replica exchange molecular dynamics (REMD) simulations for conformational sampling, Transition Path Theory (TPT) for constructing folding pathways and stochastic simulations for sampling the pathways in a high dimensional structure space. REMD simulations of Trp-Cage with 16 replicas at temperatures between 270K and 566K are carried out with an all-atom force field (OPLSAA) and an implicit solvent model (AGBNP). The conformations sampled from all temperatures are collected. They form a discretized state space that can be used to model the folding process. The equilibrium population for each state at a target temperature can be calculated using the Weighted-Histogram-Analysis Method (WHAM). By connecting states with similar structures and creating edges satisfying detailed balance conditions, we construct a kinetic network that preserves the equilibrium population distribution of the state space. After defining the folded and unfolded macrostates, committor probabilities (Pfold) are calculated by solving a set of linear equations for each node in the network and pathways are extracted together with their fluxes using the TPT algorithm. By clustering the pathways into folding “tubes”, a more physically meaningful picture of the diversity of folding routes emerges. Stochastic simulations are carried out on the network and a procedure is developed to project sampled trajectories onto the folding tubes. The fluxes through the folding tubes calculated from the stochastic trajectories are in good agreement with the corresponding values obtained from the TPT analysis. The temperature dependence of the ensemble of Trp-Cage folding pathways is investigated. Above the folding temperature, a large number of diverse folding pathways with comparable fluxes flood the energy landscape. At low temperature

  6. A new stable alpha chain variant: Hb Basel [alpha14(A12)Trp-->Leu (alpha1)].

    PubMed

    Hergersberg, Martin; Brunner-Agten, Saskia; Kühne, Thomas; Paulussen, Michael; Huber, Andreas R

    2010-06-01

    We describe a heterozygosity for a new missense mutation on the alpha1-globin gene of an 18-year-old woman of Portuguese ancestry with severe hypochromic anemia and iron deficiency. Hemoglobin (Hb) analysis by high performance liquid chromatography (HPLC) found a prominent peak constituting about 12% of total Hb. Sequencing of the globin genes of the index patient found the mutation alpha14(A12)Trp-->Leu (alpha1), HBA1:c.44G

  7. Mutation in and lack of expression of tyrosinase-related protein-1 (TRP-1) in melanocytes from an individual with brown oculocutaneous albinism: a new subtype of albinism classified as "OCA3".

    PubMed Central

    Boissy, R. E.; Zhao, H.; Oetting, W. S.; Austin, L. M.; Wildenberg, S. C.; Boissy, Y. L.; Zhao, Y.; Sturm, R. A.; Hearing, V. J.; King, R. A.; Nordlund, J. J.

    1996-01-01

    Most types of human oculocutaneous albinism (OCA) result from mutations in the gene for tyrosinase (OCA1) or the P protein (OCA2), although other types of OCA have been described but have not been mapped to specific loci. Melanocytes were cultured from an African-American with OCA, who exhibited the phenotype of Brown OCA, and his normal fraternal twin. Melanocytes cultured from the patient with OCA and the normal twin appeared brown versus black, respectively. Melanocytes from both the patient with OCA and the normal twin demonstrated equal amounts of NP-40-soluble melanin; however, melanocytes from the patient with OCA contained only 7% of the amount of insoluble melanin found from the normal twin. Tyrosinase- related protein-1 (TRP-1) was not detected in the OCA melanocytes by use of various anti-TRP-1 probes. Furthermore, transcripts for TRP-1 were absent in cultured OCA melanocytes. The affected twin was homozygous for a single-bp deletion in exon 6, removing an A in codon 368 and leading to a premature stop at codon 384. Tyrosine hydroxylase activity of the OCA melanocytes was comparable to controls when assayed in cell lysates but was only 30% of controls when assayed in intact cells. We conclude that this mutation of the human TRP-1 gene affects its interaction with tyrosinase, resulting in dysregulation of tyrosinase activity, promotes the synthesis of brown versus black melanin, and is responsible for a third genetic type of OCA in humans, which we classify as "OCA3." Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 PMID:8651291

  8. Evidence for the functional involvement of members of the TRP channel family in the uptake of Na(+) and NH4 (+) by the ruminal epithelium.

    PubMed

    Rosendahl, Julia; Braun, Hannah S; Schrapers, Katharina T; Martens, Holger; Stumpff, Friederike

    2016-08-01

    Large quantities of protein are degraded in the fermentative parts of the gut to ammonia, which is absorbed, detoxified to urea, and excreted, leading to formation of nitrogenous compounds such as N2O that are associated with global warming. In ruminants, channel-mediated uptake of NH4 (+) from the rumen predominates. The molecular identity of these channels remains to be clarified. Ruminal cells and epithelia from cows and sheep were investigated using patch clamp, Ussing chamber, microelectrode techniques, and qPCR. In patch clamp experiments, bovine ruminal epithelial cells expressed a conductance for NH4 (+) that could be blocked in a voltage-dependent manner by divalent cations. In the native epithelium, NH4 (+) depolarized the apical potential, acidified the cytosol and induced a rise in short-circuit current (I sc) that persisted after the removal of Na(+), was blocked by verapamil, enhanced by the removal of divalent cations, and was sensitive to certain transient receptor potential (TRP) channel modulators. Menthol or thymol stimulated the I sc in Na(+) or NH4 (+) containing solutions in a dose-dependent manner and modulated transepithelial Ca(2+) fluxes. On the level of messenger RNA (mRNA), ovine and bovine ruminal epithelium expressed TRPA1, TRPV3, TRPV4, TRPM6, and TRPM7, with any expression of TRPV6 marginal. No bands were detected for TRPV1, TRPV5, or TRPM8. Functional and molecular biological data suggest that the transport of NH4 (+), Na(+), and Ca(2+) across the rumen involves TRP channels, with TRPV3 and TRPA1 emerging as prime candidate genes. TRP channels may also contribute to the transport of NH4 (+) across other epithelia.

  9. SigmoID: a user-friendly tool for improving bacterial genome annotation through analysis of transcription control signals

    PubMed Central

    Damienikan, Aliaksandr U.

    2016-01-01

    The majority of bacterial genome annotations are currently automated and based on a ‘gene by gene’ approach. Regulatory signals and operon structures are rarely taken into account which often results in incomplete and even incorrect gene function assignments. Here we present SigmoID, a cross-platform (OS X, Linux and Windows) open-source application aiming at simplifying the identification of transcription regulatory sites (promoters, transcription factor binding sites and terminators) in bacterial genomes and providing assistance in correcting annotations in accordance with regulatory information. SigmoID combines a user-friendly graphical interface to well known command line tools with a genome browser for visualising regulatory elements in genomic context. Integrated access to online databases with regulatory information (RegPrecise and RegulonDB) and web-based search engines speeds up genome analysis and simplifies correction of genome annotation. We demonstrate some features of SigmoID by constructing a series of regulatory protein binding site profiles for two groups of bacteria: Soft Rot Enterobacteriaceae (Pectobacterium and Dickeya spp.) and Pseudomonas spp. Furthermore, we inferred over 900 transcription factor binding sites and alternative sigma factor promoters in the annotated genome of Pectobacterium atrosepticum. These regulatory signals control putative transcription units covering about 40% of the P. atrosepticum chromosome. Reviewing the annotation in cases where it didn’t fit with regulatory information allowed us to correct product and gene names for over 300 loci. PMID:27257541

  10. Maximization of transcription of the serC (pdxF)-aroA multifunctional operon by antagonistic effects of the cyclic AMP (cAMP) receptor protein-cAMP complex and Lrp global regulators of Escherichia coli K-12.

    PubMed

    Man, T K; Pease, A J; Winkler, M E

    1997-06-01

    The arrangement of the Escherichia coli serC (pdxF) and aroA genes into a cotranscribed multifunctional operon allows coregulation of two enzymes required for the biosynthesis of L-serine, pyridoxal 5'-phosphate, chorismate, and the aromatic amino acids and vitamins. RNase T2 protection assays revealed two major transcripts that were initiated from a promoter upstream from serC (pdxF). Between 80 to 90% of serC (pdxF) transcripts were present in single-gene mRNA molecules that likely arose by Rho-independent termination between serC (pdxF) and aroA. serC (pdxF)-aroA cotranscripts terminated at another Rho-independent terminator near the end of aroA. We studied operon regulation by determining differential rates of beta-galactosidase synthesis in a merodiploid strain carrying a single-copy lambda[phi(serC [pdxF]'-lacZYA)] operon fusion. serC (pdxF) transcription was greatest in bacteria growing in minimal salts-glucose medium (MMGlu) and was reduced in minimal salts-glycerol medium, enriched MMGlu, and LB medium. serC (pdxF) transcription was increased in cya or crp mutants compared to their cya+ crp+ parent in MMGlu or LB medium. In contrast, serC (pdxF) transcription decreased in an lrp mutant compared to its lrp+ parent in MMGlu. Conclusions obtained by using the operon fusion were corroborated by quantitative Western immunoblotting of SerC (PdxF), which was present at around 1,800 dimers per cell in bacteria growing in MMGlu. RNase T2 protection assays of serC (pdxF)-terminated and serC (pdxF)-aroA cotranscript amounts supported the conclusion that the operon was regulated at the transcription level under the conditions tested. Results with a series of deletions upstream of the P(serC (pdxF)) promoter revealed that activation by Lrp was likely direct, whereas repression by the cyclic AMP (cAMP) receptor protein-cAMP complex (CRP-cAMP) was likely indirect, possibly via a repressor whose amount or activity was stimulated by CRP-cAMP.

  11. Defense Against Cannibalism: The SdpI Family of Bacterial Immunity/Signal Transduction Proteins

    PubMed Central

    Povolotsky, Tatyana Leonidovna; Orlova, Ekaterina; Tamang, Dorjee G.

    2010-01-01

    The SdpI family consists of putative bacterial toxin immunity and signal transduction proteins. One member of the family in Bacillus subtilis, SdpI, provides immunity to cells from cannibalism in times of nutrient limitation. SdpI family members are transmembrane proteins with 3, 4, 5, 6, 7, 8, or 12 putative transmembrane α-helical segments (TMSs). These varied topologies appear to be genuine rather than artifacts due to sequencing or annotation errors. The basic and most frequently occurring element of the SdpI family has 6 TMSs. Homologues of all topological types were aligned to determine the homologous TMSs and loop regions, and the positive-inside rule was used to determine sidedness. The two most conserved motifs were identified between TMSs 1 and 2 and TMSs 4 and 5 of the 6 TMS proteins. These showed significant sequence similarity, leading us to suggest that the primordial precursor of these proteins was a 3 TMS–encoding genetic element that underwent intragenic duplication. Various deletional and fusional events, as well as intragenic duplications and inversions, may have yielded SdpI homologues with topologies of varying numbers and positions of TMSs. We propose a specific evolutionary pathway that could have given rise to these distantly related bacterial immunity proteins. We further show that genes encoding SdpI homologues often appear in operons with genes for homologues of SdpR, SdpI’s autorepressor. Our analyses allow us to propose structure–function relationships that may be applicable to most family members. Electronic supplementary material The online version of this article (doi:10.1007/s00232-010-9260-7) contains supplementary material, which is available to authorized users. PMID:20563570

  12. Cytotoxic Chromosomal Targeting by CRISPR/Cas Systems Can Reshape Bacterial Genomes and Expel or Remodel Pathogenicity Islands

    PubMed Central

    Vercoe, Reuben B.; Chang, James T.; Dy, Ron L.; Taylor, Corinda; Gristwood, Tamzin; Clulow, James S.; Richter, Corinna; Przybilski, Rita; Pitman, Andrew R.; Fineran, Peter C.

    2013-01-01

    In prokaryotes, clustered regularly interspaced short palindromic repeats (CRISPRs) and their associated (Cas) proteins constitute a defence system against bacteriophages and plasmids. CRISPR/Cas systems acquire short spacer sequences from foreign genetic elements and incorporate these into their CRISPR arrays, generating a memory of past invaders. Defence is provided by short non-coding RNAs that guide Cas proteins to cleave complementary nucleic acids. While most spacers are acquired from phages and plasmids, there are examples of spacers that match genes elsewhere in the host bacterial chromosome. In Pectobacterium atrosepticum the type I-F CRISPR/Cas system has acquired a self-complementary spacer that perfectly matches a protospacer target in a horizontally acquired island (HAI2) involved in plant pathogenicity. Given the paucity of experimental data about CRISPR/Cas–mediated chromosomal targeting, we examined this process by developing a tightly controlled system. Chromosomal targeting was highly toxic via targeting of DNA and resulted in growth inhibition and cellular filamentation. The toxic phenotype was avoided by mutations in the cas operon, the CRISPR repeats, the protospacer target, and protospacer-adjacent motif (PAM) beside the target. Indeed, the natural self-targeting spacer was non-toxic due to a single nucleotide mutation adjacent to the target in the PAM sequence. Furthermore, we show that chromosomal targeting can result in large-scale genomic alterations, including the remodelling or deletion of entire pre-existing pathogenicity islands. These features can be engineered for the targeted deletion of large regions of bacterial chromosomes. In conclusion, in DNA–targeting CRISPR/Cas systems, chromosomal interference is deleterious by causing DNA damage and providing a strong selective pressure for genome alterations, which may have consequences for bacterial evolution and pathogenicity. PMID:23637624

  13. Identification and Characterization of MalA in the Maltose/Maltodextrin Operon of Sulfolobus acidocaldarius DSM639

    PubMed Central

    Choi, Kyoung-Hwa; Hwang, Sungmin

    2013-01-01

    A putative maltose/maltodextrin operon was found in the Sulfolobus acidocaldarius DSM639 genome. The gene cluster consisted of 7 genes (malA, trmB, amyA, malG, malF, malE, and malK). Here, we report the identification of MalA, which is responsible for the hydrolysis of maltose or maltodextrin to glucose in S. acidocaldarius. The transcription level of malA was increased 3-fold upon the addition of maltose or starch to the medium. Moreover, the α-glucosidase activity for maltose as a substrate in cell extracts of S. acidocaldarius DSM639 was also 11- and 10-fold higher during growth in YT medium (Brock's mineral salts, 0.1% [wt/vol] tryptone, and 0.005% [wt/vol] yeast extract) containing maltose or starch, respectively, than during growth on other sugars. The gene encoding MalA was cloned and expressed in S. acidocaldarius. The enzyme purified from the organism was a dodecamer in its active state and showed strong maltose-hydrolyzing activity at 100°C and pH 5.0. MalA was remarkably thermostable, with half-lives of 33.8 h, 10.6 h, and 1.8 h at 95°C, 100°C, and 105°C, respectively. Substrate specificity and kinetic studies of MalA with maltooligosaccharides indicated that MalA efficiently hydrolyzed maltose to maltopentaose, which is a typical characteristic of GH31-type α-glucosidases. However, glycogen or starch was not hydrolyzed. Reverse transcription-PCR, sugar uptake, and growth studies of the wild-type DSM639 and ΔmalEFG mutant on different sugars demonstrated that MalA located in the mal operon gene cluster is involved in maltose and starch metabolism in S. acidocaldarius. PMID:23396915

  14. Evaluation of phylogenetic footprint discovery for predicting bacterial cis-regulatory elements and revealing their evolution.

    PubMed

    Janky, Rekin's; van Helden, Jacques

    2008-01-23

    The detection of conserved motifs in promoters of orthologous genes (phylogenetic footprints) has become a common strategy to predict cis-acting regulatory elements. Several software tools are routinely used to raise hypotheses about regulation. However, these tools are generally used as black boxes, with default parameters. A systematic evaluation of optimal parameters for a footprint discovery strategy can bring a sizeable improvement to the predictions. We evaluate the performances of a footprint discovery approach based on the detection of over-represented spaced motifs. This method is particularly suitable for (but not restricted to) Bacteria, since such motifs are typically bound by factors containing a Helix-Turn-Helix domain. We evaluated footprint discovery in 368 Escherichia coli K12 genes with annotated sites, under 40 different combinations of parameters (taxonomical level, background model, organism-specific filtering, operon inference). Motifs are assessed both at the levels of correctness and significance. We further report a detailed analysis of 181 bacterial orthologs of the LexA repressor. Distinct motifs are detected at various taxonomical levels, including the 7 previously characterized taxon-specific motifs. In addition, we highlight a significantly stronger conservation of half-motifs in Actinobacteria, relative to Firmicutes, suggesting an intermediate state in specificity switching between the two Gram-positive phyla, and thereby revealing the on-going evolution of LexA auto-regulation. The footprint discovery method proposed here shows excellent results with E. coli and can readily be extended to predict cis-acting regulatory signals and propose testable hypotheses in bacterial genomes for which nothing is known about regulation.

  15. A new regulatory mechanism for bacterial lipoic acid synthesis

    PubMed Central

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-01

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID

  16. A new regulatory mechanism for bacterial lipoic acid synthesis.

    PubMed

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-22

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. © 2015

  17. MprAB regulates the espA operon in Mycobacterium tuberculosis and modulates ESX-1 function and host cytokine response.

    PubMed

    Pang, Xiuhua; Samten, Buka; Cao, Guangxiang; Wang, Xisheng; Tvinnereim, Amy R; Chen, Xiu-Lan; Howard, Susan T

    2013-01-01

    The ESX-1 secretion system exports the immunomodulatory protein ESAT-6 and other proteins important in the pathogenesis of Mycobacterium tuberculosis. Components and substrates of ESX-1 are encoded at several loci, but the regulation of the encoding genes is only partially understood. In this study, we investigated the role of the MprAB two-component system in the regulation of ESX-1 activity. We determined that MprAB directly regulates the espA gene cluster, a locus necessary for ESX-1 function. Transcript mapping determined that the five genes in the cluster form an operon with two transcriptional start points, and several MprA binding sites were detected in the espA promoter. Expression analyses and promoter constructs indicated that MprAB represses the espA operon. However, the MprAB mutant Rv-D981 secreted lower levels of EspA, ESAT-6, and the ESX-1 substrate EspB than control strains. Secretion of CFP10, which is normally cosecreted with ESAT-6, was similar in Rv-D981 and control strains, further demonstrating aberrant ESX-1 activity in the mutant. ESAT-6 induces proinflammatory cytokines, and macrophages infected with Rv-D981 elicited lower levels of interleukin 1β (IL-1β) and tumor necrosis factor alpha (TNF-α), consistent with the reduced levels of ESAT-6. These findings indicate that MprAB modulates ESX-1 function and reveal a new role for MprAB in host-pathogen interactions.

  18. The speEspeD operon of Escherichia coli. Formation and processing of a proenzyme form of S-adenosylmethionine decarboxylase.

    PubMed

    Tabor, C W; Tabor, H

    1987-11-25

    We have previously shown that the gene (speD) for S-adenosylmethionine decarboxylase is part of an operon that also contains the gene (speE) for spermidine synthase (Tabor, C. W., Tabor, H., and Xie, Q.-W. (1986) Proc. Natl. Acad. Sci. U. S. A. 83, 6040-6044). We have now determined the nucleotide sequence of this operon and have found that speD codes for a polypeptide of Mr = 30,400, which is considerably greater than the subunit size of the purified enzyme. Our studies show that S-adenosylmethionine decarboxylase is first formed as a Mr = 30,400 polypeptide and that this proenzyme is then cleaved at the Lys111-Ser112 peptide bond to form a Mr = 12,400 subunit and a Mr = 18,000 subunit. The latter subunit contains the pyruvoyl moiety that we previously showed is required for enzymatic activity. Both subunits are present in the purified enzyme. These conclusions are based on (i) pulse-chase experiments with a strain containing a speD+ plasmid which showed a precursor-product relationship between the proenzyme and the enzyme subunits, (ii) the amino acid sequence of the proenzyme form of S-adenosylmethionine decarboxylase (derived from the nucleotide sequence of the speD gene), and (iii) comparison of this sequence of the proenzyme with the N-terminal amino acid sequences of the two subunits of the purified enzyme reported by Anton and Kutny (Anton, D. L., and Kutny, R. (1987) J. Biol. Chem. 262, 2817-2822).

  19. Effect of Zingiber officinale Supplementation on Obesity Management with Respect to the Uncoupling Protein 1 -3826A>G and ß3-adrenergic Receptor Trp64Arg Polymorphism.

    PubMed

    Ebrahimzadeh Attari, Vahideh; Asghari Jafarabadi, Mohammad; Zemestani, Maryam; Ostadrahimi, Alireza

    2015-07-01

    The present study aimed to investigate the effect of ginger (Zingiber officinale) supplementation on some obesity-associated parameters, with nutrigenetics approach. Accordingly, 80 eligible obese women (aged 18-45 years) were randomly assigned to receive either ginger (2-g ginger rhizomes powder as two 1-g tablets per day) or placebo supplements (corn starch with the same amount) for 12 weeks. Subjects were tested for changes in body weight, body mass index, waist and hip circumferences, body composition, appetite score, and dietary intake. Moreover, participants were genotyped for the -3826A>G and Trp64Arg polymorphisms of uncoupling protein 1 and ß3-adrenergic receptor genes, respectively. Over 12 weeks, ginger supplementation resulted in a slight but statistically significant decrease in all anthropometric measurements and total appetite score as compared with placebo group, which were more pronounced in subjects with the AA genotype for uncoupling protein 1 and Trp64Trp genotype for ß3-adrenergic receptor gene. However, there was no significant difference in changes of body composition and total energy and macronutrients intake between groups. In conclusion, our findings suggest that ginger consumption has potential in managing obesity, accompanying with an intervention-genotype interaction effect. However, further clinical trials need to explore ginger's efficacy as an anti-obesity agent in the form of powder, extract, or its active components. Copyright © 2015 John Wiley & Sons, Ltd.

  20. NqrM (DUF539) Protein Is Required for Maturation of Bacterial Na+-Translocating NADH:Quinone Oxidoreductase

    PubMed Central

    Kostyrko, Vitaly A.; Bertsova, Yulia V.; Serebryakova, Marina V.; Baykov, Alexander A.

    2015-01-01

    ABSTRACT Na+-translocating NADH:quinone oxidoreductase (Na+-NQR) catalyzes electron transfer from NADH to ubiquinone in the bacterial respiratory chain, coupled with Na+ translocation across the membrane. Na+-NQR maturation involves covalent attachment of flavin mononucleotide (FMN) residues, catalyzed by flavin transferase encoded by the nqr-associated apbE gene. Analysis of complete bacterial genomes has revealed another putative gene (duf539, here renamed nqrM) that usually follows the apbE gene and is present only in Na+-NQR-containing bacteria. Expression of the Vibrio harveyi nqr operon alone or with the associated apbE gene in Escherichia coli, which lacks its own Na+-NQR, resulted in an enzyme incapable of Na+-dependent NADH or reduced nicotinamide hypoxanthine dinucleotide (dNADH) oxidation. However, fully functional Na+-NQR was restored when these genes were coexpressed with the V. harveyi nqrM gene. Furthermore, nqrM lesions in Klebsiella pneumoniae and V. harveyi prevented production of functional Na+-NQR, which could be recovered by an nqrM-containing plasmid. The Na+-NQR complex isolated from the nqrM-deficient strain of V. harveyi lacks several subunits, indicating that nqrM is necessary for Na+-NQR assembly. The protein product of the nqrM gene, NqrM, contains a single putative transmembrane α-helix and four conserved Cys residues. Mutating one of these residues (Cys33 in V. harveyi NqrM) to Ser completely prevented Na+-NQR maturation, whereas mutating any other Cys residue only decreased the yield of the mature protein. These findings identify NqrM as the second specific maturation factor of Na+-NQR in proteobacteria, which is presumably involved in the delivery of Fe to form the (Cys)4[Fe] center between subunits NqrD and NqrE. IMPORTANCE Na+-translocating NADH:quinone oxidoreductase complex (Na+-NQR) is a unique primary Na+ pump believed to enhance the vitality of many bacteria, including important pathogens such as Vibrio cholerae, Vibrio