Crystallization behaviours of bacterially synthesized poly(hydroxyalkanoate)s in the presence of oxalamide compounds with different configurations.

PubMed

Xu, Pengwu; Feng, Yongqi; Ma, Piming; Chen, Yongjun; Dong, Weifu; Chen, Mingqing

2017-11-01

Bacterially synthesized poly(hydroxyalkanoate)s (PHAs) suffers from low crystallization rate which is enhanced by using tailor-made oxalamide compounds as nucleators. The influence of nucleator configurations on the crystallization behaviour of the PHAs was investigated using differential scanning calorimetry (DSC), polarized optical microscopy (POM) and X-ray diffraction (XRD). The oxalamide compounds with ringy terminal structures (cyclohexyl and phenyl), notably the phenyl group, show higher nucleation efficiency and a better compatibility in the PHAs matrix, while the linear terminal structure (n-hexane) has poor nucleation effect. The crystallization temperature (T c ) and the crystallinity (X c ) of the PHAs are increased from 58°C to 71°C and from 5% to 48%, respectively, after addition of 0.75wt% of the nucleator (phenyl group) upon cooling from the melt. Meanwhile, the half-life isothermal crystallization time (t 0.5 ) of the PHAs at 110°C is decreased by 70%. The oxalamide compounds increases the nuclei density of the PHAs accompanied with a reduction in spherulitic size. In addition, the crystal form and crystallization mechanism of the PHAs are not altered obviously after addition of the nulceators as confirmed by the POM, XRD and Avrami analysis. Copyright © 2017 Elsevier B.V. All rights reserved.

Purification of CD47-streptavidin fusion protein from bacterial lysate using biotin-agarose affinity chromatography.

PubMed

Salehi, Nasrin; Peng, Ching-An

2016-07-08

CD47 is a widely expressed transmembrane glycoprotein that modulates the activity of a plethora of immune cells via its extracellular domain. Therefore, CD47 plays important roles in the regulation of immune responses and may serve as targets for the development of immunotherapeutic agents. To make sure CD47 functionality is intact under the process of protein conjugation, CD47-streptavidin fusion protein was expressed and purified because it can easily bind to biotin-tagged materials via the unique biotin-streptavidin affinity. In this study, gene sequences of CD47 extracellular domain (CD47ECD) and core streptavidin (coreSA) with a total 834 bp were inserted into pET20b plasmid to construct recombinant plasmid encoding CD47-SA fusion gene. After bacteria transformation, the CD47-SA fusion protein was expressed by isopropyl-β-d-thiogalactopyranoside (IPTG) induction. The collected bacteria lysate was loaded on biotinylated agarose to proceed the purification of CD47-SA fusion protein. Due to the unexpected high affinity between biotin and coreSA, standard washing and elution approaches (e.g., varying pH, using biotin, and applying guanidine hydrochloride) reported for biotin-streptavidin affinity chromatography were not able to separate the target fusion protein. Instead, using low concentration of the non-ionic detergent Triton X-100 followed with alkaline buffer could efficiently weaken the binding between biotin and coreSA, thereby eluting out CD47-SA fusion protein from the biotin agarose column. The purified CD47-SA fusion protein was further characterized by molecular biology methods and its antiphagocytic functionality was confirmed by the phagocytosis assay. © 2016 American Institute of Chemical Engineers Biotechnol. Prog., 32:949-958, 2016. © 2016 American Institute of Chemical Engineers.

Surface-independent antibacterial coating using silver nanoparticle-generating engineered mussel glue.

PubMed

Jo, Yun Kee; Seo, Jeong Hyun; Choi, Bong-Hyuk; Kim, Bum Jin; Shin, Hwa Hui; Hwang, Byeong Hee; Cha, Hyung Joon

2014-11-26

During implant surgeries, antibacterial agents are needed to prevent bacterial infections, which can cause the formation of biofilms between implanted materials and tissue. Mussel adhesive proteins (MAPs) derived from marine mussels are bioadhesives that show strong adhesion and coating ability on various surfaces even in wet environment. Here, we proposed a novel surface-independent antibacterial coating strategy based on the fusion of MAP to a silver-binding peptide, which can synthesize silver nanoparticles having broad antibacterial activity. This sticky recombinant fusion protein enabled the efficient coating on target surface and the easy generation of silver nanoparticles on the coated-surface under mild condition. The biosynthesized silver nanoparticles showed excellent antibacterial efficacy against both Gram-positive and Gram-negative bacteria and also revealed good cytocompatibility with mammalian cells. In this coating strategy, MAP-silver binding peptide fusion proteins provide hybrid environment incorporating inorganic silver nanoparticle and simultaneously mediate the interaction of silver nanoparticle with surroundings. Moreover, the silver nanoparticles were fully synthesized on various surfaces including metal, plastic, and glass by a simple, surface-independent coating manner, and they were also successfully synthesized on a nanofiber surface fabricated by electrospinning of the fusion protein. Thus, this facile surface-independent silver nanoparticle-generating antibacterial coating has great potential to be used for the prevention of bacterial infection in diverse biomedical fields.

A survey of infrared and visual image fusion methods

NASA Astrophysics Data System (ADS)

Jin, Xin; Jiang, Qian; Yao, Shaowen; Zhou, Dongming; Nie, Rencan; Hai, Jinjin; He, Kangjian

2017-09-01

Infrared (IR) and visual (VI) image fusion is designed to fuse multiple source images into a comprehensive image to boost imaging quality and reduce redundancy information, which is widely used in various imaging equipment to improve the visual ability of human and robot. The accurate, reliable and complementary descriptions of the scene in fused images make these techniques be widely used in various fields. In recent years, a large number of fusion methods for IR and VI images have been proposed due to the ever-growing demands and the progress of image representation methods; however, there has not been published an integrated survey paper about this field in last several years. Therefore, we make a survey to report the algorithmic developments of IR and VI image fusion. In this paper, we first characterize the IR and VI image fusion based applications to represent an overview of the research status. Then we present a synthesize survey of the state of the art. Thirdly, the frequently-used image fusion quality measures are introduced. Fourthly, we perform some experiments of typical methods and make corresponding analysis. At last, we summarize the corresponding tendencies and challenges in IR and VI image fusion. This survey concludes that although various IR and VI image fusion methods have been proposed, there still exist further improvements or potential research directions in different applications of IR and VI image fusion.

Strong nonlinear photonic responses from microbiologically synthesized tellurium nanocomposites

USGS Publications Warehouse

Liao, K.-S.; Wang, Jingyuan; Dias, S.; Dewald, J.; Alley, N.J.; Baesman, S.M.; Oremland, R.S.; Blau, W.J.; Curran, S.A.

2010-01-01

A new class of nanomaterials, namely microbiologically-formed nanorods composed of elemental tellurium [Te(0)] that forms unusual nanocomposites when combined with poly(m-phenylenevinylene-co-2,5-dioctoxy-phenylenevinylene) (PmPV) is described. These bio-nanocomposites exhibit excellent broadband optical limiting at 532 and 1064 nm. Nonlinear scattering, originating from the laser induced solvent bubbles and microplasmas, is responsible for this nonlinear behavior. The use of bacterially-formed Te(0) when combined with an organic chemical host (e.g., PmPV) is a new green method of nanoparticle syntheses. This opens the possibilities of using unique, biologically synthesized materials to advance future nanoelectronic and nanophotonic applications. ?? 2009 Elsevier B.V. All rights reserved.

Potent antimicrobial and antibiofilm activities of bacteriogenically synthesized gold-silver nanoparticles against pathogenic bacteria and their physiochemical characterizations.

PubMed

Ramasamy, Mohankandhasamy; Lee, Jin-Hyung; Lee, Jintae

2016-09-01

The objective of this study was to develop a bimetallic nanoparticle with enhanced antibacterial activity that would improve the therapeutic efficacy against bacterial biofilms. Bimetallic gold-silver nanoparticles were bacteriogenically synthesized using γ-proteobacterium, Shewanella oneidensis MR-1. The antibacterial activities of gold-silver nanoparticles were assessed on the planktonic and biofilm phases of individual and mixed multi-cultures of pathogenic Gram negative (Escherichia coli and Pseudomonas aeruginosa) and Gram positive bacteria (Enterococcus faecalis and Staphylococcus aureus), respectively. The minimum inhibitory concentration of gold-silver nanoparticles was 30-50 µM than that of other nanoparticles (>100 µM) for the tested bacteria. Interestingly, gold-silver nanoparticles were more effective in inhibiting bacterial biofilm formation at 10 µM concentration. Both scanning and transmission electron microscopy results further accounted the impact of gold-silver nanoparticles on biocompatibility and bactericidal effect that the small size and bio-organic materials covering on gold-silver nanoparticles improves the internalization and thus caused bacterial inactivation. Thus, bacteriogenically synthesized gold-silver nanoparticles appear to be a promising nanoantibiotic for overcoming the bacterial resistance in the established bacterial biofilms. © The Author(s) 2016.

Arsenic uptake in bacterial calcite

NASA Astrophysics Data System (ADS)

Catelani, Tiziano; Perito, Brunella; Bellucci, Francesco; Lee, Sang Soo; Fenter, Paul; Newville, Matthew; Rimondi, Valentina; Pratesi, Giovanni; Costagliola, Pilario

2018-02-01

Bio-mediated processes for arsenic (As) uptake in calcite were investigated by means of X-ray Diffraction (XRD) and X-ray Absorption Spectroscopy (XAS) coupled with X-ray Fluorescence measurements. The environmental bacterial strain Bacillus licheniformis BD5, sampled at the Bullicame Hot Springs (Viterbo, Central Italy), was used to synthesize calcite from As-enriched growth media. Both liquid and solid cultures were applied to simulate planktonic and biofilm community environments, respectively. Bacterial calcite samples cultured in liquid media had an As enrichment factor (Kd) 50 times higher than that from solid media. The XRD analysis revealed an elongation of the crystal lattice along the c axis (by 0.03 Å) for biogenic calcite, which likely resulted from the substitution of larger arsenate for carbonate in the crystal. The XAS data also showed a clear difference in the oxidation state of sorbed As between bacterial and abiotic calcite. Abiotic chemical processes yielded predominantly As(V) uptake whereas bacterial precipitation processes led to the uptake of both As(III) and As(V). The presence of As(III) in bacterial calcite is proposed to result from subsequent reduction of arsenate to arsenite by bacterial activities. To the best of our knowledge, this is the first experimental observation of the incorporation of As(III) in the calcite crystal lattice, revealing a critical role of biochemical processes for the As cycling in nature.

UGT-29 protein expression and localization during bacterial infection in Caenorhabditis elegans

NASA Astrophysics Data System (ADS)

Wong, Rui-Rui; Lee, Song-Hua; Nathan, Sheila

2014-09-01

The nematode Caenorhabditis elegans is routinely used as an animal model to delineate complex molecular mechanisms involved in the host response to pathogen infection. Following up on an earlier study on host-pathogen interaction, we constructed a ugt-29::GFP transcriptional fusion transgenic worm strain to examine UGT-29 protein expression and localization upon bacterial infection. UGT-29 orthologs can be found in higher organisms including humans and is proposed as a member of the UDP-Glucoronosyl Transferase family of proteins which are involved in phase II detoxification of compounds detrimental to the host organism. Under uninfected conditions, UGT-29::GFP fusion protein was highly expressed in the C. elegans anterior pharynx and intestine, two major organs involved in detoxification. We further evaluated the localization of the enzyme in worms infected with the bacterial pathogen, Burkholderia pseudomallei. The infected ugt-29::GFP transgenic strain exhibited increased fluorescence in the pharynx and intestine with pronounced fluorescence also extending to body wall muscle. This transcriptional fusion GFP transgenic worm is a convenient and direct tool to provide information on UGT detoxification enzyme gene expression and could be a useful tool for a number of diverse applications.

Bacterial and primary production in the pelagic zone of the Kara Sea

NASA Astrophysics Data System (ADS)

Sazhin, A. F.; Romanova, N. D.; Mosharov, S. A.

2010-10-01

Data on the bacterial and primary production, which were obtained simultaneously for the same water samples, are presented for three regions of the Kara Sea. The samples were collected for the transect westwards of the Yamal Peninsula, along the St. Anna Trough, and the transect in Ob Bay. Direct counts of the DAPI-stained bacterial cells were performed. The bacterial production and grazing rates were determined using a direct method when metabolic inhibitors vancomycin and penicillin were added. The primary production rates were estimated using the 14C method. The average primary production was 112.6, 58.5, and 28.7 mg C m-2 day-1, and the bacterial production was 12.8, 48.9, and 81.6 mg C m-2 day-1 along the Yamal Peninsula, the St. Anna Trough, and Ob Bay, respectively. The average bacterial carbon demand was 34.6, 134.5, and 220.4 mg C m-2 day-1 for these regions, respectively. The data obtained lead us to conclude that the phytoplankton-synthesized organic matter is generally insufficient to satisfy the bacterial carbon demand and may be completely assimilated via the heterotrophic processes in the marine ecosystems. Therefore, the bacterial activity and, consequently, the amount of the synthesized biomass (i.e., the production) both depend directly on the phytoplankton’s condition and activity. We consider these relationships to be characteristics of the Kara Sea’s biota.

Enzymatic hydrolysis of biomimetic bacterial cellulose-hemicellulose composites.

PubMed

Penttilä, Paavo A; Imai, Tomoya; Hemming, Jarl; Willför, Stefan; Sugiyama, Junji

2018-06-15

The production of biofuels and other chemicals from lignocellulosic biomass is limited by the inefficiency of enzymatic hydrolysis. Here a biomimetic composite material consisting of bacterial cellulose and wood-based hemicelluloses was used to study the effects of hemicelluloses on the enzymatic hydrolysis with a commercial cellulase mixture. Bacterial cellulose synthesized in the presence of hemicelluloses, especially xylan, was found to be more susceptible to enzymatic hydrolysis than hemicellulose-free bacterial cellulose. The reason for the easier hydrolysis could be related to the nanoscale structure of the substrate, particularly the packing of cellulose microfibrils into ribbons or bundles. In addition, small-angle X-ray scattering was used to show that the average nanoscale morphology of bacterial cellulose remained unchanged during the enzymatic hydrolysis. The reported easier enzymatic hydrolysis of bacterial cellulose produced in the presence of wood-based xylan offers new insights to overcome biomass recalcitrance through genetic engineering. Copyright © 2018 Elsevier Ltd. All rights reserved.

Potential Theranostics Application of Bio-Synthesized Silver Nanoparticles (4-in-1 System)

PubMed Central

Mukherjee, Sudip; Chowdhury, Debabrata; Kotcherlakota, Rajesh; Patra, Sujata; B, Vinothkumar; Bhadra, Manika Pal; Sreedhar, Bojja; Patra, Chitta Ranjan

2014-01-01

In this report, we have designed a simple and efficient green chemistry approach for the synthesis of colloidal silver nanoparticles (b-AgNPs) that is formed by the reduction of silver nitrate (AgNO3) solution using Olax scandens leaf extract. The colloidal b-AgNPs, characterized by various physico-chemical techniques exhibit multifunctional biological activities (4-in-1 system). Firstly, bio-synthesized silver nanoparticles (b-AgNPs) shows enhanced antibacterial activity compared to chemically synthesize silver nanoparticles (c-AgNPs). Secondly, b-AgNPs show anti-cancer activities to different cancer cells (A549: human lung cancer cell lines, B16: mouse melanoma cell line & MCF7: human breast cancer cells) (anti-cancer). Thirdly, these nanoparticles are biocompatible to rat cardiomyoblast normal cell line (H9C2), human umbilical vein endothelial cells (HUVEC) and Chinese hamster ovary cells (CHO) which indicates the future application of b-AgNPs as drug delivery vehicle. Finally, the bio-synthesized AgNPs show bright red fluorescence inside the cells that could be utilized to detect the localization of drug molecules inside the cancer cells (a diagnostic approach). All results together demonstrate the multifunctional biological activities of bio-synthesized AgNPs (4-in-1 system) that could be applied as (i) anti-bacterial & (ii) anti-cancer agent, (iii) drug delivery vehicle, and (iv) imaging facilitator. To the best of our knowledge, there is not a single report of biosynthesized AgNPs that demonstrates the versatile applications (4-in-1 system) towards various biomedical applications. Additionally, a plausible mechanistic approach has been explored for the synthesis of b-AgNPs and its anti-bacterial as well as anti-cancer activity. We strongly believe that bio-synthesized AgNPs will open a new direction towards various biomedical applications in near future. PMID:24505239

Identification and Partial Characterization of a Novel UDP-N-Acetylenolpyruvoylglucosamine Reductase/UDP-N-Acetylmuramate:l-Alanine Ligase Fusion Enzyme from Verrucomicrobium spinosum DSM 4136(T).

PubMed

Naqvi, Kubra F; Patin, Delphine; Wheatley, Matthew S; Savka, Michael A; Dobson, Renwick C J; Gan, Han Ming; Barreteau, Hélène; Blanot, Didier; Mengin-Lecreulx, Dominique; Hudson, André O

2016-01-01

The enzymes involved in synthesizing the bacterial cell wall are attractive targets for the design of antibacterial compounds, since this pathway is essential for bacteria and is absent in animals, particularly humans. A survey of the genome of a bacterium that belongs to the phylum Verrucomicrobia, the closest free-living relative to bacteria from the Chlamydiales phylum, shows genetic evidence that Verrucomicrobium spinosum possesses a novel fusion open reading frame (ORF) annotated by the locus tag (VspiD_010100018130). The ORF, which is predicted to encode the enzymes UDP-N-acetylenolpyruvoylglucosamine reductase (MurB) and UDP-N-acetylmuramate:l-alanine ligase (MurC) that are involved in the cytoplasmic steps of peptidoglycan biosynthesis, was cloned. In vivo analyses using functional complementation showed that the fusion gene was able to complement Escherichia coli murB and murC temperature sensitive mutants. The purified recombinant fusion enzyme (MurB/C Vs ) was shown to be endowed with UDP-N-acetylmuramate:l-alanine ligase activity. In vitro analyses demonstrated that the latter enzyme had a pH optimum of 9.0, a magnesium optimum of 10 mM and a temperature optimum of 44-46°C. Its apparent K m values for ATP, UDP-MurNAc, and l-alanine were 470, 90, and 25 μM, respectively. However, all attempts to demonstrate an in vitro UDP-N-acetylenolpyruvoylglucosamine reductase (MurB) activity were unsuccessful. Lastly, Hidden Markov Model-based similarity search and phylogenetic analysis revealed that this fusion enzyme could only be identified in specific lineages within the Verrucomicrobia phylum.

Identification and Partial Characterization of a Novel UDP-N-Acetylenolpyruvoylglucosamine Reductase/UDP-N-Acetylmuramate:l-Alanine Ligase Fusion Enzyme from Verrucomicrobium spinosum DSM 4136T

PubMed Central

Naqvi, Kubra F.; Patin, Delphine; Wheatley, Matthew S.; Savka, Michael A.; Dobson, Renwick C. J.; Gan, Han Ming; Barreteau, Hélène; Blanot, Didier; Mengin-Lecreulx, Dominique; Hudson, André O.

2016-01-01

The enzymes involved in synthesizing the bacterial cell wall are attractive targets for the design of antibacterial compounds, since this pathway is essential for bacteria and is absent in animals, particularly humans. A survey of the genome of a bacterium that belongs to the phylum Verrucomicrobia, the closest free-living relative to bacteria from the Chlamydiales phylum, shows genetic evidence that Verrucomicrobium spinosum possesses a novel fusion open reading frame (ORF) annotated by the locus tag (VspiD_010100018130). The ORF, which is predicted to encode the enzymes UDP-N-acetylenolpyruvoylglucosamine reductase (MurB) and UDP-N-acetylmuramate:l-alanine ligase (MurC) that are involved in the cytoplasmic steps of peptidoglycan biosynthesis, was cloned. In vivo analyses using functional complementation showed that the fusion gene was able to complement Escherichia coli murB and murC temperature sensitive mutants. The purified recombinant fusion enzyme (MurB/CVs) was shown to be endowed with UDP-N-acetylmuramate:l-alanine ligase activity. In vitro analyses demonstrated that the latter enzyme had a pH optimum of 9.0, a magnesium optimum of 10 mM and a temperature optimum of 44–46°C. Its apparent Km values for ATP, UDP-MurNAc, and l-alanine were 470, 90, and 25 μM, respectively. However, all attempts to demonstrate an in vitro UDP-N-acetylenolpyruvoylglucosamine reductase (MurB) activity were unsuccessful. Lastly, Hidden Markov Model-based similarity search and phylogenetic analysis revealed that this fusion enzyme could only be identified in specific lineages within the Verrucomicrobia phylum. PMID:27047475

Antimicrobial Nanoparticle for the Treatment of Bacterial Infection

NASA Astrophysics Data System (ADS)

Pornpattananangkul, Dissaya

Liposomes are spherical lipid vesicles with bilayered membrane structure, which have been recognized as one of the most widely used carriers for delivering a myriad of pharmaceuticals. Liposomes can carry both hydrophilic and hydrophobic agents with high efficiency and protect them from undesired effects of external conditions. However, the applications of liposomes are usually limited by their instability during storage. They are inclined to fuse with one another immediately after preparation, resulting in undesired mixing, increase in size, and payload loss. To overcome this limitation, this dissertation will focus on the technology to stabilize liposomes during storage and destabilize at specific conditions in order to allow controllable therapeutic release, as well as demonstrate their application to treat one of the bacterial infection diseases, acne vulgaris. The first area of this research is stimuli-responsive liposomes development, where the liposomes are stabilized by introducing gold nanoparticles to adsorb to their surface. As a result, the liposomes are prevented from fusing with one another and undesirable payload release during storage or physiological environments. Moreover, therapeutic is controllably released depending on environment conditions, such as acidic pH and bacterial virulence factor. In case of acid-responsive liposomes, the bound gold nanoparticles can effectively prevent liposomes from fusing with one another at neutral pH value, while at acidic environment (e.g. pH<5), the gold particle stabilizers will fall off from the liposomes, thereby reinstalling the fusion activity of liposomes. The fusion activity of the stabilized liposomes is found to be 25% at pH=7, in contrast to 80% at pH=4. Another stimulus that can activate drug release from liposomes is virulence factor released from bacteria themselves, such as bacterial toxin. When nanoparticle-stabilized liposomes encounter with bacteria that secrete toxin, the toxin will insert

Arsenic uptake in bacterial calcite

DOE Office of Scientific and Technical Information (OSTI.GOV)

Catelani, Tiziano; Perito, Brunella; Bellucci, Francesco

Bio-mediated processes for arsenic (As) uptake in calcite were investigated by means of X-ray Diffraction (XRD) and Xray Absorption Spectroscopy (XAS) coupled with X-ray Fluorescence measurements. The environmental bacterial strain Bacillus licheniformis BD5, sampled at the Bullicame Hot Springs (Viterbo, Central Italy), was used to synthesize calcite from As-enriched growth media. Both liquid and solid cultures were applied to simulate planktonic and biofilm community environments, respectively. Bacterial calcite samples cultured in liquid media had an As enrichment factor (Kd) 50 times higher than that from solid media. The XRD analysis revealed an elongation of the crystal lattice along the cmore » axis (by 0.03Å) for biogenic calcite, which likely resulted from the substitution of larger arsenate for carbonate in the crystal. The XAS data also showed a clear difference in the oxidation state of sorbed As between bacterial and abiotic calcite. Abiotic chemical processes yielded predominantly As(V) uptake whereas bacterial precipitation processes led to the uptake of both As(III) and As(V). The presence of As(III) in bacterial calcite is proposed to result from subsequent reduction of arsenate to arsenite by bacterial activities. To the best of our knowledge, this is the first experimental observation of the incorporation of As(III) in the calcite crystal lattice, revealing a critical role of biochemical processes for the As cycling in nature.« less

Tuning bacterial hydrodynamics with magnetic fields

NASA Astrophysics Data System (ADS)

Pierce, C. J.; Mumper, E.; Brown, E. E.; Brangham, J. T.; Lower, B. H.; Lower, S. K.; Yang, F. Y.; Sooryakumar, R.

2017-06-01

Magnetotactic bacteria are a group of motile prokaryotes that synthesize chains of lipid-bound, magnetic nanoparticles called magnetosomes. This study exploits their innate magnetism to investigate previously unexplored facets of bacterial hydrodynamics at surfaces. Through use of weak, uniform, external magnetic fields and local, micromagnetic surface patterns, the relative strength of hydrodynamic, magnetic, and flagellar force components is tuned through magnetic control of the bacteria's orientation. The resulting swimming behaviors provide a means to experimentally determine hydrodynamic parameters and offer a high degree of control over large numbers of living microscopic entities. The implications of this controlled motion for studies of bacterial motility near surfaces and for micro- and nanotechnology are discussed.

Membrane-spanning lipids for an uncompromised monitoring of membrane fusion and intermembrane lipid transfer

PubMed Central

Schwarzmann, Günter; Breiden, Bernadette; Sandhoff, Konrad

2015-01-01

A Förster resonance energy transfer-based fusion and transfer assay was developed to study, in model membranes, protein-mediated membrane fusion and intermembrane lipid transfer of fluorescent sphingolipid analogs. For this assay, it became necessary to apply labeled reporter molecules that are resistant to spontaneous as well as protein-mediated intermembrane transfer. The novelty of this assay is the use of nonextractable fluorescent membrane-spanning bipolar lipids. Starting from the tetraether lipid caldarchaeol, we synthesized fluorescent analogs with fluorophores at both polar ends. In addition, we synthesized radioactive glycosylated caldarchaeols. These labeled lipids were shown to stretch through bilayer membranes rather than to loop within a single lipid layer of liposomes. More important, the membrane-spanning lipids (MSLs) in contrast to phosphoglycerides proved to be nonextractable by proteins. We could show that the GM2 activator protein (GM2AP) is promiscuous with respect to glycero- and sphingolipid transfer. Saposin (Sap) B also transferred sphingolipids albeit with kinetics different from GM2AP. In addition, we could unambiguously show that the recombinant activator protein Sap C x His6 induced membrane fusion rather than intermembrane lipid transfer. These findings showed that these novel MSLs, in contrast with fluorescent phosphoglycerolipids, are well suited for an uncompromised monitoring of membrane fusion and intermembrane lipid transfer. PMID:26269359

Membrane-spanning lipids for an uncompromised monitoring of membrane fusion and intermembrane lipid transfer.

PubMed

Schwarzmann, Günter; Breiden, Bernadette; Sandhoff, Konrad

2015-10-01

A Förster resonance energy transfer-based fusion and transfer assay was developed to study, in model membranes, protein-mediated membrane fusion and intermembrane lipid transfer of fluorescent sphingolipid analogs. For this assay, it became necessary to apply labeled reporter molecules that are resistant to spontaneous as well as protein-mediated intermembrane transfer. The novelty of this assay is the use of nonextractable fluorescent membrane-spanning bipolar lipids. Starting from the tetraether lipid caldarchaeol, we synthesized fluorescent analogs with fluorophores at both polar ends. In addition, we synthesized radioactive glycosylated caldarchaeols. These labeled lipids were shown to stretch through bilayer membranes rather than to loop within a single lipid layer of liposomes. More important, the membrane-spanning lipids (MSLs) in contrast to phosphoglycerides proved to be nonextractable by proteins. We could show that the GM2 activator protein (GM2AP) is promiscuous with respect to glycero- and sphingolipid transfer. Saposin (Sap) B also transferred sphingolipids albeit with kinetics different from GM2AP. In addition, we could unambiguously show that the recombinant activator protein Sap C x His6 induced membrane fusion rather than intermembrane lipid transfer. These findings showed that these novel MSLs, in contrast with fluorescent phosphoglycerolipids, are well suited for an uncompromised monitoring of membrane fusion and intermembrane lipid transfer. Copyright © 2015 by the American Society for Biochemistry and Molecular Biology, Inc.

Fusion tags for protein solubility, purification and immunogenicity in Escherichia coli: the novel Fh8 system

PubMed Central

Costa, Sofia; Almeida, André; Castro, António; Domingues, Lucília

2014-01-01

Proteins are now widely produced in diverse microbial cell factories. The Escherichia coli is still the dominant host for recombinant protein production but, as a bacterial cell, it also has its issues: the aggregation of foreign proteins into insoluble inclusion bodies is perhaps the main limiting factor of the E. coli expression system. Conversely, E. coli benefits of cost, ease of use and scale make it essential to design new approaches directed for improved recombinant protein production in this host cell. With the aid of genetic and protein engineering novel tailored-made strategies can be designed to suit user or process requirements. Gene fusion technology has been widely used for the improvement of soluble protein production and/or purification in E. coli, and for increasing peptide’s immunogenicity as well. New fusion partners are constantly emerging and complementing the traditional solutions, as for instance, the Fh8 fusion tag that has been recently studied and ranked among the best solubility enhancer partners. In this review, we provide an overview of current strategies to improve recombinant protein production in E. coli, including the key factors for successful protein production, highlighting soluble protein production, and a comprehensive summary of the latest available and traditionally used gene fusion technologies. A special emphasis is given to the recently discovered Fh8 fusion system that can be used for soluble protein production, purification, and immunogenicity in E. coli. The number of existing fusion tags will probably increase in the next few years, and efforts should be taken to better understand how fusion tags act in E. coli. This knowledge will undoubtedly drive the development of new tailored-made tools for protein production in this bacterial system. PMID:24600443

Basic distinctions between cold- and hot-fusion reactions in the synthesis of superheavy elements

NASA Astrophysics Data System (ADS)

Nasirov, A. K.; Muminov, A. I.; Giardina, G.; Mandaglio, G.

2014-07-01

Superheavy elements (SHE) of charge number in the range of Z = 106-112 were synthesized in so-called cold-fusion reactions. The smallness of the excitation energy of compound nuclei is the main advantage of cold-fusion reactions. However, the synthesis of SHEs of charge number in the region of Z ≥ 112 is strongly complicated in cold-fusion reactions by a sharp decrease in the cross section of a compound nucleus formation in the entrance channel because of superiority of quasifission in the competition with complete fusion. Two favorable circumstances contributed to the success of the experiments aimed at the synthesis of the Z = 113-118 elements and performed at the Laboratory of Nuclear Reactions at the Joint Institute for Nuclear Research: large cross sections for the production of a compound nucleus, which are characteristic of hot-fusion reactions, and an increase in the fission barrier for nuclei toward the stability island. The factor that complicates the formation of a compound nucleus in cold-fusion reactions is discussed.

Cellulose-ethylenediaminetetraacetic acid conjugates protect mammalian cells from bacterial cells.

PubMed

Luo, Jie; Lv, Wei; Deng, Ying; Sun, Yuyu

2013-04-08

Cellulose-ethylenediaminetetraacetic acid (EDTA) conjugates were synthesized by the esterification of cellulose with ethylenediaminetetraacetic dianhydride (EDTAD). The new materials provided potent antimicrobial activities against Staphylococcus aureus (S. aureus, Gram-positive bacteria) and Pseudomonas aeruginosa (P. aeruginosa, Gram-negative bacteria), and inhibited the formation of bacterial biofilms. The biocompatibility of the new cellulose-EDTA conjugates was evaluated with mouse skin fibroblasts for up to 14 days. SEM observation and DNA content analysis suggested that the new materials sustained the viability of fibroblast cells. Moreover, in mouse skin fibroblast-bacteria co-culture systems, the new cellulose-EDTA conjugates prevented bacterial biofilm formation and protected the mammalian cells from the bacterial cells for at least one day.

Structure of the enzymatically synthesized fructan inulin.

PubMed

Heyer, A G; Schroeer, B; Radosta, S; Wolff, D; Czapla, S; Springer, J

1998-12-15

Construction, purification and characterization of a fusion protein of maltose-binding protein of Escherichia coli and the fructosyltransferase of Streptococcus mutans is described. With the purified protein, in vitro synthesis of inulin was performed. The obtained polysaccharide was characterized by high-performance size-exclusion chromatography (HPSEC) and static light scattering (SLS) in dilute aqueous and dimethyl sulfoxide solution. For all samples very high molecular weights between 60 x 10(6) and 90 x 10(6) g/mol and a remarkable small polydispersity index of 1.1 have been determined. Small root-mean-square radii of gyration point to a compact conformation in dilute solution. No difference between native and enzymatically synthesized inulin was observed by X-ray powder diffraction and thermoanalysis of solid samples.

Fast degradable citrate-based bone scaffold promotes spinal fusion.

PubMed

Tang, Jiajun; Guo, Jinshan; Li, Zhen; Yang, Cheng; Xie, Denghui; Chen, Jian; Li, Shengfa; Li, Shaolin; Kim, Gloria B; Bai, Xiaochun; Zhang, Zhongmin; Yang, Jian

2015-07-21

It is well known that high rates of fusion failure and pseudoarthrosis development (5~35%) are concomitant in spinal fusion surgery, which was ascribed to the shortage of suitable materials for bone regeneration. Citrate was recently recognized to play an indispensable role in enhancing osteconductivity and osteoinductivity, and promoting bone formation. To address the material challenges in spinal fusion surgery, we have synthesized mechanically robust and fast degrading citrate-based polymers by incorporating N-methyldiethanolamine (MDEA) into clickable poly(1, 8-octanediol citrates) (POC-click), referred to as POC-M-click. The obtained POC-M-click were fabricated into POC-M-click-HA matchstick scaffolds by compositing with hydroxyapatite (HA) for interbody spinal fusion in a rabbit model. Spinal fusion was analyzed by radiography, manual palpation, biomechanical testing, and histological evaluation. At 4 and 8 weeks post surgery, POC-M-click-HA scaffolds presented optimal degradation rates that facilitated faster new bone formation and higher spinal fusion rates (11.2±3.7, 80±4.5 at week 4 and 8, respectively) than the poly(L-lactic acid)-HA (PLLA-HA) control group (9.3±2.4 and 71.1±4.4) (p<0.05). The POC-M-click-HA scaffold-fused vertebrates possessed a maximum load and stiffness of 880.8±14.5 N and 843.2±22.4 N/mm, respectively, which were also much higher than those of the PLLA-HA group (maximum: 712.0±37.5 N, stiffness: 622.5±28.4 N/mm, p<0.05). Overall, the results suggest that POC-M-click-HA scaffolds could potentially serve as promising bone grafts for spinal fusion applications.

The Flocculating Cationic Polypetide from Moringa oleifera Seeds Damages Bacterial Cell Membranes by Causing Membrane Fusion.

PubMed

Shebek, Kevin; Schantz, Allen B; Sines, Ian; Lauser, Kathleen; Velegol, Stephanie; Kumar, Manish

2015-04-21

A cationic protein isolated from the seeds of the Moringa oleifera tree has been extensively studied for use in water treatment in developing countries and has been proposed for use in antimicrobial and therapeutic applications. However, the molecular basis for the antimicrobial action of this peptide, Moringa oleifera cationic protein (MOCP), has not been previously elucidated. We demonstrate here that a dominant mechanism of MOCP antimicrobial activity is membrane fusion. We used a combination of cryogenic electron microscopy (cryo-EM) and fluorescence assays to observe and study the kinetics of fusion of membranes in liposomes representing model microbial cells. We also conducted cryo-EM experiments on E. coli cells where MOCP was seen to fuse the inner and outer membranes. Coarse-grained molecular dynamics simulations of membrane vesicles with MOCP molecules were used to elucidate steps in peptide adsorption, stalk formation, and fusion between membranes.

Elastin-like-polypeptide based fusion proteins for osteogenic factor delivery in bone healing.

PubMed

McCarthy, Bryce; Yuan, Yuan; Koria, Piyush

2016-07-08

Modern treatments of bone injuries and diseases are becoming increasingly dependent on the usage of growth factors to stimulate bone growth. Bone morphogenetic protein-2 (BMP-2), a potent osteogenic inductive protein, exhibits promising results in treatment models, but recently has had its practical efficacy questioned due to the lack of local retention, ectopic bone formation, and potentially lethal inflammation. Where a new delivery technique of the BMP-2 is necessary, here we demonstrate the viability of an elastin-like peptide (ELP) fusion protein containing BMP-2 for delivery of the BMP-2. This fusion protein retains the performance characteristics of both the BMP-2 and ELP. The fusion protein was found to induce osteogenic differentiation of mesenchymal stem cells as evidenced by the production of alkaline phosphatase and extracellular calcium deposits in response to treatment by the fusion protein. Retention of the ELPs inverse phase transition property has allowed for expression of the fusion protein within a bacterial host (such as Escherichia coli) and easy and rapid purification using inverse transition cycling. The fusion protein formed self-aggregating nanoparticles at human-body temperature. The data collected suggests the viability of these fusion protein nanoparticles as a dosage-efficient and location-precise noncytotoxic delivery vehicle for BMP-2 in bone treatment. © 2016 American Institute of Chemical Engineers Biotechnol. Prog., 32:1029-1037, 2016. © 2016 American Institute of Chemical Engineers.

Fast degradable citrate-based bone scaffold promotes spinal fusion

PubMed Central

Tang, Jiajun; Guo, Jinshan; Li, Zhen; Yang, Cheng; Xie, Denghui; Chen, Jian; Li, Shengfa; Li, Shaolin; Kim, Gloria B.; Bai, Xiaochun; Zhang, Zhongmin; Yang, Jian

2015-01-01

It is well known that high rates of fusion failure and pseudoarthrosis development (5~35%) are concomitant in spinal fusion surgery, which was ascribed to the shortage of suitable materials for bone regeneration. Citrate was recently recognized to play an indispensable role in enhancing osteconductivity and osteoinductivity, and promoting bone formation. To address the material challenges in spinal fusion surgery, we have synthesized mechanically robust and fast degrading citrate-based polymers by incorporating N-methyldiethanolamine (MDEA) into clickable poly(1, 8-octanediol citrates) (POC-click), referred to as POC-M-click. The obtained POC-M-click were fabricated into POC-M-click-HA matchstick scaffolds by compositing with hydroxyapatite (HA) for interbody spinal fusion in a rabbit model. Spinal fusion was analyzed by radiography, manual palpation, biomechanical testing, and histological evaluation. At 4 and 8 weeks post surgery, POC-M-click-HA scaffolds presented optimal degradation rates that facilitated faster new bone formation and higher spinal fusion rates (11.2±3.7, 80±4.5 at week 4 and 8, respectively) than the poly(L-lactic acid)-HA (PLLA-HA) control group (9.3±2.4 and 71.1±4.4) (p<0.05). The POC-M-click-HA scaffold-fused vertebrates possessed a maximum load and stiffness of 880.8±14.5 N and 843.2±22.4 N/mm, respectively, which were also much higher than those of the PLLA-HA group (maximum: 712.0±37.5 N, stiffness: 622.5±28.4 N/mm, p<0.05). Overall, the results suggest that POC-M-click-HA scaffolds could potentially serve as promising bone grafts for spinal fusion applications. PMID:26213625

The SIGN nail for knee fusion: technique and clinical results

PubMed Central

Anderson, Duane Ray; Anderson, Lucas Aaron; Haller, Justin M.; Feyissa, Abebe Chala

2016-01-01

Purpose: Evaluate the efficacy of using the SIGN nail for instrumented knee fusion. Methods: Six consecutive patients (seven knees, three males) with an average age of 30.5 years (range, 18–50 years) underwent a knee arthrodesis with SIGN nail (mean follow-up 10.7 months; range, 8–14 months). Diagnoses included tuberculosis (two knees), congenital knee dislocation in two knees (one patient), bacterial septic arthritis (one knee), malunited spontaneous fusion (one knee), and severe gout with 90° flexion contracture (one knee). The nail was inserted through an anteromedial entry point on the femur and full weightbearing was permitted immediately. Results: All knees had clinical and radiographic evidence of fusion at final follow-up and none required further surgery. Four of six patients ambulated without assistive device, and all patients reported improved overall physical function. There were no post-operative complications. Conclusion: The technique described utilizing the SIGN nail is both safe and effective for knee arthrodesis and useful for austere environments with limited fluoroscopy and implant options. PMID:27163095

The SIGN nail for knee fusion: technique and clinical results.

PubMed

Anderson, Duane Ray; Anderson, Lucas Aaron; Haller, Justin M; Feyissa, Abebe Chala

2016-02-05

Evaluate the efficacy of using the SIGN nail for instrumented knee fusion. Six consecutive patients (seven knees, three males) with an average age of 30.5 years (range, 18-50 years) underwent a knee arthrodesis with SIGN nail (mean follow-up 10.7 months; range, 8-14 months). Diagnoses included tuberculosis (two knees), congenital knee dislocation in two knees (one patient), bacterial septic arthritis (one knee), malunited spontaneous fusion (one knee), and severe gout with 90° flexion contracture (one knee). The nail was inserted through an anteromedial entry point on the femur and full weightbearing was permitted immediately. All knees had clinical and radiographic evidence of fusion at final follow-up and none required further surgery. Four of six patients ambulated without assistive device, and all patients reported improved overall physical function. There were no post-operative complications. The technique described utilizing the SIGN nail is both safe and effective for knee arthrodesis and useful for austere environments with limited fluoroscopy and implant options.

Mitochondrial fusion increases the mitochondrial DNA copy number in budding yeast.

PubMed

Hori, Akiko; Yoshida, Minoru; Ling, Feng

2011-05-01

Mitochondrial fusion plays an important role in mitochondrial DNA (mtDNA) maintenance, although the underlying mechanisms are unclear. In budding yeast, certain levels of reactive oxygen species (ROS) can promote recombination-mediated mtDNA replication, and mtDNA maintenance depends on the homologous DNA pairing protein Mhr1. Here, we show that the fusion of isolated yeast mitochondria, which can be monitored by the bimolecular fluorescence complementation-derived green fluorescent protein (GFP) fluorescence, increases the mtDNA copy number in a manner dependent on Mhr1. The fusion event, accompanied by the degradation of dissociated electron transport chain complex IV and transient reductions in the complex IV subunits by the inner membrane AAA proteases such as Yme1, increases ROS levels. Analysis of the initial stage of mitochondrial fusion in early log-phase cells produced similar results. Moreover, higher ROS levels in mitochondrial fusion-deficient mutant cells increased the amount of newly synthesized mtDNA, resulting in increases in the mtDNA copy number. In contrast, reducing ROS levels in yme1 null mutant cells significantly decreased the mtDNA copy number, leading to an increase in cells lacking mtDNA. Our results indicate that mitochondrial fusion induces mtDNA synthesis by facilitating ROS-triggered, recombination-mediated replication and thereby prevents the generation of mitochondria lacking DNA. © 2011 The Authors. Journal compilation © 2011 by the Molecular Biology Society of Japan/Blackwell Publishing Ltd.

Independent evolutionary origins of functional polyamine biosynthetic enzyme fusions catalyzing de novo diamine to triamine formation

PubMed Central

Green, Robert; Hanfrey, Colin C.; Elliott, Katherine A.; McCloskey, Diane E.; Wang, Xiaojing; Kanugula, Sreenivas; Pegg, Anthony E.; Michael, Anthony J.

2011-01-01

Summary We have identified gene fusions of polyamine biosynthetic enzymes S-adenosylmethionine decarboxylase (AdoMetDC, speD) and aminopropyltransferase (speE) orthologues in diverse bacterial phyla. Both domains are functionally active and we demonstrate the novel de novo synthesis of the triamine spermidine from the diamine putrescine by fusion enzymes from β-proteobacterium Delftia acidovorans and δ-proteobacterium Syntrophus aciditrophicus, in a ΔspeDE gene deletion strain of Salmonella enterica sv. Typhimurium. Fusion proteins from marine α-proteobacterium Candidatus Pelagibacter ubique, actinobacterium Nocardia farcinica, chlorobi species Chloroherpeton thalassium, and β-proteobacterium Delftia acidovorans each produce a different profile of non-native polyamines including sym-norspermidine when expressed in Escherichia coli. The different aminopropyltransferase activities together with phylogenetic analysis confirm independent evolutionary origins for some fusions. Comparative genomic analysis strongly indicates that gene fusions arose by merger of adjacent open reading frames. Independent fusion events, and horizontal and vertical gene transfer contributed to the scattered phyletic distribution of the gene fusions. Surprisingly, expression of fusion genes in E. coli and S. Typhimurium revealed novel latent spermidine catabolic activity producing non-native 1,3-diaminopropane in these species. We have also identified fusions of polyamine biosynthetic enzymes agmatine deiminase and N-carbamoylputrescine amidohydrolase in archaea, and of S-adenosylmethionine decarboxylase and ornithine decarboxylase in the single-celled green alga Micromonas. PMID:21762220

Fusion 2.0: The Next Generation of Fusion in California: Aligning State and Regional Fusion Centers

DTIC Science & Technology

2010-03-01

bible ” for fusion center management, as evidenced by the theme of the 2009 National Fusion Center Conference; appropriately called “Achieving Baseline...NAVAL POSTGRADUATE SCHOOL MONTEREY, CALIFORNIA THESIS FUSION 2.0: THE NEXT GENERATION OF FUSION IN CALIFORNIA: ALIGNING STATE AND...Master’s Thesis 4. TITLE AND SUBTITLE Fusion 2.0: The Next Generation of Fusion in California: Aligning State and Regional Fusion

Moraxella catarrhalis synthesizes an autotransporter that is an acid phosphatase.

PubMed

Hoopman, Todd C; Wang, Wei; Brautigam, Chad A; Sedillo, Jennifer L; Reilly, Thomas J; Hansen, Eric J

2008-02-01

Moraxella catarrhalis O35E was shown to synthesize a 105-kDa protein that has similarity to both acid phosphatases and autotransporters. The N-terminal portion of the M. catarrhalis acid phosphatase A (MapA) was most similar (the BLAST probability score was 10(-10)) to bacterial class A nonspecific acid phosphatases. The central region of the MapA protein had similarity to passenger domains of other autotransporter proteins, whereas the C-terminal portion of MapA resembled the translocation domain of conventional autotransporters. Cloning and expression of the M. catarrhalis mapA gene in Escherichia coli confirmed the presence of acid phosphatase activity in the MapA protein. The MapA protein was shown to be localized to the outer membrane of M. catarrhalis and was not detected either in the soluble cytoplasmic fraction from disrupted M. catarrhalis cells or in the spent culture supernatant fluid from M. catarrhalis. Use of the predicted MapA translocation domain in a fusion construct with the passenger domain from another predicted M. catarrhalis autotransporter confirmed the translocation ability of this MapA domain. Inactivation of the mapA gene in M. catarrhalis strain O35E reduced the acid phosphatase activity expressed by this organism, and this mutation could be complemented in trans with the wild-type mapA gene. Nucleotide sequence analysis of the mapA gene from six M. catarrhalis strains showed that this protein was highly conserved among strains of this pathogen. Site-directed mutagenesis of a critical histidine residue (H233A) in the predicted active site of the acid phosphatase domain in MapA eliminated acid phosphatase activity in the recombinant MapA protein. This is the first description of an autotransporter protein that expresses acid phosphatase activity.

Moraxella catarrhalis Synthesizes an Autotransporter That Is an Acid Phosphatase▿

PubMed Central

Hoopman, Todd C.; Wang, Wei; Brautigam, Chad A.; Sedillo, Jennifer L.; Reilly, Thomas J.; Hansen, Eric J.

2008-01-01

Moraxella catarrhalis O35E was shown to synthesize a 105-kDa protein that has similarity to both acid phosphatases and autotransporters. The N-terminal portion of the M. catarrhalis acid phosphatase A (MapA) was most similar (the BLAST probability score was 10−10) to bacterial class A nonspecific acid phosphatases. The central region of the MapA protein had similarity to passenger domains of other autotransporter proteins, whereas the C-terminal portion of MapA resembled the translocation domain of conventional autotransporters. Cloning and expression of the M. catarrhalis mapA gene in Escherichia coli confirmed the presence of acid phosphatase activity in the MapA protein. The MapA protein was shown to be localized to the outer membrane of M. catarrhalis and was not detected either in the soluble cytoplasmic fraction from disrupted M. catarrhalis cells or in the spent culture supernatant fluid from M. catarrhalis. Use of the predicted MapA translocation domain in a fusion construct with the passenger domain from another predicted M. catarrhalis autotransporter confirmed the translocation ability of this MapA domain. Inactivation of the mapA gene in M. catarrhalis strain O35E reduced the acid phosphatase activity expressed by this organism, and this mutation could be complemented in trans with the wild-type mapA gene. Nucleotide sequence analysis of the mapA gene from six M. catarrhalis strains showed that this protein was highly conserved among strains of this pathogen. Site-directed mutagenesis of a critical histidine residue (H233A) in the predicted active site of the acid phosphatase domain in MapA eliminated acid phosphatase activity in the recombinant MapA protein. This is the first description of an autotransporter protein that expresses acid phosphatase activity. PMID:18065547

Quality assessment of remote sensing image fusion using feature-based fourth-order correlation coefficient

NASA Astrophysics Data System (ADS)

Ma, Dan; Liu, Jun; Chen, Kai; Li, Huali; Liu, Ping; Chen, Huijuan; Qian, Jing

2016-04-01

In remote sensing fusion, the spatial details of a panchromatic (PAN) image and the spectrum information of multispectral (MS) images will be transferred into fused images according to the characteristics of the human visual system. Thus, a remote sensing image fusion quality assessment called feature-based fourth-order correlation coefficient (FFOCC) is proposed. FFOCC is based on the feature-based coefficient concept. Spatial features related to spatial details of the PAN image and spectral features related to the spectrum information of MS images are first extracted from the fused image. Then, the fourth-order correlation coefficient between the spatial and spectral features is calculated and treated as the assessment result. FFOCC was then compared with existing widely used indices, such as Erreur Relative Globale Adimensionnelle de Synthese, and quality assessed with no reference. Results of the fusion and distortion experiments indicate that the FFOCC is consistent with subjective evaluation. FFOCC significantly outperforms the other indices in evaluating fusion images that are produced by different fusion methods and that are distorted in spatial and spectral features by blurring, adding noise, and changing intensity. All the findings indicate that the proposed method is an objective and effective quality assessment for remote sensing image fusion.

Synthesis of [18F]-labelled Maltose Derivatives as PET Tracers for Imaging Bacterial Infection

PubMed Central

Namavari, Mohammad; Gowrishankar, Gayatri; Hoehne, Aileen; Jouannot, Erwan; Gambhir, Sanjiv S

2015-01-01

Purpose To develop novel positron emission tomography (PET) agents for visualization and therapy monitoring of bacterial infections. Procedures It is known that maltose and maltodextrins are energy sources for bacteria. Hence, 18F-labelled maltose derivatives could be a valuable tool for imaging bacterial infections. We have developed methods to synthesize 4-O-(α-D-glucopyranosyl)-6-deoxy-6-[18F]fluoro-D-glucopyranoside (6-[18F]fluoromaltose) and 4-O-(α-D-glucopyranosyl)-1-deoxy-1-[18F]fluoro-D-glucopyranoside (1-[18F]fluoromaltose) as bacterial infection PET imaging agents. 6-[18F]fluoromaltose was prepared from precursor 1,2,3-tri-O-acetyl-4-O-(2′,3′,-di-O-acetyl-4′,6′-benzylidene-α-D-glucopyranosyl)-6-deoxy-6-nosyl-D-glucopranoside (5). The synthesis involved the radio-fluorination of 5 followed by acidic and basic hydrolysis to give 6-[18F]fluoromaltose. In an analogous procedure, 1-[18F]fluoromaltose was synthesized from 2,3, 6-tri-O-acetyl-4-O-(2′,3′,4′,6-tetra-O-acetyl-α-D-glucopyranosyl)-1-deoxy-1-O-triflyl-D-glucopranoside (9). Stability of 6-[18F]fluoromaltose in phosphate-buffered saline (PBS) and human and mouse serum at 37 °C was determined. Escherichia coli uptake of 6-[18F]fluoromaltose was examined. Results A reliable synthesis of 1- and 6-[18F]fluoromaltose has been accomplished with 4–6 and 5–8 % radiochemical yields, respectively (decay-corrected with 95 % radiochemical purity). 6-[18F]fluoromaltose was sufficiently stable over the time span needed for PET studies (~96 % intact compound after 1-h and ~65 % after 2-h incubation in serum). Bacterial uptake experiments indicated that E. coli transports 6-[18F]fluoromaltose. Competition assays showed that the uptake of 6-[18F]fluoromaltose was completely blocked by co-incubation with 1 mM of the natural substrate maltose. Conclusion We have successfully synthesized 1- and 6-[18F]fluoromaltose via direct fluorination of appropriate protected maltose precursors. Bacterial uptake

Nanostructural reorganization of bacterial cellulose by ultrasonic treatment.

PubMed

Tischer, Paula C S Faria; Sierakowski, Maria Rita; Westfahl, Harry; Tischer, Cesar Augusto

2010-05-10

In this work, bacterial cellulose was subjected to a high-power ultrasonic treatment for different time intervals. The morphological analysis, scanning electron microscopy, and atomic force microscopy revealed that this treatment changed the width and height of the microfibrillar ribbons and roughness of their surface, originating films with new nanostructures. Differential thermal analysis showed a higher thermal stability for ultrasonicated samples with a pyrolysis onset temperature of 208 degrees C for native bacterial cellulose and 250 and 268 degrees C for the modified samples. The small-angle X-ray scattering experiments demonstrated that the treatment with ultrasound increased the thickness of the ribbons, while wide-angle X-ray scattering experiments demonstrated that the average crystallite dimension and the degree of crystallinity also increased. A model is proposed where the thicker ribbons and crystallites result from the fusion of neighboring ribbons due to cavitation effects.

T-cell immunotherapy for human MK-1-expressing tumors using a fusion protein of the superantigen SEA and anti-MK-1 scFv antibody.

PubMed

Ueno, Aruto; Arakawa, Fumiko; Abe, Hironori; Matsumoto, Hisanobu; Kudo, Toshio; Asano, Ryutaro; Tsumoto, Kohei; Kumagai, Izumi; Kuroki, Motomu; Kuroki, Masahide

2002-01-01

The bacterial superantigen staphylococcal enterotoxin A (SEA) is an extremely potent activator of T lymphocytes when presented on major histocompatibility complex (MHC) class II molecules. To develop a tumor-specific superantigen for cancer therapy, we constructed a recombinant fusion protein of SEA and the single-chain variable fragment (scFv) of the FU-MK-1 antibody, which recognizes a glycoprotein antigen (termed MK-1 antigen) present on most carcinomas. We employed recombinant DNA techniques to fuse recombinant mutant SEA to an scFv antibody derived from FU-MK-1 and the resulting fusion protein (SEA/FUscFv) was produced by a bacterial expression system, purified with a metal-affinity column, and characterized for its MK-1-binding specificity and its antitumor activity. The SEA/FUscFv fusion protein retained the reactivity with MK-1-expressing tumor cells, introduced a specific cytotoxicity of lymphokine-activated killer T-cells to the tumor cells, and consequently suppressed the tumor growth in a SCID mouse xenograft model. This genetically engineered SEA/FUscFv fusion protein may serve as a potentially useful immunotherapeutic reagent for human MK-1-expressing tumors.

Genes Sufficient for Synthesizing Peptidoglycan are Retained in Gymnosperm Genomes, and MurE from Larix gmelinii can Rescue the Albino Phenotype of Arabidopsis MurE Mutation.

PubMed

Lin, Xiaofei; Li, Ningning; Kudo, Hiromi; Zhang, Zhe; Li, Jinyu; Wang, Li; Zhang, Wenbo; Takechi, Katsuaki; Takano, Hiroyoshi

2017-03-01

The endosymbiotic theory states that plastids are derived from a single cyanobacterial ancestor that possessed a cell wall. Peptidoglycan (PG), the main component of the bacteria cell wall, gradually degraded during plastid evolution. PG-synthesizing Mur genes have been found to be retained in the genomes of basal streptophyte plants, although many of them have been lost from the genomes of angiosperms. The enzyme encoded by bacterial MurE genes catalyzes the formation of the UDP-N-acetylmuramic acid (UDP-MurNAc) tripeptide in bacterial PG biosynthesis. Knockout of the MurE gene in the moss Physcomitrella patens resulted in defects of chloroplast division, whereas T-DNA-tagged mutants of Arabidopsis thaliana for MurE revealed inhibition of chloroplast development but not of plastid division, suggesting that AtMurE is functionally divergent from the bacterial and moss MurE proteins. Here, we could identify 10 homologs of bacterial Mur genes, including MurE, in the recently sequenced genomes of Picea abies and Pinus taeda, suggesting the retention of the plastid PG system in gymnosperms. To investigate the function of gymnosperm MurE, we isolated an ortholog of MurE from the larch, Larix gmelinii (LgMurE) and confirmed its presence as a single copy per genome, as well as its abundant expression in the leaves of larch seedlings. Analysis with a fusion protein combining green fluorescent protein and LgMurE suggested that it localizes in chloroplasts. Cross-species complementation assay with MurE mutants of A. thaliana and P. patens showed that the expression of LgMurE cDNA completely rescued the albefaction defects in A. thaliana but did not rescue the macrochloroplast phenotype in P. patens. The evolution of plastid PG and the mechanism behind the functional divergence of MurE genes are discussed in the context of information about plant genomes at different evolutionary stages. © The Author 2017. Published by Oxford University Press on behalf of Japanese Society of

Bacterial production of the biodegradable plastics polyhydroxyalkanoates.

PubMed

Urtuvia, Viviana; Villegas, Pamela; González, Myriam; Seeger, Michael

2014-09-01

Petroleum-based plastics constitute a major environmental problem due to their low biodegradability and accumulation in various environments. Therefore, searching for novel biodegradable plastics is of increasing interest. Microbial polyesters known as polyhydroxyalkanoates (PHAs) are biodegradable plastics. Life cycle assessment indicates that PHB is more beneficial than petroleum-based plastics. In this report, bacterial production of PHAs and their industrial applications are reviewed and the synthesis of PHAs in Burkholderia xenovorans LB400 is described. PHAs are synthesized by a large number of microorganisms during unbalanced nutritional conditions. These polymers are accumulated as carbon and energy reserve in discrete granules in the bacterial cytoplasm. 3-hydroxybutyrate and 3-hydroxyvalerate are two main PHA units among 150 monomers that have been reported. B. xenovorans LB400 is a model bacterium for the degradation of polychlorobiphenyls and a wide range of aromatic compounds. A bioinformatic analysis of LB400 genome indicated the presence of pha genes encoding enzymes of pathways for PHA synthesis. This study showed that B. xenovorans LB400 synthesize PHAs under nutrient limitation. Staining with Sudan Black B indicated the production of PHAs by B. xenovorans LB400 colonies. The PHAs produced were characterized by GC-MS. Diverse substrates for the production of PHAs in strain LB400 were analyzed. Copyright © 2014 Elsevier B.V. All rights reserved.

EDITORIAL: The Nuclear Fusion Award The Nuclear Fusion Award

NASA Astrophysics Data System (ADS)

Kikuchi, M.

2011-01-01

The Nuclear Fusion Award ceremony for 2009 and 2010 award winners was held during the 23rd IAEA Fusion Energy Conference in Daejeon. This time, both 2009 and 2010 award winners were celebrated by the IAEA and the participants of the 23rd IAEA Fusion Energy Conference. The Nuclear Fusion Award is a paper prize to acknowledge the best distinguished paper among the published papers in a particular volume of the Nuclear Fusion journal. Among the top-cited and highly-recommended papers chosen by the Editorial Board, excluding overview and review papers, and by analyzing self-citation and non-self-citation with an emphasis on non-self-citation, the Editorial Board confidentially selects ten distinguished papers as nominees for the Nuclear Fusion Award. Certificates are given to the leading authors of the Nuclear Fusion Award nominees. The final winner is selected among the ten nominees by the Nuclear Fusion Editorial Board voting confidentially. 2009 Nuclear Fusion Award nominees For the 2009 award, the papers published in the 2006 volume were assessed and the following papers were nominated, most of which are magnetic confinement experiments, theory and modeling, while one addresses inertial confinement. Sabbagh S.A. et al 2006 Resistive wall stabilized operation in rotating high beta NSTX plasmas Nucl. Fusion 46 635-44 La Haye R.J. et al 2006 Cross-machine benchmarking for ITER of neoclassical tearing mode stabilization by electron cyclotron current drive Nucl. Fusion 46 451-61 Honrubia J.J. et al 2006 Three-dimensional fast electron transport for ignition-scale inertial fusion capsules Nucl. Fusion 46 L25-8 Ido T. et al 2006 Observation of the interaction between the geodesic acoustic mode and ambient fluctuation in the JFT-2M tokamak Nucl. Fusion 46 512-20 Plyusnin V.V. et al 2006 Study of runaway electron generation during major disruptions in JET Nucl. Fusion 46 277-84 Pitts R.A. et al 2006 Far SOL ELM ion energies in JET Nucl. Fusion 46 82-98 Berk H.L. et al 2006

Export of FepA::PhoA fusion proteins to the outer membrane of Escherichia coli K-12.

PubMed

Murphy, C K; Klebba, P E

1989-11-01

A library of fepA::phoA gene fusions was generated in order to study the structure and secretion of the Escherichia coli K-12 ferric enterobactin receptor, FepA. All of the fusion proteins contained various lengths of the amino-terminal portion of FepA fused in frame to the catalytic portion of bacterial alkaline phosphatase. Localization of FepA::PhoA fusion proteins in the cell envelope was dependent on the number of residues of mature FepA present at the amino terminus. Hybrids containing up to one-third of the amino-terminal portion of FepA fractionated with their periplasm, while those containing longer sequences of mature FepA were exported to the outer membrane. Outer membrane-localized fusion proteins expressed FepA sequences on the external face of the outer membrane and alkaline phosphatase moieties in the periplasmic space. From sequence determinations of the fepA::phoA fusion joints, residues within FepA which may be exposed on the periplasmic side of the outer membrane were identified.

Fusion

NASA Astrophysics Data System (ADS)

Herman, Robin

1990-10-01

The book abounds with fascinating anecdotes about fusion's rocky path: the spurious claim by Argentine dictator Juan Peron in 1951 that his country had built a working fusion reactor, the rush by the United States to drop secrecy and publicize its fusion work as a propaganda offensive after the Russian success with Sputnik; the fortune Penthouse magazine publisher Bob Guccione sank into an unconventional fusion device, the skepticism that met an assertion by two University of Utah chemists in 1989 that they had created "cold fusion" in a bottle. Aimed at a general audience, the book describes the scientific basis of controlled fusion--the fusing of atomic nuclei, under conditions hotter than the sun, to release energy. Using personal recollections of scientists involved, it traces the history of this little-known international race that began during the Cold War in secret laboratories in the United States, Great Britain and the Soviet Union, and evolved into an astonishingly open collaboration between East and West.

A bacterial type III secretion-based protein delivery tool for broad applications in cell biology.

PubMed

Ittig, Simon J; Schmutz, Christoph; Kasper, Christoph A; Amstutz, Marlise; Schmidt, Alexander; Sauteur, Loïc; Vigano, M Alessandra; Low, Shyan Huey; Affolter, Markus; Cornelis, Guy R; Nigg, Erich A; Arrieumerlou, Cécile

2015-11-23

Methods enabling the delivery of proteins into eukaryotic cells are essential to address protein functions. Here we propose broad applications to cell biology for a protein delivery tool based on bacterial type III secretion (T3S). We show that bacterial, viral, and human proteins, fused to the N-terminal fragment of the Yersinia enterocolitica T3S substrate YopE, are effectively delivered into target cells in a fast and controllable manner via the injectisome of extracellular bacteria. This method enables functional interaction studies by the simultaneous injection of multiple proteins and allows the targeting of proteins to different subcellular locations by use of nanobody-fusion proteins. After delivery, proteins can be freed from the YopE fragment by a T3S-translocated viral protease or fusion to ubiquitin and cleavage by endogenous ubiquitin proteases. Finally, we show that this delivery tool is suitable to inject proteins in living animals and combine it with phosphoproteomics to characterize the systems-level impact of proapoptotic human truncated BID on the cellular network. © 2015 Ittig et al.

Detail-enhanced multimodality medical image fusion based on gradient minimization smoothing filter and shearing filter.

PubMed

Liu, Xingbin; Mei, Wenbo; Du, Huiqian

2018-02-13

In this paper, a detail-enhanced multimodality medical image fusion algorithm is proposed by using proposed multi-scale joint decomposition framework (MJDF) and shearing filter (SF). The MJDF constructed with gradient minimization smoothing filter (GMSF) and Gaussian low-pass filter (GLF) is used to decompose source images into low-pass layers, edge layers, and detail layers at multiple scales. In order to highlight the detail information in the fused image, the edge layer and the detail layer in each scale are weighted combined into a detail-enhanced layer. As directional filter is effective in capturing salient information, so SF is applied to the detail-enhanced layer to extract geometrical features and obtain directional coefficients. Visual saliency map-based fusion rule is designed for fusing low-pass layers, and the sum of standard deviation is used as activity level measurement for directional coefficients fusion. The final fusion result is obtained by synthesizing the fused low-pass layers and directional coefficients. Experimental results show that the proposed method with shift-invariance, directional selectivity, and detail-enhanced property is efficient in preserving and enhancing detail information of multimodality medical images. Graphical abstract The detailed implementation of the proposed medical image fusion algorithm.

Enhance field water-color measurements with a Secchi disk and its implication for fusion of active and passive ocean-color remote sensing.

PubMed

Lee, Zhongping; Shang, Shaoling; Du, Keping; Liu, Bingyi; Lin, Gong; Wei, Jianwei; Li, Xiaolong

2018-05-01

Inversion of the total absorption (a) and backscattering coefficients of bulk water through a fusion of remote sensing reflectance (R rs ) and Secchi disk depth (Z SD ) is developed. An application of such a system to a synthesized wide-range dataset shows a reduction of ∼3 folds in the uncertainties of inverted a(λ) (in a range of ∼0.01-6.8  m -1 ) from R rs (λ) for the 350-560 nm range. Such a fusion is further proposed to process concurrent active (ocean LiDAR) and passive (ocean-color) measurements, which can lead to nearly "exact" analytical inversion of an R rs spectrum. With such a fusion, it is found that the uncertainty in the inverted total a in the 350-560 nm range could be reduced to ∼2% for the synthesized data, which can thus significantly improve the derivation of a coefficients of other varying components. Although the inclusion of Z SD places an extra constraint in the inversion of R rs , no apparent improvement over the quasi-analytical algorithm (QAA) was found when the fusion of Z SD and R rs was applied to a field dataset, which calls for more accurate determination of the absorption coefficients from water samples.

Screening Fusion Tags for Improved Recombinant Protein Expression in E. coli with the Expresso® Solubility and Expression Screening System.

PubMed

Steinmetz, Eric J; Auldridge, Michele E

2017-11-01

The simplicity, speed, and low cost of bacterial culture make E. coli the system of choice for most initial trials of recombinant protein expression. However, many heterologous proteins are either poorly expressed in bacteria, or are produced as incorrectly folded, insoluble aggregates that lack the activity of the native protein. In many cases, fusion to a partner protein can allow for improved expression and/or solubility of a difficult target protein. Although several different fusion partners have gained favor, none are universally effective, and identifying the one that best improves soluble expression of a given target protein is an empirical process. This unit presents a strategy for parallel screening of fusion partners for enhanced expression or solubility. The Expresso® Solubility and Expression Screening System includes a panel of seven distinct fusion partners and utilizes an extremely simple cloning strategy to enable rapid screening and identification of the most effective fusion partner. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.

Development of Rare Bacterial Monosaccharide Analogs for Metabolic Glycan Labeling in Pathogenic Bacteria.

PubMed

Clark, Emily L; Emmadi, Madhu; Krupp, Katharine L; Podilapu, Ananda R; Helble, Jennifer D; Kulkarni, Suvarn S; Dube, Danielle H

2016-12-16

Bacterial glycans contain rare, exclusively bacterial monosaccharides that are frequently linked to pathogenesis and essentially absent from human cells. Therefore, bacterial glycans are intriguing molecular targets. However, systematic discovery of bacterial glycoproteins is hampered by the presence of rare deoxy amino sugars, which are refractory to traditional glycan-binding reagents. Thus, the development of chemical tools that label bacterial glycans is a crucial step toward discovering and targeting these biomolecules. Here, we explore the extent to which metabolic glycan labeling facilitates the studying and targeting of glycoproteins in a range of pathogenic and symbiotic bacterial strains. We began with an azide-containing analog of the naturally abundant monosaccharide N-acetylglucosamine and discovered that it is not broadly incorporated into bacterial glycans, thus revealing a need for additional azidosugar substrates to broaden the utility of metabolic glycan labeling in bacteria. Therefore, we designed and synthesized analogs of the rare deoxy amino d-sugars N-acetylfucosamine, bacillosamine, and 2,4-diacetamido-2,4,6-trideoxygalactose and established that these analogs are differentially incorporated into glycan-containing structures in a range of pathogenic and symbiotic bacterial species. Further application of these analogs will refine our knowledge of the glycan repertoire in diverse bacteria and may find utility in treating a variety of infectious diseases with selectivity.

Cell-fusion method to visualize interphase nuclear pore formation.

PubMed

Maeshima, Kazuhiro; Funakoshi, Tomoko; Imamoto, Naoko

2014-01-01

In eukaryotic cells, the nucleus is a complex and sophisticated organelle that organizes genomic DNA to support essential cellular functions. The nuclear surface contains many nuclear pore complexes (NPCs), channels for macromolecular transport between the cytoplasm and nucleus. It is well known that the number of NPCs almost doubles during interphase in cycling cells. However, the mechanism of NPC formation is poorly understood, presumably because a practical system for analysis does not exist. The most difficult obstacle in the visualization of interphase NPC formation is that NPCs already exist after nuclear envelope formation, and these existing NPCs interfere with the observation of nascent NPCs. To overcome this obstacle, we developed a novel system using the cell-fusion technique (heterokaryon method), previously also used to analyze the shuttling of macromolecules between the cytoplasm and the nucleus, to visualize the newly synthesized interphase NPCs. In addition, we used a photobleaching approach that validated the cell-fusion method. We recently used these methods to demonstrate the role of cyclin-dependent protein kinases and of Pom121 in interphase NPC formation in cycling human cells. Here, we describe the details of the cell-fusion approach and compare the system with other NPC formation visualization methods. Copyright © 2014 Elsevier Inc. All rights reserved.

Proteomic analysis of the bacterial cell cycle

PubMed Central

Grünenfelder, Björn; Rummel, Gabriele; Vohradsky, Jiri; Röder, Daniel; Langen, Hanno; Jenal, Urs

2001-01-01

A global approach was used to analyze protein synthesis and stability during the cell cycle of the bacterium Caulobacter crescentus. Approximately one-fourth (979) of the estimated C. crescentus gene products were detected by two-dimensional gel electrophoresis, 144 of which showed differential cell cycle expression patterns. Eighty-one of these proteins were identified by mass spectrometry and were assigned to a wide variety of functional groups. Pattern analysis revealed that coexpression groups were functionally clustered. A total of 48 proteins were rapidly degraded in the course of one cell cycle. More than half of these unstable proteins were also found to be synthesized in a cell cycle-dependent manner, establishing a strong correlation between rapid protein turnover and the periodicity of the bacterial cell cycle. This is, to our knowledge, the first evidence for a global role of proteolysis in bacterial cell cycle control. PMID:11287652

Novel Bacterial Proteins and Lipids Reveal the Diversity of Triterpenoid Biomarker Synthesis

NASA Astrophysics Data System (ADS)

Wei, J. H.; Banta, A. B.; Gill, C. C. C.; Giner, J. L.; Welander, P. V.

2017-12-01

Lipids preserved in sediments and rocks function as organic biomarkers providing evidence for the types of organisms that lived in ancient environments. We use a combined approach utilizing comparative genomics, molecular biology, and lipid analysis to discover novel cyclic triteprenoid lipids and their biosynthetic pathways in bacteria. Here, we present two cases of bacterial synthesis of pentacylic triterpenols previously thought to be indicative of eukaryotes, which address current incongruities in the fossil record. Cyclic triterpenoid lipids, such as hopanoids and sterols, are generally associated with bacteria and eukaryotes, respectively. The pentacyclic triterpenoid tetrahymanol, first discovered in the ciliate Tetrahymena pyriformis, and its diagenetic product gammacerane, have been previously interpreted as markers for eukaryotes and linked to water column stratification. Yet the occurrence of tetrahymanol in bacteria implies our knowledge of extant tetrahymanol producers is not complete. Through comparative genomics we identified a new gene required for tetrahymanol synthesis in the bacterium Methylomicrobium alcaliphilum. This gene encodes a novel enzyme, Tetrahymanol synthase (THS), that synthesizes tetrahymanol from the hopanoid diploptene demonstrating a pathway for tetrahymanol production in bacteria distinct from that in eukaryotes. We bionformatically identified THS homologs in 104 bacterial genomes and 472 metagenomes, implying a great diversity of tetrahymanol producers. Lipids of the arborane class, such as iso-arborinol, are commonly found in modern angiosperms. Arobranes are synthesized by the enzyme oxidosqualene cyclase (OSC), which in plants can form both tetra and pentacyclic molecules. While bacteria are known to produce tetracyclic sterol compounds, bacterial synthesis of pentacyclic arborane class triterpenols of this class were previously undiscovered. We have identified a bacterium, Eudoraea adriatica, whose OSC synthesizes

Inhibition of Bacteria Associated with Wound Infection by Biocompatible Green Synthesized Gold Nanoparticles from South African Plant Extracts

PubMed Central

Elbagory, Abdulrahman M.; Meyer, Mervin; Cupido, Christopher N.

2017-01-01

Unlike conventional physical and chemical methods, the biogenic synthesis of gold nanoparticles (GNPs) is considered a green and non-toxic approach to produce biocompatible GNPs that can be utilized in various biomedical applications. This can be achieved by using plant-derived phytochemicals to reduce gold salt into GNPs. Several green synthesized GNPs have been shown to have antibacterial effects, which can be applied in wound dressings to prevent wound infections. Therefore, the aim of this study is to synthesize biogenic GNPs from the South African Galenia africana and Hypoxis hemerocallidea plants extracts and evaluate their antibacterial activity, using the Alamar blue assay, against bacterial strains that are known to cause wound infections. Additionally, we investigated the toxicity of the biogenic GNPs to non-cancerous human fibroblast cells (KMST-6) using 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyl tetrazolium bromide (MTT) assay. In this paper, spherical GNPs, with particle sizes ranging from 9 to 27 nm, were synthesized and fully characterized. The GNPs from H. hemerocallidea exhibited antibacterial activity against all the tested bacterial strains, whereas GNPs produced from G. africana only exhibited antibacterial activity against Pseudomonas aeruginosa. The GNPs did not show any significant toxicity towards KMST-6 cells, which may suggest that these nanoparticles can be safely applied in wound dressings. PMID:29186826

High Level Information Fusion (HLIF) with nested fusion loops

NASA Astrophysics Data System (ADS)

Woodley, Robert; Gosnell, Michael; Fischer, Amber

2013-05-01

Situation modeling and threat prediction require higher levels of data fusion in order to provide actionable information. Beyond the sensor data and sources the analyst has access to, the use of out-sourced and re-sourced data is becoming common. Through the years, some common frameworks have emerged for dealing with information fusion—perhaps the most ubiquitous being the JDL Data Fusion Group and their initial 4-level data fusion model. Since these initial developments, numerous models of information fusion have emerged, hoping to better capture the human-centric process of data analyses within a machine-centric framework. 21st Century Systems, Inc. has developed Fusion with Uncertainty Reasoning using Nested Assessment Characterizer Elements (FURNACE) to address challenges of high level information fusion and handle bias, ambiguity, and uncertainty (BAU) for Situation Modeling, Threat Modeling, and Threat Prediction. It combines JDL fusion levels with nested fusion loops and state-of-the-art data reasoning. Initial research has shown that FURNACE is able to reduce BAU and improve the fusion process by allowing high level information fusion (HLIF) to affect lower levels without the double counting of information or other biasing issues. The initial FURNACE project was focused on the underlying algorithms to produce a fusion system able to handle BAU and repurposed data in a cohesive manner. FURNACE supports analyst's efforts to develop situation models, threat models, and threat predictions to increase situational awareness of the battlespace. FURNACE will not only revolutionize the military intelligence realm, but also benefit the larger homeland defense, law enforcement, and business intelligence markets.

Photocatalytic studies of electrochemically synthesized polysaccharide-functionalized ZnO nanoparticles

NASA Astrophysics Data System (ADS)

Kaur, Simranjeet; Kaur, Harpreet

2018-05-01

The present work reports the electrochemical synthesis of polysaccharide-functionalized ZnO nanoparticles using sodium hydroxide, starch, and zinc electrodes for the degradation of cationic dye (Rhodamine-B) under sunlight. Physiochemical properties of synthesized sample have been characterized by different techniques such as XRD, TEM, FESEM, EDS, IR, and UV-visible spectroscopic techniques. The influence of various factors such as effect of dye concentration, contact time, amount of photocatalyst, and pH has been studied. The results obtained from the photodegradation study showed that degradation rate of Rhodamine-B dye has been increased with increase of amount of photocatalyst and decreased with increase in initial dye concentration. Furthermore, the kinetics of the degradation has been investigated. It has been found that the photodegradation of Rhodamine-B dye follows pseudo-first-order kinetics and prepared photocatalyst can effectively degrade the cationic dye. Thus, this ecofriendly and efficient photocatalyst can be used for the treatment of dye-contaminated water. This catalyst also showed the antibacterial activity against Bacillus pumilus and Escherichia coli bacterial strains, so the synthesized nanoparticles also have the pharmaceutical properties.

Antibacterial properties of silver nanoparticles synthesized by marine Ochrobactrum sp.

PubMed

Thomas, Roshmi; Janardhanan, Anju; Varghese, Rintu T; Soniya, E V; Mathew, Jyothis; Radhakrishnan, E K

2014-01-01

Metal nanoparticle synthesis is an interesting area in nanotechnology due to their remarkable optical, magnetic, electrical, catalytic and biomedical properties, but there needs to develop clean, non-toxic and environmental friendly methods for the synthesis and assembly of nanoparticles. Biological agents in the form of microbes have emerged up as efficient candidates for nanoparticle synthesis due to their extreme versatility to synthesize diverse nanoparticles with varying size and shape. In the present study, an eco favorable method for the biosynthesis of silver nanoparticles using marine bacterial isolate has been attempted. Very interestingly, molecular identification proved it as a strain of Ochrobactrum anhtropi. In addition, the isolate was found to have the potential to form silver nanoparticles intracellularly at room temperature within 24 h. The biosynthesized silver nanoparticles were characterized by UV-Vis spectroscopy, transmission electron microscope (TEM) and scanning electron microscope (SEM). The UV-visible spectrum of the aqueous medium containing silver nanoparticles showed a peak at 450 nm corresponding to the plasmon absorbance of silver nanoparticles. The SEM and TEM micrographs revealed that the synthesized silver nanoparticles were spherical in shape with a size range from 38 nm - 85 nm. The silver nanoparticles synthesized by the isolate were also used to explore its antibacterial potential against pathogens like Salmonella Typhi, Salmonella Paratyphi, Vibrio cholerae and Staphylococcus aureus.

Antibacterial properties of silver nanoparticles synthesized by marine Ochrobactrum sp

PubMed Central

Thomas, Roshmi; Janardhanan, Anju; Varghese, Rintu T.; Soniya, E.V.; Mathew, Jyothis; Radhakrishnan, E.K.

2014-01-01

Metal nanoparticle synthesis is an interesting area in nanotechnology due to their remarkable optical, magnetic, electrical, catalytic and biomedical properties, but there needs to develop clean, non-toxic and environmental friendly methods for the synthesis and assembly of nanoparticles. Biological agents in the form of microbes have emerged up as efficient candidates for nanoparticle synthesis due to their extreme versatility to synthesize diverse nanoparticles with varying size and shape. In the present study, an eco favorable method for the biosynthesis of silver nanoparticles using marine bacterial isolate has been attempted. Very interestingly, molecular identification proved it as a strain of Ochrobactrum anhtropi. In addition, the isolate was found to have the potential to form silver nanoparticles intracellularly at room temperature within 24 h. The biosynthesized silver nanoparticles were characterized by UV-Vis spectroscopy, transmission electron microscope (TEM) and scanning electron microscope (SEM). The UV-visible spectrum of the aqueous medium containing silver nanoparticles showed a peak at 450 nm corresponding to the plasmon absorbance of silver nanoparticles. The SEM and TEM micrographs revealed that the synthesized silver nanoparticles were spherical in shape with a size range from 38 nm – 85 nm. The silver nanoparticles synthesized by the isolate were also used to explore its antibacterial potential against pathogens like Salmonella Typhi, Salmonella Paratyphi, Vibrio cholerae and Staphylococcus aureus. PMID:25763025

Applications of Bacterial Magnetic Nanoparticles in Nanobiotechnology.

PubMed

Chen, Chuanfang; Wang, Pingping; Li, Linlin

2016-03-01

The bacterial magnetic nanoparticle (BMP) has been well researched in nanobiotechnology as a new magnetic crystal. The BMPs are extracted from magnetotactic bacteria and under precise biological control. Compared with engineered magnetic nanoparticles synthesized by chemical approaches, BMPs have the properties of large production, monodispersity, high crystallinity, and close-to-bulk magnetization, which enable BMPs to be the highly promising magnetic nanoparticles for nanobiotechnology. In this paper, we review the biomedical applications of BMPs in magnetic hyperthermia, drug treatment with tumour and bioseparation. In addition, the biodistribution and toxicity are also reviewed.

Fusion breeder

DOE Office of Scientific and Technical Information (OSTI.GOV)

Moir, R.W.

1982-02-22

The fusion breeder is a fusion reactor designed with special blankets to maximize the transmutation by 14 MeV neutrons of uranium-238 to plutonium or thorium to uranium-233 for use as a fuel for fission reactors. Breeding fissile fuels has not been a goal of the US fusion energy program. This paper suggests it is time for a policy change to make the fusion breeder a goal of the US fusion program and the US nuclear energy program. The purpose of this paper is to suggest this policy change be made and tell why it should be made, and to outlinemore » specific research and development goals so that the fusion breeder will be developed in time to meet fissile fuel needs.« less

Fusion breeder

DOE Office of Scientific and Technical Information (OSTI.GOV)

Moir, R.W.

1982-04-20

The fusion breeder is a fusion reactor designed with special blankets to maximize the transmutation by 14 MeV neutrons of uranium-238 to plutonium or thorium to uranium-233 for use as a fuel for fission reactors. Breeding fissile fuels has not been a goal of the US fusion energy program. This paper suggests it is time for a policy change to make the fusion breeder a goal of the US fusion program and the US nuclear energy program. The purpose of this paper is to suggest this policy change be made and tell why it should be made, and to outlinemore » specific research and development goals so that the fusion breeder will be developed in time to meet fissile fuel needs.« less

Viral membrane fusion

DOE Office of Scientific and Technical Information (OSTI.GOV)

Harrison, Stephen C., E-mail: harrison@crystal.harvard.edu

2015-05-15

Membrane fusion is an essential step when enveloped viruses enter cells. Lipid bilayer fusion requires catalysis to overcome a high kinetic barrier; viral fusion proteins are the agents that fulfill this catalytic function. Despite a variety of molecular architectures, these proteins facilitate fusion by essentially the same generic mechanism. Stimulated by a signal associated with arrival at the cell to be infected (e.g., receptor or co-receptor binding, proton binding in an endosome), they undergo a series of conformational changes. A hydrophobic segment (a “fusion loop” or “fusion peptide”) engages the target-cell membrane and collapse of the bridging intermediate thus formedmore » draws the two membranes (virus and cell) together. We know of three structural classes for viral fusion proteins. Structures for both pre- and postfusion conformations of illustrate the beginning and end points of a process that can be probed by single-virion measurements of fusion kinetics. - Highlights: • Viral fusion proteins overcome the high energy barrier to lipid bilayer merger. • Different molecular structures but the same catalytic mechanism. • Review describes properties of three known fusion-protein structural classes. • Single-virion fusion experiments elucidate mechanism.« less

Steady at the wheel: conservative sex and the benefits of bacterial transformation

PubMed Central

Ambur, Ole Herman; Engelstädter, Jan; Johnsen, Pål J.

2016-01-01

Many bacteria are highly sexual, but the reasons for their promiscuity remain obscure. Did bacterial sex evolve to maximize diversity and facilitate adaptation in a changing world, or does it instead help to retain the bacterial functions that work right now? In other words, is bacterial sex innovative or conservative? Our aim in this review is to integrate experimental, bioinformatic and theoretical studies to critically evaluate these alternatives, with a main focus on natural genetic transformation, the bacterial equivalent of eukaryotic sexual reproduction. First, we provide a general overview of several hypotheses that have been put forward to explain the evolution of transformation. Next, we synthesize a large body of evidence highlighting the numerous passive and active barriers to transformation that have evolved to protect bacteria from foreign DNA, thereby increasing the likelihood that transformation takes place among clonemates. Our critical review of the existing literature provides support for the view that bacterial transformation is maintained as a means of genomic conservation that provides direct benefits to both individual bacterial cells and to transformable bacterial populations. We examine the generality of this view across bacteria and contrast this explanation with the different evolutionary roles proposed to maintain sex in eukaryotes.  This article is part of the themed issue ‘Weird sex: the underappreciated diversity of sexual reproduction’. PMID:27619692

Steady at the wheel: conservative sex and the benefits of bacterial transformation.

PubMed

Ambur, Ole Herman; Engelstädter, Jan; Johnsen, Pål J; Miller, Eric L; Rozen, Daniel E

2016-10-19

Many bacteria are highly sexual, but the reasons for their promiscuity remain obscure. Did bacterial sex evolve to maximize diversity and facilitate adaptation in a changing world, or does it instead help to retain the bacterial functions that work right now? In other words, is bacterial sex innovative or conservative? Our aim in this review is to integrate experimental, bioinformatic and theoretical studies to critically evaluate these alternatives, with a main focus on natural genetic transformation, the bacterial equivalent of eukaryotic sexual reproduction. First, we provide a general overview of several hypotheses that have been put forward to explain the evolution of transformation. Next, we synthesize a large body of evidence highlighting the numerous passive and active barriers to transformation that have evolved to protect bacteria from foreign DNA, thereby increasing the likelihood that transformation takes place among clonemates. Our critical review of the existing literature provides support for the view that bacterial transformation is maintained as a means of genomic conservation that provides direct benefits to both individual bacterial cells and to transformable bacterial populations. We examine the generality of this view across bacteria and contrast this explanation with the different evolutionary roles proposed to maintain sex in eukaryotes. This article is part of the themed issue 'Weird sex: the underappreciated diversity of sexual reproduction'. © 2016 The Author(s).

Paramyxovirus fusion: Real-time measurement of parainfluenza virus 5 virus-cell fusion

DOE Office of Scientific and Technical Information (OSTI.GOV)

Connolly, Sarah A.; Lamb, Robert A.

2006-11-25

Although cell-cell fusion assays are useful surrogate methods for studying virus fusion, differences between cell-cell and virus-cell fusion exist. To examine paramyxovirus fusion in real time, we labeled viruses with fluorescent lipid probes and monitored virus-cell fusion by fluorimetry. Two parainfluenza virus 5 (PIV5) isolates (W3A and SER) and PIV5 containing mutations within the fusion protein (F) were studied. Fusion was specific and temperature-dependent. Compared to many low pH-dependent viruses, the kinetics of PIV5 fusion was slow, approaching completion within several minutes. As predicted from cell-cell fusion assays, virus containing an F protein with an extended cytoplasmic tail (rSV5 F551)more » had reduced fusion compared to wild-type virus (W3A). In contrast, virus-cell fusion for SER occurred at near wild-type levels, despite the fact that this isolate exhibits a severely reduced cell-cell fusion phenotype. These results support the notion that virus-cell and cell-cell fusion have significant differences.« less

Reactive Oxygen Species Mediated Bacterial Biofilm Inhibition via Zinc Oxide Nanoparticles and Their Statistical Determination

PubMed Central

Dwivedi, Sourabh; Wahab, Rizwan; Khan, Farheen; Mishra, Yogendra K.; Musarrat, Javed; Al-Khedhairy, Abdulaziz A.

2014-01-01

The formation of bacterial biofilm is a major challenge in clinical applications. The main aim of this study is to describe the synthesis, characterization and biocidal potential of zinc oxide nanoparticles (NPs) against bacterial strain Pseudomonas aeruginosa. These nanoparticles were synthesized via soft chemical solution process in a very short time and their structural properties have been investigated in detail by using X-ray diffraction and transmission electron microscopy measurements. In this work, the potential of synthesized ZnO-NPs (∼10–15 nm) has been assessed in-vitro inhibition of bacteria and the formation of their biofilms was observed using the tissue culture plate assays. The crystal violet staining on biofilm formation and its optical density revealed the effect on biofilm inhibition. The NPs at a concentration of 100 µg/mL significantly inhibited the growth of bacteria and biofilm formation. The biofilm inhibition by ZnO-NPs was also confirmed via bio-transmission electron microscopy (Bio-TEM). The Bio-TEM analysis of ZnO-NPs treated bacteria confirmed the deformation and damage of cells. The bacterial growth in presence of NPs concluded the bactericidal ability of NPs in a concentration dependent manner. It has been speculated that the antibacterial activity of NPs as a surface coating material, could be a feasible approach for controlling the pathogens. Additionally, the obtained bacterial solution data is also in agreement with the results from statistical analytical methods. PMID:25402188

Reactive oxygen species mediated bacterial biofilm inhibition via zinc oxide nanoparticles and their statistical determination.

PubMed

Dwivedi, Sourabh; Wahab, Rizwan; Khan, Farheen; Mishra, Yogendra K; Musarrat, Javed; Al-Khedhairy, Abdulaziz A

2014-01-01

The formation of bacterial biofilm is a major challenge in clinical applications. The main aim of this study is to describe the synthesis, characterization and biocidal potential of zinc oxide nanoparticles (NPs) against bacterial strain Pseudomonas aeruginosa. These nanoparticles were synthesized via soft chemical solution process in a very short time and their structural properties have been investigated in detail by using X-ray diffraction and transmission electron microscopy measurements. In this work, the potential of synthesized ZnO-NPs (∼ 10-15 nm) has been assessed in-vitro inhibition of bacteria and the formation of their biofilms was observed using the tissue culture plate assays. The crystal violet staining on biofilm formation and its optical density revealed the effect on biofilm inhibition. The NPs at a concentration of 100 µg/mL significantly inhibited the growth of bacteria and biofilm formation. The biofilm inhibition by ZnO-NPs was also confirmed via bio-transmission electron microscopy (Bio-TEM). The Bio-TEM analysis of ZnO-NPs treated bacteria confirmed the deformation and damage of cells. The bacterial growth in presence of NPs concluded the bactericidal ability of NPs in a concentration dependent manner. It has been speculated that the antibacterial activity of NPs as a surface coating material, could be a feasible approach for controlling the pathogens. Additionally, the obtained bacterial solution data is also in agreement with the results from statistical analytical methods.

Role of cytoskeleton in regulating fusion of nucleoli: a study using the activated mouse oocyte model.

PubMed

Lian, Hua-Yu; Jiao, Guang-Zhong; Wang, Hui-Li; Tan, Xiu-Wen; Wang, Tian-Yang; Zheng, Liang-Liang; Kong, Qiao-Qiao; Tan, Jing-He

2014-09-01

Although fusion of nucleoli was observed during pronuclear development of zygotes and the behavior of nucleoli in pronuclei has been suggested as an indicator of embryonic developmental potential, the mechanism for nucleolar fusion is unclear. Although both cytoskeleton and the nucleolus are important cellular entities, there are no special reports on the relationship between the two. Role of cytoskeleton in regulating fusion of nucleoli was studied using the activated mouse oocyte model. Mouse oocytes were cultured for 6 h in activating medium (Ca²⁺-free CZB medium containing 10 mM SrCl₂) supplemented with or without inhibitors for cytoskeleton or protein synthesis before pronuclear formation, nucleolar fusion, and the activity of maturation-promoting factor (MPF) were examined. Whereas treatment with microfilament inhibitor cytochalasin D or B or intermediate filament inhibitor acrylamide suppressed nucleolar fusion efficiently, treatment with microtubule inhibitor demecolcine or nocodazole or protein synthesis inhibitor cycloheximide had no effect. The cytochalasin D- or acrylamide-sensitive temporal window coincided well with the reported temporal window for nucleolar fusion in activated oocytes. Whereas a continuous incubation with demecolcine prevented pronuclear formation, pronuclei formed normally when demecolcine was excluded during the first hour of activation treatment when the MPF activity dropped dramatically. The results suggest that 1) microfilaments and intermediate filaments but not microtubules support nucleolar fusion, 2) proteins required for nucleolar fusion including microfilaments and intermediate filaments are not de novo synthesized, and 3) microtubule disruption prevents pronuclear formation by activating MPF. © 2014 by the Society for the Study of Reproduction, Inc.

Portable Speech Synthesizer

NASA Technical Reports Server (NTRS)

Leibfritz, Gilbert H.; Larson, Howard K.

1987-01-01

Compact speech synthesizer useful traveling companion to speech-handicapped. User simply enters statement on board, and synthesizer converts statement into spoken words. Battery-powered and housed in briefcase, easily carried on trips. Unit used on telephones and face-to-face communication. Synthesizer consists of micro-computer with memory-expansion module, speech-synthesizer circuit, batteries, recharger, dc-to-dc converter, and telephone amplifier. Components, commercially available, fit neatly in 17-by 13-by 5-in. briefcase. Weighs about 20 lb (9 kg) and operates and recharges from ac receptable.

TRAIL-CM4 fusion protein shows in vitro antibacterial activity and a stronger antitumor activity than solo TRAIL protein.

PubMed

Sang, Ming; Zhang, Jiaxin; Li, Bin; Chen, Yuqing

2016-06-01

A TRAIL-CM4 fusion protein in soluble form with tumor selective apoptosis and antibacterial functions was expressed in the Escherichia coli expression system and isolated through dialysis refolding and histidine-tag Nickel-affinity purification. Fresh Jurkat cells were treated with the TRAIL-CM4 fusion protein. Trypan blue staining and MTT analyses showed that, similar to a TRAIL positive control, Jurkat cell proliferation was significantly inhibited. Flow cytometry analyses using Annexin V-fluorescein revealed that Jurkat cells treated with the TRAIL-CM4 fusion protein exhibited increased apoptosis. Laser confocal microscopy showed that APB-CM4 and the fusion protein TRAIL-CM4 can bind to Jurkat cell membranes and initiate their destruction. ABP-CM4 enhances the antitumor activity of TRAIL by targeting and damaging the tumor cell membrane. In antibacterial experiments, agar well diffusion and bacterial growth inhibition curve assays revealed concentration-dependent TRAIL-CM4 antibacterial activity against Escherichia coli K12D31. The expressed TRAIL-CM4 fusion protein exhibited enhanced antitumor and antibacterial activities. Fusion protein expression allowed the two different proteins to function in combination. Copyright © 2016 Elsevier Inc. All rights reserved.

Bismuth Oxybromide-based Photocatalysts: Syntheses, Characterizations and Applications

NASA Astrophysics Data System (ADS)

Wu, Dan

The increasing intractable crises of environmental pollution and fossil fuels shortage are among the biggest challenges in current society and becoming an overwhelming concern for the development of our future world. Semiconductor photocatalysis has received considerable interdisciplinary attention and research interest owing to their diverse potentials in energy and environmental applications. As an important V-VI-VII ternary semiconductor, BiOBr has been recently received considerable attention owing to its fascinating physicochemical prosperities originated from its unique layered structures. However, existing reports on the photocatalytic bacterial inactivation of BiOBr based photocatalysts are rather limited. In addition, the mechanisms in visible-light-driven (VLD) photocatalytic disinfection systems are far from fully understandable. Moreover, the exploitation of facile ways to make BiOBr photocatalysts harvesting a wide range of solar spectrum with high efficiency remains challenging, yet highly desirable. In this study, BiOBr based photocatalysts with various nanostructures were synthesized and characterized. Their photocatalytic activities were systematically investigated towards bacterial inactivation, dye degradation and CO2 reduction. The exploration on the photo-excited charge carriers and reactive species were conducted to gain some insight into the corresponding photocatalytic mechanisms. Firstly, BiOBr 2D nanosheets with a high percentage of exposed {001} and {010} facets were synthesized via a facile hydrothermal method. BiOBr with dominant {001} facet (B001) nanosheets exhibited remarkably higher photocatalytic activity in inactivating E. coli K-12 under visible light irradiation, in comparison with BiOBr with dominant {010} facet (B010) nanosheets. There were 7-log bacterial cells inactivated within 2 h for B001, while B010 needed 6 h irradiation to inactivate 6.5-log bacterial cells. This superior activity was assigned to the more favorable

Thermostable group II intron reverse transcriptase fusion proteins and their use in cDNA synthesis and next-generation RNA sequencing.

PubMed

Mohr, Sabine; Ghanem, Eman; Smith, Whitney; Sheeter, Dennis; Qin, Yidan; King, Olga; Polioudakis, Damon; Iyer, Vishwanath R; Hunicke-Smith, Scott; Swamy, Sajani; Kuersten, Scott; Lambowitz, Alan M

2013-07-01

Mobile group II introns encode reverse transcriptases (RTs) that function in intron mobility ("retrohoming") by a process that requires reverse transcription of a highly structured, 2-2.5-kb intron RNA with high processivity and fidelity. Although the latter properties are potentially useful for applications in cDNA synthesis and next-generation RNA sequencing (RNA-seq), group II intron RTs have been difficult to purify free of the intron RNA, and their utility as research tools has not been investigated systematically. Here, we developed general methods for the high-level expression and purification of group II intron-encoded RTs as fusion proteins with a rigidly linked, noncleavable solubility tag, and we applied them to group II intron RTs from bacterial thermophiles. We thus obtained thermostable group II intron RT fusion proteins that have higher processivity, fidelity, and thermostability than retroviral RTs, synthesize cDNAs at temperatures up to 81°C, and have significant advantages for qRT-PCR, capillary electrophoresis for RNA-structure mapping, and next-generation RNA sequencing. Further, we find that group II intron RTs differ from the retroviral enzymes in template switching with minimal base-pairing to the 3' ends of new RNA templates, making it possible to efficiently and seamlessly link adaptors containing PCR-primer binding sites to cDNA ends without an RNA ligase step. This novel template-switching activity enables facile and less biased cloning of nonpolyadenylated RNAs, such as miRNAs or protein-bound RNA fragments. Our findings demonstrate novel biochemical activities and inherent advantages of group II intron RTs for research, biotechnological, and diagnostic methods, with potentially wide applications.

Size-dependent antimicrobial properties of sugar-encapsulated gold nanoparticles synthesized by a green method

PubMed Central

2012-01-01

The antimicrobial properties of dextrose-encapsulated gold nanoparticles (dGNPs) with average diameters of 25, 60, and 120 nm (± 5) and synthesized by green chemistry principles were investigated against both Gram-negative and Gram-positive bacteria. Studies were performed involving the effect of dGNPs on the growth, morphology, and ultrastructural properties of bacteria. dGNPs were found to have significant dose-dependent antibacterial activity which was also proportional to their size. Experiments revealed the dGNPs to be bacteriostatic as well as bactericidal. The dGNPs exhibited their bactericidal action by disrupting the bacterial cell membrane which leads to the leakage of cytoplasmic content. The overall outcome of this study suggests that green-synthesized dGNPs hold promise as a potent antibacterial agent against a wide range of disease-causing bacteria by preventing and controlling possible infections or diseases. PMID:23146145

Engineering Escherichia coli for Biodiesel Production Utilizing a Bacterial Fatty Acid Methyltransferase▿†

PubMed Central

Nawabi, Parwez; Bauer, Stefan; Kyrpides, Nikos; Lykidis, Athanasios

2011-01-01

The production of low-cost biofuels in engineered microorganisms is of great interest due to the continual increase in the world's energy demands. Biodiesel is a renewable fuel that can potentially be produced in microbes cost-effectively. Fatty acid methyl esters (FAMEs) are a common component of biodiesel and can be synthesized from either triacylglycerol or free fatty acids (FFAs). Here we report the identification of a novel bacterial fatty acid methyltransferase (FAMT) that catalyzes the formation of FAMEs and 3-hydroxyl fatty acid methyl esters (3-OH-FAMEs) from the respective free acids and S-adenosylmethionine (AdoMet). FAMT exhibits a higher specificity toward 3-hydroxy free fatty acids (3-OH-FFAs) than FFAs, synthesizing 3-hydroxy fatty acid methyl esters (3-OH-FAMEs) in vivo. We have also identified bacterial members of the fatty acyl-acyl carrier protein (ACP) thioesterase (FAT) enzyme family with distinct acyl chain specificities. These bacterial FATs exhibit increased specificity toward 3-hydroxyacyl-ACP, generating 3-OH-FFAs, which can subsequently be utilized by FAMTs to produce 3-OH-FAMEs. PhaG (3-hydroxyacyl ACP:coenzyme A [CoA] transacylase) constitutes an alternative route to 3-OH-FFA synthesis; the coexpression of PhaG with FAMT led to the highest level of accumulation of 3-OH-FAMEs and FAMEs. The availability of AdoMet, the second substrate for FAMT, is an important factor regulating the amount of methyl esters produced by bacterial cells. Our results indicate that the deletion of the global methionine regulator metJ and the overexpression of methionine adenosyltransferase result in increased methyl ester synthesis. PMID:21926202

Bacterial Cell Growth Inhibitors Targeting Undecaprenyl Diphosphate Synthase and Undecaprenyl Diphosphate Phosphatase.

PubMed

Wang, Yang; Desai, Janish; Zhang, Yonghui; Malwal, Satish R; Shin, Christopher J; Feng, Xinxin; Sun, Hong; Liu, Guizhi; Guo, Rey-Ting; Oldfield, Eric

2016-10-19

We synthesized a series of benzoic acids and phenylphosphonic acids and investigated their effects on the growth of Staphylococcus aureus and Bacillus subtilis. One of the most active compounds, 5-fluoro-2-(3-(octyloxy)benzamido)benzoic acid (7, ED 50 ∼0.15 μg mL -1 ) acted synergistically with seven antibiotics known to target bacterial cell-wall biosynthesis (a fractional inhibitory concentration index (FICI) of ∼0.35, on average) but had indifferent effects in combinations with six non-cell-wall biosynthesis inhibitors (average FICI∼1.45). The most active compounds were found to inhibit two enzymes involved in isoprenoid/bacterial cell-wall biosynthesis: undecaprenyl diphosphate synthase (UPPS) and undecaprenyl diphosphate phosphatase (UPPP), but not farnesyl diphosphate synthase, and there were good correlations between bacterial cell growth inhibition, UPPS inhibition, and UPPP inhibition. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Femtosecond spectroscopy probes the folding quality of antibody fragments expressed as GFP fusions in the cytoplasm

DOE Office of Scientific and Technical Information (OSTI.GOV)

Didier, P.; Weiss, E.; Sibler, A.-P.

2008-02-22

Time-resolved femtosecond spectroscopy can improve the application of green fluorescent proteins (GFPs) as protein-folding reporters. The study of ultrafast excited-state dynamics (ESD) of GFP fused to single chain variable fragment (scFv) antibody fragments, allowed us to define and measure an empirical parameter that only depends on the folding quality (FQ) of the fusion. This method has been applied to the analysis of genetic fusions expressed in the bacterial cytoplasm and allowed us to distinguish folded and thus functional antibody fragments (high FQ) with respect to misfolded antibody fragments. Moreover, these findings were strongly correlated to the behavior of the samemore » scFvs expressed in animal cells. This method is based on the sensitivity of the ESD to the modifications in the tertiary structure of the GFP induced by the aggregation state of the fusion partner. This approach may be applicable to the study of the FQ of polypeptides over-expressed under reducing conditions.« less

A target oriented expeditious approach towards synthesis of certain bacterial rare sugar derivatives.

PubMed

Chaudhury, Aritra; Ghosh, Rina

2017-02-07

Bacterial rare amino deoxy sugars are found in the cell surface polysaccharides of multiple pathogenic bacterial strains, but are absent in the human metabolism. This helps in the differentiation between pathogens and host cells which can be exploited for target specific drug discovery and carbohydrate based vaccine development. The principal bacterial atypical sugar derivatives include 2-acetamido-4-amino-2,4,6-trideoxy-d-galactose (AAT), 2,4-diacetamido-2,4,6-trideoxy-d-galactose (DATDG) and N-acetylfucosamine (FucNAc). Herein, a highly streamlined protocol leading to the aforesaid derivatives is presented. The highlights of the method lie in radical mediated 6-deoxygenation along with a one-pot like protection profile manipulation on suitably derivatised d-glucosamine or d-mannose motifs to obtain a vital quinovosaminoside or rhamnoside from which rare sugar derivatives were synthesized in a diversity oriented manner.

Powerful colloidal silver nanoparticles for the prevention of gastrointestinal bacterial infections

NASA Astrophysics Data System (ADS)

Le, Anh-Tuan; Tam Le, Thi; Quy Nguyen, Van; Hoang Tran, Huy; Dang, Duc Anh; Tran, Quang Huy; Vu, Dinh Lam

2012-12-01

In this work we have demonstrated a powerful disinfectant ability of colloidal silver nanoparticles (NPs) for the prevention of gastrointestinal bacterial infections. The silver NPs colloid was synthesized by a UV-enhanced chemical precipitation. Two gastrointestinal bacterial strains of Escherichia coli (ATCC 43888-O157:k-:H7) and Vibrio cholerae (O1) were used to verify the antibacterial activity of the as-prepared silver NPs colloid by means of surface disinfection assay in agar plates and turbidity assay in liquid media. Transmission electron microscopy was also employed to analyze the ultrastructural changes of bacterial cells caused by silver NPs. Noticeably, our silver NPs colloid displayed a highly effective bactericidal effect against two tested gastrointestinal bacterial strains at a silver concentration as low as ˜3 mg l-1. More importantly, the silver NPs colloid showed an enhancement of antibacterial activity and long-lasting disinfectant effect as compared to conventional chloramin B (5%) disinfection agent. These advantages of the as-prepared colloidal silver NPs make them very promising for environmental treatments contaminated with gastrointestinal bacteria and other infectious pathogens. Moreover, the powerful disinfectant activity of silver-containing materials can also help in controlling and preventing further outbreak of diseases.

Recombinant Scorpine Produced Using SUMO Fusion Partner in Escherichia coli Has the Activities against Clinically Isolated Bacteria and Inhibits the Plasmodium falciparum Parasitemia In Vitro

PubMed Central

Gu, Yaping; Zhou, Huayun; Cao, Jun; Gao, Qi

2014-01-01

Scorpine, a small cationic peptide from the venom of Pandinus imperator, which has been shown to have anti-bacterial and anti-plasmodial activities, has potential important applications in the pharmaceutical industries. However, the isolation of scorpine from natural sources is inefficient and time-consuming. Here, we first report the expression and purification of recombinant scorpine in Escherichia coli, using small ubiquitin-related modifier (SUMO) fusion partner. The fusion protein was expressed in soluble form in E. coli, and expression was verified by SDS-PAGE and western blotting analysis. The fusion protein was purified to 90% purity by nickel–nitrilotriacetic acid (Ni2+–NTA) resin chromatography. After the SUMO-scorpine fusion protein was cleaved by the SUMO protease, the cleaved sample was reapplied to a Ni2+–NTA column. Tricine/SDS-PAGE gel results indicated that Scorpine had been purified successfully to more than 95% purity. The recombinantly expressed Scorpine showed anti-bacterial activity against two standard bacteria including Staphylococcus aureus ATCC 29213 and Acinetobacter baumannii ATCC 19606, and clinically isolated bacteria including S. aureus S, S. aureus R, A. baumannii S, and A. baumannii R. It also produced 100% reduction in Plasmodium falciparum parasitemia in vitro. Thus, the expression strategy presented in this study allowed convenient high yield and easy purification of recombinant Scorpine for pharmaceutical applications in the future. PMID:25068263

A method for constructing single-copy lac fusions in Salmonella typhimurium and its application to the hemA-prfA operon.

PubMed

Elliott, T

1992-01-01

This report describes a set of Escherichia coli and Salmonella typhimurium strains that permits the reversible transfer of lac fusions between a plasmid and either bacterial chromosome. The system relies on homologous recombination in an E. coli recD host for transfer from plasmid to chromosome. This E. coli strain carries the S. typhimurium put operon inserted into trp, and the resulting fusions are of the form trp::put::[Kanr-X-lac], where X is the promoter or gene fragment under study. The put homology flanks the lac fusion segment, so that fusions can be transduced into S. typhimurium, replacing the resident put operon. Subsequent transduction into an S. typhimurium strain with a large chromosomal deletion covering put allows selection for recombinants that inherit the fusion on a plasmid. A transposable version of the put operon was constructed and used to direct lac fusions to novel locations, including the F plasmid and the ara locus. Transductional crosses between strains with fusions bearing different segments of the hemA-prfA operon were used to determine the contribution of the hemA promoter region to expression of the prfA gene and other genes downstream of hemA in S. typhimurium.

Modulating bacterial and gut mucosal interactions with engineered biofilm matrix proteins.

PubMed

Duraj-Thatte, Anna M; Praveschotinunt, Pichet; Nash, Trevor R; Ward, Frederick R; Joshi, Neel S

2018-02-22

Extracellular appendages play a significant role in mediating communication between bacteria and their host. Curli fibers are a class of bacterial fimbria that is highly amenable to engineering. We demonstrate the use of engineered curli fibers to rationally program interactions between bacteria and components of the mucosal epithelium. Commensal E. coli strains were engineered to produce recombinant curli fibers fused to the trefoil family of human cytokines. Biofilms formed from these strains bound more mucins than those producing wild-type curli fibers, and modulated mucin rheology as well. When treated with bacteria producing the curli-trefoil fusions mammalian cells behaved identically in terms of their migration behavior as when they were treated with the corresponding soluble trefoil factors. Overall, this demonstrates the potential utility of curli fibers as a scaffold for the display of bioactive domains and an untapped approach to rationally modulating host-microbe interactions using bacterial matrix proteins.

Sensor fusion of monocular cameras and laser rangefinders for line-based Simultaneous Localization and Mapping (SLAM) tasks in autonomous mobile robots.

PubMed

Zhang, Xinzheng; Rad, Ahmad B; Wong, Yiu-Kwong

2012-01-01

This paper presents a sensor fusion strategy applied for Simultaneous Localization and Mapping (SLAM) in dynamic environments. The designed approach consists of two features: (i) the first one is a fusion module which synthesizes line segments obtained from laser rangefinder and line features extracted from monocular camera. This policy eliminates any pseudo segments that appear from any momentary pause of dynamic objects in laser data. (ii) The second characteristic is a modified multi-sensor point estimation fusion SLAM (MPEF-SLAM) that incorporates two individual Extended Kalman Filter (EKF) based SLAM algorithms: monocular and laser SLAM. The error of the localization in fused SLAM is reduced compared with those of individual SLAM. Additionally, a new data association technique based on the homography transformation matrix is developed for monocular SLAM. This data association method relaxes the pleonastic computation. The experimental results validate the performance of the proposed sensor fusion and data association method.

Rho GTPase activity modulates paramyxovirus fusion protein-mediated cell-cell fusion

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schowalter, Rachel M.; Wurth, Mark A.; Aguilar, Hector C.

2006-07-05

The paramyxovirus fusion protein (F) promotes fusion of the viral envelope with the plasma membrane of target cells as well as cell-cell fusion. The plasma membrane is closely associated with the actin cytoskeleton, but the role of actin dynamics in paramyxovirus F-mediated membrane fusion is unclear. We examined cell-cell fusion promoted by two different paramyxovirus F proteins in three cell types in the presence of constitutively active Rho family GTPases, major cellular coordinators of actin dynamics. Reporter gene and syncytia assays demonstrated that expression of either Rac1{sup V12} or Cdc42{sup V12} could increase cell-cell fusion promoted by the Hendra ormore » SV5 glycoproteins, though the effect was dependent on the cell type expressing the viral glycoproteins. In contrast, RhoA{sup L63} decreased cell-cell fusion promoted by Hendra glycoproteins but had little affect on SV5 F-mediated fusion. Also, data suggested that GTPase activation in the viral glycoprotein-containing cell was primarily responsible for changes in fusion. Additionally, we found that activated Cdc42 promoted nuclear rearrangement in syncytia.« less

[Transformation of antimicrobial peptide fusion gene of cecropin B and rabbit NP-1 to Houttuynia cordata].

PubMed

Dong, Yan; Zhang, Ying; Yi, Lang; Lai, Huili; Zhang, Yaming; Zhou, Lian; Wang, Peixun

2010-07-01

To transform the antimicrobial peptide fusion gene of cecropin B and rabbit NP-1(CN) into Houttuynia cordata to improve its antimicrobic capability. The fusion gene of CN designed and synthesized artificially was recombined with expression vector pBI121. The recombined vector was transformed to Agrobacterium tumefaciens LBA4404, by which CN gene was transformed to the explants of H. cordata. The transgenic regeneration plantlets were selected by kanamycin and rapid screening PCR. The transgenic plants were identified by PCR-Southern of genomic DNA and RT-PCR. The disease resistances were detected by antibacterial zone trail of leaf extracts to E. coli K12 and infection by Rhizoctonia solani. Gene of interesting CN was inserted into genomic DNA and expressed in transformed H, cordata, whose resistance to E. coli K12 and Rh. solani was stronger than that of the non-transformed control. The fusion gene CN can improve antimicrobic capability of transformed H. cordata.

Antibacterial and cytotoxic potential of silver nanoparticles synthesized using latex of Calotropis gigantea L.

NASA Astrophysics Data System (ADS)

Rajkuberan, Chandrasekaran; Sudha, Kannaiah; Sathishkumar, Gnanasekar; Sivaramakrishnan, Sivaperumal

2015-02-01

The present study aimed to synthesis silver nanoparticles (AgNPs) in a greener route using aqueous latex extract of Calotropis gigantea L. toward biomedical applications. Initially, synthesis of AgNPs was confirmed through UV-Vis spectroscopy which shows the surface plasmonic resonance peak (SPR) at 420 nm. Fourier transform infrared spectroscopy (FTIR) analysis provides clear evidence that protein fractions present in the latex extract act as reducing and stabilizing bio agents. Energy dispersive X-ray (EDAX) spectroscopy confirms the presence of silver as a major constituent element. X-ray diffractograms displays that the synthesized AgNPs were biphasic crystalline nature. Electron microscopic studies such as Field emission scanning electron microscopic (Fe-SEM) and Transmission electron microscope (TEM) reveals that synthesized AgNPs are spherical in shape with the size range between 5 and 30 nm. Further, crude latex aqueous extract and synthesized AgNPs were evaluated against different bacterial pathogens such as Bacillus cereus, Enterococci sp, Shigella sp, Pseudomonas aeruginosa, Klebsiella pneumonia, Staphylococcus aureus and Escherichia coli. Compared to the crude latex aqueous extract, biosynthesized AgNPs exhibits a remarkable antimicrobial activity. Likewise invitro anticancer study manifests the cytotoxicity value of synthesized AgNPs against tested HeLa cells. The output of this study clearly suggesting that biosynthesized AgNPs using latex of C. gigantea can be used as promising nanomaterial for therapeutic application in context with nanodrug formulation.

Genome Calligrapher: A Web Tool for Refactoring Bacterial Genome Sequences for de Novo DNA Synthesis.

PubMed

Christen, Matthias; Deutsch, Samuel; Christen, Beat

2015-08-21

Recent advances in synthetic biology have resulted in an increasing demand for the de novo synthesis of large-scale DNA constructs. Any process improvement that enables fast and cost-effective streamlining of digitized genetic information into fabricable DNA sequences holds great promise to study, mine, and engineer genomes. Here, we present Genome Calligrapher, a computer-aided design web tool intended for whole genome refactoring of bacterial chromosomes for de novo DNA synthesis. By applying a neutral recoding algorithm, Genome Calligrapher optimizes GC content and removes obstructive DNA features known to interfere with the synthesis of double-stranded DNA and the higher order assembly into large DNA constructs. Subsequent bioinformatics analysis revealed that synthesis constraints are prevalent among bacterial genomes. However, a low level of codon replacement is sufficient for refactoring bacterial genomes into easy-to-synthesize DNA sequences. To test the algorithm, 168 kb of synthetic DNA comprising approximately 20 percent of the synthetic essential genome of the cell-cycle bacterium Caulobacter crescentus was streamlined and then ordered from a commercial supplier of low-cost de novo DNA synthesis. The successful assembly into eight 20 kb segments indicates that Genome Calligrapher algorithm can be efficiently used to refactor difficult-to-synthesize DNA. Genome Calligrapher is broadly applicable to recode biosynthetic pathways, DNA sequences, and whole bacterial genomes, thus offering new opportunities to use synthetic biology tools to explore the functionality of microbial diversity. The Genome Calligrapher web tool can be accessed at https://christenlab.ethz.ch/GenomeCalligrapher  .

The Fusion Gain Analysis of the Inductively Driven Liner Compression Based Fusion

NASA Astrophysics Data System (ADS)

Shimazu, Akihisa; Slough, John

2016-10-01

An analytical analysis of the fusion gain expected in the inductively driven liner compression (IDLC) based fusion is conducted to identify the fusion gain scaling at various operating conditions. The fusion based on the IDLC is a magneto-inertial fusion concept, where a Field-Reversed Configuration (FRC) plasmoid is compressed via the inductively-driven metal liner to drive the FRC to fusion conditions. In the past, an approximate scaling law for the expected fusion gain for the IDLC based fusion was obtained under the key assumptions of (1) D-T fuel at 5-40 keV, (2) adiabatic scaling laws for the FRC dynamics, (3) FRC energy dominated by the pressure balance with the edge magnetic field at the peak compression, and (4) the liner dwell time being liner final diameter divided by the peak liner velocity. In this study, various assumptions made in the previous derivation is relaxed to study the change in the fusion gain scaling from the previous result of G ml1 / 2 El11 / 8 , where ml is the liner mass and El is the peak liner kinetic energy. The implication from the modified fusion gain scaling on the performance of the IDLC fusion reactor system is also explored.

Green in-situ synthesized silver nanoparticles embedded in bacterial cellulose nanopaper as a bionanocomposite plasmonic sensor.

PubMed

Pourreza, Nahid; Golmohammadi, Hamed; Naghdi, Tina; Yousefi, Hossein

2015-12-15

Herein, we introduce a new strategy for green, in-situ generation of silver nanoparticles using flexible and transparent bacterial cellulose nanopapers. In this method, adsorbed silver ions on bacterial cellulose nanopaper are reduced by the hydroxyl groups of cellulose nanofibers, acting as the reducing agent producing a bionanocomposite "embedded silver nanoparticles in transparent nanopaper" (ESNPs). The fabricated ESNPs were investigated and characterized by field emission scanning electron microscopy (FE-SEM), UV-visible spectroscopy (UV-vis), Fourier-transform infrared spectroscopy (FT-IR), thermogravimetric analysis (TGA) and energy-dispersive X-ray spectroscopy (EDX). The important parameters affecting the ESNPs were optimized during the fabrication of specimens. The resulting ESNPs were used as a novel and sensitive probe for the optical sensing of cyanide ion (CN(-)) and 2-mercaptobenzothiazole (MBT) in water samples with satisfactory results. The change in surface plasmon resonance absorption intensity of ESNPs was linearly proportional to the concentration in the range of 0.2-2.5 µg mL(-1) and 2-110 µg mL(-1) with a detection limit of 0.012 µg mL(-1) and 1.37 µg mL(-1) for CN(-) and MBT, respectively. Copyright © 2015 Elsevier B.V. All rights reserved.

A multipurpose fusion tag derived from an unstructured and hyperacidic region of the amyloid precursor protein

PubMed Central

Sangawa, Takeshi; Tabata, Sanae; Suzuki, Kei; Saheki, Yasushi; Tanaka, Keiji; Takagi, Junichi

2013-01-01

Expression and purification of aggregation-prone and disulfide-containing proteins in Escherichia coli remains as a major hurdle for structural and functional analyses of high-value target proteins. Here, we present a novel gene-fusion strategy that greatly simplifies purification and refolding procedure at very low cost using a unique hyperacidic module derived from the human amyloid precursor protein. Fusion with this polypeptide (dubbed FATT for Flag-Acidic-Target Tag) results in near-complete soluble expression of variety of extracellular proteins, which can be directly refolded in the crude bacterial lysate and purified in one-step by anion exchange chromatography. Application of this system enabled preparation of functionally active extracellular enzymes and antibody fragments without the need for condition optimization. PMID:23526492

Exchange of rotor components in functioning bacterial flagellar motor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fukuoka, Hajime; Inoue, Yuichi; Graduate School of Life Sciences, Tohoku University, Aoba-ku, Sendai 980-8577

2010-03-26

The bacterial flagellar motor is a rotary motor driven by the electrochemical potential of a coupling ion. The interaction between a rotor and stator units is thought to generate torque. The overall structure of flagellar motor has been thought to be static, however, it was recently proved that stators are exchanged in a rotating motor. Understanding the dynamics of rotor components in functioning motor is important for the clarifying of working mechanism of bacterial flagellar motor. In this study, we focused on the dynamics and the turnover of rotor components in a functioning flagellar motor. Expression systems for GFP-FliN, FliM-GFP,more » and GFP-FliG were constructed, and each GFP-fusion was functionally incorporated into the flagellar motor. To investigate whether the rotor components are exchanged in a rotating motor, we performed fluorescence recovery after photobleaching experiments using total internal reflection fluorescence microscopy. After photobleaching, in a tethered cell producing GFP-FliN or FliM-GFP, the recovery of fluorescence at the rotational center was observed. However, in a cell producing GFP-FliG, no recovery of fluorescence was observed. The transition phase of fluorescence intensity after full or partially photobleaching allowed the turnover of FliN subunits to be calculated as 0.0007 s{sup -1}, meaning that FliN would be exchanged in tens of minutes. These novel findings indicate that a bacterial flagellar motor is not a static structure even in functioning state. This is the first report for the exchange of rotor components in a functioning bacterial flagellar motor.« less

Fusion of digital breast tomosynthesis images via wavelet synthesis for improved lesion conspicuity

NASA Astrophysics Data System (ADS)

Hariharan, Harishwaran; Pomponiu, Victor; Zheng, Bin; Whiting, Bruce; Gur, David

2014-03-01

Full-field digital mammography (FFDM) is the most common screening procedure for detecting early breast cancer. However, due to complications such as overlapping breast tissue in projection images, the efficacy of FFDM reading is reduced. Recent studies have shown that digital breast tomosynthesis (DBT), in combination with FFDM, increases detection sensitivity considerably while decreasing false-positive, recall rates. There is a huge interest in creating diagnostically accurate 2-D interpretations from the DBT slices. Most of the 2-D syntheses rely on visualizing the maximum intensities (brightness) from each slice through different methods. We propose a wavelet based fusion method, where we focus on preserving holistic information from larger structures such as masses while adding high frequency information that is relevant and helpful for diagnosis. This method enables the spatial generation of a 2D image from a series of DBT images, each of which contains both smooth and coarse structures distributed in the wavelet domain. We believe that the wavelet-synthesized images, generated from their DBT image datasets, provide radiologists with improved lesion and micro-calcification conspicuity as compared with FFDM images. The potential impact of this fusion method is (1) Conception of a device-independent, data-driven modality that increases the conspicuity of lesions, thereby facilitating early detection and potentially reducing recall rates; (2) Reduction of the accompanying radiation dose to the patient.

Microalgae associated Brevundimonas sp. MSK 4 as the nano particle synthesizing unit to produce antimicrobial silver nanoparticles

NASA Astrophysics Data System (ADS)

Rajamanickam, Karthic; Sudha, S. S.; Francis, Mebin; Sowmya, T.; Rengaramanujam, J.; Sivalingam, Periyasamy; Prabakar, Kandasamy

2013-09-01

The biosynthesis of silver nanoparticles and its antimicrobial property was studied using bacteria isolated from Spirulina products. Isolated bacteria were identified as Bacillus sp. MSK 1 (JX495945), Staphylococcus sp. MSK 2 (JX495946), Bacillus sp. MSK 3 (JX495947) and Brevundimonas sp. MSK 4 (JX495948). Silver nanoparticles (AgNPs) were synthesized using bacterial culture filtrate with AgNO3. The initial syntheses of Ag nanoparticles were characterized by UV-vis spectrophotometer (by measuring the color change to intense brown). Fourier Transform Infrared Spectroscopy (FTIR) study showed evidence that proteins are possible reducing agents and Energy-dispersive X-ray (EDX) study showing the metal silver as major signal. The structure of AgNPs was determined by Scanning electron microscopy (SEM) and X-ray diffraction (XRD). Synthesized Ag nanoparticles with an average size of 40-65 nm have antimicrobial property against human pathogens like Proteus vulgaris, Salmonella typhi, Vibrio cholera, Streptococcus sp., Bacillus subtilis, Staphylococcus aureus, and Escherichia coli. Among the isolates Brevundimonas sp. MSK 4 alone showed good activity in both synthesis of AgNPs and antimicrobial activity. This work demonstrates the possible use of biological synthesized silver nanoparticles to combat the drug resistant problem.

Novel cooperative neural fusion algorithms for image restoration and image fusion.

PubMed

Xia, Youshen; Kamel, Mohamed S

2007-02-01

To deal with the problem of restoring degraded images with non-Gaussian noise, this paper proposes a novel cooperative neural fusion regularization (CNFR) algorithm for image restoration. Compared with conventional regularization algorithms for image restoration, the proposed CNFR algorithm can relax need of the optimal regularization parameter to be estimated. Furthermore, to enhance the quality of restored images, this paper presents a cooperative neural fusion (CNF) algorithm for image fusion. Compared with existing signal-level image fusion algorithms, the proposed CNF algorithm can greatly reduce the loss of contrast information under blind Gaussian noise environments. The performance analysis shows that the proposed two neural fusion algorithms can converge globally to the robust and optimal image estimate. Simulation results confirm that in different noise environments, the proposed two neural fusion algorithms can obtain a better image estimate than several well known image restoration and image fusion methods.

Structure of a bacterial toxin-activating acyltransferase.

PubMed

Greene, Nicholas P; Crow, Allister; Hughes, Colin; Koronakis, Vassilis

2015-06-09

Secreted pore-forming toxins of pathogenic Gram-negative bacteria such as Escherichia coli hemolysin (HlyA) insert into host-cell membranes to subvert signal transduction and induce apoptosis and cell lysis. Unusually, these toxins are synthesized in an inactive form that requires posttranslational activation in the bacterial cytosol. We have previously shown that the activation mechanism is an acylation event directed by a specialized acyl-transferase that uses acyl carrier protein (ACP) to covalently link fatty acids, via an amide bond, to specific internal lysine residues of the protoxin. We now reveal the 2.15-Å resolution X-ray structure of the 172-aa ApxC, a toxin-activating acyl-transferase (TAAT) from pathogenic Actinobacillus pleuropneumoniae. This determination shows that bacterial TAATs are a structurally homologous family that, despite indiscernible sequence similarity, form a distinct branch of the Gcn5-like N-acetyl transferase (GNAT) superfamily of enzymes that typically use acyl-CoA to modify diverse bacterial, archaeal, and eukaryotic substrates. A combination of structural analysis, small angle X-ray scattering, mutagenesis, and cross-linking defined the solution state of TAATs, with intermonomer interactions mediated by an N-terminal α-helix. Superposition of ApxC with substrate-bound GNATs, and assay of toxin activation and binding of acyl-ACP and protoxin peptide substrates by mutated ApxC variants, indicates the enzyme active site to be a deep surface groove.

Genetic Fusions of a CFA/I/II/IV MEFA (Multiepitope Fusion Antigen) and a Toxoid Fusion of Heat-Stable Toxin (STa) and Heat-Labile Toxin (LT) of Enterotoxigenic Escherichia coli (ETEC) Retain Broad Anti-CFA and Antitoxin Antigenicity

PubMed Central

Ruan, Xiaosai; Sack, David A.; Zhang, Weiping

2015-01-01

Immunological heterogeneity has long been the major challenge in developing broadly effective vaccines to protect humans and animals against bacterial and viral infections. Enterotoxigenic Escherichia coli (ETEC) strains, the leading bacterial cause of diarrhea in humans, express at least 23 immunologically different colonization factor antigens (CFAs) and two distinct enterotoxins [heat-labile toxin (LT) and heat-stable toxin type Ib (STa or hSTa)]. ETEC strains expressing any one or two CFAs and either toxin cause diarrhea, therefore vaccines inducing broad immunity against a majority of CFAs, if not all, and both toxins are expected to be effective against ETEC. In this study, we applied the multiepitope fusion antigen (MEFA) strategy to construct ETEC antigens and examined antigens for broad anti-CFA and antitoxin immunogenicity. CFA MEFA CFA/I/II/IV [CVI 2014, 21(2):243-9], which carried epitopes of seven CFAs [CFA/I, CFA/II (CS1, CS2, CS3), CFA/IV (CS4, CS5, CS6)] expressed by the most prevalent and virulent ETEC strains, was genetically fused to LT-STa toxoid fusion monomer 3xSTaA14Q-dmLT or 3xSTaN12S-dmLT [IAI 2014, 82(5):1823-32] for CFA/I/II/IV-STaA14Q-dmLT and CFA/I/II/IV-STaN12S-dmLT MEFAs. Mice intraperitoneally immunized with either CFA/I/II/IV-STa-toxoid-dmLT MEFA developed antibodies specific to seven CFAs and both toxins, at levels equivalent or comparable to those induced from co-administration of the CFA/I/II/IV MEFA and toxoid fusion 3xSTaN12S-dmLT. Moreover, induced antibodies showed in vitro adherence inhibition activities against ETEC or E. coli strains expressing these seven CFAs and neutralization activities against both toxins. These results indicated CFA/I/II/IV-STa-toxoid-dmLT MEFA or CFA/I/II/IV MEFA combined with 3xSTaN12S-dmLT induced broadly protective anti-CFA and antitoxin immunity, and suggested their potential application in broadly effective ETEC vaccine development. This MEFA strategy may be generally used in multivalent

Genetic fusions of a CFA/I/II/IV MEFA (multiepitope fusion antigen) and a toxoid fusion of heat-stable toxin (STa) and heat-labile toxin (LT) of enterotoxigenic Escherichia coli (ETEC) retain broad anti-CFA and antitoxin antigenicity.

PubMed

Ruan, Xiaosai; Sack, David A; Zhang, Weiping

2015-01-01

Immunological heterogeneity has long been the major challenge in developing broadly effective vaccines to protect humans and animals against bacterial and viral infections. Enterotoxigenic Escherichia coli (ETEC) strains, the leading bacterial cause of diarrhea in humans, express at least 23 immunologically different colonization factor antigens (CFAs) and two distinct enterotoxins [heat-labile toxin (LT) and heat-stable toxin type Ib (STa or hSTa)]. ETEC strains expressing any one or two CFAs and either toxin cause diarrhea, therefore vaccines inducing broad immunity against a majority of CFAs, if not all, and both toxins are expected to be effective against ETEC. In this study, we applied the multiepitope fusion antigen (MEFA) strategy to construct ETEC antigens and examined antigens for broad anti-CFA and antitoxin immunogenicity. CFA MEFA CFA/I/II/IV [CVI 2014, 21(2):243-9], which carried epitopes of seven CFAs [CFA/I, CFA/II (CS1, CS2, CS3), CFA/IV (CS4, CS5, CS6)] expressed by the most prevalent and virulent ETEC strains, was genetically fused to LT-STa toxoid fusion monomer 3xSTaA14Q-dmLT or 3xSTaN12S-dmLT [IAI 2014, 82(5):1823-32] for CFA/I/II/IV-STaA14Q-dmLT and CFA/I/II/IV-STaN12S-dmLT MEFAs. Mice intraperitoneally immunized with either CFA/I/II/IV-STa-toxoid-dmLT MEFA developed antibodies specific to seven CFAs and both toxins, at levels equivalent or comparable to those induced from co-administration of the CFA/I/II/IV MEFA and toxoid fusion 3xSTaN12S-dmLT. Moreover, induced antibodies showed in vitro adherence inhibition activities against ETEC or E. coli strains expressing these seven CFAs and neutralization activities against both toxins. These results indicated CFA/I/II/IV-STa-toxoid-dmLT MEFA or CFA/I/II/IV MEFA combined with 3xSTaN12S-dmLT induced broadly protective anti-CFA and antitoxin immunity, and suggested their potential application in broadly effective ETEC vaccine development. This MEFA strategy may be generally used in multivalent

Magnetic-confinement fusion

NASA Astrophysics Data System (ADS)

Ongena, J.; Koch, R.; Wolf, R.; Zohm, H.

2016-05-01

Our modern society requires environmentally friendly solutions for energy production. Energy can be released not only from the fission of heavy nuclei but also from the fusion of light nuclei. Nuclear fusion is an important option for a clean and safe solution for our long-term energy needs. The extremely high temperatures required for the fusion reaction are routinely realized in several magnetic-fusion machines. Since the early 1990s, up to 16 MW of fusion power has been released in pulses of a few seconds, corresponding to a power multiplication close to break-even. Our understanding of the very complex behaviour of a magnetized plasma at temperatures between 150 and 200 million °C surrounded by cold walls has also advanced substantially. This steady progress has resulted in the construction of ITER, a fusion device with a planned fusion power output of 500 MW in pulses of 400 s. ITER should provide answers to remaining important questions on the integration of physics and technology, through a full-size demonstration of a tenfold power multiplication, and on nuclear safety aspects. Here we review the basic physics underlying magnetic fusion: past achievements, present efforts and the prospects for future production of electrical energy. We also discuss questions related to the safety, waste management and decommissioning of a future fusion power plant.

The Binary Toxin CDT of Clostridium difficile as a Tool for Intracellular Delivery of Bacterial Glucosyltransferase Domains.

PubMed

Beer, Lara-Antonia; Tatge, Helma; Schneider, Carmen; Ruschig, Maximilian; Hust, Michael; Barton, Jessica; Thiemann, Stefan; Fühner, Viola; Russo, Giulio; Gerhard, Ralf

2018-06-01

Binary toxins are produced by several pathogenic bacteria. Examples are the C2 toxin from Clostridium botulinum , the iota toxin from Clostridium perfringens, and the CDT from Clostridium difficile . All these binary toxins have ADP-ribosyltransferases (ADPRT) as their enzymatically active component that modify monomeric actin in their target cells. The binary C2 toxin was intensively described as a tool for intracellular delivery of allogenic ADPRTs. Here, we firstly describe the binary toxin CDT from C. difficile as an effective tool for heterologous intracellular delivery. Even 60 kDa glucosyltransferase domains of large clostridial glucosyltransferases can be delivered into cells. The glucosyltransferase domains of five tested large clostridial glucosyltransferases were successfully introduced into cells as chimeric fusions to the CDTa adapter domain (CDTaN). Cell uptake was demonstrated by the analysis of cell morphology, cytoskeleton staining, and intracellular substrate glucosylation. The fusion toxins were functional only when the adapter domain of CDTa was N -terminally located, according to its native orientation. Thus, like other binary toxins, the CDTaN/b system can be used for standardized delivery systems not only for bacterial ADPRTs but also for a variety of bacterial glucosyltransferase domains.

Enhanced Toxic Metal Accumulation in Engineered Bacterial Cells Expressing Arabidopsis thaliana Phytochelatin Synthase

PubMed Central

Sauge-Merle, Sandrine; Cuiné, Stéphan; Carrier, Patrick; Lecomte-Pradines, Catherine; Luu, Doan-Trung; Peltier, Gilles

2003-01-01

Phytochelatins (PCs) are metal-binding cysteine-rich peptides, enzymatically synthesized in plants and yeasts from glutathione in response to heavy metal stress by PC synthase (EC 2.3.2.15). In an attempt to increase the ability of bacterial cells to accumulate heavy metals, the Arabidopsis thaliana gene encoding PC synthase (AtPCS) was expressed in Escherichia coli. A marked accumulation of PCs was observed in vivo together with a decrease in the glutathione cellular content. When bacterial cells expressing AtPCS were placed in the presence of heavy metals such as cadmium or the metalloid arsenic, cellular metal contents were increased 20- and 50-fold, respectively. We discuss the possibility of using genes of the PC biosynthetic pathway to design bacterial strains or higher plants with increased abilities to accumulate toxic metals, and also arsenic, for use in bioremediation and/or phytoremediation processes. PMID:12514032

Junction region of EWS-FLI1 fusion protein has a dominant negative effect in Ewing's sarcoma in vitro.

PubMed

Jully, Babu; Vijayalakshmi, Ramshankar; Gopal, Gopisetty; Sabitha, Kesavan; Rajkumar, Thangarajan

2012-11-12

Ewing's sarcoma is a malignancy characterized by a specific 11:22 chromosomal translocation which generates a novel EWS-FLI1 fusion protein functioning as an aberrant transcription factor. In the present study, we have further characterized the junction region of the EWS-FLI1 fusion protein. In-silico model of EWS-FLI1 fusion protein was analysed for ligand binding sites, and a putative region (amino acid (aa) 251-343 of the type 1 fusion protein) in the vicinity of the fusion junction was cloned and expressed using bacterial expression. The recombinant protein was characterized by Circular Dichroism (CD). We then expressed aa 251-280 ectopically in Ewing's sarcoma cell-line and its effect on cell proliferation, tumorigenicity and expression of EWS-FLI1 target genes were analysed. Our modelling analysis indicated that Junction region (aa 251-343) encompasses potential ligand biding sites in the EWS-FLI1 protein and when expressed in bacteria was present as soluble form. Ectopically expressing this region in Ewing's sarcoma cells inhibited tumorigenicity, and EWS-FLI1 target genes indicating a dominant negative biological effect. Junction region can be exploited further as target for drug development in future to specifically target EWS-FLI1 in Ewing's Sarcoma.

Bacterial genome replication at subzero temperatures in permafrost

PubMed Central

Tuorto, Steven J; Darias, Phillip; McGuinness, Lora R; Panikov, Nicolai; Zhang, Tingjun; Häggblom, Max M; Kerkhof, Lee J

2014-01-01

Microbial metabolic activity occurs at subzero temperatures in permafrost, an environment representing ∼25% of the global soil organic matter. Although much of the observed subzero microbial activity may be due to basal metabolism or macromolecular repair, there is also ample evidence for cellular growth. Unfortunately, most metabolic measurements or culture-based laboratory experiments cannot elucidate the specific microorganisms responsible for metabolic activities in native permafrost, nor, can bulk approaches determine whether different members of the microbial community modulate their responses as a function of changing subzero temperatures. Here, we report on the use of stable isotope probing with 13C-acetate to demonstrate bacterial genome replication in Alaskan permafrost at temperatures of 0 to −20 °C. We found that the majority (80%) of operational taxonomic units detected in permafrost microcosms were active and could synthesize 13C-labeled DNA when supplemented with 13C-acetate at temperatures of 0 to −20 °C during a 6-month incubation. The data indicated that some members of the bacterial community were active across all of the experimental temperatures, whereas many others only synthesized DNA within a narrow subzero temperature range. Phylogenetic analysis of 13C-labeled 16S rRNA genes revealed that the subzero active bacteria were members of the Acidobacteria, Actinobacteria, Chloroflexi, Gemmatimonadetes and Proteobacteria phyla and were distantly related to currently cultivated psychrophiles. These results imply that small subzero temperature changes may lead to changes in the active microbial community, which could have consequences for biogeochemical cycling in permanently frozen systems. PMID:23985750

FuzzyFusion: an application architecture for multisource information fusion

NASA Astrophysics Data System (ADS)

Fox, Kevin L.; Henning, Ronda R.

2009-04-01

The correlation of information from disparate sources has long been an issue in data fusion research. Traditional data fusion addresses the correlation of information from sources as diverse as single-purpose sensors to all-source multi-media information. Information system vulnerability information is similar in its diversity of sources and content, and in the desire to draw a meaningful conclusion, namely, the security posture of the system under inspection. FuzzyFusionTM, A data fusion model that is being applied to the computer network operations domain is presented. This model has been successfully prototyped in an applied research environment and represents a next generation assurance tool for system and network security.

Enhanced bactericidal potency of nanoliposomes by modification of the fusion activity between liposomes and bacterium.

PubMed

Ma, Yufan; Wang, Zhao; Zhao, Wen; Lu, Tingli; Wang, Rutao; Mei, Qibing; Chen, Tao

2013-01-01

liposomal encapsulated tobramycin was prepared, and the bactericidal effect occurred more quickly when bacteria were cultured with liposomal encapsulated tobramycin. The bactericidal potency of fluid liposomes is dramatically enhanced with respect to fusion ability when the fusogenic lipid, DOPE, is included. Regardless of changes in liposome composition, fluid liposomes-bacterium fusion is universally enhanced by calcium ions. The information obtained in this study will increase our understanding of fluid liposomal action mechanisms, and help in optimizing the new generation of fluid liposomal formulations for the treatment of pulmonary bacterial infections.

Enhanced bactericidal potency of nanoliposomes by modification of the fusion activity between liposomes and bacterium

PubMed Central

Ma, Yufan; Wang, Zhao; Zhao, Wen; Lu, Tingli; Wang, Rutao; Mei, Qibing; Chen, Tao

2013-01-01

. Furthermore, the fluid liposomal encapsulated tobramycin was prepared, and the bactericidal effect occurred more quickly when bacteria were cultured with liposomal encapsulated tobramycin. Conclusion The bactericidal potency of fluid liposomes is dramatically enhanced with respect to fusion ability when the fusogenic lipid, DOPE, is included. Regardless of changes in liposome composition, fluid liposomes-bacterium fusion is universally enhanced by calcium ions. The information obtained in this study will increase our understanding of fluid liposomal action mechanisms, and help in optimizing the new generation of fluid liposomal formulations for the treatment of pulmonary bacterial infections. PMID:23847417

Silver nanoparticles synthesized using aqueous leaf extract of Ziziphus oenoplia (L.) Mill: Characterization and assessment of antibacterial activity.

PubMed

Soman, Soumya; Ray, J G

2016-10-01

Biological approach to synthesis of metal nanoparticles using aqueous leaf extract is a highly relevant and recent theme in nanotechnological research. Phytosynthesized AgNPs have better inhibitory and antimicrobial effects compared to aqueous leaf extract and silver nitrate. In the present investigation crystalline silver nanoparticles (AgNPs) with size of 10nm have been successfully synthesized using aqueous leaf extract (AQLE) of Ziziphus oenoplia (L.) Mill., which act as both reducing as well as capping agent. The particles were characterized using UV Visible spectroscopy, HRTEM-EDAX, XRD, FT-IR and DLS. An evaluation of the anti bacterial activity was carried out using Agar well diffusion method and MIC determination against four bacterial strains, Klebsiella pneumoniae, Pseudomonas aeruginosa, Escherichia coli and Salmonella typhi; the AgNPs exhibited quite high antibacterial activity. Furthermore, bactericidal studies with TEM at different time intervals after AgNPs treatment showed the presence of AgNPs near cell membrane of bacteria at about 30min exposure and the bacterial-lysis was found completed at 24h. This gave an insight on the mechanism of bacterial-lysis by direct damage to the cell membrane. Copyright © 2016 Elsevier B.V. All rights reserved.

Hendra virus fusion protein transmembrane domain contributes to pre-fusion protein stability

PubMed Central

Webb, Stacy; Nagy, Tamas; Moseley, Hunter; Fried, Michael; Dutch, Rebecca

2017-01-01

Enveloped viruses utilize fusion (F) proteins studding the surface of the virus to facilitate membrane fusion with a target cell membrane. Fusion of the viral envelope with a cellular membrane is required for release of viral genomic material, so the virus can ultimately reproduce and spread. To drive fusion, the F protein undergoes an irreversible conformational change, transitioning from a metastable pre-fusion conformation to a more thermodynamically stable post-fusion structure. Understanding the elements that control stability of the pre-fusion state and triggering to the post-fusion conformation is important for understanding F protein function. Mutations in F protein transmembrane (TM) domains implicated the TM domain in the fusion process, but the structural and molecular details in fusion remain unclear. Previously, analytical ultracentrifugation was utilized to demonstrate that isolated TM domains of Hendra virus F protein associate in a monomer-trimer equilibrium (Smith, E. C., Smith, S. E., Carter, J. R., Webb, S. R., Gibson, K. M., Hellman, L. M., Fried, M. G., and Dutch, R. E. (2013) J. Biol. Chem. 288, 35726–35735). To determine factors driving this association, 140 paramyxovirus F protein TM domain sequences were analyzed. A heptad repeat of β-branched residues was found, and analysis of the Hendra virus F TM domain revealed a heptad repeat leucine-isoleucine zipper motif (LIZ). Replacement of the LIZ with alanine resulted in dramatically reduced TM-TM association. Mutation of the LIZ in the whole protein resulted in decreased protein stability, including pre-fusion conformation stability. Together, our data suggest that the heptad repeat LIZ contributed to TM-TM association and is important for F protein function and pre-fusion stability. PMID:28213515

Characterization of fusion genes and the significantly expressed fusion isoforms in breast cancer by hybrid sequencing

PubMed Central

Weirather, Jason L.; Afshar, Pegah Tootoonchi; Clark, Tyson A.; Tseng, Elizabeth; Powers, Linda S.; Underwood, Jason G.; Zabner, Joseph; Korlach, Jonas; Wong, Wing Hung; Au, Kin Fai

2015-01-01

We developed an innovative hybrid sequencing approach, IDP-fusion, to detect fusion genes, determine fusion sites and identify and quantify fusion isoforms. IDP-fusion is the first method to study gene fusion events by integrating Third Generation Sequencing long reads and Second Generation Sequencing short reads. We applied IDP-fusion to PacBio data and Illumina data from the MCF-7 breast cancer cells. Compared with the existing tools, IDP-fusion detects fusion genes at higher precision and a very low false positive rate. The results show that IDP-fusion will be useful for unraveling the complexity of multiple fusion splices and fusion isoforms within tumorigenesis-relevant fusion genes. PMID:26040699

Muon Catalyzed Fusion

NASA Technical Reports Server (NTRS)

Armour, Edward A.G.

2007-01-01

Muon catalyzed fusion is a process in which a negatively charged muon combines with two nuclei of isotopes of hydrogen, e.g, a proton and a deuteron or a deuteron and a triton, to form a muonic molecular ion in which the binding is so tight that nuclear fusion occurs. The muon is normally released after fusion has taken place and so can catalyze further fusions. As the muon has a mean lifetime of 2.2 microseconds, this is the maximum period over which a muon can participate in this process. This article gives an outline of the history of muon catalyzed fusion from 1947, when it was first realised that such a process might occur, to the present day. It includes a description of the contribution that Drachrnan has made to the theory of muon catalyzed fusion and the influence this has had on the author's research.

Hendra virus fusion protein transmembrane domain contributes to pre-fusion protein stability.

PubMed

Webb, Stacy; Nagy, Tamas; Moseley, Hunter; Fried, Michael; Dutch, Rebecca

2017-04-07

Enveloped viruses utilize fusion (F) proteins studding the surface of the virus to facilitate membrane fusion with a target cell membrane. Fusion of the viral envelope with a cellular membrane is required for release of viral genomic material, so the virus can ultimately reproduce and spread. To drive fusion, the F protein undergoes an irreversible conformational change, transitioning from a metastable pre-fusion conformation to a more thermodynamically stable post-fusion structure. Understanding the elements that control stability of the pre-fusion state and triggering to the post-fusion conformation is important for understanding F protein function. Mutations in F protein transmembrane (TM) domains implicated the TM domain in the fusion process, but the structural and molecular details in fusion remain unclear. Previously, analytical ultracentrifugation was utilized to demonstrate that isolated TM domains of Hendra virus F protein associate in a monomer-trimer equilibrium (Smith, E. C., Smith, S. E., Carter, J. R., Webb, S. R., Gibson, K. M., Hellman, L. M., Fried, M. G., and Dutch, R. E. (2013) J. Biol. Chem. 288, 35726-35735). To determine factors driving this association, 140 paramyxovirus F protein TM domain sequences were analyzed. A heptad repeat of β-branched residues was found, and analysis of the Hendra virus F TM domain revealed a heptad repeat leucine-isoleucine zipper motif (LIZ). Replacement of the LIZ with alanine resulted in dramatically reduced TM-TM association. Mutation of the LIZ in the whole protein resulted in decreased protein stability, including pre-fusion conformation stability. Together, our data suggest that the heptad repeat LIZ contributed to TM-TM association and is important for F protein function and pre-fusion stability. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

FusionAnalyser: a new graphical, event-driven tool for fusion rearrangements discovery

PubMed Central

Piazza, Rocco; Pirola, Alessandra; Spinelli, Roberta; Valletta, Simona; Redaelli, Sara; Magistroni, Vera; Gambacorti-Passerini, Carlo

2012-01-01

Gene fusions are common driver events in leukaemias and solid tumours; here we present FusionAnalyser, a tool dedicated to the identification of driver fusion rearrangements in human cancer through the analysis of paired-end high-throughput transcriptome sequencing data. We initially tested FusionAnalyser by using a set of in silico randomly generated sequencing data from 20 known human translocations occurring in cancer and subsequently using transcriptome data from three chronic and three acute myeloid leukaemia samples. in all the cases our tool was invariably able to detect the presence of the correct driver fusion event(s) with high specificity. In one of the acute myeloid leukaemia samples, FusionAnalyser identified a novel, cryptic, in-frame ETS2–ERG fusion. A fully event-driven graphical interface and a flexible filtering system allow complex analyses to be run in the absence of any a priori programming or scripting knowledge. Therefore, we propose FusionAnalyser as an efficient and robust graphical tool for the identification of functional rearrangements in the context of high-throughput transcriptome sequencing data. PMID:22570408

FusionAnalyser: a new graphical, event-driven tool for fusion rearrangements discovery.

PubMed

Piazza, Rocco; Pirola, Alessandra; Spinelli, Roberta; Valletta, Simona; Redaelli, Sara; Magistroni, Vera; Gambacorti-Passerini, Carlo

2012-09-01

Gene fusions are common driver events in leukaemias and solid tumours; here we present FusionAnalyser, a tool dedicated to the identification of driver fusion rearrangements in human cancer through the analysis of paired-end high-throughput transcriptome sequencing data. We initially tested FusionAnalyser by using a set of in silico randomly generated sequencing data from 20 known human translocations occurring in cancer and subsequently using transcriptome data from three chronic and three acute myeloid leukaemia samples. in all the cases our tool was invariably able to detect the presence of the correct driver fusion event(s) with high specificity. In one of the acute myeloid leukaemia samples, FusionAnalyser identified a novel, cryptic, in-frame ETS2-ERG fusion. A fully event-driven graphical interface and a flexible filtering system allow complex analyses to be run in the absence of any a priori programming or scripting knowledge. Therefore, we propose FusionAnalyser as an efficient and robust graphical tool for the identification of functional rearrangements in the context of high-throughput transcriptome sequencing data.

Mobile Bacterial Group II Introns at the Crux of Eukaryotic Evolution

PubMed Central

Lambowitz, Alan M.; Belfort, Marlene

2015-01-01

SUMMARY This review focuses on recent developments in our understanding of group II intron function, the relationships of these introns to retrotransposons and spliceosomes, and how their common features have informed thinking about bacterial group II introns as key elements in eukaryotic evolution. Reverse transcriptase-mediated and host factor-aided intron retrohoming pathways are considered along with retrotransposition mechanisms to novel sites in bacteria, where group II introns are thought to have originated. DNA target recognition and movement by target-primed reverse transcription infer an evolutionary relationship among group II introns, non-LTR retrotransposons, such as LINE elements, and telomerase. Additionally, group II introns are almost certainly the progenitors of spliceosomal introns. Their profound similarities include splicing chemistry extending to RNA catalysis, reaction stereochemistry, and the position of two divalent metals that perform catalysis at the RNA active site. There are also sequence and structural similarities between group II introns and the spliceosome’s small nuclear RNAs (snRNAs) and between a highly conserved core spliceosomal protein Prp8 and a group II intron-like reverse transcriptase. It has been proposed that group II introns entered eukaryotes during bacterial endosymbiosis or bacterial-archaeal fusion, proliferated within the nuclear genome, necessitating evolution of the nuclear envelope, and fragmented giving rise to spliceosomal introns. Thus, these bacterial self-splicing mobile elements have fundamentally impacted the composition of extant eukaryotic genomes, including the human genome, most of which is derived from close relatives of mobile group II introns. PMID:25878921

Characterization of fusion genes and the significantly expressed fusion isoforms in breast cancer by hybrid sequencing.

PubMed

Weirather, Jason L; Afshar, Pegah Tootoonchi; Clark, Tyson A; Tseng, Elizabeth; Powers, Linda S; Underwood, Jason G; Zabner, Joseph; Korlach, Jonas; Wong, Wing Hung; Au, Kin Fai

2015-10-15

We developed an innovative hybrid sequencing approach, IDP-fusion, to detect fusion genes, determine fusion sites and identify and quantify fusion isoforms. IDP-fusion is the first method to study gene fusion events by integrating Third Generation Sequencing long reads and Second Generation Sequencing short reads. We applied IDP-fusion to PacBio data and Illumina data from the MCF-7 breast cancer cells. Compared with the existing tools, IDP-fusion detects fusion genes at higher precision and a very low false positive rate. The results show that IDP-fusion will be useful for unraveling the complexity of multiple fusion splices and fusion isoforms within tumorigenesis-relevant fusion genes. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Burn Control in Fusion Reactors via Isotopic Fuel Tailoring

NASA Astrophysics Data System (ADS)

Boyer, Mark D.; Schuster, Eugenio

2011-10-01

The control of plasma density and temperature are among the most fundamental problems in fusion reactors and will be critical to the success of burning plasma experiments like ITER. Economic and technological constraints may require future commercial reactors to operate with low temperature, high-density plasma, for which the burn condition may be unstable. An active control system will be essential for stabilizing such operating points. In this work, a volume-averaged transport model for the energy and the densities of deuterium and tritium fuel ions, as well as the alpha particles, is used to synthesize a nonlinear feedback controller for stabilizing the burn condition. The controller makes use of ITER's planned isotopic fueling capability and controls the densities of these ions separately. The ability to modulate the DT fuel mix is exploited in order to reduce the fusion power during thermal excursions without the need for impurity injection. By moving the isotopic mix in the plasma away from the optimal 50:50 mix, the reaction rate is slowed and the alpha-particle heating is reduced to desired levels. Supported by the NSF CAREER award program (ECCS-0645086).

Mitochondrial remodeling following fission inhibition by 15d-PGJ2 involves molecular changes in mitochondrial fusion protein OPA1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kar, Rekha; Department of Biochemistry, UT Health Science Center at San Antonio, San Antonio, TX 78229; Mishra, Nandita

2010-09-03

Research highlights: {yields} Chemical inhibition of fission protein Drp1 leads to mitochondrial fusion. {yields} Increased fusion stimulates molecular changes in mitochondrial fusion protein OPA1. {yields} Proteolysis of larger isoforms, new synthesis and ubiquitination of OPA1 occur. {yields} Loss of mitochondrial tubular rigidity and disorganization of cristae. {yields} Generation of large swollen dysfunctional mitochondria. -- Abstract: We showed earlier that 15 deoxy {Delta}{sup 12,14} prostaglandin J2 (15d-PGJ2) inactivates Drp1 and induces mitochondrial fusion . However, prolonged incubation of cells with 15d-PGJ2 resulted in remodeling of fused mitochondria into large swollen mitochondria with irregular cristae structure. While initial fusion of mitochondria bymore » 15d-PGJ2 required the presence of both outer (Mfn1 and Mfn2) and inner (OPA1) mitochondrial membrane fusion proteins, later mitochondrial changes involved increased degradation of the fusion protein OPA1 and ubiquitination of newly synthesized OPA1 along with decreased expression of Mfn1 and Mfn2, which likely contributed to the loss of tubular rigidity, disorganization of cristae, and formation of large swollen degenerated dysfunctional mitochondria. Similar to inhibition of Drp1 by 15d-PGJ2, decreased expression of fission protein Drp1 by siRNA also resulted in the loss of fusion proteins. Prevention of 15d-PGJ2 induced mitochondrial elongation by thiol antioxidants prevented not only loss of OPA1 isoforms but also its ubiquitination. These findings provide novel insights into unforeseen complexity of molecular events that modulate mitochondrial plasticity.« less

Transition metal ions mediated tyrosine based short peptide amphiphile nanostructures inhibit bacterial growth.

PubMed

Joshi, Khashti Ballabh; Singh, Ramesh; Mishra, Narendra Kumar; Kumar, Vikas; Vinayak, Vandana

2018-05-17

We report the design and synthesis of biocompatible small peptide based molecule for the controlled and targeted delivery of the encapsulated bioactive metal ions via transforming their internal nanostructures. Tyrosine based short peptide amphiphile (sPA) was synthesized which self-assembled into β-sheet like secondary structures. The self assembly of the designed sPA was modulated by using different bioactive transition metal ions which is confirmed by spectroscopic and microscopic techniques. These bioactive metal ions conjugated sPA hybrid structures are further used to develop antibacterial materials. It is due to the excellent antibacterial activity of zinc ions that the growth of clinically relevant bacteria such as E. Coli was inhibited in the presence of zinc-sPA conjugate. The bacterial test demonstrated that owing to high biocompatibility with bacterial cell, the designed sPA worked as metal ions delivery agent and therefore it can show great potential in locally addressing bacterial infections. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Antiviral activity and specific modes of action of bacterial prodigiosin against Bombyx mori nucleopolyhedrovirus in vitro.

PubMed

Zhou, Wei; Zeng, Cheng; Liu, RenHua; Chen, Jie; Li, Ru; Wang, XinYan; Bai, WenWen; Liu, XiaoYuan; Xiang, TingTing; Zhang, Lin; Wan, YongJi

2016-05-01

Prodigiosin, the tripyrrole red pigment, is a bacterial secondary metabolite with multiple bioactivities; however, the antiviral activity has not been reported yet. In the present study, we found the antiviral activity of bacterial prodigiosin on Bombyx mori nucleopolyhedrovirus (BmNPV)-infected cells in vitro, with specific modes of action. Prodigiosin at nontoxic concentrations selectively killed virus-infected cells, inhibited viral gene transcription, especially viral early gene ie-1, and prevented virus-mediated membrane fusion. Under prodigiosin treatment, both progeny virus production and viral DNA replication were significantly inhibited. Fluorescent assays showed that prodigiosin predominantly located in cytoplasm which suggested it might interact with cytoplasm factors to inhibit virus replication. In conclusion, the present study clearly indicates that prodigiosin possesses significant antiviral activity against BmNPV.

Nuclear Fusion prize laudation Nuclear Fusion prize laudation

NASA Astrophysics Data System (ADS)

Burkart, W.

2011-01-01

Clean energy in abundance will be of critical importance to the pursuit of world peace and development. As part of the IAEA's activities to facilitate the dissemination of fusion related science and technology, the journal Nuclear Fusion is intended to contribute to the realization of such energy from fusion. In 2010, we celebrated the 50th anniversary of the IAEA journal. The excellence of research published in the journal is attested to by its high citation index. The IAEA recognizes excellence by means of an annual prize awarded to the authors of papers judged to have made the greatest impact. On the occasion of the 2010 IAEA Fusion Energy Conference in Daejeon, Republic of Korea at the welcome dinner hosted by the city of Daejeon, we celebrated the achievements of the 2009 and 2010 Nuclear Fusion prize winners. Steve Sabbagh, from the Department of Applied Physics and Applied Mathematics, Columbia University, New York is the winner of the 2009 award for his paper: 'Resistive wall stabilized operation in rotating high beta NSTX plasmas' [1]. This is a landmark paper which reports record parameters of beta in a large spherical torus plasma and presents a thorough investigation of the physics of resistive wall mode (RWM) instability. The paper makes a significant contribution to the critical topic of RWM stabilization. John Rice, from the Plasma Science and Fusion Center, MIT, Cambridge is the winner of the 2010 award for his paper: 'Inter-machine comparison of intrinsic toroidal rotation in tokamaks' [2]. The 2010 award is for a seminal paper that analyzes results across a range of machines in order to develop a universal scaling that can be used to predict intrinsic rotation. This paper has already triggered a wealth of experimental and theoretical work. I congratulate both authors and their colleagues on these exceptional papers. W. Burkart Deputy Director General Department of Nuclear Sciences and Applications International Atomic Energy Agency, Vienna

Measuring time of flight of fusion products in an inertial electrostatic confinement fusion device for spatial profiling of fusion reactions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Donovan, D. C.; Boris, D. R.; Kulcinski, G. L.

2013-03-15

A new diagnostic has been developed that uses the time of flight (TOF) of the products from a nuclear fusion reaction to determine the location where the fusion reaction occurred. The TOF diagnostic uses charged particle detectors on opposing sides of the inertial electrostatic confinement (IEC) device that are coupled to high resolution timing electronics to measure the spatial profile of fusion reactions occurring between the two charged particle detectors. This diagnostic was constructed and tested by the University of Wisconsin-Madison Inertial Electrostatic Confinement Fusion Group in the IEC device, HOMER, which accelerates deuterium ions to fusion relevant energies inmore » a high voltage ({approx}100 kV), spherically symmetric, electrostatic potential well [J. F. Santarius, G. L. Kulcinski, R. P. Ashley, D. R. Boris, B. B. Cipiti, S. K. Murali, G. R. Piefer, R. F. Radel, T. E. Radel, and A. L. Wehmeyer, Fusion Sci. Technol. 47, 1238 (2005)]. The TOF diagnostic detects the products of D(d,p)T reactions and determines where along a chord through the device the fusion event occurred. The diagnostic is also capable of using charged particle spectroscopy to determine the Doppler shift imparted to the fusion products by the center of mass energy of the fusion reactants. The TOF diagnostic is thus able to collect spatial profiles of the fusion reaction density along a chord through the device, coupled with the center of mass energy of the reactions occurring at each location. This provides levels of diagnostic detail never before achieved on an IEC device.« less

Protective effects of a bacterially expressed NIF-KGF fusion protein against bleomycin-induced acute lung injury in mice.

PubMed

Li, Xinping; Li, Shengli; Zhang, Miaotao; Li, Xiukun; Zhang, Xiaoming; Zhang, Wenlong; Li, Chuanghong

2010-08-01

Current evidence suggests that the keratinocyte growth factor (KGF) and the polymorphonuclear leukocyte may play key roles in the development of lung fibrosis. Here we describe the construction, expression, purification, and identification of a novel NIF (neutrophil inhibitory factor)-KGF mutant fusion protein (NKM). The fusion gene was ligated via a flexible octapeptide hinge and expressed as an insoluble protein in Escherichia coli BL21 (DE3). The fusion protein retained the activities of KGF and NIF, as it inhibited both fibroblast proliferation and leukocyte adhesion. Next, the effects of NKM on bleomycin-induced lung fibrosis in mice were examined. The mice were divided into the following four groups: (i) saline group; (ii) bleomycin group (instilled with 5 mg/kg bleomycin intratracheally); (iii) bleomycin plus dexamethasone (Dex) group (Dex was given intraperitoneally (i.p.) at 1 mg/kg/day 2 days prior to bleomycin instillation and daily after bleomycin instillation until the end of the treatment); and (iv) bleomycin plus NKM group (NKM was given i.p. at 2 mg/kg/day using the same protocol as the Dex group). NKM significantly improved the survival rates of mice exposed to bleomycin. The marked morphological changes and increased hydroxyproline levels resulted from the instillation of bleomycin (on Day 17) in the lungs were significantly inhibited by NKM. These results revealed that NKM can attenuate bleomycin-induced lung fibrosis, suggesting that NKM could be used to prevent bleomycin-induced lung damage or other interstitial pulmonary fibrosis.

[Construction and prokaryotic expression of recombinant gene EGFRvIII HBcAg and immunogenicity analysis of the fusion protein].

PubMed

Duan, Xiao-yi; Wang, Jian-sheng; Guo, You-min; Han, Jun-li; Wang, Quan-ying; Yang, Guang-xiao

2007-01-01

To construct recombinant prokaryotic expression plasmid pET28a(+)/c-PEP-3-c and evaluate the immunogenicity of the fusion protein. cDNA fragment encoding PEP-3 was obtained from pGEM-T Easy/PEP-3 and inserted into recombinant plasmid pGEMEX/HBcAg. Then it was subcloned in prokaryotic expression vector and transformed into E.coli BL21(DE3). The fusion protein was expressed by inducing IPTG and purified by Ni(2+)-NTA affinity chromatography. BALB/c mice were immunized with fusion protein and the antibody titre was determined by indirect ELISA. The recombinant gene was confirmed to be correct by restriction enzyme digestion and DNA sequencing. After prokaryotic expression, fusion protein existed in sediment and accounted for 56% of all bacterial lysate. The purified product accounted for 92% of all protein and its concentration was 8 g/L. The antibody titre in blood serum reached 1:16 000 after the fourth immunization and reached 1:2.56x10(5) after the sixth immunization. The titre of anti-PEP-3 antibody reached 1:1.28x10(5) and the titre of anti-HBcAg antibody was less than 1:4x10(3). Fusion gene PEP-3-HBcAg is highly expressed in E.coli BL21. The expressed fusion protein can induce neutralizing antibody with high titer and specificity, which lays a foundation for the study of genetically engineering vaccine for malignant tumors with the high expression of EGFRvIII.

Stereo matching image processing by synthesized color and the characteristic area by the synthesized color

NASA Astrophysics Data System (ADS)

Akiyama, Akira; Mutoh, Eiichiro; Kumagai, Hideo

2014-09-01

We have developed the stereo matching image processing by synthesized color and the corresponding area by the synthesized color for ranging the object and image recognition. The typical images from a pair of the stereo imagers may have some image disagreement each other due to the size change, missed place, appearance change and deformation of characteristic area. We constructed the synthesized color and corresponding color area with the same synthesized color to make the distinct stereo matching. We constructed the synthesized color and corresponding color area with the same synthesized color by the 3 steps. The first step is making binary edge image by differentiating the focused image from each imager and verifying that differentiated image has normal density of frequency distribution to find the threshold level of binary procedure. We used Daubechies wavelet transformation for the procedures of differentiating in this study. The second step is deriving the synthesized color by averaging color brightness between binary edge points with respect to horizontal direction and vertical direction alternatively. The averaging color procedure was done many times until the fluctuation of averaged color become negligible with respect to 256 levels in brightness. The third step is extracting area with same synthesized color by collecting the pixel of same synthesized color and grouping these pixel points by 4 directional connectivity relations. The matching areas for the stereo matching are determined by using synthesized color areas. The matching point is the center of gravity of each synthesized color area. The parallax between a pair of images is derived by the center of gravity of synthesized color area easily. The experiment of this stereo matching was done for the object of the soccer ball toy. From this experiment we showed that stereo matching by the synthesized color technique are simple and effective.

Spinal Fusion

MedlinePlus

... concept of fusion is similar to that of welding in industry. Spinal fusion surgery, however, does not ... bone taken from the patient has a long history of use and results in predictable healing. Autograft ...

Review of fusion synfuels

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fillo, J.A.

1980-01-01

Thermonuclear fusion offers an inexhaustible source of energy for the production of hydrogen from water. Depending on design, electric generation efficiencies of approx. 40 to 60% and hydrogen production efficiencies by high-temperature electrolysis of approx. 50 to 65% are projected for fusion reactors using high-temperatures blankets. Fusion/coal symbiotic systems appear economically promising for the first generation of commercial fusion synfuels plants. Coal production requirements and the environmental effects of large-scale coal usage would be greatly reduced by a fusion/coal system. In the long term, there could be a gradual transition to an inexhaustible energy system based solely on fusion.

An advanced communications synthesizer

NASA Astrophysics Data System (ADS)

Scherer, Ernst F.

1994-02-01

With the proliferation of smaller and lower cost EHF terminals, the fast-hopping microwave synthesizer subsystem is rapidly becoming the limiting factor for further size and cost reduction. A new approach, based on a high-speed direct digital synthesizer (DDS) and a very fast voltage controlled oscillator (VCO) tracking loop, has yielded a highly integrable design with true low-cost potential. A frequency range of 1 to 20 GHz can be covered by a simple substitution of the VCO module. This advanced synthesizer realization promises a generic solution to a large class of synthesizer requirements, greatly facilitating standardization and promoting modular system concepts.

Microalgae associated Brevundimonas sp. MSK 4 as the nano particle synthesizing unit to produce antimicrobial silver nanoparticles.

PubMed

Rajamanickam, Karthic; Sudha, S S; Francis, Mebin; Sowmya, T; Rengaramanujam, J; Sivalingam, Periyasamy; Prabakar, Kandasamy

2013-09-01

The biosynthesis of silver nanoparticles and its antimicrobial property was studied using bacteria isolated from Spirulina products. Isolated bacteria were identified as Bacillus sp. MSK 1 (JX495945), Staphylococcus sp. MSK 2 (JX495946), Bacillus sp. MSK 3 (JX495947) and Brevundimonas sp. MSK 4 (JX495948). Silver nanoparticles (AgNPs) were synthesized using bacterial culture filtrate with AgNO3. The initial syntheses of Ag nanoparticles were characterized by UV-vis spectrophotometer (by measuring the color change to intense brown). Fourier Transform Infrared Spectroscopy (FTIR) study showed evidence that proteins are possible reducing agents and Energy-dispersive X-ray (EDX) study showing the metal silver as major signal. The structure of AgNPs was determined by Scanning electron microscopy (SEM) and X-ray diffraction (XRD). Synthesized Ag nanoparticles with an average size of 40-65 nm have antimicrobial property against human pathogens like Proteus vulgaris, Salmonella typhi, Vibrio cholera, Streptococcus sp., Bacillus subtilis, Staphylococcus aureus, and Escherichia coli. Among the isolates Brevundimonas sp. MSK 4 alone showed good activity in both synthesis of AgNPs and antimicrobial activity. This work demonstrates the possible use of biological synthesized silver nanoparticles to combat the drug resistant problem. Copyright © 2013 Elsevier B.V. All rights reserved.

Arthroscopic partial wrist fusion.

PubMed

Ho, Pak-Cheong

2008-12-01

The wide intraarticular exposure of the wrist joint under arthroscopic view provides an excellent ground for various forms of partial wrist fusion. Combining with percutaneous fixation technique, arthroscopic partial wrist fusion can potentially generate the best possible functional outcome by preserving the maximal motion pertained with each type of partial wrist fusion because the effect of extraarticular adhesion associated with open surgery can be minimized. From November 1997 to May 2008, the author had performed 12 cases of arthroscopic partial wrist fusion, including scaphotrapeziotrapezoid fusion in 3, scaphoidectomy and 4-corner fusion in 4, radioscapholunate fusion in 3, radiolunate fusion in 1, and lunotriquetral fusion in 1 case. Through the radiocarpal or midcarpal joint, the corresponding articular surfaces were denuded of cartilage using arthroscopic burr and curette. Carpal bones involved in the fusion process were then transfixed with K wires percutaneously after alignment corrected and confirmed under fluoroscopic control. Autogenous cancellous bone graft or bone substitute were inserted and impacted to the fusion site through cannula under direct arthroscopic view. Final fixation could be by multiple K wires or cannulated screw system. Early mobilization was encouraged. Surgical complications were minor, including pin tract infection, skin burn, and delay union in 1 case. Uneventful radiologic union was obtained in 9 cases, stable fibrous union in 2, and nonunion in 1. The average follow-up period was 70 months. Symptom was resolved or improved, and functional motion was gained in all cases. All surgical scars were almost invisible, and aesthetic outcome was excellent.

Magneto-Inertial Fusion

DOE PAGES

Wurden, G. A.; Hsu, S. C.; Intrator, T. P.; ...

2015-11-17

In this community white paper, we describe an approach to achieving fusion which employs a hybrid of elements from the traditional magnetic and inertial fusion concepts, called magneto-inertial fusion (MIF). Furthermore, the status of MIF research in North America at multiple institutions is summarized including recent progress, research opportunities, and future plans.

Membrane fusion and exocytosis.

PubMed

Jahn, R; Südhof, T C

1999-01-01

Membrane fusion involves the merger of two phospholipid bilayers in an aqueous environment. In artificial lipid bilayers, fusion proceeds by means of defined transition states, including hourglass-shaped intermediates in which the proximal leaflets of the fusing membranes are merged whereas the distal leaflets are separate (fusion stalk), followed by the reversible opening of small aqueous fusion pores. Fusion of biological membranes requires the action of specific fusion proteins. Best understood are the viral fusion proteins that are responsible for merging the viral with the host cell membrane during infection. These proteins undergo spontaneous and dramatic conformational changes upon activation. In the case of the paradigmatic fusion proteins of the influenza virus and of the human immunodeficiency virus, an amphiphilic fusion peptide is inserted into the target membrane. The protein then reorients itself, thus forcing the fusing membranes together and inducing lipid mixing. Fusion of intracellular membranes in eukaryotic cells involves several protein families including SNAREs, Rab proteins, and Sec1/Munc-18 related proteins (SM-proteins). SNAREs form a novel superfamily of small and mostly membrane-anchored proteins that share a common motif of about 60 amino acids (SNARE motif). SNAREs reversibly assemble into tightly packed helical bundles, the core complexes. Assembly is thought to pull the fusing membranes closely together, thus inducing fusion. SM-proteins comprise a family of soluble proteins that bind to certain types of SNAREs and prevent the formation of core complexes. Rab proteins are GTPases that undergo highly regulated GTP-GDP cycles. In their GTP form, they interact with specific proteins, the effector proteins. Recent evidence suggests that Rab proteins function in the initial membrane contact connecting the fusing membranes but are not involved in the fusion reaction itself.

Phenyl thiazolyl urea and carbamate derivatives as new inhibitors of bacterial cell-wall biosynthesis.

PubMed

Francisco, Gerardo D; Li, Zhong; Albright, J Donald; Eudy, Nancy H; Katz, Alan H; Petersen, Peter J; Labthavikul, Pornpen; Singh, Guy; Yang, Youjun; Rasmussen, Beth A; Lin, Yang-I; Mansour, Tarek S

2004-01-05

Over 50 phenyl thiazolyl urea and carbamate derivatives were synthesized for evaluation as new inhibitors of bacterial cell-wall biosynthesis. Many of them demonstrated good activity against MurA and MurB and gram-positive bacteria including MRSA, VRE and PRSP. 3,4-Difluorophenyl 5-cyanothiazolylurea (3p) with clog P of 2.64 demonstrated antibacterial activity against both gram-positive and gram-negative bacteria.

Estimating bacterial production in marine waters from the simultaneous incorporation of thymidine and leucine.

PubMed

Chin-Leo, G; Kirchman, D L

1988-08-01

We examined the simultaneous incorporation of [H]thymidine and [C]leucine to obtain two independent indices of bacterial production (DNA and protein syntheses) in a single incubation. Incorporation rates of leucine estimated by the dual-label method were generally higher than those obtained by the single-label method, but the differences were small (dual/single = 1.1 +/- 0.2 [mean +/- standard deviation]) and were probably due to the presence of labeled leucyl-tRNA in the cold trichloroacetic acid-insoluble fraction. There were no significant differences in thymidine incorporation between dual- and single-label incubations (dual/ single = 1.03 +/- 0.13). Addition of the two substrates in relatively large amounts (25 nM) did not apparently increase bacterial activity during short incubations (<5 h). With the dual-label method we found that thymidine and leucine incorporation rates covaried over depth profiles of the Chesapeake Bay. Estimates of bacterial production based on thymidine and leucine differed by less than 25%. Although the need for appropriate conversion factors has not been eliminated, the dual-label approach can be used to examine the variation in bacterial production while ensuring that the observed variation in incorporation rates is due to real changes in bacterial production rather than changes in conversion factors or introduction of other artifacts.

Review of the magnetic fusion program by the 1986 ERAB Fusion Panel

NASA Astrophysics Data System (ADS)

Davidson, Ronald C.

1987-09-01

The 1986 ERAB Fusion Panel finds that fusion energy continues to be an attractive energy source with great potential for the future, and that the magnetic fusion program continues to make substantial technical progress. In addition, fusion research advances plasma physics, a sophisticated and useful branch of applied science, as well as technologies important to industry and defense. These factors fully justify the substantial expenditures by the Department of Energy in fusion research and development (R&D). The Panel endorses the overall program direction, strategy, and plans, and recognizes the importance and timeliness of proceeding with a burning plasma experiment, such as the proposed Compact Ignition Tokamak (CIT) experiment.

Amyloid-linked cellular toxicity triggered by bacterial inclusion bodies

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gonzalez-Montalban, Nuria; Departament de Genetica i de Microbiologia, Universitat Autonoma de Barcelona, Bellaterra, 08193 Barcelona; Ciber de Bioingenieria, Biomateriales y Nanomedicina

The aggregation of proteins in the form of amyloid fibrils and plaques is the characteristic feature of some pathological conditions ranging from neurodegenerative disorders to systemic amyloidoses. The mechanisms by which the aggregation processes result in cell damage are under intense investigation but recent data indicate that prefibrillar aggregates are the most proximate mediators of toxicity rather than mature fibrils. Since it has been shown that prefibrillar forms of the nondisease-related misfolded proteins are highly toxic to cultured mammalian cells we have studied the cytoxicity associated to bacterial inclusion bodies that have been recently described as protein deposits presenting amyloid-likemore » structures. We have proved that bacterial inclusion bodies composed by a misfolding-prone {beta}-galactosidase fusion protein are clearly toxic for mammalian cells but the {beta}-galactosidase wild type enzyme forming more structured thermal aggregates does not impair cell viability, despite it also binds and enter into the cells. These results are in the line that the most cytotoxic aggregates are early prefibrilar assemblies but discard the hypothesis that the membrane destabilization is Key event to subsequent disruption of cellular processes, such as ion balance, oxidative state and the eventually cell death.« less

The actin cytoskeleton inhibits pore expansion during PIV5 fusion protein-promoted cell-cell fusion

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wurth, Mark A.; Schowalter, Rachel M.; Smith, Everett Clinton

2010-08-15

Paramyxovirus fusion (F) proteins promote both virus-cell fusion, required for viral entry, and cell-cell fusion, resulting in syncytia formation. We used the F-actin stabilizing drug, jasplakinolide, and the G-actin sequestrant, latrunculin A, to examine the role of actin dynamics in cell-cell fusion mediated by the parainfluenza virus 5 (PIV5) F protein. Jasplakinolide treatment caused a dose-dependent increase in cell-cell fusion as measured by both syncytia and reporter gene assays, and latrunculin A treatment also resulted in fusion stimulation. Treatment with jasplakinolide or latrunculin A partially rescued a fusion pore opening defect caused by deletion of the PIV5 F protein cytoplasmicmore » tail, but these drugs had no effect on fusion inhibited at earlier stages by either temperature arrest or by a PIV5 heptad repeat peptide. These data suggest that the cortical actin cytoskeleton is an important regulator of fusion pore enlargement, an energetically costly stage of viral fusion protein-mediated membrane merger.« less

The actin cytoskeleton inhibits pore expansion during PIV5 fusion protein-promoted cell-cell fusion

PubMed Central

Wurth, Mark A.; Schowalter, Rachel M.; Smith, Everett Clinton; Moncman, Carole L.; Dutch, Rebecca Ellis; McCann, Richard O.

2010-01-01

Paramyxovirus fusion (F) proteins promote both virus-cell fusion, required for viral entry, and cell-cell fusion, resulting in syncytia formation. We used the F-actin stabilizing drug, jasplakinolide, and the G-actin sequestrant, latrunculin A, to examine the role of actin dynamics in cell-cell fusion mediated by the parainfluenza virus 5 (PIV5) F protein. Jasplakinolide treatment caused a dose-dependent increase in cell-cell fusion as measured by both syncytia and reporter gene assays, and latrunculin A treatment also resulted in fusion stimulation. Treatment with jasplakinolide or latrunculin A partially rescued a fusion pore opening defect caused by deletion of the PIV5 F protein cytoplasmic tail, but these drugs had no effect on fusion inhibited at earlier stages by either temperature arrest or by a PIV5 heptad repeat peptide. These data suggest that the cortical actin cytoskeleton is an important regulator of fusion pore enlargement, an energetically costly stage of viral fusion protein-mediated membrane merger. PMID:20537366

Post-translational modification of ribosomally synthesized peptides by a radical SAM epimerase in Bacillus subtilis

NASA Astrophysics Data System (ADS)

Benjdia, Alhosna; Guillot, Alain; Ruffié, Pauline; Leprince, Jérôme; Berteau, Olivier

2017-07-01

Ribosomally synthesized peptides are built out of L-amino acids, whereas D-amino acids are generally the hallmark of non-ribosomal synthetic processes. Here we show that the model bacterium Bacillus subtilis is able to produce a novel type of ribosomally synthesized and post-translationally modified peptide that contains D-amino acids, and which we propose to call epipeptides. We demonstrate that a two [4Fe-4S]-cluster radical S-adenosyl-L-methionine (SAM) enzyme converts L-amino acids into their D-counterparts by catalysing Cα-hydrogen-atom abstraction and using a critical cysteine residue as the hydrogen-atom donor. Unexpectedly, these D-amino acid residues proved to be essential for the activity of a peptide that induces the expression of LiaRS, a major component of the bacterial cell envelope stress-response system. Present in B. subtilis and in several members of the human microbiome, these epipeptides and radical SAM epimerases broaden the landscape of peptidyl structures accessible to living organisms.

Ontological Issues in Higher Levels of Information Fusion: User Refinement of the Fusion Process

DTIC Science & Technology

2003-01-01

fusion question, the thing that is separates the Greek We explore the higher-level purpose offusion systems by philosophical questions and modem day...the The Greeks focused on both data fusion and the Fusion02 conference there are common fusion questions philosophical questions of an ontology - the...data World of Visible Things Belief (pistis) fusion - user refinement. The rest of the paper is as Appearances follows: Section 2 details the Greek

Antibacterial Activity of Electrochemically Synthesized Colloidal Silver Nanoparticles Against Hospital-Acquired Infections

NASA Astrophysics Data System (ADS)

Thuc, Dao Tri; Huy, Tran Quang; Hoang, Luc Huy; Hoang, Tran Huy; Le, Anh-Tuan; Anh, Dang Duc

2017-06-01

This study evaluated the antibacterial activity of electrochemically synthesized colloidal silver nanoparticles (AgNPs) against hospital-acquired infections. Colloidal AgNPs were synthesized via a single process using bulk silver bars, bi-distilled water, trisodium citrate, and direct current voltage at room temperature. Colloidal AgNPs were characterized by transmission electron microscopy, field-emission scanning electron microscopy, and energy-dispersive x-ray analyses. The antibacterial activity of colloidal AgNPs against four bacterial strains isolated from clinical samples, including methicillin-resistant Staphylococcus aureus, Escherichia coli O157:H7, multidrug-resistant Pseudomonas aeruginosa, and carbapenem-resistant Klebsiella pneumonia, was evaluated by disc diffusion, minimum inhibitory concentration (MIC), and ultrathin sectioning electron microscopy. The results showed that the prepared AgNPs were 19.7 ± 4.3 nm in size, quasi-spherical, and of high purity. Zones of inhibition approximately 6-10 mm in diameter were found, corresponding to AgNPs concentrations of 50 μg/mL to 100 μg/mL. The MIC results revealed that the antibacterial activity of the prepared AgNPs was strongly dependent on the concentration and strain of the tested bacteria.

Decolorization of Distillery Spent Wash Using Biopolymer Synthesized by Pseudomonas aeruginosa Isolated from Tannery Effluent.

PubMed

David, Charles; Arivazhagan, M; Balamurali, M N; Shanmugarajan, Dhivya

2015-01-01

A bacterial strain was isolated from tannery effluent which can tolerate high concentrations of potassium dichromate up to 1000 ppm. The isolated microorganism was identified as Pseudomonas aeruginosa by performing biochemical tests and molecular characterization. In the presence of excess of carbohydrate source, which is a physiological stress, this strain produces Polyhydroxybutyrate (PHB). This intracellular polymer, which is synthesized, is primarily a product of carbon assimilation and is employed by microorganisms as an energy storage molecule to be metabolized when other common energy sources are limitedly available. Efforts were taken to check whether the PHB has any positive effect on spent wash decolorization. When a combination of PHB and the isolated bacterial culture was added to spent wash, a maximum color removal of 92.77% was found which was comparatively higher than the color removed when the spent wash was treated individually with the PHB and Pseudomonas aeruginosa. PHB behaved as a support material for the bacteria to bind to it and thus develops biofilm, which is one of the natural physiological growth forms of microorganisms. The bacterial growth in the biofilm and the polymer together acted in synergy, adsorbing and coagulating the pollutants in the form of color pigments.

Distinct Requirements for HIV-Cell Fusion and HIV-mediated Cell-Cell Fusion*

PubMed Central

Kondo, Naoyuki; Marin, Mariana; Kim, Jeong Hwa; Desai, Tanay M.; Melikyan, Gregory B.

2015-01-01

Whether HIV-1 enters cells by fusing with the plasma membrane or with endosomes is a subject of active debate. The ability of HIV-1 to mediate fusion between adjacent cells, a process referred to as “fusion-from-without” (FFWO), shows that this virus can fuse with the plasma membrane. To compare FFWO occurring at the cell surface with HIV-cell fusion through a conventional entry route, we designed an experimental approach that enabled the measurements of both processes in the same sample. The following key differences were observed. First, a very small fraction of viruses fusing with target cells participated in FFWO. Second, whereas HIV-1 fusion with adherent cells was insensitive to actin inhibitors, post-CD4/coreceptor binding steps during FFWO were abrogated. A partial dependence of HIV-cell fusion on actin remodeling was observed in CD4+ T cells, but this effect appeared to be due to the actin dependence of virus uptake. Third, deletion of the cytoplasmic tail of HIV-1 gp41 dramatically enhanced the ability of the virus to promote FFWO, while having a modest effect on virus-cell fusion. Distinct efficiencies and actin dependences of FFWO versus HIV-cell fusion are consistent with the notion that, except for a minor fraction of particles that mediate fusion between the plasma membranes of adjacent cells, HIV-1 enters through an endocytic pathway. We surmise, however, that cell-cell contacts enabling HIV-1 fusion with the plasma membrane could be favored at the sites of high density of target cells, such as lymph nodes. PMID:25589785

A Supramolecular Approach toward Bioinspired PAMAM-Dendronized Fusion Toxins.

PubMed

Kuan, Seah Ling; Förtsch, Christina; Ng, David Yuen Wah; Fischer, Stephan; Tokura, Yu; Liu, Weina; Wu, Yuzhou; Koynov, Kaloian; Barth, Holger; Weil, Tanja

2016-06-01

Nature has provided a highly optimized toolbox in bacterial endotoxins with precise functions dictated by their clear structural division. Inspired by this streamlined design, a supramolecular approach capitalizing on the strong biomolecular (streptavidin (SA))-biotin interactions is reported herein to prepare two multipartite fusion constructs, which involves the generation 2.0 (D2) or generation 3.0 (D3) polyamidoamine-dendronized transporter proteins (dendronized streptavidin (D3SA) and dendronized human serum albumin (D2HSA)) non-covalently fused to the C3bot1 enzyme from Clostridium botulinum, a potent and specific Rho-inhibitor. The fusion constructs, D3SA-C3 and D2HSA-C3, represent the first examples of dendronized protein transporters that are fused to the C3 enzyme, and it is successfully demonstrated that the C3 Rho-inhibitor is delivered into the cytosol of mammalian cells as determined from the characteristic C3-mediated changes in cell morphology and confocal microscopy. The design circumvents the low uptake of the C3 enzyme by eukaryotic cells and holds great promise for reprogramming the properties of toxin enzymes using a supramolecular approach to broaden their therapeutic applications. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Indole-based novel small molecules for the modulation of bacterial signalling pathways.

PubMed

Biswas, Nripendra Nath; Kutty, Samuel K; Barraud, Nicolas; Iskander, George M; Griffith, Renate; Rice, Scott A; Willcox, Mark; Black, David StC; Kumar, Naresh

2015-01-21

Gram-negative bacteria such as Pseudomonas aeruginosa use N-acylated L-homoserine lactones (AHLs) as autoinducers (AIs) for quorum sensing (QS), a major regulatory and cell-to-cell communication system for social adaptation, virulence factor production, biofilm formation and antibiotic resistance. Some bacteria use indole moieties for intercellular signaling and as regulators of various bacterial phenotypes important for evading the innate host immune response and antimicrobial resistance. A range of natural and synthetic indole derivatives have been found to act as inhibitors of QS-dependent bacterial phenotypes, complementing the bactericidal ability of traditional antibiotics. In this work, various indole-based AHL mimics were designed and synthesized via the 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC·HCl) and N,N'-dicyclohexylcarbodiimide (DCC) mediated coupling reactions of a variety of substituted or unsubstituted aminoindoles with different alkanoic acids. All synthesized compounds were tested for QS inhibition using a P. aeruginosa QS reporter strain by measuring the amount of green fluorescent protein (GFP) production. Docking studies were performed to examine their potential to bind and therefore inhibit the target QS receptor protein. The most potent compounds 11a, 11d and 16a showed 44 to 65% inhibition of QS activity at 250 μM concentration, and represent promising drug leads for the further development of anti-QS antimicrobial compounds.

Synthesis of α,β-unsaturated aldehydes as potential substrates for bacterial luciferases.

PubMed

Brodl, Eveline; Ivkovic, Jakov; Tabib, Chaitanya R; Breinbauer, Rolf; Macheroux, Peter

2017-02-15

Bacterial luciferase catalyzes the monooxygenation of long-chain aldehydes such as tetradecanal to the corresponding acid accompanied by light emission with a maximum at 490nm. In this study even numbered aldehydes with eight, ten, twelve and fourteen carbon atoms were compared with analogs having a double bond at the α,β-position. These α,β-unsaturated aldehydes were synthesized in three steps and were examined as potential substrates in vitro. The luciferase of Photobacterium leiognathi was found to convert these analogs and showed a reduced but significant bioluminescence activity compared to tetradecanal. This study showed the trend that aldehydes, both saturated and unsaturated, with longer chain lengths had higher activity in terms of bioluminescence than shorter chain lengths. The maximal light intensity of (E)-tetradec-2-enal was approximately half with luciferase of P. leiognathi, compared to tetradecanal. Luciferases of Vibrio harveyi and Aliivibrio fisheri accepted these newly synthesized substrates but light emission dropped drastically compared to saturated aldehydes. The onset and the decay rate of bioluminescence were much slower, when using unsaturated substrates, indicating a kinetic effect. As a result the duration of the light emission is doubled. These results suggest that the substrate scope of bacterial luciferases is broader than previously reported. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

Technologies for Army Knowledge Fusion

DTIC Science & Technology

2004-09-01

interpret it in context and understand the implications (Alberts et al., 2002). Note that the knowledge / information fusion issue arises immediately here...Army Knowledge Fusion Richard Scherl Department of Computer Science Monmouth University Dana L. Ulery Computational and Information Sciences...civilian and military sources. Knowledge fusion, also called information fusion and multisensor data fusion, names the body of techniques needed to

Structure of the cleavage-activated prefusion form of the parainfluenza virus 5 fusion protein.

PubMed

Welch, Brett D; Liu, Yuanyuan; Kors, Christopher A; Leser, George P; Jardetzky, Theodore S; Lamb, Robert A

2012-10-09

The paramyxovirus parainfluenza virus 5 (PIV5) enters cells by fusion of the viral envelope with the plasma membrane through the concerted action of the fusion (F) protein and the receptor binding protein hemagglutinin-neuraminidase. The F protein folds initially to form a trimeric metastable prefusion form that is triggered to undergo large-scale irreversible conformational changes to form the trimeric postfusion conformation. It is thought that F refolding couples the energy released with membrane fusion. The F protein is synthesized as a precursor (F0) that must be cleaved by a host protease to form a biologically active molecule, F1,F2. Cleavage of F protein is a prerequisite for fusion and virus infectivity. Cleavage creates a new N terminus on F1 that contains a hydrophobic region, known as the FP, which intercalates target membranes during F protein refolding. The crystal structure of the soluble ectodomain of the uncleaved form of PIV5 F is known; here we report the crystal structure of the cleavage-activated prefusion form of PIV5 F. The structure shows minimal movement of the residues adjacent to the protease cleavage site. Most of the hydrophobic FP residues are buried in the uncleaved F protein, and only F103 at the newly created N terminus becomes more solvent-accessible after cleavage. The conformational freedom of the charged arginine residues that compose the protease recognition site increases on cleavage of F protein.

Structure of the cleavage-activated prefusion form of the parainfluenza virus 5 fusion protein

PubMed Central

Welch, Brett D.; Liu, Yuanyuan; Kors, Christopher A.; Leser, George P.; Jardetzky, Theodore S.; Lamb, Robert A.

2012-01-01

The paramyxovirus parainfluenza virus 5 (PIV5) enters cells by fusion of the viral envelope with the plasma membrane through the concerted action of the fusion (F) protein and the receptor binding protein hemagglutinin-neuraminidase. The F protein folds initially to form a trimeric metastable prefusion form that is triggered to undergo large-scale irreversible conformational changes to form the trimeric postfusion conformation. It is thought that F refolding couples the energy released with membrane fusion. The F protein is synthesized as a precursor (F0) that must be cleaved by a host protease to form a biologically active molecule, F1,F2. Cleavage of F protein is a prerequisite for fusion and virus infectivity. Cleavage creates a new N terminus on F1 that contains a hydrophobic region, known as the FP, which intercalates target membranes during F protein refolding. The crystal structure of the soluble ectodomain of the uncleaved form of PIV5 F is known; here we report the crystal structure of the cleavage-activated prefusion form of PIV5 F. The structure shows minimal movement of the residues adjacent to the protease cleavage site. Most of the hydrophobic FP residues are buried in the uncleaved F protein, and only F103 at the newly created N terminus becomes more solvent-accessible after cleavage. The conformational freedom of the charged arginine residues that compose the protease recognition site increases on cleavage of F protein. PMID:23012473

Influence of incomplete fusion on complete fusion at energies above the Coulomb barrier

NASA Astrophysics Data System (ADS)

Shuaib, Mohd; Sharma, Vijay R.; Yadav, Abhishek; Sharma, Manoj Kumar; Singh, Pushpendra P.; Singh, Devendra P.; Kumar, R.; Singh, R. P.; Muralithar, S.; Singh, B. P.; Prasad, R.

2017-10-01

In the present work, excitation functions of several reaction residues in the system 19F+169Tm, populated via the complete and incomplete fusion processes, have been measured using off-line γ-ray spectroscopy. The analysis of excitation functions has been done within the framework of statistical model code pace4. The excitation functions of residues populated via xn and pxn channels are found to be in good agreement with those estimated by the theoretical model code, which confirms the production of these residues solely via complete fusion process. However, a significant enhancement has been observed in the cross-sections of residues involving α-emitting channels as compared to the theoretical predictions. The observed enhancement in the cross-sections has been attributed to the incomplete fusion processes. In order to have a better insight into the onset and strength of incomplete fusion, the incomplete fusion strength function has been deduced. At present, there is no theoretical model available which can satisfactorily explain the incomplete fusion reaction data at energies ≈4-6 MeV/nucleon. In the present work, the influence of incomplete fusion on complete fusion in the 19F+169Tm system has also been studied. The measured cross-section data may be important for the development of reactor technology as well. It has been found that the incomplete fusion strength function strongly depends on the α-Q value of the projectile, which is found to be in good agreement with the existing literature data. The analysis strongly supports the projectile-dependent mass-asymmetry systematics. In order to study the influence of Coulomb effect ({Z}{{P}}{Z}{{T}}) on incomplete fusion, the deduced strength function for the present work is compared with the nearby projectile-target combinations. The incomplete fusion strength function is found to increase linearly with {Z}{{P}}{Z}{{T}}, indicating a strong influence of Coulomb effect in the incomplete fusion reactions.

Cluster-impact fusion, or beam-contaminant fusion? (abstract)a),b)

NASA Astrophysics Data System (ADS)

Lo, Daniel H.; Petrasso, Richard D.; Wenzel, Kevin W.

1992-10-01

Beuhler, Friedlander, and Friedman (BFF) reported anomalously huge D-D fusion rates while bombarding deuterated targets with (D2O)N+ clusters (N˜25-1000) accelerated to ≊325 keV [R. J. Beuhler et al., Phys. Rev. Lett. 63, 1292 (1989); R. J. Beuhler et al., J. Phys. Chem. 94, 7665 (1990)] [i.e., ≊0.3 keV lab energy for D in (D2O)100+]. However, from our analysis of BFF's fusion product spectra, we conclude that their D lab energy was ˜50 keV. Therefore, no gross anomalies exist. Also, from our analysis of the BFF beam-ranging experiments through 500 μg/cm2 of Au, we conclude that light-ion-beam contaminants (e.g., D+ of order 100 keV) have not been ruled out, and are the probable cause of their fusion reactions. This work was supported by LLNL Subcontract B116798, Department of Energy (DOE) Grant No. DE-FG02-91ER54109, DOE Magnetic Fusion Energy Technology Fellowship Program (D. H. Lo), and DOE Fusion Energy Postdoctoral Research Program (Kevin W. Wenzel).

Fusion Science Education Outreach

NASA Astrophysics Data System (ADS)

Danielson, C. A.; DIII-D Education Group

1996-11-01

This presentation will focus on education outreach activities at General Atomics that have been expanded to include the general population on science education with a focus on fusion energy. Outreach materials are distributed upon request both nationally and internationally. These materials include a notebook containing copies of DIII--D tour panels, fusion poster, new fusion energy video, new fusion energy brochure, and the electromagnetic spectrum curriculum. The 1996 Fusion Forum (held in the House Caucus Room) included a student/ teacher lunch with Energy Secretary Hazel O'Leary and a private visit to the Forum exhibits. The continuing partnership with Kearny High School includes lectures, job shadowing, internship, equipment donations and an award-winning electric car-racing program. Development of distribution by CD of the existing interactive fusion energy kiosk and a virtual reality tour of the DIII--D facility are underway. The DIII--D fusion education WWW site includes e-mail addresses to ``Ask the Wizard,'' and/or receive GA's outreach materials. Steve Rodecker, a local science teacher, aided by DIII--D fusion staff, won his second Tapestry Award; he also was named the ``1995 National Science Teacher of the Year'' and will be present to share his experiences with the DIII--D educational outreach program.

Fusion Studies in Japan

NASA Astrophysics Data System (ADS)

Ogawa, Yuichi

2016-05-01

A new strategic energy plan decided by the Japanese Cabinet in 2014 strongly supports the steady promotion of nuclear fusion development activities, including the ITER project and the Broader Approach activities from the long-term viewpoint. Atomic Energy Commission (AEC) in Japan formulated the Third Phase Basic Program so as to promote an experimental fusion reactor project. In 2005 AEC has reviewed this Program, and discussed on selection and concentration among many projects of fusion reactor development. In addition to the promotion of ITER project, advanced tokamak research by JT-60SA, helical plasma experiment by LHD, FIREX project in laser fusion research and fusion engineering by IFMIF were highly prioritized. Although the basic concept is quite different between tokamak, helical and laser fusion researches, there exist a lot of common features such as plasma physics on 3-D magnetic geometry, high power heat load on plasma facing component and so on. Therefore, a synergetic scenario on fusion reactor development among various plasma confinement concepts would be important.

Tuning Bacterial Hydrodynamics with Magnetic Fields: A Path to Bacterial Robotics

NASA Astrophysics Data System (ADS)

Pierce, Christopher; Mumper, Eric; Brangham, Jack; Wijesinghe, Hiran; Lower, Stephen; Lower, Brian; Yang, Fengyuan; Sooryakumar, Ratnasingham

Magnetotactic Bacteria (MTB) are a group of motile prokaryotes that synthesize chains of lipid-bound, magnetic nano-particles. In this study, the innate magnetism of these flagellated swimmers is exploited to explore their hydrodynamics near confining surfaces, using the magnetic field as a tuning parameter. With weak (Gauss), uniform, external, magnetic ?elds and the field gradients arising from micro-magnetic surface patterns, the relative strength of hydrodynamic, magnetic and ?agellar force components is tuned through magnetic control of the bacteria's orientation and position. In addition to direct measurement of several hydrodynamic quantities related to the motility of individual cells, their tunable dynamics reveal a number of novel, highly controllable swimming behaviors with potential value in micro-robotics applications. Specifically, the experiments permit the MTB cells to be directed along parallel or divergent trajectories, suppress their flagellar forces through magnetic means, and induce transitions between planar, circulating trajectories and drifting, vertically oriented ``top-like'' motion. The implications of the work for fundamental hydrodynamics research as well as bacterially driven robotics applications will be discussed.

Fusion Rate and Clinical Outcomes in Two-Level Posterior Lumbar Interbody Fusion.

PubMed

Aono, Hiroyuki; Takenaka, Shota; Nagamoto, Yukitaka; Tobimatsu, Hidekazu; Yamashita, Tomoya; Furuya, Masayuki; Iwasaki, Motoki

2018-04-01

Posterior lumbar interbody fusion (PLIF) has become a general surgical method for degenerative lumbar diseases. Although many reports have focused on single-level PLIF, few have focused on 2-level PLIF, and no report has covered the fusion status of 2-level PLIF. The purpose of this study is to investigate clinical outcomes and fusion for 2-level PLIF by using a combination of dynamic radiographs and multiplanar-reconstruction computed tomography scans. This study consisted of 48 consecutive patients who underwent 2-level PLIF for degenerative lumbar diseases. We assessed surgery duration, estimated blood loss, complications, clinical outcomes as measured by the Japanese Orthopaedic Association score, lumbar sagittal alignment as measured on standing lateral radiographs, and fusion status as measured by dynamic radiographs and multiplanar-reconstruction computed tomography. Patients were examined at a follow-up point of 4.8 ± 2.2 years after surgery. Thirty-eight patients who did not undergo lumbosacral fusion comprised the lumbolumbar group, and 10 patients who underwent lumbosacral fusion comprised the lumbosacral group. The mean Japanese Orthopaedic Association score improved from 12.1 to 22.4 points by the final follow-up examination. Sagittal alignment also was improved. All patients had fusion in the cranial level. Seven patients had nonunion in the caudal level, and the lumbosacral group (40%) had a significantly poorer fusion rate than the lumbolumbar group (97%) did. Surgical outcomes of 2-level PLIF were satisfactory. The fusion rate at both levels was 85%. All nonunion was observed at the caudal level and concentrated at L5-S level in L4-5-S PLIF. Copyright © 2018 Elsevier Inc. All rights reserved.

Expression of lysozymes from Erwinia amylovora phages and Erwinia genomes and inhibition by a bacterial protein.

PubMed

Müller, Ina; Gernold, Marina; Schneider, Bernd; Geider, Klaus

2012-01-01

Genes coding for lysozyme-inhibiting proteins (Ivy) were cloned from the chromosomes of the plant pathogens Erwinia amylovora and Erwinia pyrifoliae. The product interfered not only with activity of hen egg white lysozyme, but also with an enzyme from E. amylovora phage ΦEa1h. We have expressed lysozyme genes from the genomes of three Erwinia species in Escherichia coli. The lysozymes expressed from genes of the E. amylovora phages ΦEa104 and ΦEa116, Erwinia chromosomes and Arabidopsis thaliana were not affected by Ivy. The enzyme from bacteriophage ΦEa1h was fused at the N- or C-terminus to other peptides. Compared to the intact lysozyme, a His-tag reduced its lytic activity about 10-fold and larger fusion proteins abolished activity completely. Specific protease cleavage restored lysozyme activity of a GST-fusion. The bacteriophage-encoded lysozymes were more active than the enzymes from bacterial chromosomes. Viral lyz genes were inserted into a broad-host range vector, and transfer to E. amylovora inhibited cell growth. Inserted in the yeast Pichia pastoris, the ΦEa1h-lysozyme was secreted and also inhibited by Ivy. Here we describe expression of unrelated cloned 'silent' lyz genes from Erwinia chromosomes and a novel interference of bacterial Ivy proteins with a viral lysozyme. Copyright © 2012 S. Karger AG, Basel.

Bacterial molecular networks: bridging the gap between functional genomics and dynamical modelling.

PubMed

van Helden, Jacques; Toussaint, Ariane; Thieffry, Denis

2012-01-01

This introductory review synthesizes the contents of the volume Bacterial Molecular Networks of the series Methods in Molecular Biology. This volume gathers 9 reviews and 16 method chapters describing computational protocols for the analysis of metabolic pathways, protein interaction networks, and regulatory networks. Each protocol is documented by concrete case studies dedicated to model bacteria or interacting populations. Altogether, the chapters provide a representative overview of state-of-the-art methods for data integration and retrieval, network visualization, graph analysis, and dynamical modelling.

Control of mechanically activated polymersome fusion: Factors affecting fusion

DOE PAGES

Henderson, Ian M.; Paxton, Walter F.

2014-12-15

Previously we have studied the mechanically-activated fusion of extruded (200 nm) polymer vesicles into giant polymersomes using agitation in the presence of salt. In this study we have investigated several factors contributing to this phenomenon, including the effects of (i) polymer vesicle concentration, (ii) agitation speed and duration, and iii) variation of the salt and its concentration. It was found that increasing the concentration of the polymer dramatically increases the production of giant vesicles through the increased collisions of polymersomes. Our investigations also found that increasing the frequency of agitation increased the efficiency of fusion, though ultimately limited the sizemore » of vesicle which could be produced due to the high shear involved. Finally it was determined that salt-mediation of the fusion process was not limited to NaCl, but is instead a general effect facilitated by the presence of solvated ionic compounds, albeit with different salts initiating fusion at different concentration.« less

Image fusion

NASA Technical Reports Server (NTRS)

Pavel, M.

1993-01-01

The topics covered include the following: a system overview of the basic components of a system designed to improve the ability of a pilot to fly through low-visibility conditions such as fog; the role of visual sciences; fusion issues; sensor characterization; sources of information; image processing; and image fusion.

Nuclear and cytoplasmic genome components of Solanum tuberosum + S. chacoense somatic hybrids and three SSR alleles related to bacterial wilt resistance.

PubMed

Chen, Lin; Guo, Xianpu; Xie, Conghua; He, Li; Cai, Xingkui; Tian, Lingli; Song, Botao; Liu, Jun

2013-07-01

The somatic hybrids were derived previously from protoplast fusion between Solanum tuberosum and S. chacoense to gain the bacterial wilt resistance from the wild species. The genome components analysis in the present research was to clarify the nuclear and cytoplasmic composition of the hybrids, to explore the molecular markers associated with the resistance, and provide information for better use of these hybrids in potato breeding. One hundred and eight nuclear SSR markers and five cytoplasmic specific primers polymorphic between the fusion parents were used to detect the genome components of 44 somatic hybrids. The bacterial wilt resistance was assessed thrice by inoculating the in vitro plants with a bacterial suspension of race 1. The disease index, relative disease index, and resistance level were assigned to each hybrid, which were further analyzed in relation to the molecular markers for elucidating the potential genetic base of the resistance. All of the 317 parental unique nuclear SSR alleles appeared in the somatic hybrids with some variations in the number of bands detected. Nearly 80 % of the hybrids randomly showed the chloroplast pattern of one parent, and most of the hybrids exhibited a fused mitochondrial DNA pattern. One hundred and nine specific SSR alleles of S. chacoense were analyzed for their relationship with the disease index of the hybrids, and three alleles were identified to be significantly associated with the resistance. Selection for the resistant SSR alleles of S. chacoense may increase the possibility of producing resistant pedigrees.

50 years of fusion research

NASA Astrophysics Data System (ADS)

Meade, Dale

2010-01-01

Fusion energy research began in the early 1950s as scientists worked to harness the awesome power of the atom for peaceful purposes. There was early optimism for a quick solution for fusion energy as there had been for fission. However, this was soon tempered by reality as the difficulty of producing and confining fusion fuel at temperatures of 100 million °C in the laboratory was appreciated. Fusion research has followed two main paths—inertial confinement fusion and magnetic confinement fusion. Over the past 50 years, there has been remarkable progress with both approaches, and now each has a solid technical foundation that has led to the construction of major facilities that are aimed at demonstrating fusion energy producing plasmas.

Green synthesis of silk sericin-capped silver nanoparticles and their potent anti-bacterial activity

NASA Astrophysics Data System (ADS)

Aramwit, Pornanong; Bang, Nipaporn; Ratanavaraporn, Juthamas; Ekgasit, Sanong

2014-02-01

In this study, a `green chemistry' approach was introduced to synthesize silk sericin (SS)-capped silver nanoparticles (AgNPs) under an alkaline condition (pH 11) using SS as a reducing and stabilizing agent instead of toxic chemicals. The SS-capped AgNPs were successfully synthesized at various concentrations of SS and AgNO3, but the yields were different. A higher yield of SS-capped AgNPs was obtained when the concentrations of SS and AgNO3 were increased. The SS-capped AgNPs showed a round shape and uniform size with diameter at around 48 to 117 nm. The Fourier transform infrared (FT-IR) spectroscopy result proved that the carboxylate groups obtained from alkaline degradation of SS would be a reducing agent for the generation of AgNPs while COO- and NH2 + groups stabilized the AgNPs and prevented their precipitation or aggregation. Furthermore, the SS-capped AgNPs showed potent anti-bacterial activity against various gram-positive bacteria (minimal inhibitory concentration (MIC) 0.008 mM) and gram-negative bacteria (MIC ranging from 0.001 to 0.004 mM). Therefore, the SS-capped AgNPs would be a safe candidate for anti-bacterial applications.

Transgenic carrot expressing fusion protein comprising M. tuberculosis antigens induces immune response in mice.

PubMed

Permyakova, Natalia V; Zagorskaya, Alla A; Belavin, Pavel A; Uvarova, Elena A; Nosareva, Olesya V; Nesterov, Andrey E; Novikovskaya, Anna A; Zav'yalov, Evgeniy L; Moshkin, Mikhail P; Deineko, Elena V

2015-01-01

Tuberculosis remains one of the major infectious diseases, which continues to pose a major global health problem. Transgenic plants may serve as bioreactors to produce heterologous proteins including antibodies, antigens, and hormones. In the present study, a genetic construct has been designed that comprises the Mycobacterium tuberculosis genes cfp10, esat6 and dIFN gene, which encode deltaferon, a recombinant analog of the human γ-interferon designed for expression in plant tissues. This construct was transferred to the carrot (Daucus carota L.) genome by Agrobacterium-mediated transformation. This study demonstrates that the fusion protein CFP10-ESAT6-dIFN is synthesized in the transgenic carrot storage roots. The protein is able to induce both humoral and cell-mediated immune responses in laboratory animals (mice) when administered either orally or by injection. It should be emphasized that M. tuberculosis antigens contained in the fusion protein have no cytotoxic effect on peripheral blood mononuclear cells.

Fusion for Space Propulsion

NASA Technical Reports Server (NTRS)

Thio, Y. C. Francis; Schafer, Charles (Technical Monitor)

2001-01-01

There is little doubt that humans will attempt to explore and develop the solar system in this century. A large amount of energy will be required for accomplishing this. The need for fusion propulsion is discussed. For a propulsion system, there are three important thermodynamical attributes: (1) The absolute amount of energy available, (2) the propellant exhaust velocity, and (3) the jet power per unit mass of the propulsion system (specific power). For human exploration and development of the solar system, propellant exhaust velocity in excess of 100 km/s and specific power in excess of 10 kW/kg are required. Chemical combustion can produce exhaust velocity up to about 5 km/s. Nuclear fission processes typically result in producing energy in the form of heat that needs to be manipulated at temperatures limited by materials to about 2,800 K. Using the energy to heat a hydrogen propellant increases the exhaust velocity by only a factor of about two. Alternatively the energy can be converted into electricity which is then used to accelerate particles to high exhaust velocity. The necessary power conversion and conditioning equipment, however, increases the mass of the propulsion system for the same jet power by more than two orders of magnitude over chemical system, thus greatly limits the thrust-to-weight ratio attainable. The principal advantage of the fission process is that its development is relatively mature and is available right now. If fusion can be developed, fusion appears to have the best of all worlds in terms of propulsion - it can provide the absolute amount, the propellant exhaust velocity, and the high specific jet power. An intermediate step towards pure fusion propulsion is a bimodal system in which a fission reactor is used to provide some of the energy to drive a fusion propulsion unit. The technical issues related to fusion for space propulsion are discussed. The technical priorities for developing and applying fusion for propulsion are

C-terminal tyrosine residues modulate the fusion activity of the Hendra virus fusion protein

PubMed Central

Popa, Andreea; Pager, Cara Teresia; Dutch, Rebecca Ellis

2011-01-01

The paramyxovirus family includes important human pathogens such as measles, mumps, respiratory syncytial virus and the recently emerged, highly pathogenic Hendra and Nipah viruses. The viral fusion (F) protein plays critical roles in infection, promoting both the viral-cell membrane fusion events needed for viral entry as well as cell-cell fusion events leading to syncytia formation. We describe the surprising finding that addition of the short epitope HA tag to the cytoplasmic tail (CT) of the Hendra virus F protein leads to a significant increase in cell-cell membrane fusion. This increase was not due to alterations in surface expression, cleavage state, or association with lipid microdomains. Addition of a Myc tag of similar length did not alter Hendra F fusion activity, indicating that the observed stimulation was not solely a result of lengthening the CT. Three tyrosine residues within the HA tag were critical for the increase in fusion, suggesting C-terminal tyrosines may modulate Hendra fusion activity. The effects of HA tag addition varied with other fusion proteins, as parainfluenza virus 5 F-HA showed decreased surface expression and no stimulation in fusion. These results indicate that additions to the C-terminal end of the F protein CT can modulate protein function in a sequence specific manner, reinforcing the need for careful analysis of epitope tagged glycoproteins. In addition, our results implicate C-terminal tyrosine residues in modulation of the membrane fusion reaction promoted by these viral glycoproteins. PMID:21175223

Biological effects of individually synthesized TNF-binding domain of variola virus CrmB protein.

PubMed

Tsyrendorzhiev, D D; Orlovskaya, I A; Sennikov, S V; Tregubchak, T V; Gileva, I P; Tsyrendorzhieva, M D; Shchelkunov, S N

2014-06-01

The biological characteristics of a 17-kDa protein synthesized in bacterial cells, a TNF-binding domain (VARV-TNF-BP) of a 47-kDa variola virus CrmB protein (VARV-CrmB) consisting of TNF-binding and chemokine-binding domains, were studied. Removal of the C-terminal chemokine-binding domain from VARV-CrmB protein was inessential for the efficiency of its inhibition of TNF cytotoxicity towards L929 mouse fibroblast culture and for TNF-induced oxidative metabolic activity of mouse blood leukocytes. The results of this study could form the basis for further studies of VARV-TNF-BP mechanisms of activity for prospective use in practical medicine.

Opioids delay healing of spinal fusion: a rabbit posterolateral lumbar fusion model.

PubMed

Jain, Nikhil; Himed, Khaled; Toth, Jeffrey M; Briley, Karen C; Phillips, Frank M; Khan, Safdar N

2018-04-19

Opioid use is prevalent for management of pre- and post-operative pain in patients undergoing spinal fusion. There is evidence that opioids downregulate osteoblasts in-vitro, and one previous study found that morphine delays the maturation and remodeling of callus in a rat femur fracture model. However, the effect of opioids on healing of spinal fusion has not been investigated before. Isolating the effect of opioid exposure in humans would be limited by the numerous confounding factors that affect fusion healing. Therefore, we have used a well-established rabbit model to study the process of spinal fusion healing that closely mimics humans. To study the effect of systemic opioids on the process of healing of spinal fusion in a rabbit posterolateral spinal fusion model. Pre-clinical animal study. 24 adult New Zealand white rabbits were studied in two groups after approval from the Institutional Animal Care and Use Committee (IACUC). The opioid group (n=12) received four-weeks pre-operative and six-weeks post-operative transdermal fentanyl. Serum fentanyl levels were measured just before surgery and four-weeks post-operatively to ensure adequate levels. The control group (n=12) received only peri-operative pain control as necessary. All animals received a bilateral L5-L6 posterolateral spinal fusion using iliac crest autograft. Animals were euthanized at the six-week post-operative time point, and assessment of fusion was done by manual palpation, plain radiographs, micro-computed tomography (microCT), and histology. 12 animals in control group and 11 animals in the opioid group were available for analysis at the end of six weeks. The fusion scores on manual palpation, radiographs, and microCT were not statistically different. Three-dimensional microCT morphometry found that the fusion mass in the opioid group had a lower bone volume (p=0.09), lower trabecular number (p=0.02) and higher trabecular separation (p=0.02) as compared to control. Histological analysis

Glutamyl-gamma-boronate inhibitors of bacterial Glu-tRNA(Gln) amidotransferase.

PubMed

Decicco, C P; Nelson, D J; Luo, Y; Shen, L; Horiuchi, K Y; Amsler, K M; Foster, L A; Spitz, S M; Merrill, J J; Sizemore, C F; Rogers, K C; Copeland, R A; Harpel, M R

2001-09-17

Analogues of glutamyl-gamma-boronate (1) were synthesized as mechanism-based inhibitors of bacterial Glu-tRNA(Gln) amidotransferase (Glu-AdT) and were designed to engage a putative catalytic serine nucleophile required for the glutaminase activity of the enzyme. Although 1 provides potent enzyme inhibition, structure-activity studies revealed a narrow range of tolerated chemical changes that maintained activity. Nonetheless, growth inhibition of organisms that require Glu-AdT by the most potent enzyme inhibitors appears to validate mechanism-based inhibitor design of Glu-AdT as an approach to antimicrobial development.

Systematic analysis of advanced fusion fuel in inertial fusion energy

NASA Astrophysics Data System (ADS)

Velarde, G.; Eliezer, S.; Henis, Z.; Piera, M.; Martinez-Val, J. M.

1997-04-01

Aneutronic fusion reactions can be considered as the cleanest way to exploit nuclear energy. However, these reactions present in general two main drawbacks.—very high temperatures are needed to reach relevant values of their cross sections—Moderate (and even low) energy yield per reaction. This value is still lower if measured in relation to the Z number of the reacting particles. It is already known that bremsstrahlung overruns the plasma reheating by fusion born charged-particles in most of the advanced fuels. This is for instance the case for proton-boron-11 fusion in a stoichiometric plasma and is also so in lithium isotopes fusion reactions. In this paper, the use of deuterium-tritium seeding is suggested to allow to reach higher burnup fractions of advanced fuels, starting at a lower ignition temperature. Of course, neutron production increases as DT contents does. Nevertheless, the ratio of neutron production to energy generation is much lower in DT-advanced fuel mixtures than in pure DT plasmas. One of the main findings of this work is that some natural resources (as D and Li-7) can be burned-up in a catalytic regime for tritium. In this case, neither external tritium breeding nor tritium storage are needed, because the tritium inventory after the fusion burst is the same as before it. The fusion reactor can thus operate on a pure recycling of a small tritium inventory.

The role of magnetic iron oxide nanoparticles in the bacterially induced calcium carbonate precipitation.

PubMed

Seifan, Mostafa; Ebrahiminezhad, Alireza; Ghasemi, Younes; Samani, Ali Khajeh; Berenjian, Aydin

2018-04-01

Recently, magnetic iron oxide nanoparticles (IONs) have been used to control and modify the characteristics of concrete and mortar. Concrete is one of the most used materials in the world; however, it is susceptible to cracking. Over recent years, a sustainable biotechnological approach has emerged as an alternative approach to conventional techniques to heal the concrete cracks by the incorporation of bacterial cells and nutrients into the concrete matrix. Once cracking occurs, CaCO 3 is induced and the crack is healed. Considering the positive effects of IONs on the concrete properties, the effect of these nanoparticles on bacterial growth and CaCO 3 biosynthesis needs to be evaluated for their possible application in bio self-healing concrete. In the present work, IONs were successfully synthesized and characterized using various techniques. The presence of IONs showed a significant effect on both bacterial growth and CaCO 3 precipitation. The highest bacterial growth was observed in the presence of 150 μg/mL IONs. The highest concentration of induced CaCO 3 (34.54 g/L) was achieved when the bacterial cells were immobilized with 300 μg/mL of IONs. This study provides new data and supports the possibility of using IONs as a new tool in designing the next generation of bio self-healing concrete.

Estimating Bacterial Production in Marine Waters from the Simultaneous Incorporation of Thymidine and Leucine

PubMed Central

Chin-Leo, Gerardo; Kirchman, David L.

1988-01-01

We examined the simultaneous incorporation of [3H]thymidine and [14C]leucine to obtain two independent indices of bacterial production (DNA and protein syntheses) in a single incubation. Incorporation rates of leucine estimated by the dual-label method were generally higher than those obtained by the single-label method, but the differences were small (dual/single = 1.1 ± 0.2 [mean ± standard deviation]) and were probably due to the presence of labeled leucyl-tRNA in the cold trichloroacetic acid-insoluble fraction. There were no significant differences in thymidine incorporation between dual- and single-label incubations (dual/ single = 1.03 ± 0.13). Addition of the two substrates in relatively large amounts (25 nM) did not apparently increase bacterial activity during short incubations (<5 h). With the dual-label method we found that thymidine and leucine incorporation rates covaried over depth profiles of the Chesapeake Bay. Estimates of bacterial production based on thymidine and leucine differed by less than 25%. Although the need for appropriate conversion factors has not been eliminated, the dual-label approach can be used to examine the variation in bacterial production while ensuring that the observed variation in incorporation rates is due to real changes in bacterial production rather than changes in conversion factors or introduction of other artifacts. PMID:16347706

The Extracellular Domain of Human High Affinity Copper Transporter (hNdCTR1), Synthesized by E. coli Cells, Chelates Silver and Copper Ions In Vivo.

PubMed

Sankova, Tatiana P; Orlov, Iurii A; Saveliev, Andrey N; Kirilenko, Demid A; Babich, Polina S; Brunkov, Pavel N; Puchkova, Ludmila V

2017-11-03

There is much interest in effective copper chelators to correct copper dyshomeostasis in neurodegenerative and oncological diseases. In this study, a recombinant fusion protein for expression in Escherichia coli cells was constructed from glutathione-S-transferase (GST) and the N-terminal domain (ectodomain) of human high affinity copper transporter CTR1 (hNdCTR1), which has three metal-bound motifs. Several biological properties of the GST-hNdCTR1 fusion protein were assessed. It was demonstrated that in cells, the protein was prone to oligomerization, formed inclusion bodies and displayed no toxicity. Treatment of E. coli cells with copper and silver ions reduced cell viability in a dose- and time-dependent manner. Cells expressing GST-hNdCTR1 protein demonstrated resistance to the metal treatments. These cells accumulated silver ions and formed nanoparticles that contained AgCl and metallic silver. In this bacterial population, filamentous bacteria with a length of about 10 µm were often observed. The possibility for the fusion protein carrying extracellular metal binding motifs to integrate into the cell's copper metabolism and its chelating properties are discussed.

FusionHub: A unified web platform for annotation and visualization of gene fusion events in human cancer.

PubMed

Panigrahi, Priyabrata; Jere, Abhay; Anamika, Krishanpal

2018-01-01

Gene fusion is a chromosomal rearrangement event which plays a significant role in cancer due to the oncogenic potential of the chimeric protein generated through fusions. At present many databases are available in public domain which provides detailed information about known gene fusion events and their functional role. Existing gene fusion detection tools, based on analysis of transcriptomics data usually report a large number of fusion genes as potential candidates, which could be either known or novel or false positives. Manual annotation of these putative genes is indeed time-consuming. We have developed a web platform FusionHub, which acts as integrated search engine interfacing various fusion gene databases and simplifies large scale annotation of fusion genes in a seamless way. In addition, FusionHub provides three ways of visualizing fusion events: circular view, domain architecture view and network view. Design of potential siRNA molecules through ensemble method is another utility integrated in FusionHub that could aid in siRNA-based targeted therapy. FusionHub is freely available at https://fusionhub.persistent.co.in.

Gene Fusion Markup Language: a prototype for exchanging gene fusion data.

PubMed

Kalyana-Sundaram, Shanker; Shanmugam, Achiraman; Chinnaiyan, Arul M

2012-10-16

An avalanche of next generation sequencing (NGS) studies has generated an unprecedented amount of genomic structural variation data. These studies have also identified many novel gene fusion candidates with more detailed resolution than previously achieved. However, in the excitement and necessity of publishing the observations from this recently developed cutting-edge technology, no community standardization approach has arisen to organize and represent the data with the essential attributes in an interchangeable manner. As transcriptome studies have been widely used for gene fusion discoveries, the current non-standard mode of data representation could potentially impede data accessibility, critical analyses, and further discoveries in the near future. Here we propose a prototype, Gene Fusion Markup Language (GFML) as an initiative to provide a standard format for organizing and representing the significant features of gene fusion data. GFML will offer the advantage of representing the data in a machine-readable format to enable data exchange, automated analysis interpretation, and independent verification. As this database-independent exchange initiative evolves it will further facilitate the formation of related databases, repositories, and analysis tools. The GFML prototype is made available at http://code.google.com/p/gfml-prototype/. The Gene Fusion Markup Language (GFML) presented here could facilitate the development of a standard format for organizing, integrating and representing the significant features of gene fusion data in an inter-operable and query-able fashion that will enable biologically intuitive access to gene fusion findings and expedite functional characterization. A similar model is envisaged for other NGS data analyses.

Gene Fusion Markup Language: a prototype for exchanging gene fusion data

PubMed Central

2012-01-01

Background An avalanche of next generation sequencing (NGS) studies has generated an unprecedented amount of genomic structural variation data. These studies have also identified many novel gene fusion candidates with more detailed resolution than previously achieved. However, in the excitement and necessity of publishing the observations from this recently developed cutting-edge technology, no community standardization approach has arisen to organize and represent the data with the essential attributes in an interchangeable manner. As transcriptome studies have been widely used for gene fusion discoveries, the current non-standard mode of data representation could potentially impede data accessibility, critical analyses, and further discoveries in the near future. Results Here we propose a prototype, Gene Fusion Markup Language (GFML) as an initiative to provide a standard format for organizing and representing the significant features of gene fusion data. GFML will offer the advantage of representing the data in a machine-readable format to enable data exchange, automated analysis interpretation, and independent verification. As this database-independent exchange initiative evolves it will further facilitate the formation of related databases, repositories, and analysis tools. The GFML prototype is made available at http://code.google.com/p/gfml-prototype/. Conclusion The Gene Fusion Markup Language (GFML) presented here could facilitate the development of a standard format for organizing, integrating and representing the significant features of gene fusion data in an inter-operable and query-able fashion that will enable biologically intuitive access to gene fusion findings and expedite functional characterization. A similar model is envisaged for other NGS data analyses. PMID:23072312

Line tension at lipid phase boundaries as driving force for HIV fusion peptide-mediated fusion

NASA Astrophysics Data System (ADS)

Yang, Sung-Tae; Kiessling, Volker; Tamm, Lukas K.

2016-04-01

Lipids and proteins are organized in cellular membranes in clusters, often called `lipid rafts'. Although raft-constituent ordered lipid domains are thought to be energetically unfavourable for membrane fusion, rafts have long been implicated in many biological fusion processes. For the case of HIV gp41-mediated membrane fusion, this apparent contradiction can be resolved by recognizing that the interfaces between ordered and disordered lipid domains are the predominant sites of fusion. Here we show that line tension at lipid domain boundaries contributes significant energy to drive gp41-fusion peptide-mediated fusion. This energy, which depends on the hydrophobic mismatch between ordered and disordered lipid domains, may contribute tens of kBT to fusion, that is, it is comparable to the energy required to form a lipid stalk intermediate. Line-active compounds such as vitamin E lower line tension in inhomogeneous membranes, thereby inhibit membrane fusion, and thus may be useful natural viral entry inhibitors.

Gradient-based multiresolution image fusion.

PubMed

Petrović, Valdimir S; Xydeas, Costas S

2004-02-01

A novel approach to multiresolution signal-level image fusion is presented for accurately transferring visual information from any number of input image signals, into a single fused image without loss of information or the introduction of distortion. The proposed system uses a "fuse-then-decompose" technique realized through a novel, fusion/decomposition system architecture. In particular, information fusion is performed on a multiresolution gradient map representation domain of image signal information. At each resolution, input images are represented as gradient maps and combined to produce new, fused gradient maps. Fused gradient map signals are processed, using gradient filters derived from high-pass quadrature mirror filters to yield a fused multiresolution pyramid representation. The fused output image is obtained by applying, on the fused pyramid, a reconstruction process that is analogous to that of conventional discrete wavelet transform. This new gradient fusion significantly reduces the amount of distortion artefacts and the loss of contrast information usually observed in fused images obtained from conventional multiresolution fusion schemes. This is because fusion in the gradient map domain significantly improves the reliability of the feature selection and information fusion processes. Fusion performance is evaluated through informal visual inspection and subjective psychometric preference tests, as well as objective fusion performance measurements. Results clearly demonstrate the superiority of this new approach when compared to conventional fusion systems.

A Cell-Cell Fusion Assay to Assess Arenavirus Envelope Glycoprotein Membrane-Fusion Activity.

PubMed

York, Joanne; Nunberg, Jack H

2018-01-01

For many viruses that enter their target cells through pH-dependent fusion of the viral and endosomal membranes, cell-cell fusion assays can provide an experimental platform for investigating the structure-function relationships that promote envelope glycoprotein membrane-fusion activity. Typically, these assays employ effector cells expressing the recombinant envelope glycoprotein on the cell surface and target cells engineered to quantitatively report fusion with the effector cell. In the protocol described here, Vero cells are transfected with a plasmid encoding the arenavirus envelope glycoprotein complex GPC and infected with the vTF7-3 vaccinia virus expressing the bacteriophage T7 RNA polymerase. These effector cells are mixed with target cells infected with the vCB21R-lacZ vaccinia virus encoding a β-galactosidase reporter under the control of the T7 promoter. Cell-cell fusion is induced upon exposure to low-pH medium (pH 5.0), and the resultant expression of the β-galactosidase reporter is quantitated using a chemiluminescent substrate. We have utilized this robust microplate cell-cell fusion assay extensively to study arenavirus entry and its inhibition by small-molecule fusion inhibitors.

ITER Fusion Energy

ScienceCinema

Holtkamp, Norbert

2018-01-09

ITER (in Latin “the way”) is designed to demonstrate the scientific and technological feasibility of fusion energy. Fusion is the process by which two light atomic nuclei combine to form a heavier over one and thus release energy. In the fusion process two isotopes of hydrogen – deuterium and tritium – fuse together to form a helium atom and a neutron. Thus fusion could provide large scale energy production without greenhouse effects; essentially limitless fuel would be available all over the world. The principal goals of ITER are to generate 500 megawatts of fusion power for periods of 300 to 500 seconds with a fusion power multiplication factor, Q, of at least 10. Q ? 10 (input power 50 MW / output power 500 MW). The ITER Organization was officially established in Cadarache, France, on 24 October 2007. The seven members engaged in the project – China, the European Union, India, Japan, Korea, Russia and the United States – represent more than half the world’s population. The costs for ITER are shared by the seven members. The cost for the construction will be approximately 5.5 billion Euros, a similar amount is foreseen for the twenty-year phase of operation and the subsequent decommissioning.

Surface zwitterionization: Effective method for preventing oral bacterial biofilm formation on hydroxyapatite surfaces

NASA Astrophysics Data System (ADS)

Lee, Myoungjin; Kim, Heejin; Seo, Jiae; Kang, Minji; Kang, Sunah; Jang, Joomyung; Lee, Yan; Seo, Ji-Hun

2018-01-01

In this study, we conducted surface zwitterionization of hydroxyapatite (HA) surfaces by immersing them in the zwitterionic polymer solutions to provide anti-bacterial properties to the HA surface. Three different monomers containing various zwitterionic groups, i.e., phosphorylcholine (PC), sulfobetaine (SB), and carboxybetaine (CB), were copolymerized with the methacrylic monomer containing a Ca2+-binding moiety, using the free radical polymerization method. As a control, functionalization of the copolymer containing the Ca2+-binding moiety was synthesized using a hydroxy group. The stable immobilization of the zwitterionic functional groups was confirmed by water contact angle analysis and X-ray photoelectron spectroscopy (XPS) measurement conducted after the sonication process. The zwitterionized HA surface showed significantly decreased protein adsorption, whereas the hydroxyl group-coated HA surface showed limited efficacy. The anti-bacterial adhesion property was confirmed by conducting Streptococcus mutans (S. mutans) adhesion tests for 6 h and 24 h. When furanone C-30, a representative anti-quorum sensing molecule for S. mutans, was used, only a small amount of bacteria adhered after 6 h and the population did not increase after 24 h. In contrast, zwitterionized HA surfaces showed almost no bacterial adhesion after 6 h and the effect was retained for 24 h, resulting in the lowest level of oral bacterial adhesion. These results confirm that surface zwitterionization is a promising method to effectively prevent oral bacterial adhesion on HA-based materials.

Paramyxovirus F1 protein has two fusion peptides: implications for the mechanism of membrane fusion.

PubMed

Peisajovich, S G; Samuel, O; Shai, Y

2000-03-10

Viral fusion proteins contain a highly hydrophobic segment, named the fusion peptide, which is thought to be responsible for the merging of the cellular and viral membranes. Paramyxoviruses are believed to contain a single fusion peptide at the N terminus of the F1 protein. However, here we identified an additional internal segment in the Sendai virus F1 protein (amino acids 214-226) highly homologous to the fusion peptides of HIV-1 and RSV. A synthetic peptide, which includes this region, was found to induce membrane fusion of large unilamellar vesicles, at concentrations where the known N-terminal fusion peptide is not effective. A scrambled peptide as well as several peptides from other regions of the F1 protein, which strongly bind to membranes, are not fusogenic. The functional and structural characterization of this active segment suggest that the F1 protein has an additional internal fusion peptide that could participate in the actual fusion event. The presence of homologous regions in other members of the same family suggests that the concerted action of two fusion peptides, one N-terminal and the other internal, is a general feature of paramyxoviruses. Copyright 2000 Academic Press.

Bacterial prostatitis.

PubMed

Gill, Bradley C; Shoskes, Daniel A

2016-02-01

The review provides the infectious disease community with a urologic perspective on bacterial prostatitis. Specifically, the article briefly reviews the categorization of prostatitis by type and provides a distillation of new findings published on bacterial prostatitis over the past year. It also highlights key points from the established literature. Cross-sectional prostate imaging is becoming more common and may lead to more incidental diagnoses of acute bacterial prostatitis. As drug resistance remains problematic in this condition, the reemergence of older antibiotics such as fosfomycin, has proven beneficial. With regard to chronic bacterial prostatitis, no clear clinical risk factors emerged in a large epidemiological study. However, bacterial biofilm formation has been associated with more severe cases. Surgery has a limited role in bacterial prostatitis and should be reserved for draining of a prostatic abscess or the removal of infected prostatic stones. Prostatitis remains a common and bothersome clinical condition. Antibiotic therapy remains the basis of treatment for both acute and chronic bacterial prostatitis. Further research into improving prostatitis treatment is indicated.

Cell fusion and nuclear fusion in plants.

PubMed

Maruyama, Daisuke; Ohtsu, Mina; Higashiyama, Tetsuya

2016-12-01

Eukaryotic cells are surrounded by a plasma membrane and have a large nucleus containing the genomic DNA, which is enclosed by a nuclear envelope consisting of the outer and inner nuclear membranes. Although these membranes maintain the identity of cells, they sometimes fuse to each other, such as to produce a zygote during sexual reproduction or to give rise to other characteristically polyploid tissues. Recent studies have demonstrated that the mechanisms of plasma membrane or nuclear membrane fusion in plants are shared to some extent with those of yeasts and animals, despite the unique features of plant cells including thick cell walls and intercellular connections. Here, we summarize the key factors in the fusion of these membranes during plant reproduction, and also focus on "non-gametic cell fusion," which was thought to be rare in plant tissue, in which each cell is separated by a cell wall. Copyright © 2016 Elsevier Ltd. All rights reserved.

Bacterial Sialidase

NASA Technical Reports Server (NTRS)

2004-01-01

Data shows that elevated sialidase in bacterial vaginosis patients correlates to premature births in women. Bacterial sialidase also plays a significant role in the unusual colonization of Pseudomonas aeruginosa in cystic fibrosis patients. Crystals of Salmonella sialidase have been reproduced and are used for studying the inhibitor-enzyme complexes. These inhibitors may also be used to inhibit a trans-sialidase of Trypanosome cruzi, a very similar enzyme to bacterial sialidase, therefore preventing T. cruzi infection, the causitive agent of Chagas' disease. The Center for Macromolecular Crystallography suggests that inhibitors of bacterial sialidases can be used as prophylactic drugs to prevent bacterial infections in these critical cases.

Multi-modality image fusion based on enhanced fuzzy radial basis function neural networks.

PubMed

Chao, Zhen; Kim, Dohyeon; Kim, Hee-Joung

2018-04-01

In clinical applications, single modality images do not provide sufficient diagnostic information. Therefore, it is necessary to combine the advantages or complementarities of different modalities of images. Recently, neural network technique was applied to medical image fusion by many researchers, but there are still many deficiencies. In this study, we propose a novel fusion method to combine multi-modality medical images based on the enhanced fuzzy radial basis function neural network (Fuzzy-RBFNN), which includes five layers: input, fuzzy partition, front combination, inference, and output. Moreover, we propose a hybrid of the gravitational search algorithm (GSA) and error back propagation algorithm (EBPA) to train the network to update the parameters of the network. Two different patterns of images are used as inputs of the neural network, and the output is the fused image. A comparison with the conventional fusion methods and another neural network method through subjective observation and objective evaluation indexes reveals that the proposed method effectively synthesized the information of input images and achieved better results. Meanwhile, we also trained the network by using the EBPA and GSA, individually. The results reveal that the EBPGSA not only outperformed both EBPA and GSA, but also trained the neural network more accurately by analyzing the same evaluation indexes. Copyright © 2018 Associazione Italiana di Fisica Medica. Published by Elsevier Ltd. All rights reserved.

Investigations of image fusion

NASA Astrophysics Data System (ADS)

Zhang, Zhong

1999-12-01

The objective of image fusion is to combine information from multiple images of the same scene. The result of image fusion is a single image which is more suitable for the purpose of human visual perception or further image processing tasks. In this thesis, a region-based fusion algorithm using the wavelet transform is proposed. The identification of important features in each image, such as edges and regions of interest, are used to guide the fusion process. The idea of multiscale grouping is also introduced and a generic image fusion framework based on multiscale decomposition is studied. The framework includes all of the existing multiscale-decomposition- based fusion approaches we found in the literature which did not assume a statistical model for the source images. Comparisons indicate that our framework includes some new approaches which outperform the existing approaches for the cases we consider. Registration must precede our fusion algorithms. So we proposed a hybrid scheme which uses both feature-based and intensity-based methods. The idea of robust estimation of optical flow from time- varying images is employed with a coarse-to-fine multi- resolution approach and feature-based registration to overcome some of the limitations of the intensity-based schemes. Experiments show that this approach is robust and efficient. Assessing image fusion performance in a real application is a complicated issue. In this dissertation, a mixture probability density function model is used in conjunction with the Expectation- Maximization algorithm to model histograms of edge intensity. Some new techniques are proposed for estimating the quality of a noisy image of a natural scene. Such quality measures can be used to guide the fusion. Finally, we study fusion of images obtained from several copies of a new type of camera developed for video surveillance. Our techniques increase the capability and reliability of the surveillance system and provide an easy way to obtain 3-D

A new regulatory mechanism for bacterial lipoic acid synthesis

PubMed Central

Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

2015-01-01

Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID

A new regulatory mechanism for bacterial lipoic acid synthesis.

PubMed

Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

2015-01-22

Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. © 2015

Quantitative Analysis of Lipid Droplet Fusion: Inefficient Steady State Fusion but Rapid Stimulation by Chemical Fusogens

PubMed Central

Murphy, Samantha; Martin, Sally; Parton, Robert G.

2010-01-01

Lipid droplets (LDs) are dynamic cytoplasmic organelles containing neutral lipids and bounded by a phospholipid monolayer. Previous studies have suggested that LDs can undergo constitutive homotypic fusion, a process linked to the inhibitory effects of fatty acids on glucose transporter trafficking. Using strict quantitative criteria for LD fusion together with refined light microscopic methods and real-time analysis, we now show that LDs in diverse cell types show low constitutive fusogenic activity under normal growth conditions. To investigate the possible modulation of LD fusion, we screened for agents that can trigger fusion. A number of pharmacological agents caused homotypic fusion of lipid droplets in a variety of cell types. This provided a novel cell system to study rapid regulated fusion between homotypic phospholipid monolayers. LD fusion involved an initial step in which the two adjacent membranes became continuous (<10 s), followed by the slower merging (100 s) of the neutral lipid cores to produce a single spherical LD. These fusion events were accompanied by changes to the LD surface organization. Measurements of LDs undergoing homotypic fusion showed that fused LDs maintained their initial volume, with a corresponding decrease in surface area suggesting rapid removal of membrane from the fused LD. This study provides estimates for the level of constitutive LD fusion in cells and questions the role of LD fusion in vivo. In addition, it highlights the extent of LD restructuring which occurs when homotypic LD fusion is triggered in a variety of cell types. PMID:21203462

A novel biological recovery approach for PHA employing selective digestion of bacterial biomass in animals.

PubMed

Ong, Su Yean; Zainab-L, Idris; Pyary, Somarajan; Sudesh, Kumar

2018-03-01

Polyhydroxyalkanoate (PHA) is a family of microbial polyesters that is completely biodegradable and possesses the mechanical and thermal properties of some commonly used petrochemical-based plastics. Therefore, PHA is attractive as a biodegradable thermoplastic. It has always been a challenge to commercialize PHA due to the high cost involved in the biosynthesis of PHA via bacterial fermentation and the subsequent purification of the synthesized PHA from bacterial cells. Innovative enterprise by researchers from various disciplines over several decades successfully reduced the cost of PHA production through the efficient use of cheap and renewable feedstock, precisely controlled fermentation process, and customized bacterial strains. Despite the fact that PHA yields have been improved tremendously, the recovery and purification processes of PHA from bacterial cells remain exhaustive and require large amounts of water and high energy input besides some chemicals. In addition, the residual cell biomass ends up as waste that needs to be treated. We have found that some animals can readily feed on the dried bacterial cells that contain PHA granules. The digestive system of the animals is able to assimilate the bacterial cells but not the PHA granules which are excreted in the form of fecal pellets, thus resulting in partial recovery and purification of PHA. In this mini-review, we will discuss this new concept of biological recovery, the selection of the animal model for biological recovery, and the properties and possible applications of the biologically recovered PHA.

Membrane-on-a-chip: microstructured silicon/silicon-dioxide chips for high-throughput screening of membrane transport and viral membrane fusion.

PubMed

Kusters, Ilja; van Oijen, Antoine M; Driessen, Arnold J M

2014-04-22

Screening of transport processes across biological membranes is hindered by the challenge to establish fragile supported lipid bilayers and the difficulty to determine at which side of the membrane reactants reside. Here, we present a method for the generation of suspended lipid bilayers with physiological relevant lipid compositions on microstructured Si/SiO2 chips that allow for high-throughput screening of both membrane transport and viral membrane fusion. Simultaneous observation of hundreds of single-membrane channels yields statistical information revealing population heterogeneities of the pore assembly and conductance of the bacterial toxin α-hemolysin (αHL). The influence of lipid composition and ionic strength on αHL pore formation was investigated at the single-channel level, resolving features of the pore-assembly pathway. Pore formation is inhibited by a specific antibody, demonstrating the applicability of the platform for drug screening of bacterial toxins and cell-penetrating agents. Furthermore, fusion of H3N2 influenza viruses with suspended lipid bilayers can be observed directly using a specialized chip architecture. The presented micropore arrays are compatible with fluorescence readout from below using an air objective, thus allowing high-throughput screening of membrane transport in multiwell formats in analogy to plate readers.

Enhanced image capture through fusion

NASA Technical Reports Server (NTRS)

Burt, Peter J.; Hanna, Keith; Kolczynski, Raymond J.

1993-01-01

Image fusion may be used to combine images from different sensors, such as IR and visible cameras, to obtain a single composite with extended information content. Fusion may also be used to combine multiple images from a given sensor to form a composite image in which information of interest is enhanced. We present a general method for performing image fusion and show that this method is effective for diverse fusion applications. We suggest that fusion may provide a powerful tool for enhanced image capture with broad utility in image processing and computer vision.

Positional effects of fusion partners on the yield and solubility of MBP fusion proteins

PubMed Central

Raran-Kurussi, Sreejith; Keefe, Karina; Waugh, David S.

2015-01-01

Escherichia coli maltose-binding protein (MBP) is exceptionally effective at promoting the solubility of its fusion partners. However, there are conflicting reports in the literature claiming that 1) MBP is an effective solubility enhancer only when it is joined to the N-terminus of an aggregation-prone passenger protein, and 2) MBP is equally effective when fused to either end of the passenger. Here, we endeavor to resolve this controversy by comparing the solubility of a diverse set of MBP fusion proteins that, unlike those analyzed in previous studies, are identical in every way except for the order of the two domains. The results indicate that fusion proteins with an N-terminal MBP provide an excellent solubility advantage along with more robust expression when compared to analogous fusions in which MBP is the C-terminal fusion partner. We find that only intrinsically soluble passenger proteins (i.e., those not requiring a solubility enhancer) are produced as soluble fusions when they precede MBP. We also report that even subtle differences in inter-domain linker sequences can influence the solubility of fusion proteins. PMID:25782741

Fusion or confusion: knowledge or nonsense?

NASA Astrophysics Data System (ADS)

Rothman, Peter L.; Denton, Richard V.

1991-08-01

The terms 'data fusion,' 'sensor fusion,' multi-sensor integration,' and 'multi-source integration' have been used widely in the technical literature to refer to a variety of techniques, technologies, systems, and applications which employ and/or combine data derived from multiple information sources. Applications of data fusion range from real-time fusion of sensor information for the navigation of mobile robots to the off-line fusion of both human and technical strategic intelligence data. The Department of Defense Critical Technologies Plan lists data fusion in the highest priority group of critical technologies, but just what is data fusion? The DoD Critical Technologies Plan states that data fusion involves 'the acquisition, integration, filtering, correlation, and synthesis of useful data from diverse sources for the purposes of situation/environment assessment, planning, detecting, verifying, diagnosing problems, aiding tactical and strategic decisions, and improving system performance and utility.' More simply states, sensor fusion refers to the combination of data from multiple sources to provide enhanced information quality and availability over that which is available from any individual source alone. This paper presents a survey of the state-of-the- art in data fusion technologies, system components, and applications. A set of characteristics which can be utilized to classify data fusion systems is presented. Additionally, a unifying mathematical and conceptual framework within which to understand and organize fusion technologies is described. A discussion of often overlooked issues in the development of sensor fusion systems is also presented.

Dicentric breakage at telomere fusions

PubMed Central

Pobiega, Sabrina; Marcand, Stéphane

2010-01-01

Nonhomologous end-joining (NHEJ) inhibition at telomeres ensures that native chromosome ends do not fuse together. But the occurrence and consequences of rare telomere fusions are not well understood. It is notably unclear whether a telomere fusion could be processed to restore telomere ends. Here we address the behavior of individual dicentrics formed by telomere fusion in the yeast Saccharomyces cerevisiae. Our approach was to first stabilize and amplify fusions between two chromosomes by temporarily inactivating one centromere. Next we analyzed dicentric breakage following centromere reactivation. Unexpectedly, dicentrics often break at the telomere fusions during progression through mitosis, a process that restores the parental chromosomes. This unforeseen result suggests a rescue pathway able to process telomere fusions and to back up NHEJ inhibition at telomeres. PMID:20360388

Discovery of methylsulfonyl indazoles as potent and orally active respiratory syncytial Virus(RSV) fusion inhibitors.

PubMed

Feng, Song; Li, Chao; Chen, Dongdong; Zheng, Xiufang; Yun, Hongying; Gao, Lu; Shen, Hong C

2017-09-29

Recently we described a novel class of imidazopyridine compounds that showed exceptional anti-RSV potency in cell culture. However, unfavorable pharmacokinetic (PK) properties and glutathione (GSH) adduct liabilities impeded their further development. In a bid to address the PK and early safety concerns, a small compound library consisting of dozens of scaffold-hopping analogues was designed and synthesized for RSV CPE assay screening, which led to the identification of a new chemical starting point: methylsulfonyl indole compound 8. In this paper, we report the discovery and optimization of a series of methylsulfonyl indazoles as potent RSV fusion inhibitors. In particular, compound 47 was orally efficacious in a RSV mouse model, with 1.6 log unit viral load reduction at 25 mg/kg BID upon oral dosing. The results may have broad implications for the design of new RSV fusion inhibitors, and demonstrate the potential for developing novel therapies for RSV infection. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

Axially substituted silicon(IV) phthalocyanine and its quaternized derivative as photosensitizers towards tumor cells and bacterial pathogens.

PubMed

Ömeroğlu, İpek; Kaya, Esra Nur; Göksel, Meltem; Kussovski, Vesselin; Mantareva, Vanya; Durmuş, Mahmut

2017-10-15

Axially di-(alpha,alpha-diphenyl-4-pyridylmethoxy) silicon(IV) phthalocyanine (3) and its quaternized derivative (3Q) were synthesized and tested as photosensitizers against tumor and bacterial cells. These new phthalocyanines were characterized by elemental analysis, and different spectroscopic methods such as FT-IR, UV-Vis, MALDI-TOF and 1 H NMR. The photophysical properties such as absorption and fluorescence, and the photochemical properties such as singlet oxygen generation of both phthalocyanines were investigated in solutions. The obtained values were compared to the values obtained with unsubstituted silicon(IV) phthalocyanine dichloride (SiPcCl 2 ). The addition of two di-(alpha,alpha-diphenyl-4-pyridylmethanol) groups as axial ligands showed an improvement of the photophysical and photochemical properties and an increasement of the singlet oxygen quantum yield (Φ Δ ) from 0.15 to 0.33 was determined. The photodynamic efficacy of synthesized photosensitizers (3 and 3Q) were evaluated with promising photocytotoxicity (17% cell survival for 3 and 28% for 3Q) against the cervical cancer cell line (HeLa). The photodynamic inactivation of pathogenic bacterial strains Streptococcus mutans, Staphylococcus aureus, and Pseudomonas aeruginosa suggested a high susceptibility with quaternized derivative (3Q). The both Gram-positive bacterial strains were fully photoinactivated with 11μM 3Q and mild light dose 50J.cm -2 . In case of P. aeruginosa the effect was negligible for concentrations up to 22μM 3Q and light dose 100J.cm -2 . The results suggested that the novel axially substituted silicon(IV) phthalocyanines have promising characteristic as photosensitizer towards tumor cells. The quaternized derivative 3Q has high potential for photoinactivation of pathogenic bacterial species. Copyright © 2017 Elsevier Ltd. All rights reserved.

Magnetized Target Fusion

NASA Technical Reports Server (NTRS)

Griffin, Steven T.

2002-01-01

Magnetized target fusion (MTF) is under consideration as a means of building a low mass, high specific impulse, and high thrust propulsion system for interplanetary travel. This unique combination is the result of the generation of a high temperature plasma by the nuclear fusion process. This plasma can then be deflected by magnetic fields to provide thrust. Fusion is initiated by a small traction of the energy generated in the magnetic coils due to the plasma's compression of the magnetic field. The power gain from a fusion reaction is such that inefficiencies due to thermal neutrons and coil losses can be overcome. Since the fusion reaction products are directly used for propulsion and the power to initiate the reaction is directly obtained from the thrust generation, no massive power supply for energy conversion is required. The result should be a low engine mass, high specific impulse and high thrust system. The key is to successfully initiate fusion as a proof-of-principle for this application. Currently MSFC is implementing MTF proof-of-principle experiments. This involves many technical details and ancillary investigations. Of these, selected pertinent issues include the properties, orientation and timing of the plasma guns and the convergence and interface development of the "pusher" plasma. Computer simulations of the target plasma's behavior under compression and the convergence and mixing of the gun plasma are under investigation. This work is to focus on the gun characterization and development as it relates to plasma initiation and repeatability.

Inhibition of growth and biofilm formation of clinical bacterial isolates by NiO nanoparticles synthesized from Eucalyptus globulus plants.

PubMed

Saleem, Samia; Ahmed, Bilal; Khan, Mohammad Saghir; Al-Shaeri, Majed; Musarrat, Javed

2017-10-01

Nanotechnology based therapeutics has emerged as a promising approach for augmenting the activity of existing antimicrobials due to the unique physical and chemical properties of nanoparticles (NPs). Nickel oxide nanoparticles (NiO-NPs) have been suggested as prospective antibacterial and antitumor agent. In this study, NiO-NPs have been synthesized by a green approach using Eucalyptus globulus leaf extract and assessed for their bactericidal activity. The morphology and purity of synthesized NiO-NPs determined through various spectroscopic techniques like UV-Visible, FT-IR, XRD, EDX and electron microscopy differed considerably. The synthesized NiO-NPs were pleomorphic varying in size between 10 and 20 nm. The XRD analysis revealed the average size of NiO-NPs as 19 nm. The UV-Vis spectroscopic data showed a strong SPR of NiO-NPs with a characteristic spectral peak at 396 nm. The FTIR data revealed various functional moieties like C=C, C-N, C-H and O-H which elucidate the role of leaf biomolecules in capping and dispersal of NiO-NPs. The bioactivity assay revealed the antibacterial and anti-biofilm activity of NiO-NPs against ESβL (+) E. coli, P. aeruginosa, methicillin sensitive and resistant S. aureus. Growth inhibition assay demonstrated time and NiO-NPs concentration dependent decrease in the viability of treated cells. NiO-NPs induced biofilm inhibition was revealed by a sharp increase in characteristic red fluorescence of PI, while SEM images of NiO-NPs treated cells were irregular shrink and distorted with obvious depressions/indentations. The results suggested significant antibacterial and antibiofilm activity of NiO-NPs which may play an important role in the management of infectious diseases affecting human health. Copyright © 2017 Elsevier Ltd. All rights reserved.

Biologically synthesized titanium oxide nanostructures combined with morphogenetic protein as wound healing agent in the femoral fracture after surgery.

PubMed

Zhang, Yushu; Zhang, Chuanlian; Liu, Kemiao; Zhu, Xia; Liu, Fang; Ge, Xiaofen

2018-05-01

The aim of the present study is to develop novel approach for the green synthesis of titanium oxide nanoparticles (TiO 2 NPs) using Eichhornia crassipes extract and calcined at different temperatures for evaluate the wound healing activity in the femoral fracture. The synthesized TiO 2 are formed different (plate and rod-like) nanostructures at various calcination temperatures. These samples were characterized by X-ray diffraction (XRD), Fourier transform-infrared spectroscopy (FTIR), Field emission scanning electron microscope (FE-SEM) and transmission electron microscope (TEM). Microscopic studies of TiO 2 NPs revealed that the synthesized TiO 2 NPs are formed well-defined rod-like structures at 400 °C with size ranged from 200 nm to 500 nm. The characterized plate and rod-like TiO 2 NPs are combined with human morphogenetic protein (HbMP) to improving its wound healing activity and osteoblast properties on femoral fractures. The biocompatibility was tested by using human bone marrow mesenchymal stem cells (BMSC) cells and antibacterial efficacy analyzed using human pathogenica bacteria Staphylococcus aureus and Escherichia coli through agar well diffusion assay. The green synthesized rod-like TiO 2 NPs combined with HbMP has been exhibited effective bone fusion behaviors with biomechanical properties and also improved antibacterial activity against pathogenic bacteria. From this study results, it is suggested that green synthesized TiO 2 NPs could be used effectively in biomedical application. Copyright © 2018. Published by Elsevier B.V.

Crystal Structure of the Pre-fusion Nipah Virus Fusion Glycoprotein Reveals a Novel Hexamer-of-Trimers Assembly.

PubMed

Xu, Kai; Chan, Yee-Peng; Bradel-Tretheway, Birgit; Akyol-Ataman, Zeynep; Zhu, Yongqun; Dutta, Somnath; Yan, Lianying; Feng, YanRu; Wang, Lin-Fa; Skiniotis, Georgios; Lee, Benhur; Zhou, Z Hong; Broder, Christopher C; Aguilar, Hector C; Nikolov, Dimitar B

2015-12-01

Nipah virus (NiV) is a paramyxovirus that infects host cells through the coordinated efforts of two envelope glycoproteins. The G glycoprotein attaches to cell receptors, triggering the fusion (F) glycoprotein to execute membrane fusion. Here we report the first crystal structure of the pre-fusion form of the NiV-F glycoprotein ectodomain. Interestingly this structure also revealed a hexamer-of-trimers encircling a central axis. Electron tomography of Nipah virus-like particles supported the hexameric pre-fusion model, and biochemical analyses supported the hexamer-of-trimers F assembly in solution. Importantly, structure-assisted site-directed mutagenesis of the interfaces between F trimers highlighted the functional relevance of the hexameric assembly. Shown here, in both cell-cell fusion and virus-cell fusion systems, our results suggested that this hexamer-of-trimers assembly was important during fusion pore formation. We propose that this assembly would stabilize the pre-fusion F conformation prior to cell attachment and facilitate the coordinated transition to a post-fusion conformation of all six F trimers upon triggering of a single trimer. Together, our data reveal a novel and functional pre-fusion architecture of a paramyxoviral fusion glycoprotein.

Fusion Power measurement at ITER

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bertalot, L.; Barnsley, R.; Krasilnikov, V.

2015-07-01

Nuclear fusion research aims to provide energy for the future in a sustainable way and the ITER project scope is to demonstrate the feasibility of nuclear fusion energy. ITER is a nuclear experimental reactor based on a large scale fusion plasma (tokamak type) device generating Deuterium - Tritium (DT) fusion reactions with emission of 14 MeV neutrons producing up to 700 MW fusion power. The measurement of fusion power, i.e. total neutron emissivity, will play an important role for achieving ITER goals, in particular the fusion gain factor Q related to the reactor performance. Particular attention is given also tomore » the development of the neutron calibration strategy whose main scope is to achieve the required accuracy of 10% for the measurement of fusion power. Neutron Flux Monitors located in diagnostic ports and inside the vacuum vessel will measure ITER total neutron emissivity, expected to range from 1014 n/s in Deuterium - Deuterium (DD) plasmas up to almost 10{sup 21} n/s in DT plasmas. The neutron detection systems as well all other ITER diagnostics have to withstand high nuclear radiation and electromagnetic fields as well ultrahigh vacuum and thermal loads. (authors)« less

A sensitive HIV-1 envelope induced fusion assay identifies fusion enhancement of thrombin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cheng, De-Chun; Zhong, Guo-Cai; Su, Ju-Xiang

2010-01-22

To evaluate the interaction between HIV-1 envelope glycoprotein (Env) and target cell receptors, various cell-cell-fusion assays have been developed. In the present study, we established a novel fusion system. In this system, the expression of the sensitive reporter gene, firefly luciferase (FL) gene, in the target cells was used to evaluate cell fusion event. Simultaneously, constitutively expressed Renilla luciferase (RL) gene was used to monitor effector cell number and viability. FL gave a wider dynamic range than other known reporters and the introduction of RL made the assay accurate and reproducible. This system is especially beneficial for investigation of potentialmore » entry-influencing agents, for its power of ruling out the false inhibition or enhancement caused by the artificial cell-number variation. As a case study, we applied this fusion system to observe the effect of a serine protease, thrombin, on HIV Env-mediated cell-cell fusion and have found the fusion enhancement activity of thrombin over two R5-tropic HIV strains.« less

Fusion of Enveloped Viruses in Endosomes

PubMed Central

White, Judith M.; Whittaker, Gary R.

2016-01-01

Ari Helenius launched the field of enveloped virus fusion in endosomes with a seminal paper in the Journal of Cell Biology in 1980. In the intervening years a great deal has been learned about the structures and mechanisms of viral membrane fusion proteins as well as about the endosomes in which different enveloped viruses fuse and the endosomal cues that trigger fusion. We now recognize three classes of viral membrane fusion proteins based on structural criteria and four mechanisms of fusion triggering. After reviewing general features of viral membrane fusion proteins and viral fusion in endosomes, we delve into three characterized mechanisms for viral fusion triggering in endosomes: by low pH, by receptor binding plus low pH, and by receptor binding plus the action of a protease. We end with a discussion of viruses that may employ novel endosomal fusion triggering mechanisms. A key take home message is that enveloped viruses that enter cells by fusing in endosomes traverse the endocytic pathway until they reach an endosome that has all of the environmental conditions (pH, proteases, ions, intracellular receptors, and lipid composition) to (if needed) prime and (in all cases) trigger the fusion protein and to support membrane fusion. PMID:26935856

Feasibility study on sensor data fusion for the CP-140 aircraft: fusion architecture analyses

NASA Astrophysics Data System (ADS)

Shahbazian, Elisa

1995-09-01

Loral Canada completed (May 1995) a Department of National Defense (DND) Chief of Research and Development (CRAD) contract, to study the feasibility of implementing a multi- sensor data fusion (MSDF) system onboard the CP-140 Aurora aircraft. This system is expected to fuse data from: (a) attributed measurement oriented sensors (ESM, IFF, etc.); (b) imaging sensors (FLIR, SAR, etc.); (c) tracking sensors (radar, acoustics, etc.); (d) data from remote platforms (data links); and (e) non-sensor data (intelligence reports, environmental data, visual sightings, encyclopedic data, etc.). Based on purely theoretical considerations a central-level fusion architecture will lead to a higher performance fusion system. However, there are a number of systems and fusion architecture issues involving fusion of such dissimilar data: (1) the currently existing sensors are not designed to provide the type of data required by a fusion system; (2) the different types (attribute, imaging, tracking, etc.) of data may require different degree of processing, before they can be used within a fusion system efficiently; (3) the data quality from different sensors, and more importantly from remote platforms via the data links must be taken into account before fusing; and (4) the non-sensor data may impose specific requirements on the fusion architecture (e.g. variable weight/priority for the data from different sensors). This paper presents the analyses performed for the selection of the fusion architecture for the enhanced sensor suite planned for the CP-140 aircraft in the context of the mission requirements and environmental conditions.

Positional effects of fusion partners on the yield and solubility of MBP fusion proteins.

PubMed

Raran-Kurussi, Sreejith; Keefe, Karina; Waugh, David S

2015-06-01

Escherichia coli maltose-binding protein (MBP) is exceptionally effective at promoting the solubility of its fusion partners. However, there are conflicting reports in the literature claiming that (1) MBP is an effective solubility enhancer only when it is joined to the N-terminus of an aggregation-prone passenger protein, and (2) MBP is equally effective when fused to either end of the passenger. Here, we endeavor to resolve this controversy by comparing the solubility of a diverse set of MBP fusion proteins that, unlike those analyzed in previous studies, are identical in every way except for the order of the two domains. The results indicate that fusion proteins with an N-terminal MBP provide an excellent solubility advantage along with more robust expression when compared to analogous fusions in which MBP is the C-terminal fusion partner. We find that only intrinsically soluble passenger proteins (i.e., those not requiring a solubility enhancer) are produced as soluble fusions when they precede MBP. We also report that even subtle differences in inter-domain linker sequences can influence the solubility of fusion proteins. Published by Elsevier Inc.

Exo-endo cellulase fusion protein

DOEpatents

Bower, Benjamin S [Palo Alto, CA; Larenas, Edmund A [Palo Alto, CA; Mitchinson, Colin [Palo Alto, CA

2012-01-17

The present invention relates to a heterologous exo-endo cellulase fusion construct, which encodes a fusion protein having cellulolytic activity comprising a catalytic domain derived from a fungal exo-cellobiohydrolase and a catalytic domain derived from an endoglucanase. The invention also relates to vectors and fungal host cells comprising the heterologous exo-endo cellulase fusion construct as well as methods for producing a cellulase fusion protein and enzymatic cellulase compositions.

Two Strategic Decisions Facing Fusion

NASA Astrophysics Data System (ADS)

Baldwin, D. E.

1998-06-01

Two strategic decisions facing the U.S. fusion program are described. The first decision deals with the role and rationale of the tokamak within the U. S. fusion program, and it underlies the debate over our continuing role in the evolving ITER collaboration (mid-1998). The second decision concerns how to include Inertial Fusion Energy (IFE) as a viable part of the national effort to harness fusion energy.

Hybrid- and complex-type N-glycans are not essential for Newcastle disease virus infection and fusion of host cells.

PubMed

Sun, Qing; Zhao, Lixiang; Song, Qingqing; Wang, Zheng; Qiu, Xusheng; Zhang, Wenjun; Zhao, Mingjun; Zhao, Guo; Liu, Wenbo; Liu, Haiyan; Li, Yunsen; Liu, Xiufan

2012-03-01

N-linked glycans are composed of three major types: high-mannose (Man), hybrid or complex. The functional role of hybrid- and complex-type N-glycans in Newcastle disease virus (NDV) infection and fusion was examined in N-acetylglucosaminyltransferase I (GnT I)-deficient Lec1 cells, a mutant Chinese hamster ovary (CHO) cell incapable of synthesizing hybrid- and complex-type N-glycans. We used recombinant NDV expressing green fluorescence protein or red fluorescence protein to monitor NDV infection, syncytium formation and viral yield. Flow cytometry showed that CHO-K1 and Lec1 cells had essentially the same degree of NDV infection. In contrast, Lec2 cells were found to be resistant to NDV infection. Compared with CHO-K1 cells, Lec1 cells were shown to more sensitive to fusion induced by NDV. Viral attachment was found to be comparable in both lines. We found that there were no significant differences in the yield of progeny virus produced by both CHO-K1 and Lec1 cells. Quantitative analysis revealed that NDV infection and fusion in Lec1 cells were also inhibited by treatment with sialidase. Pretreatment of Lec1 cells with Galanthus nivalis agglutinin specific for terminal α1-3-linked Man prior to inoculation with NDV rendered Lec1 cells less sensitive to cell-to-cell fusion compared with mock-treated Lec1 cells. Treatment of CHO-K1 and Lec1 cells with tunicamycin, an inhibitor of N-glycosylation, significantly blocked fusion and infection. In conclusion, our results suggest that hybrid- and complex-type N-glycans are not required for NDV infection and fusion. We propose that high-Man-type N-glycans could play an important role in the cell-to-cell fusion induced by NDV.

Frontier of Fusion Research: Path to the Steady State Fusion Reactor by Large Helical Device

NASA Astrophysics Data System (ADS)

Motojima, Osamu

2006-12-01

The ITER, the International Thermonuclear Experimental Reactor, which will be built in Cadarache in France, has finally started this year, 2006. Since the thermal energy produced by fusion reactions divided by the external heating power, i.e., the Q value, will be larger than 10, this is a big step of the fusion research for half a century trying to tame the nuclear fusion for the 6.5 Billion people on the Earth. The source of the Sun's power is lasting steadily and safely for 8 Billion years. As a potentially safe environmentally friendly and economically competitive energy source, fusion should provide a sustainable future energy supply for all mankind for ten thousands of years. At the frontier of fusion research important milestones are recently marked on a long road toward a true prototype fusion reactor. In its own merits, research into harnessing turbulent burning plasmas and thereby controlling fusion reaction, is one of the grand challenges of complex systems science. After a brief overview of a status of world fusion projects, a focus is given on fusion research at the National Institute for Fusion Science (NIFS) in Japan, which is playing a role of the Inter University Institute, the coordinating Center of Excellence for academic fusion research and by the Large Helical Device (LHD), the world's largest superconducting heliotron device, as a National Users' facility. The current status of LHD project is presented focusing on the experimental program and the recent achievements in basic parameters and in steady state operations. Since, its start in a year 1998, a remarkable progress has presently resulted in the temperature of 140 Million degree, the highest density of 500 Thousand Billion/cc with the internal density barrier (IDB) and the highest steady average beta of 4.5% in helical plasma devices and the largest total input energy of 1.6 GJ, in all magnetic confinement fusion devices. Finally, a perspective is given of the ITER Broad Approach program

The dengue virus type 2 envelope protein fusion peptide is essential for membrane fusion

DOE Office of Scientific and Technical Information (OSTI.GOV)

Huang, Claire Y.-H., E-mail: CHuang1@cdc.go; Butrapet, Siritorn; Moss, Kelly J.

The flaviviral envelope (E) protein directs virus-mediated membrane fusion. To investigate membrane fusion as a requirement for virus growth, we introduced 27 unique mutations into the fusion peptide of an infectious cDNA clone of dengue 2 virus and recovered seven stable mutant viruses. The fusion efficiency of the mutants was impaired, demonstrating for the first time the requirement for specific FP AAs in optimal fusion. Mutant viruses exhibited different growth kinetics and/or genetic stabilities in different cell types and adult mosquitoes. Virus particles could be recovered following RNA transfection of cells with four lethal mutants; however, recovered viruses could notmore » re-infect cells. These viruses could enter cells, but internalized virus appeared to be retained in endosomal compartments of infected cells, thus suggesting a fusion blockade. Mutations of the FP also resulted in reduced virus reactivity with flavivirus group-reactive antibodies, confirming earlier reports using virus-like particles.« less

Nighttime images fusion based on Laplacian pyramid

NASA Astrophysics Data System (ADS)

Wu, Cong; Zhan, Jinhao; Jin, Jicheng

2018-02-01

This paper expounds method of the average weighted fusion, image pyramid fusion, the wavelet transform and apply these methods on the fusion of multiple exposures nighttime images. Through calculating information entropy and cross entropy of fusion images, we can evaluate the effect of different fusion. Experiments showed that Laplacian pyramid image fusion algorithm is suitable for processing nighttime images fusion, it can reduce the halo while preserving image details.

Fusion of disubstituted benzenes.

PubMed

Martin, E; Yalkowsky, S H; Wells, J E

1979-05-01

The entropy of fusion of 84 disubstituted benzenes was essentially constant and independent of the participation of the compounds in intramolecular or intermolecular hydrogen bonding. It was also independent of the shapes, sizes, and dipole moments of the rigid molecules studied. While the entropy of fusion was independent of these parameters, the melting point and the heat of fusion showed a direct dependence on molecular properties.

Comparison of instrumented anterior interbody fusion with instrumented circumferential lumbar fusion.

PubMed

Madan, S S; Boeree, N R

2003-12-01

Posterior lumbar interbody fusion (PLIF) restores disc height, the load bearing ability of anterior ligaments and muscles, root canal dimensions, and spinal balance. It immobilizes the painful degenerate spinal segment and decompresses the nerve roots. Anterior lumbar interbody fusion (ALIF) does the same, but could have complications of graft extrusion, compression and instability contributing to pseudarthrosis in the absence of instrumentation. The purpose of this study was to assess and compare the outcome of instrumented circumferential fusion through a posterior approach [PLIF and posterolateral fusion (PLF)] with instrumented ALIF using the Hartshill horseshoe cage, for comparable degrees of internal disc disruption and clinical disability. It was designed as a prospective study, comparing the outcome of two methods of instrumented interbody fusion for internal disc disruption. Between April 1994 and June 1998, the senior author (N.R.B.) performed 39 instrumented ALIF procedures and 35 instrumented circumferential fusion with PLIF procedures. The second author, an independent assessor (S.M.), performed the entire review. Preoperative radiographic assessment included plain radiographs, magnetic resonance imaging (MRI) and provocative discography in all the patients. The outcome in the two groups was compared in terms of radiological improvement and clinical improvement, measured on the basis of improvement of back pain and work capacity. Preoperatively, patients were asked to fill out a questionnaire giving their demographic details, maximum walking distance and current employment status in order to establish the comparability of the two groups. Patient assessment was with the Oswestry Disability Index, quality of life questionnaire (subjective), pain drawing, visual analogue scale, disability benefit, compensation status, and psychological profile. The results of the study showed a satisfactory outcome (score< or =30) on the subjective (quality of life

Preparation of GST Fusion Proteins.

PubMed

Einarson, Margret B; Pugacheva, Elena N; Orlinick, Jason R

2007-04-01

INTRODUCTIONThis protocol describes the preparation of glutathione-S-transferase (GST) fusion proteins, which have had a wide range of applications since their introduction as tools for synthesis of recombinant proteins in bacteria. GST was originally selected as a fusion moiety because of several desirable properties. First and foremost, when expressed in bacteria alone, or as a fusion, GST is not sequestered in inclusion bodies (in contrast to previous fusion protein systems). Second, GST can be affinity-purified without denaturation because it binds to immobilized glutathione, which provides the basis for simple purification. Consequently, GST fusion proteins are routinely used for antibody generation and purification, protein-protein interaction studies, and biochemical analysis.

Estimating the melting point, entropy of fusion, and enthalpy of fusion of organic compounds via SPARC.

PubMed

Whiteside, T S; Hilal, S H; Brenner, A; Carreira, L A

2016-08-01

The entropy of fusion, enthalpy of fusion, and melting point of organic compounds can be estimated through three models developed using the SPARC (SPARC Performs Automated Reasoning in Chemistry) platform. The entropy of fusion is modelled through a combination of interaction terms and physical descriptors. The enthalpy of fusion is modelled as a function of the entropy of fusion, boiling point, and flexibility of the molecule. The melting point model is the enthalpy of fusion divided by the entropy of fusion. These models were developed in part to improve SPARC's vapour pressure and solubility models. These models have been tested on 904 unique compounds. The entropy model has a RMS of 12.5 J mol(-1) K(-1). The enthalpy model has a RMS of 4.87 kJ mol(-1). The melting point model has a RMS of 54.4°C.

Molecular mechanisms involved in gamete interaction: evidence for the participation of cysteine-rich secretory proteins (CRISP) in sperm-egg fusion.

PubMed

Da Ros, V; Busso, D; Cohen, D J; Maldera, J; Goldweic, N; Cuasnicu, P S

2007-01-01

Epididymal protein DE and testicular protein Tpx-1 are two cysteine-rich secretory proteins also known as CRISP-1 and CRISP-2, respectively. DE/ CRISP-1 is localised on the equatorial segment of acrosome-reacted sperm and participates in rat gamete fusion through its binding to egg-complementary sites. Recent results using bacterially-expressed recombinant fragments of DE as well as synthetic peptides revealed that the ability of DE to bind to the egg surface and inhibit gamete fusion resides in a region of 12 amino acids corresponding to an evolutionary conserved motif of the CRISP family (Signature 2). Given the high degree of homology between DE/CRISP-1 and Tpx-1/CRISP-2, we also explored the potential participation of the testicular intra-acrosomal protein in gamete fusion. Results showing the ability of recombinant Tpx-1 to bind to the surface of rat eggs (evaluated by indirect immunofluorescence) and to significantly inhibit zona-free egg penetration, support the participation of this protein in gamete fusion through its interaction with egg-binding sites. Interestingly, rat Tpx-1 exhibits only two substitutions in Signature 2 when compared to this region in DE. Together, these results provide evidence for the involvement of both epididymal DE/CRISP-1 and testicular Tpx-1/CRISP-2 in gamete fusion suggesting the existence of a functional cooperation between homologue molecules as a mechanism to ensure the success of fertilisation.

Pyramiding transgenes for multiple resistance in rice against bacterial blight, yellow stem borer and sheath blight.

PubMed

Datta, K; Baisakh, N; Thet, K Maung; Tu, J; Datta, S K

2002-12-01

Here we describe the development of transgene-pyramided stable elite rice lines resistant to disease and insect pests by conventional crossing of two transgenic parental lines transformed independently with different genes. The Xa21 gene (resistance to bacterial blight), the Bt fusion gene (for insect resistance) and the chitinase gene (for tolerance of sheath blight) were combined in a single rice line by reciprocal crossing of two transgenic homozygous IR72 lines. F4 plant lines carrying all the genes of interest stably were identified using molecular methods. The identified lines, when exposed to infection caused by Xanthomonas oryzae pv oryzae, showed resistance to bacterial blight. Neonate larval mortality rates of yellow stem borer ( Scirpophaga incertulas) in an insect bioassay of the same identified lines were 100%. The identified line pyramided with different genes to protect against yield loss showed high tolerance of sheath blight disease caused by Rhizoctonia solani.

Kinetic advantage of controlled intermediate nuclear fusion

NASA Astrophysics Data System (ADS)

Guo, Xiaoming

2012-09-01

The dominated process of controlled fusion is to let nuclei gain enough kinetic energy to overcome Coulomb barrier. As a result, a fusion scheme can consider two factors in its design: to increase kinetic energy of nuclei and to alter the Coulomb barrier. Cold Fusion and Hot fusion are all one-factor schemes while Intermediate Fusion is a twofactors scheme. This made CINF kinetically superior. Cold Fusion reduces deuteron-deuteron distance, addressing Coulomb barrier, and Hot Fusion heat up plasma into extreme high temperature, addressing kinetic energy. Without enough kinetic energy made Cold Fusion skeptical. Extreme high temperature made Hot Fusion very difficult to engineer. Because CIFN addresses both factors, CIFN is a more promising technique to be industrialized.

Preventing Bacterial Infections using Metal Oxides Nanocoatings on Bone Implant

NASA Astrophysics Data System (ADS)

Duceac, L. D.; Straticiuc, S.; Hanganu, E.; Stafie, L.; Calin, G.; Gavrilescu, S. L.

2017-06-01

Nowadays bone implant removal is caused by infection that occurs around it possibly acquired after surgery or during hospitalization. The purpose of this study was to reveal some metal oxides applied as coatings on bone implant thus limiting the usual antibiotics-resistant bacteria colonization. Therefore ZnO, TiO2 and CuO were synthesized and structurally and morphologically analized in order to use them as an alternative antimicrobial agents deposited on bone implant. XRD, SEM, and FTIR characterization techniques were used to identify structure and texture of these nanoscaled metal oxides. These metal oxides nanocoatings on implant surface play a big role in preventing bacterial infection and reducing surgical complications.

Effective non-denaturing purification method for improving the solubility of recombinant actin-binding proteins produced by bacterial expression.

PubMed

Chung, Jeong Min; Lee, Sangmin; Jung, Hyun Suk

2017-05-01

Bacterial expression is commonly used to produce recombinant and truncated mutant eukaryotic proteins. However, heterologous protein expression may render synthesized proteins insoluble. The conventional method used to express a poorly soluble protein, which involves denaturation and refolding, is time-consuming and inefficient. There are several non-denaturing approaches that can increase the solubility of recombinant proteins that include using different bacterial cell strains, altering the time of induction, lowering the incubation temperature, and employing different detergents for purification. In this study, we compared several non-denaturing protocols to express and purify two insoluble 34 kDa actin-bundling protein mutants. The solubility of the mutant proteins was not affected by any of the approaches except for treatment with the detergent sarkosyl. These results indicate that sarkosyl can effectively improve the solubility of insoluble proteins during bacterial expression. Copyright © 2016. Published by Elsevier Inc.

Robotics and local fusion

NASA Astrophysics Data System (ADS)

Emmerman, Philip J.

2005-05-01

Teams of robots or mixed teams of warfighters and robots on reconnaissance and other missions can benefit greatly from a local fusion station. A local fusion station is defined here as a small mobile processor with interfaces to enable the ingestion of multiple heterogeneous sensor data and information streams, including blue force tracking data. These data streams are fused and integrated with contextual information (terrain features, weather, maps, dynamic background features, etc.), and displayed or processed to provide real time situational awareness to the robot controller or to the robots themselves. These blue and red force fusion applications remove redundancies, lessen ambiguities, correlate, aggregate, and integrate sensor information with context such as high resolution terrain. Applications such as safety, team behavior, asset control, training, pattern analysis, etc. can be generated or enhanced by these fusion stations. This local fusion station should also enable the interaction between these local units and a global information world.

Fusion gamma diagnostics

NASA Astrophysics Data System (ADS)

Medley, S. S.; Cecil, F. E.; Cole, D.; Conway, M. A.; Wilkinson, F. J., III

1985-05-01

Nuclear reactions of interest in fusion research often possess a branch yielding prompt emission of gamma radiation in excess of 15 MeV which can be exploited to provide a new fusion reaction diagnostic having applications similar to conventional neutron emission measurements. Conceptual aspects of fusion gamma diagnostics are discussed with emphasis on application to the Tokamak Fusion Test Reactor (TFTR) during deuterium neutral beam heating of D-T and D-3He plasmas. Recent measurements of the D (T, γ)5He, D(3He, γ)5Li, and D(D, γ)4He branching ratios at low center-of-mass energy (30-100 keV) and of the response of a large volume Ne226 detector for gamma detection in high neutron backgrounds are presented. Using a well-shielded Ne226 detector during 20 MW-120 kV deuterium beam heating of a tritium plasma in TFTR, the D(T, γ)5He gamma signal level is estimated to be 3.5×105 cps.

The cytoplasmic domain of the gamete membrane fusion protein HAP2 targets the protein to the fusion site in Chlamydomonas and regulates the fusion reaction.

PubMed

Liu, Yanjie; Pei, Jimin; Grishin, Nick; Snell, William J

2015-03-01

Cell-cell fusion between gametes is a defining step during development of eukaryotes, yet we know little about the cellular and molecular mechanisms of the gamete membrane fusion reaction. HAP2 is the sole gamete-specific protein in any system that is broadly conserved and shown by gene disruption to be essential for gamete fusion. The wide evolutionary distribution of HAP2 (also known as GCS1) indicates it was present in the last eukaryotic common ancestor and, therefore, dissecting its molecular properties should provide new insights into fundamental features of fertilization. HAP2 acts at a step after membrane adhesion, presumably directly in the merger of the lipid bilayers. Here, we use the unicellular alga Chlamydomonas to characterize contributions of key regions of HAP2 to protein location and function. We report that mutation of three strongly conserved residues in the ectodomain has no effect on targeting or fusion, although short deletions that include those residues block surface expression and fusion. Furthermore, HAP2 lacking a 237-residue segment of the cytoplasmic region is expressed at the cell surface, but fails to localize at the apical membrane patch specialized for fusion and fails to rescue fusion. Finally, we provide evidence that the ancient HAP2 contained a juxta-membrane, multi-cysteine motif in its cytoplasmic region, and that mutation of a cysteine dyad in this motif preserves protein localization, but substantially impairs HAP2 fusion activity. Thus, the ectodomain of HAP2 is essential for its surface expression, and the cytoplasmic region targets HAP2 to the site of fusion and regulates the fusion reaction. © 2015. Published by The Company of Biologists Ltd.

Inertial-confinement fusion with lasers

NASA Astrophysics Data System (ADS)

Betti, R.; Hurricane, O. A.

2016-05-01

The quest for controlled fusion energy has been ongoing for over a half century. The demonstration of ignition and energy gain from thermonuclear fuels in the laboratory has been a major goal of fusion research for decades. Thermonuclear ignition is widely considered a milestone in the development of fusion energy, as well as a major scientific achievement with important applications in national security and basic sciences. The US is arguably the world leader in the inertial confinement approach to fusion and has invested in large facilities to pursue it, with the objective of establishing the science related to the safety and reliability of the stockpile of nuclear weapons. Although significant progress has been made in recent years, major challenges still remain in the quest for thermonuclear ignition via laser fusion. Here, we review the current state of the art in inertial confinement fusion research and describe the underlying physical principles.

Pedicle screw fixation for isthmic spondylolisthesis: does posterior lumbar interbody fusion improve outcome over posterolateral fusion?

PubMed

La Rosa, Giovanni; Conti, Alfredo; Cacciola, Fabio; Cardali, Salvatore; La Torre, Domenico; Gambadauro, Nicola Maria; Tomasello, Francesco

2003-09-01

Posterolateral fusion involving instrumentation-assisted segmental fixation represents a valid procedure in the treatment of lumbar instability. In cases of anterior column failure, such as in isthmic spondylolisthesis, supplemental posterior lumbar interbody fusion (PLIF) may improve the fusion rate and endurance of the construct. Posterior lumbar interbody fusion is, however, a more demanding procedure and increases costs and risks of the intervention. The advantages of this technique must, therefore, be weighed against those of a simple posterior lumbar fusion. Thirty-five consecutive patients underwent pedicle screw fixation for isthmic spondylolisthesis. In 18 patients posterior lumbar fusion was performed, and in 17 patients PLIF was added. Clinical, economic, functional, and radiographic data were assessed to determine differences in clinical and functional results and biomechanical properties. At 2-year follow-up examination, the correction of subluxation, disc height, and foraminal area were maintained in the group in which a PLIF procedure was performed, but not in the posterolateral fusion-only group (p < 0.05). Nevertheless, no statistical intergroup differences were demonstrated in terms of neurological improvement (p = 1), economic (p = 0.43), or functional (p = 0.95) outcome, nor in terms of fusion rate (p = 0.49). The authors' findings support the view that an interbody fusion confers superior mechanical strength to the spinal construct; when posterolateral fusion is the sole intervention, progressive loss of the extreme correction can be expected. Such mechanical insufficiency, however, did not influence clinical outcome.

[Bacterial meningitis].

PubMed

Brouwer, M C; van de Beek, D

2012-05-01

Bacterial meningitis is a severe disease which affects 35.000 Europeans each year and has a mortality rate of about 20%. During the past 25 years the epidemiology of bacterial meningitis has changed significantly due to the implementation of vaccination against Haemophilus influenzae, Neisseria meningtidis group C and Streptococcus pneumoniae. Due to these vaccines, meningitis is now predominantly a disease occurring in adults, caused especially by Streptococcus pneumoniae, while it was formerly a child disease which was largely caused by Haemophilus influenzae. Bacterial meningitis is often difficult to recognize since the classical presentation with neck stiffness, reduced awareness and fever occurs in less than half of the patients. The only way to diagnose or exclude bacterial meningitis is by performing low-threshold cerebrospinal fluid examination with a suspicion of bacterial meningitis. The treatment consists of the prescription of antibiotics and dexamethasone.

Disc replacement adjacent to cervical fusion: a biomechanical comparison of hybrid construct versus two-level fusion.

PubMed

Lee, Michael J; Dumonski, Mark; Phillips, Frank M; Voronov, Leonard I; Renner, Susan M; Carandang, Gerard; Havey, Robert M; Patwardhan, Avinash G

2011-11-01

A cadaveric biomechanical study. To investigate the biomechanical behavior of the cervical spine after cervical total disc replacement (TDR) adjacent to a fusion as compared to a two-level fusion. There are concerns regarding the biomechanical effects of cervical fusion on the mobile motion segments. Although previous biomechanical studies have demonstrated that cervical disc replacement normalizes adjacent segment motion, there is a little information regarding the function of a cervical disc replacement adjacent to an anterior cervical decompression and fusion, a potentially common clinical application. Nine cadaveric cervical spines (C3-T1, age: 60.2 ± 3.5 years) were tested under load- and displacement-control testing. After intact testing, a simulated fusion was performed at C4-C5, followed by C6-C7. The simulated fusion was then reversed, and the response of TDR at C5-C6 was measured. A hybrid construct was then tested with the TDR either below or above a single-level fusion and contrasted with a simulated two-level fusion (C4-C6 and C5-C7). The external fixator device used to simulate fusion significantly reduced range of motion (ROM) at C4-C5 and C6-C7 by 74.7 ± 8.1% and 78.1 ± 11.5%, respectively (P < 0.05). Removal of the fusion construct restored the motion response of the spinal segments to their intact state. Arthroplasty performed at C5-C6 using the porous-coated motion disc prosthesis maintained the total flexion-extension ROM to the level of the intact controls when used as a stand-alone procedure or when implanted adjacent to a single-level fusion (P > 0.05). The location of the single-level fusion, whether above or below the arthroplasty, did not significantly affect the motion response of the arthroplasty in the hybrid construct. Performing a two-level fusion significantly increased the motion demands on the nonoperated segments as compared to a hybrid TDR-plus fusion construct when the spine was required to reach the same motion end points

Nitrogen-doped carbon nanofibers derived from polypyrrole coated bacterial cellulose as high-performance electrode materials for supercapacitors and Li-ion batteries

DOE PAGES

Lei, Wen; Han, Lili; Xuan, Cuijuan; ...

2016-05-24

Here, nitrogen-doped carbon nanofiber (NDCN) was synthesized via carbonization of polypyrrole (PPy) coated bacterial cellulose (BC) composites, where BC serves as templates as well as precursor, and PPy serves as the nitrogen source. The synthesized NDCN was employed as electrode for both supercapacitors and Li-ion batteries. The large surface area exposed to electrolyte resulting from the 3D carbon networks leads to sufficient electrode/electrolyte interface and creates shorter transport paths of electrolyte ions and Li + ion. Besides, the three types of N dopants in NDCN improve the electronic conductivity, as well as superior electrochemical performance.

Controlled Nuclear Fusion.

ERIC Educational Resources Information Center

Glasstone, Samuel

This publication is one of a series of information booklets for the general public published by The United States Atomic Energy Commission. Among the topics discussed are: Importance of Fusion Energy; Conditions for Nuclear Fusion; Thermonuclear Reactions in Plasmas; Plasma Confinement by Magnetic Fields; Experiments With Plasmas; High-Temperature…

The Extracellular Domain of Human High Affinity Copper Transporter (hNdCTR1), Synthesized by E. coli Cells, Chelates Silver and Copper Ions In Vivo

PubMed Central

Sankova, Tatiana P.; Orlov, Iurii A.; Saveliev, Andrey N.; Kirilenko, Demid A.; Babich, Polina S.; Brunkov, Pavel N.; Puchkova, Ludmila V.

2017-01-01

There is much interest in effective copper chelators to correct copper dyshomeostasis in neurodegenerative and oncological diseases. In this study, a recombinant fusion protein for expression in Escherichia coli cells was constructed from glutathione-S-transferase (GST) and the N-terminal domain (ectodomain) of human high affinity copper transporter CTR1 (hNdCTR1), which has three metal-bound motifs. Several biological properties of the GST-hNdCTR1 fusion protein were assessed. It was demonstrated that in cells, the protein was prone to oligomerization, formed inclusion bodies and displayed no toxicity. Treatment of E. coli cells with copper and silver ions reduced cell viability in a dose- and time-dependent manner. Cells expressing GST-hNdCTR1 protein demonstrated resistance to the metal treatments. These cells accumulated silver ions and formed nanoparticles that contained AgCl and metallic silver. In this bacterial population, filamentous bacteria with a length of about 10 µm were often observed. The possibility for the fusion protein carrying extracellular metal binding motifs to integrate into the cell’s copper metabolism and its chelating properties are discussed. PMID:29099786

Anti-bacterial properties of ultrafiltration membrane modified by graphene oxide with nano-silver particles.

PubMed

Li, Jingchun; Liu, Xuyang; Lu, Jiaqi; Wang, Yudan; Li, Guanglu; Zhao, Fangbo

2016-12-15

To improve the anti-biofouling properties of PVDF membranes, GO-Ag composites were synthesized and used as membrane antibacterial agent by a simple and environmentally friendly method. As identified by XRD, TEM and FTIR analysis, AgNPs were uniformly assembled on the synthesized GO-Ag sheets. The membranes were prepared by phase inversion method with different additional amounts (0.00-0.15wt%) of GO-Ag composites. The GO-Ag composites modified membranes show improved hydrophilicity, mechanical property and permeability than unmodified PVDF membrane. Specially, the antibacterial properties and inhibition of biofilm formation were greatly enhanced based on conventional inhibition zone test and anti-adhesion of bacterial experiment. The modified membranes also reveal a remarkable long-term continuous antimicrobial activity with slower release rate of Ag + compared to AgNPs/PVDF membrane. Copyright © 2016 Elsevier Inc. All rights reserved.

Fusion Simulation Project Workshop Report

NASA Astrophysics Data System (ADS)

Kritz, Arnold; Keyes, David

2009-03-01

The mission of the Fusion Simulation Project is to develop a predictive capability for the integrated modeling of magnetically confined plasmas. This FSP report adds to the previous activities that defined an approach to integrated modeling in magnetic fusion. These previous activities included a Fusion Energy Sciences Advisory Committee panel that was charged to study integrated simulation in 2002. The report of that panel [Journal of Fusion Energy 20, 135 (2001)] recommended the prompt initiation of a Fusion Simulation Project. In 2003, the Office of Fusion Energy Sciences formed a steering committee that developed a project vision, roadmap, and governance concepts [Journal of Fusion Energy 23, 1 (2004)]. The current FSP planning effort involved 46 physicists, applied mathematicians and computer scientists, from 21 institutions, formed into four panels and a coordinating committee. These panels were constituted to consider: Status of Physics Components, Required Computational and Applied Mathematics Tools, Integration and Management of Code Components, and Project Structure and Management. The ideas, reported here, are the products of these panels, working together over several months and culminating in a 3-day workshop in May 2007.

Alternative approaches to fusion. [reactor design and reactor physics for Tokamak fusion reactors

NASA Technical Reports Server (NTRS)

Roth, R. J.

1976-01-01

The limitations of the Tokamak fusion reactor concept are discussed and various other fusion reactor concepts are considered that employ the containment of thermonuclear plasmas by magnetic fields (i.e., stellarators). Progress made in the containment of plasmas in toroidal devices is reported. Reactor design concepts are illustrated. The possibility of using fusion reactors as a power source in interplanetary space travel and electric power plants is briefly examined.

The importance of proximal fusion level selection for outcomes of multi-level lumbar posterolateral fusion.

PubMed

Nam, Woo Dong; Cho, Jae Hwan

2015-03-01

There are few studies about risk factors for poor outcomes from multi-level lumbar posterolateral fusion limited to three or four level lumbar posterolateral fusions. The purpose of this study was to analyze the outcomes of multi-level lumbar posterolateral fusion and to search for possible risk factors for poor surgical outcomes. We retrospectively analyzed 37 consecutive patients who underwent multi-level lumbar or lumbosacral posterolateral fusion with posterior instrumentation. The outcomes were deemed either 'good' or 'bad' based on clinical and radiological results. Many demographic and radiological factors were analyzed to examine potential risk factors for poor outcomes. Student t-test, Fisher exact test, and the chi-square test were used based on the nature of the variables. Multiple logistic regression analysis was used to exclude confounding factors. Twenty cases showed a good outcome (group A, 54.1%) and 17 cases showed a bad outcome (group B, 45.9%). The overall fusion rate was 70.3%. The revision procedures (group A: 1/20, 5.0%; group B: 4/17, 23.5%), proximal fusion to L2 (group A: 5/20, 25.0%; group B: 10/17, 58.8%), and severity of stenosis (group A: 12/19, 63.3%; group B: 3/11, 27.3%) were adopted as possible related factors to the outcome in univariate analysis. Multiple logistic regression analysis revealed that only the proximal fusion level (superior instrumented vertebra, SIV) was a significant risk factor. The cases in which SIV was L2 showed inferior outcomes than those in which SIV was L3. The odds ratio was 6.562 (95% confidence interval, 1.259 to 34.203). The overall outcome of multi-level lumbar or lumbosacral posterolateral fusion was not as high as we had hoped it would be. Whether the SIV was L2 or L3 was the only significant risk factor identified for poor outcomes in multi-level lumbar or lumbosacral posterolateral fusion in the current study. Thus, the authors recommend that proximal fusion levels be carefully determined when

Production of Phloroglucinol, a Platform Chemical, in Arabidopsis using a Bacterial Gene.

PubMed

Abdel-Ghany, Salah E; Day, Irene; Heuberger, Adam L; Broeckling, Corey D; Reddy, Anireddy S N

2016-12-07

Phloroglucinol (1,3,5-trihydroxybenzene; PG) and its derivatives are phenolic compounds that are used for various industrial applications. Current methods to synthesize PG are not sustainable due to the requirement for carbon-based precursors and co-production of toxic byproducts. Here, we describe a more sustainable production of PG using plants expressing a native bacterial or a codon-optimized synthetic PhlD targeted to either the cytosol or chloroplasts. Transgenic lines were analyzed for the production of PG using gas and liquid chromatography coupled to mass spectroscopy. Phloroglucinol was produced in all transgenic lines and the line with the highest PhlD transcript level showed the most accumulation of PG. Over 80% of the produced PG was glycosylated to phlorin. Arabidopsis leaves have the machinery to glycosylate PG to form phlorin, which can be hydrolyzed enzymatically to produce PG. Furthermore, the metabolic profile of plants with PhlD in either the cytosol or chloroplasts was altered. Our results provide evidence that plants can be engineered to produce PG using a bacterial gene. Phytoproduction of PG using a bacterial gene paves the way for further genetic manipulations to enhance the level of PG with implications for the commercial production of this important platform chemical in plants.

Ultra-High-Throughput Screening of an In Vitro-Synthesized Horseradish Peroxidase Displayed on Microbeads Using Cell Sorter

PubMed Central

Zhu, Bo; Mizoguchi, Takuro; Kojima, Takaaki; Nakano, Hideo

2015-01-01

The C1a isoenzyme of horseradish peroxidase (HRP) is an industrially important heme-containing enzyme that utilizes hydrogen peroxide to oxidize a wide variety of inorganic and organic compounds for practical applications, including synthesis of fine chemicals, medical diagnostics, and bioremediation. To develop a ultra-high-throughput screening system for HRP, we successfully produced active HRP in an Escherichia coli cell-free protein synthesis system, by adding disulfide bond isomerase DsbC and optimizing the concentrations of hemin and calcium ions and the temperature. The biosynthesized HRP was fused with a single-chain Cro (scCro) DNA-binding tag at its N-terminal and C-terminal sites. The addition of the scCro-tag at both ends increased the solubility of the protein. Next, HRP and its fusion proteins were successfully synthesized in a water droplet emulsion by using hexadecane as the oil phase and SunSoft No. 818SK as the surfactant. HRP fusion proteins were displayed on microbeads attached with double-stranded DNA (containing the scCro binding sequence) via scCro-DNA interactions. The activities of the immobilized HRP fusion proteins were detected with a tyramide-based fluorogenic assay using flow cytometry. Moreover, a model microbead library containing wild type hrp (WT) and inactive mutant (MUT) genes was screened using fluorescence-activated cell-sorting, thus efficiently enriching the WT gene from the 1:100 (WT:MUT) library. The technique described here could serve as a novel platform for the ultra-high-throughput discovery of more useful HRP mutants and other heme-containing peroxidases. PMID:25993095

Detection of an unknown fusion protein in confiscated black market products.

PubMed

Walpurgis, Katja; Krug, Oliver; Thomas, Andreas; Laussmann, Tim; Schänzer, Wilhelm; Thevis, Mario

2014-01-01

Even without clinical approval, many performance-enhancing drugs are available on the black market and can therefore be easily obtained by cheating athletes. The misuse of these preparations can be associated with unforeseeable health risks - either due to a poor quality of the drugs or as a result of an insufficient clinical assessment. Moreover, confiscated black market products have frequently been shown to contain ingredients other than those declared on the label as well as additional by-products or compounds with a modified molecular structure. This communication describes the identification of an unknown fusion protein observed in several unlabelled black market products obtained from independent sources. Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and liquid chromatography-tandem mass spectrometry (LC-MS/MS) analysis of the confiscated preparations indicated the presence of an 18-kDa fusion protein consisting of the bacterial redox protein thioredoxin-1 (Trx, 12 kDa) and a 6-kDa peptide of unassigned composition. Trx has no relevance as performance enhancing agent but is routinely used as solubility tag for recombinant protein production. Further evaluation of the acquired MS/MS data revealed both an additional His tag and a thrombin cleavage site between the tags and the presumed bioactive peptide. However, thrombin cleavage of the fusion protein and LC-MS/MS analysis of the resulting peptide fragment finally suggested that the unknown protein is only the product of an empty expression vector without the DNA insert of interest. These findings are a further alarming example for the high level of risk that athletes take when misusing drugs obtained from the black market. Copyright © 2014 John Wiley & Sons, Ltd.

S argassum muticum-synthesized silver nanoparticles: an effective control tool against mosquito vectors and bacterial pathogens.

PubMed

Madhiyazhagan, Pari; Murugan, Kadarkarai; Kumar, Arjunan Naresh; Nataraj, Thiyagarajan; Dinesh, Devakumar; Panneerselvam, Chellasamy; Subramaniam, Jayapal; Mahesh Kumar, Palanisamy; Suresh, Udaiyan; Roni, Mathath; Nicoletti, Marcello; Alarfaj, Abdullah A; Higuchi, Akon; Munusamy, Murugan A; Benelli, Giovanni

2015-11-01

Mosquito-borne diseases represent a deadly threat for millions of people worldwide. Furthermore, pathogens and parasites polluting water also constitute a severe plague for populations of developing countries. In this research, silver nanoparticles (AgNP) were synthesized using the aqueous extract of the seaweed Sargassum muticum. The production of AgNP was confirmed by surface plasmon resonance band illustrated in UV-vis spectrophotometry. AgNP were characterized by FTIR, SEM, EDX, and XRD analyses. AgNP were mostly spherical in shape, crystalline in nature, with face-centered cubic geometry, and mean size was 43-79 nm. Toxicity of AgNP was assessed against Aedes aegypti, Anopheles stephensi, and Culex quinquefasciatus. In laboratory, AgNP were highly toxic against larvae and pupae of the three mosquito species. Maximum efficacy was observed against A. stephensi larvae, with LC50 ranging from 16.156 ppm (larva I) to 28.881 ppm (pupa). In the field, a single treatment with AgNP (10 × LC50) in water storage reservoirs was effective against the three mosquito vectors, allowing complete elimination of larval populations after 72 h. In ovicidal experiments, egg hatchability was reduced by 100% after treatment with 30 ppm of AgNP. Ovideterrence assays highlighted that 10 ppm of AgNP reduced oviposition rates of more than 70% in A. aegypti, A. stephensi, and C. quinquefasciatus (OAI = -0.61, -0.63, and -0.58, respectively). Antibacterial properties of AgNP were evaluated against Bacillus subtilis, Klebsiella pneumoniae, and Salmonella typhi using the agar disk diffusion and minimum inhibitory concentration protocol. AgNP tested at 50 ppm evoked growth inhibition zones larger than 5 mm in all tested bacteria. Overall, the chance to use S. muticum-synthesized AgNP for control of mosquito vectors seems promising since they are effective at low doses and may constitute an advantageous alternative to build newer and safer mosquito control tools. This is the first

Degenerative lumbar scoliosis in elderly patients: dynamic stabilization without fusion versus posterior instrumented fusion.

PubMed

Di Silvestre, Mario; Lolli, Francesco; Bakaloudis, Georgios

2014-01-01

Posterolateral fusion with pedicle screw instrumentation is currently the most widely accepted technique for degenerative lumbar scoliosis in elderly patients. However, a high incidence of complications has been reported in most series. Dynamic stabilization without fusion in patients older than 60 years has not previously been compared with the use of posterior fusion in degenerative lumbar scoliosis. To compare dynamic stabilization without fusion and posterior instrumented fusion in the treatment of degenerative lumbar scoliosis in elderly patients, in terms of perioperative findings, clinical outcomes, and adverse events. A retrospective study. Fifty-seven elderly patients were included. There were 45 women (78%) and 12 men (22%) with a mean age of 68.1 years (range, 61-78 years). All patients had degenerative de novo lumbar scoliosis, associated with vertebral canal stenosis in 51 cases (89.4%) and degenerative spondylolisthesis in 24 patients (42.1%). Clinical (Oswestry Disability Index, visual analog scale, Roland-Morris Disability Questionnaire) and radiological (scoliosis and lordosis corrections) outcomes as well as incidence of complications. Patients were divided into two groups: 32 patients (dynamic group) had dynamic stabilization without fusion and 25 patients (fusion group) underwent posterior instrumented fusion. All the patients' medical records and X-rays were reviewed. Preoperative, postoperative, and follow-up questionnaires were obtained to evaluate clinical outcomes. At an average follow-up of 64 months (range, 42-90 months), clinical results improved similarly in both groups of patients. Statistically superior scoliosis and final lordosis corrections were achieved with posterior fusion (56.9% vs. 37.3% and -46.8° vs. -35.8°, respectively). However, in the dynamic group, incidence of overall complications was lower (25% vs. 44%), and fewer patients required revision surgery (6.2% vs. 16%). Furthermore, lower average values of operative

Versatile fusion source integrator AFSI for fast ion and neutron studies in fusion devices

NASA Astrophysics Data System (ADS)

Sirén, Paula; Varje, Jari; Äkäslompolo, Simppa; Asunta, Otto; Giroud, Carine; Kurki-Suonio, Taina; Weisen, Henri; JET Contributors, The

2018-01-01

ASCOT Fusion Source Integrator AFSI, an efficient tool for calculating fusion reaction rates and characterizing the fusion products, based on arbitrary reactant distributions, has been developed and is reported in this paper. Calculation of reactor-relevant D-D, D-T and D-3He fusion reactions has been implemented based on the Bosch-Hale fusion cross sections. The reactions can be calculated between arbitrary particle populations, including Maxwellian thermal particles and minority energetic particles. Reaction rate profiles, energy spectra and full 4D phase space distributions can be calculated for the non-isotropic reaction products. The code is especially suitable for integrated modelling in self-consistent plasma physics simulations as well as in the Serpent neutronics calculation chain. Validation of the model has been performed for neutron measurements at the JET tokamak and the code has been applied to predictive simulations in ITER.

Structural and biochemical analyses indicate that a bacterial persulfide dioxygenase–rhodanese fusion protein functions in sulfur assimilation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Motl, Nicole; Skiba, Meredith A.; Kabil, Omer

Hydrogen sulfide (H2S) is a signaling molecule that is toxic at elevated concentrations. In eukaryotes, it is cleared via a mitochondrial sulfide oxidation pathway, which comprises sulfide quinone oxidoreductase, persulfide dioxygenase (PDO), rhodanese, and sulfite oxidase and converts H2S to thiosulfate and sulfate. Natural fusions between the non-heme iron containing PDO and rhodanese, a thiol sulfurtransferase, exist in some bacteria. However, little is known about the role of the PDO–rhodanese fusion (PRF) proteins in sulfur metabolism. Herein, we report the kinetic properties and the crystal structure of a PRF from the Gram-negative endophytic bacterium Burkholderia phytofirmans. The crystal structures ofmore » wild-type PRF and a sulfurtransferase-inactivated C314S mutant with and without glutathione were determined at 1.8, 2.4, and 2.7 Å resolution, respectively. We found that the two active sites are distant and do not show evidence of direct communication. The B. phytofirmans PRF exhibited robust PDO activity and preferentially catalyzed sulfur transfer in the direction of thiosulfate to sulfite and glutathione persulfide; sulfur transfer in the reverse direction was detectable only under limited turnover conditions. Together with the kinetic data, our bioinformatics analysis reveals that B. phytofirmans PRF is poised to metabolize thiosulfate to sulfite in a sulfur assimilation pathway rather than in sulfide stress response as seen, for example, with the Staphylococcus aureus PRF or sulfide oxidation and disposal as observed with the homologous mammalian proteins.« less

Complementation between avirulent Newcastle disease virus and a fusion protein gene expressed from a retrovirus vector: requirements for membrane fusion.

PubMed Central

Morrison, T; McQuain, C; McGinnes, L

1991-01-01

The cDNA derived from the fusion gene of the virulent AV strain of Newcastle disease virus (NDV) was expressed in chicken embryo cells by using a retrovirus vector. The fusion protein expressed in this system was transported to the cell surface and was efficiently cleaved into the disulfide-linked F1-F2 form found in infectious virions. The cells expressing the fusion gene grew normally and could be passaged many times. Monolayers of these cells would plaque, in the absence of trypsin, avirulent NDV strains (strains which encode a fusion protein which is not cleaved in tissue culture). Fusion protein-expressing cells would not fuse if mixed with uninfected cells or uninfected cells expressing the hemagglutinin-neuraminidase (HN) protein. However, the fusion protein-expressing cells, if infected with avirulent strains of NDV, would fuse with uninfected cells, suggesting that fusion requires both the fusion protein and another viral protein expressed in the same cell. Fusion was also seen after transfection of the HN protein gene into fusion protein-expressing cells. Thus, the expressed fusion protein gene is capable of complementing the virus infection, providing an active cleaved fusion protein required for the spread of infection. However, the fusion protein does not mediate cell fusion unless the cell also expresses the HN protein. Fusion protein-expressing cells would not plaque influenza virus in the absence of trypsin, nor would influenza virus-infected fusion protein-expressing cells fuse with uninfected cells. Thus, the influenza virus HA protein will not substitute for the NDV HN protein in cell-to-cell fusion. Images PMID:1987376

Structural Transition and Antibody Binding of EBOV GP and ZIKV E Proteins from Pre-Fusion to Fusion-Initiation State.

PubMed

Lappala, Anna; Nishima, Wataru; Miner, Jacob; Fenimore, Paul; Fischer, Will; Hraber, Peter; Zhang, Ming; McMahon, Benjamin; Tung, Chang-Shung

2018-05-10

Membrane fusion proteins are responsible for viral entry into host cells—a crucial first step in viral infection. These proteins undergo large conformational changes from pre-fusion to fusion-initiation structures, and, despite differences in viral genomes and disease etiology, many fusion proteins are arranged as trimers. Structural information for both pre-fusion and fusion-initiation states is critical for understanding virus neutralization by the host immune system. In the case of Ebola virus glycoprotein (EBOV GP) and Zika virus envelope protein (ZIKV E), pre-fusion state structures have been identified experimentally, but only partial structures of fusion-initiation states have been described. While the fusion-initiation structure is in an energetically unfavorable state that is difficult to solve experimentally, the existing structural information combined with computational approaches enabled the modeling of fusion-initiation state structures of both proteins. These structural models provide an improved understanding of four different neutralizing antibodies in the prevention of viral host entry.

STATs and macrophage fusion.

PubMed

Miyamoto, Takeshi

2013-07-01

Macrophages play a pivotal role in host defense against multiple foreign materials such as bacteria, parasites and artificial devices. Some macrophage lineage cells, namely osteoclasts and foreign body giant cells (FBGCs), form multi-nuclear giant cells by the cell-cell fusion of mono-nuclear cells. Osteoclasts are bone-resorbing cells, and are formed in the presence of RANKL on the surface of bones, while FBGCs are formed in the presence of IL-4 or IL-13 on foreign materials such as artificial joints, catheters and parasites. Recently, fusiogenic mechanisms and the molecules required for the cell-cell fusion of these macrophage lineage cells were, at least in part, clarified. Dendritic cell specific transmembrane protein (DC-STAMP) and osteoclast stimulatory transmembrane protein (OC-STAMP), both of which comprise seven transmembrane domains, are required for both osteoclast and FBGC cell-cell fusion. STAT6 was demonstrated to be required for the cell-cell fusion of FBGCs but not osteoclasts. In this review, advances in macrophage cell-cell fusion are discussed.

Membrane fusion triggers rapid degradation of two gamete-specific, fusion-essential proteins in a membrane block to polygamy in Chlamydomonas.

PubMed

Liu, Yanjie; Misamore, Michael J; Snell, William J

2010-05-01

The plasma membranes of gametes are specialized for fusion, yet, once fusion occurs, in many organisms the new zygote becomes incapable of further membrane fusion reactions. The molecular mechanisms that underlie this loss of fusion capacity (block to polygamy) remain unknown. During fertilization in the green alga Chlamydomonas, the plus gamete-specific membrane protein FUS1 is required for adhesion between the apically localized sites on the plasma membranes of plus and minus gametes that are specialized for fusion, and the minus-specific membrane protein HAP2 is essential for completion of the membrane fusion reaction. HAP2 (GCS1) family members are also required for fertilization in Arabidopsis, and for the membrane fusion reaction in the malaria organism Plasmodium berghei. Here, we tested whether Chlamydomonas gamete fusion triggers alterations in FUS1 and HAP2 and renders the plasma membranes of the cells incapable of subsequent fusion. We find that, even though the fusogenic sites support multi-cell adhesions, triploid zygotes are rare, indicating a fusion-triggered block to the membrane fusion reaction. Consistent with the extinction of fusogenic capacity, both FUS1 and HAP2 are degraded upon fusion. The rapid, fusion-triggered cleavage of HAP2 in zygotes is distinct from degradation occurring during constitutive turnover in gametes. Thus, gamete fusion triggers specific degradation of fusion-essential proteins and renders the zygote incapable of fusion. Our results provide the first molecular explanation for a membrane block to polygamy in any organism.

PULSE SYNTHESIZING GENERATOR

DOEpatents

Kerns, Q.A.

1963-08-01

>An electronlc circuit for synthesizing electrical current pulses having very fast rise times includes several sinewave generators tuned to progressively higher harmonic frequencies with signal amplitudes and phases selectable according to the Fourier series of the waveform that is to be synthesized. Phase control is provided by periodically triggering the generators at precisely controlled times. The outputs of the generators are combined in a coaxial transmission line. Any frequency-dependent delays that occur in the transmission line can be readily compensated for so that the desired signal wave shape is obtained at the output of the line. (AEC)

Magnetized Target Fusion: Prospects for Low-Cost Fusion Energy

NASA Technical Reports Server (NTRS)

Siemon, Richard E.; Turchi, Peter J.; Barnes, Daniel C.; Degnan, James; Parks, Paul; Ryutov, Dmitri D.; Thio, Y. C. Francis; Schafer, Charles (Technical Monitor)

2001-01-01

Magnetized Target Fusion (MTF) has attracted renewed interest in recent years because it has the potential to resolve one of the major problems with conventional fusion energy research - the high cost of facilities to do experiments and in general develop practical fusion energy. The requirement for costly facilities can be traced to fundamental constraints. The Lawson condition implies large system size in the case of conventional magnetic confinement, or large heating power in the case of conventional inertial confinement. The MTF approach is to use much higher fuel density than with conventional magnetic confinement (corresponding to megabar pressures), which results in a much-reduced system size to achieve Lawson conditions. Intrinsically the system must be pulsed because the pressures exceed the strength of any known material. To facilitate heating the fuel (or "target") to thermonuclear conditions with a high-power high-intensity source of energy, magnetic fields are used to insulate the high-pressure fuel from material surroundings (thus "magnetized target"). Because of magnetic insulation, the required heating power intensity is reduced by many orders of magnitude compared to conventional inertial fusion, even with relatively poor energy confinement in the magnetic field, such as that characterized by Bohm diffusion. In this paper we show semi-quantitatively why MTF-should allow fusion energy production without costly facilities within the same generally accepted physical constraints used for conventional magnetic and inertial fusion. We also briefly discuss potential applications of this technology ranging from nuclear rockets for space propulsion to a practical commercial energy system. Finally, we report on the exploratory research underway, and the interesting physics issues that arise in the MTF regime of parameters. Experiments at Los Alamos are focused on formation of a suitable plasma target for compression, utilizing the knowledge base for compact

Structural and physical properties of antibacterial Ag-doped nano-hydroxyapatite synthesized at 100°C

PubMed Central

2011-01-01

Synthesis of nanosized particle of Ag-doped hydroxyapatite with antibacterial properties is in the great interest in the development of new biomedical applications. In this article, we propose a method for synthesized the Ag-doped nanocrystalline hydroxyapatite. A silver-doped nanocrystalline hydroxyapatite was synthesized at 100°C in deionized water. Other phase or impurities were not observed. Silver-doped hydroxyapatite nanoparticles (Ag:HAp) were performed by setting the atomic ratio of Ag/[Ag + Ca] at 20% and [Ca + Ag]/P as 1.67. The X-ray diffraction studies demonstrate that powders made by co-precipitation at 100°C exhibit the apatite characteristics with good crystal structure and no new phase or impurity is found. The scanning electron microscopy (SEM) observations suggest that these materials present a little different morphology, which reveals a homogeneous aspect of the synthesized particles for all samples. The presence of calcium (Ca), phosphor (P), oxygen (O), and silver (Ag) in the Ag:HAp is confirmed by energy dispersive X-ray (EDAX) analysis. FT-IR and FT-Raman spectroscopies revealed that the presence of the various vibrational modes corresponds to phosphates and hydroxyl groups. The strain of Staphylococcus aureus was used to evaluate the antibacterial activity of the Ca10-xAgx(PO4)6(OH)2 (x = 0 and 0.2). In vitro bacterial adhesion study indicated a significant difference between HAp (x = 0) and Ag:HAp (x = 0.2). The Ag:Hap nanopowder showed higher inhibition. PMID:22136671

Structural and physical properties of antibacterial Ag-doped nano-hydroxyapatite synthesized at 100°C

NASA Astrophysics Data System (ADS)

Ciobanu, Carmen Steluta; Massuyeau, Florian; Constantin, Liliana Violeta; Predoi, Daniela

2011-12-01

Synthesis of nanosized particle of Ag-doped hydroxyapatite with antibacterial properties is in the great interest in the development of new biomedical applications. In this article, we propose a method for synthesized the Ag-doped nanocrystalline hydroxyapatite. A silver-doped nanocrystalline hydroxyapatite was synthesized at 100°C in deionized water. Other phase or impurities were not observed. Silver-doped hydroxyapatite nanoparticles (Ag:HAp) were performed by setting the atomic ratio of Ag/[Ag + Ca] at 20% and [Ca + Ag]/P as 1.67. The X-ray diffraction studies demonstrate that powders made by co-precipitation at 100°C exhibit the apatite characteristics with good crystal structure and no new phase or impurity is found. The scanning electron microscopy (SEM) observations suggest that these materials present a little different morphology, which reveals a homogeneous aspect of the synthesized particles for all samples. The presence of calcium (Ca), phosphor (P), oxygen (O), and silver (Ag) in the Ag:HAp is confirmed by energy dispersive X-ray (EDAX) analysis. FT-IR and FT-Raman spectroscopies revealed that the presence of the various vibrational modes corresponds to phosphates and hydroxyl groups. The strain of Staphylococcus aureus was used to evaluate the antibacterial activity of the Ca10- x Ag x (PO4)6(OH)2 ( x = 0 and 0.2). In vitro bacterial adhesion study indicated a significant difference between HAp ( x = 0) and Ag:HAp ( x = 0.2). The Ag:Hap nanopowder showed higher inhibition.

Stem Cells in Spinal Fusion

PubMed Central

Haudenschild, Dominik R.; Wegner, Adam M.; Klineberg, Eric O.

2017-01-01

Study Design: Review of literature. Objectives: This review of literature investigates the application of mesenchymal stem cells (MSCs) in spinal fusion, highlights potential uses in the development of bone grafts, and discusses limitations based on both preclinical and clinical models. Methods: A review of literature was conducted looking at current studies using stem cells for augmentation of spinal fusion in both animal and human models. Results: Eleven preclinical studies were found that used various animal models. Average fusion rates across studies were 59.8% for autograft and 73.7% for stem cell–based grafts. Outcomes included manual palpation and stressing of the fusion, radiography, micro–computed tomography (μCT), and histological analysis. Fifteen clinical studies, 7 prospective and 8 retrospective, were found. Fusion rates ranged from 60% to 100%, averaging 87.1% in experimental groups and 87.2% in autograft control groups. Conclusions: It appears that there is minimal clinical difference between commercially available stem cells and bone marrow aspirates indicating that MSCs may be a good choice in a patient with poor marrow quality. Overcoming morbidity and limitations of autograft for spinal fusion, remains a significant problem for spinal surgeons and further studies are needed to determine the efficacy of stem cells in augmenting spinal fusion. PMID:29238646

Outcomes of Posterolateral Fusion with and without Instrumentation and of Interbody Fusion for Isthmic Spondylolisthesis: A Prospective Study.

PubMed

Endler, Peter; Ekman, Per; Möller, Hans; Gerdhem, Paul

2017-05-03

Various methods for the treatment of isthmic spondylolisthesis are available. The aim of this study was to compare outcomes after posterolateral fusion without instrumentation, posterolateral fusion with instrumentation, and interbody fusion. The Swedish Spine Register was used to identify 765 patients who had been operated on for isthmic spondylolisthesis and had at least preoperative and 2-year outcome data; 586 of them had longer follow-up (a mean of 6.9 years). The outcome measures were a global assessment of leg and back pain, the Oswestry Disability Index (ODI), the EuroQol-5 Dimensions (EQ-5D) Questionnaire, the Short Form-36 (SF-36), a visual analog scale (VAS) for back and leg pain, and satisfaction with treatment. Data on additional lumbar spine surgery was searched for in the register, with the mean duration of follow-up for this variable being 10.6 years after the index procedure. Statistical analyses were performed with analysis of covariance or competing-risks proportional hazards regression, adjusted for baseline differences in the studied variables, smoking, employment status, and level of fusion. Posterolateral fusion without instrumentation was performed in 102 patients; posterolateral fusion with instrumentation, in 452; and interbody fusion, in 211. At 1 year, improvement was reported in the global assessment for back pain by 54% of the patients who had posterolateral fusion without instrumentation, 68% of those treated with posterolateral fusion with instrumentation, and 70% of those treated with interbody fusion (p = 0.009). The VAS for back pain and reported satisfaction with treatment showed similar patterns (p = 0.003 and p = 0.017, respectively), whereas other outcomes did not differ among the treatment groups at 1 year. At 2 years, the global assessment for back pain indicated improvement in 57% of the patients who had undergone posterolateral fusion without instrumentation, 70% of those who had posterolateral fusion with instrumentation

Induction of cell-cell fusion by ectromelia virus is not inhibited by its fusion inhibitory complex.

PubMed

Erez, Noam; Paran, Nir; Maik-Rachline, Galia; Politi, Boaz; Israely, Tomer; Schnider, Paula; Fuchs, Pinhas; Melamed, Sharon; Lustig, Shlomo

2009-09-29

Ectromelia virus, a member of the Orthopox genus, is the causative agent of the highly infectious mousepox disease. Previous studies have shown that different poxviruses induce cell-cell fusion which is manifested by the formation of multinucleated-giant cells (polykaryocytes). This phenomenon has been widely studied with vaccinia virus in conditions which require artificial acidification of the medium. We show that Ectromelia virus induces cell-cell fusion under neutral pH conditions and requires the presence of a sufficient amount of viral particles on the plasma membrane of infected cells. This could be achieved by infection with a replicating virus and its propagation in infected cells (fusion "from within") or by infection with a high amount of virus particles per cell (fusion "from without"). Inhibition of virus maturation or inhibition of virus transport on microtubules towards the plasma membrane resulted in a complete inhibition of syncytia formation. We show that in contrast to vaccinia virus, Ectromelia virus induces cell-cell fusion irrespectively of its hemagglutination properties and cell-surface expression of the orthologs of the fusion inhibitory complex, A56 and K2. Additionally, cell-cell fusion was also detected in mice lungs following lethal respiratory infection. Ectromelia virus induces spontaneous cell-cell fusion in-vitro and in-vivo although expressing an A56/K2 fusion inhibitory complex. This syncytia formation property cannot be attributed to the 37 amino acid deletion in ECTV A56.

The continuum fusion theory of signal detection applied to a bi-modal fusion problem

NASA Astrophysics Data System (ADS)

Schaum, A.

2011-05-01

A new formalism has been developed that produces detection algorithms for model-based problems, in which one or more parameter values is unknown. Continuum Fusion can be used to generate different flavors of algorithm for any composite hypothesis testing problem. The methodology is defined by a fusion logic that can be translated into max/min conditions. Here it is applied to a simple sensor fusion model, but one for which the generalized likelihood ratio test is intractable. By contrast, a fusion-based response to the same problem can be devised that is solvable in closed form and represents a good approximation to the GLR test.

Line-Tension Controlled Mechanism for Influenza Fusion

PubMed Central

Risselada, Herre Jelger; Smirnova, Yuliya G.; Grubmüller, Helmut; Marrink, Siewert Jan; Müller, Marcus

2012-01-01

Our molecular simulations reveal that wild-type influenza fusion peptides are able to stabilize a highly fusogenic pre-fusion structure, i.e. a peptide bundle formed by four or more trans-membrane arranged fusion peptides. We rationalize that the lipid rim around such bundle has a non-vanishing rim energy (line-tension), which is essential to (i) stabilize the initial contact point between the fusing bilayers, i.e. the stalk, and (ii) drive its subsequent evolution. Such line-tension controlled fusion event does not proceed along the hypothesized standard stalk-hemifusion pathway. In modeled influenza fusion, single point mutations in the influenza fusion peptide either completely inhibit fusion (mutants G1V and W14A) or, intriguingly, specifically arrest fusion at a hemifusion state (mutant G1S). Our simulations demonstrate that, within a line-tension controlled fusion mechanism, these known point mutations either completely inhibit fusion by impairing the peptide’s ability to stabilize the required peptide bundle (G1V and W14A) or stabilize a persistent bundle that leads to a kinetically trapped hemifusion state (G1S). In addition, our results further suggest that the recently discovered leaky fusion mutant G13A, which is known to facilitate a pronounced leakage of the target membrane prior to lipid mixing, reduces the membrane integrity by forming a ‘super’ bundle. Our simulations offer a new interpretation for a number of experimentally observed features of the fusion reaction mediated by the prototypical fusion protein, influenza hemagglutinin, and might bring new insights into mechanisms of other viral fusion reactions. PMID:22761674

The Importance of Proximal Fusion Level Selection for Outcomes of Multi-Level Lumbar Posterolateral Fusion

PubMed Central

Nam, Woo Dong

2015-01-01

Background There are few studies about risk factors for poor outcomes from multi-level lumbar posterolateral fusion limited to three or four level lumbar posterolateral fusions. The purpose of this study was to analyze the outcomes of multi-level lumbar posterolateral fusion and to search for possible risk factors for poor surgical outcomes. Methods We retrospectively analyzed 37 consecutive patients who underwent multi-level lumbar or lumbosacral posterolateral fusion with posterior instrumentation. The outcomes were deemed either 'good' or 'bad' based on clinical and radiological results. Many demographic and radiological factors were analyzed to examine potential risk factors for poor outcomes. Student t-test, Fisher exact test, and the chi-square test were used based on the nature of the variables. Multiple logistic regression analysis was used to exclude confounding factors. Results Twenty cases showed a good outcome (group A, 54.1%) and 17 cases showed a bad outcome (group B, 45.9%). The overall fusion rate was 70.3%. The revision procedures (group A: 1/20, 5.0%; group B: 4/17, 23.5%), proximal fusion to L2 (group A: 5/20, 25.0%; group B: 10/17, 58.8%), and severity of stenosis (group A: 12/19, 63.3%; group B: 3/11, 27.3%) were adopted as possible related factors to the outcome in univariate analysis. Multiple logistic regression analysis revealed that only the proximal fusion level (superior instrumented vertebra, SIV) was a significant risk factor. The cases in which SIV was L2 showed inferior outcomes than those in which SIV was L3. The odds ratio was 6.562 (95% confidence interval, 1.259 to 34.203). Conclusions The overall outcome of multi-level lumbar or lumbosacral posterolateral fusion was not as high as we had hoped it would be. Whether the SIV was L2 or L3 was the only significant risk factor identified for poor outcomes in multi-level lumbar or lumbosacral posterolateral fusion in the current study. Thus, the authors recommend that proximal fusion

Bacterial Magnetosome: A Novel Biogenetic Magnetic Targeted Drug Carrier with Potential Multifunctions

PubMed Central

Sun, Jianbo; Li, Ying; Liang, Xing-Jie; Wang, Paul C.

2012-01-01

Bacterial magnetosomes (BMs) synthesized by magnetotactic bacteria have recently drawn great interest due to their unique features. BMs are used experimentally as carriers for antibodies, enzymes, ligands, nucleic acids, and chemotherapeutic drugs. In addition to the common attractive properties of magnetic carriers, BMs also show superiority as targeting nanoscale drug carriers, which is hardly matched by artificial magnetic particles. We are presenting the potential applications of BMs as drug carriers by introducing the drug-loading methods and strategies and the recent research progress of BMs which has contributed to the application of BMs as drug carriers. PMID:22448162

[Identification of the authentic quality of Longdanxiegan pill by systematic quantified fingerprint method based on three wavelength fusion chromatogram].

PubMed

Sun, Guoxiang; Zhang, Jingxian

2009-05-01

The three wavelength fusion high performance liquid chromatographic fingerprin (TWFFP) of Longdanxiegan pill (LDXGP) was established to identify the quality of LDXGP by the systematic quantified fingerprint method. The chromatographic fingerprints (CFPs) of the 12 batches of LDXGP were determined by reversed-phase high performance liquid chromatography. The technique of multi-wavelength fusion fingerprint was applied during processing the fingerprints. The TWFFPs containing 63 co-possessing peaks were obtained when choosing baicalin peak as the referential peak. The 12 batches of LDXGP were identified with hierarchical clustering analysis by using macro qualitative similarity (S(m)) as the variable. According to the results of classification, the referential fingerprint (RFP) was synthesized from 10 batches of LDXGP. Taking the RFP for the qualified model, all the 12 batches of LDXGP were evaluated by the systematic quantified fingerprint method. Among the 12 batches of LDXGP, 9 batches were completely qualified, the contents of 1 batch were obviously higher while the chemical constituents quantity and distributed proportion in 2 batches were not qualified. The systematic quantified fingerprint method based on the technique of multi-wavelength fusion fingerprint ca effectively identify the authentic quality of traditional Chinese medicine.

Estimating the melting point, entropy of fusion, and enthalpy of fusion of organic compounds via SPARC

EPA Science Inventory

The entropies of fusion, enthalies of fusion, and melting points of organic compounds can be estimated through three models developed using the SPARC (SPARC Performs Automated Reasoning in Chemistry) platform. The entropy of fusion is modeled through a combination of interaction ...

Telomeres and mechanisms of Robertsonian fusion.

PubMed

Slijepcevic, P

1998-05-01

The Robertsonian (Rb) fusion, a chromosome rearrangement involving centric fusion of two acro-(telo)centric chromosomes to form a single metacentric, is one of the most frequent events in mammalian karyotype evolution. Since one of the functions of telomeres is to preserve chromosome integrity, a prerequisite for the formation of Rb fusions should be either telomere loss or telomere inactivation. Possible mechanisms underlying the formation of various types of Rb fusion are discussed here. For example, Rb fusion in wild mice involves complete loss of p-arm telomeres by chromosome breakage within minor satellite sequences. By contrast, interstitial telomeric sites are found in the pericentromeric regions of chromosomes originating from a number of vertebrate species, suggesting the occurrence of Rb-like fusion without loss of telomeres, a possibility consistent with some form of telomere inactivation. Finally, a recent study suggests that telomere shortening induced by the deletion of the telomerase RNA gene in the mouse germ-line leads to telomere loss and high frequencies of Rb fusion in mouse somatic cells. Thus, at least three mechanisms in mammalian cells lead to the formation of Rb fusions.

Immunogenicity of a recombinant fusion protein of tandem repeat epitopes of foot-and-mouth disease virus type Asia 1 for guinea pigs.

PubMed

Zhang, Q; Yang, Y Q; Zhang, Z Y; Li, L; Yan, W Y; Jiang, W J; Xin, A G; Lei, C X; Zheng, Z X

2002-01-01

In this study, the sequences of capsid protein VPI regions of YNAs1.1 and YNAs1.2 isolates of foot-and-mouth disease virus (FMDV) were analyzed and a peptide containing amino acids (aa) 133-158 of VP1 and aa 20-34 of VP4 of FMDV type Asia I was assumed to contain B and T cell epitopes, because it is hypervariable and includes a cell attachment site RGD located in the G-H loop. The DNA fragments encoding aa 133-158 of VP1 and aa 20-34 of VP4 of FMDV type Asia 1 were chemically synthesized and ligated into a tandem repeat of aa 133-158-20 approximately 34-133-158. In order to enhance its immunogenicity, the tandem repeat was inserted downstream of the beta-galactosidase gene in the expression vector pWR590. This insertion yielded a recombinant expression vector pAS1 encoding the fusion protein. The latter reacted with sera from FMDV type Asia 1-infected animals in vitro and elicited high levels of neutralizing antibodies in guinea pigs. The T cell proliferation in immunized animals increased following stimulation with the fusion protein. It is reported for the first time that a recombinant fusion protein vaccine was produced using B and T cell epitopes of FMDV type Asia 1 and that this fusion protein was immunogenic. The fusion protein reported here can serve as a candidate of fusion epitopes for design of a vaccine against FMDV type Asia 1.

Cell fusion in the liver, revisited

PubMed Central

Lizier, Michela; Castelli, Alessandra; Montagna, Cristina; Lucchini, Franco; Vezzoni, Paolo; Faggioli, Francesca

2018-01-01

There is wide agreement that cell fusion is a physiological process in cells in mammalian bone, muscle and placenta. In other organs, such as the cerebellum, cell fusion is controversial. The liver contains a considerable number of polyploid cells: They are commonly believed to originate by genome endoreplication, although the contribution of cell fusion to polyploidization has not been excluded. Here, we address the topic of cell fusion in the liver from a historical point of view. We discuss experimental evidence clearly supporting the hypothesis that cell fusion occurs in the liver, specifically when bone marrow cells were injected into mice and shown to rescue genetic hepatic degenerative defects. Those experiments-carried out in the latter half of the last century-were initially interpreted to show “transdifferentiation”, but are now believed to demonstrate fusion between donor macrophages and host hepatocytes, raising the possibility that physiologically polyploid cells, such as hepatocytes, could originate, at least partially, through homotypic cell fusion. In support of the homotypic cell fusion hypothesis, we present new data generated using a chimera-based model, a much simpler model than those previously used. Cell fusion as a road to polyploidization in the liver has not been extensively investigated, and its contribution to a variety of conditions, such as viral infections, carcinogenesis and aging, remains unclear. PMID:29527257

Specific regulation of thermosensitive lipid droplet fusion by a nuclear hormone receptor pathway

PubMed Central

Li, Shiwei; Li, Qi; Kong, Yuanyuan; Wu, Shuang; Cui, Qingpo; Zhang, Mingming; Zhang, Shaobing O.

2017-01-01

Nuclear receptors play important roles in regulating fat metabolism and energy production in humans. The regulatory functions and endogenous ligands of many nuclear receptors are still unidentified, however. Here, we report that CYP-37A1 (ortholog of human cytochrome P450 CYP4V2), EMB-8 (ortholog of human P450 oxidoreductase POR), and DAF-12 (homolog of human nuclear receptors VDR/LXR) constitute a hormone synthesis and nuclear receptor pathway in Caenorhabditis elegans. This pathway specifically regulates the thermosensitive fusion of fat-storing lipid droplets. CYP-37A1, together with EMB-8, synthesizes a lipophilic hormone not identical to Δ7-dafachronic acid, which represses the fusion-promoting function of DAF-12. CYP-37A1 also negatively regulates thermotolerance and lifespan at high temperature in a DAF-12–dependent manner. Human CYP4V2 can substitute for CYP-37A1 in C. elegans. This finding suggests the existence of a conserved CYP4V2-POR–nuclear receptor pathway that functions in converting multilocular lipid droplets to unilocular ones in human cells; misregulation of this pathway may lead to pathogenic fat storage. PMID:28760992

Specific regulation of thermosensitive lipid droplet fusion by a nuclear hormone receptor pathway.

PubMed

Li, Shiwei; Li, Qi; Kong, Yuanyuan; Wu, Shuang; Cui, Qingpo; Zhang, Mingming; Zhang, Shaobing O

2017-08-15

Nuclear receptors play important roles in regulating fat metabolism and energy production in humans. The regulatory functions and endogenous ligands of many nuclear receptors are still unidentified, however. Here, we report that CYP-37A1 (ortholog of human cytochrome P450 CYP4V2), EMB-8 (ortholog of human P450 oxidoreductase POR), and DAF-12 (homolog of human nuclear receptors VDR/LXR) constitute a hormone synthesis and nuclear receptor pathway in Caenorhabditis elegans This pathway specifically regulates the thermosensitive fusion of fat-storing lipid droplets. CYP-37A1, together with EMB-8, synthesizes a lipophilic hormone not identical to Δ7-dafachronic acid, which represses the fusion-promoting function of DAF-12. CYP-37A1 also negatively regulates thermotolerance and lifespan at high temperature in a DAF-12-dependent manner. Human CYP4V2 can substitute for CYP-37A1 in C. elegans This finding suggests the existence of a conserved CYP4V2-POR-nuclear receptor pathway that functions in converting multilocular lipid droplets to unilocular ones in human cells; misregulation of this pathway may lead to pathogenic fat storage.

Introduction to Nuclear Fusion Power and the Design of Fusion Reactors. An Issue-Oriented Module.

ERIC Educational Resources Information Center

Fillo, J. A.

This three-part module focuses on the principles of nuclear fusion and on the likely nature and components of a controlled-fusion power reactor. The physical conditions for a net energy release from fusion and two approaches (magnetic and inertial confinement) which are being developed to achieve this goal are described. Safety issues associated…

Matched Comparison of Fusion Rates between Hydroxyapatite Demineralized Bone Matrix and Autograft in Lumbar Interbody Fusion.

PubMed

Kim, Dae Hwan; Lee, Nam; Shin, Dong Ah; Yi, Seong; Kim, Keung Nyun; Ha, Yoon

2016-07-01

To compare the fusion rate of a hydroxyapatite demineralized bone matrix (DBM) with post-laminectomy acquired autograft in lumbar interbody fusion surgery and to evaluate the correlation between fusion rate and clinical outcome. From January 2013 to April 2014, 98 patients underwent lumbar interbody fusion surgery with hydroxyapatite DBM (HA-DBM group) in our institute. Of those patients, 65 received complete CT scans for 12 months postoperatively in order to evaluate fusion status. For comparison with autograft, we selected another 65 patients who underwent lumbar interbody fusion surgery with post-laminectomy acquired autograft (Autograft group) during the same period. Both fusion material groups were matched in terms of age, sex, body mass index (BMI), and bone mineral density (BMD). To evaluate the clinical outcomes, we analyzed the results of visual analogue scale (VAS), Oswestry Disability Index (ODI), and Short Form Health Survey (SF-36). We reviewed the CT scans of 149 fusion levels in 130 patients (HA-DBM group, 75 levels/65 patients; Autograft group, 74 levels/65 patients). Age, sex, BMI, and BMD were not significantly different between the groups (p=0.528, p=0.848, p=0.527, and p=0.610, respectively). The HA-DBM group showed 39 of 75 fused levels (52%), and the Autograft group showed 46 of 74 fused levels (62.2%). This difference was not statistically significant (p=0.21). In the HA-DBM group, older age and low BMD were significantly associated with non-fusion (61.24 vs. 66.68, p=0.027; -1.63 vs. -2.29, p=0.015, respectively). VAS and ODI showed significant improvement after surgery when fusion was successfully achieved in both groups (p=0.004, p=0.002, HA-DBM group; p=0.012, p=0.03, Autograft group). The fusion rates of the hydroxyapatite DBM and Autograft groups were not significantly different. In addition, clinical outcomes were similar between the groups. However, older age and low BMD are risk factors that might induce non-union after surgery with

Matched Comparison of Fusion Rates between Hydroxyapatite Demineralized Bone Matrix and Autograft in Lumbar Interbody Fusion

PubMed Central

Kim, Dae Hwan; Lee, Nam; Shin, Dong Ah; Yi, Seong; Kim, Keung Nyun

2016-01-01

Objective To compare the fusion rate of a hydroxyapatite demineralized bone matrix (DBM) with post-laminectomy acquired autograft in lumbar interbody fusion surgery and to evaluate the correlation between fusion rate and clinical outcome. Methods From January 2013 to April 2014, 98 patients underwent lumbar interbody fusion surgery with hydroxyapatite DBM (HA-DBM group) in our institute. Of those patients, 65 received complete CT scans for 12 months postoperatively in order to evaluate fusion status. For comparison with autograft, we selected another 65 patients who underwent lumbar interbody fusion surgery with post-laminectomy acquired autograft (Autograft group) during the same period. Both fusion material groups were matched in terms of age, sex, body mass index (BMI), and bone mineral density (BMD). To evaluate the clinical outcomes, we analyzed the results of visual analogue scale (VAS), Oswestry Disability Index (ODI), and Short Form Health Survey (SF-36). Results We reviewed the CT scans of 149 fusion levels in 130 patients (HA-DBM group, 75 levels/65 patients; Autograft group, 74 levels/65 patients). Age, sex, BMI, and BMD were not significantly different between the groups (p=0.528, p=0.848, p=0.527, and p=0.610, respectively). The HA-DBM group showed 39 of 75 fused levels (52%), and the Autograft group showed 46 of 74 fused levels (62.2%). This difference was not statistically significant (p=0.21). In the HA-DBM group, older age and low BMD were significantly associated with non-fusion (61.24 vs. 66.68, p=0.027; -1.63 vs. -2.29, p=0.015, respectively). VAS and ODI showed significant improvement after surgery when fusion was successfully achieved in both groups (p=0.004, p=0.002, HA-DBM group; p=0.012, p=0.03, Autograft group). Conclusion The fusion rates of the hydroxyapatite DBM and Autograft groups were not significantly different. In addition, clinical outcomes were similar between the groups. However, older age and low BMD are risk factors that might

La Crosse virus (LACV) Gc fusion peptide mutants have impaired growth and fusion phenotypes, but remain neurotoxic

DOE Office of Scientific and Technical Information (OSTI.GOV)

Soldan, Samantha S., E-mail: sssoldan@mail.med.upenn.ed; Hollidge, Bradley S.; Department of Neuroscience Graduate Group, University of Pennsylvania School of Medicine, Philadelphia, PA 19104-4283

La Crosse virus is a leading cause of pediatric encephalitis in the Midwestern United States and an emerging pathogen in the American South. The LACV glycoprotein Gc plays a critical role in entry as the virus attachment protein. A 22 amino acid hydrophobic region within Gc (1066-1087) was recently identified as the LACV fusion peptide. To further define the role of Gc (1066-1087) in virus entry, fusion, and neuropathogenesis, a panel of recombinant LACV (rLACV) fusion peptide mutant viruses was generated. Replication of mutant rLACVs was significantly reduced. In addition, the fusion peptide mutants demonstrated decreased fusion phenotypes relative tomore » LACV-WT. Interestingly, these viruses maintained their ability to cause neuronal loss in culture, suggesting that the fusion peptide of LACV Gc is a determinant of properties associated with neuroinvasion (growth to high titer in muscle cells and a robust fusion phenotype), but not necessarily of neurovirulence.« less

Inertial-confinement fusion with lasers

DOE PAGES

Betti, R.; Hurricane, O. A.

2016-05-03

The quest for controlled fusion energy has been ongoing for over a half century. The demonstration of ignition and energy gain from thermonuclear fuels in the laboratory has been a major goal of fusion research for decades. Thermonuclear ignition is widely considered a milestone in the development of fusion energy, as well as a major scientific achievement with important applications to national security and basic sciences. The U.S. is arguably the world leader in the inertial con fment approach to fusion and has invested in large facilities to pursue it with the objective of establishing the science related to themore » safety and reliability of the stockpile of nuclear weapons. Even though significant progress has been made in recent years, major challenges still remain in the quest for thermonuclear ignition via laser fusion.« less

Adjoint affine fusion and tadpoles

DOE Office of Scientific and Technical Information (OSTI.GOV)

Urichuk, Andrew, E-mail: andrew.urichuk@uleth.ca; Walton, Mark A., E-mail: walton@uleth.ca; International School for Advanced Studies

2016-06-15

We study affine fusion with the adjoint representation. For simple Lie algebras, elementary and universal formulas determine the decomposition of a tensor product of an integrable highest-weight representation with the adjoint representation. Using the (refined) affine depth rule, we prove that equally striking results apply to adjoint affine fusion. For diagonal fusion, a coefficient equals the number of nonzero Dynkin labels of the relevant affine highest weight, minus 1. A nice lattice-polytope interpretation follows and allows the straightforward calculation of the genus-1 1-point adjoint Verlinde dimension, the adjoint affine fusion tadpole. Explicit formulas, (piecewise) polynomial in the level, are writtenmore » for the adjoint tadpoles of all classical Lie algebras. We show that off-diagonal adjoint affine fusion is obtained from the corresponding tensor product by simply dropping non-dominant representations.« less

Glycoprotein interactions in paramyxovirus fusion

PubMed Central

Iorio, Ronald M; Melanson, Vanessa R; Mahon, Paul J

2009-01-01

The Paramyxoviridae are enveloped, negative-stranded RNA viruses, some of which recognize sialic acid-containing receptors, while others recognize specific proteinaceous receptors. The major cytopathic effect of paramyxovirus infection is membrane fusion-induced syncytium formation. Paramyxoviruses are unusual in that the receptor-binding and fusion-promoting activities reside on two different spike structures, the attachment and fusion glycoproteins, respectively. For most paramyxoviruses, this distribution of functions requires a mechanism by which the two processes can be linked for the promotion of fusion. This is accomplished by a virus-specific interaction between the two proteins. An increasing body of evidence supports the notion that members of this family of viruses utilize this glycoprotein interaction in different ways in order to mediate the regulation of the fusion protein activation, depending on the type of receptor utilized by the virus. PMID:20161127

Multiscale Medical Image Fusion in Wavelet Domain

PubMed Central

Khare, Ashish

2013-01-01

Wavelet transforms have emerged as a powerful tool in image fusion. However, the study and analysis of medical image fusion is still a challenging area of research. Therefore, in this paper, we propose a multiscale fusion of multimodal medical images in wavelet domain. Fusion of medical images has been performed at multiple scales varying from minimum to maximum level using maximum selection rule which provides more flexibility and choice to select the relevant fused images. The experimental analysis of the proposed method has been performed with several sets of medical images. Fusion results have been evaluated subjectively and objectively with existing state-of-the-art fusion methods which include several pyramid- and wavelet-transform-based fusion methods and principal component analysis (PCA) fusion method. The comparative analysis of the fusion results has been performed with edge strength (Q), mutual information (MI), entropy (E), standard deviation (SD), blind structural similarity index metric (BSSIM), spatial frequency (SF), and average gradient (AG) metrics. The combined subjective and objective evaluations of the proposed fusion method at multiple scales showed the effectiveness and goodness of the proposed approach. PMID:24453868

Novel t(5;11)(q32;q13.4) with NUMA1-PDGFRB fusion in a myeloid neoplasm with eosinophilia with response to imatinib mesylate.

PubMed

Zou, Ying S; Hoppman, Nicole L; Singh, Zeba N; Sawhney, Sameer; Kotiah, Sandy D; Baer, Maria R

2017-04-01

We report a NUMA1-PDGFRB fusion in a myeloproliferative neoplasm with eosinophilia in a 61-year old man, with response to imatinib mesylate therapy. A t(5;11) chromosome translocation involving bands 5q32 and 11q13.4 was identified by metaphase chromosome analysis, and rearrangement of the platelet-derived growth factor receptor beta (PDGFRB) gene on 5q32 was demonstrated by FISH using a PDGFRB break-apart probe set. Bacterial artificial chromosome (BAC) FISH mapping of the PDGFRB fusion partner gene narrowed the breakpoint at 11q13.4 to a 150 kb genomic region containing three genes, including NUMA1. Mate pair sequencing analysis demonstrated NUMA1-PDGFRB fusion. The fusion protein includes coiled-coil domains of nuclear mitotic apparatus protein 1 (NuMA1, involved in protein homodimerization and heteroassociation) and tyrosine kinase domains of PDGFRB. Diverse rearrangements involving the PDGFRB gene have been identified in myeloid and lymphoid neoplasms with eosinophilia, but rearrangement of the nuclear mitotic apparatus protein 1 (NUMA1) gene has previously been reported in a human malignancy in only one instance, a NUMA1-RARA fusion caused by a t(11;17) translocation in a patient with acute promyelocytic leukemia. The NUMA1-PDGFRB fusion is the second instance of rearrangement of NUMA1, encoding an element of the mitotic apparatus, in human cancer. Copyright © 2017 Elsevier Inc. All rights reserved.

Expression of the cationic antimicrobial peptide lactoferricin fused with the anionic peptide in Escherichia coli.

PubMed

Kim, Ha-Kun; Chun, Dae-Sik; Kim, Joon-Sik; Yun, Cheol-Ho; Lee, Ju-Hoon; Hong, Soon-Kwang; Kang, Dae-Kyung

2006-09-01

Direct expression of lactoferricin, an antimicrobial peptide, is lethal to Escherichia coli. For the efficient production of lactoferricin in E. coli, we developed an expression system in which the gene for the lysine- and arginine-rich cationic lactoferricin was fused to an anionic peptide gene to neutralize the basic property of lactoferricin, and successfully overexpressed the concatemeric fusion gene in E. coli. The lactoferricin gene was linked to a modified magainin intervening sequence gene by a recombinational polymerase chain reaction, thus producing an acidic peptide-lactoferricin fusion gene. The monomeric acidic peptide-lactoferricin fusion gene was multimerized and expressed in E. coli BL21(DE3) upon induction with isopropyl-beta-D-thiogalactopyranoside. The expression levels of the fusion peptide reached the maximum at the tetramer, while further increases in the copy number of the fusion gene substantially reduced the peptide expression level. The fusion peptides were isolated and cleaved to generate the separate lactoferricin and acidic peptide. About 60 mg of pure recombinant lactoferricin was obtained from 1 L of E. coli culture. The purified recombinant lactoferricin was found to have a molecular weight similar to that of chemically synthesized lactoferricin. The recombinant lactoferricin showed antimicrobial activity and disrupted bacterial membrane permeability, as the native lactoferricin peptide does.

Influenza Virus-Mediated Membrane Fusion: Determinants of Hemagglutinin Fusogenic Activity and Experimental Approaches for Assessing Virus Fusion

PubMed Central

Hamilton, Brian S.; Whittaker, Gary R.; Daniel, Susan

2012-01-01

Hemagglutinin (HA) is the viral protein that facilitates the entry of influenza viruses into host cells. This protein controls two critical aspects of entry: virus binding and membrane fusion. In order for HA to carry out these functions, it must first undergo a priming step, proteolytic cleavage, which renders it fusion competent. Membrane fusion commences from inside the endosome after a drop in lumenal pH and an ensuing conformational change in HA that leads to the hemifusion of the outer membrane leaflets of the virus and endosome, the formation of a stalk between them, followed by pore formation. Thus, the fusion machinery is an excellent target for antiviral compounds, especially those that target the conserved stem region of the protein. However, traditional ensemble fusion assays provide a somewhat limited ability to directly quantify fusion partly due to the inherent averaging of individual fusion events resulting from experimental constraints. Inspired by the gains achieved by single molecule experiments and analysis of stochastic events, recently-developed individual virion imaging techniques and analysis of single fusion events has provided critical information about individual virion behavior, discriminated intermediate fusion steps within a single virion, and allowed the study of the overall population dynamics without the loss of discrete, individual information. In this article, we first start by reviewing the determinants of HA fusogenic activity and the viral entry process, highlight some open questions, and then describe the experimental approaches for assaying fusion that will be useful in developing the most effective therapies in the future. PMID:22852045

Evaluation of antibacterial and Antibiofilm activity of Synthesized Zinc-Hydroxyapatite Biocomposites from Labeo rohita fish scale waste

NASA Astrophysics Data System (ADS)

Sathiskumar, Swamiappan; Vanaraj, Sekar; Sabarinathan, Devaraj; Preethi, Kathirvel

2018-02-01

Materials based on hydroxyapatite (HAp) Synthesized from bio-wastes have been regarded as useful, novel, eco-friendly medical applications that are targeted primarily for their antibacterial nature. In the present study, HAp was Synthesized from the fish scales of Labeo rohita using alkaline heat treatment and subsequently mixed with 1, 2 and 3 wt% of zinc (Zn) at 800 °C using calcination method to yield Zn-HAp composites. A detailed characterization of the generated composites was analysed by XRD, FT-IR, SEM, EDX and DLS methods. Further, antibacterial and biofilm inhibitory activity of the generated composites was determined using strains of Staphylococcus aureus and Escherichia coli. The confirmation of the presence of zinc, confirmed by EDAX spectra, XRD, FT-IR, SEM and DLS observations, established that HAp and Zn-HAp composites were without impurities, irregular in shape and were 848 nm sized particles. Although 1-3 wt% Zn-HAp composites showed antibacterial activity, the 3 wt% Zn-HAp composite was found suitable to kill the surrounding bacterial growth and showed potent inhibitory activity against biofilm formation.

A Review of Data Fusion Techniques

PubMed Central

2013-01-01

The integration of data and knowledge from several sources is known as data fusion. This paper summarizes the state of the data fusion field and describes the most relevant studies. We first enumerate and explain different classification schemes for data fusion. Then, the most common algorithms are reviewed. These methods and algorithms are presented using three different categories: (i) data association, (ii) state estimation, and (iii) decision fusion. PMID:24288502

A review of data fusion techniques.

PubMed

Castanedo, Federico

2013-01-01

The integration of data and knowledge from several sources is known as data fusion. This paper summarizes the state of the data fusion field and describes the most relevant studies. We first enumerate and explain different classification schemes for data fusion. Then, the most common algorithms are reviewed. These methods and algorithms are presented using three different categories: (i) data association, (ii) state estimation, and (iii) decision fusion.

Fusion barrier characteristics of actinides

NASA Astrophysics Data System (ADS)

Manjunatha, H. C.; Sridhar, K. N.

2018-03-01

We have studied fusion barrier characteristics of actinide compound nuclei with atomic number range 89 ≤ Z ≤ 103 for all projectile target combinations. After the calculation of fusion barrier heights and positions, we have searched for their parameterization. We have achieved the empirical formula for fusion barrier heights (VB), positions (RB), curvature of the inverted parabola (ħω) of actinide compound nuclei with atomic number range 89 ≤ Z ≤ 103 for all projectile target combinations (6 fusion barrier characteristics of 7205 projectile target combinations. The values produced by the present formula are also compared with experiments. The present pocket formula produces fusion barrier characteristics of actinides with the simple inputs of mass number (A) and atomic number (Z) of projectile-targets.

Prevalence of Abelson murine leukemia viral oncogene homolog-breakpoint cluster region fusions and correlation with peripheral blood parameters in chronic myelogenous leukemia patients in Lorestan Province, Iran.

PubMed

Kiani, Ali Asghar; Shahsavar, Farhad; Gorji, Mojtaba; Ahmadi, Kolsoum; Nazarabad, Vahideh Heydari; Bahmani, Banafsheh

2016-01-01

Chronic myelogenous leukemia (CML) is a chronic malignancy of myeloid linage associated with a significant increase in granulocytes in bone marrow and peripheral blood. CML diagnosis is based on detection of Philadelphia chromosome and "Abelson murine leukemia viral oncogene homolog" (ABL)-"breakpoint cluster region protein" fusions (ABL-BCR fusions). In this study, patients with CML morphology were studied according to ABL-BCR fusions and the relationship between the fusions and peripheral blood cell changes was examined. All patients suspected to chronic myeloproliferative disorders in Lorestan Province visiting subspecialist hematology clinics who were confirmed by oncologist were studied over a period of 5 years. After completing basic data questionnaire, blood samples were obtained with informed consent from the patients. Blood cell count and morphology were investigated and RNA was extracted from blood samples. cDNA was synthesized from RNA and ABL-BCR fusions including b3a2 and b2a2 (protein 210 kd or p210), e1a2 (protein 190 kdor p190), and e19a2 (protein 230 kdor p230) were studied by multiplex reverse transcription polymerase chain reaction method. Coexistence of e1a2 and b2a2 (p210/p190) fusions was also studied. The prevalence of mutations and their correlation with the blood parameters were statistically analyzed. Of 58 patients positive for ABL-BCR fusion, 18 (30.5%) had b2a2 fusion, 37 (62.71%) had b3a2 fusion and three (3.08%) had e1a2 fusion. Coexistence of e1a2 and b2a2 (p210/p190) was not observed. There was no significant correlation between ABL-BCR fusions and white blood cell count, platelet count, and hemoglobin concentration. The ABL-BCR fusions in Lorestan Province were similar to other studies in Iran, and b3a2 fusion had the highest prevalence in the studied patients studied.

Localization of a bacterial group II intron-encoded protein in eukaryotic nuclear splicing-related cell compartments.

PubMed

Nisa-Martínez, Rafael; Laporte, Philippe; Jiménez-Zurdo, José Ignacio; Frugier, Florian; Crespi, Martin; Toro, Nicolás

2013-01-01

Some bacterial group II introns are widely used for genetic engineering in bacteria, because they can be reprogrammed to insert into the desired DNA target sites. There is considerable interest in developing this group II intron gene targeting technology for use in eukaryotes, but nuclear genomes present several obstacles to the use of this approach. The nuclear genomes of eukaryotes do not contain group II introns, but these introns are thought to have been the progenitors of nuclear spliceosomal introns. We investigated the expression and subcellular localization of the bacterial RmInt1 group II intron-encoded protein (IEP) in Arabidopsis thaliana protoplasts. Following the expression of translational fusions of the wild-type protein and several mutant variants with EGFP, the full-length IEP was found exclusively in the nucleolus, whereas the maturase domain alone targeted EGFP to nuclear speckles. The distribution of the bacterial RmInt1 IEP in plant cell protoplasts suggests that the compartmentalization of eukaryotic cells into nucleus and cytoplasm does not prevent group II introns from invading the host genome. Furthermore, the trafficking of the IEP between the nucleolus and the speckles upon maturase inactivation is consistent with the hypothesis that the spliceosomal machinery evolved from group II introns.

Localization of a Bacterial Group II Intron-Encoded Protein in Eukaryotic Nuclear Splicing-Related Cell Compartments

PubMed Central

Nisa-Martínez, Rafael; Laporte, Philippe; Jiménez-Zurdo, José Ignacio; Frugier, Florian; Crespi, Martin; Toro, Nicolás

2013-01-01

Some bacterial group II introns are widely used for genetic engineering in bacteria, because they can be reprogrammed to insert into the desired DNA target sites. There is considerable interest in developing this group II intron gene targeting technology for use in eukaryotes, but nuclear genomes present several obstacles to the use of this approach. The nuclear genomes of eukaryotes do not contain group II introns, but these introns are thought to have been the progenitors of nuclear spliceosomal introns. We investigated the expression and subcellular localization of the bacterial RmInt1 group II intron-encoded protein (IEP) in Arabidopsis thaliana protoplasts. Following the expression of translational fusions of the wild-type protein and several mutant variants with EGFP, the full-length IEP was found exclusively in the nucleolus, whereas the maturase domain alone targeted EGFP to nuclear speckles. The distribution of the bacterial RmInt1 IEP in plant cell protoplasts suggests that the compartmentalization of eukaryotic cells into nucleus and cytoplasm does not prevent group II introns from invading the host genome. Furthermore, the trafficking of the IEP between the nucleolus and the speckles upon maturase inactivation is consistent with the hypothesis that the spliceosomal machinery evolved from group II introns. PMID:24391881

Multiplexed chirp waveform synthesizer

DOEpatents

Dudley, Peter A.; Tise, Bert L.

2003-09-02

A synthesizer for generating a desired chirp signal has M parallel channels, where M is an integer greater than 1, each channel including a chirp waveform synthesizer generating at an output a portion of a digital representation of the desired chirp signal; and a multiplexer for multiplexing the M outputs to create a digital representation of the desired chirp signal. Preferably, each channel receives input information that is a function of information representing the desired chirp signal.

Bacterial meningitis.

PubMed

Heckenberg, Sebastiaan G B; Brouwer, Matthijs C; van de Beek, Diederik

2014-01-01

Bacterial meningitis is a neurologic emergency. Vaccination against common pathogens has decreased the burden of disease. Early diagnosis and rapid initiation of empiric antimicrobial and adjunctive therapy are vital. Therapy should be initiated as soon as blood cultures have been obtained, preceding any imaging studies. Clinical signs suggestive of bacterial meningitis include fever, headache, meningismus, and an altered level of consciousness but signs may be scarce in children, in the elderly, and in meningococcal disease. Host genetic factors are major determinants of susceptibility to meningococcal and pneumococcal disease. Dexamethasone therapy has been implemented as adjunctive treatment of adults with pneumococcal meningitis. Adequate and prompt treatment of bacterial meningitis is critical to outcome. In this chapter we review the epidemiology, pathophysiology, and management of bacterial meningitis. © 2014 Elsevier B.V. All rights reserved.

HEDP and new directions for fusion energy

NASA Astrophysics Data System (ADS)

Kirkpatrick, Ronald C.

2010-06-01

Magnetic-confinement fusion energy and inertia-confinement fusion energy (IFE) represent two extreme approaches to the quest for the application of thermonuclear fusion to electrical energy generation. Blind pursuit of these extreme approaches has long delayed the achievement of their common goal. We point out the possibility of an intermediate approach that promises cheaper, and consequently more rapid development of fusion energy. For example, magneto-inertial fusion appears to be possible over a broad range of parameter space. It is further argued that imposition of artificial constraints impedes the discovery of physics solutions for the fusion energy problem.

INTRODUCTION: Status report on fusion research

NASA Astrophysics Data System (ADS)

Burkart, Werner

2005-10-01

A major milestone on the path to fusion energy was reached in June 2005 on the occasion of the signing of the joint declaration of all parties to the ITER negotiations, agreeing on future arrangements and on the construction site at Cadarache in France. The International Atomic Energy Agency has been promoting fusion activities since the late 1950s; it took over the auspices of the ITER Conceptual Design Activities in 1988, and of the ITER Engineering and Design Activities in 1992. The Agency continues its support to Member States through the organization of consultancies, workshops and technical meetings, the most prominent being the series of International Fusion Energy Conferences (formerly called the International Conference on Plasma Physics and Controlled Nuclear Fusion Research). The meetings serve as a platform for experts from all Member States to have open discussions on their latest accomplishments as well as on their problems and eventual solutions. The papers presented at the meetings and conferences are routinely published, many being sent to the journal it Nuclear Fusion, co-published monthly by Institute of Physics Publishing, Bristol, UK. The journal's reputation is reflected in the fact that it is a world-renowned publication, and the International Fusion Research Council has used it for the publication of a Status Report on Controlled Thermonuclear Fusion in 1978 and 1990. This present report marks the conclusion of the preparatory phases of ITER activities. It provides background information on the progress of fusion research within the last 15 years. The International Fusion Research Council (IFRC), which initiated the report, was fully aware of the complexities of including all scientific results in just one paper, and so decided to provide an overview and extensive references for the interested reader who need not necessarily be a fusion specialist. Professor Predhiman K. Kaw, Chairman, prepared the report on behalf of the IFRC, reflecting

76 FR 49757 - Fusion Energy Sciences Advisory Committee

Federal Register 2010, 2011, 2012, 2013, 2014

2011-08-11

... DEPARTMENT OF ENERGY Fusion Energy Sciences Advisory Committee AGENCY: Office of Science... Services Administration, notice is hereby given that the Fusion Energy Sciences Advisory Committee will be... science, fusion science, and fusion technology related to the Fusion Energy Sciences program. Additionally...

Fusion for Space Propulsion

NASA Technical Reports Server (NTRS)

Thio, Y. C. Francis; Schmidt, George R.; Santarius, John F.; Turchi, Peter J.; Siemon, Richard E.; Rodgers, Stephen L. (Technical Monitor)

2002-01-01

The need for fusion propulsion for interplanetary flights is discussed. For a propulsion system, there are three important system attributes: (1) The absolute amount of energy available, (2) the propellant exhaust velocity, and (3) the jet power per unit mass of the propulsion system (specific power). For efficient and affordable human exploration of the solar system, propellant exhaust velocity in excess of 100 km/s and specific power in excess of 10 kW/kg are required. Chemical combustion obviously cannot meet the requirement in propellant exhaust velocity. Nuclear fission processes typically result in producing energy in the form of heat that needs to be manipulated at temperatures limited by materials to about 2,800 K. Using the fission energy to heat a low atomic weight propellant produces propellant velocity of the order of 10 kinds. Alternatively the fission energy can be converted into electricity that is used to accelerate particles to high exhaust velocity. However, the necessary power conversion and conditioning equipment greatly increases the mass of the propulsion system. Fundamental considerations in waste heat rejection and power conditioning in a fission electric propulsion system place a limit on its jet specific power to the order of about 0.2 kW/kg. If fusion can be developed for propulsion, it appears to have the best of all worlds - it can provide the largest absolute amount of energy, the propellant exhaust velocity (> 100 km/s), and the high specific jet power (> 10 kW/kg). An intermediate step towards fusion propulsion might be a bimodal system in which a fission reactor is used to provide some of the energy to drive a fusion propulsion unit. There are similarities as well as differences between applying fusion to propulsion and to terrestrial electrical power generation. The similarities are the underlying plasma and fusion physics, the enabling component technologies, the computational and the diagnostics capabilities. These physics and

Minimally Invasive Transforaminal Lumbar Interbody Fusion: Meta-analysis of the Fusion Rates. What is the Optimal Graft Material?

PubMed

Parajón, Avelino; Alimi, Marjan; Navarro-Ramirez, Rodrigo; Christos, Paul; Torres-Campa, Jose M; Moriguchi, Yu; Lang, Gernot; Härtl, Roger

2017-12-01

Minimally invasive transforaminal lumbar interbody fusion (MIS-TLIF) is an increasingly popular procedure with several potential advantages over traditional open TLIF. The current study aimed to compare fusion rates of different graft materials used in MIS-TLIF, via meta-analysis of the published literature. A Medline search was performed and a database was created including patient's type of graft, clinical outcome, fusion rate, fusion assessment modality, and duration of follow-up. Meta-analysis of the fusion rate was performed using StatsDirect software (StatsDirect Ltd, Cheshire, United Kingdom). A total of 1533 patients from 40 series were included. Fusion rates were high, ranging from 91.8% to 99%. The imaging modalities used to assess fusion were computed tomography scans (30%) and X-rays (70%). Comparison of all recombinant human bone morphogenetic protein (rhBMP) series with all non-rhBMP series showed fusion rates of 96.6% and 92.5%, respectively. The lowest fusion rate was seen with isolated use of autologous local bone (91.8%). The highest fusion rate was observed with combination of autologous local bone with bone extender and rhBMP (99.1%). The highest fusion rate without the use of BMP was seen with autologous local bone + bone extender (93.1%). The reported complication rate ranged from 0% to 35.71%. Clinical improvement was observed in all studies. Fusion rates are generally high with MIS-TLIF regardless of the graft material used. Given the potential complications of iliac bone harvesting and rhBMP, use of other bone graft options for MIS-TLIF is reasonable. The highest fusion rate without the use of rhBMP was seen with autologous local bone plus bone extender (93.1%). Published by Oxford University Press on behalf of Congress of Neurological Surgeons 2017. This work is written by (a) US Government employee(s) and is in the public domain in the US.

The interaction between Pseudomonas aeruginosa cells and cationic PC:Chol:DOTAP liposomal vesicles versus outer-membrane structure and envelope properties of bacterial cell.

PubMed

Drulis-Kawa, Zuzanna; Dorotkiewicz-Jach, Agata; Gubernator, Jerzy; Gula, Grzegorz; Bocer, Tomasz; Doroszkiewicz, Wlodzimierz

2009-02-09

The interactions between cationic liposomal formulations (PC:Chol:DOTAP 3:4:3) and 23 Pseudomonas aeruginosa strains were tested. The study was undertaken because different antimicrobial results had been obtained by the authors for Pseudomonas aeruginosa strains and liposomal antibiotics (Drulis-Kawa, Z., Gubernator, J., Dorotkiewicz-Jach, A., Doroszkiewicz, W., Kozubek, A., 2006. The comparison of in vitro antimicrobial activity of liposomes containing meropenem and gentamicin. Cell. Mol. Biol. Lett., 11, 360-375; Drulis-Kawa, Z., Gubernator, J., Dorotkiewicz-Jach, A., Doroszkiewicz W., Kozubek, A., 2006. In vitro antimicrobial activity of liposomal meropenem against Pseudomonas aeruginosa strains. Int. J. Pharm., 315, 59-66). The experiments evaluate the roles of the bacterial outer-membrane structure, especially outer-membrane proteins and LPS, and envelope properties (hydrophobicity and electrostatic potential) in the interactions/fusion process between cells and lipid vesicles. The interactions were examined by fluorescent microscopy using PE-rhodamine-labelled liposomes. Some of the strains exhibited red-light emission (fusion with vesicles or vesicles surrounding the cell) and some showed negative reaction (no red-light emission). The main aim of the study was to determine what kinds of bacterial structure or envelope properties have a major influence on the fusion process. Negatively charged cells and hydrophobic properties promote interaction with cationic lipid vesicles, but no specific correlation was noted for the tested strains. A similar situation concerned LPS structure, where parent strains and their mutants possessing identical ladder-like band patterns in SDS-PAGE analysis exhibited totally different results with fluorescent microscopy. Outer-membrane protein analysis showed that an 18-kDA protein occurred in the isolates showing fusion with rhodamine-labelled vesicles and, conversely, strains lacking the 18-kDA protein exhibited no positive

Different polyamine pathways from bacteria have replaced eukaryotic spermidine biosynthesis in ciliates Tetrahymena thermophila and Paramecium tetaurelia.

PubMed

Li, Bin; Kim, Sok Ho; Zhang, Yang; Hanfrey, Colin C; Elliott, Katherine A; Ealick, Steven E; Michael, Anthony J

2015-09-01

The polyamine spermidine is absolutely required for growth and cell proliferation in eukaryotes, due to its role in post-translational modification of essential translation elongation factor eIF5A, mediated by deoxyhypusine synthase. We have found that free-living ciliates Tetrahymena and Paramecium lost the eukaryotic genes encoding spermidine biosynthesis: S-adenosylmethionine decarboxylase (AdoMetDC) and spermidine synthase (SpdSyn). In Tetrahymena, they were replaced by a gene encoding a fusion protein of bacterial AdoMetDC and SpdSyn, present as three copies. In Paramecium, a bacterial homospermidine synthase replaced the eukaryotic genes. Individual AdoMetDC-SpdSyn fusion protein paralogues from Tetrahymena exhibit undetectable AdoMetDC activity; however, when two paralogous fusion proteins are mixed, AdoMetDC activity is restored and spermidine is synthesized. Structural modelling indicates a functional active site is reconstituted by sharing critical residues from two defective protomers across the heteromer interface. Paramecium was found to accumulate homospermidine, suggesting it replaces spermidine for growth. To test this concept, a budding yeast spermidine auxotrophic strain was found to grow almost normally with homospermidine instead of spermidine. Biosynthesis of spermidine analogue aminopropylcadaverine, but not exogenously provided norspermidine, correlated with some growth. Finally, we found that diverse single-celled eukaryotic parasites and multicellular metazoan Schistosoma worms have lost the spermidine biosynthetic pathway but retain deoxyhypusine synthase. © 2015 John Wiley & Sons Ltd.

PI(4,5)P2 regulates myoblast fusion through Arp2/3 regulator localization at the fusion site

PubMed Central

Bothe, Ingo; Deng, Su; Baylies, Mary

2014-01-01

Cell-cell fusion is a regulated process that requires merging of the opposing membranes and underlying cytoskeletons. However, the integration between membrane and cytoskeleton signaling during fusion is not known. Using Drosophila, we demonstrate that the membrane phosphoinositide PI(4,5)P2 is a crucial regulator of F-actin dynamics during myoblast fusion. PI(4,5)P2 is locally enriched and colocalizes spatially and temporally with the F-actin focus that defines the fusion site. PI(4,5)P2 enrichment depends on receptor engagement but is upstream or parallel to actin remodeling. Regulators of actin branching via Arp2/3 colocalize with PI(4,5)P2 in vivo and bind PI(4,5)P2 in vitro. Manipulation of PI(4,5)P2 availability leads to impaired fusion, with a reduction in the F-actin focus size and altered focus morphology. Mechanistically, the changes in the actin focus are due to a failure in the enrichment of actin regulators at the fusion site. Moreover, improper localization of these regulators hinders expansion of the fusion interface. Thus, PI(4,5)P2 enrichment at the fusion site encodes spatial and temporal information that regulates fusion progression through the localization of activators of actin polymerization. PMID:24821989

Probing the stabilizing effects of modified nucleotides in the bacterial decoding region of 16S ribosomal RNA

PubMed Central

Mahto, Santosh K.

2013-01-01

The bacterial decoding region of 16S ribosomal RNA has multiple modified nucleotides. In order to study the role of N4,2′-O-dimethylcytidine (m4Cm), the corresponding phosphoramidite was synthesized utilizing 5′-silyl-2′-ACE chemistry. Using solid-phase synthesis, m4Cm, 5-methylcytidine (m5C), 3-methyluridine (m3U), and 2′-O-methylcytidine (Cm) were site-specifically incorporated into small RNAs representing the decoding regions of different bacterial species. Biophysical studies were then used to provide insight into the stabilizing roles of the modified nucleotides. These studies reveal that methylation of cytidine and uridine has different effects. The same modifications at different positions or sequence contexts within similar RNA constructs also have contrasting roles, such as stabilizing or destabilizing the RNA helix. PMID:23566761

Magnetized Target Fusion At General Fusion: An Overview

NASA Astrophysics Data System (ADS)

Laberge, Michel; O'Shea, Peter; Donaldson, Mike; Delage, Michael; Fusion Team, General

2017-10-01

Magnetized Target Fusion (MTF) involves compressing an initial magnetically confined plasma on a timescale faster than the thermal confinement time of the plasma. If near adiabatic compression is achieved, volumetric compression of 350X or more of a 500 eV target plasma would achieve a final plasma temperature exceeding 10 keV. Interesting fusion gains could be achieved provided the compressed plasma has sufficient density and dwell time. General Fusion (GF) is developing a compression system using pneumatic pistons to collapse a cavity formed in liquid metal containing a magnetized plasma target. Low cost driver, straightforward heat extraction, good tritium breeding ratio and excellent neutron protection could lead to a practical power plant. GF (65 employees) has an active plasma R&D program including both full scale and reduced scale plasma experiments and simulation of both. Although pneumatic driven compression of full scale plasmas is the end goal, present compression studies use reduced scale plasmas and chemically accelerated aluminum liners. We will review results from our plasma target development, motivate and review the results of dynamic compression field tests and briefly describe the work to date on the pneumatic driver front.

Fusion technologies for Laser Inertial Fusion Energy (LIFE)

NASA Astrophysics Data System (ADS)

Kramer, K. J.; Latkowski, J. F.; Abbott, R. P.; Anklam, T. P.; Dunne, A. M.; El-Dasher, B. S.; Flowers, D. L.; Fluss, M. J.; Lafuente, A.; Loosmore, G. A.; Morris, K. R.; Moses, E.; Reyes, S.

2013-11-01

The Laser Inertial Fusion-based Energy (LIFE) engine design builds upon on going progress at the National Ignition Facility (NIF) and offers a near-term pathway to commercial fusion. Fusion technologies that are critical to success are reflected in the design of the first wall, blanket and tritium separation subsystems. The present work describes the LIFE engine-related components and technologies. LIFE utilizes a thermally robust indirect-drive target and a chamber fill gas. Coolant selection and a large chamber solid-angle coverage provide ample tritium breeding margin and high blanket gain. Target material selection eliminates the need for aggressive chamber clearing, while enabling recycling. Demonstrated tritium separation and storage technologies limit the site tritium inventory to attractive levels. These key technologies, along with the maintenance and advanced materials qualification program have been integrated into the LIFE delivery plan. This describes the development of components and subsystems, through prototyping and integration into a First Of A Kind power plant. This work performed under the auspices of the U.S. Department of Energy by Lawrence Livermore National Laboratory under Contract DE-AC52-07NA27344.

Z-Pinch Fusion for Energy Applications

DOE Office of Scientific and Technical Information (OSTI.GOV)

SPIELMAN,RICK B.

2000-01-01

Z pinches, the oldest fusion concept, have recently been revisited in light of significant advances in the fields of plasma physics and pulsed power engineering. The possibility exists for z-pinch fusion to play a role in commercial energy applications. We report on work to develop z-pinch fusion concepts, the result of an extensive literature search, and the output for a congressionally-mandated workshop on fusion energy held in Snowmass, Co July 11-23,1999.

Moult-inhibiting fusion protein augments while polyclonal antisera attenuate moult stages and duration in Penaeus monodon.

PubMed

Vrinda, S; Jasmin, C; Sivakumar, K C; Jose, Blessy; Philip, Rosamma; Bright Singh, I S

2016-07-01

Moulting in crustaceans is regulated by moult-inhibiting hormone (MIH) of the CHH family neuropeptides. The inhibitory functions of MIH have pivotal roles in growth and reproduction of Penaeus monodon. In this study, we report the expression of a thioredoxin-fused mature MIH I protein (mf-PmMIH I) of P. monodon in a bacterial system and its use as antigen to raise polyclonal antiserum (anti-mf-PmMIH I). The mature MIH I gene of 231bp, that codes for 77 amino acids, was cloned into the Escherichia coli thioredoxin gene fusion expression system. The translation expression vector construct (mf-PmMIH I+pET32a+) upon induction produced 29.85kDa mature MIH I fusion protein (mf-PmMIH I). The purified fusion protein was used as exogenous MIH I and as antigen to raise polyclonal antisera. When fusion protein (mf-PmMIH I) was injected into D2 and D3 stages of juvenile shrimp, the moult cycle duration was extended significantly to 16.67±1.03 and 14.67±1.03days respectively compared to that of 11.67±1.03days in controls. Moult duration was further reduced to 8.33±0.82days when polyclonal antiserum (anti-mf-PmMIH I - 1:500 dilutions) was injected. Anti-mf-PmMIH I immunolocalized MIH I producing neurosecretory cells in the eyestalk of P. monodon. In short, the present manuscript reports an innovative means of moult regulation in P. monodon with thioredoxin fused MIH I and antisera developed. Copyright © 2016 Elsevier Inc. All rights reserved.

The cost-effectiveness of interbody fusions versus posterolateral fusions in 137 patients with lumbar spondylolisthesis.

PubMed

Bydon, Mohamad; Macki, Mohamed; Abt, Nicholas B; Witham, Timothy F; Wolinsky, Jean-Paul; Gokaslan, Ziya L; Bydon, Ali; Sciubba, Daniel M

2015-03-01

Reimbursements for interbody fusions have declined recently because of their questionable cost-effectiveness. A Markov model was adopted to compare the cost-effectiveness of posterior lumbar interbody fusion (PLIF) or transforaminal lumbar interbody fusion (/TLIF) versus noninterbody fusion and posterolateral fusion (PLF) in patients with lumbar spondylolisthesis. Decision model analysis based on retrospective data from a single institutional series. One hundred thirty-seven patients underwent first-time instrumented lumbar fusions for degenerative or isthmic spondylolisthesis. Quality of life adjustments and expenditures were assigned to each short-term complication (durotomy, surgical site infection, and medical complication) and long-term outcome (bowel/bladder dysfunction and paraplegia, neurologic deficit, and chronic back pain). Patients were divided into a PLF cohort and a PLF plus PLIF/TLIF cohort. Anterior techniques and multilevel interbody fusions were excluded. Each short-term complication and long-term outcome was assigned a numerical quality-adjusted life-year (QALY), based on time trade-off values in the Beaver Dam Health Outcomes Study. The cost data for short-term complications were calculated from charges accrued by the institution's finance sector, and the cost data for long-term outcomes were estimated from the literature. The difference in cost of PLF plus PLIF/TLIF from the cost of PLF alone divided by the difference in QALY equals the cost-effectiveness ratio (CER). We do not report any study funding sources or any study-specific appraisal of potential conflict of interest-associated biases in this article. Of 137 first-time lumbar fusions for spondylolisthesis, 83 patients underwent PLF and 54 underwent PLIF/TLIF. The average time to reoperation was 3.5 years. The mean QALY over 3.5 years was 2.81 in the PLF cohort versus 2.66 in the PLIFo/TLIF cohort (p=.110). The mean 3.5-year costs of $54,827.05 after index interbody fusion were

Lunar Helium-3 and Fusion Power

NASA Technical Reports Server (NTRS)

1988-01-01

The NASA Office of Exploration sponsored the NASA Lunar Helium-3 and Fusion Power Workshop. The meeting was held to understand the potential of using He-3 from the moon for terrestrial fusion power production. It provided an overview, two parallel working sessions, a review of sessions, and discussions. The lunar mining session concluded that mining, beneficiation, separation, and return of He-3 from the moon would be possible but that a large scale operation and improved technology is required. The fusion power session concluded that: (1) that He-3 offers significant, possibly compelling, advantages over fusion of tritium, principally increased reactor life, reduced radioactive wastes, and high efficiency conversion, (2) that detailed assessment of the potential of the D/He-3 fuel cycle requires more information, and (3) D/He-3 fusion may be best for commercial purposes, although D/T fusion is more near term.

Multispectral image fusion for target detection

NASA Astrophysics Data System (ADS)

Leviner, Marom; Maltz, Masha

2009-09-01

Various different methods to perform multi-spectral image fusion have been suggested, mostly on the pixel level. However, the jury is still out on the benefits of a fused image compared to its source images. We present here a new multi-spectral image fusion method, multi-spectral segmentation fusion (MSSF), which uses a feature level processing paradigm. To test our method, we compared human observer performance in an experiment using MSSF against two established methods: Averaging and Principle Components Analysis (PCA), and against its two source bands, visible and infrared. The task that we studied was: target detection in the cluttered environment. MSSF proved superior to the other fusion methods. Based on these findings, current speculation about the circumstances in which multi-spectral image fusion in general and specific fusion methods in particular would be superior to using the original image sources can be further addressed.

Two heretical thoughts on fusion and climate

NASA Astrophysics Data System (ADS)

Manheimer, Wallace

2016-10-01

This presents and explores 2 heretical thoughts regarding controlled fusion and climate. First, the only way that fusion can contribute to midcentury power is by switching its goal from pure fusion, to fusion breeding. Fusion breeding makes many fewer demands on the fusion device than does pure fusion. Fusion breeding could lead to a sustainable, carbon free, environmentally and economically viable, midcentury infrastructure, with little or no proliferation risk, which could provide terawatts of power for the world. The second involves climate. We are all inundated by media warnings, not only of warming from CO2 in the atmosphere, but all sorts of other environmental disasters. For instance there will be more intense storms, rising sea levels, wild fires, retreating glaciers, droughts, loss of agricultural productivity... These assertions are very easy to check out. Such a search shows that we are nowhere near any sort of environmental crisis. The timing could be serendipitous; the time necessary to develop fusion breeding could well match up to the time when it is needed so as to avoid harm to the earth's climate and/or depletion of finite energy resources.

Composites comprising biologically-synthesized nanomaterials

DOEpatents

Curran, Seamus; Dias, Sampath; Blau, Werner; Wang, Jun; Oremland, Ronald S; Baesman, Shaun

2013-04-30

The present disclosure describes composite materials containing a polymer material and a nanoscale material dispersed in the polymer material. The nanoscale materials may be biologically synthesized, such as tellurium nanorods synthesized by Bacillus selenitireducens. Composite materials of the present disclosure may have optical limiting properties and find use in optical limiting devices.

Spherical torus fusion reactor

DOEpatents

Martin Peng, Y.K.M.

1985-10-03

The object of this invention is to provide a compact torus fusion reactor with dramatic simplification of plasma confinement design. Another object of this invention is to provide a compact torus fusion reactor with low magnetic field and small aspect ratio stable plasma confinement. In accordance with the principles of this invention there is provided a compact toroidal-type plasma confinement fusion reactor in which only the indispensable components inboard of a tokamak type of plasma confinement region, mainly a current conducting medium which carries electrical current for producing a toroidal magnet confinement field about the toroidal plasma region, are retained.

Fusion Propulsion Z-Pinch Engine Concept

NASA Technical Reports Server (NTRS)

Miernik, J.; Statham, G.; Fabisinski, L.; Maples, C. D.; Adams, R.; Polsgrove, T.; Fincher, S.; Cassibry, J.; Cortez, R.; Turner, M.;

Novel kinase fusion transcripts found in endometrial cancer

PubMed Central

Tamura, Ryo; Yoshihara, Kosuke; Yamawaki, Kaoru; Suda, Kazuaki; Ishiguro, Tatsuya; Adachi, Sosuke; Okuda, Shujiro; Inoue, Ituro; Verhaak, Roel G. W.; Enomoto, Takayuki

2015-01-01

Recent advances in RNA-sequencing technology have enabled the discovery of gene fusion transcripts in the transcriptome of cancer cells. However, it remains difficult to differentiate the therapeutically targetable fusions from passenger events. We have analyzed RNA-sequencing data and DNA copy number data from 25 endometrial cancer cell lines to identify potential therapeutically targetable fusion transcripts, and have identified 124 high-confidence fusion transcripts, of which 69% are associated with gene amplifications. As targetable fusion candidates, we focused on three in-frame kinase fusion transcripts that retain a kinase domain (CPQ-PRKDC, CAPZA2-MET, and VGLL4-PRKG1). We detected only CPQ-PRKDC fusion transcript in three of 122 primary endometrial cancer tissues. Cell proliferation of the fusion-positive cell line was inhibited by knocking down the expression of wild-type PRKDC but not by blocking the CPQ-PRKDC fusion transcript expression. Quantitative real-time RT-PCR demonstrated that the expression of the CPQ-PRKDC fusion transcript was significantly lower than that of wild-type PRKDC, corresponding to a low transcript allele fraction of this fusion, based on RNA-sequencing read counts. In endometrial cancers, the CPQ-PRKDC fusion transcript may be a passenger aberration related to gene amplification. Our findings suggest that transcript allele fraction is a useful predictor to find bona-fide therapeutic-targetable fusion transcripts. PMID:26689674

Novel kinase fusion transcripts found in endometrial cancer.

PubMed

Tamura, Ryo; Yoshihara, Kosuke; Yamawaki, Kaoru; Suda, Kazuaki; Ishiguro, Tatsuya; Adachi, Sosuke; Okuda, Shujiro; Inoue, Ituro; Verhaak, Roel G W; Enomoto, Takayuki

2015-12-22

Recent advances in RNA-sequencing technology have enabled the discovery of gene fusion transcripts in the transcriptome of cancer cells. However, it remains difficult to differentiate the therapeutically targetable fusions from passenger events. We have analyzed RNA-sequencing data and DNA copy number data from 25 endometrial cancer cell lines to identify potential therapeutically targetable fusion transcripts, and have identified 124 high-confidence fusion transcripts, of which 69% are associated with gene amplifications. As targetable fusion candidates, we focused on three in-frame kinase fusion transcripts that retain a kinase domain (CPQ-PRKDC, CAPZA2-MET, and VGLL4-PRKG1). We detected only CPQ-PRKDC fusion transcript in three of 122 primary endometrial cancer tissues. Cell proliferation of the fusion-positive cell line was inhibited by knocking down the expression of wild-type PRKDC but not by blocking the CPQ-PRKDC fusion transcript expression. Quantitative real-time RT-PCR demonstrated that the expression of the CPQ-PRKDC fusion transcript was significantly lower than that of wild-type PRKDC, corresponding to a low transcript allele fraction of this fusion, based on RNA-sequencing read counts. In endometrial cancers, the CPQ-PRKDC fusion transcript may be a passenger aberration related to gene amplification. Our findings suggest that transcript allele fraction is a useful predictor to find bona-fide therapeutic-targetable fusion transcripts.

A local approach for focussed Bayesian fusion

NASA Astrophysics Data System (ADS)

Sander, Jennifer; Heizmann, Michael; Goussev, Igor; Beyerer, Jürgen

2009-04-01

Local Bayesian fusion approaches aim to reduce high storage and computational costs of Bayesian fusion which is separated from fixed modeling assumptions. Using the small world formalism, we argue why this proceeding is conform with Bayesian theory. Then, we concentrate on the realization of local Bayesian fusion by focussing the fusion process solely on local regions that are task relevant with a high probability. The resulting local models correspond then to restricted versions of the original one. In a previous publication, we used bounds for the probability of misleading evidence to show the validity of the pre-evaluation of task specific knowledge and prior information which we perform to build local models. In this paper, we prove the validity of this proceeding using information theoretic arguments. For additional efficiency, local Bayesian fusion can be realized in a distributed manner. Here, several local Bayesian fusion tasks are evaluated and unified after the actual fusion process. For the practical realization of distributed local Bayesian fusion, software agents are predestinated. There is a natural analogy between the resulting agent based architecture and criminal investigations in real life. We show how this analogy can be used to improve the efficiency of distributed local Bayesian fusion additionally. Using a landscape model, we present an experimental study of distributed local Bayesian fusion in the field of reconnaissance, which highlights its high potential.

Fusomorphogenesis: cell fusion in organ formation.

PubMed

Shemer, G; Podbilewicz, B

2000-05-01

Cell fusion is a universal process that occurs during fertilization and in the formation of organs such as muscles, placenta, and bones. Very little is known about the molecular and cellular mechanisms of cell fusion during pattern formation. Here we review the dynamic anatomy of all cell fusions during embryonic and postembryonic development in an organism. Nearly all the cell fates and cell lineages are invariant in the nematode C. elegans and one third of the cells that are born fuse to form 44 syncytia in a reproducible and stereotyped way. To explain the function of cell fusion in organ formation we propose the fusomorphogenetic model as a simple cellular mechanism to efficiently redistribute membranes using a combination of cell fusion and polarized membrane recycling during morphogenesis. Thus, regulated intercellular and intracellular membrane fusion processes may drive elongation of the embryo as well as postembryonic organ formation in C. elegans. Finally, we use the fusomorphogenetic hypothesis to explain the role of cell fusion in the formation of organs like muscles, bones, and placenta in mammals and other species and to speculate on how the intracellular machinery that drive fusomorphogenesis may have evolved.

URREF Reliability Versus Credibility in Information Fusion

DTIC Science & Technology

2013-07-01

Fusion, Vol. 3, No. 2, December, 2008. [31] E. Blasch, J. Dezert, and P. Valin , “DSMT Applied to Seismic and Acoustic Sensor Fusion,” Proc. IEEE Nat...44] E. Blasch, P. Valin , E. Bossé, “Measures of Effectiveness for High- Level Fusion,” Int. Conference on Information Fusion, 2010. [45] X. Mei, H...and P. Valin , “Information Fusion Measures of Effectiveness (MOE) for Decision Support,” Proc. SPIE 8050, 2011. [49] Y. Zheng, W. Dong, and E

Accelerators for Fusion Materials Testing

NASA Astrophysics Data System (ADS)

Knaster, Juan; Okumura, Yoshikazu

Fusion materials research is a worldwide endeavor as old as the parallel one working toward the long term stable confinement of ignited plasma. In a fusion reactor, the preservation of the required minimum thermomechanical properties of the in-vessel components exposed to the severe irradiation and heat flux conditions is an indispensable factor for safe operation; it is also an essential goal for the economic viability of fusion. Energy from fusion power will be extracted from the 14 MeV neutron freed as a product of the deuterium-tritium fusion reactions; thus, this kinetic energy must be absorbed and efficiently evacuated and electricity eventually generated by the conventional methods of a thermal power plant. Worldwide technological efforts to understand the degradation of materials exposed to 14 MeV neutron fluxes >1018 m-2s-1, as expected in future fusion power plants, have been intense over the last four decades. Existing neutron sources can reach suitable dpa (“displacement-per-atom”, the figure of merit to assess materials degradation from being exposed to neutron irradiation), but the differences in the neutron spectrum of fission reactors and spallation sources do not allow one to unravel the physics and to anticipate the degradation of materials exposed to fusion neutrons. Fusion irradiation conditions can be achieved through Li (d, xn) nuclear reactions with suitable deuteron beam current and energy, and an adequate flowing lithium screen. This idea triggered in the late 1970s at Los Alamos National Laboratory (LANL) a campaign working toward the feasibility of continuous wave (CW) high current linacs framed by the Fusion Materials Irradiation Test (FMIT) project. These efforts continued with the Low Energy Demonstrating Accelerator (LEDA) (a validating prototype of the canceled Accelerator Production of Tritium (APT) project), which was proposed in 2002 to the fusion community as a 6.7MeV, 100mA CW beam injector for a Li (d, xn) source to bridge

Accelerators for Fusion Materials Testing

NASA Astrophysics Data System (ADS)

Knaster, Juan; Okumura, Yoshikazu

Fusion materials research is a worldwide endeavor as old as the parallel one working toward the long term stable confinement of ignited plasma. In a fusion reactor, the preservation of the required minimum thermomechanical properties of the in-vessel components exposed to the severe irradiation and heat flux conditions is an indispensable factor for safe operation; it is also an essential goal for the economic viability of fusion. Energy from fusion power will be extracted from the 14 MeV neutron freed as a product of the deuterium-tritium fusion reactions; thus, this kinetic energy must be absorbed and efficiently evacuated and electricity eventually generated by the conventional methods of a thermal power plant. Worldwide technological efforts to understand the degradation of materials exposed to 14 MeV neutron fluxes > 1018 m-2s-1, as expected in future fusion power plants, have been intense over the last four decades. Existing neutron sources can reach suitable dpa ("displacement-per-atom", the figure of merit to assess materials degradation from being exposed to neutron irradiation), but the differences in the neutron spectrum of fission reactors and spallation sources do not allow one to unravel the physics and to anticipate the degradation of materials exposed to fusion neutrons. Fusion irradiation conditions can be achieved through Li (d, xn) nuclear reactions with suitable deuteron beam current and energy, and an adequate flowing lithium screen. This idea triggered in the late 1970s at Los Alamos National Laboratory (LANL) a campaign working toward the feasibility of continuous wave (CW) high current linacs framed by the Fusion Materials Irradiation Test (FMIT) project. These efforts continued with the Low Energy Demonstrating Accelerator (LEDA) (a validating prototype of the canceled Accelerator Production of Tritium (APT) project), which was proposed in 2002 to the fusion community as a 6.7MeV, 100mA CW beam injector for a Li (d, xn) source to bridge

Dynamic Information Collection and Fusion

DTIC Science & Technology

2015-12-02

AFRL-AFOSR-VA-TR-2016-0069 DYNAMIC INFORMATION COLLECTION AND FUSION Venugopal Veeravalli UNIVERSITY OF ILLINOIS CHAMPAIGN Final Report 12/02/2015...TITLE AND SUBTITLE Dynamic Information Collection and Fusion 5a. CONTRACT NUMBER FA9550-10-1-0458 5b. GRANT NUMBER AF FA9550-10-1-0458 5c. PROGRAM...information collection, fusion , and inference from diverse modalities Our research has been organized under three inter-related thrusts. The first thrust

Sensor fusion for synthetic vision

NASA Technical Reports Server (NTRS)

Pavel, M.; Larimer, J.; Ahumada, A.

1991-01-01

Display methodologies are explored for fusing images gathered by millimeter wave sensors with images rendered from an on-board terrain data base to facilitate visually guided flight and ground operations in low visibility conditions. An approach to fusion based on multiresolution image representation and processing is described which facilitates fusion of images differing in resolution within and between images. To investigate possible fusion methods, a workstation-based simulation environment is being developed.

Psychoacoustic Analysis of Synthesized Jet Noise

NASA Technical Reports Server (NTRS)

Okcu, Selen; Rathsam, Jonathan; Rizzi, Stephen A.

2013-01-01

An aircraft noise synthesis capability is being developed so the annoyance caused by proposed aircraft can be assessed during the design stage. To make synthesized signals as realistic as possible, high fidelity simulation is required for source (e.g., engine noise, airframe noise), propagation and receiver effects. This psychoacoustic study tests whether the jet noise component of synthesized aircraft engine noise can be made more realistic using a low frequency oscillator (LFO) technique to simulate fluctuations in level observed in recordings. Jet noise predictions are commonly made in the frequency domain based on models of time-averaged empirical data. The synthesis process involves conversion of the frequency domain prediction into an audible pressure time history. However, because the predictions are time-invariant, the synthesized sound lacks fluctuations observed in recordings. Such fluctuations are hypothesized to be perceptually important. To introduce time-varying characteristics into jet noise synthesis, a method has been developed that modulates measured or predicted 1/3-octave band levels with a (<20Hz) LFO. The LFO characteristics are determined through analysis of laboratory jet noise recordings. For the aft emission angle, results indicate that signals synthesized using a generic LFO are perceived as more similar to recordings than those using no LFO, and signals synthesized with an angle-specific LFO are more similar to recordings than those synthesized with a generic LFO.

Osteoclasts and giant cells: macrophage–macrophage fusion mechanism

PubMed Central

Vignery, Agnès

2000-01-01

Membrane fusion is a ubiquitous event that occurs in a wide range of biological processes. While intracellular membrane fusion mediating organelle trafficking is well understood, much less is known about cell–cell fusion mediating sperm cell–oocyte, myoblast–myoblast and macrophage–macrophage fusion. In the case of mononuclear phagocytes, their fusion is not only associated with the differentiation of osteoclasts, cells which play a key role in the pathogenesis of osteoporosis, but also of giant cells that are present in chronic inflammatory reactions and in tumours. Despite the biological and pathophysiological importance of intercellular fusion events, the actual molecular mechanism of macrophage fusion is still unclear. One of the main research themes in my laboratory has been to investigate the molecular mechanism of mononuclear phagocyte fusion. Our hypothesis has been that macrophage–macrophage fusion, similar to virus–cell fusion, is mediated by specific cell surface proteins. But, in contrast with myoblasts and sperm cells, macrophage fusion is a rare event that occurs in specific instances. To test our hypothesis, we established an in vitro cell–cell fusion assay as a model system which uses alveolar macrophages. Upon multinucleation, these macrophages acquire the osteoclast phenotype. This indicates that multinucleation of macrophages leads to a specific and novel functional phenotype in macrophages. To identify the components of the fusion machinery, we generated four monoclonal antibodies (mAbs) which block the fusion of alveolar macrophages and purified the unique antigen recognized by these mAbs. This led us to the cloning of MFR (Macrophage Fusion Receptor). MFR was cloned simultaneously as P84/SHPS-1/SIRPα/BIT by other laboratories. We subsequently showed that the recombinant extracellular domain of MFR blocks fusion. Most recently, we identified a lower molecular weight form of MFR that is missing two extracellular immunoglobulin (Ig

Membrane Topology Mapping of the Na+-Pumping NADH: Quinone Oxidoreductase from Vibrio cholerae by PhoA- Green Fluorescent Protein Fusion Analysis▿

PubMed Central

Duffy, Ellen B.; Barquera, Blanca

2006-01-01

The membrane topologies of the six subunits of Na+-translocating NADH:quinone oxidoreductase (Na+-NQR) from Vibrio cholerae were determined by a combination of topology prediction algorithms and the construction of C-terminal fusions. Fusion expression vectors contained either bacterial alkaline phosphatase (phoA) or green fluorescent protein (gfp) genes as reporters of periplasmic and cytoplasmic localization, respectively. A majority of the topology prediction algorithms did not predict any transmembrane helices for NqrA. A lack of PhoA activity when fused to the C terminus of NqrA and the observed fluorescence of the green fluorescent protein C-terminal fusion confirm that this subunit is localized to the cytoplasmic side of the membrane. Analysis of four PhoA fusions for NqrB indicates that this subunit has nine transmembrane helices and that residue T236, the binding site for flavin mononucleotide (FMN), resides in the cytoplasm. Three fusions confirm that the topology of NqrC consists of two transmembrane helices with the FMN binding site at residue T225 on the cytoplasmic side. Fusion analysis of NqrD and NqrE showed almost mirror image topologies, each consisting of six transmembrane helices; the results for NqrD and NqrE are consistent with the topologies of Escherichia coli homologs YdgQ and YdgL, respectively. The NADH, flavin adenine dinucleotide, and Fe-S center binding sites of NqrF were localized to the cytoplasm. The determination of the topologies of the subunits of Na+-NQR provides valuable insights into the location of cofactors and identifies targets for mutagenesis to characterize this enzyme in more detail. The finding that all the redox cofactors are localized to the cytoplasmic side of the membrane is discussed. PMID:17041063

Physical control oriented model of large scale refrigerators to synthesize advanced control schemes. Design, validation, and first control results

NASA Astrophysics Data System (ADS)

Bonne, François; Alamir, Mazen; Bonnay, Patrick

2014-01-01

In this paper, a physical method to obtain control-oriented dynamical models of large scale cryogenic refrigerators is proposed, in order to synthesize model-based advanced control schemes. These schemes aim to replace classical user experience designed approaches usually based on many independent PI controllers. This is particularly useful in the case where cryoplants are submitted to large pulsed thermal loads, expected to take place in the cryogenic cooling systems of future fusion reactors such as the International Thermonuclear Experimental Reactor (ITER) or the Japan Torus-60 Super Advanced Fusion Experiment (JT-60SA). Advanced control schemes lead to a better perturbation immunity and rejection, to offer a safer utilization of cryoplants. The paper gives details on how basic components used in the field of large scale helium refrigeration (especially those present on the 400W @1.8K helium test facility at CEA-Grenoble) are modeled and assembled to obtain the complete dynamic description of controllable subsystems of the refrigerator (controllable subsystems are namely the Joule-Thompson Cycle, the Brayton Cycle, the Liquid Nitrogen Precooling Unit and the Warm Compression Station). The complete 400W @1.8K (in the 400W @4.4K configuration) helium test facility model is then validated against experimental data and the optimal control of both the Joule-Thompson valve and the turbine valve is proposed, to stabilize the plant under highly variable thermals loads. This work is partially supported through the European Fusion Development Agreement (EFDA) Goal Oriented Training Program, task agreement WP10-GOT-GIRO.

Physical control oriented model of large scale refrigerators to synthesize advanced control schemes. Design, validation, and first control results

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bonne, François; Bonnay, Patrick; Alamir, Mazen

2014-01-29

In this paper, a physical method to obtain control-oriented dynamical models of large scale cryogenic refrigerators is proposed, in order to synthesize model-based advanced control schemes. These schemes aim to replace classical user experience designed approaches usually based on many independent PI controllers. This is particularly useful in the case where cryoplants are submitted to large pulsed thermal loads, expected to take place in the cryogenic cooling systems of future fusion reactors such as the International Thermonuclear Experimental Reactor (ITER) or the Japan Torus-60 Super Advanced Fusion Experiment (JT-60SA). Advanced control schemes lead to a better perturbation immunity and rejection,more » to offer a safer utilization of cryoplants. The paper gives details on how basic components used in the field of large scale helium refrigeration (especially those present on the 400W @1.8K helium test facility at CEA-Grenoble) are modeled and assembled to obtain the complete dynamic description of controllable subsystems of the refrigerator (controllable subsystems are namely the Joule-Thompson Cycle, the Brayton Cycle, the Liquid Nitrogen Precooling Unit and the Warm Compression Station). The complete 400W @1.8K (in the 400W @4.4K configuration) helium test facility model is then validated against experimental data and the optimal control of both the Joule-Thompson valve and the turbine valve is proposed, to stabilize the plant under highly variable thermals loads. This work is partially supported through the European Fusion Development Agreement (EFDA) Goal Oriented Training Program, task agreement WP10-GOT-GIRO.« less

Magnetized Target Fusion in Advanced Propulsion Research

NASA Technical Reports Server (NTRS)

Cylar, Rashad

2003-01-01

The Magnetized Target Fusion (MTF) Propulsion lab at NASA Marshall Space Flight Center in Huntsville, Alabama has a program in place that has adopted to attempt to create a faster, lower cost and more reliable deep space transportation system. In this deep space travel the physics and development of high velocity plasma jets must be understood. The MTF Propulsion lab is also in attempt to open up the solar system for human exploration and commercial use. Fusion, as compared to fission, is just the opposite. Fusion involves the light atomic nuclei combination to produce denser nuclei. In the process, the energy is created by destroying the mass according to the distinguished equation: E = mc2 . Fusion energy development is being pursued worldwide as a very sustainable form of energy that is environmentally friendly. For the purposes of space exploration fusion reactions considered include the isotopes of hydrogen-deuterium (D2) and tritium (T3). Nuclei have an electrostatic repulsion between them and in order for the nuclei to fuse this repulsion must be overcome. One technique to bypass repulsion is to heat the nuclei to very high temperatures. The temperatures vary according to the type of reactions. For D-D reactions, one billion degrees Celsius is required, and for D-T reactions, one hundred million degrees is sufficient. There has to be energy input for useful output to be obtained form the fusion To make fusion propulsion practical, the mass, the volume, and the cost of the equipment to produce the reactions (generally called the reactor) need to be reduced by an order of magnitude or two from the state-of-the-art fusion machines. Innovations in fusion schemes are therefore required, especially for obtaining thrust for propulsive applications. Magnetized target fusion (MTF) is one of the innovative fusion concepts that have emerged over the last several years. MSFC is working with Los Alamos National Laboratory and other research groups in studying the

Insertion of inter-domain linkers improves expression and bioactivity of Zygote arrest (Zar) fusion proteins.

PubMed

Cook, Jonathan M; Charlesworth, Amanda

2017-04-01

Developmentally important proteins that are crucial for fertilization and embryogenesis are synthesized through highly regulated translation of maternal mRNA. The Zygote arrest proteins, Zar1 and Zar2, are crucial for embryogenesis and have been implicated in binding mRNA and repressing mRNA translation. To investigate Zar1 and Zar2, the full-length proteins had been fused to glutathione-S-transferase (GST) or MS2 protein tags with minimal inter-domain linkers derived from multiple cloning sites; however, these fusion proteins expressed poorly and/or lacked robust function. Here, we tested the effect of inserting additional linkers between the fusion domains. Three linkers were tested, each 17 amino acids long with different physical and chemical properties: flexible hydrophilic, rigid extended or rigid helical. In the presence of any of the three linkers, GST-Zar1 and GST-Zar2 had fewer breakdown products. Moreover, in the presence of any of the linkers, MS2-Zar1 was expressed to higher levels, and in dual luciferase tethered assays, both MS2-Zar1 and MS2-Zar2 repressed luciferase translation to a greater extent. These data suggest that for Zar fusion proteins, increasing the length of linkers, regardless of their physical or chemical properties, improves stability, expression and bioactivity. © The Author 2017. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Paramyxovirus Glycoproteins and the Membrane Fusion Process.

PubMed

Aguilar, Hector C; Henderson, Bryce A; Zamora, J Lizbeth; Johnston, Gunner P

2016-09-01

The family Paramyxoviridae includes many viruses that significantly affect human and animal health. An essential step in the paramyxovirus life cycle is viral entry into host cells, mediated by virus-cell membrane fusion. Upon viral entry, infection results in expression of the paramyxoviral glycoproteins on the infected cell surface. This can lead to cell-cell fusion (syncytia formation), often linked to pathogenesis. Thus membrane fusion is essential for both viral entry and cell-cell fusion and an attractive target for therapeutic development. While there are important differences between viral-cell and cell-cell membrane fusion, many aspects are conserved. The paramyxoviruses generally utilize two envelope glycoproteins to orchestrate membrane fusion. Here, we discuss the roles of these glycoproteins in distinct steps of the membrane fusion process. These findings can offer insights into evolutionary relationships among Paramyxoviridae genera and offer future targets for prophylactic and therapeutic development.

Paramyxovirus Glycoproteins and the Membrane Fusion Process

PubMed Central

Aguilar, Hector C.; Henderson, Bryce A.; Zamora, J. Lizbeth; Johnston, Gunner P.

2016-01-01

The family Paramyxoviridae includes many viruses that significantly affect human and animal health. An essential step in the paramyxovirus life cycle is viral entry into host cells, mediated by virus-cell membrane fusion. Upon viral entry, infection results in expression of the paramyxoviral glycoproteins on the infected cell surface. This can lead to cell-cell fusion (syncytia formation), often linked to pathogenesis. Thus membrane fusion is essential for both viral entry and cell-cell fusion and an attractive target for therapeutic development. While there are important differences between viral-cell and cell-cell membrane fusion, many aspects are conserved. The paramyxoviruses generally utilize two envelope glycoproteins to orchestrate membrane fusion. Here, we discuss the roles of these glycoproteins in distinct steps of the membrane fusion process. These findings can offer insights into evolutionary relationships among Paramyxoviridae genera and offer future targets for prophylactic and therapeutic development. PMID:28138419

The Trajectory Synthesizer Generalized Profile Interface

NASA Technical Reports Server (NTRS)

Lee, Alan G.; Bouyssounouse, Xavier; Murphy, James R.

2010-01-01

The Trajectory Synthesizer is a software program that generates aircraft predictions for Air Traffic Management decision support tools. The Trajectory Synthesizer being used by researchers at NASA Ames Research Center was restricted in the number of trajectory types that could be generated. This limitation was not sufficient to support the rapidly changing Air Traffic Management research requirements. The Generalized Profile Interface was developed to address this issue. It provides a flexible approach to describe the constraints applied to trajectory generation and may provide a method for interoperability between trajectory generators. It also supports the request and generation of new types of trajectory profiles not possible with the previous interface to the Trajectory Synthesizer. Other enhancements allow the Trajectory Synthesizer to meet the current and future needs of Air Traffic Management research.

Two Horizons of Fusion

ERIC Educational Resources Information Center

Lo, Mun Ling; Chik, Pakey Pui Man

2016-01-01

In this paper, we aim to differentiate the internal and external horizons of "fusion." "Fusion" in the internal horizon relates to the structure and meaning of the object of learning as experienced by the learner. It clarifies the interrelationships among an object's critical features and aspects. It also illuminates the…

Antibiofilm efficacy of green synthesized graphene oxide-silver nanocomposite using Lagerstroemia speciosa floral extract: A comparative study on inhibition of gram-positive and gram-negative biofilms.

PubMed

Kulshrestha, Shatavari; Qayyum, Shariq; Khan, Asad U

2017-02-01

Biofilm architecture provides bacteria with enhanced antibiotic resistance, thus raising the need to search for alternative therapies that can inhibit the bacterial colonization. In the present study, we synthesized graphene oxide-silver nanocomposite (GO-Ag) by non-toxic and eco-friendly route using a floral extract of Legistromia speciosa (L.) Pers. The gas chromatography-mass spectrometry (GC-MS) analysis of plant extract revealed the presence of compounds which can simultaneously act as reducing and capping agents. The sub-inhibitory concentrations of synthesized GO-Ag reduced the biofilm formation in both gram-negative (E. cloacae) and gram-positive (S. mutans) bacterial models. Growth curve assay, membrane integrity assay, scanning electron microscopy (SEM) and confocal scanning laser microscopy (CSLM) revealed different mechanisms of biofilm inhibition in E. cloacae and S. mutans. Moreover, quantitative RT-PCR (qRT-PCR) results suggested GO-Ag is acting on S. mutans biofilm formation cascade. Biofilm inhibitory concentrations GO-Ag were also found to be non-toxic against HEK-293 (human embryonic kidney cell line). The whole study highlights the therapeutic potential of GO-Ag to restrain the onset of biofilm formation in bacteria. Copyright © 2016 Elsevier Ltd. All rights reserved.

Oral cancer/endothelial cell fusion experiences nuclear fusion and acquisition of enhanced survival potential

DOE Office of Scientific and Technical Information (OSTI.GOV)

Song, Kai; The State Key Laboratory Breeding Base of Basic Science of Stomatology; Song, Yong

Most previous studies have linked cancer–macrophage fusion with tumor progression and metastasis. However, the characteristics of hybrid cells derived from oral cancer and endothelial cells and their involvement in cancer remained unknown. Double-immunofluorescent staining and fluorescent in situ hybridization (FISH) were performed to confirm spontaneous cell fusion between eGFP-labeled human umbilical vein endothelial cells (HUVECs) and RFP-labeled SCC9, and to detect the expression of vementin and cytokeratin 18 in the hybrids. The property of chemo-resistance of such hybrids was examined by TUNEL assay. The hybrid cells in xenografted tumor were identified by FISH and GFP/RFP dual-immunofluoresence staining. We showed thatmore » SCC9 cells spontaneously fused with cocultured endothelial cells, and the resultant hybrid cells maintained the division and proliferation activity after re-plating and thawing. Such hybrids expressed markers of both parental cells and became more resistant to chemotherapeutic drug cisplatin as compared to the parental SCC9 cells. Our in vivo data indicated that the hybrid cells contributed to tumor composition by using of immunostaining and FISH analysis, even though the hybrid cells and SCC9 cells were mixed with 1:10,000, according to the FACS data. Our study suggested that the fusion events between oral cancer and endothelial cells undergo nuclear fusion and acquire a new property of drug resistance and consequently enhanced survival potential. These experimental findings provide further supportive evidence for the theory that cell fusion is involved in cancer progression. - Highlights: • The fusion events between oral cancer and endothelial cells undergo nuclear fusion. • The resulting hybrid cells acquire a new property of drug resistance. • The resulting hybrid cells express the markers of both parental cells (i.e. vimentin and cytokeratin 18). • The hybrid cells contribute to tumor repopulation in vivo.« less

Assessment of NDE Methods to Detect Lack of Fusion in HDPE Butt Fusion Joints

DOE Office of Scientific and Technical Information (OSTI.GOV)

Crawford, Susan L.; Doctor, Steven R.; Cinson, Anthony D.

2011-07-31

Studies at the Pacific Northwest National Laboratory (PNNL) in Richland, Washington, were conducted to evaluate nondestructive examinations (NDE) coupled with mechanical testing of butt fusion joints in high-density polyethylene (HDPE) pipe for assessing lack of fusion. The work provided information to the United States Nuclear Regulatory Commission (NRC) on the effectiveness of volumetric inspection techniques of HDPE butt fusion joints in Section III, Division 1, Class 3, buried piping systems in nuclear power plants. This paper describes results from assessments using ultrasonic and microwave nondestructive techniques and mechanical testing with the high-speed tensile impact test and the side-bend test formore » determining joint integrity. A series of butt joints were fabricated in 3408, 12-inch (30.5-cm) IPS DR-11 HDPE material by varying the fusion parameters to create good joints and joints containing a range of lack-of-fusion conditions. Six of these butt joints were volumetrically examined with time-of-flight diffraction (TOFD), phased-array (PA) ultrasound, and the Evisive microwave system. The outer diameter (OD) weld beads were removed for microwave evaluation and the pipes ultrasonically re-evaluated. In two of the six pipes, both the outer and inner diameter (ID) weld beads were removed and the pipe joints re-evaluated. Some of the pipes were sectioned and the joints destructively evaluated with the high-speed tensile test and the side-bend test. The fusion parameters, nondestructive and destructive evaluation results have been correlated to validate the effectiveness of what each NDE technology detects and what each does not detect. There was no single NDE method that detected all of the lack-of-fusion flaws but a combination of NDE methods did detect most of the flaws.« less

Characterization of Chlamydia MurC-Ddl, a fusion protein exhibiting D-alanyl-D-alanine ligase activity involved in peptidoglycan synthesis and D-cycloserine sensitivity.

PubMed

McCoy, Andrea J; Maurelli, Anthony T

2005-07-01

Recent characterization of chlamydial genes encoding functional peptidoglycan (PG)-synthesis proteins suggests that the Chlamydiaceae possess the ability to synthesize PG yet biochemical evidence for the synthesis of PG has yet to be demonstrated. The presence of D-amino acids in PG is a hallmark of bacteria. Chlamydiaceae do not appear to encode amino acid racemases however, a D-alanyl-D-alanine (D-Ala-D-Ala) ligase homologue (Ddl) is encoded in the genome. Thus, we undertook a genetics-based approach to demonstrate and characterize the D-Ala-D-Ala ligase activity of chlamydial Ddl, a protein encoded as a fusion with MurC. The full-length murC-ddl fusion gene from Chlamydia trachomatis serovar L2 was cloned and placed under the control of the arabinose-inducible ara promoter and transformed into a D-Ala-D-Ala ligase auxotroph of Escherichia coli possessing deletions of both the ddlA and ddlB genes. Viability of the E. coliDeltaddlADeltaddlB mutant in the absence of exogenous D-Ala-D-Ala dipeptide became dependent on the expression of the chlamydial murC-ddl thus demonstrating functional ligase activity. Domain mapping of the full-length fusion protein and site-directed mutagenesis of the MurC domain revealed that the structure of the full fusion protein but not MurC enzymatic activity was required for ligase activity in vivo. Recombinant MurC-Ddl exhibited substrate specificity for D-Ala. Chlamydia growth is inhibited by D-cycloserine (DCS) and in vitro analysis provided evidence for the chlamydial MurC-Ddl as the target for DCS sensitivity. In vivo sensitivity to DCS could be reversed by addition of exogenous D-Ala and D-Ala-D-Ala. Together, these findings further support our hypothesis that PG is synthesized by members of the Chlamydiaceae family and suggest that D-amino acids, specifically D-Ala, are present in chlamydial PG.

Fabrication of a Functionalized Magnetic Bacterial Nanocellulose with Iron Oxide Nanoparticles

PubMed Central

Arias, Sandra L.; Shetty, Akshath R.; Senpan, Angana; Echeverry-Rendón, Mónica; Reece, Lisa M.; Allain, Jean Paul

2016-01-01

In this study, bacterial nanocellulose (BNC) produced by the bacteria Gluconacetobacter xylinus is synthesized and impregnated in situ with iron oxide nanoparticles (IONP) (Fe3O4) to yield a magnetic bacterial nanocellulose (MBNC). The synthesis of MBNC is a precise and specifically designed multi-step process. Briefly, bacterial nanocellulose (BNC) pellicles are formed from preserved G. xylinus strain according to our experimental requirements of size and morphology. A solution of iron(III) chloride hexahydrate (FeCl3·6H2O) and iron(II) chloride tetrahydrate (FeCl2·4H2O) with a 2:1 molar ratio is prepared and diluted in deoxygenated high purity water. A BNC pellicle is then introduced in the vessel with the reactants. This mixture is stirred and heated at 80 °C in a silicon oil bath and ammonium hydroxide (14%) is then added by dropping to precipitate the ferrous ions into the BNC mesh. This last step allows forming in situ magnetite nanoparticles (Fe3O4) inside the bacterial nanocellulose mesh to confer magnetic properties to BNC pellicle. A toxicological assay was used to evaluate the biocompatibility of the BNC-IONP pellicle. Polyethylene glycol (PEG) was used to cover the IONPs in order to improve their biocompatibility. Scanning electron microscopy (SEM) images showed that the IONP were located preferentially in the fibril interlacing spaces of the BNC matrix, but some of them were also found along the BNC ribbons. Magnetic force microscope measurements performed on the MBNC detected the presence magnetic domains with high and weak intensity magnetic field, confirming the magnetic nature of the MBNC pellicle. Young's modulus values obtained in this work are also in a reasonable agreement with those reported for several blood vessels in previous studies. PMID:27285589

Fabrication of a Functionalized Magnetic Bacterial Nanocellulose with Iron Oxide Nanoparticles.

PubMed

Arias, Sandra L; Shetty, Akshath R; Senpan, Angana; Echeverry-Rendón, Mónica; Reece, Lisa M; Allain, Jean Paul

2016-05-26

In this study, bacterial nanocellulose (BNC) produced by the bacteria Gluconacetobacter xylinus is synthesized and impregnated in situ with iron oxide nanoparticles (IONP) (Fe3O4) to yield a magnetic bacterial nanocellulose (MBNC). The synthesis of MBNC is a precise and specifically designed multi-step process. Briefly, bacterial nanocellulose (BNC) pellicles are formed from preserved G. xylinus strain according to our experimental requirements of size and morphology. A solution of iron(III) chloride hexahydrate (FeCl3·6H2O) and iron(II) chloride tetrahydrate (FeCl2·4H2O) with a 2:1 molar ratio is prepared and diluted in deoxygenated high purity water. A BNC pellicle is then introduced in the vessel with the reactants. This mixture is stirred and heated at 80 °C in a silicon oil bath and ammonium hydroxide (14%) is then added by dropping to precipitate the ferrous ions into the BNC mesh. This last step allows forming in situ magnetite nanoparticles (Fe3O4) inside the bacterial nanocellulose mesh to confer magnetic properties to BNC pellicle. A toxicological assay was used to evaluate the biocompatibility of the BNC-IONP pellicle. Polyethylene glycol (PEG) was used to cover the IONPs in order to improve their biocompatibility. Scanning electron microscopy (SEM) images showed that the IONP were located preferentially in the fibril interlacing spaces of the BNC matrix, but some of them were also found along the BNC ribbons. Magnetic force microscope measurements performed on the MBNC detected the presence magnetic domains with high and weak intensity magnetic field, confirming the magnetic nature of the MBNC pellicle. Young's modulus values obtained in this work are also in a reasonable agreement with those reported for several blood vessels in previous studies.

Myoblast fusion in Drosophila

DOE Office of Scientific and Technical Information (OSTI.GOV)

Haralalka, Shruti; Abmayr, Susan M., E-mail: sma@stowers.org; Department of Anatomy and Cell Biology, University of Kansas Medical Center, Kansas City, MO 66160

2010-11-01

The body wall musculature of a Drosophila larva is composed of an intricate pattern of 30 segmentally repeated muscle fibers in each abdominal hemisegment. Each muscle fiber has unique spatial and behavioral characteristics that include its location, orientation, epidermal attachment, size and pattern of innervation. Many, if not all, of these properties are dictated by founder cells, which determine the muscle pattern and seed the fusion process. Myofibers are then derived from fusion between a specific founder cell and several fusion competent myoblasts (FCMs) fusing with as few as 3-5 FCMs in the small muscles on the most ventral sidemore » of the embryo and as many as 30 FCMs in the larger muscles on the dorsal side of the embryo. The focus of the present review is the formation of the larval muscles in the developing embryo, summarizing the major issues and players in this process. We have attempted to emphasize experimentally-validated details of the mechanism of myoblast fusion and distinguish these from the theoretically possible details that have not yet been confirmed experimentally. We also direct the interested reader to other recent reviews that discuss myoblast fusion in Drosophila, each with their own perspective on the process . With apologies, we use gene nomenclature as specified by Flybase (http://flybase.org) but provide Table 1 with alternative names and references.« less

The VISTA spacecraft: Advantages of ICF (Inertial Confinement Fusion) for interplanetary fusions propulsion applications

NASA Technical Reports Server (NTRS)

Orth, Charles D.; Klein, Gail; Sercel, Joel; Hoffman, Nate; Murray, Kathy; Chang-Diaz, Franklin

1987-01-01

Inertial Confinement Fusion (ICF) is an attractive engine power source for interplanetary manned spacecraft, especially for near-term missions requiring minimum flight duration, because ICF has inherent high power-to-mass ratios and high specific impulses. We have developed a new vehicle concept called VISTA that uses ICF and is capable of round-trip manned missions to Mars in 100 days using A.D. 2020 technology. We describe VISTA's engine operation, discuss associated plasma issues, and describe the advantages of DT fuel for near-term applications. Although ICF is potentially superior to non-fusion technologies for near-term interplanetary transport, the performance capabilities of VISTA cannot be meaningfully compared with those of magnetic-fusion systems because of the lack of a comparable study of the magnetic-fusion systems. We urge that such a study be conducted.

A Model for Membrane Fusion

NASA Astrophysics Data System (ADS)

Ngatchou, Annita

2010-01-01

Pheochromocytoma is a tumor of the adrenal gland which originates from chromaffin cells and is characterized by the secretion of excessive amounts of neurotransmitter which lead to high blood pressure and palpitations. Pheochromocytoma contain membrane bound granules that store neurotransmitter. The release of these stored molecules into the extracellular space occurs by fusion of the granule membrane with the cell plasma membrane, a process called exocytosis. The molecular mechanism of this membrane fusion is not well understood. It is proposed that the so called SNARE proteins [1] are the pillar of vesicle fusion as their cleavage by clostridial toxin notably, Botulinum neurotoxin and Tetanus toxin abrogate the secretion of neurotransmitter [2]. Here, I describe how physical principles are applied to a biological cell to explore the role of the vesicle SNARE protein synaptobrevin-2 in easing granule fusion. The data presented here suggest a paradigm according to which the movement of the C-terminal of synaptobrevin-2 disrupts the lipid bilayer to form a fusion pore through which molecules can exit.

Repeated evolution of chimeric fusion genes in the β-globin gene family of laurasiatherian mammals.

PubMed

Gaudry, Michael J; Storz, Jay F; Butts, Gary Tyler; Campbell, Kevin L; Hoffmann, Federico G

2014-05-09

The evolutionary fate of chimeric fusion genes may be strongly influenced by their recombinational mode of origin and the nature of functional divergence between the parental genes. In the β-globin gene family of placental mammals, the two postnatally expressed δ- and β-globin genes (HBD and HBB, respectively) have a propensity for recombinational exchange via gene conversion and unequal crossing-over. In the latter case, there are good reasons to expect differences in retention rates for the reciprocal HBB/HBD and HBD/HBB fusion genes due to thalassemia pathologies associated with the HBD/HBB "Lepore" deletion mutant in humans. Here, we report a comparative genomic analysis of the mammalian β-globin gene cluster, which revealed that chimeric HBB/HBD fusion genes originated independently in four separate lineages of laurasiatherian mammals: Eulipotyphlans (shrews, moles, and hedgehogs), carnivores, microchiropteran bats, and cetaceans. In cases where an independently derived "anti-Lepore" duplication mutant has become fixed, the parental HBD and/or HBB genes have typically been inactivated or deleted, so that the newly created HBB/HBD fusion gene is primarily responsible for synthesizing the β-type subunits of adult and fetal hemoglobin (Hb). Contrary to conventional wisdom that the HBD gene is a vestigial relict that is typically inactivated or expressed at negligible levels, we show that HBD-like genes often encode a substantial fraction (20-100%) of β-chain Hbs in laurasiatherian taxa. Our results indicate that the ascendancy or resuscitation of genes with HBD-like coding sequence requires the secondary acquisition of HBB-like promoter sequence via unequal crossing-over or interparalog gene conversion. © The Author(s) 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Myoblast fusion: lessons from flies and mice

PubMed Central

Abmayr, Susan M.; Pavlath, Grace K.

2012-01-01

The fusion of myoblasts into multinucleate syncytia plays a fundamental role in muscle function, as it supports the formation of extended sarcomeric arrays, or myofibrils, within a large volume of cytoplasm. Principles learned from the study of myoblast fusion not only enhance our understanding of myogenesis, but also contribute to our perspectives on membrane fusion and cell-cell fusion in a wide array of model organisms and experimental systems. Recent studies have advanced our views of the cell biological processes and crucial proteins that drive myoblast fusion. Here, we provide an overview of myoblast fusion in three model systems that have contributed much to our understanding of these events: the Drosophila embryo; developing and regenerating mouse muscle; and cultured rodent muscle cells. PMID:22274696

Premature activation of the paramyxovirus fusion protein before target cell attachment with corruption of the viral fusion machinery.

PubMed

Farzan, Shohreh F; Palermo, Laura M; Yokoyama, Christine C; Orefice, Gianmarco; Fornabaio, Micaela; Sarkar, Aurijit; Kellogg, Glen E; Greengard, Olga; Porotto, Matteo; Moscona, Anne

2011-11-04

Paramyxoviruses, including the childhood pathogen human parainfluenza virus type 3, enter host cells by fusion of the viral and target cell membranes. This fusion results from the concerted action of its two envelope glycoproteins, the hemagglutinin-neuraminidase (HN) and the fusion protein (F). The receptor-bound HN triggers F to undergo conformational changes that render it competent to mediate fusion of the viral and cellular membranes. We proposed that, if the fusion process could be activated prematurely before the virion reaches the target host cell, infection could be prevented. We identified a small molecule that inhibits paramyxovirus entry into target cells and prevents infection. We show here that this compound works by an interaction with HN that results in F-activation prior to receptor binding. The fusion process is thereby prematurely activated, preventing fusion of the viral membrane with target cells and precluding viral entry. This first evidence that activation of a paramyxovirus F can be specifically induced before the virus contacts its target cell suggests a new strategy with broad implications for the design of antiviral agents.

Applications of Fusion Energy Sciences Research - Scientific Discoveries and New Technologies Beyond Fusion

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wendt, Amy; Callis, Richard; Efthimion, Philip

Since the 1950s, scientists and engineers in the U.S. and around the world have worked hard to make an elusive goal to be achieved on Earth: harnessing the reaction that fuels the stars, namely fusion. Practical fusion would be a source of energy that is unlimited, safe, environmentally benign, available to all nations and not dependent on climate or the whims of the weather. Significant resources, most notably from the U.S. Department of Energy (DOE) Office of Fusion Energy Sciences (FES), have been devoted to pursuing that dream, and significant progress is being made in turning it into a reality.more » However, that is only part of the story. The process of creating a fusion-based energy supply on Earth has led to technological and scientific achievements of far-reaching impact that touch every aspect of our lives. Those largely unanticipated advances, spanning a wide variety of fields in science and technology, are the focus of this report. There are many synergies between research in plasma physics (the study of charged particles and fluids interacting with self-consistent electric and magnetic fields), high-energy physics, and condensed matter physics dating back many decades. For instance, the formulation of a mathematical theory of solitons, solitary waves which are seen in everything from plasmas to water waves to Bose-Einstein Condensates, has led to an equal span of applications, including the fields of optics, fluid mechanics and biophysics. Another example, the development of a precise criterion for transition to chaos in Hamiltonian systems, has offered insights into a range of phenomena including planetary orbits, two-person games and changes in the weather. Seven distinct areas of fusion energy sciences were identified and reviewed which have had a recent impact on fields of science, technology and engineering not directly associated with fusion energy: Basic plasma science; Low temperature plasmas; Space and astrophysical plasmas; High energy

A bacterial genetic selection system for ubiquitylation cascade discovery.

PubMed

Levin-Kravets, Olga; Tanner, Neta; Shohat, Noa; Attali, Ilan; Keren-Kaplan, Tal; Shusterman, Anna; Artzi, Shay; Varvak, Alexander; Reshef, Yael; Shi, Xiaojing; Zucker, Ori; Baram, Tamir; Katina, Corine; Pilzer, Inbar; Ben-Aroya, Shay; Prag, Gali

2016-11-01

About one-third of the eukaryotic proteome undergoes ubiquitylation, but the enzymatic cascades leading to substrate modification are largely unknown. We present a genetic selection tool that utilizes Escherichia coli, which lack deubiquitylases, to identify interactions along ubiquitylation cascades. Coexpression of split antibiotic resistance protein tethered to ubiquitin and ubiquitylation target together with a functional ubiquitylation apparatus results in a covalent assembly of the resistance protein, giving rise to bacterial growth on selective media. We applied the selection system to uncover an E3 ligase from the pathogenic bacteria EHEC and to identify the epsin ENTH domain as an ultraweak ubiquitin-binding domain. The latter was complemented with a structure-function analysis of the ENTH-ubiquitin interface. We also constructed and screened a yeast fusion library, discovering Sem1 as a novel ubiquitylation substrate of Rsp5 E3 ligase. Collectively, our selection system provides a robust high-throughput approach for genetic studies of ubiquitylation cascades and for small-molecule modulator screening.

Involvement of Pacific oyster CgPGRP-S1S in bacterial recognition, agglutination and granulocyte degranulation.

PubMed

Iizuka, Masao; Nagasaki, Toshihiro; Takahashi, Keisuke G; Osada, Makoto; Itoh, Naoki

2014-03-01

Peptidoglycan recognition protein (PGRP) recognizes invading bacteria through their peptidoglycans (PGN), a component of the bacterial cell wall. Insect PGRPs contribute to effective immune systems as inducers of other host defense responses, while this function has not been reported from PGRP of bivalves. In this study, recombinant CgPGRP-S1S (rCgPGRP-S1S), produced in the mantle and the gill, was synthesized and used to elucidate the immunological function of CgPGRP-S1S. rCgPGRP-S1S bound specifically to DAP-type PGN and to Escherichia coli cells, but not to other DAP-type PGN-containing bacterial species, Vibrio anguillarum, or Bacillus subtilis. Antibacterial activity was not detected, but E. coli cells were agglutinated. Moreover, in addition to these direct interactions with bacterial cells, rCgPGRP-S1S induced secretion of granular contents by hemocyte degranulation. Taken together, these results suggest for the first time that a PGRP of bivalves is, just as in insects, involved in host defense, not only by direct interaction with bacteria, but also by triggering other defense pathways. Copyright © 2013 Elsevier Ltd. All rights reserved.

Fusion energy: Status and prospects

NASA Astrophysics Data System (ADS)

Salomaa, Rainer

A review of the present state of the international fusion research is given. In the largest tokamak devices (JET, TFTR, JT-60) fusion relevant temperatures are routinely obtained and the scientific feasibility of plasma confinement has been demonstrated. Plans concerning the next step are described. A critical view is presented on questions as to what extent the generic advantages of fusion (availability, sufficiency, safety, environmental acceptability, etc.) can be exploited in a practical power reactor where the formidable technological problems call for compromises.

Fc-fusion Proteins in Therapy: An Updated View.

PubMed

Jafari, Reza; Zolbanin, Naime M; Rafatpanah, Houshang; Majidi, Jafar; Kazemi, Tohid

2017-01-01

Fc-fusion proteins are composed of Fc region of IgG antibody (Hinge-CH2-CH3) and a desired linked protein. Fc region of Fc-fusion proteins can bind to neonatal Fc receptor (FcRn) thereby rescuing it from degradation. The first therapeutic Fc-fusion protein was introduced for the treatment of AIDS. The molecular designing is the first stage in production of Fc-fusion proteins. The amino acid residues in the Fc region and linked protein are very important in the bioactivity and affinity of the fusion proteins. Although, therapeutic monoclonal antibodies are the top selling biologics but the application of therapeutic Fc-fusion proteins in clinic is in progress and among these medications Etanercept is the most effective in therapy. At present, eleven Fc-fusion proteins have been approved by FDA. There are novel Fc-fusion proteins which are in pre-clinical and clinical development. In this article, we review the molecular and biological characteristics of Fc-fusion proteins and then further discuss the features of novel therapeutic Fc-fusion proteins. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

The transition zone above a lumbosacral fusion.

PubMed

Hambly, M F; Wiltse, L L; Raghavan, N; Schneiderman, G; Koenig, C

1998-08-15

The clinical and radiographic effect of a lumbar or lumbosacral fusion was studied in 42 patients who had undergone a posterolateral fusion with an average follow-up of 22.6 years. To examine the long-term effects of posterolateral lumbar or lumbosacral fusion on the cephalad two motion segments (transition zone). It is commonly held that accelerated degeneration occurs in the motion segments adjacent to a fusion. Most studies are of short-term, anecdotal, uncontrolled reports that pay particular attention only to the first motion segment immediately cephalad to the fusion. Forty-two patients who had previously undergone a posterolateral lumbar or lumbosacral fusion underwent radiographic and clinical evaluation. Rate of fusion, range of motion, osteophytes, degenerative spondylolisthesis, retrolisthesis, facet arthrosis, disc ossification, dynamic instability, and disc space height were all studied and statistically compared with an age- and gender-matched control group. The patient's self-reported clinical outcome was also recorded. Degenerative changes occurred at the second level above the fused levels with a frequency equal to those occurring in the first level. There was no statistical difference between the study group and the cohort group in the presence of radiographic changes within the transition zone. In those patients undergoing fusion for degenerative processes, 75% reported a good to excellent outcome, whereas 84% of those undergoing fusion for spondylolysis or spondylolisthesis reported a good to excellent outcome. Radiographic changes occur within the transition zone cephalad to a lumbar or lumbosacral fusion. However, these changes are also seen in control subjects who have had no surgery.

Waveform synthesizer

DOEpatents

Franks, Larry A.; Nelson, Melvin A.

1981-01-01

A method of producing optical and electrical pulses of desired shape. An optical pulse of arbitrary but defined shape illuminates one end of an array of optical fiber waveguides of differing lengths to time differentiate the input pulse. The optical outputs at the other end of the array are combined to form a synthesized pulse of desired shape.

Magnetized Target Fusion Driven by Plasma Liners

NASA Technical Reports Server (NTRS)

Thio, Y. C. Francis; Kirkpatrick, Ronald C.; Knapp, Charles E.; Rodgers, Stephen L. (Technical Monitor)

2002-01-01

Magnetized target fusion is an emerging, relatively unexplored approach to fusion for electrical power and propulsion application. The physical principles of the concept are founded upon both inertial confinement fusion (ICF) and magnetic confinement fusion (MCF). It attempts to combine the favorable attributes of both these orthogonal approaches to fusion, but at the same time, avoiding the extreme technical challenges of both by exploiting a fusion regime intermediate between them. It uses a material liner to compress, heat and contain the fusion reacting plasma (the target plasma) mentally. By doing so, the fusion burn could be made to occur at plasma densities as high as six orders of magnitude higher than conventional MCF such as tokamak, thus leading to an approximately three orders of magnitude reduction in the plasma energy required for ignition. It also uses a transient magnetic field, compressed to extremely high intensity (100's T to 1000T) in the target plasma, to slow down the heat transport to the liner and to increase the energy deposition of charged-particle fusion products. This has several compounding beneficial effects. It leads to longer energy confinement time compared with conventional ICF without magnetized target, and thus permits the use of much lower plasma density to produce reasonable burn-up fraction. The compounding effects of lower plasma density and the magneto-insulation of the target lead to greatly reduced compressional heating power on the target. The increased energy deposition rate of charged-particle fusion products also helps to lower the energy threshold required for ignition and increasing the burn-up fraction. The reduction in ignition energy and the compressional power compound to lead to reduced system size, mass and R&D cost. It is a fusion approach that has an affordable R&D pathway, and appears attractive for propulsion application in the nearer term.

Zinc-oxide-silica-silver nanocomposite: Unique one-pot synthesis and enhanced catalytic and anti-bacterial performance.

PubMed

Kokate, Mangesh; Garadkar, Kalyanrao; Gole, Anand

2016-12-01

We describe herein a unique approach to synthesize zinc oxide-silica-silver (ZnO-SiO2-Ag) nanocomposite, in a simple, one-pot process. The typical process for ZnO synthesis by alkaline precipitation of zinc salts has been tweaked to replace alkali by alkaline sodium silicate. The free acid from zinc salts helps in the synthesis of silica nanoparticles, whereas the alkalinity of sodium silicate precipitates the zinc salts. Addition of silver ions into the reaction pot prior to addition of sodium silicate, and subsequent reduction by borohydride, gives additional functionality of metallic centres for catalytic applications. The synthesis strategy is based on our recent work typically involving acid-base type of cross-reactions and demonstrates a novel strategy to synthesize nanocomposites in a one-pot approach. Each component in the composite offers a unique feature. ZnO besides displaying mild catalytic and anti-bacterial behaviour is an excellent and a cheap 3-D support for heterogeneous catalysis. Silver nanoparticles enhance the catalytic & anti-bacterial properties of ZnO. Silica is an important part of the composite; which not only "glues" the two nanoparticles thereby stabilizing the nanocomposite, but also significantly enhances the surface area of the composite; which is an attractive feature of any catalyst composite. The nanocomposite is found to show excellent catalytic performance with very high turnover frequencies (TOFs) when studied for catalytic reduction of Rhodamine B (RhB) and 4-Nitrophenol (4-NP). Additionally, the composite has been tested for its anti-bacterial properties on three different bacterial strains i.e. E. coli, B. Cereus and Bacillus firmus. The mechanism for enhancement of catalytic performance has been probed by understanding the role of silica in offering accessibility to the catalyst via its porous high surface area network. The nanocomposite has been characterized by a host of different analytical techniques. The uniqueness of

Intense fusion neutron sources

NASA Astrophysics Data System (ADS)

Kuteev, B. V.; Goncharov, P. R.; Sergeev, V. Yu.; Khripunov, V. I.

2010-04-01

The review describes physical principles underlying efficient production of free neutrons, up-to-date possibilities and prospects of creating fission and fusion neutron sources with intensities of 1015-1021 neutrons/s, and schemes of production and application of neutrons in fusion-fission hybrid systems. The physical processes and parameters of high-temperature plasmas are considered at which optimal conditions for producing the largest number of fusion neutrons in systems with magnetic and inertial plasma confinement are achieved. The proposed plasma methods for neutron production are compared with other methods based on fusion reactions in nonplasma media, fission reactions, spallation, and muon catalysis. At present, intense neutron fluxes are mainly used in nanotechnology, biotechnology, material science, and military and fundamental research. In the near future (10-20 years), it will be possible to apply high-power neutron sources in fusion-fission hybrid systems for producing hydrogen, electric power, and technological heat, as well as for manufacturing synthetic nuclear fuel and closing the nuclear fuel cycle. Neutron sources with intensities approaching 1020 neutrons/s may radically change the structure of power industry and considerably influence the fundamental and applied science and innovation technologies. Along with utilizing the energy produced in fusion reactions, the achievement of such high neutron intensities may stimulate wide application of subcritical fast nuclear reactors controlled by neutron sources. Superpower neutron sources will allow one to solve many problems of neutron diagnostics, monitor nano-and biological objects, and carry out radiation testing and modification of volumetric properties of materials at the industrial level. Such sources will considerably (up to 100 times) improve the accuracy of neutron physics experiments and will provide a better understanding of the structure of matter, including that of the neutron itself.

High level expression, purification and characterization of active fusion human C1q and tumor necrosis factor related protein 2 (hCTRP2) in Escherichia coli.

PubMed

Li, Hongbo; Gao, Xuefei; Zhou, Yi; Li, Na; Ge, Caozuo; Hui, Xiaoyan; Wang, Yu; Xu, Aimin; Jin, Shouguang; Wu, Donghai

2011-09-01

C1q and tumor necrosis factor related proteins (CTRPs) are a family of adiponectin paralogues. Among them, CTRP2 is the only CTRP protein that has been shown to possess similar biological activities as adiponectin. To further explore the physiological roles of human CTRP2 and its mechanisms of action, hCTRP2 gene was expressed in Escherichia coli and Pichia pastoris, respectively. In the P. pastoris expression system, recombinant hCTRP2 could be secreted into the culture medium under induction condition, however, the resultant recombinant protein was highly unstable, resulting two main degradation products with molecular masses of approximately 20 and 26 kDa, respectively. In the E. coli expression system, a large amount of soluble thioredoxin (Trx)-hCTRP2 fusion protein could be produced, which accounts about 42% of the total soluble bacterial proteins. The recombinant Trx-hCTRP2 fusion protein was purified to an approximately 95% purity using Ni-NTA affinity chromatography and Superdex G-75 column with a yield of about 15 mg/l protein from 1l bacterial culture. The purified recombinant Trx-hCTRP2 was shown to be active under in vitro assay conditions. Copyright © 2011 Elsevier Inc. All rights reserved.

Fusion Imaging for Procedural Guidance.

PubMed

Wiley, Brandon M; Eleid, Mackram F; Thaden, Jeremy J

2018-05-01

The field of percutaneous structural heart interventions has grown tremendously in recent years. This growth has fueled the development of new imaging protocols and technologies in parallel to help facilitate these minimally-invasive procedures. Fusion imaging is an exciting new technology that combines the strength of 2 imaging modalities and has the potential to improve procedural planning and the safety of many commonly performed transcatheter procedures. In this review we discuss the basic concepts of fusion imaging along with the relative strengths and weaknesses of static vs dynamic fusion imaging modalities. This review will focus primarily on echocardiographic-fluoroscopic fusion imaging and its application in commonly performed transcatheter structural heart procedures. Copyright © 2017 Sociedad Española de Cardiología. Published by Elsevier España, S.L.U. All rights reserved.

High-gain magnetized inertial fusion.

PubMed

Slutz, Stephen A; Vesey, Roger A

2012-01-13

Magnetized inertial fusion (MIF) could substantially ease the difficulty of reaching plasma conditions required for significant fusion yields, but it has been widely accepted that the gain is not sufficient for fusion energy. Numerical simulations are presented showing that high-gain MIF is possible in cylindrical liner implosions based on the MagLIF concept [S. A. Slutz et al Phys. Plasmas 17, 056303 (2010)] with the addition of a cryogenic layer of deuterium-tritium (DT). These simulations show that a burn wave propagates radially from the magnetized hot spot into the surrounding much denser cold DT given sufficient hot-spot areal density. For a drive current of 60 MA the simulated gain exceeds 100, which is more than adequate for fusion energy applications. The simulated gain exceeds 1000 for a drive current of 70 MA.

Information Fusion - Methods and Aggregation Operators

NASA Astrophysics Data System (ADS)

Torra, Vicenç

Information fusion techniques are commonly applied in Data Mining and Knowledge Discovery. In this chapter, we will give an overview of such applications considering their three main uses. This is, we consider fusion methods for data preprocessing, model building and information extraction. Some aggregation operators (i.e. particular fusion methods) and their properties are briefly described as well.

Z-Pinch fusion-based nuclear propulsion

NASA Astrophysics Data System (ADS)

Miernik, J.; Statham, G.; Fabisinski, L.; Maples, C. D.; Adams, R.; Polsgrove, T.; Fincher, S.; Cassibry, J.; Cortez, R.; Turner, M.; Percy, T.

2013-02-01

Fusion-based nuclear propulsion has the potential to enable fast interplanetary transportation. Due to the great distances between the planets of our solar system and the harmful radiation environment of interplanetary space, high specific impulse (Isp) propulsion in vehicles with high payload mass fractions must be developed to provide practical and safe vehicles for human space flight missions. The Z-Pinch dense plasma focus method is a Magneto-Inertial Fusion (MIF) approach that may potentially lead to a small, low cost fusion reactor/engine assembly [1]. Recent advancements in experimental and theoretical understanding of this concept suggest favorable scaling of fusion power output yield [2]. The magnetic field resulting from the large current compresses the plasma to fusion conditions, and this process can be pulsed over short timescales (10-6 s). This type of plasma formation is widely used in the field of Nuclear Weapons Effects testing in the defense industry, as well as in fusion energy research. A Z-Pinch propulsion concept was designed for a vehicle based on a previous fusion vehicle study called "Human Outer Planet Exploration" (HOPE), which used Magnetized Target Fusion (MTF) [3] propulsion. The reference mission is the transport of crew and cargo to Mars and back, with a reusable vehicle. The analysis of the Z-Pinch MIF propulsion system concludes that a 40-fold increase of Isp over chemical propulsion is predicted. An Isp of 19,436 s and thrust of 3812 N s/pulse, along with nearly doubling the predicted payload mass fraction, warrants further development of enabling technologies.

Helicobacter pylori VacA Toxin Promotes Bacterial Intracellular Survival in Gastric Epithelial Cells▿ †

PubMed Central

Terebiznik, M. R.; Vazquez, C. L.; Torbicki, K.; Banks, D.; Wang, T.; Hong, W.; Blanke, S. R.; Colombo, M. I.; Jones, N. L.

2006-01-01

Helicobacter pylori colonizes the gastric epithelium of at least 50% of the world's human population, playing a causative role in the development of chronic gastritis, peptic ulcers, and gastric adenocarcinoma. Current evidence indicates that H. pylori can invade epithelial cells in the gastric mucosa. However, relatively little is known about the biology of H. pylori invasion and survival in host cells. Here, we analyze both the nature of and the mechanisms responsible for the formation of H. pylori's intracellular niche. We show that in AGS cells infected with H. pylori, bacterium-containing vacuoles originate through the fusion of late endocytic organelles. This process is mediated by the VacA-dependent retention of the small GTPase Rab7. In addition, functional interactions between Rab7 and its downstream effector, Rab-interacting lysosomal protein (RILP), are necessary for the formation of the bacterial compartment since expression of mutant forms of RILP or Rab7 that fail to bind each other impaired the formation of this unique bacterial niche. Moreover, the VacA-mediated sequestration of active Rab7 disrupts the full maturation of vacuoles as assessed by the lack of both colocalization with cathepsin D and degradation of internalized cargo in the H. pylori-containing vacuole. Based on these findings, we propose that the VacA-dependent isolation of the H. pylori-containing vacuole from bactericidal components of the lysosomal pathway promotes bacterial survival and contributes to the persistence of infection. PMID:17000720

Bacterial Interactions with CdSe Quantum Dots

NASA Astrophysics Data System (ADS)

Holden, P.; Nadeau, J. L.; Kumar, A.; Clarke, S.; Priester, J. H.; Stucky, G. D.

2007-12-01

Cadmium selenide quantum dots (QDs) are semiconductor nanoparticles that are manufactured for biomedical imaging, photovoltaics, and other applications. While metallic nanoparticles can be made biotically by bacteria and fungi, and thus occur in nature, the fate of either natural or engineered QDs and relationships to nanoparticle size, conjugate and biotic conditions are mostly unknown. Working with several different bacterial strains and QDs of different sizes and conjugate chemistries, including QDs synthesized by a Fusarium fungal strain, we show that QDs can enter cells through specfic receptor-mediated processes, that QDs are broken down by bacteria during cell association, and that toxicity to cells is much like that imposed by Cd(II) ions. The mechanisms of entry and toxicity are not fully understood, but preliminary evidence suggests that electron transfer between cells and QDs occurs. Also, cell membranes are compromised, indicating oxidative stress is occurring. Results with planktonic and biofilm bacteria are similar, but differently, biofilms tend to accumulate Cd(II) associated with QD treatments.

Mars manned fusion spaceship

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hedrick, J.; Buchholtz, B.; Ward, P.

1991-01-01

Fusion Propulsion has an enormous potential for space exploration in the near future. In the twenty-first century, a usable and efficient fusion rocket will be developed and in use. Because of the great distance between other planets and Earth, efficient use of time, fuel, and payload is essential. A nuclear spaceship would provide greater fuel efficiency, less travel time, and a larger payload. Extended missions would give more time for research, experiments, and data acquisition. With the extended mission time, a need for an artificial environment exists. The topics of magnetic fusion propulsion, living modules, artificial gravity, mass distribution, spacemore » connection, and orbital transfer to Mars are discussed. The propulsion system is a magnetic fusion reactor based on a tandem mirror design. This allows a faster, shorter trip time and a large thrust to weight ratio. The fuel proposed is a mixture of deuterium and helium. Helium can be obtained from lunar mining. There will be minimal external radiation from the reactor resulting in a safe, efficient propulsion system.« less

Mars manned fusion spaceship

NASA Technical Reports Server (NTRS)

Hedrick, James; Buchholtz, Brent; Ward, Paul; Freuh, Jim; Jensen, Eric

1991-01-01

Fusion Propulsion has an enormous potential for space exploration in the near future. In the twenty-first century, a usable and efficient fusion rocket will be developed and in use. Because of the great distance between other planets and Earth, efficient use of time, fuel, and payload is essential. A nuclear spaceship would provide greater fuel efficiency, less travel time, and a larger payload. Extended missions would give more time for research, experiments, and data acquisition. With the extended mission time, a need for an artificial environment exists. The topics of magnetic fusion propulsion, living modules, artificial gravity, mass distribution, space connection, and orbital transfer to Mars are discussed. The propulsion system is a magnetic fusion reactor based on a tandem mirror design. This allows a faster, shorter trip time and a large thrust to weight ratio. The fuel proposed is a mixture of deuterium and helium-3. Helium-3 can be obtained from lunar mining. There will be minimal external radiation from the reactor resulting in a safe, efficient propulsion system.

A Conserved Region in the F2 Subunit of Paramyxovirus Fusion Proteins Is Involved In Fusion Regulation▿

PubMed Central

Gardner, Amanda E.; Dutch, Rebecca E.

2007-01-01

Paramyxoviruses utilize both an attachment protein and a fusion (F) protein to drive virus-cell and cell-cell fusion. F exists functionally as a trimer of two disulfide-linked subunits: F1 and F2. Alignment and analysis of a set of paramyxovirus F protein sequences identified three conserved blocks (CB): one in the fusion peptide/heptad repeat A domain, known to play important roles in fusion promotion, one in the region between the heptad repeats of F1 (CBF1) (A. E. Gardner, K. L. Martin, and R. E. Dutch, Biochemistry 46:5094-5105, 2007), and one in the F2 subunit (CBF2). To analyze the functions of CBF2, alanine substitutions at conserved positions were created in both the simian virus 5 (SV5) and Hendra virus F proteins. A number of the CBF2 mutations resulted in folding and expression defects. However, the CBF2 mutants that were properly expressed and trafficked had altered fusion promotion activity. The Hendra virus CBF2 Y79A and P89A mutants showed significantly decreased levels of fusion, whereas the SV5 CBF2 I49A mutant exhibited greatly increased cell-cell fusion relative to that for wild-type F. Additional substitutions at SV5 F I49 suggest that both side chain volume and hydrophobicity at this position are important in the folding of the metastable, prefusion state and the subsequent triggering of membrane fusion. The recently published prefusogenic structure of parainfluenza virus 5/SV5 F (H. S. Yin et al., Nature 439:38-44, 2006) places CBF2 in direct contact with heptad repeat A. Our data therefore indicate that this conserved region plays a critical role in stabilizing the prefusion state, likely through interactions with heptad repeat A, and in triggering membrane fusion. PMID:17507474

SNARE-mediated membrane fusion in autophagy

PubMed Central

Wang, Yongyao; Li, Linsen; Hou, Chen; Lai, Ying; Long, Jiangang; Liu, Jiankang; Zhong, Qing; Diao, Jiajie

2016-01-01

Autophagy, a conserved self-eating process for the bulk degradation of cytoplasmic materials, involves double-membrane autophagosomes formed when an isolation membrane emerges and their direct fusion with lysosomes for degradation. For the early biogenesis of autophagosomes and their later degradation in lysosomes, membrane fusion is necessary, although different sets of genes and autophagy-related proteins involved in distinct fusion steps have been reported. To clarify the molecular mechanism of membrane fusion in autophagy, to not only expand current knowledge of autophagy, but also benefit human health, this review discusses key findings that elucidate the unique membrane dynamics of autophagy. PMID:27422330

Novel L-amino acid oxidase with algicidal activity against toxic cyanobacterium Microcystis aeruginosa synthesized by a bacterium Aquimarina sp.

PubMed

Chen, Wen Ming; Sheu, Fu Sian; Sheu, Shih Yi

2011-09-10

A brownish yellow pigmented bacterial strain, designated antisso-27, was recently isolated from a water area of saltpan in Southern Taiwan. Phylogenetic analyses based on 16S rRNA gene sequences indicate that strain antisso-27 belongs the genus Aquimarina in the family Flavobacteriacea and its only closest neighbor is Aquimarina spongiae (96.6%). Based on screening for algicidal activity, strain antisso-27 exhibits potent activity against the toxic cyanobacterium Microcystis aeruginosa. Both the strain antisso-27 bacterial culture and its culture filtrate show algicidal activity against the toxic cyanobacterium, indicating that an algicidal substance is released from strain antisso-27. The algicidal activity of strain antisso-27 occurs during the late stationary phase of bacterial growth. Strain antisso-27 can synthesize an algicidal protein with a molecular mass of 190 kDa, and its isoelectric point is approximately 9.4. This study explores the nature of this algicidal protein such as L-amino acid oxidase with broad substrate specificity. The enzyme is most active with L-leucine, L-isoleucine, L-methionine and L-valine and the hydrogen peroxide generated by its catalysis mediates algicidal activity. This is the first report on an Aquimarina strain algicidal to the toxic M. aeruginosa and the algicidal activity is generated through its enzymatic activity of L-amino acid oxidase. Copyright © 2011 Elsevier Inc. All rights reserved.

The MARVEL domain protein, Singles Bar, is required for progression past the pre-fusion complex stage of myoblast fusion.

PubMed

Estrada, Beatriz; Maeland, Anne D; Gisselbrecht, Stephen S; Bloor, James W; Brown, Nicholas H; Michelson, Alan M

2007-07-15

Multinucleated myotubes develop by the sequential fusion of individual myoblasts. Using a convergence of genomic and classical genetic approaches, we have discovered a novel gene, singles bar (sing), that is essential for myoblast fusion. sing encodes a small multipass transmembrane protein containing a MARVEL domain, which is found in vertebrate proteins involved in processes such as tight junction formation and vesicle trafficking where--as in myoblast fusion--membrane apposition occurs. sing is expressed in both founder cells and fusion competent myoblasts preceding and during myoblast fusion. Examination of embryos injected with double-stranded sing RNA or embryos homozygous for ethane methyl sulfonate-induced sing alleles revealed an identical phenotype: replacement of multinucleated myofibers by groups of single, myosin-expressing myoblasts at a stage when formation of the mature muscle pattern is complete in wild-type embryos. Unfused sing mutant myoblasts form clusters, suggesting that early recognition and adhesion of these cells are unimpaired. To further investigate this phenotype, we undertook electron microscopic ultrastructural studies of fusing myoblasts in both sing and wild-type embryos. These experiments revealed that more sing mutant myoblasts than wild-type contain pre-fusion complexes, which are characterized by electron-dense vesicles paired on either side of the fusing plasma membranes. In contrast, embryos mutant for another muscle fusion gene, blown fuse (blow), have a normal number of such complexes. Together, these results lead to the hypothesis that sing acts at a step distinct from that of blow, and that sing is required on both founder cell and fusion-competent myoblast membranes to allow progression past the pre-fusion complex stage of myoblast fusion, possibly by mediating fusion of the electron-dense vesicles to the plasma membrane.

Integrated Data Analysis for Fusion: A Bayesian Tutorial for Fusion Diagnosticians

NASA Astrophysics Data System (ADS)

Dinklage, Andreas; Dreier, Heiko; Fischer, Rainer; Gori, Silvio; Preuss, Roland; Toussaint, Udo von

2008-03-01

Integrated Data Analysis (IDA) offers a unified way of combining information relevant to fusion experiments. Thereby, IDA meets with typical issues arising in fusion data analysis. In IDA, all information is consistently formulated as probability density functions quantifying uncertainties in the analysis within the Bayesian probability theory. For a single diagnostic, IDA allows the identification of faulty measurements and improvements in the setup. For a set of diagnostics, IDA gives joint error distributions allowing the comparison and integration of different diagnostics results. Validation of physics models can be performed by model comparison techniques. Typical data analysis applications benefit from IDA capabilities of nonlinear error propagation, the inclusion of systematic effects and the comparison of different physics models. Applications range from outlier detection, background discrimination, model assessment and design of diagnostics. In order to cope with next step fusion device requirements, appropriate techniques are explored for fast analysis applications.

Structural differences in the bacterial flagellar motor among bacterial species.

PubMed

Terashima, Hiroyuki; Kawamoto, Akihiro; Morimoto, Yusuke V; Imada, Katsumi; Minamino, Tohru

2017-01-01

The bacterial flagellum is a supramolecular motility machine consisting of the basal body as a rotary motor, the hook as a universal joint, and the filament as a helical propeller. Intact structures of the bacterial flagella have been observed for different bacterial species by electron cryotomography and subtomogram averaging. The core structures of the basal body consisting of the C ring, the MS ring, the rod and the protein export apparatus, and their organization are well conserved, but novel and divergent structures have also been visualized to surround the conserved structure of the basal body. This suggests that the flagellar motors have adapted to function in various environments where bacteria live and survive. In this review, we will summarize our current findings on the divergent structures of the bacterial flagellar motor.

Forecasting Chronic Diseases Using Data Fusion.

PubMed

Acar, Evrim; Gürdeniz, Gözde; Savorani, Francesco; Hansen, Louise; Olsen, Anja; Tjønneland, Anne; Dragsted, Lars Ove; Bro, Rasmus

2017-07-07

Data fusion, that is, extracting information through the fusion of complementary data sets, is a topic of great interest in metabolomics because analytical platforms such as liquid chromatography-mass spectrometry (LC-MS) and nuclear magnetic resonance (NMR) spectroscopy commonly used for chemical profiling of biofluids provide complementary information. In this study, with a goal of forecasting acute coronary syndrome (ACS), breast cancer, and colon cancer, we jointly analyzed LC-MS, NMR measurements of plasma samples, and the metadata corresponding to the lifestyle of participants. We used supervised data fusion based on multiple kernel learning and exploited the linearity of the models to identify significant metabolites/features for the separation of healthy referents and the cases developing a disease. We demonstrated that (i) fusing LC-MS, NMR, and metadata provided better separation of ACS cases and referents compared with individual data sets, (ii) NMR data performed the best in terms of forecasting breast cancer, while fusion degraded the performance, and (iii) neither the individual data sets nor their fusion performed well for colon cancer. Furthermore, we showed the strengths and limitations of the fusion models by discussing their performance in terms of capturing known biomarkers for smoking and coffee. While fusion may improve performance in terms of separating certain conditions by jointly analyzing metabolomics and metadata sets, it is not necessarily always the best approach as in the case of breast cancer.

Chimera: a Bioconductor package for secondary analysis of fusion products.

PubMed

Beccuti, Marco; Carrara, Matteo; Cordero, Francesca; Lazzarato, Fulvio; Donatelli, Susanna; Nadalin, Francesca; Policriti, Alberto; Calogero, Raffaele A

2014-12-15

Chimera is a Bioconductor package that organizes, annotates, analyses and validates fusions reported by different fusion detection tools; current implementation can deal with output from bellerophontes, chimeraScan, deFuse, fusionCatcher, FusionFinder, FusionHunter, FusionMap, mapSplice, Rsubread, tophat-fusion and STAR. The core of Chimera is a fusion data structure that can store fusion events detected with any of the aforementioned tools. Fusions are then easily manipulated with standard R functions or through the set of functionalities specifically developed in Chimera with the aim of supporting the user in managing fusions and discriminating false-positive results. © The Author 2014. Published by Oxford University Press.

In situ synthesis of silver-nanoparticles/bacterial cellulose composites for slow-released antimicrobial wound dressing.

PubMed

Wu, Jian; Zheng, Yudong; Song, Wenhui; Luan, Jiabin; Wen, Xiaoxiao; Wu, Zhigu; Chen, Xiaohua; Wang, Qi; Guo, Shaolin

2014-02-15

Bacterial cellulose has attracted increasing attention as a novel wound dressing material, but it has no antimicrobial activity, which is one of critical skin-barrier functions in wound healing. To overcome such deficiency, we developed a novel method to synthesize and impregnate silver nanoparticles on to bacterial cellulose nanofibres (AgNP-BC). Uniform spherical silver nano-particles (10-30 nm) were generated and self-assembled on the surface of BC nano-fibers, forming a stable and evenly distributed Ag nanoparticles coated BC nanofiber. Such hybrid nanostructure prevented Ag nanoparticles from dropping off BC network and thus minimized the toxicity of nanoparticles. Regardless the slow Ag(+) release, AgNP-BC still exhibited significant antibacterial activities with more than 99% reductions in Escherichia coli, Staphylococcus aureus and Pseudomonas aeruginosa. Moreover, AgNP-BC allowed attachment and growth of epidermal cells with no cytotoxicity emerged. The results demonstrated that AgNP-BC could reduce inflammation and promote wound healing. Copyright © 2013 Elsevier Ltd. All rights reserved.

The Sweet Tooth of Bacteria: Common Themes in Bacterial Glycoconjugates

PubMed Central

Tytgat, Hanne L. P.

2014-01-01

SUMMARY Humans have been increasingly recognized as being superorganisms, living in close contact with a microbiota on all their mucosal surfaces. However, most studies on the human microbiota have focused on gaining comprehensive insights into the composition of the microbiota under different health conditions (e.g., enterotypes), while there is also a need for detailed knowledge of the different molecules that mediate interactions with the host. Glycoconjugates are an interesting class of molecules for detailed studies, as they form a strain-specific barcode on the surface of bacteria, mediating specific interactions with the host. Strikingly, most glycoconjugates are synthesized by similar biosynthesis mechanisms. Bacteria can produce their major glycoconjugates by using a sequential or an en bloc mechanism, with both mechanistic options coexisting in many species for different macromolecules. In this review, these common themes are conceptualized and illustrated for all major classes of known bacterial glycoconjugates, with a special focus on the rather recently emergent field of glycosylated proteins. We describe the biosynthesis and importance of glycoconjugates in both pathogenic and beneficial bacteria and in both Gram-positive and -negative organisms. The focus lies on microorganisms important for human physiology. In addition, the potential for a better knowledge of bacterial glycoconjugates in the emerging field of glycoengineering and other perspectives is discussed. PMID:25184559

Lactic acid bacterial extract as a biogenic mineral growth modifier

NASA Astrophysics Data System (ADS)

Borah, Ballav M.; Singh, Atul K.; Ramesh, Aiyagari; Das, Gopal

2009-04-01

The formation of minerals and mechanisms by which bacteria could control their formation in natural habitats is now of current interest for material scientists to have an insight of the mechanism of in vivo mineralization, as well as to seek industrial and technological applications. Crystalline uniform structures of calcium and barium minerals formed micron-sized building blocks when synthesized in the presence of an organic matrix consisting of secreted protein extracts from three different lactic acid bacteria (LAB) viz.: Lactobacillus plantarum MTCC 1325, Lactobacillus acidophilus NRRL B4495 and Pediococcus acidilactici CFR K7. LABs are not known to form organic matrix in biological materialization processes. The influence of these bacterial extracts on the crystallization behavior was investigated in details to test the basic coordination behavior of the acidic protein. In this report, varied architecture of the mineral crystals obtained in presence of high molecular weight protein extracts of three different LAB strains has been discussed. The role of native form of high molecular weight bacterial protein extracts in the generation of nucleation centers for crystal growth was clearly established. A model for the formation of organic matrix-cation complex and the subsequent events leading to crystal growth is proposed.

A downstream box fusion allows stable accumulation of a bacterial cellulase in Chlamydomonas reinhardtii chloroplasts.

PubMed

Richter, Lubna V; Yang, Huijun; Yazdani, Mohammad; Hanson, Maureen R; Ahner, Beth A

2018-01-01

We investigated strategies to improve foreign protein accumulation in the chloroplasts of the model algae Chlamydomonas reinhardtii and tested the outcome in both standard culture conditions as well as one pertinent to algal biofuel production. The downstream box (DB) of the TetC or NPTII genes, the first 15 codons following the start codon, was N -terminally fused to the coding region of cel6A , an endoglucanase from Thermobifida fusca . We also employed a chimeric regulatory element, consisting of the 16S rRNA promoter and the atpA 5'UTR, previously reported to enhance protein expression, to regulate the expression of the TetC- cel6A gene. We further investigated the accumulation of TetC-Cel6A under N -deplete growth conditions. Both of the DB fusions improved intracellular accumulation of Cel6A in transplastomic C. reinhardtii strains though the TetC DB was much more effective than the NPTII DB. Furthermore, using the chimeric regulatory element, the TetC-Cel6A protein accumulation displayed a significant increase to 0.3% total soluble protein (TSP), whereas NPTII-Cel6A remained too low to quantify. Comparable levels of TetC- and NPTII- cel6A transcripts were observed, which suggests that factors other than transcript abundance mediate the greater TetC-Cel6A accumulation. The TetC-Cel6A accumulation was stable regardless of the growth stage, and the transplastomic strain growth rate was not altered. When transplastomic cells were suspended in N -deplete medium, cellular levels of TetC-Cel6A increased over time along with TSP, and were greater than those in cells suspended in N -replete medium. The DB fusion holds great value as a tool to enhance foreign protein accumulation in C. reinhardtii chloroplasts and its influence is related to translation or other post-transcriptional processes. Our results also suggest that transplastomic protein production can be compatible with algal biofuel production strategies. Cells displayed a consistent accumulation of

Status and problems of fusion reactor development.

PubMed

Schumacher, U

2001-03-01

Thermonuclear fusion of deuterium and tritium constitutes an enormous potential for a safe, environmentally compatible and sustainable energy supply. The fuel source is practically inexhaustible. Further, the safety prospects of a fusion reactor are quite favourable due to the inherently self-limiting fusion process, the limited radiologic toxicity and the passive cooling property. Among a small number of approaches, the concept of toroidal magnetic confinement of fusion plasmas has achieved most impressive scientific and technical progress towards energy release by thermonuclear burn of deuterium-tritium fuels. The status of thermonuclear fusion research activity world-wide is reviewed and present solutions to the complicated physical and technological problems are presented. These problems comprise plasma heating, confinement and exhaust of energy and particles, plasma stability, alpha particle heating, fusion reactor materials, reactor safety and environmental compatibility. The results and the high scientific level of this international research activity provide a sound basis for the realisation of the International Thermonuclear Experimental Reactor (ITER), whose goal is to demonstrate the scientific and technological feasibility of a fusion energy source for peaceful purposes.

[Metapneumovirus expands the understanding of Paramyxovirus cell fusion--a review].

PubMed

Liu, Xiaoyu; Zhang, Xiaodong; Wei, Yongwei

2014-04-04

For most viruses in Paramyxoviridae, cell fusion requires both attachment protein and fusion protein. The attachment protein is responsible for the binding to its cognate receptors, while the interaction between fusion protein and attachment protein triggers the fusion protein which is responsible for the fusion. However, the Metapneumovirus fusion in Pneumovirinae subfamily displayed different mechanism where the attachment protein is not required. The cell fusion is accomplished by fusion protein alone without the help of the attachment protein. Recent studies indicate that low pH is required for cell fusion promoted by some hMPV strains. The fusion protein of aMPV type A is highly fusogenic, whereas that of type B is low. The original fusion models for Paramyxovirus cannot explain the phenomenon above. The mechanism to regulate the cell fusion of Metapneumovirus is poorly understood. It is becoming a hot spot for the study of cell fusion triggered by Paramyxovirus where it enlarged the traditional scope of Paramyxovirus fusion. In this review, we discuss the new achievements and advances in the understanding of cell fusion triggered by Metapneumovirus.

Fusion plasma theory project summaries

NASA Astrophysics Data System (ADS)

1993-10-01

This Project Summary book is a published compilation consisting of short descriptions of each project supported by the Fusion Plasma Theory and Computing Group of the Advanced Physics and Technology Division of the Department of Energy, Office of Fusion Energy. The summaries contained in this volume were written by the individual contractors with minimal editing by the Office of Fusion Energy. Previous summaries were published in February of 1982 and December of 1987. The Plasma Theory program is responsible for the development of concepts and models that describe and predict the behavior of a magnetically confined plasma. Emphasis is given to the modelling and understanding of the processes controlling transport of energy and particles in a toroidal plasma and supporting the design of the International Thermonuclear Experimental Reactor (ITER). A tokamak transport initiative was begun in 1989 to improve understanding of how energy and particles are lost from the plasma by mechanisms that transport them across field lines. The Plasma Theory program has actively participated in this initiative. Recently, increased attention has been given to issues of importance to the proposed Tokamak Physics Experiment (TPX). Particular attention has been paid to containment and thermalization of fast alpha particles produced in a burning fusion plasma as well as control of sawteeth, current drive, impurity control, and design of improved auxiliary heating. In addition, general models of plasma behavior are developed from physics features common to different confinement geometries. This work uses both analytical and numerical techniques. The Fusion Theory program supports research projects at U.S. government laboratories, universities and industrial contractors. Its support of theoretical work at universities contributes to the office of Fusion Energy mission of training scientific manpower for the U.S. Fusion Energy Program.

Pre-fusion RSV F strongly boosts pre-fusion specific neutralizing responses in cattle pre-exposed to bovine RSV.

PubMed

Steff, Ann-Muriel; Monroe, James; Friedrich, Kristian; Chandramouli, Sumana; Nguyen, Thi Lien-Anh; Tian, Sai; Vandepaer, Sarah; Toussaint, Jean-François; Carfi, Andrea

2017-10-20

Human respiratory syncytial virus (hRSV) is responsible for serious lower respiratory tract disease in infants and in older adults, and remains an important vaccine need. RSV fusion (F) glycoprotein is a key target for neutralizing antibodies. RSV F stabilized in its pre-fusion conformation (DS-Cav1 F) induces high neutralizing antibody titers in naïve animals, but it remains unknown to what extent pre-fusion F can boost pre-existing neutralizing responses in RSV seropositive adults. We here assess DS-Cav1 F immunogenicity in seropositive cattle pre-exposed to bovine RSV, a virus closely related to hRSV. A single immunization with non-adjuvanted DS-Cav1 F strongly boosts RSV neutralizing responses, directed towards pre-fusion F-specific epitopes, whereas a post-fusion F is unable to do so. Vaccination with pre-fusion F thus represents a promising strategy for maternal immunization and for other RSV vaccine target populations such as older adults.

Studies of antibacterial efficacy of different biopolymer protected silver nanoparticles synthesized under reflux condition

NASA Astrophysics Data System (ADS)

Su, Chia Hung; Velusamy, Palaniyandi; Kumar, Govindarajan Venkat; Adhikary, Shritama; Pandian, Kannaiyan; Anbu, Periyasamy

2017-01-01

In the present study, a simple method to impregnate silver nanoparticles (AgNPs) into carboxymethyl cellulose (CMC) and sodium alginate (SA) is reported for the first time. Single step synthesis of carboxymethyl cellulose (CMC) and sodium alginate (SA) biopolymer protected silver nanoparticles (AgNPs) using aniline as a reducing agent under reflux conditions was investigated. The synthesized nanoparticles were characterized by UV-Vis spectrophotometry, X-ray diffraction (XRD), Fourier transform infrared spectroscopy (FTIR) and field emission scanning electron microscopy (FESEM). The FESEM results of CMC@AgNPs and SA@AgNPs showed the formation of spherical nanoparticles sized 30-60 nm. Testing of the antibiofilm efficacy of the polymer protected AgNPs against different bacterial strains such as Klebsiella pneumoniae MTCC 4032 and Streptococcus pyogenes MTCC 1924 revealed that the biopolymer protected AgNPs had excellent antibiofilm activity.

Bacterial mycophagy: definition and diagnosis of a unique bacterial-fungal interaction.

PubMed

Leveau, Johan H J; Preston, Gail M

2008-01-01

This review analyses the phenomenon of bacterial mycophagy, which we define as a set of phenotypic behaviours that enable bacteria to obtain nutrients from living fungi and thus allow the conversion of fungal into bacterial biomass. We recognize three types of bacterial strategies to derive nutrition from fungi: necrotrophy, extracellular biotrophy and endocellular biotrophy. Each is characterized by a set of uniquely sequential and differently overlapping interactions with the fungal target. We offer a detailed analysis of the nature of these interactions, as well as a comprehensive overview of methodologies for assessing and quantifying their individual contributions to the mycophagy phenotype. Furthermore, we discuss future prospects for the study and exploitation of bacterial mycophagy, including the need for appropriate tools to detect bacterial mycophagy in situ in order to be able to understand, predict and possibly manipulate the way in which mycophagous bacteria affect fungal activity, turnover, and community structure in soils and other ecosystems.

Helium Find Thaws the Cold Fusion Trail.

ERIC Educational Resources Information Center

Pennisi, E.

1991-01-01

Reported is a study of cold fusion in which trace amounts of helium, possible evidence of an actual fusion reaction, were found. Research methodology is detailed. The controversy over the validity of experimental results with cold fusion are reviewed. (CW)

Semiotic foundation for multisensor-multilook fusion

NASA Astrophysics Data System (ADS)

Myler, Harley R.

1998-07-01

This paper explores the concept of an application of semiotic principles to the design of a multisensor-multilook fusion system. Semiotics is an approach to analysis that attempts to process media in a united way using qualitative methods as opposed to quantitative. The term semiotic refers to signs, or signatory data that encapsulates information. Semiotic analysis involves the extraction of signs from information sources and the subsequent processing of the signs into meaningful interpretations of the information content of the source. The multisensor fusion problem predicated on a semiotic system structure and incorporating semiotic analysis techniques is explored and the design for a multisensor system as an information fusion system is explored. Semiotic analysis opens the possibility of using non-traditional sensor sources and modalities in the fusion process, such as verbal and textual intelligence derived from human observers. Examples of how multisensor/multimodality data might be analyzed semiotically is shown and discussion on how a semiotic system for multisensor fusion could be realized is outlined. The architecture of a semiotic multisensor fusion processor that can accept situational awareness data is described, although an implementation has not as yet been constructed.

Cellular damage in bacterial meningitis: an interplay of bacterial and host driven toxicity.

PubMed

Weber, Joerg R; Tuomanen, Elaine I

2007-03-01

Bacterial meningitis is still an important infectious disease causing death and disability. Invasive bacterial infections of the CNS generate some of the most powerful inflammatory responses known in medicine. Although the components of bacterial cell surfaces are now chemically defined in exquisite detail and the interaction with several receptor pathways has been discovered, it is only very recently that studies combining these advanced biochemical and cell biological tools have been done. Additional to the immunological response direct bacterial toxicity has been identified as an important contributor to neuronal damage. A detailed understanding of the complex interaction of bacterial toxicity and host response may generate opportunities for innovative and specific neuroprotective therapies.

SNARE-mediated membrane fusion in autophagy.

PubMed

Wang, Yongyao; Li, Linsen; Hou, Chen; Lai, Ying; Long, Jiangang; Liu, Jiankang; Zhong, Qing; Diao, Jiajie

2016-12-01

Autophagy, a conserved self-eating process for the bulk degradation of cytoplasmic materials, involves double-membrane autophagosomes formed when an isolation membrane emerges and their direct fusion with lysosomes for degradation. For the early biogenesis of autophagosomes and their later degradation in lysosomes, membrane fusion is necessary, although different sets of genes and autophagy-related proteins involved in distinct fusion steps have been reported. To clarify the molecular mechanism of membrane fusion in autophagy, to not only expand current knowledge of autophagy, but also benefit human health, this review discusses key findings that elucidate the unique membrane dynamics of autophagy. Copyright © 2016 Elsevier Ltd. All rights reserved.

Multifocus image fusion using phase congruency

NASA Astrophysics Data System (ADS)

Zhan, Kun; Li, Qiaoqiao; Teng, Jicai; Wang, Mingying; Shi, Jinhui

2015-05-01

We address the problem of fusing multifocus images based on the phase congruency (PC). PC provides a sharpness feature of a natural image. The focus measure (FM) is identified as strong PC near a distinctive image feature evaluated by the complex Gabor wavelet. The PC is more robust against noise than other FMs. The fusion image is obtained by a new fusion rule (FR), and the focused region is selected by the FR from one of the input images. Experimental results show that the proposed fusion scheme achieves the fusion performance of the state-of-the-art methods in terms of visual quality and quantitative evaluations.

Response to FESAC survey, non-fusion connections to Fusion Energy Sciences. Applications of the FES-supported beam and plasma simulation code, Warp

DOE Office of Scientific and Technical Information (OSTI.GOV)

Friedman, A.; Grote, D. P.; Vay, J. L.

2015-05-29

The Fusion Energy Sciences Advisory Committee’s subcommittee on non-fusion applications (FESAC NFA) is conducting a survey to obtain information from the fusion community about non-fusion work that has resulted from their DOE-funded fusion research. The subcommittee has requested that members of the community describe recent developments connected to the activities of the DOE Office of Fusion Energy Sciences. Two questions in particular were posed by the subcommittee. This document contains the authors’ responses to those questions.

Skyrme forces and decay of the Rf266*104 nucleus synthesized via different incoming channels

NASA Astrophysics Data System (ADS)

Niyti, Deep, Aman; Kharab, Rajesh; Chopra, Sahila; Gupta, Raj K.

2017-03-01

The excitation functions for the production of 262Rf, 261Rf, and 260Rf isotopes via 4 n -, 5 n -, and 6 n -decay channels from the *266Rf compound nucleus are studied within the dynamical cluster-decay model (DCM), including deformations β2 i and so-called hot-optimum orientations θi which support symmetric fission, in agreement with experiments. The data are available for 18O+248Cm and 22Ne+244Pu reactions, respectively, at the energy ranges of Elab=88.2 to 101.3 and 109.0 to 124.8 MeV. For the nuclear interaction potentials, we use the Skyrme energy density functional (SEDF) based on semiclassical extended Thomas Fermi (ETF) approach, which means an extension of the earlier study of excitation functions of *266Rf formed in 18O+248Cm reaction, based on the DCM using the pocket formula for nuclear proximity potential, showing interaction dependence. The Skyrme forces used here are the old SIII and SIV and new GSkI and KDE0(v1) given for both normal and isospin-rich nuclei, with densities added in frozen density approximation. Interestingly, the DCM gives an excellent fit to the measured data on fusion evaporation residue (ER) for both the incoming channels (18O+248Cm and 22Ne+244Pu ) at the energy range Elab=88.2 to 124.8 MeV, independent of the entrance channel and Skyrme force used. The possible fusion-fission (ff) and quasifission (qf) mass regions of fragments on DCM are also predicted. The DCM with Skyrme forces is further used to look for all the possible target-projectile (t-p) combinations forming the cold compound nucleus (CN) *266Rf at the CN excitation energy of Elab for hot compact configurations. The fusion evaporation residue cross sections, for the proposed new reactions in synthesizing the CN *266Rf, are also estimated for the future experiments, and role of mass asymmetry of nuclei is indicated.

Spherical torus fusion reactor

DOEpatents

Peng, Yueng-Kay M.

1989-04-04

A fusion reactor is provided having a near spherical-shaped plasma with a modest central opening through which straight segments of toroidal field coils extend that carry electrical current for generating a toroidal magnet plasma confinement fields. By retaining only the indispensable components inboard of the plasma torus, principally the cooled toroidal field conductors and in some cases a vacuum containment vessel wall, the fusion reactor features an exceptionally small aspect ratio (typically about 1.5), a naturally elongated plasma cross section without extensive field shaping, requires low strength magnetic containment fields, small size and high beta. These features combine to produce a spherical torus plasma in a unique physics regime which permits compact fusion at low field and modest cost.

Spherical torus fusion reactor

DOEpatents

Peng, Yueng-Kay M.

1989-01-01

A fusion reactor is provided having a near spherical-shaped plasma with a modest central opening through which straight segments of toroidal field coils extend that carry electrical current for generating a toroidal magnet plasma confinement fields. By retaining only the indispensable components inboard of the plasma torus, principally the cooled toroidal field conductors and in some cases a vacuum containment vessel wall, the fusion reactor features an exceptionally small aspect ratio (typically about 1.5), a naturally elongated plasma cross section without extensive field shaping, requires low strength magnetic containment fields, small size and high beta. These features combine to produce a spherical torus plasma in a unique physics regime which permits compact fusion at low field and modest cost.

Simulation of Fusion Plasmas

ScienceCinema

Holland, Chris [UC San Diego, San Diego, California, United States

2017-12-09

The upcoming ITER experiment (www.iter.org) represents the next major milestone in realizing the promise of using nuclear fusion as a commercial energy source, by moving into the “burning plasma” regime where the dominant heat source is the internal fusion reactions. As part of its support for the ITER mission, the US fusion community is actively developing validated predictive models of the behavior of magnetically confined plasmas. In this talk, I will describe how the plasma community is using the latest high performance computing facilities to develop and refine our models of the nonlinear, multiscale plasma dynamics, and how recent advances in experimental diagnostics are allowing us to directly test and validate these models at an unprecedented level.

Characterization, antibacterial, and neurotoxic effect of Green synthesized nanosilver using Ziziphus spina Christi aqueous leaf extract collected from Riyadh, Saudi Arabia

NASA Astrophysics Data System (ADS)

El-Ansary, Afaf; Warsy, Arjumand; Daghestani, Maha; Merghani, Nada M.; Al-Dbass, Abeer; Bukhari, Wadha; Al-Ojayan, Badryah; Ibrahim, Eiman M.; Al-Qahtani, Asma M.; Shafi Bhat, Ramesa

2018-02-01

The current study aims to synthesize silver nanoparticles using Ziziphus spina Christi (ZSC) or (Sidr) aqueous leaf extract collected from Riyadh, Saudi Arabia. The green synthesis of silver nanoparticles using sidr leaves extract was successful. Production of silver nanoparticles was confirmed through UV-vis Spectrophotometer, particles size and zeta potential analysis, Infra-red spectroscopy, Scanning, and Transmission Electron Microscope (SEM and TEM). The UV-visible spectra showed that the absorption peak existed at 400 nm. SEM analysis showed that the synthesized AgNPs were spherical but in slightly aggregated form. TEM demonstrated different size range of 4-33 nm with an average size of 13. The element analysis profile showed silver signal together with oxygen, calcium, and potassium peaks which might be related to the plant structure. Biological effects of the synthesized AgNPs exhibit satisfactory inhibitory effect against ten tested microorganisms. It inhibited the growth of 5 gram-positive and five gram-negative bacteria. Moreover, AgNPs demonstrated a synergistic effect on the neurotoxicity induced in rat pups with orally administered methyl mercury (MeHg). The present study showed that AgNPs prepared from ZSC might be a promising antimicrobial agent for successful treatment of bacterial infection in intensive care units (ICU) especially in case of antibiotic resistance.

Statistical algorithms improve accuracy of gene fusion detection

PubMed Central

Hsieh, Gillian; Bierman, Rob; Szabo, Linda; Lee, Alex Gia; Freeman, Donald E.; Watson, Nathaniel; Sweet-Cordero, E. Alejandro

2017-01-01

Abstract Gene fusions are known to play critical roles in tumor pathogenesis. Yet, sensitive and specific algorithms to detect gene fusions in cancer do not currently exist. In this paper, we present a new statistical algorithm, MACHETE (Mismatched Alignment CHimEra Tracking Engine), which achieves highly sensitive and specific detection of gene fusions from RNA-Seq data, including the highest Positive Predictive Value (PPV) compared to the current state-of-the-art, as assessed in simulated data. We show that the best performing published algorithms either find large numbers of fusions in negative control data or suffer from low sensitivity detecting known driving fusions in gold standard settings, such as EWSR1-FLI1. As proof of principle that MACHETE discovers novel gene fusions with high accuracy in vivo, we mined public data to discover and subsequently PCR validate novel gene fusions missed by other algorithms in the ovarian cancer cell line OVCAR3. These results highlight the gains in accuracy achieved by introducing statistical models into fusion detection, and pave the way for unbiased discovery of potentially driving and druggable gene fusions in primary tumors. PMID:28541529

Full-Length Trimeric Influenza Virus Hemagglutinin II Membrane Fusion Protein and Shorter Constructs Lacking the Fusion Peptide or Transmembrane Domain: Hyperthermostability of the Full-Length Protein and the Soluble Ectodomain and Fusion Peptide Make Significant Contributions to Fusion of Membrane Vesicles†

PubMed Central

Ratnayake, Punsisi U.; Ekanayaka, E. A. Prabodha; Komanduru, Sweta S.; Weliky, David P.

2015-01-01

Influenza virus is a Class I enveloped virus which is initially endocytosed into a host respiratory epithelial cell. Subsequent reduction of the pH to the 5–6 range triggers a structural change of the viral hemagglutinin II (HA2) protein, fusion of the viral and endosomal membranes, and release of the viral nucleocapsid into the cytoplasm. HA2 contains fusion peptide (FP), soluble ectodomain (SE), transmembrane (TM), and intraviral domains with respective lengths of ~25, ~160, ~25, and ~10 residues. The present work provides a straightforward protocol for producing and purifying mg quantities of full-length HA2 from expression in bacteria. Biophysical and structural comparisons are made between full-length HA2 and shorter constructs including SHA2 ≡ SE, FHA2 ≡ FP + SE, and SHA2-TM ≡ SE + TM constructs. The constructs are helical in detergent at pH 7.4 and the dominant trimer species. The proteins are highly thermostable in decylmaltoside detergent with Tm > 90 °C for HA2 with stabilization provided by the SE, FP, and TM domains. The proteins are likely in a trimer-of-hairpins structure, the final protein state during fusion. All constructs induce fusion of negatively-charged vesicles at pH 5.0 with much less fusion at pH 7.4. Attractive protein/vesicle electrostatics play a role in fusion, as the proteins are positively-charged at pH 5.0 and negatively-charged at pH 7.4 and the pH-dependence of fusion is reversed for positively-charged vesicles. Comparison of fusion between constructs supports significant contributions to fusion from the SE and the FP with little effect from the TM. PMID:26297995

Full-length trimeric influenza virus hemagglutinin II membrane fusion protein and shorter constructs lacking the fusion peptide or transmembrane domain: Hyperthermostability of the full-length protein and the soluble ectodomain and fusion peptide make significant contributions to fusion of membrane vesicles.

PubMed

Ratnayake, Punsisi U; Prabodha Ekanayaka, E A; Komanduru, Sweta S; Weliky, David P

2016-01-01

Influenza virus is a class I enveloped virus which is initially endocytosed into a host respiratory epithelial cell. Subsequent reduction of the pH to the 5-6 range triggers a structural change of the viral hemagglutinin II (HA2) protein, fusion of the viral and endosomal membranes, and release of the viral nucleocapsid into the cytoplasm. HA2 contains fusion peptide (FP), soluble ectodomain (SE), transmembrane (TM), and intraviral domains with respective lengths of ∼ 25, ∼ 160, ∼ 25, and ∼ 10 residues. The present work provides a straightforward protocol for producing and purifying mg quantities of full-length HA2 from expression in bacteria. Biophysical and structural comparisons are made between full-length HA2 and shorter constructs including SHA2 ≡ SE, FHA2 ≡ FP+SE, and SHA2-TM ≡ SE+TM constructs. The constructs are helical in detergent at pH 7.4 and the dominant trimer species. The proteins are highly thermostable in decylmaltoside detergent with Tm>90 °C for HA2 with stabilization provided by the SE, FP, and TM domains. The proteins are likely in a trimer-of-hairpins structure, the final protein state during fusion. All constructs induce fusion of negatively-charged vesicles at pH 5.0 with much less fusion at pH 7.4. Attractive protein/vesicle electrostatics play a role in fusion, as the proteins are positively-charged at pH 5.0 and negatively-charged at pH 7.4 and the pH-dependence of fusion is reversed for positively-charged vesicles. Comparison of fusion between constructs supports significant contributions to fusion from the SE and the FP with little effect from the TM. Copyright © 2015 Elsevier Inc. All rights reserved.

Transition Metal Nanomaterials by Bacterial Precipitation: Synthesis and Characterization of Cadmium Sulfide Quantum Dots

NASA Astrophysics Data System (ADS)

Marusak, Katherine Elizabeth

We present a new method to fabricate semiconducting, transition metal nanoparticles (NPs) with tunable bandgap energies using engineered Escherichia coli. These bacteria overexpress the Treponema denticola cysteine desulfhydrase gene to facilitate precipitation of cadmium sulfide (CdS) NPs. Multiple characterization techniques reveal that the bacterially precipitated NPs are agglomerates of mostly quantum dots, with diameters that can range from 3 to 15 nm, embedded in a carbon-rich matrix. Notably, the measured photoelectrochemical current generated by these NPs is comparable to values reported in the literature and higher than that of synthesized chemical bath deposited CdS NPs. We showed that we can manipulate the bandgap energy of the NPs by controlling their size through varying the precursor concentrations. Our calculated bandgap energies ranged between 2.67 eV (i.e., quantum confined CdS) to 2.36 eV ( i.e., bulk CdS). By adding the CdCl2 precursor at a specific stage of the bacterial growth cycle, we were able to induce extracellular CdS NP precipitation. Additionally, we adapted extracellular precipitation strategies to form CdS NPs on surfaces as bacterial/PC membrane composites and characterized them by spectroscopic and imaging methods, including energy dispersive spectroscopy, and scanning and transmission electron microscopy. This method allowed us to control the localization of NP precipitation throughout the layered bacterial/membrane composite, by varying the timing of the cadmium precursor addition. Additionally, we demonstrated the photodegradation of methyl orange using the CdS functionalized porous membranes, thus confirming the photocatalytic properties of our composites for eventual translation to device development. We finally also explored the precipitation of other metallic NPs using our bacterial system, using enzyme extracted from our bacterial system, and using commercially available, his-tagged enzyme. We hope to extend this research to

Tensor functors between Morita duals of fusion categories

NASA Astrophysics Data System (ADS)

Galindo, César; Plavnik, Julia Yael

2017-03-01

Given a fusion category C and an indecomposable C -module category M , the fusion category C^*_{_{M}} of C-module endofunctors of M is called the (Morita) dual fusion category of C with respect to M . We describe tensor functors between two arbitrary duals C^*_{_{M}} and D^*_N in terms of data associated to C and D . We apply the results to G-equivariantizations of fusion categories and group-theoretical fusion categories. We describe the orbits of the action of the Brauer-Picard group on the set of module categories and we propose a categorification of the Rosenberg-Zelinsky sequence for fusion categories.

Bacterial surface adaptation

NASA Astrophysics Data System (ADS)

Utada, Andrew

2014-03-01

Biofilms are structured multi-cellular communities that are fundamental to the biology and ecology of bacteria. Parasitic bacterial biofilms can cause lethal infections and biofouling, but commensal bacterial biofilms, such as those found in the gut, can break down otherwise indigestible plant polysaccharides and allow us to enjoy vegetables. The first step in biofilm formation, adaptation to life on a surface, requires a working knowledge of low Reynolds number fluid physics, and the coordination of biochemical signaling, polysaccharide production, and molecular motility motors. These crucial early stages of biofilm formation are at present poorly understood. By adapting methods from soft matter physics, we dissect bacterial social behavior at the single cell level for several prototypical bacterial species, including Pseudomonas aeruginosa and Vibrio cholerae.

Grounding Lines Detecting Using LANDSAT8 Oli and CRYOSAT-2 Data Fusion

NASA Astrophysics Data System (ADS)

Li, F.; Guo, Y.; Zhang, Y.; Zhang, S.

2018-04-01

The grounding zone is the region where ice transitions from grounded ice sheet to freely floating ice shelf, grounding lines are actually more of a zone, typically over several kilometers. The mass loss from Antarctica is strongly linked to changes in the ice shelves and their grounding lines, since the variation in the grounding line can result in very rapid changes in glacier and ice-shelf behavior. Based on remote sensing observations, five global Antarctic grounding line products have been released internationally, including MOA, ASAID, ICESat, MEaSUREs, and Synthesized grounding lines. However, the five products could not provide the annual grounding line products of the whole Antarctic, even some products have stopped updating, which limits the time series analysis of Antarctic material balance to a certain extent. Besides, the accurate of single remote-sensing data based grounding line products is far from satisficed. Therefore, we use algorithms to extract grounding lines with SAR and Cryosat-2 data respectively, and combine the results of two kinds of grounding lines to obtain new products, we obtain a mature grounding line extraction algorithm process, so that we can realize the extraction of grounding line of the Antarctic each year in the future. The comparison between fusion results and the MOA product results indicate that there is a maximum deviation of 188.67 meters between the MOA product and the fusion result.

Marker-Based Multi-Sensor Fusion Indoor Localization System for Micro Air Vehicles.

PubMed

Xing, Boyang; Zhu, Quanmin; Pan, Feng; Feng, Xiaoxue

2018-05-25

A novel multi-sensor fusion indoor localization algorithm based on ArUco marker is designed in this paper. The proposed ArUco mapping algorithm can build and correct the map of markers online with Grubbs criterion and K-mean clustering, which avoids the map distortion due to lack of correction. Based on the conception of multi-sensor information fusion, the federated Kalman filter is utilized to synthesize the multi-source information from markers, optical flow, ultrasonic and the inertial sensor, which can obtain a continuous localization result and effectively reduce the position drift due to the long-term loss of markers in pure marker localization. The proposed algorithm can be easily implemented in a hardware of one Raspberry Pi Zero and two STM32 micro controllers produced by STMicroelectronics (Geneva, Switzerland). Thus, a small-size and low-cost marker-based localization system is presented. The experimental results show that the speed estimation result of the proposed system is better than Px4flow, and it has the centimeter accuracy of mapping and positioning. The presented system not only gives satisfying localization precision, but also has the potential to expand other sensors (such as visual odometry, ultra wideband (UWB) beacon and lidar) to further improve the localization performance. The proposed system can be reliably employed in Micro Aerial Vehicle (MAV) visual localization and robotics control.

EDITORIAL: Plasma Surface Interactions for Fusion

NASA Astrophysics Data System (ADS)

2006-05-01

Because plasma-boundary physics encompasses some of the most important unresolved issues for both the International Thermonuclear Experimental Reactor (ITER) project and future fusion power reactors, there is a strong interest in the fusion community for better understanding and characterization of plasma wall interactions. Chemical and physical sputtering cause the erosion of the limiters/divertor plates and vacuum vessel walls (made of C, Be and W, for example) and degrade fusion performance by diluting the fusion fuel and excessively cooling the core, while carbon redeposition could produce long-term in-vessel tritium retention, degrading the superior thermo-mechanical properties of the carbon materials. Mixed plasma-facing materials are proposed, requiring optimization for different power and particle flux characteristics. Knowledge of material properties as well as characteristics of the plasma material interaction are prerequisites for such optimizations. Computational power will soon reach hundreds of teraflops, so that theoretical and plasma science expertise can be matched with new experimental capabilities in order to mount a strong response to these challenges. To begin to address such questions, a Workshop on New Directions for Advanced Computer Simulations and Experiments in Fusion-Related Plasma Surface Interactions for Fusion (PSIF) was held at the Oak Ridge National Laboratory from 21 to 23 March, 2005. The purpose of the workshop was to bring together researchers in fusion related plasma wall interactions in order to address these topics and to identify the most needed and promising directions for study, to exchange opinions on the present depth of knowledge of surface properties for the main fusion-related materials, e.g., C, Be and W, especially for sputtering, reflection, and deuterium (tritium) retention properties. The goal was to suggest the most important next steps needed for such basic computational and experimental work to be facilitated

High-level expression and purification of heparin-binding epidermal growth factor (HB-EGF) with SUMO fusion.

PubMed

Lu, Wuguang; Cao, Peng; Lei, Huangzong; Zhang, Shuangquan

2010-03-01

Heparin-binding epidermal growth factor (HB-EGF) can stimulate the division of various cell types and has potential clinical applications that stimulate growth and differentiation. HB-EGF has an EGF-like domain typical of all members of the EGF family. The high expression of active HB-EGF in Escherichia coli has not been successful as the protein contains three intra-molecular disulfide bonds, the same as other members of the EGF super family that are difficult to form correctly in the bacterial intracellular environment. This work fused the non-glycosylated HB-EGF gene with a small ubiquitin-related modifier gene (SUMO) by over-lap PCR. The resulting fusion gene SUMO-HBEGF was highly expressed in BL21(DE3) that the soluble SUMO-HBEGF was up to 30% of the total cellular protein. The fusion protein was purified by Ni-NTA affinity chromatography and cleaved by a SUMO-specific protease Ulp1 to obtain the native HB-EGF, which was further purified by Ni-NTA affinity chromatography. MTT assays indicated the purified HB-EGF, as well as SUMO-HBEGF, had mitogenic activity in a dose-dependent manner.

Tobramycin mediated silver nanospheres/graphene oxide composite for synergistic therapy of bacterial infection.

PubMed

Ullah, Sadeeq; Ahmad, Aftab; Subhan, Fazli; Jan, Aminullah; Raza, Muslim; Khan, Arif Ullah; Rahman, Aziz-Ur; Khan, Usman Ali; Tariq, Muhammad; Yuan, Qipeng

2018-06-01

Graphene-based materials have attracted a significant attention in constructing hybrid systems for drug delivery with enhanced antimicrobial activities. In our work, we demonstrated the formation of silver nanoparticles (AgNPs) on graphene oxide (GO) using tobramycin (TOB), an aminoglycoside antibiotic, as reducing and decorating agent. The TOB decorated GO AgNPs (TOB-GO-Ag) composite was used as an antibacterial agent against multi-drug resistant Gram-negative E-coli (BL21 DE3). The reversal of surface potential from -30 mV (GO) to +20 mV confirms the successful reduction of GO by TOB. Atomic force microscopy (AFM) and high-resolution transmission electron microscopic (HRTEM) analyses confirmed the formation of uniformly distributed AgNPs on the reduced GO with an approximate particle size of 5 nm. The as-synthesized nanocomposite displayed significant antibacterial activity as compared to pure AgNPs and TOB. The positively charged TOB-GO-Ag interacts with the negatively charged E. coli membrane and inhibit bacterial growth by the antibacterial actions of the released silver, GO and tobramycin from the TOB-GO-Ag composite. The significant loss of bacterial membrane potential from -52 ± 2 mV (control) to -2 ± 1 mV (treated) indicates a severe cell wall damage caused by TOB-GO-Ag composite. Furthermore, fluorescence study also demonstrated a severe membrane disruption in bacterial cells treated with TOB-GO-Ag composite as compared to pure AgNPs and GO. In conclusion, the development of such hybrid systems would help in enhancing the efficacy of available drugs and eradicating the emerging bacterial resistance. Copyright © 2018 Elsevier B.V. All rights reserved.

C-reactive Protein Versus Neutrophil/lymphocyte Ratio in Differentiating Bacterial and Non-bacterial Pneumonia in Children.

PubMed

Gauchan, E; Adhikari, S

2016-09-01

Pneumonia is a leading cause of childhood mortality in a low resource country. Simple laboratory markers can help differentiate between bacterial and non-bacterial pneumonias for appropriate management. In children aged one to 60 months with features of lower respiratory infection, C-reactive protein (CRP) and neutrophil-lymphocyte ratio (NLR) were used to differentiate between bacterial and non-bacterial pneumonias. The cutoff values for detecting bacterial pneumonias were evaluated by statistical tools. Bacterial pneumonia was diagnosed in 285 (43.6%) children out of 654 studied. At a cut-off value of 36 mg/L CRP was predictive of bacterial pneumonias with sensitivity and specificity of 61.8% and 91.3% respectively while the sensitivity and specificity for predicting bacterial pneumonia using NLR was 45.6% and 64% respectively with 1.28 used as a cut-off. Our study shows that CRP is superior to NLR in differentiating bacterial from non-bacterial pneumonias in children.

Revisions to the JDL data fusion model

NASA Astrophysics Data System (ADS)

Steinberg, Alan N.; Bowman, Christopher L.; White, Franklin E.

1999-03-01

The Data Fusion Model maintained by the Joint Directors of Laboratories (JDL) Data Fusion Group is the most widely-used method for categorizing data fusion-related functions. This paper discusses the current effort to revise the expand this model to facilitate the cost-effective development, acquisition, integration and operation of multi- sensor/multi-source systems. Data fusion involves combining information - in the broadest sense - to estimate or predict the state of some aspect of the universe. These may be represented in terms of attributive and relational states. If the job is to estimate the state of a people, it can be useful to include consideration of informational and perceptual states in addition to the physical state. Developing cost-effective multi-source information systems requires a method for specifying data fusion processing and control functions, interfaces, and associate databases. The lack of common engineering standards for data fusion systems has been a major impediment to integration and re-use of available technology: current developments do not lend themselves to objective evaluation, comparison or re-use. This paper reports on proposed revisions and expansions of the JDL Data FUsion model to remedy some of these deficiencies. This involves broadening the functional model and related taxonomy beyond the original military focus, and integrating the Data Fusion Tree Architecture model for system description, design and development.

Emerging therapeutic delivery capabilities and challenges utilizing enzyme/protein packaged bacterial vesicles.

PubMed

Alves, Nathan J; Turner, Kendrick B; Medintz, Igor L; Walper, Scott A

2015-07-01

Nanoparticle-based therapeutics are poised to play a critical role in treating disease. These complex multifunctional drug delivery vehicles provide for the passive and active targeted delivery of numerous small molecule, peptide and protein-derived pharmaceuticals. This article will first discuss some of the current state of the art nanoparticle classes (dendrimers, lipid-based, polymeric and inorganic), highlighting benefits/drawbacks associated with their implementation. We will then discuss an emerging class of nanoparticle therapeutics, bacterial outer membrane vesicles, that can provide many of the nanoparticle benefits while simplifying assembly. Through molecular biology techniques; outer membrane vesicle hijacking potentially allows for stringent control over nanoparticle production allowing for targeted protein packaged nanoparticles to be fully synthesized by bacteria.

A New Approach to Image Fusion Based on Cokriging

NASA Technical Reports Server (NTRS)

Memarsadeghi, Nargess; LeMoigne, Jacqueline; Mount, David M.; Morisette, Jeffrey T.

2005-01-01

We consider the image fusion problem involving remotely sensed data. We introduce cokriging as a method to perform fusion. We investigate the advantages of fusing Hyperion with ALI. The evaluation is performed by comparing the classification of the fused data with that of input images and by calculating well-chosen quantitative fusion quality metrics. We consider the Invasive Species Forecasting System (ISFS) project as our fusion application. The fusion of ALI with Hyperion data is studies using PCA and wavelet-based fusion. We then propose utilizing a geostatistical based interpolation method called cokriging as a new approach for image fusion.

On the path to fusion energy

NASA Astrophysics Data System (ADS)

Tabak, M.

2016-10-01

There is a need to develop alternate energy sources in the coming century because fossil fuels will become depleted and their use may lead to global climate change. Inertial fusion can become such an energy source, but significant progress must be made before its promise is realized. The high-density approach to inertial fusion suggested by Nuckolls et al. leads reaction chambers compatible with civilian power production. Methods to achieve the good control of hydrodynamic stability and implosion symmetry required to achieve these high fuel densities will be discussed. Fast Ignition, a technique that achieves fusion ignition by igniting fusion fuel after it is assembled, will be described along with its gain curves. Fusion costs of energy for conventional hotspot ignition will be compared with those of Fast Ignition and their capital costs compared with advanced fission plants. Finally, techniques that may improve possible Fast Ignition gains by an order of magnitude and reduce driver scales by an order of magnitude below conventional ignition requirements are described.

Maltose-Binding Protein Enhances Secretion of Recombinant Human Granzyme B Accompanied by In Vivo Processing of a Precursor MBP Fusion Protein

PubMed Central

Dälken, Benjamin; Jabulowsky, Robert A.; Oberoi, Pranav; Benhar, Itai; Wels, Winfried S.

2010-01-01

Background The apoptosis-inducing serine protease granzyme B (GrB) is an important factor contributing to lysis of target cells by cytotoxic lymphocytes. Expression of enzymatically active GrB in recombinant form is a prerequisite for functional analysis and application of GrB for therapeutic purposes. Methods and Findings We investigated the influence of bacterial maltose-binding protein (MBP) fused to GrB via a synthetic furin recognition motif on the expression of the MBP fusion protein also containing an N-terminal α-factor signal peptide in the yeast Pichia pastoris. MBP markedly enhanced the amount of GrB secreted into culture supernatant, which was not the case when GrB was fused to GST. MBP-GrB fusion protein was cleaved during secretion by an endogenous furin-like proteolytic activity in vivo, liberating enzymatically active GrB without the need of subsequent in vitro processing. Similar results were obtained upon expression of a recombinant fragment of the ErbB2/HER2 receptor protein or GST as MBP fusions. Conclusions Our results demonstrate that combination of MBP as a solubility enhancer with specific in vivo cleavage augments secretion of processed and functionally active proteins from yeast. This strategy may be generally applicable to improve folding and increase yields of recombinant proteins. PMID:21203542

Fusion welding process

DOEpatents

Thomas, Kenneth C.; Jones, Eric D.; McBride, Marvin A.

1983-01-01

A process for the fusion welding of nickel alloy steel members wherein a ferrite containing pellet is inserted into a cavity in one member and melted by a welding torch. The resulting weld nugget, a fusion of the nickel containing alloy from the members to be welded and the pellet, has a composition which is sufficiently low in nickel content such that ferrite phases occur within the weld nugget, resulting in improved weld properties. The steel alloys encompassed also include alloys containing carbon and manganese, considered nickel equivalents.

Spring-Loaded Model Revisited: Paramyxovirus Fusion Requires Engagement of a Receptor Binding Protein beyond Initial Triggering of the Fusion Protein▿

PubMed Central

Porotto, Matteo; DeVito, Ilaria; Palmer, Samantha G.; Jurgens, Eric M.; Yee, Jia L.; Yokoyama, Christine C.; Pessi, Antonello; Moscona, Anne

2011-01-01

During paramyxovirus entry into a host cell, receptor engagement by a specialized binding protein triggers conformational changes in the adjacent fusion protein (F), leading to fusion between the viral and cell membranes. According to the existing paradigm of paramyxovirus membrane fusion, the initial activation of F by the receptor binding protein sets off a spring-loaded mechanism whereby the F protein progresses independently through the subsequent steps in the fusion process, ending in membrane merger. For human parainfluenza virus type 3 (HPIV3), the receptor binding protein (hemagglutinin-neuraminidase [HN]) has three functions: receptor binding, receptor cleaving, and activating F. We report that continuous receptor engagement by HN activates F to advance through the series of structural rearrangements required for fusion. In contrast to the prevailing model, the role of HN-receptor engagement in the fusion process is required beyond an initiating step, i.e., it is still required even after the insertion of the fusion peptide into the target cell membrane, enabling F to mediate membrane merger. We also report that for Nipah virus, whose receptor binding protein has no receptor-cleaving activity, the continuous stimulation of the F protein by a receptor-engaged binding protein is key for fusion. We suggest a general model for paramyxovirus fusion activation in which receptor engagement plays an active role in F activation, and the continued engagement of the receptor binding protein is essential to F protein function until the onset of membrane merger. This model has broad implications for the mechanism of paramyxovirus fusion and for strategies to prevent viral entry. PMID:21976650

Spring-loaded model revisited: paramyxovirus fusion requires engagement of a receptor binding protein beyond initial triggering of the fusion protein.

PubMed

Porotto, Matteo; Devito, Ilaria; Palmer, Samantha G; Jurgens, Eric M; Yee, Jia L; Yokoyama, Christine C; Pessi, Antonello; Moscona, Anne

2011-12-01

During paramyxovirus entry into a host cell, receptor engagement by a specialized binding protein triggers conformational changes in the adjacent fusion protein (F), leading to fusion between the viral and cell membranes. According to the existing paradigm of paramyxovirus membrane fusion, the initial activation of F by the receptor binding protein sets off a spring-loaded mechanism whereby the F protein progresses independently through the subsequent steps in the fusion process, ending in membrane merger. For human parainfluenza virus type 3 (HPIV3), the receptor binding protein (hemagglutinin-neuraminidase [HN]) has three functions: receptor binding, receptor cleaving, and activating F. We report that continuous receptor engagement by HN activates F to advance through the series of structural rearrangements required for fusion. In contrast to the prevailing model, the role of HN-receptor engagement in the fusion process is required beyond an initiating step, i.e., it is still required even after the insertion of the fusion peptide into the target cell membrane, enabling F to mediate membrane merger. We also report that for Nipah virus, whose receptor binding protein has no receptor-cleaving activity, the continuous stimulation of the F protein by a receptor-engaged binding protein is key for fusion. We suggest a general model for paramyxovirus fusion activation in which receptor engagement plays an active role in F activation, and the continued engagement of the receptor binding protein is essential to F protein function until the onset of membrane merger. This model has broad implications for the mechanism of paramyxovirus fusion and for strategies to prevent viral entry.

Conserved Glycine Residues in the Fusion Peptide of the Paramyxovirus Fusion Protein Regulate Activation of the Native State

PubMed Central

Russell, Charles J.; Jardetzky, Theodore S.; Lamb, Robert A.

2004-01-01

Hydrophobic fusion peptides (FPs) are the most highly conserved regions of class I viral fusion-mediating glycoproteins (vFGPs). FPs often contain conserved glycine residues thought to be critical for forming structures that destabilize target membranes. Unexpectedly, a mutation of glycine residues in the FP of the fusion (F) protein from the paramyxovirus simian parainfluenza virus 5 (SV5) resulted in mutant F proteins with hyperactive fusion phenotypes (C. M. Horvath and R. A. Lamb, J. Virol. 66:2443-2455, 1992). Here, we constructed G3A and G7A mutations into the F proteins of SV5 (W3A and WR isolates), Newcastle disease virus (NDV), and human parainfluenza virus type 3 (HPIV3). All of the mutant F proteins, except NDV G7A, caused increased cell-cell fusion despite having slight to moderate reductions in cell surface expression compared to those of wild-type F proteins. The G3A and G7A mutations cause SV5 WR F, but not NDV F or HPIV3 F, to be triggered to cause fusion in the absence of coexpression of its homotypic receptor-binding protein hemagglutinin-neuraminidase (HN), suggesting that NDV and HPIV3 F have stricter requirements for homotypic HN for fusion activation. Dye transfer assays show that the G3A and G7A mutations decrease the energy required to activate F at a step in the fusion cascade preceding prehairpin intermediate formation and hemifusion. Conserved glycine residues in the FP of paramyxovirus F appear to have a primary role in regulating the activation of the metastable native form of F. Glycine residues in the FPs of other class I vFGPs may also regulate fusion activation. PMID:15564482

Feature level fusion of hand and face biometrics

NASA Astrophysics Data System (ADS)

Ross, Arun A.; Govindarajan, Rohin

2005-03-01

Multibiometric systems utilize the evidence presented by multiple biometric sources (e.g., face and fingerprint, multiple fingers of a user, multiple matchers, etc.) in order to determine or verify the identity of an individual. Information from multiple sources can be consolidated in several distinct levels, including the feature extraction level, match score level and decision level. While fusion at the match score and decision levels have been extensively studied in the literature, fusion at the feature level is a relatively understudied problem. In this paper we discuss fusion at the feature level in 3 different scenarios: (i) fusion of PCA and LDA coefficients of face; (ii) fusion of LDA coefficients corresponding to the R,G,B channels of a face image; (iii) fusion of face and hand modalities. Preliminary results are encouraging and help in highlighting the pros and cons of performing fusion at this level. The primary motivation of this work is to demonstrate the viability of such a fusion and to underscore the importance of pursuing further research in this direction.

Fusion Power.

ERIC Educational Resources Information Center

Dingee, David A.

1979-01-01

Discusses the extraordinary potential, the technical difficulties, and the financial problems that are associated with research and development of fusion power plants as a major source of energy. (GA)

Local electrostatic interactions determine the diameter of fusion pores

PubMed Central

Guček, Alenka; Jorgačevski, Jernej; Górska, Urszula; Rituper, Boštjan; Kreft, Marko; Zorec, Robert

2015-01-01

In regulated exocytosis vesicular and plasma membranes merge to form a fusion pore in response to stimulation. The nonselective cation HCN channels are involved in the regulation of unitary exocytotic events by at least 2 mechanisms. They can affect SNARE-dependent exocytotic activity indirectly, via the modulation of free intracellular calcium; and/or directly, by altering local cation concentration, which affects fusion pore geometry likely via electrostatic interactions. By monitoring membrane capacitance, we investigated how extracellular cation concentration affects fusion pore diameter in pituitary cells and astrocytes. At low extracellular divalent cation levels predominantly transient fusion events with widely open fusion pores were detected. However, fusion events with predominately narrow fusion pores were present at elevated levels of extracellular trivalent cations. These results show that electrostatic interactions likely help determine the stability of discrete fusion pore states by affecting fusion pore membrane composition. PMID:25835258

pH-Sensitive Liposomes: Acid-Induced Liposome Fusion

NASA Astrophysics Data System (ADS)

Connor, Jerome; Yatvin, Milton B.; Huang, Leaf

1984-03-01

Sonicated unilamellar liposomes containing phosphatidylethanolamine and palmitoylhomocysteine fuse rapidly when the medium pH is lowered from 7 to 5. Liposome fusion was demonstrated by (i) mixing of the liposomal lipids as shown by resonance energy transfer, (ii) gel filtration, and (iii) electron microscopy. The pH-sensitive fusion of liposomes was observed only when palmitoylhomocysteine (>= 20 mol%) was present in the liposomes. The presence of phosphatidyl-ethanolamine in the liposomes greatly enhanced fusion whereas the presence of phosphatidylcholine inhibited fusion. During fusion of liposomes containing phosphatidylethanolamine and palmitoylhomocysteine (8:2, mol/mol), almost all of the encapsulated calcein was released. Inclusion of cholesterol (40 mol%) in the liposomes substantially decreased leakage without impairing fusion.

Possible application of electromagnetic guns to impact fusion

NASA Astrophysics Data System (ADS)

Kostoff, R. N.; Peaslee, A. T., Jr.; Ribe, F. L.

1982-01-01

The possible application of electromagnetic guns to impact fusion for the generation of electric power is discussed, and advantages of impact fusion over the more conventional inertial confinement fusion concepts are examined. It is shown that impact fusion can achieve the necessary high yields, of the order of a few gigajoules, which are difficult to achieve with lasers except at unrealistically high target gains. The rail gun accelerator is well adapted to the delivery of some 10-100 megajoules of energy to the fusion target, and the electrical technology involved is relatively simple: inductive storage or rotating machinery and capacitors. It is concluded that the rail gun has the potential of developing into an impact fusion macroparticle accelerator.

History of Nuclear Fusion Research in Japan

NASA Astrophysics Data System (ADS)

Iguchi, Harukazu; Matsuoka, Keisuke; Kimura, Kazue; Namba, Chusei; Matsuda, Shinzaburo

In the late 1950s just after the atomic energy research was opened worldwide, there was a lively discussion among scientists on the strategy of nuclear fusion research in Japan. Finally, decision was made that fusion research should be started from the basic, namely, research on plasma physics and from cultivation of human resources at universities under the Ministry of Education, Science and Culture (MOE). However, an endorsement was given that construction of an experimental device for fusion research would be approved sooner or later. Studies on toroidal plasma confinement started at Japan Atomic Energy Research Institute (JAERI) under the Science and Technology Agency (STA) in the mid-1960s. Dualistic fusion research framework in Japan was established. This structure has lasted until now. Fusion research activities over the last 50 years are described by the use of a flowchart, which is convenient to glance the historical development of fusion research in Japan.

Neutron diffraction studies of viral fusion peptides

NASA Astrophysics Data System (ADS)

Bradshaw, Jeremy P.; J. M. Darkes, Malcolm; Katsaras, John; Epand, Richard M.

2000-03-01

Membrane fusion plays a vital role in a large and diverse number of essential biological processes. Despite this fact, the precise molecular events that occur during fusion are still not known. We are currently engaged on a study of membrane fusion as mediated by viral fusion peptides. These peptides are the N-terminal regions of certain viral envelope proteins that mediate the process of fusion between the viral envelope and the membranes of the host cell during the infection process. As part of this study, we have carried out neutron diffraction measurements at the ILL, BeNSC and Chalk River, on a range of viral fusion peptides. The peptides, from simian immunodeficiency virus (SIV), influenza A and feline leukaemia virus (FeLV), were incorporated into stacked phospholipid bilayers. Some of the peptides had been specifically deuterated at key amino acids. Lamellar diffraction data were collected and analysed to yield information on the peptide conformation, location and orientation relative to the bilayer.

Heavy ion fusion reactions in stars

NASA Astrophysics Data System (ADS)

Tang, X. D.

2018-04-01

Heavy ion fusion reactions play important roles in a wide variety of stellar burning scenarios. 12C+12C, 12C+16O and 16O+16O are the principle reactions during the advance burning stages of massive star. 12C+12C also triggers the happening of superburst and Type Ia supernovae. The heavy ion fusion reactions of the neutron-rich isotopes such as 24O are the major heating source in the crust of neutron star. In this talk, I will review the challenges and the recent progress in the study of these heavy ion fusion reactions at stellar energies. The outlook for the studies of the astrophysical heavy-ion fusion reactions will also be presented.

Sequential evolution of bacterial morphology by co-option of a developmental regulator.

PubMed

Jiang, Chao; Brown, Pamela J B; Ducret, Adrien; Brun, Yves V

2014-02-27

What mechanisms underlie the transitions responsible for the diverse shapes observed in the living world? Although bacteria exhibit a myriad of morphologies, the mechanisms responsible for the evolution of bacterial cell shape are not understood. We investigated morphological diversity in a group of bacteria that synthesize an appendage-like extension of the cell envelope called the stalk. The location and number of stalks varies among species, as exemplified by three distinct subcellular positions of stalks within a rod-shaped cell body: polar in the genus Caulobacter and subpolar or bilateral in the genus Asticcacaulis. Here we show that a developmental regulator of Caulobacter crescentus, SpmX, is co-opted in the genus Asticcacaulis to specify stalk synthesis either at the subpolar or bilateral positions. We also show that stepwise evolution of a specific region of SpmX led to the gain of a new function and localization of this protein, which drove the sequential transition in stalk positioning. Our results indicate that changes in protein function, co-option and modularity are key elements in the evolution of bacterial morphology. Therefore, similar evolutionary principles of morphological transitions apply to both single-celled prokaryotes and multicellular eukaryotes.

The path to fusion power†

PubMed Central

Smith, Chris Llewellyn; Cowley, Steve

2010-01-01

The promise, status and challenges of developing fusion power are outlined. The key physics and engineering principles are described and recent progress quantified. As the successful demonstration of 16 MW of fusion in 1997 in the Joint European Torus showed, fusion works. The central issue is therefore to make it work reliably and economically on the scale of a power station. We argue that to meet this challenge in 30 years we must follow the aggressive programme known as the ‘Fast Track to Fusion’. This programme is described in some detail. PMID:20123748

Direct current stimulation of titanium interbody fusion devices in primates.

PubMed

Cook, Stephen D; Patron, Laura P; Christakis, Petros M; Bailey, Kirk J; Banta, Charles; Glazer, Paul A

2004-01-01

The fusion rate for anterior lumbar interbody fusion (ALIF) varies widely with the use of different interbody devices and bone graft options. Adjunctive techniques such as electrical stimulation may improve the rate of bony fusion. To determine if direct current (DC) electrical stimulation of a metallic interbody fusion device enhanced the incidence or extent of anterior bony fusion. ALIF was performed using titanium alloy interbody fusion devices with and without adjunctive DC electrical stimulation in nonhuman primates. ALIF was performed through an anterolateral approach in 35 macaques with autogenous bone graft and either a titanium alloy (Ti-6Al-4V) fusion device or femoral allograft ring. The fusion devices of 19 animals received high (current density 19.6 microA/cm2) or low (current density 5.4 microA/cm2) DC electrical stimulation using an implanted generator for a 12- or 26-week evaluation period. Fusion sites were studied using serial radiographs, computed tomography imaging, nondestructive mechanical testing and qualitative and semiquantitative histology. Fusion was achieved with the titanium fusion device and autogenous bone graft. At 12 weeks, the graft was consolidating and early to moderate bridging callus was observed in and around the device. By 26 weeks, the anterior callus formation was more advanced with increased evidence of bridging trabeculations and early bone remodeling. The callus formation was not as advanced or abundant for the allograft ring group. Histology revealed the spinal fusion device had an 86% incidence of bony fusion at 26 weeks compared with a 50% fusion rate for the allograft rings. DC electrical stimulation of the fusion device had a positive effect on anterior interbody fusion by increasing both the presence and extent of bony fusion in a current density-dependent manner. Adjunctive DC electrical stimulation of the fusion device improved the rate and extent of bony fusion compared with a nonstimulated device. The fusion

Sacroiliac Joint Fusion: One Year Clinical and Radiographic Results Following Minimally Invasive Sacroiliac Joint Fusion Surgery

PubMed Central

Kube, Richard A.; Muir, Jeffrey M.

2016-01-01

Background: Recalcitrant sacroiliac joint pain responds well to minimally-invasive surgical (MIS) techniques, although long-term radiographic and fusion data are limited. Objective: To evaluate the one-year clinical results from a cohort of patients with chronic sacroiliac (SI) joint pain unresponsive to conservative therapies who have undergone minimally invasive SI joint fusion. Methods: SI joint fusion was performed between May 2011 and January 2014. Outcomes included radiographic assessment of fusion status, leg and back pain severity via visual analog scale (VAS), disability via Oswestry Disability Index (ODI) and complication rate. Outcomes were measured at baseline and at follow-up appointments 6 months and 12 months post-procedure. Results: Twenty minimally invasive SI joint fusion procedures were performed on 18 patients (mean age: 47.2 (14.2), mean BMI: 29.4 (5.3), 56% female). At 12 months, the overall fusion rate was 88%. Back and leg pain improved from 81.7 to 44.1 points (p<0.001) and from 63.6 to 27.7 points (p=0.001), respectively. Disability scores improved from 61.0 to 40.5 (p=0.009). Despite a cohort containing patients with multiple comorbidities and work-related injuries, eight patients (50%) achieved the minimal clinically important difference (MCID) in back pain at 12 months, with 9 (69%) patients realizing this improvement in leg pain and 8 (57%) realizing the MCID in ODI scores at 12 months. No major complications were reported. Conclusion: Minimally invasive SI joint surgery is a safe and effective procedure, with a high fusion rate, a satisfactory safety profile and significant improvements in pain severity and disability reported through 12 months post-procedure. PMID:28144378

Sacroiliac Joint Fusion: One Year Clinical and Radiographic Results Following Minimally Invasive Sacroiliac Joint Fusion Surgery.

PubMed

Kube, Richard A; Muir, Jeffrey M

2016-01-01

Recalcitrant sacroiliac joint pain responds well to minimally-invasive surgical (MIS) techniques, although long-term radiographic and fusion data are limited. To evaluate the one-year clinical results from a cohort of patients with chronic sacroiliac (SI) joint pain unresponsive to conservative therapies who have undergone minimally invasive SI joint fusion. SI joint fusion was performed between May 2011 and January 2014. Outcomes included radiographic assessment of fusion status, leg and back pain severity via visual analog scale (VAS), disability via Oswestry Disability Index (ODI) and complication rate. Outcomes were measured at baseline and at follow-up appointments 6 months and 12 months post-procedure. Twenty minimally invasive SI joint fusion procedures were performed on 18 patients (mean age: 47.2 (14.2), mean BMI: 29.4 (5.3), 56% female). At 12 months, the overall fusion rate was 88%. Back and leg pain improved from 81.7 to 44.1 points (p<0.001) and from 63.6 to 27.7 points (p=0.001), respectively. Disability scores improved from 61.0 to 40.5 (p=0.009). Despite a cohort containing patients with multiple comorbidities and work-related injuries, eight patients (50%) achieved the minimal clinically important difference (MCID) in back pain at 12 months, with 9 (69%) patients realizing this improvement in leg pain and 8 (57%) realizing the MCID in ODI scores at 12 months. No major complications were reported. Minimally invasive SI joint surgery is a safe and effective procedure, with a high fusion rate, a satisfactory safety profile and significant improvements in pain severity and disability reported through 12 months post-procedure.

A small molecule fusion inhibitor of dengue virus.

PubMed

Poh, Mee Kian; Yip, Andy; Zhang, Summer; Priestle, John P; Ma, Ngai Ling; Smit, Jolanda M; Wilschut, Jan; Shi, Pei-Yong; Wenk, Markus R; Schul, Wouter

2009-12-01

The dengue virus envelope protein plays an essential role in viral entry by mediating fusion between the viral and host membranes. The crystal structure of the envelope protein shows a pocket (located at a "hinge" between Domains I and II) that can be occupied by ligand n-octyl-beta-D-glucoside (betaOG). Compounds blocking the betaOG pocket are thought to interfere with conformational changes in the envelope protein that are essential for fusion. Two fusion assays were developed to examine the anti-fusion activities of compounds. The first assay measures the cellular internalization of propidium iodide upon membrane fusion. The second assay measures the protease activity of trypsin upon fusion between dengue virions and trypsin-containing liposomes. We performed an in silico virtual screening for small molecules that can potentially bind to the betaOG pocket and tested these candidate molecules in the two fusion assays. We identified one compound that inhibits dengue fusion in both assays with an IC(50) of 6.8 microM and reduces viral titers with an EC(50) of 9.8 microM. Time-of-addition experiments showed that the compound was only active when present during viral infection but not when added 1h later, in agreement with a mechanism of action through fusion inhibition.

Membrane Fusion Induced by Small Molecules and Ions

PubMed Central

Mondal Roy, Sutapa; Sarkar, Munna

2011-01-01

Membrane fusion is a key event in many biological processes. These processes are controlled by various fusogenic agents of which proteins and peptides from the principal group. The fusion process is characterized by three major steps, namely, inter membrane contact, lipid mixing forming the intermediate step, pore opening and finally mixing of inner contents of the cells/vesicles. These steps are governed by energy barriers, which need to be overcome to complete fusion. Structural reorganization of big molecules like proteins/peptides, supplies the required driving force to overcome the energy barrier of the different intermediate steps. Small molecules/ions do not share this advantage. Hence fusion induced by small molecules/ions is expected to be different from that induced by proteins/peptides. Although several reviews exist on membrane fusion, no recent review is devoted solely to small moleculs/ions induced membrane fusion. Here we intend to present, how a variety of small molecules/ions act as independent fusogens. The detailed mechanism of some are well understood but for many it is still an unanswered question. Clearer understanding of how a particular small molecule can control fusion will open up a vista to use these moleucles instead of proteins/peptides to induce fusion both in vivo and in vitro fusion processes. PMID:21660306

Future Directions for Fusion Propulsion Research at NASA

NASA Technical Reports Server (NTRS)

Adams, Robert B.; Cassibry, Jason T.

2005-01-01

Fusion propulsion is inevitable if the human race remains dedicated to exploration of the solar system. There are fundamental reasons why fusion surpasses more traditional approaches to routine crewed missions to Mars, crewed missions to the outer planets, and deep space high speed robotic missions, assuming that reduced trip times, increased payloads, and higher available power are desired. A recent series of informal discussions were held among members from government, academia, and industry concerning fusion propulsion. We compiled a sufficient set of arguments for utilizing fusion in space. .If the U.S. is to lead the effort and produce a working system in a reasonable amount of time, NASA must take the initiative, relying on, but not waiting for, DOE guidance. Arguments for fusion propulsion are presented, along with fusion enabled mission examples, fusion technology trade space, and a proposed outline for future efforts.

Binaural Pitch Fusion in Bilateral Cochlear Implant Users.

PubMed

Reiss, Lina A J; Fowler, Jennifer R; Hartling, Curtis L; Oh, Yonghee

Binaural pitch fusion is the fusion of stimuli that evoke different pitches between the ears into a single auditory image. Individuals who use hearing aids or bimodal cochlear implants (CIs) experience abnormally broad binaural pitch fusion, such that sounds differing in pitch by as much as 3-4 octaves are fused across ears, leading to spectral averaging and speech perception interference. The goal of this study was to determine if adult bilateral CI users also experience broad binaural pitch fusion. Stimuli were pulse trains delivered to individual electrodes. Fusion ranges were measured using simultaneous, dichotic presentation of reference and comparison stimuli in opposite ears, and varying the comparison stimulus to find the range that fused with the reference stimulus. Bilateral CI listeners had binaural pitch fusion ranges varying from 0 to 12 mm (average 6.1 ± 3.9 mm), where 12 mm indicates fusion over all electrodes in the array. No significant correlations of fusion range were observed with any subject factors related to age, hearing loss history, or hearing device history, or with any electrode factors including interaural electrode pitch mismatch, pitch match bandwidth, or within-ear electrode discrimination abilities. Bilateral CI listeners have abnormally broad fusion, similar to hearing aid and bimodal CI listeners. This broad fusion may explain the variability of binaural benefits for speech perception in quiet and in noise in bilateral CI users.

Bacterial Prostatitis: Bacterial Virulence, Clinical Outcomes, and New Directions.

PubMed

Krieger, John N; Thumbikat, Praveen

2016-02-01

Four prostatitis syndromes are recognized clinically: acute bacterial prostatitis, chronic bacterial prostatitis, chronic prostatitis/chronic pelvic pain syndrome, and asymptomatic prostatitis. Because Escherichia coli represents the most common cause of bacterial prostatitis, we investigated the importance of bacterial virulence factors and antimicrobial resistance in E. coli strains causing prostatitis and the potential association of these characteristics with clinical outcomes. A structured literature review revealed that we have limited understanding of the virulence-associated characteristics of E. coli causing acute prostatitis. Therefore, we completed a comprehensive microbiological and molecular investigation of a unique strain collection isolated from healthy young men. We also considered new data from an animal model system suggesting certain E. coli might prove important in the etiology of chronic prostatitis/chronic pelvic pain syndrome. Our human data suggest that E. coli needs multiple pathogenicity-associated traits to overcome anatomic and immune responses in healthy young men without urological risk factors. The phylogenetic background and accumulation of an exceptional repertoire of extraintestinal pathogenic virulence-associated genes indicate that these E. coli strains belong to a highly virulent subset of uropathogenic variants. In contrast, antibiotic resistance confers little added advantage to E. coli strains in these healthy outpatients. Our animal model data also suggest that certain pathogenic E. coli may be important in the etiology of chronic prostatitis/chronic pelvic pain syndrome through mechanisms that are dependent on the host genetic background and the virulence of the bacterial strain.

Live imaging of mouse secondary palate fusion

PubMed Central

Kim, Seungil; Prochazka, Jan; Bush, Jeffrey O.

2017-01-01

LONG ABSTRACT The fusion of the secondary palatal shelves to form the intact secondary palate is a key process in mammalian development and its disruption can lead to cleft secondary palate, a common congenital anomaly in humans. Secondary palate fusion has been extensively studied leading to several proposed cellular mechanisms that may mediate this process. However, these studies have been mostly performed on fixed embryonic tissues at progressive timepoints during development or in fixed explant cultures analyzed at static timepoints. Static analysis is limited for the analysis of dynamic morphogenetic processes such a palate fusion and what types of dynamic cellular behaviors mediate palatal fusion is incompletely understood. Here we describe a protocol for live imaging of ex vivo secondary palate fusion in mouse embryos. To examine cellular behaviors of palate fusion, epithelial-specific Keratin14-cre was used to label palate epithelial cells in ROSA26-mTmGflox reporter embryos. To visualize filamentous actin, Lifeact-mRFPruby reporter mice were used. Live imaging of secondary palate fusion was performed by dissecting recently-adhered secondary palatal shelves of embryonic day (E) 14.5 stage embryos and culturing in agarose-containing media on a glass bottom dish to enable imaging with an inverted confocal microscope. Using this method, we have detected a variety of novel cellular behaviors during secondary palate fusion. An appreciation of how distinct cell behaviors are coordinated in space and time greatly contributes to our understanding of this dynamic morphogenetic process. This protocol can be applied to mutant mouse lines, or cultures treated with pharmacological inhibitors to further advance understanding of how secondary palate fusion is controlled. PMID:28784960

Antibacterial potential of silver nanoparticles against isolated urinary tract infectious bacterial pathogens