Peroxiredoxin 1 protects the pea aphid Acyrthosiphon pisum from oxidative stress induced by Micrococcus luteus infection.

PubMed

Zhang, Yongdong; Lu, Zhiqiang

2015-05-01

Reactive oxygen species (ROSs) are generated in organisms in response to infections caused by invading microbes. However, excessive ROSs will inflict oxidative damage on the host. Peroxiredoxins (Prxs) are antioxidative enzymes that may eliminate ROSs efficiently. In this study, ApPrx1 from the pea aphid Acyrthosiphon pisum was cloned, and its function was investigated in vitro and in vivo. In the presence of DTT, recombinant ApPrx1 protein from Escherichia coli showed antioxidative activity by eliminating H2O2 effectively. The H2O2 levels were significantly higher in Micrococcus luteus-infected aphids than in uninfected aphids, and ApPrx1 expression was remarkably up-regulated when the aphids were infected with M. luteus or injected with H2O2. When ApPrx1 expression was reduced by dsRNA injection, the survival of the aphids decreased significantly after M. luteus infection. Knockdown of ApPrx1 decreased M. luteus loads inside the aphids 48h post-infection. While under infection conditions, the H2O2 levels were much higher in ApPrx1 knockdown aphids than in dsGFP-injected aphids, indicating that the decreased survival of the aphids was caused by increased oxidative stress. Taken together, our results reveal that ApPrx1 plays a protective role in oxidative stress caused by bacterial infection. Copyright © 2015 Elsevier Inc. All rights reserved.

Comparative analysis of Micrococcus luteus isolates from blood cultures of patients with pulmonary hypertension receiving epoprostenol continuous infusion.

PubMed

Hirata, Yoshinori; Sata, Makoto; Makiuchi, Yuko; Morikane, Keita; Wada, Akihito; Okabe, Nobuhiko; Tomoike, Hitonobu

2009-12-01

During the period 2002-2008, at the National Cardiovascular Center, Osaka, 28 Micrococcus luteus isolates and one Kocuria spp. isolate were obtained from blood cultures of pulmonary hypertension (PH) patients who were receiving continuous infusion therapy with epoprostenol. Pulsed-field gel electrophoresis patterns of the isolates were unrelated, suggesting that the infections had multiple origins. The preparation of epoprostenol solution by patients themselves was thought to be a risk factor.

Genome Sequence of the Fleming Strain of Micrococcus luteus, a Simple Free-Living Actinobacterium▿ †‡

PubMed Central

Young, Michael; Artsatbanov, Vladislav; Beller, Harry R.; Chandra, Govind; Chater, Keith F.; Dover, Lynn G.; Goh, Ee-Been; Kahan, Tamar; Kaprelyants, Arseny S.; Kyrpides, Nikos; Lapidus, Alla; Lowry, Stephen R.; Lykidis, Athanasios; Mahillon, Jacques; Markowitz, Victor; Mavromatis, Konstantinos; Mukamolova, Galina V.; Oren, Aharon; Rokem, J. Stefan; Smith, Margaret C. M.; Young, Danielle I.; Greenblatt, Charles L.

2010-01-01

Micrococcus luteus (NCTC2665, “Fleming strain”) has one of the smallest genomes of free-living actinobacteria sequenced to date, comprising a single circular chromosome of 2,501,097 bp (G+C content, 73%) predicted to encode 2,403 proteins. The genome shows extensive synteny with that of the closely related organism, Kocuria rhizophila, from which it was taxonomically separated relatively recently. Despite its small size, the genome harbors 73 insertion sequence (IS) elements, almost all of which are closely related to elements found in other actinobacteria. An IS element is inserted into the rrs gene of one of only two rrn operons found in M. luteus. The genome encodes only four sigma factors and 14 response regulators, a finding indicative of adaptation to a rather strict ecological niche (mammalian skin). The high sensitivity of M. luteus to β-lactam antibiotics may result from the presence of a reduced set of penicillin-binding proteins and the absence of a wblC gene, which plays an important role in the antibiotic resistance in other actinobacteria. Consistent with the restricted range of compounds it can use as a sole source of carbon for energy and growth, M. luteus has a minimal complement of genes concerned with carbohydrate transport and metabolism and its inability to utilize glucose as a sole carbon source may be due to the apparent absence of a gene encoding glucokinase. Uniquely among characterized bacteria, M. luteus appears to be able to metabolize glycogen only via trehalose and to make trehalose only via glycogen. It has very few genes associated with secondary metabolism. In contrast to most other actinobacteria, M. luteus encodes only one resuscitation-promoting factor (Rpf) required for emergence from dormancy, and its complement of other dormancy-related proteins is also much reduced. M. luteus is capable of long-chain alkene biosynthesis, which is of interest for advanced biofuel production; a three-gene cluster essential for this

[Expression in E.coli and bioactivity assay of Micrococcus luteus resuscitation promoting factor domain and its mutants].

PubMed

Yue, Chen-Li; Shi, Jie-Ran; Shi, Chang-Hong; Zhang, Hai; Zhao, Lei; Zhang, Ting-Fen; Zhao, Yong; Xi, Li

2008-10-01

To express Micrococcus luteus resuscitation promoting factor (Rpf) domain and its mutants in prokaryotic cells, and to investigate their bioactivity. The gene of Rpf domain and its mutants (E54K, E54A) were amplified by polymerase chain reaction (PCR) from the genome of Micrococcus luteus and cloned into pMD18-T vector. After sequenced, the Rpf domain and its mutant gene were subcloned into expression vector PGEX-4T-1, and transfected into E. coli DH5alpha. The expressed product was purified by affinity chromatography using GST Fusion Protein Purification bead. The aim proteins were identified by SDS-PAGE analysis and by Western blot with monoclonal antibodies against Rpf domain (mAb). The bioactivity of the proteins was analyzed by stimulating the resuscitation of Mycobacterium smegmatis. The sequences of the PCR products were identical to those of the Rpf domain and its mutant gene in GenBank. The relative molecular mass identified by SDS-PAGE analysis was consistent with that had been reported, which was also confirmed by Western blot analysis that there were specific bindings at 32 000 with Rpf domain mAb. The purified GST-Rpf domain could stimulate resuscitation of Mycobacterium smegmatis. Replacements E54A and especially E54K resulted in inhibition of Rpf resuscitation activity. Rpf domain and two kinds of its mutant protein were obtained, and its effects on the resuscitation of dormant Mycobacterium smegmatis were clarified.

Physicochemical parameters influencing coaggregation between the freshwater bacteria Sphingomonas natatoria 2.1 and Micrococcus luteus 2.13.

PubMed

Min, K R; Zimmer, M N; Rickard, A H

2010-11-01

The aim of this study was to explore the physicochemical parameters that influence coaggregation between the freshwater bacteria Sphingomonas natatoria 2.1 and Micrococcus luteus 2.13. Using visual coaggregation assays, the effect of different buffers, solutions of differing ionic strength, pH, temperature, and viscosity on the degree of coaggregation was assessed. Coaggregation occurred maximally in distilled water but was inhibited when coaggregates were suspended in a commonly-used oral bacterial coaggregation buffer, saline solutions, and Tris-Cl buffers. Coaggregation was weakly expressed in standard laboratory buffers. The ionic strength of inorganic salt solutions required to inhibit coaggregation depended upon the inorganic salt being tested. Coaggregation occurred at a pH of 3-10, between 5 and 80°C and was inhibited in solutions with a viscosity of 22.5 centipoises at 20°C. Inhibition of coaggregation with NaCl impaired biofilm development. When developing buffers to test for coaggregation, the natural liquid environment should be considered. Coaggregation between S. natatoria 2.1 and M. luteus 2.13 is only affected by physicochemical conditions beyond those typically found in natural freshwater ecosystems. Such a robust ability to coaggregate may enhance the ability of S. natatoria 2.1 and M. luteus 2.13 to develop a niche in freshwater biofilms.

Taxonomic dissection of the genus Micrococcus: Kocuria gen. nov., Nesterenkonia gen. nov., Kytococcus gen. nov., Dermacoccus gen. nov., and Micrococcus Cohn 1872 gen. emend.

PubMed

Stackebrandt, E; Koch, C; Gvozdiak, O; Schumann, P

1995-10-01

The results of a phylogenetic and chemotaxonomic analysis of the genus Micrococcus indicated that it is significantly heterogeneous. Except for Micrococcus lylae, no species groups phylogenetically with the type species of the genus, Micrococcus luteus. The other members of the genus form three separate phylogenetic lines which on the basis of chemotaxonomic properties can be assigned to four genera. These genera are the genus Kocuria gen. nov. for Micrococcus roseus, Micrococcus varians, and Micrococcus kristinae, described as Kocuria rosea comb. nov., Kocuria varians comb. nov., and Kocuria kristinae comb. nov., respectively; the genus Nesterenkonia gen. nov. for Micrococcus halobius, described as Nesterenkonia halobia comb. nov.; the genus Nesterenkonia gen. nov. for Micrococcus halobius, described as Nesterenkonia halobia comb. nov.; the genus Dermacoccus gen. nov. for Micrococcus nishinomiyaensis, described as Dermacoccus nishinomiyaensis comb. nov.; and the genus Kytocossus gen. nov. for Micrococcus sedentarius, described as Kytococcus sedentarius comb. nov. M. luteus and M. lylae, which are closely related phylogenetically but differ in some chemotaxonomic properties, are the only species that remain in the genus Micrococcus Cohn 1872. An emended description of the genus Micrococcus is given [corrected].

Structural changes and cellular localization of resuscitation-promoting factor in environmental isolates of Micrococcus luteus.

PubMed

Koltunov, Viktoria; Greenblatt, Charles L; Goncharenko, Anna V; Demina, Galya R; Klein, Benjamin Y; Young, Michael; Kaprelyants, Arseny S

2010-02-01

Dormancy among nonsporulating actinobacteria is now a widely accepted phenomenon. In Micrococcus luteus, the resuscitation of dormant cells is caused by a small secreted protein (resuscitation-promoting factor, or Rpf) that is found in "spent culture medium." Rpf is encoded by a single essential gene in M. luteus. Homologs of Rpf are widespread among the high G + C Gram-positive bacteria, including mycobacteria and streptomycetes, and most organisms make several functionally redundant proteins. M. luteus Rpf comprises a lysozyme-like domain that is necessary and sufficient for activity connected through a short linker region to a LysM motif, which is present in a number of cell-wall-associated enzymes. Muralytic activity is responsible for resuscitation. In this report, we characterized a number of environmental isolates of M. luteus, including several recovered from amber. There was substantial variation in the predicted rpf gene product. While the lysozyme-like and LysM domains showed little variation, the linker region was elongated from ten amino acid residues in the laboratory strains to as many as 120 residues in one isolate. The genes encoding these Rpf proteins have been characterized, and a possible role for the Rpf linker in environmental adaptation is proposed. The environmental isolates show enhanced resistance to lysozyme as compared with the laboratory strains and this correlates with increased peptidoglycan acetylation. In strains that make a protein with an elongated linker, Rpf was bound to the cell wall, rather than being released to the growth medium, as occurs in reference strains. This rpf gene was introduced into a lysozyme-sensitive reference strain. Both rpf genes were expressed in transformants which showed a slight but statistically significant increase in lysozyme resistance.

Detection of Micrococcus luteus biofilm formation in microfluidic environments by pH measurement using an ion-sensitive field-effect transistor.

PubMed

Matsuura, Koji; Asano, Yuka; Yamada, Akira; Naruse, Keiji

2013-02-18

Biofilm formation in microfluidic channels is difficult to detect because sampling volumes are too small for conventional turbidity measurements. To detect biofilm formation, we used an ion-sensitive field-effect transistor (ISFET) measurement system to measure pH changes in small volumes of bacterial suspension. Cells of Micrococcus luteus (M. luteus) were cultured in polystyrene (PS) microtubes and polymethylmethacrylate (PMMA)-based microfluidic channels laminated with polyvinylidene chloride. In microtubes, concentrations of bacteria and pH in the suspension were analyzed by measuring turbidity and using an ISFET sensor, respectively. In microfluidic channels containing 20 μL of bacterial suspension, we measured pH changes using the ISFET sensor and monitored biofilm formation using a microscope. We detected acidification and alkalinization phases of M. luteus from the ISFET sensor signals in both microtubes and microfluidic channels. In the alkalinization phase, after 2 day culture, dense biofilm formation was observed at the bottom of the microfluidic channels. In this study, we used an ISFET sensor to detect biofilm formation in clinical and industrial microfluidic environments by detecting alkalinization of the culture medium. 

Effect of simulated microgravity on growth and production of exopolymeric substances of Micrococcus luteus space and earth isolates.

PubMed

Mauclaire, Laurie; Egli, Marcel

2010-08-01

Microorganisms tend to form biofilms on surfaces, thereby causing deterioration of the underlaying material. In addition, biofilm is a potential health risk to humans. Therefore, microorganism growth is not only an issue on Earth but also in manned space habitats like the International Space Station (ISS). The aim of the study was to identify physiological processes relevant for Micrococcus luteus attachment under microgravity conditions. The results demonstrate that simulated microgravity influences physiological processes which trigger bacterial attachment and biofilm formation. The ISS strains produced larger amounts of exopolymeric substances (EPS) compared with a reference strain from Earth. In contrast, M. luteus strains were growing faster, and Earth as well as ISS isolates produced a higher yield of biomass under microgravity conditions than under normal gravity. Furthermore, microgravity caused a reduction of the colloidal EPS production of ISS isolates in comparison with normal gravity, which probably influences biofilm thickness and stability as well.

Proteomic and metabolomic responses in hepatopancreas of Mytilus galloprovincialis challenged by Micrococcus luteus and Vibrio anguillarum.

PubMed

Wu, Huifeng; Ji, Chenglong; Wei, Lei; Zhao, Jianmin; Lu, Hongjian

2013-12-06

The outbreak of pathogens can induce diseases and lead to massive mortalities of aquaculture animals including fish, mollusk and shrimp. In this work, the responses induced by Micrococcus luteus and Vibrio anguillarum were investigated in hepatopancreas of mussel Mytilus galloprovincialis using proteomics and metabolomics. Metabolic biomarkers demonstrated that M. luteus and V. anguillarum injections could induce osmotic stress and disturbance in energy metabolism. And the uniquely and more markedly altered metabolic biomarkers (glutamine, succinate, aspartate, glucose, ATP, homarine and tyrosine) indicated that V. anguillarum could cause more severe disturbances in osmotic regulation and energy metabolism. The differentially altered proteins meant that M. luteus and V. anguillarum induced different effects in mussels. However, the common proteomic biomarkers, arginine kinase and small heat shock protein, demonstrated that these two bacteria induced similar effects including oxidative stress and disturbance in energy metabolism in M. galloprovincialis. In addition, some metabolic biomarkers, ATP and glutamine, were confirmed by related proteins including arginine kinase, ATP synthase, nucleoside diphosphate kinase and glutamine synthetase in bacteria-challenged mussels. This study demonstrated that proteomics and metabolomics could provide an insightful view into the effects of environmental pathogens to the marine mussel M. galloprovincialis. The outbreak of pathogens can lead to diseases and massive mortalities of aquaculture animals including fish, mollusk and shrimp. The mussel M. galloprovincialis distributes widely along the Bohai coast and is popularly consumed as delicious seafood by local residents. This bivalve has become one of the important species in marine aquaculture industry in China. Therefore a study on pathogen-induced effects is necessary. In the present study, an integrated metabolomic and proteomic approach was used to elucidate the

Effect of Nisin's Controlled Release on Microbial Growth as Modeled for Micrococcus luteus.

PubMed

Balasubramanian, Aishwarya; Lee, Dong Sun; Chikindas, Michael L; Yam, Kit L

2011-06-01

The need for safe food products has motivated food scientists and industry to find novel technologies for antimicrobial delivery for improving food safety and quality. Controlled release packaging is a novel technology that uses the package to deliver antimicrobials in a controlled manner and sustain antimicrobial stress on the targeted microorganism over the required shelf life. This work studied the effect of controlled release of nisin to inhibit growth of Micrococcus luteus (a model microorganism) using a computerized syringe pump system to mimic the release of nisin from packaging films which was characterized by an initially fast rate and a slower rate as time progressed. The results show that controlled release of nisin was strikingly more effective than instantly added ("formulated") nisin. While instant addition experiments achieved microbial inhibition only at the beginning, controlled release experiments achieved complete microbial inhibition for a longer time, even when as little as 15% of the amount of nisin was used as compared to instant addition.

Dynamic miRNA-mRNA regulations are essential for maintaining Drosophila immune homeostasis during Micrococcus luteus infection.

PubMed

Wei, Guanyun; Sun, Lianjie; Li, Ruimin; Li, Lei; Xu, Jiao; Ma, Fei

2018-04-01

Pathogen bacteria infections can lead to dynamic changes of microRNA (miRNA) and mRNA expression profiles, which may control synergistically the outcome of immune responses. To reveal the role of dynamic miRNA-mRNA regulation in Drosophila innate immune responses, we have detailedly analyzed the paired miRNA and mRNA expression profiles at three time points during Drosophila adult males with Micrococcus luteus (M. luteus) infection using RNA- and small RNA-seq data. Our results demonstrate that differentially expressed miRNAs and mRNAs represent extensively dynamic changes over three time points during Drosophila with M. luteus infection. The pathway enrichment analysis indicates that differentially expressed genes are involved in diverse signaling pathways, including Toll and Imd as well as orther signaling pathways at three time points during Drosophila with M. luteus infection. Remarkably, the dynamic change of miRNA expression is delayed by compared to mRNA expression change over three time points, implying that the "time" parameter should be considered when the function of miRNA/mRNA is further studied. In particular, the dynamic miRNA-mRNA regulatory networks have shown that miRNAs may synergistically regulate gene expressions of different signaling pathways to promote or inhibit innate immune responses and maintain homeostasis in Drosophila, and some new regulators involved in Drosophila innate immune response have been identified. Our findings strongly suggest that miRNA regulation is a key mechanism involved in fine-tuning cooperatively gene expressions of diverse signaling pathways to maintain innate immune response and homeostasis in Drosophila. Taken together, the present study reveals a novel role of dynamic miRNA-mRNA regulation in immune response to bacteria infection, and provides a new insight into the underlying molecular regulatory mechanism of Drosophila innate immune responses. Copyright © 2017 Elsevier Ltd. All rights reserved.

A marine bacterium, Micrococcus MCCB 104, antagonistic to vibrios in prawn larval rearing systems.

PubMed

Jayaprakash, N S; Pai, S Somnath; Anas, A; Preetha, R; Philip, Rosamma; Singh, I S Bright

2005-12-30

A marine bacterium, Micrococcus MCCB 104, isolated from hatchery water, demonstrated extracellular antagonistic properties against Vibrio alginolyticus, V. parahaemolyticus, V. vulnificus, V. fluviallis, V. nereis, V. proteolyticus, V. mediterranei, V cholerae and Aeromonas sp., bacteria associated with Macrobrachium rosenbergii larval rearing systems. The isolate inhibited the growth of V. alginolyticus during co-culture. The antagonistic component of the extracellular product was heat-stable and insensitive to proteases, lipase, catalase and alpha-amylase. Micrococcus MCCB 104 was demonstrated to be non-pathogenic to M. rosenbergii larvae.

University Research Initiative Program for Combat Readiness

DTIC Science & Technology

1999-05-01

found in sponge-associated bacteria Micrococcus luteus (Bultel-Ponce et al., 1998). Such compounds have antimicrobial activity. Water contact angles...Guyot, M. 1998. Metabolites from the sponge-associated bacterium Micrococcus luteus. J. Mar. Biotechnol. 6:233-236. 3. Incze, B.I., Sea Technol. 1996, 37

Extrachromosomal genetic elements in Micrococcus.

PubMed

Dib, Julián Rafael; Liebl, Wolfgang; Wagenknecht, Martin; Farías, María Eugenia; Meinhardt, Friedhelm

2013-01-01

Micrococci are Gram-positive G + C-rich, nonmotile, nonspore-forming actinomycetous bacteria. Micrococcus comprises ten members, with Micrococcus luteus being the type species. Representatives of the genus play important roles in the biodegradation of xenobiotics, bioremediation processes, production of biotechnologically important enzymes or bioactive compounds, as test strains in biological assays for lysozyme and antibiotics, and as infective agents in immunocompromised humans. The first description of plasmids dates back approximately 28 years, when several extrachromosomal elements ranging in size from 1.5 to 30.2 kb were found in Micrococcus luteus. Up to the present, a number of circular plasmids conferring antibiotic resistance, the ability to degrade aromatic compounds, and osmotolerance are known, as well as cryptic elements with unidentified functions. Here, we review the Micrococcus extrachromosomal traits reported thus far including phages and the only quite recently described large linear extrachromosomal genetic elements, termed linear plasmids, which range in size from 75 kb (pJD12) to 110 kb (pLMA1) and which confer putative advantageous capabilities, such as antibiotic or heavy metal resistances (inferred from sequence analyses and curing experiments). The role of the extrachromosomal elements for the frequently proven ecological and biotechnological versatility of the genus will be addressed as well as their potential for the development and use as genetic tools.

Radiation-Resistant Micrococcus luteus SC1204 and Its Proteomics Change Upon Gamma Irradiation.

PubMed

Deng, Wuyuan; Yang, Yang; Gao, Peng; Chen, Hao; Wen, Wenting; Sun, Qun

2016-06-01

To explore the radiation-resistance mechanisms in bacteria, a radiation-resistant strain SC1204 was isolated from the surrounding area of a (60)Co-γ radiation facility. SC1204 could survive up to 8 kGy dose of gamma irradiation and was identified as Micrococcus luteus by phylogenetic analysis of 16S rRNA gene sequences. Its proteomic changes under 2-kGy irradiation were examined by two-dimensional electrophoresis followed by MALDI-TOF-TOF/MS analysis. The results showed that at least 24 proteins displayed significant changes (p < 0.05) at expression level under the radiation stress, among which 22 were successfully identified and classified into the major functional categories of metabolism, energy production and conservation, translation, ribosomal structure, and biogenesis. Among these proteins, leucyl aminopeptidase involved in synthesis of glutathione was the most abundant induced protein during postirradiation recovery, indicating that anti-oxidation protection was the most important line of defense in SC1204 against radiation. The next abundant protein was phosphoribosyl aminoimidazole carboxamide formyltransferase/IMP cyclohydrolase (AICAR Tfase/IMPCH), the key enzyme in the biosynthetic pathway of purine that is anti-radiation compound. Other proteins changing significantly (p < 0.05) after radiation exposure included urocanate hydratase, dihydrolipoyl dehydrogenase, succinyl-CoA synthetase subunit alpha, phosphoglycerate kinase, cell division protein FtsZ, elongation factor Ts and Tu, translation elongation factor Tu and G, 30S ribosomal protein S1, histidyl-tRNA synthetase, and arginyl-tRNA synthetase, which were considered to be the key proteins in urocanate metabolism, tricarboxylic acid cycle, glycolysis, cell division process, and synthesis process of proteins. Therefore, these proteins may also play important roles in radiation resistance in M. luteus.

Physicochemical properties and membrane biofouling of extra-cellular polysaccharide produced by a Micrococcus luteus strain.

PubMed

Feng, Lei; Li, Xiufen; Song, Ping; Du, Guocheng; Chen, Jian

2014-07-01

The physicochemical properties of the extra-cellular polysaccharide (EPS) produced by a Micrococcus luteus strain, a dominating strain isolated from membrane biofouling layer, were determined in this study. The EPS isolated from this strain was measured to have an average molecular weight of 63,540 Da and some typical polysaccharide absorption peaks in Fourier transform infrared spectrum. Monosaccharide components of the EPS contained rhamnose, fucose, arabinose, xylose, mannose, galactose and glucose in a molar ratio of 0.2074:0.0454:0.0262:0.0446:1.7942:1.2086:0.4578. Pseudo plastic properties were also observed for the EPS through the rheological measurement. The EPS was further characterized for its behavior to cause membrane flux decline. The results showed that both flux declines for polyvinylidenefluoride (PVDF) and polypropylene membranes became more severe as EPS feed concentration increased. A higher irreversible fouling for the PVDF membrane suggested that the EPS had the larger fouling potential to this microfiltration membrane.

Secondary structure and phylogeny of Staphylococcus and Micrococcus 5S rRNAs.

PubMed Central

Dekio, S; Yamasaki, R; Jidoi, J; Hori, H; Osawa, S

1984-01-01

Nucleotide sequences of 5S rRNAs from four bacteria, Staphylococcus aureus Smith (diffuse), Staphylococcus epidermidis ATCC 14990, Micrococcus luteus ATCC 9341 and Micrococcus luteus ATCC 4698, were determined. The secondary structural models of S. aureus and S. epidermidis sequences showed characteristics of the gram-positive bacterial 5S rRNA (116-N type [H. Hori and S. Osawa, Proc. Natl. Acad. Sci. U.S.A. 76:381-385, 1979]). Those of M. luteus ATCC 9341 and M. luteus ATCC 4698 together with that of Streptomyces griseus (A. Simoncsits, Nucleic Acids Res. 8:4111-4124, 1980) showed intermediary characteristics between the gram-positive and gram-negative (120-N type [H. Hori and S. Osawa, 1979]) 5S rRNAs. This and previous studies revealed that there exist at least three major groups of eubacteria having distinct 5S rRNA and belonging to different stems in the 5S rRNA phylogenic tree. PMID:6735981

Endonuclease from Micrococcus luteus Which Has Activity Toward Ultraviolet-Irradiated Deoxyribonucleic Acid: Its Action on Transforming Deoxyribonucleic Acid

PubMed Central

Setlow, R. B.; Setlow, Jane K.; Carrier, W. L.

1970-01-01

An endonuclease purified from Micrococcus luteus makes single-strand breaks in ultraviolet (UV)-irradiated, native deoxyribonucleic acid (DNA). The purified endonuclease is able to reactivate UV-inactivated transforming DNA of Haemophilus influenzae, especially when the DNA is assayed on a UV-sensitive mutant of H. influenzae. After extensive endonuclease action, there is a loss of transforming DNA when assayed on both UV-sensitive and -resistant cells. The endonuclease does not affect unirradiated DNA. The results indicate that the endonuclease function is involved in the repair of biological damage resulting from UV irradiation and that the UV-sensitive mutant is deficient in this step. We interpret the data as indicating that the various steps in the repair of DNA must be well coordinated if repair is to be effective. PMID:4314478

Impact of Branched-Chain Amino Acid Catabolism on Fatty Acid and Alkene Biosynthesis in Micrococcus luteus.

PubMed

Surger, Maximilian J; Angelov, Angel; Stier, Philipp; Übelacker, Maria; Liebl, Wolfgang

2018-01-01

Micrococcus luteus naturally produces alkenes, unsaturated aliphatic hydrocarbons, and represents a promising host to produce hydrocarbons as constituents of biofuels and lubricants. In this work, we identify the genes for key enzymes of the branched-chain amino acid catabolism in M. luteus , whose first metabolic steps lead also to the formation of primer molecules for branched-chain fatty acid and olefin biosynthesis, and demonstrate how these genes can be used to manipulate the production of specific olefins in this organism. We constructed mutants of several gene candidates involved in the branched-chain amino acid metabolism or its regulation and investigated the resulting changes in the cellular fatty acid and olefin profiles by GC/MS. The gene cluster encoding the components of the branched-chain α-keto acid dehydrogenase (BCKD) complex was identified by deletion and promoter exchange mutagenesis. Overexpression of the BCKD gene cluster resulted in about threefold increased olefin production whereas deletion of the cluster led to a drastic reduction in branched-chain fatty acid content and a complete loss of olefin production. The specificities of the acyl-CoA dehydrogenases of the branched amino acid degradation pathways were deduced from the fatty acid and olefin profiles of the respective deletion mutant strains. In addition, growth experiments with branched amino acids as the only nitrogen source were carried out with the mutants in order to confirm our annotations. Both the deletion mutant of the BCKD complex, responsible for the further degradation of all three branched-chain amino acids, as well as the deletion mutant of the proposed isovaleryl-CoA dehydrogenase (specific for leucine degradation) were not able to grow on leucine in contrast to the parental strain. In conclusion, our experiments allow the unambigous assignment of specific functions to the genes for key enzymes of the branched-chain amino acid metabolism of M. luteus . We also show how

Evaluation of enhanced thermostability and operational stability of carbonic anhydrase from Micrococcus species.

PubMed

Bhattacharya, Abhishek; Shrivastava, Ankita; Sharma, Anjana

2013-06-01

Carbonic anhydrase (CA) was purified from Micrococcus lylae and Micrococcus luteus with 49.90 and 53.8 % yield, respectively, isolated from calcium carbonate kilns. CA from M. lylae retained 80 % stability in the pH and temperature range of 6.0-8.0 and 35-45 °C, respectively. However, CA from M. luteus was stable in the pH and temperature range of 7.5-10.0 and 35-55 °C, respectively. Cross-linked enzyme aggregates (CLEAs) raised the transition temperature of M. lylae and M. luteus CA up to 67.5 and 74.0 °C, while the operational stability (T(1/20) of CA at 55 °C was calculated to be 7.7 and 12.0 h, respectively. CA from both the strains was found to be monomeric in nature with subunit molecular weight and molecular mass of 29 kDa. Ethoxozolamide was identified as the most potent inhibitor based on both IC(50) values and inhibitory constant measurement (K(i)). The K(m) and V(max) for M. lylae CA (2.31 mM; 769.23 μmol/mg/min) and M. luteus CA (2.0 mM; 1,000 μmol/mg/min) were calculated from Lineweaver-Burk plots in terms of esterase activity. Enhanced thermostability of CLEAs alleviates its role in operational stability for application at an on-site scrubber. The characteristic profile of purified CA from Micrococcus spp. advocates its effective application in biomimetic CO(2) sequestration.

Culture-dependent and culture-independent characterization of potentially functional biphenyl-degrading bacterial community in response to extracellular organic matter from Micrococcus luteus.

PubMed

Su, Xiao-Mei; Liu, Yin-Dong; Hashmi, Muhammad Zaffar; Ding, Lin-Xian; Shen, Chao-Feng

2015-05-01

Biphenyl (BP)-degrading bacteria were identified to degrade various polychlorinated BP (PCB) congers in long-term PCB-contaminated sites. Exploring BP-degrading capability of potentially useful bacteria was performed for enhancing PCB bioremediation. In the present study, the bacterial composition of the PCB-contaminated sediment sample was first investigated. Then extracellular organic matter (EOM) from Micrococcus luteus was used to enhance BP biodegradation. The effect of the EOM on the composition of bacterial community was investigated by combining with culture-dependent and culture-independent methods. The obtained results indicate that Proteobacteria and Actinobacteria were predominant community in the PCB-contaminated sediment. EOM from M. luteus could stimulate the activity of some potentially difficult-to-culture BP degraders, which contribute to significant enhancement of BP biodegradation. The potentially difficult-to-culture bacteria in response to EOM addition were mainly Rhodococcus and Pseudomonas belonging to Gammaproteobacteria and Actinobacteria respectively. This study provides new insights into exploration of functional difficult-to-culture bacteria with EOM addition and points out broader BP/PCB degrading, which could be employed for enhancing PCB-bioremediation processes. © 2015 The Authors. Microbial Biotechnology published by John Wiley & Sons Ltd and Society for Applied Microbiology.

Description of Micrococcus aloeverae sp. nov., an endophytic actinobacterium isolated from Aloe vera.

PubMed

Prakash, Om; Nimonkar, Yogesh; Munot, Hitendra; Sharma, Avinash; Vemuluri, Venkata Ramana; Chavadar, Mahesh S; Shouche, Yogesh S

2014-10-01

A yellow Gram-stain-positive, non-motile, non-endospore -forming, spherical endophytic actinobacterium, designated strain AE-6(T), was isolated from the inner fleshy leaf tissues of Aloe barbadensis (Aloe vera) collected from Pune, Maharashtra, India. Strain AE-6(T) grew at high salt concentrations [10% (w/v) NaCl], temperatures of 15-41 °C and a pH range of 5-12. It showed highest (99.7%) 16S rRNA gene sequence similarity with Micrococcus yunnanensis YIM 65004(T) followed by Micrococcus luteus NCTC 2665(T) (99.6%) and Micrococcus endophyticus YIM 56238(T) (99.0%). Ribosomal protein profiling by MALDI-TOF/MS also showed it was most closely related to M. yunnanensis YIM 65004(T) and M. luteus NCTC 2665(T). Like other members of the genus Micrococcus, strain AE-6(T) had a high content of branched chain fatty acids (iso-C15:0 and anteiso-C15:0). MK-8(H2) and MK-8 were the predominant isoprenoid quinones. Cell wall analysis showed an 'A2 L-Lys-peptide subunit' type of peptidoglycan and ribose to be the major cell wall sugar. The DNA G+C content was 70 mol%. Results of DNA-DNA hybridization of AE-6(T) with its closest relatives from the genus Micrococcus produced a value of less than 70%. Based on the results of this study, strain AE-6(T) could be clearly differentiated from other members of the genus Micrococcus. We propose that it represents a novel species of the genus Micrococcus and suggest the name Micrococcus aloeverae sp. nov., with strain AE-6(T) ( = MCC 2184(T) = DSM 27472(T)) as the type strain of the species. © 2014 IUMS.

Biosynthetic elongation of isolated teichuronic acid polymers via glucosyl- and N-acetylmannosaminuronosyltransferases from solubilized cytoplasmic membrane fragments of Micrococcus luteus.

PubMed Central

Hildebrandt, K M; Anderson, J S

1990-01-01

Cytoplasmic membrane fragments of Micrococcus luteus catalyze in vitro biosynthesis of teichuronic acid from uridine diphosphate D-glucose (UDP-glucose), uridine diphosphate N-acetyl-D-mannosaminuronic acid (UDP-ManNAcA), and uridine diphosphate N-acetyl-D-glucosamine. Membrane fragments solubilized with Thesit (dodecyl alcohol polyoxyethylene ether) can utilize UDP-glucose and UDP-ManNAcA to effect elongation of teichuronic acid isolated from native cell walls. When UDP-glucose is the only substrate supplied, the detergent-solubilized glucosyltransferase incorporates a single glucosyl residue onto each teichuronic acid acceptor. When both UDP-glucose and UDP-ManNAcA are supplied, the glucosyltransferase and the N-acetylmannosaminuronosyltransferase act cooperatively to elongate the teichuronic acid acceptor by multiple additions of the disaccharide repeat unit. As shown by polyacrylamide gel electrophoresis, low-molecular-weight fractions of teichuronic acid are converted to higher-molecular-weight polymers by the addition of as many as 17 disaccharide repeat units. Images PMID:2118507

Viability and biomass of Micrococcus luteus DE2008 at different salinity concentrations determined by specific fluorochromes and CLSM-image analysis.

PubMed

Puyen, Zully M; Villagrasa, Eduard; Maldonado, Juan; Esteve, Isabel; Solé, Antonio

2012-01-01

In previous studies, our group developed a method based on Confocal Laser Scanning Microscopy and Image Analysis (CLSM-IA) to analyze the diversity and biomass of cyanobacteria in microbial mats. However, this method cannot be applied to heterotrophic microorganisms, as these do not have autofluorescence. In this article, we present a method that combines CLSM-IA and Hoechst 33342 and SYTOX Green fluorochromes (FLU-CLSM-IA) to determine the viability and biomass of Micrococcus luteus DE2008, isolated from a saline microbial mat (Ebro Delta, Tarragona, Spain). The method has been applied to assess the effect of salinity on this microorganism. A reduction in viability and biomass (live cells) was observed as the salt concentration increases. The largest effect was at 100‰ NaCl with a cell death of 27.25% and a decrease in total and individual biomass of 39.75 and 0.009 mgC/cm(3), respectively, both with respect to optimal growth (10 ‰ NaCl). On the other hand, another important contribution of this article was that combining the FLU-CLSM-IA results with those achieved by plate counts enabled us to determine, for first time, the viability and the total biomass of the "dormant cells" (66.75% of viability and 40.59 mgC/cm(3) of total biomass at 100‰ NaCl). FLU-CLSM-IA is an efficient, fast, and reliable method for making a total count of cells at pixel level, including the dormant cells, to evaluate the viability and the biomass of a hetetrophic microorganism, M. luteus DE2008.

Amino acids in cell wall of Gram-positive bacterium Micrococcus sp. hsn08 with flocculation activity on Chlorella vulgaris biomass.

PubMed

Li, Yi; Xu, Yanting; Zheng, Tianling; Wang, Hailei

2018-02-01

The aim of this work was to investigate the flocculation mechanism by Gram-positive bacterium, Micrococcus sp. hsn08 as a means for harvesting Chlorella vulgaris biomass. Bacterial cells of Micrococcus sp. hsn08 were added into algal culture to harvest algal cells through direct contacting with algae to form flocs. Viability dependence test confirmed that flocculation activity does not depend on live bacteria, but on part of the peptidoglycan. The further investigation has determined that amino acids in cell wall play an important role to flocculate algal cells. Positively charged calcium can combine bacterial and algal cells together, and form a bridge between them, thereby forming the flocs, suggesting that ions bridging is the main flocculation mechanism. These results suggest that bacterial cells of Micrococcus sp. hsn08 can be applied to harvest microalgae biomass with the help of amino acids in cell wall. Copyright © 2017 Elsevier Ltd. All rights reserved.

First report of linear megaplasmids in the genus Micrococcus.

PubMed

Dib, Julian R; Wagenknecht, Martin; Hill, Russell T; Farías, María E; Meinhardt, Friedhelm

2010-01-01

High-altitude wetlands (above 4200m) in the northwest of Argentina are considered pristine and extreme environments. Micrococcus sp. A1, H5, and V7, isolated from such environments, were shown to contain linear megaplasmids, designated pLMA1, pLMH5, and pLMV7, respectively. As known from linear plasmids of other actinomycetes, all three plasmids were resistant to lambda exonuclease treatment, which is consistent with having terminal proteins covalently attached to their 5' DNA ends. Electrophoretic mobility, Southern analysis, and restriction endonuclease patterns revealed pLMA1 and pLMH5 being indistinguishable plasmids, even though they were found in different strains isolated from two distant wetlands - Laguna Azul and Laguna Huaca Huasi. Analysis of 16S rDNA sequences of Micrococcus sp. A1, H5, and V7 suggested a close relationship to Micrococcus luteus. Typing of isolates was performed using fingerprint patterns generated by BOX-PCR. Plasmid-deficient strains, generated from Micrococcus sp. A1, showed a significantly decreased resistance level for erythromycin. Copyright 2009 Elsevier Inc. All rights reserved.

Biosynthetic pathway for γ-cyclic sarcinaxanthin in Micrococcus luteus: heterologous expression and evidence for diverse and multiple catalytic functions of C(50) carotenoid cyclases.

PubMed

Netzer, Roman; Stafsnes, Marit H; Andreassen, Trygve; Goksøyr, Audun; Bruheim, Per; Brautaset, Trygve

2010-11-01

We report the cloning and characterization of the biosynthetic gene cluster (crtE, crtB, crtI, crtE2, crtYg, crtYh, and crtX) of the γ-cyclic C(50) carotenoid sarcinaxanthin in Micrococcus luteus NCTC2665. Expression of the complete and partial gene cluster in Escherichia coli hosts revealed that sarcinaxanthin biosynthesis from the precursor molecule farnesyl pyrophosphate (FPP) proceeds via C(40) lycopene, C(45) nonaflavuxanthin, C(50) flavuxanthin, and C(50) sarcinaxanthin. Glucosylation of sarcinaxanthin was accomplished by the crtX gene product. This is the first report describing the biosynthetic pathway of a γ-cyclic C(50) carotenoid. Expression of the corresponding genes from the marine M. luteus isolate Otnes7 in a lycopene-producing E. coli host resulted in the production of up to 2.5 mg/g cell dry weight sarcinaxanthin in shake flasks. In an attempt to experimentally understand the specific difference between the biosynthetic pathways of sarcinaxanthin and the structurally related ε-cyclic decaprenoxanthin, we constructed a hybrid gene cluster with the γ-cyclic C(50) carotenoid cyclase genes crtYg and crtYh from M. luteus replaced with the analogous ε-cyclic C(50) carotenoid cyclase genes crtYe and crtYf from the natural decaprenoxanthin producer Corynebacterium glutamicum. Surprisingly, expression of this hybrid gene cluster in an E. coli host resulted in accumulation of not only decaprenoxanthin, but also sarcinaxanthin and the asymmetric ε- and γ-cyclic C(50) carotenoid sarprenoxanthin, described for the first time in this work. Together, these data contributed to new insight into the diverse and multiple functions of bacterial C(50) carotenoid cyclases as key catalysts for the synthesis of structurally different carotenoids.

Expression levels of chaperones influence biotransformation activity of recombinant Escherichia coli expressing Micrococcus luteus alcohol dehydrogenase and Pseudomonas putida Baeyer-Villiger monooxygenase.

PubMed

Baek, A-Hyong; Jeon, Eun-Yeong; Lee, Sun-Mee; Park, Jin-Byung

2015-05-01

We demonstrated for the first time that the archaeal chaperones (i.e., γ-prefoldin and thermosome) can stabilize enzyme activity in vivo. Ricinoleic acid biotransformation activity of recombinant Escherichia coli expressing Micrococcus luteus alcohol dehydrogenase and the Pseudomonas putida KT2440 Baeyer-Villiger monooxygenase improved significantly with co-expression of γ-prefoldin or recombinant themosome originating from the deep-sea hyperthermophile archaea Methanocaldococcus jannaschii. Furthermore, the degree of enhanced activity was dependent on the expression levels of the chaperones. For example, whole-cell biotransformation activity was highest at 12 µmol/g dry cells/min when γ-prefoldin expression level was approximately 46% of the theoretical maximum. This value was approximately two-fold greater than that in E. coli, where the γ-prefoldin expression level was zero or set to the theoretical maximum. Therefore, it was assumed that the expression levels of chaperones must be optimized to achieve maximum biotransformation activity in whole-cell biocatalysts. © 2014 Wiley Periodicals, Inc.

A novel approach to enhance biological nutrient removal using a culture supernatant from Micrococcus luteus containing resuscitation-promoting factor (Rpf) in SBR process.

PubMed

Liu, Yindong; Su, Xiaomei; Lu, Lian; Ding, Linxian; Shen, Chaofeng

2016-03-01

A culture supernatant from Micrococcus luteus containing resuscitation-promoting factor (SRpf) was used to enhance the biological nutrient removal of potentially functional bacteria. The obtained results suggest that SRpf accelerated the start-up process and significantly enhanced the biological nutrient removal in sequencing batch reactor (SBR). PO4 (3-)-P removal efficiency increased by over 12 % and total nitrogen removal efficiency increased by over 8 % in treatment reactor acclimated by SRpf compared with those without SRpf addition. The Illumina high-throughput sequencing analysis showed that SRpf played an essential role in shifts in the composition and diversity of bacterial community. The phyla of Proteobacteria and Actinobacteria, which were closely related to biological nutrient removal, were greatly abundant after SRpf addition. This study demonstrates that SRpf acclimation or addition might hold great potential as an efficient and cost-effective alternative for wastewater treatment plants (WWTPs) to meet more stringent operation conditions and legislations.

[Occurrence of bacteria in the mouth from genera of Micrococcus, Kocuria, Nesterenkonia, Kytococcus and Dermacoccus].

PubMed

Szczerba, Izabela; Krzemiński, Zbigniew

2002-01-01

The aim of the study was to assess the prevalence of different bacteria in the oral cavity. The bacteria were present in the oral cavities of 73 (48.7%) of 150 individuals. Nesterenkonia halobia, the most frequently isolated species, was found in 20 (27%) individuals, Micrococcus luteus in 16 (22%), Kocuria kristinae in 12 (16%), Kocuria varians in 10 (14%), Dermacoccus sedentarius in 9 (12%), Micrococcus lylae in 8 (11%), and Kytococcus nishinomiyaensis in 3 (4%). Mean counts of these microorganisms were relatively low and amounted in log10 CFU/ml saliva for M. luteus 1.87 +/- 0.52, for M. lylae 2.03 +/- 0.39, for N. halobia 2.14 +/- 0.56, for K. kristinae 2.20 +/- 0.69, for K. varians 2.19 +/- 0.67, for K. nishinomiyaensis 1.72 +/- 0.39, and for D. sedentarius 2.27 +/- 0.55. The factor limiting the population sizes of these microorganisms was most probably the antagonistic activity of the bacteria living in oral cavity.

Characterization of Micrococcus strains isolated from indoor air.

PubMed

Kooken, Jennifer M; Fox, Karen F; Fox, Alvin

2012-02-01

The characterization of microbes, such as opportunists and pathogens (e.g., methicillin resistant Staphylococcus aureus [MRSA]), in indoor air is important for understanding disease transmission from person-to-person. Common genera found in the human skin microbiome include Micrococcus and Staphylococcus, but there only a limited number of tests to differentiate these genera and/or species. Both genera are believed to be released into indoor air from the shedding of human skin and are morphologically difficult to distinguish. In the current work, after the extraction of proteins from micrococci and the separation of these proteins on one dimensional electrophoretic gels, tryptic peptides were analyzed by MALDI TOF MS and the mass profiles compared with those of a reference strain (ATCC 4698). The results confirmed that all strains were consistent in identity with Micrococcus luteus. Copyright © 2011 Elsevier Ltd. All rights reserved.

Characterization of Micrococcus strains isolated from indoor air

PubMed Central

Kooken, Jennifer M.; Fox, Karen F.; Fox, Alvin

2014-01-01

The characterization of microbes, such as of opportunists and pathogens (e.g. methicillin resistant Staphylococcus aureus [MRSA]), in indoor air is important for understanding disease transmission from person-to-person. Common genera found in the human skin microbiome include Micrococcus and Staphylococcus, but there only a limited number of tests to differentiate these genera and/or species. Both genera are believed to be released into indoor air from the shedding of human skin and are morphologically difficult to distinguish. In the current work, after the extraction of proteins from micrococci and the separation of these proteins on one dimensional electrophoretic gels, tryptic peptides were analyzed by MALDI TOF MS and the mass profiles compared with those of a reference strain (ATCC 4698). The results confirmed that all strains were consistent in identity with Micrococcus luteus. PMID:21963944

Crystal structure of salt-tolerant glutaminase from Micrococcus luteus K-3 in the presence and absence of its product L-glutamate and its activator Tris.

PubMed

Yoshimune, Kazuaki; Shirakihara, Yasuo; Wakayama, Mamoru; Yumoto, Isao

2010-02-01

Glutaminase from Micrococcus luteus K-3 [Micrococcus glutaminase (Mglu); 456 amino acid residues (aa); 48 kDa] is a salt-tolerant enzyme. Our previous study determined the structure of its major 42-kDa fragment. Here, using new crystallization conditions, we determined the structures of the intact enzyme in the presence and absence of its product L-glutamate and its activator Tris, which activates the enzyme by sixfold. With the exception of a 'lid' part (26-29 aa) and a few other short stretches, the structures were all very similar over the entire polypeptide chain. However, the presence of the ligands significantly reduced the length of the disordered regions: 41 aa in the unliganded structure (N), 21 aa for L-glutamate (G), 8 aa for Tris (T) and 6 aa for both L-glutamate and Tris (TG). L-glutamate was identified in both the G and TG structures, whereas Tris was only identified in the TG structure. Comparison of the glutamate-binding site between Mglu and salt-labile glutaminase (YbgJ) from Bacillus subtilis showed significantly smaller structural changes of the protein part in Mglu. A comparison of the substrate-binding pocket of Mglu, which is highly specific for L-glutamine, with that of Erwinia carotovora asparaginase, which has substrates other than L-glutamine, shows that Mglu has a larger substrate-binding pocket that prevents the binding of L-asparagine with proper interactions.

Whole-Genome Sequence of the Soil Bacterium Micrococcus sp. KBS0714.

PubMed

Kuo, V; Shoemaker, W R; Muscarella, M E; Lennon, J T

2017-08-10

We present here a draft genome assembly of Micrococcus sp. KBS0714, which was isolated from agricultural soil. The genome provides insight into the strategies that Micrococcus spp. use to contend with environmental stressors such as desiccation and starvation in environmental and host-associated ecosystems. Copyright © 2017 Kuo et al.

Micrococcus flavus sp. nov., isolated from activated sludge in a bioreactor.

PubMed

Liu, Xing-Yu; Wang, Bao-Jun; Jiang, Cheng-Ying; Liu, Shuang-Jiang

2007-01-01

Bacterial strain LW4(T) was isolated from activated sludge of a wastewater-treatment bioreactor. Cells of strain LW4(T) were Gram-positive cocci, with a diameter of 0.7-1.0 microm. Colonies produced on LB agar plates were yellow, smooth, circular and 0.5-1.5 mm in diameter. Strain LW4(T) was aerobic and grew over the temperature range 26-34 degrees C and pH range 5-9, with optimal growth at 30.5-31.5 degrees C and pH 6.0-6.2. The cell-wall peptidoglycan of strain LW4(T) contained amino acid residues of lysine, glutamic acid, alanine, glycine and aspartic acid. The most abundant cellular fatty acids of strain LW4(T) were anteiso-C(15 : 0) (32.15 %) and iso-C(15 : 0) (31.65 %). Major respiratory quinones were MK-8(H(2)) (57.3 %) and MK-7(H(2)) (32.9 %). The DNA G+C content was 71.4 mol% (T(m)). 16S rRNA gene sequence analysis indicated that strain LW4(T) was phylogenetically related to members of the genus Micrococcus, with similarities ranging from 96.5 to 97.3 %. Levels of DNA-DNA relatedness of strain LW4(T) to Micrococcus luteus DSM 20030(T), Micrococcus lylae DSM 20315(T) and Micrococcus antarcticus AS 1.2372(T) were 55, 48 and 36 %, respectively. Based on these results, it is concluded that strain LW4(T) represents a novel species of the genus Micrococcus, for which the name Micrococcus flavus sp. nov. is proposed. The type strain is strain LW4(T) (=CGMCC 1.5361(T)=JCM 14000(T)).

Nisin Migration in Shelf Stable, Tuna-Filled Tortillas During Storage

DTIC Science & Technology

2014-09-22

RATIONS SHELF LIFE ACCEPTABILITY MICROCOCCUS LUTEUS STORAGE INHIBITION MILITARY RATIONS...7 Figure 3. The assay of nisin against Micrococcus luteus ATCC 10240 in tuna enrobed in a tortilla wrap...METHODS 2.1 BACTERIAL STRAINS, MEDIA, AND BUFFER The nisin-sensitive test organism, Micrococcus luteus ATCC® 10240, was obtained from the American

Alkylation Induced DNA Repair and Mutagenesis in Escherichia coli.

DTIC Science & Technology

1987-11-23

III (Gates and inn, 1977), Micrococcus luteus UV endo- nuclease (Grossman et al, 1978) and bacteriophage T UV endonuclease (Warner et al, 1980) have DNA...34, Garland Publishing, Inc. New York & London USA. Ather, A., Z. Ahmed and S. Riazxxddin, 1984. Adaptive response of Micrococcus luteus to alkylating...Laval, J., 3. Pierre and F. Laval. 1981. Release of 7-nmthylguanine residues frain alkylated ENA by extracts of Micrococcus luteus and Escherichia

Survival of Microorganisms in Nature.

DTIC Science & Technology

1982-04-07

number) Survival of bacteria; Death of bacteria; Cysts; Dormancy; Pseudomonas aeruginosa; Azotobacter; Chemotaxis; Micrococcus luteus; Predation...attracted to and rapidly destroys (lyses) added Micrococcus luteus cells. There is also attack of predator on predator in this system. DO 1 DIT1 473 Oor I OV...and on laboratory media. 4 1 SUMMARY OF IMPORTANT RESULTS Micrococcus luteus was shown to survive only poorly in soil (Casida, 1980a). This was

Standardized Procedures for Use of Nucleic Acid-Based Tools

DTIC Science & Technology

2008-08-01

Dhc size or cell wall characteristics including Brevundimonas diminuta (small), Micrococcus sp. (small coccoid) and Halobacterium sp. (Dhc-like cell...Halobacterium species as a Dhc surrogate. Another potential surrogate based on size and shape is Micrococcus species including Micrococcus luteus... Micrococcus luteus (ATCC-4442) are relatively small (1,000 nm) spherical bacteria (Madigan et al., 2006). Due to the fact that introduction and

Improvement of cadmium phytoremediation after soil inoculation with a cadmium-resistant Micrococcus sp.

PubMed

Sangthong, Chirawee; Setkit, Kunchaya; Prapagdee, Benjaphorn

2016-01-01

Cadmium-resistant Micrococcus sp. TISTR2221, a plant growth-promoting bacterium, has stimulatory effects on the root lengths of Zea mays L. seedlings under toxic cadmium conditions compared to uninoculated seedlings. The performance of Micrococcus sp. TISTR2221 on promoting growth and cadmium accumulation in Z. mays L. was investigated in a pot experiment. The results indicated that Micrococcus sp. TISTR2221significantly promoted the root length, shoot length, and dry biomass of Z. mays L. transplanted in both uncontaminated and cadmium-contaminated soils. Micrococcus sp. TISTR2221 significantly increased cadmium accumulation in the roots and shoots of Z. mays L. compared to uninoculated plants. At the beginning of the planting period, cadmium accumulated mainly in the shoots. With a prolonged duration of cultivation, cadmium content increased in the roots. As expected, little cadmium was found in maize grains. Soil cadmium was significantly reduced with time, and the highest percentage of cadmium removal was found in the bacterial-inoculated Z. mays L. after transplantation for 6 weeks. We conclude that Micrococcus sp. TISTR2221 is a potent bioaugmenting agent, facilitating cadmium phytoextraction in Z. mays L.

Devices for monitoring content of microparticles and bacterium in injection solutions in pharmaceutical production

NASA Astrophysics Data System (ADS)

Bilyi, Olexander I.; Getman, Vasyl B.; Konyev, Fedir A.; Sapunkov, Olexander; Sapunkov, Pavlo G.

2001-06-01

The devices for monitoring of parameters of efficiency of water solutions filtration, which are based on the analysis of scattered light by microparticles are considered in this article. The efficiency of using of devices in pharmaceutics in technological processes of manufacturing medical injection solutions is shown. The examples of monitoring of contents of bacterial cultures Pseudomonas aeruginosa, Escherichia coli, and Micrococcus luteus in water solutions of glucose are indicated.

21 CFR 610.12 - Sterility.

Code of Federal Regulations, 2010 CFR

2010-04-01

.... Non-spore-formers 3. Candida albicans (ATCC No. 10231) Do. 4. Micrococcus luteus (ATCC No. 9341) Do. 5.... 6633) 20 to 25 °C. Non-spore-formers 2. Candida albicans (ATCC No. 10231) Do. 3. Micrococcus luteus...

Distribution and Persistence of Staphylococcus and Micrococcus Species and Other Aerobic Bacteria on Human Skin1

PubMed Central

Kloos, Wesley E.; Musselwhite, Margaret S.

1975-01-01

The distribution of Staphylococcus and Micrococcus species and associated coryneform bacteria, Acinetobacter, Klebsiella, Enterobacter, Bacillus, and Streptomyces on skin was determined during October 1971 from samples collected on persons living in North Carolina and New Jersey. Persistence of these organisms on skin was estimated in temporal studies conducted during the period from June 1971 to June 1972 on persons living in North Carolina. Staphylococci and coryneforms were the most predominant and persistent bacteria isolated from the nares and axillae. Staphylococci, coryneforms, micrococci, and Bacillus were the most predominant and persistent bacteria isolated from the head, legs, and arms. Acinetobacters were most frequently isolated during the warmer months of the years. Staphylococcus aureus and S. epidermidis were the most predominant and persistent staphylococci isolated from the nares, whereas S. epidermidis and S. hominis were the most predominant and persistent staphylococci isolated from the axillae, head, legs, and arms. S. capitis was often isolated from the head and arms and S. haemolyticus was often isolated from the head, legs, and arms. S. simulans, S. xylosus, S. cohnii, S. saprophyticus, S. warneri, and an unclassified coagulase-positive species were only occasionally isolated from skin. Micrococcus luteus was the most predominant and persistent Micrococcus isolated from skin and preferred regions of the head, legs, and arms. M. varians was the second most frequent Micrococcus isolated. M. lylae, M. sedentarius, M. roseus, M. kristinae, and M. nishinomiyaensis were only occasionally isolated from skin. M. lylae was most frequently isolated during the colder months of the years. PMID:810086

Natural History of Multi-Drug Resistant Organisms in a New Military Medical Facility

DTIC Science & Technology

2012-10-01

Enterobacter cloacae  Maternity Ward  05.312  Sink top  Micrococcus  luteus  Maternity Ward  05.312  Telephone  Pantoea agglomerans  Maternity Ward...Acinetobacter baumannii  Surgical Ward  06.316  Call box  Acinetobacter  baumannii/calcoaceticus complex  Surgical Ward  06.316  Sink top  Micrococcus  luteus...Medical Ward  07.216  Sink top  Micrococcus  luteus  Medical Ward  07.216  Room Sink  Staphylococcus sciuri  ICU  02.123  Toilet seat  Staphylococcus

Evaluation of autochthonous micrococcus strains as starter cultures for the production of Kedong sufu.

PubMed

Feng, Z; Huang, S; Ai, Z W; Zhang, M; Zhai, S; Chen, X

2016-03-01

The technological properties of 22 micrococcus strains from traditional fermented Kedong sufu were evaluated in order to develop autochthonous starter cultures. The proteolytic, autolytic and lipolytic activity, salt tolerance, production and degradation of the biogenic amines of six Micrococcus luteus, nine Kocuria kristinae and seven Kocuria rosea were evaluated. The results indicated that these micrococcus strains exhibited a certain technological diversity, and the results also indicated the best properties to be used in mixed starter cultures. Based on the above findings, two sets of autochthonous starters were formulated. Considering the physicochemical properties and sensory characteristics of sufu, the maturation period of sufu was shortened by 30 days. The profiles of free amino acids and peptides partly revealed the mechanism of sensory quality and shorter ripening time of sufu manufactured using autochthonous mixed starters. Compared to back-slopping fermentation, sufu manufactured with selected autochthonous starter cultures exhibited lower levels of total biogenic amines. The selected strains could be used as starter to avoid the accumulation of high concentrations of biogenic amines while also maintaining typical sensory characteristics and preserving the autochthonous strains of the traditional Kedong sufu. The maturation times of Kedong sufu were shortened by 30 days with application of the autochthonous starter. Autochthonous mixed starters can reduce the generation of biogenic amines, speed up the sufu maturation process and preserve typical sensory quality. Furthermore, the rotation of two sets of mixed starter cultures can effectively resist phage attack during the production of sufu. © 2015 The Society for Applied Microbiology.

Halophilic Nuclease from a Moderately Halophilic Micrococcus varians

PubMed Central

Kamekura, Masahiro; Onishi, Hiroshi

1974-01-01

The moderately halophilic bacterium Micrococcus varians, isolated from soy sauce mash, produced extracellular nuclease when cultivated aerobically in media containing 1 to 4 M NaCl or KCl. The enzyme, purified to an electrophoretically homogeneous state, had both ribonuclease and deoxyribonuclease activities. The nuclease had maximal activity in the presence of 2.9 M NaCl or 2.1 M KCl at 40 C. The enzymatic activity was lost by dialysis against low-salt buffer, whereas when the inactivated enzyme was dialyzed against 3.4 M NaCl buffer as much as 77% of the initial activity could be restored. Images PMID:4852218

Chemical composition and antimicrobial activity of the essential oil of the leaves of Feronia elephantum (Rutaceae) from north west Karnataka.

PubMed

Joshi, Rajesh K; Badakar, Vijayalaxmi M; Kholkute, Sanjiva D; Khatib, Nayeem

2011-01-01

The essential oil of the leaves of Feronia elephantum Corr. was analyzed by gas chromatography and gas chromatography/mass spectrometry. The main constituents were beta-pinene (28.4%), Z-anethole (22.1%), methyl chavicol (12.0%) and E-anethole (8.1%), among thirty-three identified compounds, which represented 92.6% of the total oil. The antimicrobial activity was tested against five Gram-positive and eight Gram-negative bacteria, and four fungi. The oil was active against Micrococcus luteus (Gram-positive bacterium), Proteus mirabilis (Gram-negative bacterium), Penicillium chrysogenum and Aspergillus niger (fungi) with MIC values of 0.31 +/- 0.06, 0.52 +/- 0.10, 0.20 +/- 0.50 and 0.26 +/- 0.52 mg/mL, respectively.

Sterilization effects of atmospheric cold plasma brush

NASA Astrophysics Data System (ADS)

Yu, Q. S.; Huang, C.; Hsieh, F.-H.; Huff, H.; Duan, Yixiang

2006-01-01

This study investigated the sterilization effects of a brush-shaped plasma created at one atmospheric pressure. A population of 1.0×104-1.0×105 Escherichia coli or Micrococcus luteus bacteria was seeded in filter paper media and then subjected to Ar and/or Ar +O2 plasmas. A complete kill of the Micrococcus luteus required about 3 min argon plasma exposures. With oxygen addition into the argon plasma gas streams, a complete kill of the bacteria needed only less than 1 min plasma exposure for Micrococcus luteus and about 2 min exposure for Escherichia coli. The plasma treatment effects on the different bacteria cell structures were examined using scanning electron microscopy.

Immunochemical analysis of Micrococcus lysodeikticus (luteus) F1-ATPase and its subunits.

PubMed

Urban, C; Salton, M R

1983-08-31

The F1-ATPase from Micrococcus lysodeikticus has been purified to 95% protein homogeneity in this laboratory and as all other bacterial F1S, possesses five distinct subunits with molecular weights ranging from 60 000 to 10 000 (Huberman, M. and Salton, M.R.J. (1979) Biochim. Biophys. Acta 547, 230-240). In this communication, we demonstrate the immunochemical reactivities of antibodies to native and SDS-dissociated subunits with the native and dissociated F1-ATPase and show that: (1) the antibodies generated to the native or SDS-dissociated subunits react with the native molecule; (2) all of the subunits comprising the F1 are antigenically unique as determined by crossed immunoelectrophoresis and the Ouchterlony double-diffusion techniques; (3) antibodies to the SDS-denatured individual delta- and epsilon-subunits can be used to destabilize the interaction of these specific subunits with the rest of the native F1; and (4) all subunit antibodies as well as anti-native F1 were found to inhibit ATPase activity to varying degrees, the strongest inhibition being seen with antibodies to the total F1 and anti-alpha- and anti-beta-subunit antibodies. The interaction of specific subunit antibodies may provide a new and novel way to study further and characterize the catalytic portions of F1-ATPases and in general may offer an additional method for the examination of multimeric proteins.

Sterilization effects of atmospheric cold plasma brush

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yu, Q.S.; Huang, C.; Hsieh, F.-H.

2006-01-02

This study investigated the sterilization effects of a brush-shaped plasma created at one atmospheric pressure. A population of 1.0x10{sup 4}-1.0x10{sup 5} Escherichia coli or Micrococcus luteus bacteria was seeded in filter paper media and then subjected to Ar and/or Ar+O{sub 2} plasmas. A complete kill of the Micrococcus luteus required about 3 min argon plasma exposures. With oxygen addition into the argon plasma gas streams, a complete kill of the bacteria needed only less than 1 min plasma exposure for Micrococcus luteus and about 2 min exposure for Escherichia coli. The plasma treatment effects on the different bacteria cell structuresmore » were examined using scanning electron microscopy.« less

Biodegradation of cypermethrin by Micrococcus sp. strain CPN 1.

PubMed

Tallur, Preeti N; Megadi, Veena B; Ninnekar, Harichandra Z

2008-02-01

A bacterium capable of utilizing pyrethroid pesticide cypermethrin as sole source of carbon was isolated from soil and identified as a Micrococcus sp. The organism also utilized fenvalerate, deltamethrin, perimethrin, 3-phenoxybenzoate, phenol, protocatechuate and catechol as growth substrates. The organism degraded cypermethrin by hydrolysis of ester linkage to yield 3-phenoxybenzoate, leading to loss of its insecticidal activity. 3-Phenoxybenzoate was further metabolized by diphenyl ether cleavage to yield protocatechuate and phenol as evidenced by isolation and identification of metabolites and enzyme activities in the cell-free extracts. Protocatechuate and phenol were oxidized by ortho-cleavage pathway. Thus, the organism was versatile in detoxification and complete mineralization of pyrethroid cypermethrin.

[Features of interaction bacterial strains Micrococcus luteus LBK1 from plants varieties/hybrids cucumber and sweet pepper and with fungus Fusarium oxysporum Scelecht].

PubMed

Parfeniuk, A; Sterlikova, O; Beznosko, I; Krut', V

2014-01-01

The article presents the results of studying the impact of bacterial strain M. luteus LBK1, stimulating the growth and development of plant varieties/hybrids of cucumber and sweet pepper on the intensity of sporulation of the fungus F. oxysporum Scelecht--fusariose rot pathogen.

Crystal structure of heterodimeric hexaprenyl diphosphate synthase from Micrococcus luteus B-P 26 reveals that the small subunit is directly involved in the product chain length regulation.

PubMed

Sasaki, Daisuke; Fujihashi, Masahiro; Okuyama, Naomi; Kobayashi, Yukiko; Noike, Motoyoshi; Koyama, Tanetoshi; Miki, Kunio

2011-02-04

Hexaprenyl diphosphate synthase from Micrococcus luteus B-P 26 (Ml-HexPPs) is a heterooligomeric type trans-prenyltransferase catalyzing consecutive head-to-tail condensations of three molecules of isopentenyl diphosphates (C(5)) on a farnesyl diphosphate (FPP; C(15)) to form an (all-E) hexaprenyl diphosphate (HexPP; C(30)). Ml-HexPPs is known to function as a heterodimer of two different subunits, small and large subunits called HexA and HexB, respectively. Compared with homooligomeric trans-prenyltransferases, the molecular mechanism of heterooligomeric trans-prenyltransferases is not yet clearly understood, particularly with respect to the role of the small subunits lacking the catalytic motifs conserved in most known trans-prenyltransferases. We have determined the crystal structure of Ml-HexPPs both in the substrate-free form and in complex with 7,11-dimethyl-2,6,10-dodecatrien-1-yl diphosphate ammonium salt (3-DesMe-FPP), an analog of FPP. The structure of HexB is composed of mostly antiparallel α-helices joined by connecting loops. Two aspartate-rich motifs (designated the first and second aspartate-rich motifs) and the other characteristic motifs in HexB are located around the diphosphate part of 3-DesMe-FPP. Despite the very low amino acid sequence identity and the distinct polypeptide chain lengths between HexA and HexB, the structure of HexA is quite similar to that of HexB. The aliphatic tail of 3-DesMe-FPP is accommodated in a large hydrophobic cleft starting from HexB and penetrating to the inside of HexA. These structural features suggest that HexB catalyzes the condensation reactions and that HexA is directly involved in the product chain length control in cooperation with HexB.

Inactivation of the Radiation-Resistant Spoilage Bacterium Micrococcus radiodurans

PubMed Central

Duggan, D. E.; Anderson, A. W.; Elliker, P. R.

1963-01-01

A simplified technique permitting the pipetting of raw puréed meats for quantitative bacteriological study is described for use in determining survival of these non-sporing bacteria, which are exceptionally resistant to radiation. Survival curves, using gamma radiation as the sterilizing agent, were determined in raw beef with four strains of Micrococcus radiodurans. Survival curves of the R1 strain in other meat substrates showed that survival was significantly greater in raw beef and raw chicken than in raw fish or in cooked beef. Resistance was lowest in the buffer. Cells grown in broth (an artificial growth medium) and resuspended in beef did not differ in resistance from cells that had been grown and irradiated in beef. Survival rate was statistically independent of the initial cell concentration, even though there appeared to be a correlation between lower death rate and lower initial cell concentrations. The initial viable count of this culture of the domesticated R1 strain in beef was reduced by a factor of about 10-5 by 3.0 megarad, and 4.0 megarad reduced the initial count by a factor of more than 10-9. Data suggest that M. radiodurans R1 is more resistant to radiation than spore-forming spoilage bacteria for which inactivation rates have been published. PMID:14063780

Multiplicity of genome equivalents in the radiation-resistant bacterium Micrococcus radiodurans.

PubMed Central

Hansen, M T

1978-01-01

The complexity of the genome of Micrococcus radiodurans was determined to be (2.0 +/- 0.3) X 10(9) daltons by DNA renaturation kinetics. The number of genome equivalents of DNA per cell was calculated from the complexity and the content of DNA. A lower limit of four genome equivalents per cell was approached with decreasing growth rate. Thus, no haploid stage appeared to be realized in this organism. The replication time was estimated from the kinetics and amount of residual DNA synthesis after inhibiting initiation of new rounds of replication. From this, the redundancy of terminal genetic markers was calculated to vary with growth rate from four to approximately eight copies per cell. All genetic material, including the least abundant, is thus multiply represented in each cell. The potential significance of the maintenance in each cell of multiple gene copies is discussed in relation to the extreme radiation resistance of M. radiodurans. PMID:649572

Characterization of Catalase from Psychrotolerant Psychrobacter piscatorii T-3 Exhibiting High Catalase Activity

PubMed Central

Kimoto, Hideyuki; Yoshimune, Kazuaki; Matsuyma, Hidetoshi; Yumoto, Isao

2012-01-01

A psychrotolerant bacterium, strain T-3 (identified as Psychrobacter piscatorii), that exhibited an extraordinarily high catalase activity was isolated from the drain pool of a plant that uses H2O2 as a bleaching agent. Its cell extract exhibited a catalase activity (19,700 U·mg protein−1) that was higher than that of Micrococcus luteus used for industrial catalase production. Catalase was approximately 10% of the total proteins in the cell extract of the strain. The catalase (PktA) was purified homogeneously by only two purification steps, anion exchange and hydrophobic chromatographies. The purified catalase exhibited higher catalytic efficiency and higher sensitivity of activity at high temperatures than M. luteus catalase. The deduced amino acid sequence showed the highest homology with catalase of Psycrobacter cryohalolentis, a psychrotolelant bacterium obtained from Siberian permafrost. These findings suggest that the characteristics of the PktA molecule reflected the taxonomic relationship of the isolate as well as the environmental conditions (low temperatures and high concentrations of H2O2) under which the bacterium survives. Strain T-3 efficiently produces a catalase (PktA) at a higher rate than Exiguobacterium oxidotolerans, which produces a very strong activity of catalase (EktA) at a moderate rate, in order to adapt to high concentration of H2O2. PMID:22408420

Antimicrobial activity of 9-O-acyl- and 9-O-benzoyl-substituted berberrubines.

PubMed

Hong, S W; Kim, S H; Jeun, J A; Lee, S J; Kim, S U; Kim, J H

2000-05-01

In the course of a structure-activity relationship study on berberrubine derivatives, a series of compounds bearing 9-O-acyl-(4-6) and 9-O-benzoyl- (7) substituents was synthesized with the expectation of increasing the antimicrobial activity. One of the berberrubine derivatives, 9-lauroylberberrubine chloride was the most active against Gram-positive bacteria Enterococcus faecalis, Staphylococcus aureus, Staphylococcus epidermidis, Micrococcus luteus, Bacillus subtilis as well as the Gram-negative bacterium Klebsiella pneumoniae in comparison to berberine, the currently used antibiotic in clinic. This result suggested that the presence of lipophilic substituents of certain structures and sizes might be crucial for the optimal antimicrobial activity.

Branimycins B and C, Antibiotics Produced by the Abyssal Actinobacterium Pseudonocardia carboxydivorans M-227.

PubMed

Braña, Alfredo F; Sarmiento-Vizcaíno, Aida; Pérez-Victoria, Ignacio; Otero, Luis; Fernández, Jonathan; Palacios, Juan José; Martín, Jesús; de la Cruz, Mercedes; Díaz, Caridad; Vicente, Francisca; Reyes, Fernando; García, Luis A; Blanco, Gloria

2017-02-24

Two new antibiotics, branimycins B (2) and C (3), were produced by fermentation of the abyssal actinobacterium Pseudonocardia carboxydivorans M-227, isolated from deep seawater of the Avilés submarine Canyon. Their structures were elucidated by HRMS and NMR analyses. These compounds exhibit antibacterial activities against a panel of Gram-positive bacteria, including Corynebacterium urealyticum, Clostridium perfringens, and Micrococcus luteus, and against the Gram-negative bacterium Neisseria meningitidis. Additionally, branimycin B displayed moderate antibacterial activity against other Gram-negative bacteria such as Bacteroides fragilis, Haemophilus influenzae, and Escherichia coli, and branimycin C against the Gram-positive Enterococcus faecalis and methicillin-sensitive and methicillin-resistant Staphylococcus aureus.

21 CFR 173.135 - Catalase derived from Micrococcus lysodeikticus.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Catalase derived from Micrococcus lysodeikticus... Micrococcus lysodeikticus. Bacterial catalase derived from Micrococcus lysodeikticus by a pure culture... cheese, in accordance with the following conditions. (a) The organism Micrococcus lysodeikticus from...

Successful immunotherapy with micrococcus, BCG or related polysaccharides on L1210 leukaemia after BCNU chemotherapy.

PubMed Central

Verloes, R.; Atassi, G.; Dumont, P.; Kanarek, L.

1981-01-01

The experiments aimed at evaluating the optimal parameters in the chemo-immunotherapeutic treatment of the L1210 lymphoid leukaemia grafted to [female BALB/c (H2d) X male DBA/2 (H2d)]F1 hybrid mice, hereafter referred to as CDF1 mice. In vitro irradiation of leukaemic ascites cells by X- or gamma-rays and subsequent inoculation in mice showed that optimum immunogenicity is radiation dose-dependent. Grafting mice with 10(7) leukaemic ascites cells irradiated at optimum dose (80 GyX- or gamma-rays) delays mortality of the animals when challenged later with untreated L1210 cells, but is unable to cure mice. By contrast, specific immunoprophylaxis induced by Micrococcus, complement-triggering polysaccharides or BCG and irradiated leukaemic cells was able to protect mice against grafts of 10(4) L1210 cells. The i.p. route was notably superior to the i.v. route. When mice bearing advanced L1210 tumour were treated by chemotherapy (12 mg/kg of BCNU) on Day 6.5 after grafting 10(4) L1210 cells and subsequently treated by immunotherapy, a very high percentage (up to 90%) of mice with 10(8) leukaemic cells could be cured by repeated 1mg injections of bacterium or polysaccharide, and challenge with irradiated leukaemic cells was unnecessary. Because of the high cure rate obtained, the very regular response pattern and the non-pathogenicity, the bacterium Micrococcus lysodeikticus would seem a promising new candidate for chemo-immunotherapeutic antitumour strategies. PMID:7470382

[Occurrence and number of bacteria from the Micrococcus, Kocuria, Nesterenkonia, Kytococcus and Dermacoccus genera on skin and mucous membranes in humans].

PubMed

Szczerba, Izabela

2003-01-01

The aim of work was to evaluate the frequency of occurrence of bacteria from genera of Micrococcus, Kocuria, Nesterenkonia, kytococcus and Dermatococcus on human skin and mucous membranes in healthy population. Among 150 investigated persons these bacteria were found in 122 (81.3%). The frequency of isolation was similar in both sex (82.4% in female and 79.7% in male). Most often the strains were isolated from oral cavity (48.7%), and from skin of palm and forearm (40.7% and 37.3%). Least frequency of occurrence was observed in vestibule of nose (26%). The predominant isolated strains were: M. luteus (26.2%), and N. halobia (21%) followed by K. varians (16.4%), M. lylae (12.2%), D. sedentarius (9.1%), K. kristinae (7.3%), K. nishinomiyaensis (7.3%), K. rosea (0.3%).

Micrococcus species-related peritonitis in patients receiving peritoneal dialysis.

PubMed

Kao, Chih-Chin; Chiang, Chih-Kang; Huang, Jenq-Wen

2014-01-01

Peritonitis is a major complication of peritoneal dialysis (PD) and remains the most common cause of PD failure. Micrococci are catalase-positive, coagulase-negative, and gram-positive cocci that are spherical, often found in tetrad, and belong to the family Micrococcaceae. Micrococcus species are commonly found in the environment, and it is now recognized that Micrococcus species can be opportunistic pathogens in immunocompromised patients. The only consistent predisposing factor for Micrococcus infection is an immunocompromised state. We report three cases of Micrococcus PD peritonitis. Improper practice of PD may have been the causative factor. Although Micrococcus species are low-virulence pathogens, infection could result in refractory peritonitis and subsequent PD failure. Intraperitoneal administration of vancomycin for at least 2 weeks is recommended for Micrococcus peritonitis.

21 CFR 173.135 - Catalase derived from Micrococcus lysodeikticus.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 21 Food and Drugs 3 2011-04-01 2011-04-01 false Catalase derived from Micrococcus lysodeikticus... FOOD FOR HUMAN CONSUMPTION Enzyme Preparations and Microorganisms § 173.135 Catalase derived from Micrococcus lysodeikticus. Bacterial catalase derived from Micrococcus lysodeikticus by a pure culture...

Extraction, purification and characterization of a protease from Micrococcus sp. VKMM 037.

PubMed

Manikandan, Muthu; Kannan, Vijayaraghavan; Pasić, Lejla

2011-10-01

The haloalkaliphilic bacterium Micrococcus sp. VKMM 037, isolated from an effluent of the caustic soda industry, was found to produce a protease. Maximal proteolytic activity was observed in cell culture grown at 40 degrees C using 2% (w/v) glycerol, 2% (w/v) beef extract and 2% (w/v) peptone as nutrients in medium also containing 0.85 M NaCl with a pH of 10.0. An efficient purification procedure combining ammonium sulphate precipitation and Q-Sepharose ion-exchange chromatography was developed. The purified 41 kDa protease was stable in a temperature range between 20 degrees C and 60 degrees C. The protease remained active over a wide range of pH values (4.0-12.0) and NaCl concentrations (0-3.42 M) with an optimum at pH 10.0 and 0.85 M NaCl, respectively. Furthermore, the enzyme remained stable or was only marginally inhibited in the presence of various organic solvents, surfactants and reducing agents. The purified protease of Micrococcus sp. VKMM 037 efficiently removed blood stains within 40 minutes of treatment. Given the biochemical characteristics determined, this novel protease could be exploited as an additive in the detergent industry and also for the synthesis of biomolecules and the degradation of protein.

The Role of Inducible DNA Repair in W-Reactivation and Related Phenomena.

DTIC Science & Technology

1981-10-14

unexcised dimers in X DNA. This was consistent with the finding of Tomilin and Mosevitskaya (1975) which showed that the UV-endonuclease from Micrococcus ...of DNA in vitro with UV-endonuclease from Micrococcus luteus. Mutat. Res. 27, 147-156 (1975) Tomizawa, J., Ogawa, T.: Effect of ultraviolet irradiation

Limazepines A-F, pyrrolo[1,4]benzodiazepine Antibiotics from an Indonesian Micrococcus sp.

PubMed

Fotso, Serge; Zabriskie, T Mark; Proteau, Philip J; Flatt, Patricia M; Santosa, Dwi Andreas; Mahmud, Taifo

2009-04-01

In our screening of Indonesian microorganisms for novel bioactive natural products we have isolated seven new compounds, designated as limazepines A, B1 and B2 (isolated as an isomeric mixture), C, D, E, and F, from the culture broth of Micrococcus sp. strain ICBB 8177. In addition, the known natural products prothracarcin and 7-O-succinylmacrolactin A, as well as two previously reported synthetic compounds, 2-amino-3-hydroxy-4-methoxybenzoic acid methyl ester and 4-ethylpyrrole-2-carboxaldehyde, were obtained from the extract. Chemical structures were determined by spectroscopic methods and by comparison with the NMR data of structurally related compounds. The limazepines belong to the growing group of the pyrrolo[1,4]benzodiazepine antitumor antibiotics isolated from various soil bacteria. Limazepines B1/B2 mixture, C, and E were active against the Gram-positive bacterium Staphylococcus aureus and the Gram-negative bacterium Escherichia coli. Limazepine D was also active against S. aureus, but was not active against E. coli. Interestingly, only the limazepines B1/B2 mixture and D were active against Pseudomonas aeruginosa.

Gene cloning and characterization of a cold-adapted β-glucosidase belonging to glycosyl hydrolase family 1 from a psychrotolerant bacterium Micrococcus antarcticus.

PubMed

Fan, Hong-Xia; Miao, Li-Li; Liu, Ying; Liu, Hong-Can; Liu, Zhi-Pei

2011-06-10

The gene bglU encoding a cold-adapted β-glucosidase (BglU) was cloned from Micrococcus antarcticus. Sequence analysis revealed that the bglU contained an open reading frame of 1419 bp and encoded a protein of 472 amino acid residues. Based on its putative catalytic domains, BglU was classified as a member of the glycosyl hydrolase family 1 (GH1). BglU possessed lower arginine content and Arg/(Arg+Lys) ratio than mesophilic GH1 β-glucosidases. Recombinant BglU was purified with Ni2+ affinity chromatography and subjected to enzymatic characterization. SDS-PAGE and native staining showed that it was a monomeric protein with an apparent molecular mass of 48 kDa. BglU was particularly thermolabile since its half-life time was only 30 min at 30°C and it exhibited maximal activity at 25°C and pH 6.5. Recombinant BglU could hydrolyze a wide range of aryl-β-glucosides and β-linked oligosaccharides with highest activity towards cellobiose and then p-nitrophenyl-β-d-glucopyranoside (pNPG). Under the optimal conditions with pNPG as substrate, the K(m) and k(cat) were 7 mmol/L and 7.85 × 103/s, respectively. This is the first report of cloning and characterization of a cold-adapted β-glucosidase belonging to GH1 from a psychrotolerant bacterium. Copyright © 2011 Elsevier Inc. All rights reserved.

Agrococcus terreus sp. nov. and Micrococcus terreus sp. nov., isolated from forest soil.

PubMed

Zhang, Jia-Yue; Liu, Xing-Yu; Liu, Shuang-Jiang

2010-08-01

Two bacterial strains, DNG5T and V3M1T, isolated from forest soil of the Changbai mountains in China, were characterized using a polyphasic approach. Analysis of their 16S rRNA gene sequences indicated that strains DNG5T and V3M1T were phylogenetically related to members of the genus Agrococcus (96.0-98.4% similarity) and Micrococcus (96.7-98.0% similarity), respectively, within the order Actinomycetales. Strains DNG5T and V3M1T were Gram-stain-positive and strictly aerobic and formed yellow colonies on LB agar. Cells of strain DNG5T were short, non-motile rods, 0.4-0.5x0.8-1.0 microm. Strain DNG5T contained MK-10 and MK-11 as the major respiratory quinones and anteiso-C15:0 (49.2%) and iso-C16:0 (22.4%) as the major fatty acids. The diamino acid in the peptidoglycan of strain DNG5T was 2,4-diaminobutyric acid and the murein was of the acetyl type. Cells of strain V3M1T were cocci, 0.6-0.7 microm in diameter. The cell-wall peptidoglycan of strain V3M1T contained the amino acids lysine, glutamic acid, alanine and glycine. Strain V3M1T contained MK-7, MK-7(H2), MK-8 and MK-8(H2) as respiratory quinones and anteiso-C15:0 (78.2%) and iso-C15:0 (13.1%) as the major cellular fatty acids. The DNA G+C contents of strains DNG5T and V3M1T were 75.9 and 67.2 mol%, respectively. The DNA-DNA relatedness of strain DNG5T to Agrococcus jejuensis DSM 22002T, A. jenensis JCM 9950T, A. baldri JCM 12132T and A. citreus JCM 12398T was 58.3, 43.9, 36.1 and 54.1%, respectively. The DNA-DNA relatedness of strain V3M1T to Micrococcus luteus CGMCC 1.2299T, M. antarcticus CGMCC 1.2373T and M. lylae CGMCC 1.2300T was 57.5, 45.4 and 39.0%, respectively. Combining phenotypic and genotypic traits, strain DNG5T represents a novel species of the genus Agrococcus, for which the name Agrococcus terreus sp. nov. is proposed, with DNG5T (=CGMCC 1.6960T =NBRC 104260T) as the type strain. Strain V3M1T represents a novel species of the genus Micrococcus, for which the name Micrococcus terreus sp. nov. is

Pitting failure of copper pipings for emergency fire sprinkler in ground water

NASA Astrophysics Data System (ADS)

Baek, Seung-won; Lee, Jong-kwon; Kim, Jong-jip; Kim, Kyung-ja

2015-05-01

The possibility of microbiologically influenced corrosion was investigated in the early pitted copper pipes. The pipes were installed for less than 6 months as an immergency fire sprinkler. The bacteria were cultured by sampling of corrosion by-product near pits on failed copper pipes for the aerobic as well as anaerobic bacteria. However, only aerobic bacteria was found, which were Micrococcus Luteus and Bacillus sp.. The corrosion rate of copper pipes were studied by weight loss in the groundwater and polarization method. In immersion test as well as the electrochemical polarization test in ground water, only Micrococcus Luteus could activate corrosion of copper by 20% and 15%, respectively. On the other hand, Bacillus sp. showed little effect on corrosion in the above two tests. The shape and characteristics of failed copper pipes as well as simulated copper were investigated using stereoscope, optical microscopy, scanning electron microscope and EDS. The cause of pits were discussed, related with the dissolved copper concentrations, pH, and optical density. It could be concluded that the early failure of copper pipings could be ascribed to the acceration of copper in the presence of bacteria, i.e., Micrococcus Luteus.

Optimization of Nutrients and Culture Conditions for Alkaline Protease Production Using Two Endophytic Micrococci: Micrococcus aloeverae and Micrococcus yunnanensis.

PubMed

Prakash, Om; Nimonkar, Yogesh; Chavadar, Mahesh S; Bharti, Nidhi; Pawar, Shrikant; Sharma, Ashutosh; Shouche, Yogesh S

2017-06-01

An endophytic species of Micrococcus was isolated from Aloe vera leaf (syn. Aloe barbadensis ) and screened for protease production with five other species of Micrococcus . Data indicated that endophytic Micrococcus aloeverae AE-6 MCC 2184 T and Micrococcus yunnanensis DSM 21948 T showed efficient protease production potential and secreted active protease at high salt (10%), temperature (40 °C) and in wide range of pH 8-10. Unlike M . yunnanensis DSM 21948 T , protease production by M . aloeverae AE-6 MCC 2184 T was stringently controlled by pH. Protease induction study using different group of peptides, peptide carbohydrates and peptide macronutrient combinations showed variable response with both the organisms. Result indicated that the amount of protease was not directly related to cell biomass but it depends on nature of inducible peptides. In this study we also developed a modified agar-well assay for semi-quantitative data from large number of replicates.

Violacein-producing Collimonas sp. from the sea surface microlayer of costal waters in Trøndelag, Norway.

PubMed

Hakvåg, Sigrid; Fjaervik, Espen; Klinkenberg, Geir; Borgos, Sven Even F; Josefsen, Kjell D; Ellingsen, Trond E; Zotchev, Sergey B

2009-11-12

A new strain belonging to the genus Collimonas was isolated from the sea surface microlayer off the coast of Trøndelag, Norway. The bacterium, designated Collimonas CT, produced an antibacterial compound active against Micrococcus luteus. Subsequent studies using LC-MS identified this antibacterial compound as violacein, known to be produced by several marine-derived bacteria. Fragments of the violacein biosynthesis genes vioA and vioB were amplified by PCR from the Collimonas CT genome and sequenced. Phylogenetic analysis of these sequences demonstrated close relatedness of the Collimonas CT violacein biosynthetic gene cluster to those in Janthinobacterium lividum and Duganella sp., suggesting relatively recent horizontal gene transfer. Considering diverse biological activities of violacein, Collimonas CT shall be further studied as a potential producer of this compound.

Micrococcus lactis sp. nov., isolated from dairy industry waste.

PubMed

Chittpurna; Singh, Pradip K; Verma, Dipti; Pinnaka, Anil Kumar; Mayilraj, Shanmugam; Korpole, Suresh

2011-12-01

A Gram-positive, yellow-pigmented, actinobacterial strain, DW152(T), was isolated from a dairy industry effluent treatment plant. 16S rRNA gene sequence analysis indicated that strain DW152(T) exhibited low similarity with many species with validly published names belonging to the genera Micrococcus and Arthrobacter. However, phenotypic properties including chemotaxonomic markers affiliated strain DW152(T) to the genus Micrococcus. Strain DW152(T) had ai-C(15:0) and i-C(15:0) as major cellular fatty acids, and MK-8(H(2)) as the major menaquinone. The cell-wall peptidoglycan of strain DW152(T) had l-lysine as the diagnostic amino acid and the type was A4α. The DNA G+C content of strain DW152(T) was 68.0 mol%. In 16S rRNA gene sequence analysis, strain DW152(T) exhibited significant similarity with Micrococcus terreus NBRC 104258(T), but the mean value of DNA-DNA relatedness between these strains was only 42.3%. Moreover, strain DW152(T) differed in biochemical and chemotaxonomic characteristics from M. terreus and other species of the genus Micrococcus. Based on the above differences, we conclude that strain DW152(T) should be treated as a novel species of the genus Micrococcus, for which the name Micrococcus lactis sp. nov. is proposed. The type strain of Micrococcus lactis sp. nov. is DW152(T) (=MTCC10523(T) =DSM 23694(T)).

Urinary infection caused by Micrococcus subgroup 3

PubMed Central

Kerr, Helen

1973-01-01

The laboratory findings and clinical presentations in urinary infections in 23 nurses, 10 caused by Micrococcus subgroup 3 and 13 by Escherichia coli, were studied, and the symptoms and possible predisposing factors compared. There were no important differences between the two groups. The infections caused by Micrococcus subgroup 3 were symptomatically severe, as were those caused by Escherichia coli. PMID:4593863

Innate immune system capabilities of the Asian citrus psyllid, Diaphorina citri.

PubMed

Arp, Alex P; Martini, Xavier; Pelz-Stelinski, Kirsten S

2017-09-01

Citrus production worldwide is currently threatened by Huanglongbing, or citrus greening disease. The associated pathogen, Candidatus Liberibacter asiaticus (CLas), is transmitted by the Asian citrus psyllid, Diaphorina citri. Annotation of the D. citri genome revealed a reduced innate immune system lacking a number of antimicrobial peptides and the Imd pathway associated with defense against Gram-negative bacteria. We characterized this apparent immune reduction in survival assays in which D. citri were exposed to Gram-negative or Gram-positive bacteria. D. citri experienced significant mortality when exposed to Serratia marcescens (Gram-negative) through oral ingestion or by septic injury. Escherichia coli (Gram-negative) also caused significant D. citri mortality, but only when inoculated at high concentrations through oral ingestion or by septic injury. Neither Micrococcus luteus (Gram-positive) or Bacillus subtilis (Gram-positive) caused significant mortality as compared to controls in any experiment. E. coli titers increased rapidly following exposure, while M. luteus titer remained stable for 72 h. We demonstrate that D. citri is capable of defending against E. coli, a Gram-negative bacterium, despite lacking the Imd defense pathway. The tolerance of D. citri to M. luteus infection, yet inability to effectively clear infections, presents questions to efficacy of D. citri immune response to effectively clear Gram-positive infections. Copyright © 2017. Published by Elsevier Inc.

Improved agar diffusion method for detecting residual antimicrobial agents.

PubMed

Tsai, C E; Kondo, F

2001-03-01

The improved agar diffusion method for determination of residual antimicrobial agents was investigated, and the sensitivities of various combinations of test organisms and assay media were determined using 7 organisms, 5 media, and 31 antimicrobial agents. Bacillus stearothermophilus and synthetic assay medium (SAM) showed the greatest sensitivity for screening penicillins (penicillin G and ampicillin). The combination of Bacillus subtilis and minimum medium (MM) was the most sensitive for tetracyclines (oxytetracycline and chlortetracycline), B. stearothermophilus and SAM or Micrococcus luteus and Mueller-Hinton agar (MHA) for detecting tylosin and erythromycin, B. subtilis and MHA for aminoglycosides (streptomycin, kanamycin, gentamicin, and dihydrostreptomycin), B. stearothermophilus and SAM for polyethers (salinomycin and lasalocid), and B. subtilis and MM or Clostridium perfringens and GAM for polypeptides (thiopeptin, enramycin, virginiamycin, and bacitracin). However, gram-negative bacterium Escherichia coli ATCC 27166 and MM were better for screening for colistin and polymixin-B. For detecting the synthetic drugs tested, the best combination was B. subtilis and MM for sulfonamides, E. coli 27166 and MM for quinolones (oxolinic acid and nalidixic acid), B. subtilis and MM for furans (furazolidone), and the bioluminescent bacterium Photobacterium phosphoreum and luminescence assay medium for chloramphenicol and oxolinic acid. The results showed that the use of four assay plates, B. stearothermophilus and SAM, B. subtilis and MM, M. luteus and MHA, and E. coli 27166 and MM, was superior to the currently available techniques for screening for residual antimicrobial agents in edible animal tissues.

Violacein-Producing Collimonas sp. from the Sea Surface Microlayer of Costal Waters in Trøndelag, Norway

PubMed Central

Hakvåg, Sigrid; Fjærvik, Espen; Klinkenberg, Geir; Borgos, Sven Even F.; Josefsen, Kjell D.; Ellingsen, Trond E.; Zotchev, Sergey B.

2009-01-01

A new strain belonging to the genus Collimonas was isolated from the sea surface microlayer off the coast of Trøndelag, Norway. The bacterium, designated Collimonas CT, produced an antibacterial compound active against Micrococcus luteus. Subsequent studies using LC-MS identified this antibacterial compound as violacein, known to be produced by several marine-derived bacteria. Fragments of the violacein biosynthesis genes vioA and vioB were amplified by PCR from the Collimonas CT genome and sequenced. Phylogenetic analysis of these sequences demonstrated close relatedness of the Collimonas CT violacein biosynthetic gene cluster to those in Janthinobacterium lividum and Duganella sp., suggesting relatively recent horizontal gene transfer. Considering diverse biological activities of violacein, Collimonas CT shall be further studied as a potential producer of this compound. PMID:20098599

Development of a rapid optic bacteria detecting system based on ATP bioluminescence

NASA Astrophysics Data System (ADS)

Liu, Jun Tao; Luo, JinPing; Liu, XiaoHong; Cai, XinXia

2014-12-01

A rapid optic bacteria detecting system based on the principle of Adenosine triphosphate(ATP) bioluminescence was presented in this paper. This system consisted of bioluminescence-based biosensor and the high-sensitivity optic meter. A photon counting photomultiplier tube (PMT) module was used to improve the detection sensitivity, and a NIOS II/f processor based on a Field Programmable Gate Array(FPGA) was used to control the system. In this work, Micrococcus luteus were chosen as the test sample. Several Micrococcus luteus suspension with different concentration was tested by both T2011 and plate counting method. By comparing the two group results, an calibration curve was obtained from the bioluminescence intensity for Micrococcus luteus in the range of 2.3×102 ~ 2.3×106 CFU/mL with a good correlation coefficient of 0.960. An impacting Air microorganism sampler was used to capture Airborne Bacteria, and 8 samples were collected in different place. The TBC results of 8 samples by T2011 were between 10 ~ 2×103 cfu/mL, consistent with that of plate counting method, which indicated that 8 samples were between 10 ~ 3×103 cfu/mL. For total airborne bacteria count was small, correlation coefficient was poor. Also no significant difference was found between T2011 and plate counting method by statistical analyses.

Halophilic Amylase from a Moderately Halophilic Micrococcus

PubMed Central

Onishi, Hiroshi

1972-01-01

A moderately halophilic Micrococcus sp., isolated from unrefined solar salt, produced a considerable amount of extracellular dextrinogenic amylase when cultivated aerobically in media containing 1 to 3 m NaCl. The Micrococcus amylase had maximal activity at pH 6 to 7 in 1.4 to 2 m NaCl or KCl at 50 C. Calcium ion and a high concentration of NaCl or KCl were essential for activity and stability of the amylase. The salt response of the amylase depended greatly on the pH and temperature of the enzyme assay. PMID:5058445

Yellow lupin (Lupinus luteus L.) transcriptome sequencing: molecular marker development and comparative studies.

PubMed

Parra-González, Lorena B; Aravena-Abarzúa, Gabriela A; Navarro-Navarro, Cristell S; Udall, Joshua; Maughan, Jeff; Peterson, Louis M; Salvo-Garrido, Haroldo E; Maureira-Butler, Iván J

2012-08-24

Yellow lupin (Lupinus luteus L.) is a minor legume crop characterized by its high seed protein content. Although grown in several temperate countries, its orphan condition has limited the generation of genomic tools to aid breeding efforts to improve yield and nutritional quality. In this study, we report the construction of 454-expresed sequence tag (EST) libraries, carried out comparative studies between L. luteus and model legume species, developed a comprehensive set of EST-simple sequence repeat (SSR) markers, and validated their utility on diversity studies and transferability to related species. Two runs of 454 pyrosequencing yielded 205 Mb and 530 Mb of sequence data for L1 (young leaves, buds and flowers) and L2 (immature seeds) EST- libraries. A combined assembly (L1L2) yielded 71,655 contigs with an average contig length of 632 nucleotides. L1L2 contigs were clustered into 55,309 isotigs. 38,200 isotigs translated into proteins and 8,741 of them were full length. Around 57% of L. luteus sequences had significant similarity with at least one sequence of Medicago, Lotus, Arabidopsis, or Glycine, and 40.17% showed positive matches with all of these species. L. luteus isotigs were also screened for the presence of SSR sequences. A total of 2,572 isotigs contained at least one EST-SSR, with a frequency of one SSR per 17.75 kbp. Empirical evaluation of the EST-SSR candidate markers resulted in 222 polymorphic EST-SSRs. Two hundred and fifty four (65.7%) and 113 (30%) SSR primer pairs were able to amplify fragments from L. hispanicus and L. mutabilis DNA, respectively. Fifty polymorphic EST-SSRs were used to genotype a sample of 64 L. luteus accessions. Neighbor-joining distance analysis detected the existence of several clusters among L. luteus accessions, strongly suggesting the existence of population subdivisions. However, no clear clustering patterns followed the accession's origin. L. luteus deep transcriptome sequencing will facilitate the further

Characterization and antioxidative activities of rare C(50) carotenoids-sarcinaxanthin, sarcinaxanthin monoglucoside, and sarcinaxanthin diglucoside-obtained from Micrococcus yunnanensis.

PubMed

Osawa, Ayako; Ishii, Yoko; Sasamura, Nao; Morita, Marie; Kasai, Hiroaki; Maoka, Takashi; Shindo, Kazutoshi

2010-01-01

While screening for antioxidative carotenoids from marine bacteria, we isolated and identified sarcinaxanthin and its glucosylated compounds (sarcinaxanthin monoglucoside and sarcinaxanthin diglucoside) from a moderately halophilic bacterium-Micrococcus yunnanensis strain AOY-1. In the singlet oxygen ((¹O₂) quenching model, the IC(50) values of the antioxidative activities of these carotenoids were as follows: sarcinaxanthin , 57 µM; sarcinaxanthin monoglucoside, 54 µM; and sarcinaxanthin diglucoside, 74 µM. In addition, the complete proton nuclear magnetic resonance (¹H NMR) assignments of sarcinaxanthin monoglucoside pentaacetate and sarcinaxanthin diglucoside octaacetate, and fast atom bombardment mass spectrometry/mass spectrometry (FAB-MS/MS) analyses of sarcinaxanthin and sarcinaxanthin monoglucoside are reported for the first time.

Antimicrobial susceptibilities of Stomatococcus mucilaginosus and of Micrococcus spp.

PubMed Central

von Eiff, C; Herrmann, M; Peters, G

1995-01-01

The in vitro susceptibilities of 63 isolates of Stomatococcus mucilaginosus and of 188 isolates of Micrococcus spp. to 18 antimicrobial agents were determined by the agar dilution method. Many beta-lactams, imipenem, rifampin, and the glycopeptides were shown to be active in vitro against Stomatococcus and Micrococcus isolates, whereas the activities of antibiotics such as some aminoglycosides, erythromycin, and fosfomycin against an important number of these microorganisms are limited. PMID:7695321

Yellow lupin (Lupinus luteus L.) transcriptome sequencing: molecular marker development and comparative studies

PubMed Central

2012-01-01

Background Yellow lupin (Lupinus luteus L.) is a minor legume crop characterized by its high seed protein content. Although grown in several temperate countries, its orphan condition has limited the generation of genomic tools to aid breeding efforts to improve yield and nutritional quality. In this study, we report the construction of 454-expresed sequence tag (EST) libraries, carried out comparative studies between L. luteus and model legume species, developed a comprehensive set of EST-simple sequence repeat (SSR) markers, and validated their utility on diversity studies and transferability to related species. Results Two runs of 454 pyrosequencing yielded 205 Mb and 530 Mb of sequence data for L1 (young leaves, buds and flowers) and L2 (immature seeds) EST- libraries. A combined assembly (L1L2) yielded 71,655 contigs with an average contig length of 632 nucleotides. L1L2 contigs were clustered into 55,309 isotigs. 38,200 isotigs translated into proteins and 8,741 of them were full length. Around 57% of L. luteus sequences had significant similarity with at least one sequence of Medicago, Lotus, Arabidopsis, or Glycine, and 40.17% showed positive matches with all of these species. L. luteus isotigs were also screened for the presence of SSR sequences. A total of 2,572 isotigs contained at least one EST-SSR, with a frequency of one SSR per 17.75 kbp. Empirical evaluation of the EST-SSR candidate markers resulted in 222 polymorphic EST-SSRs. Two hundred and fifty four (65.7%) and 113 (30%) SSR primer pairs were able to amplify fragments from L. hispanicus and L. mutabilis DNA, respectively. Fifty polymorphic EST-SSRs were used to genotype a sample of 64 L. luteus accessions. Neighbor-joining distance analysis detected the existence of several clusters among L. luteus accessions, strongly suggesting the existence of population subdivisions. However, no clear clustering patterns followed the accession’s origin. Conclusion L. luteus deep transcriptome

Rapid lysostaphin test to differentiate Staphylococcus and Micrococcus species.

PubMed Central

Geary, C; Stevens, M

1986-01-01

A rapid, simple lysostaphin lysis susceptibility test to differentiate the genera Staphylococcus and Micrococcus was evaluated. Of 181 strains from culture collections, 95 of 95 Staphylococcus strains were lysed, and 79 of 79 Micrococcus strains were not lysed. The seven Planococcus strains were resistant. Clinical isolates (890) were tested with lysostaphin and for the ability to produce acid from glycerol in the presence of erythromycin. Overall agreement between the methods was 99.2%. All clinical Micrococcus strains (43) were resistant to lysostaphin, and all clinical Staphylococcus strains (847) were susceptible. Seven of the Staphylococcus strains did not produce acid from glycerol in the presence of erythromycin. This lysostaphin test provides results in 2 h. It is easier to perform than previously described lysostaphin lysis methods. It is also more rapid and accurate than the glycerol-erythromycin test. PMID:3519667

Factors Affecting Transformation of Micrococcus lysodeikticus

PubMed Central

Kloos, Wesley E.

1969-01-01

Relatively high transfo mation frequencies were obtained with Micrococcus lysodeikticus cells, previou[ill]sly grown in defined broth, with a tris(hydroxymethyl)-aminomethane-glutamate b uffer containing Mg++, Ca++, Ba++, or Sr++. PMID:5788710

EFFECT OF IMPACT STRESS ON MICROBIAL RECOVERY ON AN AGAR SURFACE

EPA Science Inventory

Microbial stress due to the impaction of microorganisms onto an agar collection surface was studied experimentally. he relative recovery rates of aerosolized Pseudomonas fluorescens and Micrococcus luteus were determined as a function of the impaction velocity by using a moving a...

Micrococcus endophyticus sp. nov., isolated from surface-sterilized Aquilaria sinensis roots.

PubMed

Chen, Hua-Hong; Zhao, Guo-Zhen; Park, Dong-Jin; Zhang, Yu-Qin; Xu, Li-Hua; Lee, Jae-Chan; Kim, Chang-Jin; Li, Wen-Jun

2009-05-01

A Gram-positive bacterial strain, designated YIM 56238(T), was isolated from plant roots (Aquilaria sinensis), and characterized by using a polyphasic approach. Strain YIM 56238(T) grew optimally at pH 7.0-8.0 and at 28 degrees C. Analysis of the 16S rRNA gene sequence of strain YIM 56238(T) indicated that it belongs to the genus Micrococcus. Chemotaxonomic data strongly supported the classification of this strain within the genus Micrococcus: the cell-wall peptidoglycan contained lysine, glutamic acid, alanine and glycine; the predominant menaquinones were MK-8(H(2)) (63.6 %) and MK-7(H(2)) (21.1 %); the phospholipids were diphosphatidylglycerol, phosphatidylglycerol, phosphatidylinositol and an unknown ninhydrin-negative phospholipid; and the major cellular fatty acids were iso-C(15 : 0) (30.95 %) and anteiso-C(15 : 0) (53.75 %). The G+C content of the genomic DNA was 72.9 mol%. A number of physiological features were found that clearly distinguished strain YIM 56238(T) from recognized species of the genus Micrococcus. DNA-DNA hybridization studies suggested that the novel strain represents a separate genomic species. On the basis of the data, therefore, strain YIM 56238(T) represents a novel species of the genus Micrococcus, for which the name Micrococcus endophyticus sp. nov. is proposed. The type strain is YIM 56238(T) (=DSM 17945(T)=KCTC 19156(T)).

Endocarditis due to Micrococcus sedentarius incertae sedis.

PubMed Central

Old, D C; McNeill, G P

1979-01-01

The clinical and bacteriological features of a case of endocarditis are described in which a Gram-positive coccus, presently designated Micrococcus sedentarius incertae sedis, was repeatedly isolated. PMID:512056

Regioselective synthesis of 3-benzyl substituted pyrimidino chromen-2-ones and evaluation of anti-microbial and anti-biofilm activities.

PubMed

Emmadi, Narender Reddy; Atmakur, Krishnaiah; Bingi, Chiranjeevi; Godumagadda, Narender Reddy; Chityal, Ganesh Kumar; Nanubolu, Jagadeesh Babu

2014-01-15

Regioselective synthesis of a number of highly functionalized 3-benzylpyrimidino chromen-2-ones (4) were accomplished in a one pot three component reaction in acetic acid and determined their anti-microbial and anti-biofilm activities. Compounds 4o and 4p showed an excellent anti-microbial activity against Micrococcus luteus MTCC 2470 at a par with standard control (Ciprofloxacin) and exhibited best activity against Staphylococcus aureus MTCC 96 and Bacillus subtilis MTCC 121. Further, compounds 4h, 4i, 4m, 4n and 4q showed promising activity against Micrococcus luteus MTCC 2470, Staphylococcus aureus MTCC 96 and Bacillus subtilis MTCC 121. Whereas, compounds 4m showed very promising biofilm inhibition activity against Staphylococcus aureus MLS 16 MTCC 2940 and 4o, 4p showed very potent activity against Staphylococcus aureus MTCC 96 at a par with Ciprofloxacin used as standard control. Copyright © 2013 Elsevier Ltd. All rights reserved.

Micrococcus cohnii sp. nov., isolated from the air in a medical practice.

PubMed

Rieser, Gernot; Scherer, Siegfried; Wenning, Mareike

2013-01-01

Three Gram-reaction-positive bacteria, isolated from the air in a medical practice (strains WS4601(T), WS4602) or a pharmaceutical clean room (strain WS4599), were characterized using a polyphasic approach. Phylogenetic analyses based on 16S rRNA and recA gene sequences of the three novel strains showed that they formed a distinct lineage within the genus Micrococcus, sharing 16S rRNA gene sequence similarities of 96.1-98.0 % with other species of this genus. Chemotaxonomic features also supported the classification of the three novel strains within the genus Micrococcus. The major cellular fatty acids of strain WS4601(T) were anteiso-C(15 : 0) and iso-C(15 : 0), the cell-wall peptidoglycan was of type A3α (L-Lys-L-Ala), and the predominant respiratory quinones were MK-7(H(2)) and MK-8(H(2)). The polar lipid profile contained diphosphatidylglycerol and phosphatidylglycerol, but no phosphatidylinositol. The G+C content of the genomic DNA was 70.4 mol%. Numerous physiological properties were found that clearly distinguished strains WS4599, WS4601(T) and WS4602 from established members of the genus Micrococcus. Based on the phenotypic and phylogenetic data, strains WS4599, WS4601(T) and WS4602 are considered to represent three different strains of a novel species of the genus Micrococcus, for which the name Micrococcus cohnii sp. nov. is proposed. The type strain is WS4601(T) (=DSM 23974(T)=LMG 26183(T)).

Characterization of Light Non-Methane Hydrocarbons, Surface Water DOC, and Aerosols over the Nordic Seas

NASA Astrophysics Data System (ADS)

Hudson, E. D.; Ariya, P. A.

2006-12-01

Whole air, size-fractionated marine aerosols, and surface ocean water DOC were sampled together during June-July 2004 on the Nordic seas, in order to explore factors leading to the formation of volatile organic compounds (VOCs) at the sea surface and their transfer to the atmosphere. High site-to-site variability in 19 non-methane hydrocarbon concentrations suggests highly variable, local sources for these compounds. Acetone, C5 and C6 hydrocarbons, and dimethylsulfide were identified in the seawater samples using solid-phase microextraction/GC-MS. The aerosols were analysed by SEM-EDX and contained primarily inorganic material (sea salt, marine sulfates, and carbonates) and little organic matter. However, a culturable bacterium was isolated from the large (9.9 - 18 μ m) fraction at one site, and identified as Micrococcus luteus. We will discuss the implication of these results on potential exchange processes at the ocean-atmosphere interface and the impact of bioaerosols in transferring marine organic carbon to atmospheric organic carbon.

Micrococcus yunnanensis sp. nov., a novel actinobacterium isolated from surface-sterilized Polyspora axillaris roots.

PubMed

Zhao, Guo-Zhen; Li, Jie; Qin, Sheng; Zhang, Yu-Qin; Zhu, Wen-Yong; Jiang, Cheng-Lin; Xu, Li-Hua; Li, Wen-Jun

2009-10-01

In this study, strain YIM 65004(T), isolated from roots of Polyspora axillaris, was shown to represent a novel species of the genus Micrococcus by means of a polyphasic approach. Chemotaxonomic data gathered for peptidoglycan type, menaquinones, phospholipids and fatty acids strongly supported the classification of this strain within the genus Micrococcus: the cell-wall peptidoglycan contained lysine, glutamic acid, alanine, glycine and aspartic acid, the predominant menaquinones were MK-8(H(2)) (66.97 %) and MK-7(H(2)) (23.26 %), the phospholipids were diphosphatidylglycerol, phosphatidylglycerol, phosphatidylinositol and an unknown ninhydrin-negative phospholipid, and the major cellular fatty acids were anteiso-C(15 : 0) (61.98 %), iso-C(16 : 0) (14.25 %) and iso-C(15 : 0) (13.04 %). The G+C content of the genomic DNA was 71.7 mol%. A number of physiological features were found that clearly distinguished strain YIM 65004(T) from recognized Micrococcus species. DNA-DNA hybridization studies suggested that the novel strain represents a separate genomic species. Based on the above data, a novel species of the genus Micrococcus, Micrococcus yunnanensis sp. nov., is proposed, with the type strain YIM 65004(T) (=CCTCC AA 208060(T)=DSM 21948(T)).

Production of gluconic acid using Micrococcus sp.: optimisation of carbon and nitrogen sources.

PubMed

Joshi, V D; Sreekantiah, K R; Manjrekar, S P

1996-01-01

A process for production of gluconic acid from glucose by a Micrococcus sp. is described. More than 400 bacterial cultures isolated from local soil were tested for gluconic acid production. Three isolates, were selected on basis of their ability to produce gluconic acid and high titrable acidity. These were identified as Micrococcus sp. and were named M 27, M 54 and M 81. Nutritional and other parameters for maximum production of gluconic acid by the selected isolates were optimised. It was found that Micrococcus sp. isolate M 27 gave highest yield of 8.19 g gluconic acid from 9 g glucose utilised giving 91% conversion effeciency.

Biodegradation of cypermethrin by immobilized cells of Micrococcus sp. strain CPN 1

PubMed Central

Tallur, Preeti N.; Mulla, Sikandar I.; Megadi, Veena B.; Talwar, Manjunatha P.; Ninnekar, Harichandra Z.

2015-01-01

Pyrethroid pesticide cypermethrin is a environmental pollutant because of its widespread use, toxicity and persistence. Biodegradation of such chemicals by microorganisms may provide an cost-effective method for their detoxification. We have investigated the degradation of cypermethrin by immobilized cells of Micrococcus sp. strain CPN 1 in various matrices such as, polyurethane foam (PUF), polyacrylamide, sodium alginate and agar. The optimum temperature and pH for the degradation of cypermethrin by immobilized cells of Micrococcus sp. were found to be 30 °C and 7.0, respectively. The rate of degradation of 10 and 20 mM of cypermethrin by freely suspended cells were compared with that of immobilized cells in batches and semi-continuous with shaken cultures. PUF-immobilized cells showed higher degradation of cypermethrin (10 mM and 20 mM) than freely suspended cells and cells immobilized in other matrices. The PUF-immobilized cells of Micrococcus sp. strain CPN 1 were retain their degradation capacity. Thus, they can be reused for more than 32 cycles, without losing their degradation capacity. Hence, the PUF-immobilized cells of Micrococcus sp. could potentially be used in the bioremediation of cypermethrin contaminated water. PMID:26413046

Biodegradation of cypermethrin by immobilized cells of Micrococcus sp. strain CPN 1.

PubMed

Tallur, Preeti N; Mulla, Sikandar I; Megadi, Veena B; Talwar, Manjunatha P; Ninnekar, Harichandra Z

2015-01-01

Pyrethroid pesticide cypermethrin is a environmental pollutant because of its widespread use, toxicity and persistence. Biodegradation of such chemicals by microorganisms may provide an cost-effective method for their detoxification. We have investigated the degradation of cypermethrin by immobilized cells of Micrococcus sp. strain CPN 1 in various matrices such as, polyurethane foam (PUF), polyacrylamide, sodium alginate and agar. The optimum temperature and pH for the degradation of cypermethrin by immobilized cells of Micrococcus sp. were found to be 30 °C and 7.0, respectively. The rate of degradation of 10 and 20 mM of cypermethrin by freely suspended cells were compared with that of immobilized cells in batches and semi-continuous with shaken cultures. PUF-immobilized cells showed higher degradation of cypermethrin (10 mM and 20 mM) than freely suspended cells and cells immobilized in other matrices. The PUF-immobilized cells of Micrococcus sp. strain CPN 1 were retain their degradation capacity. Thus, they can be reused for more than 32 cycles, without losing their degradation capacity. Hence, the PUF-immobilized cells of Micrococcus sp. could potentially be used in the bioremediation of cypermethrin contaminated water.

Identification of Staphylococcus and Micrococcus species with the STAPHYtest system.

PubMed

Sedlácek, I; Kocur, M

1991-01-01

A collection of 216 well-characterized strains of Staphylococcus, Micrococcus and Stomatococcus was examined by a commercially available STAPHYtest system (Lachema, Brno, Czechoslovakia). The results of STAPHYtest agreed with those of conventional tests. The STAPHYtest permitted a clear-cut separation of Staphylococcus from Micrococcus and Stomatococcus strains and correctly identified 104 of 145 (72%) Staphylococcus strains after 24 h of incubation. However, it allowed the identification only of 19 of 29 validly published Staphylococcus species. The STAPHYtest proved to be a simple and rapid system for the separation of staphylococci from micrococci and for the identification of most frequent clinically significant staphylococci.

Molecular cloning of the BLADE-ON-PETIOLE gene and expression analyses during nodule development in Lupinus luteus.

PubMed

Frankowski, Kamil; Wilmowicz, Emilia; Kućko, Agata; Zienkiewicz, Agnieszka; Zienkiewicz, Krzysztof; Kopcewicz, Jan

2015-05-01

The BLADE-ON-PETIOLE (BOP) genes have been recently shown to play an essential role in many physiological processes, including embryogenesis, meristem determinacy, leaf patterning and nodule development. In our research we used Lupinus luteus, a plant with great agronomic potential due to its high protein content and nitrogen fixation ability. In this work, LlBOP in L. luteus was identified for the first time and its expression during nodule development was analyzed. The high expression levels of LlBOP and LlLbI (LEGHEMOGLOBIN), essential to nitrogen-fixing symbiosis, were noted in the developing root nodules and were correlated with the occurrence of leghemoglobin. All of these data indicate that LlBOP is an important regulator of root nodule formation and functioning in L. luteus. Copyright © 2015 Elsevier GmbH. All rights reserved.

Development of microsatellite markers in Lupinus luteus (Fabaceae) and cross-species amplification in other lupine species.

PubMed

Gonzalez, Lorena B Parra; Straub, Shannon C K; Doyle, Jeff J; Ortega, Paula E Mora; Garrido, Haroldo E Salvo; Butler, Iván J Maureira

2010-08-01

Microsatellite primers were developed in Lupinus luteus L., an emerging temperate protein crop, to investigate genetic diversity, population structure, and to facilitate the generation of better yellow lupine varieties. • Thirteen polymorphic primer sets were evaluated in a European and Eastern European accession collection of L. luteus. The primers amplified di-, tri-, and tetranucleotide repeats with 2-4 alleles per locus. These revealed a moderate to low level of genetic variation, as indicated by an average observed heterozygosity of 0.0126. Select loci also amplified successfully in the closely related species L. hispanicus Boiss. & Reut. and in the New World species L. mutabilis Sweet. • These results indicate the utility of primers for the study of genetic diversity across L. luteus populations and related lupine species. The use of these microsatellite markers will facilitate the implementation of several molecular breeding strategies in yellow lupine.

Production, purification, and characterization of micrococcin GO5, a bacteriocin produced by Micrococcus sp. GO5 isolated from kimchi.

PubMed

Kim, Mi-Hee; Kong, Yoon-Jung; Baek, Hong; Hyun, Hyung-Hwan

2005-01-01

Strain GO5, a bacteriocin-producing bacterium, was isolated from green onion kimchi and identified as Micrococcus sp. The bacteriocin, micrococcin GO5, displayed a broad spectrum of inhibitory activity against a variety of pathogenic and nonpathogenic microorganisms, as tested by the spot-on-lawn method; its activity spectrum was almost identical to that of nisin. Micrococcin GO5 was inactivated by trypsin (whereas nisin was not) and was completely stable at 100 degrees C for 30 min and in the pH range of 2.0 to 7.0. Micrococcin GO5 exhibited a typical mode of bactericidal activity against Micrococcus flavus ATCC 10240. It was purified to homogeneity through ammonium sulfate precipitation, ultrafiltration, and CM-Sepharose column chromatography. The molecular mass of micrococcin GO5 was estimated to be about 5.0 kDa by tricine-sodium dodecyl sulfate-polyacrylamide gel electrophoresis and in situ activity assay with the indicator organism. The amino acid sequence of micrococcin GO5 lacks lanthionine and beta-methyllanthionine and is rich in hydrophobic amino acids and glycine, providing the basis for the high heat stability of this bacteriocin. The N-terminal amino acid sequence of micrococcin GO5 is Lys-Lys-Ser-Phe-Cys-Gln-Lys, and no homology to bacteriocins reported previously was observed in the amino acid composition or N-terminal amino acid sequence. Based on the physicochemical properties, small molecular size, and inhibition of Listeria monocytogenes, micrococcin GO5 has been placed with the class II bacteriocins, but its broad spectrum of activity differs from that of other bacteriocins in this class.

Antimicrobial activity of Bryum argenteum.

PubMed

Sabovljevic, Aneta; Sokovic, Marina; Sabovljevic, Marko; Grubisic, Dragoljub

2006-02-01

The antimicrobial activity of Bryum argenteum ethanol extracts was evaluated by microdilution method against four bacterial (Escherichia coli, Bacillus subtilis, Micrococcus luteus and Staphilococcus aureus) and four fungal species (Aspergillus niger, Penicillium ochrochloron, Candida albicans and Trichophyton mentagrophyes). All the investigated ethanol extracts have been proved to be active against all bacteria and fungi tested.

Antibacterial properties of the skin mucus of the freshwater fishes, Rita rita and Channa punctatus.

PubMed

Kumari, U; Nigam, A K; Mitial, S; Mitial, A K

2011-07-01

The skin mucus of Rita rita and Channa punctatus was investigated to explore the possibilities of its antibacterial properties. Skin mucus was extracted in acidic solvents (0.1% trifluoroacetic acid and 3% acetic acid) and in triple distilled water (aqueous medium). The antibacterial activity of the mucus extracts was analyzed, using disc diffusion method, against five strains of bacteria--the Gram-positive Staphylococcus aureus and Micrococcus luteus; and the Gram negative Escherichia coli, Pseudomonas aeruginosa and Salmonella typhi. In both Rita rita and Channa punctatus, the skin mucus extracted in acidic solvents as well as in aqueous medium show antibacterial activity against Staphylococcus aureus and Micrococcus luteus. Nevertheless, the activity is higher in acidic solvents than that in aqueous medium. The acidic mucus extracts of Rita rita, show antibacterial activity against Salmonella typhi as well. The results suggest that fish skin mucus have bactericidal properties and thus play important role in the protection of fish against the invasion of pathogens. Fish skin mucus could thus be regarded as a potential source of novel antibacterial components.

In vitro antibacterial activity of selected medicinal plants from lower Himalayas.

PubMed

Zulqarnain; Rahim, Abdur; Ahmad, Khalid; Ullah, Faizan; Ullah, Hamid; Nishan, Umar

2015-03-01

The present studies cover antibacterial activity of the crude methanolic extracts of 11 medicinal plants viz. Adhatoda vasica, Bauhenia variegate, Bombax ceiba, Carrisa opaca, Caryopteris grata, Debregeasia salicifolia, Lantana camara, Melia azedarach, Phyllanthus emblica, Pinus roxburghii and Olea ferruginea collected from lower Himalayas against two Gram positive (Staphylococcus aureus, Micrococcus luteus) and two Gram negative (Escherichia coli, Pseudomonas aureginosa) bacterial strains. The extracts were applied at four different concentrations (120 mg/mL, 90mg/mL, 60mg/mL and 30mg/mL) in dimethyl sulfoxide (DMSO) by using agar well diffusion method. Antibacterial activities against Staphylococcus aureus and Micrococcus luteus were observed formethanolic extracts of all the above mentioned plants. Greater antibacterial activity against Pseudomonas aeruginosa was only exhibited by Phyllanthus emblica, Pinus roxburghii, Debregeasia salicifolia and Lantana camara. Escherichia coli was highly resistant to all the plant extracts at all concentrations. It is inferred that methanolic crude extracts of the above mentioned plantsexhibitantibacterial activities against pathogenic bacteria, which proved the ethnobotanical importance of the selected plants that indigenous people use for cure against various diseases.

Micrococcus sedentarius bacteraemia presenting with haemophagocytic syndrome in previously healthy boy.

PubMed

Kuskonmaz, Baris; Kara, Ates; Ozen, Maide; Cengiz, A Bülent; Ozen, Metehan; Seçmeer, Gülten; Gürgey, Aytemiz

2006-01-01

Haemophagocytic syndromes are the clinical manifestation of an increased macrophagic activity with haemophagocytosis. Infection-associated HS was originally described by Risdall in 1979, in viral disease. Since the initial description HS has also been documented in patients with bacterial, parasitic or fungal infections. We describe a case of Micrococcus sedentarius bacteraemia in a previously healthy 10-y-old boy with haemophagocytic syndrome. Species of micrococci are generally considered as non-pathogenic commensals that colonize the skin, mucosae and oropharynx. We report the first case of Microccoccus sedentarius bacteraemia in an immunocompetent host and first case of HS associated with Micrococcus species.

Stimulation of Lactic Acid Bacteria by a Micrococcus Isolate: Evidence for Multiple Effects

PubMed Central

Nath, K. R.; Wagner, B. J.

1973-01-01

Growth of, and rate of acid production by, six cultures of lactic acid bacteria were increased in the presence of Micrococcus isolate F4 or a preparation of its capsular material. Concentrations of hydrogen peroxide found in pure cultures of the lactic acid bacteria were not detectable, or were greatly reduced, in mixed culture with Micrococcus isolate F4. The capsular material was not as effective as whole cells in preventing accumulation of H2O2. Catalase stimulated growth of, and the rate of acid production by, the lactic acid bacteria, but not to the same extent as Micrococcus isolate F4 in some cultures. The existence of two mechanisms for micrococcal stimulation of the lactic acid bacteria is postulated. One mechanism involves removal of H2O2; the other has not been characterized. PMID:4199337

Biodegradation of 2-nitrotoluene by Micrococcus sp. strain SMN-1.

PubMed

Mulla, Sikandar I; Hoskeri, Robertcyril S; Shouche, Yogesh S; Ninnekar, Harichandra Z

2011-02-01

A bacterial consortium capable of degrading nitroaromatic compounds was isolated from pesticide-contaminated soil samples by selective enrichment on 2-nitrotoluene as a sole source of carbon and energy. The three different bacterial isolates obtained from bacterial consortium were identified as Bacillus sp. (A and C), Bacillus flexus (B) and Micrococcus sp. (D) on the basis of their morphological and biochemical characteristics and by phylogenetic analysis based on 16S rRNA gene sequences. The pathway for the degradation of 2-nitrotoluene by Micrococcus sp. strain SMN-1 was elucidated by the isolation and identification of metabolites, growth and enzymatic studies. The organism degraded 2-nitrotoluene through 3-methylcatechol by a meta-cleavage pathway, with release of nitrite.

Rhizostabilization of metals in soils using Lupinus luteus inoculated with the metal resistant rhizobacterium Serratia sp. MSMC541.

PubMed

El Aafi, N; Brhada, F; Dary, M; Maltouf, A Filali; Pajuelo, E

2012-03-01

The aim of this work was to test Lupinus luteus plants, inoculated with metal resistant rhizobacteria, in order to phytostabilise metals in contaminated soils. The resistance to heavy metals of strains isolated from nodules of Lupinus plants was evaluated. The strain MSMC541 showed multi-resistance to several metals (up to 13.3 mM As, 2.2 mM Cd, 2.3 mM Cu, 9 mM Pb and 30 mM Zn), and it was selected for further characterization. Furthermore, this strain was able to biosorb great amounts of metals in cell biomass. 16S rDNA sequencing positioned this strain within the genus Serratia. The presence of arsenic resistance genes was confirmed by southern blot and PCR amplification. A rhizoremediation pot experiment was conducted using Lupinus luteus grown on sand supplemented with heavy metals and inoculated with MSMC541. Plant growth parameters and metal accumulation were determined in inoculated vs. non-inoculated Lupinus luteus plants. The results showed that inoculation with MSMC541 improved the plant tolerance to metals. At the same time, metal translocation to the shoot was significantly reduced upon inoculation. These results suggest that Lupinus luteus plants, inoculated with the metal resistant strain Serratia sp. MSMC541, have a great potential for phytostabilization of metal contaminated soils.

Differential expression of the lethal gene Luteus-Pa in cacao of the Parinari series.

PubMed

Rehem, B C; Almeida, A-A F; Figueiredo, G S F; Gesteira, A S; Santos, S C; Corrêa, R X; Yamada, M M; Valle, R R

2016-02-22

The recessive lethal character Luteus-Pa is found in cacao (Theobroma cacao) genotypes of the Parinari series (Pa) and is characterized by expression of leaf chlorosis and seedling death. Several genotypes of the Pa series are bearers of the gene responsible for the expression of the Luteus-Pa character, which can be used as a tool for determining relationships between genotypes of this group. To evaluate this phenomenon, we analyzed the differential expression of genes between mutant seedlings and wild-type hybrid Pa 30 x 169 seedlings, with the aim of elucidating the possible lethal mechanisms of the homozygous recessive character Luteus-Pa. Plant material was harvested from leaves of wild and mutant seedlings at different periods to construct a subtractive library and perform quantitative analysis using real-time PCR. The 649 sequences obtained from the subtractive library had an average length of 500 bp, forming 409 contigs. The probable proteins encoded were grouped into 10 functional categories. Data from ESTs identified genes associated with Rubisco, peroxidases, and other proteins and enzymes related to carbon assimilation, respiration, and photosystem 2. Mutant seedlings were characterized by synthesizing defective PsbO and PsbA proteins, which were overexpressed from 15 to 20 days after seedling emergence.

Environmental conditions affecting exopolysaccharide production by Pseudomonas aeruginosa, Micrococcus sp., and Ochrobactrum sp.

PubMed

Kiliç, Nur Koçberber; Dönmez, Gönül

2008-06-15

Three different chromium-resistant microorganisms (Pseudomonas aeruginosa, Micrococcus sp., and Ochrobactrum sp.) were tested with regard to their EPS production at different pH levels, temperatures, Cr(VI) concentrations, and incubation periods. The optimum pH level was 7 for P. aeruginosa and Micrococcus sp., while it was 8 for Ochrobactrum sp. according to the highest EPS amount at 100 mg/L Cr(VI) concentration. The highest production of EPSs by the three bacteria was obtained under different environmental conditions. P. aeruginosa produced the highest EPS (863.3 mg/L) after incubation for 96 h on media with 50 mg/L Cr(VI) at 20 degrees C, Micrococcus sp. gave the highest yield (444.6 mg/L) after incubation for 72 h on media with 100 mg/L Cr(VI) at the same temperature, and Ochrobactrum sp. had the highest production (430.5 mg/L) on media with 150 mg/L Cr(VI) at 30 degrees C at the end of 48 h of incubation.

A New Perspective on Radiation Resistance Based on Deinococcus radiodurans

DTIC Science & Technology

2009-03-01

Halobacterium sp. NRc-1 | Lactobacillus plantarum | Micrococcus luteus | Pyrococcus furiosus | Shewanella oneidensis | Synechocystis sp. Pcc... Lactobacillus plantarum16,47, which lacks the enzyme superoxide dismutase, and Synechocystis sp. PCC 68034 (Ref. 48) accumulated exceptionally high levels...high specificity for Mn2+, has been detected in L. plantarum , but has not been found in D. radiodurans. Manganese transport in D. radiodurans is

Unique antimicrobial spectrum of ophiobolin K produced by Aspergillus ustus.

PubMed

Sohsomboon, Natthapat; Kanzaki, Hiroshi; Nitoda, Teruhiko

2018-03-01

A co-cultivation study of two fungal strains showed that Aspergillus ustus could inhibit Aspergillus repens growth. The bioactive compound responsible for the observed activity was purified and identified as a sesterterpene, ophiobolin K. Ophiobolin K exhibited marked inhibition against both fungi and bacteria, especially A. repens, A. glaucus and gram-positive bacteria including Bacillus subtilis, Staphylococcus aureus, and Micrococcus luteus.

ROLE OF POTASSIUM IN THE OXIDATIVE METABOLISM OF MICROCOCCUS SODONENSIS1

PubMed Central

Perry, Jerome J.; Evans, James B.

1961-01-01

Perry, Jerome J. (The University of Chicago, Chicago, Ill.), and James B. Evans. Role of potassium in the oxidative metabolism of Micrococcus sodonensis. J. Bacteriol. 82:551–555. 1961.—An absolute potassium requirement has been established for the growth of Micrococcus sodonensis with lactate or pyruvate as substrate. Potassium at 0.67 × 10−2m concentration was necessary for maximal growth. Resting cell and cell-free preparations from cells grown on minimal levels of potassium were stimulated by potassium but, due to residual or bound cation, did not show an absolute requirement. Rubidium and cesium replaced potassium in these cells although cesium is much less effective. PMID:14485577

21 CFR 173.135 - Catalase derived from Micrococcus lysodeikticus.

Code of Federal Regulations, 2013 CFR

2013-04-01

... 21 Food and Drugs 3 2013-04-01 2013-04-01 false Catalase derived from Micrococcus lysodeikticus. 173.135 Section 173.135 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION (CONTINUED) SECONDARY DIRECT FOOD ADDITIVES PERMITTED IN...

21 CFR 173.135 - Catalase derived from Micrococcus lysodeikticus.

Code of Federal Regulations, 2012 CFR

2012-04-01

... 21 Food and Drugs 3 2012-04-01 2012-04-01 false Catalase derived from Micrococcus lysodeikticus. 173.135 Section 173.135 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION (CONTINUED) SECONDARY DIRECT FOOD ADDITIVES PERMITTED IN...

21 CFR 173.135 - Catalase derived from Micrococcus lysodeikticus.

Code of Federal Regulations, 2014 CFR

2014-04-01

... 21 Food and Drugs 3 2014-04-01 2014-04-01 false Catalase derived from Micrococcus lysodeikticus. 173.135 Section 173.135 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) SECONDARY DIRECT FOOD ADDITIVES PERMITTED IN FOOD FOR HUMAN CONSUMPTION Enzyme...

Antibiotic Sensitivity of Micrococcus radiodurans

PubMed Central

Hawiger, J.; Jeljaszewicz, J.

1967-01-01

A wild-type strain of Micrococcus radiodurans and its nonpigmented mutant W1 were tested for sensitivity to 10 antibiotics selected from the standpoint of their mechanism of action. Representatives of groups of antibiotics inhibiting deoxyribonucleic acid (DNA) synthesis, DNA-dependent ribonucleic acid synthesis, protein synthesis, and cell wall synthesis were selected. M. radiodurans and its mutant exhibited full susceptibility to all antibiotics tested (mitomycin C, actinomycin D, chloramphenicol, dihydrostreptomycin, erythromycin, neomycin, kanamycin, benzylpenicillin, bacitracin, and vancomycin), the degree of susceptibility being of the same order as that of a standard strain of Staphylococcus aureus 209 P, with the exception of dihydrostreptomycin. PMID:4166078

Restriction of the anti-bovine serum albumin response in rabbits immunized with Micrococcus lysodeikticus.

PubMed Central

De Baetselier, P; Hamers-Casterman, C; Van der Loo, W; Hamers, R

1977-01-01

Rabbits capable of producing antibodies of restricted heterogeneity in response to Micrococcus lysodeikticus are equally capable of producing antibodies of restricted heterogeneity to bovine serum albumin. These antibodies are produced when animals are simultaneously injected with micrococcus and BSA and their specificity is restricted to a small number of epitopes. These results suggest that micrococcal vaccines can induce the restriction of heterogeneity in antibodies raised against totally unrelated antigens. Images Figure 4 Figure 5 Figure 2 Figure 6 Figure 7 Figure 8 PMID:71263

Micrococcus-associated central venous catheter infection in patients with pulmonary arterial hypertension.

PubMed

Oudiz, Ronald J; Widlitz, Allison; Beckmann, X Joy; Camanga, Daisy; Alfie, Jose; Brundage, Bruce H; Barst, Robyn J

2004-07-01

To determine the incidence of catheter-related infection in patients with pulmonary arterial hypertension (PAH) receiving epoprostenol (EPO), and to note an etiologic role for Micrococcus spp, which is rarely reported as a pathogen in the medical literature. Observational study. Two PAH specialty treatment centers, Harbor-UCLA Medical Center (Torrance, CA), and the College of Physicians and Surgeons, Columbia University (New York, NY). A total of 192 patients with PAH receiving continuous therapy with IV EPO. From 1987 to 2000, 192 patients with PAH received infusions of EPO via central venous catheter. Catheter care included regular dressing changes with dry gauze using a sterile procedure, without the use of flushes. Patients were asked to report on known infections and treatments, and symptoms. All infections were verified by a telephone call to the patient, care provider, and microbiology laboratory whenever possible. There were 335,285 catheter days (mean +/- SD, 1,325 +/- 974 catheter days). There were 88 clinical catheter infections with 51 blood culture-positive infections, necessitating catheter removal in 38 instances. The following pathogens were isolated: Staphylococcus aureus (25); Micrococcus spp (14); mixed flora (3); coagulase-negative Staphylococcus spp (2); Corynebacterium spp (2); Serratia marcessens (1); Enterobacter spp (1); Pseudomonas aeruginosa (1); enterococci (1); and unidentified Gram-positive cocci (1). The catheter infection rate was 0.26 per 1,000 catheter days. The use of long-term therapy with continuous EPO appears to be associated with a low incidence of catheter-related infections. Micrococcus spp were the second most common etiologic agent. Caregivers managing patients with PAH must be aware of the risk of catheter infection, as it may contribute to the morbidity and mortality associated with the use of EPO. When isolated, Micrococcus spp should not be viewed as a contaminant, but rather as a true pathogen that may require

A CASE OF ACUTE ENDOCARDITIS CAUSED BY MICROCOCCUS ZYMOGENES (NOV. SPEC.), WITH A DESCRIPTION OF THE MICROORGANISM

PubMed Central

MacCallum, William G.; Hastings, Thomas W.

1899-01-01

From a case of acute endocarditis of the aortic and mitral valves with infarctions m the spleen and kidneys a micrococcus was twice isolated in pure culture from the blood during life and was demonstrated after death both microscopically and in pure culture in large numbers in the valvular vegetations, the infarctions and other parts. No other species of microorganism was found. This micrococcus is very small, occurs mainly in pairs, sometimes in short chains, stains by Gram's method, grows in small, pale, grayish-white colonies on gelatine and agar, at first clouds bouillon, which then becomes clear with a whitish sediment, does not produce gas in glucose media, liquefies gelatine slowly and to some extent also blood serum, and is especially characterized by its behavior in milk, which it acidifies, coagulates and subsequently liquefies. It produces a milk-curdling ferment and also a proteolytic ferment, each of which is separable from the bacterial cells. It remains viable for months in old cultures and is tolerably resistant to the action of heat and antiseptics. The micrococcus is pathogenic for mice and rabbits, causing either abscesses or general infections. Typical acute vegetative endocarditis was experimentally produced by intravenous inoculation of the organism in a rabbit and a dog, and the cocci were demonstrated in pure culture in the vegetations and other parts of these animals after death. Although the micrococcus here described has some points of resemblance to the pneumococcus and Streptococcus pyogenes on the one hand and to the pyogenic staphylococci on the other, it is readily distinguished from each of these species by cultural features which have been described and which are so obvious that the differentiation of these species from our micrococcus need not be discussed in detail. We have searched through the records concerning microorganisms described in association with endocarditis and other diseases, as well as those isolated from water

A CASE OF ACUTE ENDOCARDITIS CAUSED BY MICROCOCCUS ZYMOGENES (NOV. SPEC.), WITH A DESCRIPTION OF THE MICROORGANISM.

PubMed

Maccallum, W G; Hastings, T W

1899-09-01

From a case of acute endocarditis of the aortic and mitral valves with infarctions m the spleen and kidneys a micrococcus was twice isolated in pure culture from the blood during life and was demonstrated after death both microscopically and in pure culture in large numbers in the valvular vegetations, the infarctions and other parts. No other species of microorganism was found. This micrococcus is very small, occurs mainly in pairs, sometimes in short chains, stains by Gram's method, grows in small, pale, grayish-white colonies on gelatine and agar, at first clouds bouillon, which then becomes clear with a whitish sediment, does not produce gas in glucose media, liquefies gelatine slowly and to some extent also blood serum, and is especially characterized by its behavior in milk, which it acidifies, coagulates and subsequently liquefies. It produces a milk-curdling ferment and also a proteolytic ferment, each of which is separable from the bacterial cells. It remains viable for months in old cultures and is tolerably resistant to the action of heat and antiseptics. The micrococcus is pathogenic for mice and rabbits, causing either abscesses or general infections. Typical acute vegetative endocarditis was experimentally produced by intravenous inoculation of the organism in a rabbit and a dog, and the cocci were demonstrated in pure culture in the vegetations and other parts of these animals after death. Although the micrococcus here described has some points of resemblance to the pneumococcus and Streptococcus pyogenes on the one hand and to the pyogenic staphylococci on the other, it is readily distinguished from each of these species by cultural features which have been described and which are so obvious that the differentiation of these species from our micrococcus need not be discussed in detail. We have searched through the records concerning microorganisms described in association with endocarditis and other diseases, as well as those isolated from water

Purification and characterization of vanillin dehydrogenases from alkaliphile Micrococcus sp. TA1 and neutrophile Burkholderia cepacia TM1.

PubMed

Mitsui, Ryoji; Hirota, Mizuho; Tsuno, Takuo; Tanaka, Mitsuo

2010-02-01

Vanillin dehydrogenases (VDHs) were purified and characterized from two bacterial strains that have different pH dependencies for growth. The alkaliphile Micrococcus sp. TA1, isolated from an alkaline spa, can grow on several aromatic compounds such as ferulic acid, vanillin, vanillic acid, and protocatechuic acid under alkaline conditions. The neutrophile Burkholderia cepacia TM1, which was isolated previously, also grew on the above-mentioned compounds because they functioned as the sole carbon source under neutral conditions. Purified VDHs showed activities toward some aromatic aldehydes. These enzymes have the same subunit molecular mass of about 57 kDa as determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, but differed in some of their observed properties. Native molecular masses also differed between the purified enzymes. These were 250 kDa for the enzyme from alkaliphilic strain TA1 and 110 kDa for that from neutrophilic strain TM1, as determined by gel filtration. The enzyme from strain TA1 required NADP(+) as a coenzyme for its activity, but that from strain TM1 required NAD(+). These results are important because this is the first report of an alkaliphilic bacterium consuming lignin monomers.

Use of plant growth promoting bacterial strains to improve Cytisus striatus and Lupinus luteus development for potential application in phytoremediation.

PubMed

Balseiro-Romero, María; Gkorezis, Panagiotis; Kidd, Petra S; Van Hamme, Jonathan; Weyens, Nele; Monterroso, Carmen; Vangronsveld, Jaco

2017-03-01

Plant growth promoting (PGP) bacterial strains possess different mechanisms to improve plant development under common environmental stresses, and are therefore often used as inoculants in soil phytoremediation processes. The aims of the present work were to study the effects of a collection of plant growth promoting bacterial strains on plant development, antioxidant enzyme activities and nutritional status of Cytisus striatus and/or Lupinus luteus plants a) growing in perlite under non-stress conditions and b) growing in diesel-contaminated soil. For this, two greenhouse experiments were designed. Firstly, C. striatus and L. luteus plants were grown from seeds in perlite, and periodically inoculated with 6 PGP strains, either individually or in pairs. Secondly, L. luteus seedlings were grown in soil samples of the A and B horizons of a Cambisol contaminated with 1.25% (w/w) of diesel and inoculated with best PGP inoculant selected from the first experiment. The results indicated that the PGP strains tested in perlite significantly improved plant growth. Combination treatments provoked better growth of L. luteus than the respective individual strains, while individual inoculation treatments were more effective for C. striatus. L. luteus growth in diesel-contaminated soil was significantly improved in the presence of PGP strains, presenting a 2-fold or higher increase in plant biomass. Inoculants did not provoke significant changes in plant nutritional status, with the exception of a subset of siderophore-producing and P-solubilising bacterial strains that resulted in significantly modification of Fe or P concentrations in leaf tissues. Inoculants did not cause significant changes in enzyme activities in perlite experiments, however they significantly reduced oxidative stress in contaminated soils suggesting an improvement in plant tolerance to diesel. Some strains were applied to non-host plants, indicating a non-specific performance of their plant growth promotion

Molecular identification and nanoremediation of microbial contaminants in algal systems using untreated wastewater.

PubMed

Limayem, Alya; Gonzalez, Francisco; Micciche, Andrew; Haller, Edward; Nayak, Bina; Mohapatra, Shyam

2016-12-01

Wastewater-algal biomass is a promising option to biofuel production. However, microbial contaminants constitute a substantial barrier to algal biofuel yield. A series of algal strains, Nannochloris oculata and Chlorella vulgaris samples (n = 30), were purchased from the University of Texas, and were used for both stock flask cultures and flat-panel vertical bioreactors. A number of media were used for isolation and differentiation of potential contaminants according to laboratory standards (CLSI). Conventional PCR amplification was performed followed by 16S rDNA sequencing to identify isolates at the species level. Nanotherapeutics involving a nanomicellar combination of natural chitosan and zinc oxide (CZNPs) were tested against the microbial lytic groups through Minimum Inhibitory Concentration (MIC) tests and Transmission Electronic Microscopy (TEM). Results indicated the presence of Pseudomonas spp., Bacillus pumilus/ safensis, Cellulosimicrobium cellulans, Micrococcus luteus and Staphylococcus epidermidis strains at a substantial level in the wastewater-fed algal reactors. TEM confirmed the effectiveness of CZNPs on the lytic group while the average MICs (mg/mL) detected for the strains, Pseudomonas spp, Micrococcus luteus, and Bacillus pumilus were 0.417, 3.33, and 1.458, respectively. Conclusively, CZNP antimicrobials proved to be effective as inhibitory agents against currently identified lytic microbial group, did not impact algae cells, and shows promise for in situ interventions.

Multilayer polyelectrolyte films functionalized by insertion of defensin: a new approach to protection of implants from bacterial colonization.

PubMed

Etienne, O; Picart, C; Taddei, C; Haikel, Y; Dimarcq, J L; Schaaf, P; Voegel, J C; Ogier, J A; Egles, C

2004-10-01

Infection of implanted materials by bacteria constitutes one of the most serious complications following prosthetic surgery. In the present study, we developed a new strategy based on the insertion of an antimicrobial peptide (defensin from Anopheles gambiae mosquitoes) into polyelectrolyte multilayer films built by the alternate deposition of polyanions and polycations. Quartz crystal microbalance and streaming potential measurements were used to follow step by step the construction of the multilayer films and embedding of the defensin within the films. Antimicrobial assays were performed with two strains: Micrococcus luteus (a gram-positive bacterium) and Escherichia coli D22 (a gram-negative bacterium). The inhibition of E. coli D22 growth at the surface of defensin-functionalized films was found to be 98% when 10 antimicrobial peptide layers were inserted in the film architecture. Noticeably, the biofunctionalization could be achieved only when positively charged poly(l-lysine) was the outermost layer of the film. On the basis of the results of bacterial adhesion experiments observed by confocal or electron microscopy, these observations could result from the close interaction of the bacteria with the positively charged ends of the films, which allows defensin to interact with the bacterial membrane structure. These results open new possibilities for the use of such easily built and functionalized architectures onto any type of implantable biomaterial. The modified surfaces are active against microbial infection and represent a novel means of local host protection.

N-O chemistry for antibiotics: discovery of N-alkyl-N-(pyridin-2-yl)hydroxylamine scaffolds as selective antibacterial agents using nitroso Diels-Alder and ene chemistry.

PubMed

Wencewicz, Timothy A; Yang, Baiyuan; Rudloff, James R; Oliver, Allen G; Miller, Marvin J

2011-10-13

The discovery, syntheses, and structure-activity relationships (SAR) of a new family of heterocyclic antibacterial compounds based on N-alkyl-N-(pyridin-2-yl)hydroxylamine scaffolds are described. A structurally diverse library of ∼100 heterocyclic molecules generated from Lewis acid-mediated nucleophilic ring-opening reactions with nitroso Diels-Alder cycloadducts and nitroso ene reactions with substituted alkenes was evaluated in whole cell antibacterial assays. Compounds containing the N-alkyl-N-(pyridin-2-yl)hydroxylamine structure demonstrated selective and potent antibacterial activity against the Gram-positive bacterium Micrococcus luteus ATCC 10240 (MIC(90) = 2.0 μM or 0.41 μg/mL) and moderate activity against other Gram-positive strains including antibiotic resistant strains of Staphylococcus aureus (MRSA) and Enterococcus faecalis (VRE). A new synthetic route to the active core was developed using palladium-catalyzed Buchwald-Hartwig amination reactions of N-alkyl-O-(4-methoxybenzyl)hydroxylamines with 2-halo-pyridines that facilitated SAR studies and revealed the simplest active structural fragment. This work shows the value of using a combination of diversity-oriented synthesis (DOS) and parallel synthesis for identifying new antibacterial scaffolds.

N-O Chemistry for Antibiotics: Discovery of N-Alkyl-N-(pyridin-2-yl)hydroxylamine Scaffolds as Selective Antibacterial Agents Using Nitroso Diels-Alder and Ene Chemistry

PubMed Central

Wencewicz, Timothy A.; Yang, Baiyuan; Rudloff, James R.; Oliver, Allen G.; Miller, Marvin J.

2011-01-01

The discovery, syntheses, and structure-activity relationships (SAR) of a new family of heterocyclic antibacterial compounds based on N-alkyl-N-(pyridin-2-yl)hydroxylamine scaffolds are described. A structurally diverse library of ~100 heterocyclic molecules generated from Lewis acid-mediated nucleophilic ring opening reactions with nitroso Diels-Alder cycloadducts and nitroso ene reactions with substituted alkenes was evaluated in whole cell antibacterial assays. Compounds containing the N-alkyl-N-(pyridin-2-yl)hydroxylamine structure demonstrated selective and potent antibacterial activity against the Gram-positive bacterium Micrococcus luteus ATCC 10240 (MIC90 = 2.0 μM or 0.41 μg/mL) and moderate activity against other Gram-positive strains including antibiotic resistant strains of Staphylococcus aureus (MRSA) and Enterococcus faecalis (VRE). A new synthetic route to the active core was developed using palladium-catalyzed Buchwald-Hartwig amination reactions of N-alkyl-O-(4-methoxybenzyl)hydroxylamines with 2-halo-pyridines that facilitated SAR studies and revealed the simplest active structural fragment. This work shows the value of using a combination of diversity-oriented synthesis (DOS) and parallel synthesis for identifying new antibacterial scaffolds. PMID:21859126

Oxygenated N-Acyl Alanine Methyl Esters (NAMEs) from the Marine Bacterium Roseovarius tolerans EL-164.

PubMed

Bruns, Hilke; Herrmann, Jennifer; Müller, Rolf; Wang, Hui; Wagner Döbler, Irene; Schulz, Stefan

2018-01-26

The marine bacterium Roseovarius tolerans EL-164 (Rhodobacteraceae) can produce unique N-acylalanine methyl esters (NAMEs) besides strucutrally related N-acylhomoserine lactones (AHLs), bacterial signaling compounds widespread in the Rhodobacteraceae. The structures of two unprecedented NAMEs carrying a rare terminally oxidized acyl chain are reported here. The compounds (Z)-N-16-hydroxyhexadec-9-enoyl-l-alanine methyl ester (Z9-16-OH-C16:1-NAME, 3) and (Z)-N-15-carboxypentadec-9-enoyl-l-alanine methyl ester (16COOH-C16:1-NAME, 4) were isolated, and the structures were determined by NMR and MS experiments. Both compounds were synthesized to prove assignments and to test their biological activity. Finally, non-natural, structurally related Z9-3-OH-C16:1-NAME (18) was synthesized to investigate the mass spectroscopy of structurally related NAMEs. Compound 3 showed moderate antibacterial activity against microorganisms such as Bacillus, Streptococcus, Micrococcus, or Mucor strains. In contrast to AHLs, quorum-sensing or quorum-quenching activity was not observed.

Evaluation of antibacterial properties of some medicinal plants used in Iran.

PubMed

Bonjar, Shahidi

2004-10-01

Forty-five species of 29 plant families used in the traditional medicine by Iranian people, showed antibacterial activities against one or more of the bacterial species: Bacillus cereus, Bacillus pumilus, Bordetella bronchiseptica, Escherichia coli, Klebsiella pneumoniae, Micrococcus luteus, Pseudomonas aeruginosa, Pseudomonas fluorescens, Serratia marcescens, Staphylococcus aureus and Staphylococcus epidermidis. No plant showed activity against Serratia marcescens; Bordetella bronchiseptica being the most susceptible species. All extracts showed the same activity 18 months later.

Molecular assessment of the membrane menaquinones of irradiated micrococcus on disposable medical devices with high performance liquid chromatography (HPLC)

NASA Astrophysics Data System (ADS)

Ghojaie, M.

1993-10-01

The genus of micrococcus and its main species like; M. Roseus, M. Nishinomiyansis consist of upto 10% of microbial contamination of disposable medical devices. Chemical alteration of Menuquinones Mainly [MK-7-(H2), MK-8(H2),…] from some Irradiated species of the micrococcus at different doses (500 Gy to 25 kGy; the sterilization dose) are quantitatively evaluated by HPLC.

The deoxyribonucleic acid of Micrococcus radiodurans

PubMed Central

Schein, Arnold H.

1966-01-01

The DNA of Micrococcus radiodurans was prepared by three methods. Although the recovery of DNA varied considerably, the percentage molar base ratios of the DNA from the three preparations were essentially the same: guanine, 33±2; adenine, 18±1; cytosine, 33±2; thymine, 17±1. Base compositions calculated from Tm values and from density in caesium chloride gradients also yielded guanine+cytosine contents of 66 and 68% of total bases respectively. No unusual bases were observed. The S20,w values were characteristic of high-molecular-weight DNA. Electron microscopy showed the purified DNA in long strands; occasionally these were coiled. Images(a)(b)(c)(d)(e)Fig. 1. PMID:16742439

Structures Containing Polyphosphate in Micrococcus lysodeikticus1

PubMed Central

Friedberg, Ilan; Avigad, Gad

1968-01-01

Granular structures containing inorganic polyphosphate were found in Micrococcus lysodeikticus. These structures were isolated by fractionation of the bacterial extract obtained by lysing the organisms with lysozyme. The composition of the fraction which was enriched with these structures was found to be: protein, 24%; lipids, 30%; and polyphosphate, 27%. This fraction also contained small amounts of ribonucleic acids, carbohydrate, and polyvalent cations. The effect of different reagents and enzymes on the integrity of the granules was examined. It was noticed that they accumulate in the bacteria during the logarithmic phase of growth but disappear gradually during the stationary phase. Images PMID:5674060

Oxidation and Assimilation of Carbohydrates by Micrococcus sodonensis1

PubMed Central

Perry, Jerome J.; Evans, James B.

1966-01-01

Perry, Jerome J. (North Carolina State University, Raleigh), and James B. Evans. Oxidation and assimilation of carbohydrates by Micrococcus sodonensis. J. Bacteriol. 91:33–38. 1966.—Micrococcus sodonensis is a biotin-requiring strict aerobe that cannot utilize carbohydrates as sole sources of carbon and energy. However, addition of mannose, glucose, sucrose, or maltose to a medium on which the organism can grow resulted in an increase in total growth. M. sodonensis oxidized these sugars without induction, thus indicating the presence of constitutive enzymes for their transport, activation, and metabolism. Under appropriate nonproliferating cell conditions, glucose was readily incorporated into essential constituents of the cell. When glucose-1-C14 and glucose-6-C14 were oxidized by nonproliferating cells, the label was found in both the protein and nucleic acid fractions of the cell. The respiratory quotients of cells oxidizing glucose in saline and in phosphate buffer indicated assimilation of sugar carbon in buffer and virtually no assimilation in saline. The ability of M. sodonensis to completely oxidize glucose and to grow on intermediates of glucose oxidation but not on glucose suggests that glucose may suppress or repress some reaction(s) necessary for growth, and that growth substrates either derepress or circumvent this block. PMID:5903100

Systematics of a widely distributed western North American springsnail, Pyrgulopsis micrococcus (Caenogastropoda, Hydrobiidae), with descriptions of three new congeners.

PubMed

Hershler, Robert; Liu, Hsiu-Ping; Bradford, Corbin

2013-01-01

We describe three new species of springsnails (genus Pyrgulopsis) from the Amargosa River basin, California and Nevada (P. licina sp. n., P. perforata sp. n., P. sanchezi sp. n.), each of which was previously considered to be part of P. micrococcus. We also restrict P. micrococcus to its type locality area (Oasis Valley) and redefine a regional congener, P. turbatrix, to include populations from the central Death Valley region and San Bernardino Mountains that had been previously identified as P. micrococcus. The five species treated herein form genetically distinct lineages that differ from each other by 4.2-12.6% for mtCOI and 5.2-13.6% for mtNDI (based on previously published and newly obtained data), and are diagnosable by shell and/or penial characters. The new molecular data presented herein confirm sympatry of P. licina and P. sanchezi in Ash Meadows (consistent with morphological evidence) and delineate an additional lineage of P. micrococcus (in the broad sense) that we do not treat taxonomically owing to the paucity of morphological material. Conservation measures are needed to ensure the long term persistence of populations of P. micrococcus and a genetically differentiated lineage of P. sanchezi which live in disturbed habitats on private lands.

Metabolism of dimethylphthalate by Micrococcus sp. strain 12B.

PubMed Central

Eaton, R W; Ribbons, D W

1982-01-01

During growth of Micrococcus sp. strain 12B with dimethylphthalate, 4-carboxy-2-hydroxymuconate lactone (CHML, X) and 3,4-dihydroxyphthalate-2-methyl ester (XI) were isolated from culture filtrates. CHML is the lactone of intermediate 4-carboxy-2-hydroxymuconate (IX). Accumulation of XI which is not a substrate for 3,4-dihydroxyphthalate-2-decarboxylase in strain 12B afforded an easy access to the preparation of 3,4-dihydroxyphthalate. PMID:7085569

The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

PubMed Central

Hori, H; Osawa, S; Murao, K; Ishikura, H

1980-01-01

The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

Single Upconversion Nanoparticle-Bacterium Cotrapping for Single-Bacterium Labeling and Analysis.

PubMed

Xin, Hongbao; Li, Yuchao; Xu, Dekang; Zhang, Yueli; Chen, Chia-Hung; Li, Baojun

2017-04-01

Detecting and analyzing pathogenic bacteria in an effective and reliable manner is crucial for the diagnosis of acute bacterial infection and initial antibiotic therapy. However, the precise labeling and analysis of bacteria at the single-bacterium level are a technical challenge but very important to reveal important details about the heterogeneity of cells and responds to environment. This study demonstrates an optical strategy for single-bacterium labeling and analysis by the cotrapping of single upconversion nanoparticles (UCNPs) and bacteria together. A single UCNP with an average size of ≈120 nm is first optically trapped. Both ends of a single bacterium are then trapped and labeled with single UCNPs emitting green light. The labeled bacterium can be flexibly moved to designated locations for further analysis. Signals from bacteria of different sizes are detected in real time for single-bacterium analysis. This cotrapping method provides a new approach for single-pathogenic-bacterium labeling, detection, and real-time analysis at the single-particle and single-bacterium level. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Regioselective synthesis of novel 3-allyl-2-(substituted imino)-4-phenyl-3H-thiazole and 2,2‧-(1,3-phenylene)bis(3-substituted-2-imino-4-phenyl-3H-thiazole) derivatives as antibacterial agents

NASA Astrophysics Data System (ADS)

Abbasi Shiran, Jafar; Yahyazadeh, Asieh; Mamaghani, Manouchehr; Rassa, Mehdi

2013-05-01

Several novel 3-allyl-2-(substituted imino)-4-phenyl-3H-thiazole derivatives were synthesized by the reaction of allyl-thioureas and 2-bromoacetophenone. We also report the synthesis of bis-allyl-3H thiazoles using the reaction of various isothiocyanates and 1,3-phenylenediamine. The structures of all compounds were characterized by spectral and elemental analysis. Most of the synthesized compounds exhibited efficient antibacterial activities against Salmonella enterica, Micrococcus luteus, Bacillus subtilis and Pseudomonas aeruginosa.

Effect of Hydroxyurea on Staphylococcus epidermidis and Micrococcus lysodeikticus: Thickening of the Cell Wall

PubMed Central

Feiner, Rose R.; Coward, Joe E.; Rosenkranz, Herbert S.

1973-01-01

Hydroxyurea-sensitive strains of Staphylococcus epidermidis and Micrococcus lysodeikticus showed marked thickening of cell walls and reduction in deoxyribonucleic acid synthesis when grown in the presence of hydroxyurea. Images PMID:4790602

Isolation and Identification of Echinenone from Micrococcus roseus

PubMed Central

Schwartzel, E. H.; Cooney, J. J.

1970-01-01

An orange carotenoid from Micrococcus roseus was purified by solvent partitioning followed by column and thin-layer chromatography. Absorption spectra, chromatographic mobility, and partition coefficient suggested that the pigment was echinenone (4-keto-β-carotene). Reduction yielded a pigment with the spectral and polar properties of isocryptoxanthin (4-hydroxy-β-carotene), the expected product. The orange pigment and its reduction product co-chromatographed with the respective authentic pigments, confirming the original pigment as echinenone. To our knowledge echinenone has not been identified previously as a bacterial pigment. PMID:5473895

Members of Microvirga and Bradyrhizobium genera are native endosymbiotic bacteria nodulating Lupinus luteus in Northern Tunisian soils.

PubMed

Msaddak, Abdelhakim; Rejili, Mokhtar; Durán, David; Rey, Luis; Imperial, Juan; Palacios, Jose Manuel; Ruiz-Argüeso, Tomas; Mars, Mohamed

2017-06-01

The genetic diversity of bacterial populations nodulating Lupinus luteus (yellow lupine) in Northern Tunisia was examined. Phylogenetic analyses of 43 isolates based on recA and gyrB partial sequences grouped them in three clusters, two of which belong to genus Bradyrhizobium (41 isolates) and one, remarkably, to Microvirga (2 isolates), a genus never previously described as microsymbiont of this lupine species. Representatives of the three clusters were analysed in-depth by multilocus sequence analysis of five housekeeping genes (rrs, recA, glnII, gyrB and dnaK). Surprisingly, the Bradyrhizobium cluster with the two isolates LluI4 and LluTb2 may constitute a new species defined by a separate position between Bradyrhizobium manausense and B. denitrificans. A nodC-based phylogeny identified only two groups: one formed by Bradyrhizobium strains included in the symbiovar genistearum and the other by the Microvirga strains. Symbiotic behaviour of representative isolates was tested, and among the seven legumes inoculated only a difference was observed i.e. the Bradyrhizobium strains nodulated Ornithopus compressus unlike the two strains of Microvirga. On the basis of these data, we conclude that L. luteus root nodule symbionts in Northern Tunisia are mostly strains within the B. canariense/B. lupini lineages, and the remaining strains belong to two groups not previously identified as L. luteus endosymbionts: one corresponding to a new clade of Bradyrhizobium and the other to the genus Microvirga. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

[Production and characteristics of bacteria-labeled talc dust for experimental air hygiene studies].

PubMed

Ohgke, H; Oldenburg, B; Gropengiesser, R; Herbst, M

1983-04-01

Freeze-drying of suspensions of Micrococcus luteus together with talc yields bacteria-labelled dust. This material can be used in experimental air hygiene. Loss of viability due to drying in air during experiments can be expected to be negligible. A wide range of particle diameters (1 to greater than 23 micron) is available. Scanning electron microscopy shows the bacteria sticking on talc particles after freeze-drying (Fig. 3a + b). Viable counts of the material decreased very slowly on storage.

One-pot and two-step synthesis of novel carbonylthioureas and dicarbonyldithioureas derivatives

NASA Astrophysics Data System (ADS)

Banaei, Alireza; Shiran, Jafar Abbasi; Saadat, Afshin; Ardabili, Farnaz Fazlalizadeh; McArdle, Patrick

2015-11-01

One-pot, two-step synthesis of several 1-cyclopropanecarbonyl-3-(substituted phenyl)-thioureas and 1-(phenylene-1,4-dione)-3,3‧-(substituted phenyl)-dithioureas have been successfully prepared. The structures of the synthesized compounds were confirmed by elemental analysis, FT-IR spectroscopy and NMR. Also the crystal structure one of these compounds was determined by X-ray crystallography. All synthesized compounds were evaluated for antibacterial activity using Salmonella enterica (SE), Micrococcus luteus (ML), Bacillus subtilis (BS) and Pseudomonas aeruginosa (PS).

Immune challenge differentially affects transcript abundance of three antimicrobial peptides in hemocytes from the moth Pseudoplusia includens.

PubMed

Lavine, M D; Chen, G; Strand, M R

2005-12-01

Inducible expression of antimicrobial peptides and other humoral immune factors by the insect fat body is well documented. Hemocytes comprise the second essential arm of the insect immune system but it is unclear whether antimicrobial peptide genes are expressed by all or only some types of hemocytes. Here we report the cloning of cecropin A (Pi-cecA), lebocin (Pi-leb) and lysozyme (Pi-lys) homologs from the moth Pseudoplusia includens. Relative-quantitative real-time PCR (rq-rtPCR) indicated that transcript abundance for each antimicrobial gene increased in fat body and hemocytes following immune challenge with the Gram-negative bacterium Escherichia coli. Relative transcript abundance of Pi-cecA was much higher in fat body than hemocytes. In contrast, transcript levels of Pi-leb were three-fold lower in hemocytes than fat body while transcript levels of Pi-lys were three-fold higher. Estimates for the overall contribution of the fat body and hemocytes to antimicrobial peptide expression suggested that hemocytes contribute significantly to Pi-lys transcript levels in larvae but produce much smaller amounts of Pi-cecA and Pi-leb compared to the fat body. Each antimicrobial peptide was also inducibly expressed in hemocytes following challenge with the Gram-positive bacterium Micrococcus luteus or when hemocytes formed capsules around chromatography beads. Analysis of hemocyte types indicated that granulocytes and plasmatocytes expressed all three antimicrobial peptides, whereas spherule cells and oenocytoids expressed only lysozyme. Transcriptional profiles of these antimicrobial genes were similar in granulocytes and plasmatocytes in vivo but were very different in vitro.

REDUCTION OF INORGANIC COMPOUNDS WITH MOLECULAR HYDROGEN BY MICROCOCCUS LACTILYTICUS I.

PubMed Central

Woolfolk, C. A.; Whiteley, H. R.

1962-01-01

Woolfolk, C. A. (University of Washington, Seattle) and H. R. Whiteley. Reduction of inorganic compounds with molecular hydrogen by Micrococcus lactilyticus. I. Stoichiometry with compounds of arsenic, selenium, tellurium, transition and other elements. J. Bacteriol. 84:647–658. 1962.—Extracts of Micrococcus lactilyticus (Veillonella alcalescens) oxidize molecular hydrogen at the expense of certain compounds of arsenic, bismuth, selenium, tellurium, lead, thallium, vanadium, manganese, iron, copper, molybdenum, tungsten, osmium, ruthenium, gold, silver, and uranium, as well as molecular oxygen. Chemical and manometric data indicate that the following reductions are essentially quantitative: arsenate to arsenite, pentavalent and trivalent bismuth to the free element, selenite via elemental selenium to selenide, tellurate and tellurite to tellurium, lead dioxide and manganese dioxide to the divalent state, ferric to ferrous iron, osmium tetroxide to osmate ion, osmium dioxide and trivalent osmium to the metal, uranyl uranium to the tetravalent state, vanadate to the level of vanadyl, and polymolybdate ions to molybdenum blues with an average valence for molybdenum of +5. The results of a study of certain other hydrogenase-containing bacteria with respect to their ability to carry out some of the same reactions are also presented. PMID:14001842

Accumulation and distribution of mercury in fruiting bodies by fungus Suillus luteus foraged in Poland, Belarus and Sweden.

PubMed

Saba, Martyna; Falandysz, Jerzy; Nnorom, Innocent C

2016-02-01

Presented in this paper is result of the study of the bioconcentration potential of mercury (Hg) by Suillus luteus mushroom collected from regions within Central, Eastern, and Northern regions of Europe. As determined by cold-vapor atomic absorption spectroscopy, the Hg content varied from 0.13 ± 0.05 to 0.33 ± 0.13 mg kg(-1) dry matter for caps and from 0.038 ± 0.014 to 0.095 ± 0.038 mg kg(-1) dry matter in stems. The Hg content of the soil substratum (0-10 cm layer) underneath the fruiting bodies showed generally low Hg concentrations that varied widely ranging from 0.0030 to 0.15 mg kg(-1) dry matter with mean values varying from 0.0078 ± 0.0035 to 0.053 ± 0.025 mg kg(-1) dry matter, which is below typical content in the Earth crust. The caps were observed to be on the richer in Hg than the stems at ratio between 1.8 ± 0.4 and 5.3 ± 2.6. The S. luteus mushroom showed moderate ability to accumulate Hg with bioconcentration factor (BCF) values ranging from 3.6 ± 1.3 to 42 ± 18. The consumption of fresh S. luteus mushroom in quantities up to 300 g week(-1) (assuming no Hg ingestion from other foods) from background areas in the Central, Eastern, and Northern part of Europe will not result in the intake of Hg exceeds the provisional weekly tolerance limit (PTWI) of 0.004 mg kg(-1) body mass.

Responses of Mytilus galloprovincialis to bacterial challenges by metabolomics and proteomics.

PubMed

Ji, Chenglong; Wu, Huifeng; Wei, Lei; Zhao, Jianmin; Wang, Qing; Lu, Hongjian

2013-08-01

Pathogens can cause diseases and lead to massive mortalities of aquaculture animals and substantial economic loss. In this work, we studied the responses induced by Micrococcus luteus and Vibrio anguillarum in gill of mussel Mytilus galloprovincialis at protein and metabolite levels. Metabolic biomarkers (e.g., amino acids, betaine, ATP) suggested that both M. luteus and V. anguillarum induced disturbances in energy metabolism and osmotic regulation. The unique and some more remarkably altered metabolic biomarkers (threonine, alanine, aspartate, taurine, succinate) demonstrated that V. anguillarum could cause more severe disturbances in osmotic regulation and energy metabolism. Proteomic biomarkers (e.g., goose-type lysozyme 2, matrilin, ependymin-related protein, peptidyl-prolyl cis-trans isomerases) indicated that M. luteus caused immune stress, and disturbances in signaling pathways and protein synthesis. However, V. anguillarum mainly induced oxidative stress and disturbance in energy metabolism in mussel gills indicated by altered procollagen-proline dioxygenase, protein disulfide isomerase, nucleoside diphosphate kinases, electron transfer flavoprotein and glutathione S-transferase. This work confirmed that an integration of proteomics and metabolomics could provide an insightful view into the effects of pathogens to the marine mussel M. galloprovincialis. Copyright © 2013 Elsevier Ltd. All rights reserved.

Effect of physiological age on radiation resistance of some bacteria that are highly radiation resistant. [Micrococcus radiodurans; Micrococcus sp. isolate C-3; Moraxella sp isolate 4; Escherichia coli

DOE Office of Scientific and Technical Information (OSTI.GOV)

Keller, L.C.; Maxcy, R.B.

1984-05-01

Physiological age-dependent variation in radiation resistance was studied for three bacteria that are highly radiation resistant: Micrococcus radiodurans, Micrococcus sp. isolate C-3, and Moraxella sp. isolate 4. Stationary-phase cultures of M. radiodurans and isolate C-3 were much more resistant to gamma radiation than were log-phase cultures. This pattern of relative resistance was reversed for isolate 4. Resistance of isolate 4 to UV light was also greater during log phase, although heat resistance and NaCl tolerance after heat stresses were greater during stationary phase. Radiation-induced injury of isolate 4 compared with injury of Escherichia coli B suggested that the injury process,more » as well as the lethal process, was affected by growth phase. The hypothesis that growth rate affects radiation resistance was tested, and results were interpreted in light of the probable confounding effect of methods used to alter growth rates of bacteria. These results indicate that dose-response experiments should be designed to measure survival during the most resistant growth phase of the organism under study. The timing is particularly important when extrapolations of survival results might be made to potential irradiation processes for foods. 17 references.« less

Immunological properties of Micrococcus lysodeikticus membranes.

PubMed

Fukui, Y; Nachbar, M S; Salton, M R

1971-01-01

Membranes of Micrococcus lysodeikticus possess antigens which are distinct from other cellular components such as cytoplasm, ribosomes, and cell walls. Only a few (two to three) components are found when dissociated membranes are examined by immunodiffusion and immunoelectrophoresis techniques. Membranes treated with 0.3% sodium dodecyl sulfate, 0.3% Triton X-100, trypsin, phospholipase A or C, or by sonic oscillation at pH 9.0, all showed the same pattern (three major bands) when examined against membrane antisera by immunoelectrophoresis. Immunological analysis of fractions isolated by sucrose gradient centrifugation or by polyacrylamide gel electrophoresis suggests that individual components cross-react. Antibodies to adenosine triphosphatase (EC 3.6.1.3) and fast-moving component are not removed by absorption with protoplasts. Removal of antibody to one of the membrane antigens by protoplast absorption indicated a surface location. Glutaraldehyde fixation of protoplasts resulted in the loss of membrane antigens detectable by immunodiffusion.

Failure Analysis of Pitted Copper Pipes Used in Underground Water and Preventive Measures

NASA Astrophysics Data System (ADS)

Nam, Gi-ho; Lee, Jong-kwon; Kim, Kyung-ja

2018-05-01

This study performed an experiment on the causes of pitting corrosion in a copper tubing used for a sprinkler system. Corrosion products of a copper tubing that sustained pitting corrosion were collected and cultured in Culture medium [Luria-Bertani, Brain heart infusion, Tryptic soy broth (TSB), R2A]. Four types of bacteria were found through identification: Micrococcus luteus sp (species)., Staphylococcus sp., Sphingomonas sp., and Bacillus sp. The copper toxicity test was performed for each microorganism. Among the four microorganisms, Micrococcus luteus sp. showed good growth in the environment containing copper ions. On the immersion test, changes in pH and Optical density were measured; On the inductively coupled plasma optical emission spectrometry test, the copper concentration of each culture medium was measured. The surface of each copper sample was observed using a scanning electron microscope. The corrosion potential of a copper sample, after 48 h exposure of the TSB medium containing Micrococcus luteus sp., was measured using a potentiodynamic polarization experiment. The next experiment was conducted to prevent microbial corrosion by suppressing the growth of microorganisms. Six 30 ml TSB culture media with controlled pH value of 4, 5, 6, 7, 8, and 9 through HCl and NaOH were manufactured. Then the microorganisms were cultured in 37 °C 133 rpm, of which the growth status was checked every 24 h for 3 days. It was found that microorganisms did not grow on culture media with the pH value of 6 and lower. The same experiment conducted on culture media controlled with acetic acid, nitric acid, and sulfuric acid, also showed no growth of microorganisms on media with pH value of 6 and lower. Six 5 ml TSB culture media each containing 0.5, 0.25, 0.125, 0.0625, 0.0312%, and 0.0156% NaOCl and NaOBr as germicides were manufactured. 0.01 μl of microorganisms were inoculated on the media and cultured in 37 °C for 48 h. It was found that microorganisms did not

Failure Analysis of Pitted Copper Pipes Used in Underground Water and Preventive Measures

NASA Astrophysics Data System (ADS)

Nam, Gi-ho; Lee, Jong-kwon; Kim, Kyung-ja

2018-03-01

This study performed an experiment on the causes of pitting corrosion in a copper tubing used for a sprinkler system. Corrosion products of a copper tubing that sustained pitting corrosion were collected and cultured in Culture medium [Luria-Bertani, Brain heart infusion, Tryptic soy broth (TSB), R2A]. Four types of bacteria were found through identification: Micrococcus luteus sp (species)., Staphylococcus sp., Sphingomonas sp., and Bacillus sp. The copper toxicity test was performed for each microorganism. Among the four microorganisms, Micrococcus luteus sp. showed good growth in the environment containing copper ions. On the immersion test, changes in pH and Optical density were measured; On the inductively coupled plasma optical emission spectrometry test, the copper concentration of each culture medium was measured. The surface of each copper sample was observed using a scanning electron microscope. The corrosion potential of a copper sample, after 48 h exposure of the TSB medium containing Micrococcus luteus sp., was measured using a potentiodynamic polarization experiment. The next experiment was conducted to prevent microbial corrosion by suppressing the growth of microorganisms. Six 30 ml TSB culture media with controlled pH value of 4, 5, 6, 7, 8, and 9 through HCl and NaOH were manufactured. Then the microorganisms were cultured in 37 °C 133 rpm, of which the growth status was checked every 24 h for 3 days. It was found that microorganisms did not grow on culture media with the pH value of 6 and lower. The same experiment conducted on culture media controlled with acetic acid, nitric acid, and sulfuric acid, also showed no growth of microorganisms on media with pH value of 6 and lower. Six 5 ml TSB culture media each containing 0.5, 0.25, 0.125, 0.0625, 0.0312%, and 0.0156% NaOCl and NaOBr as germicides were manufactured. 0.01 μl of microorganisms were inoculated on the media and cultured in 37 °C for 48 h. It was found that microorganisms did not

Efficient biotransformation of herbicide diuron by bacterial strain Micrococcus sp. PS-1.

PubMed

Sharma, Priyanka; Chopra, Adity; Cameotra, Swaranjit Singh; Suri, C Raman

2010-11-01

A Gram-positive, Micrococcus sp. strain PS-1 capable of utilizing phenylurea herbicide diuron as a sole carbon source at a high concentration (up to 250 ppm) was isolated from diuron storage site by selective enrichment study. The taxonomic characterization with 16S rRNA gene sequencing (1,477 bp) identified PS-1 as a member of Micrococcus sp. It was studied for the degradation of diuron and a range of its analogues (monuron, linuron, monolinuron, chlortoluron and fenuron). The shake flasks experiments demonstrated fast degradation of diuron (up to 96% at 250 ppm within 30 h incubation) with the addition of small quantity (0.01%) of non-ionic detergent. The relative degradation profile by the isolate was in the order of fenuron > monuron > diuron > linuron > monolinuron > chlortoluron. Further, the biochemical characterization of catabolic pathway by spectroscopic and chromatographic techniques demonstrated that the degradation proceeded via formation of dealkylated metabolites to form 3,4-dichloroaniline (3,4-DCA). It was the major metabolite formed, associated with profound increase in degradation kinetics in presence of appropriate additive.

Endocarditis associated with cardiac catheterization due to a Gram-positive coccus designated Micrococcus mucilaginosus incertae sedis.

PubMed Central

Rubin, S J; Lyons, R W; Murcia, A J

1978-01-01

A gram-positive coccus, presently named Micrococcus mucilaginosus incertae sedis, was isolated from 14 blood cultures from a patient with endocarditis. The first positive blood culture was drawn 5 days after the patient underwent cardiac catheterization. PMID:670378

Antimicrobial activity of a nisin-activated plastic film for food packaging.

PubMed

Mauriello, G; De Luca, E; La Storia, A; Villani, F; Ercolini, D

2005-01-01

To determine the effectiveness of a packaging film coated with nisin to inhibit Micrococcus luteus ATCC 10240 in tryptone soya broth (TSB) and the microbiota of raw milk during storage. A further aim was to examine the release of nisin from the activated film. An active package, obtained from nisin-treated film, was filled with 1 l of M. luteus ATCC 10240 (ML) suspension in TSB and stored at 4 and 25 degrees C for 2 days. After 24 h at 25 degrees C there was a remarkable reduction of M. luteus ATCC 10240 compared with the control, while at 4 degrees C a slight reduction was observed. Moreover, microbial growth was controlled when 1 l of three different kinds of milk was poured into the active package and stored at 4 degrees C for 7 days. The most significant results were observed in raw milk and pasteurized milk with a reduction of 0.9 log and 1.3 log, respectively. The release experiments showed that nisin release from the film was unpredictable, but it was favoured by low pH and high temperature. It appears that nisin-coated films were effective in inhibiting M. luteus ATCC 10240 in TSB and the bacterial flora in milk, and the release of nisin was pH and temperature dependent. Nisin-activated film may control bacterial growth, maintaining food quality, safety and extending the shelf-life of food products.

Specific amino acids responsible for the cold adaptedness of Micrococcus antarcticus β-glucosidase BglU.

PubMed

Miao, Li-Li; Fan, Hong-Xia; Qu, Jie; Liu, Ying; Liu, Zhi-Pei

2017-03-01

Psychrophilic enzymes display efficient activity at moderate or low temperatures (4-25 °C) and are therefore of great interest in biotechnological industries. We previously examined the crystal structure of BglU, a psychrophilic β-glucosidase from the bacterium Micrococcus antarcticus, at 2.2 Å resolution. In structural comparison and sequence alignment with mesophilic (BglB) and thermophilic (GlyTn) counterpart enzymes, BglU showed much lower contents of Pro residue and of charged amino acids (particularly positively charged) on the accessible surface area. In the present study, we investigated the roles of specific amino acid residues in the cold adaptedness of BglU. Mutagenesis assays showed that the mutations G261R and Q448P increased optimal temperature (from 25 to 40-45 °C) at the expense of low-temperature activity, but had no notable effects on maximal activity or heat lability. Mutations A368P, T383P, and A389E significantly increased optimal temperature (from 25 to 35-40 °C) and maximal activity (~1.5-fold relative to BglU). Thermostability of A368P and A389E increased slightly at 30 °C. Mutations K163P, N228P, and H301A greatly reduced enzymatic activity-almost completely in the case of H301A. Low contents of Pro, Arg, and Glu are important factors contributing to BglU's psychrophilic properties. Our findings will be useful in structure-based engineering of psychrophilic enzymes and in production of mutants suitable for a variety of industrial processes (e.g., food production, sewage treatment) at cold or moderate temperatures.

Purification, crystallization and preliminary crystallographic studies of plant S-adenosyl-l-homocysteine hydrolase (Lupinus luteus)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Brzezinski, Krzysztof; Department of Crystallography, Faculty of Chemistry, A. Mickiewicz University, Poznan; Bujacz, Grzegorz

2008-07-01

Single crystals of recombinant S-adenosyl-l-homocysteine hydrolase from L. luteus in complex with adenosine diffract X-rays to 1.17 Å resolution at 100 K. The crystals are tetragonal, space group P4{sub 3}2{sub 1}2, and contain one copy of the dimeric enzyme in the asymmetric unit. By degrading S-adenosyl-l-homocysteine, which is a byproduct of S-adenosyl-l-methionine-dependent methylation reactions, S-adenosyl-l-homocysteine hydrolase (SAHase) acts as a regulator of cellular methylation processes. S-Adenosyl-l-homocysteine hydrolase from the leguminose plant yellow lupin (Lupinus luteus), LlSAHase, which is composed of 485 amino acids and has a molecular weight of 55 kDa, has been cloned, expressed in Escherichia coli and purified.more » Crystals of LlSAHase in complex with adenosine were obtained by the hanging-drop vapour-diffusion method using 20%(w/v) PEG 4000 and 10%(v/v) 2-propanol as precipitants in 0.1 M Tris–HCl buffer pH 8.0. The crystals were tetragonal, space group P4{sub 3}2{sub 1}2, with unit-cell parameters a = 122.4, c = 126.5 Å and contained two protein molecules in the asymmetric unit, corresponding to the functional dimeric form of the enzyme. Atomic resolution (1.17 Å) X-ray diffraction data have been collected using synchrotron radiation.« less

Facile fabrication and characterization of chitosan-based zinc oxide nanoparticles and evaluation of their antimicrobial and antibiofilm activity

NASA Astrophysics Data System (ADS)

Dhillon, Gurpreet Singh; Kaur, Surinder; Brar, Satinder Kaur

2014-06-01

The present investigation deals with the facile synthesis and characterization of chitosan (CTS)-based zinc oxide (ZnO) nanoparticles (NPs) and their antimicrobial activities against pathogenic microorganisms. ZnO-CTS NPs were synthesized through two different methods: nano spray drying and precipitation, using various organic compounds (citric acid, glycerol, starch and whey powder) as stabilizers. Both the synthesis methods were simple and were devoid of any chemical usage. The detailed characterization of the NPs was carried out using UV-Vis spectroscopy, dynamic light scattering particle size analysis, zeta potential measurements and scanning electron microscopy, which confirmed the fabrication of NPs with different shapes and sizes. Antimicrobial assay of synthesized ZnO-CTS NPs was carried out against different pathogenic microbial strains ( Candida albicans, Micrococcus luteus and Staphylococcus aureus). The significant ( p < 0.05) inhibition of growth was observed for both M. luteus and S. aureus with ZnO-CTS NPs (with a concentration ranging from 0.625 to 0.156 mg/ml) as compared to control treatment. ZnO-CTS NPs also showed significant biofilm inhibition activity ( p < 0.05) against M. luteus and S. aureus. The study demonstrated the potential of ZnO-CTS NPs as antimicrobial and antibiofilm agents.

Screening of the constituents, antimicrobial and antioxidant activity of endemic Origanum hypericifolium O. Schwartz & P.H. Davis.

PubMed

Celik, Ali; Nur Herken, E; Arslan, Idris; Zafer Ozel, M; Mercan, Nazime

2010-10-01

The chemical compositions, total phenol content, antioxidant and antimicrobial activities with oxidant status of the essential oil from an endemic Turkish species, Origanum hypericifolium, were investigated. Steam distillation (SD) was used to isolate the essential oils, and the chemical analyses were performed by gas chromatography-mass spectrometry (GC-MS). The antimicrobial activity was tested by agar disc diffusion method against Morganella morganii (clinic isolate), Micrococcus flavus (clinic isolate), Micrococcus luteus NRLL B-4375, Proteus vulgaris RSKK 96026, Escherichia coli ATCC 11230, Escherichia coli ATCC 25922, Yersinia enterecolitica RSKK 1501, Staphylococcus aureus ATCC 25923, S. aureus ATCC 25933, S. aureus ATCC 12598, S. aureus (clinic isolate), MRSA 1 (clinic isolate), MRSA 2 (clinic isolate), MRSA 3 (clinic isolate) and MRSA 4 (clinic isolate). The major compounds found in volatiles of O. hypericifolium were p-cymene, carvacrol and γ-terpinene. Results showed that O. hypericifolium has the potential for being used in food and medicine because of its antioxidant and antibacterial activity.

Presence of a new cytochrome b - like pigment with a peak at 567 nm in various aerobic bacteria.

PubMed

Jacobs, N J; O'Hara, J; Gray, C T

1983-09-01

Several physiological groups of bacteria were examined for the presence of a cytochrome b - like pigment which is demonstrable in dithionite-reduced minus substrate-reduced difference spectra. This pigment is characterized by an unusually high alpha band at 567 nm, a low concentration relative to conventional cytochromes, and an inability to be fully reduced by endogenous substrates or NADH. Previous studies with one denitrifying and nondenitrifying species of the genus Pseudomonas, in Paracoccus denitrificans, in Alcaligenes faecalis, in Azotobacter vinelandii, in Branhamella catarrhalis, and in Neisseria lactamicus. In all these organisms, the peak of the 567-nm pigment is accompanied by a peak of about equal height at approximately 559 nm, which exhibits similar properties to the 567-nm pigment. The 567-nm pigment was not demonstrable by this technique in Gluconobacter oxydans subspecies suboxydans, Bacillus subtilis, Bacillus licheniformis, Aeromonas hydrophilia, Escherichia coli, a Klebsiella species, Moraxella osloensis, Aquaspirillum itersonii, Micrococcus lysodeikticus, Micrococcus luteus, Agrobacterium tumefaciens, or Rhizobium meliloti.

The first complete chloroplast genome of the Genistoid legume Lupinus luteus: evidence for a novel major lineage-specific rearrangement and new insights regarding plastome evolution in the legume family

PubMed Central

Martin, Guillaume E.; Rousseau-Gueutin, Mathieu; Cordonnier, Solenn; Lima, Oscar; Michon-Coudouel, Sophie; Naquin, Delphine; de Carvalho, Julie Ferreira; Aïnouche, Malika; Salmon, Armel; Aïnouche, Abdelkader

2014-01-01

Background and Aims To date chloroplast genomes are available only for members of the non-protein amino acid-accumulating clade (NPAAA) Papilionoid lineages in the legume family (i.e. Millettioids, Robinoids and the ‘inverted repeat-lacking clade’, IRLC). It is thus very important to sequence plastomes from other lineages in order to better understand the unusual evolution observed in this model flowering plant family. To this end, the plastome of a lupine species, Lupinus luteus, was sequenced to represent the Genistoid lineage, a noteworthy but poorly studied legume group. Methods The plastome of L. luteus was reconstructed using Roche-454 and Illumina next-generation sequencing. Its structure, repetitive sequences, gene content and sequence divergence were compared with those of other Fabaceae plastomes. PCR screening and sequencing were performed in other allied legumes in order to determine the origin of a large inversion identified in L. luteus. Key Results The first sequenced Genistoid plastome (L. luteus: 155 894 bp) resulted in the discovery of a 36-kb inversion, embedded within the already known 50-kb inversion in the large single-copy (LSC) region of the Papilionoideae. This inversion occurs at the base or soon after the Genistoid emergence, and most probably resulted from a flip–flop recombination between identical 29-bp inverted repeats within two trnS genes. Comparative analyses of the chloroplast gene content of L. luteus vs. Fabaceae and extra-Fabales plastomes revealed the loss of the plastid rpl22 gene, and its functional relocation to the nucleus was verified using lupine transcriptomic data. An investigation into the evolutionary rate of coding and non-coding sequences among legume plastomes resulted in the identification of remarkably variable regions. Conclusions This study resulted in the discovery of a novel, major 36-kb inversion, specific to the Genistoids. Chloroplast mutational hotspots were also identified, which contain novel and

Antagonistic intestinal microflora produces antimicrobial substance inhibitory to Pseudomonas species and other spoilage organisms.

PubMed

Hatew, Bayissa; Delessa, Tenagne; Zakin, Vered; Gollop, Natan

2011-10-01

Chicken intestine harbors a vast number of bacterial strains. In the present study, antimicrobial substance produced by lactic acid bacteria (LAB) isolated from the gastrointestinal tract of healthy chicken was detected, characterized, and purified. Based on 16S rRNA sequencing, the bacteria were identified as Lactobacillus plantarum vN. The antimicrobial substance produced by this bacterium was designated vN-1 and exhibited a broad-spectrum of activity against many important pathogenic and spoilage microorganisms, including Pseudomonas aeruginosa, Staphylococcus aureus, Micrococcus luteus, Salmonella Typhimurium, and Erwinia amylovova. vN-1 was determined to be thermostable, insensitive to pH values ranging from 2.0 to 8.0, resistant to various organic solvents and to enzymatic inactivation. The inhibition kinetics displayed a bactericidal mode of action. This study revealed an antimicrobial substance with low molecular mass of less than 1 kDa as determined by ultrafiltration and having features not previously reported for LAB isolated from chicken intestines. The detection of this antimicrobial substance addresses an important aspect of biotechnological control agents of spoilage caused by Pseudomonas spp. and promises the possibility for preservation of refrigerated poultry meat. Practical Application:  The newly characterized antimicrobial substance and designated as vN-1 may have the potential to be used in food preservation. © 2011 Institute of Food Technologists®

Isolation and characterization of aerobic culturable arsenic-resistant bacteria from surfacewater and groundwater of Rautahat District, Nepal.

PubMed

Shakya, S; Pradhan, B; Smith, L; Shrestha, J; Tuladhar, S

2012-03-01

Arsenic (As) contamination of groundwater is a serious Environmental Health Management issue of drinking water sources especially in Terai region of Nepal. Many studies have reported that due to natural abundance of arsenic in the environment, various bacteria have developed different resistance mechanisms for arsenic compound. In this study, the culturable arsenic-resistant bacteria indigenous to surfacewater as well as groundwater from Rautahat District of Nepal were randomly isolated by standard plate count method on the basis of viable growth on plate count agar amended with arsenate ranging from 0, 0.5, 10, 40, 80 to 160 milligram per liter (mg/l). With respect to the morphological and biochemical tests, nine morphologically distinct potent arsenate tolerant bacteria showed relatedness with Micrococcus varians, Micrococcus roseus, Micrococcus luteus, Pseudomonas maltophilia, Pseudomonas sp., Vibrio parahaemolyticus, Bacillus cereus, Bacillus smithii 1 and Bacillus smithii 2. The isolates were capable of tolerating more than 1000 mg/l of arsenate and 749 mg/l of arsenite. Likewise, bioaccumulation capability was highest with M. roseus (85.61%) and the least with B. smithii (47.88%) indicating the potential of the organisms in arsenic resistance and most probably in bioremediation. Copyright © 2011 Elsevier Ltd. All rights reserved.

Enhanced degradation of 2-nitrotoluene by immobilized cells of Micrococcus sp. strain SMN-1.

PubMed

Mulla, Sikandar I; Talwar, Manjunatha P; Bagewadi, Zabin K; Hoskeri, Robertcyril S; Ninnekar, Harichandra Z

2013-02-01

Nitrotoluenes are the toxic pollutants of the environment because of their large scale use in the production of explosives. Biodegradation of such chemicals by microorganisms may provide an effective method for their detoxification. We have studied the degradation of 2-nitrotoluene by cells of Micrococcus sp. strain SMN-1 immobilized in various matrices such as polyurethane foam (PUF), sodium alginate (SA), sodium alginate-polyvinyl alcohol (SA-PVA), agar and polyacrylamide. The rate of degradation of 15 and 30 mM 2-nitrotoluene by freely suspended cells and immobilized cells in batches and fed-batch with shaken cultures were compared. The PUF-immobilized cells achieved higher degradation of 15 and 30 mM 2-nitrotoluene than freely suspended cells and the cells immobilized in SA-PVA, polyacrylamide, SA and agar. The PUF-immobilized cells could be reused more than 24 cycles without loosing their degradation capacity and showed more tolerance to pH and temperature changes than freely suspended cells. These results revealed the enhanced rate of degradation of 2-nitrotoluene by PUF-immobilized cells of Micrococcus sp. strain SMN-1. Copyright © 2012 Elsevier Ltd. All rights reserved.

One-pot synthesis of biologically active 1,2,3-trisubstituted pyrrolo[2,3-b]quinoxalines through a palladium-catalyzed reaction with internal alkyne moieties.

PubMed

Keivanloo, Ali; Besharati-Seidani, Tayebeh; Kaboudin, Babak; Yoshida, Akihiro; Yokomatsu, Tsutomu

2018-06-16

Synthesis of 2,3-disubstituted 1-alkylpyrrolo[2,3-b]quinoxalines was accomplished through the reaction of 3-chloroquinoxalin-2-amines with internal alkynes in the presence of Pd(OAc)[Formula: see text], NaOAc, and KOtBu in DMSO. This method afforded desired pyrrolo[2,3-b]quinoxalines in 65-92% reaction yields. The minimum inhibition concentration and minimum bactericidal concentration determinations against Micrococcus luteus and Pseudomonas aeruginosa revealed that some of the synthesized compounds showed the same values compared to tetracycline. These compounds could be used in the future research for the development of new antibiotics.

Proteomic characterization of seeds from yellow lupin (Lupinus luteus L.).

PubMed

Ogura, Takahiro; Ogihara, Jun; Sunairi, Michio; Takeishi, Hidetaka; Aizawa, Tomoko; Olivos-Trujillo, Marcos R; Maureira-Butler, Iván J; Salvo-Garrido, Haroldo E

2014-06-01

Yellow lupin (Lupinus luteus L.) is a legume crop containing a large amount of protein in its seeds. In this study, we constructed a seed-protein catalog to provide a foundation for further study of the seeds. A total of 736 proteins were identified in 341 2DE spots by nano-LC-MS/MS. Eight storage proteins were found as multiple spots in the 2DE gels. The 736 proteins correspond to 152 unique proteins as shown by UniRef50 clustering. Sixty-seven of the 152 proteins were associated with KEGG-defined pathways. Of the remaining proteins, 57 were classified according to a GO term. The functions of the remaining 28 proteins have yet to be determined. This is the first yellow lupin seed-protein catalog, and it contains considerably more data than previously reported for white lupin (L. albus L.). © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Comparison of nutritional and antinutritional traits among different species (Lupinus albus L., Lupinus luteus L., Lupinus angustifolius L.) and varieties of lupin seeds.

PubMed

Musco, N; Cutrignelli, M I; Calabrò, S; Tudisco, R; Infascelli, F; Grazioli, R; Lo Presti, V; Gresta, F; Chiofalo, B

2017-12-01

In order to promote the use of lupin in pig nutrition, in this research the nutritional characteristics (i.e. dietary fibre, alkaloid and fatty acid profile) and the in vitro gas production of 12 lupin varieties grown in the Mediterranean basin and belonging to three lupin species (Lupinus albus, Lupinus angustifolius and Lupinus luteus) were assessed. Four varieties of L. albus (Asfer, Lublanc, Lutteur and Multitalia) were grown in South Campania. Three varieties of L. luteus (Dukat, Mister and Taper), three of L. angustifolius (Jindalee, Sonet and Wonga) and two of L. albus (Rosetta and Luxor) were grown in Eastern Sicily. Lupinus albus varieties showed interesting nutritional and dietetic characteristics (i.e. high protein and low fibre content); the lipid fraction, rather elevated, is well represented by monounsaturated fatty acids (544 g/kg), whereas saturated fatty acids (SFAs) are less represented (167 g/kg) and the n-3/n-6 ratio (0.510) is the most favourable. Lupinus luteus varieties presented the most remarkable dietetic aspects, in terms of polyunsaturated fatty acid (PUFA) content (569 g/kg), n-6 PUFA series (490 g/kg), UFA/SFA (5.24) and PUFA/SFA (3.56) ratios and atherogenic (0.059) and thrombogenic (0.100) indices and very low alkaloid content (1.07 mg per 100 g). Lupinus angustifolius varieties showed the least interesting nutritional and dietetic characteristics: low protein and fat content, high fibre level, high SFA amount (248 g/kg) and the lowest favourable nutritional indices (IA: 0.164 and IT: 0.334). Regarding the fermentation process, in L. albus, the tendency to increase the rate of gas production during the early stages of fermentation suggests that the high presence of alkaloids did not affect the in vitro degradability, production of short-chain fatty acids and fermentation process, probably due to their concentration and/or water solubility. Lupinus angustifolius and L. luteus showed intermediate and slightly worse in

The first complete chloroplast genome of the Genistoid legume Lupinus luteus: evidence for a novel major lineage-specific rearrangement and new insights regarding plastome evolution in the legume family.

PubMed

Martin, Guillaume E; Rousseau-Gueutin, Mathieu; Cordonnier, Solenn; Lima, Oscar; Michon-Coudouel, Sophie; Naquin, Delphine; de Carvalho, Julie Ferreira; Aïnouche, Malika; Salmon, Armel; Aïnouche, Abdelkader

2014-06-01

To date chloroplast genomes are available only for members of the non-protein amino acid-accumulating clade (NPAAA) Papilionoid lineages in the legume family (i.e. Millettioids, Robinoids and the 'inverted repeat-lacking clade', IRLC). It is thus very important to sequence plastomes from other lineages in order to better understand the unusual evolution observed in this model flowering plant family. To this end, the plastome of a lupine species, Lupinus luteus, was sequenced to represent the Genistoid lineage, a noteworthy but poorly studied legume group. The plastome of L. luteus was reconstructed using Roche-454 and Illumina next-generation sequencing. Its structure, repetitive sequences, gene content and sequence divergence were compared with those of other Fabaceae plastomes. PCR screening and sequencing were performed in other allied legumes in order to determine the origin of a large inversion identified in L. luteus. The first sequenced Genistoid plastome (L. luteus: 155 894 bp) resulted in the discovery of a 36-kb inversion, embedded within the already known 50-kb inversion in the large single-copy (LSC) region of the Papilionoideae. This inversion occurs at the base or soon after the Genistoid emergence, and most probably resulted from a flip-flop recombination between identical 29-bp inverted repeats within two trnS genes. Comparative analyses of the chloroplast gene content of L. luteus vs. Fabaceae and extra-Fabales plastomes revealed the loss of the plastid rpl22 gene, and its functional relocation to the nucleus was verified using lupine transcriptomic data. An investigation into the evolutionary rate of coding and non-coding sequences among legume plastomes resulted in the identification of remarkably variable regions. This study resulted in the discovery of a novel, major 36-kb inversion, specific to the Genistoids. Chloroplast mutational hotspots were also identified, which contain novel and potentially informative regions for molecular

Antibacterial potential of Calotropis procera (flower) extract against various pathogens.

PubMed

Ali, Abid; Ansari, Asma; Qader, Shah Ali Ul; Mumtaz, Majid; Saied, Sumayya; Mahboob, Tabassum

2014-09-01

Increased bacterial resistance towards commonly used antibiotics has become a debated issue all over the world in a last few decades. Due to this, consumer demand towards natural anti-microbial agents is increasing day by day. Natural anti-microbial agents have gained enormous attention as an alternative therapeutic agent in pharmaceutical industry. Current study is an effort to explore and identify a bactericidal potential of various solvent extracts of Calotropis procera flower. Flowers of C. procera were extracted with hexane, butanol, ethyl acetate and aqua to evaluate the antibacterial activity by agar well diffusion method against the various human pathogens. The microorganisms used in this study includes Salmonella typhi, Escherichia coli (O157:H7), Micrococcus luteus KIBGE-IB20 (Gen Bank accession: JQ250612) and methicillin resistant Staphylococcus aureus (MRSA) KIBGE-IB23 (Gen Bank accession: KC465400). Zones of inhibition were observed against all four pathogenic strains. Fraction soluble in hexane showed broad spectrum of inhibition against all the studied pathogens. However, fractions soluble in ethyl acetate inhibited the growth of E. coli, MRSA, and M. luteus. In case of butanol and aqueous extracts only growth of M. luteus was inhibited. Results revealed that the flower extracts of C. procera have a potential to be used as an antibacterial agent against these pathogenic organisms.

Halovarius luteus gen. nov., sp. nov., an extremely halophilic archaeon from a salt lake.

PubMed

Mehrshad, Maliheh; Amoozegar, Mohammad Ali; Makhdoumi, Ali; Rasooli, Mehrnoosh; Asadi, Basaer; Schumann, Peter; Ventosa, Antonio

2015-08-01

An extremely halophilic archaeon, strain DA50T, was isolated from a brine sample of Urmia lake, a hypersaline environment in north-west Iran. Strain DA50T was orange-pigmented, motile, pleomorphic and required at least 2.5 M NaCl but not MgCl2 for growth. Optimal growth was achieved at 4.0 M NaCl and 0.3 M MgCl2. The optimum pH and temperature for growth were pH 7.0 and 45 °C, while it was able to grow over a pH range of 6.5-8.0 and a temperature range of 25-50 °C. Analysis of 16S rRNA gene sequences revealed that strain DA50T is a member of the family Halobacteriaceae, showing a low level of similarity with other members of this family. Highest similarities, 94.4, 94.0 and 93.9 %, were obtained with the 16S rRNA gene sequences of the type strains of Natrialba aegyptia, Halobiforma lacisalsi and Halovivax asiaticus, respectively. Polar lipid analyses revealed that strain DA50T contains phosphatidylglycerol and phosphatidylglycerol phosphate methyl ester. Four unidentified glycolipids and two minor phospholipids were also observed. The only quinone present was MK-8(II-H2). The G+C content of its DNA was 62.3 mol%. On the basis of the data obtained, the new isolate could not be classified in any recognized genus. Strain DA50T is thus considered to represent a novel species of a new genus within the family Halobacteriaceae, order Halobacteriales, for which the name Halovarius luteus gen. nov., sp. nov. is proposed. The type strain of Halovarius luteus is DA50T ( = IBRC-M 10912T = CECT 8510T).

Contrasting adaptive strategies to terminal drought-stress gradients in Mediterranean legumes: phenology, productivity, and water relations in wild and domesticated Lupinus luteus L.

PubMed Central

Berger, J. D.; Ludwig, C.

2014-01-01

Our understanding of within-species annual plant adaptation to rainfall gradients is fragmented. Broad-scale ecological applications of Grime’s C-S-R triangle are often superficial, while detailed drought physiology tends to be narrow, focusing on elite cultivars. The former lack the detail to explain how plants respond, while the latter provide little context to investigate trade-offs among traits, to explain where/why these might be adaptive. Ecophysiology, combining the breadth of the former with the detail of the latter, can resolve this disconnect and is applied here to describe adaptive strategies in the Mediterranean legume Lupinus luteus. Wild and domesticated material from low- and high-rainfall environments was evaluated under contrasting terminal drought. These opposing environments have selected for contrasting, integrated, adaptive strategies. Long-season, high-rainfall habitats select for competitive (C) traits: delayed phenology, high above- and below-ground biomass, productivity, and fecundity, leading to high water-use and early stress onset. Terminal drought-prone environments select for the opposite: ruderal (R) traits that facilitate drought escape/avoidance but limit reproductive potential. Surprisingly, high-rainfall ecotypes generate lower critical leaf water potentials under water deficit, maintaining higher relative water content than the latter. Given that L. luteus evolved in sandy, low-water-holding capacity soils, this represents a bet-hedging response to intermittent self-imposed water-deficits associated with a strongly C-selected adaptive strategy that is therefore redundant in R-selected low-rainfall ecotypes. Domesticated L. luteus is even more R-selected, reflecting ongoing selection for early maturity. Introgression of appropriate C-selected adaptive traits from wild germplasm may widen the crop production range. PMID:24591050

Culturable bacteria present in the fluid of the hooded-pitcher plant Sarracenia minor based on 16S rDNA gene sequence data.

PubMed

Siragusa, Alex J; Swenson, Janice E; Casamatta, Dale A

2007-08-01

The culturable microbial community within the pitcher fluid of 93 Sarracenia minor carnivorous plants was examined over a 2-year study. Many aspects of the plant/bacterial/insect interaction within the pitcher fluid are minimally understood because the bacterial taxa present in these pitchers have not been identified. Thirteen isolates were characterized by 16S rDNA sequencing and subsequent phylogenetic analysis. The Proteobacteria were the most abundant taxa and included representatives from Serratia, Achromobacter, and Pantoea. The Actinobacteria Micrococcus was also abundant while Bacillus, Lactococcus, Chryseobacterium, and Rhodococcus were infrequently encountered. Several isolates conformed to species identifiers (>98% rDNA gene sequence similarity) including Serratia marcescens (isolates found in 27.5% of pitchers), Achromobacter xylosoxidans (37.6%), Micrococcus luteus (40.9%), Bacillus cereus (isolates found in 10.2%), Bacillus thuringiensis (5.4%), Lactococcus lactis (17.2%), and Rhodococcus equi (2.2%). Species-area curves suggest that sampling efforts were sufficient to recover a representative culturable bacterial community. The bacteria present represent a diverse community probably as a result of introduction by insect vectors, but the ecological significance remains under explored.

Spätzle-Processing Enzyme-independent Activation of the Toll Pathway in Drosophila Innate Immunity.

PubMed

Yamamoto-Hino, Miki; Goto, Satoshi

2016-05-07

The Toll pathway regulates innate immunity in insects and vertebrates. The Drosophila Toll receptor is activated by a processed form of a ligand, Spätzle. Spätzle-processing enzyme (SPE) is the only enzyme identified to date that functions in converting Spätzle to an active form during the immune response. In the present study, Toll activation induced by immune challenge was almost suppressed in spätzle mutant larvae and adults, whereas it was present in SPE mutant larvae challenged with Micrococcus luteus and adults challenged with Bacillus subtilis. Our data suggest that an unidentified protease besides SPE processes Spätzle under conditions of microbial challenge.

Antimicrobial and anticancer efficacy of antineoplastic agent capped gold nanoparticles.

PubMed

Selvaraj, V; Grace, A Nirmala; Alagar, M; Hamerton, I

2010-04-01

Synthesis of thioguanine (TG)-capped Au nanoparticles (Au@TG) and their enhanced in vitro antimicrobial and anticancer efficacy against Micrococcus luteus, Staphylococcus aureus, Pseudomonas aeruginosa, E. coli, Aspergillus fumigatus, Aspergillus niger and Hep2 cancer cell (Human epidermiod cell) have been reported. The nature of binding between 6-TG and the gold nanoparticles via complexation is investigated using ultraviolet-visible spectrum, cyclic voltammetry, transmission electron microscopy, fluorescence and Fourier transform infrared (FT-IR) spectroscopy. The present experimental studies suggests that Au@TG are more potential than TG towards antimicrobial and anticancer activities. Hence, gold nanoparticles have the potential to be used as effective carriers for anticancer drug.

Structural studies of 4-aminoantipyrine derivatives

NASA Astrophysics Data System (ADS)

Cunha, Silvio; Oliveira, Shana M.; Rodrigues, Manoel T.; Bastos, Rodrigo M.; Ferrari, Jailton; de Oliveira, Cecília M. A.; Kato, Lucília; Napolitano, Hamilton B.; Vencato, Ivo; Lariucci, Carlito

2005-10-01

Reaction of 4-aminoantipyrine with acetylacetone, ethyl acetoacetate, benzoyl isothiocyanate, phenyl isothiocyanate, maleic anhydride and methoxymethylene Meldrum's acid afforded a series of new antipyrine derivatives. The antibacterial activity of the synthesized compounds against Micrococcus luteus ATCC 9341, Staphilococcus aureus ATCC 29737, and Escherichia coli ATCC 8739 was evaluated and the minimal inhibitory concentration determined. Modest activity was found only to the maleamic acid obtained from the reaction of 4-aminoantipyrine and maleic anhydride. 1H NMR investigation of this maleamic acid showed that it is slowly converted to the corresponding toxic maleimide. The structures of three derivatives were determined by X-ray diffraction analysis.

Biofilm Formation by a Metabolically Versatile Bacterium

DTIC Science & Technology

2009-03-19

ABSTRACT Rhodopseudomonas palustris is a photosynthetic bacterium that has good potential as a biocatalyst for the production ofhydrogen gas, a biofuel...Biofilm formation by a metabolically versatile bacterium: final report Report Title ABSTRACT Rhodopseudomonas palustris is a photosynthetic bacterium...agricultural waste. We characterized five new Rhodopseudomonas genome sequences and isolated and described R. palustris mutant strains that produce

Molecular Structural Basis for the Cold Adaptedness of the Psychrophilic β-Glucosidase BglU in Micrococcus antarcticus

PubMed Central

Miao, Li-Li; Hou, Yan-Jie; Fan, Hong-Xia; Qu, Jie; Qi, Chao; Liu, Ying

2016-01-01

Psychrophilic enzymes play crucial roles in cold adaptation of microbes and provide useful models for studies of protein evolution, folding, and dynamic properties. We examined the crystal structure (2.2-Å resolution) of the psychrophilic β-glucosidase BglU, a member of the glycosyl hydrolase 1 (GH1) enzyme family found in the cold-adapted bacterium Micrococcus antarcticus. Structural comparison and sequence alignment between BglU and its mesophilic and thermophilic counterpart enzymes (BglB and GlyTn, respectively) revealed two notable features distinct to BglU: (i) a unique long-loop L3 (35 versus 7 amino acids in others) involved in substrate binding and (ii) a unique amino acid, His299 (Tyr in others), involved in the stabilization of an ordered water molecule chain. Shortening of loop L3 to 25 amino acids reduced low-temperature catalytic activity, substrate-binding ability, the optimal temperature, and the melting temperature (Tm). Mutation of His299 to Tyr increased the optimal temperature, the Tm, and the catalytic activity. Conversely, mutation of Tyr301 to His in BglB caused a reduction in catalytic activity, thermostability, and the optimal temperature (45 to 35°C). Loop L3 shortening and H299Y substitution jointly restored enzyme activity to the level of BglU, but at moderate temperatures. Our findings indicate that loop L3 controls the level of catalytic activity at low temperatures, residue His299 is responsible for thermolability (particularly heat lability of the active center), and long-loop L3 and His299 are jointly responsible for the psychrophilic properties. The described structural basis for the cold adaptedness of BglU will be helpful for structure-based engineering of new cold-adapted enzymes and for the production of mutants useful in a variety of industrial processes at different temperatures. PMID:26801571

Molecular Structural Basis for the Cold Adaptedness of the Psychrophilic β-Glucosidase BglU in Micrococcus antarcticus.

PubMed

Miao, Li-Li; Hou, Yan-Jie; Fan, Hong-Xia; Qu, Jie; Qi, Chao; Liu, Ying; Li, De-Feng; Liu, Zhi-Pei

2016-01-22

Psychrophilic enzymes play crucial roles in cold adaptation of microbes and provide useful models for studies of protein evolution, folding, and dynamic properties. We examined the crystal structure (2.2-Å resolution) of the psychrophilic β-glucosidase BglU, a member of the glycosyl hydrolase 1 (GH1) enzyme family found in the cold-adapted bacterium Micrococcus antarcticus. Structural comparison and sequence alignment between BglU and its mesophilic and thermophilic counterpart enzymes (BglB and GlyTn, respectively) revealed two notable features distinct to BglU: (i) a unique long-loop L3 (35 versus 7 amino acids in others) involved in substrate binding and (ii) a unique amino acid, His299 (Tyr in others), involved in the stabilization of an ordered water molecule chain. Shortening of loop L3 to 25 amino acids reduced low-temperature catalytic activity, substrate-binding ability, the optimal temperature, and the melting temperature (Tm). Mutation of His299 to Tyr increased the optimal temperature, the Tm, and the catalytic activity. Conversely, mutation of Tyr301 to His in BglB caused a reduction in catalytic activity, thermostability, and the optimal temperature (45 to 35°C). Loop L3 shortening and H299Y substitution jointly restored enzyme activity to the level of BglU, but at moderate temperatures. Our findings indicate that loop L3 controls the level of catalytic activity at low temperatures, residue His299 is responsible for thermolability (particularly heat lability of the active center), and long-loop L3 and His299 are jointly responsible for the psychrophilic properties. The described structural basis for the cold adaptedness of BglU will be helpful for structure-based engineering of new cold-adapted enzymes and for the production of mutants useful in a variety of industrial processes at different temperatures. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Influence of Culture Media on the Radiation Resistance of Micrococcus radiodurans

PubMed Central

Krabbenhoft, K. L.; Anderson, A. W.; Elliker, P. R.

1967-01-01

The addition of NZ-case (a tryptic digest of casein) to a growth medium (PC) consisting of tryptone, glucose, and yeast extract caused a significant decrease in γ radiation resistance of Micrococcus radiodurans. The level of radiation resistance was inversely related to the concentration of NZ-case. The ld50 for this organism was approximately 700 krad when grown in tryptone, glucose, yeast extract, and dl-methionine (TGYM) broth, but it was approximately one-half as resistant when grown in a PC medium containing 0.5% NZ-case (PCNZ). The resistance to ultraviolet light was also reduced. Cultures transferred from PCNZ to TGYM media regained the high level of resistance. Images Fig. 2 Fig. 3 PMID:5340165

Diverse deep-sea fungi from the South China Sea and their antimicrobial activity.

PubMed

Zhang, Xiao-Yong; Zhang, Yun; Xu, Xin-Ya; Qi, Shu-Hua

2013-11-01

We investigated the diversity of fungal communities in nine different deep-sea sediment samples of the South China Sea by culture-dependent methods followed by analysis of fungal internal transcribed spacer (ITS) sequences. Although 14 out of 27 identified species were reported in a previous study, 13 species were isolated from sediments of deep-sea environments for the first report. Moreover, these ITS sequences of six isolates shared 84-92 % similarity with their closest matches in GenBank, which suggested that they might be novel phylotypes of genera Ajellomyces, Podosordaria, Torula, and Xylaria. The antimicrobial activities of these fungal isolates were explored using a double-layer technique. A relatively high proportion (56 %) of fungal isolates exhibited antimicrobial activity against at least one pathogenic bacterium or fungus among four marine pathogenic microbes (Micrococcus luteus, Pseudoaltermonas piscida, Aspergerillus versicolor, and A. sydowii). Out of these antimicrobial fungi, the genera Arthrinium, Aspergillus, and Penicillium exhibited antibacterial and antifungal activities, while genus Aureobasidium displayed only antibacterial activity, and genera Acremonium, Cladosporium, Geomyces, and Phaeosphaeriopsis displayed only antifungal activity. To our knowledge, this is the first report to investigate the diversity and antimicrobial activity of culturable deep-sea-derived fungi in the South China Sea. These results suggest that diverse deep-sea fungi from the South China Sea are a potential source for antibiotics' discovery and further increase the pool of fungi available for natural bioactive product screening.

Contrasting adaptive strategies to terminal drought-stress gradients in Mediterranean legumes: phenology, productivity, and water relations in wild and domesticated Lupinus luteus L.

PubMed

Berger, J D; Ludwig, C

2014-11-01

Our understanding of within-species annual plant adaptation to rainfall gradients is fragmented. Broad-scale ecological applications of Grime's C-S-R triangle are often superficial, while detailed drought physiology tends to be narrow, focusing on elite cultivars. The former lack the detail to explain how plants respond, while the latter provide little context to investigate trade-offs among traits, to explain where/why these might be adaptive. Ecophysiology, combining the breadth of the former with the detail of the latter, can resolve this disconnect and is applied here to describe adaptive strategies in the Mediterranean legume Lupinus luteus. Wild and domesticated material from low- and high-rainfall environments was evaluated under contrasting terminal drought. These opposing environments have selected for contrasting, integrated, adaptive strategies. Long-season, high-rainfall habitats select for competitive (C) traits: delayed phenology, high above- and below-ground biomass, productivity, and fecundity, leading to high water-use and early stress onset. Terminal drought-prone environments select for the opposite: ruderal (R) traits that facilitate drought escape/avoidance but limit reproductive potential. Surprisingly, high-rainfall ecotypes generate lower critical leaf water potentials under water deficit, maintaining higher relative water content than the latter. Given that L. luteus evolved in sandy, low-water-holding capacity soils, this represents a bet-hedging response to intermittent self-imposed water-deficits associated with a strongly C-selected adaptive strategy that is therefore redundant in R-selected low-rainfall ecotypes. Domesticated L. luteus is even more R-selected, reflecting ongoing selection for early maturity. Introgression of appropriate C-selected adaptive traits from wild germplasm may widen the crop production range. © The Author 2014. Published by Oxford University Press on behalf of the Society for Experimental Biology.

New antibacterial xanthone from the marine sponge-derived Micrococcus sp. EG45.

PubMed

Eltamany, Enas E; Abdelmohsen, Usama Ramadan; Ibrahim, Amany K; Hassanean, Hashim A; Hentschel, Ute; Ahmed, Safwat A

2014-11-01

Microluside A [4 (19-para-hydroxy benzoyloxy-O-β-D-cellobiosyl), 5 (30-para-hydroxy benzoyloxy-O-β-D-glucopyranosyl) xanthone (1)] is a unique O-glycosylated disubstituted xanthone isolated from the broth culture of Micrococcus sp. EG45 cultivated from the Red Sea sponge Spheciospongia vagabunda. The structure of microluside A was determined by 1D- and 2D-NMR techniques as well as high resolution tandem mass spectrometry. The antimicrobial activity evaluation showed that 1 exhibited antibacterial potential against Enterococcus faecalis JH212 and Staphylococcus aureus NCTC 8325 with MIC values of 10 and 13 μM, respectively. Copyright © 2014 Elsevier Ltd. All rights reserved.

Monohexosylceramides from Rhizopus Species Isolated from Brazilian Caatinga: Chemical Characterization and Evaluation of Their Anti-Biofilm and Antibacterial Activities.

PubMed

Vieira, Edson Rodrigues; Xisto, Mariana Ingrid Dutra da Silva; Pele, Milagre Américo; Alviano, Daniela Sales; Alviano, Celuta Sales; Barreto-Bergter, Eliana; de Campos-Takaki, Galba Maria

2018-06-01

Monohexosylceramides (CMHs) are highly conserved fungal glycosphingolipids playing a role in several cellular processes such as growth, differentiation and morphological transition. In this study, we report the isolation, purification and chemical characterization of CMHs from Rhizopus stolonifer and R. microspores . Using positive ion mode ESI-MS, two major ion species were observed at m / z 750 and m / z 766, respectively. Both ion species consisted of a glucose/galactose residue attached to a ceramide moiety containing 9-methyl-4,8-sphingadienine with an amidic linkage to a hydroxylated C16:0 fatty acid. The antimicrobial activity of CMH was evaluated against Gram positive and Gram negative bacteria using the agar diffusion assay. CMH from both Rhizopus species inhibited the growth of Bacillus terrae , Micrococcus luteus ( M. luteus ) and Pseudomonas stutzeri ( P. stutzeri ) with a MIC 50 of 6.25, 6.25 and 3.13 mg/mL, respectively. The bactericidal effect was detected only for M. luteus and P. stutzeri , with MBC values of 25 and 6.25 mg/mL, respectively. Furthermore, the action of CMH on the biofilm produced by methicillin-resistant Staphylococcus aureus (MRSA) was analyzed using 12.5 and 25 mg/mL of CMH from R. microsporus . Total biofilm biomass, biofilm matrix and viability of the cells that form the biofilm structure were evaluated. CMH from R. microsporus was able to inhibit the MRSA biofilm formation in all parameters tested.

The utilization of aconate and itaconate by Micrococcus sp

PubMed Central

Cooper, R. A.; Itiaba, K.; Kornberg, H. L.

1965-01-01

1. An organism, identified as Micrococcus sp., was isolated by elective culture on aconate; it also grew on itaconate. 2. Washed suspensions of the aconate-grown organism readily oxidized intermediates of the tricarboxylic acid cycle, aconate and succinic semialdehyde, but not itaconate. Itaconate-grown cells oxidized tricarboxylic acid-cycle intermediates, succinic semialdehyde and itaconate, but not aconate. Succinate-grown cells oxidized neither itaconate nor aconate. 3. Extracts of aconate-grown cells catalysed the formation of succinic semialdehyde and carbon dioxide, in equimolar amounts, from aconate. In the presence of NAD or NADP, succinic semialdehyde was oxidized to succinate with concomitant reduction of the coenzyme. 4. Extracts of itaconate-grown cells catalysed the formation of pyruvate and acetyl-CoA from itaconyl-CoA. 5. Key enzymes involved in the formation of succinate from aconate, and of pyruvate and acetyl-CoA from itaconate, were distinct and inducible: their formation preceded growth on the appropriate substrate. PMID:14342240

Proposal for creation of a new genus Neomicrococcus gen. nov. to accommodate Zhihengliuella aestuarii Baik et al. 2011 and Micrococcus lactis Chittpurna et al. 2011 as Neomicrococcus aestuarii comb. nov. and Neomicrococcus lactis comb. nov.

PubMed

Prakash, Om; Sharma, Avinash; Nimonkar, Yogesh; Shouche, Yogesh S

2015-11-01

Micrococcus lactis and Zhihengliuella aestuarii were described independently in 2011. Their type strains showed high levels of 16S rRNA gene sequence similarity (99.3%). Phylogenetic analysis revealed that M. lactis MCC 2278T and Z. aestuarii JCM 16166T formed a monophyletic group and showed distant relationships to other members of closely related genera such as Micrococcus, Zhihengliuella, Arthrobacter and Citricoccus. The presence of large proportions of iso-C14:0 and iso-C16:0 with small amounts of iso-C15:0 distinguished M. lactis MCC 2278T and Z. aestuarii JCM 16166T from other members of the genera Micrococcus and Zhihengliuella. Unlike other members of the genera Zhihengliuella and Micrococcus, M. lactis MCC 2278T and Z. aestuarii JCM 16166T showed growth at low concentrations of NaCl. Thus, based on distinctive phylogenetic, chemotaxonomic and physiological features of these two organisms in comparison with other members of the genera Micrococcus and Zhihengliuella, it is clear that they do not fit within the existing classification and deserve separate status. DNA-DNA hybridization between the two type strains was 63%, indicating that they represent separate species. In this study, we propose the creation of a novel genus, Neomicrococcus gen. nov., to accommodate the two species with Neomicrococcus aestuarii gen. nov., comb. nov. (type strain JCM 16166T = KCTC 19557T) as the type species. Neomicrococcus lactis comb. nov. (type strain MCC 2278T = DSM 23694T) is also proposed.

NREL Researchers Discover How a Bacterium, Clostridium thermocellum,

Science.gov Websites

containing the bacterium actually promotes the growth of C. thermocellum, yet its mechanistic details remained a puzzle. This enhanced growth implied the bacterium had the ability to use CO2 and prompted NREL researchers to investigate the phenomena enhancing the bacterium's growth. "It took us by surprise that

Application of halophilic nuclease H of Micrococcus varians subsp. halophilus to commercial production of flavoring agent 5'-GMP.

PubMed Central

Kamekura, M; Hamakawa, T; Onishi, H

1982-01-01

RNA was degraded at 60 degrees C for 24 h by halophilic nuclease H in supernatants from broth cultures of Micrococcus varians subsp. halophilus containing 12% NaCl. Since contaminating 5'-nucleotidase exhibited almost no activity under these conditions, the 5'-GMP formed could be recovered from the reaction mixture, and the yield was 805 mg from 5 g of RNA. PMID:6184020

A novel antibacterial and antifungal phenolic compound from the endophytic fungus Pestalotiopsis mangiferae.

PubMed

Subban, Kamalraj; Subramani, Ramesh; Johnpaul, Muthumary

2013-01-01

A novel phenolic compound, 4-(2,4,7-trioxa-bicyclo[4.1.0]heptan-3-yl) phenol (1), was isolated from Pestalotiopsis mangiferae, an endophytic fungus associated with Mangifera indica Linn. The structure of the compound was elucidated on the basis of comprehensive spectral analysis (UV, IR, ¹H-, ¹³C- and 2D-NMR, as well as HRESI-MS). Compound (1) shows potent antibacterial and antifungal activity against Bacillus subtilis, Klebsiella pneumoniae, Escherichia coli, Micrococcus luteus, Pseudomonas aeruginosa and Candida albicans. The transmission electron microscope study for the mode of inhibition of compound (1) on bacterial pathogens revealed the destruction of bacterial cells by cytoplasm agglutination with the formation of pores in cell wall membranes.

Analytical detection and biological assay of antileukemic drug 5-fluorouracil using gold nanoparticles as probe.

PubMed

Selvaraj, Vaithilingam; Alagar, Muthukaruppan

2007-06-07

Gold nanoparticles are reported and evaluated as probes for the detection of anticancer drug 5-fluorouracil (5FU). The nature of binding between 5FU and gold nanoparticles via complexation is investigated using ultraviolet visible spectrophotometry, cyclic voltammetry, transmission electron microscopy, fluorescence and Fourier transform infrared (FTIR) spectroscopy. The bound antileukemic drug is fluorescent and the quenching property of gold nanoparticles could be exploited for biological investigations. The 5FU-colloidal gold complex (Au@5FU) is observed to have appreciable antibacterial and antifungal activity against Micrococcus luteus, Staphylococcus aureus, Pseudomonas aeruginosa, Escherichia coli, Aspergillus fumigatus, and Aspergillus niger. The experimental studies suggest that gold nanoparticles have the potential to be used as effective carriers for anticancer drugs.

Isolation of DNA methyltransferase from plants

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ehrlich, K.; Malbroue, C.

1987-05-01

DNA methyltransferases (DMT) were isolated from nuclei of cauliflower, soybean, and pea by extraction with 0.35 M NaCl. Assays were performed on hemimethylated Micrococcus luteus DNA or on M. luteus DNA to test for maintenance or de novo methylase activity, respectively. Fully methylated DNA was used as a substrate to determine background levels of methylation. Based on these tests, yields of maintenance DMT activity in the crude extract from pea hypocotyl, soybean hypocotyl, and cauliflower inflorescence were 2.8, 0.9, and 1.6 units per g wet tissue (one unit equals 1 pmol of methyl from (/sup 3/H)AdoMet incorporated into acid precipitablemore » material per h at 30/sup 0/). Two peaks of DMT activity were detected in the soybean nuclear extract following phosphocellulose chromatography. One eluted at 0.4 M and the other at 0.8 M KCl. With both fractions maintenance activity was approximately 2 times that of the de novo activity. Using gel filtration the DMT eluted at 220,000 Daltons. The optimal pH for activity was between 6.5 and 7.0, and the optimal temperature was 30/sup 0/.« less

Immunolocalization of dually phosphorylated MAPKs in dividing root meristem cells of Vicia faba, Pisum sativum, Lupinus luteus and Lycopersicon esculentum.

PubMed

Winnicki, Konrad; Żabka, Aneta; Bernasińska, Joanna; Matczak, Karolina; Maszewski, Janusz

2015-06-01

In plants, phosphorylated MAPKs display constitutive nuclear localization; however, not all studied plant species show co-localization of activated MAPKs to mitotic microtubules. The mitogen-activated protein kinase (MAPK) signaling pathway is involved not only in the cellular response to biotic and abiotic stress but also in the regulation of cell cycle and plant development. The role of MAPKs in the formation of a mitotic spindle has been widely studied and the MAPK signaling pathway was found to be indispensable for the unperturbed course of cell division. Here we show cellular localization of activated MAPKs (dually phosphorylated at their TXY motifs) in both interphase and mitotic root meristem cells of Lupinus luteus, Pisum sativum, Vicia faba (Fabaceae) and Lycopersicon esculentum (Solanaceae). Nuclear localization of activated MAPKs has been found in all species. Co-localization of these kinases to mitotic microtubules was most evident in L. esculentum, while only about 50% of mitotic cells in the root meristems of P. sativum and V. faba displayed activated MAPKs localized to microtubules during mitosis. Unexpectedly, no evident immunofluorescence signals at spindle microtubules and phragmoplast were noted in L. luteus. Considering immunocytochemical analyses and studies on the impact of FR180204 (an inhibitor of animal ERK1/2) on mitotic cells, we hypothesize that MAPKs may not play prominent role in the regulation of microtubule dynamics in all plant species.

Functional gene-based discovery of phenazines from the actinobacteria associated with marine sponges in the South China Sea.

PubMed

Karuppiah, Valliappan; Li, Yingxin; Sun, Wei; Feng, Guofang; Li, Zhiyong

2015-07-01

Phenazines represent a large group of nitrogen-containing heterocyclic compounds produced by the diverse group of bacteria including actinobacteria. In this study, a total of 197 actinobacterial strains were isolated from seven different marine sponge species in the South China Sea using five different culture media. Eighty-seven morphologically different actinobacterial strains were selected and grouped into 13 genera, including Actinoalloteichus, Kocuria, Micrococcus, Micromonospora, Mycobacterium, Nocardiopsis, Prauserella, Rhodococcus, Saccharopolyspora, Salinispora, Serinicoccus, and Streptomyces by the phylogenetic analysis of 16S rRNA gene. Based on the screening of phzE genes, ten strains, including five Streptomyces, two Nocardiopsis, one Salinispora, one Micrococcus, and one Serinicoccus were found to be potential for phenazine production. The level of phzE gene expression was highly expressed in Nocardiopsis sp. 13-33-15, 13-12-13, and Serinicoccus sp. 13-12-4 on the fifth day of fermentation. Finally, 1,6-dihydroxy phenazine (1) from Nocardiopsis sp. 13-33-15 and 13-12-13, and 1,6-dimethoxy phenazine (2) from Nocardiopsis sp. 13-33-15 were isolated and identified successfully based on ESI-MS and NMR analysis. The compounds 1 and 2 showed antibacterial activity against Bacillus mycoides SJ14, Staphylococcus aureus SJ51, Escherichia coli SJ42, and Micrococcus luteus SJ47. This study suggests that the integrated approach of gene screening and chemical analysis is an effective strategy to find the target compounds and lays the basis for the production of phenazine from the sponge-associated actinobacteria.

ORIGIN OF PALMITIC ACID CARBON IN PALMITATES FORMED FROM HEXADECANE-1-C14 AND TETRADECANE-1-C14 BY MICROCOCCUS CERIFICANS

PubMed Central

Finnerty, W. R.; Kallio, R. E.

1964-01-01

Finnerty, W. R. (University of Iowa, Iowa City), and R. E. Kallio. Origin of palmitic acid carbon in palmitates formed from hexadecane-1-C14 and tetradecane-1-C14 by Micrococcus cerificans. J. Bacteriol. 87:1261–1265. 1964.—Degradation of the palmitic acid moiety of cetyl palmitate and myristyl palmitate formed from hexadecane-1-C14 and tetradecane-1-C14 by Micrococcus cerificans was carried out. The patterns of C14 labeling in palmitic acid from cetyl palmitate showed that hexadecane is oxidized at the C1 position, and cetyl alcohol and palmitic acid thus formed are directly esterified. Palmitic acid arising from tetradecane and esterified to tetradecanol appeared to have been synthesized by the addition of two carbon atoms to an existing 14-carbon atom skeleton. Considerable mixing of C14 occurred in the C1 and C2 positions of palmitic acid thus synthesized. PMID:14188700

Characterization of the membrane-bound succinic dehydrogenase of Micrococcus lysodeikticus.

PubMed

Pollock, J J; Linder, R; Salton, M R

1971-07-01

The occurrence of succinic dehydrogenase [succinic:(acceptor) oxidoreductase, EC 1.3.99.1] in membrane fractions of Micrococcus lysodeikticus was investigated. The enzyme could be purified 10-fold, by deoxycholate treatment. Butanol extraction of membranes yielded an active fraction, nonsedimentable at 130,000 x g for 2 hr and altered in its phospholipid content relative to membranes. The activity of the enzyme in particulate preparations was decreased in the presence of competitive inhibitors and by compounds known to react with iron, sulfhydryl groups, and flavine. In this respect, the bacterial succinic dehydrogenase is similar to the enzyme derived from yeast and mammalian sources. In certain membrane fractions, Ca(2+) and Mg(2+) exhibited inhibitory effects whereas Triton X-100 caused activation. The enzyme could also be activated by substrate. In the phenazine reductase assay, incomplete reduction of electron acceptor was observed upon addition of divalent cations and iron binding agents.

[Bacterial flora of the conjunctival sac of the horse].

PubMed

Cattabiani, F; Cabassi, E; Allodi, C; Gianelli, F

1976-01-01

The AA. report the results of taxonomic research conducted on the conjunctival sac of 59 horses for identification of the present bacterial flora. In the controlled animals, it was observed, at the level of the considered niche, a community constituted of normal bacterial populations, but not autochtonous in the significance they attributed from DUBOS et al., relative to the characterization of the indigenous microbiota of the intestine. The isolated normal bacterial flora seems to be constituted of: Micrococcus (subgroup 6 of Baird-Parker, M. luteus, Micrococcus spp.) isolated in 49,15% of the samples; Staphylococcus aureus and St. epidermidis (18,64%); Moraxella osloensis, M. phenylpiruvica, M. equi and Moraxella spp. (11,86%); Bacillus cereus (11,86%); Neisseria catarrhalis (8,47%); Streptococcus equi and Str. zooepidemicus (6,77%); Corynebacterium spp. (6,77%) and Acinetobacter lwoffi (5,08%). The AA. have found, besides, a particular group of bacteria of uncertain classification, attributed to the coryneforms and found in 30,50% of the examined horses. So-called transient bacteria taxa have been considered are Streptomyces spp., isolated in the 10,16% of the controlled subjects, Aerococcus viridans and Bacillus spp. found in only one equine.

Nurses’ uniforms: How many bacteria do they carry after one shift?

PubMed Central

Sanon, Marie-Anne; Watkins, Sally

2013-01-01

This pilot study investigated the pathogens that nurses are potentially bringing into the public and their home when they wear work uniforms outside of the work environment. To achieve this, sterilized uniforms were distributed to 10 nurses at a local hospital in Washington State at the beginning of their shift. Worn uniforms were collected at the end of the shifts and sent to a laboratory for analysis. Four tests were conducted: 1) a heterotrophic growth plate count, 2) methicillin-resistant Staphylococcus aureus (MRSA) growth, 3) vancomycin-resistant Enterococci (VRE), and 4) identification of the heterotrophic plate counts. Each participant completed a questionnaire and a survey. The results showed that the average bacteria colony growth per square inch was 1,246 and 5,795 for day and night shift, respectively. After 48 h, MRSA positives were present on 4 of the day shift and 3 of the night shift uniforms. Additional bacteria identified include: Bacillus sp., Micrococcus luteus, Staphylococcus aureus, Staphylococcus epidermidis, and Micrococcus roseus. The significant presence of bacteria on the uniforms 48 h after the shift ended necessitates further study, discussions and policy consideration regarding wearing health care uniforms outside of the work environment. PMID:25285235

Nurses' uniforms: How many bacteria do they carry after one shift?

PubMed

Sanon, Marie-Anne; Watkins, Sally

2012-12-01

This pilot study investigated the pathogens that nurses are potentially bringing into the public and their home when they wear work uniforms outside of the work environment. To achieve this, sterilized uniforms were distributed to 10 nurses at a local hospital in Washington State at the beginning of their shift. Worn uniforms were collected at the end of the shifts and sent to a laboratory for analysis. Four tests were conducted: 1) a heterotrophic growth plate count, 2) methicillin-resistant Staphylococcus aureus (MRSA) growth, 3) vancomycin-resistant Enterococci (VRE), and 4) identification of the heterotrophic plate counts. Each participant completed a questionnaire and a survey. The results showed that the average bacteria colony growth per square inch was 1,246 and 5,795 for day and night shift, respectively. After 48 h, MRSA positives were present on 4 of the day shift and 3 of the night shift uniforms. Additional bacteria identified include: Bacillus sp., Micrococcus luteus, Staphylococcus aureus, Staphylococcus epidermidis, and Micrococcus roseus. The significant presence of bacteria on the uniforms 48 h after the shift ended necessitates further study, discussions and policy consideration regarding wearing health care uniforms outside of the work environment.

Draft Genome Sequence of Micrococcus sp. Strain MS-AsIII-49, an Arsenate-Reducing Isolate from Tropical Metal-Rich Sediment

PubMed Central

Costa, Patrícia S.; Tschoeke, Diogo A.; Silva, Bruno S. O.; Thompson, Fabiano; Reis, Mariana P.; Chartone-Souza, Edmar

2015-01-01

Micrococcus sp. strain MS-AsIII-49, which was isolated from a tropical metal-polluted stream sediment in Brazil, has the ability to reduce AsV to AsIII. Analysis of its draft genome revealed 186 contigs with a total size of 2,440,924 bp encoding several metal resistance genes. PMID:25883272

The influence of abscisic acid on the ethylene biosynthesis pathway in the functioning of the flower abscission zone in Lupinus luteus.

PubMed

Wilmowicz, Emilia; Frankowski, Kamil; Kućko, Agata; Świdziński, Michał; de Dios Alché, Juan; Nowakowska, Anna; Kopcewicz, Jan

2016-11-01

Flower abscission is a highly regulated developmental process activated in response to exogenous (e.g. changing environmental conditions) and endogenous stimuli (e.g. phytohormones). Ethylene (ET) and abscisic acid (ABA) are very effective stimulators of flower abortion in Lupinus luteus, which is a widely cultivated species in Poland, Australia and Mediterranean countries. In this paper, we show that artificial activation of abscission by flower removal caused an accumulation of ABA in the abscission zone (AZ). Moreover, the blocking of that phytohormone's biosynthesis by NDGA (nordihydroguaiaretic acid) decreased the number of abscised flowers. However, the application of NBD - an inhibitor of ET action - reversed the stimulatory effect of ABA on flower abscission, indicating that ABA itself is not sufficient to turn on the organ separation. Our analysis revealed that exogenous ABA significantly accelerated the transcriptional activity of the ET biosynthesis genes ACC synthase (LlACS) and oxidase (LlACO), and moreover, strongly increased the level of 1-aminocyclopropane-1-carboxylic acid (ACC) - ET precursor, which was specifically localized within AZ cells. We cannot exclude the possibility that ABA mediates flower abscission processes by enhancing the ET biosynthesis rate. The findings of our study will contribute to the overall basic knowledge on the phytohormone-regulated generative organs abscission in L. luteus. Copyright © 2016 Elsevier GmbH. All rights reserved.

Characterization of the Membrane-Bound Succinic Dehydrogenase of Micrococcus lysodeikticus

PubMed Central

Pollock, Jerry J.; Linder, Regina; Salton, Milton R. J.

1971-01-01

The occurrence of succinic dehydrogenase [succinic:(acceptor) oxidoreductase, EC 1.3.99.1] in membrane fractions of Micrococcus lysodeikticus was investigated. The enzyme could be purified 10-fold, by deoxycholate treatment. Butanol extraction of membranes yielded an active fraction, nonsedimentable at 130,000 × g for 2 hr and altered in its phospholipid content relative to membranes. The activity of the enzyme in particulate preparations was decreased in the presence of competitive inhibitors and by compounds known to react with iron, sulfhydryl groups, and flavine. In this respect, the bacterial succinic dehydrogenase is similar to the enzyme derived from yeast and mammalian sources. In certain membrane fractions, Ca2+ and Mg2+ exhibited inhibitory effects whereas Triton X-100 caused activation. The enzyme could also be activated by substrate. In the phenazine reductase assay, incomplete reduction of electron acceptor was observed upon addition of divalent cations and iron binding agents. Images PMID:4327510

Antimicrobial Activity and Phytochemical Screening of Buchenavia tetraphylla (Aubl.) R. A. Howard (Combretaceae: Combretoideae)

PubMed Central

de Oliveira, Ygor Lucena Cabral; Nascimento da Silva, Luís Cláudio; da Silva, Alexandre Gomes; Macedo, Alexandre José; de Araújo, Janete Magali; Correia, Maria Tereza dos Santos; da Silva, Márcia Vanusa

2012-01-01

This study evaluated the antimicrobial and hemolytic activities and phytochemical constituents of hydroalcoholic extract and its fractions from Buchenavia tetraphylla leaves. Cyclohexane (BTCF), ethyl acetate (BTEF), and n-butanol-soluble (BTSBF) and non-soluble (BTNBF) fractions were obtained from a liquid-liquid partition of hydroalcoholic extract (BTHE) from B. tetraphylla leaves. The hemolytic activity of active fractions was checked. The BTHE inhibited the growth of Micrococcus luteus (MIC: 0.10 mg/mL), Pseudomonas aeruginosa (MIC: 0.20 mg/mL), Mycobacterium smegmatis (MIC: 0.39 mg/mL), Proteus vulgaris, and Staphylococcus aureus (MIC: 0.78 mg/mL for both). The more active fractions were BTCF and BTBSF. BTCF showed better potential to inhibit M. luteus (0.10 mg/mL), P. aeruginosa (0.20 mg/mL), S. enteritidis (0.39 mg/mL), and S. aureus (1.56 mg/mL). BTBSF showed the best results for M. luteus (0.10 mg/mL), M. smegmatis, B. subtilis (0.39 mg/mL for both), and P. vulgaris (0.10 mg/mL). The HC50 were greater than observed MIC: 20.30, 4.70 and 2.53 mg/mL, respectively, to BTBF, BTHE and BTCF, which. The phytochemical analysis detected the presence of flavanoids, triterpene, carbohydrate, and tannin. Our work showed for the first time the broad-spread antimicrobial activity of B. tetraphylla, which has nonhemolytic action, creating a new perspective on the interesting association of traditional and scientific knowledge. PMID:23365533

Composition of Asarum heterotropoides var. mandshuricum radix oil from different extraction methods and activities against human body odor-producing bacteria.

PubMed

Haque, A S M Tanbirul; Moon, Jin Nam; Saravana, P S; Tilahun, Adane; Chun, Byung-Soo

2016-10-01

In this study, oils from Asarum heterotropoides were extracted by traditional solvent extraction and supercritical CO 2 (SC-CO 2 ) extraction methods and their antioxidant activities along with antimicrobial and inhibitory activities against five human body odor-producing bacteria (Staphylococcus epidermidis, Propionibacterium freudenreichii, Micrococcus luteus, Corynebacterium jeikeium, and Corynebacterium xerosis) were evaluated. The oil was found to contain 15 components, among which the most abundant component was methyl eugenol (37.6%), which was identified at every condition studied in different extraction methods. The oil extracted with n-hexane and ethanol mixture exhibited a strong antioxidant activity (92% ± 2%) and the highest ABTS and 2,2-diphenyl-1-picrylhydrazyl scavenging activities (89% ± 0.2%). The highest amounts of total phenolic content and total flavonoid content were 23.1±0.4 mg/g and 4.9±0.1 mg/g, respectively, in the traditional method. In the SC-CO 2 method performed at 200 bar/50°C using ethanol as an entrainer, the highest inhibition zone was recorded against all the aforementioned bacteria. In particular, strong antibacterial activity (38±2 mm) was found against M. luteus. The minimum inhibitory concentration (MIC) for the oil against bacteria ranged from 10.1±0.1 μg/mL to 46±2 μg/mL. The lowest MIC was found against M. luteus. Methyl eugenol was found to be one of the major compounds working against human body odor-producing bacteria. Copyright © 2016. Published by Elsevier B.V.

Effect of calcium and magnesium on the antimicrobial action of enterocin LR/6 produced by Enterococcus faecium LR/6.

PubMed

Kumar, Manoj; Srivastava, Sheela

2011-06-01

Enterococci are well-known producers of antimicrobial peptides (enterocins) that possess potential as biopreservatives in food. In this study, divalent cations and release of intracellular potassium were used to assess the mechanism of interaction and killing of enterocin LR/6 produced by Enterococcus faecium LR/6 on three target Gram-positive and Gram-negative bacteria, namely Micrococcus luteus, Enterococcus sp. strain LR/3 and Escherichia coli K-12. Whilst treatment with enterocin LR/6 in all cases led to a significant loss of viability, suggesting a bactericidal mode of action, E. coli K-12 showed better tolerance than the other two strains. Bacteriocins have generally been reported to create pores in the membrane of sensitive cells and this function is diminished by divalent cations. In this study it was shown that Ca(2+) and Mg(2+) markedly improved the viability of enterocin LR/6-treated cells in a concentration-dependent manner. K(+) release as a sign of membrane leakiness was higher in M. luteus compared with the other two test strains. In agreement with the viability response, pre-exposure to Ca(2+) and Mg(2+) substantially reduced the amount of K(+) leakage by M. luteus and Enterococcus sp.; in the case of E. coli K-12, no leakage of K(+) was recorded. These results suggest that enterocin LR/6, which possesses good antibacterial potential, may not be very effective as a preservative in foods containing high concentrations of calcium and magnesium. Copyright © 2011 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.

Relative Roles of the Cellular and Humoral Responses in the Drosophila Host Defense against Three Gram-Positive Bacterial Infections

PubMed Central

Cho, Ju Hyun; Lee, Janice; Lafarge, Marie-Céline; Kocks, Christine; Ferrandon, Dominique

2011-01-01

Background Two NF-kappaB signaling pathways, Toll and immune deficiency (imd), are required for survival to bacterial infections in Drosophila. In response to septic injury, these pathways mediate rapid transcriptional activation of distinct sets of effector molecules, including antimicrobial peptides, which are important components of a humoral defense response. However, it is less clear to what extent macrophage-like hemocytes contribute to host defense. Methodology/Principal Findings In order to dissect the relative importance of humoral and cellular defenses after septic injury with three different Gram-positive bacteria (Micrococcus luteus, Enterococcus faecalis, Staphylococcus aureus), we used latex bead pre-injection to ablate macrophage function in flies wildtype or mutant for various Toll and imd pathway components. We found that in all three infection models a compromised phagocytic system impaired fly survival – independently of concomitant Toll or imd pathway activation. Our data failed to confirm a role of the PGRP-SA and GNBP1 Pattern Recognition Receptors for phagocytosis of S. aureus. The Drosophila scavenger receptor Eater mediates the phagocytosis by hemocytes or S2 cells of E. faecalis and S. aureus, but not of M. luteus. In the case of M. luteus and E. faecalis, but not S. aureus, decreased survival due to defective phagocytosis could be compensated for by genetically enhancing the humoral immune response. Conclusions/Significance Our results underscore the fundamental importance of both cellular and humoral mechanisms in Drosophila immunity and shed light on the balance between these two arms of host defense depending on the invading pathogen. PMID:21390224

Bacterial Coaggregation and Cohesion Among Isolates From Contact Lens Cases.

PubMed

Datta, Ananya; Stapleton, Fiona; Willcox, Mark D P

2018-06-01

The aim of this study was to examine cohesion, coaggregation, and coculture between bacteria commonly isolated from contact lens cases. Staphylococcus epidermidis, Staphylococcus haemolyticus, Micrococcus luteus, and Acinetobacter radioresistens (two strains each) isolated from contact lens cases of two asymptomatic wearers were used in this study. In the cohesion assay, bacteria were grown, washed, and examined by incubating lens cases with two different types of bacteria sequentially and assessing the number of adhered cells of each isolate. The ability of isolates to interfere with the growth of other isolates was tested by growing strains in cocultures for 24 hours and determining the numbers of cells of individual strains. For coaggregation, equal proportions of two bacterial suspensions were mixed and allowed to coaggregate for 24 hours. Inhibition of coaggregation was tested by the addition of lactose (0.06 M) or sucrose (0.06 M) or pronase. The initial adhesion of M. luteus or A. radioresistens significantly (P < 0.05) enhanced the subsequent adhesion of the staphylococci. The addition of A. radioresistens in liquid media significantly (P < 0.05) enhanced the growth of staphylococci. S. epidermidis or S. haemolyticus coaggregated with M. luteus or A. radioresistens. The degree of coaggregation varied between 30% and 54%. The highest coaggregation (54% ± 5%) was seen between A. radioresistens 22-1 and S. epidermidis 22-1, isolated from the same lens case. Only lactose or sucrose treatment of staphylococci could partly inhibit coaggregation of some pairs. Coaggregation, cohesion, and growth promotion may facilitate the process of bacterial colonization of contact lens cases.

Optimization of culture conditions and medium composition for the production of micrococcin GO5 by Micrococcus sp. GO5.

PubMed

Kim, Mi-Hee; Kong, Yoon-Jung; Baek, Hong; Hyun, Hyung-Hwan

2006-01-02

To enhance the production of micrococcin GO5, a bacteriocin produced by Micrococcus sp. GO5, cultivation conditions and medium composition were optimized. The optimal initial pH and temperature for bacteriocin production were 7.0-9.0 and 37 degrees C, respectively. Micrococcus sp. GO5 displayed the highest micrococcin GO5 activity when grown in modified MRS medium that contained lactose or sucrose, rather than glucose, as a carbon source. The maximum bacteriocin activity was obtained in modified MRS medium containing 0.5% tryptone and 1.0% yeast extract as nitrogen sources instead of the other nitrogen sources present in MRS medium. Bacteriocin production was greatly affected by the concentration of K(2)HPO(4); strain GO5 produced eight-fold more bacteriocin in medium containing 2.0-2.5% K(2)HPO(4) than in medium containing 0.2% K(2)HPO(4). The optimal concentration of MgSO(4).7H(2)O for bacteriocin production was 0.5%. The production of micrococcin GO5 was increased 32-fold in shake flask culture and 16-fold in a bioreactor using the optimized medium (TY medium), compared with culturing in MRS medium.

Characterization of the cellulose-degrading bacterium NCIMB 10462

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dees, C.; Scott, T.C.; Phelps, T.J.

The gram-negative cellulase-producing bacterium NCIMB 10462 has been previously named Pseudomonas fluorescens subsp. or var. cellulose. Because of renewed interest in cellulose-degrading bacteria for use in the bioconversion of cellulose to chemical feed stocks and fuels, we re-examined the characteristics of this microorganism to determine its true metabolic potential. Metabolic and physical characterization of NCIMB 10462 revealed that this is an alkalophilic, non-fermentative, gram-negative, oxidase-positive, motile, cellulose-degrading bacterium. The aerobic substrate utilization profile of this bacterium has few characteristics consistent with a classification of P. fluorescens and a very low probability match with the genus Sphingomonas. However, total lipid analysismore » did not reveal that any sphingolipid bases are produced by this bacterium. NCIMB 10462 grows best aerobically, but also grows well in complex media under reducing conditions. NCIMB 10462 grows slowly under anaerobic conditions on complex media, but growth on cellulosic media occurred only under aerobic conditions. Total fatty acid analysis (MIDI) of NCIMB 10462 failed to group this bacterium with a known pseudomonas species. However, fatty acid analysis of the bacteria when grown at temperatures below 37{degrees}C suggest that the organism is a pseudomonad. Since a predominant characteristic of this bacterium is its ability to degrade cellulose, we suggest that it be called Pseudomonas cellulosa.« less

[Secondary metabolites from a deep-sea-derived actinomycete Micrococcus sp. R21].

PubMed

Peng, Kun; Su, Rui-qiang; Zhang, Gai-yun; Cheng, Xuan-xuan; Yang, Quan; Liu, Yong-hong; Yang, Xian-wen

2015-06-01

To investigate cytotoxic secondary metabolites of Micrococcus sp. R21, an actinomycete isolated from a deep-sea sediment (-6 310 m; 142 degrees 19. 9' E, 10 degrees 54. 6' N) of the Western Pacific Ocean, column chromatography was introduced over silica gel, ODS, and Sephadex LH-20. As a result, eight compounds were obtained. By mainly detailed analysis of the NMR data, their structures were elucidated as cyclo(4-hydroxy-L-Pro-L-leu) (1), cyclo(L-Pro-L-Gly) (2), cyclo( L-Pro-L-Ala) (3), cyclo( D-Pro-L-Leu) (4), N-β-acetyltryptamine (5), 2-hydroxybenzoic acid (6), and phenylacetic acid (7). Compound 1 exhibited weak cytotoxic activity against RAW264. 7 cells with IC50 value of 9.1 μmol x L(-1).

Single Bacterium Detection Using Sers

NASA Astrophysics Data System (ADS)

Gonchukov, S. A.; Baikova, T. V.; Alushin, M. V.; Svistunova, T. S.; Minaeva, S. A.; Ionin, A. A.; Kudryashov, S. I.; Saraeva, I. N.; Zayarny, D. A.

2016-02-01

This work is devoted to the study of a single Staphylococcus aureus bacterium detection using surface-enhanced Raman spectroscopy (SERS) and resonant Raman spectroscopy (RS). It was shown that SERS allows increasing sensitivity of predominantly low frequency lines connected with the vibrations of Amide, Proteins and DNA. At the same time the lines of carotenoids inherent to this kind of bacterium are well-detected due to the resonance Raman scattering mechanism. The reproducibility and stability of Raman spectra strongly depend on the characteristics of nanostructured substrate, and molecular structure and size of the tested biological object.

[In vitro studies on antioxidant and antimicrobial activities of polysaccharide from Lycoris aurea].

PubMed

Ru, Qiao-Mei; Pei, Zhen-Ming; Zheng, Hai-Lei

2008-10-01

To study the preliminary antioxidant and antimicrobial activities of polysaccharide extracted from Lycoris aurea. The scavenging activities of the polysaccharide in vitro on superoxide radical (O2-*), hydroxyl radical (*OH), alkyl radical (R*) and hydrogen peroxide (H2O2) were investigated by modified chemical systems. Meanwhile, the antimicrobial activities were tested using paper-discagar diffusion method. In general, the antioxidant activities of the polysaccharide were lower compared with Vc. However, the scavenging effects to *OH and H2O2 were parallel to Vc. Meanwhile, polysaccharide from Lycoris aurea had strong antimicrobial activities against Micrococcus luteus, Bacillus pumilus and Staphylococcus aureus. The polysaccharide extracted from L. aurea can scavenge *OH and H2O2 effectively and inhibit Gram-positive bacterias.

Repair of Ultraviolet Radiation Damage in Sensitive Mutants of Micrococcus radiodurans

PubMed Central

Moseley, B. E. B.

1969-01-01

Various aspects of the repair of ultraviolet (UV) radiation-induced damage were compared in wild-type Micrococcus radiodurans and two UV-sensitive mutants. Unlike the wild type, the mutants are more sensitive to radiation at 265 nm than at 280 nm. The delay in deoxyribonucleic acid (DNA) synthesis following exposure to UV is about seven times as long in the mutants as in the wild type. All three strains excise UV-induced pyrimidine dimers from their DNA, although the rate at which cytosine-thymine dimers are excised is slower in the mutants. The three strains also mend the single-strand breaks that appear in the irradiated DNA as a result of dimer excision, although the process is less efficient in the mutants. It is suggested that the increased sensitivity of the mutants to UV radiation may be caused by a partial defect in the second step of dimer excision. PMID:5773016

Highly efficient decolorization of Malachite Green by a novel Micrococcus sp. strain BD15.

PubMed

Du, Lin-Na; Zhao, Ming; Li, Gang; Zhao, Xiao-Ping; Zhao, Yu-Hua

2011-08-01

Malachite Green (MG) is used for a variety of applications but is also known to be carcinogenic and mutagenic. In this study, a novel Micrococcus sp. (strain BD15) was observed to efficiently decolorize MG. The purposes of this study were to explore the optimal conditions for decolorization and to evaluate the potential use of this strain for MG decolorization. Optical microscope and UV-visible analyses were carried out to determine whether the decolorization was due to biosorption or biodegradation. A Plackett-Burman design was employed to investigate the effect of various parameters on decolorization, and response surface methodology was then used to explore the optimal decolorization conditions. Kinetics analysis and antimicrobial activity tests were also performed. The results indicated that the decolorization by the strain was mainly due to biodegradation. Concentrations of MG, urea, and yeast extract and inoculum size had significantly positive effects on MG decolorization, while concentrations of CuCl(2) and MgCl(2), and temperature had significantly negative effects. The interaction between different parameters could significantly affect decolorization, and the optimal conditions for decolorization were 1.0 g/L urea, 0.9 g/L yeast extract, 100 mg/L MG, 0.1 g/L inoculums (dry weight), and incubation at 25.2°C. Under the optimal conditions, 96.9% of MG was removed by the strain within 1 h, which represents highly efficient microbial decolorization. Moreover, the kinetic data for decolorization fit a second-order model well, and the strain showed a good MG detoxification capability. Based on the results of this study, we propose Micrococcus sp. strain BD15 as an excellent candidate strain for MG removal from wastewater.

Bioremediation of contaminated surface water by immobilized Micrococcus roseus.

PubMed

Li, H; Li, P; Hua, T; Zhang, Y; Xiong, X; Gong, Z

2005-08-01

The problems caused by contaminated surface water have gradually become more serious in recent years. Although various remediation technologies were investigated, unfortunately, no efficient method was developed. In this paper, a new bioremediation technology was studied using Micrococcus roseus, which was immobilized in porous spherical beads by an improved polyvinyl alcohol (PVA) - sodium alginate (SA) embedding method. The experimental results indicated that COD removal rate could reach 64.7 % within 72 hours when immobilized M. roseus beads were used, which was ten times as high as that of free cells. The optimum inoculation rate of immobilized M. roseus beads was 10 % (mass percent of the beads in water sample, g g(-1)). Suitable aeration was proved necessary to enhance the bioremediation process. The immobilized cells had an excellent tolerance to pH and temperature changes, and were also more resistant to heavy metal stress compared with free cells. The immobilized M. roseus beads had an excellent regeneration capacity and could be reused after 180-day continuous usage. The Scanning Electronic Microscope (SEM) analysis showed that the bead microstructure was suitable for M. roseus growth, however, some defect structures should still be improved.

Whole Genome Sequence Analysis of an Alachlor and Endosulfan Degrading Micrococcus sp. strain 2385 Isolated from Ochlockonee River, Florida

PubMed Central

Pathak, Ashish; Chauhan, Ashvini; Ewida, Ayman Y.I.; Stothard, Paul

2016-01-01

We recently isolated Micrococcus sp. strain 2385 from Ochlockonee River, Florida and demonstrated potent biodegradative activity against two commonly used pesticides- alachlor [(2-chloro-2`,6`-diethylphenyl-N (methoxymethyl)acetanilide)] and endosulfan [(6,7,8,9,10,10-hexachloro-1,5,5a,6,9,9a-hexahydro-6,9methano-2,3,4-benzo(e)di-oxathiepin-3-oxide], respectively. To further identify the repertoire of metabolic functions possessed by strain 2385, a draft genome sequence was obtained, assembled, annotated and analyzed. The genome sequence of Micrococcus sp. strain 2385 consisted of 1,460,461,440 bases which assembled into 175 contigs with an N50 contig length of 50,109 bases and a coverage of 600x. The genome size of this strain was estimated at 2,431,226 base pairs with a G+C content of 72.8 and a total number of 2,268 putative genes. RAST annotated a total of 340 subsystems in the genome of strain 2385 along with the presence of 2,177 coding sequences. A genome wide survey indicated that that strain 2385 harbors a plethora of genes to degrade other pollutants including caprolactam, PAHs (such as naphthalene), styrene, toluene and several chloroaromatic compounds. PMID:27672405

Whole Genome Sequence Analysis of an Alachlor and Endosulfan Degrading Micrococcus sp. strain 2385 Isolated from Ochlockonee River, Florida.

PubMed

Pathak, Ashish; Chauhan, Ashvini; Ewida, Ayman Y I; Stothard, Paul

2016-01-01

We recently isolated Micrococcus sp. strain 2385 from Ochlockonee River, Florida and demonstrated potent biodegradative activity against two commonly used pesticides- alachlor [(2-chloro-2`,6`-diethylphenyl-N (methoxymethyl)acetanilide)] and endosulfan [(6,7,8,9,10,10-hexachloro-1,5,5a,6,9,9a-hexahydro-6,9methano-2,3,4-benzo(e)di-oxathiepin-3-oxide], respectively. To further identify the repertoire of metabolic functions possessed by strain 2385, a draft genome sequence was obtained, assembled, annotated and analyzed. The genome sequence of Micrococcus sp. strain 2385 consisted of 1,460,461,440 bases which assembled into 175 contigs with an N50 contig length of 50,109 bases and a coverage of 600x. The genome size of this strain was estimated at 2,431,226 base pairs with a G+C content of 72.8 and a total number of 2,268 putative genes. RAST annotated a total of 340 subsystems in the genome of strain 2385 along with the presence of 2,177 coding sequences. A genome wide survey indicated that that strain 2385 harbors a plethora of genes to degrade other pollutants including caprolactam, PAHs (such as naphthalene), styrene, toluene and several chloroaromatic compounds.

Microencapsulation, Chemical Characterization, and Antimicrobial Activity of Mexican (Lippia graveolens H.B.K.) and European (Origanum vulgare L.) Oregano Essential Oils

PubMed Central

Regalado-González, Carlos; Vázquez-Landaverde, Pedro; Guerrero-Legarreta, Isabel; García-Almendárez, Blanca E.

2014-01-01

The effect of solvent polarity (methanol and pentane) on the chemical composition of hydrodistilled essential oils (EO's) of Lippia graveolens H.B.K. (MXO) and Origanum vulgare L. (EUO) was studied by GC-MS. Composition of modified starch microencapsulated EO's was conducted by headspace-solid-phase microextraction (HS-SPME). The antimicrobial activity of free and microencapsulated EO's was evaluated. They were tested against Salmonella sp., Brochothrix thermosphacta, Pseudomonas fragi, Lactobacillus plantarum, and Micrococcus luteus. Thymol and carvacrol were among the main components of EO's and their free and microencapsulated inhibitory activity was tested against M. luteus, showing an additive combined effect. Chemical composition of EO's varied according to the solvent used for GC analysis and to volatile fraction as evaluated by HS-SPME. Thymol (both solvents) was the main component in essential oil of MXO, while carvacrol was the main component of the volatile fraction. EUO showed α-pinene (methanol) and γ-terpinene (pentane) as major constituents, the latter being the main component of the volatile fraction. EO's showed good stability after 3 months storage at 4°C, where antimicrobial activity of microencapsulated EO's remained the same, while free EO's decreased 41% (MXO) and 67% (EUO) from initial activity. Microencapsulation retains most antimicrobial activity and improves stability of EO's from oregano. PMID:25177730

Antimicrobial peptide gene induction, involvement of Toll and IMD pathways and defense against bacteria in the red flour beetle, Tribolium castaneum.

PubMed

Yokoi, Kakeru; Koyama, Hiroaki; Minakuchi, Chieka; Tanaka, Toshiharu; Miura, Ken

2012-01-01

Using Tribolium castaneum, we quantitatively investigated the induction of nine antimicrobial peptide (AMP) genes by live gram-negative bacteria (Escherichia coli and Enterobacter cloacae), gram-positive bacteria (Micrococcus luteus and Bacillus subtilis) and the budding yeast (Saccharomyces cerevisiae). Then, five representative AMP genes were selected, and the involvement of the Toll and IMD pathways in their induction by E. coli, M. luteus and S. cerevisiae was examined by utilizing RNA interference of either MyD88 or IMD. Results indicated: Robust and acute induction of three genes by the two bacterial species was mediated mainly by the IMD pathway; slow and sustained induction of one gene by the two bacteria was mediated mainly by the Toll pathway; induction of the remaining one gene by the two bacteria was mediated by both pathways; induction of the five genes by the yeast was mediated by the Toll and/or IMD pathways depending on respective genes. These results suggest that more promiscuous activation and usage of the two pathways may occur in T. castaneum than in Drosophila melanogaster. In addition, the IMD pathway was revealed to dominantly contribute to defense against two bacterial species, gram-negative E. cloacae and gram-positive B. subtilis that possesses DAP-type peptidoglycan.

Mode of action and safety of lactosporin, a novel antimicrobial protein produced by Bacillus coagulans ATCC 7050

PubMed Central

Riazi, Shadi; Dover, Sara E.; Chikindas, Michael L.

2012-01-01

Aims To determine the mechanism of action of antimicrobial protein, lactosporin, against Gardnerella vaginalis and to evaluate its safety in-vitro. Methods and Results Bacillus coagulans ATCC 7050 was grown at 37 °C for 18 hours. The cell free supernatant was concentrated 10-fold and screened for antimicrobial activity against indicator strain Micrococcus luteus. The mode of action of lactosporin was determined by measuring the potassium release and monitoring the changes in transmembrane potential (Δψ) and transmembrane pH (ΔpH) of the sensitive cells. Lactosporin caused efflux of potassium ions from M. luteus cells and dissipation of ΔpH in G. vaginalis while it had no effect on the Δψ. The safety of lactosporin was evaluated by using EpiVaginal™ ectocervical (VEC-100) tissue model. Over 80% of the cells in the vaginal tissue remained viable after exposure to lactosporin for 24 hours. Conclusions Lactosporin potentially exerts its antimicrobial activity by selective dissipation of ΔpH and/or by causing leakage of ions from the sensitive cells. Safety studies suggest that lactosporin is a non-cytotoxix antimicrobial for vaginal application. Significance and Impact of the Study This study revealed that lactosporin is an effective and safe antimicrobial preparation with potential application for control of bacterial vaginosis. PMID:22737982

Antimicrobial activity in the common seawhip, Leptogorgia virgulata (Cnidaria: Gorgonaceae).

PubMed

Shapo, Jacqueline L; Moeller, Peter D; Galloway, Sylvia B

2007-09-01

Antimicrobial activity was examined in the gorgonian Leptogorgia virgulata (common seawhip) from South Carolina waters. Extraction and assay protocols were developed to identify antimicrobial activity in crude extracts of L. virgulata. Detection was determined by liquid growth inhibition assays using Escherichia coli BL21, Vibrio harveyii, Micrococcus luteus, and a Bacillus sp. isolate. This represents the first report of antimicrobial activity in L. virgulata, a temperate/sub-tropical coral of the western Atlantic Ocean. Results from growth inhibition assays guided a fractionation scheme to identify active compounds. Reverse-phase HPLC, HPLC-mass spectrometry, and 1H and 13C NMR spectroscopy were used to isolate, purify, and characterize metabolites in antimicrobial fractions of L. virgulata. Corroborative HPLC-MS/NMR evidence validated the presence of homarine and a homarine analog, well-known emetic metabolites previously isolated from L. virgulata, in coral extracts. In subsequent assays, partially-purified L. virgulata fractions collected from HPLC-MS fractionation were shown to contain antimicrobial activity using M. luteus and V. harveyii. This study provides evidence that homarine is an active constituent of the innate immune system in L. virgulata. We speculate it may act synergistically with cofactors and/or congeners in this octocoral to mount a response to microbial invasion and disease.

Microencapsulation, chemical characterization, and antimicrobial activity of Mexican (Lippia graveolens H.B.K.) and European (Origanum vulgare L.) oregano essential oils.

PubMed

Hernández-Hernández, Elvia; Regalado-González, Carlos; Vázquez-Landaverde, Pedro; Guerrero-Legarreta, Isabel; García-Almendárez, Blanca E

2014-01-01

The effect of solvent polarity (methanol and pentane) on the chemical composition of hydrodistilled essential oils (EO's) of Lippia graveolens H.B.K. (MXO) and Origanum vulgare L. (EUO) was studied by GC-MS. Composition of modified starch microencapsulated EO's was conducted by headspace-solid-phase microextraction (HS-SPME). The antimicrobial activity of free and microencapsulated EO's was evaluated. They were tested against Salmonella sp., Brochothrix thermosphacta, Pseudomonas fragi, Lactobacillus plantarum, and Micrococcus luteus. Thymol and carvacrol were among the main components of EO's and their free and microencapsulated inhibitory activity was tested against M. luteus, showing an additive combined effect. Chemical composition of EO's varied according to the solvent used for GC analysis and to volatile fraction as evaluated by HS-SPME. Thymol (both solvents) was the main component in essential oil of MXO, while carvacrol was the main component of the volatile fraction. EUO showed α-pinene (methanol) and γ-terpinene (pentane) as major constituents, the latter being the main component of the volatile fraction. EO's showed good stability after 3 months storage at 4°C, where antimicrobial activity of microencapsulated EO's remained the same, while free EO's decreased 41% (MXO) and 67% (EUO) from initial activity. Microencapsulation retains most antimicrobial activity and improves stability of EO's from oregano.

Detection of Salmonella bacterium in drinking water using microring resonator.

PubMed

Bahadoran, Mahdi; Noorden, Ahmad Fakhrurrazi Ahmad; Mohajer, Faeze Sadat; Abd Mubin, Mohamad Helmi; Chaudhary, Kashif; Jalil, Muhammad Arif; Ali, Jalil; Yupapin, Preecha

2016-01-01

A new microring resonator system is proposed for the detection of the Salmonella bacterium in drinking water, which is made up of SiO2-TiO2 waveguide embedded inside thin film layer of the flagellin. The change in refractive index due to the binding of the Salmonella bacterium with flagellin layer causes a shift in the output signal wavelength and the variation in through and drop port's intensities, which leads to the detection of Salmonella bacterium in drinking water. The sensitivity of proposed sensor for detecting of Salmonella bacterium in water solution is 149 nm/RIU and the limit of detection is 7 × 10(-4)RIU.

Interconversion of large packets and small groups of cells of Micrococcus rubens: dependence upon magnesium and phosphate.

PubMed Central

Yamada, M; Koyama, T; Matsuhashi, M

1977-01-01

Micrococcus rubens, a gram-positive occus, usually forms large, cubic packets of more than 500 cells that are regularly arranged in three-dimensional cell groups. In medium with extremely low concentration of Mg2+ and phosphate, in which the cells can only grow on a agar surface, it formed small groups of 2 to 20 cells. Irregularly arraged cell groups of intermediated size were obtained in culture media containing intermediated concentrations of Mg2+ and phosphate. Mutants that formed irregular cell groups of intermediate size under normal culture conditions were also obtained. Images PMID:845123

Taxonomic characterization of the cellulose-degrading bacterium NCIB 10462

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dees, C.; Ringleberg, D.; Scott, T.C.

The gram negative cellulase-producing bacterium NCIB 10462 has been previously named Pseudomonas fluorescens subsp. or var. cellulosa. Since there is renewed interest in cellulose-degrading bacteria for use in bioconversion of cellulose to chemical feed stocks and fuels, we re-examined the characteristics of this microorganism to determine its proper taxonomic characterization and to further define it`s true metabolic potential. Metabolic and physical characterization of NCIB 10462 revealed that this was an alkalophilic, non-fermentative, gram negative, oxidase positive, motile, cellulose-degrading bacterium. The aerobic substrate utilization profile of this bacterium was found to have few characteristics consistent with a classification of P. fluorescensmore » with a very low probability match with the genus Sphingomonas. Total lipid analysis did not reveal that any sphingolipid bases are produced by this bacterium. NCIB 10462 was found to grow best aerobically but also grows well in complex media under reducing conditions. NCIB 10462 grew slowly under full anaerobic conditions on complex media but growth on cellulosic media was found only under aerobic conditions. Total fatty acid analysis (MIDI) of NCIB 10462 failed to group this bacterium with a known pseudomonas species. However, fatty acid analysis of the bacteria when grown at temperatures below 37{degrees}C suggest that the organism is a pseudomonad. Since a predominant characteristic of this bacterium is it`s ability to degrade cellulose, we suggest it be called Pseudomonas cellulosa.« less

Evaluation of antibacterial properties of Barium Zirconate Titanate (BZT) nanoparticle

PubMed Central

Mohseni, Simin; Aghayan, Mahdi; Ghorani-Azam, Adel; Behdani, Mohammad; Asoodeh, Ahmad

2014-01-01

So far, the antibacterial activity of some organic and inorganic compounds has been studied. Barium zirconate titanate [Ba(ZrxTi1-x)O3] (x = 0.05) nanoparticle is an example of inorganic materials. In vitro studies have provided evidence for the antibacterial activity of this nanoparticle. In the current study, the nano-powder was synthesized by sol-gel method. X-ray diffraction showed that the powder was single-phase and had a perovskite structure at the calcination temperature of 1000 °C. Antibacterial activity of the desired nanoparticle was assessed on two gram-positive (Staphylococcus aureus PTCC1431 and Micrococcus luteus PTCC1625) and two gram-negative (Escherichia coli HP101BA 7601c and clinically isolated Klebsiella pneumoniae) bacteria according to Radial Diffusion Assay (RDA). The results showed that the antibacterial activity of BZT nano-powder on both gram-positive and gram-negative bacteria was acceptable. The minimum inhibitory concentration of this nano-powder was determined. The results showed that MIC values for E. coli, K. pneumoniae, M. luteus and S. aureus were about 2.3 μg/mL, 7.3 μg/mL, 3 μg/mL and 12 μg/mL, respectively. Minimum bactericidal concentration (MBC) was also evaluated and showed that the growth of E. coli, K. pneumoniae, M. luteus and S. aureus could be decreased at 2.3, 14, 3 and 18 μg/mL of BZT. Average log reduction in viable bacteria count in time-kill assay ranged between 6 Log10 cfu/mL to zero after 24 h of incubation with BZT nanoparticle. PMID:25763046

Effect of impact stress on microbial recovery on an agar surface.

PubMed Central

Stewart, S L; Grinshpun, S A; Willeke, K; Terzieva, S; Ulevicius, V; Donnelly, J

1995-01-01

Microbial stress due to the impaction of microorganisms onto an agar collection surface was studied experimentally. The relative recovery rates of aerosolized Pseudomonas fluorescens and Micrococcus luteus were determined as a function of the impaction velocity by using a moving agar slide impactor operating over a flow rate range from 3.8 to 40 liters/min yielding impaction velocities from 24 to 250 m/s. As a reference, the sixth stage of the Andersen Six-Stage Viable Particle Sizing Sampler was used at its operating flow rate of 28.3 liters/min (24 m/s). At a collection efficiency of close to 100% for the agar slide impactor, an increase in sampling flow rate and, therefore, in impaction velocity produced a significant decline in the percentage of microorganisms recovered. Conversely, when the collection efficiency was less than 100%, greater recovery and lower injury rates occurred. The highest relative rate of recovery (approximately 51% for P. fluorescens and approximately 62% for M. luteus) was obtained on the complete (Trypticase soy agar) medium at 40 and 24 m/s (6.4 and 3.8 liters/min), respectively. M. luteus demonstrated less damage than P. fluorescens, suggesting the hardy nature of the gram-positive strain versus that of the gram-negative microorganism. Comparison of results from the agar slide and Andersen impactors at the same sampling velocity showed that recovery and injury due to collection depends not only on the magnitude of the impaction velocity but also on the degree to which the microorganisms may be embedded in the collection medium.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:7747946

Indoleacetic acid production and plant growth promoting potential of bacterial endophytes isolated from rice (Oryza sativa L.) seeds.

PubMed

Shahzad, Raheem; Waqas, Muhammad; Khan, Abdul Latif; Al-Hosni, Khadija; Kang, Sang-Mo; Seo, Chang-Woo; Lee, In-Jung

2017-06-01

Bacterial endophytes from the phyllosphere and rhizosphere have been used to produce bioactive metabolites and to promote plant growth. However, little is known about the endophytes residing in seeds. This study aimed to isolate and identify seed-borne bacterial endophytes from rice and elucidate their potential for phytohormone production and growth enhancement. The isolated endophytes included Micrococcus yunnanensis RWL-2, Micrococcus luteus RWL-3, Enterobacter soli RWL-4, Leclercia adecarboxylata RWL-5, Pantoea dispersa RWL-6, and Staphylococcus epidermidis RWL-7, which were identified using 16S rRNA sequencing and phylogenetic analysis. These strains were analyzed for indoleacetic acid (IAA) production by using GC-MS and IAA was found in the range of 11.50 ± 0.77 μg ml -1 to 38.80 ± 1.35 μg ml -1 . We also assessed the strains for plant growth promoting potential because these isolates were able to produce IAA in pure culture. Most of the growth attributes of rice plants (shoot and root length, fresh and dry biomass, and chlorophyll content) were significantly increased by bacterial endophytes compared to the controls. These results show that IAA producing bacterial endophytes can improve hostplant growth traits and can be used as bio-fertilizers.

Pitfalls in efficacy testing – how important is the validation of neutralization of chlorhexidine digluconate?

PubMed Central

Reichel, Mirja; Heisig, Peter; Kampf, Günter

2008-01-01

Background Effective neutralization of active agents is essential to obtain valid efficacy results, especially when non-volatile active agents like chlorhexidine digluconate (CHG) are tested. The aim of this study was to determine an effective and non-toxic neutralizing mixture for a propan-1-ol solution containing 2% CHG. Methods Experiments were carried out according to ASTM E 1054-02. The neutralization capacity was tested separately with five challenge microorganisms in suspension, and with a rayon swab carrier. Either 0.5 mL of the antiseptic solution (suspension test) or a saturated swab with the antiseptic solution (carrier test) was added to tryptic soy broth containing neutralizing agents. After the samples were mixed, aliquots were spread immediately and after 3 h of storage at 2 – 8°C onto tryptic soy agar containing a neutralizing mixture. Results The neutralizer was, however, not consistently effective in the suspension test. Immediate spread yielded a valid neutralization with Staphylococcus aureus, Staphylococcus epidermidis and Corynebacterium jeikeium but not with Micrococcus luteus (p < 0.001) and Candida albicans (p < 0.001). A 3-h storage period of the neutralized active agents in suspension resulted in significant carry-over activity of CHG in addition against Staphylococcus epidermidis (p < 0.001) and Corynebacterium jeikeium (p = 0.044). In the carrier test, the neutralizing mixture was found to be effective and non toxic to all challenge microorganisms when spread immediately. However, after 3 h storage of the neutralized active agents significant carry-over activity of CHG against Micrococcus luteus (p = 0.004; Tukey HSD) was observed. Conclusion Without effective neutralization in the sampling fluid, non-volatile active ingredients will continue to reduce the number of surviving microorganisms after antiseptic treatment even if the sampling fluid is kept cold straight after testing. This can result in false-positive antiseptic efficacy

Pitfalls in efficacy testing--how important is the validation of neutralization of chlorhexidine digluconate?

PubMed

Reichel, Mirja; Heisig, Peter; Kampf, Günter

2008-12-02

Effective neutralization of active agents is essential to obtain valid efficacy results, especially when non-volatile active agents like chlorhexidine digluconate (CHG) are tested. The aim of this study was to determine an effective and non-toxic neutralizing mixture for a propan-1-ol solution containing 2% CHG. Experiments were carried out according to ASTM E 1054-02. The neutralization capacity was tested separately with five challenge microorganisms in suspension, and with a rayon swab carrier. Either 0.5 mL of the antiseptic solution (suspension test) or a saturated swab with the antiseptic solution (carrier test) was added to tryptic soy broth containing neutralizing agents. After the samples were mixed, aliquots were spread immediately and after 3 h of storage at 2 - 8 degrees C onto tryptic soy agar containing a neutralizing mixture. The neutralizer was, however, not consistently effective in the suspension test. Immediate spread yielded a valid neutralization with Staphylococcus aureus, Staphylococcus epidermidis and Corynebacterium jeikeium but not with Micrococcus luteus (p < 0.001) and Candida albicans (p < 0.001). A 3-h storage period of the neutralized active agents in suspension resulted in significant carry-over activity of CHG in addition against Staphylococcus epidermidis (p < 0.001) and Corynebacterium jeikeium (p = 0.044). In the carrier test, the neutralizing mixture was found to be effective and non toxic to all challenge microorganisms when spread immediately. However, after 3 h storage of the neutralized active agents significant carry-over activity of CHG against Micrococcus luteus (p = 0.004; Tukey HSD) was observed. Without effective neutralization in the sampling fluid, non-volatile active ingredients will continue to reduce the number of surviving microorganisms after antiseptic treatment even if the sampling fluid is kept cold straight after testing. This can result in false-positive antiseptic efficacy data. Attention should be paid

Bioprospecting highly diverse endophytic Pestalotiopsis spp. with antibacterial properties from Maytenus ilicifolia, a medicinal plant from Brazil.

PubMed

Gomes-Figueiredo, Josiane; Pimentel, Ida C; Vicente, Vânia A; Pie, Marcio R; Kava-Cordeiro, Vanessa; Galli-Terasawa, Lygia; Pereira, José O; de Souza, Antonia Q L; Glienke, Chirlei

2007-10-01

Thirteen endophytic fungal strains of the genus Pestalotiopsis were isolated from the medicinal plant Maytenus ilicifolia Mart. ex. Reiss (commonly known as "espinheira santa") and their antimicrobial properties were investigated. Two isolates were successful in inhibiting the growth of the tested microorganisms (Escherichia coli, Klebsiella pneumoniae, Micrococcus luteus, Staphylococcus aureus, and methicillin-resistant Staphylococcus aureus (MRSA)) using the technique of bioautographic thin-layer chromatography (TLC) agar overlay assay. An analysis based on a polyphasic approach integrating taxonomic information, morphological traits, RAPD markers, and the sequencing of the ITS1-5.8S-ITS2 of the rDNA led to the assignment of the isolates as belonging to the species Pestalotiopsis microspora, Pestalotiopsis vismiae, and Pestalotiopsis leucothoes. Therefore, the present study presents a new approach to the study of endophytic fungi of the genus Pestalotiopsis.

Degradable Polymer with Protein Resistance in a Marine Environment.

PubMed

Ma, Jielin; Ma, Chunfeng; Zhang, Guangzhao

2015-06-16

Protein resistance is the central issue in marine antibiofouling. We have prepared poly(ε-caprolactone) (PCL)-based polyurethane with 2-(dimethylamino) ethyl methacrylate (DEM) as pendant groups by a combination of the thiol-ene click reaction and the condensation reaction. By the use of quartz crystal microbalance with dissipation (QCM-D) and surface plasmon resonance (SPR), we have investigated the adsorption of fibrinogen, bovine serum albumin (BSA), and lysozyme on the polymer surface. The polymer exhibits protein resistance in seawater but not in fresh water because DEM pendant groups carry net neutral charges in the former. The evaluation of antibacterial adhesion of the polymer by using Micrococcus luteus demonstrates that the polymer can effectively inhibit the settlement of marine bacteria. Our studies also show that the polymer is degradable in marine environments.

Development of a simple and low cost microbioreactor for high-throughput bioprocessing.

PubMed

Rahman, Pattanathu K S M; Pasirayi, Godfrey; Auger, Vincent; Ali, Zulfiqur

2009-02-01

A simple microbioreactor for high-throughput bioprocessing made from low cost polymer polytetrafluoroethylene (PTFE) tubes with a working volume of 1.5 ml is described. We have developed a microfluidic system that handles a small population of cells of a model microorganism, Pseudomonas aeruginosa DS10-129. Under the conditions of the microbioreactor, the organism produced extracellular secondary metabolites by using nutrient broth modified with glycerol. Pyocyanins were isolated from the fermented medium as a metabolite of interest. Antibiotic properties of pyocyanin were effective against a number of microorganisms such as Staphylococcus aureus, S. epidermis, Bacillus subtilis, Micrococcus luteus and Saccharomyces cerevisiae. Batch fermentation of the model organism in the microbioreactor was compared to shake-flask and conventional bench fermenter methods. Results obtained from the microbioreactor compared favourably with the conventional processes.

Antibacterial properties of grapefruit seed extract against Paenibacillus larvae subsp. larvae.

PubMed

Semprini, P; Langella, V; Pasini, B; Falda, M T; Calvarese, S

2004-01-01

Twenty-one samples of grapefruit seed extract (GSE) either from marketed products or provided by an apiculturist were analysed to verify their inhibition activity, in particular against Paenibacillus larvae subsp. larvae, responsible for American foulbrood. The bactericide capacity of GSE has been measured in Bacillus subtilis BGA, Bacillus cereus 11778, Bacillus cereus K250 and Micrococcus luteus 9341a; these bacteria are normally used in the laboratory to study inhibitors. The results showed that not all GSE have the same inhibitory activity and two of those analysed do not inhibit the five bacteria used. Considering that 19 samples inhibited American foulbrood bacillus, the authors conclude that the use of a natural product (such as GSE) to control this important disease of bees, can be used as a substitute for chemotherapeutic products, after appropriate expedients.

A novel green one-step synthesis of silver nanoparticles using chitosan: catalytic activity and antimicrobial studies

NASA Astrophysics Data System (ADS)

Venkatesham, Maragoni; Ayodhya, Dasari; Madhusudhan, Alle; Veera Babu, Nagati; Veerabhadram, Guttena

2014-01-01

Stable silver nanoparticles were synthesized using chitosan acting as both reducing and stabilizing agent without using any toxic chemicals. This reaction was carried out in an autoclave at a pressure of 15 psi and 120 °C temperature by varying the time. The influence of different parameters such as time, change of concentration of silver nitrate and concentration of chitosan on the formation of silver nanoparticles were studied. The synthesized silver nanoparticles were characterized by UV-visible spectroscopy, Fourier transform infrared, X-ray diffraction and transmission electron microscopy. The results of catalytic reduction of 4-nitrophenol by sodium borohydride in the presence of green synthesized silver nanoparticles were presented. The antimicrobial activity of silver nanoparticles was tested against Escherichia coli and Micrococcus luteus and was found to be possessing inhibiting property.

Isolation and properties of mesosomal membrane fractions from Micrococcus lysodeikticus

PubMed Central

Owen, Peter; Freer, John H.

1972-01-01

1. A method is described for the isolation of pure mesosomal membrane fractions from Micrococcus lysodeikticus. 2. Plasmolysis of cells, before wall digestion, was necessary for effective mesosome release. 3. The effect of mild shearing forces, temperature and time upon the release of mesosomal membrane from protoplasts was investigated. 4. The optimum yield of mesosomal membranes from stable protoplasts was achieved at 10mm-Mg2+. 5. Mesosomal membrane vesicle fractions prepared at differing Mg2+ concentrations above 10mm were similar in chemical composition. 6. Comparison of the properties of peripheral and mesosomal membrane fractions revealed major differences in the distribution of protein components, membrane phosphorus, mannose and dehydrogenase activities between the two fractions. 7. Only cytochrome b556 was detected in mesosomal membranes, whereas peripheral membranes contained a full complement of cytochromes. 8. Preliminary investigations suggested the localization of an autolytic enzyme(s) in the mesosomal vesicles. 9. The anatomy of mesosomal and peripheral membrane have been compared by the negative-staining and freeze-fracture technique. 10. The results are discussed in relation to a plausible role for the mesosome. ImagesPLATE 1PLATE 2PLATE 3PLATE 4 PMID:4655825

Isolation and identification of symbiotic bacteria from the skin, mouth, and rectum of wild and captive tree shrews.

PubMed

Li, Gui; Lai, Ren; Duan, Gang; Lyu, Long-Bao; Zhang, Zhi-Ye; Liu, Huang; Xiang, Xun

2014-11-18

Endosymbionts influence many aspects of their hosts' health conditions, including physiology, development, immunity, metabolism, etc. Tree shrews (Tupaia belangeri chinensis) have attracted increasing attention in modeling human diseases and therapeutic responses due to their close relationship with primates. To clarify the situation of symbiotic bacteria from their body surface, oral cavity, and anus, 12 wild and 12 the third generation of captive tree shrews were examined. Based on morphological and cultural characteristics, physiological and biochemical tests, as well as the 16S rDNA full sequence analysis, 12 bacteria strains were isolated and identified from the wild tree shrews: body surface: Bacillus subtilis (detection rate 42%), Pseudomonas aeruginosa (25%), Staphlococcus aureus (33%), S. Epidermidis (75%), Micrococcus luteus (25%), Kurthia gibsonii (17%); oral cavity: Neisseria mucosa (58%), Streptococcus pneumonia (17%); anus: Enterococcus faecalis (17%), Lactococus lactis (33%), Escherichia coli (92%), Salmonella typhosa (17%); whereas, four were indentified from the third generation captive tree shrews: body surface: S. epidermidis (75%); oral cavity: N.mucosa (67%); anus: L. lactis (33%), E. coli (100%). These results indicate that S. epidermidis, N. mucosa, L. lactis and E. coli were major bacteria in tree shrews, whereas, S. aureus, M. luteus, K. gibsonii, E. faecalis and S. typhosa were species-specific flora. This study facilitates the future use of tree shrews as a standard experimental animal and improves our understanding of the relationship between endosymbionts and their hosts.

Antimicrobial Air Filters Using Natural Euscaphis japonica Nanoparticles

PubMed Central

Yun, Ji Ho; Lee, Jung Eun; Lee, Hee Ju; Nho, Chu Won; Bae, Gwi- Nam; Jung, Jae Hee

2015-01-01

Controlling bioaerosols has become more important with increasing participation in indoor activities. Treatments using natural-product nanomaterials are a promising technique because of their relatively low toxicity compared to inorganic nanomaterials such as silver nanoparticles or carbon nanotubes. In this study, antimicrobial filters were fabricated from natural Euscaphis japonica nanoparticles, which were produced by nebulizing E. japonica extract. The coated filters were assessed in terms of pressure drop, antimicrobial activity, filtration efficiency, major chemical components, and cytotoxicity. Pressure drop and antimicrobial activity increased as a function of nanoparticle deposition time (590, 855, and 1150 µg/cm2filter at 3-, 6-, and 9-min depositions, respectively). In filter tests, the antimicrobial efficacy was greater against Staphylococcus epidermidis than Micrococcus luteus; ~61, ~73, and ~82% of M. luteus cells were inactivated on filters that had been coated for 3, 6, and 9 min, respectively, while the corresponding values were ~78, ~88, and ~94% with S. epidermidis. Although statistically significant differences in filtration performance were not observed between samples as a function of deposition time, the average filtration efficacy was slightly higher for S. epidermidis aerosols (~97%) than for M. luteus aerosols (~95%). High-performance liquid chromatography (HPLC) and electrospray ionization-tandem mass spectrometry (ESI/MS) analyses confirmed that the major chemical compounds in the E. japonica extract were 1(ß)-O-galloyl pedunculagin, quercetin-3-O-glucuronide, and kaempferol-3-O-glucoside. In vitro cytotoxicity and disk diffusion tests showed that E. japonica nanoparticles were less toxic and exhibited stronger antimicrobial activity toward some bacterial strains than a reference soluble nickel compound, which is classified as a human carcinogen. This study provides valuable information for the development of a bioaerosol control

Antioxidant and antibacterial properties of green, black, and herbal teas of Camellia sinensis.

PubMed

Chan, Eric W C; Soh, Eu Ying; Tie, Pei Pei; Law, Yon Peng

2011-10-01

The role of non-polymeric phenolic (NP) and polymeric tannin (PT) constituents in the antioxidant and antibacterial properties of six brands of green, black, and herbal teas of Camellia sinensis were investigated. Total phenolic content (TPC) and ascorbic acid equivalent antioxidant capacity (AEAC) were assessed using the Folin-Ciocalteu and 2,2-diphenyl-1-picrylhydrazyl (DPPH) assays, respectively. Minimum inhibitory dose (MID) against Gram-positive Micrococcus luteus, Staphylococcus aureus, and Bacillus cereus, and Gram-negative. Escherichia coli, Salmonella typhi, and Pseudomonas aeruginosa was assessed using the disc-diffusion method. Teas were extracted with hot water successively three times for one hour each time. The extracts were fractionated using Sephadex LH-20 column chromatography to obtain the NP and PT constituents. Extraction yields ranged from 12 to 23%. Yields of NP fractions (70-81%) were much higher than those of PT fractions (1-11%), suggesting that the former are the major tea components. Ranking of antioxidant properties of extracts was green tea>black tea>herbal tea. For all six teas, antioxidant properties of PT fractions were significantly higher than extracts and NP fractions. Extracts and fractions of all six teas showed no activity against the three Gram-negative bacteria. Green teas inhibited all three Gram-positive bacteria with S. aureus being the least susceptible. Black and herbal teas inhibited the growth of M. luteus and B. cereus, but not S. aureus. The most potent were the PT fractions of Boh Cameron Highlands and Ho Yan Hor with MID of 0.01 and 0.03 mg/disc against M. luteus. Results suggested that NP constituents are major contributors to the antioxidant and antibacterial properties of teas of C. sinensis. Although PT constituents have stronger antioxidant and antibacterial properties, they constitute only a minor component of the teas.

Oxidation of Ethylene Glycol by a Salt-Requiring Bacterium

PubMed Central

Caskey, William H.; Taber, Willard A.

1981-01-01

Bacterium T-52, cultured on ethylene glycol, readily oxidized glycolate and glyoxylate and exhibited elevated activities of ethylene glycol dehydrogenase and glycolate oxidase. Labeled glyoxylate was identified in reaction mixtures containing [14C]-ethylene glycol, but no glycolate was detected. The most likely pathway of ethylene glycol catabolism by bacterium T-52 is sequential oxidation to glycolate and glyoxylate. PMID:16345810

Whole Microorganisms Studied by Pyrolysis-Gas Chromatography-Mass Spectrometry: Significance for Extraterrestrial Life Detection Experiments 1

PubMed Central

Simmonds, Peter G.

1970-01-01

Pyrolysis-gas chromatography-mass spectrometric studies of two microorganisms, Micrococcus luteus and Bacillus subtilis var. niger, indicate that the majority of thermal fragments originate from the principal classes of bio-organic matter found in living systems such as protein and carbohydrate. Furthermore, there is a close qualitative similarity between the type of pyrolysis products found in microorganisms and the pyrolysates of other biological materials. Conversely, there is very little correlation between microbial pyrolysates and comparable pyrolysis studies of meteoritic and fossil organic matter. These observations will aid in the interpretation of a soil organic analysis experiment to be performed on the surface of Mars in 1975. The science payload of this landed mission will include a combined pyrolysis-gas chromatography-mass spectrometry instrument as well as several “direct biology experiments” which are designed to search for extraterrestrial life. PMID:16349890

An antibacterial ortho-quinone diterpenoid and its derivatives from Caryopteris mongolica.

PubMed

Saruul, Erdenebileg; Murata, Toshihiro; Selenge, Erdenechimeg; Sasaki, Kenroh; Yoshizaki, Fumihiko; Batkhuu, Javzan

2015-06-15

To identify antibacterial components in traditional Mongolian medicinal plant Caryopteris mongolica, an ortho-quinone abietane caryopteron A (1) and three its derivatives caryopteron B-D (2-4) were isolated from the roots of the plant together with three known abietanes demethylcryptojaponol (5), 6α-hydroxydemethyl cryptojaponol (6), and 14-deoxycoleon U (7). The chemical structures of these abietane derivatives were elucidated on the basis of spectroscopic data. Compounds 1-4 had C-13 methylcyclopropane substructures, and 2-4 had a hexanedioic anhydride ring C instead of ortho-quinone in 1. The stereochemistry of these compound was assumed from NOE spectra and ECD Cotton effects. Compounds 1 and 5-7 showed antibacterial activities against the Gram-positive bacteria Staphylococcus aureus, Staphylococcus epidermidis, Enterococcus faecalis, and Micrococcus luteus, being 1 the more potent. Copyright © 2015 Elsevier Ltd. All rights reserved.

Chemical constituents and antimicrobial activity of the essential oil of Lantana xenica.

PubMed

Juliani, Hector R; Biurrun, Fernando; Koroch, Adolfina R; Oliva, M M; Demo, Mirta S; Trippi, Victorio S; Zygadlo, Julio A

2002-08-01

The aim of this work was to evaluate the chemical composition of Lantana xenica essential oil and its antimicrobial activity. The oil from the aerial parts of Lantana xenica Mold. (Verbenacea) was obtained by steam distillation and analyzed by gas chromatography/mass spectrometry. The major constituent of the oil was (E)-caryophyllene (35.2 %), with minor amounts of gamma-cadinene (13.3 %), alpha-pinene (9.3 %), ocimene (9.2 %) and germacrene D (6.6 %). The antimicrobial assays showed that the essential oil of L. xenica inhibited the growth of Bacillus cereus and Proteus mirabilis and both bacteria were inhibited by (E)-caryophyllene, the major component of the oil. Enterococcus faecalis, Staphylococcus epidermidis and S. aureus showed a lower inhibition. The bacteria Micrococcus luteus, Klebsiella sp., Escherichia coli and the yeast Candida albicans were insensitive to both the oil and (E)-caryophyllene.

Antimicrobial effects of Finnish plant extracts containing flavonoids and other phenolic compounds.

PubMed

Rauha, J P; Remes, S; Heinonen, M; Hopia, A; Kähkönen, M; Kujala, T; Pihlaja, K; Vuorela, H; Vuorela, P

2000-05-25

Plant phenolics, especially dietary flavonoids, are currently of growing interest owing to their supposed functional properties in promoting human health. Antimicrobial screening of 13 phenolic substances and 29 extracts prepared from Finnish plant materials against selected microbes was conducted in this study. The tests were carried out using diffusion methods with four to nine microbial species (Aspergillus niger, Bacillus subtilis, Candida albicans, Escherichia coli, Micrococcus luteus, Pseudomonas aeruginosa, Saccharomyces cerevisiae, Staphylococcus aureus and Staphylococcus epidermidis). Flavone, quercetin and naringenin were effective in inhibiting the growth of the organisms. The most active plant extracts were purple loosestrife (Lythrum salicaria L.) against Candida albicans, meadowsweet (Filipendula ulmaria (L.) Maxim.), willow herb (Epilobium angustifolium L.), cloudberry (Rubus chamaemorus L.) and raspberry (Rubus idaeus L.) against bacteria, and white birch (Betula pubescens Ehrh.), pine (Pinus sylvestris L.) and potato (Solanum tuberosum. L.) against gram-positive Staphylococcus aureus.

Enzymatic synthesis of polymers containing nicotinamide mononucleotide

NASA Technical Reports Server (NTRS)

Liu, Rihe

1995-01-01

Nicotinamide mononucleoside 5'-diphosphate in its reduced form is an excellent substrate for polynucleotide phosphorylase from Micrococcus luteus both in de novo polymerization reactions and in primer extension reactions. The oxidized form of the diphosphate is a much less efficient substrate; it can be used to extend primers but does not oligomerize in the absence of a primer. The cyanide adduct of the oxidized substrate, like the reduced substrate, polymerizes efficiently. Loss of cyanide yields high molecular weight polymers of the oxidized form. Terminal transferase from calf thymus accepts nicotinamide mononucleoside 5'-triphosphate as a substrate and efficiently adds one residue to the 3'-end of an oligodeoxynucleotide. T4 polynucleotide kinase accepts oligomers of nicotinamide mononucleotide as substrates. However, RNA polymerases do not incorporate nicotinamide mononucleoside 5'-triphosphate into products on any of the templates that we used.

Enzymatic Synthesis of Polymers Containing Nicotinamide Mononucleotide

NASA Technical Reports Server (NTRS)

Liu, Rihe; Orgel, Leslie E.

1995-01-01

Nicotinamide mononucleoside 5'-diphosphate in its reduced form is an excellent substrate for polynucleotide phosphorylase from Micrococcus luteus both in de novo polymerization reactions and in primer extension reactions. The oxidized form of the diphosphate is a much less efficient substrate; it can be used to extend primers but does not oligomerize in the absence of a primer. The cyanide adduct of the oxidized substrate, like the reduced substrate, polymerizes efficiently. Loss of cyanide yields high molecular weight polymers of the oxidized form. Terminal transferase from calf thymus accepts nicotinamide mononucleoside 5'-triphosphate as a substrate and efficiently adds one residue to the 3'-end of an oligodeoxynucleotide. T4 polynucleotide kinase accepts oligomers of nicotinamide mononucleotide as substrates. However, RNA polymerases do not incorporate nicotinamide mononucleoside 5'-triphosphate into products on any of the templates that we used.

In vitro antioxidant, anticholinesterase and antimicrobial activity studies on three Agaricus species with fatty acid compositions and iron contents: a comparative study on the three most edible mushrooms.

PubMed

Öztürk, Mehmet; Duru, Mehmet Emin; Kivrak, Seyda; Mercan-Doğan, Nazime; Türkoglu, Aziz; Özler, Mehmet Ali

2011-06-01

The fatty acids of Agaricus essettei, Agaricus bitorquis and Agaricus bisporus were investigated by using GC and GC-MS. The dominant fatty acids were found to be linoleic (61.82-67.29%) and palmitic (12.67-14.71%) acids among the 13 fatty acids detected in the oils. Total unsaturation for the oils was calculated as 77.50%, 77.44%, and 79.72%, respectively. In vitro antioxidant, anticholinesterase and antimicrobial activities were also studied. The ethyl acetate extract of Agaricus bitorquis showed the highest activity in β-carotene-linoleic acid, DPPH(·) and ABTS(·)(+) assays, while the hexane extract of Agaricus bisporus exhibited the best metal chelating activity. The ethyl acetate and hexane extract of Agaricus bitorquis and the hexane extract of Agaricus essettei showed meaningful butyrylcholinesterase activity being close to that of galantamine. The extracts were found to be effective on Gram (+) bacteria, especially against Micrococcus luteus, Micrococcus flavus, Bacillus subtilis and Bacillus cereus. In conclusion, Agaricus bitorquis and Agaricus essettei demonstrated higher iron content, and better antioxidant, anticholinesterase and antimicrobial activities than those of Agaricus bisporus commonly consumed mushroom. Hence, Agaricus species, particularly Agaricus bitorquis might be useful as antioxidant agents and moderate anticholinesterase agents, and their extracts will probably be used for development of dietary foods, food products and additives. Copyright © 2011 Elsevier Ltd. All rights reserved.

Capsule-Transmitted Gut Symbiotic Bacterium of the Japanese Common Plataspid Stinkbug, Megacopta punctatissima

PubMed Central

Fukatsu, Takema; Hosokawa, Takahiro

2002-01-01

The Japanese common plataspid stinkbug, Megacopta punctatissima, deposits small brown particles, or symbiont capsules, on the underside of the egg mass for the purpose of transmission of symbiotic bacteria to the offspring. We investigated the microbiological aspects of the bacteria contained in the capsule, such as microbial diversity, phylogenetic placement, localization in vivo, and fitness effects on the host insect. Restriction fragment length polymorphism analysis of 16S ribosomal DNA clones revealed that a single bacterial species dominates the microbiota in the capsule. The bacterium was not detected in the eggs but in the capsules, which unequivocally demonstrated that the bacterium is transmitted to the offspring of the insect orally rather than transovarially, through probing of the capsule content. Molecular phylogenetic analysis showed that the bacterium belongs to the γ-subdivision of the Proteobacteria. In adult insects the bacterium was localized in the posterior section of the midgut. Deprivation of the bacterium from the nymphs resulted in retarded development, arrested growth, abnormal body coloration, and other symptoms, suggesting that the bacterium is essential for normal development and growth of the host insect. PMID:11772649

Swimming efficiency of bacterium Escherichia coli

PubMed Central

Chattopadhyay, Suddhashil; Moldovan, Radu; Yeung, Chuck; Wu, X. L.

2006-01-01

We use measurements of swimming bacteria in an optical trap to determine fundamental properties of bacterial propulsion. In particular, we directly measure the force required to hold the bacterium in the optical trap and determine the propulsion matrix, which relates the translational and angular velocity of the flagellum to the torques and forces propelling the bacterium. From the propulsion matrix, dynamical properties such as torques, swimming speed, and power can be obtained by measuring the angular velocity of the motor. We find significant heterogeneities among different individuals even though all bacteria started from a single colony. The propulsive efficiency, defined as the ratio of the propulsive power output to the rotary power input provided by the motors, is found to be ≈2%, which is consistent with the efficiency predicted theoretically for a rigid helical coil. PMID:16954194

Coiled to diffuse: Brownian motion of a helical bacterium.

PubMed

Butenko, Alexander V; Mogilko, Emma; Amitai, Lee; Pokroy, Boaz; Sloutskin, Eli

2012-09-11

We employ real-time three-dimensional confocal microscopy to follow the Brownian motion of a fixed helically shaped Leptospira interrogans (LI) bacterium. We extract from our measurements the translational and the rotational diffusion coefficients of this bacterium. A simple theoretical model is suggested, perfectly reproducing the experimental diffusion coefficients, with no tunable parameters. An older theoretical model, where edge effects are neglected, dramatically underestimates the observed rates of translation. Interestingly, the coiling of LI increases its rotational diffusion coefficient by a factor of 5, compared to a (hypothetical) rectified bacterium of the same contour length. Moreover, the translational diffusion coefficients would have decreased by a factor of ~1.5, if LI were rectified. This suggests that the spiral shape of the spirochaete bacteria, in addition to being employed for their active twisting motion, may also increase the ability of these bacteria to explore the surrounding fluid by passive Brownian diffusion.

[Partial biological characteristics and algicidal activity of an algicidal bacterium].

PubMed

Li, San-Hua; Zhang, Qi-Ya

2013-02-01

An algicidal bacterium was isolated from freshwater (Lake Donghu in Wuhan) and coded as A01. The morphology of the algicidal bacterium was observed using optical microscope and electron microscopes, the results showed that A01 was rod-shaped, approximately 1.5 microm in length and 0.45 microm in width and with no flagella structure. A01 was Gram-negative and belongs to the family Acinetobacter sp. though identification by Gram's staining and 16S rDNA gene analysis. A01 exhibited strong algicidal activity on the bloom-forming cyanobacterium Anabaena eucompacta under laboratory conditions. The removal rate of chlorophyll a after 7-day incubation with the culture supernatant of A01 and thalli were 77% and 61%, respectively. Microscopic observation showed that almost all cyanobacterial cells were destroyed within 3 d of co-incubation with the supernatant of algicidal bacterium, but a mass of the cyanobacterial cell lysis was observed only after 5 d of co-incubation with the thalli of algicidal bacterium. These results indicated that the main algicidal component of A01 was in its culture supernatant. In other words, the strain A01 could secrete algicidal component against Anabaena eucompacta.

Numerical approach to reference identification of Staphylococcus, Stomatococcus, and Micrococcus spp.

PubMed

Rhoden, D L; Hancock, G A; Miller, J M

1993-03-01

A numerical-code system for the reference identification of Staphylococcus species, Stomatococcus mucilaginosus, and Micrococcus species was established by using a selected panel of conventional biochemicals. Results from 824 cultures (289 eye isolate cultures, 147 reference strains, and 388 known control strains) were used to generate a list of 354 identification code numbers. Each six-digit code number was based on results from 18 conventional biochemical reactions. Seven milliliters of purple agar base with 1% sterile carbohydrate solution added was poured into 60-mm-diameter agar plates. All biochemical tests were inoculated with 1 drop of a heavy broth suspension, incubated at 35 degrees C, and read daily for 3 days. All reactions were read and interpreted by the method of Kloos et al. (G. A. Hebert, C. G. Crowder, G. A. Hancock, W. R. Jarvis, and C. Thornsberry, J. Clin. Microbiol. 26:1939-1949, 1988; W. E. Kloos and D. W. Lambe, Jr., P. 222-237, in A. Balows, W. J. Hansler, Jr., K. L. Herrmann, H. D. Isenberg, and H. J. Shadomy, ed., Manual of Clinical Microbiology, 5th ed., 1991). This modified reference identification method was 96 to 98% accurate and could have value in reference and public health laboratory settings.

Functional properties of honey supplemented with bee bread and propolis.

PubMed

Kowalski, S; Makarewicz, M

2017-11-01

The aim of this work was characterisation of functional properties of honey enriched with propolis and beebread. In first step of experiment, soft propolis extract (SPEx) was obtained by extraction of propolis with ethanol. SPEx (0.25 to 1.0% w/w) as well as beebread (5 to 15% w/w) were implemented into natural honey. Fortified honeys were investigated in terms of total phenolic content, radical scavenging activity and ferric reducing antioxidant power, also their effects on the micro-organisms growth was examined. It was found that beebread had the most significant influence on antioxidant properties. On the other hand, all tested honeys showed antibacterial activity against Escherichia coli but not against Micrococcus luteus. Honeys with 1% of propolis addition were the most effective in this case. Research has indicated that for antioxidant and antimicrobial properties of honey, it is beneficial to enrich it in both beebread and propolis.

Antimicrobial activity of honokiol and magnolol isolated from Magnolia officinalis.

PubMed

Ho, K Y; Tsai, C C; Chen, C P; Huang, J S; Lin, C C

2001-03-01

The antimicrobial activity of honokiol and magnolol, the main constituents of Magnolia officinalis was investigated. The antimicrobial activity was assayed by the agar dilution method using brain heart infusion medium and the minimum inhibitory concentration (MIC) were determined for each compound using a twofold serial dilution assay. The results showed that honokiol and magnolol have a marked antimicrobial effect (MIC = 25 microg/mL) against Actinobacillus actinomycetemcomitans, Porphyromonas gingivalis, Prevotella intermedia, Micrococcus luteus and Bacillus subtilis, but did not show antimicrobial activity (MIC > or = 100 microg/mL) for Shigella flexneii, Staphylococcus epidermidis, Enterobacter aerogenes, Proteus vulgaris, Escherichia coli and Pseudomonas aeruginosa. Our results indicate that honokiol and magnolol, although less potent than tetracycline, show a significant antimicrobial activity for periodontal pathogens. Hence we suggest that honokiol and magnolol might have the potential to be an adjunct in the treatment of periodontitis. Copyright 2001 John Wiley & Sons, Ltd.

New Benzophenones and Xanthones from Cratoxylum sumatranum ssp. neriifolium and Their Antibacterial and Antioxidant Activities.

PubMed

Tantapakul, Cholpisut; Maneerat, Wisanu; Sripisut, Tawanun; Ritthiwigrom, Thunwadee; Andersen, Raymond J; Cheng, Ping; Cheenpracha, Sarot; Raksat, Achara; Laphookhieo, Surat

2016-11-23

Two new benzophenones (1 and 2) and four new xanthones (4-6 and 17) together with 24 known compounds (3, 7-16, and 18-30) were isolated from the roots and twigs of Cratoxylum sumatranum ssp. neriifolium. Their structures were elucidated by spectroscopic methods. Compounds 5 and 26 showed antibacterial activity against Micrococcus luteus, Bacillus cereus, and Staphylococcus epidermis with minimum inhibitory concentrations ranging from 4 to 8 μg/mL, whereas compounds 7, 20, and 26 displayed selective antibacterial activities against Staphylococcus aureus (8 μg/mL), Salmonella typhimurium (4 μg/mL), and Pseudomonas aeruginosa (4 μg/mL), respectively. The radical scavenging effects of some isolated compounds were investigated. Compounds 11 and 21 exhibited potent activity against 2,2-diphenyl-1-picrylhydrazyl (DPPH) with IC 50 values of 7.0 ± 1.0 and 6.0 ± 0.2 μM, respectively.

Characterizing the Catalytic Potential of Deinococcus, Arthrobacter and other Robust Bacteria in Contaminated Subsurface Environments of the Hanford Site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Daly, Michael J.

2006-05-01

Ionizing Radiation (IR) Resistance in Bacteria. Until recently, there have been no clear physiologic predictors of a cell's ability to recover from ionizing radiation (IR) and other DOE-relevant oxidative stress conditions. In general, the most resistant bacteria have been Gram-positive (e.g., Deinococcus, Arthrobacter, Lactobacillus & Enterococcus spp.) and the most sensitive have been Gram-negative (e.g., Pseudomonas, Shewanella & Neisseria spp.). However, there are several reported exceptions to this paradigm, the Gram-negative cyanobacterium Chroococcidiopsis is extremely resistant to IR, whereas the Gram-positive Micrococcus luteus is sensitive. We have identified biomolecular signatures for radiation sensitivity and resistance which are independent of phylogeny,more » where very high and very low intracellular Mn/Fe concentration ratios correlated with very high and very low resistances, respectively; and restricting Mn(II) in the famously resistant Deinococcus radiodurans sensitized this eubacterium to IR.« less

Characterizing the Catalytic Potential of Deinococcus, Arthrobacter and other Robust Bacteria in Contaminated Subsurface Environments of the Hanford Site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fredrickson, Jim K.; Daly, Michael J.

2006-06-01

Until recently, there have been no clear physiologic predictors of a cell's ability to recover from ionizing radiation (IR), desiccation, and other DOE-relevant oxidative stress conditions. In general, the most resistant bacteria have been Gram-positive (e.g., Deinococcus, Arthrobacter, Lactobacillus & Enterococcus spp.) and the most sensitive have been Gram-negative (e.g., Pseudomonas, Shewanella & Neisseria spp.). However, there are several reported exceptions to this paradigm, the Gram-negative cyanobacterium Chroococcidiopsis is extremely resistant to IR, whereas the Gram-positive Micrococcus luteus is sensitive. We have identified biomolecular signatures for radiation sensitivity and resistance which are independent of phylogeny, where very high and verymore » low intracellular Mn/Fe concentration ratios correlated with very high and very low resistances, respectively; and restricting Mn(II) in the famously resistant Deinococcus radiodurans sensitized this eubacterium to IR (http://cfyn.ifas.ufl.edu/radiation.pdf).« less

Influence of environmental factors on composition of volatile constituents and biological activity of Helichrysum italicum (Roth) Don (Asteraceae).

PubMed

Tundis, R; Statti, G A; Conforti, F; Bianchi, A; Agrimonti, C; Sacchetti, G; Muzzoli, M; Ballero, M; Menichini, F; Poli, F

2005-06-01

The biovariability of Helichrysum italicum (Roth) Don grown wild in Calabria and Sardinia (Italy) was reported. This species has been characterized through the detection, isolation and quantitative evaluation of chemical markers (alpha-terpinolene, trans-cariophyllene and neryl acetate) by GC and GC-MS. Antioxidant activity of the methanolic H. italicum extracts using DPPH and beta-carotene bleaching test showed that the Calabrian samples were more active than those from Sardinia. The antibacterial activity of all extracts evidenced the best performance on the Gram positive bacteria particularly on Micrococcus luteus. Moreover, antifungal activity of all extracts was also tested evidencing important results particularly on the phytopathogene fungus Pythium ultimum. In general, as regards the antifungal activity, the extracts from Sardinia were more active than those from Calabria. The phytochemical analysis and the biological activity data suggested a possible use of these plant matrices in alimentary, cosmetic and pharmaceutical fields.

Synthesis, characterization, antimicrobial activity and theoretical studies of new thiophene-based tripodal ligands

NASA Astrophysics Data System (ADS)

Harit, Tarik; Bellaouchi, Reda; Asehraou, Abdeslam; Rahal, Mahmoud; Bouabdallah, Ibrahim; Malek, Fouad

2017-04-01

The synthesis of new thiophene-tripods with different side arms was reported. These compounds were obtained in good yields and their structures were confirmed by NMR spectroscopy, elemental analysis, infrared spectroscopy and mass spectrometry. The in vitro antibacterial and antifungal activities of these products were screened against Gram positive bacteria (Micrococcus luteus and Bacillus subtilis), Gram negative bacteria (Escherichia coli) and fungi (Candida pelliculosa). The obtained results showed that tripods containing a hydroxyl group in the side arm inhibited both Gram-positive and Gram-negative bacteria, while the tripod with an isopropyl side arm inhibited only the Gram-negative bacteria. DFT calculations with B3LYP/6-31G* level have been used to analyze the electronic and geometric characteristics. The molecular electrostatic potential surface (MEPS) indicated that the presence of electrophile site in the side arm could be responsible for activities against Gram-positive bacteria.

Synthesis of some metallophthalocyanines with dimethyl 5-(phenoxy)-isophthalate substituents and evaluation of their antioxidant-antibacterial activities

NASA Astrophysics Data System (ADS)

Salih Ağırtaş, M.; Karataş, Ceyhun; Özdemir, Sadin

2015-01-01

The synthesis, characterization, spectral, antioxidant and antibacterial properties of dimethyl 5-(phenoxy)-isophthalate substituted Zinc, Cobalt, Copper, and Nickel phthalocyanines are reported. The novel compounds have been characterized by using electronic absorption, nuclear magnetic resonance spectroscopy, infrared, elemental analysis and mass spectrometry. The antioxidant and antibacterial activities of newly synthesized phthalocyanines and its starting material are tested. The DPPH free radical scavenging ability of phthalocyanine Co(II) and Zn(II) complexes on DPPH are 44.8% and 40.1% at 100 mg/L concentration, respectively. The phthalocyanine Co(II) and Cu(II) complexes show very strong ferrous ion chelating activity of 91.2% and 89.3% at concentration of 100 mg/L, respectively. Compound 3 displays strong reducing power like α-tocopherol. Antibacterial activities of phthalocyanine Co(II) and Amikacin (30 μg/disk) against Micrococcus luteus (ATCC 9341) are 16 mm in diameter.

Activity and immunodetection of lysozyme in earthworm Dendrobaena veneta (Annelida).

PubMed

Fiołka, Marta J; Zagaja, Mirosław P; Hułas-Stasiak, Monika; Wielbo, Jerzy

2012-01-01

In the present study, lysozyme-like activity against Micrococcus luteus was detected in the coelomic fluid, the extract from coelomocytes, intestine and in the homogenates from cocoons of Dendrobaena veneta. Four hours after immunization with Escherichia coli, the lysozyme activity in the coelomic fluid increased about three times and in the extract of coelomocytes - four times, in comparison to the control. In three cases: of the coelomic fluid, the homogenates from cocoons and the extract from coelomocytes, the antibody against HEWL (hen egg white lysozyme) recognized only one protein with a molecular mass of about 14.4 kDa. In the coelomic fluid, apart from the protein with molecular mass of 14.4 kDa the antibody directed against human lysozyme recognized an additional protein of 22 kDa. Using the bioautography technique after electrophoretic resolution of native proteins in acidic polyacrylamide gels, two lytic zones of M. luteus were observed in the case of the coelomic fluid and three after the analysis of the extract of coelomocytes and the egg homogenates. The results indicated the existence of several forms of lysozyme with a different electric charge in the analyzed D. veneta samples. The highest lysozyme activity in the intestine of D. veneta was observed in the midgut. The antibody directed against human lysozyme indicated a strong positive signal in epidermal and midgut cells of earthworm. Copyright © 2011 Elsevier Inc. All rights reserved.

Resistance of bacterial biofilms formed on stainless steel surface to disinfecting agent.

PubMed

Królasik, Joanna; Zakowska, Zofia; Krepska, Milena; Klimek, Leszek

2010-01-01

The natural ability of microorganisms for adhesion and biofilm formation on various surfaces is one of the factors causing the inefficiency of a disinfection agent, despite its proven activity in vitro. The aim of the study was to determine the effectiveness of disinfecting substances on bacterial biofilms formed on stainless steel surface. A universally applied disinfecting agent was used in the tests. Bacterial strains: Listeria innocua, Pseudomonas putida, Micrococcus luteus, Staphylococcus hominis strains, were isolated from food contact surfaces, after a cleaning and disinfection process. The disinfecting agent was a commercially available acid specimen based on hydrogen peroxide and peroxyacetic acid, the substance that was designed for food industry usage. Model tests were carried out on biofilm formed on stainless steel (type 304, no 4 finish). Biofilms were recorded by electron scanning microscope. The disinfecting agent in usable concentration, 0.5% and during 10 minutes was ineffective for biofilms. The reduction of cells in biofilms was only 1-2 logarithmic cycles. The use of the agent in higher concentration--1% for 30 minutes caused reduction of cell number by around 5 logarithmic cycles only in the case of one microorganism, M. luteus. For other types: L. innocua, P. putida, S. hominis, the requirements placed on disinfecting agents were not fulfilled. The results of experiments proved that bacterial biofilms are resistant to the disinfectant applied in its operational parameters. Disinfecting effectiveness was achieved after twofold increase of the agent's concentration.

Clearing of suspensions of Micrococcus lysodeikticus catalysed by lysozymes from hen, goose, and turkey egg whites, human milk, and phage T4. Assessment of potential as signal generators for homogeneous enzyme immunoassays for urinary steroids.

PubMed

Cooke, Delwyn G; Blackwell, Leonard F

2007-01-01

Lysozymes (3.2.1.17) from goose (Anser anser) egg white, turkey (Melagris gallopavo) egg white, phage T4 and human milk were compared with hen egg white lysozyme in their ability to clear a suspension of Micrococcus lysodeikticus. All of the lysozymes, except hen egg white lysozyme, catalysed the clearing of the Micrococcus lysodeikticus suspension in a biphasic fashion. Compared to hen egg white lysozyme, the total absorbance or transmission change over 5 and 20 minutes was less in all cases, except for human lysozyme. Human lysozyme was, therefore, a potential alternative, more rapid signal generator for the measurement of urinary estrone glucuronide excretion rates because of its structural similarity to hen egg white lysozyme. The apparent K(M) values for hen egg white lysozyme increased with the enzyme concentration.

Gut bacterium of Dendrobaena veneta (Annelida: Oligochaeta) possesses antimycobacterial activity.

PubMed

Fiołka, Marta J; Zagaja, Mirosław P; Piersiak, Tomasz D; Wróbel, Marek; Pawelec, Jarosław

2010-09-01

The new bacterial strain with antimycobacterial activity has been isolated from the midgut of Dendrobaena veneta (Annelida). Biochemical and molecular characterization of isolates from 18 individuals identified all as Raoultella ornithinolytica genus with 99% similarity. The bacterium is a possible symbiont of the earthworm D. veneta. The isolated microorganism has shown the activity against four strains of fast-growing mycobacteria: Mycobacterium butiricum, Mycobacterium jucho, Mycobacterium smegmatis and Mycobacterium phlei. The multiplication of the gut bacterium on plates with Sauton medium containing mycobacteria has caused a lytic effect. After the incubation of the cell free extract prepared from the gut bacterium with four strains of mycobacteria in liquid Sauton medium, the cells of all tested strains were deformed and divided to small oval forms and sometimes created long filaments. The effect was observed by the use of light, transmission and scanning microscopy. Viability of all examined species of mycobacteria was significantly decreased. The antimycobacterial effect was probably the result of the antibiotic action produced by the gut bacterium of the earthworm. The application of ultrafiltration procedure allowed to demonstrate that antimicrobial substance with strong antimycobacterial activity from bacterial culture supernatant, is a protein with the molecular mass above 100 kDa. Copyright 2010 Elsevier Inc. All rights reserved.

Characterization of the promising poly(3-hydroxybutyrate) producing halophilic bacterium Halomonas halophila.

PubMed

Kucera, Dan; Pernicová, Iva; Kovalcik, Adriana; Koller, Martin; Mullerova, Lucie; Sedlacek, Petr; Mravec, Filip; Nebesarova, Jana; Kalina, Michal; Marova, Ivana; Krzyzanek, Vladislav; Obruca, Stanislav

2018-05-01

This work explores molecular, morphological as well as biotechnological features of the highly promising polyhydroxyalkanoates (PHA) producer Halomonas halophila. Unlike many other halophiles, this bacterium does not require expensive complex media components and it is capable to accumulate high intracellular poly(3-hydroxybutyrate) (PHB) fractions up to 82% of cell dry mass. Most remarkably, regulating the concentration of NaCl apart from PHB yields influences also the polymer's molecular mass and polydispersity. The bacterium metabolizes various carbohydrates including sugars predominant in lignocelluloses and other inexpensive substrates. Therefore, the bacterium was employed for PHB production on hydrolysates of cheese whey, spent coffee grounds, sawdust and corn stover, which were hydrolyzed by HCl; required salinity of cultivation media was set up during neutralization by NaOH. The bacterium was capable to use all the tested hydrolysates as well as sugar beet molasses for PHB biosynthesis, indicating its potential for industrial PHB production. Copyright © 2018 Elsevier Ltd. All rights reserved.

New method for investigation of cells and other biological objects in analytical cytology

NASA Astrophysics Data System (ADS)

Bilyi, Olexander I.; Getman, Vasyl B.; Kostyukevych, Sergey A.

2001-05-01

New method and instrument intended for checking the content of biology particles in dimension band 0.1-10.0 mkm in water flow is described in this report. The instrument measures the intensity of light scattered by the particles suspended in liquid flow when they are crossing the laser beam. The results of studying light scattered by platelet and bacterium's such a Pseudomonas aeruginosa, Escherichia coli, Micrococcus lutteus in such a liquid mediums as physiological solution and glucose solution are described.

[Study on anti-bacterium activity of ginkgolic acids and their momomers].

PubMed

Yang, Xiaoming; Zhu, Wei; Chen, Jun; Qian, Zhiyu; Xie, Jimin

2004-09-01

Ginkgolic acids and their three monomers were separated from ginkgo sarcotestas. The anti-bacterium activity of ginkgolic acids were tested. The relation between the anti-bacterium activity and side chain of ginkgolic acid were studied. The MIC of ginkgolic acids and their three monomers and salicylic acid were tested. Ginkgolic acid has strong inhibitive effect on G+-bacterium. Salicylic acid has no side chain, so no anti-bacterial activity. When the length of gingkolic acid side chain is C13:0, it has the strongest anti-bacterial activity in three monomers. The side chain of ginkgolic acid is the key functional group that possessed anti-bacterial activity. The length of Ginkgolic acid was the main effective factor of anti-bacterial activity.

Irradiation of Microbes from Spent Nuclear Fuel Storage Pool Environments

DOE Office of Scientific and Technical Information (OSTI.GOV)

Breckenridge, C.R.; Watkins, C.S.; Bruhn, D.F.

Microbes have been isolated and identified from spent nuclear fuel storage pools at the Idaho National Engineering and Environmental Laboratory (INEEL). Included among these are Corynebacterium aquaticum, Pseudomonas putida, Comamonas acidovorans, Gluconobacter cerinus, Micrococcus diversus, Rhodococcus rhodochrous, and two strains of sulfate-reducing bacteria (SRB). We examined the sensitivity of these microbes to a variety of total exposures of radiation generated by a 6-MeV linear accelerator (LINAC). The advantage of using a LINAC is that it provides a relatively quick screen of radiation tolerance. In the first set of experiments, we exposed each of the aforementioned microbes along with four additionalmore » microbes, pseudomonas aeruginosa, Micrococcus luteus, Escherchia coli, and Deinococcus radiodurans to exposures of 5 x 10{sup 3} and 6 x 10{sup 4} rad. All microbial specimens withstood the lower exposure with little or no reduction in cell population. Upon exposing the microbes to the larger dose of 6 x 10{sup 4} rad, we observed two distinct groupings: microbes that demonstrate resistance to radiation, and microbes that display intolerance through a dramatic reduction from their initial population. Microbes in the radiation tolerant grouping were exposed to 1.1 x 10{sup 5} rad to examine the extent of their resistance. We observe a correlation between radiation resistance and gram stain. The gram-positive species we examined seem to demonstrate a greater radiation resistance.« less

Sponge-Derived Kocuria and Micrococcus spp. as Sources of the New Thiazolyl Peptide Antibiotic Kocurin

PubMed Central

Palomo, Sara; González, Ignacio; de la Cruz, Mercedes; Martín, Jesús; Tormo, José Rubén; Anderson, Matthew; Hill, Russell T.; Vicente, Francisca; Reyes, Fernando; Genilloud, Olga

2013-01-01

Forty four marine actinomycetes of the family Microccocaceae isolated from sponges collected primarily in Florida Keys (USA) were selected from our strain collection to be studied as new sources for the production of bioactive natural products. A 16S rRNA gene based phylogenetic analysis showed that the strains are members of the genera Kocuria and Micrococcus. To assess their biosynthetic potential, the strains were PCR screened for the presence of secondary metabolite genes encoding nonribosomal synthetase (NRPS) and polyketide synthases (PKS). A small extract collection of 528 crude extracts generated from nutritional microfermentation arrays was tested for the production of bioactive secondary metabolites against clinically relevant strains (Bacillus subtilis, methicillin-resistant Staphylococcus aureus (MRSA), Acinetobacter baumannii and Candida albicans). Three independent isolates were shown to produce a new anti-MRSA bioactive compound that was identified as kocurin, a new member of the thiazolyl peptide family of antibiotics emphasizing the role of this family as a prolific resource for novel drugs. PMID:23538871

Sponge-derived Kocuria and Micrococcus spp. as sources of the new thiazolyl peptide antibiotic kocurin.

PubMed

Palomo, Sara; González, Ignacio; de la Cruz, Mercedes; Martín, Jesús; Tormo, José Rubén; Anderson, Matthew; Hill, Russell T; Vicente, Francisca; Reyes, Fernando; Genilloud, Olga

2013-03-28

Forty four marine actinomycetes of the family Microccocaceae isolated from sponges collected primarily in Florida Keys (USA) were selected from our strain collection to be studied as new sources for the production of bioactive natural products. A 16S rRNA gene based phylogenetic analysis showed that the strains are members of the genera Kocuria and Micrococcus. To assess their biosynthetic potential, the strains were PCR screened for the presence of secondary metabolite genes encoding nonribosomal synthetase (NRPS) and polyketide synthases (PKS). A small extract collection of 528 crude extracts generated from nutritional microfermentation arrays was tested for the production of bioactive secondary metabolites against clinically relevant strains (Bacillus subtilis, methicillin-resistant Staphylococcus aureus (MRSA), Acinetobacter baumannii and Candida albicans). Three independent isolates were shown to produce a new anti-MRSA bioactive compound that was identified as kocurin, a new member of the thiazolyl peptide family of antibiotics emphasizing the role of this family as a prolific resource for novel drugs.

Endohyphal Bacterium Enhances Production of Indole-3-Acetic Acid by a Foliar Fungal Endophyte

PubMed Central

Hoffman, Michele T.; Gunatilaka, Malkanthi K.; Wijeratne, Kithsiri; Gunatilaka, Leslie; Arnold, A. Elizabeth

2013-01-01

Numerous plant pathogens, rhizosphere symbionts, and endophytic bacteria and yeasts produce the important phytohormone indole-3-acetic acid (IAA), often with profound effects on host plants. However, to date IAA production has not been documented among foliar endophytes -- the diverse guild of primarily filamentous Ascomycota that live within healthy, above-ground tissues of all plant species studied thus far. Recently bacteria that live within hyphae of endophytes (endohyphal bacteria) have been detected, but their effects have not been studied previously. Here we show not only that IAA is produced in vitro by a foliar endophyte (here identified as Pestalotiopsis aff. neglecta, Xylariales), but that IAA production is enhanced significantly when the endophyte hosts an endohyphal bacterium (here identified as Luteibacter sp., Xanthomonadales). Both the endophyte and the endophyte/bacterium complex appear to rely on an L-tryptophan dependent pathway for IAA synthesis. The bacterium can be isolated from the fungus when the symbiotic complex is cultivated at 36°C. In pure culture the bacterium does not produce IAA. Culture filtrate from the endophyte-bacterium complex significantly enhances growth of tomato in vitro relative to controls and to filtrate from the endophyte alone. Together these results speak to a facultative symbiosis between an endophyte and endohyphal bacterium that strongly influences IAA production, providing a new framework in which to explore endophyte-plant interactions. PMID:24086270

Surface Plasmon Resonance based sensing of lysozyme in serum on Micrococcus lysodeikticus-modified graphene oxide surfaces.

PubMed

Vasilescu, Alina; Gáspár, Szilveszter; Gheorghiu, Mihaela; David, Sorin; Dinca, Valentina; Peteu, Serban; Wang, Qian; Li, Musen; Boukherroub, Rabah; Szunerits, Sabine

2017-03-15

Lysozyme is an enzyme found in biological fluids, which is upregulated in leukemia, renal diseases as well as in a number of inflammatory gastrointestinal diseases. We present here the development of a novel lysozyme sensing concept based on the use of Micrococcus lysodeikticus whole cells adsorbed on graphene oxide (GO)-coated Surface Plasmon Resonance (SPR) interfaces. M. lysodeikticus is a typical enzymatic substrate for lysozyme. Unlike previously reported sensors which are based on the detection of lysozyme through bioaffinity interactions, the bioactivity of lysozyme will be used here for sensing purposes. Upon exposure to lysozyme containing serum, the integrity of the bacterial cell wall is affected and the cells detach from the GO based interfaces, causing a characteristic decrease in the SPR signal. This allows sensing the presence of clinically relevant concentrations of lysozyme in undiluted serum samples. Copyright © 2016 Elsevier B.V. All rights reserved.

A novel phagocytic receptor (CgNimC) from Pacific oyster Crassostrea gigas with lipopolysaccharide and gram-negative bacteria binding activity.

PubMed

Wang, Weilin; Liu, Rui; Zhang, Tao; Zhang, Ran; Song, Xuan; Wang, Lingling; Song, Linsheng

2015-03-01

Phagocytosis is an evolutionarily conserved process to ingest the invading microbes and apoptotic or necrotic corpses, playing vital roles in defensing invaders and maintenance of normal physiological conditions. In the present study, a new Nimrod family phagocytic receptor with three EGF-like domains was identified in Pacific oyster Crassostrea gigas (designated CgNimC). CgNimC shared homology with other identified multiple EGF-like domain containing proteins. The mRNA transcripts of CgNimC were mainly distributed in mantle and hemocytes. Its relative expression level in hemocytes was significantly (P < 0.01) up-regulated after the injection of bacteria Vibrio anguillarum. Different to the NimC in Drosophila and Anopheles gambiae, the recombinant protein of CgNimC (rCgNimC) could bind directly to two gram-negative bacteria V. anguillarum and Vibrio splendidus, but not to gram-positive bacteria Staphylococci aureus, Micrococcus luteus or fungi Yarrowia lipolytica and Pichia pastoris. The affinity of rCgNimC toward M. luteus and Y. lipolytica was enhanced when the microorganisms were pre-incubated with the cell free hemolymph. rCgNimC exhibited higher affinity to lipopolysaccharide (LPS) and relatively lower affinity to peptidoglycan (PGN), while no affinity to glucan (GLU). After the CgNimC receptor was blocked by anti-rCgNimC antibody in vitro, the phagocytic rate of hemocytes toward two gram-negative bacteria V. anguillarum and V. splendidus was reduced significantly (P < 0.05), but no significant change of phagocytic rate was observed toward M. luteus and Y. lipolytica. All these results implied that CgNimC, with significant binding capability to LPS and gram-negative bacteria, was a novel phagocytic receptor involved in immune response of Pacific oyster. Further, it was speculated that receptors of Nimrod family might function as a phagocytic receptor to recognize PAMPs on the invaders and its recognition could be promoted by opsonization of molecules in

Direct measurement of interaction forces between a single bacterium and a flat plate.

PubMed

Klein, Jonah D; Clapp, Aaron R; Dickinson, Richard B

2003-05-15

A technique for precisely measuring the equilibrium and viscous interaction forces between a single bacterium and a flat surface as functions of separation distance is described. A single-beam gradient optical trap was used to micromanipulate the bacterium against a flat surface while evanescent wave light scattering was used to measure separation distances. Calibrating the optical trap far from the surface allowed the trapped bacterium to be used as a force probe. Equilibrium force-distance profiles were determined by measuring the deflection of the cell from the center of the optical trap at various trap positions. Simultaneously, viscous forces were determined by measuring the relaxation time for the fluctuating bacterium. Absolute distances were determined using a best-fit approximation to the theoretical prediction for the hindered mobility of a diffusing sphere near a wall. Using this approach, forces in the range from 0.01 to 4 pN were measured at near-nanometer resolution between Staphylococcus aureus and glass that was bare or coated with adsorbed protein.

Chitosan/Mimosa tenuiflora films as potential cellular patch for skin regeneration.

PubMed

Valencia-Gómez, Laura Elizabeth; Martel-Estrada, Santos Adriana; Vargas-Requena, Claudia; Rivera-Armenta, José Luis; Alba-Baena, Noe; Rodríguez-González, Claudia; Olivas-Armendáriz, Imelda

2016-12-01

Bio-composites films were prepared by casting and drying of aqueous solutions containing different weight ratios of chitosan and bark of Mimosa tenuiflora. The physico-chemical and functional properties of the films were characterized by scanning electron microscopy, dynamical mechanical analysis, wettability, cytotoxicity and in vitro antibacterial activities. The morphology studies confirmed that the presence of Mimosa tenuiflora change the surface of films. Moreover, the incorporation of Mimosa tenuiflora improved the thermal stability of the films, as it was indicated by the changes in the glass temperatures obtained. Water-uptake ability changed in relation to polymeric composition of film. This property increased by the addition of Mimosa tenuiflora to the film. Improved antibacterial properties were measured against Escherichia Coli and Micrococcus lysodeikticus or luteus. Finally, cytotoxicity was studied by MTT assay and the films were non-toxic. These preliminary results provide a cheap way to prepare chitosan/Mimosa tenuiflora films for wound healing and skin regeneration. Copyright © 2016 Elsevier B.V. All rights reserved.

Chemical composition, antimicrobial, insecticidal, phytotoxic and antioxidant activities of Mediterranean Pinus brutia and Pinus pinea resin essential oils.

PubMed

Ulukanli, Zeynep; Karabörklü, Salih; Bozok, Fuat; Ates, Burhan; Erdogan, Selim; Cenet, Menderes; Karaaslan, Merve Göksin

2014-12-01

Essential oils of the resins of Pinus brutia and Pinus pinea were evaluated for their biological potential. Essential oils were characterized using GC-MS and GC/FID. in vitro antimicrobial, phytotoxic, antioxidant, and insecticidal activities were carried out using the direct contact and the fumigant assays, respectively. The chemical profile of the essential oils of the resins of P. pinea and P. brutia included mainly α-pinene (21.39% and 25.40%), β-pinene (9.68% and 9.69%), and caryophyllene (9.12% and 4.81%). The essential oils of P. pinea and P. brutia exerted notable antimicrobial activities on Micrococcus luteus and Bacillus subtilis, insecticidal activities on Ephestia kuehniella eggs, phytotoxic activities on Lactuca sativa, Lepidium sativum, and Portulaca oleracea, as well as antioxidant potential. Indications of the biological activities of the essential oils suggest their use in the formulation of ecofriendly and biocompatible pharmaceuticals. Copyright © 2014 China Pharmaceutical University. Published by Elsevier B.V. All rights reserved.

Antimicrobial activity of antihypertensive food-derived peptides and selected alanine analogues.

PubMed

McClean, Stephen; Beggs, Louise B; Welch, Robert W

2014-03-01

This study evaluated four food-derived peptides with known antihypertensive activities for antimicrobial activity against pathogenic microorganisms, and assessed structure-function relationships using alanine analogues. The peptides (EVSLNSGYY, barley; PGTAVFK, soybean; TTMPLW, α-casein; VHLPP, α-zein) and the six alanine substitution peptides of PGTAVFK were synthesised, characterised and evaluated for antimicrobial activity using the bacteria, Escherichia coli, Staphylococcus aureus, and Micrococcus luteus and the yeast, Candida albicans. The peptides TTMPLW and PGTAVFK inhibited growth of all four microorganisms tested, with activities of a similar order of magnitude to ampicillin and ethanol controls. EVSLNSGYY inhibited the growth of the bacteria, but VHLPP showed no antimicrobial activity. The alanine analogue, PGAAVFK showed the highest overall antimicrobial activity and PGTAVFA showed no activity; overall, the activities of the analogues were consistent with their structures. Some peptides with antihypertensive activity also show antimicrobial activity, suggesting that food-derived peptides may exert beneficial effects via a number of mechanisms. Copyright © 2013 Elsevier Ltd. All rights reserved.

Antibacterial Activity of the Alkaloid-Enriched Extract from Prosopis juliflora Pods and Its Influence on in Vitro Ruminal Digestion

PubMed Central

dos Santos, Edilene T.; Pereira, Mara Lúcia A.; da Silva, Camilla Flávia P.G.; Souza-Neta, Lourdes C.; Geris, Regina; Martins, Dirceu; Santana, Antônio Euzébio G.; Barbosa, Luiz Cláudio A.; Silva, Herymá Giovane O.; Freitas, Giovana C.; Figueiredo, Mauro P.; de Oliveira, Fernando F.; Batista, Ronan

2013-01-01

The purpose of this study was to assess the in vitro antimicrobial activity of alkaloid-enriched extracts from Prosopis juliflora (Fabaceae) pods in order to evaluate them as feed additives for ruminants. As only the basic chloroformic extract (BCE), whose main constituents were juliprosopine (juliflorine), prosoflorine and juliprosine, showed Gram-positive antibacterial activity against Micrococcus luteus (MIC = 25 μg/mL), Staphylococcus aureus (MIC = 50 μg/mL) and Streptococcus mutans (MIC = 50 μg/mL), its influence on ruminal digestion was evaluated using a semi-automated in vitro gas production technique, with monensin as the positive control. Results showed that BCE has decreased gas production as efficiently as monensin after 36 h of fermentation, revealing its positive influence on gas production during ruminal digestion. Since P. juliflora is a very affordable plant, this study points out this alkaloid enriched extract from the pods of Prosopis juliflora as a potential feed additive to decrease gas production during ruminal digestion. PMID:23595000

Antimicrobial and antifungal activities of the extracts and essential oils of Bidens tripartita.

PubMed

Tomczykowa, Monika; Tomczyk, Michał; Jakoniuk, Piotr; Tryniszewska, Elzbieta

2008-01-01

The aim of this study was to determine the antibacterial and antifungal properties of the extracts, subextracts and essential oils of Bidens tripartita flowers and herbs. In the study, twelve extracts and two essential oils were investigated for activity against different Gram-positive Bacillus subtilis, Micrococcus luteus, Staphylococcus aureus, Gram-negative bacteria Escherichia coli, E. coli (beta-laktamase+), Klebsiella pneumoniae (ESBL+), Pseudomonas aeruginosa and some fungal organisms Candida albicans, C. parapsilosis, Aspergillus fumigatus, A. terreus using a broth microdilution and disc diffusion methods. The results obtained indicate antimicrobial activity of the tested extracts (except butanolic extracts), which however did not inhibit the growth of fungi used in this study. Bacteriostatic effect of both essential oils is insignificant, but they have strong antifungal activity. These results support the use of B. tripartita to treat a microbial infections and it is indicated as an antimicrobial and antifungal agent, which may act as pharmaceuticals and preservatives.

An easy, rapid and inexpensive method to monitor tributyltin (TBT) toxicity in the laboratory.

PubMed

Cruz, Andreia; Moreira, Rafael; Mendo, Sónia

2014-05-01

Tributyltin (TBT) contamination remains a major problem worldwide. Many laboratories are committed to the development of remediation methodologies that could help reduce the negative impact of this compound in the environment. Furthermore, it is important to have at hand simple methodologies for evaluating TBT toxicity in the laboratory, besides the use of complex and costly analytical instrumentation. With that purpose, a method was adapted that is based on the inhibition of growth of an indicator strain, Micrococcus luteus ATCC 9341, under TBT. Different types of matrices, of TBT concentrations and sample treatments were tested. The results herein reported show that the bioassay method can be applied for both aqueous and soil samples and also for a high range of TBT concentrations (at least up to 500 μmol/L). Besides being cheap and easy to perform, it can be performed in any laboratory. Additionally, one possible application of the method to monitor TBT degradation is presented as an example.

Search for antibacterial and antifungal agents from selected Indian medicinal plants.

PubMed

Kumar, V Prashanth; Chauhan, Neelam S; Padh, Harish; Rajani, M

2006-09-19

A series of 61 Indian medicinal plants belonging to 33 different families used in various infectious disorders, were screened for their antimicrobial properties. Screening was carried out at 1000 and 500 microg/ml concentrations by agar dilution method against Bacillus cereus var mycoides, Bacillus pumilus, Bacillus subtilis, Bordetella bronchiseptica, Micrococcus luteus, Staphylococcus aureus, Staphylococcus epidermidis, Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa, Streptococcus faecalis, Candida albicans, Aspergillus niger and Saccharomyces cerevisiae. Twenty-eight plant extracts showed activity against at least one of the test organisms used in the screening. On the basis of the results obtained, we conclude that the crude extracts of Dorema ammoniacum, Sphaeranthus indicus, Dracaena cinnabari, Mallotus philippinensis, Jatropha gossypifolia, Aristolochia indica, Lantana camara, Nardostachys jatamansi, Randia dumetorum and Cassia fistula exhibited significant antimicrobial activity and properties that support folkloric use in the treatment of some diseases as broad-spectrum antimicrobial agents. This probably explains the use of these plants by the indigenous people against a number of infections.

Antimicrobial activity of Chinese bayberry extract for the preservation of surimi.

PubMed

Li, Jianrong; Han, Qiang; Chen, Wei; Ye, Libin

2012-08-30

Chemical preservatives such as sodium nitrite and potassium sorbate have been widely used to keep surimi products fresh. However, the potential harmfulness to human health cannot be ignored. This study was conducted to develop natural preservatives for the storage of Collichthys surimi. Among the eight Chinese traditional herbs and fruits, Chinese bayberry extract showed the greatest inhibitory effect against surimi spoilage bacteria Serratia marcescens and Pseudomonas aeruginosa. Moreover, N-butanol phase extract of bayberry (NB) showed the greatest activity among the different phases of bayberry extract. When Chinese bayberry extract was combined with tea polyphenol, an additive inhibitory effect was observed on growth of Hansenula anomala, Micrococcus luteus, Staphylococcus aureus, Pseudomonas aeruginosa, and Escherichia coli. Our results further indicated that the shelf life of surimi products stored at room temperature can be extended when supplemented with Chinese bayberry extract. Our results suggest that Chinese bayberry extract can be used as a natural preservative for the storage of Collichthys surimi. Copyright © 2012 Society of Chemical Industry.

Antibacterial activity of oregano (Origanum vulgare Linn.) against gram positive bacteria.

PubMed

Saeed, Sabahat; Tariq, Perween

2009-10-01

The present investigation is focused on antibacterial potential of infusion, decoction and essential oil of oregano (Origanum vulgare) against 111 Gram-positive bacterial isolates belonging to 23 different species related to 3 genera. Infusion and essential oil exhibited antibacterial activity against Staphylococcus saprophyticus, S. aureus, Micrococcus roseus, M. kristinae, M. nishinomiyaensis, M. lylae, M. luteus, M. sedentarius, M. varians, Bacillus megaterium, B. thuringiensis, B. alvei, B. circulans, B. brevis, B. coagulans, B. pumilus, B. laterosporus, B. polymyxa, B. macerans, B. subtilis, B. firmus, B. cereus and B. lichiniformis. The infusion exhibited maximum activity against B. laterosporus (17.5 mm mean zone of inhibition+/-1.5 Standard deviation) followed by B. polymyxa (17.0 mm+/-2.0 SD) and essential oil of oregano exhibited maximum activity against S. saprophyticus (16.8 mm+/-1.8 SD) followed by B. circulans (14.5 mm+/-0.5 SD). While all these tested isolates were found resistant to decoction of oregano.

In Vitro Structural and Functional Evaluation of Gold Nanoparticles Conjugated Antibiotics

NASA Astrophysics Data System (ADS)

Saha, Biswarup; Bhattacharya, Jaydeep; Mukherjee, Ananda; Ghosh, Anup Kumar; Santra, Chitta Ranjan; Dasgupta, Anjan K.; Karmakar, Parimal

2007-12-01

Bactericidal efficacy of gold nanoparticles conjugated with ampicillin, streptomycin and kanamycin were evaluated. Gold nanoparticles (Gnps) were conjugated with the antibiotics during the synthesis of nanoparticles utilizing the combined reducing property of antibiotics and sodium borohydride. The conjugation of nanoparticles was confirmed by dynamic light scattering (DLS) and electron microscopic (EM) studies. Such Gnps conjugated antibiotics showed greater bactericidal activity in standard agar well diffusion assay. The minimal inhibitory concentration (MIC) values of all the three antibiotics along with their Gnps conjugated forms were determined in three bacterial strains, Escherichia coli DH5α, Micrococcus luteus and Staphylococcus aureus. Among them, streptomycin and kanamycin showed significant reduction in MIC values in their Gnps conjugated form whereas; Gnps conjugated ampicillin showed slight decrement in the MIC value compared to its free form. On the other hand, all of them showed more heat stability in their Gnps conjugated forms. Thus, our findings indicated that Gnps conjugated antibiotics are more efficient and might have significant therapeutic implications.

Antioxidant, electrochemical, thermal, antimicrobial and alkane oxidation properties of tridentate Schiff base ligands and their metal complexes

NASA Astrophysics Data System (ADS)

Ceyhan, Gökhan; Çelik, Cumali; Uruş, Serhan; Demirtaş, İbrahim; Elmastaş, Mahfuz; Tümer, Mehmet

2011-10-01

In this study, two Schiff base ligands (HL 1 and HL 2) and their Cu(II), Co(II), Ni(II), Pd(II) and Ru(III) metal complexes were synthesized and characterized by the analytical and spectroscopic methods. Alkane oxidation activities of the metal complexes were studied on cyclohexane as substrate. The ligands and their metal complexes were evaluated for their antimicrobial activity against Corynebacterium xerosis, Bacillus brevis, Bacillus megaterium, Bacillus cereus, Mycobacterium smegmatis, Staphylococcus aureus, Micrococcus luteus and Enterococcus faecalis (as Gram-positive bacteria) and Pseudomonas aeruginosa, Klebsiella pneumoniae, Escherichia coli, Yersinia enterocolitica, Klebsiella fragilis, Saccharomyces cerevisiae, and Candida albicans (as Gram-negative bacteria). The antioxidant properties of the Schiff base ligands were evaluated in a series of in vitro tests: 1,1-diphenyl-2-picrylhydrazyl (DPPH rad ) free radical scavenging and reducing power activity of superoxide anion radical generated non-enzymatic systems. Electrochemical and thermal properties of the compounds were investigated.

Pure and zinc doped nano-hydroxyapatite: Synthesis, characterization, antimicrobial and hemolytic studies

NASA Astrophysics Data System (ADS)

Tank, Kashmira P.; Chudasama, Kiran S.; Thaker, Vrinda S.; Joshi, Mihir J.

2014-09-01

The structural, antimicrobial, and hemolytic properties and bioactivity have been studied of pure hydroxyapatite (HAP) and zinc doped hydroxyapatite (Zn-HAP) nano-particles for their medical applications. Pure HAP and Zn-HAP nano-particles were synthesized by the surfactant mediated approach. The doping of zinc was estimated by EDAX. The average particle size was determined by applying Scherrer's formula to powdered XRD patterns. The nano-particle morphology was studied by TEM and the presence of various functional groups was identified by FTIR spectroscopy. Good antimicrobial activity of nano-HAP and nano-Zn-HAP was found against five organisms, viz., Pseudomonas aeruginosa and Shigella flexneri as Gram negative as well as Micrococcus luteus, Staphylococcous aureus and Bacillus cereus as Gram positive. The ability of new apatite formation on the surface of pure and doped HAP samples was studied by using Simulated Body Fluid (SBF) in vitro. Hemolytic study indicated that all samples were non-hemolytic and suggesting potential application as bone implant material.

Isolation, characterization and chromatography based purification of antibacterial compound isolated from rare endophytic actinomycetes Micrococcus yunnanensis.

PubMed

Ranjan, Ravi; Jadeja, Vasantba

2017-10-01

Endophytic actinomycetes are considered as one of the relatively unexplored potential sources in search of antibiotic producer against antibiotic resistant pathogens. A potent strain isolated from Catharanthus roseus that displays antibacterial potential against antibiotic resistant human pathogen Staphylococcus aureus was characterized and designated as Micrococcus yunnanensis strain rsk5. Rsk5 is capable of producing optimum antibacterial metabolites on starch casein medium at 30 °C, pH 5 and 2% NaCl condition. The crude antibacterial agent was extracted from fermentation broth by ethyl acetate and separated by TLC using chloroform-methanol (24:1, v/v) solvent system with R f value of 0.26. It was partially purified by flash chromatography, followed by HPLC and analyzed by ultraviolet visible spectrophotometer to get absorption maxima at 208.4 nm. The ESI-MS spectra showed molecular ion peaks at m / z 472.4 [M-H], which does not match with any known antibacterial compound.

Characterization of a bioflocculant produced by a consortium of Halomonas sp. Okoh and Micrococcus sp. Leo.

PubMed

Okaiyeto, Kunle; Nwodo, Uchechukwu U; Mabinya, Leonard V; Okoh, Anthony I

2013-10-16

The physicochemical and flocculating properties of a bioflocculant produced by a bacterial consortium composed of Halomonas sp. Okoh and Micrococcus sp. Leo were investigated. The purified bioflocculant was cation and pH dependent, and optimally flocculated kaolin clay suspension at a dosage of 0.1 mg/mL. The flocculating activity of the bioflocculant was stimulated in the presence of Ca2+, Mn2+, Al3+ and had a wide pH range of 2-10, with the highest flocculating activity of 86% at pH 8. The bioflocculant was thermostable and retained more than 70% of its flocculating activity after being heated at 80 °C for 30 min. Thermogravimetric analyses revealed a partial thermal decomposition of the biofloculant at 400 °C. The infrared spectrum showed the presence of hydroxyl, carboxyl and amino moieties as functional groups. The bioflocculant produced by the bacterial consortium appears to hold promising alternative to inorganic and synthetic organic flocculants that are widely used in wastewater treatment.

Characterization of a Bioflocculant Produced by a Consortium of Halomonas sp. Okoh and Micrococcus sp. Leo

PubMed Central

Okaiyeto, Kunle; Nwodo, Uchechukwu U.; Mabinya, Leonard V.; Okoh, Anthony I.

2013-01-01

The physicochemical and flocculating properties of a bioflocculant produced by a bacterial consortium composed of Halomonas sp. Okoh and Micrococcus sp. Leo were investigated. The purified bioflocculant was cation and pH dependent, and optimally flocculated kaolin clay suspension at a dosage of 0.1 mg/mL. The flocculating activity of the bioflocculant was stimulated in the presence of Ca2+, Mn2+, Al3+ and had a wide pH range of 2–10, with the highest flocculating activity of 86% at pH 8. The bioflocculant was thermostable and retained more than 70% of its flocculating activity after being heated at 80 °C for 30 min. Thermogravimetric analyses revealed a partial thermal decomposition of the biofloculant at 400 °C. The infrared spectrum showed the presence of hydroxyl, carboxyl and amino moieties as functional groups. The bioflocculant produced by the bacterial consortium appears to hold promising alternative to inorganic and synthetic organic flocculants that are widely used in wastewater treatment. PMID:24135818

The construction of an engineered bacterium to remove cadmium from wastewater.

PubMed

Chang, S; Shu, H

2014-01-01

The removal of cadmium (Cd) from wastewater before it is released from factories is important for protecting human health. Although some researchers have developed engineered bacteria, the resistance of these engineered bacteria to Cd have not been improved. In this study, two key genes involved in glutathione synthesis (gshA and gshB), a serine acetyltransferase gene (cysE), a Thlaspi caerulescens phytochelatin synthase gene (TcPCS1), and a heavy metal ATPase gene (TcHMA3) were transformed into Escherichia coli BL21. The resistance of the engineered bacterium to Cd was significantly greater than that of the initial bacterium and the Cd accumulation in the engineered bacterium was much higher than in the initial bacterium. In addition, the Cd resistance of the bacteria harboring gshB, gshA, cysE, and TcPCS1 was higher than that of the bacteria harboring gshA, cysE, and TcPCS1. This finding demonstrated that gshB played an important role in glutathione synthesis and that the reaction catalyzed by glutathione synthase was the limiting step for producing phytochelatins. Furthermore, TcPCS1 had a greater specificity and a higher capacity for removing Cd than SpPCS1, and TcHMA3 not only played a role in T. caerulescens but also functioned in E. coli.

Metabolomics evaluation of the impact of smokeless tobacco exposure on the oral bacterium Capnocytophaga sputigena

PubMed Central

Sun, Jinchun; Jin, Jinshan; Beger, Richard D.; Cerniglia, Carl E.; Yang, Maocheng; Chen, Huizhong

2017-01-01

The association between exposure to smokeless tobacco products (STP) and oral diseases is partially due to the physiological and pathological changes in the composition of the oral microbiome and its metabolic profile. However, it is not clear how STPs affect the physiology and ecology of oral microbiota. A UPLC/QTof-MS-based metabolomics study was employed to analyze metabolic alterations in oral bacterium, Capnocytophaga sputigena as a result of smokeless tobacco exposure and to assess the capability of the bacterium to metabolize nicotine. Pathway analysis of the metabolome profiles indicated that smokeless tobacco extracts caused oxidative stress in the bacterium. The metabolomics data also showed that the argininenitric oxide pathway was perturbed by the smokeless tobacco treatment. Results also showed that LC/MS was useful in identifying STP constituents and additives, including caffeine and many flavoring compounds. No significant changes in levels of nicotine and its major metabolites were found when C. sputigena was cultured in a nutrient rich medium, although hydroxylnicotine and cotinine N-oxide were detected in the bacterial metabolites suggesting that nicotine metabolism might be present as a minor degradation pathway in the bacterium. Study results provide new insights regarding the physiological and toxicological effects of smokeless tobacco on oral bacterium C. sputigena and associated oral health as well as measuring the ability of the oral bacterium to metabolize nicotine. PMID:27480511

Metabolomics evaluation of the impact of smokeless tobacco exposure on the oral bacterium Capnocytophaga sputigena.

PubMed

Sun, Jinchun; Jin, Jinshan; Beger, Richard D; Cerniglia, Carl E; Yang, Maocheng; Chen, Huizhong

2016-10-01

The association between exposure to smokeless tobacco products (STP) and oral diseases is partially due to the physiological and pathological changes in the composition of the oral microbiome and its metabolic profile. However, it is not clear how STPs affect the physiology and ecology of oral microbiota. A UPLC/QTof-MS-based metabolomics study was employed to analyze metabolic alterations in oral bacterium, Capnocytophaga sputigena as a result of smokeless tobacco exposure and to assess the capability of the bacterium to metabolize nicotine. Pathway analysis of the metabolome profiles indicated that smokeless tobacco extracts caused oxidative stress in the bacterium. The metabolomics data also showed that the arginine-nitric oxide pathway was perturbed by the smokeless tobacco treatment. Results also showed that LC/MS was useful in identifying STP constituents and additives, including caffeine and many flavoring compounds. No significant changes in levels of nicotine and its major metabolites were found when C. sputigena was cultured in a nutrient rich medium, although hydroxylnicotine and cotinine N-oxide were detected in the bacterial metabolites suggesting that nicotine metabolism might be present as a minor degradation pathway in the bacterium. Study results provide new insights regarding the physiological and toxicological effects of smokeless tobacco on oral bacterium C. sputigena and associated oral health as well as measuring the ability of the oral bacterium to metabolize nicotine. Published by Elsevier Ltd.

Near-complete genome sequence of the cellulolytic Bacterium Bacteroides ( Pseudobacteroides) cellulosolvens ATCC 35603

DOE PAGES

Dassa, Bareket; Utturkar, Sagar M.; Hurt, Richard A.; ...

2015-09-24

We report the single-contig genome sequence of the anaerobic, mesophilic, cellulolytic bacterium, Bacteroides cellulosolvens. The bacterium produces a particularly elaborate cellulosome system, whereas the types of cohesin-dockerin interactions are opposite of other known cellulosome systems: cell-surface attachment is thus mediated via type-I interactions whereas enzymes are integrated via type-II interactions.

Exploring the potential environmental functions of viable but non-culturable bacteria.

PubMed

Su, Xiaomei; Chen, Xi; Hu, Jinxing; Shen, Chaofeng; Ding, Linxian

2013-12-01

A conventional plate count is the most commonly employed method to estimate the number of living bacteria in environmental samples. In fact, judging the level of viable culture by plate count is limited, because it is often several orders of magnitude less than the number of living bacteria actually present. Most of the bacteria are in "viable but non-culturable" (VBNC) state, whose cells are intact and alive and can resuscitate when surrounding conditions are more favorable. The most exciting recent development in resuscitating VBNC bacteria is a bacterial cytokine, namely, the resuscitation-promoting factor (Rpf), secreted by Micrococcus luteus, which promotes the resuscitation and growth of high G+C Gram-positive organisms, including some species of the genus Mycobacterium. However, most of studies deal with VBNC bacteria only from the point of view of medicine and epidemiology. It is therefore of great significance to research whether these VBNC state bacteria also possess some useful environmental capabilities, such as degradation, flocculation, etc. Further studies are needed to elucidate the possible environmental role of the VBNC bacteria, rather than only considering their role as potential pathogens from the point view of epidemiology and public health. We have studied the resuscitation of these VBNC bacteria in polluted environments by adding culture supernatant containing Rpf from M. luteus, and it was found that, as a huge microbial resource, VBNC bacteria could provide important answers to dealing with existing problems of environmental pollution. This mini-review will provide new insight for considering the potentially environmental functions of VBNC bacteria.

[A rarely isolated bacterium in microbiology laboratories: Streptococcus uberis].

PubMed

Eryıldız, Canan; Bukavaz, Şebnem; Gürcan, Şaban; Hatipoğlu, Osman

2017-04-01

Streptococcus uberis is a gram-positive bacterium that is mostly responsible for mastitis in cattle. The bacterium rarely has been associated with human infections. Conventional phenotyphic methods can be inadequate for the identification of S.uberis; and in microbiology laboratories S.uberis is confused with the other streptococci and enterococci isolates. Recently, molecular methods are recommended for the accurate identification of S.uberis isolates. The aim of this report is to present a lower respiratory tract infection case caused by S.uberis and the microbiological methods for identification of this bacterium. A 66-year-old male patient with squamous cell lung cancer who received radiotherapy was admitted in our hospital for the control. According to the chest X-Ray, patient was hospitalized with the prediagnosis of ''cavitary tumor, pulmonary abscess''. In the first day of the hospitalization, blood and sputum cultures were drawn. Blood culture was negative, however, Candida albicans was isolated in the sputum culture and it was estimated to be due to oral lesions. After two weeks from the hospitalization, sputum sample was taken from the patient since he had abnormal respiratory sounds and cough complaint. In the Gram stained smear of the sputum there were abundant leucocytes and gram-positive cocci, and S.uberis was isolated in both 5% sheep blood and chocolate agar media. Bacterial identification and antibiotic susceptibility tests were performed by VITEK 2 (Biomerieux, France) and also, the bacterium was identified by matrix assisted laser desorption/ionization time of flight mass spectrometry (MALDI-TOF MS) based VITEK MS system as S.uberis. The isolate was determined susceptible to ampicillin, erythromycin, clindamycin, levofloxacin, linezolid, penicillin, cefotaxime, ceftriaxone, tetracycline and vancomycin. 16S, 23S ribosomal RNA and 16S-23S intergenic spacer gene regions were amplified with specific primers and partial DNA sequence analysis of 16S

Trichloroethylene Biodegradation by a Methane-Oxidizing Bacterium †

PubMed Central

Little, C. Deane; Palumbo, Anthony V.; Herbes, Stephen E.; Lidstrom, Mary E.; Tyndall, Richard L.; Gilmer, Penny J.

1988-01-01

Trichloroethylene (TCE), a common groundwater contaminant, is a suspected carcinogen that is highly resistant to aerobic biodegradation. An aerobic, methane-oxidizing bacterium was isolated that degrades TCE in pure culture at concentrations commonly observed in contaminated groundwater. Strain 46-1, a type I methanotrophic bacterium, degraded TCE if grown on methane or methanol, producing CO2 and water-soluble products. Gas chromatography and 14C radiotracer techniques were used to determine the rate, methane dependence, and mechanism of TCE biodegradation. TCE biodegradation by strain 46-1 appears to be a cometabolic process that occurs when the organism is actively metabolizing a suitable growth substrate such as methane or methanol. It is proposed that TCE biodegradation by methanotrophs occurs by formation of TCE epoxide, which breaks down spontaneously in water to form dichloroacetic and glyoxylic acids and one-carbon products. Images PMID:16347616

D-alanine carboxypeptidase activity of Micrococcus lysodeikticus released into the protoplasting medium.

PubMed

Linder, R; Salton, M R

1975-06-16

Conversion of whole cells of Micrococcus lysodeikticus to protoplasts allowed the release of a soluble form of a D-alanine carboxypeptidase into the protoplasting medium. The enzyme cleaves the terminal D-alanine from the radioactively labelled UDP-N-acetylmuramyl-pentapeptide containing L-lysine as the diamino acid. However, the enzyme is only minimally active in this fraction so that it had to be enriched and partially purified before its properties could be studied. Chromatography on carboxymethyl-Sephadex removed the lysozyme used in the protoplasting of the cells. The material which was unadsorbed to the column was applied to an affinity chromatography column of Ampicillin-Sepharose. Most of the contaminating protein was washed from the column while the D-alanine carboxypeptidase adhered to the resin and could be eluted with 0.5 M Tris-HCl buffer pH 8.6. Some of the properties of the enzymic activity were studied using this preparation. The enzyme was activated by Mg2+ ions with a broad optimum from 15--35 mM. It was maximally active when NaCl at a concentrations of 0.06--0.08 M was added to the assay, and the pH curve was biphasic with an alkaline optimum. The Km for substrate was found to be 0.118 mM. Enzymic activity was completely inhibited by low concentrations of Ampicillin and penicillin G.

Draft Genome Sequence of the Cellulolytic Bacterium Clostridium papyrosolvens C7 (ATCC 700395).

PubMed

Zepeda, Veronica; Dassa, Bareket; Borovok, Ilya; Lamed, Raphael; Bayer, Edward A; Cate, Jamie H D

2013-09-12

We report the draft genome sequence of the cellulose-degrading bacterium Clostridium papyrosolvens C7, originally isolated from mud collected below a freshwater pond in Massachusetts. This Gram-positive bacterium grows in a mesophilic anaerobic environment with filter paper as the only carbon source, and it has a simple cellulosome system with multiple carbohydrate-degrading enzymes.

Draft Genome Sequence of the Cellulolytic Bacterium Clostridium papyrosolvens C7 (ATCC 700395)

PubMed Central

Zepeda, Veronica; Dassa, Bareket; Borovok, Ilya; Lamed, Raphael; Bayer, Edward A.

2013-01-01

We report the draft genome sequence of the cellulose-degrading bacterium Clostridium papyrosolvens C7, originally isolated from mud collected below a freshwater pond in Massachusetts. This Gram-positive bacterium grows in a mesophilic anaerobic environment with filter paper as the only carbon source, and it has a simple cellulosome system with multiple carbohydrate-degrading enzymes. PMID:24029755

Resonance scattering spectra of micrococcus lysodeikticus and its application to assay of lysozyme activity.

PubMed

Jiang, Zhi-Liang; Huang, Guo-Xia

2007-02-01

Several methods, including turbidimetric and colorimetric methods, have been reported for the detection of lysozyme activity. However, there is no report about the resonance scattering spectral (RSS) assay, which is based on the catalytic effect of lysozyme on the hydrolysis of micrococcus lysodeikticus (ML) and its resonance scattering effect. ML has 5 resonance scattering peaks at 360 400, 420, 470, and 520 nm with the strongest one at 470 nm. The concentration of ML in the range of 2.0x10(6)-9.3x10(8) cells/ml is proportional to the RS intensity at 470 nm (I(470 nm)). A new catalytic RSS method has been proposed for 0.24-40.0 U/ml (or 0.012-2.0 mug/ml) lysozyme activity, with a detection limit (3sigma) of 0.014 U/ml (or 0.0007 microg/ml). Saliva samples were assayed by this method, and it is in agreement with the results of turbidimetric method. The slope, intercept and the correlation coefficient of the regression analysis of the 2 assays were 0.9665, -87.50, and 0.9973, respectively. The assay has high sensitivity and simplicity.

Functional Micrococcus lysodeikticus layers deposited by laser technique for the optical sensing of lysozyme.

PubMed

Dinca, Valentina; Zaharie-Butucel, Diana; Stanica, Luciana; Brajnicov, Simona; Marascu, Valentina; Bonciu, Anca; Cristocea, Andra; Gaman, Laura; Gheorghiu, Mihaela; Astilean, Simion; Vasilescu, Alina

2018-02-01

Whole cell optical biosensors, made by immobilizing whole algal, bacterial or mammalian cells on various supports have found applications in several fields, from ecology and ecotoxicity testing to biopharmaceutical production or medical diagnostics. We hereby report the deposition of functional bacterial layers of Micrococcus lysodeikticus (ML) via Matrix-Assisted Pulsed Laser Evaporation (MAPLE) on poly(diallyldimethylamonium) (PDDA)-coated-glass slides and their application as an optical biosensor for the detection of lysozyme in serum. Lysozyme is an enzyme upregulated in inflammatory diseases and ML is an enzymatic substrate for this enzyme. The MAPLE-deposited bacterial interfaces were characterised by Scanning Electron Microscopy (SEM), Atomic Force Microscopy (AFM), Fourier-Transformed Infrared Spectroscopy (FTIR), Raman and optical microscopy and were compared with control interfaces deposited via layer-by-layer on the same substrate. After MAPLE deposition and coating with graphene oxide (GO), ML-modified interfaces retained their functionality and sensitivity to lysozyme's lytic action. The optical biosensor detected lysozyme in undiluted serum in the clinically relevant range up to 10μgmL -1 , in a fast and simple manner. Copyright © 2017 Elsevier B.V. All rights reserved.

Effect of radiolytic products on bacteria in a food system. [Escherichia coli; Pediococcus cerevisiae; Moraxella-Acinetobacter; Micrococcus sp

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dickson, J.S.; Maxcy, R.B.

Inhibitory effects of radiolytic products were studied using Escherichia coli, Pediococcus cerevisiae, and two radiation-resistant microorganisms, an isolate of Moraxella-Acinetobacter and a Micrococcus sp. End Products of an irradiation dose of 300 Krads completely inhibited resistant organisms on an experimental medium with a very low concentration of nutrients. Plate count agar, with higher nutrient concentration, required 600 Krads to produce the same inhibition. On the same medium, radiation-sensitive organisms could tolerate products generated by a 1000 Krad dose. However, no inhibition could be detected when either Escherichia coli or Moraxella-Acinetobacter was incubated at 5/sup 0/C on the surface of freshmore » meat irradiated to 1500 Krad. The effects of inhibitory products in culture media could be mitigated by the addition of catalase or sodium pyruvate. 19 references, 2 figures, 4 tables.« less

De novo Transcriptome Profiling of Flowers, Flower Pedicels and Pods of Lupinus luteus (Yellow Lupine) Reveals Complex Expression Changes during Organ Abscission.

PubMed

Glazinska, Paulina; Wojciechowski, Waldemar; Kulasek, Milena; Glinkowski, Wojciech; Marciniak, Katarzyna; Klajn, Natalia; Kesy, Jacek; Kopcewicz, Jan

2017-01-01

Yellow lupine ( Lupinus luteus L., Taper c.), a member of the legume family ( Fabaceae L.), has an enormous practical importance. Its excessive flower and pod abscission represents an economic drawback, as proper flower and seed formation and development is crucial for the plant's productivity. Generative organ detachment takes place at the basis of the pedicels, within a specialized group of cells collectively known as the abscission zone (AZ). During plant growth these cells become competent to respond to specific signals that trigger separation and lead to the abolition of cell wall adhesion. Little is known about the molecular network controlling the yellow lupine organ abscission. The aim of our study was to establish the divergences and similarities in transcriptional networks in the pods, flowers and flower pedicels abscised or maintained on the plant, and to identify genes playing key roles in generative organ abscission in yellow lupine. Based on de novo transcriptome assembly, we identified 166,473 unigenes representing 219,514 assembled unique transcripts from flowers, flower pedicels and pods undergoing abscission and from control organs. Comparison of the cDNA libraries from dropped and control organs helped in identifying 1,343, 2,933 and 1,491 differentially expressed genes (DEGs) in the flowers, flower pedicels and pods, respectively. In DEG analyses, we focused on genes involved in phytohormonal regulation, cell wall functioning and metabolic pathways. Our results indicate that auxin, ethylene and gibberellins are some of the main factors engaged in generative organ abscission. Identified 28 DEGs common for all library comparisons are involved in cell wall functioning, protein metabolism, water homeostasis and stress response. Interestingly, among the common DEGs we also found an miR169 precursor, which is the first evidence of micro RNA engaged in abscission. A KEGG pathway enrichment analysis revealed that the identified DEGs were predominantly

De novo Transcriptome Profiling of Flowers, Flower Pedicels and Pods of Lupinus luteus (Yellow Lupine) Reveals Complex Expression Changes during Organ Abscission

PubMed Central

Glazinska, Paulina; Wojciechowski, Waldemar; Kulasek, Milena; Glinkowski, Wojciech; Marciniak, Katarzyna; Klajn, Natalia; Kesy, Jacek; Kopcewicz, Jan

2017-01-01

Yellow lupine (Lupinus luteus L., Taper c.), a member of the legume family (Fabaceae L.), has an enormous practical importance. Its excessive flower and pod abscission represents an economic drawback, as proper flower and seed formation and development is crucial for the plant's productivity. Generative organ detachment takes place at the basis of the pedicels, within a specialized group of cells collectively known as the abscission zone (AZ). During plant growth these cells become competent to respond to specific signals that trigger separation and lead to the abolition of cell wall adhesion. Little is known about the molecular network controlling the yellow lupine organ abscission. The aim of our study was to establish the divergences and similarities in transcriptional networks in the pods, flowers and flower pedicels abscised or maintained on the plant, and to identify genes playing key roles in generative organ abscission in yellow lupine. Based on de novo transcriptome assembly, we identified 166,473 unigenes representing 219,514 assembled unique transcripts from flowers, flower pedicels and pods undergoing abscission and from control organs. Comparison of the cDNA libraries from dropped and control organs helped in identifying 1,343, 2,933 and 1,491 differentially expressed genes (DEGs) in the flowers, flower pedicels and pods, respectively. In DEG analyses, we focused on genes involved in phytohormonal regulation, cell wall functioning and metabolic pathways. Our results indicate that auxin, ethylene and gibberellins are some of the main factors engaged in generative organ abscission. Identified 28 DEGs common for all library comparisons are involved in cell wall functioning, protein metabolism, water homeostasis and stress response. Interestingly, among the common DEGs we also found an miR169 precursor, which is the first evidence of micro RNA engaged in abscission. A KEGG pathway enrichment analysis revealed that the identified DEGs were predominantly

Overproduction of Hydrogen From an Anaerobic Bacterium

DTIC Science & Technology

2008-12-01

fixation of nitrogen ( Haber - Bosch process), mostly to produce fertilizer. Nitrogenase provides a catalytic alternative to the commercial fixation of...the culture and suggests a uniquely simple hydrogen reactor design based on renewable feedstocks. 1. INTRODUCTION Hydrogen is an ideal... renewable feedstocks. Clostridium phytofermentans is a recently- discovered anaerobic bacterium, reported to possess cellulase enzymes that degrade

Ecofriendly degradation of sulfonated diazo dye C.I. Reactive Green 19A using Micrococcus glutamicus NCIM-2168.

PubMed

Saratale, R G; Saratale, G D; Chang, J S; Govindwar, S P

2009-09-01

Micrococcus glutamicus NCIM-2168 exhibited complete decolorization and degradation of C.I. Reactive Green 19A (an initial concentration of 50 mg l(-1)) within 42 h at temperature 37 degrees C and pH 8, under static condition. Extent of mineralization was determined with total organic carbon (TOC) and chemical oxygen demand (COD) measurement, showing a satisfactory reduction of TOC (72%) and COD (66%) within 42 h. Enzyme studies shows involvement of oxidoreductive enzymes in decolorization/degradation process. Analytical studies of the extracted metabolites confirmed the significant degradation of Reactive Green 19A into various metabolites. The microbial toxicity and phytotoxicity assay revealed that the degradation of Reactive Green 19A produced nontoxic metabolites. In addition, the M. glutamicus strain was applied to decolorize a mixture of ten reactive dyes showing a 63% decolorization (in terms of decrease in ADMI value) within 72 h, along with 48% and 42% reduction in TOC and COD under static condition.

Determination of phenanthrene bioavailability by using a self-dying reporter bacterium: test with model solids and soil.

PubMed

Shin, Doyun; Nam, Kyoungphile

2012-02-20

The present study was conducted to investigate the performance and feasibility of a self-dying reporter bacterium to visualize and quantify phenanthrene bioavailability in soil. The self-dying reporter bacterium was designed to die on the initiation of phenanthrene biodegradation. The viability of the reporter bacterium was determined by a fluorescence live/dead cell staining method and visualized by confocal laser scanning microscopic observation. Phenanthrene was spiked into four types of model solids and a sandy loam. The bioavailability of phenanthrene to the reporter bacterium was remarkably declined with the hydrophobicity of the model solids: essentially no phenanthrene was biodegraded in the presence of 9-nm pores and about 35.8% of initial phenanthrene was biodegraded without pores. Decrease in bioavailability was not evident in the nonporous hydrophilic bead, but a small decrease was observed in the porous hydrophilic bead at 1000 mg/kg of phenanthrene. The fluorescence intensity was commensurate with the extent of phenanthrene biodegradation by the reporter bacterium at the concentration range from 50 to 500 mg/kg. Such a quantitative relationship was also confirmed with a sandy loam spiked up to 1000 mg/kg of phenanthrene. This reporter bacterium may be a useful means to determine phenanthrene bioavailability in soil. Copyright © 2011 Elsevier B.V. All rights reserved.

Phosphate enhances levan production in the endophytic bacterium Gluconacetobacter diazotrophicus Pal5

PubMed Central

Idogawa, Nao; Amamoto, Ryuta; Murata, Kousaku; Kawai, Shigeyuki

2014-01-01

Gluconacetobacter diazotrophicus is a gram-negative and endophytic nitrogen-fixing bacterium that has several beneficial effects in host plants; thus, utilization of this bacterium as a biofertilizer in agriculture may be possible. G. diazotrophicus synthesizes levan, a D-fructofuranosyl polymer with β-(2→6) linkages, as an exopolysaccharide and the synthesized levan improves the stress tolerance of the bacterium. In this study, we found that phosphate enhances levan production by G. diazotrophicus Pal5, a wild type strain that showed a stronger mucous phenotype on solid medium containing 28 mM phosphate than on solid medium containing 7 mM phosphate. A G. diazotrophicus Pal5 levansucrase disruptant showed only a weak mucous phenotype regardless of the phosphate concentration, indicating that the mucous phenotype observed on 28 mM phosphate medium was caused by levan. To our knowledge, this is the first report of the effect of a high concentration of phosphate on exopolysaccharide production. PMID:24717418

[Diversity analysis of desulfuration bacterium from the oxidation ditch of city sewage treatment plant with SO2 gas].

PubMed

Huang, Bing; Zhang, Shi-Ling; Zhang, Jiang-Hong; Ao, Yong; Shi, Zhe

2011-07-01

A group of removing SO2 bacterium was obtained from the oxidation ditch of city sewage treatment plant by inductive domestication over 6 d with low concentration SO2 gas, and they have an ability with biodegradation rate of 888 mg x (L x h)(-1) and a degradation efficiency of 85% during 1.5 h for SO2 dissolved in water with their synergy. The clone library and two phylogenetic trees of the removing SO2 bacterium communities were obtained based on 16S rRNA DNA comparison by DNA extraction of the sample and in situ polymerase chain reaction (PCR). The phylogenetic analysis showed that 8 dominant desulfuration bacterium occupy about 69% of all removing SO2 bacterium, and some of them have a kindred with discovered desulfuration bacterium but not homogeneity, and there are four belong to alpha-Proteobacteria, another four belong to beta-Proteobacteria in them. The gene information about 16S rRNA sequence of the dominant desulfuration bacteria and domestication method provide a basic of looking for or domesticating removing SO2 bacterium for development microbial desulfurization technology of contained SO2 tail gas.

Characterization of a bacterium of the genus Azospirillum from cellulolytic nitrogen-fixing mixed cultures.

PubMed

Wong, P P; Stenberg, N E; Edgar, L

1980-03-01

A bacterium with the taxonomic characteristics of the genus Azospirillum was isolated from celluloytic N2-fixing mixed cultures. Its characteristics fit the descriptions of both Azopirillum lipoferum (Beijerinck) comb. nov. and Azospirillum brasilense sp. nov. It may be a variant strain of A. lipoferum. In mixed cultures with cellulolytic organisms, the bacterium grew and fixed N2 with cellelose as a sole source of energy and carbon. The mixed cultures used cellulose from leaves of wheat (Triticum aestivum L.), corn (Zea mays L.), and big bluestem grass (Andropogon gerardii Vitm). Microaerophilic N2-fixing bacteria of the genus Azospirillum, such as the bacterium we isolated, may be important contributors of fixed N2 in soil with partial anaerobiosis and cellulose decomposition.

Biofilm Formation by a Metabolically Versatile Bacterium

DTIC Science & Technology

2005-10-02

Rhodopseudomonas palustris is a photosynthetic bacterium that has good potential to be developed as a biocatalyst for the production of hydrogen, a...A for none) Samanta, S. K and C. S. Harwood. 2005. Use of the Rhodopseudomonas palustris genome to identify a single amino acid that contributes to...operon from Rhodopseudomonas palustris mediates dicarboxylic acid degradation and participates in anaerobic benzoate degradation. Microbiology 151

Boron nitride nanotube-based biosensing of various bacterium/viruses: continuum modelling-based simulation approach.

PubMed

Panchal, Mitesh B; Upadhyay, Sanjay H

2014-09-01

In this study, the feasibility of single walled boron nitride nanotube (SWBNNT)-based biosensors has been ensured considering the continuum modelling-based simulation approach, for mass-based detection of various bacterium/viruses. Various types of bacterium or viruses have been taken into consideration at the free-end of the cantilevered configuration of the SWBNNT, as a biosensor. Resonant frequency shift-based analysis has been performed with the adsorption of various bacterium/viruses considered as additional mass to the SWBNNT-based sensor system. The continuum mechanics-based analytical approach, considering effective wall thickness has been considered to validate the finite element method (FEM)-based simulation results, based on continuum volume-based modelling of the SWBNNT. As a systematic analysis approach, the FEM-based simulation results are found in excellent agreement with the analytical results, to analyse the SWBNNTs for their wide range of applications such as nanoresonators, biosensors, gas-sensors, transducers and so on. The obtained results suggest that by using the SWBNNT of smaller size the sensitivity of the sensor system can be enhanced and detection of the bacterium/virus having mass of 4.28 × 10⁻²⁴ kg can be effectively performed.

Effect of arsenite-oxidizing bacterium B. laterosporus on arsenite toxicity and arsenic translocation in rice seedlings.

PubMed

Yang, Gui-Di; Xie, Wan-Ying; Zhu, Xi; Huang, Yi; Yang, Xiao-Jun; Qiu, Zong-Qing; Lv, Zhen-Mao; Wang, Wen-Na; Lin, Wen-Xiong

2015-10-01

Arsenite [As (III)] oxidation can be accelerated by bacterial catalysis, but the effects of the accelerated oxidation on arsenic toxicity and translocation in rice plants are poorly understood. Herein we investigated how an arsenite-oxidizing bacterium, namely Brevibacillus laterosporus, influences As (III) toxicity and translocation in rice plants. Rice seedlings of four cultivars, namely Guangyou Ming 118 (GM), Teyou Hang II (TH), Shanyou 63 (SY) and Minghui 63 (MH), inoculated with or without the bacterium were grown hydroponically with As (III) to investigate its effects on arsenic toxicity and translocation in the plants. Percentages of As (III) oxidation in the solutions with the bacterium (100%) were all significantly higher than those without (30-72%). The addition of the bacterium significantly decreased As (III) concentrations in SY root, GM root and shoot, while increased the As (III) concentrations in the shoot of SY, MH and TH and in the root of MH. Furthermore, the As (III) concentrations in the root and shoot of SY were both the lowest among the treatments with the bacterium. On the other hand, its addition significantly alleviated the As (III) toxicity on four rice cultivars. Among the treatments amended with B. laterosporus, the bacterium showed the best remediation on SY seedlings, with respect to the subdued As (III) toxicity and decreased As (III) concentration in its roots. These results indicated that As (III) oxidation accelerated by B. laterosporus could be an effective method to alleviate As (III) toxicity on rice seedlings. Copyright © 2015 Elsevier Inc. All rights reserved.

Fast Mechanically Driven Daughter Cell Separation Is Widespread in Actinobacteria.

PubMed

Zhou, Xiaoxue; Halladin, David K; Theriot, Julie A

2016-08-30

Dividing cells of the coccoid Gram-positive bacterium Staphylococcus aureus undergo extremely rapid (millisecond) daughter cell separation (DCS) driven by mechanical crack propagation, a strategy that is very distinct from the gradual, enzymatically driven cell wall remodeling process that has been well described in several rod-shaped model bacteria. To determine if other bacteria, especially those in the same phylum (Firmicutes) or with similar coccoid shapes as S. aureus, might use a similar mechanically driven strategy for DCS, we used high-resolution video microscopy to examine cytokinesis in a phylogenetically wide range of species with various cell shapes and sizes. We found that fast mechanically driven DCS is rather rare in the Firmicutes (low G+C Gram positives), observed only in Staphylococcus and its closest coccoid relatives in the Macrococcus genus, and we did not observe this division strategy among the Gram-negative Proteobacteria In contrast, several members of the high-G+C Gram-positive phylum Actinobacteria (Micrococcus luteus, Brachybacterium faecium, Corynebacterium glutamicum, and Mycobacterium smegmatis) with diverse shapes ranging from coccoid to rod all undergo fast mechanical DCS during cell division. Most intriguingly, similar fast mechanical DCS was also observed during the sporulation of the actinobacterium Streptomyces venezuelae Much of our knowledge on bacterial cytokinesis comes from studying rod-shaped model organisms such as Escherichia coli and Bacillus subtilis Less is known about variations in this process among different bacterial species. While cell division in many bacteria has been characterized to some extent genetically or biochemically, few species have been examined using video microscopy to uncover the kinetics of cytokinesis and daughter cell separation (DCS). In this work, we found that fast (millisecond) DCS is exhibited by species in two independent clades of Gram-positive bacteria and is particularly prevalent

Pentocin MQ1: A Novel, Broad-Spectrum, Pore-Forming Bacteriocin From Lactobacillus pentosus CS2 With Quorum Sensing Regulatory Mechanism and Biopreservative Potential

PubMed Central

Wayah, Samson B.; Philip, Koshy

2018-01-01

Micrococcus luteus, Listeria monocytogenes, and Bacillus cereus are major food-borne pathogenic and spoilage bacteria. Emergence of antibiotic resistance and consumer demand for foods containing less of chemical preservatives led to a search for natural antimicrobials. A study aimed at characterizing, investigating the mechanism of action and regulation of biosynthesis and evaluating the biopreservative potential of pentocin from Lactobacillus pentosus CS2 was conducted. Pentocin MQ1 is a novel bacteriocin isolated from L. pentosus CS2 of coconut shake origin. The purification strategy involved adsorption-desorption of bacteriocin followed by RP-HPLC. It has a molecular weight of 2110.672 Da as determined by MALDI-TOF mass spectrometry and a molar extinction value of 298.82 M−1 cm−1. Pentocin MQ1 is not plasmid-borne and its biosynthesis is regulated by a quorum sensing mechanism. It has a broad spectrum of antibacterial activity, exhibited high chemical, thermal and pH stability but proved sensitive to proteolytic enzymes. It is potent against M. luteus, B. cereus, and L. monocytogenes at micromolar concentrations. It is quick-acting and exhibited a bactericidal mode of action against its targets. Target killing was mediated by pore formation. We report for the first time membrane permeabilization as a mechanism of action of the pentocin from the study against Gram-positive bacteria. Pentocin MQ1 is a cell wall-associated bacteriocin. Application of pentocin MQ1 improved the microbiological quality and extended the shelf life of fresh banana. This is the first report on the biopreservation of banana using bacteriocin. These findings place pentocin MQ1 as a potential biopreservative for further evaluation in food and medical applications. PMID:29636737

Characterization of a novel extremely alkalophilic bacterium

NASA Technical Reports Server (NTRS)

Souza, K. A.; Deal, P. H.

1977-01-01

A new alkalophilic bacterium, isolated from a natural spring of high pH is characterized. It is a Gram-positive, non-sporulating, motile rod requiring aerobic and alkaline conditions for growth. The characteristics of this organism resemble those of the coryneform group of bacteria; however, there are no accepted genera within this group with which this organism can be closely matched. Therefore, a new genus may be warranted.

Plant nucleoside 5'-phosphoramidate hydrolase; simple purification from yellow lupin (Lupinus luteus) seeds and properties of homogeneous enzyme.

PubMed

Guranowski, Andrzej; Wojdyła, Anna M; Rydzik, Anna M; Stepiński, Janusz; Jemielity, Jacek

2011-01-01

Adenosine 5'-phosphoramidate (NH₂-pA) is an uncommon natural nucleotide of poorly understood biochemistry and function. We studied a plant enzyme potentially involved in the catabolism of NH₂-pA. A fast and simple method comprising extraction of yellow lupin (Lupinus luteus) seed-meal with a low ionic strength buffer, ammonium sulfate and acetone fractionations, removal of contaminating proteins by heat denaturation, and affinity chromatography on AMP-agarose, yielded homogenous nucleoside 5'-phosphoramidase. Mass spectrometric analysis showed that the lupin hydrolase exhibits closest similarity to Arabidopsis thaliana Hint1 protein. The substrate specificity of the lupin enzyme, in particular its ability to split the P-S bond in adenosine 5'-phosphorothioate, is typical of known Hint1 proteins. Adenosine 5'-phosphofluoride and various derivatives of guanosine 5'-phosphoramidate were also substrates. Neither common divalent metal cations nor 10 mM EDTA or EGTA affected the hydrolysis of NH₂-pA. The enzyme functions as a homodimer (2 x 15,800 Da). At the optimum pH of 7.0, the K(m) for NH₂-pA was 0.5 µM and k(cat) 0.8 s⁻¹ (per monomer active site). The properties of the lupin nucleoside 5'-phosphoramidase are compared with those of its counterparts from other organisms.

Extracellular nucleic acids of the marine bacterium Rhodovulum sulfidophilum and recombinant RNA production technology using bacteria.

PubMed

Kikuchi, Yo; Umekage, So

2018-02-01

Extracellular nucleic acids of high molecular weight are detected ubiquitously in seawater. Recent studies have indicated that these nucleic acids are, at least in part, derived from active production by some bacteria. The marine bacterium Rhodovulum sulfidophilum is one of those bacteria. Rhodovulumsulfidophilum is a non-sulfur phototrophic marine bacterium that is known to form structured communities of cells called flocs, and to produce extracellular nucleic acids in culture media. Recently, it has been revealed that this bacterium produces gene transfer agent-like particles and that this particle production may be related to the extracellular nucleic acid production mechanism. This review provides a summary of recent physiological and genetic studies of these phenomena and also introduces a new method for extracellular production of artificial and biologically functional RNAs using this bacterium. In addition, artificial RNA production using Escherichia coli, which is related to this topic, will also be described. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Complete Genome Sequence of the p-Nitrophenol-Degrading Bacterium Pseudomonas putida DLL-E4

PubMed Central

Hu, Xiaojun; Wang, Jue; Wang, Fei; Chen, Qiongzhen; Huang, Yan

2014-01-01

The first complete genome sequence of a p-nitrophenol (PNP)-degrading bacterium is reported here. Pseudomonas putida DLL-E4, a Gram-negative bacterium isolated from methyl-parathion-polluted soil, can utilize PNP as the sole carbon and nitrogen source. P. putida DLL-E4 has a 6,484,062 bp circular chromosome that contains 5,894 genes, with a G+C content of 62.46%. PMID:24948765

Pathogenicity of Moraxella osloensis, a bacterium associated with the nematode Phasmarhabditis hermaphrodita, to the slug Deroceras reticulatum.

PubMed

Tan, L; Grewal, P S

2001-11-01

Moraxella osloensis, a gram-negative bacterium, is associated with Phasmarhabditis hermaphrodita, a nematode parasite of slugs. This bacterium-feeding nematode has potential for the biological control of slugs, especially the grey garden slug, Deroceras reticulatum. Infective juveniles of P. hermaphrodita invade the shell cavity of the slug, develop into self-fertilizing hermaphrodites, and produce progeny, resulting in host death. However, the role of the associated bacterium in the pathogenicity of the nematode to the slug is unknown. We discovered that M. osloensis alone is pathogenic to D. reticulatum after injection into the shell cavity or hemocoel of the slug. The bacteria from 60-h cultures were more pathogenic than the bacteria from 40-h cultures, as indicated by the higher and more rapid mortality of the slugs injected with the former. Coinjection of penicillin and streptomycin with the 60-h bacterial culture reduced its pathogenicity to the slug. Further work suggested that the reduction and loss of pathogenicity of the aged infective juveniles of P. hermaphrodita to D. reticulatum result from the loss of M. osloensis from the aged nematodes. Also, axenic J1/J2 nematodes were nonpathogenic after injection into the shell cavity. Therefore, we conclude that the bacterium is the sole killing agent of D. reticulatum in the nematode-bacterium complex and that P. hermaphrodita acts only as a vector to transport the bacterium into the shell cavity of the slug. The identification of the toxic metabolites produced by M. osloensis is being pursued.

Halomonas maura is a physiologically versatile bacterium of both ecological and biotechnological interest.

PubMed

Llamas, Inmaculada; del Moral, Ana; Martínez-Checa, Fernando; Arco, Yolanda; Arias, Soledad; Quesada, Emilia

2006-01-01

Halomonas maura is a bacterium of great metabolic versatility. We summarise in this work some of the properties that make it a very interesting microorganism both from an ecological and biotechnological point of view. It plays an active role in the nitrogen cycle, is capable of anaerobic respiration in the presence of nitrate and has recently been identified as a diazotrophic bacterium. Of equal interest is mauran, the exopolysaccharide produced by H. maura, which contributes to the formation of biofilms and thus affords the bacterium advantages in the colonisation of its saline niches. Mauran is highly viscous, shows thixotropic and pseudoplastic behaviour, has the capacity to capture heavy metals and exerts a certain immunomodulator effect in medicine. All these attributes have prompted us to make further investigations into its molecular characteristics. To date we have described 15 open reading frames (ORF's) related to exopolysaccharide production, nitrogen fixation and nitrate reductase activity among others.

Deinococcus mumbaiensis sp. nov., a radiation-resistant pleomorphic bacterium isolated from Mumbai, India.

PubMed

Shashidhar, Ravindranath; Bandekar, Jayant R

2006-01-01

A radiation-resistant, Gram-negative and pleomorphic bacterium (CON-1) was isolated from a contaminated tryptone glucose yeast extract agar plate in the laboratory. It was red pigmented, nonmotile, nonsporulating, and aerobic, and contained MK-8 as respiratory quinone. The cell wall of this bacterium contained ornithine. The major fatty acids were C16:0, C16:1, C17:0, C18:1 and iso C18:0. The DNA of CON-1 had a G+C content of 70 mol%. Phylogenetic analysis based on 16S rRNA gene sequences showed that CON-1 exhibited a maximum similarity (94.72%) with Deinococcus grandis. Based on the genotypic, phenotypic and chemotaxonomic characteristics, the bacterium CON-1 was identified as a new species of the genus Deinococcus, for which the name Deinococcus mumbaiensis sp. nov. is proposed. The type strain of D. mumbaiensis is CON-1 (MTCC 7297(T)=DSM 17424(T)).

From Genome to Function: Systematic Analysis of the Soil Bacterium Bacillus Subtilis

PubMed Central

Crawshaw, Samuel G.; Wipat, Anil

2001-01-01

Bacillus subtilis is a sporulating Gram-positive bacterium that lives primarily in the soil and associated water sources. Whilst this bacterium has been studied extensively in the laboratory, relatively few studies have been undertaken to study its activity in natural environments. The publication of the B. subtilis genome sequence and subsequent systematic functional analysis programme have provided an opportunity to develop tools for analysing the role and expression of Bacillus genes in situ. In this paper we discuss analytical approaches that are being developed to relate genes to function in environments such as the rhizosphere. PMID:18628943

Synthesis of novel antimicrobial aryl himachalene derivatives from naturally occurring himachalenes

PubMed Central

Chaudhary, Abha; Sood, Swati; Das, Pralay; Kaur, Pushpinder; Mahajan, Isha; Gulati, Arvind; Singh, Bikram

2014-01-01

Five new 2,9,9-trimethyl-6,7,8,9-tetrahydro-benzocyclohepten-5-ylidene-amine derivatives (16a-16e) were synthesized from α-dehydro-ar-himachalene (11) that was originally prepared from an isomeric mixture of α, β and γ himachalenes (10), the abundant sesquiterpenes of Cedrus deodara essential oil. In addition, different aryl himachalenes derivatives (9, 12, 14 and 15) were also formed from 11. The structures of the synthesized compounds were confirmed on the basis of their NMR, IR and mass spectral data. The prepared compounds were tested against a group of sixteen organisms including gram positive and gram negative bacterial and fungal strains. The introduction of a series of substituted imine groups into aryl himachalenes at 5th position (16a-16e) enhanced antimicrobial activity as compared to the aromatized derivatives (9, 12, 14 and 15) against gram-positive bacteria Bacillus subtilis, Micrococcus luteus and Staphylococcus aureus, and mycotoxigenic fungi Aspergillus parasiticus, A. ochraceous and A. sydowii. graphical Abstract, Figure 1(Fig. 1) PMID:26417335

Characterization of Cladosporols from the Marine Algal-Derived Endophytic Fungus Cladosporium cladosporioides EN-399 and Configurational Revision of the Previously Reported Cladosporol Derivatives.

PubMed

Li, Hong-Lei; Li, Xiao-Ming; Mándi, Attila; Antus, Sándor; Li, Xin; Zhang, Peng; Liu, Yang; Kurtán, Tibor; Wang, Bin-Gui

2017-10-06

Four new cladosporol derivatives, cladosporols F-I (1-4), the known cladosporol C (5), and its new epimer, cladosporol J (6), were isolated and identified from the marine algal-derived endophytic fungus Cladosporium cladosporioides EN-399. Their structures were determined by detailed interpretation of NMR and MS data, and the absolute configurations were established on the basis of TDDFT-ECD and OR calculations. The configurational assignment of cladosporols F (1) and G (2) showed that the previously reported absolute configuration of cladosporol A and all the related cladosporols need to be revised from (4'R) to (4'S). Compounds 1-6 showed antibacterial activity against Escherichia coli, Micrococcus luteus, and Vibrio harveyi with MIC values ranging from 4 to 128 μg/mL. Compound 3 showed significant cytotoxicity against A549, Huh7, and LM3 cell lines with IC 50 values of 5.0, 1.0, and 4.1 μM, respectively, and compound 5 showed activity against H446 cell line with IC 50 value of 4.0 μM.

Identification of Streptomyces sp. KH29, which produces an antibiotic substance processing an inhibitory activity against multidrug-resistant Acinetobacter baumannii.

PubMed

Lee, Keyong Ho; Kim, Kye-Woong; Rhee, Ki-Hyeong

2010-12-01

The Actinomycete strain KH29 is antagonistic to the multidrug-resistant Acinetobacter baumannii. Based on the diaminopimelic acid (DAP) type, and the morphological and physiological characteristics observed through the use of scanning electron microscopy (SEM), KH29 was confirmed as belonging to the genus Streptomyces. By way of its noted 16S rDNA nucleotide sequences, KH29 was found to have a relationship with Streptomyces cinnamonensis. The production of an antibiotic from this strain was found to be most favorable when cultured with glucose, polypeptone, and yeast extract (PY) medium for 6 days at 27 degrees C. The antibiotic produced was identified, through comparisons with reported spectral data including MS and NMR as a cyclo(L-tryptophanyl-L-tryptophanyl). Cyclo(L-Trp-L-Trp), from the PY cultures of KH29, was seen to be highly effective against 41 of 49 multidrugresistant Acinetobacter baumannii. Furthermore, cyclo(LTrp- L-Trp) had antimicrobial activity against Bacillus subtilis, Micrococcus luteus, Staphylococcus aureus, Saccharomyces cerevisiae, Aspergillus niger, and Candida albicans, However, it was ineffective against Streptomyces murinus.

[Preparation and characterization of polyhydroxyalkanoate bioplastics with antibacterial activity].

PubMed

Lou, Qiuli; Ma, Yiming; Che, Xuemei; Zhong, Jin; Sun, Xiaoxia; Zhang, Haoqian

2016-08-25

Polyhydroxyalkanoates (PHAs), as a novel class of biopolymer, are attracting more attention due to their diverse material properties and environment-independent biodegradability. Here we report the preparation of PHA exhibiting efficient antibacterial activity by embedding Nisin, a food additive generally recognized as safe, into poly(3-hydroxybutyrate-co-3-hydroxyhexanoate) (PHBHHx), a type of PHA with high biocompatibility. We first prepared Nisin-containing PHBHHx films using solvent casting method. Confocal laser scanning microscopy analysis showed that a well-mixed integrated structure of the films with an even distribution of the Nisin particles in the PHBHHx matrices. Then the antimicrobial activity of PHBHHx/Nisin films against Micrococcus luteus was quantified on agar plate by measuring the size of inhibition zone. Cultivation in liquid media further confirmed the releasing of Nisin from the films and the long-time antibacterial activity. Results showed that the threshold of Nisin concentration for long-time and effective inhibition against bacteria growth is 25 μg/g. These results altogether establish a technological foundation for the application of PHA in biomedicine and food industry.

Comparative Pharmacokinetics of Cefquinome (Cobactan 2.5%) following Repeated Intramuscular Administrations in Sheep and Goats

PubMed Central

El-Hewaity, Mohamed; Abd El Latif, Amera

2014-01-01

The comparative pharmacokinetic profile of cefquinome was studied in sheep and goats following repeated intramuscular (IM) administrations of 2 mg/kg body weight. Cefquinome concentrations in serum were determined by microbiological assay technique using Micrococcus luteus (ATCC 9341) as test organism. Following intramuscular injection of cefquinome in sheep and goats, the disposition curves were best described by two-compartment open model in both sheep and goats. The pharmacokinetics of cefquinome did not differ significantly between sheep and goats; similar intramuscular dose rate of cefquinome should therefore be applicable to both species. On comparing the data of serum levels of repeated intramuscular injections with first intramuscular injection, it was revealed that repeated intramuscular injections of cefquinome have cumulative effect in both species sheep and goats. The in vitro serum protein-binding tendency was 15.65% in sheep and 14.42% in goats. The serum concentrations of cefquinome along 24 h after injection in this study were exceeding the MICs of different susceptible microorganisms responsible for serious disease problems. These findings indicate successful use of cefquinome in sheep and goats. PMID:26464946

Glycosidases in Brachionus plicatilis (Rotifera).

PubMed

Kühle, K; Kleinow, W

1990-01-01

1. Tests for glycosidases were performed in homogenates of Brachionus plicatilis. 2. Hydrolytic activity was detected with the following substrates: (a) with synthetic substrates (NP = 4-nitrophenyl): NP-alpha- and NP-beta-D-glucopyranoside, NP-alpha- and NP-beta-D-galactopyranoside, NP-N-acetyl-beta-D-glucosaminide, NP-N-acetyl-beta-D-galactosaminide, NP-alpha- and NP-beta-D-mannopyranoside and NP-alpha-L-fucopyranoside; (b) with disaccharides: sucrose, maltose, trehalose, isomaltose, cellobiose, gentiobiose and lactose; (c) with polysaccharides: laminarine, carboxymethyl-cellulose, avicel, Micrococcus luteus (for lysozyme) and 4-nitrophenyl-alpha-D-maltoheptaoside (for amylase). 3. The pH dependence of the glycosidase activities was determined. 4. The distribution of enzyme activities within fractions from the homogenate was studied in order to localize them within the cell. 5. Proteins from Brachionus homogenate were separated by SDS-gel electrophoresis and the positions of the following glycosidase activities were detected by assays performed on the gels (estimated molecular weights in parentheses): alpha-glucosidase (250,000); beta-glucosidase (200,000); beta-galactosidase (70,000); N-acetyl-beta-glucosaminidase (60,000).

Production of human lactoferrin in animal milk.

PubMed

Goldman, I L; Georgieva, S G; Gurskiy, Ya G; Krasnov, A N; Deykin, A V; Popov, A N; Ermolkevich, T G; Budzevich, A I; Chernousov, A D; Sadchikova, E R

2012-06-01

Genetic constructs containing the human lactoferrin (hLf) gene were created within a joint program of Russian and Belorussian scientists. Using these constructs, transgenic mice were bred (the maximum hLf concentration in their milk was 160 g/L), and transgenic goats were also generated (up to 10 g/L hLf in their milk). Experimental goatherds that produced hLf in their milk were also bred, and the recombinant hLf was found to be identical to the natural protein in its physical and chemical properties. These properties included electrophoretic mobility, isoelectric point, recognition by polyclonal and monoclonal antibodies, circular dichroic spectra, interaction with natural ligands (DNA, lipopolysaccharides, and heparin), the binding of iron ions, the sequence of the 7 terminal amino acids, and its biological activity. The latter was assessed by the agglutination of Micrococcus luteus protoplasts, bactericidal activity against Escherichia coli and Listeria monocytogenes , and fungicidal activity against Candida albicans . We also demonstrated a significant increase in the activity of antibiotics when used in combination with Lf.

Elution kinetics, antimicrobial activity, and mechanical properties of 11 different antibiotic loaded acrylic bone cement.

PubMed

Gálvez-López, Ruben; Peña-Monje, Alejandro; Antelo-Lorenzo, Ramón; Guardia-Olmedo, Juan; Moliz, Juan; Hernández-Quero, José; Parra-Ruiz, Jorge

2014-01-01

Antibiotic-loaded acrylic bone cements (ALABC) spacers are routinely used in the treatment of prosthetic joint infections. The objectives of our study were to evaluate different ALABC for elution kinetics, thermal stability, and mechanical properties. A 10 or 20% mixture (w/w) beads of medium viscosity bone cement (DePuy, Inc) and vancomycin (VAN), gentamycin (GM), daptomycin (DAP), moxifloxacin (MOX), rifampicin (RIF), cefotaxime (CTX), cefepime (FEP), amoxicillin clavulanate (AmC), ampicillin (AMP), meropenem (MER), and ertapenem (ERT) were formed and placed into wells filled with phosphate-buffered saline. Antibiotic concentrations were determined using high-performance liquid chromatography. Antimicrobial activity was tested against Micrococcus luteus ATCC 9341 or Escherichia coli ATCC 25922. AmC, AMP, and FEP concentration rapidly decreased after day 2, being almost undetectable at day 4. Sustained and high elution rates were observed with VAN, GM, MOX, and RIF for the 30-day duration of the experiment. DAP, MER, ERT, and CTX elution rates constantly decreased from day 4. All antibiotics tested retained antimicrobial activity proving thermal stability. Mechanical properties of ALABC were maintained except when RIF was used. © 2013.

Detailed Investigations on the Solid Cell Culture and Antimicrobial Activities of the Iranian Arnebia euchroma

PubMed Central

Haghbeen, K.; Pourmolaei, S.; Mareftjo, M. J.; Mousavi, A.; Akbari Noghabi, K.; Hosseini Shirazi, F.; Meshkat, A.

2011-01-01

In pursuit of strong shikalkin-producing cell lines, seeds of the Iranian Arnebia euchroma were collected from Dena altitudes in the central Zagross. Chemical analysis showed that the dried root of the plant contained about 8.5% (w/w) shikalkin pigment. The root explants of the young plantlets, obtained from the germinated seeds, were used for establishing callus. Then, parameters effective on proliferation and pigment production of the resulting calli were studied in detail. Accordingly, two modified media called mLS and mM9 were optimized for propagation and pigment production, respectively. Using these media, the biomass of the A.euchroma calli was increased to 600%, and the pigment production reached to a maximum of 16.3 mg per gram of the wet biomass in a period of a subculture (21 days). Parallel to these experiments, the antimicrobial activity of shikalkin pigment was examined on some fungi and Gram-positive and Gram-negative bacteria. Results indicated that the pigment was almost ineffective on fungi and Gram-negative bacteria, but it was meaningfully effective against Micrococcus luteus. PMID:21772789

Lipopeptide biosurfactants from Paenibacillus polymyxa inhibit single and mixed species biofilms.

PubMed

Quinn, Gerry A; Maloy, Aaron P; McClean, Stephen; Carney, Brian; Slater, John W

2012-01-01

Although biofilms are recognised as important in microbial colonisation, solutions to their inhibition are predominantly based on planktonic assays. These solutions have limited efficacy against biofilms. Here, a series of biofilm-orientated tests were used to identify anti-biofilm compounds from marine micro-flora. This led to the isolation of a complex of anti-biofilm compounds from an extract of Paenibacillus polymyxa (PPE). A combination of rpHPLC and mass spectrometry identified the principle components of PPE as fusaricidin B (LI-FO4b) and polymyxin D1, with minor contributions from surfactins. This complex (PPE) reduced the biofilm biomass of Bacillus subtilis, Micrococcus luteus, Pseudomonas aeruginosa, Staphylococcus aureus and Streptococcus bovis. In contrast, ampicillin was only effective against S. aureus. PPE also inhibited a self-assembling marine biofilm (SAMB) in co-incubation assays by 99.3% ± 1.9 and disrupted established SAMB by 72.4% ± 4.4, while ampicillin showed no significant reduction. The effectiveness of this complex of lipopeptides against single and multispecies biofilms suggests a future role in biofilm prevention strategies.

Assessment of the bacterial contamination of hand air dryer in washrooms.

PubMed

Alharbi, Sulaiman Ali; Salmen, Saleh Hussein; Chinnathambi, Arunachalam; Alharbi, Naiyf S; Zayed, M E; Al-Johny, Bassam O; Wainwright, Milton

2016-03-01

The present study was carried out, using standard techniques, to identify and count the bacterial contamination of hand air dryers, used in washrooms. Bacteria were isolated from the air flow, outlet nozzle of warm air dryers in fifteen air dryers used in these washrooms. Bacteria were found to be relatively numerous in the air flows. Bacterially contaminated air was found to be emitted whenever a warm air dryer was running, even when not being used for hand drying. Our investigation shows that Staphylococcus haemolyticus, Micrococcus luteus, Pseudomonas alcaligenes, Bacillus cereus and Brevundimonad diminuta/vesicularis were emitted from all of the dryers sampled, with 95% showing evidence of the presence of the potential pathogen S. haemolyticus. It is concluded that hot air dryers can deposit pathogenic bacteria onto the hands and body of users. Bacteria are distributed into the general environment whenever dryers are running and could be inhaled by users and none-users alike. The results provide an evidence base for the development and enhancement of hygienic hand drying practices.

Assessment of the bacterial contamination of hand air dryer in washrooms

PubMed Central

Alharbi, Sulaiman Ali; Salmen, Saleh Hussein; Chinnathambi, Arunachalam; Alharbi, Naiyf S.; Zayed, M.E.; Al-Johny, Bassam O.; Wainwright, Milton

2015-01-01

The present study was carried out, using standard techniques, to identify and count the bacterial contamination of hand air dryers, used in washrooms. Bacteria were isolated from the air flow, outlet nozzle of warm air dryers in fifteen air dryers used in these washrooms. Bacteria were found to be relatively numerous in the air flows. Bacterially contaminated air was found to be emitted whenever a warm air dryer was running, even when not being used for hand drying. Our investigation shows that Staphylococcus haemolyticus, Micrococcus luteus, Pseudomonas alcaligenes, Bacillus cereus and Brevundimonad diminuta/vesicularis were emitted from all of the dryers sampled, with 95% showing evidence of the presence of the potential pathogen S. haemolyticus. It is concluded that hot air dryers can deposit pathogenic bacteria onto the hands and body of users. Bacteria are distributed into the general environment whenever dryers are running and could be inhaled by users and none-users alike. The results provide an evidence base for the development and enhancement of hygienic hand drying practices. PMID:26981009

Chemical and biological evaluation of Ranunculus muricatus.

PubMed

Khan, Farhat Ali; Zahoor, Muhammad; Khan, Ezzat

2016-03-01

Ranunculus muricatus is commonly known as spiny fruit buttercup and is used in the treatment of intermittent fevers, gout and asthma. Qualitative analysis of phytochemicals of Ranunculus muricatus indicated the presence of saponins, tannins, phenols, flavonoids and alkaloids. Saponins were present in high amount as compared with other chemicals. Inorganic and heavy metals constituents were determined. Heavy metals estimation in the sample showed that iron was present in high amount followed by zinc even then the concentration of these metals is below acceptable limit. The physical parameters, antioxidant and antimicrobial activities of the extracts were determined. Acetone extract fraction showed optimal antioxidant activity as compared to ethanol and chloroform fractions of the candidate plant. The antimicrobial and antifungal activities of the crude extract and extract fractions were determined by well agar diffusion method. Highest zone of inhibitions were observed for crude extract followed by acetone extract fraction against Micrococcus luteus. Antifungal activities were high for crude extracts against Candida Albican. Findings of this study show that Ranunculus muricatus has a good medicinal impact.

[Isolation and antimicrobial activities of actinomycetes from vermicompost].

PubMed

Wang, Xue-jun; Yan, Shuang-lin; Min, Chang-li; Yang, Yan

2015-02-01

In this paper, actinomycetes were isolated from vermicompost by tablet coating method. Antimicrobial activities of actinomycetes were measured by the agar block method. Strains with high activity were identified based on morphology and biochemical characteristics, as well as 16S rDNA gene sequence analysis. The results showed that 26 strains of actinomycetes were isolated, 16 of them had antimicrobial activities to the test strains which accounts for 61.54% of all strains. Among the 16 strains, the strain QYF12 and QYF22 had higher antimicrobial activity to Micrococcus luteus, with a formed inhibition zone of 27 mm and 31 mm, respectively. While the strain QYF26 had higher antimicrobial activity to Bacillus subtilis, and the inhibition zone diameter was 21 mm. Based on the identification of strains with high activity, the strain QYF12 was identified as Streptomyces chartreusis, the strain QYF22 was S. ossamyceticus and the strain QYF26 was S. gancidicus. This study provided a theoretical basis for further separate antibacterial product used for biological control.

Bombyx mori Serpin6 regulates prophenoloxidase activity and the expression of antimicrobial proteins.

PubMed

Li, Bing; Yu, Hai-Zhong; Ye, Chong-Jun; Ma, Yan; Li, Xing; Fan, Tao; Chen, Fu-Sheng; Xu, Jia-Ping

2017-04-30

Serpins are a family of serine protease inhibitors that are found widely in insects. They play an important role in insect physiological responses, such as innate immunity and development. In this study, we obtained the Bombyx mori serpin6 (BmSerpin6) sequence from National Center for Biotechnology Information (NCBI) and the silkworm genome database (SilkDB). Reverse transcription PCR (RT-PCR) results showed that BmSerpin6 was expressed highly in hemocytes, the midgut, and the fat body. After challenging with Micrococcus luteus (Mi) and Serratia marcescens (Sm), the BmSerpin6 expression level was induced significantly. Transcript levels of gloverin2 and prophenoloxidase (PPO) activity were reduced significantly in the fat body and hemocytes after injecting the recombinant BmSerpin6 protein into silkworm larvae. A BmSerpin6 recombinant plasmid (BmSerpin6-pAC 5.1) was constructed successfully and transfected into Drosophila S2 cells, which resulted in significantly reduced expression of the drosomycin protein. These results indicated that BmSerpin6 might regulate silkworm immune responses. Copyright © 2017 Elsevier B.V. All rights reserved.

The constituents of essential oil: antimicrobial and antioxidant activity of Micromeria congesta Boiss. & Hausskn. ex Boiss. from East Anatolia.

PubMed

Herken, Emine Nur; Celik, Ali; Aslan, Mustafa; Aydınlık, Nilüfer

2012-09-01

The chemical composition, antimicrobial activity, total phenol content, total antioxidant activity, and total oxidant status of the essential oil from Micromeria congesta Boiss. & Hausskn. ex Boiss. were investigated. Steam distillation was used to obtain the essential oil, and the chemical analyses were performed by gas chromatography-mass spectrometry. The antimicrobial activity was tested by an agar disc diffusion method against the tested microorganisms: Bacillus subtilis NRRL B-744, Bacillus cereus NRRL B-3711, Staphylococcus aureus ATCC 12598, S. aureus ATCC 25923, S. aureus ATCC 25933, Escherichia coli 0157H7, E. coli ATCC25922, Micrococcus luteus NRLL B-4375, Enterococcus faecalis ATCC 19433, Proteus vulgaris RSKK 96026, and Yersinia enterecolitica RSKK 1501. The major compounds found in volatiles of M. congesta were piperitone oxide, linalool oxide, veratrole, pulegone, dihydro carvone, naphthalene, iso-menthone, para-menthone, and cyclohexanone. Compared to that of reference antibiotics, the antibacterial activity of the essential oil is considered as significant. Results showed that M. congesta has the potential for being used in food and medicine depending on its antioxidant and antibacterial activity.

Utilization of Industrial Waste for the Production of Bio-Preservative from Bacillus licheniformis Me1 and Its Application in Milk and Milk-Based Food Products.

PubMed

Nithya, Vadakedath; Prakash, Maya; Halami, Prakash M

2018-06-01

The bio-preservative efficacy of a partially purified antibacterial peptide (ppABP) produced by Bacillus licheniformis Me1 in an economical medium developed using agro-industry waste was evaluated by direct application in milk and milk-based food products. The addition of ppABP in milk samples stored at 4 ± 2 °C and 28 ± 2 °C resulted in the growth inhibition of pathogens Listeria monocytogenes Scott A, Micrococcus luteus ATCC 9341, and Staphylococcus aureus FRI 722. The shelf life of milk samples with added ppABP increased to 4 days at 28 ± 2 °C, whereas curdling and off-odor were noticed in samples without ppABP. Furthermore, the milk samples with ppABP were sensorily acceptable. Antilisterial effect was also observed in cheese and paneer samples treated with ppABP. These results clearly indicate that the ppABP of B. licheniformis Me1 can be utilized as a bio-preservative to control the growth of spoilage and pathogenic bacteria, thereby reducing the risk of food-borne diseases.

Evaluation of dermal wound healing activity and in vitro antibacterial and antioxidant activities of a new exopolysaccharide produced by Lactobacillus sp.Ca6.

PubMed

Trabelsi, Imen; Ktari, Naourez; Ben Slima, Sirine; Triki, Mehdi; Bardaa, Sana; Mnif, Hela; Ben Salah, Riadh

2017-10-01

The present study aimed to evaluate the in vitro antibacterial and antioxidant activities and the in vivo wound healing performance of a noval exopolysaccharides (EPS-Ca 6 ) produced by Lactobacillus sp.Ca 6 strain. The results showed that EPS-Ca 6 had a potential antioxidant activity determined through four different assays: DPPH scavenging activity, reducing power, β-carotene bleaching by linoleic acid assay, and Metal chelating activities. It also exhibited significant antibacterial activity against pathogenic bacteria Salmonella enterica and Micrococcus luteus. The wound healing activity of the EPS-Ca 6 , using excision wound model in rats, showed that this novel EPS accelerated significantly wound healing activity as compared to the control group, and a total closure was achieved after 14days of wound induction. Furthermore, histological examination of biopsies showed fully re-epithelialized wound with a complete epidermal regeneration. Overall the finding indicates that the EPS-Ca 6 might be useful as a wound healing agent in modern medicine. Copyright © 2017 Elsevier B.V. All rights reserved.

Synthesis, pharmacological activities and molecular docking studies of pyrazolyltriazoles as anti-bacterial and anti-inflammatory agents.

PubMed

Dayakar, Cherupally; Kumar, Buddana Sudheer; Sneha, Galande; Sagarika, Gudem; Meghana, Koneru; Ramakrishna, Sistla; Prakasham, Reddy Shetty; China Raju, Bhimapaka

2017-10-15

A series of novel pyrazolyl alcohols (5a-h), pyrazolyl azides (6a-h), and pyrazolyltriazoles (8a-h, 10a-p and 12a-l) were prepared and evaluated for their bioactivity (anti-bacterial and anti-inflammatory) profile. The compound 5c displayed the potent anti-bacterial activity against Micrococcus luteus (MIC 3.9 and MBC 7.81µg/mL). In vitro anti-inflammatory activity data denoted that compound 8b is effective among the tested compounds against IL-6 (IC 50 6.23μM). Docking analysis of compounds 5f, 8a-b, 8e-f and 8h displayed high binding energies for the compounds 8a-b and 8h towards TNF-α dimer (2AZ5 protein) and IL-6 (1ALU protein). In vivo anti-inflammatory activity of compounds 8b and 8h with respect to LPS induced mice model indicated that compound 8h showed significant reduction in TNF-α. Copyright © 2017 Elsevier Ltd. All rights reserved.

Antifouling potentials of eight deep-sea-derived fungi from the South China Sea.

PubMed

Zhang, Xiao-Yong; Xu, Xin-Ya; Peng, Jiang; Ma, Chun-Feng; Nong, Xu-Hua; Bao, Jie; Zhang, Guang-Zhao; Qi, Shu-Hua

2014-04-01

Marine-derived microbial secondary metabolites are promising potential sources of nontoxic antifouling agents. The search for environmentally friendly and low-toxic antifouling components guided us to investigate the antifouling potentials of eight novel fungal isolates from deep-sea sediments of the South China Sea. Sixteen crude ethyl acetate extracts of the eight fungal isolates showed distinct antibacterial activity against three marine bacteria (Loktanella hongkongensis UST950701-009, Micrococcus luteus UST950701-006 and Pseudoalteromonas piscida UST010620-005), or significant antilarval activity against larval settlement of bryozoan Bugula neritina. Furthermore, the extract of Aspergillus westerdijkiae DFFSCS013 displayed strong antifouling activity in a field trial lasting 4 months. By further bioassay-guided isolation, five antifouling alkaloids including brevianamide F, circumdatin F and L, notoamide C, and 5-chlorosclerotiamide were isolated from the extract of A. westerdijkiae DFFSCS013. This is the first report about the antifouling potentials of metabolites of the deep-sea-derived fungi from the South China Sea, and the first stage towards the development of non- or low-toxic antifouling agents from deep-sea-derived fungi.

Study of Bacterial Samples Using Laser Induced Breakdown Spectroscopy

NASA Astrophysics Data System (ADS)

W, A. Farooq; M, Atif; W, Tawfik; M, S. Alsalhi; Z, A. Alahmed; M, Sarfraz; J, P. Singh

2014-12-01

Laser-induced breakdown spectroscopy (LIBS) technique has been applied to investigate two different types of bacteria, Escherichia coli (B1) and Micrococcus luteus (B2) deposited on glass slides using Spectrolaser 7000. LIBS spectra were analyzed using spectrolaser software. LIBS spectrum of glass substrate was compared with bacteria spectra. Ca, Mg, Na, K, P, S, Cl, Fe, Al, Mn, Cu, C, H and CN-band appeared in bacterial samples in air. Two carbon lines at 193.02 nm, 247.88 nm and one hydrogen line at 656.28 nm with intensity ratios of 1.9, 1.83 and 1.53 appeared in bacterial samples B1 and B2 respectively. Carbon and hydrogen are the important components of the bio-samples like bacteria and other cancer cells. Investigation on LIBS spectra of the samples in He and Ar atmospheres is also presented. Ni lines appeared only in B2 sample in Ar atmosphere. From the present experimental results we are able to show that LIBS technique has a potential in the identification and discrimination of different types of bacteria.

Prokaryotic complex of newly formed soils on nepheline-containing industrial waste

NASA Astrophysics Data System (ADS)

Evdokimova, G. A.; Kalmykova, V. V.

2010-06-01

The characteristics are given of the prokaryotic complex participating in the processes of the primary soil formation on nepheline-containing waste and depending on the time of the waste disposal and degree of reclamation. The total population density of the bacteria determined with the method of fluorescent microscopy in “pure” sand ranged within 0.34—0.60 billion CFU/g soil; in the reclaimed sand under different vegatation communities, from 2.6 to 7.2 billion CFU/g soil. Gram-positive bacteria dominate in the prokaryotic complex of the nepheline sands, whereas the Grarrmegative ones dominate in the zonal soils. The bacteria predominating in the nepheline sands were classified on the basis of the comparative analysis of the nucleotide sequences in the 16S rRNA genes within the Actinobacteria class (Arthrobacter boritolerans, A. ramosus, Rhodococcusfascians, Micrococcus luteus, and Streptomyces spp.). The evolution of the microbial community in the nepheline sands in the course of their reclamation and in the course of their overgrowing by plants proceeds in way toward the microbial communities of the zonal soils on moraine deposits.

Synthesis, structural characterisation and antibacterial activity of Ag+-doped fluorapatite nanomaterials prepared by neutralization method

NASA Astrophysics Data System (ADS)

Stanić, Vojislav; Radosavljević-Mihajlović, Ana S.; Živković-Radovanović, Vukosava; Nastasijević, Branislav; Marinović-Cincović, Milena; Marković, Jelena P.; Budimir, Milica D.

2015-05-01

Silver doped fluorapatite nanopowders were synthesised by neutralization method, which consists of dissolving Ag2O in solution of HF and H3PO4 and addition to suspension of Ca(OH)2. The powder XRD, SEM and FTIR studies indicated the formation of a fluorapatite nanomaterials with average length of the particles is about 80 nm and a width of about 15 nm. The FTIR studies show that carbonate content in samples is very small and carbonte ions substitute both phosphate and hydroxyl groups in the crystal structure of samples, forming AB-type fluorapatite. Antibacterial studies have demonstrated that all Ag+-doped fluorapatite samples exhibit bactericidal effect against pathogens: Staphylococcus aureus, Micrococcus luteus and Kllebsiela pneumoniae. Antibacterial activity increased with the increase of Ag+ in the samples. The atomic force microscopy studies revealed extensive damage to the bacterial cell envelops in the presence of Ag+-doped fluorapatite particles which may lead to their death. The synthesized Ag+-doped fluorapatite nanomaterials are promising as antibacterial biomaterials in orthopedics and dentistry.

Enhancement of antidandruff activity of shampoo by biosynthesized silver nanoparticles from Solanum trilobatum plant leaf

NASA Astrophysics Data System (ADS)

Pant, Gaurav; Nayak, Nitesh; Gyana Prasuna, R.

2013-10-01

The present investigation describes simple and effective method for synthesis of silver nanoparticles via green route. Solanum trilobatum Linn extract were prepared by both conventional and homogenization method. We optimized the production of silver nanoparticles under sunlight, microwave and room temperature. The best results were obtained with sunlight irradiation, exhibiting 15-20 nm silver nanoparticles having cubic and hexagonal shape. Biosynthesized nanoparticles were highly toxic to various bacterial strains tested. In this study we report antibacterial activity against various Gram negative ( Klebsiella pneumoniae, Vibrio cholerae and Salmonella typhi) and Gram positive ( Staphylococcus aureus, Bacillus cereus and Micrococcus luteus) bacterial strains. Screening was also performed for any antifungal properties of the nanoparticles against human pathogenic fungal strains ( Candida albicans and Candida parapsilosis). We also demonstrated that these nanoparticles when mixed with shampoo enhance the anti-dandruff effect against dandruff causing fungal pathogens ( Pityrosporum ovale and Pityrosporum folliculitis). The present study showed a simple, rapid and economical route to synthesize silver nanoparticles and their applications hence has a great potential in biomedical field.

Heterogeneous precipitation of silver nanoparticles on kaolinite plates

NASA Astrophysics Data System (ADS)

Cabal, B.; Torrecillas, R.; Malpartida, F.; Moya, J. S.

2010-11-01

Two different methods to obtain silver nanoparticles supported on kaolin crystals have been performed: the first one followed a thermal reduction and the second one a chemical reduction. In both cases, the silver nanoparticles with two different average particles size (ca.12 and 30 nm) were perfectly isolated and attached to the surface of the kaolin plates. The silver nanoparticles were localized mainly at the edge of the single crystal plates, the hydroxyl groups being the main centres of adsorption. The samples were fully characterized by XRD, UV-vis spectroscopy and TEM. The antimicrobial benefits of the composites were evaluated as antibacterial against common Gram-positive and Gram-negative bacteria, and antifungal activity against yeast. The results indicated a high antimicrobial activity for Escherichia coli JM 110 and Micrococcus luteus, while being inactive against yeast under our experimental conditions. The chemical analysis of Ag in the fermentation broths show that only a small portion of metal (<9 ppm) is released from the kaolin/metakaolin particles. Therefore, the risk of toxicity due to a high concentration of metal in the medium is minimized.

Hemocyte-mediated phagocytosis and melanization in the mosquito Armigeres subalbatus following immune challenge by bacteria.

PubMed

Hillyer, Julián F; Schmidt, Shelley L; Christensen, Bruce M

2003-07-01

Mosquitoes are important vectors of disease. These insects respond to invading organisms with strong cellular and humoral immune responses that share many similarities with vertebrate immune systems. The strength and specificity of these responses are directly correlated to a mosquito's ability to transmit disease. In the current study, we characterized the hemocytes (blood cells) of Armigeres subalbatus by morphology (ultrastructure), lectin binding, enzyme activity, immunocytochemistry, and function. We found four hemocyte types: granulocytes, oenocytoids, adipohemocytes, and thrombocytoids. Granulocytes contained acid phosphatase activity and bound the exogenous lectins Helix pomatia agglutinin, Galanthus nivalis lectin, and wheat germ agglutinin. Following bacteria inoculation, granulocytes mounted a strong phagocytic response as early as 5 min postexposure. Bacteria also elicited a hemocyte-mediated melanization response. Phenoloxidase, the rate-limiting enzyme in the melanization pathway, was present exclusively in oenocytoids and in many of the melanotic capsules enveloping bacteria. The immune responses mounted against different bacteria were not identical; gram(-) Escherichia coli were predominantly phagocytosed and gram(+) Micrococcus luteus were melanized. These studies implicate hemocytes as the primary line of defense against bacteria.

Complete Genome Sequence of a thermotolerant sporogenic lactic acid bacterium, Bacillus coagulans strain 36D1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xie, Gary; Dalin, Eileen; Tice, Hope

Bacillus coagulans is a ubiquitous soil bacterium that grows at 50-55 C and pH 5.0 and fer-ments various sugars that constitute plant biomass to L (+)-lactic acid. The ability of this sporogenic lactic acid bacterium to grow at 50-55 C and pH 5.0 makes this organism an attractive microbial biocatalyst for production of optically pure lactic acid at industrial scale not only from glucose derived from cellulose but also from xylose, a major constituent of hemi-cellulose. This bacterium is also considered as a potential probiotic. Complete genome squence of a representative strain, B. coagulans strain 36D1, is presented and discussed.

Genome Sequence of the Soil Bacterium Janthinobacterium sp. KBS0711

PubMed Central

Shoemaker, William R.; Muscarella, Mario E.

2015-01-01

We present a draft genome of Janthinobacterium sp. KBS0711 that was isolated from agricultural soil. The genome provides insight into the ecological strategies of this bacterium in free-living and host-associated environments. PMID:26089434

Structure and morphology of magnetite anaerobically-produced by a marine magnetotactic bacterium and a dissimilatory iron-reducing bacterium

USGS Publications Warehouse

Sparks, N.H.C.; Mann, S.; Bazylinski, D.A.; Lovley, D.R.; Jannasch, H.W.; Frankel, R.B.

1990-01-01

Intracellular crystals of magnetite synthesized by cells of the magnetotactic vibroid organism, MV-1, and extracellular crystals of magnetite produced by the non-magnetotactic dissimilatory iron-reducing bacterium strain GS-15, were examined using high-resolution transmission electron microscopy, electron diffraction and 57Fe Mo??ssbauer spectroscopy. The magnetotactic bacterium contained a single chain of approximately 10 crystals aligned along the long axis of the cell. The crystals were essentially pure stoichiometric magnetite. When viewed along the crystal long axis the particles had a hexagonal cross-section whereas side-on they appeared as rectangules or truncated rectangles of average dimension, 53 ?? 35 nm. These findings are explained in terms of a three-dimensional morphology comprising a hexagonal prism of {110} faces which are capped and truncated by {111} end faces. Electron diffraction and lattice imaging studies indicated that the particles were structurally well-defined single crystals. In contrast, magnetite particles produced by the strain, GS-15 were irregular in shape and had smaller mean dimensions (14 nm). Single crystals were imaged but these were not of high structural perfection. These results highlight the influence of intracellular control on the crystallochemical specificity of bacterial magnetites. The characterization of these crystals is important in aiding the identification of biogenic magnetic materials in paleomagnetism and in studies of sediment magnetization. ?? 1990.

Some biological activities of pigments extracted from Micrococcus roseus (PTCC 1411) and Rhodotorula glutinis (PTCC 5257).

PubMed

Rostami, Hossein; Hamedi, Hassan; Yolmeh, Mahmoud

2016-12-01

The importance of replacing synthetic pigments with natural types is increasing day by day in the food industry due to the harmful effects of some synthetic pigments. Microorganisms are a major source of natural pigments, which nowadays have attracted the attention of researchers. In this study, carotenoid pigments were produced by Micrococcus roseus and Rhodotorula glutinis, and some of their biological properties such as antimicrobial, antioxidant, anticancer, and anti-inflammatory activities were evaluated. Given the results, bacteria, especially gram-positive bacteria, had higher sensitivity to the pigments extracted from M. roseus (PEM) and R. glutinis (PER) compared to molds so that Bacillus cereus and Alternaria citri had the highest and the lowest sensitivity, respectively. PER showed a higher antioxidant activity compared with PEM in the various methods of measuring antioxidant activity. In vitro and in vivo anti-tumor-promoting activities of PER were measured significantly more than PEM (P <0.05). Both pigment extracts remarkably inhibited the 12-O-tetradecanoylphorbol-13-acetate (TPA)-induced inflammation, so that ID 50 (50% inhibitory dose) of PEM and PER were 0.22 and 0.09 mg/ear, respectively. © The Author(s) 2016.

Some biological activities of pigments extracted from Micrococcus roseus (PTCC 1411) and Rhodotorula glutinis (PTCC 5257)

PubMed Central

Rostami, Hossein; Hamedi, Hassan; Yolmeh, Mahmoud

2016-01-01

The importance of replacing synthetic pigments with natural types is increasing day by day in the food industry due to the harmful effects of some synthetic pigments. Microorganisms are a major source of natural pigments, which nowadays have attracted the attention of researchers. In this study, carotenoid pigments were produced by Micrococcus roseus and Rhodotorula glutinis, and some of their biological properties such as antimicrobial, antioxidant, anticancer, and anti-inflammatory activities were evaluated. Given the results, bacteria, especially gram-positive bacteria, had higher sensitivity to the pigments extracted from M. roseus (PEM) and R. glutinis (PER) compared to molds so that Bacillus cereus and Alternaria citri had the highest and the lowest sensitivity, respectively. PER showed a higher antioxidant activity compared with PEM in the various methods of measuring antioxidant activity. In vitro and in vivo anti-tumor-promoting activities of PER were measured significantly more than PEM (P <0.05). Both pigment extracts remarkably inhibited the 12-O-tetradecanoylphorbol-13-acetate (TPA)-induced inflammation, so that ID50 (50% inhibitory dose) of PEM and PER were 0.22 and 0.09 mg/ear, respectively. PMID:27895288

Transcriptome analysis of the rhizosphere bacterium Azospirillum brasilense reveals an extensive auxin response.

PubMed

Van Puyvelde, Sandra; Cloots, Lore; Engelen, Kristof; Das, Frederik; Marchal, Kathleen; Vanderleyden, Jos; Spaepen, Stijn

2011-05-01

The rhizosphere bacterium Azospirillum brasilense produces the auxin indole-3-acetic acid (IAA) through the indole-3-pyruvate pathway. As we previously demonstrated that transcription of the indole-3-pyruvate decarboxylase (ipdC) gene is positively regulated by IAA, produced by A. brasilense itself or added exogenously, we performed a microarray analysis to study the overall effects of IAA on the transcriptome of A. brasilense. The transcriptomes of A. brasilense wild-type and the ipdC knockout mutant, both cultured in the absence and presence of exogenously added IAA, were compared.Interfering with the IAA biosynthesis/homeostasis in A. brasilense through inactivation of the ipdC gene or IAA addition results in much broader transcriptional changes than anticipated. Based on the multitude of changes observed by comparing the different transcriptomes, we can conclude that IAA is a signaling molecule in A. brasilense. It appears that the bacterium, when exposed to IAA, adapts itself to the plant rhizosphere, by changing its arsenal of transport proteins and cell surface proteins. A striking example of adaptation to IAA exposure, as happens in the rhizosphere, is the upregulation of a type VI secretion system (T6SS) in the presence of IAA. The T6SS is described as specifically involved in bacterium-eukaryotic host interactions. Additionally, many transcription factors show an altered regulation as well, indicating that the regulatory machinery of the bacterium is changing.

Pathogenicity of Moraxella osloensis, a Bacterium Associated with the Nematode Phasmarhabditis hermaphrodita, to the Slug Deroceras reticulatum

PubMed Central

Tan, Li; Grewal, Parwinder S.

2001-01-01

Moraxella osloensis, a gram-negative bacterium, is associated with Phasmarhabditis hermaphrodita, a nematode parasite of slugs. This bacterium-feeding nematode has potential for the biological control of slugs, especially the grey garden slug, Deroceras reticulatum. Infective juveniles of P. hermaphrodita invade the shell cavity of the slug, develop into self-fertilizing hermaphrodites, and produce progeny, resulting in host death. However, the role of the associated bacterium in the pathogenicity of the nematode to the slug is unknown. We discovered that M. osloensis alone is pathogenic to D. reticulatum after injection into the shell cavity or hemocoel of the slug. The bacteria from 60-h cultures were more pathogenic than the bacteria from 40-h cultures, as indicated by the higher and more rapid mortality of the slugs injected with the former. Coinjection of penicillin and streptomycin with the 60-h bacterial culture reduced its pathogenicity to the slug. Further work suggested that the reduction and loss of pathogenicity of the aged infective juveniles of P. hermaphrodita to D. reticulatum result from the loss of M. osloensis from the aged nematodes. Also, axenic J1/J2 nematodes were nonpathogenic after injection into the shell cavity. Therefore, we conclude that the bacterium is the sole killing agent of D. reticulatum in the nematode-bacterium complex and that P. hermaphrodita acts only as a vector to transport the bacterium into the shell cavity of the slug. The identification of the toxic metabolites produced by M. osloensis is being pursued. PMID:11679319

Understanding the interaction between an obligate hyperparasitic bacterium, Pasteuria penetrans and its obligate plant-parasitic nematode host, Meloidogyne spp.

PubMed

Davies, Keith G

2009-01-01

Pasteuria penetrans is an endospore-forming bacterium, which is a hyperparasite of root-knot nematodes Meloidogyne spp. that are economically important pests of a wide range of crops. The life cycle of the bacterium and nematode are described with emphasis on the bacterium's potential as a biocontrol agent. Two aspects that currently prohibit the commercial development of the bacterium as a biocontrol agent are the inability to culture it outside its host and its host specificity. Vegetative growth of the bacterium is possible in vitro; however, getting the vegetative stages of the bacterium to enter sporogenesis has been problematic. Insights from genomic survey sequences regarding the role of cation concentration and the phosphorylation of Spo0F have proved useful in inducing vegetative bacteria to sporulate. Similarly, genomic data have also proved useful in understanding the attachment of endospores to the cuticle of infective nematode juveniles, and a Velcro-like model of spore attachment is proposed that involves collagen-like fibres on the surface of the endospore interacting with mucins on the nematode cuticle. Ecological studies of the interactions between Daphnia and Pasteuria ramosa are examined and similarities are drawn between the co-evolution of virulence in the Daphnia system and that of plant-parasitic nematodes.

Description of a bacterium associated with redmouth disease of rainbow trout (Salmo gairdneri)

USGS Publications Warehouse

Ross, A.J.; Rucker, R.R.; Ewing, W.H.

1966-01-01

A description was given of a gram-negative, peritrichously flagellated, fermentative bacterium that was isolated on numerous occasions from kidney tissues of rainbow trout (Salmo gairdneri) afflicted with redmouth disease. Although the bacteria apparently were members of the family Enterobacteriaceae, it was impossible to determine their taxonomic position within the family with certainty. Hence it was recommended that their taxonomic position remain sub judice for the present. As a temporary designation RM bacterium was used. Redmouth disease was transmitted from infected to normal fish through the medium of water.

Cadherin Domains in the Polysaccharide-Degrading Marine Bacterium Saccharophagus degradans 2-40 Are Carbohydrate-Binding Modules▿

PubMed Central

Fraiberg, Milana; Borovok, Ilya; Bayer, Edward A.; Weiner, Ronald M.; Lamed, Raphael

2011-01-01

The complex polysaccharide-degrading marine bacterium Saccharophagus degradans strain 2-40 produces putative proteins that contain numerous cadherin and cadherin-like domains involved in intercellular contact interactions. The current study reveals that both domain types exhibit reversible calcium-dependent binding to different complex polysaccharides which serve as growth substrates for the bacterium. PMID:21036994

Complete Genome Sequence of a thermotolerant sporogenic lactic acid bacterium, Bacillus coagulans strain 36D1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rhee, Mun Su; Moritz, Brelan E.; Xie, Gary

Bacillus coagulans is a ubiquitous soil bacterium that grows at 50-55 C and pH 5.0 and fer- ments various sugars that constitute plant biomass to L (+)-lactic acid. The ability of this spo- rogenic lactic acid bacterium to grow at 50-55 C and pH 5.0 makes this organism an attrac- tive microbial biocatalyst for production of optically pure lactic acid at industrial scale not only from glucose derived from cellulose but also from xylose, a major constituent of hemi- cellulose. This bacterium is also considered as a potential probiotic. Complete genome se- quence of a representative strain, B. coagulans strainmore » 36D1, is presented and discussed.« less

Complete Genome Sequence of a thermotolerant sporogenic lactic acid bacterium, Bacillus coagulans strain 36D1

PubMed Central

Rhee, Mun Su; Moritz, Brélan E.; Xie, Gary; Glavina del Rio, T.; Dalin, E.; Tice, H.; Bruce, D.; Goodwin, L.; Chertkov, O.; Brettin, T.; Han, C.; Detter, C.; Pitluck, S.; Land, Miriam L.; Patel, Milind; Ou, Mark; Harbrucker, Roberta; Ingram, Lonnie O.; Shanmugam, K. T.

2011-01-01

Bacillus coagulans is a ubiquitous soil bacterium that grows at 50-55 °C and pH 5.0 and ferments various sugars that constitute plant biomass to L (+)-lactic acid. The ability of this sporogenic lactic acid bacterium to grow at 50-55 °C and pH 5.0 makes this organism an attractive microbial biocatalyst for production of optically pure lactic acid at industrial scale not only from glucose derived from cellulose but also from xylose, a major constituent of hemicellulose. This bacterium is also considered as a potential probiotic. Complete genome sequence of a representative strain, B. coagulans strain 36D1, is presented and discussed. PMID:22675583

Paradigms: examples from the bacterium Xylella fastidiosa.

PubMed

Purcell, Alexander

2013-01-01

The history of advances in research on Xylella fastidiosa provides excellent examples of how paradigms both advance and limit our scientific understanding of plant pathogens and the plant diseases they cause. I describe this from a personal perspective, having been directly involved with many persons who made paradigm-changing discoveries, beginning with the discovery that a bacterium, not a virus, causes Pierce's disease of grape and other plant diseases in numerous plant species, including important crop and forest species.

Primary structure of inorganic polyphosphate/ATP-NAD kinase from Micrococcus flavus, and occurrence of substrate inorganic polyphosphate for the enzyme.

PubMed

Kawai, Shigeyuki; Mori, Shigetarou; Murata, Kousaku

2003-08-01

The gene encoding an inorganic polyphosphate/ATP-NAD kinase was cloned from Micrococcus flavus, and its primary structure was analyzed. Alignment of the primary structure with those of other characterized NAD kinases revealed candidate amino acid residues, mainly charged ones, that would be related to inorganic polyphosphate use. The alignment also showed that the primary structure found carried a protruding C-terminal polypeptide. Although the C-terminal polypeptide was demonstrated to be dispensable for the kinase activities, and was proposed to be removed in M. flavus, the entire primary structure including the C-terminal polypeptide was homologous with that of the ATP synthase beta chain. The inorganic polyphosphate used by the inorganic polyphosphate/ATP-NAD kinase as a phosphoryl donor was isolated from cells of M. flavus, suggesting that the ability of the enzyme to use inorganic polyphosphate is of physiological significance and is not an evolutionary trait alone.

A novel strategy for acetonitrile wastewater treatment by using a recombinant bacterium with biofilm-forming and nitrile-degrading capability.

PubMed

Li, Chunyan; Yue, Zhenlei; Feng, Fengzhao; Xi, Chuanwu; Zang, Hailian; An, Xuejiao; Liu, Keran

2016-10-01

There is a great need for efficient acetonitrile removal technology in wastewater treatment to reduce the discharge of this pollutant in untreated wastewater. In this study, a nitrilase gene (nit) isolated from a nitrile-degrading bacterium (Rhodococcus rhodochrous BX2) was cloned and transformed into a biofilm-forming bacterium (Bacillus subtilis N4) that expressed the recombinant protein upon isopropylthio-β-galactoside (IPTG) induction. The recombinant bacterium (B. subtilis N4-pHT01-nit) formed strong biofilms and had nitrile-degrading capability. Further testing demonstrated that biofilms formed by B. subtilis N4-pHT01-nit were highly resistant to loading shock from acetonitrile and almost completely degraded the initial concentration of acetonitrile (800 mg L(-1)) within 24 h in a moving bed biofilm reactor (MBBR) after operation for 35 d. The bacterial composition of the biofilm, identified by high-throughput sequencing, in a reactor in which the B. subtilis N4-pHT01-nit bacterium was introduced indicated that the engineered bacterium was successfully immobilized in the reactor and became dominant genus. This work demonstrates that an engineered bacterium with nitrile-degrading and biofilm-forming capacity can improve the degradation of contaminants in wastewater. This approach offers a novel strategy for enhancing the biological oxidation of toxic pollutants in wastewater. Copyright © 2016 Elsevier Ltd. All rights reserved.

Genome Sequence of Lactobacillus delbrueckii subsp. lactis CNRZ327, a Dairy Bacterium with Anti-Inflammatory Properties.

PubMed

El Kafsi, Hela; Binesse, Johan; Loux, Valentin; Buratti, Julien; Boudebbouze, Samira; Dervyn, Rozenn; Hammani, Amal; Maguin, Emmanuelle; van de Guchte, Maarten

2014-07-17

Lactobacillus delbrueckii subsp. lactis CNRZ327 is a dairy bacterium with anti-inflammatory properties both in vitro and in vivo. Here, we report the genome sequence of this bacterium, which appears to contain no less than 215 insertion sequence (IS) elements, an exceptionally high number regarding the small genome size of the strain. Copyright © 2014 El Kafsi et al.

Chitin utilization by the insect-transmitted bacterium Xylella fastidiosa.

PubMed

Killiny, Nabil; Prado, Simone S; Almeida, Rodrigo P P

2010-09-01

Xylella fastidiosa is an insect-borne bacterium that colonizes xylem vessels of a large number of host plants, including several crops of economic importance. Chitin is a polysaccharide present in the cuticle of leafhopper vectors of X. fastidiosa and may serve as a carbon source for this bacterium. Biological assays showed that X. fastidiosa reached larger populations in the presence of chitin. Additionally, chitin induced phenotypic changes in this bacterium, notably increasing adhesiveness. Quantitative PCR assays indicated transcriptional changes in the presence of chitin, and an enzymatic assay demonstrated chitinolytic activity by X. fastidiosa. An ortholog of the chitinase A gene (chiA) was identified in the X. fastidiosa genome. The in silico analysis revealed that the open reading frame of chiA encodes a protein of 351 amino acids with an estimated molecular mass of 40 kDa. chiA is in a locus that consists of genes implicated in polysaccharide degradation. Moreover, this locus was also found in the genomes of closely related bacteria in the genus Xanthomonas, which are plant but not insect associated. X. fastidiosa degraded chitin when grown on a solid chitin-yeast extract-agar medium and grew in liquid medium with chitin as the sole carbon source; ChiA was also determined to be secreted. The gene encoding ChiA was cloned into Escherichia coli, and endochitinase activity was detected in the transformant, showing that the gene is functional and involved in chitin degradation. The results suggest that X. fastidiosa may use its vectors' foregut surface as a carbon source. In addition, chitin may trigger X. fastidiosa's gene regulation and biofilm formation within vectors. Further work is necessary to characterize the role of chitin and its utilization in X. fastidiosa.

Complete genome of Martelella sp. AD-3, a moderately halophilic polycyclic aromatic hydrocarbons-degrading bacterium.

PubMed

Cui, Changzheng; Li, Zhijie; Qian, Jiangchao; Shi, Jie; Huang, Ling; Tang, Hongzhi; Chen, Xin; Lin, Kuangfei; Xu, Ping; Liu, Yongdi

2016-05-10

Martelella sp. strain AD-3, a moderate halophilic bacterium, was isolated from a petroleum-contaminated soil with high salinity in China. Here, we report the complete genome of strain AD-3, which contains one circular chromosome and two circular plasmids. An array of genes related to metabolism of polycyclic aromatic hydrocarbons and halophilic mechanism in this bacterium was identified by the whole genome analysis. Copyright © 2016 Elsevier B.V. All rights reserved.

Complete genome of the cellulolytic ruminal bacterium Ruminococcus albus 7

USDA-ARS?s Scientific Manuscript database

Ruminococcus albus 7 is a highly cellulolytic rumen bacterium that is a member of the phylum Firmicutes. Here, we describe the complete genome for this microbe. This genome will be useful for rumen microbiology, cellulosome biology, and in biofuel production, as one of its major fermentation product...

Preparative isolation of a cytotoxic principle of a forest mushroom Suillus luteus by sodium dodecyl sulfate based "salting-in" countercurrent chromatography.

PubMed

Yang, Zhi; Hu, Xueqian; Wu, Shihua

2016-02-01

In the course of screening new anticancer natural products, an edible forest mushroom Suillus luteus (L. Ex Franch). Gray was found to have potent cytotoxicity against several human cancer cells. However, the lipophilic sample made some countercurrent chromatography solvent systems emulsify, which caused difficulties in the separation of its cytotoxic components. Here, we found that the addition of an organic salt sodium dodecyl sulfate could efficiently shorten the settling time of the mushroom sample solutions by eliminating the emulsification of two-phase solvent systems. Moreover, we found that sodium dodecyl sulfate could play a new "salting-in" role and made the partition coefficients of the solutes decrease with the increased concentrations. Thus, a sodium dodecyl sulfate based salting-in countercurrent chromatography method has been successfully established for the first time for preparative isolation of a cytotoxic principle of the mushroom. The active component was identified as isosuillin. Whole results indicated that sodium dodecyl sulfate could be used as an efficient salting-in reagent for two-phase solvent system selection and targeted countercurrent chromatography isolation. It is very useful for current natural products isolation and drug discovery. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Isolation and characterization of novel plant growth promoting Micrococcus sp NII-0909 and its interaction with cowpea.

PubMed

Dastager, Syed G; Deepa, C K; Pandey, Ashok

2010-12-01

A phosphate-solubilizing bacterial strain NII-0909 isolated from the Western ghat forest soil in India was identified as Micrococcus sp on the basis of phenotypic characteristics, carbon source utilization pattern, fatty acid methyl esters analysis, and 16S rRNA gene sequence. The strain exhibited the plant growth-promoting attributes of phosphate solubilization, auxin production, 1-aminocyclopropane-1-carboxylate deaminase activity, and siderophore production. It was able to solubilize (122.4μg of Ca(3)PO(4) ml(-1)), and produce IAA (109μgml(-1)) at 30°C. P-solubilizing activity of the strain NII-0909 was associated with the release of organic acids and a drop in the pH of the NBRIP medium. HPLC analysis detected two organic acids in the course of P-solubilization. A significant increase in the growth of cow pea was recorded for inoculations under controlled conditions. Scanning electron microscopic study revealed the root colonization of strain on cow pea seedlings. These results demonstrate that isolates NII-0909 has the promising PGPR attributes to be develop as a biofertilizer to enhance soil fertility and promote the plant growth. Copyright © 2010 Elsevier Masson SAS. All rights reserved.

Comprehensive update of dalbavancin activity when tested against uncommonly isolated streptococci, Corynebacterium spp., Listeria monocytogenes, and Micrococcus spp. (1357 strains).

PubMed

Jones, Ronald N; Stilwell, Matthew G

2013-06-01

Dalbavancin is an investigational lipoglycopeptide having an extended serum elimination half-life allowing once-weekly dosing. Data from testing 1357 strains of uncommonly isolated species expand the dalbavancin spectrum details as follows (MIC50/90): β-haemolytic streptococcal serogroups C, F, and G (≤0.03/≤0.03 μg/mL), 7 viridans group of streptococci (≤0.03/≤0.03-0.06 μg/mL), 5 Corynebacterium spp. (0.06/0.12 μg/mL), Listeria monocytogenes (0.06/0.12 μg/mL), and Micrococcus spp. (≤0.03/≤0.03 μg/mL). Among all reported isolates, 99.8% of tested strains were inhibited at dalbavancin MIC values at ≤0.12 μg/mL. Dalbavancin remains very potent against rarer Gram-positive pathogens, using in vitro test experience with organisms cultured through 2011. Copyright © 2013 Elsevier Inc. All rights reserved.

Draft Genome Sequence of an Anaerobic and Extremophilic Bacterium, Caldanaerobacter yonseiensis, Isolated from a Geothermal Hot Stream

PubMed Central

Lee, Sang-Jae; Lee, Yong-Jik; Park, Gun-Seok; Kim, Byoung-Chan; Lee, Sang Jun; Shin, Jae-Ho

2013-01-01

Caldanaerobacter yonseiensis is a strictly anaerobic, thermophilic, spore-forming bacterium, which was isolated from a geothermal hot stream in Indonesia. This bacterium utilizes xylose and produces a variety of proteases. Here, we report the draft genome sequence of C. yonseiensis, which reveals insights into the pentose phosphate pathway and protein degradation metabolism in thermophilic microorganisms. PMID:24201201

[Micrococcus sp.--the pathogen of leaf necrosis of horse-chestnuts (Aesculus L.) in Kiev].

PubMed

Iakovleva, L M; Makhinia, L V; Shcherbina, T N; Ogorodnik, L E

2013-01-01

A group of phytopathogenic bacteria was isolated from patterns of drying horse-chestnuts (Aesculus L.), which grow in Kyiv. The properties of slowly growing, highly aggressive microorganisms have been described in the paper. They grow up on the 8-10th day after sowing. The investigated microorganisms form very small (0.5-1 mm in diameter) colonies on the potato agar. Bacteria are protuberant, shining, smooth with flat edges, they are pale yellow, yellow, or pink. The bacteria are Gram-positive, spherical, are disposed in smears singly, in pairs, as accumulations, or netting. They are aerobes, do not form spores, are not mobile. They are inert in respect of different sources of carbon. They reduce nitrates, do not dilute gelatin, do not hydrolyze starch, do not release hydrogen sulphide and indole. The bacteria are catalase-positive, oxidase-negative. They do not cause potato and carrot rot. They lose quickly their viability under the laboratory conditions. The saturated acids C 14:0; C 15:0; C16:0; C18:0 have been revealed in the composition of cellular fatty acids. Microorganisms are identified as Micrococcus sp. Under artificial inoculation this highly aggressive pathogen causes drying of the horse-chestnut buds and necrosis, which occupies 1/3-1/2 of the leaf plate. A wide zone of chlorosis, surrounding necrosis, may occupy the whole leaf surface. The infected leaves use to twist up from the top (apex) or along a midrib and to dry.

Fine Structure and Host-Virus Relationship of a Marine Bacterium and Its Bacteriophage

PubMed Central

Valentine, Artrice F.; Chapman, George B.

1966-01-01

Valentine, Artrice F. (Georgetown University, Washington, D.C.), and George B. Chapman. Fine structure and host-virus relationship of a marine bacterium and its bacteriophage. J. Bacteriol. 92:1535–1554. 1966.—The fine structure of a gram-negative marine bacterium, Cytophaga marinoflava sp. n., has been revealed by ultrathin sectioning and electron microscopy. Stages in the morphogenesis of the bacterial virus NCMB 385, which has been shown to be highly specific for this organism, were also demonstrated in bacterial cells fixed according to the Kellenberger technique. The bacterium possessed a cell wall, cytoplasmic membrane, and nuclear and cytoplasmic regions typical of bacterial cells. Both the cell wall and the cytoplasmic membrane showed a tripartite structure, i.e., each was composed of two dense layers separated by a low-density zone. Intracytoplasmic membrane systems were also observed, especially in dividing cells and in cells in which new viruses were being formed. As many as 18 hexagonally shaped, empty phage heads (membranes only) were observed in untreated, infected bacterial cells. Phage heads, intermediate in density to empty heads and fully condensed ones, possibly representing stages in the morphological development of the virus, were also seen. Images PMID:5924277

Complete genome sequence of the haloalkaliphilic, hydrogen-producing bacterium Halanaerobium hydrogeniformans.

PubMed

Brown, Steven D; Begemann, Matthew B; Mormile, Melanie R; Wall, Judy D; Han, Cliff S; Goodwin, Lynne A; Pitluck, Samuel; Land, Miriam L; Hauser, Loren J; Elias, Dwayne A

2011-07-01

Halanaerobium hydrogenoformans is an alkaliphilic bacterium capable of biohydrogen production at pH 11 and 7% (wt/vol) salt. We present the 2.6-Mb genome sequence to provide insights into its physiology and potential for bioenergy applications.

Isolation and biological characteristics of aerobic marine magnetotactic bacterium YSC-1

NASA Astrophysics Data System (ADS)

Gao, Jun; Pan, Hongmiao; Yue, Haidong; Song, Tao; Zhao, Yong; Chen, Guanjun; Wu, Longfei; Xiao, Tian

2006-12-01

Magnetotactic bacteria have become a hot spot of research in microbiology attracting intensive interest of researchers in multiple disciplinary fields. However, the studies were limited in few fastidious bacteria. The objective of this study aims at isolating new marine magnetic bacteria and better comprehension of magnetotactic bacteria. In this study, an aerobic magnetotactic bacterium YSC-1 was isolated from sediments in the Yellow Sea Cold Water Mass (YSCWM). In TEM, magnetic cells have one or several circular magnetosomes in diameter of 100nm, and consist of Fe and Co shown on energy dispersive X-ray spectrum. The biological and physiological characteristics of this bacterium were also described. The colour of YSC-1 colony is white in small rod. The gram stain is negative. Results showed that Strain YSC-1 differs from microaerophile magnetotactic bacteria MS-1 and WD-1 in biology.

The influence of bacteria-dominated diets on Daphnia magna somatic growth, reproduction, and lipid composition.

PubMed

Taipale, Sami J; Brett, Michael T; Pulkkinen, Katja; Kainz, Martin J

2012-10-01

We explored how dietary bacteria affect the life history traits and biochemical composition of Daphnia magna, using three bacteria taxa with very different lipid composition. Our objectives were to (1) examine whether and how bacteria-dominated diets affect Daphnia survival, growth, and fecundity, (2) see whether bacteria-specific fatty acid (FA) biomarkers accrued in Daphnia lipids, and (3) explore the quantitative relationship between bacteria availability in Daphnia diets and the amounts of bacterial FA in their lipids. Daphnia were fed monospecific and mixed diets of heterotrophic (Micrococcus luteus) or methanotrophic bacteria (Methylomonas methanica and Methylosinus trichosporium) and two phytoplankton species (Cryptomonas ozolinii and Scenedesmus obliquus). Daphnia neonates fed pure bacteria diets died after 6-12 days and produced no viable offspring, whereas those fed pure phytoplankton diets had high survival, growth, and reproduction success. Daphnia fed a mixed diet with 80% M. luteus and 20% of either phytoplankton had high somatic growth, but low reproduction. Conversely, Daphnia fed mixed diets including 80% of either methane-oxidizing bacteria and 20% Cryptomonas had high reproduction rates, but low somatic growth. All Daphnia fed mixed bacteria and phytoplankton diets had strong evidence of both bacteria- and phytoplankton-specific FA biomarkers in their lipids. FA mixing model calculations indicated that Daphnia that received 80% of their carbon from bacteria assimilated 46 ± 25% of their FA from this source. A bacteria-phytoplankton gradient experiment showed a strong positive correlation between the proportions of the bacterial FA in the Daphnia and their diet, indicating that bacterial utilization can be traced in this keystone consumer using FA biomarkers. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

Antimicrobial and Cytotoxic Activity of Extracts of Ferula heuffelii Griseb. ex Heuff. and Its Metabolites.

PubMed

Pavlović, Ivan; Petrović, Silvana; Milenković, Marina; Stanojković, Tatjana; Nikolić, Dejan; Krunić, Aleksej; Niketić, Marjan

2015-10-01

The antimicrobial and cytotoxic activities of isolates (CHCl3 and MeOH extracts and selected metabolites) obtained from the underground parts of the Balkan endemic plant Ferula heuffelii Griseb. ex Heuff. were assessed. The CHCl3 and MeOH extracts exhibited moderate antimicrobial activity, being more pronounced against Gram-positive than Gram-negative bacteria, especially against Staphylococcus aureus (MIC=12.5 μg/ml for both extracts) and Micrococcus luteus (MIC=50 and 12.5 μg/ml, resp.). Among the tested metabolites, (6E)-1-(2,4-dihydroxyphenyl)-3,7,11-trimethyl-3-vinyldodeca-6,10-dien-1-one (2) and (2S*,3R*)-2-[(3E)-4,8-dimethylnona-3,7-dien-1-yl]-2,3-dihydro-7-hydroxy-2,3-dimethylfuro[3,2-c]coumarin (4) demonstrated the best antimicrobial activity. Compounds 2 and 4 both strongly inhibited the growth of M. luteus (MIC=11.2 and 5.2 μM, resp.) and Staphylococcus epidermidis (MIC=22.5 and 10.5 μM, resp.) and compound 2 additionally also the growth of Bacillus subtilis (MIC=11.2 μM). The cytotoxic activity of the isolates was tested against three human cancer cell lines, viz., cervical adenocarcinoma (HeLa), chronic myelogenous leukemia (K562), and breast cancer (MCF-7) cells. The CHCl3 extract exhibited strong cytotoxic activity against all cell lines (IC50 <11.0 μg/ml). All compounds strongly inhibited the growth of the K562 and HeLa cell lines. Compound 4 exhibited also a strong activity against the MCF-7 cell line, comparable to that of cisplatin (IC50 =22.32±1.32 vs. 18.67±0.75μM). Copyright © 2015 Verlag Helvetica Chimica Acta AG, Zürich.

Multiphoton near-infrared femtosecond laser pulse-induced DNA damage with and without the photosensitizer proflavine.

PubMed

Shafirovich, V; Dourandin, A; Luneva, N P; Singh, C; Kirigin, F; Geacintov, N E

1999-03-01

The excitation of pBr322 supercoiled plasmid DNA with intense near-IR 810 nm fs laser pulses by a simultaneous multiphoton absorption mechanism results in single-strand breaks after treatment of the irradiated samples with Micrococcus luteus UV endonuclease. This enzyme cleaves DNA strands at sites of cyclobutane dimers that are formed by the simultaneous absorption of three (or more) 810 nm IR photons (pulse width approximately 140 fs, 76 MHz pulse repetition, average power output focused through 10x microscope objective is approximately 1.2 MW/cm2). Direct single-strand breaks (without treatment with M. luteus) were not observed under these conditions. However, in the presence of 6 microM of the intercalator proflavine (PF), both direct single- and double-strand breaks are observed under conditions where substantial fractions of undamaged supercoiled DNA molecules are still present. The fraction of direct double-strand breaks is 30 +/- 5% of all measurable strand cleavage events, is independent of dosage (up to 6.4 GJ/cm2) and is proportional to In, where I is the average power/area of the 810 nm fs laser pulses, and n = 3 +/- 1. The nicking of two DNA strands in the immediate vicinity of the excited PF molecules gives rise to this double-strand cleavage. In contrast, excitation of the same samples under low-power, single-photon absorption conditions (approximately 400-500 nm) gives rise predominantly to single-strand breaks, but some double-strand breaks are observed at the higher dosages. Thus, single-photon excitation with 400-500 nm light and multiphoton activation of PF by near-IR fs laser pulses produces different distributions of single- and double-strand breaks. These results suggest that DNA strand cleavage originates from unrelaxed, higher excited states when PF is excited by simultaneous IR multiphoton absorption processes.

Differential transcriptomic responses of Biomphalaria glabrata (Gastropoda, Mollusca) to bacteria and metazoan parasites, Schistosoma mansoni and Echinostoma paraensei (Digenea, Platyhelminthes)

PubMed Central

Adema, Coen M; Hanington, Patrick C.; Lun, Cheng-Man; Rosenberg, George H.; Aragon, Anthony D; Stout, Barbara A; Richard, Mara L. Lennard; Gross, Paul S.; Loker, Eric S

2009-01-01

A 70-mer oligonucleotide-based microarray (1152 features) that emphasizes stress and immune responses factors was constructed to study transcriptomic responses of the snail Biomphalaria glabrata to different immune challenges. In addition to sequences with relevant putative ID and Gene Ontology (GO) annotation, the array features non-immune factors and unknown B. glabrata ESTs for functional gene discovery. The transcription profiles of B. glabrata (3 biological replicates, each a pool of 5 snails) were recorded at 12 hours post wounding, exposure to Gram negative or Gram positive bacteria (Escherichia coli and Micrococcus luteus, respectively), or infection with compatible trematode parasites (S. mansoni or E. paraensei, 20 miracidia/snail), relative to controls, using universal reference RNA. The data were subjected to Significance Analysis for Microarrays (SAM), with a false positive rate (FPR) ≤10%. Wounding yielded a modest differential expression profile (27 up/21 down) with affected features mostly dissimilar from other treatments. Partially overlapping, yet distinct expression profiles were recorded from snails challenged with E. coli (83 up/20 down) or M. luteus (120 up/42 down), mostly showing up-regulation of defense and stress-related features. Significantly altered expression of selected immune features indicates that B. glabrata detects and responds differently to compatible trematodes. Echinostoma paraensei infection was associated mostly with down regulation of many (immune-) transcripts (42 up/68 down), whereas S. mansoni exposure yielded a preponderance of up-regulated features (140 up/23 down), with only few known immune genes affected. These observations may reflect the divergent strategies developed by trematodes during their evolution as specialized pathogens of snails to negate host defense responses. Clearly, the immune defenses of B. glabrata distinguish and respond differently to various immune challenges. PMID:19962194

Immune function of a Rab-related protein by modulating the JAK-STAT signaling pathway in the silkworm, Bombyx mori.

PubMed

Chen, Chen; Eldein, Salah; Zhou, Xiaosan; Sun, Yu; Gao, Jin; Sun, Yuxuan; Liu, Chaoliang; Wang, Lei

2018-01-01

The Rab-family GTPases mainly regulate intracellular vesicle transport, and play important roles in the innate immune response in invertebrates. However, the function and signal transduction of Rab proteins in immune reactions remain unclear in silkworms. In this study, we analyzed a Rab-related protein of silkworm Bombyx mori (BmRABRP) by raising antibodies against its bacterially expressed recombinant form. Tissue distribution analysis showed that BmRABRP mRNA and protein were high expressed in the Malpighian tubule and fat body, respectively. However, among the different stages, only the fourth instar larvae and pupae showed significant BmRABRP levels. After challenge with four pathogenic microorganisms (Escherichia coli, BmNPV, Beauveria bassiana, Micrococcus luteus), the expression of BmRABRP mRNA in the fat body was significantly upregulated. In contrast, the BmRABRP protein was significantly upregulated after infection with BmNPV, while it was downregulated by E. coli, B. bassiana, and M. luteus. A specific dsRNA was used to explore the immune function and relationship between BmRABRP and the JAK-STAT signaling pathway. After BmRABRP gene interference, significant reduction in the number of nodules and increased mortality suggested that BmRABRP plays an important role in silkworm's response to bacterial challenge. In addition, four key genes (BmHOP, BmSTAT, BmSOCS2, and BmSOCS6) of the JAK-STAT signaling pathway showed significantly altered expressions after BmRABRP silencing. BmHOP and BmSOCS6 expressions were significantly decreased, while BmSTAT and BmSOCS2 were significantly upregulated. Our results suggested that BmRABRP is involved in the innate immune response against pathogenic microorganisms through the JAK-STAT signaling pathway in silkworm. © 2017 Wiley Periodicals, Inc.

Ultraviolet/ultrasound-activated persulfate for degradation of drug by zinc selenide quantum dots: Catalysis and microbiology study.

PubMed

Fakhri, Ali; Naji, Mahsa; Tahami, Shiva

2017-05-01

In this study, wet chemical method used for ZnSe quantum dots (QDs) and characterized by, UV-vis, photoluminescence spectroscopy, X-ray diffraction and transmission electron microscopy. The crystallites size of ZnSe QDs was 4.0nm. The average diameters of ZnSe QDs were 3.0-5.3nm. Ritalin was degraded using the UV/ZnSe QDs/persulfate process. The several parameters investigated for the influence of Rtialin degradation were the temperature, the persulfate concentration, and the initial Ritalin concentration. The values of optimum parameters ware room temperature, concentration persulfate 5mmol/L and initial Ritalin concentration 0.09mmol/L. Comparative analyses showed the maximum degradation of Ritalin was found for ZnSe/persulfate under ultra-visible and ultra-sonic irradiation process. Comparative analysis showed the maximum degradation of Ritalin was found for ZnSe/persulfate under ultra-visible and ultra-sonic irradiation process. The values of first-order rate constants from degradation of Ritalin at 25°C were 0.96×10 -2 , 1.09×10 -2 , 1.59×10 -2 and 2.19×10 -2 for US/PS, UV/PS, ZnSe/US/PS and ZnSe/UV/PS system, respectively. The antibacterial activity evaluation against two bacterials, including Gram-positive bacteria Staphylococcus aureus (ATCC 43300), Bacillus megaterium (ATCC 14581) and Gram-negative bacteria Pseudomonas aeruginosa (ATCC 27853), Micrococcus luteus (ATCC 4698) was considered. It was found that the MIC values for the antibacterial assay in the presence of ZnSe QDs were around 0.30mM with 64.0, 66.0, 79.2, and 83.5% inhibition for the S. aureus, B. megaterium, P. aeruginosa and M. luteus bacterial strains, respectively. Then, results show that the ZnSe QDs have antibacterial activity. Copyright © 2017 Elsevier B.V. All rights reserved.

Polysaccharide degradation systems of the saprophytic bacterium Cellvibrio japonicus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gardner, Jeffrey G.

Study of recalcitrant polysaccharide degradation by bacterial systems is critical for understanding biological processes such as global carbon cycling, nutritional contributions of the human gut microbiome, and the production of renewable fuels and chemicals. One bacterium that has a robust ability to degrade polysaccharides is the Gram-negative saprophyte Cellvibrio japonicus. A bacterium with a circuitous history, C. japonicus underwent several taxonomy changes from an initially described Pseudomonas sp. Most of the enzymes described in the pre-genomics era have also been renamed. Furthermore, this review aims to consolidate the biochemical, structural, and genetic data published on C. japonicus and its remarkablemore » ability to degrade cellulose, xylan, and pectin substrates. Initially, C. japonicus carbohydrate-active enzymes were studied biochemically and structurally for their novel polysaccharide binding and degradation characteristics, while more recent systems biology approaches have begun to unravel the complex regulation required for lignocellulose degradation in an environmental context. Also included is a discussion for the future of C. japonicus as a model system, with emphasis on current areas unexplored in terms of polysaccharide degradation and emerging directions for C. japonicus in both environmental and biotechnological applications.« less

Polysaccharide degradation systems of the saprophytic bacterium Cellvibrio japonicus

DOE PAGES

Gardner, Jeffrey G.

2016-06-04

Study of recalcitrant polysaccharide degradation by bacterial systems is critical for understanding biological processes such as global carbon cycling, nutritional contributions of the human gut microbiome, and the production of renewable fuels and chemicals. One bacterium that has a robust ability to degrade polysaccharides is the Gram-negative saprophyte Cellvibrio japonicus. A bacterium with a circuitous history, C. japonicus underwent several taxonomy changes from an initially described Pseudomonas sp. Most of the enzymes described in the pre-genomics era have also been renamed. Furthermore, this review aims to consolidate the biochemical, structural, and genetic data published on C. japonicus and its remarkablemore » ability to degrade cellulose, xylan, and pectin substrates. Initially, C. japonicus carbohydrate-active enzymes were studied biochemically and structurally for their novel polysaccharide binding and degradation characteristics, while more recent systems biology approaches have begun to unravel the complex regulation required for lignocellulose degradation in an environmental context. Also included is a discussion for the future of C. japonicus as a model system, with emphasis on current areas unexplored in terms of polysaccharide degradation and emerging directions for C. japonicus in both environmental and biotechnological applications.« less

Biodegradation of polyethylene by the thermophilic bacterium Brevibacillus borstelensis.

PubMed

Hadad, D; Geresh, S; Sivan, A

2005-01-01

To select a polyethylene-degrading micro-organism and to study the factors affecting its biodegrading activity. A thermophilic bacterium Brevibaccillus borstelensis strain 707 (isolated from soil) utilized branched low-density polyethylene as the sole carbon source and degraded it. Incubation of polyethylene with B. borstelensis (30 days, 50 degrees C) reduced its gravimetric and molecular weights by 11 and 30% respectively. Brevibaccillus borstelensis also degraded polyethylene in the presence of mannitol. Biodegradation of u.v. photo-oxidized polyethylene increased with increasing irradiation time. Fourier Transform Infra-Red (FTIR) analysis of photo-oxidized polyethylene revealed a reduction in carbonyl groups after incubation with the bacteria. This study demonstrates that polyethylene--considered to be inert--can be biodegraded if the right microbial strain is isolated. Enrichment culture methods were effective for isolating a thermophilic bacterium capable of utilizing polyethylene as the sole carbon and energy source. Maximal biodegradation was obtained in combination with photo-oxidation, which showed that carbonyl residues formed by photo-oxidation play a role in biodegradation. Brevibaccillus borstelensis also degraded the CH2 backbone of nonirradiated polyethylene. Biodegradation of polyethylene by a single bacterial strain contributes to our understanding of the process and the factors affecting polyethylene biodegradation.

Aerobic Reduction of Arsenate by a Bacterium Isolated From Activated Sludge

NASA Astrophysics Data System (ADS)

Kozai, N.; Ohnuki, T.; Hanada, S.; Nakamura, K.; Francis, A. J.

2006-12-01

Microlunatus phosphovorus strain NM-1 is a polyphosphate-accumulating bacterium isolated from activated sludge. This bacterium takes up a large amount of polyphosphate under aerobic conditions and release phosphate ions by hydrolysis of polyphosphate to orthophosphate under anaerobic conditions to derive energy for taking up substrates. To understand the nature of this strain, especially, influence of potential contaminants in sewage and wastewater on growth, we have been investigating behavior of this bacterium in media containing arsenic. The present paper mainly reports reduction of arsenate by this bacterium under aerobic conditions. The strain NM-1 (JCM 9379) was aerobically cultured at 30 °C in a nutrient medium containing 2.5 g/l peptone, 0.5 g/l glucose, 1.5 g/l yeast extract, and arsenic [Na2HAsO4 (As(V)) or Na3AsO3 (As(III))] at concentrations between 0 and 50 mM. The cells collected from arsenic-free media were dispersed in buffer solutions containing 2mM HEPES, 10mM NaCl, prescribed concentrations of As(V), and 0-0.2 percent glucose. Then, this cell suspension was kept at 20 °C under aerobic or anaerobic conditions. The speciation of arsenic was carried out by ion chromatography and ICP-MS. The growth of the strain under aerobic conditions was enhanced by the addition of As(V) at the concentration between 1 and 10 mM. The maximum optical density of the culture in the medium containing 5mM As(V) was 1.4 times greater than that of the control culture. Below the As(V) concentration of 10mM, most of the As(V) was reduced to As(III). The growth of the strain under anaerobic conditions has not been observed so far. The cells in the buffer solutions reduced As(V) under aerobic condition. The reduction was enhanced by the addition of glucose. However, the cell did not reduce As(V) under anaerobic conditions. The strain NM-1 showed high resistance to As(V) and As(III). The maximum optical density of the culture grown in a medium containing 50 mM As(V) was only

Thermostable purified endoglucanase from thermophilic bacterium acidothermus cellulolyticus

DOEpatents

Tucker, Melvin P.; Grohmann, Karel; Himmel, Michael E.; Mohagheghi, Ali

1992-01-01

A substantially purified high molecular weight cellulase enzyme having a molecular weight of between about 156,000 to about 203,400 daltons isolated from the bacterium Acidothermus cellulolyticus (ATCC 43068) and a method of producing it are disclosed. The enzyme is water soluble, possesses both C.sub.1 and C.sub.x types of enzymatic activity, has a high degree of stability toward heat and exhibits both a high optimum temperature activity and high inactivation characteristics.

Genome sequence of the algicidal bacterium Kordia algicida OT-1.

PubMed

Lee, Hyun Sook; Kang, Sung Gyun; Kwon, Kae Kyoung; Lee, Jung-Hyun; Kim, Sang-Jin

2011-08-01

Kordia algicida OT-1 is an algicidal bacterium against the bloom-forming microalgae. The genome sequence of K. algicida revealed a number of interesting features, including the degradation of macromolecules, the biosynthesis of carotenoid pigment and secondary metabolites, and the capacity for gliding motility, which might facilitate the understanding of algicidal mechanisms.

Evidence of carbon fixation pathway in a bacterium from candidate phylum SBR1093 revealed with genomic analysis.

PubMed

Wang, Zhiping; Guo, Feng; Liu, Lili; Zhang, Tong

2014-01-01

Autotrophic CO2 fixation is the most important biotransformation process in the biosphere. Research focusing on the diversity and distribution of relevant autotrophs is significant to our comprehension of the biosphere. In this study, a draft genome of a bacterium from candidate phylum SBR1093 was reconstructed with the metagenome of an industrial activated sludge. Based on comparative genomics, this autotrophy may occur via a newly discovered carbon fixation path, the hydroxypropionate-hydroxybutyrate (HPHB) cycle, which was demonstrated in a previous work to be uniquely possessed by some genera from Archaea. This bacterium possesses all of the thirteen enzymes required for the HPHB cycle; these enzymes share 30∼50% identity with those in the autotrophic species of Archaea that undergo the HPHB cycle and 30∼80% identity with the corresponding enzymes of the mixotrophic species within Bradyrhizobiaceae. Thus, this bacterium might have an autotrophic growth mode in certain conditions. A phylogenetic analysis based on the 16S rRNA gene reveals that the phylotypes within candidate phylum SBR1093 are primarily clustered into 5 clades with a shallow branching pattern. This bacterium is clustered with phylotypes from organically contaminated environments, implying a demand for organics in heterotrophic metabolism. Considering the types of regulators, such as FnR, Fur, and ArsR, this bacterium might be a facultative aerobic mixotroph with potential multi-antibiotic and heavy metal resistances. This is the first report on Bacteria that may perform potential carbon fixation via the HPHB cycle, thus may expand our knowledge of the distribution and importance of the HPHB cycle in the biosphere.

Characterization of a potentially novel 'blown pack' spoilage bacterium isolated from bovine hide.

PubMed

Moschonas, G; Bolton, D J

2013-03-01

To characterize a psychrotrophic bacterium, designated TC1, previously isolated from a cattle hide in Ireland, and to investigate the ability of this strain to cause 'blown pack' spoilage (BPS) of vacuum-packaged beef primals. TC1 was characterized using a combination of phenotypic, chemotaxonomic and genotypic analyses and was assessed for its ability to spoil vacuum-packaged beef at refrigerated temperatures. TC1 was Gram-positive and formed elliptical subterminal endospores. The strain was able to grow between 0 and 33 °C, with optimal growth between 23 and 24 °C. TC1 could be differentiated from its phylogenetically closest neighbour (Clostridium lituseburense DSM 797(T)) by 16S rRNA gene sequencing, pulsed-field gel electrophoresis and cellular fatty acid composition. TC1 spoiled (BPS) beef within 42 days when inoculated in cold-stored (1 °C) vacuum-packed beef. The phenotypic, chemotaxonomic and genotypic characterization indicated that TC1 may represent a potentially novel, cold-tolerant, gas-producing bacterium of considerable economic significance to the beef industry. This study reports and characterizes an emerging BPS bacterium, which should be considered in future activities designed to minimize the psychrophilic and psychrotrophic spoilage of vacuum-packaged beef. © 2012 The Society for Applied Microbiology.

The gene transfer agent-like particle of the marine phototrophic bacterium Rhodovulum sulfidophilum.

PubMed

Nagao, Nobuyoshi; Yamamoto, Junya; Komatsu, Hiroyuki; Suzuki, Hiromichi; Hirose, Yuu; Umekage, So; Ohyama, Takashi; Kikuchi, Yo

2015-12-01

Gene transfer agents (GTAs) are shaped like bacteriophage particles but have many properties that distinguish them from bacteriophages. GTAs play a role in horizontal gene transfer in nature and thus affect the evolution of prokaryotic genomes. In the course of studies on the extracellular production of designed RNAs using the marine bacterium Rhodovulum sulfidophilum , we found that this bacterium produces a GTA-like particle. The particle contains DNA fragments of 4.5 kb, which consist of randomly fragmented genomic DNA from the bacterium. This 4.5-kb DNA production was prevented while quorum sensing was inhibited. Direct observation of the particle by transmission electron microscopy revealed that the particle resembles a tailed phage and has a head diameter of about 40 nm and a tail length of about 60 nm. We also identified the structural genes for the GTA in the genome. Translated amino acid sequences and gene positions are closely related to those of the genes that encode the Rhodobacter capsulatus GTA. This is the first report of a GTA-like particle from the genus Rhodovulum . However, gene transfer activity of this particle has not yet been confirmed. The differences between this particle and other GTAs are discussed.

Chitin Utilization by the Insect-Transmitted Bacterium Xylella fastidiosa▿ †

PubMed Central

Killiny, Nabil; Prado, Simone S.; Almeida, Rodrigo P. P.

2010-01-01

Xylella fastidiosa is an insect-borne bacterium that colonizes xylem vessels of a large number of host plants, including several crops of economic importance. Chitin is a polysaccharide present in the cuticle of leafhopper vectors of X. fastidiosa and may serve as a carbon source for this bacterium. Biological assays showed that X. fastidiosa reached larger populations in the presence of chitin. Additionally, chitin induced phenotypic changes in this bacterium, notably increasing adhesiveness. Quantitative PCR assays indicated transcriptional changes in the presence of chitin, and an enzymatic assay demonstrated chitinolytic activity by X. fastidiosa. An ortholog of the chitinase A gene (chiA) was identified in the X. fastidiosa genome. The in silico analysis revealed that the open reading frame of chiA encodes a protein of 351 amino acids with an estimated molecular mass of 40 kDa. chiA is in a locus that consists of genes implicated in polysaccharide degradation. Moreover, this locus was also found in the genomes of closely related bacteria in the genus Xanthomonas, which are plant but not insect associated. X. fastidiosa degraded chitin when grown on a solid chitin-yeast extract-agar medium and grew in liquid medium with chitin as the sole carbon source; ChiA was also determined to be secreted. The gene encoding ChiA was cloned into Escherichia coli, and endochitinase activity was detected in the transformant, showing that the gene is functional and involved in chitin degradation. The results suggest that X. fastidiosa may use its vectors' foregut surface as a carbon source. In addition, chitin may trigger X. fastidiosa's gene regulation and biofilm formation within vectors. Further work is necessary to characterize the role of chitin and its utilization in X. fastidiosa. PMID:20656858

Investigations of Iron Minerals Formed by Dissimilatory Alkaliphilic Bacterium with 57Fe Mössbauer Spectroscopy

NASA Astrophysics Data System (ADS)

Chistyakova, N. I.; Rusakov, V. S.; Shapkin, A. A.; Zhilina, T. N.; Zavarzina, D. G.; Lančok, A.; Kohout, J.

2010-07-01

Anaerobic alkaliphilic bacterium of Geoalkalibacter ferrihydriticus type (strain Z-0531), isolated from a bottom sediment sample from the weakly mineralized soda Lake Khadyn, have been analyzed. The strain uses the amorphous Fe(III)-hydroxide (AFH) as an electron acceptor and acetate CH3COO- as an electron donor. Mössbauer investigations of solid phase samples obtained during the process of the bacterium growth were carried out at room temperature, 77.8 K, 4.2 K without and with the presence of an external magnetic field (6 T) applied perpendicular to the γ-bebam.

Studying the Symbiotic Bacterium Xenorhabdus nematophila in Individual, Living Steinernema carpocapsae Nematodes Using Microfluidic Systems.

PubMed

Stilwell, Matthew D; Cao, Mengyi; Goodrich-Blair, Heidi; Weibel, Douglas B

2018-01-01

Animal-microbe symbioses are ubiquitous in nature and scientifically important in diverse areas, including ecology, medicine, and agriculture. Steinernema nematodes and Xenorhabdus bacteria compose an established, successful model system for investigating microbial pathogenesis and mutualism. The bacterium Xenorhabdus nematophila is a species-specific mutualist of insect-infecting Steinernema carpocapsae nematodes. The bacterium colonizes a specialized intestinal pocket within the infective stage of the nematode, which transports the bacteria between insects that are killed and consumed by the pair for reproduction. Current understanding of the interaction between the infective-stage nematode and its bacterial colonizers is based largely on population-level, snapshot time point studies on these organisms. This limitation arises because investigating temporal dynamics of the bacterium within the nematode is impeded by the difficulty of isolating and maintaining individual living nematodes and tracking colonizing bacterial cells over time. To overcome this challenge, we developed a microfluidic system that enables us to spatially isolate and microscopically observe individual, living Steinernema nematodes and monitor the growth and development of the associated X. nematophila bacterial communities-starting from a single cell or a few cells-over weeks. Our data demonstrate, to our knowledge, the first direct, temporal, in vivo visual analysis of a symbiosis system and the application of this system to reveal continuous dynamics of the symbiont population in the living host animal. IMPORTANCE This paper describes an experimental system for directly investigating population dynamics of a symbiotic bacterium, Xenorhabdus nematophila , in its host-the infective stage of the entomopathogenic nematode Steinernema carpocapsae . Tracking individual and groups of bacteria in individual host nematodes over days and weeks yielded insight into dynamic growth and topology changes

Tyrosine sulfation in a Gram-negative bacterium

PubMed Central

Han, Sang-Wook; Lee, Sang-Won; Bahar, Ofir; Schwessinger, Benjamin; Robinson, Michelle R.; Shaw, Jared B.; Madsen, James A.; Brodbelt, Jennifer S.; Ronald, Pamela C.

2015-01-01

Tyrosine sulfation, a well-characterized post-translation modification in eukaryotes, has not previously been reported in prokaryotes. Here we demonstrate that the RaxST protein from the Gram-negative bacterium, Xanthomonas oryzae pv. oryzae, is a tyrosine sulfotransferase. We used a newly developed sulfotransferase assay and ultraviolet photodissociation mass spectrometry (UVPD) to demonstrate that RaxST catalyzes sulfation of tyrosine 22 of the Xoo Ax21 (activator of XA21-mediated immunity). These results demonstrate a previously undescribed post-translational modification in a prokaryotic species with implications extending to host immune response and bacterial cell-cell communication system. PMID:23093190

Partial proteome of the corynetoxin-producing Gram-positive bacterium, Rathayibacter toxicus

USDA-ARS?s Scientific Manuscript database

Rathayibacter toxicus is a Gram-positive bacterium that is the causative agent of annual ryegrass toxicity (ARGT), a disease that causes devastating losses in the Australian livestock industry. R. toxicus exhibits a complex life cycle, using the nematode Anguina funesta as a physical vector to carry...

Application of agglomerative clustering for analyzing phylogenetically on bacterium of saliva

NASA Astrophysics Data System (ADS)

Bustamam, A.; Fitria, I.; Umam, K.

2017-07-01

Analyzing population of Streptococcus bacteria is important since these species can cause dental caries, periodontal, halitosis (bad breath) and more problems. This paper will discuss the phylogenetically relation between the bacterium Streptococcus in saliva using a phylogenetic tree of agglomerative clustering methods. Starting with the bacterium Streptococcus DNA sequence obtained from the GenBank, then performed characteristic extraction of DNA sequences. The characteristic extraction result is matrix form, then performed normalization using min-max normalization and calculate genetic distance using Manhattan distance. Agglomerative clustering technique consisting of single linkage, complete linkage and average linkage. In this agglomerative algorithm number of group is started with the number of individual species. The most similar species is grouped until the similarity decreases and then formed a single group. Results of grouping is a phylogenetic tree and branches that join an established level of distance, that the smaller the distance the more the similarity of the larger species implementation is using R, an open source program.

Melanin from the Nitrogen-Fixing Bacterium Azotobacter chroococcum: A Spectroscopic Characterization

PubMed Central

Banerjee, Raja

2014-01-01

Melanins, the ubiquitous hetero-polymer pigments found widely dispersed among various life forms, are usually dark brown/black in colour. Although melanins have variety of biological functions, including protection against ultraviolet radiation of sunlight and are used in medicine, cosmetics, extraction of melanin from the animal and plant kingdoms is not an easy task. Using complementary physicochemical techniques (i.e. MALDI-TOF, FTIR absorption and cross-polarization magic angle spinning solid-state 13C NMR), we report here the characterization of melanins extracted from the nitrogen-fixing non-virulent bacterium Azotobacter chroococcum, a safe viable source. Moreover, considering dihydroxyindole moiety as the main constituent, an effort is made to propose the putative molecular structure of the melanin hetero-polymer extracted from the bacterium. Characterization of the melanin obtained from Azotobacter chroococcum would provide an inspiration in extending research activities on these hetero-polymers and their use as protective agent against UV radiation. PMID:24416247

Draft Genome Sequence of Arthrobacter sp. Strain SPG23, a Hydrocarbon-Degrading and Plant Growth-Promoting Soil Bacterium.

PubMed

Gkorezis, Panagiotis; Bottos, Eric M; Van Hamme, Jonathan D; Thijs, Sofie; Rineau, Francois; Franzetti, Andrea; Balseiro-Romero, Maria; Weyens, Nele; Vangronsveld, Jaco

2015-12-23

We report here the 4.7-Mb draft genome of Arthrobacter sp. SPG23, a hydrocarbonoclastic Gram-positive bacterium belonging to the Actinobacteria, isolated from diesel-contaminated soil at the Ford Motor Company site in Genk, Belgium. Strain SPG23 is a potent plant growth promoter useful for diesel fuel remediation applications based on plant-bacterium associations. Copyright © 2015 Gkorezis et al.

Draft Genome Sequence of Bacillus licheniformis Strain GB2, a Hydrocarbon-Degrading and Plant Growth-Promoting Soil Bacterium.

PubMed

Gkorezis, Panagiotis; Van Hamme, Jonathan; Bottos, Eric; Thijs, Sofie; Balseiro-Romero, Maria; Monterroso, Carmela; Kidd, Petra Suzan; Rineau, Francois; Weyens, Nele; Sillen, Wouter; Vangronsveld, Jaco

2016-06-23

We report the 4.39 Mb draft genome of Bacillus licheniformis GB2, a hydrocarbonoclastic Gram-positive bacterium of the family Bacillaceae, isolated from diesel-contaminated soil at the Ford Motor Company site in Genk, Belgium. Strain GB2 is an effective plant-growth promoter useful for diesel fuel remediation applications based on plant-bacterium associations. Copyright © 2016 Gkorezis et al.

Microbiological assay for the determination of meropenem in pharmaceutical dosage form.

PubMed

Mendez, Andreas S L; Weisheimer, Vanessa; Oppe, Tércio P; Steppe, Martin; Schapoval, Elfrides E S

2005-04-01

Meropenem is a highly active carbapenem antibiotic used in the treatment of a wide range of serious infections. The present work reports a microbiological assay, applying the cylinder-plate method, for the determination of meropenem in powder for injection. The validation method yielded good results and included linearity, precision, accuracy and specificity. The assay is based on the inhibitory effect of meropenem upon the strain of Micrococcus luteus ATCC 9341 used as the test microorganism. The results of assay were treated statistically by analysis of variance (ANOVA) and were found to be linear (r=0.9999) in the range of 1.5-6.0 microg ml(-1), precise (intra-assay: R.S.D.=0.29; inter-assay: R.S.D.=0.94) and accurate. A preliminary stability study of meropenem was performed to show that the microbiological assay is specific for the determination of meropenem in the presence of its degradation products. The degraded samples were also analysed by the HPLC method. The proposed method allows the quantitation of meropenem in pharmaceutical dosage form and can be used for the drug analysis in routine quality control.

Antimicrobial activity, cytotoxicity, and phytochemical screening of Voacanga globosa (Blanco) Merr. leaf extract (Apocynaceae).

PubMed

Vital, Pierangeli G; Rivera, Windell L

2011-10-01

To determine the antibacterial, antifungal, antiprotozoal, cytotoxic, and phytochemical properties of ethanol extracts of leaves of Voacanga globosa (Blanco) Merr. (V. globosa). The extracts were tested against bacteria and fungus through disc diffusion assay; against protozoa through growth curve determination, antiprotozoal and cytotoxicity assays. The extract revealed antibacterial activities, inhibiting the growth of Staphylococcus aureus, Bacillus cereus, Pseudomonas aeruginosa, Micrococcus luteus, and Salmonella typhimurium. Antifungal assay showed that it inhibited Candida albicans. The antiprotozoal assay against Trichomonas vaginalis and Entamoeba histolytica showed that V. globosa can inhibit the parasites, wherein the action can be comparable to metronidazole. With the in situ cell death detection kit, Trichomonas vaginalis and Entamoeba histolytica exposed to V. globosa leaf extract was observed to fluoresce simultaneously in red and yellow signals signifying apoptotic-like changes. Preliminary phytochemical screening revealed the chemical composition of plant extract containing alkaloids, saponins, 2-deoxysugars, and hydrolysable tannins. Thus, this study provides scientific evidence on the traditional use of V. globosa leaf extract in treating microbial diseases. Further, the leaf extract can possibly be used to produce alternative forms of antimicrobials. Copyright © 2011 Hainan Medical College. Published by Elsevier B.V. All rights reserved.

Hexapeptide Derivatives of Glycopeptide Antibiotics: Tools for Mechanism of Action Studies

PubMed Central

Allen, Norris E.; LeTourneau, Deborah L.; Hobbs, Joe N.; Thompson, Richard C.

2002-01-01

Hexapeptide (des-N-methylleucyl) derivatives of LY264826 were prepared in order to examine further the role of N-substituted hydrophobic side chains in defining the mechanisms of action of semisynthetic glycopeptide antibiotics. The hexapeptide of LY264826 binds to the cell wall intermediate analog l-Lys-d-Ala-d-Ala with a 100-fold lower affinity than LY264826 and inhibits Micrococcus luteus almost 200-fold more poorly than LY264826 does. Alkylation of the 4-epi-vancosamine moiety of the disaccharide significantly enhanced the antibacterial activity of the hexapeptide. Alkylation did not affect the binding affinity for d-alanyl-d-alanine residues; however, it did enhance dimerization 7,000-fold and enhanced binding to bacterial membrane vesicles noticeably compared with the levels of dimerization and binding for the unsubstituted hexapeptide. The findings from this study complement those presented in an earlier report (N. E. Allen, D. L. LeTourneau, and J. N. Hobbs, Jr., J. Antibiot. 50:677-684, 1997) and are consistent with the conclusion that the enhanced antibacterial activities of semisynthetic glycopeptide antibiotics derive from the ability of the hydrophobic side chain to markedly affect both dimerization and binding to bacterial membranes. PMID:12121903

Antimicrobial and free radical scavenging activities of five Palestinian medicinal plants.

PubMed

Qabaha, Khaled Ibraheem

2013-01-01

Extracts from five indigenous Palestinian medicinal plants including Rosmarinus officinalis, Pisidium guajava, Punica granatum peel, grape seeds and Teucrium polium were investigated for antimicrobial and free radical scavenging activities against eight microorganisms, using well diffusion method. The microorganisms included six bacterial isolates (i.e. Staphylococcus aureus, Escherichia coli, Pseudomonas aeruginos, Klebsiella pneumonia, Bacillus subtilis and Micrococcus luteus) and two fungal isolates (i.e. Candida albicans and Aspergillus niger). A standard antioxidant assay was performed on the plant extracts to assess their capability in scavenging 2,2-diphenyl-1-picrylhydrazyl (DPPH). Of the five tested plant extract, only Rosmarinus offcinalis extract contained significant antimicrobial activity against all eight microbial isolates including Pseudomonas aeruginosa. Extracts from other four plants exhibited a variable antimicrobial activity against all microorganisms, except Pseudomonas aeruginosa. Significant antioxidant activity was detected in all plant extracts. However, extracts from Pisidium guajava leaves contained significantly higher antioxidant activity compared to the other extracts tested. The antimicrobial and scavenging activities detected in this in vitro study in extracts from the five Palestinian medicinal plants suggest that further study is needed to identify active compounds to target diseases caused by a wide-spectrum pathogens.

High-Throughput Identification of Antimicrobial Peptides from Amphibious Mudskippers

PubMed Central

You, Xinxin; Bian, Chao; Chen, Shixi; Lv, Zhao; Qiu, Limei; Shi, Qiong

2017-01-01

Widespread existence of antimicrobial peptides (AMPs) has been reported in various animals with comprehensive biological activities, which is consistent with the important roles of AMPs as the first line of host defense system. However, no big-data-based analysis on AMPs from any fish species is available. In this study, we identified 507 AMP transcripts on the basis of our previously reported genomes and transcriptomes of two representative amphibious mudskippers, Boleophthalmus pectinirostris (BP) and Periophthalmus magnuspinnatus (PM). The former is predominantly aquatic with less time out of water, while the latter is primarily terrestrial with extended periods of time on land. Within these identified AMPs, 449 sequences are novel; 15 were reported in BP previously; 48 are identically overlapped between BP and PM; 94 were validated by mass spectrometry. Moreover, most AMPs presented differential tissue transcription patterns in the two mudskippers. Interestingly, we discovered two AMPs, hemoglobin β1 and amylin, with high inhibitions on Micrococcus luteus. In conclusion, our high-throughput screening strategy based on genomic and transcriptomic data opens an efficient pathway to discover new antimicrobial peptides for ongoing development of marine drugs. PMID:29165344

Two-stage phyto-microremediation of tannery effluent by Spirodela polyrrhiza (L.) Schleid. and chromium resistant bacteria.

PubMed

Singh, Asha; Vyas, Dhiraj; Malaviya, Piyush

2016-09-01

Two-stage sequential treatment of tannery effluent was conducted employing a wetland plant, Spirodela polyrrhiza (L.) Schleid., and chromium (Cr) resistant bacterial strains. The bacterial strains were isolated from Cr-enriched environmental matrices and rhizosphere of Spirodela polyrrhiza. The phyto-rhizoremediation of tannery effluent by Spirodela and its rhizospheric bacteria (Cellulomonas biazotea APBR1-6, Bacillus safensis APBR2-12, Staphylococcus warneri APBR3-5, Microbacterium oleivorans APBR2-6), followed by microremediation by Cr resistant bacteria (Micrococcus luteus APBS5-1, Bacillus pumilus APBS5-2, Bacillus flexus APBE3-1, Virgibacillus sediminis APBS6-1) resulted in reduction of pollution parameters [COD (81.2%), total Cr (97.3%), Cr(VI) (99.3%), Pb(II) (97.0%), Ni (95.7%)]. The LC-MS analysis showed that many pollutants detected in untreated tannery effluent were diminished after bioremediation or long chains of alcohol polyethoxylates viz. C18EO6 in untreated effluent were broken down into smaller unit of alcohol polyethoxylate ((+)HHO[CH2CH2O]H), indicating that bacteria and Spirodela polyrrhiza, alongwith its rhizospheric associates utilized them as carbon and energy source. Copyright © 2016 Elsevier Ltd. All rights reserved.

Ecological effects of a deodorant and a plain soap upon human skin bacteria.

PubMed Central

Bibel, D. J.

1977-01-01

The effects of a commercial trichlorocarbanilide-containing deodorant soap and a commercial plain soap upon the cutaneous flora of individuals were compared. Using a cross-over design, 21 volunteers (10 women and 11 men) washed their forearms at least once a day with one soap for 3 weeks and then switched soaps for another 4 weeks use. By analysis of variance no significant difference in total colony counts was noted among individuals in their use of the two soaps. With the exception of individual variation, neither sequence of use, sex, nor any combination was influential. However, in 20 of 21 subjects an alteration in the composition of skin flora was observed. The deodorant soap, which in six cases increased total flora, tended to reduce or eliminate diphtheroids in 12 to 17 carriers (71%). Fewer kinds of bacteria were also noted. More Staphylococcus epidermidis was seen with the plain soap, but washing with the deodorant soap seemed to favour Acinetobacter calcoaceticus and Micrococcus luteus. The impact of this alteration and the use of total counts to measure effectiveness of deodorant soaps were brought into question. PMID:264493

Lysozyme as a recognition element for monitoring of bacterial population.

PubMed

Zheng, Laibao; Wan, Yi; Yu, Liangmin; Zhang, Dun

2016-01-01

Bacterial infections remain a significant challenge in biomedicine and environment safety. Increasing worldwide demand for point-of-care techniques and increasing concern on their safe development and use, require a simple and sensitive bioanalysis for pathogen detection. However, this goal is not yet achieved. A design for fluorescein isothiocyanate-labeled lysozyme (FITC-LYZ), which provides quantitative binding information for gram-positive bacteria, Micrococcus luteus, and detects pathogen concentration, is presented. The functional lysozyme is used not only as the pathogenic detection platform, but also as a tracking reagent for microbial population in antibacterial tests. A nonlinear relationship between the system response and the logarithm of the bacterial concentration was observed in the range of 1.2×10(2)-1.2×10(5) cfu mL(-1). The system has a potential for further applications and provides a facile and simple method for detection of pathogenic bacteria. Meanwhile, the fluorescein isothiocyanate -labeled lysozyme is also employed as the tracking agent for antibacterial dynamic assay, which show a similar dynamic curve compared with UV-vis test. Copyright © 2015 Elsevier B.V. All rights reserved.

Chemical constituents of essential oil of endemic Rhanterium suaveolens Desf. growing in Algerian Sahara with antibiofilm, antioxidant and anticholinesterase activities.

PubMed

Chemsa, Ahmed Elkhalifa; Erol, Ebru; Öztürk, Mehmet; Zellagui, Amar; Özgür, Ceylan; Gherraf, Noureddine; Duru, Mehmet Emin

2016-09-01

Twenty compounds were detected in the essential oil of Rhanterium suaveolens representing 98.01% of the total oil content. Perillaldehyde (45.79%), caryophyllene oxide (24.82%) and β-cadinol (5.61%) were identified as the main constituents. In β-carotene-linoleic acid assay, both the oil and the methanol extract exhibited good lipid peroxidation inhibition activity, with IC50 values of 17.97 ± 5.40 and 11.55 ± 3.39 μg/mL, respectively. In DPPH and CUPRAC assays, however, the methanol extract exhibited a good antioxidant activity. The highest antibiofilm activity has been found 50.30% against Staphylococcus epidermidis (MU 30) at 20 μg/mL for essential oil and 58.34% against Micrococcus luteus (NRRL B-4375) at 25 mg/mL concentration for methanol extract. The in vitro anticholinesterase activity of methanol extract showed a moderate acetylcholinesterase inhibitory (IC50 = 168.76 ± 0.62 μg/mL) and good butyrylcholinesterase inhibitory (IC50 = 54.79 ± 1.89 μg/mL) activities. The essential oil was inactive against both enzymes.

Cloning and heterologous expression of plnE, -F, -J and -K genes derived from soil metagenome and purification of active plantaricin peptides.

PubMed

Pal, Gargi; Srivastava, Sheela

2014-02-01

Plantaricin gene-specific primers were used to obtain plnE, -F, -J and -K structural gene amplicons from soil metagenome. These amplicons were cloned and expressed in pET32a (+) vector in Escherichia coli BL21 (DE3). PlnE, -F, -J and -K peptides were expressed as His-tagged-fusion proteins and were separated by Ni(2+) -chelating affinity chromatography. The peptides were released from the fusion by enterokinase cleavage and separated from the carrier thioredoxin. The cleaved peptides were further analysed for antimicrobial activity and found to be active against Listeria innocua NRRL B33314, Micrococcus luteus MTCC 106 and lactic acid bacteria, such as Enterococcus casseliflavus NRRL B3502, Lactococcus lactis lactis NRRL 1821, Lactobacillus curvatus NRRL B4562 and Lactobacillus plantarum NRRL B4496. E. coli has been successfully exploited as a host for heterologous expression with a significant yield of fused and cleaved peptides in the range of 8-12 and 1-1.5 mg/l of the culture, respectively. Heterologous expression, therefore, can be used to overcome the constraints of low yield often reported from a native strain.

High-Throughput Identification of Antimicrobial Peptides from Amphibious Mudskippers.

PubMed

Yi, Yunhai; You, Xinxin; Bian, Chao; Chen, Shixi; Lv, Zhao; Qiu, Limei; Shi, Qiong

2017-11-22

Widespread existence of antimicrobial peptides (AMPs) has been reported in various animals with comprehensive biological activities, which is consistent with the important roles of AMPs as the first line of host defense system. However, no big-data-based analysis on AMPs from any fish species is available. In this study, we identified 507 AMP transcripts on the basis of our previously reported genomes and transcriptomes of two representative amphibious mudskippers, Boleophthalmus pectinirostris (BP) and Periophthalmus magnuspinnatus (PM). The former is predominantly aquatic with less time out of water, while the latter is primarily terrestrial with extended periods of time on land. Within these identified AMPs, 449 sequences are novel; 15 were reported in BP previously; 48 are identically overlapped between BP and PM; 94 were validated by mass spectrometry. Moreover, most AMPs presented differential tissue transcription patterns in the two mudskippers. Interestingly, we discovered two AMPs, hemoglobin β1 and amylin, with high inhibitions on Micrococcus luteus . In conclusion, our high-throughput screening strategy based on genomic and transcriptomic data opens an efficient pathway to discover new antimicrobial peptides for ongoing development of marine drugs.

Antioxidant and Antimicrobial Properties of the Essential Oil and Extracts of Zanthoxylum alatum Grown in North-Western Himalaya

PubMed Central

Tiku, A. K.; Koul, Apurva; Gupta, Sahil; Singh, Gurjinder; Razdan, V. K.

2013-01-01

The essential oil obtained from the fresh leaves of Zanthoxylum alatum was analysed by gas chromatography/mass spectrometry (GC/MS). Fourteen components were identified, and linalool (30.58%), 2-decanone (20.85%), β-fenchol (9.43%), 2-tridecanone (8.86%), β-phellandrene (5.99%), Sabinene (4.82%), and α-pinene (4.11%) were the main components. The EO and methanolic extract of Z. alatum exhibited potent antifungal activity against Alternaria alternata, Alternaria brassicae, and Curvularia lunata. The EO also showed significant antibacterial activity against Bacillus subtilis, Micrococcus luteus, Staphylococcus aureus, and Escherichia coli. Further, antimicrobial constituents of the EO were isolated by bioautography and preparative thin layer chromatography (PTLC) and identified as β-fenchol and linalool using GC/MS analysis. In addition to this, the free radical scavenging activity and antioxidant potential of EO and methanolic extract/fractions of Z. alatum were also investigated using in vitro assays including scavenging ability against DPPH•, reducing power and chelating ability on Fe2+ ions. Our results demonstrate that Z. alatum could be used as a resource of antioxidant and antimicrobial compounds which may find applications in food and pesticide industries. PMID:23781160

Isolation of Viable but Non-culturable Bacteria from Printing and Dyeing Wastewater Bioreactor Based on Resuscitation Promoting Factor.

PubMed

Jin, Yi; Gan, Guojuan; Yu, Xiaoyun; Wu, Dongdong; Zhang, Li; Yang, Na; Hu, Jiadan; Liu, Zhiheng; Zhang, Lixin; Hong, Huachang; Yan, Xiaoqing; Liang, Yan; Ding, Linxian; Pan, Yonglong

2017-07-01

Printing and dyeing wastewater with high content of organic matters, high colority, and poor biochemical performance is hard to be degraded. In this study, we isolated viable but non-culturable (VBNC) bacteria from printing and dyeing wastewater with the culture media contained resuscitation promoting factor (Rpf) protein secreted by Micrococcus luteus, counted the culturable cells number with the most probable number, sequenced 16S rRNA genes, and performed polymerase chain reaction-denaturing gradient gel electrophoresis. It is obviously that the addition of Rpf in the enrichment culture could promote growth and resuscitation of bacteria in VBNC state to obtain more fastidious bacteria significantly. The identified bacteria were assigned to nine genera in the treatment group, while the two strains of Ochrobactrum anthropi and Microbacterium sp. could not be isolated from the control group. The function of isolated strains was explored and these strains could degrade the dye of Congo red. This study provides a new sight into the further study including the present state, composition, formation mechanism, and recovery mechanism about VBNC bacteria in printing and dyeing wastewater, which would promote to understand bacterial community in printing and dyeing wastewater, and to obtain VBNC bacteria from ecological environment.

Standoff detection and classification of bacteria by multispectral laser-induced fluorescence

NASA Astrophysics Data System (ADS)

Duschek, Frank; Fellner, Lea; Gebert, Florian; Grünewald, Karin; Köhntopp, Anja; Kraus, Marian; Mahnke, Peter; Pargmann, Carsten; Tomaso, Herbert; Walter, Arne

2017-04-01

Biological hazardous substances such as certain fungi and bacteria represent a high risk for the broad public if fallen into wrong hands. Incidents based on bio-agents are commonly considered to have unpredictable and complex consequences for first responders and people. The impact of such an event can be minimized by an early and fast detection of hazards. The presented approach is based on optical standoff detection applying laser-induced fluorescence (LIF) on bacteria. The LIF bio-detector has been designed for outdoor operation at standoff distances from 20 m up to more than 100 m. The detector acquires LIF spectral data for two different excitation wavelengths (280 and 355 nm) which can be used to classify suspicious samples. A correlation analysis and spectral classification by a decision tree is used to discriminate between the measured samples. In order to demonstrate the capabilities of the system, suspensions of the low-risk and non-pathogenic bacteria Bacillus thuringiensis, Bacillus atrophaeus, Bacillus subtilis, Brevibacillus brevis, Micrococcus luteus, Oligella urethralis, Paenibacillus polymyxa and Escherichia coli (K12) have been investigated with the system, resulting in a discrimination accuracy of about 90%.

DNA-binding studies and biological activities of new nitrosubstituted acyl thioureas

NASA Astrophysics Data System (ADS)

Tahir, Shaista; Badshah, Amin; Hussain, Raja Azadar; Tahir, Muhammad Nawaz; Tabassum, Saira; Patujo, Jahangir Ali; Rauf, Muhammad Khawar

2015-11-01

Four new nitrosubstituted acylthioureas i.e. 1-acetyl-3-(4-nitrophenyl)thiourea (TU1), 1-acetyl-3-(2-methyl-4-nitrophenyl)thiourea (TU2), 1-acetyl-3-(2-methoxy-4-nitrophenyl)thiourea (TU3) and 1-acetyl-3-(4-chloro-3-nitrophenyl)thiourea (TU4) have been synthesized and characterized (by C13 and H1 nuclear magnetic resonance, Fourier transform infrared spectroscopy and single crystal X-ray diffraction). As a preliminary investigation of the anti-cancer potencies of the said compounds, DNA interaction studies have been carried out using cyclic voltammetry and UV-vis spectroscopy along with verification from computational studies. The drug-DNA binding constants are found to be in the order, KTU3 9.04 × 106 M-1 > KTU4 8.57 × 106 M-1 > KTU2 6.05 × 106 M-1 > KTU1 1.16 × 106 M-1. Furthermore, the antioxidant, cytotoxic, antibacterial and antifungal activities have been carried out against DPPH (1,1-diphenyl-2-dipicrylhydrazyl), Brine shrimp eggs, gram positive (Micrococcus luteus, Staphylococcus aureus) and gram negative (Bordetella bronchiseptica, Salmonella typhimurium, Enterobacter aerogens) and fungal cultures (Aspergillus fumigatus, Mucor species, Aspergillus niger, Aspergillus flavus) respectively.

Cobalt-doped nanohydroxyapatite: synthesis, characterization, antimicrobial and hemolytic studies

NASA Astrophysics Data System (ADS)

Tank, Kashmira P.; Chudasama, Kiran S.; Thaker, Vrinda S.; Joshi, Mihir J.

2013-05-01

Hydroxyapatite (Ca10(PO4)6(OH)2; HAP) is a major mineral component of the calcified tissues, and it has various applications in medicine and dentistry. In the present investigation, cobalt-doped hydroxyapatite (Co-HAP) nanoparticles were synthesized by surfactant-mediated approach and characterized by different techniques. The EDAX was carried out to estimate the amount of doping in Co-HAP. The transmission electron microscopy result suggested the transformation of morphology from needle shaped to spherical type on increasing the doping concentration. The powder XRD study indicated the formation of a new phase of brushite for higher concentration of cobalt. The average particle size and strain were calculated using Williamson-Hall analysis. The average particle size was found to be 30-60 nm. The FTIR study confirmed the presence of various functional groups in the samples. The antimicrobial activity was evaluated against four organisms Pseudomonas aeruginosa and Shigella flexneri as Gram negative as well as Micrococcus luteus and Staphylococcus aureus as Gram positive. The hemolytic test result suggested that all samples were non-hemolytic. The photoluminescence study was carried out to identify its possible applicability as a fluorescent probe.

Speleothems from Mawsmai and Krem Phyllut caves, Meghalaya, India: some evidences on biogenic activities

NASA Astrophysics Data System (ADS)

Baskar, Sushmitha; Baskar, R.; Lee, Natuschka; Theophilus, P. K.

2009-05-01

The Mawsmai cave and Krem Phyllut caves, East Khasi hills, Meghalaya, India has so far not yet attracted the attention of geomicrobiologists. Observations and hypotheses on the possible influence of identified microorganisms for speleothem formations in Meghalaya are reported for the first time. XRD studies identified calcite in speleothems and gypsum in cave wall deposits as the dominant minerals. SEM-EDAX showed interesting microfabric features showing strong resemblance with fossilised bacteria, calcified filaments, needle calcite and numerous nano scale calcite crystals, highly weathered and disintegrated crystals of calcite, that point towards a significant microbial influence in its genesis. Thin section petrography showed laminated stromatolitic features. The microorganisms identified by conventional isolation and further evaluation of isolates by molecular techniques include Bacillus cereus, Bacillus mycoides, Bacillus licheniformis, Micrococcus luteus, and Actinomycetes. Microscopic observations also showed unidentifiable cocci and four unidentifiable strains of CaSO4 (gypsum) precipitating bacteria. Experimental studies confirmed that these bacteria are able to precipitate calcium minerals (calcite, gypsum, minor amounts of dolomite) in the laboratory. These results allow us to postulate that species like these may contribute to active biogenic influence in the cave formations at Meghalaya.

["Candidatus contubernalis alkalaceticum," an obligately syntrophic alkaliphilic bacterium capable of anaerobic acetate oxidation in a coculture with Desulfonatronum cooperativum].

PubMed

Zhilina, T N; Zavarzina, D G; Kolganova, T V; Turova, T P; Zavarzin, G A

2005-01-01

From the silty sediments of the Khadyn soda lake (Tuva), a binary sulfidogenic bacterial association capable of syntrophic acetate oxidation at pH 10.0 was isolated. An obligately syntrophic, gram-positive, spore-forming alkaliphilic rod-shaped bacterium performs acetate oxidation in a syntrophic association with a hydrogenotrophic, alkaliphilic sulfate-reducing bacterium; the latter organism was previously isolated and characterized as the new species Desulfonatronum cooperativum. Other sulfate-reducing bacteria of the genera Desulfonatronum and Desulfonatronovibrio can also act as the hydrogenotrophic partner. Apart from acetate, the syntrophic culture can oxidize ethanol, propanol, isopropanol, serine, fructose, and isobutyric acid. Selective amplification of 16S rRNA gene fragments of the acetate-utilizing syntrophic component of the binary culture was performed; it was found to cluster with clones of uncultured gram-positive bacteria within the family Syntrophomonadaceae. The acetate-oxidizing bacterium is thus the first representative of this cluster obtained in a laboratory culture. Based on its phylogenetic position, the new acetate-oxidizing syntrophic bacterium is proposed to be assigned, in a Candidate status, to a new genus and species: "Candidatus Contubernalis alkalaceticum."

Isolation and characterization of Leu[7]-Surfactin from the endophytic bacterium Bacillus mojavensis RRC 101, a biocontrol agent for Fusarium verticillioides

USDA-ARS?s Scientific Manuscript database

Bacillus mojavensis is an endophytic bacterium patented for control of fungal diseases in maize and other plants. Culture extracts and filtrates from this bacterium were antagonistic to the pathogenic and mycotoxic fungus Fusarium verticillioides. However, the identity of the inhibitory substance ...

Stress of algicidal substances from a bacterium Exiguobacterium sp. h10 on Microcystis aeruginosa.

PubMed

Li, Y; Liu, L; Xu, Y; Li, P; Zhang, K; Jiang, X; Zheng, T; Wang, H

2017-01-01

Microcystis aeruginosa is a cyanobacterial bloom-causing species and is considered a serious threat to human health and biological safety. In this study, the algicidal bacterium h10 showed high algicidal effects on M. aeruginosa 7820, and strain h10 was confirmed to belong to the genus Exiguobacterium, for which the name Exiguobacterium sp. h10 is proposed. Algicidal activity and mode analysis revealed that the supernatant, rather than the bacterial cells, was responsible for the algicidal activity, indicating that the algicidal mode of strain h10 is by indirect attack through the production of algicidal substances. Analysis of the algicidal substance characteristics showed a molecular weight of <1000 Da and that algicidal substances exhibit high thermal stability and pH instability, and the characteristic functional groups of the algicidal substance mainly included carbonyl, amino and hydroxyl groups. Under the effects of the algicidal substance, the cellular pigment content was significantly decreased, and the algal cell structure and morphology were seriously damaged. The results indicate that the algicidal bacterium Exiguobacterium sp. h10 could be a potential bio-agent for controlling cyanobacterial blooms of M. aeruginosa. In this study, the effects of algicidal substances from an algicidal bacterium Exiguobacterium sp. h10 on the toxic cyanobacterium, Microcystis aeruginosa 7820, were first investigated. The algicidal mode of action was confirmed as an indirect attack through the production of algicidal substances. The characteristics of the algicidal substance were determined, especially the functional groups analysis that confirmed the algicidal substances were glycolipid mixtures. With the stress of algicidal substances, the algal chlorophyll a synthesis, cell structure and morphology were seriously damaged. This study proved that algicidal bacteria are promising sources of potential cyanobacterial bloom-control, and provided good procedures for the

Isolation and characterization of a mannan from mesosomal membrane vesicles of Micrococcus lysodeikticus.

PubMed

Owen, P; Salton, M R

1975-10-06

The carbohydrate content of mesosomal membranes of Micrococcus lysodeikticus has been shown to be consistently higher (about four times) than that of corresponding plasma membrane preparations. Analysis of washed membrane fractions by gas-liquid chromatography indicated that mannose was the major neutral sugar of both types of membrane (accounting for 95 and 89%, respectively, of the mesosomal and plasma membrane carbohydrate). Small amounts of inositol, glucose and ribose were also detected. We have shown by polyacrylamide gel electrophoresis in sodium dodecylsulphate and by precipitation and agar gel diffusion experiments with concanavalin A that a mannan is the major carbohydrate component of both types of membrane. This polymer can be selectively released from mesosomal membranes by a simple procedure involving low ionic strength-shock and heating to 80 degrees C for 1 min, and purified by ultrafiltration and ethanol precipitation. The mannan contains mannose as the only neutral carbohydrate, is not phosphorylated and does not contain significant amounts of amino sugars or uronic acids. Agar gel electrophoresis experiments, however, indicate an anionic polymer whose acidic properties are eliminated upon mild base hydrolysis. Analysis of native mannan by infrared spectroscopy reveals absorption bands attributable to ester carbonyl groups and to carboxylate ions, consistent with the presence of succinyl residues in the polymer (Owen, P. and Salton, M.R.J. (1975) Biochem, Biophys. Res. Commun. 63, 875--800). A sedimentation coefficient of 1.39 S was obtained by analytical ultracentrifugation in 1.0 M NaCl and a value of one reducing equivalent per 50 mannose residues by reduction with NaB3H4. The polysaccharide was only slightly degraded (2%) by jack bean alpha-mannosidase and could precipitate 15 times its own weight of concanavalin A. The acidic polymers was also detected in the cell "periplasm" and was secreted from cells grown in defined media during the

Biodegradation of Ethylene Glycol by a Salt-Requiring Bacterium1

PubMed Central

Gonzalez, Carlos F.; Taber, Willard A.; Zeitoun, M. A.

1972-01-01

A gram-negative nonmotile rod which was capable of using 1,2-14C-ethylene glycol as a sole carbon source for growth was isolated from a brine pond, Great Salt Lake, Utah. The bacterium (ATCC 27042) required at least 0.85% NaCl for growth and, although the chloride ion was replaceable by sulfate ion, the sodium ion was not replaceable by potassium ion. The maximal concentration of salt tolerated for growth was approximately 12%. The bacterium was oxidase-negative when N,N-dimethyl-p-phenylenediamine was used and weakly positive when N,N,N′,N′-tetramethyl-p-phenylenediamine was used. It grows on many sugars but does not ferment them, it does not have an exogenous vitamin requirement, and it possesses a guanine plus cytosine ratio of 64.3%. Incorporation of ethylene glycol carbon into cell and respired CO2 was quantitated by use of radioactive ethylene glycol and a force-aerated fermentor. Glucose suppressed ethylene glycol metabolism. Cells grown on ethylene and propylene glycol respired ethylene glycol in a Warburg respirometer more rapidly than cells grown on glucose. Spectrophotometric evidence was obtained for oxidation of glycolate to glyoxylate by a dialyzed cell extract. PMID:4568254

Chromatin organization and radio resistance in the bacterium Gemmata obscuriglobus.

PubMed

Lieber, Arnon; Leis, Andrew; Kushmaro, Ariel; Minsky, Abraham; Medalia, Ohad

2009-03-01

The organization of chromatin has a major impact on cellular activities, such as gene expression. For bacteria, it was suggested that the spatial organization of the genetic material correlates with transcriptional levels, implying a specific architecture of the chromosome within the cytoplasm. Accordingly, recent technological advances have emphasized the organization of the genetic material within nucleoid structures. Gemmata obscuriglobus, a member of the phylum Planctomycetes, exhibits a distinctive nucleoid structure in which chromatin is encapsulated within a discrete membrane-bound compartment. Here, we show that this soil and freshwater bacterium tolerates high doses of UV and ionizing radiation. Cryoelectron tomography of frozen hydrated sections and electron microscopy of freeze-substituted cells have indicated a more highly ordered condensed-chromatin organization in actively dividing and stationary-phase G. obscuriglobus cells. These three-dimensional analyses revealed a complex network of double membranes that engulf the condensed DNA. Bioinformatics analysis has revealed the existence of a putative component involved in nonhomologous DNA end joining that presumably plays a role in maintaining chromatin integrity within the bacterium. Thus, our observations further support the notion that packed chromatin organization enhances radiation tolerance.

Isolation of a New Polysaccharide-Digesting Bacterium from a Salt Marsh

PubMed Central

Andrykovitch, George; Marx, Irene

1988-01-01

A new marine bacterium that digested a variety of storage and structural polysaccharides, including agar, was isolated. Strain 2-40 is a nonfermentative gram-negative, polarly flagellated rod that sometimes grew as a filamentous helix and secreted a melaninlike pigment. Its characteristics conform to those of no previously described species. PMID:16347602

An Endohyphal Bacterium (Chitinophaga, Bacteroidetes) Alters Carbon Source Use by Fusarium keratoplasticum (F. solani Species Complex, Nectriaceae)

PubMed Central

Shaffer, Justin P.; U'Ren, Jana M.; Gallery, Rachel E.; Baltrus, David A.; Arnold, A. Elizabeth

2017-01-01

Bacterial endosymbionts occur in diverse fungi, including members of many lineages of Ascomycota that inhabit living plants. These endosymbiotic bacteria (endohyphal bacteria, EHB) often can be removed from living fungi by antibiotic treatment, providing an opportunity to assess their effects on functional traits of their fungal hosts. We examined the effects of an endohyphal bacterium (Chitinophaga sp., Bacteroidetes) on substrate use by its host, a seed-associated strain of the fungus Fusarium keratoplasticum, by comparing growth between naturally infected and cured fungal strains across 95 carbon sources with a Biolog® phenotypic microarray. Across the majority of substrates (62%), the strain harboring the bacterium significantly outperformed the cured strain as measured by respiration and hyphal density. These substrates included many that are important for plant- and seed-fungus interactions, such as D-trehalose, myo-inositol, and sucrose, highlighting the potential influence of EHB on the breadth and efficiency of substrate use by an important Fusarium species. Cases in which the cured strain outperformed the strain harboring the bacterium were observed in only 5% of substrates. We propose that additive or synergistic substrate use by the fungus-bacterium pair enhances fungal growth in this association. More generally, alteration of the breadth or efficiency of substrate use by dispensable EHB may change fungal niches in short timeframes, potentially shaping fungal ecology and the outcomes of fungal-host interactions. PMID:28382021

Effects of an equol-producing bacterium isolated from human faeces on isoflavone and lignan metabolism in mice.

PubMed

Tamura, Motoi; Hori, Sachiko; Nakagawa, Hiroyuki; Yamauchi, Satoshi; Sugahara, Takuya

2016-07-01

Equol is a metabolite of daidzein that is produced by intestinal microbiota. The oestrogenic activity of equol is stronger than daidzein. Equol-producing bacteria are believed to play an important role in the gut. The rod-shaped and Gram-positive anaerobic equol-producing intestinal bacterium Slackia TM-30 was isolated from healthy human faeces and its effects on urinary phyto-oestrogen, plasma and faecal lipids were assessed in adult mice. The urinary amounts of equol in urine were significantly higher in mice receiving the equol-producing bacterium TM-30 (BAC) group than in the control (CO) group (P < 0.05). However, no significant differences were observed between the urinary amounts of daidzein, dihydrodaidzein, enterodiol, and enterolactone between the BAC and CO groups. No significant differences in the plasma lipids were observed between the two groups. The lipid content (% dry weight) in the faeces sampled on the final day of the experiment tended to be higher in the BAC group than in the CO group (P = 0.07). Administration of equol-producing bacterium TM-30 affected the urinary amounts of phyto-oestrogens and the faecal lipid contents of mice. The equol-producing bacterium TM-30 likely influences the metabolism of phyto-oestrogen via changes in the gastrointestinal environment. © 2015 Society of Chemical Industry. © 2015 Society of Chemical Industry.

Halobacterium saccharovorum sp. nov., a carbohydrate-metabolizing, extremely halophilic bacterium

NASA Technical Reports Server (NTRS)

Tomlinson, G. A.; Hochstein, L. I.

1976-01-01

The previously described extremely halophilic bacterium, strain M6, metabolizes a variety of carbohydrates with the production of acid. In addition, the organism produces nitrite (but no gas) from nitrate, is motile, and grows most rapidly at about 50 C. These characteristics distinguish it from all previously described halophilic bacteria in the genus Halobacterium. It is suggested that it be designated as a new species, Halobacterium saccharovorum.

Draft genome sequence of a strictly anaerobic dichloromethane-degrading bacterium

DOE PAGES

Kleindienst, Sara; Higgins, Steven A.; Tsementzi, Despina; ...

2016-03-03

Here, an anaerobic, dichloromethane-degrading bacterium affiliated with novel Peptococcaceae was maintained in a microbial consortium. The organism originated from pristine freshwater sediment collected from Rio Mameyes in Luquillo, Puerto Rico, in October 2009 (latitude 18°21'43.9", longitude –65°46'8.4"). The draft genome sequence is 2.1 Mb and has a G+C content of 43.5%.

Enhancement of survival and electricity production in an engineered bacterium by light-driven proton pumping.

PubMed

Johnson, Ethan T; Baron, Daniel B; Naranjo, Belén; Bond, Daniel R; Schmidt-Dannert, Claudia; Gralnick, Jeffrey A

2010-07-01

Microorganisms can use complex photosystems or light-dependent proton pumps to generate membrane potential and/or reduce electron carriers to support growth. The discovery that proteorhodopsin is a light-dependent proton pump that can be expressed readily in recombinant bacteria enables development of new strategies to probe microbial physiology and to engineer microbes with new light-driven properties. Here, we describe functional expression of proteorhodopsin and light-induced changes in membrane potential in the bacterium Shewanella oneidensis strain MR-1. We report that there were significant increases in electrical current generation during illumination of electrochemical chambers containing S. oneidensis expressing proteorhodopsin. We present evidence that an engineered strain is able to consume lactate at an increased rate when it is illuminated, which is consistent with the hypothesis that proteorhodopsin activity enhances lactate uptake by increasing the proton motive force. Our results demonstrate that there is coupling of a light-driven process to electricity generation in a nonphotosynthetic engineered bacterium. Expression of proteorhodopsin also preserved the viability of the bacterium under nutrient-limited conditions, providing evidence that fulfillment of basic energy needs of organisms may explain the widespread distribution of proteorhodopsin in marine environments.

Genome Sequence of the Algicidal Bacterium Kordia algicida OT-1 ▿

PubMed Central

Lee, Hyun Sook; Kang, Sung Gyun; Kwon, Kae Kyoung; Lee, Jung-Hyun; Kim, Sang-Jin

2011-01-01

Kordia algicida OT-1 is an algicidal bacterium against the bloom-forming microalgae. The genome sequence of K. algicida revealed a number of interesting features, including the degradation of macromolecules, the biosynthesis of carotenoid pigment and secondary metabolites, and the capacity for gliding motility, which might facilitate the understanding of algicidal mechanisms. PMID:21622754

Physiological characterization of strain DCB-1, a unique dehalogenating sulfidogenic bacterium.

PubMed Central

Stevens, T O; Linkfield, T G; Tiedje, J M

1988-01-01

Strain DCB-1 is an obligately anaerobic bacterium which carries out the reductive dehalogenation of halobenzoates and was previously known to grow only on pyruvate plus 20% ruminal fluid. When various electron acceptors were supplied, thiosulfate and sulfite were found to stimulate growth. Sulfide was produced from thiosulfate. Cytochrome c and desulfoviridin were detected. The mol% G+C was 49 (at the thermal denaturation temperature). Of 55 carbon sources tested, only pyruvate supported growth as the sole carbon source in mineral medium. Lactate, acetate, L- and D-malate, glycerol, and L- and D-arabinose stimulated growth when supplemented with 10% ruminal fluid and 20 mM thiosulfate. In mineral medium, pyruvate was converted to acetate and lactate, with small amounts of succinate and fumarate accumulating transiently. During growth with thiosulfate, all of these products accumulated transiently. Addition of excess hydrogen to pyruvate-grown cultures resulted in diversion of carbon to formate, lactate, and butyrate, which caused a decrease in cell yield. We conclude that strain DCB-1 is a new type of sulfidogenic bacterium. PMID:3223760

A novel marine bacterium algicidal to the toxic dinoflagellate Alexandrium tamarense.

PubMed

Wang, B X; Zhou, Y Y; Bai, S J; Su, J Q; Tian, Y; Zheng, T L; Yang, X R

2010-11-01

This work is aiming at investigating algicidal characterization of a bacterium isolate DHQ25 against harmful alga Alexandrium tamarense. 16S rDNA sequence analysis showed that the most probable affiliation of DHQ25 belongs to the γ-proteobacteria subclass and the genus Vibrio. Bacterial isolate DHQ25 showed algicidal activity through an indirect attack. Xenic culture of A. tamarense was susceptible to the culture filtrate of DHQ25 by algicidal activity assay. Algicidal process demonstrated that the alga cell lysed and cellular substances released under the visual field of microscope. DHQ25 was a challenge controller of A. tamarense by the above characterizations of algicidal activity assay and algicidal process. Interactions between bacteria and harmful algal bloom (HAB) species proved to be an important factor regulating the population of these algae. This is the first report of a Vibrio sp. bacterium algicidal to the toxic dinoflagellate A. tamarense. The findings increase our knowledge of the role of bacteria in algal-bacterial interaction. © 2010 The Authors. © 2010 The Society for Applied Microbiology.

Chemical constituents of Helichrysum italicum (Roth) G. Don essential oil and their antimicrobial activity against Gram-positive and Gram-negative bacteria, filamentous fungi and Candida albicans.

PubMed

Djihane, Bouzid; Wafa, Nouioua; Elkhamssa, Soltani; Pedro, De Haro Juan; Maria, Angeles Esteban; Mohamed Mihoub, Zerroug

2017-07-01

The aerial parts of Helichrysum italicum (Roth) G. Don were subjected to hydrodistillation to obtain essential oils which had been analyzed by gas chromatography and gas chromatography coupled with mass spectrometry and tested for antimicrobial activity against 12 bacteria, two yeasts and four fungi by agar diffusion method. The essential oil yielded 0.44% (v/w) and 67 compounds accounting for 99.24% of the oil were identified with a high content of oxygenated sesquiterpenes (61.42%). The most oxygenated sesquiterpene compounds were α-Cedrene (13.61%), α-Curcumene (11.41%), Geranyl acetate (10.05%), Limonene (6.07%), Nerol (5.04%), Neryl acetate (4.91%) and α-Pinene (3.78%). The antimicrobial activity of the essential oil was assayed by using the disk diffusion method on Escherichia coli ATCC 25922, Staphylococcus aureus ATCC 6538, Micrococcus luteus ATCC 4698, Klebsiella pneumonia ATCC 4352, Enterococcus cereus ATCC 2035, Bacillus cereus ATCC 10876, Staphylococcus epidermidis ATCC 12228, Bacillus subtilis ATCC 9372, Pseudomonas aeruginosa ATCC 27853, Enterococcus faecalis ATCC 49452, Proteus mirabilis ATCC 35659, Listeria monocytogenes ATCC 15313 and yeasts Candida albicans ATCC 10231, Saccharomyces cerevisiae ATCC 9763 and fungi, Fusarium solani var. coeruleum , Aspergillus niger , Alternaria alternata , Ascochyta rabiei . H. italicum inhibited the growth of all the tested microorganisms except three bacteria, E. coli ATCC 25922, K. pneumonia ATCC 4352 and L. monocytogenes ATCC 15313. The most sensitive bacterium was E. cereus ATCC 2035 with minimum inhibitory and bactericidal concentrations of 0.79 μg ml -1 . A minimum fungistatic and fungicide concentration of 6.325 μg ml -1 and 12.65 μg ml -1 respectively was obtained with C. albicans ATCC 10231 and S. cerevisiae ATCC 9763. However the four fungi were more resistant with fungistatic minimum concentration ranging from 6.325 μg ml -1 to 50.6 μg ml -1 and a fungicide minimum concentration of 50

Draft Genome Sequence of the Algicidal Bacterium Mangrovimonas yunxiaonensis Strain LY01

PubMed Central

Li, Yi; Zhu, Hong; Li, Chongping; Zhang, Huajun; Chen, Zhangran; Zheng, Wei

2014-01-01

Mangrovimonas yunxiaonensis LY01, a novel bacterium isolated from mangrove sediment, showed high algicidal effects on harmful algal blooms of Alexandrium tamarense. Here, we present the first draft genome sequence of this strain to further understanding of the functional genes related to algicidal activity. PMID:25428978

Robinsoniella peoriensis: A model anaerobic commensal bacterium for acquisition of antibiotic resistance?

USDA-ARS?s Scientific Manuscript database

Background: R. peoriensis was characterized in our laboratories from swine manure and feces as a Gram-positive, anaerobic bacterium. Since then strains of this species have been identified from a variety of mammalian and other gastrointestinal (GI) tracts, suggesting it is a member of the commensal ...

Sexual Transmission of a Plant Pathogenic Bacterium, Candidatus Liberibacter asiaticus, between Conspecific Insect Vectors during Mating

PubMed Central

Mann, Rajinder S.; Pelz-Stelinski, Kirsten; Hermann, Sara L.; Tiwari, Siddharth; Stelinski, Lukasz L.

2011-01-01

Candidatus Liberibacter asiaticus is a fastidious, phloem-inhabiting, gram-negative bacterium transmitted by Asian citrus psyllid, Diaphorina citri Kuwayama (Hemiptera: Psyllidae). The bacterium is the presumed causal agent of huanglongbing (HLB), one of the most destructive and economically important diseases of citrus. We investigated whether Las is transmitted between infected and uninfected D. citri adults during courtship. Our results indicate that Las was sexually transmitted from Las-infected male D. citri to uninfected females at a low rate (<4%) during mating. Sexual transmission was not observed following mating of infected females and uninfected males or among adult pairs of the same sex. Las was detected in genitalia of both sexes and also in eggs of infected females. A latent period of 7 days or more was required to detect the bacterium in recipient females. Rod shaped as well as spherical structures resembling Las were observed in ovaries of Las-infected females with transmission electron microscopy, but were absent in ovaries from uninfected D. citri females. The size of the rod shaped structures varied from 0.39 to 0.67 µm in length and 0.19 to 0.39 µm in width. The spherical structures measured from 0.61 to 0.80 µm in diameter. This investigation provides convincing evidence that a plant pathogenic bacterium is sexually transmitted from male to female insects during courtship and established evidence that bacteria persist in reproductive organs. Moreover, these findings provide an alternative sexually horizontal mechanism for the spread of Las within populations of D. citri, even in the absence of infected host trees. PMID:22216209

Cell Based Drug Delivery: Micrococcus luteus Loaded Neutrophils as Chlorhexidine Delivery Vehicles in a Mouse Model of Liver Abscesses in Cattle.

PubMed

Wendel, Sebastian O; Menon, Sailesh; Alshetaiwi, Hamad; Shrestha, Tej B; Chlebanowski, Lauren; Hsu, Wei-Wen; Bossmann, Stefan H; Narayanan, Sanjeev; Troyer, Deryl L

2015-01-01

The recent WHO report on antibiotic resistances shows a dramatic increase of microbial resistance against antibiotics. With only a few new antibiotics in the pipeline, a different drug delivery approach is urgently needed. We have obtained evidence demonstrating the effectiveness of a cell based drug delivery system that utilizes the innate immune system as targeting carrier for antibacterial drugs. In this study we show the efficient loading of neutrophil granulocytes with chlorhexidine and the complete killing of E. coli as well as Fusobacterium necrophorum in in-vitro studies. Fusobacterium necrophorum causes hepatic abscesses in cattle fed high grain diets. We also show in a mouse model that this delivery system targets infections of F. necrophorum in the liver and reduces the bacterial burden by an order of magnitude from approximately 2•106 to 1•105.

Isolation and Characterization of a Novel, Highly Selective Astaxanthin-Producing Marine Bacterium.

PubMed

Asker, Dalal

2017-10-18

A high-throughput screening approach for astaxanthin-producing bacteria led to the discovery of a novel, highly selective astaxanthin-producing marine bacterium (strain N-5). Phylogenetic analysis based on partial 16S rRNA gene and phenotypic metabolic testing indicated it belongs to the genus Brevundimonas. Therefore, it was designated as Brevundimonas sp. strain N-5. To identify and quantify carotenoids produced by strain N-5, HPLC-DAD and HPLC-MS methods were used. The culture conditions including media, shaking, and time had significant effects on cell growth and carotenoids production including astaxanthin. The total carotenoids were ∼601.2 μg g -1 dry cells including a remarkable amount (364.6 μg g -1 dry cells) of optically pure astaxanthin (3S, 3'S) isomer, with high selectivity (∼60.6%) under medium aeration conditions. Notably, increasing the culture aeration enhanced astaxanthin production up to 85% of total carotenoids. This is the first report that describes a natural, highly selective astaxanthin-producing marine bacterium.

IN SITU RT-PCR WITH A SULFATE-REDUCING BACTERIUM ISOLATED FROM SEAGRASS ROOTS

EPA Science Inventory

Bacteria considered to be obligate anaerobes internally colonize roots of the submerged macrophyte Halodule wrightii. A sulfate reducing bacterium, Summer lac 1, was isolated on lactate from H. wrightii roots. The isolate has physiological characteristics typical of Desulfovibri...

The chemical formula of a magnetotactic bacterium.

PubMed

Naresh, Mohit; Das, Sayoni; Mishra, Prashant; Mittal, Aditya

2012-05-01

Elucidation of the chemical logic of life is one of the grand challenges in biology, and essential to the progress of the upcoming field of synthetic biology. Treatment of microbial cells explicitly as a "chemical" species in controlled reaction (growth) environments has allowed fascinating discoveries of elemental formulae of a few species that have guided the modern views on compositions of a living cell. Application of mass and energy balances on living cells has proved to be useful in modeling of bioengineering systems, particularly in deriving optimized media compositions for growing microorganisms to maximize yields of desired bio-derived products by regulating intra-cellular metabolic networks. In this work, application of elemental mass balance during growth of Magnetospirillum gryphiswaldense in bioreactors has resulted in the discovery of the chemical formula of the magnetotactic bacterium. By developing a stoichiometric equation characterizing the formation of a magnetotactic bacterial cell, coupled with rigorous experimental measurements and robust calculations, we report the elemental formula of M. gryphiswaldense cell as CH(2.06)O(0.13)N(0.28)Fe(1.74×10(-3)). Remarkably, we find that iron metabolism during growth of this magnetotactic bacterium is much more correlated individually with carbon and nitrogen, compared to carbon and nitrogen with each other, indicating that iron serves more as a nutrient during bacterial growth rather than just a mineral. Magnetotactic bacteria have not only invoked some interest in the field of astrobiology for the last two decades, but are also prokaryotes having the unique ability of synthesizing membrane bound intracellular organelles. Our findings on these unique prokaryotes are a strong addition to the limited repertoire, of elemental compositions of living cells, aimed at exploring the chemical logic of life. Copyright © 2011 Wiley Periodicals, Inc.

Five new amicoumacins isolated from a marine-derived bacterium Bacillus subtilis.

PubMed

Li, Yongxin; Xu, Ying; Liu, Lingli; Han, Zhuang; Lai, Pok Yui; Guo, Xiangrong; Zhang, Xixiang; Lin, Wenhan; Qian, Pei-Yuan

2012-02-01

Four novel amicoumacins, namely lipoamicoumacins A-D (1-4), and one new bacilosarcin analog (5) were isolated from culture broth of a marine-derived bacterium Bacillus subtilis, together with six known amicoumacins. Their structures were elucidated on the basis of extensive spectroscopic (2D NNR, IR, CD and MS) analysis and in comparison with data in literature.

Draft Genome Sequence of Sphingobium fuliginis OMI, a Bacterium That Degrades Alkylphenols and Bisphenols

PubMed Central

Ogata, Yuka; Yahara, Tatsuya; Yokoyama, Takashi; Ishizawa, Hidehiro; Takada, Kazuki; Inoue, Daisuke; Sei, Kazunari

2017-01-01

ABSTRACT Sphingobium fuliginis OMI is a bacterium that can degrade a variety of recalcitrant alkylphenols and bisphenols. This study reports the draft genome sequence of S. fuliginis OMI. PMID:29167253

Purification and characterization of an alkaline protease from Micrococcus sp. isolated from the South China Sea

NASA Astrophysics Data System (ADS)

Hou, Enling; Xia, Tao; Zhang, Zhaohui; Mao, Xiangzhao

2017-04-01

Protease is wildly used in various fields, such as food, medicine, washing, leather, cosmetics and other industrial fields. In this study, an alkaline protease secreted by Micrococcus NH54PC02 isolated from the South China Sea was purified and characterized. The growth curve and enzyme activity curve indicated that the cell reached a maximum concentration at the 30th hour and the enzyme activity reached the maximum value at the 36th hour. The protease was purified with 3 steps involving ammonium sulfate precipitation, ion-exchange chromatography and hydrophobic chromatography with 8.22-fold increase in specific activity and 23.68% increase in the recovery. The molecular mass of the protease was estimated to be 25 kDa by SDS-PAGE analysis. The optimum temperature and pH for the protease activity were 50°C and pH 10.0, respectively. The protease showed a strong stability in a wide range of pH values ranging from 6.0-11.0, and maintained 90% enzyme activity in strong alkaline environment with pH 11.0. Inhibitor trials indicated that the protease might be serine protease. But it also possessed the characteristic of metalloprotease as it could be strongly inhibited by EDTA and strongly stimulated by Mn2+. Evaluation of matrix-assisted laser desorption ionization/time-of-flight MS (MALDI-TOF-TOF/MS) showed that the protease might belong to the peptidase S8 family.

A pathway closely related to the (D)-tagatose pathway of gram-negative enterobacteria identified in the gram-positive bacterium Bacillus licheniformis.

PubMed

Van der Heiden, Edwige; Delmarcelle, Michaël; Lebrun, Sarah; Freichels, Régine; Brans, Alain; Vastenavond, Christian M; Galleni, Moreno; Joris, Bernard

2013-06-01

We report the first identification of a gene cluster involved in d-tagatose catabolism in Bacillus licheniformis. The pathway is closely related to the d-tagatose pathway of the Gram-negative bacterium Klebsiella oxytoca, in contrast to the d-tagatose 6-phosphate pathway described in the Gram-positive bacterium Staphylococcus aureus.

Magnetic guidance of the magnetotactic bacterium Magnetospirillum gryphiswaldense.

PubMed

Loehr, Johannes; Pfeiffer, Daniel; Schüler, Dirk; Fischer, Thomas M

2016-04-21

Magnetospirillum gryphiswaldense is a magnetotactic bacterium with a permanent magnetic moment capable of swimming using two bipolarly located flagella. In their natural environment these bacteria swim along the field lines of the homogeneous geomagnetic field in a typical run and reversal pattern and thereby create non-differentiable trajectories with sharp edges. In the current work we nevertheless achieve stable guidance along curved lines of mechanical instability by using a heterogeneous magnetic field of a garnet film. The successful guidance of the bacteria depends on the right balance between motility and the magnetic moment of the magnetosome chain.

Bacterium-Induced CXCL10 Secretion by Osteoblasts Can Be Mediated in Part through Toll-Like Receptor 4

PubMed Central

Gasper, Nancy A.; Petty, Cynthia C.; Schrum, Laura W.; Marriott, Ian; Bost, Kenneth L.

2002-01-01

Two common pathogens known to cause bone infection, Salmonella and Staphylococcus aureus, were investigated to determine their abilities to induce chemokine expression in cultured mouse and human osteoblasts. While these cells are responsible for bone formation, we were surprised to find that they could respond to bacterial infection by upregulating expression of the chemokine CXCL10 (IP-10). However, there were significant differences in the abilities of the gram-negative bacterium Salmonella and the gram-positive bacterium S. aureus to induce expression of CXCL10. Reverse transcription-PCR and enzyme-linked immunosorbent assay analyses showed high levels of Salmonella-induced CXCL10 mRNA and protein expression, respectively, whereas the osteoblast response to S. aureus was significantly less. Consistent with these findings, Salmonella-derived lipopolysaccharide (LPS), but not S. aureus-derived peptidoglycan, could induce expression of CXCL10. An antibody against toll-like receptor 4 (TLR4) could block the LPS-induced CXCL10 production, demonstrating the functional expression of TLR4 by osteoblasts. Despite the inducible nature of TLR2 mRNA expression by bacterium-infected osteoblasts, peptidoglycan failed to stimulate CXCL10 secretion. Immunofluorescent staining of bacterium-infected calvaria (i.e., skull bone) demonstrated the presence of CXCL10 in osteoblasts. The fact that osteoblasts did not express CXCR3 mRNA, whereas T lymphocytes can express high levels of this receptor, suggests that osteoblast-derived CXCL10 may recruit T lymphocytes to the sites of bone infections. PMID:12117914

Diversity in bacterium-host interactions within the species Helicobacter heilmannii sensu stricto

PubMed Central

2013-01-01

Helicobacter (H.) heilmannii sensu stricto (s.s.) is a zoonotic bacterium that naturally colonizes the stomach of dogs and cats. In humans, this microorganism has been associated with gastritis, peptic ulcer disease and mucosa associated lymphoid tissue (MALT) lymphoma. Little information is available about the pathogenesis of H. heilmannii s.s. infections in humans and it is unknown whether differences in virulence exist within this species. Therefore, a Mongolian gerbil model was used to study bacterium-host interactions of 9 H. heilmannii s.s. strains. The colonization ability of the strains, the intensity of gastritis and gene expression of various inflammatory cytokines in the stomach were determined at 9 weeks after experimental infection. The induction of an antrum-dominant chronic active gastritis with formation of lymphocytic aggregates was shown for 7 strains. High-level antral colonization was seen for 4 strains, while colonization of 4 other strains was more restricted and one strain was not detected in the stomach at 9 weeks post infection. All strains inducing a chronic active gastritis caused an up-regulation of the pro-inflammatory cytokine IL-1β in the antrum. A reduced antral expression of H+/K+ ATPase was seen in the stomach after infection with 3 highly colonizing strains and 2 highly colonizing strains caused an increased gastrin expression in the fundus. In none of the H. heilmannii s.s.-infected groups, IFN-γ expression was up-regulated. This study demonstrates diversity in bacterium-host interactions within the species H. heilmannii s.s. and that the pathogenesis of gastric infections with this microorganism is not identical to that of an H. pylori infection. PMID:23895283

Antimicrobial polyketide furanoterpenoids from seaweed-associated heterotrophic bacterium Bacillus subtilis MTCC 10403.

PubMed

Chakraborty, Kajal; Thilakan, Bini; Raola, Vamshi Krishna

2017-10-01

Brown seaweed Anthophycus longifolius (Turner) Kützing (family Sargassaceae) associated heterotrophic bacterium Bacillus subtilis MTCC 10403 was found to be a potent isolate with broad range of antibacterial activity against important perceptive food pathogens Vibrio parahaemolyticus, V. vulnificus, and Aeromonas hydrophila. This bacterium was positive for polyketide synthetase gene (KC589397), and therefore, was selected to bioprospect specialized metabolites bearing polyketide backbone. Bioactivity-guided chromatographic fractionation of the ethyl acetate extract of the seaweed-associated bacterium segregated four homologous polyketide furanoterpenoids with potential antibacterial activities against clinically important pathogens. The minimum inhibitory concentration (MIC) assay showed that the referral antibiotics tetracycline and ampicillin were active at 25 μg/mL against the test pathogens, whereas the previously undescribed (4E)-methyl 13-((16-(furan-2-yl) ethyl)-octahydro-7-hydroxy-4-((E)-23-methylbut-21-enyl)-2H-chromen-6-yl)-4-methylpent-4-enoate (compound 1) and methyl 3-(hexahydro-9-((E)-3-methylpent-1-enyl)-4H-furo[3,2-g]isochromen-6-yl) propanoate (compound 3) displayed antibacterial activities against the test pathogens at a lesser concentration (MIC < 7 μg/mL). The title compounds were characterized by comprehensive nuclear magnetic resonance and mass spectroscopic experiments. Polyketide synthase catalyzed putative biosynthetic mechanism additionally corroborated the structural ascriptions of the hitherto undescribed furanoterpenoids from seaweed-associated bacterial symbiont. The electronic and hydrophobic parameters appeared to hold a conspicuous part in directing the antibacterial properties of the compounds. Seaweed-associated B. subtilis MTCC 10403 demonstrated to represent a potential source of antimicrobial polyketides for pharmaceutical applications. Copyright © 2017 Elsevier Ltd. All rights reserved.

A Pathway Closely Related to the d-Tagatose Pathway of Gram-Negative Enterobacteria Identified in the Gram-Positive Bacterium Bacillus licheniformis

PubMed Central

Van der Heiden, Edwige; Lebrun, Sarah; Freichels, Régine; Brans, Alain; Vastenavond, Christian M.; Galleni, Moreno; Joris, Bernard

2013-01-01

We report the first identification of a gene cluster involved in d-tagatose catabolism in Bacillus licheniformis. The pathway is closely related to the d-tagatose pathway of the Gram-negative bacterium Klebsiella oxytoca, in contrast to the d-tagatose 6-phosphate pathway described in the Gram-positive bacterium Staphylococcus aureus. PMID:23524682

Geovibrio ferrireducens, a phylogenetically distinct dissimilatory Fe(III)-reducing bacterium

USGS Publications Warehouse

Caccavo, F.; Coates, J.D.; Rossello-Mora, R. A.; Ludwig, W.; Schleifer, K.H.; Lovley, D.R.; McInerney, M.J.

1996-01-01

A new, phylogenetically distinct, dissimilatory, Fe(III)-reducing bacterium was isolated from surface sediment of a hydrocarbon-contaminated ditch. The isolate, designated strain PAL-1, was an obligately anaerobic, non-fermentative, motile, gram-negative vibrio. PAL-1 grew in a defined medium with acetate as electron donor and ferric pyrophosphate, ferric oxyhydroxide, ferric citrate, Co(III)-EDTA, or elemental sulfur as sole electron acceptor. PAL-1 also used proline, hydrogen, lactate, propionate, succinate, fumarate, pyruvate, or yeast extract as electron donors for Fe(III) reduction. It is the first bacterium known to couple the oxidation of an amino acid to Fe(III) reduction. PAI-1 did not reduce oxygen, Mn(IV), U(VI), Cr(VI), nitrate, sulfate, sulfite, or thiosulfate with acetate as the electron donor. Cell suspensions of PAL-1 exhibited dithionite-reduced minus air-oxidized difference spectra that were characteristic of c-type cytochromes. Analysis of the 16S rRNA gene sequence of PAL-1 showed that the strain is not related to any of the described metal-reducing bacteria in the Proteobacteria and, together with Flexistipes sinusarabici, forms a separate line of descent within the Bacteria. Phenotypically and phylogenetically, strain PAI-1 differs from all other described bacteria, and represents the type strain of a new genus and species. Geovibrio ferrireducens.

Draft Genome Sequence of the Algicidal Bacterium Mangrovimonas yunxiaonensis Strain LY01.

PubMed

Li, Yi; Zhu, Hong; Li, Chongping; Zhang, Huajun; Chen, Zhangran; Zheng, Wei; Xu, Hong; Zheng, Tianling

2014-11-26

Mangrovimonas yunxiaonensis LY01, a novel bacterium isolated from mangrove sediment, showed high algicidal effects on harmful algal blooms of Alexandrium tamarense. Here, we present the first draft genome sequence of this strain to further understanding of the functional genes related to algicidal activity. Copyright © 2014 Li et al.

Aerobic mineralization of vinyl chlorides by a bacterium of the order Actinomycetales

DOE Office of Scientific and Technical Information (OSTI.GOV)

Phelps, T.J.; Malachowsky, K.; Schram, R.M.

1991-04-01

A gram-positive branched bacterium isolated from a trichloroethylene-degrading consortium mineralized vinyl chloride in growing cultures and cell suspensions. Greater than 67% of the (1,2-{sup 14}C)vinyl chloride was mineralized to carbon dioxide, with approximately 10% of the radioactivity appearing in {sup 14}C-aqueous-phase products.

Draft Genome Sequence of Sphingobium fuliginis OMI, a Bacterium That Degrades Alkylphenols and Bisphenols.

PubMed

Kuroda, Masashi; Ogata, Yuka; Yahara, Tatsuya; Yokoyama, Takashi; Ishizawa, Hidehiro; Takada, Kazuki; Inoue, Daisuke; Sei, Kazunari; Ike, Michihiko

2017-11-22

Sphingobium fuliginis OMI is a bacterium that can degrade a variety of recalcitrant alkylphenols and bisphenols. This study reports the draft genome sequence of S. fuliginis OMI. Copyright © 2017 Kuroda et al.

Investigating the Effects of Simulated Space conditions on Novel Extremely Halophilic Archaea: Halovarius Luteus gen. nov., sp. nov.

NASA Astrophysics Data System (ADS)

Feshangsaz, Niloofar; Van Loon, ing.. Jack J. W. A.; Nazmi, Kamran; Semsarha, Farid

2016-07-01

Studying halophiles from different environments of Earth provide new insights into our search for life in the universe. Haloarchaea show some unique characteristics and physiological adaptations like acidic proteins against harsh environments such as natural brine with salt concentration approaching saturation (5 M) and regions with low active water. These properties make haloarchaea interesting candidate for astrobiological studies. Halovarius luteus gen. nov., sp. nov. a novel extremely halophilic archaeon from Urmia salt lake, in Iran has been chosen to explore its resistance against a series of extreme conditions. The aim of this study is to assess the resistance of strain DA50T under the effects of simulated space conditions like simulated microgravity, hypergravity, and desiccation. In this paper we will discuss the results of these studies where we specifically focus on changes in carotenoid pigments production and whole cell proteome. This is the first report of very novel Iranian archaea in response to extreme space conditions. The pigments were extracted by acetone and methanol. Pigments were analyzed by scanning the absorbance spectrum in the UV-VIS spectrophotometer. And they were separated by TLC. Whole protein from cell lysate supernatant was extracted after lysis with Bacterial Protein Extraction Reagent and fractionated by RP-HPLC using C18 column. Proteome analyzed by electrophoresis (SDS-PAGE), and MALDI-TOF. Carotenoid pigments are formed under different extreme conditions such as dry environment and gravitational changes. Also the protein composition exhibits alterations after exposure to the same conditions. Our conclusion is that pigments and proteins formation depend on the growth circumstances. Halophiles use this as an adaptation to survive under different environmental conditions.

Isolation of Bacteriophages of the Marine Bacterium Beneckea natriegens from Coastal Salt Marshes1

PubMed Central

Zachary, Arthur

1974-01-01

Bacteriophages of the marine bacterium Beneckea natriegens were isolated from coastal marshes where they were limited to brackish and marine waters. The phages were widely distributed and morphologically diverse in the marshes. Images PMID:4133830

Enhancement of Survival and Electricity Production in an Engineered Bacterium by Light-Driven Proton Pumping▿ †

PubMed Central

Johnson, Ethan T.; Baron, Daniel B.; Naranjo, Belén; Bond, Daniel R.; Schmidt-Dannert, Claudia; Gralnick, Jeffrey A.

2010-01-01

Microorganisms can use complex photosystems or light-dependent proton pumps to generate membrane potential and/or reduce electron carriers to support growth. The discovery that proteorhodopsin is a light-dependent proton pump that can be expressed readily in recombinant bacteria enables development of new strategies to probe microbial physiology and to engineer microbes with new light-driven properties. Here, we describe functional expression of proteorhodopsin and light-induced changes in membrane potential in the bacterium Shewanella oneidensis strain MR-1. We report that there were significant increases in electrical current generation during illumination of electrochemical chambers containing S. oneidensis expressing proteorhodopsin. We present evidence that an engineered strain is able to consume lactate at an increased rate when it is illuminated, which is consistent with the hypothesis that proteorhodopsin activity enhances lactate uptake by increasing the proton motive force. Our results demonstrate that there is coupling of a light-driven process to electricity generation in a nonphotosynthetic engineered bacterium. Expression of proteorhodopsin also preserved the viability of the bacterium under nutrient-limited conditions, providing evidence that fulfillment of basic energy needs of organisms may explain the widespread distribution of proteorhodopsin in marine environments. PMID:20453141

Haloanaerobium salsugo sp. nov., a moderately halophilic, anaerobic bacterium from a subterranean brine

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bhupathiraju, V.K.; Sharma, P.K.; Tanner, R.S.

A strictly anaerobic, moderately halophilic, gram-negative bacterium was isolated from a highly saline oil field brine. The bacterium was a non-spore-forming, nonmotile rod, appearing singly, in pairs, or occasionally as long chains, and measured 0.3 to 0.4 by 2.6 to 4 {micro}m. The bacterium had a specific requirement for NaCl and grew at NaCl concentrations of between 6 and 24%, with optimal growth at 9% NaCl. The isolate grew at temperatures of between 22 and 51 C and pH values of between 5.6 and 8.0. The doubling time in a complex medium containing 10% NaCl was 9 h. Growth wasmore » inhibited by chloramphenicol, tetracycline, and penicillin but not by cycloheximide or azide. Fermentable substrates were predominantly carbohydrates. The end products of glucose fermentation were acetate, ethanol, CO{sub 2}, and H{sub 2}. The major components of the cellular fatty acids were C{sub 14:0}, C{sub 16:0}, C{sub 16:1}, and C{sub 17:0 cyc} acids. The DNA base composition of the isolate was 34 mol% G+C. Oligonucleotide catalog and sequence analyses of the 16S rRNA showed that strain VS-752{sup T} was most closely related to Haloanaerobium praevalens GSL{sup T} (ATCC 33744), the sole member of the genus Haloanaerobium. The authors propose that strain VS-752 (ATCC 51327) by established as the type strain of a new species, Haloanaerobium salsugo, in the genus Haloanaerobium. 40 refs., 3 figs, 5 tabs.« less

Genome Sequence of Sphingobium indicum B90A, a Hexachlorocyclohexane-Degrading Bacterium

PubMed Central

Anand, Shailly; Sangwan, Naseer; Lata, Pushp; Kaur, Jasvinder; Dua, Ankita; Singh, Amit Kumar; Verma, Mansi; Kaur, Jaspreet; Khurana, Jitendra P.; Khurana, Paramjit; Mathur, Saloni

2012-01-01

Sphingobium indicum B90A, an efficient degrader of hexachlorocyclohexane (HCH) isomers, was isolated in 1990 from sugarcane rhizosphere soil in Cuttack, India. Here we report the draft genome sequence of this bacterium, which has now become a model system for understanding the genetics, biochemistry, and physiology of HCH degradation. PMID:22843598

Ammonificins C and D, Hydroxyethylamine Chromene Derivatives from a Cultured Marine Hydrothermal Vent Bacterium, Thermovibrio ammonificans

PubMed Central

Andrianasolo, Eric H.; Haramaty, Liti; Rosario-Passapera, Richard; Vetriani, Costantino; Falkowski, Paul; White, Eileen; Lutz, Richard

2012-01-01

Chemical and biological investigation of the cultured marine hydrothermal vent bacterium, Thermovibrio ammonifican led to the isolation of two hydroxyethylamine chromene derivatives, ammonificins C and D. Their structures were elucidated using combination of NMR and mass spectrometry. Absolute stereochemistry was ascertained by comparison of experimental and calculated CD spectra. Biological evaluation and assessment were determined using the patented ApopScreen cell-based screen for apoptosis-induction. Ammonificins C and D induce apoptosis in micromolar concentrations. To our knowledge, this finding is the first report of chemical compounds that induce apoptosis from the cultured deep-sea marine organism, hydrothermal vent bacterium, Thermovibrio ammonificans. PMID:23170085

Vector potential of houseflies for the bacterium Aeromonas caviae.

PubMed

Nayduch, D; Noblet, G Pittman; Stutzenberger, F J

2002-06-01

Houseflies, Musca domestica Linnaeus (Diptera: Muscidae), have been implicated as vectors or transporters of numerous gastrointestinal pathogens encountered during feeding and ovipositing on faeces. The putative enteropathogen Aeromonas caviae (Proteobacteria: Aeromonadaceae) may be present in faeces of humans and livestock. Recently A. caviae was detected in houseflies by PCR and isolated by culture methods. In this study, we assessed the vector potential of houseflies for A. caviae relative to multiplication and persistence of the bacterium in the fly and to contamination of other flies and food materials. In experimentally fed houseflies, the number of bacteria increased up to 2 days post-ingestion (d PI) and then decreased significantly 3 d PI. A large number of bacteria was detected in the vomitus and faeces of infected flies at 2-3 d PI. The bacteria persisted in flies for up to 8 d PI, but numbers were low. Experimentally infected flies transmitted A. caviae to chicken meat, and transmissibility was directly correlated with exposure time. Flies contaminated the meat for up to 7 d PI; however, a significant decrease in contamination was observed 2-3 d PI. In the fly-to-fly transmission experiments, the transmission of A. caviae was observed and was apparently mediated by flies sharing food. These results support houseflies as potential vectors for A. caviae because the bacterium multiplied, persisted in flies for up to 8 d PI, and could be transmitted to human food items.

Extreme furfural tolerance of a soil bacterium Enterobacter cloacae GGT036.

PubMed

Choi, Sun Young; Gong, Gyeongtaek; Park, Hong-Sil; Um, Youngsoon; Sim, Sang Jun; Woo, Han Min

2015-01-10

Detoxification process of cellular inhibitors including furfural is essential for production of bio-based chemicals from lignocellulosic biomass. Here we isolated an extreme furfural-tolerant bacterium Enterobacter cloacae GGT036 from soil sample collected in Mt. Gwanak, Republic of Korea. Among isolated bacteria, only E. cloacae GGT036 showed cell growth with 35 mM furfural under aerobic culture. Compared to the maximal half inhibitory concentration (IC50) of well-known industrial strains Escherichia coli (24.9 mM furfural) and Corynebacterium glutamicum (10 mM furfural) based on the cell density, IC50 of E. cloacae GGT036 (47.7 mM) was significantly higher after 24 h, compared to E. coli and C. glutamicum. Since bacterial cell growth was exponentially inhibited depending on linearly increased furfural concentrations in the medium, we concluded that E. cloacae GGT036 is an extreme furfural-tolerant bacterium. Recently, the complete genome sequence of E. cloacae GGT036 was announced and this could provide an insight for engineering of E. cloacae GGT036 itself or other industrially relevant bacteria. Copyright © 2014 Elsevier B.V. All rights reserved.

Colwellia agarivorans sp. nov., an agar-digesting marine bacterium isolated from coastal seawater

USDA-ARS?s Scientific Manuscript database

A novel Gram-stain-negative, facultatively anaerobic, yellowish and agar-digesting marine bacterium, designated strain QM50**T, was isolated from coastal seawater in an aquaculture site near Qingdao, China. Phylogenetic analysis based on 16S rDNA sequences revealed that the novel isolate represented...

Catalytic Biomineralization of Fluorescent Calcite by the Thermophilic Bacterium Geobacillus thermoglucosidasius▿

PubMed Central

Yoshida, Naoto; Higashimura, Eiji; Saeki, Yuichi

2010-01-01

The thermophilic Geobacillus bacterium catalyzed the formation of 100-μm hexagonal crystals at 60°C in a hydrogel containing sodium acetate, calcium chloride, and magnesium sulfate. Under fluorescence microscopy, crystals fluoresced upon excitation at 365 ± 5, 480 ± 20, or 545 ± 15 nm. X-ray diffraction indicated that the crystals were magnesium-calcite in calcite-type calcium carbonate. PMID:20851984

Comment on "A bacterium that degrades and assimilates poly(ethylene terephthalate)".

PubMed

Yang, Yu; Yang, Jun; Jiang, Lei

2016-08-19

Yoshida et al (Report, 11 March 2016, p. 1196) reported that the bacterium Ideonella sakaiensis 201-F6 can degrade and assimilate poly(ethylene terephthalate) (PET). However, the authors exaggerated degradation efficiency using a low-crystallinity PET and presented no straightforward experiments to verify depolymerization and assimilation of PET. Thus, the authors' conclusions are rather misleading. Copyright © 2016, American Association for the Advancement of Science.

Synthesis of ectomycorrhizae on northern red oak seedlings in a Michigan nursery

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dixon, R.K.; Johnson, P.S.

1993-01-01

Vegetative inoculum of the ectomycorrhizal fungus Suillus luteus was thoroughly mixed into fumigated nursery soil, and northern red oak seedlings of four families were evaluated one and two years after sowing for ectomycorrhizal development, growth, and nutrition. At the end of year one, treated seedlings were successfully inoculated with S. luteus, but the percentage varied significantly with family. Suillus luteus persisted on lateral roots two years following sowing. Two of four seedling families inoculated with S. luteus were significantly larger in size than control plants. These results suggest that the fungal symbiont S. luteus can be successfully introduced into nurseriesmore » and that early ectomycorrhizal development improves the growth of northern red oak seedlings.« less

Draft Genome Sequence of the Deinococcus-Thermus Bacterium Meiothermus ruber Strain A

DOE PAGES

Thiel, Vera; Tomsho, Lynn P.; Burhans, Richard; ...

2015-03-26

The draft genome sequence of the Deinococcus-Thermus group bacterium Meiothermus ruber strain A, isolated from a cyanobacterial enrichment culture obtained from Octopus Spring (Yellowstone National Park, WY), comprises 2,968,099 bp in 170 contigs. It is predicted to contain 2,895 protein-coding genes, 44 tRNA-coding genes, and 2 rRNA operons.

Aerobic mineralization of vinyl chloride by a bacterium of the order Actinomycetales.

PubMed Central

Phelps, T J; Malachowsky, K; Schram, R M; White, D C

1991-01-01

A gram-positive branched bacterium isolated from a trichloroethylene-degrading consortium mineralized vinyl chloride in growing cultures and cell suspensions. Greater than 67% of the [1,2-14C]vinyl chloride was mineralized to carbon dioxide, with approximately 10% of the radioactivity appearing in cell biomass and another 10% appearing in 14C-aqueous-phase products. PMID:1905522

Isolation and characterization of a novel simazine-degrading bacterium from agricultural soil of central Chile, Pseudomonas sp. MHP41.

PubMed

Hernández, Marcela; Villalobos, Patricio; Morgante, Verónica; González, Myriam; Reiff, Caroline; Moore, Edward; Seeger, Michael

2008-09-01

s-Triazine herbicides are used extensively in South America in agriculture and forestry. In this study, a bacterium designated as strain MHP41, capable of degrading simazine and atrazine, was isolated from agricultural soil in the Quillota valley, central Chile. Strain MHP41 is able to grow in minimal medium, using simazine as the sole nitrogen source. In this medium, the bacterium exhibited a growth rate of mu=0.10 h(-1), yielding a high biomass of 4.2 x 10(8) CFU mL(-1). Resting cells of strain MHP41 degrade more than 80% of simazine within 60 min. The atzA, atzB, atzC, atzD, atzE and atzF genes encoding the enzymes of the simazine upper and lower pathways were detected in strain MHP41. The motile Gram-negative bacterium was identified as a Pseudomonas sp., based on the Biolog microplate system and comparative sequence analyses of the 16S rRNA gene. Amplified ribosomal DNA restriction analysis allowed the differentiation of strain MHP41 from Pseudomonas sp. ADP. The comparative 16S rRNA gene sequence analyses suggested that strain MHP41 is closely related to Pseudomonas nitroreducens and Pseudomonas multiresinovorans. This is the first s-triazine-degrading bacterium isolated in South America. Strain MHP41 is a potential biocatalyst for the remediation of s-triazine-contaminated environments.

Bacterium induces cryptic meroterpenoid pathway in the pathogenic fungus Aspergillus fumigatus.

PubMed

König, Claudia C; Scherlach, Kirstin; Schroeckh, Volker; Horn, Fabian; Nietzsche, Sandor; Brakhage, Axel A; Hertweck, Christian

2013-05-27

Stimulating encounter: The intimate, physical interaction between the soil-derived bacterium Streptomyces rapamycinicus and the human pathogenic fungus Aspergillus fumigatus led to the activation of an otherwise silent polyketide synthase (PKS) gene cluster coding for an unusual prenylated polyphenol (fumicycline A). The meroterpenoid pathway is regulated by a pathway-specific activator gene as well as by epigenetic factors. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Multiple cellobiohydrolases and cellobiose phosphorylases cooperate in the ruminal bacterium Ruminococcus albus 8 to degrade cellooligosaccharides

NASA Astrophysics Data System (ADS)

Devendran, Saravanan; Abdel-Hamid, Ahmed M.; Evans, Anton F.; Iakiviak, Michael; Kwon, In Hyuk; Mackie, Roderick I.; Cann, Isaac

2016-10-01

Digestion of plant cell wall polysaccharides is important in energy capture in the gastrointestinal tract of many herbivorous and omnivorous mammals, including humans and ruminants. The members of the genus Ruminococcus are found in both the ruminant and human gastrointestinal tract, where they show versatility in degrading both hemicellulose and cellulose. The available genome sequence of Ruminococcus albus 8, a common inhabitant of the cow rumen, alludes to a bacterium well-endowed with genes that target degradation of various plant cell wall components. The mechanisms by which R. albus 8 employs to degrade these recalcitrant materials are, however, not clearly understood. In this report, we demonstrate that R. albus 8 elaborates multiple cellobiohydrolases with multi-modular architectures that overall enhance the catalytic activity and versatility of the enzymes. Furthermore, our analyses show that two cellobiose phosphorylases encoded by R. albus 8 can function synergistically with a cognate cellobiohydrolase and endoglucanase to completely release, from a cellulosic substrate, glucose which can then be fermented by the bacterium for production of energy and cellular building blocks. We further use transcriptomic analysis to confirm the over-expression of the biochemically characterized enzymes during growth of the bacterium on cellulosic substrates compared to cellobiose.

Genome-wide identification and characterization of five MyD88 duplication genes in Yesso scallop (Patinopecten yessoensis) and expression changes in response to bacterial challenge.

PubMed

Ning, Xianhui; Wang, Ruijia; Li, Xue; Wang, Shuyue; Zhang, Mengran; Xing, Qiang; Sun, Yan; Wang, Shi; Zhang, Lingling; Hu, Xiaoli; Bao, Zhenmin

2015-10-01

Myeloid differentiation factor 88 (MyD88) is a pivotal adaptor in the TLR/IL-1R signaling pathway, which plays an important role in activating the innate immune system. Although MyD88 genes have been identified in a variety of species, they have not been systematically characterized in scallops. In this study, five MyD88 genes were identified in Yesso scallop (Patinopecten yessoensis), PyMyD88-1, PyMyD88-2a, PyMyD88-2b, PyMyD88-3 and PyMyD88-4, which consisted of two pairs of tandem duplications located on the same chromosome. To our knowledge, this is the largest number of MyD88 genes found in an invertebrate. Phylogenetic and protein structural analyses were carried out to determine the identities and evolutionary relationships of these genes. PyMyD88s have highly conserved structures compared to MyD88 genes from other invertebrate species, except for PyMyD88-4, which contains only a DD domain, suggesting the evolutionarily conserved form of this particular gene member. We investigated the expression profiles of PyMyD88 genes at different developmental stages and in healthy adult tissues and hemocytes after Micrococcus luteus and Vibrio anguillarum infection using quantitative real-time PCR (qRT-PCR). The expression of most PyMyD88s was significantly induced in the acute phase (3-6 h) after infection with both gram-positive (M. luteus) and gram-negative (V. anguillarum) bacteria, with much more dramatic changes in PyMyD88 expression being observed after V. anguillarum challenge. Collectively, the abundance of MyD88s and their specific expression patterns provide insight into their versatile roles in the response of the bivalve innate immune system to gram-negative bacterial pathogens. Copyright © 2015 Elsevier Ltd. All rights reserved.

A newly discovered bacterium associated with parthenogenesis and a change in host selection behavior in parasitoid wasps.

PubMed

Zchori-Fein, E; Gottlieb, Y; Kelly, S E; Brown, J K; Wilson, J M; Karr, T L; Hunter, M S

2001-10-23

The symbiotic bacterium Wolbachia pipientis has been considered unique in its ability to cause multiple reproductive anomalies in its arthropod hosts. Here we report that an undescribed bacterium is vertically transmitted and associated with thelytokous parthenogenetic reproduction in Encarsia, a genus of parasitoid wasps. Although Wolbachia was found in only one of seven parthenogenetic Encarsia populations examined, the "Encarsia bacterium" (EB) was found in the other six. Among seven sexually reproducing populations screened, EB was present in one, and none harbored Wolbachia. Antibiotic treatment did not induce male production in Encarsia pergandiella but changed the oviposition behavior of females. Cured females accepted one host type at the same rate as control females but parasitized significantly fewer of the other host type. Phylogenetic analysis based on the 16S rDNA gene sequence places the EB in a unique clade within the Cytophaga-Flexibacter-Bacteroid group and shows EB is unrelated to the Proteobacteria, where Wolbachia and most other insect symbionts are found. These results imply evolution of the induction of parthenogenesis in a lineage other than Wolbachia. Importantly, these results also suggest that EB may modify the behavior of its wasp carrier in a way that enhances its transmission.

Experimental study of the quasi 1d motion of a ``robot bacterium'' within a tube

NASA Astrophysics Data System (ADS)

Liu, Kai; Jiao, Yusheng; Li, Shutong; Ding, Yang; Xu, Xinliang; Complex Fluids Team

2017-11-01

Understanding how solid boundary influences the motion of a micro-swimmer can be quite important. Here we experimentally study the problem with a system of centi-meter size ``robot bacterium'' immersed in the solvent silicon oil. Equipped with build-in battery and motor, the robot mimics a free swimmer and the overall Reynolds number of the system is kept very small as we use silicon oil with very high viscosity. The motion of centi-meter size ``robot bacterium'' within cylindrical tube is experimentally studied in detail. Our results show that robot bacteria with different shapes respond very different to the solid boundary. For certain shapes the swimmers actually swim much faster within a tube, when compared to their motions without any confinement, in good agreement with our numerical evaluations of the hydrodynamics of the system.

Antibacterial activity of antibacterial cutting boards in household kitchens.

PubMed

Kounosu, Masayuki; Kaneko, Seiichi

2007-12-01

We examined antibacterial cutting boards with antibacterial activity values of either "2" or "4" in compliance with the JIS Z 2801 standard, and compared their findings with those of cutting boards with no antibacterial activity. These cutting boards were used in ten different households, and we measured changes in the viable cell counts of several types of bacteria with the drop plate method. We also identified the detected bacterial flora and measured the minimum antimicrobial concentrations of several commonly used antibacterial agents against the kinds of bacteria identified to determine the expected antibacterial activity of the respective agents. Cutting boards with activity values of both "2" and "4" proved to be antibacterial in actual use, although no correlation between the viable cell counts and the antibacterial activity values was observed. In the kitchen environment, large quantities of Pseudomonas, Flavobacterium, Micrococcus, and Bacillus were detected, and it was confirmed that common antibacterial agents used in many antibacterial products are effective against these bacterial species. In addition, we measured the minimum antimicrobial concentrations of the agents against lactobacillus, a typical good bacterium, and discovered that this bacterium is less sensitive to these antibacterial agents compared to more common bacteria.

Complete Genome Sequence of the Endophytic Bacterium Burkholderia sp. Strain KJ006

PubMed Central

Kwak, Min-Jung; Song, Ju Yeon; Kim, Seon-Young; Jeong, Haeyoung; Kang, Sung Gyun; Kim, Byung Kwon; Kwon, Soon-Kyeong; Lee, Choong Hoon; Yu, Dong Su

2012-01-01

Endophytes live inside plant tissues without causing any harm and may even benefit plants. Here, we provide the high-quality genome sequence of Burkholderia sp. strain KJ006, an endophytic bacterium of rice with antifungal activity. The 6.6-Mb genome, consisting of three chromosomes and a single plasmid, contains genes related to plant growth promotion or degradation of aromatic compounds. PMID:22843575

Nematode-bacterium symbioses--cooperation and conflict revealed in the "omics" age.

PubMed

Murfin, Kristen E; Dillman, Adler R; Foster, Jeremy M; Bulgheresi, Silvia; Slatko, Barton E; Sternberg, Paul W; Goodrich-Blair, Heidi

2012-08-01

Nematodes are ubiquitous organisms that have a significant global impact on ecosystems, economies, agriculture, and human health. The applied importance of nematodes and the experimental tractability of many species have promoted their use as models in various research areas, including developmental biology, evolutionary biology, ecology, and animal-bacterium interactions. Nematodes are particularly well suited for the investigation of host associations with bacteria because all nematodes have interacted with bacteria during their evolutionary history and engage in a variety of association types. Interactions between nematodes and bacteria can be positive (mutualistic) or negative (pathogenic/parasitic) and may be transient or stably maintained (symbiotic). Furthermore, since many mechanistic aspects of nematode-bacterium interactions are conserved, their study can provide broader insights into other types of associations, including those relevant to human diseases. Recently, genome-scale studies have been applied to diverse nematode-bacterial interactions and have helped reveal mechanisms of communication and exchange between the associated partners. In addition to providing specific information about the system under investigation, these studies also have helped inform our understanding of genome evolution, mutualism, and innate immunity. In this review we discuss the importance and diversity of nematodes, "omics"' studies in nematode-bacterial systems, and the wider implications of the findings.

Nematode-Bacterium Symbioses - Cooperation and Conflict Revealed in the 'Omics' Age

PubMed Central

Murfin, Kristen E.; Dillman, Adler R.; Foster, Jeremy M.; Bulgheresi, Silvia; Slatko, Barton E.; Sternberg, Paul W.; Goodrich-Blair, Heidi

2012-01-01

Nematodes are ubiquitous organisms that have a significant global impact on ecosystems, economies, agriculture, and human health. The applied importance of nematodes and the experimental tractability of many species have promoted their use as models in various research areas, including developmental biology, evolutionary biology, ecology, and animal-bacterium interactions. Nematodes are particularly well suited for investigating host associations with bacteria because all nematodes have interacted with bacteria during their evolutionary history and engage in a diversity of association types. Interactions between nematodes and bacteria can be positive (mutualistic) or negative (pathogenic/parasitic) and may be transient or stably maintained (symbiotic). Furthermore, since many mechanistic aspects of nematode-bacterium interactions are conserved their study can provide broader insights into other types of associations, including those relevant to human diseases. Recently, genome-scale studies have been applied to diverse nematode-bacterial interactions, and have helped reveal mechanisms of communication and exchange between the associated partners. In addition to providing specific information about the system under investigation, these studies also have helped inform our understanding of genome evolution, mutualism, and innate immunity. In this review we will discuss the importance and diversity of nematodes, 'omics' studies in nematode-bacterial systems, and the wider implications of the findings. PMID:22983035

Purification and Characterization of Bacteriocin Produced by Weissella confusa A3 of Dairy Origin

PubMed Central

Goh, Hweh Fen; Philip, Koshy

2015-01-01

A dramatic increase in bacterial resistance towards currently available antibiotics has raised worldwide concerns for public health. Therefore, antimicrobial peptides (AMPs) have emerged as a promisingly new group of therapeutic agents for managing infectious diseases. The present investigation focusses on the isolation and purification of a novel bacteriocin from an indigenous sample of cow milk and it’s mode of action. The bacteriocin was isolated from Weissella confusa A3 that was isolated from the sample and was shown to have inhibitory activity towards pathogenic bacteria namely Bacillus cereus, Escherichia coli, Pseudomonas aeruginosa and Micrococcus luteus. The bacteriocin was shown to be heat stable and functioned well at low pH (2 to 6). Reduction of activity was shown after treatment with proteinase K, trypsin and peptidase that confirmed the proteinaceous nature of the compound. MALDI-TOF analysis of the sample gave a mass approximating 2.7 kDa. The membrane of the bacteria was disrupted by the bacteriocin causing SYTOX® green dye to enter the cell and bind to the bacterial DNA giving fluorescence signal. Bacterial cell treated with the bacteriocin also showed significant morphological changes under transmission electron microscope. No virulence and disease related genes can be detected from the genome of the strain. PMID:26474074

Commercial probiotic bacteria and prebiotic carbohydrates: a fundamental study on prebiotics uptake, antimicrobials production and inhibition of pathogens.

PubMed

Cruz-Guerrero, Alma; Hernández-Sánchez, Humberto; Rodríguez-Serrano, Gabriela; Gómez-Ruiz, Lorena; García-Garibay, Mariano; Figueroa-González, Ivonne

2014-08-01

Probiotics and prebiotics are among the most important functional food ingredients worldwide. The proven benefits of such ingredients to human health have encouraged the development of functional foods containing both probiotics and prebiotics. In this work, the production of antimicrobial compounds coupled to the uptake of commercial prebiotics by probiotic bacteria was investigated. The probiotic bacteria studied were able to take up commercial prebiotic carbohydrates to the same or higher extent than that observed for lactose (control carbohydrate). The growth of probiotic bacteria was coupled to the production of antimicrobials such as short-chain fatty acids (SCFA), H2 O2 and bacteriocins. A higher production of antimicrobial compounds was recorded with Oligomate 55® compared with Regulact® and Frutafit® (3-5 and 10-115 times higher SCFA and H2 O2 production, respectively). The probiotic bacteria grown with Oligomate 55® also produced bacteriocins and other non-identified antimicrobial compounds. The antimicrobials produced by the probiotic bacteria inhibited up to 50% the growth of model pathogens such as Escherichia coli, Listeria innocua and Micrococcus luteus compared with control cultures. The results here obtained are useful for the adequate selection of probiotic/prebiotics pairs and therefore in the development of efficient functional foods. © 2013 Society of Chemical Industry.

Exploring multi potential uses of marine bacteria; an integrated approach for PHB production, PAHs and polyethylene biodegradation.

PubMed

Mohanrasu, K; Premnath, N; Siva Prakash, G; Sudhakar, Muniyasamy; Boobalan, T; Arun, A

2018-05-19

There are copious of bacteria exist in marine environment and it is very important to screen the potential microbes that has the ability to produce biopolymer polyhydroxybutyrate (PHB) as well as polycyclic aromatic hydrocarbons (PAHs) degradation and conventional plastic high density polyethylene (HDPE) biodegradation. Numerous studies have been investigated individually on either one of characteristic feature like PHB production, PAHs and high density polyethylene (HDPE) degradation, but not all together. Hence, in this study, we tried to screen potential marine microbes that have the ability to perform all three features. We have isolated 203 phenotyphicaly different colonies from 19 different sites (marine soil sediments, marine water and oil spilled marine water) which cover the north east to down south seashore regions of Tamilnadu, India. Of the 203 microbial isolates, the best PHB producing (Micrococcus luteus), PAHs degradation (Klebsiella pneumonia) and HDPE degradation (Brevibacillus borstelensis) microorganisms were identified through 16S rRNA sequencing. Analytical studies confirmed PHB production by fourier transform infrared spectroscopy (FT-IR) and nuclear magnetic resonance ( 1 H & 13 C NMR); PAHs degradation by high performance liquid chromatography (HPLC), confocal laser scanning microscopy (CLSM), scanning electron microscopy (SEM); HDPE degradation by CLSM, FT-IR and SEM which cover the spectroscopy studies on biological systems. Copyright © 2018. Published by Elsevier B.V.

Bacteria associated with Amblyomma cajennense tick eggs

PubMed Central

Machado-Ferreira, Erik; Vizzoni, Vinicius Figueiredo; Piesman, Joseph; Gazeta, Gilberto Salles; Soares, Carlos Augusto Gomes

2015-01-01

Abstract Ticks represent a large group of pathogen vectors that blood feed on a diversity of hosts. In the Americas, the Ixodidae ticks Amblyomma cajennense are responsible for severe impact on livestock and public health. In the present work, we present the isolation and molecular identification of a group of culturable bacteria associated with A. cajennense eggs from females sampled in distinct geographical sites in southeastern Brazil. Additional comparative analysis of the culturable bacteria from Anocentor nitens, Rhipicephalus sanguineus and Ixodes scapularis tick eggs were also performed. 16S rRNA gene sequence analyses identified 17 different bacterial types identified as Serratia marcescens, Stenotrophomonas maltophilia, Pseudomonas fluorescens, Enterobacter spp., Micrococcus luteus, Ochrobactrum anthropi, Bacillus cereus and Staphylococcus spp., distributed in 12 phylogroups. Staphylococcus spp., especially S. sciuri, was the most prevalent bacteria associated with A. cajennense eggs, occurring in 65% of the samples and also frequently observed infecting A. nitens eggs. S. maltophilia, S. marcescens and B. cereus occurred infecting eggs derived from specific sampling sites, but in all cases rising almost as pure cultures from infected A. cajennense eggs. The potential role of these bacterial associations is discussed and they possibly represent new targets for biological control strategies of ticks and tick borne diseases. PMID:26537602

A new laboratory cultivation of Paramecium bursaria using non-pathogenic bacteria strains.

PubMed

Bator, Tomasz

2010-01-01

In most studies dealing with the laboratory cultivation of paramecia (Paramecium bursaria), Klebsiella pneumoniae bacteria are used to inoculate the medium. However, Klebsiella pneumoniae is a typical pathogen, and its use is always associated with a risk of infection. The aim of the present research was to examine non-pathogenic bacteria strains as components of the medium for Paramecium bursaria. The paramecia were incubated on lettuce infusions bacterized with different bacteria strains: Bacillus subtilis DSM 10, Bacillus megaterium DSM 32, Escherichia coli DSM 498, Micrococcus luteus DSM 348. A strain derived from the natural habitat of Paramecium bursaria was used as the control one. Experiments were conducted under constant light and in the dark. Paramecia cells were counted under a stereomicroscope on consecutive days of incubation. The obtained results show that the most intensive growth of Paramecium bursaria occurs in the presence of Escherichia coli DSM 498. The use of this strain as a component of the medium allows one to obtain a high number of ciliates regardless of the light conditions. It can be concluded that the Paramecium bursaria cultivation procedure can be modified by using the non-pathogenic bacteria strain Escherichia coli DSM 498 instead of Klebsiella pneumoniae.

Leptoglycin: a new Glycine/Leucine-rich antimicrobial peptide isolated from the skin secretion of the South American frog Leptodactylus pentadactylus (Leptodactylidae).

PubMed

Sousa, Juliana C; Berto, Raquel F; Gois, Elicélia A; Fontenele-Cardi, Nauíla C; Honório, José E R; Konno, Katsuhiro; Richardson, Michael; Rocha, Marcos F G; Camargo, Antônio A C M; Pimenta, Daniel C; Cardi, Bruno A; Carvalho, Krishnamurti M

2009-07-01

Antimicrobial peptides are components of innate immunity that is the first-line defense against invading pathogens for a wide range of organisms. Here, we describe the isolation, biological characterization and amino acid sequencing of a novel neutral Glycine/Leucine-rich antimicrobial peptide from skin secretion of Leptodactylus pentadactylus named leptoglycin. The amino acid sequence of the peptide purified by RP-HPLC (C(18) column) was deduced by mass spectrometric de novo sequencing and confirmed by Edman degradation: GLLGGLLGPLLGGGGGGGGGLL. Leptoglycin was able to inhibit the growth of Gram-negative bacteria Pseudomonas aeruginosa, Escherichia coli and Citrobacter freundii with minimal inhibitory concentrations (MICs) of 8 microM, 50 microM, and 75 microM respectively, but it did not show antimicrobial activity against Gram-positive bacteria (Staphylococcus aureus, Micrococcus luteus and Enterococcus faecalis), yeasts (Candida albicans and Candida tropicalis) and dermatophytes fungi (Microsporum canis and Trichophyton rubrum). No hemolytic activity was observed at the 2-200 microM range concentration. The amino acid sequence of leptoglycin with high level of glycine (59.1%) and leucine (36.4%) containing an unusual central proline suggests the existence of a new class of Gly/Leu-rich antimicrobial peptides. Taken together, these results suggest that this natural antimicrobial peptide could be a tool to develop new antibiotics.

Antimicrobial, wound healing and antioxidant activity of Plagiochasma appendiculatum Lehm. et Lind.

PubMed

Singh, Meenakshi; Govindarajan, Raghavan; Nath, Virendra; Rawat, Ajay Kumar Singh; Mehrotra, Shanta

2006-08-11

Plagiochasma appendiculatum (Aytoniaceae) of the order Marchantiales is widely used in the form of paste ethnomedicinally by Gaddi tribe in Kangra valley for treating skin diseases. In this context, antimicrobical potential of Plagiochasma appendiculatum against a wide range of microorganisms was studied. To validate the ethnotherapeutic claims of the plant in skin diseases, wound healing activity was studied, besides antioxidant activity to understand the mechanism of wound healing activity. The plant (alchoholic and aqueous extract) showed significant antibacterial and antifungal activity against almost all the organisms: Micrococcus luteus, Bacillus subtilis, Bacillus cereus, Staphylococcus aureus, Streptococcus pneumoniae, Enterobacter aerogenes, Escherichia coli, Klebsiella pneumoniae, Proteus mirabilis, Pseudomonas aeruginosa, Salmonella typhimurium, and eight fungi Candida albicans and Cryptococcus albidus-dimorphic fungi, Trichophyton rubrum-dermatophyte fungi, Aspergillus niger, Aspergillus flavus, Aspergillus spinulosus, Aspergillus terreus and Aspergillus nidulans-systemic fungi, with especially good activity against the dermatophyte (Trichophyton rubrum) and some infectious bacteria (Escherichia coli, Proteus mirabilis and Salmonella typhimurium) with an MIC of 2.5 microg/disc. The results show that Plagiochasma appendiculatum extract has potent wound healing capacity as evident from the wound contraction and increased tensile strength. The results also indicated that Plagiochasma appendiculatum extract possesses potent antioxidant activity by inhibiting lipid peroxidation and increase in the superoxide dismutase (SOD) and Catalase activity.

Comparative study of antibiotic-containing polymethylmetacrylate capsules and beads.

PubMed

Borzsei, László; Mintál, Tibor; Horváth, Aranka; Koós, Zoltán; Kocsis, Béla; Nyárády, József

2006-01-01

This study aimed at making local antibiotic therapy wider in cases of chronic suppurations by administering antibiotics which previously could not be given in this way through the conventional polymethylmetacrylate (PMMA) carrier techniques. Capsules from this material were produced with a pressing machine designed and laid out by us. The characteristics of antibiotic penetration from this novel carrier were compared to those of PMMA beads. The time-dependent outflow of amikacin, clindamycin, pefloxacin, piperacillin + tazobactam, amoxicillin + clavulanic acid and cefotaxime was examined from the capsules and the beads with standard microbiological techniques using the Micrococcus luteus ATCC9341 test strain. The diameter of the inhibitory zones was measured after 24 h incubation at 37 degrees C and converted to mug/ml antibiotic concentrations. Our results revealed that all antibiotics showed longer-lasting and higher concentration outflow from the PMMA capsules than from the beads. Therefore, these capsules can provide a more promising new opportunity for specific local antimicrobial treatment in cases of chronic suppurative bone and soft tissue injuries. In these cases the polymerization has already been completed and the heat does not influence the structure of the antibiotics; therefore, it can be inserted into the capsules in powder or solution form. Copyright 2006 S. Karger AG, Basel.