Sample records for bacterium myxococcus xanthus

  1. Active matter model of Myxococcus xanthus aggregation

    NASA Astrophysics Data System (ADS)

    Patch, Adam; Bahar, Fatmagul; Liu, Guannan; Thutupalli, Shashi; Welch, Roy; Yllanes, David; Shaevitz, Joshua; Marchetti, M. Cristina

    Myxococcus xanthus is a soil-dwelling bacterium that exhibits several fascinating collective behaviors including streaming, swarming, and generation of fruiting bodies. A striking feature of M. xanthus is that it periodically reverses its motility direction. The first stage of fruiting body formation is characterized by the aggregation of cells on a surface into round mesoscopic structures. Experiments have shown that this aggregation relies heavily on regulation of the reversal rate and local mechanical interactions, suggesting motility-induced phase separation may play an important role. We have adapted self-propelled particle models to include cell reversal and motility suppression resulting from sporulation observed in aggregates. Using 2D molecular dynamics simulations, we map the phase behavior in the space of Péclet number and local density and examine the kinetics of aggregation for comparison to experiments.

  2. Earthquake-like dynamics in Myxococcus xanthus social motility

    PubMed Central

    Gibiansky, Maxsim L.; Hu, Wei; Dahmen, Karin A.; Shi, Wenyuan; Wong, Gerard C. L.

    2013-01-01

    Myxococcus xanthus is a bacterium capable of complex social organization. Its characteristic social (“S”)-motility mechanism is mediated by type IV pili (TFP), linear actuator appendages that propel the bacterium along a surface. TFP are known to bind to secreted exopolysaccharides (EPS), but it is unclear how M. xanthus manages to use the TFP-EPS technology common to many bacteria to achieve its unique coordinated multicellular movements. We examine M. xanthus S-motility, using high-resolution particle-tracking algorithms, and observe aperiodic stick–slip movements. We show that they are not due to chemotaxis, but are instead consistent with a constant TFP-generated force interacting with EPS, which functions both as a glue and as a lubricant. These movements are quantitatively homologous to the dynamics of earthquakes and other crackling noise systems. These systems exhibit critical behavior, which is characterized by a statistical hierarchy of discrete “avalanche” motions described by a power law distribution. The measured critical exponents from M. xanthus are consistent with mean field theoretical models and with other crackling noise systems, and the measured Lyapunov exponent suggests the existence of highly branched EPS. Such molecular architectures, which are common for efficient lubricants but rare in bacterial EPS, may be necessary for S-motility: We show that the TFP of leading “locomotive” cells initiate the collective motion of follower cells, indicating that lubricating EPS may alleviate the force generation requirements on the lead cell and thus make S-motility possible. PMID:23341622

  3. Phase separation like dynamics during Myxococcus xanthus fruiting body formation

    NASA Astrophysics Data System (ADS)

    Liu, Guannan; Thutupalli, Shashi; Wigbers, Manon; Shaevitz, Joshua

    2015-03-01

    Collective motion exists in many living organisms as an advantageous strategy to help the entire group with predation, forage, and survival. However, the principles of self-organization underlying such collective motions remain unclear. During various developmental stages of the soil-dwelling bacterium, Myxococcus xanthus, different types of collective motions are observed. In particular, when starved, M. xanthus cells eventually aggregate together to form 3-dimensional structures (fruiting bodies), inside which cells sporulate in response to the stress. We study the fruiting body formation process as an out of equilibrium phase separation process. As local cell density increases, the dynamics of the aggregation M. xanthus cells switch from a spatio-temporally random process, resembling nucleation and growth, to an emergent pattern formation process similar to a spinodal decomposition. By employing high-resolution microscopy and a video analysis system, we are able to track the motion of single cells within motile collective groups, while separately tuning local cell density, cell velocity and reversal frequency, probing the multi-dimensional phase space of M. xanthus development.

  4. Nanoscale visualization and characterization of Myxococcus xanthus cells with atomic force microscopy

    PubMed Central

    Pelling, Andrew E.; Li, Yinuo; Shi, Wenyuan; Gimzewski, James K.

    2005-01-01

    Multicellular microbial communities are the predominant form of existence for microorganisms in nature. As one of the most primitive social organisms, Myxococcus xanthus has been an ideal model bacterium for studying intercellular interaction and multicellular organization. Through previous genetic and EM studies, various extracellular appendages and matrix components have been found to be involved in the social behavior of M. xanthus, but none of them was directly visualized and analyzed under native conditions. Here, we used atomic force microscopy (AFM) imaging and in vivo force spectroscopy to characterize these cellular structures under native conditions. AFM imaging revealed morphological details on the extracellular ultrastructures at an unprecedented resolution, and in vivo force spectroscopy of live cells in fluid allowed us to nanomechanically characterize extracellular polymeric substances. The findings provide the basis for AFM as a useful tool for investigating microbial-surface ultrastructures and nanomechanical properties under native conditions. PMID:15840722

  5. Rhizobial galactoglucan determines the predatory pattern of Myxococcus xanthus and protects Sinorhizobium meliloti from predation

    PubMed Central

    Pérez, Juana; Jiménez-Zurdo, José I.; Martínez-Abarca, Francisco; Millán, Vicenta; Shimkets, Lawrence J.; Muñoz-Dorado, José

    2014-01-01

    Summary Myxococcus xanthus is a social bacterium that preys on prokaryotic and eukaryotic microorganisms. Co-culture of M. xanthus with reference laboratory strains and field isolates of the legume symbiont Sinorhizobium meliloti revealed two different predatory patterns that resemble frontal and wolfpack attacks. Use of mutants impaired in the two types of M. xanthus surface motility (A or adventurous and S or social motility) and a csgA mutant, which is unable to form macroscopic travelling waves known as ripples, has demonstrated that both motility systems but not rippling are required for efficient predation. To avoid frontal attack and reduce killing rates, rhizobial cells require a functional expR gene. ExpR regulates expression of genes involved in a variety of functions. The use of S. meliloti mutants impaired in several of these functions revealed that the exopolysaccharide galactoglucan (EPS II) is the major determinant of the M. xanthus predatory pattern. The data also suggest that this biopolymer confers an ecological advantage to rhizobial survival in soil, which may have broad environmental implications. PMID:24707988

  6. Fatty Acids of Myxococcus xanthus

    PubMed Central

    Ware, Judith C.; Dworkin, Martin

    1973-01-01

    Fatty acids were extracted from saponified vegetative cells and myxospores of Myxococcus xanthus and examined as the methyl esters by gas-liquid chromatography. The acids consisted mainly of C14 to C17 species. Branched acids predominated, and iso-pentadecanoic acid constituted half or more of the mixture. The other leading component (11–28%) was found to be 11-n-hexadecenoic acid. Among the unsaturated acids were two diunsaturated ones, an n-hexadecadienoic acid and an iso-heptadecadienoic acid. No significant differences between the fatty acid compositions of the vegetative cells and myxospores could be detected. The fatty acid composition of M. xanthus was found to be markedly similar to that of Stigmatella aurantiaca. It is suggested that a fatty acid pattern consisting of a large proportion of iso-branched C15 and C17 acids and a substantial amount of an n-16:1 acid is characteristic of myxobacteria. PMID:4197903

  7. Myxococcus xanthus induces actinorhodin overproduction and aerial mycelium formation by Streptomyces coelicolor

    PubMed Central

    Pérez, Juana; Muñoz‐Dorado, José; Braña, Alfredo F.; Shimkets, Lawrence J.; Sevillano, Laura; Santamaría, Ramón I.

    2011-01-01

    Summary Interaction of the predatory myxobacterium Myxococcus xanthus with the non‐motile, antibiotic producer Streptomyces coelicolor was examined using a variety of experimental approaches. Myxococcus xanthus cells prey on S. coelicolor, forming streams of ordered cells that lyse the S. coelicolor hyphae in the contact area between the two colonies. The interaction increases actinorhodin production by S. coelicolor up to 20‐fold and triggers aerial mycelium production. Other bacteria are also able to induce these processes in S. coelicolor though to a lesser extent. These studies offer new clues about the expression of genes that remain silent or are expressed at low level in axenic cultures and open the possibility of overproducing compounds of biotechnological interest by using potent inducers synthesized by other bacteria. PMID:21342463

  8. Identification and characterization of the Myxococcus xanthus bsgA gene product.

    PubMed Central

    Gill, R E; Bornemann, M C

    1988-01-01

    The bsgA mutants of Myxococcus xanthus are blocked at a very early stage of the developmental program. They fail to produce fruiting bodies or to sporulate under normal conditions but can be rescued by extracellular complementation in mixtures with wild-type cells. A bsgA-lacZ gene fusion was constructed and expressed in Escherichia coli. The resulting fusion protein, which has beta-galactosidase enzyme activity, was partially purified by affinity chromatography and preparative polyacrylamide gel electrophoresis. The protein was used to immunize mice, which produced a hybridoma secreting monoclonal antibody that was specific for the bsgA gene product. The monoclonal antibody was used in Western blot (immunoblot) experiments to determine the apparent cellular location of the bsgA protein in M. xanthus and to compare the level of this protein at various times in the Myxococcus life cycle. Images PMID:2846515

  9. A Dynamic Response Regulator Protein Modulates G-Protein–Dependent Polarity in the Bacterium Myxococcus xanthus

    PubMed Central

    Zhang, Yong; Guzzo, Mathilde; Ducret, Adrien; Li, Yue-Zhong; Mignot, Tâm

    2012-01-01

    Migrating cells employ sophisticated signal transduction systems to respond to their environment and polarize towards attractant sources. Bacterial cells also regulate their polarity dynamically to reverse their direction of movement. In Myxococcus xanthus, a GTP-bound Ras-like G-protein, MglA, activates the motility machineries at the leading cell pole. Reversals are provoked by pole-to-pole switching of MglA, which is under the control of a chemosensory-like signal transduction cascade (Frz). It was previously known that the asymmetric localization of MglA at one cell pole is regulated by MglB, a GTPase Activating Protein (GAP). In this process, MglB specifically localizes at the opposite lagging cell pole and blocks MglA localization at that pole. However, how MglA is targeted to the leading pole and how Frz activity switches the localizations of MglA and MglB synchronously remained unknown. Here, we show that MglA requires RomR, a previously known response regulator protein, to localize to the leading cell pole efficiently. Specifically, RomR-MglA and RomR-MglB complexes are formed and act complementarily to establish the polarity axis, segregating MglA and MglB to opposite cell poles. Finally, we present evidence that Frz signaling may regulate MglA localization through RomR, suggesting that RomR constitutes a link between the Frz-signaling and MglAB polarity modules. Thus, in Myxococcus xanthus, a response regulator protein governs the localization of a small G-protein, adding further insight to the polarization mechanism and suggesting that motility regulation evolved by recruiting and combining existing signaling modules of diverse origins. PMID:22916026

  10. The lethal cargo of Myxococcus xanthus outer membrane vesicles.

    PubMed

    Berleman, James E; Allen, Simon; Danielewicz, Megan A; Remis, Jonathan P; Gorur, Amita; Cunha, Jack; Hadi, Masood Z; Zusman, David R; Northen, Trent R; Witkowska, H Ewa; Auer, Manfred

    2014-01-01

    Myxococcus xanthus is a bacterial micro-predator known for hunting other microbes in a wolf pack-like manner. Outer membrane vesicles (OMVs) are produced in large quantities by M. xanthus and have a highly organized structure in the extracellular milieu, sometimes occurring in chains that link neighboring cells within a biofilm. OMVs may be a vehicle for mediating wolf pack activity by delivering hydrolytic enzymes and antibiotics aimed at killing prey microbes. Here, both the protein and small molecule cargo of the OMV and membrane fractions of M. xanthus were characterized and compared. Our analysis indicates a number of proteins that are OMV-specific or OMV-enriched, including several with putative hydrolytic function. Secondary metabolite profiling of OMVs identifies 16 molecules, many associated with antibiotic activities. Several hydrolytic enzyme homologs were identified, including the protein encoded by MXAN_3564 (mepA), an M36 protease homolog. Genetic disruption of mepA leads to a significant reduction in extracellular protease activity suggesting MepA is part of the long-predicted (yet to date undetermined) extracellular protease suite of M. xanthus.

  11. A bacteriophage for Myxococcus xanthus: isolation, characterization and relation of infectivity to host morphogenesis.

    PubMed

    Burchard, R P; Dworkin, M

    1966-03-01

    Burchard, Robert P. (University of Minnesota, Minneapolis), and M. Dworkin. A bacteriophage for Myxococcus xanthus: isolation, characterization and relation of infectivity to host morphogenesis. J. Bacteriol. 91:1305-1313. 1966.-A bacteriophage (MX-1) infecting Myxococcus xanthus FB(t) has been isolated from cow dung. The bacteriophage particle is approximately 175 mmu long. A tail about 100 mmu in length is encased in a contractile sheath and terminates in a tail plate. The head is polyhedral with a width of about 75 mmu. The nucleic acid of the bacteriophage is deoxyribonucleic acid and has a guanine plus cytosine content of 55.5%. The bacteriophage requires 10(-3)m Ca(++) and 10(-2)m monovalent cation for optimal adsorption. Grown on vegetative cells of M. xanthus FB(t) at 30 C in 2% Casitone medium, the bacteriophage has a latent period of 120 min and a burst size of approximately 100. Host range studies indicate that three strains of M. xanthus including a morphogenetic mutant are sensitive to the bacteriophage, whereas M. fulvus, Cytophaga, Sporocytophaga myxococcoides, and a fourth strain of M. xanthus are not. Of the two cellular forms characteristic of the Myxococcus life cycle, the bacteriophage infect only the vegetative cells; they do not adsorb to microcysts. Ability to adsorb bacteriophage is lost between 65 and 75 min after initiation of the relatively synchronous conversion of vegetative cells to microcysts. The bacteriophage does not adsorb to spheroplasts. After the appearance of visible morphogenesis and before the loss of bacteriophage receptor sites, addition of bacteriophage results in the formation of microcysts which give rise to infective centers only upon germination. The possibility that the infected microcysts are harboring intact bacteriophages has been eliminated.

  12. Bacterial social networks: structure and composition of Myxococcus xanthus outer membrane vesicle chains.

    PubMed

    Remis, Jonathan P; Wei, Dongguang; Gorur, Amita; Zemla, Marcin; Haraga, Jessica; Allen, Simon; Witkowska, H Ewa; Costerton, J William; Berleman, James E; Auer, Manfred

    2014-02-01

    The social soil bacterium, Myxococcus xanthus, displays a variety of complex and highly coordinated behaviours, including social motility, predatory rippling and fruiting body formation. Here we show that M. xanthus cells produce a network of outer membrane extensions in the form of outer membrane vesicle chains and membrane tubes that interconnect cells. We observed peritrichous display of vesicles and vesicle chains, and increased abundance in biofilms compared with planktonic cultures. By applying a range of imaging techniques, including three-dimensional (3D) focused ion beam scanning electron microscopy, we determined these structures to range between 30 and 60 nm in width and up to 5 μm in length. Purified vesicle chains consist of typical M. xanthus lipids, fucose, mannose, N-acetylglucosamine and N-acetylgalactoseamine carbohydrates and a small set of cargo protein. The protein content includes CglB and Tgl outer membrane proteins known to be transferable between cells in a contact-dependent manner. Most significantly, the 3D organization of cells within biofilms indicates that cells are connected via an extensive network of membrane extensions that may connect cells at the level of the periplasmic space. Such a network would allow the transfer of membrane proteins and other molecules between cells, and therefore could provide a mechanism for the coordination of social activities. © 2013 Society for Applied Microbiology and John Wiley & Sons Ltd.

  13. Growth of Myxococcus xanthus in continuous-flow-cell bioreactors as a method for studying development.

    PubMed

    Smaldone, Gregory T; Jin, Yujie; Whitfield, Damion L; Mu, Andrew Y; Wong, Edward C; Wuertz, Stefan; Singer, Mitchell

    2014-04-01

    Nutrient sensors and developmental timers are two classes of genes vital to the establishment of early development in the social soil bacterium Myxococcus xanthus. The products of these genes trigger and regulate the earliest events that drive the colony from a vegetative state to aggregates, which ultimately leads to the formation of fruiting bodies and the cellular differentiation of the individual cells. In order to more accurately identify the genes and pathways involved in the initiation of this multicellular developmental program in M. xanthus, we adapted a method of growing vegetative populations within a constant controllable environment by using flow cell bioreactors, or flow cells. By establishing an M. xanthus community within a flow cell, we are able to test developmental responses to changes in the environment with fewer concerns for effects due to nutrient depletion or bacterial waste production. This approach allows for greater sensitivity in investigating communal environmental responses, such as nutrient sensing. To demonstrate the versatility of our growth environment, we carried out time-lapse confocal laser scanning microscopy to visualize M. xanthus biofilm growth and fruiting body development, as well as fluorescence staining of exopolysaccharides deposited by biofilms. We also employed the flow cells in a nutrient titration to determine the minimum concentration required to sustain vegetative growth. Our data show that by using a flow cell, M. xanthus can be held in a vegetative growth state at low nutrient concentrations for long periods, and then, by slightly decreasing the nutrient concentration, cells can be allowed to initiate the developmental program.

  14. The Myxococcus xanthus Spore Cuticula Protein C Is a Fragment of FibA, an Extracellular Metalloprotease Produced Exclusively in Aggregated Cells

    PubMed Central

    Lee, Bongsoo; Mann, Petra; Grover, Vidhi; Treuner-Lange, Anke; Kahnt, Jörg; Higgs, Penelope I.

    2011-01-01

    Myxococcus xanthus is a soil bacterium with a complex life cycle involving distinct cell fates, including production of environmentally resistant spores to withstand periods of nutrient limitation. Spores are surrounded by an apparently self-assembling cuticula containing at least Proteins S and C; the gene encoding Protein C is unknown. During analyses of cell heterogeneity in M. xanthus, we observed that Protein C accumulated exclusively in cells found in aggregates. Using mass spectrometry analysis of Protein C either isolated from spore cuticula or immunoprecipitated from aggregated cells, we demonstrate that Protein C is actually a proteolytic fragment of the previously identified but functionally elusive zinc metalloprotease, FibA. Subpopulation specific FibA accumulation is not due to transcriptional regulation suggesting post-transcriptional regulation mechanisms mediate its heterogeneous accumulation patterns. PMID:22174937

  15. Mechanism for Collective Cell Alignment in Myxococcus xanthus Bacteria

    PubMed Central

    Balagam, Rajesh; Igoshin, Oleg A.

    2015-01-01

    Myxococcus xanthus cells self-organize into aligned groups, clusters, at various stages of their lifecycle. Formation of these clusters is crucial for the complex dynamic multi-cellular behavior of these bacteria. However, the mechanism underlying the cell alignment and clustering is not fully understood. Motivated by studies of clustering in self-propelled rods, we hypothesized that M. xanthus cells can align and form clusters through pure mechanical interactions among cells and between cells and substrate. We test this hypothesis using an agent-based simulation framework in which each agent is based on the biophysical model of an individual M. xanthus cell. We show that model agents, under realistic cell flexibility values, can align and form cell clusters but only when periodic reversals of cell directions are suppressed. However, by extending our model to introduce the observed ability of cells to deposit and follow slime trails, we show that effective trail-following leads to clusters in reversing cells. Furthermore, we conclude that mechanical cell alignment combined with slime-trail-following is sufficient to explain the distinct clustering behaviors observed for wild-type and non-reversing M. xanthus mutants in recent experiments. Our results are robust to variation in model parameters, match the experimentally observed trends and can be applied to understand surface motility patterns of other bacterial species. PMID:26308508

  16. Purification and Properties of Myxococcus xanthus C-Factor, an Intercellular Signaling Protein

    NASA Astrophysics Data System (ADS)

    Kim, Seung K.; Kaiser, Dale

    1990-05-01

    C-factor, a Myxococcus xanthus protein that restores the developmental defects of a class of nonautonomous mutants resulting from mutation of the csgA gene, has been purified approximately 1000-fold from starved wild-type cells. The monomeric form of C-factor is a single polypeptide with a molecular mass of 17 kDa that can be solubilized by detergent from membrane components. Characterization by gel filtration and denaturing gel electrophoresis suggests that biologically active C-factor is a dimer composed of two 17-kDa monomers. Antibodies against a form of the M. xanthus csgA gene product overexpressed in Escherichia coli react with purified C-factor.

  17. Mechanism of cell alignment in groups of Myxococcus xanthus bacteria

    NASA Astrophysics Data System (ADS)

    Balgam, Rajesh; Igoshin, Oleg

    2015-03-01

    Myxococcus xanthus is a model for studying self-organization in bacteria. These flexible cylindrical bacteria move along. In groups, M. xanthus cells align themselves into dynamic cell clusters but the mechanism underlying their formation is unknown. It has been shown that steric interactions can cause alignment in self-propelled hard rods but it is not clear how flexibility and reversals affect the alignment and cluster formation. We have investigated cell alignment process using our biophysical model of M. xanthus cell in an agent-based simulation framework under realistic cell flexibility values. We observed that flexible model cells can form aligned cell clusters when reversals are suppressed but these clusters disappeared when reversals frequency becomes similar to the observed value. However, M. xanthus cells follow slime (polysaccharide gel like material) trails left by other cells and we show that implementing this into our model rescues cell clustering for reversing cells. Our results show that slime following along with periodic cell reversals act as positive feedback to reinforce existing slime trails and recruit more cells. Furthermore, we have observed that mechanical cell alignment combined with slime following is sufficient to explain the distinct clustering patterns of reversing and non-reversing cells as observed in recent experiments. This work is supported by NSF MCB 0845919 and 1411780.

  18. Cell Alignment Required in Differentiation of Myxococcus xanthus

    NASA Astrophysics Data System (ADS)

    Kim, Seung K.; Kaiser, Dale

    1990-08-01

    During fruiting body morphogenesis of Myxococcus xanthus, cell movement is required for transmission of C-factor, a short range intercellular signaling protein necessary for sporulation and developmental gene expression. Nonmotile cells fail to sporulate and to express C-factor-dependent genes, but both defects were rescued by a simple manipulation of cell position that oriented the cells in aligned, parallel groups. A similar pattern of aligned cells normally results from coordinated recruitment of wild-type cells into multicellular aggregates, which later form mature fruiting bodies. It is proposed that directed cell movement establishes critical contacts between adjacent cells, which are required for efficient intercellular C-factor transmission.

  19. Nitrate-Dependent Activation of the Dif Signaling Pathway of Myxococcus xanthus Mediated by a NarX-DifA Interspecies Chimera

    PubMed Central

    Xu, Qian; Black, Wesley P.; Ward, Scott M.; Yang, Zhaomin

    2005-01-01

    Myxococcus xanthus fibril exopolysaccharide (EPS), essential for the social gliding motility and development of this bacterium, is regulated by the Dif chemotaxis-like pathway. DifA, an MCP homolog, is proposed to mediate signal input to the Dif pathway. However, DifA lacks a prominent periplasmic domain, which in classical chemoreceptors is responsible for signal perception and for initiating transmembrane signaling. To investigate the signaling properties of DifA, we constructed a NarX-DifA (NafA) chimera from the sensory module of Escherichia coli NarX and the signaling module of M. xanthus DifA. We report here the first functional chimeric signal transducer constructed using genes from organisms in two different phylogenetic subdivisions. When expressed in M. xanthus, NafA restored fruiting body formation, EPS production, and S-motility to difA mutants in the presence of nitrate. Studies with various double mutants indicate that NafA requires the downstream Dif proteins to function. We propose that signal inputs to the Dif pathway and transmembrane signaling by DifA are essential for the regulation of EPS production in M. xanthus. Despite the apparent structural differences, DifA appears to share similar transmembrane signaling mechanisms with enteric sensor kinases and chemoreceptors. PMID:16159775

  20. Pattern-formation mechanisms in motility mutants of Myxococcus xanthus

    PubMed Central

    Starruß, Jörn; Peruani, Fernando; Jakovljevic, Vladimir; Søgaard-Andersen, Lotte; Deutsch, Andreas; Bär, Markus

    2012-01-01

    Formation of spatial patterns of cells is a recurring theme in biology and often depends on regulated cell motility. Motility of the rod-shaped cells of the bacterium Myxococcus xanthus depends on two motility machineries, type IV pili (giving rise to S-motility) and the gliding motility apparatus (giving rise to A-motility). Cell motility is regulated by occasional reversals. Moving M. xanthus cells can organize into spreading colonies or spore-filled fruiting bodies, depending on their nutritional status. To ultimately understand these two pattern-formation processes and the contributions by the two motility machineries, as well as the cell reversal machinery, we analyse spatial self-organization in three M. xanthus strains: (i) a mutant that moves unidirectionally without reversing by the A-motility system only, (ii) a unidirectional mutant that is also equipped with the S-motility system, and (iii) the wild-type that, in addition to the two motility systems, occasionally reverses its direction of movement. The mutant moving by means of the A-engine illustrates that collective motion in the form of large moving clusters can arise in gliding bacteria owing to steric interactions of the rod-shaped cells, without the need of invoking any biochemical signal regulation. The two-engine strain mutant reveals that the same phenomenon emerges when both motility systems are present, and as long as cells exhibit unidirectional motion only. From the study of these two strains, we conclude that unidirectional cell motion induces the formation of large moving clusters at low and intermediate densities, while it results in vortex formation at very high densities. These findings are consistent with what is known from self-propelled rod models, which strongly suggests that the combined effect of self-propulsion and volume exclusion interactions is the pattern-formation mechanism leading to the observed phenomena. On the other hand, we learn that when cells occasionally reverse

  1. Regulated Exopolysaccharide Production in Myxococcus xanthus

    PubMed Central

    Kim, Sang-Hoon; Ramaswamy, Srinivas; Downard, John

    1999-01-01

    Myxococcus xanthus fibrils are cell surface-associated structures composed of roughly equal amounts of polysaccharide and protein. The level of M. xanthus polysaccharide production under different conditions in the wild type and in several mutants known to have alterations in fibril production was investigated. Wild-type exopolysaccharide increased significantly as cells entered the stationary phase of growth or upon addition of Ca2+ to growing cells, and the polysaccharide-induced cells exhibited an enhanced capacity for cell-cell agglutination. The activity of the key gluconeogenic pathway enzyme phosphoenolpyruvate carboxykinase (Pck) also increased under these conditions. Most fibril-deficient mutants failed to produce polysaccharide in a stationary-phase- or Ca2+-dependent fashion. However, regulation of Pck activity was generally unimpaired in these mutant strains. In an stk mutant, which overproduces fibrils, polysaccharide production and Pck activity were constitutively high under the conditions tested. Polysaccharide production increased in most fibril-deficient strains when an stk mutant allele was present, indicating that these fibril-deficient mutants retained the basic cellular components required for fibril polysaccharide production. In contrast to other divalent cations tested, Sr2+ effectively replaced Ca2+ in stimulating polysaccharide production, and either Ca2+ or Sr2+ was required for fruiting-body formation by wild-type cells. By using transmission electron microscopy of freeze-substituted log-phase wild-type cells, fibril material was observed as a cell surface-associated layer of uniform thickness composed of filaments with an ordered structure. PMID:10049381

  2. Novel Developmental Genes, fruCD, of Myxococcus xanthus: Involvement of a Cell Division Protein in Multicellular Development

    PubMed Central

    Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

    2003-01-01

    Myxococcus xanthus is a gram-negative soil bacterium that undergoes multicellular development upon nutrient starvation. In the present study, two novel developmental genes, fruC and fruD, of M. xanthus were identified and characterized. The FruD protein has significant amino acid sequence similarity to the DivIVA proteins of many bacteria including Bacillus subtilis. Vegetative cells of the fruD mutant exhibited a filamentous phenotype. The fruC and fruD mutants displayed similar delayed-development phenotypes. The formation of tightly aggregated mounds by fruC and fruD mutants was slower than that by the wild-type strain. Spore formation by the fruC and fruD mutants initiated after 30 h poststarvation, whereas wild-type M. xanthus initiated spore formation after 18 h. The fruCD genes were constitutively expressed as an operon during vegetative growth and development. S1 mapping revealed that transcription initiation sites of the fruCD operon were located 114 (P1) and 55 bp (P2) upstream of the fruC initiation codon. Only the P1 promoter was active during vegetative growth, while both the P1 and P2 promoters were active during development. The FruD protein was produced as a cytoplasmic protein and formed an oligomer during vegetative growth and development. PMID:12754229

  3. Cloning and expression of clt genes encoding milk-clotting proteases from Myxococcus xanthus 422.

    PubMed

    Poza, M; Prieto-Alcedo, M; Sieiro, C; Villa, T G

    2004-10-01

    The screening of a gene library of the milk-clotting strain Myxococcus xanthus 422 constructed in Escherichia coli allowed the description of eight positive clones containing 26 open reading frames. Only three of them (cltA, cltB, and cltC) encoded proteins that exhibited intracellular milk-clotting ability in E. coli, Saccharomyces cerevisiae, and Pichia pastoris expression systems.

  4. Myxococcus xanthus Growth, Development, and Isolation.

    PubMed

    Vaksman, Zalman; Kaplan, Heidi B

    2015-11-03

    Myxobacteria are a highly social group among the delta proteobacteria that display unique multicellular behaviors during their complex life cycle and provide a rare opportunity to study the boundary between single cells and multicellularity. These organisms are also unusual as their entire life cycle is surface associated and includes a number of social behaviors: social gliding and rippling motility, 'wolf-pack'-like predation, and self-organizing complex biostructures, termed fruiting bodies, which are filled with differentiated environmentally resistant spores. Here we present methods for the growth, maintenance, and storage of Myxococcus xanthus, the most commonly studied of the myxobacteria. We also include methods to examine various developmental and social behaviors (fruiting body and spore formation, predation, and rippling motility). As the myxobacteria, similar to the streptomycetes, are excellent sources of many characterized and uncharacterized antibiotics and other natural products, we have provided a protocol for obtaining natural isolates from a variety of environmental sources. Copyright © 2015 John Wiley & Sons, Inc.

  5. Describing Myxococcus xanthus Aggregation Using Ostwald Ripening Equations for Thin Liquid Films

    PubMed Central

    Bahar, Fatmagül; Pratt-Szeliga, Philip C.; Angus, Stuart; Guo, Jiaye; Welch, Roy D.

    2014-01-01

    When starved, a swarm of millions of Myxococcus xanthus cells coordinate their movement from outward swarming to inward coalescence. The cells then execute a synchronous program of multicellular development, arranging themselves into dome shaped aggregates. Over the course of development, about half of the initial aggregates disappear, while others persist and mature into fruiting bodies. This work seeks to develop a quantitative model for aggregation that accurately simulates which will disappear and which will persist. We analyzed time-lapse movies of M. xanthus development, modeled aggregation using the equations that describe Ostwald ripening of droplets in thin liquid films, and predicted the disappearance and persistence of aggregates with an average accuracy of 85%. We then experimentally validated a prediction that is fundamental to this model by tracking individual fluorescent cells as they moved between aggregates and demonstrating that cell movement towards and away from aggregates correlates with aggregate disappearance. Describing development through this model may limit the number and type of molecular genetic signals needed to complete M. xanthus development, and it provides numerous additional testable predictions. PMID:25231319

  6. LC-MS/MS profiling-based secondary metabolite screening of Myxococcus xanthus.

    PubMed

    Kim, Jiyoung; Choi, Jung Nam; Kim, Pil; Sok, Dai-Eun; Nam, Soo-Wan; Lee, Choong Hwan

    2009-01-01

    Myxobacteria, Gram-negative soil bacteria, are a well-known producer of bioactive secondary metabolites. Therefore, this study presents a methodological approach for the high-throughput screening of secondary metabolites from 4 wild-type Myxococcus xanthus strains. First, electrospray ionization mass spectrometry (ESI-MS) was performed using extracellular crude extracts. As a result, 22 metabolite peaks were detected, and the metabolite profiling was then conducted using the m/z value, retention time, and MS/MS fragmentation pattern analyses. Among the peaks, one unknown compound peak was identified as analogous to the myxalamid A, B, and C series. An analysis of the tandem mass spectrometric fragmentation patterns and HR-MS identified myxalamid K as a new compound derived from M. xanthus. In conclusion, LC-MS/MS-based chemical screening of diverse secondary metabolites would appear to be an effective approach for discovering unknown microbial secondary metabolites.

  7. Fatty Acid Oxidation Is Required for Myxococcus xanthus Development.

    PubMed

    Bullock, Hannah A; Shen, Huifeng; Boynton, Tye O; Shimkets, Lawrence J

    2018-05-15

    Myxococcus xanthus cells produce lipid bodies containing triacylglycerides during fruiting body development. Fatty acid β-oxidation is the most energy-efficient pathway for lipid body catabolism. In this study, we used mutants in fadJ (MXAN_5371 and MXAN_6987) and fadI (MXAN_5372) homologs to examine whether β-oxidation serves an essential developmental function. These mutants contained more lipid bodies than the wild-type strain DK1622 and 2-fold more flavin adenine dinucleotide (FAD), consistent with the reduced consumption of fatty acids by β-oxidation. The β-oxidation pathway mutants exhibited differences in fruiting body morphogenesis and produced spores with thinner coats and a greater susceptibility to thermal stress and UV radiation. The MXAN_5372/5371 operon is upregulated in sporulating cells, and its expression could not be detected in csgA , fruA , or mrpC mutants. Lipid bodies were found to persist in mature spores of DK1622 and wild strain DK851, suggesting that the roles of lipid bodies and β-oxidation may extend to spore germination. IMPORTANCE Lipid bodies act as a reserve of triacylglycerides for use when other sources of carbon and energy become scarce. β-Oxidation is essential for the efficient metabolism of fatty acids associated with triacylglycerides. Indeed, the disruption of genes in this pathway has been associated with severe disorders in animals and plants. Myxococcus xanthus , a model organism for the study of development, is ideal for investigating the complex effects of altered lipid metabolism on cell physiology. Here, we show that β-oxidation is used to consume fatty acids associated with lipid bodies and that the disruption of the β-oxidation pathway is detrimental to multicellular morphogenesis and spore formation. Copyright © 2018 American Society for Microbiology.

  8. Directional reversals enable Myxococcus xanthus cells to produce collective one-dimensional streams during fruiting-body formation

    PubMed Central

    Thutupalli, Shashi; Sun, Mingzhai; Bunyak, Filiz; Palaniappan, Kannappan; Shaevitz, Joshua W.

    2015-01-01

    The formation of a collectively moving group benefits individuals within a population in a variety of ways. The surface-dwelling bacterium Myxococcus xanthus forms dynamic collective groups both to feed on prey and to aggregate during times of starvation. The latter behaviour, termed fruiting-body formation, involves a complex, coordinated series of density changes that ultimately lead to three-dimensional aggregates comprising hundreds of thousands of cells and spores. How a loose, two-dimensional sheet of motile cells produces a fixed aggregate has remained a mystery as current models of aggregation are either inconsistent with experimental data or ultimately predict unstable structures that do not remain fixed in space. Here, we use high-resolution microscopy and computer vision software to spatio-temporally track the motion of thousands of individuals during the initial stages of fruiting-body formation. We find that cells undergo a phase transition from exploratory flocking, in which unstable cell groups move rapidly and coherently over long distances, to a reversal-mediated localization into one-dimensional growing streams that are inherently stable in space. These observations identify a new phase of active collective behaviour and answer a long-standing open question in Myxococcus development by describing how motile cell groups can remain statistically fixed in a spatial location. PMID:26246416

  9. The guanosine nucleotide (p)ppGpp initiates development and A-factor production in myxococcus xanthus.

    PubMed

    Harris, B Z; Kaiser, D; Singer, M

    1998-04-01

    Guanosine 3'-di-5'-(tri)di-phosphate nucleotides [(p)ppGpp], synthesized in response to amino acid limitation, induce early gene expression leading to multicellular fruiting body formation in Myxococcus xanthus. A mutant (DK527) that fails to accumulate (p)ppGpp in response to starvation was found to be blocked in development prior to aggregation. By use of a series of developmentally regulated Tn5lac transcriptional fusion reporters, the time of developmental arrest in DK527 was narrowed to within the few hours of development, the period of starvation recognition. The mutant is also defective in the production of A-factor, an early extracellular cell-density signal. The relA gene from Escherichia coli, which encodes a ribosome-dependent (p)ppGpp synthetase, rescues this mutant. We also demonstrate that inactivation of the M. xanthus relA homolog blocks development and the accumulation of (p)ppGpp. Moreover, the wild-type allele of Myxococcus relA rescues DK527. These observations support a model in which accumulation of (p)ppGpp, in response to starvation, initiates the program of fruiting body development, including the production of A-factor.

  10. Quantifying Aggregation Dynamics during Myxococcus xanthus Development▿†

    PubMed Central

    Zhang, Haiyang; Angus, Stuart; Tran, Michael; Xie, Chunyan; Igoshin, Oleg A.; Welch, Roy D.

    2011-01-01

    Under starvation conditions, a swarm of Myxococcus xanthus cells will undergo development, a multicellular process culminating in the formation of many aggregates called fruiting bodies, each of which contains up to 100,000 spores. The mechanics of symmetry breaking and the self-organization of cells into fruiting bodies is an active area of research. Here we use microcinematography and automated image processing to quantify several transient features of developmental dynamics. An analysis of experimental data indicates that aggregation reaches its steady state in a highly nonmonotonic fashion. The number of aggregates rapidly peaks at a value 2- to 3-fold higher than the final value and then decreases before reaching a steady state. The time dependence of aggregate size is also nonmonotonic, but to a lesser extent: average aggregate size increases from the onset of aggregation to between 10 and 15 h and then gradually decreases thereafter. During this process, the distribution of aggregates transitions from a nearly random state early in development to a more ordered state later in development. A comparison of experimental results to a mathematical model based on the traffic jam hypothesis indicates that the model fails to reproduce these dynamic features of aggregation, even though it accurately describes its final outcome. The dynamic features of M. xanthus aggregation uncovered in this study impose severe constraints on its underlying mechanisms. PMID:21784940

  11. Exopolysaccharide-Independent Social Motility of Myxococcus xanthus

    PubMed Central

    Hu, Wei; Hossain, Muhaiminu; Lux, Renate; Wang, Jing; Yang, Zhe; Li, Yuezhong; Shi, Wenyuan

    2011-01-01

    Social motility (S motility), the coordinated movement of large cell groups on agar surfaces, of Myxococcus xanthus requires type IV pili (TFP) and exopolysaccharides (EPS). Previous models proposed that this behavior, which only occurred within cell groups, requires cycles of TFP extension and retraction triggered by the close interaction of TFP with EPS. However, the curious observation that M. xanthus can perform TFP-dependent motility at a single-cell level when placed onto polystyrene surfaces in a highly viscous medium containing 1% methylcellulose indicated that “S motility” is not limited to group movements. In an apparent further challenge of the previous findings for S motility, mutants defective in EPS production were found to perform TFP-dependent motility on polystyrene surface in methylcellulose-containing medium. By exploring the interactions between pilin and surface materials, we found that the binding of TFP onto polystyrene surfaces eliminated the requirement for EPS in EPS- cells and thus enabled TFP-dependent motility on a single cell level. However, the presence of a general anchoring surface in a viscous environment could not substitute for the role of cell surface EPS in group movement. Furthermore, EPS was found to serve as a self-produced anchoring substrate that can be shed onto surfaces to enable cells to conduct TFP-dependent motility regardless of surface properties. These results suggested that in certain environments, such as in methylcellulose solution, the cells could bypass the need for EPS to anchor their TPF and conduct single-cell S motility to promote exploratory movement of colonies over new specific surfaces. PMID:21245931

  12. Transposon tagging of genes for cell-cell interactions in Myxococcus xanthus.

    PubMed Central

    Kalos, M; Zissler, J

    1990-01-01

    The prokaryote Myxococcus xanthus is a model for cell interactions important in multicellular behavior. We used the transposon TnphoA to specifically identify genes for cell-surface factors involved in cell interactions. From a library of 10,700 insertions of TnphoA, we isolated 36 that produced alkaline phosphatase activity. Three TnphoA insertions tagged cell motility genes, called cgl, which control the adventurous movement of cells. The products of the tagged cgl genes could function in trans upon other cells and were localized primarily in the cell envelope and extracellular space, consistent with TnphoA tagging genes for extracellular factors controlling motility. Images PMID:2172982

  13. Profiling the outer membrane proteome during growth and development of the social bacterium Myxococcus xanthus by selective biotinylation and analyses of outer membrane vesicles.

    PubMed

    Kahnt, Jörg; Aguiluz, Kryssia; Koch, Jürgen; Treuner-Lange, Anke; Konovalova, Anna; Huntley, Stuart; Hoppert, Michael; Søgaard-Andersen, Lotte; Hedderich, Reiner

    2010-10-01

    Social behavior in the bacterium Myxococcus xanthus relies on contact-dependent activities involving cell-cell and cell-substratum interactions. To identify outer membrane proteins that have a role in these activities, we profiled the outer membrane proteome of growing and starving cells using two strategies. First, outer membrane proteins were enriched by biotinylation of intact cells using the reagent NHS (N-hydroxysuccinimide)-PEO(12) (polyethylene oxide)-biotin with subsequent membrane solubilization and affinity chromatography. Second, the proteome of outer membrane vesicles (OMV) was determined. Comparisons of detected proteins show that these methods have different detection profiles and together provide a comprehensive view of the outer membrane proteome. From 362 proteins identified, 274 (76%) were cell envelope proteins including 64 integral outer membrane proteins and 85 lipoproteins. The majority of these proteins were of unknown function. Among integral outer membrane proteins with homologues of known function, TonB-dependent transporters comprise the largest group. Our data suggest novel functions for these transporters. Among lipoproteins with homologues of known function, proteins with hydrolytic functions comprise the largest group. The luminal load of OMV was enriched for proteins with hydrolytic functions. Our data suggest that OMV have functions in predation and possibly in transfer of intercellular signaling molecules between cells.

  14. Effects of Exopolysaccharide Production on Liquid Vegetative Growth, Stress Survival and Stationary Phase Recovery in Myxococcus xanthus

    PubMed Central

    Hu, Wei; Wang, Jing; McHardy, Ian; Lux, Renate; Yang, Zhe; Li, Yuezhong; Shi, Wenyuan

    2013-01-01

    Exopolysaccharide (EPS) of Myxococcus xanthus is a well-regulated cell surface component. In addition to its known functions for social motility and fruiting body formation on solid surfaces, EPS has also been proposed to play a role in multi-cellular clumping in liquid medium, though this phenomenon has not been well studied. In this report, we confirmed that M. xanthus clumps formed in liquid were correlated with EPS levels and demonstrated that the EPS encased cell clumps exhibited biofilm-like structures. The clumps protected the cells at physiologically relevant EPS concentrations, while cells lacking EPS exhibited significant reduction in long-term viability and resistance to stressful conditions. However, excess EPS production was counterproductive to vegetative growth and viable cell recovery declined in extended late stationary phase as cells became trapped in the matrix of clumps. Therefore, optimal EPS production by M. xanthus is important for normal physiological functions in liquid. PMID:22538652

  15. Spore formation in Myxococcus xanthus is tied to cytoskeleton functions and polysaccharide spore coat deposition

    PubMed Central

    Müller, Frank D.; Schink, Christian W.; Hoiczyk, Egbert; Cserti, Emöke; Higgs, Penelope I.

    2011-01-01

    Summary Myxococcus xanthus is a Gram-negative bacterium that differentiates into environmentally resistant spores. Spore differentiation involves septation-independent remodelling of the rod-shaped vegetative cell into a spherical spore and deposition of a thick and compact spore coat outside of the outer membrane. Our analyses suggest that spore coat polysaccharides are exported to the cell surface by the Exo outer membrane polysaccharide export/polysaccharide co-polymerase 2a (OPX/PCP-2a) machinery. Conversion of the capsule-like polysaccharide layer into a compact spore coat layer requires the Nfs proteins which likely form a complex in the cell envelope. Mutants in either nfs, exo, or two other genetic loci encoding homologs of polysaccharide synthesis enzymes, fail to complete morphogenesis from rods to spherical spores and instead produce a transient state of deformed cell morphology before reversion into typical rods. We additionally provide evidence that the cell cytoskeletal protein, MreB, plays an important role in rod to spore morphogenesis and for spore outgrowth. These studies provide evidence that this novel gram-negative differentiation process is tied to cytoskeleton functions and polysaccharide spore coat deposition. PMID:22188356

  16. Activation of a development-specific gene, dofA, by FruA, an essential transcription factor for development of Myxococcus xanthus.

    PubMed

    Ueki, Toshiyuki; Inouye, Sumiko

    2005-12-01

    FruA is an essential transcription factor for Myxococcus xanthus development. The expression of tps and dofA genes is fruA dependent. In this study, we show by gel shift and footprint assays with the C-terminal DNA-binding domain of FruA and by a lacZ fusion assay that FruA may directly activate dofA expression during development.

  17. Activation of a Development-Specific Gene, dofA, by FruA, an Essential Transcription Factor for Development of Myxococcus xanthus

    PubMed Central

    Ueki, Toshiyuki; Inouye, Sumiko

    2005-01-01

    FruA is an essential transcription factor for Myxococcus xanthus development. The expression of tps and dofA genes is fruA dependent. In this study, we show by gel shift and footprint assays with the C-terminal DNA-binding domain of FruA and by a lacZ fusion assay that FruA may directly activate dofA expression during development. PMID:16321956

  18. Enzymatic characterization of a class II lysyl-tRNA synthetase, LysS, from Myxococcus xanthus.

    PubMed

    Oka, Manami; Takegawa, Kaoru; Kimura, Yoshio

    2015-08-01

    Lysyl-tRNA synthetases efficiently produce diadenosine tetraphosphate (Ap4A) from lysyl-AMP with ATP in the absence of tRNA. We characterized recombinant class II lysyl-tRNA synthetase (LysS) from Myxococcus xanthus and found that it is monomeric and requires Mn(2+) for the synthesis of Ap4A. Surprisingly, Zn(2+) inhibited enzyme activity in the presence of Mn(2+). When incubated with ATP, Mn(2+), lysine, and inorganic pyrophosphatase, LysS first produced Ap4A and ADP, then converted Ap4A to diadenosine triphosphate (Ap3A), and finally converted Ap3A to ADP, the end product of the reaction. Recombinant LysS retained Ap4A synthase activity without lysine addition. Additionally, when incubated with Ap4A (minus pyrophosphatase), LysS converted Ap4A mainly ATP and AMP, or ADP in the presence or absence of lysine, respectively. These results demonstrate that M. xanthus LysS has different enzymatic properties from class II lysyl-tRNA synthetases previously reported. Copyright © 2015 Elsevier Inc. All rights reserved.

  19. Data-driven modeling reveals cell behaviors controlling self-organization during Myxococcus xanthus development

    PubMed Central

    Cotter, Christopher R.; Schüttler, Heinz-Bernd; Igoshin, Oleg A.; Shimkets, Lawrence J.

    2017-01-01

    Collective cell movement is critical to the emergent properties of many multicellular systems, including microbial self-organization in biofilms, embryogenesis, wound healing, and cancer metastasis. However, even the best-studied systems lack a complete picture of how diverse physical and chemical cues act upon individual cells to ensure coordinated multicellular behavior. Known for its social developmental cycle, the bacterium Myxococcus xanthus uses coordinated movement to generate three-dimensional aggregates called fruiting bodies. Despite extensive progress in identifying genes controlling fruiting body development, cell behaviors and cell–cell communication mechanisms that mediate aggregation are largely unknown. We developed an approach to examine emergent behaviors that couples fluorescent cell tracking with data-driven models. A unique feature of this approach is the ability to identify cell behaviors affecting the observed aggregation dynamics without full knowledge of the underlying biological mechanisms. The fluorescent cell tracking revealed large deviations in the behavior of individual cells. Our modeling method indicated that decreased cell motility inside the aggregates, a biased walk toward aggregate centroids, and alignment among neighboring cells in a radial direction to the nearest aggregate are behaviors that enhance aggregation dynamics. Our modeling method also revealed that aggregation is generally robust to perturbations in these behaviors and identified possible compensatory mechanisms. The resulting approach of directly combining behavior quantification with data-driven simulations can be applied to more complex systems of collective cell movement without prior knowledge of the cellular machinery and behavioral cues. PMID:28533367

  20. Herbicidal and antioxidant responses of transgenic rice overexpressing Myxococcus xanthus protoporphyrinogen oxidase.

    PubMed

    Jung, Sunyo; Back, Kyoungwhan

    2005-05-01

    We analyzed the herbicidal and antioxidant defense responses of transgenic rice plants that overexpressed the Myxococcus xanthus protoporphyrinogen oxidase gene. Leaf squares of the wild-type incubated with oxyfluorfen were characterized by necrotic leaf lesions and increases in conductivity and malonyldialdehyde levels, whereas transgenic lines M4 and M7 did not show any change with up to 100 microM oxyfluorfen. The wild-type had decreased F(v)/F(m) and produced a high level of H(2)O(2) at 18 h after foliar application of oxyfluorfen, whereas transgenic lines M4 and M7 were unaffected. In response to oxyfluorfen, violaxanthin, beta-carotene, and chlorophylls (Chls) decreased in wild-type plants, whereas antheraxanthin and zeaxanthin increased. Only a slight decline in Chls was observed in transgenic lines at 48 h after oxyfluorfen treatment. Noticeable increases of cytosolic Cu/Zn-superoxide dismutase, peroxidase isozymes 1 and 2, and catalase were observed after at 48 h of oxyfluorfen treatment in the wild-type. Non-enzymatic antioxidants appeared to respond faster to oxyfluorfen-induced photodynamic stress than did enzymatic antioxidants. Protective responses for the detoxification of active oxygen species were induced to counteract photodynamic stress in oxyfluorfen-treated, wild-type plants. However, oxyfluorfen-treated, transgenic plants suffered less oxidative stress, confirming increased herbicidal resistance resulted from dual expression of M. xanthus Protox in chloroplasts and mitochondria.

  1. Global transcriptome analysis of spore formation in Myxococcus xanthus reveals a locus necessary for cell differentiation

    PubMed Central

    2010-01-01

    Background Myxococcus xanthus is a Gram negative bacterium that can differentiate into metabolically quiescent, environmentally resistant spores. Little is known about the mechanisms involved in differentiation in part because sporulation is normally initiated at the culmination of a complex starvation-induced developmental program and only inside multicellular fruiting bodies. To obtain a broad overview of the sporulation process and to identify novel genes necessary for differentiation, we instead performed global transcriptome analysis of an artificial chemically-induced sporulation process in which addition of glycerol to vegetatively growing liquid cultures of M. xanthus leads to rapid and synchronized differentiation of nearly all cells into myxospore-like entities. Results Our analyses identified 1 486 genes whose expression was significantly regulated at least two-fold within four hours of chemical-induced differentiation. Most of the previously identified sporulation marker genes were significantly upregulated. In contrast, most genes that are required to build starvation-induced multicellular fruiting bodies, but which are not required for sporulation per se, were not significantly regulated in our analysis. Analysis of functional gene categories significantly over-represented in the regulated genes, suggested large rearrangements in core metabolic pathways, and in genes involved in protein synthesis and fate. We used the microarray data to identify a novel operon of eight genes that, when mutated, rendered cells unable to produce viable chemical- or starvation-induced spores. Importantly, these mutants displayed no defects in building fruiting bodies, suggesting these genes are necessary for the core sporulation process. Furthermore, during the starvation-induced developmental program, these genes were expressed in fruiting bodies but not in peripheral rods, a subpopulation of developing cells which do not sporulate. Conclusions These results suggest

  2. Identification of Major Enzymes Involved in the Synthesis of Diadenosine Tetraphosphate and/or Adenosine Tetraphosphate in Myxococcus xanthus.

    PubMed

    Kimura, Yoshio; Tanaka, Chihiro; Oka, Manami

    2018-07-01

    Myxococcus xanthus generates diadenosine tetraphosphates (Ap 4 A) and diadenosine pentaphosphates (Ap 5 A) under various stress conditions. M. xanthus lysyl-tRNA synthetase (LysS) efficiently synthesizes Ap 4 A from ATP, Ap 5 A from ATP and adenosine tetraphosphate (Ap 4 ), and Ap 4 from ATP and triphosphate. To identify other M. xanthus enzymes that can catalyze Ap 4 A and Ap 4 synthesis, 15 M. xanthus aminoacyl-tRNA synthetases (aaRSs), four acyl-CoA synthetases (Acys), three acetyl-CoA synthetases (Aces), phosphoglycerate kinase (Pgk), and adenylate kinase (Adk) were expressed in Escherichia coli and examined for Ap 4 A or Ap 4 synthetase activity using ATP or ATP and triphosphate as substrates. Among the tested enzymes, LysS had the highest Ap 4 A synthetase activity. AlaRS, SerRS, and LeuRS1 showed high ADP synthetase activity with ATP as a substrate in the presence of pyrophosphatase, and also demonstrated the ability to produce Ap 4 from ATP and triphosphate in the absence of pyrophosphatase. Ap 4 formation by AlaRS, SerRS, and LeuRS1 was approximately 4- to 13-fold higher compared with that of Ap 4 A, suggesting that these enzymes prefer triphosphate over ATP as a substrate in the second reaction. Some of the recombinant M. xanthus Acys and Aces also synthesized Ap 4 from ATP and triphosphate. However, Pgk was capable of catalyzing the production of Ap 4 from ATP and 3-phosphoglycerate in the presence of Mg 2+ and did not require triphosphate, suggesting that this enzyme is mainly responsible for Ap 4 synthesis in M. xanthus.

  3. Transposon Insertions of magellan-4 That Impair Social Gliding Motility in Myxococcus xanthus

    PubMed Central

    Youderian, Philip; Hartzell, Patricia L.

    2006-01-01

    Myxococcus xanthus has two different mechanisms of motility, adventurous (A) motility, which permits individual cells to glide over solid surfaces, and social (S) motility, which permits groups of cells to glide. To identify the genes involved in S-gliding motility, we mutagenized a ΔaglU (A−) strain with the defective transposon, magellan-4, and screened for S− mutants that form nonmotile colonies. Sequence analysis of the sites of the magellan-4 insertions in these mutants and the alignment of these sites with the M. xanthus genome sequence show that two-thirds of these insertions lie within 27 of the 37 nonessential genes known to be required for social motility, including those necessary for the biogenesis of type IV pili, exopolysaccharide, and lipopolysaccharide. The remaining insertions also identify 31 new, nonessential genes predicted to encode both structural and regulatory determinants of S motility. These include three tetratricopeptide repeat proteins, several regulators of transcription that may control the expression of genes involved in pilus extension and retraction, and additional enzymes involved in polysaccharide metabolism. Three insertions that abolish S motility lie within genes predicted to encode glycolytic enzymes, suggesting that the signal for pilus retraction may be a simple product of exopolysaccharide catabolism. PMID:16299386

  4. Light-induced carotenogenesis in Myxococcus xanthus: evidence that CarS acts as an anti-repressor of CarA.

    PubMed

    Whitworth, D E; Hodgson, D A

    2001-11-01

    In the bacterium Myxococcus xanthus, carotenoids are produced in response to illumination, as a result of expression of the crt carotenoid biosynthesis genes. The majority of crt genes are clustered in the crtEBDC operon, which is repressed in the dark by CarA. Genetic data suggest that, in the light, CarS is synthesized and achieves activation of the crtEBDC operon by removing the repressive action of CarA. As CarS contains no known DNA-binding motif, the relief of CarA-mediated repression was postulated to result from a direct interaction between these two proteins. Use of the yeast two-hybrid system demonstrated direct interaction between CarA and CarS. The two-hybrid system also implied that CarA and, possibly, CarS are capable of homodimerization. Direct evidence for CarS anti-repressor action was provided in vitro. A glutathione S-transferase (GST)-CarA protein fusion was shown to bind specifically to a palindromic operator sequence within the crtEBDC promoter. CarA was prevented from binding to its operator, and prebound CarA was removed by the addition of purified CarS. CarS is therefore an anti-repressor.

  5. Regulation of the Myxococcus xanthus C-Signal-Dependent Ω4400 Promoter by the Essential Developmental Protein FruA

    PubMed Central

    Yoder-Himes, Deborah R.; Kroos, Lee

    2006-01-01

    The bacterium Myxococcus xanthus employs extracellular signals to coordinate aggregation and sporulation during multicellular development. Extracellular, contact-dependent signaling that involves the CsgA protein (called C-signaling) activates FruA, a putative response regulator that governs a branched signaling pathway inside cells. One branch regulates cell movement, leading to aggregation. The other branch regulates gene expression, leading to sporulation. C-signaling is required for full expression of most genes induced after 6 h into development, including the gene identified by Tn5 lac insertion Ω4400. To determine if FruA is a direct regulator of Ω4400 transcription, a combination of in vivo and in vitro experiments was performed. Ω4400 expression was abolished in a fruA mutant. The DNA-binding domain of FruA bound specifically to DNA upstream of the promoter −35 region in vitro. Mutations between bp −86 and −77 greatly reduced binding. One of these mutations had been shown previously to reduce Ω4400 expression in vivo and make it independent of C-signaling. For the first time, chromatin immunoprecipitation (ChIP) experiments were performed on M. xanthus. The ChIP experiments demonstrated that FruA is associated with the Ω4400 promoter region late in development, even in the absence of C-signaling. Based on these results, we propose that FruA directly activates Ω4400 transcription to a moderate level prior to C-signaling and, in response to C-signaling, binds near bp −80 and activates transcription to a higher level. Also, the highly localized effects of mutations between bp −86 and −77 on DNA binding in vitro, together with recently published footprints, allow us to predict a consensus binding site of GTCG/CGA/G for the FruA DNA-binding domain. PMID:16816188

  6. Increasing on-target cleavage efficiency for CRISPR/Cas9-induced large fragment deletion in Myxococcus xanthus.

    PubMed

    Yang, Ying-Jie; Wang, Ye; Li, Zhi-Feng; Gong, Ya; Zhang, Peng; Hu, Wen-Chao; Sheng, Duo-Hong; Li, Yue-Zhong

    2017-08-16

    The CRISPR/Cas9 system is a powerful tool for genome editing, in which the sgRNA binds and guides the Cas9 protein for the sequence-specific cleavage. The protocol is employable in different organisms, but is often limited by cell damage due to the endonuclease activity of the introduced Cas9 and the potential off-target DNA cleavage from incorrect guide by the 20 nt spacer. In this study, after resolving some critical limits, we have established an efficient CRISPR/Cas9 system for the deletion of large genome fragments related to the biosynthesis of secondary metabolites in Myxococcus xanthus cells. We revealed that the high expression of a codon-optimized cas9 gene in M. xanthus was cytotoxic, and developed a temporally high expression strategy to reduce the cell damage from high expressions of Cas9. We optimized the deletion protocol by using the tRNA-sgRNA-tRNA chimeric structure to ensure correct sgRNA sequence. We found that, in addition to the position-dependent nucleotide preference, the free energy of a 20 nt spacer was a key factor for the deletion efficiency. By using the developed protocol, we achieved the CRISPR/Cas9-induced deletion of large biosynthetic gene clusters for secondary metabolites in M. xanthus DK1622 and its epothilone-producing mutant. The findings and the proposals described in this paper were suggested to be workable in other organisms, for example, other Gram negative bacteria with high GC content.

  7. Conservation of ornamental stone by Myxococcus xanthus-induced carbonate biomineralization.

    PubMed

    Rodriguez-Navarro, Carlos; Rodriguez-Gallego, Manuel; Ben Chekroun, Koutar; Gonzalez-Muñoz, Maria Teresa

    2003-04-01

    Increasing environmental pollution in urban areas has been endangering the survival of carbonate stones in monuments and statuary for many decades. Numerous conservation treatments have been applied for the protection and consolidation of these works of art. Most of them, however, either release dangerous gases during curing or show very little efficacy. Bacterially induced carbonate mineralization has been proposed as a novel and environmentally friendly strategy for the conservation of deteriorated ornamental stone. However, the method appeared to display insufficient consolidation and plugging of pores. Here we report that Myxococcus xanthus-induced calcium carbonate precipitation efficiently protects and consolidates porous ornamental limestone. The newly formed carbonate cements calcite grains by depositing on the walls of the pores without plugging them. Sonication tests demonstrate that these new carbonate crystals are strongly attached to the substratum, mostly due to epitaxial growth on preexisting calcite grains. The new crystals are more stress resistant than the calcite grains of the original stone because they are organic-inorganic composites. Variations in the phosphate concentrations of the culture medium lead to changes in local pH and bacterial productivity. These affect the structure of the new cement and the type of precipitated CaCO(3) polymorph (vaterite or calcite). The manipulation of culture medium composition creates new ways of controlling bacterial biomineralization that in the future could be applied to the conservation of ornamental stone.

  8. Conservation of Ornamental Stone by Myxococcus xanthus-Induced Carbonate Biomineralization

    PubMed Central

    Rodriguez-Navarro, Carlos; Rodriguez-Gallego, Manuel; Ben Chekroun, Koutar; Gonzalez-Muñoz, Maria Teresa

    2003-01-01

    Increasing environmental pollution in urban areas has been endangering the survival of carbonate stones in monuments and statuary for many decades. Numerous conservation treatments have been applied for the protection and consolidation of these works of art. Most of them, however, either release dangerous gases during curing or show very little efficacy. Bacterially induced carbonate mineralization has been proposed as a novel and environmentally friendly strategy for the conservation of deteriorated ornamental stone. However, the method appeared to display insufficient consolidation and plugging of pores. Here we report that Myxococcus xanthus-induced calcium carbonate precipitation efficiently protects and consolidates porous ornamental limestone. The newly formed carbonate cements calcite grains by depositing on the walls of the pores without plugging them. Sonication tests demonstrate that these new carbonate crystals are strongly attached to the substratum, mostly due to epitaxial growth on preexisting calcite grains. The new crystals are more stress resistant than the calcite grains of the original stone because they are organic-inorganic composites. Variations in the phosphate concentrations of the culture medium lead to changes in local pH and bacterial productivity. These affect the structure of the new cement and the type of precipitated CaCO3 polymorph (vaterite or calcite). The manipulation of culture medium composition creates new ways of controlling bacterial biomineralization that in the future could be applied to the conservation of ornamental stone. PMID:12676699

  9. Two-Component Signal Transduction Systems That Regulate the Temporal and Spatial Expression of Myxococcus xanthus Sporulation Genes.

    PubMed

    Sarwar, Zaara; Garza, Anthony G

    2016-02-01

    When starved for nutrients, Myxococcus xanthus produces a biofilm that contains a mat of rod-shaped cells, known as peripheral rods, and aerial structures called fruiting bodies, which house thousands of dormant and stress-resistant spherical spores. Because rod-shaped cells differentiate into spherical, stress-resistant spores and spore differentiation occurs only in nascent fruiting bodies, many genes and multiple levels of regulation are required. Over the past 2 decades, many regulators of the temporal and spatial expression of M. xanthus sporulation genes have been uncovered. Of these sporulation gene regulators, two-component signal transduction circuits, which typically contain a histidine kinase sensor protein and a transcriptional regulator known as response regulator, are among the best characterized. In this review, we discuss prototypical two-component systems (Nla6S/Nla6 and Nla28S/Nla28) that regulate an early, preaggregation phase of sporulation gene expression during fruiting body development. We also discuss orphan response regulators (ActB and FruA) that regulate a later phase of sporulation gene expression, which begins during the aggregation stage of fruiting body development. In addition, we summarize the research on a complex two-component system (Esp) that is important for the spatial regulation of sporulation. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  10. High concentrations of intracellular Ap4A and/or Ap5A in developing Myxococcus xanthus cells inhibit sporulation.

    PubMed

    Kimura, Yoshio; Tanaka, Chihiro; Sasaki, Katsuho; Sasaki, Masashi

    2017-01-01

    Diadenosine polyphosphates (ApnA) are thought to act as signalling molecules regulating stress responses and biofilm formation in prokaryotes. However, ApnA function in Myxococcus xanthus remains unknown. Here, we investigated the role of ApnA in M. xanthus, using the wild-type and ApnA hydrolase (apaH) mutant strains exposed to various stress conditions. In both wild-type and apaH mutant cells cultured on starvation medium (CF agar), the levels of intracellular diadenosine tetraphosphate (Ap4A) and pentaphosphate (Ap5A) increased several fold during the first 16 h of development and decreased gradually thereafter. The levels of Ap4A and Ap5A in the apaH mutant were about 5- and 11-fold higher than those in the wild-type strain at 16 h, respectively. ApnA hydrolase activity of the wild-type strain increased 1.5-fold during the first 8 h of development, and it then gradually decreased. The apaH mutant formed spores 1-2 days after the wild-type strain did, and the yield of viable spores was 5.5 % of that in the wild-type strain 5 days after inoculation onto CF agar. These results suggest the possibility that high intracellular levels of Ap4A and/or Ap5A may inhibit M. xanthus sporulation at the early stage of development and that the bacteria reduce intracellular Ap4A and Ap5A accumulation through ApnA hydrolase activity.

  11. Sibling Rivalry in Myxococcus xanthus Is Mediated by Kin Recognition and a Polyploid Prophage.

    PubMed

    Dey, Arup; Vassallo, Christopher N; Conklin, Austin C; Pathak, Darshankumar T; Troselj, Vera; Wall, Daniel

    2016-01-19

    Myxobacteria form complex social communities that elicit multicellular behaviors. One such behavior is kin recognition, in which cells identify siblings via their polymorphic TraA cell surface receptor, to transiently fuse outer membranes and exchange their contents. In addition, outer membrane exchange (OME) regulates behaviors, such as inhibition of wild-type Myxococcus xanthus (DK1622) from swarming. Here we monitored the fate of motile cells and surprisingly found they were killed by nonmotile siblings. The kill phenotype required OME (i.e., was TraA dependent). The genetic basis of killing was traced to ancestral strains used to construct DK1622. Specifically, the kill phenotype mapped to a large "polyploid prophage," Mx alpha. Sensitive strains contained a 200-kb deletion that removed two of three Mx alpha units. To explain these results, we suggest that Mx alpha expresses a toxin-antitoxin cassette that uses the OME machinery of M. xanthus to transfer a toxin that makes the population "addicted" to Mx alpha. Thus, siblings that lost Mx alpha units (no immunity) are killed by cells that harbor the element. To test this, an Mx alpha-harboring laboratory strain was engineered (by traA allele swap) to recognize a closely related species, Myxococcus fulvus. As a result, M. fulvus, which lacks Mx alpha, was killed. These TraA-mediated antagonisms provide an explanation for how kin recognition specificity might have evolved in myxobacteria. That is, recognition specificity is determined by polymorphisms in traA, which we hypothesize were selected for because OME with non-kin leads to lethal outcomes. The transition from single cell to multicellular life is considered a major evolutionary event. Myxobacteria have successfully made this transition. For example, in response to starvation, individual cells aggregate into multicellular fruiting bodies wherein cells differentiate into spores. To build fruits, cells need to recognize their siblings, and in part, this is

  12. Sibling Rivalry in Myxococcus xanthus Is Mediated by Kin Recognition and a Polyploid Prophage

    PubMed Central

    Dey, Arup; Vassallo, Christopher N.; Conklin, Austin C.; Pathak, Darshankumar T.; Troselj, Vera

    2016-01-01

    ABSTRACT Myxobacteria form complex social communities that elicit multicellular behaviors. One such behavior is kin recognition, in which cells identify siblings via their polymorphic TraA cell surface receptor, to transiently fuse outer membranes and exchange their contents. In addition, outer membrane exchange (OME) regulates behaviors, such as inhibition of wild-type Myxococcus xanthus (DK1622) from swarming. Here we monitored the fate of motile cells and surprisingly found they were killed by nonmotile siblings. The kill phenotype required OME (i.e., was TraA dependent). The genetic basis of killing was traced to ancestral strains used to construct DK1622. Specifically, the kill phenotype mapped to a large “polyploid prophage,” Mx alpha. Sensitive strains contained a 200-kb deletion that removed two of three Mx alpha units. To explain these results, we suggest that Mx alpha expresses a toxin-antitoxin cassette that uses the OME machinery of M. xanthus to transfer a toxin that makes the population “addicted” to Mx alpha. Thus, siblings that lost Mx alpha units (no immunity) are killed by cells that harbor the element. To test this, an Mx alpha-harboring laboratory strain was engineered (by traA allele swap) to recognize a closely related species, Myxococcus fulvus. As a result, M. fulvus, which lacks Mx alpha, was killed. These TraA-mediated antagonisms provide an explanation for how kin recognition specificity might have evolved in myxobacteria. That is, recognition specificity is determined by polymorphisms in traA, which we hypothesize were selected for because OME with non-kin leads to lethal outcomes. IMPORTANCE The transition from single cell to multicellular life is considered a major evolutionary event. Myxobacteria have successfully made this transition. For example, in response to starvation, individual cells aggregate into multicellular fruiting bodies wherein cells differentiate into spores. To build fruits, cells need to recognize their

  13. Interplay between type IV pili activity and exopolysaccharides secretion controls motility patterns in single cells of Myxococcus xanthus

    PubMed Central

    Hu, Wei; Gibiansky, Maxsim L.; Wang, Jing; Wang, Chuandong; Lux, Renate; Li, Yuezhong; Wong, Gerard C. L.; Shi, Wenyuan

    2016-01-01

    Myxococcus xanthus performs coordinated social motility of cell groups through the extension and retraction of type IV pili (TFP) on solid surfaces, which requires both TFP and exopolysaccharides (EPS). By submerging cells in a liquid medium containing 1% methylcellulose, M. xanthus TFP-driven motility was induced in isolated cells and independently of EPS. We measured and analyzed the movements of cells using community tracking algorithms, which combine single-cell resolution with statistics from large sample populations. Cells without significant multi-cellular social interactions have surprisingly complex behaviors: EPS− cells exhibited a pronounced increase in the tendency to stand vertically and moved with qualitatively different characteristics than other cells. A decrease in the EPS secretion of cells correlates with a higher instantaneous velocity, but with lower directional persistence in trajectories. Moreover, EPS− cells do not adhere to the surface as strongly as wild-type and EPS overproducing cells, and display a greater tendency to have large deviations between the direction of movement and the cell axis, with cell velocity showing only minimal dependence on the direction of movement. The emerging picture is that EPS does not simply provide rheological resistance to a single mechanism but rather that the availability of EPS impacts motility pattern. PMID:26821939

  14. Myxococcus xanthus Gliding Motors Are Elastically Coupled to the Substrate as Predicted by the Focal Adhesion Model of Gliding Motility

    PubMed Central

    Balagam, Rajesh; Litwin, Douglas B.; Czerwinski, Fabian; Sun, Mingzhai; Kaplan, Heidi B.; Shaevitz, Joshua W.; Igoshin, Oleg A.

    2014-01-01

    Myxococcus xanthus is a model organism for studying bacterial social behaviors due to its ability to form complex multi-cellular structures. Knowledge of M. xanthus surface gliding motility and the mechanisms that coordinated it are critically important to our understanding of collective cell behaviors. Although the mechanism of gliding motility is still under investigation, recent experiments suggest that there are two possible mechanisms underlying force production for cell motility: the focal adhesion mechanism and the helical rotor mechanism, which differ in the biophysics of the cell–substrate interactions. Whereas the focal adhesion model predicts an elastic coupling, the helical rotor model predicts a viscous coupling. Using a combination of computational modeling, imaging, and force microscopy, we find evidence for elastic coupling in support of the focal adhesion model. Using a biophysical model of the M. xanthus cell, we investigated how the mechanical interactions between cells are affected by interactions with the substrate. Comparison of modeling results with experimental data for cell-cell collision events pointed to a strong, elastic attachment between the cell and substrate. These results are robust to variations in the mechanical and geometrical parameters of the model. We then directly measured the motor-substrate coupling by monitoring the motion of optically trapped beads and find that motor velocity decreases exponentially with opposing load. At high loads, motor velocity approaches zero velocity asymptotically and motors remain bound to beads indicating a strong, elastic attachment. PMID:24810164

  15. Allopatric integrations selectively change host transcriptomes, leading to varied expression efficiencies of exotic genes in Myxococcus xanthus.

    PubMed

    Zhu, Li-Ping; Yue, Xin-Jing; Han, Kui; Li, Zhi-Feng; Zheng, Lian-Shuai; Yi, Xiu-Nan; Wang, Hai-Long; Zhang, You-Ming; Li, Yue-Zhong

    2015-07-22

    Exotic genes, especially clustered multiple-genes for a complex pathway, are normally integrated into chromosome for heterologous expression. The influences of insertion sites on heterologous expression and allotropic expressions of exotic genes on host remain mostly unclear. We compared the integration and expression efficiencies of single and multiple exotic genes that were inserted into Myxococcus xanthus genome by transposition and attB-site-directed recombination. While the site-directed integration had a rather stable chloramphenicol acetyl transferase (CAT) activity, the transposition produced varied CAT enzyme activities. We attempted to integrate the 56-kb gene cluster for the biosynthesis of antitumor polyketides epothilones into M. xanthus genome by site-direction but failed, which was determined to be due to the insertion size limitation at the attB site. The transposition technique produced many recombinants with varied production capabilities of epothilones, which, however, were not paralleled to the transcriptional characteristics of the local sites where the genes were integrated. Comparative transcriptomics analysis demonstrated that the allopatric integrations caused selective changes of host transcriptomes, leading to varied expressions of epothilone genes in different mutants. With the increase of insertion fragment size, transposition is a more practicable integration method for the expression of exotic genes. Allopatric integrations selectively change host transcriptomes, which lead to varied expression efficiencies of exotic genes.

  16. Identification of an activator protein required for the induction of fruA, a gene essential for fruiting body development in Myxococcus xanthus

    PubMed Central

    Ueki, Toshiyuki; Inouye, Sumiko

    2003-01-01

    Myxococcus xanthus exhibits social behavior and multicellular development. FruA is an essential transcription factor for fruiting body development in M. xanthus. In the present study, the upstream promoter region was found to be necessary for the induction of fruA expression during development. A cis-acting element required for the induction was identified and was located between nucleotides –154 and –107 with respect to the transcription initiation site. In addition, it was found that two binding sites exist within this element of the fruA promoter. By using DNA affinity column chromatography containing the cis-acting element, a fruA promoter-binding protein was purified. The purified protein was shown by N-terminal sequence analysis to be identical to MrpC, a protein identified previously by transposon insertion mutagenesis as an essential locus for fruiting body development [Sun, H. & Shi, W. (2001) J. Bacteriol. 183, 4786–4795]. Furthermore, fruA mRNA was not detectable in the mrpC::km strain, demonstrating that MrpC is essential for fruA expression. Moreover, mutational analysis of the binding sites for MrpC in the fruA promoter indicates that binding of MrpC activates transcription of fruA in vivo. This report provides evidence for a direct molecular interaction involved in temporally regulated gene expression in M. xanthus. PMID:12851461

  17. Identification of a mutant locus that bypasses the BsgA protease requirement for social development in Myxococcus xanthus.

    PubMed

    Cusick, John K; Hager, Elizabeth; Gill, Ronald E

    2015-01-01

    The BsgA protease is required for the earliest morphological changes observed in Myxococcus xanthus development. We hypothesize that the BsgA protease is required to cleave an inhibitor of the developmental program, and isolation of genetic bypass suppressors of a bsgA mutant was used to identify signaling components controlling development downstream of the BsgA protease. Strain M955 was created by transposon mutagenesis of a bsgA mutant followed by screening for strains that could develop despite the absence of the BsgA protease. Strain M955 was able to aggregate, form fruiting bodies, and partially restored the production of viable spores in comparison to the parental bsgA mutant. The bsgA Tn5Ω955 strain partially restored developmental expression to a subset of genes normally induced during development, and expressed one developmentally induced fusion at higher amounts during vegetative growth in comparison to wild-type cells. The transposon in strain M955 was localized to a Ribonuclease D homolog that appears to exist in an operon with a downstream aminopeptidase-encoding gene. The identification of a third distinct bypass suppressor of the BsgA protease suggests that the BsgA protease may regulate a potentially complex pathway during the initiation of the M. xanthus developmental program. © FEMS 2014. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  18. Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

    PubMed

    Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

    2002-12-01

    The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

  19. Analysis of dofA, a fruA-Dependent Developmental Gene, and Its Homologue, dofB, in Myxococcus xanthus

    PubMed Central

    Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

    2002-01-01

    The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested. PMID:12446630

  20. Intra- and Interprotein Phosphorylation between Two-hybrid Histidine Kinases Controls Myxococcus xanthus Developmental Progression*

    PubMed Central

    Schramm, Andreas; Lee, Bongsoo; Higgs, Penelope I.

    2012-01-01

    Histidine-aspartate phosphorelay signaling systems are used to couple stimuli to cellular responses. A hallmark feature is the highly modular signal transmission modules that can form both simple “two-component” systems and sophisticated multicomponent systems that integrate stimuli over time and space to generate coordinated and fine-tuned responses. The deltaproteobacterium Myxococcus xanthus contains a large repertoire of signaling proteins, many of which regulate its multicellular developmental program. Here, we assign an orphan hybrid histidine protein kinase, EspC, to the Esp signaling system that negatively regulates progression through the M. xanthus developmental program. The Esp signal system consists of the hybrid histidine protein kinase, EspA, two serine/threonine protein kinases, and a putative transport protein. We demonstrate that EspC is an essential component of this system because ΔespA, ΔespC, and ΔespA ΔespC double mutants share an identical developmental phenotype. Neither substitution of the phosphoaccepting histidine residue nor deletion of the entire catalytic ATPase domain in EspC produces an in vivo mutant developmental phenotype. In contrast, substitution of the receiver phosphoaccepting residue yields the null phenotype. Although the EspC histidine kinase can efficiently autophosphorylate in vitro, it does not act as a phosphodonor to its own receiver domain. Our in vitro and in vivo analyses suggest the phosphodonor is instead the EspA histidine kinase. We propose EspA and EspC participate in a novel hybrid histidine protein kinase signaling mechanism involving both inter- and intraprotein phosphotransfer. The output of this signaling system appears to be the combined phosphorylated state of the EspA and EspC receiver modules. This system regulates the proteolytic turnover of MrpC, an important regulator of the developmental program. PMID:22661709

  1. The Myxococcus xanthus two-component system CorSR regulates expression of a gene cluster involved in maintaining copper tolerance during growth and development.

    PubMed

    Sánchez-Sutil, María Celestina; Pérez, Juana; Gómez-Santos, Nuria; Shimkets, Lawrence J; Moraleda-Muñoz, Aurelio; Muñoz-Dorado, José

    2013-01-01

    Myxococcus xanthus is a soil-dwelling member of the δ-Proteobacteria that exhibits a complex developmental cycle upon starvation. Development comprises aggregation and differentiation into environmentally resistant myxospores in an environment that includes fluctuations in metal ion concentrations. While copper is essential for M. xanthus cells because several housekeeping enzymes use it as a cofactor, high copper concentrations are toxic. These opposing effects force cells to maintain a tight copper homeostasis. A plethora of paralogous genes involved in copper detoxification, all of which are differentially regulated, have been reported in M. xanthus. The use of in-frame deletion mutants and fusions with the reporter gene lacZ has allowed the identification of a two-component system, CorSR, that modulates the expression of an operon termed curA consisting of nine genes whose expression slowly increases after metal addition, reaching a plateau. Transcriptional regulation of this operon is complex because transcription can be initiated at different promoters and by different types of regulators. These genes confer copper tolerance during growth and development. Copper induces carotenoid production in a ΔcorSR mutant at lower concentrations than with the wild-type strain due to lack of expression of a gene product resembling subunit III of cbb3-type cytochrome c oxidase. This data may explain why copper induces carotenoid biosynthesis at suboptimal rather than optimal growth conditions in wild-type strains.

  2. Myxococcus xanthus Swarms Are Driven by Growth and Regulated by a Pacemaker ▿

    PubMed Central

    Kaiser, Dale; Warrick, Hans

    2011-01-01

    The principal social activity of Myxococcus xanthus is to organize a dynamic multicellular structure, known as a swarm. Although its cell density is high, the swarm can grow and expand rapidly. Within the swarm, the individual rod-shaped cells are constantly moving, transiently interacting with one another, and independently reversing their gliding direction. Periodic reversal is, in fact, essential for creating a swarm, and the reversal frequency controls the rate of swarm expansion. Chemotaxis toward nutrient has been thought to drive swarming, but here the nature of swarm growth and the impact of genetic deletions of members of the Frz family of proteins suggest otherwise. We find that three cytoplasmic Frz proteins, FrzCD, FrzF, and FrzE, constitute a cyclic pathway that sets the reversal frequency. Within each cell these three proteins appear to be connected in a negative-feedback loop that produces oscillations whose frequencies are finely tuned by methylation and by phosphorylation. This oscillator, in turn, drives MglAB, a small G-protein switch, to oscillate between its GTP- and GDP-bound states that ultimately determine when the cell moves forward or backward. The periodic reversal of interacting rod-shaped cells promotes their alignment. Swarm organization ensures that each cell can move without blocking the movement of others. PMID:21856842

  3. Role of fruA and csgA genes in gene expression during development of Myxococcus xanthus. Analysis by two-dimensional gel electrophoresis.

    PubMed

    Horiuchi, Takayuki; Taoka, Masato; Isobe, Toshiaki; Komano, Teruya; Inouye, Sumiko

    2002-07-26

    Two genes, fruA and csgA, encoding a putative transcription factor and C-factor, respectively, are essential for fruiting body formation of Myxococcus xanthus. To investigate the role of fruA and csgA genes in developmental gene expression, developing cells as well as vegetative cells of M. xanthus wild-type, fruA::Tc, and csgA731 strains were pulse-labeled with [(35)S]methionine, and the whole cell proteins were analyzed using two-dimensional immobilized pH gradient/SDS-PAGE. Differences in protein synthesis patterns among more than 700 protein spots were detected during development of the three strains. Fourteen proteins showing distinctly different expression patterns in mutant cells were analyzed in more detail. Five of the 14 proteins were identified as elongation factor Tu (EF-Tu), Dru, DofA, FruA, and protein S by immunoblot analysis and mass spectroscopy. A gene encoding DofA was cloned and sequenced. Although both fruA and csgA genes regulate early development of M. xanthus, they were found to differently regulate expression of several developmental genes. The production of six proteins, including DofA and protein S, was dependent on fruA, whereas the production of two proteins was dependent on csgA, and one protein was dependent on both fruA and csgA. To explain the present findings, a new model was presented in which different levels of FruA phosphorylation may distinctively regulate the expression of two groups of developmental genes.

  4. The Myxococcus xanthus Two-Component System CorSR Regulates Expression of a Gene Cluster Involved in Maintaining Copper Tolerance during Growth and Development

    PubMed Central

    Sánchez-Sutil, María Celestina; Pérez, Juana; Gómez-Santos, Nuria; Shimkets, Lawrence J.; Moraleda-Muñoz, Aurelio; Muñoz-Dorado, José

    2013-01-01

    Myxococcus xanthus is a soil-dwelling member of the δ–Proteobacteria that exhibits a complex developmental cycle upon starvation. Development comprises aggregation and differentiation into environmentally resistant myxospores in an environment that includes fluctuations in metal ion concentrations. While copper is essential for M. xanthus cells because several housekeeping enzymes use it as a cofactor, high copper concentrations are toxic. These opposing effects force cells to maintain a tight copper homeostasis. A plethora of paralogous genes involved in copper detoxification, all of which are differentially regulated, have been reported in M. xanthus. The use of in-frame deletion mutants and fusions with the reporter gene lacZ has allowed the identification of a two-component system, CorSR, that modulates the expression of an operon termed curA consisting of nine genes whose expression slowly increases after metal addition, reaching a plateau. Transcriptional regulation of this operon is complex because transcription can be initiated at different promoters and by different types of regulators. These genes confer copper tolerance during growth and development. Copper induces carotenoid production in a ΔcorSR mutant at lower concentrations than with the wild-type strain due to lack of expression of a gene product resembling subunit III of cbb3-type cytochrome c oxidase. This data may explain why copper induces carotenoid biosynthesis at suboptimal rather than optimal growth conditions in wild-type strains. PMID:23874560

  5. Outside-in assembly pathway of the type IV pilus system in Myxococcus xanthus.

    PubMed

    Friedrich, Carmen; Bulyha, Iryna; Søgaard-Andersen, Lotte

    2014-01-01

    Type IV pili (T4P) are ubiquitous bacterial cell surface structures that undergo cycles of extension, adhesion, and retraction. T4P function depends on a highly conserved envelope-spanning macromolecular machinery consisting of 10 proteins that localizes polarly in Myxococcus xanthus. Using this localization, we investigated the entire T4P machinery assembly pathway by systematically profiling the stability of all and the localization of eight of these proteins in the absence of other T4P machinery proteins as well as by mapping direct protein-protein interactions. Our experiments uncovered a sequential, outside-in pathway starting with the outer membrane (OM) PilQ secretin ring. PilQ recruits a subcomplex consisting of the inner membrane (IM) lipoprotein PilP and the integral IM proteins PilN and PilO by direct interaction with the periplasmic domain of PilP. The PilP/PilN/PilO subcomplex recruits the cytoplasmic PilM protein, by direct interaction between PilN and PilM, and the integral IM protein PilC. The PilB/PilT ATPases that power extension/retraction localize independently of other T4P machinery proteins. Thus, assembly of the T4P machinery initiates with formation of the OM secretin ring and continues inwards over the periplasm and IM to the cytoplasm.

  6. Heterologous Expression of the Oxytetracycline Biosynthetic Pathway in Myxococcus xanthus▿

    PubMed Central

    Stevens, D. Cole; Henry, Michael R.; Murphy, Kimberly A.; Boddy, Christopher N.

    2010-01-01

    New natural products for drug discovery may be accessed by heterologous expression of bacterial biosynthetic pathways in metagenomic DNA libraries. However, a “universal” host is needed for this experiment. Herein, we show that Myxococcus xanthus is a potential “universal” host for heterologous expression of polyketide biosynthetic gene clusters. PMID:20208031

  7. The dev Operon Regulates the Timing of Sporulation during Myxococcus xanthus Development

    PubMed Central

    Rajagopalan, Ramya

    2017-01-01

    ABSTRACT Myxococcus xanthus undergoes multicellular development when starved. Thousands of rod-shaped cells coordinate their movements and aggregate into mounds in which cells differentiate into spores. Mutations in the dev operon impair development. The dev operon encompasses a clustered regularly interspaced short palindromic repeat-associated (CRISPR-Cas) system. Null mutations in devI, a small gene at the beginning of the dev operon, suppress the developmental defects caused by null mutations in the downstream devR and devS genes but failed to suppress defects caused by a small in-frame deletion in devT. We provide evidence that the original mutant has a second-site mutation. We show that devT null mutants exhibit developmental defects indistinguishable from devR and devS null mutants, and a null mutation in devI suppresses the defects of a devT null mutation. The similarity of DevTRS proteins to components of the CRISPR-associated complex for antiviral defense (Cascade), together with our molecular characterization of dev mutants, support a model in which DevTRS form a Cascade-like subcomplex that negatively autoregulates dev transcript accumulation and prevents DevI overproduction that would strongly inhibit sporulation. Our results also suggest that DevI transiently inhibits sporulation when regulated normally. The mechanism of transient inhibition may involve MrpC, a key transcription factor, whose translation appears to be weakly inhibited by DevI. Finally, our characterization of a devI devS mutant indicates that very little exo transcript is required for sporulation, which is surprising since Exo proteins help form the polysaccharide spore coat. IMPORTANCE CRISPR-Cas systems typically function as adaptive immune systems in bacteria. The dev CRISPR-Cas system of M. xanthus has been proposed to prevent bacteriophage infection during development, but how dev controls sporulation has been elusive. Recent evidence supported a model in which DevR and Dev

  8. Coupling of protein localization and cell movements by a dynamically localized response regulator in Myxococcus xanthus

    PubMed Central

    Leonardy, Simone; Freymark, Gerald; Hebener, Sabrina; Ellehauge, Eva; Søgaard-Andersen, Lotte

    2007-01-01

    Myxococcus xanthus cells harbor two motility machineries, type IV pili (Tfp) and the A-engine. During reversals, the two machineries switch polarity synchronously. We present a mechanism that synchronizes this polarity switching. We identify the required for motility response regulator (RomR) as essential for A-motility. RomR localizes in a bipolar, asymmetric pattern with a large cluster at the lagging cell pole. The large RomR cluster relocates to the new lagging pole in parallel with cell reversals. Dynamic RomR localization is essential for cell reversals, suggesting that RomR relocalization induces the polarity switching of the A-engine. The analysis of RomR mutants shows that the output domain targets RomR to the poles and the receiver domain is essential for dynamic localization. The small GTPase MglA establishes correct RomR polarity, and the Frz two-component system regulates dynamic RomR localization. FrzS localizes with Tfp at the leading pole and relocates in an Frz-dependent manner to the opposite pole during reversals; FrzS and RomR localize and oscillate independently. The Frz system synchronizes these oscillations and thus the synchronous polarity switching of the motility machineries. PMID:17932488

  9. Control of asgE Expression during Growth and Development of Myxococcus xanthus

    PubMed Central

    Garza, Anthony G.; Harris, Baruch Z.; Greenberg, Brandon M.; Singer, Mitchell

    2000-01-01

    One of the earliest events in the Myxococcus xanthus developmental cycle is production of an extracellular cell density signal called A-signal (or A-factor). Previously, we showed that cells carrying an insertion in the asgE gene fail to produce normal levels of this cell-cell signal. In this study we found that expression of asgE is growth phase regulated and developmentally regulated. Several lines of evidence indicate that asgE is cotranscribed with an upstream gene during development. Using primer extension analyses, we identified two 5′ ends for this developmental transcript. The DNA sequence upstream of one 5′ end has similarity to the promoter regions of several genes that are A-signal dependent, whereas sequences located upstream of the second 5′ end show similarity to promoter elements identified for genes that are C-signal dependent. Consistent with this result is our finding that mutants failing to produce A-signal or C-signal are defective for developmental expression of asgE. In contrast to developing cells, the large majority of the asgE transcript found in vegetative cells appears to be monocistronic. This finding suggests that asgE uses different promoters for expression during vegetative growth and development. Growth phase regulation of asgE is abolished in a relA mutant, indicating that this vegetative promoter is induced by starvation. The data presented here, in combination with our previous results, indicate that the level of AsgE in vegetative cells is sufficient for this protein to carry out its function during development. PMID:11073904

  10. Myxococcus xanthus Developmental Cell Fate Production: Heterogeneous Accumulation of Developmental Regulatory Proteins and Reexamination of the Role of MazF in Developmental Lysis

    PubMed Central

    Lee, Bongsoo; Holkenbrink, Carina; Treuner-Lange, Anke

    2012-01-01

    Myxococcus xanthus undergoes a starvation-induced multicellular developmental program during which cells partition into three known fates: (i) aggregation into fruiting bodies followed by differentiation into spores, (ii) lysis, or (iii) differentiation into nonaggregating persister-like cells, termed peripheral rods. As a first step to characterize cell fate segregation, we enumerated total, aggregating, and nonaggregating cells throughout the developmental program. We demonstrate that both cell lysis and cell aggregation begin with similar timing at approximately 24 h after induction of development. Examination of several known regulatory proteins in the separated aggregated and nonaggregated cell fractions revealed previously unknown heterogeneity in the accumulation patterns of proteins involved in type IV pilus (T4P)-mediated motility (PilC and PilA) and regulation of development (MrpC, FruA, and C-signal). As part of our characterization of the cell lysis fate, we set out to investigate the unorthodox MazF-MrpC toxin-antitoxin system which was previously proposed to induce programmed cell death (PCD). We demonstrate that deletion of mazF in two different wild-type M. xanthus laboratory strains does not significantly reduce developmental cell lysis, suggesting that MazF's role in promoting PCD is an adaption to the mutant background strain used previously. PMID:22493014

  11. Myxotyrosides A and B, Unusual rhamnosides from Myxococcus sp.

    PubMed

    Ohlendorf, Birgit; Lorenzen, Wolfram; Kehraus, Stefan; Krick, Anja; Bode, Helge B; König, Gabriele M

    2009-01-01

    Myxobacteria are gliding bacteria of the delta-subdivision of the Proteobacteria and known for their unique biosynthetic capabilities. Two examples of a new class of metabolites, myxotyrosides A (1) and B (2), were isolated from a Myxococcus sp. The myxotyrosides have a tyrosine-derived core structure glycosylated with rhamnose and acylated with unusual fatty acids such as (Z)-15-methyl-2-hexadecenoic and (Z)-2-hexadecenoic acid. The fatty acid profile of the investigated Myxococcus sp. (strain 131) is that of a typical myxobacterium with a high similarity to those described for M. fulvus and M. xanthus, with significant concentrations of neither 15-methyl-2-hexadecenoic acid nor 2-hexadecenoic acid being detected.

  12. A Versatile Class of Cell Surface Directional Motors Gives Rise to Gliding Motility and Sporulation in Myxococcus xanthus

    PubMed Central

    Wartel, Morgane; Czerwinski, Fabian; Le Gall, Anne-Valérie; Mauriello, Emilia M. F.; Bergam, Ptissam; Brun, Yves V.; Shaevitz, Joshua; Mignot, Tâm

    2013-01-01

    Eukaryotic cells utilize an arsenal of processive transport systems to deliver macromolecules to specific subcellular sites. In prokaryotes, such transport mechanisms have only been shown to mediate gliding motility, a form of microbial surface translocation. Here, we show that the motility function of the Myxococcus xanthus Agl-Glt machinery results from the recent specialization of a versatile class of bacterial transporters. Specifically, we demonstrate that the Agl motility motor is modular and dissociates from the rest of the gliding machinery (the Glt complex) to bind the newly expressed Nfs complex, a close Glt paralogue, during sporulation. Following this association, the Agl system transports Nfs proteins directionally around the spore surface. Since the main spore coat polymer is secreted at discrete sites around the spore surface, its transport by Agl-Nfs ensures its distribution around the spore. Thus, the Agl-Glt/Nfs machineries may constitute a novel class of directional bacterial surface transporters that can be diversified to specific tasks depending on the cognate cargo and machinery-specific accessories. PMID:24339744

  13. The dev Operon Regulates the Timing of Sporulation during Myxococcus xanthus Development.

    PubMed

    Rajagopalan, Ramya; Kroos, Lee

    2017-05-15

    Myxococcus xanthus undergoes multicellular development when starved. Thousands of rod-shaped cells coordinate their movements and aggregate into mounds in which cells differentiate into spores. Mutations in the dev operon impair development. The dev operon encompasses a clustered regularly interspaced short palindromic repeat-associated (CRISPR-Cas) system. Null mutations in devI , a small gene at the beginning of the dev operon, suppress the developmental defects caused by null mutations in the downstream devR and devS genes but failed to suppress defects caused by a small in-frame deletion in devT We provide evidence that the original mutant has a second-site mutation. We show that devT null mutants exhibit developmental defects indistinguishable from devR and devS null mutants, and a null mutation in devI suppresses the defects of a devT null mutation. The similarity of DevTRS proteins to components of the CRISPR-associated complex for antiviral defense (Cascade), together with our molecular characterization of dev mutants, support a model in which DevTRS form a Cascade-like subcomplex that negatively autoregulates dev transcript accumulation and prevents DevI overproduction that would strongly inhibit sporulation. Our results also suggest that DevI transiently inhibits sporulation when regulated normally. The mechanism of transient inhibition may involve MrpC, a key transcription factor, whose translation appears to be weakly inhibited by DevI. Finally, our characterization of a devI devS mutant indicates that very little exo transcript is required for sporulation, which is surprising since Exo proteins help form the polysaccharide spore coat. IMPORTANCE CRISPR-Cas systems typically function as adaptive immune systems in bacteria. The dev CRISPR-Cas system of M. xanthus has been proposed to prevent bacteriophage infection during development, but how dev controls sporulation has been elusive. Recent evidence supported a model in which DevR and DevS prevent

  14. Cell-to-cell stimulation of movement in nonmotile mutants of Myxococcus

    PubMed Central

    Hodgkin, Jonathan; Kaiser, Dale

    1977-01-01

    A large number of nonmotile mutants of the gliding bacterium Myxococcus xanthus have been isolated and partly characterized. About [unk] of these mutants are conditional mutants of a novel kind: mutant cells become transiently motile after contact with nonmutant cells or with cells of a different mutant type. These “stimulatable” mutants fall into five phenotypic classes (types B, C, D, E, and F). Most mutants are nonstimulatable (type A) and never become motile, but type A cells (and wild-type cells) can stimulate cells of any of the other five types. Stimulatable mutants of different types are capable of stimulating each other. For example, in a mixture of B and C cells, both become motile. Linkage analysis using a generalized transducing phage has shown that each of types B, C, D, E, and F corresponds to a single distinct genetic locus. Type A mutants, by contrast, belong to at least 17 different loci. Stimulation depends on close apposition of interacting cells, because stimulation does not occur when contact between cells is prevented. It is possible that the stimulatable mutants are defective in components of the gliding mechanism that can be exchanged between cells. Alternatively, they may be defective in a system of cell communication controlling the coordinated cell movements observed in Myxococcus. Images PMID:16592422

  15. Enzymatic characteristics of an ApaH-like phosphatase, PrpA, and a diadenosine tetraphosphate hydrolase, ApaH, from Myxococcus xanthus.

    PubMed

    Sasaki, Masashi; Takegawa, Kaoru; Kimura, Yoshio

    2014-09-17

    We characterized the activities of the Myxococcus xanthus ApaH-like phosphatases PrpA and ApaH, which share homologies with both phosphoprotein phosphatases and diadenosine tetraphosphate (Ap4A) hydrolases. PrpA exhibited a phosphatase activity towards p-nitrophenyl phosphate (pNPP), tyrosine phosphopeptide and tyrosine-phosphorylated protein, and a weak hydrolase activity towards ApnA and ATP. In the presence of Mn(2+), PrpA hydrolyzed Ap4A into AMP and ATP, whereas in the presence of Co(2+) PrpA hydrolyzed Ap4A into two molecules of ADP. ApaH exhibited high phosphatase activity towards pNPP, and hydrolase activity towards ApnA and ATP. Mn(2+) was required for ApaH-mediated pNPP dephosphorylation and ATP hydrolysis, whereas Co(2+) was required for ApnA hydrolysis. Thus, PrpA and ApaH may function mainly as a tyrosine protein phosphatase and an ApnA hydrolase, respectively. Copyright © 2014 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  16. Effects of site-directed mutagenesis of mglA on motility and swarming of Myxococcus xanthus

    PubMed Central

    2010-01-01

    Background The mglA gene from the bacterium Myxococcus xanthus encodes a 22kDa protein related to the Ras superfamily of monomeric GTPases. MglA is required for the normal function of A-motility (adventurous), S-motility (social), fruiting body morphogenesis, and sporulation. MglA and its homologs differ from all eukaryotic and other prokaryotic GTPases because they have a threonine (Thr78) in place of the highly conserved aspartate residue of the consensus PM3 (phosphate-magnesium binding) region. To identify residues critical for MglA function or potential protein interactions, and explore the function of Thr78, the phenotypes of 18 mglA mutants were characterized. Results Nine mutants, with mutations predicted to alter residues that bind the guanine base or coordinate magnesium, did not produce detectable MglA. As expected, these mutants were mot- dev- because MglA is essential for these processes. Of the remaining nine mutants, seven showed a wild-type distribution pattern for MglA but fell into two categories with regard to function. Five of the seven mutants exhibited mild phenotypes, but two mutants, T78D and P80A, abolished motility and development. The localization pattern of MglA was abolished in two mutants that were mot- spo- and dev-. These two mutants were predicted to alter surface residues at Asp52 and Thr54, which suggests that these residues are critical for proper localization and may define a protein interaction site. Improving the consensus match with Ras at Thr78 abolished function of MglA. Only the conservative serine substitution was tolerated at this position. Merodiploid constructs revealed that a subset of alleles, including mglAD52A, were dominant and also illustrated that changing the balance of MglA and its co-transcribed partner, MglB, affects A-motility. Conclusion Our results suggest that GTP binding is critical for stability of MglA because MglA does not accumulate in mutants that cannot bind GTP. The threonine in PM3 of Mgl

  17. Comparative genomics of transport proteins in developmental bacteria: Myxococcus xanthus and Streptomyces coelicolor

    PubMed Central

    2013-01-01

    Background Two of the largest fully sequenced prokaryotic genomes are those of the actinobacterium, Streptomyces coelicolor (Sco), and the δ-proteobacterium, Myxococcus xanthus (Mxa), both differentiating, sporulating, antibiotic producing, soil microbes. Although the genomes of Sco and Mxa are the same size (~9 Mbp), Sco has 10% more genes that are on average 10% smaller than those in Mxa. Results Surprisingly, Sco has 93% more identifiable transport proteins than Mxa. This is because Sco has amplified several specific types of its transport protein genes, while Mxa has done so to a much lesser extent. Amplification is substrate- and family-specific. For example, Sco but not Mxa has amplified its voltage-gated ion channels but not its aquaporins and mechano-sensitive channels. Sco but not Mxa has also amplified drug efflux pumps of the DHA2 Family of the Major Facilitator Superfamily (MFS) (49 versus 6), amino acid transporters of the APC Family (17 versus 2), ABC-type sugar transport proteins (85 versus 6), and organic anion transporters of several families. Sco has not amplified most other types of transporters. Mxa has selectively amplified one family of macrolid exporters relative to Sco (16 versus 1), consistent with the observation that Mxa makes more macrolids than does Sco. Conclusions Except for electron transport carriers, there is a poor correlation between the types of transporters found in these two organisms, suggesting that their solutions to differentiative and metabolic needs evolved independently. A number of unexpected and surprising observations are presented, and predictions are made regarding the physiological functions of recognizable transporters as well as the existence of yet to be discovered transport systems in these two important model organisms and their relatives. The results provide insight into the evolutionary processes by which two dissimilar prokaryotes evolved complexity, particularly through selective chromosomal gene

  18. Identification and Characterization of Genes Required for Early Myxococcus xanthus Developmental Gene Expression

    PubMed Central

    Guo, Dongchuan; Wu, Yun; Kaplan, Heidi B.

    2000-01-01

    Starvation and cell density regulate the developmental expression of Myxococcus xanthus gene 4521. Three classes of mutants allow expression of this developmental gene during growth on nutrient agar, such that colonies of strains containing a Tn5 lac Ω4521 fusion are Lac+. One class of these mutants inactivates SasN, a negative regulator of 4521 expression; another class activates SasS, a sensor kinase-positive regulator of 4521 expression; and a third class blocks lipopolysaccharide (LPS) O-antigen biosynthesis. To identify additional positive regulators of 4521 expression, 11 Lac− TnV.AS transposon insertion mutants were isolated from a screen of 18,000 Lac+ LPS O-antigen mutants containing Tn5 lac Ω4521 (Tcr). Ten mutations identified genes that could encode positive regulators of 4521 developmental expression based on their ability to abolish 4521 expression during development in the absence of LPS O antigen and in an otherwise wild-type background. Eight of these mutations mapped to the sasB locus, which encodes the known 4521 regulators SasS and SasN. One mapped to sasS, whereas seven identified new genes. Three mutations mapped to a gene encoding an NtrC-like response regulator homologue, designated sasR, and four others mapped to a gene designated sasP. One mutation, designated ssp10, specifically suppressed the LPS O-antigen defect; the ssp10 mutation had no effect on 4521 expression in an otherwise wild-type background but reduced 4521 developmental expression in the absence of LPS O antigen to a level close to that of the parent strain. All of the mutations except those in sasP conferred defects during growth and development. These data indicate that a number of elements are required for 4521 developmental expression and that most of these are necessary for normal growth and fruiting body development. PMID:10913090

  19. Myxospore Coat Synthesis in Myxococcus xanthus: In Vivo Incorporation of Acetate and Glycine

    PubMed Central

    Filer, D.; White, D.; Kindler, S. H.; Rosenberg, E.

    1977-01-01

    Myxospore coat synthesis in Myxococcus xanthus was studied by incorporation of [14C]acetate into intermediates in the biosynthesis of coat polysaccharide and into acid-insoluble material during vegetative growth and after glycerol induction of myxospores. During short labeling periods at 27°C, the radioactivity was shown to be located primarily in N-acetyl groups rather than sugar moieties. Two hours after glycerol induction, the pools of N-acetylglucosamine 6-phosphate and uridine 5′-diphosphate-N-acetylgalactosamine (UDPGalNAc) plus uridine 5′-diphosphate-N-glucosamine increased about twofold and were labeled at twice the rate measured for vegetative cells. The increased rate of synthesis of UDPGalNAc and its precursors could be correlated with increased enzyme activities measured in vitro. Controlled acid hydrolysis revealed that the galactosamine portion of the myxospore coat was N-acetylated. After glycerol induction, the incorporation of acetate into acid-insoluble material increased threefold. This enhanced incorporation was sensitive to neither penicillin nor d-cycloserine. In contrast, bacitracin inhibited the incorporation of [14C]acetate into acid-insoluble material more effectively 2 h after myxospore induction than during vegetative growth. Chloramphenicol added to cells 90 min after induction blocked further increase in the rate of [14C]acetate incorporation. Since the myxospore coat contains glycine, polymer synthesis was also measured by chloramphenicol-insensitive [14C]glycine incorporation into acid-insoluble material. Although protein synthesis decreased after glycerol induction, glycine incorporation increased. Two hours after induction, glycine incorporation was only 75% inhibited by chloramphenicol and rifampin. The chloramphenicol-insensitive rate of incorporation of [14C]glycine increased during the first hour after myxospore induction and reached a peak rate after 2 to 3 h. The chloramphenicol-resistant incorporation of [14C

  20. Operator design and mechanism for CarA repressor-mediated down-regulation of the photoinducible carB operon in Myxococcus xanthus.

    PubMed

    López-Rubio, José Juan; Padmanabhan, S; Lázaro, Jose María; Salas, Margarita; Murillo, Francisco José; Elías-Arnanz, Montserrat

    2004-07-09

    The carB operon encodes all except one of the enzymes involved in light-induced carotenogenesis in Myxococcus xanthus. Expression of its promoter (P(B)) is repressed in the dark by sequence-specific DNA binding of CarA to a palindrome (pI) located between positions -47 and -64 relative to the transcription start site. This promotes subsequent binding of CarA to additional sites that remain to be defined. CarS, produced in the light, interacts physically with CarA, abrogates CarA-DNA binding, and thereby derepresses P(B). In this study, we delineate the operator design that exists for CarA by precisely mapping out the second operator element. For this, we examined how stepwise deletions and site-directed mutagenesis in the region between the palindrome and the transcription start site affect CarA binding around P(B) in vitro and expression of P(B) in vivo. These revealed the second operator element to be an imperfect interrupted palindrome (pII) spanning positions -26 to -40. In vitro assays using purified M. xanthus RNA polymerase showed that CarA abolishes P(B)-RNA polymerase binding and runoff transcription and that both were restored by CarS, thus rationalizing the observations in vivo. CarA binding to pII (after association with pI) effectively occludes RNA polymerase from P(B) and so provides the operative mechanism for the repression of the carB operon by CarA. The bipartite operator design, whereby transcription is blocked by the low affinity CarA-pII binding and is readily restored by CarS, may have evolved to match the needs for a rapid and an effective response to light.

  1. Fatty acids from membrane lipids become incorporated into lipid bodies during Myxococcus xanthus differentiation.

    PubMed

    Bhat, Swapna; Boynton, Tye O; Pham, Dan; Shimkets, Lawrence J

    2014-01-01

    Myxococcus xanthus responds to amino acid limitation by producing fruiting bodies containing dormant spores. During development, cells produce triacylglycerides in lipid bodies that become consumed during spore maturation. As the cells are starved to induce development, the production of triglycerides represents a counterintuitive metabolic switch. In this paper, lipid bodies were quantified in wild-type strain DK1622 and 33 developmental mutants at the cellular level by measuring the cross sectional area of the cell stained with the lipophilic dye Nile red. We provide five lines of evidence that triacylglycerides are derived from membrane phospholipids as cells shorten in length and then differentiate into myxospores. First, in wild type cells, lipid bodies appear early in development and their size increases concurrent with an 87% decline in membrane surface area. Second, developmental mutants blocked at different stages of shortening and differentiation accumulated lipid bodies proportionate with their cell length with a Pearson's correlation coefficient of 0.76. Third, peripheral rods, developing cells that do not produce lipid bodies, fail to shorten. Fourth, genes for fatty acid synthesis are down-regulated while genes for fatty acid degradation are up regulated. Finally, direct movement of fatty acids from membrane lipids in growing cells to lipid bodies in developing cells was observed by pulse labeling cells with palmitate. Recycling of lipids released by Programmed Cell Death appears not to be necessary for lipid body production as a fadL mutant was defective in fatty acid uptake but proficient in lipid body production. The lipid body regulon involves many developmental genes that are not specifically involved in fatty acid synthesis or degradation. MazF RNA interferase and its target, enhancer-binding protein Nla6, appear to negatively regulate cell shortening and TAG accumulation whereas most cell-cell signals activate these processes.

  2. Molecular cloning and characterization of two genes for the biotin carboxylase and carboxyltransferase subunits of acetyl coenzyme A carboxylase in Myxococcus xanthus.

    PubMed

    Kimura, Y; Miyake, R; Tokumasu, Y; Sato, M

    2000-10-01

    We have cloned a DNA fragment from a genomic library of Myxococcus xanthus using an oligonucleotide probe representing conserved regions of biotin carboxylase subunits of acetyl coenzyme A (acetyl-CoA) carboxylases. The fragment contained two open reading frames (ORF1 and ORF2), designated the accB and accA genes, capable of encoding a 538-amino-acid protein of 58.1 kDa and a 573-amino-acid protein of 61.5 kDa, respectively. The protein (AccA) encoded by the accA gene was strikingly similar to biotin carboxylase subunits of acetyl-CoA and propionyl-CoA carboxylases and of pyruvate carboxylase. The putative motifs for ATP binding, CO(2) fixation, and biotin binding were found in AccA. The accB gene was located upstream of the accA gene, and they formed a two-gene operon. The protein (AccB) encoded by the accB gene showed high degrees of sequence similarity with carboxyltransferase subunits of acetyl-CoA and propionyl-CoA carboxylases and of methylmalonyl-CoA decarboxylase. Carboxybiotin-binding and acyl-CoA-binding domains, which are conserved in several carboxyltransferase subunits of acyl-CoA carboxylases, were found in AccB. An accA disruption mutant showed a reduced growth rate and reduced acetyl-CoA carboxylase activity compared with the wild-type strain. Western blot analysis indicated that the product of the accA gene was a biotinylated protein that was expressed during the exponential growth phase. Based on these results, we propose that this M. xanthus acetyl-CoA carboxylase consists of two subunits, which are encoded by the accB and accA genes, and occupies a position between prokaryotic and eukaryotic acetyl-CoA carboxylases in terms of evolution.

  3. Colony Expansion of Socially Motile Myxococcus xanthus Cells Is Driven by Growth, Motility, and Exopolysaccharide Production

    PubMed Central

    Patra, Pintu; Kissoon, Kimberley; Cornejo, Isabel; Kaplan, Heidi B.; Igoshin, Oleg A.

    2016-01-01

    Myxococcus xanthus, a model organism for studies of multicellular behavior in bacteria, moves exclusively on solid surfaces using two distinct but coordinated motility mechanisms. One of these, social (S) motility is powered by the extension and retraction of type IV pili and requires the presence of exopolysaccharides (EPS) produced by neighboring cells. As a result, S motility requires close cell-to-cell proximity and isolated cells do not translocate. Previous studies measuring S motility by observing the colony expansion of cells deposited on agar have shown that the expansion rate increases with initial cell density, but the biophysical mechanisms involved remain largely unknown. To understand the dynamics of S motility-driven colony expansion, we developed a reaction-diffusion model describing the effects of cell density, EPS deposition and nutrient exposure on the expansion rate. Our results show that at steady state the population expands as a traveling wave with a speed determined by the interplay of cell motility and growth, a well-known characteristic of Fisher’s equation. The model explains the density-dependence of the colony expansion by demonstrating the presence of a lag phase–a transient period of very slow expansion with a duration dependent on the initial cell density. We propose that at a low initial density, more time is required for the cells to accumulate enough EPS to activate S-motility resulting in a longer lag period. Furthermore, our model makes the novel prediction that following the lag phase the population expands at a constant rate independent of the cell density. These predictions were confirmed by S motility experiments capturing long-term expansion dynamics. PMID:27362260

  4. Colony Expansion of Socially Motile Myxococcus xanthus Cells Is Driven by Growth, Motility, and Exopolysaccharide Production.

    PubMed

    Patra, Pintu; Kissoon, Kimberley; Cornejo, Isabel; Kaplan, Heidi B; Igoshin, Oleg A

    2016-06-01

    Myxococcus xanthus, a model organism for studies of multicellular behavior in bacteria, moves exclusively on solid surfaces using two distinct but coordinated motility mechanisms. One of these, social (S) motility is powered by the extension and retraction of type IV pili and requires the presence of exopolysaccharides (EPS) produced by neighboring cells. As a result, S motility requires close cell-to-cell proximity and isolated cells do not translocate. Previous studies measuring S motility by observing the colony expansion of cells deposited on agar have shown that the expansion rate increases with initial cell density, but the biophysical mechanisms involved remain largely unknown. To understand the dynamics of S motility-driven colony expansion, we developed a reaction-diffusion model describing the effects of cell density, EPS deposition and nutrient exposure on the expansion rate. Our results show that at steady state the population expands as a traveling wave with a speed determined by the interplay of cell motility and growth, a well-known characteristic of Fisher's equation. The model explains the density-dependence of the colony expansion by demonstrating the presence of a lag phase-a transient period of very slow expansion with a duration dependent on the initial cell density. We propose that at a low initial density, more time is required for the cells to accumulate enough EPS to activate S-motility resulting in a longer lag period. Furthermore, our model makes the novel prediction that following the lag phase the population expands at a constant rate independent of the cell density. These predictions were confirmed by S motility experiments capturing long-term expansion dynamics.

  5. A genetic screen in Myxococcus xanthus identifies mutants that uncouple outer membrane exchange from a downstream cellular response.

    PubMed

    Dey, Arup; Wall, Daniel

    2014-12-01

    Upon physical contact with sibling cells, myxobacteria transiently fuse their outer membranes (OMs) and exchange OM proteins and lipids. From previous work, TraA and TraB were identified to be essential factors for OM exchange (OME) in donor and recipient cells. To define the genetic complexity of OME, we carried out a comprehensive forward genetic screen. The screen was based on the observation that Myxococcus xanthus nonmotile cells, by a Tra-dependent mechanism, block swarm expansion of motile cells when mixed. Thus, mutants defective in OME or a downstream responsive pathway were readily identified as escape flares from mixed inocula seeded on agar. This screen was surprisingly powerful, as we found >50 mutants defective in OME. Importantly, all of the mutations mapped to the traAB operon, suggesting that there may be few, if any, proteins besides TraA and TraB directly required for OME. We also found a second and phenotypically different class of mutants that exhibited wild-type OME but were defective in a responsive pathway. This pathway is postulated to control inner membrane homeostasis by covalently attaching amino acids to phospholipids. The identified proteins are homologous to the Staphylococcus aureus MprF protein, which is involved in membrane adaptation and antibiotic resistance. Interestingly, we also found that a small number of nonmotile cells were sufficient to block the swarming behavior of a large gliding-proficient population. This result suggests that an OME-derived signal could be amplified from a few nonmotile producers to act on many responder cells. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  6. The groEL2 gene, but not groEL1, is required for biosynthesis of the secondary metabolite myxovirescin in Myxococcus xanthus DK1622.

    PubMed

    Wang, Yan; Li, Xi; Zhang, Wenyan; Zhou, Xiuwen; Li, Yue-zhong

    2014-03-01

    Myxococcus xanthus DK1622 possesses two copies of the groEL gene: groEL1, which participates in development, and groEL2, which is involved in the predatory ability of cells. In this study, we determined that the groEL2 gene is required for the biosynthesis of the secondary metabolite myxovirescin (TA), which plays essential roles in predation. The groEL2-knockout mutant strain was defective in producing a zone of inhibition and displayed decreased killing ability against Escherichia coli, while the groEL1-knockout mutant strain exhibited little difference from the wild-type strain DK1622. HPLC revealed that deletion of the groEL2 gene blocked the production of TA, which was present in the groEL1-knockout mutant. The addition of exogenous TA rescued the inhibition and killing abilities of the groEL2-knockout mutant against E. coli. Analysis of GroEL domain-swapping mutants indicated that the C-terminal equatorial domain of GroEL2 was essential for TA production, while the N-terminal equatorial or apical domains of GroEL2 were not sufficient to rescue TA production of the groEL2 knockout.

  7. In depth analysis of the mechanism of action of metal-dependent sigma factors: characterization of CorE2 from Myxococcus xanthus

    PubMed Central

    Marcos-Torres, Francisco Javier; Pérez, Juana; Gómez-Santos, Nuria; Moraleda-Muñoz, Aurelio; Muñoz-Dorado, José

    2016-01-01

    Extracytoplasmic function sigma factors represent the third pillar of signal-transduction mechanisms in bacteria. The variety of stimuli they recognize and mechanisms of action they use have allowed their classification into more than 50 groups. We have characterized CorE2 from Myxococcus xanthus, which belongs to group ECF44 and upregulates the expression of two genes when it is activated by cadmium and zinc. Sigma factors of this group contain a Cys-rich domain (CRD) at the C terminus which is essential for detecting metals. Point mutations at the six Cys residues of the CRD have revealed the contribution of each residue to CorE2 activity. Some of them are essential, while others are either dispensable or their mutations only slightly affect the activity of the protein. However, importantly, mutation of Cys174 completely shifts the specificity of CorE2 from cadmium to copper, indicating that the Cys arrangement of the CRD determines the metal specificity. Moreover, the conserved CxC motif located between the σ2 domain and the σ4.2 region has also been found to be essential for activity. The results presented here contribute to our understanding of the mechanism of action of metal-dependent sigma factors and help to define new common features of the members of this group of regulators. PMID:26951374

  8. DifA, a methyl-accepting chemoreceptor protein-like sensory protein, uses a novel signaling mechanism to regulate exopolysaccharide production in Myxococcus xanthus.

    PubMed

    Xu, Qian; Black, Wesley P; Nascimi, Heidi M; Yang, Zhaomin

    2011-02-01

    DifA is a methyl-accepting chemotaxis protein (MCP)-like sensory transducer that regulates exopolysaccharide (EPS) production in Myxococcus xanthus. Here mutational analysis and molecular biology were used to probe the signaling mechanisms of DifA in EPS regulation. We first identified the start codon of DifA experimentally; this identification extended the N terminus of DifA for 45 amino acids (aa) from the previous bioinformatics prediction. This extension helped to address the outstanding question of how DifA receives input signals from type 4 pili without a prominent periplasmic domain. The results suggest that DifA uses its N-terminus extension to sense an upstream signal in EPS regulation. We suggest that the perception of the input signal by DifA is mediated by protein-protein interactions with upstream components. Subsequent signal transmission likely involves transmembrane signaling instead of direct intramolecular interactions between the input and the output modules in the cytoplasm. The basic functional unit of DifA for signal transduction is likely dimeric as mutational alteration of the predicted dimeric interface of DifA significantly affected EPS production. Deletions of 14-aa segments in the C terminus suggest that the newly defined flexible bundle subdomain in MCPs is likely critical for DifA function because shortening of this bundle can lead to constitutively active mutations.

  9. Gliding Motility Revisited: How Do the Myxobacteria Move without Flagella?

    PubMed Central

    Mauriello, Emilia M. F.; Mignot, Tâm; Yang, Zhaomin; Zusman, David R.

    2010-01-01

    Summary: In bacteria, motility is important for a wide variety of biological functions such as virulence, fruiting body formation, and biofilm formation. While most bacteria move by using specialized appendages, usually external or periplasmic flagella, some bacteria use other mechanisms for their movements that are less well characterized. These mechanisms do not always exhibit obvious motility structures. Myxococcus xanthus is a motile bacterium that does not produce flagella but glides slowly over solid surfaces. How M. xanthus moves has remained a puzzle that has challenged microbiologists for over 50 years. Fortunately, recent advances in the analysis of motility mutants, bioinformatics, and protein localization have revealed likely mechanisms for the two M. xanthus motility systems. These results are summarized in this review. PMID:20508248

  10. Myxococcus CsgA, Drosophila Sniffer, and human HSD10 are cardiolipin phospholipases

    PubMed Central

    Boynton, Tye O'Hara; Shimkets, Lawrence Joseph

    2015-01-01

    Myxococcus xanthus development requires CsgA, a member of the short-chain alcohol dehydrogenase (SCAD) family of proteins. We show that CsgA and SocA, a protein that can replace CsgA function in vivo, oxidize the 2′-OH glycerol moiety on cardiolipin and phosphatidylglycerol to produce diacylglycerol (DAG), dihydroxyacetone, and orthophosphate. A lipid extract enriched in DAGs from wild-type cells initiates development and lipid body production in a csgA mutant to bypass the mutational block. This novel phospholipase C-like reaction is widespread. SCADs that prevent neurodegenerative disorders, such as Drosophila Sniffer and human HSD10, oxidize cardiolipin with similar kinetic parameters. HSD10 exhibits a strong preference for cardiolipin with oxidized fatty acids. This activity is inhibited in the presence of the amyloid β peptide. Three HSD10 variants associated with neurodegenerative disorders are inactive with cardiolipin. We suggest that HSD10 protects humans from reactive oxygen species by removing damaged cardiolipin before it induces apoptosis. PMID:26338420

  11. Myxococcus CsgA, Drosophila Sniffer, and human HSD10 are cardiolipin phospholipases.

    PubMed

    Boynton, Tye O'Hara; Shimkets, Lawrence Joseph

    2015-09-15

    Myxococcus xanthus development requires CsgA, a member of the short-chain alcohol dehydrogenase (SCAD) family of proteins. We show that CsgA and SocA, a protein that can replace CsgA function in vivo, oxidize the 2'-OH glycerol moiety on cardiolipin and phosphatidylglycerol to produce diacylglycerol (DAG), dihydroxyacetone, and orthophosphate. A lipid extract enriched in DAGs from wild-type cells initiates development and lipid body production in a csgA mutant to bypass the mutational block. This novel phospholipase C-like reaction is widespread. SCADs that prevent neurodegenerative disorders, such as Drosophila Sniffer and human HSD10, oxidize cardiolipin with similar kinetic parameters. HSD10 exhibits a strong preference for cardiolipin with oxidized fatty acids. This activity is inhibited in the presence of the amyloid β peptide. Three HSD10 variants associated with neurodegenerative disorders are inactive with cardiolipin. We suggest that HSD10 protects humans from reactive oxygen species by removing damaged cardiolipin before it induces apoptosis. © 2015 Boynton and Shimkets; Published by Cold Spring Harbor Laboratory Press.

  12. Complete Genome Sequence and Comparative Genomics of a Novel Myxobacterium Myxococcus hansupus

    PubMed Central

    Sharma, Gaurav; Narwani, Tarun; Subramanian, Srikrishna

    2016-01-01

    Myxobacteria, a group of Gram-negative aerobes, belong to the class δ-proteobacteria and order Myxococcales. Unlike anaerobic δ-proteobacteria, they exhibit several unusual physiogenomic properties like gliding motility, desiccation-resistant myxospores and large genomes with high coding density. Here we report a 9.5 Mbp complete genome of Myxococcus hansupus that encodes 7,753 proteins. Phylogenomic and genome-genome distance based analysis suggest that Myxococcus hansupus is a novel member of the genus Myxococcus. Comparative genome analysis with other members of the genus Myxococcus was performed to explore their genome diversity. The variation in number of unique proteins observed across different species is suggestive of diversity at the genus level while the overrepresentation of several Pfam families indicates the extent and mode of genome expansion as compared to non-Myxococcales δ-proteobacteria. PMID:26900859

  13. Uncovering the Mystery of Gliding Motility in the Myxobacteria

    PubMed Central

    Nan, Beiyan; Zusman, David R.

    2012-01-01

    Bacterial gliding motility is the smooth movement of cells on solid surfaces unaided by flagella or pili. Many diverse groups of bacteria exhibit gliding, but the mechanism of gliding motility has remained a mystery since it was first observed more than a century ago. Recent studies on the motility of Myxococcus xanthus, a soil myxobacterium, suggest a likely mechanism for gliding in this organism. About forty M. xanthus genes were shown to be involved in gliding motility, and some of their protein products were labeled and localized within cells. These studies suggest that gliding motility in M. xanthus involves large multiprotein structural complexes, regulatory proteins, and cytoskeletal filaments. In this review, we summarize recent experiments that provide the basis for this emerging view of M. xanthus motility. We also discuss alternative models for gliding. PMID:21910630

  14. Bacterial motility complexes require the actin-like protein, MreB and the Ras homologue, MglA.

    PubMed

    Mauriello, Emilia M F; Mouhamar, Fabrice; Nan, Beiyan; Ducret, Adrien; Dai, David; Zusman, David R; Mignot, Tâm

    2010-01-20

    Gliding motility in the bacterium Myxococcus xanthus uses two motility engines: S-motility powered by type-IV pili and A-motility powered by uncharacterized motor proteins and focal adhesion complexes. In this paper, we identified MreB, an actin-like protein, and MglA, a small GTPase of the Ras superfamily, as essential for both motility systems. A22, an inhibitor of MreB cytoskeleton assembly, reversibly inhibited S- and A-motility, causing rapid dispersal of S- and A-motility protein clusters, FrzS and AglZ. This suggests that the MreB cytoskeleton is involved in directing the positioning of these proteins. We also found that a DeltamglA motility mutant showed defective localization of AglZ and FrzS clusters. Interestingly, MglA-YFP localization mimicked both FrzS and AglZ patterns and was perturbed by A22 treatment, consistent with results indicating that both MglA and MreB bind to motility complexes. We propose that MglA and the MreB cytoskeleton act together in a pathway to localize motility proteins such as AglZ and FrzS to assemble the A-motility machineries. Interestingly, M. xanthus motility systems, like eukaryotic systems, use an actin-like protein and a small GTPase spatial regulator.

  15. Bacterial motility complexes require the actin-like protein, MreB and the Ras homologue, MglA

    PubMed Central

    Mauriello, Emilia M F; Mouhamar, Fabrice; Nan, Beiyan; Ducret, Adrien; Dai, David; Zusman, David R; Mignot, Tâm

    2010-01-01

    Gliding motility in the bacterium Myxococcus xanthus uses two motility engines: S-motility powered by type-IV pili and A-motility powered by uncharacterized motor proteins and focal adhesion complexes. In this paper, we identified MreB, an actin-like protein, and MglA, a small GTPase of the Ras superfamily, as essential for both motility systems. A22, an inhibitor of MreB cytoskeleton assembly, reversibly inhibited S- and A-motility, causing rapid dispersal of S- and A-motility protein clusters, FrzS and AglZ. This suggests that the MreB cytoskeleton is involved in directing the positioning of these proteins. We also found that a ΔmglA motility mutant showed defective localization of AglZ and FrzS clusters. Interestingly, MglA–YFP localization mimicked both FrzS and AglZ patterns and was perturbed by A22 treatment, consistent with results indicating that both MglA and MreB bind to motility complexes. We propose that MglA and the MreB cytoskeleton act together in a pathway to localize motility proteins such as AglZ and FrzS to assemble the A-motility machineries. Interestingly, M. xanthus motility systems, like eukaryotic systems, use an actin-like protein and a small GTPase spatial regulator. PMID:19959988

  16. Implementation of the agmatine-controlled expression system for inducible gene expression in Lactococcus lactis.

    PubMed

    Linares, Daniel M; Alvarez-Sieiro, Patricia; del Rio, Beatriz; Ladero, Victor; Redruello, Begoña; Martin, Ma Cruz; Fernandez, Maria; Alvarez, Miguel A

    2015-12-30

    Lactococcus lactis has been safely consumed in fermented foods for millennia. This Gram-positive bacterium has now become of industrial importance as an expression host for the overproduction of lipopolysaccharide-free recombinant proteins used as food ingredients, therapeutic proteins and biotechnological enzymes. This paper reports an agmatine-controlled expression (ACE) system for L. lactis, comprising the lactococcal agmatine-sensor/transcriptional activator AguR and its target promoter P(aguB). The usefulness and efficiency of this system was checked via the reporter gene gfp and by producing PEP (Myxococcus xanthus prolyl-endopeptidase), an enzyme of biomedical interest able to degrade the immunotoxic peptides produced during the gastrointestinal breakdown of gluten. The ACE system developed in this work was suitable for the efficient expression of the functional recombinant proteins GFP and PEP. The expression system was tightly regulated by the agmatine concentration and allowed high protein production without leakiness.

  17. Localization of a bacterial cytoplasmic receptor is dynamic and changes with cell-cell contacts

    PubMed Central

    Mauriello, Emilia M. F.; Astling, David P.; Sliusarenko, Oleksii; Zusman, David R.

    2009-01-01

    Directional motility in the gliding bacterium Myxococcus xanthus requires controlled cell reversals mediated by the Frz chemosensory system. FrzCD, a cytoplasmic chemoreceptor, does not form membrane-bound polar clusters typical for most bacteria, but rather cytoplasmic clusters that appear helically arranged and span the cell length. The distribution of FrzCD in living cells was found to be dynamic: FrzCD was localized in clusters that continuously changed their size, number, and position. The number of FrzCD clusters was correlated with cellular reversal frequency: fewer clusters were observed in hypo-reversing mutants and additional clusters were observed in hyper-reversing mutants. When moving cells made side-to-side contacts, FrzCD clusters in adjacent cells showed transient alignments. These events were frequently followed by one of the interacting cells reversing. These observations suggest that FrzCD detects signals from a cell contact-sensitive signaling system and then re-localizes as it directs reversals to distributed motility engines. PMID:19273862

  18. Bacterial Polymertropism, the Response to Strain-Induced Alignment of Polymers

    NASA Astrophysics Data System (ADS)

    Lemon, David J.

    In nature, bacteria often live in surface-associated communities known as biofilms. Biofilm-forming bacteria deposit a layer of polysaccharide on the surfaces they inhabit; hence, polysaccharide is their immediate environment on any surface. In this study, we examined how the physical characteristics of polysaccharide substrates influence the behavior of the biofilm-forming bacterium Myxococcus xanthus. M. xanthus colonies, and indeed those of the majority of biofilm-forming species tested, respond to the compression-induced deformation of polysaccharide substrates by preferentially spreading across the surface perpendicular to the axis of compression. This response is conserved across multiple distantly related phyla and is found in species with an array of distinct motility apparatuses.The birefringence and small angle X-ray scattering patterns of compressed polysaccharide substrates indicate that the directed surface movements of these bacteria consistently match the orientation of the long axes of aligned and tightly packed polysaccharide fibers in compressed substrates. Therefore, we refer to this behavior as polymertropism to denote that the directed movements are a response to the physical arrangement of the change in packing and alignment of the polymers in the substrate. In addition to altering the colony morphology we find the behavior of groups of cells, called flares, is also affected in several species resulting in increased flare speed, duration, and displacement on compressed gel substrates.We suggest that polymertropism, which requires a downward-facing motility apparatus in M. xanthus, may be responsible for the observed tendency of bacterial cells to follow trails of extruded and presumably aligned polysaccharides, which their neighbors secrete and deposit on the substrate as they move across it. Polymertropism may also play a role in the organization of bacteria in a biofilm, as the iterative process of polysaccharide trail deposition and

  19. Exopolysaccharide microchannels direct bacterial motility and organize multicellular behavior

    DOE PAGES

    Berleman, James E.; Zemla, Marcin; Remis, Jonathan P.; ...

    2016-05-06

    The myxobacteria are a family of soil bacteria that form biofilms of complex architecture, aligned multilayered swarms or fruiting body structures that are simple or branched aggregates containing myxospores. Here, we examined the structural role of matrix exopolysaccharide (EPS) in the organization of these surface-dwelling bacterial cells. Using time-lapse light and fluorescence microscopy, as well as transmission electron microscopy and focused ion beam/scanning electron microscopy (FIB/SEM) electron microscopy, we found that Myxococcus xanthus cell organization in biofilms is dependent on the formation of EPS microchannels. Cells are highly organized within the three-dimensional structure of EPS microchannels that are required formore » cell alignment and advancement on surfaces. Mutants lacking EPS showed a lack of cell orientation and poor colony migration. Purified, cell-free EPS retains a channel-like structure, and can complement EPS - mutant motility defects. In addition, EPS provides the cooperative structure for fruiting body formation in both the simple mounds of M. xanthus and the complex, tree-like structures of Chondromyces crocatus. We furthermore investigated the possibility that EPS impacts community structure as a shared resource facilitating cooperative migration among closely related isolates of M. xanthus.« less

  20. Social complementation and growth advantages promote socially defective bacterial isolates.

    PubMed

    Kraemer, Susanne A; Velicer, Gregory J

    2014-04-22

    Social interactions among diverse individuals that encounter one another in nature have often been studied among animals but rarely among microbes. For example, the evolutionary forces that determine natural frequencies of bacteria that express cooperative behaviours at low levels remain poorly understood. Natural isolates of the soil bacterium Myxococcus xanthus sampled from the same fruiting body often vary in social phenotypes, such as group swarming and multicellular development. Here, we tested whether genotypes highly proficient at swarming or development might promote the persistence of less socially proficient genotypes from the same fruiting body. Fast-swarming strains complemented slower isolates, allowing the latter to keep pace with faster strains in mixed groups. During development, one low-sporulating strain was antagonized by high sporulators, whereas others with severe developmental defects had those defects partially complemented by high-sporulating strains. Despite declining in frequency overall during competition experiments spanning multiple cycles of development, developmentally defective strains exhibited advantages during the growth phases of competitions. These results suggest that microbes with low-sociality phenotypes often benefit from interacting with more socially proficient strains. Such complementation may combine with advantages at other traits to increase equilibrium frequencies of low-sociality genotypes in natural populations.

  1. Bacterially mediated mineralization of vaterite

    NASA Astrophysics Data System (ADS)

    Rodriguez-Navarro, Carlos; Jimenez-Lopez, Concepcion; Rodriguez-Navarro, Alejandro; Gonzalez-Muñoz, Maria Teresa; Rodriguez-Gallego, Manuel

    2007-03-01

    Myxococcus xanthus, a common soil bacterium, plays an active role in the formation of spheroidal vaterite. Bacterial production of CO 2 and NH 3 and the transformation of the NH 3 to NH4+ and OH -, thus increasing solution pH and carbonate alkalinity, set the physicochemical conditions (high supersaturation) leading to vaterite precipitation in the microenvironment around cells, and directly onto the surface of bacterial cells. In the latter case, fossilization of bacteria occurs. Vaterite crystals formed by aggregation of oriented nanocrystals with c-axis normal to the bacterial cell-wall, or to the core of the spherulite when bacteria were not encapsulated. While preferred orientation of vaterite c-axis appears to be determined by electrostatic affinity (ionotropic effect) between vaterite crystal (0001) planes and the negatively charged functional groups of organic molecules on the bacterium cell-wall or on extracellular polymeric substances (EPS), analysis of the changes in the culture medium chemistry as well as high resolution transmission electron microscopy (HRTEM) observations point to polymorph selection by physicochemical (kinetic) factors (high supersaturation) and stabilization by organics, both connected with bacterial activity. The latter is in agreement with inorganic precipitation of vaterite induced by NH 3 and CO 2 addition in the protein-rich sterile culture medium. Our results as well as recent studies on vaterite precipitation in the presence of different types of bacteria suggest that bacterially mediated vaterite precipitation is not strain-specific, and could be more common than previously thought.

  2. Reversals and collisions optimize protein exchange in bacterial swarms

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Amiri, Aboutaleb; Harvey, Cameron; Buchmann, Amy

    Swarming groups of bacteria coordinate their behavior by self-organizing as a population to move over surfaces in search of nutrients and optimal niches for colonization. Many open questions remain about the cues used by swarming bacteria to achieve this self-organization. While chemical cue signaling known as quorum sensing is well-described, swarming bacteria often act and coordinate on time scales that could not be achieved via these extracellular quorum sensing cues. Here, cell-cell contact-dependent protein exchange is explored as amechanism of intercellular signaling for the bacterium Myxococcus xanthus. A detailed biologically calibrated computational model is used to study how M. xanthusmore » optimizes the connection rate between cells and maximizes the spread of an extracellular protein within the population. The maximum rate of protein spreading is observed for cells that reverse direction optimally for swarming. Cells that reverse too slowly or too fast fail to spread extracellular protein efficiently. In particular, a specific range of cell reversal frequencies was observed to maximize the cell-cell connection rate and minimize the time of protein spreading. Furthermore, our findings suggest that predesigned motion reversal can be employed to enhance the collective behavior of biological synthetic active systems.« less

  3. Interspecies conflict affects RNA expression.

    PubMed

    Whitworth, David E

    2018-05-01

    Predation is an extreme form of competition between bacteria, involving the secretion of antimicrobial substances by predators, often packaged within outer membrane vesicles (OMVs). Recent studies into the Myxococcus xanthus/Escherichia coli predator/prey relationship have illuminated transcriptional changes during predation, identifying likely targets of predatory attack in the prey and nutrient assimilation strategies of the predator. Abundant non-coding RNAs can be observed in the predator and prey transcriptomes, with evidence of predation-dependent regulation of RNA levels. Given the observed secretion of regulatory RNAs within OMVs by bacteria, it will next be exciting to test whether the intercellular trafficking of regulatory RNAs is employed by predator and/or prey in their survival struggles.

  4. Division of Labor in Biofilms: the Ecology of Cell Differentiation.

    PubMed

    van Gestel, Jordi; Vlamakis, Hera; Kolter, Roberto

    2015-04-01

    The dense aggregation of cells on a surface, as seen in biofilms, inevitably results in both environmental and cellular heterogeneity. For example, nutrient gradients can trigger cells to differentiate into various phenotypic states. Not only do cells adapt physiologically to the local environmental conditions, but they also differentiate into cell types that interact with each other. This allows for task differentiation and, hence, the division of labor. In this article, we focus on cell differentiation and the division of labor in three bacterial species: Myxococcus xanthus, Bacillus subtilis, and Pseudomonas aeruginosa. During biofilm formation each of these species differentiates into distinct cell types, in some cases leading to cooperative interactions. The division of labor and the cooperative interactions between cell types are assumed to yield an emergent ecological benefit. Yet in most cases the ecological benefits have yet to be elucidated. A notable exception is M. xanthus, in which cell differentiation within fruiting bodies facilitates the dispersal of spores. We argue that the ecological benefits of the division of labor might best be understood when we consider the dynamic nature of both biofilm formation and degradation.

  5. Bioconservation of deteriorated monumental calcarenite stone and identification of bacteria with carbonatogenic activity.

    PubMed

    Jroundi, Fadwa; Fernández-Vivas, Antonia; Rodriguez-Navarro, Carlos; Bedmar, Eulogio J; González-Muñoz, María Teresa

    2010-07-01

    The deterioration of the stone built and sculptural heritage has prompted the search and development of novel consolidation/protection treatments that can overcome the limitations of traditional ones. Attention has been drawn to bioconservation, particularly bacterial carbonatogenesis (i.e. bacterially induced calcium carbonate precipitation), as a new environmentally friendly effective conservation strategy, especially suitable for carbonate stones. Here, we study the effects of an in situ bacterial bioconsolidation treatment applied on porous limestone (calcarenite) in the sixteenth century San Jeronimo Monastery in Granada, Spain. The treatment consisted in the application of a nutritional solution (with and without Myxococcus xanthus inoculation) on decayed calcarenite stone blocks. The treatment promoted the development of heterotrophic bacteria able to induce carbonatogenesis. Both the consolidation effect of the treatment and the response of the culturable bacterial community present in the decayed stone were evaluated. A significant surface strengthening (consolidation) of the stone, without altering its surface appearance or inducing any detrimental side effect, was achieved upon application of the nutritional solution. The treatment efficacy was independent of the presence of M. xanthus (which is known as an effective carbonatogenic bacterium). The genetic diversity of 116 bacterial strains isolated from the stone, of which 113 strains showed carbonatogenic activity, was analysed by repetitive extragenic palindromic-polymerase chain reaction (REP-PCR) and 16S rRNA gene sequencing. The strains were distributed into 31 groups on the basis of their REP-PCR patterns, and a representative strain of each group was subjected to 16S rRNA gene sequencing. Analysis of these sequences showed that isolates belong to a wide variety of phylogenetic groups being closely related to species of 15 genera within the Proteobacteria, Firmicutes and the Actinobacteria. This

  6. Mycoplasma pneumoniae, an Underutilized Model for Bacterial Cell Biology

    PubMed Central

    2014-01-01

    In recent decades, bacterial cell biology has seen great advances, and numerous model systems have been developed to study a wide variety of cellular processes, including cell division, motility, assembly of macromolecular structures, and biogenesis of cell polarity. Considerable attention has been given to these model organisms, which include Escherichia coli, Bacillus subtilis, Caulobacter crescentus, and Myxococcus xanthus. Studies of these processes in the pathogenic bacterium Mycoplasma pneumoniae and its close relatives have also been carried out on a smaller scale, but this work is often overlooked, in part due to this organism's reputation as minimalistic and simple. In this minireview, I discuss recent work on the role of the M. pneumoniae attachment organelle (AO), a structure required for adherence to host cells, in these processes. The AO is constructed from proteins that generally lack homology to those found in other organisms, and this construction occurs in coordination with cell cycle events. The proteins of the M. pneumoniae AO share compositional features with proteins with related roles in model organisms. Once constructed, the AO becomes activated for its role in a form of gliding motility whose underlying mechanism appears to be distinct from that of other gliding bacteria, including Mycoplasma mobile. Together with the FtsZ cytoskeletal protein, motility participates in the cell division process. My intention is to bring this deceptively complex organism into alignment with the better-known model systems. PMID:25157081

  7. Laboratory measurements of biomarkers and individual performances in Chironomus xanthus to evaluate pesticide contamination of sediments in a river of southeastern Brazil.

    PubMed

    Printes, Liane Biehl; Fernandes, Marisa Narciso; Espíndola, Evaldo Luiz Gaeta

    2011-03-01

    This study aimed at evaluating biomarkers, individual and population responses in the native Chironomus xanthus to assess the toxicity of pesticide-contaminated sediments from the Monjolinho River (Southeast Brazil). We measured cholinesterase (ChE) and glutathione S-transferase activities (GST), as biomarkers and survival, individual growth and adult emergence, as individual performances. There was no response of the ChE activity and a tendency to decreased GST activity in contaminated sites, but this was generally not statistically significant. Therefore, there was no association of the biomarker responses with exposure to sediment containing pesticides. In contrast, ash free dry mass was significantly increased and male emergence was decreased in C. xanthus exposed to the same sediments. In conclusion, the selected biomarkers were not sensitive and specific enough to detect and anticipate effects of pesticide contamination at the levels measured in the study area. Nevertheless, individual performances alterations pointed to potential pollution problems and possible ecological consequences. Copyright © 2010 Elsevier Inc. All rights reserved.

  8. An evolutionary link between capsular biogenesis and surface motility in bacteria.

    PubMed

    Agrebi, Rym; Wartel, Morgane; Brochier-Armanet, Céline; Mignot, Tâm

    2015-05-01

    Studying the evolution of macromolecular assemblies is important to improve our understanding of how complex cellular structures evolved, and to identify the functional building blocks that are involved. Recent studies suggest that the macromolecular complexes that are involved in two distinct processes in Myxococcus xanthus - surface motility and sporulation - are derived from an ancestral polysaccharide capsule assembly system. In this Opinion article, we argue that the available data suggest that the motility machinery evolved from this capsule assembly system following a gene duplication event, a change in carbohydrate polymer specificity and the acquisition of additional proteins by the motility complex, all of which are key features that distinguish the motility and sporulation systems. Furthermore, the presence of intermediates of these systems in bacterial genomes suggests a testable evolutionary model for their emergence and spread.

  9. Generation of food-grade recombinant Lactobacillus casei delivering Myxococcus xanthus prolyl endopeptidase

    PubMed Central

    Alvarez-Sieiro, Patricia; Martin, Maria Cruz; Redruello, Begoña; del Rio, Beatriz; Ladero, Victor; Palanski, Brad A.; Khosla, Chaitan; Fernandez, Maria; Alvarez, Miguel A.

    2015-01-01

    Prolyl endopeptidases (PEP), a family of serine proteases with the ability to hydrolyze the peptide bond on the carboxyl side of an internal proline residue, are able to degrade immunotoxic peptides responsible for celiac disease (CD), such as a 33-residue gluten peptide (33-mer). Oral administration of PEP has been suggested as a potential therapeutic approach for CD, although delivery of the enzyme to the small intestine requires intrinsic gastric stability or advanced formulation technologies. We have engineered two food-grade Lactobacillus casei strains to deliver PEP in an in vitro model of small intestine environment. One strain secretes PEP into the extracellular medium, whereas the other retains PEP in the intracellular environment. The strain that secretes PEP into the extracellular medium is the most effective to degrade the 33-mer and is resistant to simulated gastrointestinal stress. Our results suggest that in a future, after more studies and clinical trials, an engineered food-grade Lactobacillus strain may be useful as a vector for in situ production of PEP in the upper small intestine of CD patients. PMID:24752841

  10. Wet-surface–enhanced ellipsometric contrast microscopy identifies slime as a major adhesion factor during bacterial surface motility

    PubMed Central

    Ducret, Adrien; Valignat, Marie-Pierre; Mouhamar, Fabrice; Mignot, Tâm; Theodoly, Olivier

    2012-01-01

    In biology, the extracellular matrix (ECM) promotes both cell adhesion and specific recognition, which is essential for central developmental processes in both eukaryotes and prokaryotes. However, live studies of the dynamic interactions between cells and the ECM, for example during motility, have been greatly impaired by imaging limitations: mostly the ability to observe the ECM at high resolution in absence of specific staining by live microscopy. To solve this problem, we developed a unique technique, wet-surface enhanced ellipsometry contrast (Wet-SEEC), which magnifies the contrast of transparent organic materials deposited on a substrate (called Wet-surf) with exquisite sensitivity. We show that Wet-SEEC allows both the observation of unprocessed nanofilms as low as 0.2 nm thick and their accurate 3D topographic reconstructions, directly by standard light microscopy. We next used Wet-SEEC to image slime secretion, a poorly defined property of many prokaryotic and eukaryotic organisms that move across solid surfaces in absence of obvious extracellular appendages (gliding). Using combined Wet-SEEC and fluorescent-staining experiments, we observed slime deposition by gliding Myxococcus xanthus cells at unprecedented resolution. Altogether, the results revealed that in this bacterium, slime associates preferentially with the outermost components of the motility machinery and promotes its adhesion to the substrate on the ventral side of the cell. Strikingly, analogous roles have been proposed for the extracellular proteoglycans of gliding diatoms and apicomplexa, suggesting that slime deposition is a general means for gliding organisms to adhere and move over surfaces. PMID:22665761

  11. Light-dependent gene regulation by a coenzyme B12-based photoreceptor

    PubMed Central

    Ortiz-Guerrero, Juan Manuel; Polanco, María Carmen; Murillo, Francisco J.; Padmanabhan, S.; Elías-Arnanz, Montserrat

    2011-01-01

    Cobalamin (B12) typically functions as an enzyme cofactor but can also regulate gene expression via RNA-based riboswitches. B12-directed gene regulatory mechanisms via protein factors have, however, remained elusive. Recently, we reported down-regulation of a light-inducible promoter in the bacterium Myxococcus xanthus by two paralogous transcriptional repressors, of which one, CarH, but not the other, CarA, absolutely requires B12 for activity even though both have a canonical B12-binding motif. Unanswered were what underlies this striking difference, what is the specific cobalamin used, and how it acts. Here, we show that coenzyme B12 (5′-deoxyadenosylcobalamin, AdoB12), specifically dictates CarH function in the dark and on exposure to light. In the dark, AdoB12-binding to the autonomous domain containing the B12-binding motif foments repressor oligomerization, enhances operator binding, and blocks transcription. Light, at various wavelengths at which AdoB12 absorbs, dismantles active repressor oligomers by photolysing the bound AdoB12 and weakens repressor–operator binding to allow transcription. By contrast, AdoB12 alters neither CarA oligomerization nor operator binding, thus accounting for its B12-independent activity. Our findings unveil a functional facet of AdoB12 whereby it serves as the chromophore of a unique photoreceptor protein class acting in light-dependent gene regulation. The prevalence of similar proteins of unknown function in microbial genomes suggests that this distinct B12-based molecular mechanism for photoregulation may be widespread in bacteria. PMID:21502508

  12. Molecular monitoring of the microbial dynamics occurring on historical limestone buildings during and after the in situ application of different bio-consolidation treatments

    PubMed Central

    Ettenauer, Jörg; Piñar, Guadalupe; Sterflinger, Katja; Gonzalez-Muñoz, Maria Teresa; Jroundi, Fadwa

    2011-01-01

    Microbially Induced Carbonate Precipitation is proposed as an environmentally friendly method to protect decayed ornamental stone and introduced in the field of preservation of Cultural Heritage. Recent conservation studies performed under laboratory conditions on non-sterile calcarenite stones have successfully reported on the application of a suitable nutritional solution, inoculated and non-inoculated with Myxococcus xanthus, as a bioconsolidation treatment. Furthermore, this procedure has been applied in situ, very recently, to selected historical buildings in Granada, Spain. For the first time, we evaluate the efficiency and risks of the in situ application of the above mentioned treatments onto two historical buildings in Granada. The evaluation consists of a detailed investigation of the micro-biota actively growing during the seven days of the treatments – short-term monitoring and of that remaining on the stones after six and twelve months of the application – long-term monitoring. A molecular strategy, including DNA extraction, PCR amplification of 16S rRNA sequences, construction of clone libraries and fingerprinting by DGGE (Denaturing Gradient Gel Electrophoresis) analysis followed by sequencing was used to gain insight into the microbial diversity present on the differentially treated stones. The monitoring of M. xanthus was performed by PCR using species-specific primers. Similar dynamics were triggered on both buildings by the application of the nutritional solution (inoculated or non-inoculated). 16S rDNA sequencing revealed the dominant occurrence of members belonging to the Firmicutes and Proteobacteria during the seven days of the treatment, whereas after one year the order Bacillales of the phylum Firmicutes was the predominantly detected microorganisms. M. xanthus could be detected only during the seven days of the treatment. The treatments seem to activate no dangerous microorganisms and furthermore, to select the remainder of a

  13. Single Upconversion Nanoparticle-Bacterium Cotrapping for Single-Bacterium Labeling and Analysis.

    PubMed

    Xin, Hongbao; Li, Yuchao; Xu, Dekang; Zhang, Yueli; Chen, Chia-Hung; Li, Baojun

    2017-04-01

    Detecting and analyzing pathogenic bacteria in an effective and reliable manner is crucial for the diagnosis of acute bacterial infection and initial antibiotic therapy. However, the precise labeling and analysis of bacteria at the single-bacterium level are a technical challenge but very important to reveal important details about the heterogeneity of cells and responds to environment. This study demonstrates an optical strategy for single-bacterium labeling and analysis by the cotrapping of single upconversion nanoparticles (UCNPs) and bacteria together. A single UCNP with an average size of ≈120 nm is first optically trapped. Both ends of a single bacterium are then trapped and labeled with single UCNPs emitting green light. The labeled bacterium can be flexibly moved to designated locations for further analysis. Signals from bacteria of different sizes are detected in real time for single-bacterium analysis. This cotrapping method provides a new approach for single-pathogenic-bacterium labeling, detection, and real-time analysis at the single-particle and single-bacterium level. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Use of microorganisms to improve the cementation of granular structures. Applications in the restoration of monuments

    NASA Astrophysics Data System (ADS)

    González, Isabel; Mayoral, Eduardo; Ortiz, Pilar; Segura, Dolores; Vazquez, Auxiliadora; Barba, Cinta; Ortiz, Rocio; Romero, Antonio

    2015-04-01

    This researching work focuses on the development of new procedures to be applied in heritage rehabilitation, through the implementation of low-cost biotechnological processes in the realm of engineering and architecture. In doing so, it explores the possibilities of MICP (Microbially Induced Calcite Precipitation), which is a biomineralization process applied to improve the engineering properties of granular structures. This is a novelty approach at present, as there are few researches putting together knowledge in biotechnology and mineralogy to by applied in architecture and engineer. Some authors propose the bacteria use to generate habitable structures that reduce desertification (Magnus Larsson 2008). Innovative research teams led by De Jong and the University of California UC Davis (XXXX) study how cement or stabilize soils to prevent landslides, improving the foundation injecting populations of Bacillus pasteurii in the field. Bacterially induced mineralization has emerged as a method for protecting and consolidating decayed ornamental stone, which offers noticeable advantages compared to traditional restoration procedures (Tiano et al., 1999). Castanier et al. (2000) found that Bacillus cereus was able to induce extracellular precipitation of calcium carbonate on decayed limestones. Rodriguez-Navarro et al. (2003) tested the ability of Myxococcus xanthus to induce calcium carbonate precipitation. Current studies are evaluating the potential of bacteria as self-healing agents for the autonomous decrease of permeability of concrete upon crack formation (De Muynck, et al 2010) In the urban area of Seville, most historical buildings are constructed with calcarenites, limestones, sandstones and bricks, the weathering forms associated to this building materials often are granular disintegration, so the proposed technology has a huge potential to be applied to these materials for possible restoration. This research is mainly grounded on laboratory work, which

  15. Enhancer binding proteins act as hetero-oligomers and link secondary metabolite production to myxococcal development, motility, and predation.

    PubMed

    Volz, Carsten; Kegler, Carsten; Müller, Rolf

    2012-11-21

    Motile predatory Myxobacteria are producers of multiple secondary metabolites and, on starvation, undergo concerted cellular differentiation to form multicellular fruiting bodies. These abilities demand myxobacterial genomes to encode sophisticated regulatory networks that are not satisfactorily understood. Here, we present two bacterial enhancer binding proteins (bEBPs) encoded in Myxococcus xanthus acting as direct regulators of secondary metabolites intriguingly exhibiting activating and inhibitory effects. Elucidation of a regulon for each bEBP enabled us to unravel their role in myxococcal development, predation, and motility. Interestingly, both bEBPs are able to interact by forming a hetero-oligomeric complex. Our findings represent an alternative mode of operation of bEBPs, which are currently thought to enhance promoter activity by acting as homo-oligomers. Furthermore, a direct link between secondary metabolite gene expression and predation, motility, and cellular development could be shown for the first time. Copyright © 2012 Elsevier Ltd. All rights reserved.

  16. Project EAGLE (Early Academic Gifted Learning Experience): A Program for Gifted and Talented Students (Grades K-3)--Kindergarten Activity Booklets: Xanthus; Zhack; and Activity Pages H-Z.

    ERIC Educational Resources Information Center

    Merkoski, Kay

    Three activity booklets are presented for implementing Project EAGLE, an enrichment program for gifted and talented kindergarten children. The first activity booklet contains a poem by J. D. Evans titled "In Search of the Xanthus," which describes the search for an imaginary beast that leaves an "X" on the spot where it used to be. The second…

  17. Interconnected Cavernous Structure of Bacterial Fruiting Bodies

    DOE PAGES

    Harvey, Cameron W.; Du, Huijing; Xu, Zhiliang; ...

    2012-12-27

    The formation of spore-filled fruiting bodies by myxobacteria is a fascinating case of multicelular self-organization by bacteria. The organization of Myxococcus xanthus into fruiting bodies has long been studied not only as an important example of collective motion of bacteria, but also as a simplified model for developmental morphogenesis. Sporulation within the nascent fruiting body requires signaling between moving cells in order that the rod-shaped self-propelled cells differentiate into spores at the appropriate time. Probing the three-dimensional structure of myxobacteria fruiting bodies has previously presented a challenge due to Imitations at different imaging methods. A new technique using Infrared Opticalmore » Coherence Tomography (OCT) revealed previously unknown details of the Internal structure of M. xanthus fruiting bodies consisting of interconnected pockets of relative nigh and low spore density regions. Here, to make sense of the experimentally observed structure, modeling and computer simulations were used to test a hypothesized mechanism that could produce high density pockets of spores. The mechanism consists of self-propelled cells aligning with each other and signaling by end-to-end contact to coordinate the process of differentiation resulting in a pattern of clusters observed in the experiment. The Integration of novel OCT experimental techniques with computational simulations can provide new insight Into the mechanisms that can give rise to the pattern formation seen In other biological systems such as dlctyostelids, social amoeba known to form multicellular aggregates observed as slugs under starvation conditions.« less

  18. Cell rejuvenation and social behaviors promoted by LPS exchange in myxobacteria.

    PubMed

    Vassallo, Christopher; Pathak, Darshankumar T; Cao, Pengbo; Zuckerman, David M; Hoiczyk, Egbert; Wall, Daniel

    2015-06-02

    Bacterial cells in their native environments must cope with factors that compromise the integrity of the cell. The mechanisms of coping with damage in a social or multicellular context are poorly understood. Here we investigated how a model social bacterium, Myxococcus xanthus, approaches this problem. We focused on the social behavior of outer membrane exchange (OME), in which cells transiently fuse and exchange their outer membrane (OM) contents. This behavior requires TraA, a homophilic cell surface receptor that identifies kin based on similarities in a polymorphic region, and the TraB cohort protein. As observed by electron microscopy, TraAB overexpression catalyzed a prefusion OM junction between cells. We then showed that damage sustained by the OM of one population was repaired by OME with a healthy population. Specifically, LPS mutants that were defective in motility and sporulation were rescued by OME with healthy donors. In addition, a mutant with a conditional lethal mutation in lpxC, an essential gene required for lipid A biosynthesis, was rescued by Tra-dependent interactions with a healthy population. Furthermore, lpxC cells with damaged OMs, which were more susceptible to antibiotics, had resistance conferred to them by OME with healthy donors. We also show that OME has beneficial fitness consequences to all cells. Here, in merged populations of damaged and healthy cells, OME catalyzed a dilution of OM damage, increasing developmental sporulation outcomes of the combined population by allowing it to reach a threshold density. We propose that OME is a mechanism that myxobacteria use to overcome cell damage and to transition to a multicellular organism.

  19. Motor-driven intracellular transport powers bacterial gliding motility.

    PubMed

    Sun, Mingzhai; Wartel, Morgane; Cascales, Eric; Shaevitz, Joshua W; Mignot, Tâm

    2011-05-03

    Protein-directed intracellular transport has not been observed in bacteria despite the existence of dynamic protein localization and a complex cytoskeleton. However, protein trafficking has clear potential uses for important cellular processes such as growth, development, chromosome segregation, and motility. Conflicting models have been proposed to explain Myxococcus xanthus motility on solid surfaces, some favoring secretion engines at the rear of cells and others evoking an unknown class of molecular motors distributed along the cell body. Through a combination of fluorescence imaging, force microscopy, and genetic manipulation, we show that membrane-bound cytoplasmic complexes consisting of motor and regulatory proteins are directionally transported down the axis of a cell at constant velocity. This intracellular motion is transmitted to the exterior of the cell and converted to traction forces on the substrate. Thus, this study demonstrates the existence of a conserved class of processive intracellular motors in bacteria and shows how these motors have been adapted to produce cell motility.

  20. Motor-driven intracellular transport powers bacterial gliding motility

    PubMed Central

    Sun, Mingzhai; Wartel, Morgane; Cascales, Eric; Shaevitz, Joshua W.; Mignot, Tâm

    2011-01-01

    Protein-directed intracellular transport has not been observed in bacteria despite the existence of dynamic protein localization and a complex cytoskeleton. However, protein trafficking has clear potential uses for important cellular processes such as growth, development, chromosome segregation, and motility. Conflicting models have been proposed to explain Myxococcus xanthus motility on solid surfaces, some favoring secretion engines at the rear of cells and others evoking an unknown class of molecular motors distributed along the cell body. Through a combination of fluorescence imaging, force microscopy, and genetic manipulation, we show that membrane-bound cytoplasmic complexes consisting of motor and regulatory proteins are directionally transported down the axis of a cell at constant velocity. This intracellular motion is transmitted to the exterior of the cell and converted to traction forces on the substrate. Thus, this study demonstrates the existence of a conserved class of processive intracellular motors in bacteria and shows how these motors have been adapted to produce cell motility. PMID:21482768

  1. Solution structure, backbone dynamics and chitin binding of the anti-fungal protein from Streptomyces tendae TU901.

    PubMed

    Campos-Olivas, R; Hörr, I; Bormann, C; Jung, G; Gronenborn, A M

    2001-05-11

    AFP1 is a recently discovered anti-fungal, chitin-binding protein from Streptomyces tendae Tü901. Mature AFP1 comprises 86 residues and exhibits limited sequence similarity to the cellulose-binding domains of bacterial cellulases and xylanases. No similarity to the Cys and Gly-rich domains of plant chitin-binding proteins (e.g. agglutinins, lectins, hevein) is observed. AFP1 is the first chitin-binding protein from a bacterium for which anti-fungal activity was shown. Here, we report the three-dimensional solution structure of AFP1, determined by nuclear magnetic resonance spectroscopy. The protein contains two antiparallel beta-sheets (five and four beta-strands each), that pack against each other in a parallel beta-sandwich. This type of architecture is conserved in the functionally related family II of cellulose-binding domains, albeit with different connectivity. A similar fold is also observed in other unrelated proteins (spore coat protein from Myxococcus xanthus, beta-B2 and gamma-B crystallins from Bos taurus, canavalin from Jack bean). AFP1 is therefore classified as a new member of the betagamma-crystallin superfamily. The dynamics of the protein was characterized by NMR using amide 15N relaxation and solvent exchange data. We demonstrate that the protein exhibits an axially symmetric (oblate-like) rotational diffusion tensor whose principal axis coincides to within 15 degrees with that of the inertial tensor. After completion of the present structure of AFP1, an identical fold was reported for a Streptomyces killer toxin-like protein. Based on sequence comparisons and clustering of conserved residues on the protein surface for different cellulose and chitin-binding proteins, we postulate a putative sugar-binding site for AFP1. The inability of the protein to bind short chitin fragments suggests that certain particular architectural features of the solid chitin surface are crucial for the interaction. Copyright 2001 Academic Press.

  2. The small G-protein MglA connects to the MreB actin cytoskeleton at bacterial focal adhesions

    PubMed Central

    Treuner-Lange, Anke; Macia, Eric; Guzzo, Mathilde; Hot, Edina; Faure, Laura M.; Jakobczak, Beata; Espinosa, Leon; Alcor, Damien; Ducret, Adrien; Keilberg, Daniela; Castaing, Jean Philippe; Lacas Gervais, Sandra; Franco, Michel

    2015-01-01

    In Myxococcus xanthus the gliding motility machinery is assembled at the leading cell pole to form focal adhesions, translocated rearward to propel the cell, and disassembled at the lagging pole. We show that MglA, a Ras-like small G-protein, is an integral part of this machinery. In this function, MglA stimulates the assembly of the motility complex by directly connecting it to the MreB actin cytoskeleton. Because the nucleotide state of MglA is regulated spatially and MglA only binds MreB in the guanosine triphosphate–bound form, the motility complexes are assembled at the leading pole and dispersed at the lagging pole where the guanosine triphosphatase activating protein MglB disrupts the MglA–MreB interaction. Thus, MglA acts as a nucleotide-dependent molecular switch to regulate the motility machinery spatially. The function of MreB in motility is independent of its function in peptidoglycan synthesis, representing a coopted function. Our findings highlight a new function for the MreB cytoskeleton and suggest that G-protein–cytoskeleton interactions are a universally conserved feature. PMID:26169353

  3. Cytoprophet: a Cytoscape plug-in for protein and domain interaction networks inference.

    PubMed

    Morcos, Faruck; Lamanna, Charles; Sikora, Marcin; Izaguirre, Jesús

    2008-10-01

    Cytoprophet is a software tool that allows prediction and visualization of protein and domain interaction networks. It is implemented as a plug-in of Cytoscape, an open source software framework for analysis and visualization of molecular networks. Cytoprophet implements three algorithms that predict new potential physical interactions using the domain composition of proteins and experimental assays. The algorithms for protein and domain interaction inference include maximum likelihood estimation (MLE) using expectation maximization (EM); the set cover approach maximum specificity set cover (MSSC) and the sum-product algorithm (SPA). After accepting an input set of proteins with Uniprot ID/Accession numbers and a selected prediction algorithm, Cytoprophet draws a network of potential interactions with probability scores and GO distances as edge attributes. A network of domain interactions between the domains of the initial protein list can also be generated. Cytoprophet was designed to take advantage of the visual capabilities of Cytoscape and be simple to use. An example of inference in a signaling network of myxobacterium Myxococcus xanthus is presented and available at Cytoprophet's website. http://cytoprophet.cse.nd.edu.

  4. Evolution and Design Governing Signal Precision and Amplification in a Bacterial Chemosensory Pathway

    PubMed Central

    Espinosa, Leon; Baronian, Grégory; Molle, Virginie; Mauriello, Emilia M. F.; Brochier-Armanet, Céline; Mignot, Tâm

    2015-01-01

    Understanding the principles underlying the plasticity of signal transduction networks is fundamental to decipher the functioning of living cells. In Myxococcus xanthus, a particular chemosensory system (Frz) coordinates the activity of two separate motility systems (the A- and S-motility systems), promoting multicellular development. This unusual structure asks how signal is transduced in a branched signal transduction pathway. Using combined evolution-guided and single cell approaches, we successfully uncoupled the regulations and showed that the A-motility regulation system branched-off an existing signaling system that initially only controlled S-motility. Pathway branching emerged in part following a gene duplication event and changes in the circuit structure increasing the signaling efficiency. In the evolved pathway, the Frz histidine kinase generates a steep biphasic response to increasing external stimulations, which is essential for signal partitioning to the motility systems. We further show that this behavior results from the action of two accessory response regulator proteins that act independently to filter and amplify signals from the upstream kinase. Thus, signal amplification loops may underlie the emergence of new connectivity in signal transduction pathways. PMID:26291327

  5. Biofilm Formation by a Metabolically Versatile Bacterium

    DTIC Science & Technology

    2009-03-19

    ABSTRACT Rhodopseudomonas palustris is a photosynthetic bacterium that has good potential as a biocatalyst for the production ofhydrogen gas, a biofuel...Biofilm formation by a metabolically versatile bacterium: final report Report Title ABSTRACT Rhodopseudomonas palustris is a photosynthetic bacterium...agricultural waste. We characterized five new Rhodopseudomonas genome sequences and isolated and described R. palustris mutant strains that produce

  6. NREL Researchers Discover How a Bacterium, Clostridium thermocellum,

    Science.gov Websites

    containing the bacterium actually promotes the growth of C. thermocellum, yet its mechanistic details remained a puzzle. This enhanced growth implied the bacterium had the ability to use CO2 and prompted NREL researchers to investigate the phenomena enhancing the bacterium's growth. "It took us by surprise that

  7. The small G-protein MglA connects to the MreB actin cytoskeleton at bacterial focal adhesions.

    PubMed

    Treuner-Lange, Anke; Macia, Eric; Guzzo, Mathilde; Hot, Edina; Faure, Laura M; Jakobczak, Beata; Espinosa, Leon; Alcor, Damien; Ducret, Adrien; Keilberg, Daniela; Castaing, Jean Philippe; Lacas Gervais, Sandra; Franco, Michel; Søgaard-Andersen, Lotte; Mignot, Tâm

    2015-07-20

    In Myxococcus xanthus the gliding motility machinery is assembled at the leading cell pole to form focal adhesions, translocated rearward to propel the cell, and disassembled at the lagging pole. We show that MglA, a Ras-like small G-protein, is an integral part of this machinery. In this function, MglA stimulates the assembly of the motility complex by directly connecting it to the MreB actin cytoskeleton. Because the nucleotide state of MglA is regulated spatially and MglA only binds MreB in the guanosine triphosphate-bound form, the motility complexes are assembled at the leading pole and dispersed at the lagging pole where the guanosine triphosphatase activating protein MglB disrupts the MglA-MreB interaction. Thus, MglA acts as a nucleotide-dependent molecular switch to regulate the motility machinery spatially. The function of MreB in motility is independent of its function in peptidoglycan synthesis, representing a coopted function. Our findings highlight a new function for the MreB cytoskeleton and suggest that G-protein-cytoskeleton interactions are a universally conserved feature. © 2015 Treuner-Lange et al.

  8. Structural insights into the anti-HIV activity of the Oscillatoria agardhii agglutinin homolog lectin family.

    PubMed

    Koharudin, Leonardus M I; Kollipara, Sireesha; Aiken, Christopher; Gronenborn, Angela M

    2012-09-28

    Oscillatoria agardhii agglutinin homolog (OAAH) proteins belong to a recently discovered lectin family. All members contain a sequence repeat of ~66 amino acids, with the number of repeats varying among different family members. Apart from data for the founding member OAA, neither three-dimensional structures, information about carbohydrate binding specificities, nor antiviral activity data have been available up to now for any other members of the OAAH family. To elucidate the structural basis for the antiviral mechanism of OAAHs, we determined the crystal structures of Pseudomonas fluorescens and Myxococcus xanthus lectins. Both proteins exhibit the same fold, resembling the founding family member, OAA, with minor differences in loop conformations. Carbohydrate binding studies by NMR and x-ray structures of glycan-lectin complexes reveal that the number of sugar binding sites corresponds to the number of sequence repeats in each protein. As for OAA, tight and specific binding to α3,α6-mannopentaose was observed. All the OAAH proteins described here exhibit potent anti-HIV activity at comparable levels. Altogether, our results provide structural details of the protein-carbohydrate interaction for this novel lectin family and insights into the molecular basis of their HIV inactivation properties.

  9. Identification of proteins likely to be involved in morphogenesis, cell division, and signal transduction in Planctomycetes by comparative genomics.

    PubMed

    Jogler, Christian; Waldmann, Jost; Huang, Xiaoluo; Jogler, Mareike; Glöckner, Frank Oliver; Mascher, Thorsten; Kolter, Roberto

    2012-12-01

    Members of the Planctomycetes clade share many unusual features for bacteria. Their cytoplasm contains membrane-bound compartments, they lack peptidoglycan and FtsZ, they divide by polar budding, and they are capable of endocytosis. Planctomycete genomes have remained enigmatic, generally being quite large (up to 9 Mb), and on average, 55% of their predicted proteins are of unknown function. Importantly, proteins related to the unusual traits of Planctomycetes remain largely unknown. Thus, we embarked on bioinformatic analyses of these genomes in an effort to predict proteins that are likely to be involved in compartmentalization, cell division, and signal transduction. We used three complementary strategies. First, we defined the Planctomycetes core genome and subtracted genes of well-studied model organisms. Second, we analyzed the gene content and synteny of morphogenesis and cell division genes and combined both methods using a "guilt-by-association" approach. Third, we identified signal transduction systems as well as sigma factors. These analyses provide a manageable list of candidate genes for future genetic studies and provide evidence for complex signaling in the Planctomycetes akin to that observed for bacteria with complex life-styles, such as Myxococcus xanthus.

  10. Characterization of the cellulose-degrading bacterium NCIMB 10462

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dees, C.; Scott, T.C.; Phelps, T.J.

    The gram-negative cellulase-producing bacterium NCIMB 10462 has been previously named Pseudomonas fluorescens subsp. or var. cellulose. Because of renewed interest in cellulose-degrading bacteria for use in the bioconversion of cellulose to chemical feed stocks and fuels, we re-examined the characteristics of this microorganism to determine its true metabolic potential. Metabolic and physical characterization of NCIMB 10462 revealed that this is an alkalophilic, non-fermentative, gram-negative, oxidase-positive, motile, cellulose-degrading bacterium. The aerobic substrate utilization profile of this bacterium has few characteristics consistent with a classification of P. fluorescens and a very low probability match with the genus Sphingomonas. However, total lipid analysismore » did not reveal that any sphingolipid bases are produced by this bacterium. NCIMB 10462 grows best aerobically, but also grows well in complex media under reducing conditions. NCIMB 10462 grows slowly under anaerobic conditions on complex media, but growth on cellulosic media occurred only under aerobic conditions. Total fatty acid analysis (MIDI) of NCIMB 10462 failed to group this bacterium with a known pseudomonas species. However, fatty acid analysis of the bacteria when grown at temperatures below 37{degrees}C suggest that the organism is a pseudomonad. Since a predominant characteristic of this bacterium is its ability to degrade cellulose, we suggest that it be called Pseudomonas cellulosa.« less

  11. Single Bacterium Detection Using Sers

    NASA Astrophysics Data System (ADS)

    Gonchukov, S. A.; Baikova, T. V.; Alushin, M. V.; Svistunova, T. S.; Minaeva, S. A.; Ionin, A. A.; Kudryashov, S. I.; Saraeva, I. N.; Zayarny, D. A.

    2016-02-01

    This work is devoted to the study of a single Staphylococcus aureus bacterium detection using surface-enhanced Raman spectroscopy (SERS) and resonant Raman spectroscopy (RS). It was shown that SERS allows increasing sensitivity of predominantly low frequency lines connected with the vibrations of Amide, Proteins and DNA. At the same time the lines of carotenoids inherent to this kind of bacterium are well-detected due to the resonance Raman scattering mechanism. The reproducibility and stability of Raman spectra strongly depend on the characteristics of nanostructured substrate, and molecular structure and size of the tested biological object.

  12. Force generation by groups of migrating bacteria

    PubMed Central

    Koch, Matthias D.; Liu, Guannan; Stone, Howard A.; Shaevitz, Joshua W.

    2017-01-01

    From colony formation in bacteria to wound healing and embryonic development in multicellular organisms, groups of living cells must often move collectively. Although considerable study has probed the biophysical mechanisms of how eukaryotic cells generate forces during migration, little such study has been devoted to bacteria, in particular with regard to the question of how bacteria generate and coordinate forces during collective motion. This question is addressed here using traction force microscopy. We study two distinct motility mechanisms of Myxococcus xanthus, namely, twitching and gliding. For twitching, powered by type-IV pilus retraction, we find that individual cells exert local traction in small hotspots with forces on the order of 50 pN. Twitching bacterial groups also produce traction hotspots, but with forces around 100 pN that fluctuate rapidly on timescales of <1.5 min. Gliding, the second motility mechanism, is driven by lateral transport of substrate adhesions. When cells are isolated, gliding produces low average traction on the order of 1 Pa. However, traction is amplified approximately fivefold in groups. Advancing protrusions of gliding cells push, on average, in the direction of motion. Together, these results show that the forces generated during twitching and gliding have complementary characters, and both forces have higher values when cells are in groups. PMID:28655845

  13. Force generation by groups of migrating bacteria.

    PubMed

    Sabass, Benedikt; Koch, Matthias D; Liu, Guannan; Stone, Howard A; Shaevitz, Joshua W

    2017-07-11

    From colony formation in bacteria to wound healing and embryonic development in multicellular organisms, groups of living cells must often move collectively. Although considerable study has probed the biophysical mechanisms of how eukaryotic cells generate forces during migration, little such study has been devoted to bacteria, in particular with regard to the question of how bacteria generate and coordinate forces during collective motion. This question is addressed here using traction force microscopy. We study two distinct motility mechanisms of Myxococcus xanthus , namely, twitching and gliding. For twitching, powered by type-IV pilus retraction, we find that individual cells exert local traction in small hotspots with forces on the order of 50 pN. Twitching bacterial groups also produce traction hotspots, but with forces around 100 pN that fluctuate rapidly on timescales of <1.5 min. Gliding, the second motility mechanism, is driven by lateral transport of substrate adhesions. When cells are isolated, gliding produces low average traction on the order of 1 Pa. However, traction is amplified approximately fivefold in groups. Advancing protrusions of gliding cells push, on average, in the direction of motion. Together, these results show that the forces generated during twitching and gliding have complementary characters, and both forces have higher values when cells are in groups.

  14. Glucan common to the microcyst walls of cyst-forming bacteria.

    PubMed Central

    Sutherland, I W; Mackenzie, C L

    1977-01-01

    Chemical analysis indicated that D-glucose is tha major neutral monosaccharide present in the microcysts of a range of gram-negative bacteria. Varying amounts of other neutral sugars were found. The glucose was mainly present as a glucan that could be extracted from microcysts of representative strains with alkali or mild acid treatment. The glucan could be identified as an alpha-1,3-linked polymer on the basis of (i) periodate resistance of the extracted polymer and the material present in microcysts; (ii) lectin agglutination of the microcysts; (iii) lectin precipitation of the extracted glucans; and (iv) susceptibility of the glucan either in the walls or after extraction to a specific alpha-1,3-glucanase from Aspergillus nidulans, yielding glucose as the sole hydrolysis product. The galactosamine found in microcysts of Myxococcus xanthus by other workers is clearly a component of another polymer, distinct from the glucan. The presence of an alpha 1,3-linked glucan, common to microcyst walls of various bacterial genera, probably contributes to the rigidity of the walls of these forms and, inter alia, to their resistance to ultrasonic treatment. Preliminary experiments indicate that the gulcan is discarded on germination of the microcysts rather than being broken down by specific enzymes. PMID:402353

  15. A virus capsid-like nanocompartment that stores iron and protects bacteria from oxidative stress.

    PubMed

    McHugh, Colleen A; Fontana, Juan; Nemecek, Daniel; Cheng, Naiqian; Aksyuk, Anastasia A; Heymann, J Bernard; Winkler, Dennis C; Lam, Alan S; Wall, Joseph S; Steven, Alasdair C; Hoiczyk, Egbert

    2014-09-01

    Living cells compartmentalize materials and enzymatic reactions to increase metabolic efficiency. While eukaryotes use membrane-bound organelles, bacteria and archaea rely primarily on protein-bound nanocompartments. Encapsulins constitute a class of nanocompartments widespread in bacteria and archaea whose functions have hitherto been unclear. Here, we characterize the encapsulin nanocompartment from Myxococcus xanthus, which consists of a shell protein (EncA, 32.5 kDa) and three internal proteins (EncB, 17 kDa; EncC, 13 kDa; EncD, 11 kDa). Using cryo-electron microscopy, we determined that EncA self-assembles into an icosahedral shell 32 nm in diameter (26 nm internal diameter), built from 180 subunits with the fold first observed in bacteriophage HK97 capsid. The internal proteins, of which EncB and EncC have ferritin-like domains, attach to its inner surface. Native nanocompartments have dense iron-rich cores. Functionally, they resemble ferritins, cage-like iron storage proteins, but with a massively greater capacity (~30,000 iron atoms versus ~3,000 in ferritin). Physiological data reveal that few nanocompartments are assembled during vegetative growth, but they increase fivefold upon starvation, protecting cells from oxidative stress through iron sequestration. © 2014 The Authors.

  16. Detection of Salmonella bacterium in drinking water using microring resonator.

    PubMed

    Bahadoran, Mahdi; Noorden, Ahmad Fakhrurrazi Ahmad; Mohajer, Faeze Sadat; Abd Mubin, Mohamad Helmi; Chaudhary, Kashif; Jalil, Muhammad Arif; Ali, Jalil; Yupapin, Preecha

    2016-01-01

    A new microring resonator system is proposed for the detection of the Salmonella bacterium in drinking water, which is made up of SiO2-TiO2 waveguide embedded inside thin film layer of the flagellin. The change in refractive index due to the binding of the Salmonella bacterium with flagellin layer causes a shift in the output signal wavelength and the variation in through and drop port's intensities, which leads to the detection of Salmonella bacterium in drinking water. The sensitivity of proposed sensor for detecting of Salmonella bacterium in water solution is 149 nm/RIU and the limit of detection is 7 × 10(-4)RIU.

  17. Taxonomic characterization of the cellulose-degrading bacterium NCIB 10462

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dees, C.; Ringleberg, D.; Scott, T.C.

    The gram negative cellulase-producing bacterium NCIB 10462 has been previously named Pseudomonas fluorescens subsp. or var. cellulosa. Since there is renewed interest in cellulose-degrading bacteria for use in bioconversion of cellulose to chemical feed stocks and fuels, we re-examined the characteristics of this microorganism to determine its proper taxonomic characterization and to further define it`s true metabolic potential. Metabolic and physical characterization of NCIB 10462 revealed that this was an alkalophilic, non-fermentative, gram negative, oxidase positive, motile, cellulose-degrading bacterium. The aerobic substrate utilization profile of this bacterium was found to have few characteristics consistent with a classification of P. fluorescensmore » with a very low probability match with the genus Sphingomonas. Total lipid analysis did not reveal that any sphingolipid bases are produced by this bacterium. NCIB 10462 was found to grow best aerobically but also grows well in complex media under reducing conditions. NCIB 10462 grew slowly under full anaerobic conditions on complex media but growth on cellulosic media was found only under aerobic conditions. Total fatty acid analysis (MIDI) of NCIB 10462 failed to group this bacterium with a known pseudomonas species. However, fatty acid analysis of the bacteria when grown at temperatures below 37{degrees}C suggest that the organism is a pseudomonad. Since a predominant characteristic of this bacterium is it`s ability to degrade cellulose, we suggest it be called Pseudomonas cellulosa.« less

  18. Oxidation of Ethylene Glycol by a Salt-Requiring Bacterium

    PubMed Central

    Caskey, William H.; Taber, Willard A.

    1981-01-01

    Bacterium T-52, cultured on ethylene glycol, readily oxidized glycolate and glyoxylate and exhibited elevated activities of ethylene glycol dehydrogenase and glycolate oxidase. Labeled glyoxylate was identified in reaction mixtures containing [14C]-ethylene glycol, but no glycolate was detected. The most likely pathway of ethylene glycol catabolism by bacterium T-52 is sequential oxidation to glycolate and glyoxylate. PMID:16345810

  19. Capsule-Transmitted Gut Symbiotic Bacterium of the Japanese Common Plataspid Stinkbug, Megacopta punctatissima

    PubMed Central

    Fukatsu, Takema; Hosokawa, Takahiro

    2002-01-01

    The Japanese common plataspid stinkbug, Megacopta punctatissima, deposits small brown particles, or symbiont capsules, on the underside of the egg mass for the purpose of transmission of symbiotic bacteria to the offspring. We investigated the microbiological aspects of the bacteria contained in the capsule, such as microbial diversity, phylogenetic placement, localization in vivo, and fitness effects on the host insect. Restriction fragment length polymorphism analysis of 16S ribosomal DNA clones revealed that a single bacterial species dominates the microbiota in the capsule. The bacterium was not detected in the eggs but in the capsules, which unequivocally demonstrated that the bacterium is transmitted to the offspring of the insect orally rather than transovarially, through probing of the capsule content. Molecular phylogenetic analysis showed that the bacterium belongs to the γ-subdivision of the Proteobacteria. In adult insects the bacterium was localized in the posterior section of the midgut. Deprivation of the bacterium from the nymphs resulted in retarded development, arrested growth, abnormal body coloration, and other symptoms, suggesting that the bacterium is essential for normal development and growth of the host insect. PMID:11772649

  20. Swimming efficiency of bacterium Escherichia coli

    PubMed Central

    Chattopadhyay, Suddhashil; Moldovan, Radu; Yeung, Chuck; Wu, X. L.

    2006-01-01

    We use measurements of swimming bacteria in an optical trap to determine fundamental properties of bacterial propulsion. In particular, we directly measure the force required to hold the bacterium in the optical trap and determine the propulsion matrix, which relates the translational and angular velocity of the flagellum to the torques and forces propelling the bacterium. From the propulsion matrix, dynamical properties such as torques, swimming speed, and power can be obtained by measuring the angular velocity of the motor. We find significant heterogeneities among different individuals even though all bacteria started from a single colony. The propulsive efficiency, defined as the ratio of the propulsive power output to the rotary power input provided by the motors, is found to be ≈2%, which is consistent with the efficiency predicted theoretically for a rigid helical coil. PMID:16954194

  1. Coiled to diffuse: Brownian motion of a helical bacterium.

    PubMed

    Butenko, Alexander V; Mogilko, Emma; Amitai, Lee; Pokroy, Boaz; Sloutskin, Eli

    2012-09-11

    We employ real-time three-dimensional confocal microscopy to follow the Brownian motion of a fixed helically shaped Leptospira interrogans (LI) bacterium. We extract from our measurements the translational and the rotational diffusion coefficients of this bacterium. A simple theoretical model is suggested, perfectly reproducing the experimental diffusion coefficients, with no tunable parameters. An older theoretical model, where edge effects are neglected, dramatically underestimates the observed rates of translation. Interestingly, the coiling of LI increases its rotational diffusion coefficient by a factor of 5, compared to a (hypothetical) rectified bacterium of the same contour length. Moreover, the translational diffusion coefficients would have decreased by a factor of ~1.5, if LI were rectified. This suggests that the spiral shape of the spirochaete bacteria, in addition to being employed for their active twisting motion, may also increase the ability of these bacteria to explore the surrounding fluid by passive Brownian diffusion.

  2. [Partial biological characteristics and algicidal activity of an algicidal bacterium].

    PubMed

    Li, San-Hua; Zhang, Qi-Ya

    2013-02-01

    An algicidal bacterium was isolated from freshwater (Lake Donghu in Wuhan) and coded as A01. The morphology of the algicidal bacterium was observed using optical microscope and electron microscopes, the results showed that A01 was rod-shaped, approximately 1.5 microm in length and 0.45 microm in width and with no flagella structure. A01 was Gram-negative and belongs to the family Acinetobacter sp. though identification by Gram's staining and 16S rDNA gene analysis. A01 exhibited strong algicidal activity on the bloom-forming cyanobacterium Anabaena eucompacta under laboratory conditions. The removal rate of chlorophyll a after 7-day incubation with the culture supernatant of A01 and thalli were 77% and 61%, respectively. Microscopic observation showed that almost all cyanobacterial cells were destroyed within 3 d of co-incubation with the supernatant of algicidal bacterium, but a mass of the cyanobacterial cell lysis was observed only after 5 d of co-incubation with the thalli of algicidal bacterium. These results indicated that the main algicidal component of A01 was in its culture supernatant. In other words, the strain A01 could secrete algicidal component against Anabaena eucompacta.

  3. Gut bacterium of Dendrobaena veneta (Annelida: Oligochaeta) possesses antimycobacterial activity.

    PubMed

    Fiołka, Marta J; Zagaja, Mirosław P; Piersiak, Tomasz D; Wróbel, Marek; Pawelec, Jarosław

    2010-09-01

    The new bacterial strain with antimycobacterial activity has been isolated from the midgut of Dendrobaena veneta (Annelida). Biochemical and molecular characterization of isolates from 18 individuals identified all as Raoultella ornithinolytica genus with 99% similarity. The bacterium is a possible symbiont of the earthworm D. veneta. The isolated microorganism has shown the activity against four strains of fast-growing mycobacteria: Mycobacterium butiricum, Mycobacterium jucho, Mycobacterium smegmatis and Mycobacterium phlei. The multiplication of the gut bacterium on plates with Sauton medium containing mycobacteria has caused a lytic effect. After the incubation of the cell free extract prepared from the gut bacterium with four strains of mycobacteria in liquid Sauton medium, the cells of all tested strains were deformed and divided to small oval forms and sometimes created long filaments. The effect was observed by the use of light, transmission and scanning microscopy. Viability of all examined species of mycobacteria was significantly decreased. The antimycobacterial effect was probably the result of the antibiotic action produced by the gut bacterium of the earthworm. The application of ultrafiltration procedure allowed to demonstrate that antimicrobial substance with strong antimycobacterial activity from bacterial culture supernatant, is a protein with the molecular mass above 100 kDa. Copyright 2010 Elsevier Inc. All rights reserved.

  4. Characterization of the promising poly(3-hydroxybutyrate) producing halophilic bacterium Halomonas halophila.

    PubMed

    Kucera, Dan; Pernicová, Iva; Kovalcik, Adriana; Koller, Martin; Mullerova, Lucie; Sedlacek, Petr; Mravec, Filip; Nebesarova, Jana; Kalina, Michal; Marova, Ivana; Krzyzanek, Vladislav; Obruca, Stanislav

    2018-05-01

    This work explores molecular, morphological as well as biotechnological features of the highly promising polyhydroxyalkanoates (PHA) producer Halomonas halophila. Unlike many other halophiles, this bacterium does not require expensive complex media components and it is capable to accumulate high intracellular poly(3-hydroxybutyrate) (PHB) fractions up to 82% of cell dry mass. Most remarkably, regulating the concentration of NaCl apart from PHB yields influences also the polymer's molecular mass and polydispersity. The bacterium metabolizes various carbohydrates including sugars predominant in lignocelluloses and other inexpensive substrates. Therefore, the bacterium was employed for PHB production on hydrolysates of cheese whey, spent coffee grounds, sawdust and corn stover, which were hydrolyzed by HCl; required salinity of cultivation media was set up during neutralization by NaOH. The bacterium was capable to use all the tested hydrolysates as well as sugar beet molasses for PHB biosynthesis, indicating its potential for industrial PHB production. Copyright © 2018 Elsevier Ltd. All rights reserved.

  5. [Study on anti-bacterium activity of ginkgolic acids and their momomers].

    PubMed

    Yang, Xiaoming; Zhu, Wei; Chen, Jun; Qian, Zhiyu; Xie, Jimin

    2004-09-01

    Ginkgolic acids and their three monomers were separated from ginkgo sarcotestas. The anti-bacterium activity of ginkgolic acids were tested. The relation between the anti-bacterium activity and side chain of ginkgolic acid were studied. The MIC of ginkgolic acids and their three monomers and salicylic acid were tested. Ginkgolic acid has strong inhibitive effect on G+-bacterium. Salicylic acid has no side chain, so no anti-bacterial activity. When the length of gingkolic acid side chain is C13:0, it has the strongest anti-bacterial activity in three monomers. The side chain of ginkgolic acid is the key functional group that possessed anti-bacterial activity. The length of Ginkgolic acid was the main effective factor of anti-bacterial activity.

  6. Endohyphal Bacterium Enhances Production of Indole-3-Acetic Acid by a Foliar Fungal Endophyte

    PubMed Central

    Hoffman, Michele T.; Gunatilaka, Malkanthi K.; Wijeratne, Kithsiri; Gunatilaka, Leslie; Arnold, A. Elizabeth

    2013-01-01

    Numerous plant pathogens, rhizosphere symbionts, and endophytic bacteria and yeasts produce the important phytohormone indole-3-acetic acid (IAA), often with profound effects on host plants. However, to date IAA production has not been documented among foliar endophytes -- the diverse guild of primarily filamentous Ascomycota that live within healthy, above-ground tissues of all plant species studied thus far. Recently bacteria that live within hyphae of endophytes (endohyphal bacteria) have been detected, but their effects have not been studied previously. Here we show not only that IAA is produced in vitro by a foliar endophyte (here identified as Pestalotiopsis aff. neglecta, Xylariales), but that IAA production is enhanced significantly when the endophyte hosts an endohyphal bacterium (here identified as Luteibacter sp., Xanthomonadales). Both the endophyte and the endophyte/bacterium complex appear to rely on an L-tryptophan dependent pathway for IAA synthesis. The bacterium can be isolated from the fungus when the symbiotic complex is cultivated at 36°C. In pure culture the bacterium does not produce IAA. Culture filtrate from the endophyte-bacterium complex significantly enhances growth of tomato in vitro relative to controls and to filtrate from the endophyte alone. Together these results speak to a facultative symbiosis between an endophyte and endohyphal bacterium that strongly influences IAA production, providing a new framework in which to explore endophyte-plant interactions. PMID:24086270

  7. Induced sensitivity of Bacillus subtilis colony morphology to mechanical media compression

    PubMed Central

    Polka, Jessica K.

    2014-01-01

    Bacteria from several taxa, including Kurthia zopfii, Myxococcus xanthus, and Bacillus mycoides, have been reported to align growth of their colonies to small features on the surface of solid media, including anisotropies created by compression. While the function of this phenomenon is unclear, it may help organisms navigate on solid phases, such as soil. The origin of this behavior is also unknown: it may be biological (that is, dependent on components that sense the environment and regulate growth accordingly) or merely physical. Here we show that B. subtilis, an organism that typically does not respond to media compression, can be induced to do so with two simple and synergistic perturbations: a mutation that maintains cells in the swarming (chained) state, and the addition of EDTA to the growth media, which further increases chain length. EDTA apparently increases chain length by inducing defects in cell separation, as the treatment has only marginal effects on the length of individual cells. These results lead us to three conclusions. First, the wealth of genetic tools available to B. subtilis will provide a new, tractable chassis for engineering compression sensitive organisms. Second, the sensitivity of colony morphology to media compression in Bacillus can be modulated by altering a simple physical property of rod-shaped cells. And third, colony morphology under compression holds promise as a rapid, simple, and low-cost way to screen for changes in the length of rod-shaped cells or chains thereof. PMID:25289183

  8. Direct measurement of interaction forces between a single bacterium and a flat plate.

    PubMed

    Klein, Jonah D; Clapp, Aaron R; Dickinson, Richard B

    2003-05-15

    A technique for precisely measuring the equilibrium and viscous interaction forces between a single bacterium and a flat surface as functions of separation distance is described. A single-beam gradient optical trap was used to micromanipulate the bacterium against a flat surface while evanescent wave light scattering was used to measure separation distances. Calibrating the optical trap far from the surface allowed the trapped bacterium to be used as a force probe. Equilibrium force-distance profiles were determined by measuring the deflection of the cell from the center of the optical trap at various trap positions. Simultaneously, viscous forces were determined by measuring the relaxation time for the fluctuating bacterium. Absolute distances were determined using a best-fit approximation to the theoretical prediction for the hindered mobility of a diffusing sphere near a wall. Using this approach, forces in the range from 0.01 to 4 pN were measured at near-nanometer resolution between Staphylococcus aureus and glass that was bare or coated with adsorbed protein.

  9. The construction of an engineered bacterium to remove cadmium from wastewater.

    PubMed

    Chang, S; Shu, H

    2014-01-01

    The removal of cadmium (Cd) from wastewater before it is released from factories is important for protecting human health. Although some researchers have developed engineered bacteria, the resistance of these engineered bacteria to Cd have not been improved. In this study, two key genes involved in glutathione synthesis (gshA and gshB), a serine acetyltransferase gene (cysE), a Thlaspi caerulescens phytochelatin synthase gene (TcPCS1), and a heavy metal ATPase gene (TcHMA3) were transformed into Escherichia coli BL21. The resistance of the engineered bacterium to Cd was significantly greater than that of the initial bacterium and the Cd accumulation in the engineered bacterium was much higher than in the initial bacterium. In addition, the Cd resistance of the bacteria harboring gshB, gshA, cysE, and TcPCS1 was higher than that of the bacteria harboring gshA, cysE, and TcPCS1. This finding demonstrated that gshB played an important role in glutathione synthesis and that the reaction catalyzed by glutathione synthase was the limiting step for producing phytochelatins. Furthermore, TcPCS1 had a greater specificity and a higher capacity for removing Cd than SpPCS1, and TcHMA3 not only played a role in T. caerulescens but also functioned in E. coli.

  10. Metabolomics evaluation of the impact of smokeless tobacco exposure on the oral bacterium Capnocytophaga sputigena

    PubMed Central

    Sun, Jinchun; Jin, Jinshan; Beger, Richard D.; Cerniglia, Carl E.; Yang, Maocheng; Chen, Huizhong

    2017-01-01

    The association between exposure to smokeless tobacco products (STP) and oral diseases is partially due to the physiological and pathological changes in the composition of the oral microbiome and its metabolic profile. However, it is not clear how STPs affect the physiology and ecology of oral microbiota. A UPLC/QTof-MS-based metabolomics study was employed to analyze metabolic alterations in oral bacterium, Capnocytophaga sputigena as a result of smokeless tobacco exposure and to assess the capability of the bacterium to metabolize nicotine. Pathway analysis of the metabolome profiles indicated that smokeless tobacco extracts caused oxidative stress in the bacterium. The metabolomics data also showed that the argininenitric oxide pathway was perturbed by the smokeless tobacco treatment. Results also showed that LC/MS was useful in identifying STP constituents and additives, including caffeine and many flavoring compounds. No significant changes in levels of nicotine and its major metabolites were found when C. sputigena was cultured in a nutrient rich medium, although hydroxylnicotine and cotinine N-oxide were detected in the bacterial metabolites suggesting that nicotine metabolism might be present as a minor degradation pathway in the bacterium. Study results provide new insights regarding the physiological and toxicological effects of smokeless tobacco on oral bacterium C. sputigena and associated oral health as well as measuring the ability of the oral bacterium to metabolize nicotine. PMID:27480511

  11. Metabolomics evaluation of the impact of smokeless tobacco exposure on the oral bacterium Capnocytophaga sputigena.

    PubMed

    Sun, Jinchun; Jin, Jinshan; Beger, Richard D; Cerniglia, Carl E; Yang, Maocheng; Chen, Huizhong

    2016-10-01

    The association between exposure to smokeless tobacco products (STP) and oral diseases is partially due to the physiological and pathological changes in the composition of the oral microbiome and its metabolic profile. However, it is not clear how STPs affect the physiology and ecology of oral microbiota. A UPLC/QTof-MS-based metabolomics study was employed to analyze metabolic alterations in oral bacterium, Capnocytophaga sputigena as a result of smokeless tobacco exposure and to assess the capability of the bacterium to metabolize nicotine. Pathway analysis of the metabolome profiles indicated that smokeless tobacco extracts caused oxidative stress in the bacterium. The metabolomics data also showed that the arginine-nitric oxide pathway was perturbed by the smokeless tobacco treatment. Results also showed that LC/MS was useful in identifying STP constituents and additives, including caffeine and many flavoring compounds. No significant changes in levels of nicotine and its major metabolites were found when C. sputigena was cultured in a nutrient rich medium, although hydroxylnicotine and cotinine N-oxide were detected in the bacterial metabolites suggesting that nicotine metabolism might be present as a minor degradation pathway in the bacterium. Study results provide new insights regarding the physiological and toxicological effects of smokeless tobacco on oral bacterium C. sputigena and associated oral health as well as measuring the ability of the oral bacterium to metabolize nicotine. Published by Elsevier Ltd.

  12. Near-complete genome sequence of the cellulolytic Bacterium Bacteroides ( Pseudobacteroides) cellulosolvens ATCC 35603

    DOE PAGES

    Dassa, Bareket; Utturkar, Sagar M.; Hurt, Richard A.; ...

    2015-09-24

    We report the single-contig genome sequence of the anaerobic, mesophilic, cellulolytic bacterium, Bacteroides cellulosolvens. The bacterium produces a particularly elaborate cellulosome system, whereas the types of cohesin-dockerin interactions are opposite of other known cellulosome systems: cell-surface attachment is thus mediated via type-I interactions whereas enzymes are integrated via type-II interactions.

  13. [A rarely isolated bacterium in microbiology laboratories: Streptococcus uberis].

    PubMed

    Eryıldız, Canan; Bukavaz, Şebnem; Gürcan, Şaban; Hatipoğlu, Osman

    2017-04-01

    Streptococcus uberis is a gram-positive bacterium that is mostly responsible for mastitis in cattle. The bacterium rarely has been associated with human infections. Conventional phenotyphic methods can be inadequate for the identification of S.uberis; and in microbiology laboratories S.uberis is confused with the other streptococci and enterococci isolates. Recently, molecular methods are recommended for the accurate identification of S.uberis isolates. The aim of this report is to present a lower respiratory tract infection case caused by S.uberis and the microbiological methods for identification of this bacterium. A 66-year-old male patient with squamous cell lung cancer who received radiotherapy was admitted in our hospital for the control. According to the chest X-Ray, patient was hospitalized with the prediagnosis of ''cavitary tumor, pulmonary abscess''. In the first day of the hospitalization, blood and sputum cultures were drawn. Blood culture was negative, however, Candida albicans was isolated in the sputum culture and it was estimated to be due to oral lesions. After two weeks from the hospitalization, sputum sample was taken from the patient since he had abnormal respiratory sounds and cough complaint. In the Gram stained smear of the sputum there were abundant leucocytes and gram-positive cocci, and S.uberis was isolated in both 5% sheep blood and chocolate agar media. Bacterial identification and antibiotic susceptibility tests were performed by VITEK 2 (Biomerieux, France) and also, the bacterium was identified by matrix assisted laser desorption/ionization time of flight mass spectrometry (MALDI-TOF MS) based VITEK MS system as S.uberis. The isolate was determined susceptible to ampicillin, erythromycin, clindamycin, levofloxacin, linezolid, penicillin, cefotaxime, ceftriaxone, tetracycline and vancomycin. 16S, 23S ribosomal RNA and 16S-23S intergenic spacer gene regions were amplified with specific primers and partial DNA sequence analysis of 16S

  14. Trichloroethylene Biodegradation by a Methane-Oxidizing Bacterium

    PubMed Central

    Little, C. Deane; Palumbo, Anthony V.; Herbes, Stephen E.; Lidstrom, Mary E.; Tyndall, Richard L.; Gilmer, Penny J.

    1988-01-01

    Trichloroethylene (TCE), a common groundwater contaminant, is a suspected carcinogen that is highly resistant to aerobic biodegradation. An aerobic, methane-oxidizing bacterium was isolated that degrades TCE in pure culture at concentrations commonly observed in contaminated groundwater. Strain 46-1, a type I methanotrophic bacterium, degraded TCE if grown on methane or methanol, producing CO2 and water-soluble products. Gas chromatography and 14C radiotracer techniques were used to determine the rate, methane dependence, and mechanism of TCE biodegradation. TCE biodegradation by strain 46-1 appears to be a cometabolic process that occurs when the organism is actively metabolizing a suitable growth substrate such as methane or methanol. It is proposed that TCE biodegradation by methanotrophs occurs by formation of TCE epoxide, which breaks down spontaneously in water to form dichloroacetic and glyoxylic acids and one-carbon products. Images PMID:16347616

  15. Draft Genome Sequence of the Cellulolytic Bacterium Clostridium papyrosolvens C7 (ATCC 700395).

    PubMed

    Zepeda, Veronica; Dassa, Bareket; Borovok, Ilya; Lamed, Raphael; Bayer, Edward A; Cate, Jamie H D

    2013-09-12

    We report the draft genome sequence of the cellulose-degrading bacterium Clostridium papyrosolvens C7, originally isolated from mud collected below a freshwater pond in Massachusetts. This Gram-positive bacterium grows in a mesophilic anaerobic environment with filter paper as the only carbon source, and it has a simple cellulosome system with multiple carbohydrate-degrading enzymes.

  16. Draft Genome Sequence of the Cellulolytic Bacterium Clostridium papyrosolvens C7 (ATCC 700395)

    PubMed Central

    Zepeda, Veronica; Dassa, Bareket; Borovok, Ilya; Lamed, Raphael; Bayer, Edward A.

    2013-01-01

    We report the draft genome sequence of the cellulose-degrading bacterium Clostridium papyrosolvens C7, originally isolated from mud collected below a freshwater pond in Massachusetts. This Gram-positive bacterium grows in a mesophilic anaerobic environment with filter paper as the only carbon source, and it has a simple cellulosome system with multiple carbohydrate-degrading enzymes. PMID:24029755

  17. Overproduction of Hydrogen From an Anaerobic Bacterium

    DTIC Science & Technology

    2008-12-01

    fixation of nitrogen ( Haber - Bosch process), mostly to produce fertilizer. Nitrogenase provides a catalytic alternative to the commercial fixation of...the culture and suggests a uniquely simple hydrogen reactor design based on renewable feedstocks. 1. INTRODUCTION Hydrogen is an ideal... renewable feedstocks. Clostridium phytofermentans is a recently- discovered anaerobic bacterium, reported to possess cellulase enzymes that degrade

  18. Determination of phenanthrene bioavailability by using a self-dying reporter bacterium: test with model solids and soil.

    PubMed

    Shin, Doyun; Nam, Kyoungphile

    2012-02-20

    The present study was conducted to investigate the performance and feasibility of a self-dying reporter bacterium to visualize and quantify phenanthrene bioavailability in soil. The self-dying reporter bacterium was designed to die on the initiation of phenanthrene biodegradation. The viability of the reporter bacterium was determined by a fluorescence live/dead cell staining method and visualized by confocal laser scanning microscopic observation. Phenanthrene was spiked into four types of model solids and a sandy loam. The bioavailability of phenanthrene to the reporter bacterium was remarkably declined with the hydrophobicity of the model solids: essentially no phenanthrene was biodegraded in the presence of 9-nm pores and about 35.8% of initial phenanthrene was biodegraded without pores. Decrease in bioavailability was not evident in the nonporous hydrophilic bead, but a small decrease was observed in the porous hydrophilic bead at 1000 mg/kg of phenanthrene. The fluorescence intensity was commensurate with the extent of phenanthrene biodegradation by the reporter bacterium at the concentration range from 50 to 500 mg/kg. Such a quantitative relationship was also confirmed with a sandy loam spiked up to 1000 mg/kg of phenanthrene. This reporter bacterium may be a useful means to determine phenanthrene bioavailability in soil. Copyright © 2011 Elsevier B.V. All rights reserved.

  19. Phosphate enhances levan production in the endophytic bacterium Gluconacetobacter diazotrophicus Pal5

    PubMed Central

    Idogawa, Nao; Amamoto, Ryuta; Murata, Kousaku; Kawai, Shigeyuki

    2014-01-01

    Gluconacetobacter diazotrophicus is a gram-negative and endophytic nitrogen-fixing bacterium that has several beneficial effects in host plants; thus, utilization of this bacterium as a biofertilizer in agriculture may be possible. G. diazotrophicus synthesizes levan, a D-fructofuranosyl polymer with β-(2→6) linkages, as an exopolysaccharide and the synthesized levan improves the stress tolerance of the bacterium. In this study, we found that phosphate enhances levan production by G. diazotrophicus Pal5, a wild type strain that showed a stronger mucous phenotype on solid medium containing 28 mM phosphate than on solid medium containing 7 mM phosphate. A G. diazotrophicus Pal5 levansucrase disruptant showed only a weak mucous phenotype regardless of the phosphate concentration, indicating that the mucous phenotype observed on 28 mM phosphate medium was caused by levan. To our knowledge, this is the first report of the effect of a high concentration of phosphate on exopolysaccharide production. PMID:24717418

  20. [Diversity analysis of desulfuration bacterium from the oxidation ditch of city sewage treatment plant with SO2 gas].

    PubMed

    Huang, Bing; Zhang, Shi-Ling; Zhang, Jiang-Hong; Ao, Yong; Shi, Zhe

    2011-07-01

    A group of removing SO2 bacterium was obtained from the oxidation ditch of city sewage treatment plant by inductive domestication over 6 d with low concentration SO2 gas, and they have an ability with biodegradation rate of 888 mg x (L x h)(-1) and a degradation efficiency of 85% during 1.5 h for SO2 dissolved in water with their synergy. The clone library and two phylogenetic trees of the removing SO2 bacterium communities were obtained based on 16S rRNA DNA comparison by DNA extraction of the sample and in situ polymerase chain reaction (PCR). The phylogenetic analysis showed that 8 dominant desulfuration bacterium occupy about 69% of all removing SO2 bacterium, and some of them have a kindred with discovered desulfuration bacterium but not homogeneity, and there are four belong to alpha-Proteobacteria, another four belong to beta-Proteobacteria in them. The gene information about 16S rRNA sequence of the dominant desulfuration bacteria and domestication method provide a basic of looking for or domesticating removing SO2 bacterium for development microbial desulfurization technology of contained SO2 tail gas.

  1. Characterization of a bacterium of the genus Azospirillum from cellulolytic nitrogen-fixing mixed cultures.

    PubMed

    Wong, P P; Stenberg, N E; Edgar, L

    1980-03-01

    A bacterium with the taxonomic characteristics of the genus Azospirillum was isolated from celluloytic N2-fixing mixed cultures. Its characteristics fit the descriptions of both Azopirillum lipoferum (Beijerinck) comb. nov. and Azospirillum brasilense sp. nov. It may be a variant strain of A. lipoferum. In mixed cultures with cellulolytic organisms, the bacterium grew and fixed N2 with cellelose as a sole source of energy and carbon. The mixed cultures used cellulose from leaves of wheat (Triticum aestivum L.), corn (Zea mays L.), and big bluestem grass (Andropogon gerardii Vitm). Microaerophilic N2-fixing bacteria of the genus Azospirillum, such as the bacterium we isolated, may be important contributors of fixed N2 in soil with partial anaerobiosis and cellulose decomposition.

  2. Biofilm Formation by a Metabolically Versatile Bacterium

    DTIC Science & Technology

    2005-10-02

    Rhodopseudomonas palustris is a photosynthetic bacterium that has good potential to be developed as a biocatalyst for the production of hydrogen, a...A for none) Samanta, S. K and C. S. Harwood. 2005. Use of the Rhodopseudomonas palustris genome to identify a single amino acid that contributes to...operon from Rhodopseudomonas palustris mediates dicarboxylic acid degradation and participates in anaerobic benzoate degradation. Microbiology 151

  3. Boron nitride nanotube-based biosensing of various bacterium/viruses: continuum modelling-based simulation approach.

    PubMed

    Panchal, Mitesh B; Upadhyay, Sanjay H

    2014-09-01

    In this study, the feasibility of single walled boron nitride nanotube (SWBNNT)-based biosensors has been ensured considering the continuum modelling-based simulation approach, for mass-based detection of various bacterium/viruses. Various types of bacterium or viruses have been taken into consideration at the free-end of the cantilevered configuration of the SWBNNT, as a biosensor. Resonant frequency shift-based analysis has been performed with the adsorption of various bacterium/viruses considered as additional mass to the SWBNNT-based sensor system. The continuum mechanics-based analytical approach, considering effective wall thickness has been considered to validate the finite element method (FEM)-based simulation results, based on continuum volume-based modelling of the SWBNNT. As a systematic analysis approach, the FEM-based simulation results are found in excellent agreement with the analytical results, to analyse the SWBNNTs for their wide range of applications such as nanoresonators, biosensors, gas-sensors, transducers and so on. The obtained results suggest that by using the SWBNNT of smaller size the sensitivity of the sensor system can be enhanced and detection of the bacterium/virus having mass of 4.28 × 10⁻²⁴ kg can be effectively performed.

  4. In vivo fluorescence imaging of exogenous enzyme activity in the gastrointestinal tract

    PubMed Central

    Fuhrmann, Gregor; Leroux, Jean-Christophe

    2011-01-01

    Exogenous enzymes are administered orally to treat several diseases, such as pancreatic insufficiency and lactose intolerance. Due to the proteinaceous nature of enzymes, they are subject to inactivation and/or digestion in the gastrointestinal (GI) tract. Here we describe a convenient fluorescence-based assay to monitor the activity of therapeutic enzymes in real time in vivo in the GI tract. To establish the proof of principle, the assay was applied to proline-specific endopeptidases (PEPs), a group of enzymes recently proposed as adjuvant therapy for celiac disease (a highly prevalent immunogenetic enteropathy). A short PEP-specific peptide sequence which is part of larger immunotoxic sequences of gluten was labeled with a fluorescent dye and a corresponding quencher. Upon enzymatic cleavage, the fluorescence emission was dequenched and detected with an in vivo imaging system. PEPs originating from Flavobacterium meningosepticum (FM) and Myxococcus xanthus (MX) were evaluated after oral administration in rats. While MX PEP could not cleave the peptide in the stomach, FM PEP showed significant gastric activity reaching 40–60% of the maximal in vivo signal intensity. However, both enzymes produced comparable fluorescence signals in the small intestine. Coadministration of an antacid drug significantly enhanced MX PEP’s gastric activity due to increased pH and/or inhibition of stomach proteases. With this simple procedure, differences in the in vivo performance of PEPs, which could not be identified under in vitro conditions, were detected. This imaging assay could be used to study other oral enzymes in vivo and therefore be instrumental in improving their therapeutic efficiency. PMID:21576491

  5. Influence of substrate mineralogy on bacterial mineralization of calcium carbonate: implications for stone conservation.

    PubMed

    Rodriguez-Navarro, Carlos; Jroundi, Fadwa; Schiro, Mara; Ruiz-Agudo, Encarnación; González-Muñoz, María Teresa

    2012-06-01

    The influence of mineral substrate composition and structure on bacterial calcium carbonate productivity and polymorph selection was studied. Bacterial calcium carbonate precipitation occurred on calcitic (Iceland spar single crystals, marble, and porous limestone) and silicate (glass coverslips, porous sintered glass, and quartz sandstone) substrates following culturing in liquid medium (M-3P) inoculated with different types of bacteria (Myxococcus xanthus, Brevundimonas diminuta, and a carbonatogenic bacterial community isolated from porous calcarenite stone in a historical building) and direct application of sterile M-3P medium to limestone and sandstone with their own bacterial communities. Field emission scanning electron microscopy (FESEM), atomic force microscopy (AFM), powder X-ray diffraction (XRD), and 2-dimensional XRD (2D-XRD) analyses revealed that abundant highly oriented calcite crystals formed homoepitaxially on the calcitic substrates, irrespective of the bacterial type. Conversely, scattered spheroidal vaterite entombing bacterial cells formed on the silicate substrates. These results show that carbonate phase selection is not strain specific and that under equal culture conditions, the substrate type is the overruling factor for calcium carbonate polymorph selection. Furthermore, carbonate productivity is strongly dependent on the mineralogy of the substrate. Calcitic substrates offer a higher affinity for bacterial attachment than silicate substrates, thereby fostering bacterial growth and metabolic activity, resulting in higher production of calcium carbonate cement. Bacterial calcite grows coherently over the calcitic substrate and is therefore more chemically and mechanically stable than metastable vaterite, which formed incoherently on the silicate substrates. The implications of these results for technological applications of bacterial carbonatogenesis, including building stone conservation, are discussed.

  6. Influence of Substrate Mineralogy on Bacterial Mineralization of Calcium Carbonate: Implications for Stone Conservation

    PubMed Central

    Jroundi, Fadwa; Schiro, Mara; Ruiz-Agudo, Encarnación; González-Muñoz, María Teresa

    2012-01-01

    The influence of mineral substrate composition and structure on bacterial calcium carbonate productivity and polymorph selection was studied. Bacterial calcium carbonate precipitation occurred on calcitic (Iceland spar single crystals, marble, and porous limestone) and silicate (glass coverslips, porous sintered glass, and quartz sandstone) substrates following culturing in liquid medium (M-3P) inoculated with different types of bacteria (Myxococcus xanthus, Brevundimonas diminuta, and a carbonatogenic bacterial community isolated from porous calcarenite stone in a historical building) and direct application of sterile M-3P medium to limestone and sandstone with their own bacterial communities. Field emission scanning electron microscopy (FESEM), atomic force microscopy (AFM), powder X-ray diffraction (XRD), and 2-dimensional XRD (2D-XRD) analyses revealed that abundant highly oriented calcite crystals formed homoepitaxially on the calcitic substrates, irrespective of the bacterial type. Conversely, scattered spheroidal vaterite entombing bacterial cells formed on the silicate substrates. These results show that carbonate phase selection is not strain specific and that under equal culture conditions, the substrate type is the overruling factor for calcium carbonate polymorph selection. Furthermore, carbonate productivity is strongly dependent on the mineralogy of the substrate. Calcitic substrates offer a higher affinity for bacterial attachment than silicate substrates, thereby fostering bacterial growth and metabolic activity, resulting in higher production of calcium carbonate cement. Bacterial calcite grows coherently over the calcitic substrate and is therefore more chemically and mechanically stable than metastable vaterite, which formed incoherently on the silicate substrates. The implications of these results for technological applications of bacterial carbonatogenesis, including building stone conservation, are discussed. PMID:22447589

  7. Effect of arsenite-oxidizing bacterium B. laterosporus on arsenite toxicity and arsenic translocation in rice seedlings.

    PubMed

    Yang, Gui-Di; Xie, Wan-Ying; Zhu, Xi; Huang, Yi; Yang, Xiao-Jun; Qiu, Zong-Qing; Lv, Zhen-Mao; Wang, Wen-Na; Lin, Wen-Xiong

    2015-10-01

    Arsenite [As (III)] oxidation can be accelerated by bacterial catalysis, but the effects of the accelerated oxidation on arsenic toxicity and translocation in rice plants are poorly understood. Herein we investigated how an arsenite-oxidizing bacterium, namely Brevibacillus laterosporus, influences As (III) toxicity and translocation in rice plants. Rice seedlings of four cultivars, namely Guangyou Ming 118 (GM), Teyou Hang II (TH), Shanyou 63 (SY) and Minghui 63 (MH), inoculated with or without the bacterium were grown hydroponically with As (III) to investigate its effects on arsenic toxicity and translocation in the plants. Percentages of As (III) oxidation in the solutions with the bacterium (100%) were all significantly higher than those without (30-72%). The addition of the bacterium significantly decreased As (III) concentrations in SY root, GM root and shoot, while increased the As (III) concentrations in the shoot of SY, MH and TH and in the root of MH. Furthermore, the As (III) concentrations in the root and shoot of SY were both the lowest among the treatments with the bacterium. On the other hand, its addition significantly alleviated the As (III) toxicity on four rice cultivars. Among the treatments amended with B. laterosporus, the bacterium showed the best remediation on SY seedlings, with respect to the subdued As (III) toxicity and decreased As (III) concentration in its roots. These results indicated that As (III) oxidation accelerated by B. laterosporus could be an effective method to alleviate As (III) toxicity on rice seedlings. Copyright © 2015 Elsevier Inc. All rights reserved.

  8. Characterization of a novel extremely alkalophilic bacterium

    NASA Technical Reports Server (NTRS)

    Souza, K. A.; Deal, P. H.

    1977-01-01

    A new alkalophilic bacterium, isolated from a natural spring of high pH is characterized. It is a Gram-positive, non-sporulating, motile rod requiring aerobic and alkaline conditions for growth. The characteristics of this organism resemble those of the coryneform group of bacteria; however, there are no accepted genera within this group with which this organism can be closely matched. Therefore, a new genus may be warranted.

  9. Extracellular nucleic acids of the marine bacterium Rhodovulum sulfidophilum and recombinant RNA production technology using bacteria.

    PubMed

    Kikuchi, Yo; Umekage, So

    2018-02-01

    Extracellular nucleic acids of high molecular weight are detected ubiquitously in seawater. Recent studies have indicated that these nucleic acids are, at least in part, derived from active production by some bacteria. The marine bacterium Rhodovulum sulfidophilum is one of those bacteria. Rhodovulumsulfidophilum is a non-sulfur phototrophic marine bacterium that is known to form structured communities of cells called flocs, and to produce extracellular nucleic acids in culture media. Recently, it has been revealed that this bacterium produces gene transfer agent-like particles and that this particle production may be related to the extracellular nucleic acid production mechanism. This review provides a summary of recent physiological and genetic studies of these phenomena and also introduces a new method for extracellular production of artificial and biologically functional RNAs using this bacterium. In addition, artificial RNA production using Escherichia coli, which is related to this topic, will also be described. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  10. Complete Genome Sequence of the p-Nitrophenol-Degrading Bacterium Pseudomonas putida DLL-E4

    PubMed Central

    Hu, Xiaojun; Wang, Jue; Wang, Fei; Chen, Qiongzhen; Huang, Yan

    2014-01-01

    The first complete genome sequence of a p-nitrophenol (PNP)-degrading bacterium is reported here. Pseudomonas putida DLL-E4, a Gram-negative bacterium isolated from methyl-parathion-polluted soil, can utilize PNP as the sole carbon and nitrogen source. P. putida DLL-E4 has a 6,484,062 bp circular chromosome that contains 5,894 genes, with a G+C content of 62.46%. PMID:24948765

  11. Pathogenicity of Moraxella osloensis, a bacterium associated with the nematode Phasmarhabditis hermaphrodita, to the slug Deroceras reticulatum.

    PubMed

    Tan, L; Grewal, P S

    2001-11-01

    Moraxella osloensis, a gram-negative bacterium, is associated with Phasmarhabditis hermaphrodita, a nematode parasite of slugs. This bacterium-feeding nematode has potential for the biological control of slugs, especially the grey garden slug, Deroceras reticulatum. Infective juveniles of P. hermaphrodita invade the shell cavity of the slug, develop into self-fertilizing hermaphrodites, and produce progeny, resulting in host death. However, the role of the associated bacterium in the pathogenicity of the nematode to the slug is unknown. We discovered that M. osloensis alone is pathogenic to D. reticulatum after injection into the shell cavity or hemocoel of the slug. The bacteria from 60-h cultures were more pathogenic than the bacteria from 40-h cultures, as indicated by the higher and more rapid mortality of the slugs injected with the former. Coinjection of penicillin and streptomycin with the 60-h bacterial culture reduced its pathogenicity to the slug. Further work suggested that the reduction and loss of pathogenicity of the aged infective juveniles of P. hermaphrodita to D. reticulatum result from the loss of M. osloensis from the aged nematodes. Also, axenic J1/J2 nematodes were nonpathogenic after injection into the shell cavity. Therefore, we conclude that the bacterium is the sole killing agent of D. reticulatum in the nematode-bacterium complex and that P. hermaphrodita acts only as a vector to transport the bacterium into the shell cavity of the slug. The identification of the toxic metabolites produced by M. osloensis is being pursued.

  12. Halomonas maura is a physiologically versatile bacterium of both ecological and biotechnological interest.

    PubMed

    Llamas, Inmaculada; del Moral, Ana; Martínez-Checa, Fernando; Arco, Yolanda; Arias, Soledad; Quesada, Emilia

    2006-01-01

    Halomonas maura is a bacterium of great metabolic versatility. We summarise in this work some of the properties that make it a very interesting microorganism both from an ecological and biotechnological point of view. It plays an active role in the nitrogen cycle, is capable of anaerobic respiration in the presence of nitrate and has recently been identified as a diazotrophic bacterium. Of equal interest is mauran, the exopolysaccharide produced by H. maura, which contributes to the formation of biofilms and thus affords the bacterium advantages in the colonisation of its saline niches. Mauran is highly viscous, shows thixotropic and pseudoplastic behaviour, has the capacity to capture heavy metals and exerts a certain immunomodulator effect in medicine. All these attributes have prompted us to make further investigations into its molecular characteristics. To date we have described 15 open reading frames (ORF's) related to exopolysaccharide production, nitrogen fixation and nitrate reductase activity among others.

  13. Deinococcus mumbaiensis sp. nov., a radiation-resistant pleomorphic bacterium isolated from Mumbai, India.

    PubMed

    Shashidhar, Ravindranath; Bandekar, Jayant R

    2006-01-01

    A radiation-resistant, Gram-negative and pleomorphic bacterium (CON-1) was isolated from a contaminated tryptone glucose yeast extract agar plate in the laboratory. It was red pigmented, nonmotile, nonsporulating, and aerobic, and contained MK-8 as respiratory quinone. The cell wall of this bacterium contained ornithine. The major fatty acids were C16:0, C16:1, C17:0, C18:1 and iso C18:0. The DNA of CON-1 had a G+C content of 70 mol%. Phylogenetic analysis based on 16S rRNA gene sequences showed that CON-1 exhibited a maximum similarity (94.72%) with Deinococcus grandis. Based on the genotypic, phenotypic and chemotaxonomic characteristics, the bacterium CON-1 was identified as a new species of the genus Deinococcus, for which the name Deinococcus mumbaiensis sp. nov. is proposed. The type strain of D. mumbaiensis is CON-1 (MTCC 7297(T)=DSM 17424(T)).

  14. From Genome to Function: Systematic Analysis of the Soil Bacterium Bacillus Subtilis

    PubMed Central

    Crawshaw, Samuel G.; Wipat, Anil

    2001-01-01

    Bacillus subtilis is a sporulating Gram-positive bacterium that lives primarily in the soil and associated water sources. Whilst this bacterium has been studied extensively in the laboratory, relatively few studies have been undertaken to study its activity in natural environments. The publication of the B. subtilis genome sequence and subsequent systematic functional analysis programme have provided an opportunity to develop tools for analysing the role and expression of Bacillus genes in situ. In this paper we discuss analytical approaches that are being developed to relate genes to function in environments such as the rhizosphere. PMID:18628943

  15. Complete Genome Sequence of a thermotolerant sporogenic lactic acid bacterium, Bacillus coagulans strain 36D1

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Xie, Gary; Dalin, Eileen; Tice, Hope

    Bacillus coagulans is a ubiquitous soil bacterium that grows at 50-55 C and pH 5.0 and fer-ments various sugars that constitute plant biomass to L (+)-lactic acid. The ability of this sporogenic lactic acid bacterium to grow at 50-55 C and pH 5.0 makes this organism an attractive microbial biocatalyst for production of optically pure lactic acid at industrial scale not only from glucose derived from cellulose but also from xylose, a major constituent of hemi-cellulose. This bacterium is also considered as a potential probiotic. Complete genome squence of a representative strain, B. coagulans strain 36D1, is presented and discussed.

  16. Genome Sequence of the Soil Bacterium Janthinobacterium sp. KBS0711

    PubMed Central

    Shoemaker, William R.; Muscarella, Mario E.

    2015-01-01

    We present a draft genome of Janthinobacterium sp. KBS0711 that was isolated from agricultural soil. The genome provides insight into the ecological strategies of this bacterium in free-living and host-associated environments. PMID:26089434

  17. Structure and morphology of magnetite anaerobically-produced by a marine magnetotactic bacterium and a dissimilatory iron-reducing bacterium

    USGS Publications Warehouse

    Sparks, N.H.C.; Mann, S.; Bazylinski, D.A.; Lovley, D.R.; Jannasch, H.W.; Frankel, R.B.

    1990-01-01

    Intracellular crystals of magnetite synthesized by cells of the magnetotactic vibroid organism, MV-1, and extracellular crystals of magnetite produced by the non-magnetotactic dissimilatory iron-reducing bacterium strain GS-15, were examined using high-resolution transmission electron microscopy, electron diffraction and 57Fe Mo??ssbauer spectroscopy. The magnetotactic bacterium contained a single chain of approximately 10 crystals aligned along the long axis of the cell. The crystals were essentially pure stoichiometric magnetite. When viewed along the crystal long axis the particles had a hexagonal cross-section whereas side-on they appeared as rectangules or truncated rectangles of average dimension, 53 ?? 35 nm. These findings are explained in terms of a three-dimensional morphology comprising a hexagonal prism of {110} faces which are capped and truncated by {111} end faces. Electron diffraction and lattice imaging studies indicated that the particles were structurally well-defined single crystals. In contrast, magnetite particles produced by the strain, GS-15 were irregular in shape and had smaller mean dimensions (14 nm). Single crystals were imaged but these were not of high structural perfection. These results highlight the influence of intracellular control on the crystallochemical specificity of bacterial magnetites. The characterization of these crystals is important in aiding the identification of biogenic magnetic materials in paleomagnetism and in studies of sediment magnetization. ?? 1990.

  18. Transcriptome analysis of the rhizosphere bacterium Azospirillum brasilense reveals an extensive auxin response.

    PubMed

    Van Puyvelde, Sandra; Cloots, Lore; Engelen, Kristof; Das, Frederik; Marchal, Kathleen; Vanderleyden, Jos; Spaepen, Stijn

    2011-05-01

    The rhizosphere bacterium Azospirillum brasilense produces the auxin indole-3-acetic acid (IAA) through the indole-3-pyruvate pathway. As we previously demonstrated that transcription of the indole-3-pyruvate decarboxylase (ipdC) gene is positively regulated by IAA, produced by A. brasilense itself or added exogenously, we performed a microarray analysis to study the overall effects of IAA on the transcriptome of A. brasilense. The transcriptomes of A. brasilense wild-type and the ipdC knockout mutant, both cultured in the absence and presence of exogenously added IAA, were compared.Interfering with the IAA biosynthesis/homeostasis in A. brasilense through inactivation of the ipdC gene or IAA addition results in much broader transcriptional changes than anticipated. Based on the multitude of changes observed by comparing the different transcriptomes, we can conclude that IAA is a signaling molecule in A. brasilense. It appears that the bacterium, when exposed to IAA, adapts itself to the plant rhizosphere, by changing its arsenal of transport proteins and cell surface proteins. A striking example of adaptation to IAA exposure, as happens in the rhizosphere, is the upregulation of a type VI secretion system (T6SS) in the presence of IAA. The T6SS is described as specifically involved in bacterium-eukaryotic host interactions. Additionally, many transcription factors show an altered regulation as well, indicating that the regulatory machinery of the bacterium is changing.

  19. Pathogenicity of Moraxella osloensis, a Bacterium Associated with the Nematode Phasmarhabditis hermaphrodita, to the Slug Deroceras reticulatum

    PubMed Central

    Tan, Li; Grewal, Parwinder S.

    2001-01-01

    Moraxella osloensis, a gram-negative bacterium, is associated with Phasmarhabditis hermaphrodita, a nematode parasite of slugs. This bacterium-feeding nematode has potential for the biological control of slugs, especially the grey garden slug, Deroceras reticulatum. Infective juveniles of P. hermaphrodita invade the shell cavity of the slug, develop into self-fertilizing hermaphrodites, and produce progeny, resulting in host death. However, the role of the associated bacterium in the pathogenicity of the nematode to the slug is unknown. We discovered that M. osloensis alone is pathogenic to D. reticulatum after injection into the shell cavity or hemocoel of the slug. The bacteria from 60-h cultures were more pathogenic than the bacteria from 40-h cultures, as indicated by the higher and more rapid mortality of the slugs injected with the former. Coinjection of penicillin and streptomycin with the 60-h bacterial culture reduced its pathogenicity to the slug. Further work suggested that the reduction and loss of pathogenicity of the aged infective juveniles of P. hermaphrodita to D. reticulatum result from the loss of M. osloensis from the aged nematodes. Also, axenic J1/J2 nematodes were nonpathogenic after injection into the shell cavity. Therefore, we conclude that the bacterium is the sole killing agent of D. reticulatum in the nematode-bacterium complex and that P. hermaphrodita acts only as a vector to transport the bacterium into the shell cavity of the slug. The identification of the toxic metabolites produced by M. osloensis is being pursued. PMID:11679319

  20. Understanding the interaction between an obligate hyperparasitic bacterium, Pasteuria penetrans and its obligate plant-parasitic nematode host, Meloidogyne spp.

    PubMed

    Davies, Keith G

    2009-01-01

    Pasteuria penetrans is an endospore-forming bacterium, which is a hyperparasite of root-knot nematodes Meloidogyne spp. that are economically important pests of a wide range of crops. The life cycle of the bacterium and nematode are described with emphasis on the bacterium's potential as a biocontrol agent. Two aspects that currently prohibit the commercial development of the bacterium as a biocontrol agent are the inability to culture it outside its host and its host specificity. Vegetative growth of the bacterium is possible in vitro; however, getting the vegetative stages of the bacterium to enter sporogenesis has been problematic. Insights from genomic survey sequences regarding the role of cation concentration and the phosphorylation of Spo0F have proved useful in inducing vegetative bacteria to sporulate. Similarly, genomic data have also proved useful in understanding the attachment of endospores to the cuticle of infective nematode juveniles, and a Velcro-like model of spore attachment is proposed that involves collagen-like fibres on the surface of the endospore interacting with mucins on the nematode cuticle. Ecological studies of the interactions between Daphnia and Pasteuria ramosa are examined and similarities are drawn between the co-evolution of virulence in the Daphnia system and that of plant-parasitic nematodes.

  1. Description of a bacterium associated with redmouth disease of rainbow trout (Salmo gairdneri)

    USGS Publications Warehouse

    Ross, A.J.; Rucker, R.R.; Ewing, W.H.

    1966-01-01

    A description was given of a gram-negative, peritrichously flagellated, fermentative bacterium that was isolated on numerous occasions from kidney tissues of rainbow trout (Salmo gairdneri) afflicted with redmouth disease. Although the bacteria apparently were members of the family Enterobacteriaceae, it was impossible to determine their taxonomic position within the family with certainty. Hence it was recommended that their taxonomic position remain sub judice for the present. As a temporary designation RM bacterium was used. Redmouth disease was transmitted from infected to normal fish through the medium of water.

  2. Cadherin Domains in the Polysaccharide-Degrading Marine Bacterium Saccharophagus degradans 2-40 Are Carbohydrate-Binding Modules▿

    PubMed Central

    Fraiberg, Milana; Borovok, Ilya; Bayer, Edward A.; Weiner, Ronald M.; Lamed, Raphael

    2011-01-01

    The complex polysaccharide-degrading marine bacterium Saccharophagus degradans strain 2-40 produces putative proteins that contain numerous cadherin and cadherin-like domains involved in intercellular contact interactions. The current study reveals that both domain types exhibit reversible calcium-dependent binding to different complex polysaccharides which serve as growth substrates for the bacterium. PMID:21036994

  3. Complete Genome Sequence of a thermotolerant sporogenic lactic acid bacterium, Bacillus coagulans strain 36D1

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rhee, Mun Su; Moritz, Brelan E.; Xie, Gary

    Bacillus coagulans is a ubiquitous soil bacterium that grows at 50-55 C and pH 5.0 and fer- ments various sugars that constitute plant biomass to L (+)-lactic acid. The ability of this spo- rogenic lactic acid bacterium to grow at 50-55 C and pH 5.0 makes this organism an attrac- tive microbial biocatalyst for production of optically pure lactic acid at industrial scale not only from glucose derived from cellulose but also from xylose, a major constituent of hemi- cellulose. This bacterium is also considered as a potential probiotic. Complete genome se- quence of a representative strain, B. coagulans strainmore » 36D1, is presented and discussed.« less

  4. Complete Genome Sequence of a thermotolerant sporogenic lactic acid bacterium, Bacillus coagulans strain 36D1

    PubMed Central

    Rhee, Mun Su; Moritz, Brélan E.; Xie, Gary; Glavina del Rio, T.; Dalin, E.; Tice, H.; Bruce, D.; Goodwin, L.; Chertkov, O.; Brettin, T.; Han, C.; Detter, C.; Pitluck, S.; Land, Miriam L.; Patel, Milind; Ou, Mark; Harbrucker, Roberta; Ingram, Lonnie O.; Shanmugam, K. T.

    2011-01-01

    Bacillus coagulans is a ubiquitous soil bacterium that grows at 50-55 °C and pH 5.0 and ferments various sugars that constitute plant biomass to L (+)-lactic acid. The ability of this sporogenic lactic acid bacterium to grow at 50-55 °C and pH 5.0 makes this organism an attractive microbial biocatalyst for production of optically pure lactic acid at industrial scale not only from glucose derived from cellulose but also from xylose, a major constituent of hemicellulose. This bacterium is also considered as a potential probiotic. Complete genome sequence of a representative strain, B. coagulans strain 36D1, is presented and discussed. PMID:22675583

  5. Paradigms: examples from the bacterium Xylella fastidiosa.

    PubMed

    Purcell, Alexander

    2013-01-01

    The history of advances in research on Xylella fastidiosa provides excellent examples of how paradigms both advance and limit our scientific understanding of plant pathogens and the plant diseases they cause. I describe this from a personal perspective, having been directly involved with many persons who made paradigm-changing discoveries, beginning with the discovery that a bacterium, not a virus, causes Pierce's disease of grape and other plant diseases in numerous plant species, including important crop and forest species.

  6. A novel strategy for acetonitrile wastewater treatment by using a recombinant bacterium with biofilm-forming and nitrile-degrading capability.

    PubMed

    Li, Chunyan; Yue, Zhenlei; Feng, Fengzhao; Xi, Chuanwu; Zang, Hailian; An, Xuejiao; Liu, Keran

    2016-10-01

    There is a great need for efficient acetonitrile removal technology in wastewater treatment to reduce the discharge of this pollutant in untreated wastewater. In this study, a nitrilase gene (nit) isolated from a nitrile-degrading bacterium (Rhodococcus rhodochrous BX2) was cloned and transformed into a biofilm-forming bacterium (Bacillus subtilis N4) that expressed the recombinant protein upon isopropylthio-β-galactoside (IPTG) induction. The recombinant bacterium (B. subtilis N4-pHT01-nit) formed strong biofilms and had nitrile-degrading capability. Further testing demonstrated that biofilms formed by B. subtilis N4-pHT01-nit were highly resistant to loading shock from acetonitrile and almost completely degraded the initial concentration of acetonitrile (800 mg L(-1)) within 24 h in a moving bed biofilm reactor (MBBR) after operation for 35 d. The bacterial composition of the biofilm, identified by high-throughput sequencing, in a reactor in which the B. subtilis N4-pHT01-nit bacterium was introduced indicated that the engineered bacterium was successfully immobilized in the reactor and became dominant genus. This work demonstrates that an engineered bacterium with nitrile-degrading and biofilm-forming capacity can improve the degradation of contaminants in wastewater. This approach offers a novel strategy for enhancing the biological oxidation of toxic pollutants in wastewater. Copyright © 2016 Elsevier Ltd. All rights reserved.

  7. Genome Sequence of Lactobacillus delbrueckii subsp. lactis CNRZ327, a Dairy Bacterium with Anti-Inflammatory Properties.

    PubMed

    El Kafsi, Hela; Binesse, Johan; Loux, Valentin; Buratti, Julien; Boudebbouze, Samira; Dervyn, Rozenn; Hammani, Amal; Maguin, Emmanuelle; van de Guchte, Maarten

    2014-07-17

    Lactobacillus delbrueckii subsp. lactis CNRZ327 is a dairy bacterium with anti-inflammatory properties both in vitro and in vivo. Here, we report the genome sequence of this bacterium, which appears to contain no less than 215 insertion sequence (IS) elements, an exceptionally high number regarding the small genome size of the strain. Copyright © 2014 El Kafsi et al.

  8. Chitin utilization by the insect-transmitted bacterium Xylella fastidiosa.

    PubMed

    Killiny, Nabil; Prado, Simone S; Almeida, Rodrigo P P

    2010-09-01

    Xylella fastidiosa is an insect-borne bacterium that colonizes xylem vessels of a large number of host plants, including several crops of economic importance. Chitin is a polysaccharide present in the cuticle of leafhopper vectors of X. fastidiosa and may serve as a carbon source for this bacterium. Biological assays showed that X. fastidiosa reached larger populations in the presence of chitin. Additionally, chitin induced phenotypic changes in this bacterium, notably increasing adhesiveness. Quantitative PCR assays indicated transcriptional changes in the presence of chitin, and an enzymatic assay demonstrated chitinolytic activity by X. fastidiosa. An ortholog of the chitinase A gene (chiA) was identified in the X. fastidiosa genome. The in silico analysis revealed that the open reading frame of chiA encodes a protein of 351 amino acids with an estimated molecular mass of 40 kDa. chiA is in a locus that consists of genes implicated in polysaccharide degradation. Moreover, this locus was also found in the genomes of closely related bacteria in the genus Xanthomonas, which are plant but not insect associated. X. fastidiosa degraded chitin when grown on a solid chitin-yeast extract-agar medium and grew in liquid medium with chitin as the sole carbon source; ChiA was also determined to be secreted. The gene encoding ChiA was cloned into Escherichia coli, and endochitinase activity was detected in the transformant, showing that the gene is functional and involved in chitin degradation. The results suggest that X. fastidiosa may use its vectors' foregut surface as a carbon source. In addition, chitin may trigger X. fastidiosa's gene regulation and biofilm formation within vectors. Further work is necessary to characterize the role of chitin and its utilization in X. fastidiosa.

  9. Complete genome of Martelella sp. AD-3, a moderately halophilic polycyclic aromatic hydrocarbons-degrading bacterium.

    PubMed

    Cui, Changzheng; Li, Zhijie; Qian, Jiangchao; Shi, Jie; Huang, Ling; Tang, Hongzhi; Chen, Xin; Lin, Kuangfei; Xu, Ping; Liu, Yongdi

    2016-05-10

    Martelella sp. strain AD-3, a moderate halophilic bacterium, was isolated from a petroleum-contaminated soil with high salinity in China. Here, we report the complete genome of strain AD-3, which contains one circular chromosome and two circular plasmids. An array of genes related to metabolism of polycyclic aromatic hydrocarbons and halophilic mechanism in this bacterium was identified by the whole genome analysis. Copyright © 2016 Elsevier B.V. All rights reserved.

  10. Complete genome of the cellulolytic ruminal bacterium Ruminococcus albus 7

    USDA-ARS?s Scientific Manuscript database

    Ruminococcus albus 7 is a highly cellulolytic rumen bacterium that is a member of the phylum Firmicutes. Here, we describe the complete genome for this microbe. This genome will be useful for rumen microbiology, cellulosome biology, and in biofuel production, as one of its major fermentation product...

  11. Draft Genome Sequence of an Anaerobic and Extremophilic Bacterium, Caldanaerobacter yonseiensis, Isolated from a Geothermal Hot Stream

    PubMed Central

    Lee, Sang-Jae; Lee, Yong-Jik; Park, Gun-Seok; Kim, Byoung-Chan; Lee, Sang Jun; Shin, Jae-Ho

    2013-01-01

    Caldanaerobacter yonseiensis is a strictly anaerobic, thermophilic, spore-forming bacterium, which was isolated from a geothermal hot stream in Indonesia. This bacterium utilizes xylose and produces a variety of proteases. Here, we report the draft genome sequence of C. yonseiensis, which reveals insights into the pentose phosphate pathway and protein degradation metabolism in thermophilic microorganisms. PMID:24201201

  12. Fine Structure and Host-Virus Relationship of a Marine Bacterium and Its Bacteriophage

    PubMed Central

    Valentine, Artrice F.; Chapman, George B.

    1966-01-01

    Valentine, Artrice F. (Georgetown University, Washington, D.C.), and George B. Chapman. Fine structure and host-virus relationship of a marine bacterium and its bacteriophage. J. Bacteriol. 92:1535–1554. 1966.—The fine structure of a gram-negative marine bacterium, Cytophaga marinoflava sp. n., has been revealed by ultrathin sectioning and electron microscopy. Stages in the morphogenesis of the bacterial virus NCMB 385, which has been shown to be highly specific for this organism, were also demonstrated in bacterial cells fixed according to the Kellenberger technique. The bacterium possessed a cell wall, cytoplasmic membrane, and nuclear and cytoplasmic regions typical of bacterial cells. Both the cell wall and the cytoplasmic membrane showed a tripartite structure, i.e., each was composed of two dense layers separated by a low-density zone. Intracytoplasmic membrane systems were also observed, especially in dividing cells and in cells in which new viruses were being formed. As many as 18 hexagonally shaped, empty phage heads (membranes only) were observed in untreated, infected bacterial cells. Phage heads, intermediate in density to empty heads and fully condensed ones, possibly representing stages in the morphological development of the virus, were also seen. Images PMID:5924277

  13. Complete genome sequence of the haloalkaliphilic, hydrogen-producing bacterium Halanaerobium hydrogeniformans.

    PubMed

    Brown, Steven D; Begemann, Matthew B; Mormile, Melanie R; Wall, Judy D; Han, Cliff S; Goodwin, Lynne A; Pitluck, Samuel; Land, Miriam L; Hauser, Loren J; Elias, Dwayne A

    2011-07-01

    Halanaerobium hydrogenoformans is an alkaliphilic bacterium capable of biohydrogen production at pH 11 and 7% (wt/vol) salt. We present the 2.6-Mb genome sequence to provide insights into its physiology and potential for bioenergy applications.

  14. Isolation and biological characteristics of aerobic marine magnetotactic bacterium YSC-1

    NASA Astrophysics Data System (ADS)

    Gao, Jun; Pan, Hongmiao; Yue, Haidong; Song, Tao; Zhao, Yong; Chen, Guanjun; Wu, Longfei; Xiao, Tian

    2006-12-01

    Magnetotactic bacteria have become a hot spot of research in microbiology attracting intensive interest of researchers in multiple disciplinary fields. However, the studies were limited in few fastidious bacteria. The objective of this study aims at isolating new marine magnetic bacteria and better comprehension of magnetotactic bacteria. In this study, an aerobic magnetotactic bacterium YSC-1 was isolated from sediments in the Yellow Sea Cold Water Mass (YSCWM). In TEM, magnetic cells have one or several circular magnetosomes in diameter of 100nm, and consist of Fe and Co shown on energy dispersive X-ray spectrum. The biological and physiological characteristics of this bacterium were also described. The colour of YSC-1 colony is white in small rod. The gram stain is negative. Results showed that Strain YSC-1 differs from microaerophile magnetotactic bacteria MS-1 and WD-1 in biology.

  15. Polysaccharide degradation systems of the saprophytic bacterium Cellvibrio japonicus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gardner, Jeffrey G.

    Study of recalcitrant polysaccharide degradation by bacterial systems is critical for understanding biological processes such as global carbon cycling, nutritional contributions of the human gut microbiome, and the production of renewable fuels and chemicals. One bacterium that has a robust ability to degrade polysaccharides is the Gram-negative saprophyte Cellvibrio japonicus. A bacterium with a circuitous history, C. japonicus underwent several taxonomy changes from an initially described Pseudomonas sp. Most of the enzymes described in the pre-genomics era have also been renamed. Furthermore, this review aims to consolidate the biochemical, structural, and genetic data published on C. japonicus and its remarkablemore » ability to degrade cellulose, xylan, and pectin substrates. Initially, C. japonicus carbohydrate-active enzymes were studied biochemically and structurally for their novel polysaccharide binding and degradation characteristics, while more recent systems biology approaches have begun to unravel the complex regulation required for lignocellulose degradation in an environmental context. Also included is a discussion for the future of C. japonicus as a model system, with emphasis on current areas unexplored in terms of polysaccharide degradation and emerging directions for C. japonicus in both environmental and biotechnological applications.« less

  16. Polysaccharide degradation systems of the saprophytic bacterium Cellvibrio japonicus

    DOE PAGES

    Gardner, Jeffrey G.

    2016-06-04

    Study of recalcitrant polysaccharide degradation by bacterial systems is critical for understanding biological processes such as global carbon cycling, nutritional contributions of the human gut microbiome, and the production of renewable fuels and chemicals. One bacterium that has a robust ability to degrade polysaccharides is the Gram-negative saprophyte Cellvibrio japonicus. A bacterium with a circuitous history, C. japonicus underwent several taxonomy changes from an initially described Pseudomonas sp. Most of the enzymes described in the pre-genomics era have also been renamed. Furthermore, this review aims to consolidate the biochemical, structural, and genetic data published on C. japonicus and its remarkablemore » ability to degrade cellulose, xylan, and pectin substrates. Initially, C. japonicus carbohydrate-active enzymes were studied biochemically and structurally for their novel polysaccharide binding and degradation characteristics, while more recent systems biology approaches have begun to unravel the complex regulation required for lignocellulose degradation in an environmental context. Also included is a discussion for the future of C. japonicus as a model system, with emphasis on current areas unexplored in terms of polysaccharide degradation and emerging directions for C. japonicus in both environmental and biotechnological applications.« less

  17. Biodegradation of polyethylene by the thermophilic bacterium Brevibacillus borstelensis.

    PubMed

    Hadad, D; Geresh, S; Sivan, A

    2005-01-01

    To select a polyethylene-degrading micro-organism and to study the factors affecting its biodegrading activity. A thermophilic bacterium Brevibaccillus borstelensis strain 707 (isolated from soil) utilized branched low-density polyethylene as the sole carbon source and degraded it. Incubation of polyethylene with B. borstelensis (30 days, 50 degrees C) reduced its gravimetric and molecular weights by 11 and 30% respectively. Brevibaccillus borstelensis also degraded polyethylene in the presence of mannitol. Biodegradation of u.v. photo-oxidized polyethylene increased with increasing irradiation time. Fourier Transform Infra-Red (FTIR) analysis of photo-oxidized polyethylene revealed a reduction in carbonyl groups after incubation with the bacteria. This study demonstrates that polyethylene--considered to be inert--can be biodegraded if the right microbial strain is isolated. Enrichment culture methods were effective for isolating a thermophilic bacterium capable of utilizing polyethylene as the sole carbon and energy source. Maximal biodegradation was obtained in combination with photo-oxidation, which showed that carbonyl residues formed by photo-oxidation play a role in biodegradation. Brevibaccillus borstelensis also degraded the CH2 backbone of nonirradiated polyethylene. Biodegradation of polyethylene by a single bacterial strain contributes to our understanding of the process and the factors affecting polyethylene biodegradation.

  18. Aerobic Reduction of Arsenate by a Bacterium Isolated From Activated Sludge

    NASA Astrophysics Data System (ADS)

    Kozai, N.; Ohnuki, T.; Hanada, S.; Nakamura, K.; Francis, A. J.

    2006-12-01

    Microlunatus phosphovorus strain NM-1 is a polyphosphate-accumulating bacterium isolated from activated sludge. This bacterium takes up a large amount of polyphosphate under aerobic conditions and release phosphate ions by hydrolysis of polyphosphate to orthophosphate under anaerobic conditions to derive energy for taking up substrates. To understand the nature of this strain, especially, influence of potential contaminants in sewage and wastewater on growth, we have been investigating behavior of this bacterium in media containing arsenic. The present paper mainly reports reduction of arsenate by this bacterium under aerobic conditions. The strain NM-1 (JCM 9379) was aerobically cultured at 30 °C in a nutrient medium containing 2.5 g/l peptone, 0.5 g/l glucose, 1.5 g/l yeast extract, and arsenic [Na2HAsO4 (As(V)) or Na3AsO3 (As(III))] at concentrations between 0 and 50 mM. The cells collected from arsenic-free media were dispersed in buffer solutions containing 2mM HEPES, 10mM NaCl, prescribed concentrations of As(V), and 0-0.2 percent glucose. Then, this cell suspension was kept at 20 °C under aerobic or anaerobic conditions. The speciation of arsenic was carried out by ion chromatography and ICP-MS. The growth of the strain under aerobic conditions was enhanced by the addition of As(V) at the concentration between 1 and 10 mM. The maximum optical density of the culture in the medium containing 5mM As(V) was 1.4 times greater than that of the control culture. Below the As(V) concentration of 10mM, most of the As(V) was reduced to As(III). The growth of the strain under anaerobic conditions has not been observed so far. The cells in the buffer solutions reduced As(V) under aerobic condition. The reduction was enhanced by the addition of glucose. However, the cell did not reduce As(V) under anaerobic conditions. The strain NM-1 showed high resistance to As(V) and As(III). The maximum optical density of the culture grown in a medium containing 50 mM As(V) was only

  19. Thermostable purified endoglucanase from thermophilic bacterium acidothermus cellulolyticus

    DOEpatents

    Tucker, Melvin P.; Grohmann, Karel; Himmel, Michael E.; Mohagheghi, Ali

    1992-01-01

    A substantially purified high molecular weight cellulase enzyme having a molecular weight of between about 156,000 to about 203,400 daltons isolated from the bacterium Acidothermus cellulolyticus (ATCC 43068) and a method of producing it are disclosed. The enzyme is water soluble, possesses both C.sub.1 and C.sub.x types of enzymatic activity, has a high degree of stability toward heat and exhibits both a high optimum temperature activity and high inactivation characteristics.

  20. Genome sequence of the algicidal bacterium Kordia algicida OT-1.

    PubMed

    Lee, Hyun Sook; Kang, Sung Gyun; Kwon, Kae Kyoung; Lee, Jung-Hyun; Kim, Sang-Jin

    2011-08-01

    Kordia algicida OT-1 is an algicidal bacterium against the bloom-forming microalgae. The genome sequence of K. algicida revealed a number of interesting features, including the degradation of macromolecules, the biosynthesis of carotenoid pigment and secondary metabolites, and the capacity for gliding motility, which might facilitate the understanding of algicidal mechanisms.

  1. Evidence of carbon fixation pathway in a bacterium from candidate phylum SBR1093 revealed with genomic analysis.

    PubMed

    Wang, Zhiping; Guo, Feng; Liu, Lili; Zhang, Tong

    2014-01-01

    Autotrophic CO2 fixation is the most important biotransformation process in the biosphere. Research focusing on the diversity and distribution of relevant autotrophs is significant to our comprehension of the biosphere. In this study, a draft genome of a bacterium from candidate phylum SBR1093 was reconstructed with the metagenome of an industrial activated sludge. Based on comparative genomics, this autotrophy may occur via a newly discovered carbon fixation path, the hydroxypropionate-hydroxybutyrate (HPHB) cycle, which was demonstrated in a previous work to be uniquely possessed by some genera from Archaea. This bacterium possesses all of the thirteen enzymes required for the HPHB cycle; these enzymes share 30∼50% identity with those in the autotrophic species of Archaea that undergo the HPHB cycle and 30∼80% identity with the corresponding enzymes of the mixotrophic species within Bradyrhizobiaceae. Thus, this bacterium might have an autotrophic growth mode in certain conditions. A phylogenetic analysis based on the 16S rRNA gene reveals that the phylotypes within candidate phylum SBR1093 are primarily clustered into 5 clades with a shallow branching pattern. This bacterium is clustered with phylotypes from organically contaminated environments, implying a demand for organics in heterotrophic metabolism. Considering the types of regulators, such as FnR, Fur, and ArsR, this bacterium might be a facultative aerobic mixotroph with potential multi-antibiotic and heavy metal resistances. This is the first report on Bacteria that may perform potential carbon fixation via the HPHB cycle, thus may expand our knowledge of the distribution and importance of the HPHB cycle in the biosphere.

  2. Characterization of a potentially novel 'blown pack' spoilage bacterium isolated from bovine hide.

    PubMed

    Moschonas, G; Bolton, D J

    2013-03-01

    To characterize a psychrotrophic bacterium, designated TC1, previously isolated from a cattle hide in Ireland, and to investigate the ability of this strain to cause 'blown pack' spoilage (BPS) of vacuum-packaged beef primals. TC1 was characterized using a combination of phenotypic, chemotaxonomic and genotypic analyses and was assessed for its ability to spoil vacuum-packaged beef at refrigerated temperatures. TC1 was Gram-positive and formed elliptical subterminal endospores. The strain was able to grow between 0 and 33 °C, with optimal growth between 23 and 24 °C. TC1 could be differentiated from its phylogenetically closest neighbour (Clostridium lituseburense DSM 797(T)) by 16S rRNA gene sequencing, pulsed-field gel electrophoresis and cellular fatty acid composition. TC1 spoiled (BPS) beef within 42 days when inoculated in cold-stored (1 °C) vacuum-packed beef. The phenotypic, chemotaxonomic and genotypic characterization indicated that TC1 may represent a potentially novel, cold-tolerant, gas-producing bacterium of considerable economic significance to the beef industry. This study reports and characterizes an emerging BPS bacterium, which should be considered in future activities designed to minimize the psychrophilic and psychrotrophic spoilage of vacuum-packaged beef. © 2012 The Society for Applied Microbiology.

  3. The gene transfer agent-like particle of the marine phototrophic bacterium Rhodovulum sulfidophilum.

    PubMed

    Nagao, Nobuyoshi; Yamamoto, Junya; Komatsu, Hiroyuki; Suzuki, Hiromichi; Hirose, Yuu; Umekage, So; Ohyama, Takashi; Kikuchi, Yo

    2015-12-01

    Gene transfer agents (GTAs) are shaped like bacteriophage particles but have many properties that distinguish them from bacteriophages. GTAs play a role in horizontal gene transfer in nature and thus affect the evolution of prokaryotic genomes. In the course of studies on the extracellular production of designed RNAs using the marine bacterium Rhodovulum sulfidophilum , we found that this bacterium produces a GTA-like particle. The particle contains DNA fragments of 4.5 kb, which consist of randomly fragmented genomic DNA from the bacterium. This 4.5-kb DNA production was prevented while quorum sensing was inhibited. Direct observation of the particle by transmission electron microscopy revealed that the particle resembles a tailed phage and has a head diameter of about 40 nm and a tail length of about 60 nm. We also identified the structural genes for the GTA in the genome. Translated amino acid sequences and gene positions are closely related to those of the genes that encode the Rhodobacter capsulatus GTA. This is the first report of a GTA-like particle from the genus Rhodovulum . However, gene transfer activity of this particle has not yet been confirmed. The differences between this particle and other GTAs are discussed.

  4. Chitin Utilization by the Insect-Transmitted Bacterium Xylella fastidiosa▿ †

    PubMed Central

    Killiny, Nabil; Prado, Simone S.; Almeida, Rodrigo P. P.

    2010-01-01

    Xylella fastidiosa is an insect-borne bacterium that colonizes xylem vessels of a large number of host plants, including several crops of economic importance. Chitin is a polysaccharide present in the cuticle of leafhopper vectors of X. fastidiosa and may serve as a carbon source for this bacterium. Biological assays showed that X. fastidiosa reached larger populations in the presence of chitin. Additionally, chitin induced phenotypic changes in this bacterium, notably increasing adhesiveness. Quantitative PCR assays indicated transcriptional changes in the presence of chitin, and an enzymatic assay demonstrated chitinolytic activity by X. fastidiosa. An ortholog of the chitinase A gene (chiA) was identified in the X. fastidiosa genome. The in silico analysis revealed that the open reading frame of chiA encodes a protein of 351 amino acids with an estimated molecular mass of 40 kDa. chiA is in a locus that consists of genes implicated in polysaccharide degradation. Moreover, this locus was also found in the genomes of closely related bacteria in the genus Xanthomonas, which are plant but not insect associated. X. fastidiosa degraded chitin when grown on a solid chitin-yeast extract-agar medium and grew in liquid medium with chitin as the sole carbon source; ChiA was also determined to be secreted. The gene encoding ChiA was cloned into Escherichia coli, and endochitinase activity was detected in the transformant, showing that the gene is functional and involved in chitin degradation. The results suggest that X. fastidiosa may use its vectors' foregut surface as a carbon source. In addition, chitin may trigger X. fastidiosa's gene regulation and biofilm formation within vectors. Further work is necessary to characterize the role of chitin and its utilization in X. fastidiosa. PMID:20656858

  5. Investigations of Iron Minerals Formed by Dissimilatory Alkaliphilic Bacterium with 57Fe Mössbauer Spectroscopy

    NASA Astrophysics Data System (ADS)

    Chistyakova, N. I.; Rusakov, V. S.; Shapkin, A. A.; Zhilina, T. N.; Zavarzina, D. G.; Lančok, A.; Kohout, J.

    2010-07-01

    Anaerobic alkaliphilic bacterium of Geoalkalibacter ferrihydriticus type (strain Z-0531), isolated from a bottom sediment sample from the weakly mineralized soda Lake Khadyn, have been analyzed. The strain uses the amorphous Fe(III)-hydroxide (AFH) as an electron acceptor and acetate CH3COO- as an electron donor. Mössbauer investigations of solid phase samples obtained during the process of the bacterium growth were carried out at room temperature, 77.8 K, 4.2 K without and with the presence of an external magnetic field (6 T) applied perpendicular to the γ-bebam.

  6. Studying the Symbiotic Bacterium Xenorhabdus nematophila in Individual, Living Steinernema carpocapsae Nematodes Using Microfluidic Systems.

    PubMed

    Stilwell, Matthew D; Cao, Mengyi; Goodrich-Blair, Heidi; Weibel, Douglas B

    2018-01-01

    Animal-microbe symbioses are ubiquitous in nature and scientifically important in diverse areas, including ecology, medicine, and agriculture. Steinernema nematodes and Xenorhabdus bacteria compose an established, successful model system for investigating microbial pathogenesis and mutualism. The bacterium Xenorhabdus nematophila is a species-specific mutualist of insect-infecting Steinernema carpocapsae nematodes. The bacterium colonizes a specialized intestinal pocket within the infective stage of the nematode, which transports the bacteria between insects that are killed and consumed by the pair for reproduction. Current understanding of the interaction between the infective-stage nematode and its bacterial colonizers is based largely on population-level, snapshot time point studies on these organisms. This limitation arises because investigating temporal dynamics of the bacterium within the nematode is impeded by the difficulty of isolating and maintaining individual living nematodes and tracking colonizing bacterial cells over time. To overcome this challenge, we developed a microfluidic system that enables us to spatially isolate and microscopically observe individual, living Steinernema nematodes and monitor the growth and development of the associated X. nematophila bacterial communities-starting from a single cell or a few cells-over weeks. Our data demonstrate, to our knowledge, the first direct, temporal, in vivo visual analysis of a symbiosis system and the application of this system to reveal continuous dynamics of the symbiont population in the living host animal. IMPORTANCE This paper describes an experimental system for directly investigating population dynamics of a symbiotic bacterium, Xenorhabdus nematophila , in its host-the infective stage of the entomopathogenic nematode Steinernema carpocapsae . Tracking individual and groups of bacteria in individual host nematodes over days and weeks yielded insight into dynamic growth and topology changes

  7. Tyrosine sulfation in a Gram-negative bacterium

    PubMed Central

    Han, Sang-Wook; Lee, Sang-Won; Bahar, Ofir; Schwessinger, Benjamin; Robinson, Michelle R.; Shaw, Jared B.; Madsen, James A.; Brodbelt, Jennifer S.; Ronald, Pamela C.

    2015-01-01

    Tyrosine sulfation, a well-characterized post-translation modification in eukaryotes, has not previously been reported in prokaryotes. Here we demonstrate that the RaxST protein from the Gram-negative bacterium, Xanthomonas oryzae pv. oryzae, is a tyrosine sulfotransferase. We used a newly developed sulfotransferase assay and ultraviolet photodissociation mass spectrometry (UVPD) to demonstrate that RaxST catalyzes sulfation of tyrosine 22 of the Xoo Ax21 (activator of XA21-mediated immunity). These results demonstrate a previously undescribed post-translational modification in a prokaryotic species with implications extending to host immune response and bacterial cell-cell communication system. PMID:23093190

  8. Partial proteome of the corynetoxin-producing Gram-positive bacterium, Rathayibacter toxicus

    USDA-ARS?s Scientific Manuscript database

    Rathayibacter toxicus is a Gram-positive bacterium that is the causative agent of annual ryegrass toxicity (ARGT), a disease that causes devastating losses in the Australian livestock industry. R. toxicus exhibits a complex life cycle, using the nematode Anguina funesta as a physical vector to carry...

  9. Application of agglomerative clustering for analyzing phylogenetically on bacterium of saliva

    NASA Astrophysics Data System (ADS)

    Bustamam, A.; Fitria, I.; Umam, K.

    2017-07-01

    Analyzing population of Streptococcus bacteria is important since these species can cause dental caries, periodontal, halitosis (bad breath) and more problems. This paper will discuss the phylogenetically relation between the bacterium Streptococcus in saliva using a phylogenetic tree of agglomerative clustering methods. Starting with the bacterium Streptococcus DNA sequence obtained from the GenBank, then performed characteristic extraction of DNA sequences. The characteristic extraction result is matrix form, then performed normalization using min-max normalization and calculate genetic distance using Manhattan distance. Agglomerative clustering technique consisting of single linkage, complete linkage and average linkage. In this agglomerative algorithm number of group is started with the number of individual species. The most similar species is grouped until the similarity decreases and then formed a single group. Results of grouping is a phylogenetic tree and branches that join an established level of distance, that the smaller the distance the more the similarity of the larger species implementation is using R, an open source program.

  10. Melanin from the Nitrogen-Fixing Bacterium Azotobacter chroococcum: A Spectroscopic Characterization

    PubMed Central

    Banerjee, Raja

    2014-01-01

    Melanins, the ubiquitous hetero-polymer pigments found widely dispersed among various life forms, are usually dark brown/black in colour. Although melanins have variety of biological functions, including protection against ultraviolet radiation of sunlight and are used in medicine, cosmetics, extraction of melanin from the animal and plant kingdoms is not an easy task. Using complementary physicochemical techniques (i.e. MALDI-TOF, FTIR absorption and cross-polarization magic angle spinning solid-state 13C NMR), we report here the characterization of melanins extracted from the nitrogen-fixing non-virulent bacterium Azotobacter chroococcum, a safe viable source. Moreover, considering dihydroxyindole moiety as the main constituent, an effort is made to propose the putative molecular structure of the melanin hetero-polymer extracted from the bacterium. Characterization of the melanin obtained from Azotobacter chroococcum would provide an inspiration in extending research activities on these hetero-polymers and their use as protective agent against UV radiation. PMID:24416247

  11. Draft Genome Sequence of Arthrobacter sp. Strain SPG23, a Hydrocarbon-Degrading and Plant Growth-Promoting Soil Bacterium.

    PubMed

    Gkorezis, Panagiotis; Bottos, Eric M; Van Hamme, Jonathan D; Thijs, Sofie; Rineau, Francois; Franzetti, Andrea; Balseiro-Romero, Maria; Weyens, Nele; Vangronsveld, Jaco

    2015-12-23

    We report here the 4.7-Mb draft genome of Arthrobacter sp. SPG23, a hydrocarbonoclastic Gram-positive bacterium belonging to the Actinobacteria, isolated from diesel-contaminated soil at the Ford Motor Company site in Genk, Belgium. Strain SPG23 is a potent plant growth promoter useful for diesel fuel remediation applications based on plant-bacterium associations. Copyright © 2015 Gkorezis et al.

  12. Draft Genome Sequence of Bacillus licheniformis Strain GB2, a Hydrocarbon-Degrading and Plant Growth-Promoting Soil Bacterium.

    PubMed

    Gkorezis, Panagiotis; Van Hamme, Jonathan; Bottos, Eric; Thijs, Sofie; Balseiro-Romero, Maria; Monterroso, Carmela; Kidd, Petra Suzan; Rineau, Francois; Weyens, Nele; Sillen, Wouter; Vangronsveld, Jaco

    2016-06-23

    We report the 4.39 Mb draft genome of Bacillus licheniformis GB2, a hydrocarbonoclastic Gram-positive bacterium of the family Bacillaceae, isolated from diesel-contaminated soil at the Ford Motor Company site in Genk, Belgium. Strain GB2 is an effective plant-growth promoter useful for diesel fuel remediation applications based on plant-bacterium associations. Copyright © 2016 Gkorezis et al.

  13. ["Candidatus contubernalis alkalaceticum," an obligately syntrophic alkaliphilic bacterium capable of anaerobic acetate oxidation in a coculture with Desulfonatronum cooperativum].

    PubMed

    Zhilina, T N; Zavarzina, D G; Kolganova, T V; Turova, T P; Zavarzin, G A

    2005-01-01

    From the silty sediments of the Khadyn soda lake (Tuva), a binary sulfidogenic bacterial association capable of syntrophic acetate oxidation at pH 10.0 was isolated. An obligately syntrophic, gram-positive, spore-forming alkaliphilic rod-shaped bacterium performs acetate oxidation in a syntrophic association with a hydrogenotrophic, alkaliphilic sulfate-reducing bacterium; the latter organism was previously isolated and characterized as the new species Desulfonatronum cooperativum. Other sulfate-reducing bacteria of the genera Desulfonatronum and Desulfonatronovibrio can also act as the hydrogenotrophic partner. Apart from acetate, the syntrophic culture can oxidize ethanol, propanol, isopropanol, serine, fructose, and isobutyric acid. Selective amplification of 16S rRNA gene fragments of the acetate-utilizing syntrophic component of the binary culture was performed; it was found to cluster with clones of uncultured gram-positive bacteria within the family Syntrophomonadaceae. The acetate-oxidizing bacterium is thus the first representative of this cluster obtained in a laboratory culture. Based on its phylogenetic position, the new acetate-oxidizing syntrophic bacterium is proposed to be assigned, in a Candidate status, to a new genus and species: "Candidatus Contubernalis alkalaceticum."

  14. Isolation and characterization of Leu[7]-Surfactin from the endophytic bacterium Bacillus mojavensis RRC 101, a biocontrol agent for Fusarium verticillioides

    USDA-ARS?s Scientific Manuscript database

    Bacillus mojavensis is an endophytic bacterium patented for control of fungal diseases in maize and other plants. Culture extracts and filtrates from this bacterium were antagonistic to the pathogenic and mycotoxic fungus Fusarium verticillioides. However, the identity of the inhibitory substance ...

  15. Stress of algicidal substances from a bacterium Exiguobacterium sp. h10 on Microcystis aeruginosa.

    PubMed

    Li, Y; Liu, L; Xu, Y; Li, P; Zhang, K; Jiang, X; Zheng, T; Wang, H

    2017-01-01

    Microcystis aeruginosa is a cyanobacterial bloom-causing species and is considered a serious threat to human health and biological safety. In this study, the algicidal bacterium h10 showed high algicidal effects on M. aeruginosa 7820, and strain h10 was confirmed to belong to the genus Exiguobacterium, for which the name Exiguobacterium sp. h10 is proposed. Algicidal activity and mode analysis revealed that the supernatant, rather than the bacterial cells, was responsible for the algicidal activity, indicating that the algicidal mode of strain h10 is by indirect attack through the production of algicidal substances. Analysis of the algicidal substance characteristics showed a molecular weight of <1000 Da and that algicidal substances exhibit high thermal stability and pH instability, and the characteristic functional groups of the algicidal substance mainly included carbonyl, amino and hydroxyl groups. Under the effects of the algicidal substance, the cellular pigment content was significantly decreased, and the algal cell structure and morphology were seriously damaged. The results indicate that the algicidal bacterium Exiguobacterium sp. h10 could be a potential bio-agent for controlling cyanobacterial blooms of M. aeruginosa. In this study, the effects of algicidal substances from an algicidal bacterium Exiguobacterium sp. h10 on the toxic cyanobacterium, Microcystis aeruginosa 7820, were first investigated. The algicidal mode of action was confirmed as an indirect attack through the production of algicidal substances. The characteristics of the algicidal substance were determined, especially the functional groups analysis that confirmed the algicidal substances were glycolipid mixtures. With the stress of algicidal substances, the algal chlorophyll a synthesis, cell structure and morphology were seriously damaged. This study proved that algicidal bacteria are promising sources of potential cyanobacterial bloom-control, and provided good procedures for the

  16. Biodegradation of Ethylene Glycol by a Salt-Requiring Bacterium1

    PubMed Central

    Gonzalez, Carlos F.; Taber, Willard A.; Zeitoun, M. A.

    1972-01-01

    A gram-negative nonmotile rod which was capable of using 1,2-14C-ethylene glycol as a sole carbon source for growth was isolated from a brine pond, Great Salt Lake, Utah. The bacterium (ATCC 27042) required at least 0.85% NaCl for growth and, although the chloride ion was replaceable by sulfate ion, the sodium ion was not replaceable by potassium ion. The maximal concentration of salt tolerated for growth was approximately 12%. The bacterium was oxidase-negative when N,N-dimethyl-p-phenylenediamine was used and weakly positive when N,N,N′,N′-tetramethyl-p-phenylenediamine was used. It grows on many sugars but does not ferment them, it does not have an exogenous vitamin requirement, and it possesses a guanine plus cytosine ratio of 64.3%. Incorporation of ethylene glycol carbon into cell and respired CO2 was quantitated by use of radioactive ethylene glycol and a force-aerated fermentor. Glucose suppressed ethylene glycol metabolism. Cells grown on ethylene and propylene glycol respired ethylene glycol in a Warburg respirometer more rapidly than cells grown on glucose. Spectrophotometric evidence was obtained for oxidation of glycolate to glyoxylate by a dialyzed cell extract. PMID:4568254

  17. Chromatin organization and radio resistance in the bacterium Gemmata obscuriglobus.

    PubMed

    Lieber, Arnon; Leis, Andrew; Kushmaro, Ariel; Minsky, Abraham; Medalia, Ohad

    2009-03-01

    The organization of chromatin has a major impact on cellular activities, such as gene expression. For bacteria, it was suggested that the spatial organization of the genetic material correlates with transcriptional levels, implying a specific architecture of the chromosome within the cytoplasm. Accordingly, recent technological advances have emphasized the organization of the genetic material within nucleoid structures. Gemmata obscuriglobus, a member of the phylum Planctomycetes, exhibits a distinctive nucleoid structure in which chromatin is encapsulated within a discrete membrane-bound compartment. Here, we show that this soil and freshwater bacterium tolerates high doses of UV and ionizing radiation. Cryoelectron tomography of frozen hydrated sections and electron microscopy of freeze-substituted cells have indicated a more highly ordered condensed-chromatin organization in actively dividing and stationary-phase G. obscuriglobus cells. These three-dimensional analyses revealed a complex network of double membranes that engulf the condensed DNA. Bioinformatics analysis has revealed the existence of a putative component involved in nonhomologous DNA end joining that presumably plays a role in maintaining chromatin integrity within the bacterium. Thus, our observations further support the notion that packed chromatin organization enhances radiation tolerance.

  18. Isolation of a New Polysaccharide-Digesting Bacterium from a Salt Marsh

    PubMed Central

    Andrykovitch, George; Marx, Irene

    1988-01-01

    A new marine bacterium that digested a variety of storage and structural polysaccharides, including agar, was isolated. Strain 2-40 is a nonfermentative gram-negative, polarly flagellated rod that sometimes grew as a filamentous helix and secreted a melaninlike pigment. Its characteristics conform to those of no previously described species. PMID:16347602

  19. An Endohyphal Bacterium (Chitinophaga, Bacteroidetes) Alters Carbon Source Use by Fusarium keratoplasticum (F. solani Species Complex, Nectriaceae)

    PubMed Central

    Shaffer, Justin P.; U'Ren, Jana M.; Gallery, Rachel E.; Baltrus, David A.; Arnold, A. Elizabeth

    2017-01-01

    Bacterial endosymbionts occur in diverse fungi, including members of many lineages of Ascomycota that inhabit living plants. These endosymbiotic bacteria (endohyphal bacteria, EHB) often can be removed from living fungi by antibiotic treatment, providing an opportunity to assess their effects on functional traits of their fungal hosts. We examined the effects of an endohyphal bacterium (Chitinophaga sp., Bacteroidetes) on substrate use by its host, a seed-associated strain of the fungus Fusarium keratoplasticum, by comparing growth between naturally infected and cured fungal strains across 95 carbon sources with a Biolog® phenotypic microarray. Across the majority of substrates (62%), the strain harboring the bacterium significantly outperformed the cured strain as measured by respiration and hyphal density. These substrates included many that are important for plant- and seed-fungus interactions, such as D-trehalose, myo-inositol, and sucrose, highlighting the potential influence of EHB on the breadth and efficiency of substrate use by an important Fusarium species. Cases in which the cured strain outperformed the strain harboring the bacterium were observed in only 5% of substrates. We propose that additive or synergistic substrate use by the fungus-bacterium pair enhances fungal growth in this association. More generally, alteration of the breadth or efficiency of substrate use by dispensable EHB may change fungal niches in short timeframes, potentially shaping fungal ecology and the outcomes of fungal-host interactions. PMID:28382021

  20. Effects of an equol-producing bacterium isolated from human faeces on isoflavone and lignan metabolism in mice.

    PubMed

    Tamura, Motoi; Hori, Sachiko; Nakagawa, Hiroyuki; Yamauchi, Satoshi; Sugahara, Takuya

    2016-07-01

    Equol is a metabolite of daidzein that is produced by intestinal microbiota. The oestrogenic activity of equol is stronger than daidzein. Equol-producing bacteria are believed to play an important role in the gut. The rod-shaped and Gram-positive anaerobic equol-producing intestinal bacterium Slackia TM-30 was isolated from healthy human faeces and its effects on urinary phyto-oestrogen, plasma and faecal lipids were assessed in adult mice. The urinary amounts of equol in urine were significantly higher in mice receiving the equol-producing bacterium TM-30 (BAC) group than in the control (CO) group (P < 0.05). However, no significant differences were observed between the urinary amounts of daidzein, dihydrodaidzein, enterodiol, and enterolactone between the BAC and CO groups. No significant differences in the plasma lipids were observed between the two groups. The lipid content (% dry weight) in the faeces sampled on the final day of the experiment tended to be higher in the BAC group than in the CO group (P = 0.07). Administration of equol-producing bacterium TM-30 affected the urinary amounts of phyto-oestrogens and the faecal lipid contents of mice. The equol-producing bacterium TM-30 likely influences the metabolism of phyto-oestrogen via changes in the gastrointestinal environment. © 2015 Society of Chemical Industry. © 2015 Society of Chemical Industry.

  1. Halobacterium saccharovorum sp. nov., a carbohydrate-metabolizing, extremely halophilic bacterium

    NASA Technical Reports Server (NTRS)

    Tomlinson, G. A.; Hochstein, L. I.

    1976-01-01

    The previously described extremely halophilic bacterium, strain M6, metabolizes a variety of carbohydrates with the production of acid. In addition, the organism produces nitrite (but no gas) from nitrate, is motile, and grows most rapidly at about 50 C. These characteristics distinguish it from all previously described halophilic bacteria in the genus Halobacterium. It is suggested that it be designated as a new species, Halobacterium saccharovorum.

  2. Draft genome sequence of a strictly anaerobic dichloromethane-degrading bacterium

    DOE PAGES

    Kleindienst, Sara; Higgins, Steven A.; Tsementzi, Despina; ...

    2016-03-03

    Here, an anaerobic, dichloromethane-degrading bacterium affiliated with novel Peptococcaceae was maintained in a microbial consortium. The organism originated from pristine freshwater sediment collected from Rio Mameyes in Luquillo, Puerto Rico, in October 2009 (latitude 18°21'43.9", longitude –65°46'8.4"). The draft genome sequence is 2.1 Mb and has a G+C content of 43.5%.

  3. Enhancement of survival and electricity production in an engineered bacterium by light-driven proton pumping.

    PubMed

    Johnson, Ethan T; Baron, Daniel B; Naranjo, Belén; Bond, Daniel R; Schmidt-Dannert, Claudia; Gralnick, Jeffrey A

    2010-07-01

    Microorganisms can use complex photosystems or light-dependent proton pumps to generate membrane potential and/or reduce electron carriers to support growth. The discovery that proteorhodopsin is a light-dependent proton pump that can be expressed readily in recombinant bacteria enables development of new strategies to probe microbial physiology and to engineer microbes with new light-driven properties. Here, we describe functional expression of proteorhodopsin and light-induced changes in membrane potential in the bacterium Shewanella oneidensis strain MR-1. We report that there were significant increases in electrical current generation during illumination of electrochemical chambers containing S. oneidensis expressing proteorhodopsin. We present evidence that an engineered strain is able to consume lactate at an increased rate when it is illuminated, which is consistent with the hypothesis that proteorhodopsin activity enhances lactate uptake by increasing the proton motive force. Our results demonstrate that there is coupling of a light-driven process to electricity generation in a nonphotosynthetic engineered bacterium. Expression of proteorhodopsin also preserved the viability of the bacterium under nutrient-limited conditions, providing evidence that fulfillment of basic energy needs of organisms may explain the widespread distribution of proteorhodopsin in marine environments.

  4. Genome Sequence of the Algicidal Bacterium Kordia algicida OT-1 ▿

    PubMed Central

    Lee, Hyun Sook; Kang, Sung Gyun; Kwon, Kae Kyoung; Lee, Jung-Hyun; Kim, Sang-Jin

    2011-01-01

    Kordia algicida OT-1 is an algicidal bacterium against the bloom-forming microalgae. The genome sequence of K. algicida revealed a number of interesting features, including the degradation of macromolecules, the biosynthesis of carotenoid pigment and secondary metabolites, and the capacity for gliding motility, which might facilitate the understanding of algicidal mechanisms. PMID:21622754

  5. Physiological characterization of strain DCB-1, a unique dehalogenating sulfidogenic bacterium.

    PubMed Central

    Stevens, T O; Linkfield, T G; Tiedje, J M

    1988-01-01

    Strain DCB-1 is an obligately anaerobic bacterium which carries out the reductive dehalogenation of halobenzoates and was previously known to grow only on pyruvate plus 20% ruminal fluid. When various electron acceptors were supplied, thiosulfate and sulfite were found to stimulate growth. Sulfide was produced from thiosulfate. Cytochrome c and desulfoviridin were detected. The mol% G+C was 49 (at the thermal denaturation temperature). Of 55 carbon sources tested, only pyruvate supported growth as the sole carbon source in mineral medium. Lactate, acetate, L- and D-malate, glycerol, and L- and D-arabinose stimulated growth when supplemented with 10% ruminal fluid and 20 mM thiosulfate. In mineral medium, pyruvate was converted to acetate and lactate, with small amounts of succinate and fumarate accumulating transiently. During growth with thiosulfate, all of these products accumulated transiently. Addition of excess hydrogen to pyruvate-grown cultures resulted in diversion of carbon to formate, lactate, and butyrate, which caused a decrease in cell yield. We conclude that strain DCB-1 is a new type of sulfidogenic bacterium. PMID:3223760

  6. A novel marine bacterium algicidal to the toxic dinoflagellate Alexandrium tamarense.

    PubMed

    Wang, B X; Zhou, Y Y; Bai, S J; Su, J Q; Tian, Y; Zheng, T L; Yang, X R

    2010-11-01

    This work is aiming at investigating algicidal characterization of a bacterium isolate DHQ25 against harmful alga Alexandrium tamarense. 16S rDNA sequence analysis showed that the most probable affiliation of DHQ25 belongs to the γ-proteobacteria subclass and the genus Vibrio. Bacterial isolate DHQ25 showed algicidal activity through an indirect attack. Xenic culture of A. tamarense was susceptible to the culture filtrate of DHQ25 by algicidal activity assay. Algicidal process demonstrated that the alga cell lysed and cellular substances released under the visual field of microscope. DHQ25 was a challenge controller of A. tamarense by the above characterizations of algicidal activity assay and algicidal process. Interactions between bacteria and harmful algal bloom (HAB) species proved to be an important factor regulating the population of these algae. This is the first report of a Vibrio sp. bacterium algicidal to the toxic dinoflagellate A. tamarense. The findings increase our knowledge of the role of bacteria in algal-bacterial interaction. © 2010 The Authors. © 2010 The Society for Applied Microbiology.

  7. Draft Genome Sequence of the Algicidal Bacterium Mangrovimonas yunxiaonensis Strain LY01

    PubMed Central

    Li, Yi; Zhu, Hong; Li, Chongping; Zhang, Huajun; Chen, Zhangran; Zheng, Wei

    2014-01-01

    Mangrovimonas yunxiaonensis LY01, a novel bacterium isolated from mangrove sediment, showed high algicidal effects on harmful algal blooms of Alexandrium tamarense. Here, we present the first draft genome sequence of this strain to further understanding of the functional genes related to algicidal activity. PMID:25428978

  8. Robinsoniella peoriensis: A model anaerobic commensal bacterium for acquisition of antibiotic resistance?

    USDA-ARS?s Scientific Manuscript database

    Background: R. peoriensis was characterized in our laboratories from swine manure and feces as a Gram-positive, anaerobic bacterium. Since then strains of this species have been identified from a variety of mammalian and other gastrointestinal (GI) tracts, suggesting it is a member of the commensal ...

  9. Sexual Transmission of a Plant Pathogenic Bacterium, Candidatus Liberibacter asiaticus, between Conspecific Insect Vectors during Mating

    PubMed Central

    Mann, Rajinder S.; Pelz-Stelinski, Kirsten; Hermann, Sara L.; Tiwari, Siddharth; Stelinski, Lukasz L.

    2011-01-01

    Candidatus Liberibacter asiaticus is a fastidious, phloem-inhabiting, gram-negative bacterium transmitted by Asian citrus psyllid, Diaphorina citri Kuwayama (Hemiptera: Psyllidae). The bacterium is the presumed causal agent of huanglongbing (HLB), one of the most destructive and economically important diseases of citrus. We investigated whether Las is transmitted between infected and uninfected D. citri adults during courtship. Our results indicate that Las was sexually transmitted from Las-infected male D. citri to uninfected females at a low rate (<4%) during mating. Sexual transmission was not observed following mating of infected females and uninfected males or among adult pairs of the same sex. Las was detected in genitalia of both sexes and also in eggs of infected females. A latent period of 7 days or more was required to detect the bacterium in recipient females. Rod shaped as well as spherical structures resembling Las were observed in ovaries of Las-infected females with transmission electron microscopy, but were absent in ovaries from uninfected D. citri females. The size of the rod shaped structures varied from 0.39 to 0.67 µm in length and 0.19 to 0.39 µm in width. The spherical structures measured from 0.61 to 0.80 µm in diameter. This investigation provides convincing evidence that a plant pathogenic bacterium is sexually transmitted from male to female insects during courtship and established evidence that bacteria persist in reproductive organs. Moreover, these findings provide an alternative sexually horizontal mechanism for the spread of Las within populations of D. citri, even in the absence of infected host trees. PMID:22216209

  10. Isolation and Characterization of a Novel, Highly Selective Astaxanthin-Producing Marine Bacterium.

    PubMed

    Asker, Dalal

    2017-10-18

    A high-throughput screening approach for astaxanthin-producing bacteria led to the discovery of a novel, highly selective astaxanthin-producing marine bacterium (strain N-5). Phylogenetic analysis based on partial 16S rRNA gene and phenotypic metabolic testing indicated it belongs to the genus Brevundimonas. Therefore, it was designated as Brevundimonas sp. strain N-5. To identify and quantify carotenoids produced by strain N-5, HPLC-DAD and HPLC-MS methods were used. The culture conditions including media, shaking, and time had significant effects on cell growth and carotenoids production including astaxanthin. The total carotenoids were ∼601.2 μg g -1 dry cells including a remarkable amount (364.6 μg g -1 dry cells) of optically pure astaxanthin (3S, 3'S) isomer, with high selectivity (∼60.6%) under medium aeration conditions. Notably, increasing the culture aeration enhanced astaxanthin production up to 85% of total carotenoids. This is the first report that describes a natural, highly selective astaxanthin-producing marine bacterium.

  11. IN SITU RT-PCR WITH A SULFATE-REDUCING BACTERIUM ISOLATED FROM SEAGRASS ROOTS

    EPA Science Inventory

    Bacteria considered to be obligate anaerobes internally colonize roots of the submerged macrophyte Halodule wrightii. A sulfate reducing bacterium, Summer lac 1, was isolated on lactate from H. wrightii roots. The isolate has physiological characteristics typical of Desulfovibri...

  12. The chemical formula of a magnetotactic bacterium.

    PubMed

    Naresh, Mohit; Das, Sayoni; Mishra, Prashant; Mittal, Aditya

    2012-05-01

    Elucidation of the chemical logic of life is one of the grand challenges in biology, and essential to the progress of the upcoming field of synthetic biology. Treatment of microbial cells explicitly as a "chemical" species in controlled reaction (growth) environments has allowed fascinating discoveries of elemental formulae of a few species that have guided the modern views on compositions of a living cell. Application of mass and energy balances on living cells has proved to be useful in modeling of bioengineering systems, particularly in deriving optimized media compositions for growing microorganisms to maximize yields of desired bio-derived products by regulating intra-cellular metabolic networks. In this work, application of elemental mass balance during growth of Magnetospirillum gryphiswaldense in bioreactors has resulted in the discovery of the chemical formula of the magnetotactic bacterium. By developing a stoichiometric equation characterizing the formation of a magnetotactic bacterial cell, coupled with rigorous experimental measurements and robust calculations, we report the elemental formula of M. gryphiswaldense cell as CH(2.06)O(0.13)N(0.28)Fe(1.74×10(-3)). Remarkably, we find that iron metabolism during growth of this magnetotactic bacterium is much more correlated individually with carbon and nitrogen, compared to carbon and nitrogen with each other, indicating that iron serves more as a nutrient during bacterial growth rather than just a mineral. Magnetotactic bacteria have not only invoked some interest in the field of astrobiology for the last two decades, but are also prokaryotes having the unique ability of synthesizing membrane bound intracellular organelles. Our findings on these unique prokaryotes are a strong addition to the limited repertoire, of elemental compositions of living cells, aimed at exploring the chemical logic of life. Copyright © 2011 Wiley Periodicals, Inc.

  13. Five new amicoumacins isolated from a marine-derived bacterium Bacillus subtilis.

    PubMed

    Li, Yongxin; Xu, Ying; Liu, Lingli; Han, Zhuang; Lai, Pok Yui; Guo, Xiangrong; Zhang, Xixiang; Lin, Wenhan; Qian, Pei-Yuan

    2012-02-01

    Four novel amicoumacins, namely lipoamicoumacins A-D (1-4), and one new bacilosarcin analog (5) were isolated from culture broth of a marine-derived bacterium Bacillus subtilis, together with six known amicoumacins. Their structures were elucidated on the basis of extensive spectroscopic (2D NNR, IR, CD and MS) analysis and in comparison with data in literature.

  14. Draft Genome Sequence of Sphingobium fuliginis OMI, a Bacterium That Degrades Alkylphenols and Bisphenols

    PubMed Central

    Ogata, Yuka; Yahara, Tatsuya; Yokoyama, Takashi; Ishizawa, Hidehiro; Takada, Kazuki; Inoue, Daisuke; Sei, Kazunari

    2017-01-01

    ABSTRACT Sphingobium fuliginis OMI is a bacterium that can degrade a variety of recalcitrant alkylphenols and bisphenols. This study reports the draft genome sequence of S. fuliginis OMI. PMID:29167253

  15. A pathway closely related to the (D)-tagatose pathway of gram-negative enterobacteria identified in the gram-positive bacterium Bacillus licheniformis.

    PubMed

    Van der Heiden, Edwige; Delmarcelle, Michaël; Lebrun, Sarah; Freichels, Régine; Brans, Alain; Vastenavond, Christian M; Galleni, Moreno; Joris, Bernard

    2013-06-01

    We report the first identification of a gene cluster involved in d-tagatose catabolism in Bacillus licheniformis. The pathway is closely related to the d-tagatose pathway of the Gram-negative bacterium Klebsiella oxytoca, in contrast to the d-tagatose 6-phosphate pathway described in the Gram-positive bacterium Staphylococcus aureus.

  16. Magnetic guidance of the magnetotactic bacterium Magnetospirillum gryphiswaldense.

    PubMed

    Loehr, Johannes; Pfeiffer, Daniel; Schüler, Dirk; Fischer, Thomas M

    2016-04-21

    Magnetospirillum gryphiswaldense is a magnetotactic bacterium with a permanent magnetic moment capable of swimming using two bipolarly located flagella. In their natural environment these bacteria swim along the field lines of the homogeneous geomagnetic field in a typical run and reversal pattern and thereby create non-differentiable trajectories with sharp edges. In the current work we nevertheless achieve stable guidance along curved lines of mechanical instability by using a heterogeneous magnetic field of a garnet film. The successful guidance of the bacteria depends on the right balance between motility and the magnetic moment of the magnetosome chain.

  17. Bacterium-Induced CXCL10 Secretion by Osteoblasts Can Be Mediated in Part through Toll-Like Receptor 4

    PubMed Central

    Gasper, Nancy A.; Petty, Cynthia C.; Schrum, Laura W.; Marriott, Ian; Bost, Kenneth L.

    2002-01-01

    Two common pathogens known to cause bone infection, Salmonella and Staphylococcus aureus, were investigated to determine their abilities to induce chemokine expression in cultured mouse and human osteoblasts. While these cells are responsible for bone formation, we were surprised to find that they could respond to bacterial infection by upregulating expression of the chemokine CXCL10 (IP-10). However, there were significant differences in the abilities of the gram-negative bacterium Salmonella and the gram-positive bacterium S. aureus to induce expression of CXCL10. Reverse transcription-PCR and enzyme-linked immunosorbent assay analyses showed high levels of Salmonella-induced CXCL10 mRNA and protein expression, respectively, whereas the osteoblast response to S. aureus was significantly less. Consistent with these findings, Salmonella-derived lipopolysaccharide (LPS), but not S. aureus-derived peptidoglycan, could induce expression of CXCL10. An antibody against toll-like receptor 4 (TLR4) could block the LPS-induced CXCL10 production, demonstrating the functional expression of TLR4 by osteoblasts. Despite the inducible nature of TLR2 mRNA expression by bacterium-infected osteoblasts, peptidoglycan failed to stimulate CXCL10 secretion. Immunofluorescent staining of bacterium-infected calvaria (i.e., skull bone) demonstrated the presence of CXCL10 in osteoblasts. The fact that osteoblasts did not express CXCR3 mRNA, whereas T lymphocytes can express high levels of this receptor, suggests that osteoblast-derived CXCL10 may recruit T lymphocytes to the sites of bone infections. PMID:12117914

  18. Sensory Transduction in Microorganisms 2008 Gordon Research Conference (January 2008)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ann M. Stock

    2009-04-08

    Research into the mechanisms involved in the sensing and responses of microorganisms to changes in their environments is currently very active in a large number of laboratories worldwide. An increasingly wide range of prokaryotic and eukaryotic species are being studied with regard to their sensing of diverse chemical and physical stimuli, including nutrients, toxins, intercellular signaling molecules, redox indicators, light, pressure, magnetic fields, and surface contact, leading to adaptive responses affecting motile behavior, gene expression and/or development. The ease of manipulation of microorganisms has facilitated application of a broad range of techniques that have provided comprehensive descriptions of cellular behaviormore » and its underlying molecular mechanisms. Systems and their molecular components have been probed at levels ranging from the whole organism down to atomic resolution using behavioral analyses; electrophysiology; genetics; molecular biology; biochemical and biophysical characterization; structural biology; single molecule, fluorescence and cryo-electron microscopy; computational modeling; bioinformatics and genomic analyses. Several model systems such as bacterial chemotaxis and motility, fruiting body formation in Myxococcus xanthus, and motility and development in Dictyostelium discoideum have traditionally been a focus of this meeting. By providing a basis for assessment of similarities and differences in mechanisms, understanding of these pathways has advanced the study of many other microbial sensing systems. This conference aims to bring together researchers investigating different prokaryotic and eukaryotic microbial systems using diverse approaches to compare data, share methodologies and ideas, and seek to understand the fundamental principles underlying sensory responses. Topic areas include: (1) Receptor Sensing and Signaling; (2) Intracellular Signaling (two-component, c-di-GMP, c-AMP, etc.); (3) Intracellular

  19. Stone-isolated carbonatogenic bacteria as inoculants in bioconsolidation treatments for historical limestone.

    PubMed

    Jroundi, Fadwa; Gómez-Suaga, Patricia; Jimenez-Lopez, Concepción; González-Muñoz, Maria Teresa; Fernandez-Vivas, Maria Antonia

    2012-05-15

    Stone consolidation treatments that use bacterial biomineralization are mainly based on two strategies: (1) the inoculation of a bacterial culture with proven carbonatogenic ability and/or (2) the application of a culture medium capable of activating those bacteria able to induce the formation of calcium carbonate, from amongst the bacterial community of the stone. While the second strategy has been demonstrated to be effective and, unlike first strategy, it does not introduce any exogenous microorganism into the stone, problems may arise when the bacterial community of the stone is altered, for instance by the use of biocides in the cleaning process. In this study we isolate bacteria that belong to the natural microbial community of the stone and which have proven biomineralization capabilities, with the aim of preparing an inoculum that may be used in stone consolidation treatments wherein the natural community of those stones is altered. With this aim, outdoor experiments were undertaken to activate and isolate bacteria that display high biomineralization capacity from altered calcarenite stone. Most of the bacteria precipitated calcium carbonate in the form of calcite. The selected bacteria were phylogenetically affiliated with members of Actinobacteria, Gamma-proteobacteria and Firmicutes. Furthermore, the capability of these selected carbonatogenic bacteria to consolidate altered calcarenite stone slabs was studied in in vitro experiments, both in the presence and the absence of Myxococcus xanthus, as a potential reinforcement for the bacterial biomineralization. Herein, Acinetobacter species, belonging to the microbial community of the stone, are proposed as powerful carbonatogenic bacteria that, inoculated under appropriate conditions, may be used as inoculum for calcareous stone conservation/consolidation in restoration interventions where the microbial community of the stone is altered. Copyright © 2012 Elsevier B.V. All rights reserved.

  20. Diversity in bacterium-host interactions within the species Helicobacter heilmannii sensu stricto

    PubMed Central

    2013-01-01

    Helicobacter (H.) heilmannii sensu stricto (s.s.) is a zoonotic bacterium that naturally colonizes the stomach of dogs and cats. In humans, this microorganism has been associated with gastritis, peptic ulcer disease and mucosa associated lymphoid tissue (MALT) lymphoma. Little information is available about the pathogenesis of H. heilmannii s.s. infections in humans and it is unknown whether differences in virulence exist within this species. Therefore, a Mongolian gerbil model was used to study bacterium-host interactions of 9 H. heilmannii s.s. strains. The colonization ability of the strains, the intensity of gastritis and gene expression of various inflammatory cytokines in the stomach were determined at 9 weeks after experimental infection. The induction of an antrum-dominant chronic active gastritis with formation of lymphocytic aggregates was shown for 7 strains. High-level antral colonization was seen for 4 strains, while colonization of 4 other strains was more restricted and one strain was not detected in the stomach at 9 weeks post infection. All strains inducing a chronic active gastritis caused an up-regulation of the pro-inflammatory cytokine IL-1β in the antrum. A reduced antral expression of H+/K+ ATPase was seen in the stomach after infection with 3 highly colonizing strains and 2 highly colonizing strains caused an increased gastrin expression in the fundus. In none of the H. heilmannii s.s.-infected groups, IFN-γ expression was up-regulated. This study demonstrates diversity in bacterium-host interactions within the species H. heilmannii s.s. and that the pathogenesis of gastric infections with this microorganism is not identical to that of an H. pylori infection. PMID:23895283

  1. Antimicrobial polyketide furanoterpenoids from seaweed-associated heterotrophic bacterium Bacillus subtilis MTCC 10403.

    PubMed

    Chakraborty, Kajal; Thilakan, Bini; Raola, Vamshi Krishna

    2017-10-01

    Brown seaweed Anthophycus longifolius (Turner) Kützing (family Sargassaceae) associated heterotrophic bacterium Bacillus subtilis MTCC 10403 was found to be a potent isolate with broad range of antibacterial activity against important perceptive food pathogens Vibrio parahaemolyticus, V. vulnificus, and Aeromonas hydrophila. This bacterium was positive for polyketide synthetase gene (KC589397), and therefore, was selected to bioprospect specialized metabolites bearing polyketide backbone. Bioactivity-guided chromatographic fractionation of the ethyl acetate extract of the seaweed-associated bacterium segregated four homologous polyketide furanoterpenoids with potential antibacterial activities against clinically important pathogens. The minimum inhibitory concentration (MIC) assay showed that the referral antibiotics tetracycline and ampicillin were active at 25 μg/mL against the test pathogens, whereas the previously undescribed (4E)-methyl 13-((16-(furan-2-yl) ethyl)-octahydro-7-hydroxy-4-((E)-23-methylbut-21-enyl)-2H-chromen-6-yl)-4-methylpent-4-enoate (compound 1) and methyl 3-(hexahydro-9-((E)-3-methylpent-1-enyl)-4H-furo[3,2-g]isochromen-6-yl) propanoate (compound 3) displayed antibacterial activities against the test pathogens at a lesser concentration (MIC < 7 μg/mL). The title compounds were characterized by comprehensive nuclear magnetic resonance and mass spectroscopic experiments. Polyketide synthase catalyzed putative biosynthetic mechanism additionally corroborated the structural ascriptions of the hitherto undescribed furanoterpenoids from seaweed-associated bacterial symbiont. The electronic and hydrophobic parameters appeared to hold a conspicuous part in directing the antibacterial properties of the compounds. Seaweed-associated B. subtilis MTCC 10403 demonstrated to represent a potential source of antimicrobial polyketides for pharmaceutical applications. Copyright © 2017 Elsevier Ltd. All rights reserved.

  2. A Pathway Closely Related to the d-Tagatose Pathway of Gram-Negative Enterobacteria Identified in the Gram-Positive Bacterium Bacillus licheniformis

    PubMed Central

    Van der Heiden, Edwige; Lebrun, Sarah; Freichels, Régine; Brans, Alain; Vastenavond, Christian M.; Galleni, Moreno; Joris, Bernard

    2013-01-01

    We report the first identification of a gene cluster involved in d-tagatose catabolism in Bacillus licheniformis. The pathway is closely related to the d-tagatose pathway of the Gram-negative bacterium Klebsiella oxytoca, in contrast to the d-tagatose 6-phosphate pathway described in the Gram-positive bacterium Staphylococcus aureus. PMID:23524682

  3. Geovibrio ferrireducens, a phylogenetically distinct dissimilatory Fe(III)-reducing bacterium

    USGS Publications Warehouse

    Caccavo, F.; Coates, J.D.; Rossello-Mora, R. A.; Ludwig, W.; Schleifer, K.H.; Lovley, D.R.; McInerney, M.J.

    1996-01-01

    A new, phylogenetically distinct, dissimilatory, Fe(III)-reducing bacterium was isolated from surface sediment of a hydrocarbon-contaminated ditch. The isolate, designated strain PAL-1, was an obligately anaerobic, non-fermentative, motile, gram-negative vibrio. PAL-1 grew in a defined medium with acetate as electron donor and ferric pyrophosphate, ferric oxyhydroxide, ferric citrate, Co(III)-EDTA, or elemental sulfur as sole electron acceptor. PAL-1 also used proline, hydrogen, lactate, propionate, succinate, fumarate, pyruvate, or yeast extract as electron donors for Fe(III) reduction. It is the first bacterium known to couple the oxidation of an amino acid to Fe(III) reduction. PAI-1 did not reduce oxygen, Mn(IV), U(VI), Cr(VI), nitrate, sulfate, sulfite, or thiosulfate with acetate as the electron donor. Cell suspensions of PAL-1 exhibited dithionite-reduced minus air-oxidized difference spectra that were characteristic of c-type cytochromes. Analysis of the 16S rRNA gene sequence of PAL-1 showed that the strain is not related to any of the described metal-reducing bacteria in the Proteobacteria and, together with Flexistipes sinusarabici, forms a separate line of descent within the Bacteria. Phenotypically and phylogenetically, strain PAI-1 differs from all other described bacteria, and represents the type strain of a new genus and species. Geovibrio ferrireducens.

  4. Draft Genome Sequence of the Algicidal Bacterium Mangrovimonas yunxiaonensis Strain LY01.

    PubMed

    Li, Yi; Zhu, Hong; Li, Chongping; Zhang, Huajun; Chen, Zhangran; Zheng, Wei; Xu, Hong; Zheng, Tianling

    2014-11-26

    Mangrovimonas yunxiaonensis LY01, a novel bacterium isolated from mangrove sediment, showed high algicidal effects on harmful algal blooms of Alexandrium tamarense. Here, we present the first draft genome sequence of this strain to further understanding of the functional genes related to algicidal activity. Copyright © 2014 Li et al.

  5. Aerobic mineralization of vinyl chlorides by a bacterium of the order Actinomycetales

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Phelps, T.J.; Malachowsky, K.; Schram, R.M.

    1991-04-01

    A gram-positive branched bacterium isolated from a trichloroethylene-degrading consortium mineralized vinyl chloride in growing cultures and cell suspensions. Greater than 67% of the (1,2-{sup 14}C)vinyl chloride was mineralized to carbon dioxide, with approximately 10% of the radioactivity appearing in {sup 14}C-aqueous-phase products.

  6. Draft Genome Sequence of Sphingobium fuliginis OMI, a Bacterium That Degrades Alkylphenols and Bisphenols.

    PubMed

    Kuroda, Masashi; Ogata, Yuka; Yahara, Tatsuya; Yokoyama, Takashi; Ishizawa, Hidehiro; Takada, Kazuki; Inoue, Daisuke; Sei, Kazunari; Ike, Michihiko

    2017-11-22

    Sphingobium fuliginis OMI is a bacterium that can degrade a variety of recalcitrant alkylphenols and bisphenols. This study reports the draft genome sequence of S. fuliginis OMI. Copyright © 2017 Kuroda et al.

  7. Isolation of Bacteriophages of the Marine Bacterium Beneckea natriegens from Coastal Salt Marshes1

    PubMed Central

    Zachary, Arthur

    1974-01-01

    Bacteriophages of the marine bacterium Beneckea natriegens were isolated from coastal marshes where they were limited to brackish and marine waters. The phages were widely distributed and morphologically diverse in the marshes. Images PMID:4133830

  8. Enhancement of Survival and Electricity Production in an Engineered Bacterium by Light-Driven Proton Pumping▿ †

    PubMed Central

    Johnson, Ethan T.; Baron, Daniel B.; Naranjo, Belén; Bond, Daniel R.; Schmidt-Dannert, Claudia; Gralnick, Jeffrey A.

    2010-01-01

    Microorganisms can use complex photosystems or light-dependent proton pumps to generate membrane potential and/or reduce electron carriers to support growth. The discovery that proteorhodopsin is a light-dependent proton pump that can be expressed readily in recombinant bacteria enables development of new strategies to probe microbial physiology and to engineer microbes with new light-driven properties. Here, we describe functional expression of proteorhodopsin and light-induced changes in membrane potential in the bacterium Shewanella oneidensis strain MR-1. We report that there were significant increases in electrical current generation during illumination of electrochemical chambers containing S. oneidensis expressing proteorhodopsin. We present evidence that an engineered strain is able to consume lactate at an increased rate when it is illuminated, which is consistent with the hypothesis that proteorhodopsin activity enhances lactate uptake by increasing the proton motive force. Our results demonstrate that there is coupling of a light-driven process to electricity generation in a nonphotosynthetic engineered bacterium. Expression of proteorhodopsin also preserved the viability of the bacterium under nutrient-limited conditions, providing evidence that fulfillment of basic energy needs of organisms may explain the widespread distribution of proteorhodopsin in marine environments. PMID:20453141

  9. Haloanaerobium salsugo sp. nov., a moderately halophilic, anaerobic bacterium from a subterranean brine

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bhupathiraju, V.K.; Sharma, P.K.; Tanner, R.S.

    A strictly anaerobic, moderately halophilic, gram-negative bacterium was isolated from a highly saline oil field brine. The bacterium was a non-spore-forming, nonmotile rod, appearing singly, in pairs, or occasionally as long chains, and measured 0.3 to 0.4 by 2.6 to 4 {micro}m. The bacterium had a specific requirement for NaCl and grew at NaCl concentrations of between 6 and 24%, with optimal growth at 9% NaCl. The isolate grew at temperatures of between 22 and 51 C and pH values of between 5.6 and 8.0. The doubling time in a complex medium containing 10% NaCl was 9 h. Growth wasmore » inhibited by chloramphenicol, tetracycline, and penicillin but not by cycloheximide or azide. Fermentable substrates were predominantly carbohydrates. The end products of glucose fermentation were acetate, ethanol, CO{sub 2}, and H{sub 2}. The major components of the cellular fatty acids were C{sub 14:0}, C{sub 16:0}, C{sub 16:1}, and C{sub 17:0 cyc} acids. The DNA base composition of the isolate was 34 mol% G+C. Oligonucleotide catalog and sequence analyses of the 16S rRNA showed that strain VS-752{sup T} was most closely related to Haloanaerobium praevalens GSL{sup T} (ATCC 33744), the sole member of the genus Haloanaerobium. The authors propose that strain VS-752 (ATCC 51327) by established as the type strain of a new species, Haloanaerobium salsugo, in the genus Haloanaerobium. 40 refs., 3 figs, 5 tabs.« less

  10. Genome Sequence of Sphingobium indicum B90A, a Hexachlorocyclohexane-Degrading Bacterium

    PubMed Central

    Anand, Shailly; Sangwan, Naseer; Lata, Pushp; Kaur, Jasvinder; Dua, Ankita; Singh, Amit Kumar; Verma, Mansi; Kaur, Jaspreet; Khurana, Jitendra P.; Khurana, Paramjit; Mathur, Saloni

    2012-01-01

    Sphingobium indicum B90A, an efficient degrader of hexachlorocyclohexane (HCH) isomers, was isolated in 1990 from sugarcane rhizosphere soil in Cuttack, India. Here we report the draft genome sequence of this bacterium, which has now become a model system for understanding the genetics, biochemistry, and physiology of HCH degradation. PMID:22843598

  11. Ammonificins C and D, Hydroxyethylamine Chromene Derivatives from a Cultured Marine Hydrothermal Vent Bacterium, Thermovibrio ammonificans

    PubMed Central

    Andrianasolo, Eric H.; Haramaty, Liti; Rosario-Passapera, Richard; Vetriani, Costantino; Falkowski, Paul; White, Eileen; Lutz, Richard

    2012-01-01

    Chemical and biological investigation of the cultured marine hydrothermal vent bacterium, Thermovibrio ammonifican led to the isolation of two hydroxyethylamine chromene derivatives, ammonificins C and D. Their structures were elucidated using combination of NMR and mass spectrometry. Absolute stereochemistry was ascertained by comparison of experimental and calculated CD spectra. Biological evaluation and assessment were determined using the patented ApopScreen cell-based screen for apoptosis-induction. Ammonificins C and D induce apoptosis in micromolar concentrations. To our knowledge, this finding is the first report of chemical compounds that induce apoptosis from the cultured deep-sea marine organism, hydrothermal vent bacterium, Thermovibrio ammonificans. PMID:23170085

  12. Vector potential of houseflies for the bacterium Aeromonas caviae.

    PubMed

    Nayduch, D; Noblet, G Pittman; Stutzenberger, F J

    2002-06-01

    Houseflies, Musca domestica Linnaeus (Diptera: Muscidae), have been implicated as vectors or transporters of numerous gastrointestinal pathogens encountered during feeding and ovipositing on faeces. The putative enteropathogen Aeromonas caviae (Proteobacteria: Aeromonadaceae) may be present in faeces of humans and livestock. Recently A. caviae was detected in houseflies by PCR and isolated by culture methods. In this study, we assessed the vector potential of houseflies for A. caviae relative to multiplication and persistence of the bacterium in the fly and to contamination of other flies and food materials. In experimentally fed houseflies, the number of bacteria increased up to 2 days post-ingestion (d PI) and then decreased significantly 3 d PI. A large number of bacteria was detected in the vomitus and faeces of infected flies at 2-3 d PI. The bacteria persisted in flies for up to 8 d PI, but numbers were low. Experimentally infected flies transmitted A. caviae to chicken meat, and transmissibility was directly correlated with exposure time. Flies contaminated the meat for up to 7 d PI; however, a significant decrease in contamination was observed 2-3 d PI. In the fly-to-fly transmission experiments, the transmission of A. caviae was observed and was apparently mediated by flies sharing food. These results support houseflies as potential vectors for A. caviae because the bacterium multiplied, persisted in flies for up to 8 d PI, and could be transmitted to human food items.

  13. Extreme furfural tolerance of a soil bacterium Enterobacter cloacae GGT036.

    PubMed

    Choi, Sun Young; Gong, Gyeongtaek; Park, Hong-Sil; Um, Youngsoon; Sim, Sang Jun; Woo, Han Min

    2015-01-10

    Detoxification process of cellular inhibitors including furfural is essential for production of bio-based chemicals from lignocellulosic biomass. Here we isolated an extreme furfural-tolerant bacterium Enterobacter cloacae GGT036 from soil sample collected in Mt. Gwanak, Republic of Korea. Among isolated bacteria, only E. cloacae GGT036 showed cell growth with 35 mM furfural under aerobic culture. Compared to the maximal half inhibitory concentration (IC50) of well-known industrial strains Escherichia coli (24.9 mM furfural) and Corynebacterium glutamicum (10 mM furfural) based on the cell density, IC50 of E. cloacae GGT036 (47.7 mM) was significantly higher after 24 h, compared to E. coli and C. glutamicum. Since bacterial cell growth was exponentially inhibited depending on linearly increased furfural concentrations in the medium, we concluded that E. cloacae GGT036 is an extreme furfural-tolerant bacterium. Recently, the complete genome sequence of E. cloacae GGT036 was announced and this could provide an insight for engineering of E. cloacae GGT036 itself or other industrially relevant bacteria. Copyright © 2014 Elsevier B.V. All rights reserved.

  14. Colwellia agarivorans sp. nov., an agar-digesting marine bacterium isolated from coastal seawater

    USDA-ARS?s Scientific Manuscript database

    A novel Gram-stain-negative, facultatively anaerobic, yellowish and agar-digesting marine bacterium, designated strain QM50**T, was isolated from coastal seawater in an aquaculture site near Qingdao, China. Phylogenetic analysis based on 16S rDNA sequences revealed that the novel isolate represented...

  15. Catalytic Biomineralization of Fluorescent Calcite by the Thermophilic Bacterium Geobacillus thermoglucosidasius▿

    PubMed Central

    Yoshida, Naoto; Higashimura, Eiji; Saeki, Yuichi

    2010-01-01

    The thermophilic Geobacillus bacterium catalyzed the formation of 100-μm hexagonal crystals at 60°C in a hydrogel containing sodium acetate, calcium chloride, and magnesium sulfate. Under fluorescence microscopy, crystals fluoresced upon excitation at 365 ± 5, 480 ± 20, or 545 ± 15 nm. X-ray diffraction indicated that the crystals were magnesium-calcite in calcite-type calcium carbonate. PMID:20851984

  16. Comment on "A bacterium that degrades and assimilates poly(ethylene terephthalate)".

    PubMed

    Yang, Yu; Yang, Jun; Jiang, Lei

    2016-08-19

    Yoshida et al (Report, 11 March 2016, p. 1196) reported that the bacterium Ideonella sakaiensis 201-F6 can degrade and assimilate poly(ethylene terephthalate) (PET). However, the authors exaggerated degradation efficiency using a low-crystallinity PET and presented no straightforward experiments to verify depolymerization and assimilation of PET. Thus, the authors' conclusions are rather misleading. Copyright © 2016, American Association for the Advancement of Science.

  17. Draft Genome Sequence of the Deinococcus-Thermus Bacterium Meiothermus ruber Strain A

    DOE PAGES

    Thiel, Vera; Tomsho, Lynn P.; Burhans, Richard; ...

    2015-03-26

    The draft genome sequence of the Deinococcus-Thermus group bacterium Meiothermus ruber strain A, isolated from a cyanobacterial enrichment culture obtained from Octopus Spring (Yellowstone National Park, WY), comprises 2,968,099 bp in 170 contigs. It is predicted to contain 2,895 protein-coding genes, 44 tRNA-coding genes, and 2 rRNA operons.

  18. Aerobic mineralization of vinyl chloride by a bacterium of the order Actinomycetales.

    PubMed Central

    Phelps, T J; Malachowsky, K; Schram, R M; White, D C

    1991-01-01

    A gram-positive branched bacterium isolated from a trichloroethylene-degrading consortium mineralized vinyl chloride in growing cultures and cell suspensions. Greater than 67% of the [1,2-14C]vinyl chloride was mineralized to carbon dioxide, with approximately 10% of the radioactivity appearing in cell biomass and another 10% appearing in 14C-aqueous-phase products. PMID:1905522

  19. Isolation and characterization of a novel simazine-degrading bacterium from agricultural soil of central Chile, Pseudomonas sp. MHP41.

    PubMed

    Hernández, Marcela; Villalobos, Patricio; Morgante, Verónica; González, Myriam; Reiff, Caroline; Moore, Edward; Seeger, Michael

    2008-09-01

    s-Triazine herbicides are used extensively in South America in agriculture and forestry. In this study, a bacterium designated as strain MHP41, capable of degrading simazine and atrazine, was isolated from agricultural soil in the Quillota valley, central Chile. Strain MHP41 is able to grow in minimal medium, using simazine as the sole nitrogen source. In this medium, the bacterium exhibited a growth rate of mu=0.10 h(-1), yielding a high biomass of 4.2 x 10(8) CFU mL(-1). Resting cells of strain MHP41 degrade more than 80% of simazine within 60 min. The atzA, atzB, atzC, atzD, atzE and atzF genes encoding the enzymes of the simazine upper and lower pathways were detected in strain MHP41. The motile Gram-negative bacterium was identified as a Pseudomonas sp., based on the Biolog microplate system and comparative sequence analyses of the 16S rRNA gene. Amplified ribosomal DNA restriction analysis allowed the differentiation of strain MHP41 from Pseudomonas sp. ADP. The comparative 16S rRNA gene sequence analyses suggested that strain MHP41 is closely related to Pseudomonas nitroreducens and Pseudomonas multiresinovorans. This is the first s-triazine-degrading bacterium isolated in South America. Strain MHP41 is a potential biocatalyst for the remediation of s-triazine-contaminated environments.

  20. Bacterium induces cryptic meroterpenoid pathway in the pathogenic fungus Aspergillus fumigatus.

    PubMed

    König, Claudia C; Scherlach, Kirstin; Schroeckh, Volker; Horn, Fabian; Nietzsche, Sandor; Brakhage, Axel A; Hertweck, Christian

    2013-05-27

    Stimulating encounter: The intimate, physical interaction between the soil-derived bacterium Streptomyces rapamycinicus and the human pathogenic fungus Aspergillus fumigatus led to the activation of an otherwise silent polyketide synthase (PKS) gene cluster coding for an unusual prenylated polyphenol (fumicycline A). The meroterpenoid pathway is regulated by a pathway-specific activator gene as well as by epigenetic factors. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Multiple cellobiohydrolases and cellobiose phosphorylases cooperate in the ruminal bacterium Ruminococcus albus 8 to degrade cellooligosaccharides

    NASA Astrophysics Data System (ADS)

    Devendran, Saravanan; Abdel-Hamid, Ahmed M.; Evans, Anton F.; Iakiviak, Michael; Kwon, In Hyuk; Mackie, Roderick I.; Cann, Isaac

    2016-10-01

    Digestion of plant cell wall polysaccharides is important in energy capture in the gastrointestinal tract of many herbivorous and omnivorous mammals, including humans and ruminants. The members of the genus Ruminococcus are found in both the ruminant and human gastrointestinal tract, where they show versatility in degrading both hemicellulose and cellulose. The available genome sequence of Ruminococcus albus 8, a common inhabitant of the cow rumen, alludes to a bacterium well-endowed with genes that target degradation of various plant cell wall components. The mechanisms by which R. albus 8 employs to degrade these recalcitrant materials are, however, not clearly understood. In this report, we demonstrate that R. albus 8 elaborates multiple cellobiohydrolases with multi-modular architectures that overall enhance the catalytic activity and versatility of the enzymes. Furthermore, our analyses show that two cellobiose phosphorylases encoded by R. albus 8 can function synergistically with a cognate cellobiohydrolase and endoglucanase to completely release, from a cellulosic substrate, glucose which can then be fermented by the bacterium for production of energy and cellular building blocks. We further use transcriptomic analysis to confirm the over-expression of the biochemically characterized enzymes during growth of the bacterium on cellulosic substrates compared to cellobiose.

  2. A newly discovered bacterium associated with parthenogenesis and a change in host selection behavior in parasitoid wasps.

    PubMed

    Zchori-Fein, E; Gottlieb, Y; Kelly, S E; Brown, J K; Wilson, J M; Karr, T L; Hunter, M S

    2001-10-23

    The symbiotic bacterium Wolbachia pipientis has been considered unique in its ability to cause multiple reproductive anomalies in its arthropod hosts. Here we report that an undescribed bacterium is vertically transmitted and associated with thelytokous parthenogenetic reproduction in Encarsia, a genus of parasitoid wasps. Although Wolbachia was found in only one of seven parthenogenetic Encarsia populations examined, the "Encarsia bacterium" (EB) was found in the other six. Among seven sexually reproducing populations screened, EB was present in one, and none harbored Wolbachia. Antibiotic treatment did not induce male production in Encarsia pergandiella but changed the oviposition behavior of females. Cured females accepted one host type at the same rate as control females but parasitized significantly fewer of the other host type. Phylogenetic analysis based on the 16S rDNA gene sequence places the EB in a unique clade within the Cytophaga-Flexibacter-Bacteroid group and shows EB is unrelated to the Proteobacteria, where Wolbachia and most other insect symbionts are found. These results imply evolution of the induction of parthenogenesis in a lineage other than Wolbachia. Importantly, these results also suggest that EB may modify the behavior of its wasp carrier in a way that enhances its transmission.

  3. Experimental study of the quasi 1d motion of a ``robot bacterium'' within a tube

    NASA Astrophysics Data System (ADS)

    Liu, Kai; Jiao, Yusheng; Li, Shutong; Ding, Yang; Xu, Xinliang; Complex Fluids Team

    2017-11-01

    Understanding how solid boundary influences the motion of a micro-swimmer can be quite important. Here we experimentally study the problem with a system of centi-meter size ``robot bacterium'' immersed in the solvent silicon oil. Equipped with build-in battery and motor, the robot mimics a free swimmer and the overall Reynolds number of the system is kept very small as we use silicon oil with very high viscosity. The motion of centi-meter size ``robot bacterium'' within cylindrical tube is experimentally studied in detail. Our results show that robot bacteria with different shapes respond very different to the solid boundary. For certain shapes the swimmers actually swim much faster within a tube, when compared to their motions without any confinement, in good agreement with our numerical evaluations of the hydrodynamics of the system.

  4. Complete Genome Sequence of the Endophytic Bacterium Burkholderia sp. Strain KJ006

    PubMed Central

    Kwak, Min-Jung; Song, Ju Yeon; Kim, Seon-Young; Jeong, Haeyoung; Kang, Sung Gyun; Kim, Byung Kwon; Kwon, Soon-Kyeong; Lee, Choong Hoon; Yu, Dong Su

    2012-01-01

    Endophytes live inside plant tissues without causing any harm and may even benefit plants. Here, we provide the high-quality genome sequence of Burkholderia sp. strain KJ006, an endophytic bacterium of rice with antifungal activity. The 6.6-Mb genome, consisting of three chromosomes and a single plasmid, contains genes related to plant growth promotion or degradation of aromatic compounds. PMID:22843575

  5. Nematode-bacterium symbioses--cooperation and conflict revealed in the "omics" age.

    PubMed

    Murfin, Kristen E; Dillman, Adler R; Foster, Jeremy M; Bulgheresi, Silvia; Slatko, Barton E; Sternberg, Paul W; Goodrich-Blair, Heidi

    2012-08-01

    Nematodes are ubiquitous organisms that have a significant global impact on ecosystems, economies, agriculture, and human health. The applied importance of nematodes and the experimental tractability of many species have promoted their use as models in various research areas, including developmental biology, evolutionary biology, ecology, and animal-bacterium interactions. Nematodes are particularly well suited for the investigation of host associations with bacteria because all nematodes have interacted with bacteria during their evolutionary history and engage in a variety of association types. Interactions between nematodes and bacteria can be positive (mutualistic) or negative (pathogenic/parasitic) and may be transient or stably maintained (symbiotic). Furthermore, since many mechanistic aspects of nematode-bacterium interactions are conserved, their study can provide broader insights into other types of associations, including those relevant to human diseases. Recently, genome-scale studies have been applied to diverse nematode-bacterial interactions and have helped reveal mechanisms of communication and exchange between the associated partners. In addition to providing specific information about the system under investigation, these studies also have helped inform our understanding of genome evolution, mutualism, and innate immunity. In this review we discuss the importance and diversity of nematodes, "omics"' studies in nematode-bacterial systems, and the wider implications of the findings.

  6. Nematode-Bacterium Symbioses - Cooperation and Conflict Revealed in the 'Omics' Age

    PubMed Central

    Murfin, Kristen E.; Dillman, Adler R.; Foster, Jeremy M.; Bulgheresi, Silvia; Slatko, Barton E.; Sternberg, Paul W.; Goodrich-Blair, Heidi

    2012-01-01

    Nematodes are ubiquitous organisms that have a significant global impact on ecosystems, economies, agriculture, and human health. The applied importance of nematodes and the experimental tractability of many species have promoted their use as models in various research areas, including developmental biology, evolutionary biology, ecology, and animal-bacterium interactions. Nematodes are particularly well suited for investigating host associations with bacteria because all nematodes have interacted with bacteria during their evolutionary history and engage in a diversity of association types. Interactions between nematodes and bacteria can be positive (mutualistic) or negative (pathogenic/parasitic) and may be transient or stably maintained (symbiotic). Furthermore, since many mechanistic aspects of nematode-bacterium interactions are conserved their study can provide broader insights into other types of associations, including those relevant to human diseases. Recently, genome-scale studies have been applied to diverse nematode-bacterial interactions, and have helped reveal mechanisms of communication and exchange between the associated partners. In addition to providing specific information about the system under investigation, these studies also have helped inform our understanding of genome evolution, mutualism, and innate immunity. In this review we will discuss the importance and diversity of nematodes, 'omics' studies in nematode-bacterial systems, and the wider implications of the findings. PMID:22983035

  7. Triazine herbicide resistance in the photosynthetic bacterium Rhodopseudomonas sphaeroides

    PubMed Central

    Brown, Alfred E.; Gilbert, Carl W.; Guy, Rachel; Arntzen, Charles J.

    1984-01-01

    The photoaffinity herbicide azidoatrazine (2-azido-4-ethylamino-6-isopropylamino-s-triazine) selectively labels the L subunit of the reaction center of the photosynthetic bacterium Rhodopseudomonas sphaeroides. Herbicide-resistant mutants retain the L subunit and have altered binding properties for methylthio- and chloro-substituted triazines as well as altered equilibrium constants for electron transfer between primary and secondary electron acceptors. We suggest that a subtle alteration in the L subunit is responsible for herbicide resistance and that the L subunit is the functional analog of the 32-kDa QB protein of chloroplast membranes. Images PMID:16593520

  8. Studies of the Extracellular Glycocalyx of the Anaerobic Cellulolytic Bacterium Ruminococcus albus 7▿

    PubMed Central

    Weimer, Paul J.; Price, Neil P. J.; Kroukamp, Otini; Joubert, Lydia-Marie; Wolfaardt, Gideon M.; Van Zyl, Willem H.

    2006-01-01

    Anaerobic cellulolytic bacteria are thought to adhere to cellulose via several mechanisms, including production of a glycocalyx containing extracellular polymeric substances (EPS). As the compositions and structures of these glycocalyces have not been elucidated, variable-pressure scanning electron microscopy (VP-SEM) and chemical analysis were used to characterize the glycocalyx of the ruminal bacterium Ruminococcus albus strain 7. VP-SEM revealed that growth of this strain was accompanied by the formation of thin cellular extensions that allowed the bacterium to adhere to cellulose, followed by formation of a ramifying network that interconnected individual cells to one another and to the unraveling cellulose microfibrils. Extraction of 48-h-old whole-culture pellets (bacterial cells plus glycocalyx [G] plus residual cellulose [C]) with 0.1 N NaOH released carbohydrate and protein in a ratio of 1:5. Boiling of the cellulose fermentation residue in a neutral detergent solution removed almost all of the adherent cells and protein while retaining a residual network of adhering noncellular material. Trifluoroacetic acid hydrolysis of this residue (G plus C) released primarily glucose, along with substantial amounts of xylose and mannose, but only traces of galactose, the most abundant sugar in most characterized bacterial exopolysaccharides. Linkage analysis and characterization by nuclear magnetic resonance suggested that most of the glucosyl units were not present as partially degraded cellulose. Calculations suggested that the energy demand for synthesis of the nonprotein fraction of EPS by this organism represents only a small fraction (<4%) of the anabolic ATP expenditure of the bacterium. PMID:17028224

  9. Multiscale Model of Swarming Bacteria

    NASA Astrophysics Data System (ADS)

    Alber, Mark

    2011-03-01

    Many bacteria can rapidly traverse surfaces from which they are extracting nutrient for growth. They generate flat, spreading colonies, called swarms because they resemble swarms of insects. In the beginning of the talk, swarms of the M. xanthus will be described in detail. Individual M. xanthus cells are elongated; they always move in the direction of their long axis; and they are in constant motion, repeatedly touching each other. As a cell glides, the slime capsule of a cell interacts with the bare agar surface, non-oriented slime which arises from the surface contact with the slime capsule, or oriented slime trails. Remarkably, cells regularly reverse their gliding directions. In this talk a detailed cell- and behavior-based computational model of M. xanthus swarming will be used to demonstrate that reversals of gliding direction and cell bending are essential for swarming and that specific reversal frequencies result in optimal swarming rate of the whole population. This suggests that the circuit regulating reversals evolved to its current sensitivity under selection for growth achieved by swarming.

  10. Characterization of a Neochlamydia-like Bacterium Associated with Epitheliocystis in Cultured Artic Char Salvelinus alpinus

    USDA-ARS?s Scientific Manuscript database

    Infections of branchial epithelium by intracellular gram-negative bacteria, termed epitheliocystis, have limited culture of Arctic char (Salvelinus alpinus). To characterize a bacterium associated with epitheliocystis in cultured char, gills were sampled for histopathologic examination, conventional...

  11. Factors Affecting Zebra Mussel Kill by the Bacterium Pseudomonas fluorescens

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Daniel P. Molloy

    2004-02-24

    The specific purpose of this research project was to identify factors that affect zebra mussel kill by the bacterium Pseudomonas fluorescens. Test results obtained during this three-year project identified the following key variables as affecting mussel kill: treatment concentration, treatment duration, mussel siphoning activity, dissolved oxygen concentration, water temperature, and naturally suspended particle load. Using this latter information, the project culminated in a series of pipe tests which achieved high mussel kill inside power plants under once-through conditions using service water in artificial pipes.

  12. A Comparative biochemical study on two marine endophytes, Bacterium SRCnm and Bacillus sp. JS, Isolated from red sea algae.

    PubMed

    Ahmed, Eman Fadl; Hassan, Hossam Mokhtar; Rateb, Mostafa Ezzat; Abdel-Wahab, Noha; Sameer, Somayah; Aly Taie, Hanan Anwar; Abdel-Hameed, Mohammed Sayed; Hammouda, Ola

    2016-01-01

    Two marine endophytic bacteria were isolated from the Red Sea algae; a red alga; Acanthophora dendroides and the brown alga Sargassum sabrepandum. The isolates were identified based on their 16SrRNA sequences as Bacterium SRCnm and Bacillus sp. JS. The objective of this study was to investigate the potential anti-microbial and antioxidant activities of the extracts of the isolated bacteria grown in different nutrient conditions. Compared to amoxicillin (25μg/disk) and erythromycin (15μg/disk), the extracts of Bacterium SRCn min media II, III, IV and V were potent inhibitors of the gram-positive bacterium Sarcina maxima even at low concentrations. Also, the multidrug resistant Staphylococcus aureus(MRSA) was more sensitive to the metabolites produced in medium (II) of the same endophyte than erythromycin (15μg/disk). A moderate activity of the Bacillus sp. JS extracts of media I and II was obtained against the same pathogen. The total compounds (500ug/ml) of both isolated endophytes showed moderate antioxidant activities (48.9% and 46.1%, respectively). LC/MS analysis of the bacterial extracts was carried out to investigate the likely natural products produced. Cyclo(D-cis-Hyp-L-Leu), dihydrosphingosine and 2-Amino-1,3-hexadecanediol were identified in the fermentation medium of Bacterium SRCnm, whereas cyclo (D-Pro-L-Tyr) and cyclo (L-Leu-L-Pro) were the suggested compounds of Bacillus sp. JS.

  13. Soil-Bacterium Compatibility Model as a Decision-Making Tool for Soil Bioremediation.

    PubMed

    Horemans, Benjamin; Breugelmans, Philip; Saeys, Wouter; Springael, Dirk

    2017-02-07

    Bioremediation of organic pollutant contaminated soil involving bioaugmentation with dedicated bacteria specialized in degrading the pollutant is suggested as a green and economically sound alternative to physico-chemical treatment. However, intrinsic soil characteristics impact the success of bioaugmentation. The feasibility of using partial least-squares regression (PLSR) to predict the success of bioaugmentation in contaminated soil based on the intrinsic physico-chemical soil characteristics and, hence, to improve the success of bioaugmentation, was examined. As a proof of principle, PLSR was used to build soil-bacterium compatibility models to predict the bioaugmentation success of the phenanthrene-degrading Novosphingobium sp. LH128. The survival and biodegradation activity of strain LH128 were measured in 20 soils and correlated with the soil characteristics. PLSR was able to predict the strain's survival using 12 variables or less while the PAH-degrading activity of strain LH128 in soils that show survival was predicted using 9 variables. A three-step approach using the developed soil-bacterium compatibility models is proposed as a decision making tool and first estimation to select compatible soils and organisms and increase the chance of success of bioaugmentation.

  14. Isolation of a thermophilic bacterium capable of low-molecular-weight polyethylene degradation.

    PubMed

    Jeon, Hyun Jeong; Kim, Mal Nam

    2013-02-01

    A thermophilic bacterium capable of low-molecular-weight polyethylene (LMWPE) degradation was isolated from a compost sample, and was identified as Chelatococcus sp. E1, through sequencing of the 16S rRNA gene. LMWPE was prepared by thermal degradation of commercial PE in a strict nitrogen atmosphere. LMWPE with a weight-average-molecular-weight (Mw) in the range of 1,700-23,700 was noticeably mineralized into CO(2) by the bacterium. The biodegradability of LMWPE decreased as the Mw increased. The low molecular weight fraction of LMWPE decreased significantly as a result of the degradation process, and thereby both the number-average-molecular-weight and Mw increased after biodegradation. The polydispersity of LMWPE was either narrowed or widened, depending on the initial Mw of LMWPE, due to the preferential elimination of the low molecular weight fraction, in comparison to the high molecular weight portion. LMWPE free from an extremely low molecular weight fraction was also mineralized by the strain at a remarkable rate, and FTIR peaks assignable to C-O stretching appeared as a result of microbial action. The FTIR peaks corresponding to alkenes also became more intense, indicating that dehydrogenations occurred concomitantly with microbial induced oxidation.

  15. A highly infective plant-associated bacterium influences reproductive rates in pea aphids

    PubMed Central

    Hendry, Tory A.; Clark, Kelley J.; Baltrus, David A.

    2016-01-01

    Pea aphids, Acyrthosiphon pisum, have the potential to increase reproduction as a defence against pathogens, though how frequently this occurs or how infection with live pathogens influences this response is not well understood. Here we determine the minimum infective dose of an environmentally common bacterium and possible aphid pathogen, Pseudomonas syringae, to determine the likelihood of pathogenic effects to pea aphids. Additionally, we used P. syringae infection to investigate how live pathogens may alter reproductive rates. We found that oral bacterial exposure decreased subsequent survival of aphids in a dose-dependent manner and we estimate that ingestion of less than 10 bacterial cells is sufficient to increase aphid mortality. Pathogen dose was positively related to aphid reproduction. Aphids exposed to low bacterial doses showed decreased, although statistically indistinguishable, fecundity compared to controls. Aphids exposed to high doses reproduced significantly more than low dose treatments and also more, but not significantly so, than controls. These results are consistent with previous studies suggesting that pea aphids may use fecundity compensation as a response to pathogens. Consequently, even low levels of exposure to a common plant-associated bacterium may therefore have significant effects on pea aphid survival and reproduction. PMID:26998321

  16. A highly infective plant-associated bacterium influences reproductive rates in pea aphids.

    PubMed

    Hendry, Tory A; Clark, Kelley J; Baltrus, David A

    2016-02-01

    Pea aphids, Acyrthosiphon pisum, have the potential to increase reproduction as a defence against pathogens, though how frequently this occurs or how infection with live pathogens influences this response is not well understood. Here we determine the minimum infective dose of an environmentally common bacterium and possible aphid pathogen, Pseudomonas syringae, to determine the likelihood of pathogenic effects to pea aphids. Additionally, we used P. syringae infection to investigate how live pathogens may alter reproductive rates. We found that oral bacterial exposure decreased subsequent survival of aphids in a dose-dependent manner and we estimate that ingestion of less than 10 bacterial cells is sufficient to increase aphid mortality. Pathogen dose was positively related to aphid reproduction. Aphids exposed to low bacterial doses showed decreased, although statistically indistinguishable, fecundity compared to controls. Aphids exposed to high doses reproduced significantly more than low dose treatments and also more, but not significantly so, than controls. These results are consistent with previous studies suggesting that pea aphids may use fecundity compensation as a response to pathogens. Consequently, even low levels of exposure to a common plant-associated bacterium may therefore have significant effects on pea aphid survival and reproduction.

  17. Novel insights into the algicidal bacterium DH77-1 killing the toxic dinoflagellate Alexandrium tamarense.

    PubMed

    Yang, Xiaoru; Li, Xinyi; Zhou, Yanyan; Zheng, Wei; Yu, Changping; Zheng, Tianling

    2014-06-01

    Algicidal bacteria may play a major role in controlling harmful algal blooms (HABs) dynamics. Bacterium DH77-1 was isolated with high algicidal activity against the toxic dinoflagellate Alexandrium tamarense and identified as Joostella sp. DH77-1. The results showed that DH77-1 exhibited algicidal activity through indirect attack, which excreted active substance into the filtrate. It had a relatively wide host range and the active substance of DH77-1 was relatively stable since temperature, pH and storage condition had no obvious effect on the algicidal activity. The algicidal compound from bacterium DH77-1 was isolated based on activity-guided bioassay and the molecular weight was determined to be 125.88 by MALDI-TOF mass spectrometer, however further identification via nuclear magnetic resonance (NMR) spectra is ongoing. The physiological responses of algal cells after exposure to the DH77-1 algicidal substances were as follows: the antioxidant system of A. tamarense responded positively in self-defense; total protein content decreased significantly as did the photosynthetic pigment content; superoxide dismutase, peroxidase enzyme and malondialdehyde content increased extraordinarily and algal cell nucleic acid leaked seriously ultimately inducing cell death. Furthermore, DH77-1 is the first record of a Joostella sp. bacterium being algicidal to the harmful dinoflagellate A. tamarense, and the bacterial culture and the active compounds might be potentially used as a bio-agent for controlling harmful algal blooms. Copyright © 2014 Elsevier B.V. All rights reserved.

  18. Purification and Characterization of Haloalkaline, Organic Solvent Stable Xylanase from Newly Isolated Halophilic Bacterium-OKH

    PubMed Central

    Sanghvi, Gaurav; Jivrajani, Mehul; Patel, Nirav; Jivrajani, Heta; Bhaskara, Govinal Badiger; Patel, Shivani

    2014-01-01

    A novel, alkali-tolerant halophilic bacterium-OKH with an ability to produce extracellular halophilic, alkali-tolerant, organic solvent stable, and moderately thermostable xylanase was isolated from salt salterns of Mithapur region, Gujarat, India. Identification of the bacterium was done based upon biochemical tests and 16S rRNA sequence. Maximum xylanase production was achieved at pH 9.0 and 37°C temperature in the medium containing 15% NaCl and 1% (w/v) corn cobs. Sugarcane bagasse and wheat straw also induce xylanase production when used as carbon source. The enzyme was active over a range of 0–25% sodium chloride examined in culture broth. The optimum xylanase activity was observed at 5% sodium chloride. Xylanase was purified with 25.81%-fold purification and 17.1% yield. Kinetic properties such as Km and Vmax were 4.2 mg/mL and 0.31 μmol/min/mL, respectively. The enzyme was stable at pH 6.0 and 50°C with 60% activity after 8 hours of incubation. Enzyme activity was enhanced by Ca2+, Mn2+, and Mg2+ but strongly inhibited by heavy metals such as Hg2+, Fe3+, Ni2+, and Zn2+. Xylanase was found to be stable in organic solvents like glutaraldehyde and isopropanol. The purified enzyme hydrolysed lignocellulosic substrates. Xylanase, purified from the halophilic bacterium-OKH, has potential biotechnological applications. PMID:27350996

  19. Treatment of Alkaline Cr(VI)-Contaminated Leachate with an Alkaliphilic Metal-Reducing Bacterium.

    PubMed

    Watts, Mathew P; Khijniak, Tatiana V; Boothman, Christopher; Lloyd, Jonathan R

    2015-08-15

    Chromium in its toxic Cr(VI) valence state is a common contaminant particularly associated with alkaline environments. A well-publicized case of this occurred in Glasgow, United Kingdom, where poorly controlled disposal of a cementitious industrial by-product, chromite ore processing residue (COPR), has resulted in extensive contamination by Cr(VI)-contaminated alkaline leachates. In the search for viable bioremediation treatments for Cr(VI), a variety of bacteria that are capable of reduction of the toxic and highly soluble Cr(VI) to the relatively nontoxic and less mobile Cr(III) oxidation state, predominantly under circumneutral pH conditions, have been isolated. Recently, however, alkaliphilic bacteria that have the potential to reduce Cr(VI) under alkaline conditions have been identified. This study focuses on the application of a metal-reducing bacterium to the remediation of alkaline Cr(VI)-contaminated leachates from COPR. This bacterium, belonging to the Halomonas genus, was found to exhibit growth concomitant to Cr(VI) reduction under alkaline conditions (pH 10). Bacterial cells were able to rapidly remove high concentrations of aqueous Cr(VI) (2.5 mM) under anaerobic conditions, up to a starting pH of 11. Cr(VI) reduction rates were controlled by pH, with slower removal observed at pH 11, compared to pH 10, while no removal was observed at pH 12. The reduction of aqueous Cr(VI) resulted in the precipitation of Cr(III) biominerals, which were characterized using transmission electron microscopy and energy-dispersive X-ray analysis (TEM-EDX) and X-ray photoelectron spectroscopy (XPS). The effectiveness of this haloalkaliphilic bacterium for Cr(VI) reduction at high pH suggests potential for its use as an in situ treatment of COPR and other alkaline Cr(VI)-contaminated environments. Copyright © 2015, Watts et al.

  20. Draft Genome Sequence of a Bacillus Bacterium from the Atacama Desert Wetlands Metagenome

    PubMed Central

    Vilo, Claudia; Galetovic, Alexandra; Araya, Jorge E.; Dong, Qunfeng

    2015-01-01

    We report here the draft genome sequence of a Bacillus bacterium isolated from the microflora of Nostoc colonies grown at the Andean wetlands in northern Chile. We consider this genome sequence to be a molecular tool for exploring microbial relationships and adaptation strategies to the prevailing extreme conditions at the Atacama Desert. PMID:26294639

  1. In vitro antiplasmodial activity of bacterium RJAUTHB 14 associated with marine sponge Haliclona Grant against Plasmodium falciparum.

    PubMed

    Jacob Inbaneson, Samuel; Ravikumar, Sundaram

    2012-06-01

    Malaria is the most important parasitic disease, leading to annual death of about one million people, and the Plasmodium falciparum develops resistance to well-established antimalarial drugs. The newest antiplasmodial drug from a marine microorganism helps in addressing this problem. In the present study, Haliclona Grant were collected and subjected for enumeration and isolation of associated bacteria. The count of bacterial isolates was maximum in November 2007 (18 × 10(4) colony-forming units (CFU) g(-1), and the average count was maximum during the monsoon season (117 × 10(3) CFU g(-1)). Thirty-three morphologically different bacterial isolates were isolated from Haliclona Grant, and the extracellular ethyl acetate extracts were screened for antiplasmodial activity against P. falciparum. The antiplasmodial activity of bacterium RJAUTHB 14 (11.98 μg[Symbol: see text]ml(-1)) is highly comparable with the positive control chloroquine (IC(50) 19.59 μg[Symbol: see text]ml(-1)), but the other 21 bacterial extracts showed an IC(50) value of more than 100 μg[Symbol: see text]ml(-1). Statistical analysis reveals that significant in vitro antiplasmodial activity (P < 0.05) was observed between the concentrations and time of exposure. The chemical injury to erythrocytes showed no morphological changes in erythrocytes by the ethyl acetate extract of bacterial isolates after 48 h of incubation. The in vitro antiplasmodial activity might be due to the presence of reducing sugars and alkaloids in the ethyl acetate extracts of bacterium RJAUTHB 14. The 16S rRNA gene partial sequence of bacterium RJAUTHB 14 is deposited in NCBI (GenBank accession no. GU269569). It is concluded from the present study that the ethyl acetate extracts of bacterium RJAUTHB 14 possess lead compounds for the development of antiplasmodial drugs.

  2. Functional diversity of carbohydrate-active enzymes enabling a bacterium to ferment plant biomass.

    PubMed

    Boutard, Magali; Cerisy, Tristan; Nogue, Pierre-Yves; Alberti, Adriana; Weissenbach, Jean; Salanoubat, Marcel; Tolonen, Andrew C

    2014-11-01

    Microbial metabolism of plant polysaccharides is an important part of environmental carbon cycling, human nutrition, and industrial processes based on cellulosic bioconversion. Here we demonstrate a broadly applicable method to analyze how microbes catabolize plant polysaccharides that integrates carbohydrate-active enzyme (CAZyme) assays, RNA sequencing (RNA-seq), and anaerobic growth screening. We apply this method to study how the bacterium Clostridium phytofermentans ferments plant biomass components including glucans, mannans, xylans, galactans, pectins, and arabinans. These polysaccharides are fermented with variable efficiencies, and diauxies prioritize metabolism of preferred substrates. Strand-specific RNA-seq reveals how this bacterium responds to polysaccharides by up-regulating specific groups of CAZymes, transporters, and enzymes to metabolize the constituent sugars. Fifty-six up-regulated CAZymes were purified, and their activities show most polysaccharides are degraded by multiple enzymes, often from the same family, but with divergent rates, specificities, and cellular localizations. CAZymes were then tested in combination to identify synergies between enzymes acting on the same substrate with different catalytic mechanisms. We discuss how these results advance our understanding of how microbes degrade and metabolize plant biomass.

  3. Optimization of liquid media and biosafety assessment for algae-lysing bacterium NP23.

    PubMed

    Liao, Chunli; Liu, Xiaobo; Shan, Linna

    2014-09-01

    To control algal bloom caused by nutrient pollution, a wild-type algae-lysing bacterium was isolated from the Baiguishan reservoir in Henan province of China and identified as Enterobacter sp. strain NP23. Algal culture medium was optimized by applying a Placket-Burman design to obtain a high cell concentration of NP23. Three minerals (i.e., 0.6% KNO3, 0.001% MnSO4·H2O, and 0.3% K2HPO4) were found to be independent factors critical for obtaining the highest cell concentration of 10(13) CFU/mL, which was 10(4) times that of the control. In the algae-lysing experiment, the strain exhibited a high lysis rate for the 4 algae test species, namely, Chlorella vulgari, Scenedesmus, Microcystis wesenbergii, and Chlorella pyrenoidosa. Acute toxicity and mutagenicity tests showed that the bacterium NP23 had no toxic and mutagenic effects on fish, even in large doses such as 10(7) or 10(9) CFU/mL. Thus, Enterobacter sp. strain NP23 has strong potential application in the microbial algae-lysing project.

  4. Massilia sp. BS-1, a novel violacein-producing bacterium isolated from soil.

    PubMed

    Agematu, Hitosi; Suzuki, Kazuya; Tsuya, Hiroaki

    2011-01-01

    A novel bacterium, Massilia sp. BS-1, producing violacein and deoxyviolacein was isolated from a soil sample collected from Akita Prefecture, Japan. The 16S ribosomal DNA of strain BS-1 displayed 93% homology with its nearest violacein-producing neighbor, Janthinobacterium lividum. Strain BS-1 grew well in a synthetic medium, but required both L-tryptophan and a small amount of L-histidine to produce violacein.

  5. Economic Game Theory to Model the Attenuation of Virulence of an Obligate Intracellular Bacterium.

    PubMed

    Tago, Damian; Meyer, Damien F

    2016-01-01

    Diseases induced by obligate intracellular pathogens have a large burden on global human and animal health. Understanding the factors involved in the virulence and fitness of these pathogens contributes to the development of control strategies against these diseases. Based on biological observations, a theoretical model using game theory is proposed to explain how obligate intracellular bacteria interact with their host. The equilibrium in such a game shows that the virulence and fitness of the bacterium is host-triggered and by changing the host's defense system to which the bacterium is confronted, an evolutionary process leads to an attenuated strain. Although, the attenuation procedure has already been conducted in practice in order to develop an attenuated vaccine (e.g., with Ehrlichia ruminantium), there was a lack of understanding of the theoretical basis behind this process. Our work provides a model to better comprehend the existence of different phenotypes and some underlying evolutionary mechanisms for the virulence of obligate intracellular bacteria.

  6. Economic Game Theory to Model the Attenuation of Virulence of an Obligate Intracellular Bacterium

    PubMed Central

    Tago, Damian; Meyer, Damien F.

    2016-01-01

    Diseases induced by obligate intracellular pathogens have a large burden on global human and animal health. Understanding the factors involved in the virulence and fitness of these pathogens contributes to the development of control strategies against these diseases. Based on biological observations, a theoretical model using game theory is proposed to explain how obligate intracellular bacteria interact with their host. The equilibrium in such a game shows that the virulence and fitness of the bacterium is host-triggered and by changing the host's defense system to which the bacterium is confronted, an evolutionary process leads to an attenuated strain. Although, the attenuation procedure has already been conducted in practice in order to develop an attenuated vaccine (e.g., with Ehrlichia ruminantium), there was a lack of understanding of the theoretical basis behind this process. Our work provides a model to better comprehend the existence of different phenotypes and some underlying evolutionary mechanisms for the virulence of obligate intracellular bacteria. PMID:27610355

  7. (Per)chlorate Reduction by the Thermophilic Bacterium Moorella perchloratireducens sp. nov., Isolated from Underground Gas Storage▿

    PubMed Central

    Balk, Melike; van Gelder, Ton; Weelink, Sander A.; Stams, Alfons J. M.

    2008-01-01

    A thermophilic bacterium, strain An10, was isolated from underground gas storage with methanol as a substrate and perchlorate as an electron acceptor. Cells were gram-positive straight rods, 0.4 to 0.6 μm in diameter and 2 to 8 μm in length, growing as single cells or in pairs. Spores were terminal with a bulged sporangium. The temperature range for growth was 40 to 70°C, with an optimum at 55 to 60°C. The pH optimum was around 7. The salinity range for growth was between 0 and 40 g NaCl liter−1 with an optimum at 10 g liter−1. Strain An10 was able to grow on CO, methanol, pyruvate, glucose, fructose, cellobiose, mannose, xylose, and pectin. The isolate was able to respire with (per)chlorate, nitrate, thiosulfate, neutralized Fe(III) complexes, and anthraquinone-2,6-disulfonate. The G+C content of the DNA was 57.6 mol%. On the basis of 16S rRNA analysis, strain An10 was most closely related to Moorella thermoacetica and Moorella thermoautotrophica. The bacterium reduced perchlorate and chlorate completely to chloride. Key enzymes, perchlorate reductase and chlorite dismutase, were detected in cell extracts. Strain An10 is the first thermophilic and gram-positive bacterium with the ability to use (per)chlorate as a terminal electron acceptor. PMID:17981952

  8. Isolation and Characterization of a Human Intestinal Bacterium Eggerthella sp. AUH-JLD49s for the Conversion of (-)-3'-Desmethylarctigenin.

    PubMed

    Wang, Ye; Yu, Fei; Liu, Ming-Yue; Zhao, Yi-Kai; Wang, Dong-Ming; Hao, Qing-Hong; Wang, Xiu-Ling

    2017-05-24

    Arctiin is the most abundant bioactive compound contained in the Arctium lappa plant. In our previous study, we isolated one single bacterium capable of bioconverting arctigenin, an aglycone of arctiin, to 3'-desmethylarctigenin (3'-DMAG) solely. However, to date, a specific bacterium capable of producing other arctiin metabolites has not been reported. In this study, we isolated one single bacterium, which we named Eggerthella sp. AUH-JLD49s, capable of bioconverting 3'-DMAG under anaerobic conditions. The metabolite of 3'-DMAG by strain AUH-JLD49s was identified as 3'-desmethyl-4'-dehydroxyarctigenin (DMDH-AG) based on electrospray ionization mass spectrometry (ESI-MS) and 1 H and 13 C nuclear magnetic resonance spectroscopy. The bioconversion kinetics and bioconversion capacity of strain AUH-JLD49s were investigated. In addition, the metabolite DMDH-AG showed an inhibitory effect on cell growth of human colon cancer cell line HCT116 and human breast cancer cell line MDA-MB-231.

  9. Genome Sequence of Lysinibacillus sphaericus, a Lignin-Degrading Bacterium Isolated from Municipal Solid Waste Soil.

    PubMed

    Persinoti, Gabriela F; Paixão, Douglas A A; Bugg, Timothy D H; Squina, Fabio M

    2018-05-03

    We report here the draft genome sequence of Lysinibacillus sphaericus strain A1, a potential lignin-degrading bacterium isolated from municipal solid waste (MSW) soil and capable of enhancing gas release from lignocellulose-containing soil. Copyright © 2018 Persinoti et al.

  10. Draft genome sequence of ‘Candidatus Phytoplasma pruni’ strain CX, a plant pathogenic bacterium

    USDA-ARS?s Scientific Manuscript database

    ‘Candidatus Phytoplasma pruni’ strain CX, belonging to subgroup 16SrIII-A, is a plant pathogenic bacterium causing economically important diseases in many fruit crops. Here we report the draft genome sequence that consists of 598,508 bases, with a G+C content of 27.21 mol%. ...

  11. Complete Genome Sequence of the Complex Carbohydrate-Degrading Marine Bacterium, Saccharophagus degradans Strain 2-40T

    PubMed Central

    Weiner, Ronald M.; Taylor, Larry E.; Henrissat, Bernard; Hauser, Loren; Land, Miriam; Coutinho, Pedro M.; Rancurel, Corinne; Saunders, Elizabeth H.; Longmire, Atkinson G.; Zhang, Haitao; Bayer, Edward A.; Gilbert, Harry J.; Larimer, Frank; Zhulin, Igor B.; Ekborg, Nathan A.; Lamed, Raphael; Richardson, Paul M.; Borovok, Ilya; Hutcheson, Steven

    2008-01-01

    The marine bacterium Saccharophagus degradans strain 2-40 (Sde 2-40) is emerging as a vanguard of a recently discovered group of marine and estuarine bacteria that recycles complex polysaccharides. We report its complete genome sequence, analysis of which identifies an unusually large number of enzymes that degrade >10 complex polysaccharides. Not only is this an extraordinary range of catabolic capability, many of the enzymes exhibit unusual architecture including novel combinations of catalytic and substrate-binding modules. We hypothesize that many of these features are adaptations that facilitate depolymerization of complex polysaccharides in the marine environment. This is the first sequenced genome of a marine bacterium that can degrade plant cell walls, an important component of the carbon cycle that is not well-characterized in the marine environment. PMID:18516288

  12. 'Cand. Actinochlamydia clariae' gen. nov., sp. nov., a unique intracellular bacterium causing epitheliocystis in catfish (Clarias gariepinus) in Uganda.

    PubMed

    Steigen, Andreas; Nylund, Are; Karlsbakk, Egil; Akoll, Peter; Fiksdal, Ingrid U; Nylund, Stian; Odong, Robinson; Plarre, Heidrun; Semyalo, Ronald; Skår, Cecilie; Watanabe, Kuninori

    2013-01-01

    Epitheliocystis, caused by bacteria infecting gill epithelial cells in fish, is common among a large range of fish species in both fresh- and seawater. The aquaculture industry considers epitheliocystis an important problem. It affects the welfare of the fish and the resulting gill disease may lead to mortalities. In a culture facility in Kampala, Uganda, juveniles of the African sharptooth catfish (Clarias gariepinus) was observed swimming in the surface, sometimes belly up, showing signs of respiratory problems. Histological examination of gill tissues from this fish revealed large amounts of epitheliocysts, and also presence of a few Ichthyobodo sp. and Trichodina sp. Sequencing of the epitheliocystis bacterium 16S rRNA gene shows 86.3% similarity with Candidatus Piscichlamydia salmonis causing epitheliocystis in Atlantic salmon (Salmo salar). Transmission electron microscopy showed that the morphology of the developmental stages of the bacterium is similar to that of members of the family Chlamydiaceae. The similarity of the bacterium rRNA gene sequences compared with other chlamydia-like bacteria ranged between 80.5% and 86.3%. Inclusions containing this new bacterium have tubules/channels (termed actinae) that are radiating from the inclusion membrane and opening on the cell surface or in neighbouring cells. Radiation of tubules/channels (actinae) from the inclusion membrane has never been described in any of the other members of Chlamydiales. It seems to be a completely new character and an apomorphy. We propose the name Candidatus Actinochlamydia clariae gen. nov., sp. nov. (Actinochlamydiaceae fam. nov., order Chlamydiales, phylum Chlamydiae) for this new agent causing epitheliocystis in African sharptooth catfish.

  13. Isolation of an unidentified pink-pigmented bacterium in a clinical specimen.

    PubMed Central

    Odugbemi, T; Nwofor, C; Joiner, K T

    1988-01-01

    An unidentified pink-pigmented bacterium isolated from a clinical specimen is reported. The organism was oxidase, urease, and catalase positive; it grew on Thayer-Martin and MacConkey media. The isolate is possibly similar to an unnamed taxon (G.L. Gilardi and Y.C. Faur, J. Clin. Microbiol. 20:626-629, 1984); however, it had unique characteristics of nonmotility with no flagellum detectable and was a gram-negative coccoid with a few rods in pairs and negative for starch hydrolysis. PMID:3384903

  14. Isolation of an unidentified pink-pigmented bacterium in a clinical specimen.

    PubMed

    Odugbemi, T; Nwofor, C; Joiner, K T

    1988-05-01

    An unidentified pink-pigmented bacterium isolated from a clinical specimen is reported. The organism was oxidase, urease, and catalase positive; it grew on Thayer-Martin and MacConkey media. The isolate is possibly similar to an unnamed taxon (G.L. Gilardi and Y.C. Faur, J. Clin. Microbiol. 20:626-629, 1984); however, it had unique characteristics of nonmotility with no flagellum detectable and was a gram-negative coccoid with a few rods in pairs and negative for starch hydrolysis.

  15. Complete Genome Sequence of the Thermophilic Bacterium Geobacillus thermoleovorans CCB_US3_UF5

    PubMed Central

    Abdul Rahman, Ahmad Yamin; Saito, Jennifer A.; Hou, Shaobin

    2012-01-01

    Geobacillus thermoleovorans CCB_US3_UF5 is a thermophilic bacterium isolated from a hot spring in Malaysia. Here, we report the complete genome of G. thermoleovorans CCB_US3_UF5, which shows high similarity to the genome of Geobacillus kaustophilus HTA 426 in terms of synteny and orthologous genes. PMID:22328744

  16. Draft Genome Sequence of the Efficient Bioflocculant-Producing Bacterium Paenibacillus sp. Strain A9

    PubMed Central

    Liu, Jin-liang; Hu, Xiao-min

    2013-01-01

    Paenibacillus sp. strain A9 is an important bioflocculant-producing bacterium, isolated from a soil sample, and is pale pink-pigmented, aerobic, and Gram-positive. Here, we report the draft genome sequence and the initial findings from a preliminary analysis of strain A9, which is a novel species of Paenibacillus. PMID:23618713

  17. The domestication of the probiotic bacterium Lactobacillus acidophilus

    PubMed Central

    Bull, Matthew J.; Jolley, Keith A.; Bray, James E.; Aerts, Maarten; Vandamme, Peter; Maiden, Martin C. J.; Marchesi, Julian R.; Mahenthiralingam, Eshwar

    2014-01-01

    Lactobacillus acidophilus is a Gram-positive lactic acid bacterium that has had widespread historical use in the dairy industry and more recently as a probiotic. Although L. acidophilus has been designated as safe for human consumption, increasing commercial regulation and clinical demands for probiotic validation has resulted in a need to understand its genetic diversity. By drawing on large, well-characterised collections of lactic acid bacteria, we examined L. acidophilus isolates spanning 92 years and including multiple strains in current commercial use. Analysis of the whole genome sequence data set (34 isolate genomes) demonstrated L. acidophilus was a low diversity, monophyletic species with commercial isolates essentially identical at the sequence level. Our results indicate that commercial use has domesticated L. acidophilus with genetically stable, invariant strains being consumed globally by the human population. PMID:25425319

  18. The domestication of the probiotic bacterium Lactobacillus acidophilus.

    PubMed

    Bull, Matthew J; Jolley, Keith A; Bray, James E; Aerts, Maarten; Vandamme, Peter; Maiden, Martin C J; Marchesi, Julian R; Mahenthiralingam, Eshwar

    2014-11-26

    Lactobacillus acidophilus is a Gram-positive lactic acid bacterium that has had widespread historical use in the dairy industry and more recently as a probiotic. Although L. acidophilus has been designated as safe for human consumption, increasing commercial regulation and clinical demands for probiotic validation has resulted in a need to understand its genetic diversity. By drawing on large, well-characterised collections of lactic acid bacteria, we examined L. acidophilus isolates spanning 92 years and including multiple strains in current commercial use. Analysis of the whole genome sequence data set (34 isolate genomes) demonstrated L. acidophilus was a low diversity, monophyletic species with commercial isolates essentially identical at the sequence level. Our results indicate that commercial use has domesticated L. acidophilus with genetically stable, invariant strains being consumed globally by the human population.

  19. Removal of arsenic from groundwater by using a native isolated arsenite-oxidizing bacterium.

    PubMed

    Kao, An-Chieh; Chu, Yu-Ju; Hsu, Fu-Lan; Liao, Vivian Hsiu-Chuan

    2013-12-01

    Arsenic (As) contamination of groundwater is a significant public health concern. In this study, the removal of arsenic from groundwater using biological processes was investigated. The efficiency of arsenite (As(III)) bacterial oxidation and subsequent arsenate (As(V)) removal from contaminated groundwater using bacterial biomass was examined. A novel As(III)-oxidizing bacterium (As7325) was isolated from the aquifer in the blackfoot disease (BFD) endemic area in Taiwan. As7325 oxidized 2300μg/l As(III) using in situ As(III)-contaminated groundwater under aerobic conditions within 1d. After the oxidation of As(III) to As(V), As(V) removal was further examined using As7325 cell pellets. The results showed that As(V) could be adsorbed efficiently by lyophilized As7325 cell pellets, the efficiency of which was related to lyophilized cell pellet concentration. Our study conducted the examination of an alternative technology for the removal of As(III) and As(V) from groundwater, indicating that the oxidation of As(III)-contaminated groundwater by native isolated bacterium, followed by As(V) removal using bacterial biomass is a potentially effective technology for the treatment of As(III)-contaminated groundwater. © 2013.

  20. NH4+ transport system of a psychrophilic marine bacterium, Vibrio sp. strain ABE-1.

    PubMed

    Chou, M; Matsunaga, T; Takada, Y; Fukunaga, N

    1999-05-01

    NH4(+) transport system of a psychrophilic marine bacterium Vibrio sp. strain ABE-1 (Vibrio ABE-1) was examined by measuring the uptake of [14C]methylammonium ion (14CH3NH3+) into the intact cells. 14CH3NH3+ uptake was detected in cells grown in medium containing glutamate as the sole nitrogen source, but not in those grown in medium containing NH4Cl instead of glutamate. Vibrio ABE-1 did not utilize CH3NH3+ as a carbon or nitrogen source. NH4Cl and nonradiolabeled CH3NH3+ completely inhibited 14CH3NH3+ uptake. These results indicate that 14CH3NH3+ uptake in this bacterium is mediated via an NH4+ transport system and not by a specific carrier for CH3NH3+. The respiratory substrate succinate was required to drive 14CH3NH3+ uptake and the uptake was completely inhibited by KCN, indicating that the uptake was energy dependent. The electrochemical potentials of H+ and/or Na+ across membranes were suggested to be the driving forces for the transport system because the ionophores carbonylcyanide m-chlorophenylhydrazone and monensin strongly inhibited uptake activities at pH 6.5 and 8.5, respectively. Furthermore, KCl activated 14CH3NH3+ uptake. The 14CH3NH3+ uptake activity of Vibrio ABE-1 was markedly high at temperatures between 0 degrees and 15 degrees C, and the apparent Km value for CH3NH3+ of the uptake did not change significantly over the temperature range from 0 degrees to 25 degrees C. Thus, the NH4+ transport system of this bacterium was highly active at low temperatures.

  1. Complete genome sequence of the bioleaching bacterium Leptospirillum sp. group II strain CF-1.

    PubMed

    Ferrer, Alonso; Bunk, Boyke; Spröer, Cathrin; Biedendieck, Rebekka; Valdés, Natalia; Jahn, Martina; Jahn, Dieter; Orellana, Omar; Levicán, Gloria

    2016-03-20

    We describe the complete genome sequence of Leptospirillum sp. group II strain CF-1, an acidophilic bioleaching bacterium isolated from an acid mine drainage (AMD). This work provides data to gain insights about adaptive response of Leptospirillum spp. to the extreme conditions of bioleaching environments. Copyright © 2016 Elsevier B.V. All rights reserved.

  2. Lytic and Chemotactic Features of the Plaque-Forming Bacterium KD531 on Phaeodactylum tricornutum

    PubMed Central

    Chen, Zhangran; Zheng, Wei; Yang, Luxi; Boughner, Lisa A.; Tian, Yun; Zheng, Tianling; Xu, Hong

    2017-01-01

    Phaeodactylum tricornutum is a dominant bloom forming species and potential biofuel feedstock. To control P. tricornutum bloom or to release lipids from P. tricornutum, we previously screened and identified the lytic bacterium Labrenzia sp. KD531 toward P. tricornutum. In the present study, we evaluated the lytic activity of Labrenzia sp. KD531 on microalgae and investigated its lytic mechanism. The results indicated that the lytic activity of KD531 was temperature- and pH-dependent, but light-independent. In addition to P. tricornutum, KD531 also showed lytic activity against other algal species, especially green algae. A quantitative analysis of algal cellular protein, carbohydrate and lipid content together with measurements of dry weight after exposure to bacteria-infected algal lysate indicated that the bacterium KD531 influenced the algal biomass by disrupting the algal cells. Both chemotactic analysis and microscopic observations of subsamples from different regions of formed plaques showed that KD531 could move toward and then directly contact algal cells. Direct contact between P. tricornutum and KD531 cells was essential for the lytic process. PMID:29312256

  3. Structural characterization and anticancer activity of extracellular polysaccharides from ascidian symbiotic bacterium Bacillus thuringiensis.

    PubMed

    Ramamoorthy, Sathishkumar; Gnanakan, Ananthan; S Lakshmana, Senthil; Meivelu, Moovendhan; Jeganathan, Arun

    2018-06-15

    In the present study, extracellular polysaccharides (EPS) producing bacterium Bacillus thuringiensis RSK CAS4 was isolated from ascidian Didemnum granulatum and its production was optimized by response surface methodology. Fructose and galactose were found as the major monosaccharides in the EPS from the strain RSK CAS4. Functional groups and structural characteristics of the EPS were characterized with FT-IR and 1 HNMR. The purified EPS showed potent antioxidant properties in investigation against DPPH, hydroxyl, superoxide free radicals. In vitro anticancer activity of purified EPS was evaluated on HEp-2 cells, A549 and Vero cell lines. Growth of cancer cells was inhibited by the EPS in a dose-dependent manner and maximum anticancer activity was found to be 76% against liver cancer at 1000 μg/ml. The antioxidant and anticancer potentials of theEPS from marine bacterium Bacillusthuringiensis RSK CAS4 suggests it as a potential natural source and its scopeas an alternative to synthetics for pharmaceutical application. Copyright © 2018 Elsevier Ltd. All rights reserved.

  4. Enhanced biosynthesis of dihydrodaidzein and dihydrogenistein by a newly isolated bovine rumen anaerobic bacterium.

    PubMed

    Wang, Xiu-Ling; Shin, Kwang-Hee; Hur, Hor-Gil; Kim, Su-Il

    2005-02-09

    A rod-shaped and Gram-positive anaerobic bacterium, named Niu-O16, which was isolated from bovine rumen contents, was found to be capable of anaerobically converting isoflavones daidzein and genistein to dihydrodaidzein (DHD) and dihydrogenistein (DHG), respectively. The metabolites DHD and DHG were identified using EI-MS and NMR spectrometric analyses. Stereoisomeric metabolites, which were separated on chiral stationary phase HPLC, were formed in equal amounts by the strain Niu-O16. Tautomerization reaction occurred on the B-ring of DHD and DHG seems to be attributed to the equal production of stereoisomeric metabolites. For the synthesis of DHD, the strain Niu-O16 showed an optimal pH range from 6.0 to 7.0 and completely reduced up to 800 microM of daidzein to DHD with the initial OD600nm=1.0 and pH 7.0 for 3 days incubation. The strain Niu-O16, showed relatively faster reduction activity toward daidzein to produce DHD than the previously isolated human intestinal bacterium Clostridium sp. HGH6.

  5. Isolation and characterization of a prokaryotic cell organelle from the anammox bacterium Kuenenia stuttgartiensis.

    PubMed

    Neumann, Sarah; Wessels, Hans J C T; Rijpstra, W Irene C; Sinninghe Damsté, Jaap S; Kartal, Boran; Jetten, Mike S M; van Niftrik, Laura

    2014-11-01

    Anaerobic ammonium oxidizing (anammox) bacteria oxidize ammonium with nitrite to nitrogen gas in the absence of oxygen. These microorganisms form a significant sink for fixed nitrogen in the oceans and the anammox process is applied as a cost-effective and environment-friendly nitrogen removal system from wastewater. Anammox bacteria have a compartmentalized cell plan that consists of three separate compartments. Here we report the fractionation of the anammox bacterium Kuenenia stuttgartiensis in order to isolate and analyze the innermost cell compartment called the anammoxosome. The subcellular fractions were microscopically characterized and all membranes in the anammox cell were shown to contain ladderane lipids which are unique for anammox bacteria. Proteome analyses and activity assays with the isolated anammoxosomes showed that these organelles harbor the energy metabolism in anammox cells. Together the experimental data provide the first thorough characterization of a respiratory cell organelle from a bacterium and demonstrate the essential role of the anammoxosome in the production of a major portion of the nitrogen gas in our atmosphere. © 2014 John Wiley & Sons Ltd.

  6. Insights in Nanoparticle-Bacterium Interactions: New Frontiers to Bypass Bacterial Resistance to Antibiotics.

    PubMed

    Diab, Roudayna; Khameneh, Bahman; Joubert, Olivier; Duval, Raphael

    2015-01-01

    Nanotechnology has been revealed as a fundamental approach for antibiotics delivery. In this paper, recent findings demonstrating the superiority of nanocarried-antibiotics over "naked" ones and the ways by which nanoparticles can help to overwhelm bacterial drug resistance are reviewed. The second part of this paper sheds light on nanoparticle-bacterium interaction patterns. Finally, key factors affecting the effectiveness of nanoparticles interactions with bacteria are discussed.

  7. Pumilacidin-Like Lipopeptides Derived from Marine Bacterium Bacillus sp. Strain 176 Suppress the Motility of Vibrio alginolyticus

    PubMed Central

    Xiu, Pengyuan; Liu, Rui

    2017-01-01

    ABSTRACT Bacterial motility is a crucial factor during the invasion and colonization processes of pathogens, which makes it an attractive therapeutic drug target. Here, we isolated a marine bacterium (Vibrio alginolyticus strain 178) from a seamount in the tropical West Pacific that exhibits vigorous motility on agar plates and severe pathogenicity to zebrafish. We found that V. alginolyticus 178 motility was significantly suppressed by another marine bacterium, Bacillus sp. strain 176, isolated from the same niche. We isolated, purified, and characterized two different cyclic lipopeptides (CLPs) from Bacillus sp. 176 using high-performance liquid chromatography, mass spectrometry, and nuclear magnetic resonance spectroscopy. The two related CLPs have a pumilacidin-like structure and were both effective inhibitors of V. alginolyticus 178 motility. The CLPs differ by only one methylene group in their fatty acid chains. In addition to motility suppression, the CLPs also induced cell aggregation in the medium and reduced adherence of V. alginolyticus 178 to glass substrates. Notably, upon CLP treatment, the expression levels of two V. alginolyticus flagellar assembly genes (flgA and flgP) dropped dramatically. Moreover, the CLPs inhibited biofilm formation in several other strains of pathogenic bacteria without inducing cell death. This study indicates that CLPs from Bacillus sp. 176 show promise as antimicrobial lead compounds targeting bacterial motility and biofilm formation with a low potential for eliciting antibiotic resistance. IMPORTANCE Pathogenic bacteria often require motility to establish infections and subsequently spread within host organisms. Thus, motility is an attractive therapeutic target for the development of novel antibiotics. We found that cyclic lipopeptides (CLPs) produced by marine bacterium Bacillus sp. strain 176 dramatically suppress the motility of the pathogenic bacterium Vibrio alginolyticus strain 178, reduce biofilm formation, and

  8. Pumilacidin-Like Lipopeptides Derived from Marine Bacterium Bacillus sp. Strain 176 Suppress the Motility of Vibrio alginolyticus.

    PubMed

    Xiu, Pengyuan; Liu, Rui; Zhang, Dechao; Sun, Chaomin

    2017-06-15

    Bacterial motility is a crucial factor during the invasion and colonization processes of pathogens, which makes it an attractive therapeutic drug target. Here, we isolated a marine bacterium ( Vibrio alginolyticus strain 178) from a seamount in the tropical West Pacific that exhibits vigorous motility on agar plates and severe pathogenicity to zebrafish. We found that V. alginolyticus 178 motility was significantly suppressed by another marine bacterium, Bacillus sp. strain 176, isolated from the same niche. We isolated, purified, and characterized two different cyclic lipopeptides (CLPs) from Bacillus sp. 176 using high-performance liquid chromatography, mass spectrometry, and nuclear magnetic resonance spectroscopy. The two related CLPs have a pumilacidin-like structure and were both effective inhibitors of V. alginolyticus 178 motility. The CLPs differ by only one methylene group in their fatty acid chains. In addition to motility suppression, the CLPs also induced cell aggregation in the medium and reduced adherence of V. alginolyticus 178 to glass substrates. Notably, upon CLP treatment, the expression levels of two V. alginolyticus flagellar assembly genes ( flgA and flgP ) dropped dramatically. Moreover, the CLPs inhibited biofilm formation in several other strains of pathogenic bacteria without inducing cell death. This study indicates that CLPs from Bacillus sp. 176 show promise as antimicrobial lead compounds targeting bacterial motility and biofilm formation with a low potential for eliciting antibiotic resistance. IMPORTANCE Pathogenic bacteria often require motility to establish infections and subsequently spread within host organisms. Thus, motility is an attractive therapeutic target for the development of novel antibiotics. We found that cyclic lipopeptides (CLPs) produced by marine bacterium Bacillus sp. strain 176 dramatically suppress the motility of the pathogenic bacterium Vibrio alginolyticus strain 178, reduce biofilm formation, and promote

  9. Whole-Genome Sequence of Cupriavidus sp. Strain BIS7, a Heavy-Metal-Resistant Bacterium

    PubMed Central

    Hong, Kar Wai; Thinagaran, Dinaiz a/l; Gan, Han Ming; Yin, Wai-Fong

    2012-01-01

    Cupriavidus sp. strain BIS7 is a Malaysian tropical soil bacterium that exhibits broad heavy-metal resistance [Co(II), Zn(II), Ni(II), Se(IV), Cu(II), chromate, Co(III), Fe(II), and Fe(III)]. It is particularly resistant to Fe(II), Fe(III), and Zn(II). Here we present the assembly and annotation of its genome. PMID:23115161

  10. Whole-genome sequence of Cupriavidus sp. strain BIS7, a heavy-metal-resistant bacterium.

    PubMed

    Hong, Kar Wai; Thinagaran, Dinaiz al; Gan, Han Ming; Yin, Wai-Fong; Chan, Kok-Gan

    2012-11-01

    Cupriavidus sp. strain BIS7 is a Malaysian tropical soil bacterium that exhibits broad heavy-metal resistance [Co(II), Zn(II), Ni(II), Se(IV), Cu(II), chromate, Co(III), Fe(II), and Fe(III)]. It is particularly resistant to Fe(II), Fe(III), and Zn(II). Here we present the assembly and annotation of its genome.

  11. Response to comments on "A bacterium that can grow using arsenic instead of phosphorus"

    USGS Publications Warehouse

    Wolfe-Simon, Felisa; Blum, Jodi Switzer; Kulp, Thomas R.; Gordon, Gwyneth W.; Hoeft, Shelley E.; Pett-Ridge, Jennifer; Stolz, John F.; Webb, Samuel M.; Weber, Peter K.; Davies, Paul C.W.; Anbar, Ariel D.; Oremland, Ronald S.

    2011-01-01

    Concerns have been raised about our recent study suggesting that arsenic (As) substitutes for phosphorus in major biomolecules of a bacterium that tolerates extreme As concentrations. We welcome the opportunity to better explain our methods and results and to consider alternative interpretations. We maintain that our interpretation of As substitution, based on multiple congruent lines of evidence, is viable.

  12. Complete Genome Sequence of the Naphthalene-Degrading Bacterium Pseudomonas stutzeri AN10 (CCUG 29243)

    PubMed Central

    Brunet-Galmés, Isabel; Busquets, Antonio; Peña, Arantxa; Gomila, Margarita; Nogales, Balbina; García-Valdés, Elena; Lalucat, Jorge; Bennasar, Antonio

    2012-01-01

    Pseudomonas stutzeri AN10 (CCUG 29243) can be considered a model strain for aerobic naphthalene degradation. We report the complete genome sequence of this bacterium. Its 4.71-Mb chromosome provides insights into other biodegradative capabilities of strain AN10 (i.e., benzoate catabolism) and suggests a high number of horizontal gene transfer events. PMID:23144395

  13. Complete genome sequence of the xylan-degrading subseafloor bacterium Microcella alkaliphila JAM-AC0309.

    PubMed

    Kurata, Atsushi; Hirose, Yuu; Misawa, Naomi; Wakazuki, Sachiko; Kishimoto, Noriaki; Kobayashi, Tohru

    2016-03-10

    Here we report the complete genome sequence of Microcella alkaliphila JAM-AC0309, which was newly isolated from the deep subseafloor core sediment from offshore of the Shimokita Peninsula of Japan. An array of genes related to utilization of xylan in this bacterium was identified by whole genome analysis. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. Draft Genome Sequence of Pontibacter sp. nov. BAB1700, a Halotolerant, Industrially Important Bacterium

    PubMed Central

    Joshi, M. N.; Sharma, A. C.; Pandya, R. V.; Patel, R. P.; Saiyed, Z. M.; Saxena, A. K.

    2012-01-01

    Pontibacter sp. nov. BAB1700 is a halotolerant, Gram-negative, rod-shaped, pink-pigmented, menaquinone-7-producing bacterium isolated from sediments of a drilling well. The draft genome sequence of the strain, consisting of one chromosome of 4.5 Mb, revealed vital gene clusters involved in vitamin biosynthesis and resistance against various metals and antibiotics. PMID:23105068

  15. Complete Genome Sequence of the Filamentous Anoxygenic Phototrophic Bacterium Chloroflexus aurantiacus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tang, Kuo-Hsiang; Barry, Kerrie; Chertkov, Olga

    Chloroflexus aurantiacus is a thermophilic filamentous anoxygenic phototrophic (FAP) bacterium, and can grow phototrophically under anaerobic conditions or chemotrophically under aerobic and dark conditions. According to 16S rRNA analysis, Chloroflexi species are the earliest branching bacteria capable of photosynthesis, and Cfl. aurantiacus has been long regarded as a key organism to resolve the obscurity of the origin and early evolution of photosynthesis. Cfl. aurantiacus contains a chimeric photosystem that comprises some characters of green sulfur bacteria and purple photosynthetic bacteria, and also has some unique electron transport proteins compared to other photosynthetic bacteria.

  16. Gene function analysis in extremophiles: the "nif" regulon of the strict iron oxidizing bacterium "Leptospirillum ferrooxidans"

    NASA Astrophysics Data System (ADS)

    Parro, Victor; Moreno-Paz, Mercedes

    2004-03-01

    In Centro de Astrobiologia it has been considered the Tinto river as a model ecosystem to study life based on iron. The final goal is to study the biological and metabolic diversity in microorganisms living there, following a genomic approach, to get insights to the mechanisms of adaptation to this environment. The Gram-negative bacterium Leptospirillum ferrooxidans is one of the most abundant microorganisms in the river, and it is one of the main responsible in maintenance of pH balance and, as a consequence, the physico-chemical properties of the exosystem. We have constructed a Shotgun DNA microarrays from this bacterium and we have used it to studied its genetic capacity for nitrogen fixation. With this approach we have identified most of the genes necessary for dinitrogen (N2) reduction, confirming the capacity of L. ferrooxidans as a free diazotrophic (nitrogen fixer) microorganism.

  17. Draft Genome Sequence of a Pseudomonas aeruginosa NA04 Bacterium Isolated from an Entomopathogenic Nematode.

    PubMed

    Salgado-Morales, Rosalba; Rivera-Gómez, Nancy; Lozano-Aguirre Beltrán, Luis Fernando; Hernández-Mendoza, Armando; Dantán-González, Edgar

    2017-09-07

    We report the draft genome sequence of Gram-negative bacterium Pseudomonas aeruginosa NA04, isolated from the entomopathogenic nematode Heterorhabditis indica MOR03. The draft genome consists of 54 contigs, a length of 6.37 Mb, and a G+C content 66.49%. Copyright © 2017 Salgado-Morales et al.

  18. Curiously modern DNA for a "250 million-year-old" bacterium.

    PubMed

    Nickle, David C; Learn, Gerald H; Rain, Matthew W; Mullins, James I; Mittler, John E

    2002-01-01

    Studies of ancient DNA have attracted considerable attention in scientific journals and the popular press. Several of the more extreme claims for ancient DNA have been questioned on biochemical grounds (i.e., DNA surviving longer than expected) and evolutionary grounds (i.e., nucleotide substitution patterns not matching theoretical expectations for ancient DNA). A recent letter to Nature from Vreeland et al. (2000), however, tops all others with respect to age and condition of the specimen. These researchers extracted and cultured a bacterium from an inclusion body from what they claim is a 250 million-year (Myr)-old salt crystal. If substantiated, this observation could fundamentally alter views about bacterial physiology, ecology and evolution. Here we report on molecular evolutionary analyses of the 16S rDNA from this specimen. We find that 2-9-3 differs from a modern halophile, Salibacillus marismortui, by just 3 unambiguous bp in 16S rDNA, versus the approximately 59 bp that would be expected if these bacteria evolved at the same rate as other bacteria. We show, using a Poisson distribution, that unless it can be shown that S. marismortui evolves 5 to 10 times more slowly than other bacteria for which 16S rDNA substitution rates have been established, Vreeland et al.'s claim would be rejected at the 0.05 level. Also, a molecular clock test and a relative rates test fail to substantiate Vreeland et al.'s claim that strain 2-9-3 is a 250-Myr-old bacterium. The report of Vreeland et al. thus falls into a long series of suspect ancient DNA studies.

  19. Draft Genome Sequence of Sphingobium ummariense Strain RL-3, a Hexachlorocyclohexane-Degrading Bacterium

    PubMed Central

    Kohli, Puneet; Dua, Ankita; Sangwan, Naseer; Oldach, Phoebe; Khurana, J. P.

    2013-01-01

    Here, we report the draft genome sequence of the hexachlorocyclohexane (HCH)-degrading bacterium Sphingobium ummariense strain RL-3, which was isolated from the HCH dumpsite located in Lucknow, India (27°00′N and 81°09′E). The annotated draft genome sequence (4.75 Mb) of strain RL-3 consisted of 139 contigs, 4,645 coding sequences, and 65% G+C content. PMID:24233594

  20. Reduction of nitric oxide catalyzed by hydroxylamine oxidoreductase from an anammox bacterium.

    PubMed

    Irisa, Tatsuya; Hira, Daisuke; Furukawa, Kenji; Fujii, Takao

    2014-12-01

    The hydroxylamine oxidoreductase (HAO) from the anammox bacterium, Candidatus Kuenenia stuttgartiensis has been reported to catalyze the oxidation of hydroxylamine (NH2OH) to nitric oxide (NO) by using bovine cytochrome c as an oxidant. In contrast, we investigated whether the HAO from anammox bacterium strain KSU-1 could catalyze the reduction of NO with reduced benzyl viologen (BVred) and the NO-releasing reagent, NOC 7. The reduction proceeded, resulting in the formation of NH2OH as a product. The oxidation rate of BVred was proportional to the concentration of BVred itself for a short period in each experiment, a situation that was termed quasi-steady state. The analyses of the states at various concentrations of HAO allowed us to determine the rate constant for the catalytic reaction, (2.85 ± 0.19) × 10(5) M(-1) s(-1), governing NO reduction by BVred and HAO, which was comparable to that reported for the HAO from the ammonium oxidizer, Nitrosomonas with reduced methyl viologen. These results suggest that the anammox HAO functions to adjust anammox by inter-conversion of NO and NH2OH depending on the redox potential of the physiological electron transfer protein in anammox bacteria. Copyright © 2014 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  1. A novel continuous toxicity test system using a luminously modified freshwater bacterium.

    PubMed

    Cho, Jang-Cheon; Park, Kyung-Je; Ihm, Hyuk-Soon; Park, Ji-Eun; Kim, Se-Young; Kang, Ilnam; Lee, Kyu-Ho; Jahng, Deokjin; Lee, Dong-Hun; Kim, Sang-Jong

    2004-09-15

    An automated continuous toxicity test system was developed using a recombinant bioluminescent freshwater bacterium. The groundwater-borne bacterium, Janthinobacterium lividum YH9-RC, was modified with luxAB and optimized for toxicity tests using different kinds of organic carbon compounds and heavy metals. luxAB-marked YH9-RC cells were much more sensitive (average 7.3-8.6 times) to chemicals used for toxicity detection than marine Vibrio fischeri cells used in the Microtox assay. Toxicity tests for wastewater samples using the YH9-RC-based toxicity assay showed that EC50-5 min values in an untreated raw wastewater sample (23.9 +/- 12.8%) were the lowest, while those in an effluent sample (76.7 +/- 14.9%) were the highest. Lyophilization conditions were optimized in 384-multiwell plates containing bioluminescent bacteria that were pre-incubated for 15 min in 0.16 M of trehalose prior to freeze-drying, increasing the recovery of bioluminescence and viability by 50%. Luminously modified cells exposed to continuous phenol or wastewater stream showed a rapid decrease in bioluminescence, which fell below detectable range within 1 min. An advanced toxicity test system, featuring automated real-time toxicity monitoring and alerting functions, was designed and finely tuned. This novel continuous toxicity test system can be used for real-time biomonitoring of water toxicity, and can potentially be used as a biological early warning system.

  2. Expression of Heterogenous Arsenic Resistance Genes in the Obligately Autotrophic Biomining Bacterium Thiobacillus ferrooxidans.

    PubMed

    Peng, J B; Yan, W M; Bao, X Z

    1994-07-01

    Two arsenic-resistant plasmids were constructed and introduced into Thiobacillus ferrooxidans strains by conjugation. The plasmids with the replicon of wide-host-range plasmid RSF1010 were stable in T. ferrooxidans. The arsenic resistance genes originating from the heterotroph were expressed in this obligately autotrophic bacterium, but the promoter derived from T. ferrooxidans showed no special function in its original host.

  3. Expression of Heterogenous Arsenic Resistance Genes in the Obligately Autotrophic Biomining Bacterium Thiobacillus ferrooxidans

    PubMed Central

    Peng, Ji-Bin; Yan, Wang-Ming; Bao, Xue-Zhen

    1994-01-01

    Two arsenic-resistant plasmids were constructed and introduced into Thiobacillus ferrooxidans strains by conjugation. The plasmids with the replicon of wide-host-range plasmid RSF1010 were stable in T. ferrooxidans. The arsenic resistance genes originating from the heterotroph were expressed in this obligately autotrophic bacterium, but the promoter derived from T. ferrooxidans showed no special function in its original host. PMID:16349341

  4. Draft Genome Sequence of Lactobacillus paracasei DmW181, a Bacterium Isolated from Wild Drosophila.

    PubMed

    Hammer, Austin J; Walters, Amber; Carroll, Courtney; Newell, Peter D; Chaston, John M

    2017-07-06

    The draft genome sequence of Lactobacillus paracasei DmW181, an anaerobic bacterium isolate from wild Drosophila flies, is reported here. Strain DmW181 possesses genes for sialic acid and mannose metabolism. The assembled genome is 3,201,429 bp, with 3,454 predicted genes. Copyright © 2017 Hammer et al.

  5. Draft Genome Sequence of the 2-Chloro-4-Nitrophenol-Degrading Bacterium Arthrobacter sp. Strain SJCon

    PubMed Central

    Vikram, Surendra; Kumar, Shailesh; Vaidya, Bhumika; Pinnaka, Anil Kumar

    2013-01-01

    We report the 4.39-Mb draft genome sequence of the 2-chloro-4-nitrophenol-degrading bacterium Arthrobacter sp. strain SJCon, isolated from a pesticide-contaminated site. The draft genome sequence of strain SJCon will be helpful in studying the genetic pathways involved in the degradation of several aromatic compounds. PMID:23516196

  6. ‘Cand. Actinochlamydia clariae’ gen. nov., sp. nov., a Unique Intracellular Bacterium Causing Epitheliocystis in Catfish (Clarias gariepinus) in Uganda

    PubMed Central

    Steigen, Andreas; Nylund, Are; Karlsbakk, Egil; Akoll, Peter; Fiksdal, Ingrid U.; Nylund, Stian; Odong, Robinson; Plarre, Heidrun; Semyalo, Ronald; Skår, Cecilie; Watanabe, Kuninori

    2013-01-01

    Background and Objectives Epitheliocystis, caused by bacteria infecting gill epithelial cells in fish, is common among a large range of fish species in both fresh- and seawater. The aquaculture industry considers epitheliocystis an important problem. It affects the welfare of the fish and the resulting gill disease may lead to mortalities. In a culture facility in Kampala, Uganda, juveniles of the African sharptooth catfish (Clarias gariepinus) was observed swimming in the surface, sometimes belly up, showing signs of respiratory problems. Histological examination of gill tissues from this fish revealed large amounts of epitheliocysts, and also presence of a few Ichthyobodo sp. and Trichodina sp. Methods and Results Sequencing of the epitheliocystis bacterium 16S rRNA gene shows 86.3% similarity with Candidatus Piscichlamydia salmonis causing epitheliocystis in Atlantic salmon (Salmo salar). Transmission electron microscopy showed that the morphology of the developmental stages of the bacterium is similar to that of members of the family Chlamydiaceae. The similarity of the bacterium rRNA gene sequences compared with other chlamydia-like bacteria ranged between 80.5% and 86.3%. Inclusions containing this new bacterium have tubules/channels (termed actinae) that are radiating from the inclusion membrane and opening on the cell surface or in neighbouring cells. Conclusions Radiation of tubules/channels (actinae) from the inclusion membrane has never been described in any of the other members of Chlamydiales. It seems to be a completely new character and an apomorphy. We propose the name Candidatus Actinochlamydia clariae gen. nov., sp. nov. (Actinochlamydiaceae fam. nov., order Chlamydiales, phylum Chlamydiae) for this new agent causing epitheliocystis in African sharptooth catfish. PMID:23826156

  7. Combination of a recombinant bacterium with organonitrile-degrading and biofilm-forming capability and a positively charged carrier for organonitriles removal.

    PubMed

    Li, Chunyan; Sun, Yueling; Yue, Zhenlei; Huang, Mingyan; Wang, Jinming; Chen, Xi; An, Xuejiao; Zang, Hailian; Li, Dapeng; Hou, Ning

    2018-04-10

    The immobilization of organonitrile-degrading bacteria via the addition of biofilm-forming bacteria represents a promising technology for the treatment of organonitrile-containing wastewater, but biofilm-forming bacteria simply mixed with degrading bacteria may reduce the biodegradation efficiency. Nitrile hydratase and amidase genes, which play critical roles in organonitriles degradation, were cloned and transformed into the biofilm-forming bacterium Bacillus subtilis N4 to construct a recombinant bacterium B. subtilis N4/pHTnha-ami. Modified polyethylene carriers with positive charge was applied to promote bacterial adherence and biofilm formation. The immobilized B. subtilis N4/pHTnha-ami was resistant to organonitriles loading shocks and could remove organic cyanide ion with a initial concentration of 392.6 mg/L for 24 h in a moving bed biofilm reactor. The imputed quorum-sensing signal and the high-throughput sequencing analysis of the biofilm indicated that B. subtilis N4/pHTnha-ami was successfully immobilized and became dominant. The successful application of the immobilized recombinant bacterium offers a novel strategy for the biodegradation of recalcitrant compounds. Copyright © 2018 Elsevier B.V. All rights reserved.

  8. Complete genome sequencing of the luminescent bacterium, Vibrio qinghaiensis sp. Q67 using PacBio technology

    NASA Astrophysics Data System (ADS)

    Gong, Liang; Wu, Yu; Jian, Qijie; Yin, Chunxiao; Li, Taotao; Gupta, Vijai Kumar; Duan, Xuewu; Jiang, Yueming

    2018-01-01

    Vibrio qinghaiensis sp.-Q67 (Vqin-Q67) is a freshwater luminescent bacterium that continuously emits blue-green light (485 nm). The bacterium has been widely used for detecting toxic contaminants. Here, we report the complete genome sequence of Vqin-Q67, obtained using third-generation PacBio sequencing technology. Continuous long reads were attained from three PacBio sequencing runs and reads >500 bp with a quality value of >0.75 were merged together into a single dataset. This resultant highly-contiguous de novo assembly has no genome gaps, and comprises two chromosomes with substantial genetic information, including protein-coding genes, non-coding RNA, transposon and gene islands. Our dataset can be useful as a comparative genome for evolution and speciation studies, as well as for the analysis of protein-coding gene families, the pathogenicity of different Vibrio species in fish, the evolution of non-coding RNA and transposon, and the regulation of gene expression in relation to the bioluminescence of Vqin-Q67.

  9. Cellulosic ethanol production via consolidated bioprocessing by a novel thermophilic anaerobic bacterium isolated from a Himalayan hot spring.

    PubMed

    Singh, Nisha; Mathur, Anshu S; Tuli, Deepak K; Gupta, Ravi P; Barrow, Colin J; Puri, Munish

    2017-01-01

    Cellulose-degrading thermophilic anaerobic bacterium as a suitable host for consolidated bioprocessing (CBP) has been proposed as an economically suited platform for the production of second-generation biofuels. To recognize the overall objective of CBP, fermentation using co-culture of different cellulolytic and sugar-fermenting thermophilic anaerobic bacteria has been widely studied as an approach to achieving improved ethanol production. We assessed monoculture and co-culture fermentation of novel thermophilic anaerobic bacterium for ethanol production from real substrates under controlled conditions. In this study, Clostridium sp. DBT-IOC-C19, a cellulose-degrading thermophilic anaerobic bacterium, was isolated from the cellulolytic enrichment cultures obtained from a Himalayan hot spring. Strain DBT-IOC-C19 exhibited a broad substrate spectrum and presented single-step conversion of various cellulosic and hemicellulosic substrates to ethanol, acetate, and lactate with ethanol being the major fermentation product. Additionally, the effect of varying cellulose concentrations on the fermentation performance of the strain was studied, indicating a maximum cellulose utilization ability of 10 g L -1 cellulose. Avicel degradation kinetics of the strain DBT-IOC-C19 displayed 94.6% degradation at 5 g L -1 and 82.74% degradation at 10 g L -1 avicel concentration within 96 h of fermentation. In a comparative study with Clostridium thermocellum DSM 1313, the ethanol and total product concentrations were higher by the newly isolated strain on pretreated rice straw at an equivalent substrate loading. Three different co-culture combinations were used on various substrates that presented two-fold yield improvement than the monoculture during batch fermentation. This study demonstrated the direct fermentation ability of the novel thermophilic anaerobic bacteria on various cellulosic and hemicellulosic substrates into ethanol without the aid of any exogenous enzymes

  10. Draft Genome Sequence of the Obligately Alkaliphilic Sulfate-Reducing Bacterium Desulfonatronum thiodismutans Strain MLF1

    PubMed Central

    Trubitsyn, Denis; Geurink, Corey; Pikuta, Elena; Lefèvre, Christopher T.; McShan, W. Michael; Gillaspy, Allison F.

    2014-01-01

    Desulfonatronum thiodismutans strain MLF1, an alkaliphilic bacterium capable of sulfate reduction, was isolated from Mono Lake, California. Here we report the 3.92-Mb draft genome sequence comprising 34 contigs and some results of its automated annotation. These data will improve our knowledge of mechanisms by which bacteria withstand extreme environments. PMID:25081260

  11. Identification and Characterization of a High Efficiency Aniline Resistance and Degrading Bacterium MC-01.

    PubMed

    Yang, Liu; Ying, Chen; Fang, Ni; Zhong, Yao; Zhao-Xiang, Zhong; Yun, Sun

    2017-05-01

    Biodegradation is one of the important methods for the treatment of industrial wastewater containing aniline. In this paper, a degrading bacterium named MC-01, which could survive in high concentration aniline wastewater, was screened from industrial wastewater containing aniline and sludge. MC-01 was preliminarily identified as Ochrobactrum sp. based on the amplified 16S rDNA gene sequence and Biolog system identification. MC-01 was highly resistant to aniline. After 24-h culture under aniline concentration of 6500 mg/L, the amount of bacterium survived still remained 0.05 × 10 6  CFU/mL. Experiments showed that there was no coupling expression between the growth of MC-01 and aniline degradation. The optimum growth conditions in LB culture were pH 6.0, 30 °C of temperature, and 4% of incubation amount, respectively. And the optimum conditions of aniline degradation of MC-01 were pH 7.0, 45 °C of temperature, and 3.0% of salt concentration, respectively. The degradation rate of MC-01 (48 h) in different aniline concentrations (200~1600 mg/L) was stable under the optimum conditions, which could reach more than 75%.

  12. The heterocyclic ring fission and dehydroxylation of catechins and related compounds by Eubacterium sp. strain SDG-2, a human intestinal bacterium.

    PubMed

    Wang, L Q; Meselhy, M R; Li, Y; Nakamura, N; Min, B S; Qin, G W; Hattori, M

    2001-12-01

    A human intestinal bacterium, Eubacterium (E.) sp. strain SDG-2, was tested for its ability to metabolize various (3R)- and (3S)-flavan-3-ols and their 3-O-gallates. This bacterium cleaved the C-ring of (3R)- and (3S)-flavan-3-ols to give 1,3-diphenylpropan-2-ol derivatives, but not their 3-O-gallates. Furthermore, E. sp. strain SDG-2 had the ability of p-dehydroxylation in the B-ring of (3R)-flavan-3-ols, such as (-)-catechin, (-)-epicatechin, (-)-gallocatechin and (-)-epigallocatechin, but not of (3S)-flavan-3-ols, such as (+)-catechin and (+)-epicatechin.

  13. Extracellular polymer substance synthesized by a halophilic bacterium Chromohalobacter canadensis 28.

    PubMed

    Radchenkova, Nadja; Boyadzhieva, Ivanka; Atanasova, Nikolina; Poli, Annarita; Finore, Ilaria; Di Donato, Paola; Nicolaus, Barbara; Panchev, Ivan; Kuncheva, Margarita; Kambourova, Margarita

    2018-04-03

    Halophilic microorganisms are producers of a lot of new compounds whose properties suggest promising perspectives for their biotechnological exploration. Moderate halophilic bacterium Chromohalobacter canadensis 28 was isolated from Pomorie salterns as an extracellular polymer substance (EP) producer. The best carbon source for extracellular polymer production was found to be lactose, a sugar received as a by-product from the dairy industry. After optimization of the culture medium and physicochemical conditions for cultivation, polymer biosynthesis increased more than 2-fold. The highest level of extracellular polymer synthesis by C. canadensis 28 was observed in an unusually high NaCl concentration (15% w/v). Chemical analysis of the purified polymer revealed the presence of an exopolysaccharide (EPS) fraction (14.3% w/w) and protein fraction (72% w/w). HPLC analysis of the protein fraction showed the main presence of polyglutamic acid (PGA) (75.7% w/w). EPS fraction analysis revealed the following sugar composition (% w/w): glucosamine 36.7, glucose 32.3, rhamnose 25.4, xylose 1.7, and not identified sugar 3.9. The hydrogel formed by PGA and EPS fractions showed high swelling behavior, very good emulsifying and stabilizing properties, and good foaming ability. This is the first report for halophilic bacterium able to synthesize a polymer containing PGA fraction. The synthesized biopolymer shows an extremely high hydrophilicity, due to the simultaneous presence of PGA and EPS. The analysis of its functional properties and the presence of glucosamine in the highest proportion in EPS fraction clearly determine the potential of EP synthesized by C. canadensis 28 for application in the cosmetics industry.

  14. Complete Genome Sequence of a New Ruminococcaceae Bacterium Isolated from Anaerobic Biomass Hydrolysis.

    PubMed

    Hahnke, Sarah; Abendroth, Christian; Langer, Thomas; Codoñer, Francisco M; Ramm, Patrice; Porcar, Manuel; Luschnig, Olaf; Klocke, Michael

    2018-04-05

    A new Ruminococcaceae bacterium, strain HV4-5-B5C, participating in the anaerobic digestion of grass, was isolated from a mesophilic two-stage laboratory-scale leach bed biogas system. The draft annotated genome sequence presented in this study and 16S rRNA gene sequence analysis indicated the affiliation of HV4-5-B5C with the family Ruminococcaceae outside recently described genera. Copyright © 2018 Hahnke et al.

  15. Quorum sensing activity of Citrobacter amalonaticus L8A, a bacterium isolated from dental plaque.

    PubMed

    Goh, Share-Yuan; Khan, Saad Ahmed; Tee, Kok Keng; Abu Kasim, Noor Hayaty; Yin, Wai-Fong; Chan, Kok-Gan

    2016-02-10

    Cell-cell communication is also known as quorum sensing (QS) that happens in the bacterial cells with the aim to regulate their genes expression in response to increased cell density. In this study, a bacterium (L8A) isolated from dental plaque biofilm was identified as Citrobacter amalonaticus by matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry (MS). Its N-acylhomoserine-lactone (AHL) production was screened by using two types of AHL biosensors namely Chromobacterium violaceum CV026 and Escherichia coli [pSB401]. Citrobacter amalonaticus strain L8A was identified and confirmed producing numerous types of AHL namely N-butyryl-L-homoserine lactone (C4-HSL), N-hexanoyl-L-homoserine lactone (C6-HSL), N-octanoyl-L-homoserine lactone (C8-HSL) and N-hexadecanoyl-L-homoserine lactone (C16-HSL). We performed the whole genome sequence analysis of this oral isolate where its genome sequence reveals the presence of QS signal synthase gene and our work will pave the ways to study the function of the related QS genes in this bacterium.

  16. Quorum sensing activity of Citrobacter amalonaticus L8A, a bacterium isolated from dental plaque

    PubMed Central

    Goh, Share-Yuan; Khan, Saad Ahmed; Tee, Kok Keng; Abu Kasim, Noor Hayaty; Yin, Wai-Fong; Chan, Kok-Gan

    2016-01-01

    Cell-cell communication is also known as quorum sensing (QS) that happens in the bacterial cells with the aim to regulate their genes expression in response to increased cell density. In this study, a bacterium (L8A) isolated from dental plaque biofilm was identified as Citrobacter amalonaticus by matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry (MS). Its N-acylhomoserine-lactone (AHL) production was screened by using two types of AHL biosensors namely Chromobacterium violaceum CV026 and Escherichia coli [pSB401]. Citrobacter amalonaticus strain L8A was identified and confirmed producing numerous types of AHL namely N-butyryl-L-homoserine lactone (C4-HSL), N-hexanoyl-L-homoserine lactone (C6-HSL), N-octanoyl-L-homoserine lactone (C8-HSL) and N-hexadecanoyl-L-homoserine lactone (C16-HSL). We performed the whole genome sequence analysis of this oral isolate where its genome sequence reveals the presence of QS signal synthase gene and our work will pave the ways to study the function of the related QS genes in this bacterium. PMID:26860259

  17. Characterization of carbon dioxide concentrating chemolithotrophic bacterium Serratia sp. ISTD04 for production of biodiesel.

    PubMed

    Kumar, Manish; Morya, Raj; Gnansounou, Edgard; Larroche, Christian; Thakur, Indu Shekhar

    2017-11-01

    Proteomics and metabolomics analysis has become a powerful tool for characterization of microbial ability for fixation of Carbon dioxide. Bacterial community of palaeoproterozoic metasediments was enriched in the shake flask culture in the presence of NaHCO 3 . One of the isolate showed resistance to NaHCO 3 (100mM) and was identified as Serratia sp. ISTD04 by 16S rRNA sequence analysis. Carbon dioxide fixing ability of the bacterium was established by carbonic anhydrase enzyme assay along with proteomic analysis by LC-MS/MS. In proteomic analysis 96 proteins were identified out of these 6 protein involved in carbon dioxide fixation, 11 in fatty acid metabolism, indicating the carbon dioxide fixing potency of bacterium along with production of biofuel. GC-MS analysis revealed that hydrocarbons and FAMEs produced by bacteria within the range of C 13 -C 24 and C 11 -C 19 respectively. Presence of 59% saturated and 41% unsaturated organic compounds, make it a better fuel composition. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. Natural Competence of Xylella fastidiosa Occurs at a High Frequency Inside Microfluidic Chambers Mimicking the Bacterium's Natural Habitats.

    PubMed

    Kandel, Prem P; Lopez, Samantha M; Almeida, Rodrigo P P; De La Fuente, Leonardo

    2016-09-01

    Xylella fastidiosa is a xylem-limited bacterium that is the causal agent of emerging diseases in a number of economically important crops. Genetic diversity studies have demonstrated homologous recombination occurring among X. fastidiosa strains, which has been proposed to contribute to host plant shifts. Moreover, experimental evidence confirmed that X. fastidiosa is naturally competent for recombination in vitro Here, as an approximation of natural habitats (plant xylem vessels and insect mouthparts), recombination was studied in microfluidic chambers (MCs) filled with media amended with grapevine xylem sap. First, different media were screened for recombination in solid agar plates using a pair of X. fastidiosa strains that were previously reported to recombine in coculture. The highest frequency of recombination was obtained with PD3 medium, compared to those with the other two media (X. fastidiosa medium [XFM] and periwinkle wilt [PW] medium) used in previous studies. Dissection of the media components led to the identification of bovine serum albumin as an inhibitor of recombination that was correlated to its previously known effect on inhibition of twitching motility. When recombination was performed in liquid culture, the frequencies were significantly higher under flow conditions (MCs) than under batch conditions (test tubes). The recombination frequencies in MCs and agar plates were not significantly different from each other. Grapevine xylem sap from both susceptible and tolerant varieties allowed high recombination frequency in MCs when mixed with PD3. These results suggest that X. fastidiosa has the ability to be naturally competent in the natural growth environment of liquid flow, and this phenomenon could have implications in X. fastidiosa environmental adaptation. Xylella fastidiosa is a plant pathogen that lives inside xylem vessels (where water and nutrients are transported inside the plant) and the mouthparts of insect vectors. This bacterium

  19. Natural Competence of Xylella fastidiosa Occurs at a High Frequency Inside Microfluidic Chambers Mimicking the Bacterium's Natural Habitats

    PubMed Central

    Kandel, Prem P.; Lopez, Samantha M.; Almeida, Rodrigo P. P.

    2016-01-01

    ABSTRACT Xylella fastidiosa is a xylem-limited bacterium that is the causal agent of emerging diseases in a number of economically important crops. Genetic diversity studies have demonstrated homologous recombination occurring among X. fastidiosa strains, which has been proposed to contribute to host plant shifts. Moreover, experimental evidence confirmed that X. fastidiosa is naturally competent for recombination in vitro. Here, as an approximation of natural habitats (plant xylem vessels and insect mouthparts), recombination was studied in microfluidic chambers (MCs) filled with media amended with grapevine xylem sap. First, different media were screened for recombination in solid agar plates using a pair of X. fastidiosa strains that were previously reported to recombine in coculture. The highest frequency of recombination was obtained with PD3 medium, compared to those with the other two media (X. fastidiosa medium [XFM] and periwinkle wilt [PW] medium) used in previous studies. Dissection of the media components led to the identification of bovine serum albumin as an inhibitor of recombination that was correlated to its previously known effect on inhibition of twitching motility. When recombination was performed in liquid culture, the frequencies were significantly higher under flow conditions (MCs) than under batch conditions (test tubes). The recombination frequencies in MCs and agar plates were not significantly different from each other. Grapevine xylem sap from both susceptible and tolerant varieties allowed high recombination frequency in MCs when mixed with PD3. These results suggest that X. fastidiosa has the ability to be naturally competent in the natural growth environment of liquid flow, and this phenomenon could have implications in X. fastidiosa environmental adaptation. IMPORTANCE Xylella fastidiosa is a plant pathogen that lives inside xylem vessels (where water and nutrients are transported inside the plant) and the mouthparts of insect

  20. Establishment of an efficient fermentation system of gamma-aminobutyric acid by a lactic acid bacterium, Enterococcus avium G-15, isolated from carrot leaves.

    PubMed

    Tamura, Takayoshi; Noda, Masafumi; Ozaki, Moeko; Maruyama, Masafumi; Matoba, Yasuyuki; Kumagai, Takanori; Sugiyama, Masanori

    2010-01-01

    In the present study, we successfully isolated a carrot leaf-derived lactic acid bacterium that produces gamma-aminobutyric acid (GABA) from monosodium L-glutamate (L-MSG) at a hyper conversion rate. The GABA-producing bacterium, identified as Enterococcus (E.) avium G-15, produced 115.7±6.4 g/l GABA at a conversion rate of 86.0±5.0% from the added L-MSG under the optimum culture condition by a continuous L-MSG feeding method using a jar-fermentor, suggesting that the bacterium displays a great potential ability for the commercial-level fermentation production of GABA. Using the reverse transcription polymerase chain reaction (RT-PCR) method, we analyzed the expression of genes for the GABA transporter and glutamate decarboxylase, designated gadT and gadG, respectively, which were cloned from the E. avium G-15 chromosome. Both genes were expressed even without the added L-MSG, but their expression was enhanced by the addition of L-MSG.

  1. Zinc biosorption by the purple non-sulfur bacterium Rhodobacter capsulatus.

    PubMed

    Magnin, Jean-Pierre; Gondrexon, Nicolas; Willison, John C

    2014-12-01

    This paper presents the first report providing information on the zinc (Zn) biosorption potentialities of the purple non-sulfur bacterium Rhodobacter capsulatus. The effects of various biological, physical, and chemical parameters on Zn biosorption were studied in both the wild-type strain B10 and a strain, RC220, lacking the endogenous plasmid. At an initial Zn concentration of 10 mg·L(-1), the Zn biosorption capacity at pH 7 for bacterial biomass grown in synthetic medium containing lactate as carbon source was 17 and 16 mg Zn·(g dry mass)(-1) for strains B10 and RC220, respectively. Equilibrium was achieved in a contact time of 30-120 min, depending on the initial Zn concentration. Zn sorption by live biomass was modelled, at equilibrium, according to the Redlich-Peterson and Langmuir isotherms, in the range of 1-600 mg Zn·L(-1). The wild-type strain showed a maximal Zn uptake capacity (Qm) of 164 ± 8 mg·(g dry mass)(-1) and an equilibrium constant (Kads) of 0.017 ± 0.00085 L·(mg Zn)(-1), compared with values of 73.9 mg·(g dry mass)(-1) and 0.361 L·mg(-1) for the strain lacking the endogenous plasmid. The Qm value observed for R. capsulatus B10 is one of the highest reported in the literature, suggesting that this strain may be useful for Zn bioremediation. The lower Qm value and higher equilibrium constant observed for strain RC220 suggest that the endogenous plasmid confers an enhanced biosorption capacity in this bacterium, although no genetic determinants for Zn resistance appear to be located on the plasmid, and possible explanations for this are discussed.

  2. The Production, Purification and Properties of the Biopolymer Levan Produced by the Bacterium Erwinia Herbicola

    DTIC Science & Technology

    1989-08-01

    standard and an inulin standard provided by Dr. Elwin Reese of this laboratory and a sample of levan from a different bacterium provided by the USDA.23 A...polymyxa 24 Levan standard Continuous culture Tangential Flow purified levan (this study) >■• <-■-’•«■ i-I-» r Inulin standard tu 25 Figure 5. NMR

  3. Genome Sequence of Pedobacter arcticus sp. nov., a Sea Ice Bacterium Isolated from Tundra Soil

    PubMed Central

    Yin, Ye; Yue, Guidong; Gao, Qiang; Wang, Zhiyong; Peng, Fang; Fang, Chengxiang; Yang, Xu

    2012-01-01

    Pedobacter arcticus sp. nov. was originally isolated from tundra soil collected from Ny-Ålesund, in the Arctic region of Norway. It is a Gram-negative bacterium which shows bleb-shaped appendages on the cell surface. Here, we report the draft annotated genome sequence of Pedobacter arcticus sp. nov., which belongs to the genus Pedobacter. PMID:23144423

  4. Hydrogen Production by Co-cultures of Rhizopus oryzae and a Photosynthetic Bacterium, Rhodobacter sphaeroides RV

    NASA Astrophysics Data System (ADS)

    Asada, Yasuo; Ishimi, Katsuhiro; Nagata, Yoko; Wakayama, Tatsuki; Miyake, Jun; Kohno, Hideki

    Hydrogen production with glucose by using co-immobilized cultures of a fungus, Rhizopus oryzae NBRC5384, and a photosynthetic bacterium, Rhodobacter sphaeroides RV, in agar gels was studied. The co-immobilized cultures converted glucose to hydrogen via lactate in a high molar yield of about 8moles of hydrogen per glucose at a maximum under illuminated conditions.

  5. Draft Genome Sequence of the Obligately Alkaliphilic Sulfate-Reducing Bacterium Desulfonatronum thiodismutans Strain MLF1.

    PubMed

    Trubitsyn, Denis; Geurink, Corey; Pikuta, Elena; Lefèvre, Christopher T; McShan, W Michael; Gillaspy, Allison F; Bazylinski, Dennis A

    2014-07-31

    Desulfonatronum thiodismutans strain MLF1, an alkaliphilic bacterium capable of sulfate reduction, was isolated from Mono Lake, California. Here we report the 3.92-Mb draft genome sequence comprising 34 contigs and some results of its automated annotation. These data will improve our knowledge of mechanisms by which bacteria withstand extreme environments. Copyright © 2014 Trubitsyn et al.

  6. Metabolism of 4-chloro-2-nitrophenol in a Gram-positive bacterium, Exiguobacterium sp. PMA

    PubMed Central

    2012-01-01

    Background Chloronitrophenols (CNPs) are widely used in the synthesis of dyes, drugs and pesticides, and constitute a major group of environmental pollutants. 4-Chloro-2-nitrophenol (4C2NP) is an isomer of CNPs that has been detected in various industrial effluents. A number of physicochemical methods have been used for treatment of wastewater containing 4C2NP. These methods are not as effective as microbial degradation, however. Results A 4C2NP-degrading bacterium, Exiguobacterium sp. PMA, which uses 4C2NP as the sole carbon and energy source was isolated from a chemically-contaminated site in India. Exiguobacterium sp. PMA degraded 4C2NP with the release of stoichiometeric amounts of chloride and ammonium ions. The effects of different substrate concentrations and various inoculum sizes on degradation of 4C2NP were investigated. Exiguobacterium sp. PMA degraded 4C2NP up to a concentration of 0.6 mM. High performance liquid chromatography and gas chromatography–mass spectrometry identified 4-chloro-2-aminophenol (4C2AP) and 2-aminophenol (2AP) as possible metabolites of the 4C2NP degradation pathway. The crude extract of 4C2NP-induced PMA cells contained enzymatic activity for 4C2NP reductase and 4C2AP dehalogenase, suggesting the involvement of these enzymes in the degradation of 4C2NP. Microcosm studies using sterile and non-sterile soils spiked with 4C2NP were carried out to monitor the bioremediation potential of Exiguobacterium sp. PMA. The bioremediation of 4C2NP by Exiguobacterium sp. PMA was faster in non-sterilized soil than sterilized soil. Conclusions Our studies indicate that Exiguobacterium sp. PMA may be useful for the bioremediation of 4C2NP-contaminated sites. This is the first report of (i) the formation of 2AP in the 4C2NP degradation pathway by any bacterium and (iii) the bioremediation of 4C2NP by any bacterium. PMID:23171039

  7. Metabolism of 4-chloro-2-nitrophenol in a gram-positive bacterium, Exiguobacterium sp. PMA.

    PubMed

    Arora, Pankaj Kumar; Sharma, Ashutosh; Mehta, Richa; Shenoy, Belle Damodara; Srivastava, Alok; Singh, Vijay Pal

    2012-11-21

    Chloronitrophenols (CNPs) are widely used in the synthesis of dyes, drugs and pesticides, and constitute a major group of environmental pollutants. 4-Chloro-2-nitrophenol (4C2NP) is an isomer of CNPs that has been detected in various industrial effluents. A number of physicochemical methods have been used for treatment of wastewater containing 4C2NP. These methods are not as effective as microbial degradation, however. A 4C2NP-degrading bacterium, Exiguobacterium sp. PMA, which uses 4C2NP as the sole carbon and energy source was isolated from a chemically-contaminated site in India. Exiguobacterium sp. PMA degraded 4C2NP with the release of stoichiometeric amounts of chloride and ammonium ions. The effects of different substrate concentrations and various inoculum sizes on degradation of 4C2NP were investigated. Exiguobacterium sp. PMA degraded 4C2NP up to a concentration of 0.6 mM. High performance liquid chromatography and gas chromatography-mass spectrometry identified 4-chloro-2-aminophenol (4C2AP) and 2-aminophenol (2AP) as possible metabolites of the 4C2NP degradation pathway. The crude extract of 4C2NP-induced PMA cells contained enzymatic activity for 4C2NP reductase and 4C2AP dehalogenase, suggesting the involvement of these enzymes in the degradation of 4C2NP. Microcosm studies using sterile and non-sterile soils spiked with 4C2NP were carried out to monitor the bioremediation potential of Exiguobacterium sp. PMA. The bioremediation of 4C2NP by Exiguobacterium sp. PMA was faster in non-sterilized soil than sterilized soil. Our studies indicate that Exiguobacterium sp. PMA may be useful for the bioremediation of 4C2NP-contaminated sites. This is the first report of (i) the formation of 2AP in the 4C2NP degradation pathway by any bacterium and (iii) the bioremediation of 4C2NP by any bacterium.

  8. Complete Genome of Enterobacteriaceae Bacterium Strain FGI 57, a Strain Associated with Leaf-Cutter Ant Fungus Gardens

    PubMed Central

    Aylward, Frank O.; Tremmel, Daniel M.; Bruce, David C.; Chain, Patrick; Chen, Amy; Walston Davenport, Karen; Detter, Chris; Han, Cliff S.; Han, James; Huntemann, Marcel; Ivanova, Natalia N.; Kyrpides, Nikos C.; Markowitz, Victor; Mavrommatis, Kostas; Nolan, Matt; Pagani, Ioanna; Pati, Amrita; Pitluck, Sam; Deshpande, Shweta; Goodwin, Lynne; Woyke, Tanja

    2013-01-01

    The Enterobacteriaceae bacterium strain FGI 57 was isolated from a fungus garden of the leaf-cutter ant Atta colombica. Analysis of its single 4.76-Mbp chromosome will shed light on community dynamics and plant biomass degradation in ant fungus gardens. PMID:23469353

  9. [Genetic variability of the bacterium Ralstonia solanacearum (Burkholderiales: Burholderiaceae) in the banana-growing region of Uraba (Colombia)].

    PubMed

    Cardozo, Carolina; Rodríguez, Paola; Cotes, José Miguel; Marín, Mauricio

    2010-03-01

    The banana moko disease, caused by the bacterium Ralstonia solanacearum, is one of the most important phytopathological problems of the banana agribusiness in tropical countries. In Uraba and Magdalena (Colombia), the main exporting regions of banana in Colombia, this disease causes a destruction estimated in 16.5 ha/year. The bacterium presents an extremely high level of genetic variation that affects control measures. This is the first study of its variation in Colombia and was done with AFLP molecular markers on a population of 100 isolates from banana plants, soils and "weeds". The high level of genetic diversity, with Nei and Shannon indexes of h=0.32 and I=0.48, respectively, and the AMOVA, showed that this population is subestructured (Fst=0.66): the host is the main factor of differentiation. Even so, previous tests show that all varieties have pathogenicity on Musa.

  10. The O-antigen structure of bacterium Comamonas aquatica CJG.

    PubMed

    Wang, Xiqian; Kondakova, Anna N; Zhu, Yutong; Knirel, Yuriy A; Han, Aidong

    2017-11-01

    Genus Comamonas is a group of bacteria that are able to degrade a variety of environmental waste. Comamonas aquatica CJG (C. aquatica) in this genus is able to absorb low-density lipoprotein but not high-density lipoprotein of human serum. Using 1 H and 13 C NMR spectroscopy, we found that the O-polysaccharide (O-antigen) of this bacterium is comprised of a disaccharide repeat (O-unit) of d-glucose and 2-O-acetyl-l-rhamnose, which is shared by Serratia marcescens O6. The O-antigen gene cluster of C. aquatica, which is located between coaX and tnp4 genes, contains rhamnose synthesis genes, glycosyl and acetyl transferase genes, and ATP-binding cassette transporter genes, and therefore is consistent with the O-antigen structure determined here.

  11. Growth of a Strictly Anaerobic Bacterium on Furfural (2-Furaldehyde)

    PubMed Central

    Brune, Gerhard; Schoberth, Siegfried M.; Sahm, Hermann

    1983-01-01

    A strictly anaerobic bacterium was isolated from a continuous fermentor culture which converted the organic constituents of sulfite evaporator condensate to methane and carbon dioxide. Furfural is one of the major components of this condensate. This furfural isolate could degrade furfural as the sole source of carbon and energy in a defined mineral-vitamin-sulfate medium. Acetic acid was the major fermentation product. This organism could also use ethanol, lactate, pyruvate, or fumarate and contained cytochrome c3 and desulfoviridin. Except for furfural degradation, the characteristics of the furfural isolate were remarkably similar to those of the sulfate reducer Desulfovibrio gigas. The furfural isolate has been tentatively identified as Desulfovibrio sp. strain F-1. Images PMID:16346423

  12. Outbreak of meningitis in weaner pigs caused by unidentified asaccharolytic gram-negative bacterium.

    PubMed Central

    Mohan, K; Holmes, B; Kock, N; Muvavarirwa, P

    1996-01-01

    Several organisms are known to cause outbreaks of meningitis in pigs, with Haemophilus species being the most frequently implicated. We report such an outbreak in which necropsied pigs manifested an unusual combination of meningitis, tracheitis, and bronchitis. The causative agent appeared to be an asaccharolytic gram-negative nonfermentative bacterium whose classification has yet to be determined. The organism was isolated from the brain and was extremely capnophilic, growing in air only after several serial subcultures. PMID:8815112

  13. Permanent draft genome of the malachite-green-tolerant bacterium Rhizobium sp. MGL06.

    PubMed

    Liu, Yang; Wang, Runping; Zeng, Runying

    2014-12-01

    Rhizobium sp. MGL06, the first Rhizobium isolate from a marine environment, is a malachite-green-tolerant bacterium with a broader salinity tolerance (range: 0.5% to 9%) than other rhizobia. This study sequences and annotates the draft genome sequence of this strain. Genome sequence information provides a basis for analyzing the malachite green tolerance, broad salinity adaptation, nitrogen fixation properties, and taxonomic classification of the isolate. Copyright © 2014 Elsevier B.V. All rights reserved.

  14. High-Quality Genome Sequence of the Highly Resistant Bacterium Staphylococcus haemolyticus, Isolated from a Neonatal Bloodstream Infection.

    PubMed

    Hosseinkhani, Farideh; Emaneini, Mohammad; van Leeuwen, Willem

    2017-07-20

    Using Illumina HiSeq and PacBio technologies, we sequenced the genome of the multidrug-resistant bacterium Staphylococcus haemolyticus , originating from a bloodstream infection in a neonate. The sequence data can be used as an accurate reference sequence. Copyright © 2017 Hosseinkhani et al.

  15. Complete genome sequences of two strains of the meat spoilage bacterium Brochothrix thermosphacta isolated from ground chicken

    USDA-ARS?s Scientific Manuscript database

    Brochothrix thermosphacta is an important meat spoilage bacterium. Here we report the genome sequences of two strains of B. thermosphacta isolated from ground chicken. The genome sequences were determined using long-read PacBio single-molecule real-time (SMRT©) technology and are the first complete ...

  16. Shedding light on microbial dark matter: a TM6 bacterium as natural endosymbiont of a free-living amoeba.

    PubMed

    Delafont, Vincent; Samba-Louaka, Ascel; Bouchon, Didier; Moulin, Laurent; Héchard, Yann

    2015-12-01

    The TM6 phylum belongs to the so-called microbial dark matter that gathers uncultivated bacteria detected only via DNA sequencing. Recently, the genome sequence of a TM6 bacterium (TM6SC1) has led to suggest that this bacterium would adopt an endosymbiotic life. In the present paper, free-living amoebae bearing a TM6 strain were isolated from a water network. The amoebae were identified as Vermamoeba vermiformis and the presence of a TM6 strain was detected by polymerase chain reaction and microscopy. The partial sequence of its 16S rRNA gene showed this strain to be closely related to the sequenced TM6SC1 strain. These bacteria displayed a pyriform shape and were found within V. vermiformis. Therefore, these bacteria were named Vermiphilus pyriformis. Interactions studies showed that V. pyriformis was highly infectious and that its relation with V. vermiformis was specific and highly stable. Finally, it was found that V. pyriformis inhibited the encystment of V. vermiformis. Overall, this study describes for the first time an endosymbiotic relationship between a TM6 bacterium and a free-living amoeba in the environment. It suggests that other bacteria of the TM6 phylum might also be endosymbiotic bacteria and may be found in other free-living amoebae or other organisms. © 2015 Society for Applied Microbiology and John Wiley & Sons Ltd.

  17. Illuminating the landscape of host–pathogen interactions with the bacterium Listeria monocytogenes

    PubMed Central

    Cossart, Pascale

    2011-01-01

    Listeria monocytogenes has, in 25 y, become a model in infection biology. Through the analysis of both its saprophytic life and infectious process, new concepts in microbiology, cell biology, and pathogenesis have been discovered. This review will update our knowledge on this intracellular pathogen and highlight the most recent breakthroughs. Promising areas of investigation such as the increasingly recognized relevance for the infectious process, of RNA-mediated regulations in the bacterium, and the role of bacterially controlled posttranslational and epigenetic modifications in the host will also be discussed. PMID:22114192

  18. Development of multiplex polymerase chain reaction assay for simultaneous detection of clostero-, badna- and mandari-viruses along with huanglongbing bacterium in citrus trees.

    PubMed

    Meena, Ram Prasnna; Baranwal, V K

    2016-09-01

    Citrus trees harbor a large number of viral and bacterial pathogens. Citrus yellow vein clearing virus (CYVCV), Indian citrus ringspot virus (ICRSV), Citrus yellow mosaic virus (CYMV), Citrus tristeza virus (CTV) and a bacterium, Candidatus Liberibacter asiaticus (CLa) associated with huanglongbing (HLB) disease, the most prevalent pathogens in citrus orchards of different regions in India and are responsible for debilitating citriculture. For detection of these viral and bacterial pathogens a quick, sensitive and cost effective detection method is required. With this objective a multiplex polymerase chain reaction (mPCR) assay was developed for simultaneous detection of four viruses and a bacterium in citrus. Several sets of primers were designed for each virus based on the retrieved reference sequences from the GenBank. A primer pair published previously was used for greening bacterium. Each pair of primers was evaluated for their sensitivity and differentiation by simplex and mPCR. The constant amplified products were identified on the basis of molecular size in mPCR and were compared with standard PCR. The amplicons were cloned and results were confirmed with sequencing analysis. The mPCR assay was validated using naturally infected field samples for one or more citrus viruses and the huanglongbing bacterium. The mPCR assay developed here will aid in the production of virus free planting materials and rapid indexing for certification of citrus budwood programme. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. Draft Genome Sequence of Acinetobacter calcoaceticus Strain P23, a Plant Growth-Promoting Bacterium of Duckweed

    PubMed Central

    Hosoyama, Akira; Yamazoe, Atsushi; Morikawa, Masaaki

    2015-01-01

    Acinetobacter calcoaceticus strain P23 is a plant growth-promoting bacterium, which was isolated from the surface of duckweed. We report here the draft genome sequence of strain P23. The genome data will serve as a valuable reference for understanding the molecular mechanism of plant growth promotion in aquatic plants. PMID:25720680

  20. Isolation, cloning and characterization of an azoreductase from the halophilic bacterium Halomonas elongata.

    PubMed

    Eslami, Maryam; Amoozegar, Mohammad Ali; Asad, Sedigheh

    2016-04-01

    Azo dyes are a major class of colorants used in various industries including textile, paper and food. These dyes are regarded as pollutant since they are not readily reduced under aerobic conditions. Halomonas elongata, a halophilic bacterium, has the ability to decolorize different mono and di-azo dyes in anoxic conditions. In this study the putative azoreductase gene of H. elongata, formerly annotated as acp, was isolated, heterologously expressed in Escherichia coli, purified and characterized. The gene product, AzoH, was found to have a molecular mass of 22 kDa. The enzyme requires NADH, as an electron donor for its activity. The apparent Km was 63 μM for NADH and 12 μM for methyl red as a mono-azo dye substrate. The specific activity for methyl red was 0.27 μmol min(-1)mg(-1). The optimum enzyme activity was achieved in 50mM sodium phosphate buffer at pH 6. Although increased salinity resulted in reduced activity, AzoH could decolorize azo dye at NaCl concentrations up to 15% (w/v). The enzyme was also shown to be able to decolorize remazol black B as a representative of di-azo dyes. This is the first report describing the sequence and activity of an azo-reducing enzyme from a halophilic bacterium. Copyright © 2015 Elsevier B.V. All rights reserved.

  1. Proteogenomic Characterization of Monocyclic Aromatic Hydrocarbon Degradation Pathways in the Aniline-Degrading Bacterium Burkholderia sp. K24.

    PubMed

    Lee, Sang-Yeop; Kim, Gun-Hwa; Yun, Sung Ho; Choi, Chi-Won; Yi, Yoon-Sun; Kim, Jonghyun; Chung, Young-Ho; Park, Edmond Changkyun; Kim, Seung Il

    2016-01-01

    Burkholderia sp. K24, formerly known as Acinetobacter lwoffii K24, is a soil bacterium capable of utilizing aniline as its sole carbon and nitrogen source. Genomic sequence analysis revealed that this bacterium possesses putative gene clusters for biodegradation of various monocyclic aromatic hydrocarbons (MAHs), including benzene, toluene, and xylene (BTX), as well as aniline. We verified the proposed MAH biodegradation pathways by dioxygenase activity assays, RT-PCR, and LC/MS-based quantitative proteomic analyses. This proteogenomic approach revealed four independent degradation pathways, all converging into the citric acid cycle. Aniline and p-hydroxybenzoate degradation pathways converged into the β-ketoadipate pathway. Benzoate and toluene were degraded through the benzoyl-CoA degradation pathway. The xylene isomers, i.e., o-, m-, and p-xylene, were degraded via the extradiol cleavage pathways. Salicylate was degraded through the gentisate degradation pathway. Our results show that Burkholderia sp. K24 possesses versatile biodegradation pathways, which may be employed for efficient bioremediation of aniline and BTX.

  2. Proteogenomic Characterization of Monocyclic Aromatic Hydrocarbon Degradation Pathways in the Aniline-Degrading Bacterium Burkholderia sp. K24

    PubMed Central

    Yun, Sung Ho; Choi, Chi-Won; Yi, Yoon-Sun; Kim, Jonghyun; Chung, Young-Ho; Park, Edmond Changkyun; Kim, Seung Il

    2016-01-01

    Burkholderia sp. K24, formerly known as Acinetobacter lwoffii K24, is a soil bacterium capable of utilizing aniline as its sole carbon and nitrogen source. Genomic sequence analysis revealed that this bacterium possesses putative gene clusters for biodegradation of various monocyclic aromatic hydrocarbons (MAHs), including benzene, toluene, and xylene (BTX), as well as aniline. We verified the proposed MAH biodegradation pathways by dioxygenase activity assays, RT-PCR, and LC/MS-based quantitative proteomic analyses. This proteogenomic approach revealed four independent degradation pathways, all converging into the citric acid cycle. Aniline and p-hydroxybenzoate degradation pathways converged into the β-ketoadipate pathway. Benzoate and toluene were degraded through the benzoyl-CoA degradation pathway. The xylene isomers, i.e., o-, m-, and p-xylene, were degraded via the extradiol cleavage pathways. Salicylate was degraded through the gentisate degradation pathway. Our results show that Burkholderia sp. K24 possesses versatile biodegradation pathways, which may be employed for efficient bioremediation of aniline and BTX. PMID:27124467

  3. Detection of the Bacterium, Xylella fastidiosa, in Saliva of Glassy-Winged Sharpshooter, Homalodisca vitripennis

    PubMed Central

    Ramirez, Jose L.; Lacava, Paulo T.; Miller, Thomas A.

    2008-01-01

    Homalodisca vitripennis (Germar) (Hemiptera: Cicadellidae), the glassy-winged sharpshooter, is one of the most important vectors of the bacterium, Xylella fastidiosa subsp. piercei (Xanthomonadales: Xanthomonadaceae) that causes Pierce's Disease in grapevines in California. In the present study we report a new method for studying pathogen transmission or probing behavior of H. vitripennis. When confined, H. vitripennis attempt to probe the surface of sterile containers 48 hours post-acquisition of X. f. piercei. The saliva deposited during attempted feeding probes was found to contain X. f. piercei. We observed no correlation between X. f. piercei titers in the foregut of H. vitripennis that fed on Xylella-infected grapevines and the presence of this bacterium in the deposited saliva. The infection rate after a 48 h post-acquisition feeding on healthy citrus and grapevines was observed to be 77% for H. vitripennis that fed on grapevines and 81% for H. vitripennis that fed on citrus, with no difference in the number of positive probing sites from H. vitripennis that fed on either grapevine or citrus. This method is amenable for individual assessment of X. f. piercei-infecuvity, with samples less likely to be affected by tissue contamination that is usually present in whole body extracts. PMID:20233080

  4. Accurate Cell Division in Bacteria: How Does a Bacterium Know Where its Middle Is?

    NASA Astrophysics Data System (ADS)

    Howard, Martin; Rutenberg, Andrew

    2004-03-01

    I will discuss the physical principles lying behind the acquisition of accurate positional information in bacteria. A good application of these ideas is to the rod-shaped bacterium E. coli which divides precisely at its cellular midplane. This positioning is controlled by the Min system of proteins. These proteins coherently oscillate from end to end of the bacterium. I will present a reaction-diffusion model that describes the diffusion of the Min proteins, and their binding/unbinding from the cell membrane. The system possesses an instability that spontaneously generates the Min oscillations, which control accurate placement of the midcell division site. I will then discuss the role of fluctuations in protein dynamics, and investigate whether fluctuations set optimal protein concentration levels. Finally I will examine cell division in a different bacteria, B. subtilis. where different physical principles are used to regulate accurate cell division. See: Howard, Rutenberg, de Vet: Dynamic compartmentalization of bacteria: accurate division in E. coli. Phys. Rev. Lett. 87 278102 (2001). Howard, Rutenberg: Pattern formation inside bacteria: fluctuations due to the low copy number of proteins. Phys. Rev. Lett. 90 128102 (2003). Howard: A mechanism for polar protein localization in bacteria. J. Mol. Biol. 335 655-663 (2004).

  5. Pneumonia and bacteremia caused by a previously undescribed Moraxella-like bacterium.

    PubMed Central

    Goetz, M B; Jones, J

    1982-01-01

    Immunocompromised patients are frequently subject to unusual infections. We recently treated a renal allograft recipient for pneumonia due to a hitherto undescribed Moraxella-like bacterium which most closely resembles M-5. M-5 has previously been associated in humans only with dog bites and wound infections. The patient responded well to treatment with aminoglycosides and cephalosporins. Susceptibility to these drugs was demonstrated in vitro by a broth dilution technique. On the basis of the known ability of Moraxella species to colonize the oropharynx and the patient's lack of animal exposure, we propose that our patient's illness was secondary to aspiration of colonized oropharyngeal contents. Images PMID:7040467

  6. A bacterium that can grow by using arsenic instead of phosphorus

    USGS Publications Warehouse

    Wolfe-Simon, Felisa; Blum, J.S.; Kulp, T.R.; Gordon, G.W.; Hoeft, S.E.; Pett-Ridge, J.; Stolz, J.F.; Webb, S.M.; Weber, P.K.; Davies, P.C.W.; Anbar, A.D.; Oremland, R.S.

    2011-01-01

    Life is mostly composed of the elements carbon, hydrogen, nitrogen, oxygen, sulfur, and phosphorus. Although these six elements make up nucleic acids, proteins, and lipids and thus the bulk of living matter, it is theoretically possible that some other elements in the periodic table could serve the same functions. Here, we describe a bacterium, strain GFAJ-1 of the Halomonadaceae, isolated from Mono Lake, California, that is able to substitute arsenic for phosphorus to sustain its growth. Our data show evidence for arsenate in macromolecules that normally contain phosphate, most notably nucleic acids and proteins. Exchange of one of the major bio-elements may have profound evolutionary and geochemical importance.

  7. Aggregation of the rhizospheric bacterium Azospirillum brasilense in response to oxygen

    NASA Astrophysics Data System (ADS)

    Abdoun, Hamid; McMillan, Mary; Pereg, Lily

    2016-04-01

    Azospirillum brasilense spp. have ecological, scientific and agricultural importance. As model plant growth promoting rhizobacteria they interact with a large variety of plants, including important food and cash crops. Azospirillum strains are known for their production of plant growth hormones that enhance root systems and for their ability to fix nitrogen. Azospirillum cells transform in response to environmental cues. The production of exopolysaccharides and cell aggregation during cellular transformation are important steps in the attachment of Azospirillum to roots. We investigate signals that induce cellular transformation and aggregation in the Azospirillum and report on the importance of oxygen to the process of aggregation in this rhizospheric bacterium.

  8. First report of a cross-kingdom pathogenic bacterium, Achromobacter xylosoxidans isolated from stipe-rot Coprinus comatus.

    PubMed

    Ye, Luona; Guo, Mengpei; Ren, Pengfei; Wang, Gangzheng; Bian, Yinbing; Xiao, Yang; Zhou, Yan

    2018-03-01

    Coprinus comatus is an edible mushroom widely cultivated in China as a delicious food. Various diseases have occurred on C. comatus with the cultivated area increasing. In this study, the pathogenic bacterium JTG-B1, identified as Achromobacter xylosoxidans by 16S rDNA and nrdA gene sequencing, was isolated from edible mushroom Coprinus comatus with serious rot disease on its stipe. A. xylosoxidans has been confirmed as an important opportunistic human pathogenic bacterium and has been isolated from respiratory samples from cystic fibrosis. It is widely distributed in the environment. Here, we first report that fungi can also serve as a host for A. xylosoxidans. We confirmed that it can cross-kingdom infect between animals (mice) and fungi (C. comatus). The results of pathogenicity tests, physiological, biochemical and genotyping analysis of A. xylosoxidans from different hosts suggested that different strain of A. xylosoxidans may have pathogenicity differentiation. A. xylosoxidans not only is pathogenic to C. comatus but also may threaten human health. Copyright © 2017 Elsevier GmbH. All rights reserved.

  9. A bacterium that degrades and assimilates poly(ethylene terephthalate).

    PubMed

    Yoshida, Shosuke; Hiraga, Kazumi; Takehana, Toshihiko; Taniguchi, Ikuo; Yamaji, Hironao; Maeda, Yasuhito; Toyohara, Kiyotsuna; Miyamoto, Kenji; Kimura, Yoshiharu; Oda, Kohei

    2016-03-11

    Poly(ethylene terephthalate) (PET) is used extensively worldwide in plastic products, and its accumulation in the environment has become a global concern. Because the ability to enzymatically degrade PET has been thought to be limited to a few fungal species, biodegradation is not yet a viable remediation or recycling strategy. By screening natural microbial communities exposed to PET in the environment, we isolated a novel bacterium, Ideonella sakaiensis 201-F6, that is able to use PET as its major energy and carbon source. When grown on PET, this strain produces two enzymes capable of hydrolyzing PET and the reaction intermediate, mono(2-hydroxyethyl) terephthalic acid. Both enzymes are required to enzymatically convert PET efficiently into its two environmentally benign monomers, terephthalic acid and ethylene glycol. Copyright © 2016, American Association for the Advancement of Science.

  10. Production of a Pyrrole Antibiotic by a Marine Bacterium1

    PubMed Central

    Burkholder, Paul R.; Pfister, Robert M.; Leitz, Frederick H.

    1966-01-01

    Evidence is presented for the isolation and identification of bacteria able to synthesize an unusual antibiotic containing five bromine atoms per molecule. The identification and taxonomic position of these bacteria was made by use of a computer in conjunction with traditional methods. These microorganisms and closely related strains have been isolated on various occasions from tropical water in the vicinity of Puerto Rico. One bacterium, a pseudomonad, has been given the name Pseudomonas bromoutilis because of its distinctive capability. The antibiotic has been extracted, purified, and obtained in crystal form, and its structure has been determined. Although clinical tests of its properties were not encouraging, it may be of significant value and interest from an ecological standpoint. Images Fig. 1 PMID:4380876

  11. Draft Genome Sequence of Limnobacter sp. Strain CACIAM 66H1, a Heterotrophic Bacterium Associated with Cyanobacteria

    PubMed Central

    da Silva, Fábio Daniel Florêncio; Lima, Alex Ranieri Jerônimo; Moraes, Pablo Henrique Gonçalves; Siqueira, Andrei Santos; Dall’Agnol, Leonardo Teixeira; Baraúna, Anna Rafaella Ferreira; Martins, Luisa Carício; Oliveira, Karol Guimarães; de Lima, Clayton Pereira Silva; Nunes, Márcio Roberto Teixeira; Vianez-Júnior, João Lídio Silva Gonçalves

    2016-01-01

    Ecological interactions between cyanobacteria and heterotrophic prokaryotes are poorly known. To improve the genomic studies of heterotrophic bacterium-cyanobacterium associations, the draft genome sequence (3.2 Mbp) of Limnobacter sp. strain CACIAM 66H1, found in a nonaxenic culture of Synechococcus sp. (cyanobacteria), is presented here. PMID:27198027

  12. Over a Decade of recA and tly Gene Sequence Typing of the Skin Bacterium Propionibacterium acnes: What Have We Learnt?

    PubMed Central

    2017-01-01

    The Gram-positive, anaerobic bacterium Propionibacterium acnes forms part of the normal microbiota on human skin and mucosal surfaces. While normally associated with skin health, P. acnes is also an opportunistic pathogen linked with a range of human infections and clinical conditions. Over the last decade, our knowledge of the intraspecies phylogenetics and taxonomy of this bacterium has increased tremendously due to the introduction of DNA typing schemes based on single and multiple gene loci, as well as whole genomes. Furthermore, this work has led to the identification of specific lineages associated with skin health and human disease. In this review we will look back at the introduction of DNA sequence typing of P. acnes based on recA and tly loci, and then describe how these methods provided a basic understanding of the population genetic structure of the bacterium, and even helped characterize the grapevine-associated lineage of P. acnes, known as P. acnes type Zappe, which appears to have undergone a host switch from humans-to-plants. Particular limitations of recA and tly sequence typing will also be presented, as well as a detailed discussion of more recent, higher resolution, DNA-based methods to type P. acnes and investigate its evolutionary history in greater detail. PMID:29267255

  13. Ability of a haloalkaliphilic bacterium isolated from Soap Lake, Washington to generate electricity at pH 11.0 and 7% salinity.

    PubMed

    Paul, Varun G; Minteer, Shelley D; Treu, Becky L; Mormile, Melanie R

    2014-01-01

    A variety of anaerobic bacteria have been shown to transfer electrons obtained from organic compound oxidation to the surface of electrodes in microbial fuel cells (MFCs) to produce current. Initial enrichments for iron (III) reducing bacteria were set up with sediments from the haloalkaline environment of Soap Lake, Washington, in batch cultures and subsequent transfers resulted in a culture that grew optimally at 7.0% salinity and pH 11.0. The culture was used to inoculate the anode chamber of a MFC with formate as the electron source. Current densities up to 12.5 mA/m2 were achieved by this bacterium. Cyclic voltammetry experiments demonstrated that an electron mediator, methylene blue, was required to transfer electrons to the anode. Scanning electron microscopic imaging of the electrode surface did not reveal heavy colonization of bacteria, providing evidence that the bacterium may be using an indirect mode of electron transfer to generate current. Molecular characterization of the 16S rRNA gene and restriction fragment length profiles (RFLP) analysis showed that the MFC enriched for a single bacterial species with a 99% similarity to the 16S rRNA gene of Halanaerobium hydrogeniformans. Though modest, electricity production was achieved by a haloalkaliphilic bacterium at pH 11.0 and 7.0% salinity.

  14. Production of dihydrodaidzein and dihydrogenistein by a novel oxygen-tolerant bovine rumen bacterium in the presence of atmospheric oxygen.

    PubMed

    Zhao, Hui; Wang, Xiu-Ling; Zhang, Hong-Lei; Li, Chao-Dong; Wang, Shi-Ying

    2011-11-01

    The original bovine rumen bacterial strain Niu-O16, capable of anaerobically bioconverting isoflavones daidzein and genistein to dihydrodaidzein (DHD) and dihydrogenistein (DHG), respectively, is a rod-shaped obligate anaerobic bacterium. After a long-term domestication, an oxygen-tolerant bacterium, which we named Aeroto-Niu-O16 was obtained. Strain Aeroto-Niu-O16, which can grow in the presence of atmospheric oxygen, differed from the original obligate anaerobic bacterium Niu-O16 by various characteristics, including a change in bacterial shape (from rod to filament), in biochemical traits (from indole negative to indole positive and from amylohydrolysis positive to negative), and point mutations in 16S rRNA gene (G398A and G438A). We found that strain Aeroto-Niu-O16 not only grew aerobically but also converted isoflavones daidzein and genistein to DHD and DHG in the presence of atmospheric oxygen. The bioconversion rate of daidzein and genistein by strain Aeroto-Niu-O16 was 60.3% and 74.1%, respectively. And the maximum bioconversion capacity for daidzein was 1.2 and 1.6 mM for genistein. Furthermore, when we added ascorbic acid (0.15%, m/v) in the cultural medium, the bioconversion rate of daidzein was increased from 60.3% to 71.7%, and that of genistein from 74.1% to 89.2%. This is the first reported oxygen-tolerant isoflavone biotransforming pure culture capable of both growing and executing the reductive activity under aerobic conditions. © Springer-Verlag 2011

  15. Responses of the terrestrial ammonia-oxidizing archaeon Ca. Nitrososphaera viennensis and the ammonia-oxidizing bacterium Nitrosospira multiformis to nitrification inhibitors.

    PubMed

    Shen, Tianlin; Stieglmeier, Michaela; Dai, Jiulan; Urich, Tim; Schleper, Christa

    2013-07-01

    Nitrification inhibitors have been used for decades to improve nitrogen fertilizer utilization in farmland. However, their effect on ammonia-oxidizing Archaea (AOA) in soil is little explored. Here, we compared the impact of diverse inhibitors on nitrification activity of the soil archaeon Ca. Nitrososphaera viennensis EN76 and compared it to that of the ammonia-oxidizing bacterium (AOB) Nitrosospira multiformis. Allylthiourea, amidinothiourea, and dicyandiamide (DCD) inhibited ammonia oxidation in cultures of both N. multiformis and N. viennensis, but the effect on N. viennensis was markedly lower. In particular, the effective concentration 50 (EC50) of allylthiourea was 1000 times higher for the AOA culture. Among the tested nitrification inhibitors, DCD was the least potent against N. viennensis. Nitrapyrin had at the maximal soluble concentration only a very weak inhibitory effect on the AOB N. multiformis, but showed a moderate effect on the AOA. The antibiotic sulfathiazole inhibited the bacterium, but barely affected the archaeon. Only the NO-scavenger carboxy-PTIO had a strong inhibitory effect on the archaeon, but had little effect on the bacterium in the concentrations tested. Our results reflect the fundamental metabolic and cellular differences of AOA and AOB and will be useful for future applications of inhibitors aimed at distinguishing activities of AOA and AOB in soil environments. © 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

  16. Effect of Tannic Acid on the Transcriptome of the Soil Bacterium Pseudomonas protegens Pf-5

    PubMed Central

    Lim, Chee Kent; Penesyan, Anahit; Hassan, Karl A.

    2013-01-01

    Tannins are a diverse group of plant-produced, polyphenolic compounds with metal-chelating and antimicrobial properties that are prevalent in many soils. Using transcriptomics, we determined that tannic acid, a form of hydrolysable tannin, broadly affects the expression of genes involved in iron and zinc homeostases, sulfur metabolism, biofilm formation, motility, and secondary metabolite biosynthesis in the soil- and rhizosphere-inhabiting bacterium Pseudomonas protegens Pf-5. PMID:23435890

  17. Complete genome sequence of Klebsiella pneumoniae J1, a protein-based microbial flocculant-producing bacterium.

    PubMed

    Pang, Changlong; Li, Ang; Cui, Di; Yang, Jixian; Ma, Fang; Guo, Haijuan

    2016-02-20

    Klebsiella pneumoniae J1 is a Gram-negative strain, which belongs to a protein-based microbial flocculant-producing bacterium. However, little genetic information is known about this species. Here we carried out a whole-genome sequence analysis of this strain and report the complete genome sequence of this organism and its genetic basis for carbohydrate metabolism, capsule biosynthesis and transport system. Copyright © 2016 Elsevier B.V. All rights reserved.

  18. A bacterium that can grow by using arsenic instead of phosphorus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wolfe-Simon, F; Blum, J S; Kulp, T R

    Life is mostly composed of the elements carbon, hydrogen, nitrogen, oxygen, sulfur and phosphorus. Although these six elements make up nucleic acids, proteins and lipids and thus the bulk of living matter, it is theoretically possible that some other elements in the periodic table could serve the same functions. Here we describe a bacterium, strain GFAJ-1 of the Halomonadaceae, isolated from Mono Lake, CA, which substitutes arsenic for phosphorus to sustain its growth. Our data show evidence for arsenate in macromolecules that normally contain phosphate, most notably nucleic acids and proteins. Exchange of one of the major bio-elements may havemore » profound evolutionary and geochemical significance.« less

  19. A hyperactive, Ca2+-dependent antifreeze protein in an Antarctic bacterium.

    PubMed

    Gilbert, Jack A; Davies, Peter L; Laybourn-Parry, Johanna

    2005-04-01

    In cold climates, some plants and bacteria that cannot avoid freezing use antifreeze proteins (AFPs) to lessen the destructive effects of ice recrystallization. These AFPs have weak freezing point depression activity, perhaps to avoid sudden, uncontrolled growth of ice. Here, we report on an uncharacteristically powerful bacterial AFP found in an Antarctic strain of the bacterium, Marinomonas primoryensis. It is Ca(2+)-dependent, shows evidence of cooperativity, and can produce over 2 degrees C of freezing point depression. Unlike most AFPs, it does not produce obvious crystal faceting during thermal hysteresis. This AFP might be capable of imparting freezing avoidance to M. primoryensis in ice-covered Antarctic lakes. A hyperactive bacterial AFP has not previously been reported.

  20. Draft Genome Sequence of Aquitalea magnusonii Strain H3, a Plant Growth-Promoting Bacterium of Duckweed (Lemna minor)

    PubMed Central

    Ishizawa, Hidehiro; Kuroda, Masashi

    2017-01-01

    ABSTRACT Aquitalea magnusonii strain H3 is a promising plant growth-promoting bacterium for duckweed. Here, we report the draft genome sequence of strain H3 comprising 4,750,601 bp in 73 contigs. Several genes associated with plant root colonization were identified. PMID:28818906

  1. Genome Sequence of Pseudomonas sp. Strain S9, an Extracellular Arylsulfatase-Producing Bacterium Isolated from Mangrove Soil ▿

    PubMed Central

    Long, Mengxian; Ruan, Lingwei; Yu, Ziniu; Xu, Xun

    2011-01-01

    Pseudomonas sp. strain S9 was originally isolated from mangrove soil in Xiamen, China. It is an aerobic bacterium which shows extracellular arylsulfatase activity. Here, we describe the 4.8-Mb draft genome sequence of Pseudomonas sp. S9, which exhibits novel cysteine-type sulfatases. PMID:21622746

  2. Characterization and identification of a chlorine-resistant bacterium, Sphingomonas TS001, from a model drinking water distribution system.

    PubMed

    Sun, Wenjun; Liu, Wenjun; Cui, Lifeng; Zhang, Minglu; Wang, Bei

    2013-08-01

    This study describes the identification and characterization of a new chlorine resistant bacterium, Sphingomonas TS001, isolated from a model drinking water distribution system. The isolate was identified by 16s rRNA gene analysis and morphological and physiological characteristics. Phylogenetic analysis indicates that TS001 belongs to the genus Sphingomonas. The model distribution system HPC results showed that, when the chlorine residual was greater than 0.7 mg L(-1), 100% of detected heterotrophic bacteria (HPC) was TS001. The bench-scale inactivation efficiency testing showed that this strain was very resistant to chlorine, and 4 mg L(-1) of chlorine with 240 min retention time provided only approximately 5% viability reduction of TS001. In contrast, a 3-log inactivation (99.9%) was obtained for UV fluencies of 40 mJ cm(-2). A high chlorine-resistant and UV sensitive bacterium, Sphingomonas TS001, was documented for the first time. Copyright © 2013 Elsevier B.V. All rights reserved.

  3. Study on human intestinal bacterium Blautia sp. AUH-JLD56 for the conversion of arctigenin to (-)-3'-desmethylarctigenin.

    PubMed

    Liu, Ming-Yue; Li, Meng; Wang, Xiu-Ling; Liu, Peng; Hao, Qing-Hong; Yu, Xiu-Mei

    2013-12-11

    Arctium lappa L. (A. lappa) is a popularly used vegetable as well as herbal medicine. Human intestinal microflora was reported to convert arctiin, the lignan compound with highest content in the dried fruits of Arctium lappa, to a series of metabolites. However, the specific bacterium responsible for the formation of 3'-desmethylarctigenin (3'-DMAG), the most predominant metabolite of arctiin by rat or human intestinal microflora, has not been isolated yet. In the present study, we isolated one single bacterium, which we named Blautia sp. AUH-JLD56, capable of solely biotransforming arctiin or arctigenin to (-)-3'-DMAG. The structure of the metabolite 3'-DMAG was elucidated by electrospray ionization mass spectrometry (ESI-MS) and (1)H and (13)C nuclear magnetic resonance spectroscopy. The biotransforming kinetics and maximum biotransforming capacity of strain AUH-JLD56 was investigated. In addition, the metabolite 3'-DMAG showed significantly higher 1,1-diphenyl-2-picrylhydrazyl (DPPH) radical-scavenging activity than that of the substrate arctigenin at the concentrations tested.

  4. Novel oxidized derivatives of antifungal pyrrolnitrin from the bacterium Burkholderia cepacia K87.

    PubMed

    Sultan, Zakir; Park, Kyungseok; Lee, Sang Yeob; Park, Jung Kon; Varughese, Titto; Moon, Surk-Sik

    2008-07-01

    The screening of antifungal active compounds from the fermentation extracts of soil-borne bacterium Burkholderia cepacia K87 afforded pyrrolnitrin (1) and two new pyrrolnitrin analogs, 3-chloro-4-(3-chloro-2-nitrophenyl)-5-methoxy-3-pyrrolin-2-one (2) and 4-chloro-3-(3-chloro-2-nitrophenyl)-5-methoxy-3-pyrrolin-2-one (3). Pyrrolnitrin showed strong antifungal activity against Rhizoctonia solani but the analogs (2 and 3) were found to be marginally active. The isolates, 2 and 3, are believed to be biodegraded derivatives of pyrrolnitrin.

  5. Complete genome sequence of the aerobically denitrifying thermophilic bacterium Chelatococcus daeguensis TAD1.

    PubMed

    Yang, Yunlong; Lin, Ershu; Huang, Shaobin

    Chelatococcus daeguensis TAD1 is a themophilic bacterium isolated from a biotrickling filter used to treat NOx in Ruiming Power Plant, located in Guangzhou, China, which shows an excellent aerobic denitrification activity at high temperature. The complete genome sequence of this strain was reported in the present study. Genes related to the aerobic denitrification were identified through whole genome analysis. This work will facilitate the mechanism of aerobic denitrification and provide evidence for its potential application in the nitrogen removal. Copyright © 2017 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

  6. Co-infections and transmission dynamics in a tick-borne bacterium community exposed to songbirds.

    PubMed

    Heylen, Dieter; Fonville, Manoj; van Leeuwen, Arieke Docters; Sprong, Hein

    2016-03-01

    We investigated the transmission dynamics of a community of tick-borne pathogenic bacteria in a common European songbird (Parus major). Tick-naïve birds were infested with three successive batches (spaced 5 days apart) of field-collected Ixodes ricinus nymphs, carrying the following tick-borne bacteria: Rickettsia helvetica (16.9%), Borrelia garinii (1.9%), Borrelia miyamotoi (1.6%), Anaplasma phagocytophilum (1.2%) and Candidatus Neoehrlichia mikurensis (0.4%). Fed ticks were screened for the pathogens after moulting to the next developmental phase. We found evidence for early transmission (within 2.75 days after exposure) of R. helvetica and B. garinii, and to a lesser extent of A. phagocytophilum based on the increased infection rates of ticks during the first infestation. The proportion of ticks infected with R. helvetica remained constant over the three infestations. In contrast, the infection rate of B. garinii in the ticks increased over the three infestations, indicating a more gradual development of host tissue infection. No interactions were found among the different bacterium species during transmission. Birds did not transmit or amplify the other bacterial species. We show that individual birds can transmit several pathogenic bacterium species at the same time using different mechanisms, and that the transmission facilitation by birds increases the frequency of co-infections in ticks. © 2015 Society for Applied Microbiology and John Wiley & Sons Ltd.

  7. Engineering cellulolytic bacterium Clostridium thermocellum to co-ferment cellulose- and hemicellulose-derived sugars simultaneously.

    PubMed

    Xiong, Wei; Reyes, Luis H; Michener, William E; Maness, Pin-Ching; Chou, Katherine J

    2018-03-15

    Cellulose and hemicellulose are the most abundant components in plant biomass. A preferred Consolidated Bioprocessing (CBP) system is one which can directly convert both cellulose and hemicellulose into target products without adding the costly hydrolytic enzyme cocktail. In this work, the thermophilic, cellulolytic, and anaerobic bacterium, Clostridium thermocellum DSM 1313, was engineered to grow on xylose in addition to cellulose. Both xylA (encoding for xylose isomerase) and xylB (encoding for xylulokinase) genes from the thermophilic anaerobic bacterium Thermoanaerobacter ethanolicus were introduced to enable xylose utilization while still retaining its inherent ability to grow on 6-carbon substrates. Targeted integration of xylAB into C. thermocellum genome realized simultaneous fermentation of xylose with glucose, with cellobiose (glucose dimer), and with cellulose, respectively, without carbon catabolite repression. We also showed that the respective H 2 and ethanol production were twice as much when both xylose and cellulose were consumed simultaneously than when consuming cellulose alone. Moreover, the engineered xylose consumer can also utilize xylo-oligomers (with degree of polymerization of 2-7) in the presence of xylose. Isotopic tracer studies also revealed that the engineered xylose catabolism contributed to the production of ethanol from xylan which is a model hemicellulose in mixed sugar fermentation, demonstrating immense potential of this enhanced CBP strain in co-utilizing both cellulose and hemicellulose for the production of fuels and chemicals. © 2018 Wiley Periodicals, Inc.

  8. Draft Genome Sequence of Limnobacter sp. Strain CACIAM 66H1, a Heterotrophic Bacterium Associated with Cyanobacteria.

    PubMed

    da Silva, Fábio Daniel Florêncio; Lima, Alex Ranieri Jerônimo; Moraes, Pablo Henrique Gonçalves; Siqueira, Andrei Santos; Dall'Agnol, Leonardo Teixeira; Baraúna, Anna Rafaella Ferreira; Martins, Luisa Carício; Oliveira, Karol Guimarães; de Lima, Clayton Pereira Silva; Nunes, Márcio Roberto Teixeira; Vianez-Júnior, João Lídio Silva Gonçalves; Gonçalves, Evonnildo Costa

    2016-05-19

    Ecological interactions between cyanobacteria and heterotrophic prokaryotes are poorly known. To improve the genomic studies of heterotrophic bacterium-cyanobacterium associations, the draft genome sequence (3.2 Mbp) of Limnobacter sp. strain CACIAM 66H1, found in a nonaxenic culture of Synechococcus sp. (cyanobacteria), is presented here. Copyright © 2016 da Silva et al.

  9. Phenotypic and genotypic properties of Microbacterium yannicii, a recently described multidrug resistant bacterium isolated from a lung transplanted patient with cystic fibrosis in France.

    PubMed

    Sharma, Poonam; Diene, Seydina M; Thibeaut, Sandrine; Bittar, Fadi; Roux, Véronique; Gomez, Carine; Reynaud-Gaubert, Martine; Rolain, Jean-Marc

    2013-05-03

    Cystic fibrosis (CF) lung microbiota consists of diverse species which are pathogens or opportunists or have unknown pathogenicity. Here we report the full characterization of a recently described multidrug resistant bacterium, Microbacterium yannicii, isolated from a CF patient who previously underwent lung transplantation. Our strain PS01 (CSUR-P191) is an aerobic, rod shaped, non-motile, yellow pigmented, gram positive, oxidase negative and catalase positive bacterial isolate. Full length 16S rRNA gene sequence showed 98.8% similarity with Microbacterium yannicii G72T type strain, which was previously isolated from Arabidopsis thaliana. The genome size is 3.95Mb, with an average G+C content of 69.5%. In silico DNA-DNA hybridization analysis between our Microbacterium yannicii PS01isolate in comparison with Microbacterium testaceum StLB037 and Microbacterium laevaniformans OR221 genomes revealed very weak relationship with only 28% and 25% genome coverage, respectively. Our strain, as compared to the type strain, was resistant to erythromycin because of the presence of a new erm 43 gene encoding a 23S rRNA N-6-methyltransferase in its genome which was not detected in the reference strain. Interestingly, our patient received azithromycin 250 mg daily for bronchiolitis obliterans syndrome for more than one year before the isolation of this bacterium. Although significance of isolating this bacterium remains uncertain in terms of clinical evolution, this bacterium could be considered as an opportunistic human pathogen as previously reported for other species in this genus, especially in immunocompromised patients.

  10. Isolation, identification, and algicidal activity of aerobic denitrifying bacterium R11 and its effect on Microcystis aeruginosa.

    PubMed

    Su, Jun-feng; Shao, Si-cheng; Huang, Ting-lin; Ma, Fang; Zhang, Kai; Wen, Gang; Zheng, Sheng-chen

    2016-01-01

    Recently, algicidal bacteria have attracted attention as possible agents for the inhibition of algal water blooms. In this study, an aerobic denitrifying bacterium, R11, with high algicidal activity against the toxic Microcystis aeruginosa was isolated from lake sediments. Based on its physiological characteristics and 16S rRNA gene sequence, it was identified as Raoultella, indicating that the bacterium R11 has a good denitrifying ability at 30 °C and can reduce the concentration of nitrate-N completely within 36 h. Additionally, different algicidal characteristics against Microcystis aeruginosa were tested. The results showed that the initial bacterial cell density and algal cell densities strongly influence the removal rates of chlorophyll a. Algicidal activity increased with an increase in the bacterial cell density. With densities of bacterial culture at over 2.4 × 10(5) cell/mL, algicidal activity of up to 80% was obtained in 4 days. We have demonstrated that, with the low initial algal cell density (OD680 less than 0.220), the algicidal activity reached was higher than 90% after 6 days.

  11. The Effect of Er:YAG Laser on Entroccocus faecalis Bacterium in the Pulpectomy of Anterior Primary Teeth

    PubMed Central

    Bahrololoomi, Zahra; Poursina, Farkhondeh; Birang, Reza; Foroughi, Elnaz; Yousefshahi, Hazhir

    2017-01-01

    Introduction: Successful root canal therapy depends on the complete elimination of microorganisms such as Entroccocus faecalis, which is impossible to achieve with the traditional methods. Lasers are recently introduced as a new method to solve the problem. The present study is planned and performed to examining the antibacterial effect of Er: YAG laser. Methods: Sixty extracted anterior primary teeth were prepared and sterilized. E. faecalis bacterium was cultured in canals. Samples were randomly divided into two groups. The first group was disinfected by NaOCl 5/25% and Er: YAG laser and the second group just by NaOCl 5/25%. Samples of canal contents were cultured and colony counts were calculated. The results were analyzed statistically by SPSS software and Mann Whitney test. Results: There was no significant difference between colony counts in both groups (P=0.142). But the number of colonies in the first group was lower than in the second group. Conclusion: Although, Er: YAG laser cannot completely eliminate E. faecalis bacterium, its simultaneous use with NaOCl decreases E. faecalis. PMID:29071021

  12. The Effect of Er:YAG Laser on Entroccocus faecalis Bacterium in the Pulpectomy of Anterior Primary Teeth.

    PubMed

    Bahrololoomi, Zahra; Poursina, Farkhondeh; Birang, Reza; Foroughi, Elnaz; Yousefshahi, Hazhir

    2017-01-01

    Introduction: Successful root canal therapy depends on the complete elimination of microorganisms such as Entroccocus faecalis , which is impossible to achieve with the traditional methods. Lasers are recently introduced as a new method to solve the problem. The present study is planned and performed to examining the antibacterial effect of Er: YAG laser. Methods: Sixty extracted anterior primary teeth were prepared and sterilized. E. faecalis bacterium was cultured in canals. Samples were randomly divided into two groups. The first group was disinfected by NaOCl 5/25% and Er: YAG laser and the second group just by NaOCl 5/25%. Samples of canal contents were cultured and colony counts were calculated. The results were analyzed statistically by SPSS software and Mann Whitney test. Results: There was no significant difference between colony counts in both groups ( P =0.142). But the number of colonies in the first group was lower than in the second group. Conclusion: Although, Er: YAG laser cannot completely eliminate E. faecalis bacterium, its simultaneous use with NaOCl decreases E. faecalis .

  13. Differential gene expression in Xylella fastidiosa 9a5c during co-cultivation with the endophytic bacterium Methylobacterium mesophilicum SR1.6/6.

    PubMed

    Dourado, Manuella Nóbrega; Santos, Daiene Souza; Nunes, Luiz Roberto; Costa de Oliveira, Regina Lúcia Batista da; de Oliveira, Marcus Vinicius; Araújo, Welington Luiz

    2015-12-01

    Xylella fastidiosa, the causal agent of citrus variegated chlorosis (CVC), colonizes plant xylem, reducing sap flow, and inducing internerval chlorosis, leaf size reduction, necrosis, and harder and smaller fruits. This bacterium may be transmitted from plant to plant by sharpshooter insects, including Bucephalogonia xanthopis. The citrus endophytic bacterium Methylobacterium mesophilicum SR1.6/6 colonizes citrus xylem and previous studies showed that this strain is also transferred from plant to plant by B. xanthopis (Insecta), suggesting that this endophytic bacterium may interact with X. fastidiosa in planta and inside the insect vector during co-transmission by the same insect vector. To better understand the X. fastidiosa behavior in the presence of M. mesophilicum, we evaluated the X. fastidiosa transcriptional profile during in vitro interaction with M. mesophilicum SR1.6/6. The results showed that during co-cultivation, X. fastidiosa down-regulated genes related to growth and up-regulated genes related to energy production, stress, transport, and motility, suggesting the existence of a specific adaptive response to the presence of M. mesophilicum in the culture medium. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Adopt a Bacterium - an active and collaborative learning experience in microbiology based on social media.

    PubMed

    Piantola, Marco Aurélio Floriano; Moreno, Ana Carolina Ramos; Matielo, Heloísa Alonso; Taschner, Natalia Pasternak; Cavalcante, Rafael Ciro Marques; Khan, Samia; Ferreira, Rita de Cássia Café

    2018-04-24

    The "Adopt a Bacterium" project is based on the use of social network as a tool in Microbiology undergraduate education, improving student learning and encouraging students to participate in collaborative learning. The approach involves active participation of both students and teachers, emphasizing knowledge exchange, based on widely used social media. Students were organized in groups and asked to adopt a specific bacterial genus and, subsequently, submit posts about "adopted genus". The formative assessment is based on posting information on Facebook®, and the summative assessment involves presentation of seminars about the adopted theme. To evaluate the project, students filled out three anonymous and voluntary surveys. Most of the students enjoyed the activities and positively evaluated the experience. A large amount of students declared a change in their attitude towards the way they processed information, especially regarding the use of scientific sources. Finally, we evaluated knowledge retention six months after the end of the course and students were able to recall relevant Microbiology concepts. Our results suggest that the "Adopt a Bacterium" project represents a useful strategy in Microbiology learning and may be applied to other academic fields. Copyright © 2018 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

  15. Characterization of Acrylamidase isolated from a newly isolated acrylamide-utilizing bacterium, Ralstonia eutropha AUM-01.

    PubMed

    Cha, Minseok; Chambliss, Glenn H

    2011-02-01

    A mesophilic bacterium capable of utilizing acrylamide was isolated, AUM-01, from soil collected from leaf litter at Picnic Point on the UW-Madison campus. In minimal medium with acrylamide as the sole carbon and nitrogen source, a batch culture of AUM-01 completely converted 28.0 mM acrylamide to acrylic acid in 8 h and reached a cell density of 0.3 (A₆₀₀)). Afterward all the acrylic acid was degraded by 20 h with the cell density increasing to 1.9 (A₆₀₀). The acrylamide-utilizing bacterium was identified as Ralstonia eutropha based on morphological observations, the BiOLOG GN2 MicroPlate™ identification system for Gram-negative bacteria, and additional physiological tests. An acrylamidase that hydrolyzes acrylamide to acrylic acid was purified from the strain AUM-01. The molecular weight of the enzyme from AUM-01 was determined to be 38 kDa by SDS-PAGE. The enzyme had pH and temperature optima of 6.3 and 55°C, and the influence of different metals and amino acids on the ability of the purified protein to transform acrylamide to acrylic acid was evaluated. The enzyme from AUM-01 was totally inhibited by ZnSO₄ and AgNO₃.

  16. Draft Genome Sequence of Aquitalea magnusonii Strain H3, a Plant Growth-Promoting Bacterium of Duckweed (Lemna minor).

    PubMed

    Ishizawa, Hidehiro; Kuroda, Masashi; Ike, Michihiko

    2017-08-17

    Aquitalea magnusonii strain H3 is a promising plant growth-promoting bacterium for duckweed. Here, we report the draft genome sequence of strain H3 comprising 4,750,601 bp in 73 contigs. Several genes associated with plant root colonization were identified. Copyright © 2017 Ishizawa et al.

  17. Loihichelins A-F, a Suite of Amphiphilic Siderophores Produced by the Marine Bacterium Halomonas LOB-5

    PubMed Central

    Homann, Vanessa V; Sandy, Moriah; Tincu, J. Andy; Templeton, Alexis S.; Tebo, Bradley M.; Butler, Alison

    2009-01-01

    A suite of amphiphilic siderophores, loihichelins A-F, were isolated from cultures of the marine bacterium Halomonas sp. LOB-5. This heterotrophic Mn(II)-oxidizing bacterium was recently isolated from the partially weathered surfaces of submarine glassy pillow basalts and associated hydrothermal flocs of iron oxides collected from the southern rift zone of Loihi Seamount east of Hawai’i. The loihichelins contain a hydrophilic head group consisting of an octapeptide comprised of D-threo-β-hydroxyaspartic acid, D-serine, L-glutamine, L-serine, L-N(δ)-acetyl-N(δ)-hydroxy ornithine, dehydroamino-2-butyric acid, D-serine and cyclic N(δ)-hydroxy-D-ornithine, appended by one of a series of fatty acids ranging from decanoic acid to tetradecanoic acid. The structure of loihichelin C was determined by a combination of amino acid and fatty acid analyses, tandem mass spectrometry and NMR spectroscopy. The structures of the other loihichelins were inferred from the amino acid and fatty acid analyses, and tandem mass spectrometry. The role of these siderophores in sequestering Fe(III) released during basaltic rock weathering, as well as their potential role in the promotion of Mn(II) and Fe(II) oxidation, is of considerable interest. PMID:19320498

  18. Influence of yeast and lactic acid bacterium on the constituent profile of soy sauce during fermentation.

    PubMed

    Harada, Risa; Yuzuki, Masanobu; Ito, Kotaro; Shiga, Kazuki; Bamba, Takeshi; Fukusaki, Eiichiro

    2017-02-01

    Soy sauce is a Japanese traditional seasoning composed of various constituents that are produced by various microbes during a long-term fermentation process. Due to the complexity of the process, the investigation of the constituent profile during fermentation is difficult. Metabolomics, the comprehensive study of low molecular weight compounds in biological samples, is thought to be a promising strategy for deep understanding of the constituent contribution to food flavor characteristics. Therefore, metabolomics is suitable for the analysis of soy sauce fermentation. Unfortunately, only few and unrefined studies of soy sauce fermentation using metabolomics approach have been reported. Therefore, we investigated changes in low molecular weight hydrophilic and volatile compounds of soy sauce using gas chromatography/mass spectrometry (GC/MS)-based non-targeted metabolic profiling. The data were analyzed by statistical analysis to evaluate influences of yeast and lactic acid bacterium on the constituent profile. Consequently, our results suggested a novel finding that lactic acid bacterium affected the production of several constituents such as cyclotene, furfural, furfuryl alcohol and methional in the soy sauce fermentation process. Copyright © 2016 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  19. Burkholderia vietnamiensis isolated from root tissues of Nipa Palm (Nypa fruticans) in Sarawak, Malaysia, proved to be its major endophytic nitrogen-fixing bacterium.

    PubMed

    Tang, Sui-Yan; Hara, Shintaro; Melling, Lulie; Goh, Kah-Joo; Hashidoko, Yasuyuki

    2010-01-01

    Root-associating bacteria of the nipa palm (Nypa fruticans), preferring brackish-water affected mud in Sarawak, Malaysia, were investigated. In a comparison of rhizobacterial microbiota between the nipa and the sago (Metroxylon sagu) palm, it was found that the nipa palm possessed a group of Burkholderia vietnamiensis as its main active nitrogen-fixing endophytic bacterium. Acetylene reduction by the various isolates of B. vietnamiensis was constant (44 to 68 nmol h(-1) in ethylene production rate) in soft gel medium containing 0.2% sucrose as sole carbon source, and the bacterium also showed motility and biofilm-forming capacity. This is the first report of endophytic nitrogen-fixing bacteria from nipa palm.

  20. Draft Genome Sequence of Acinetobacter calcoaceticus Strain GK1, a Hydrocarbon-Degrading Plant Growth-Promoting Rhizospheric Bacterium.

    PubMed

    Gkorezis, Panagiotis; Bottos, Eric M; Van Hamme, Jonathan D; Franzetti, Andrea; Abbamondi, Gennaro Roberto; Balseiro-Romero, Maria; Weyens, Nele; Rineau, Francois; Vangronsveld, Jaco

    2015-08-13

    The 3.94-Mb draft genome of Acinetobacter calcoaceticus GK1, a hydrocarbonoclastic plant growth-promoting Gram-negative rhizospheric bacterium, is presented here. Isolated at the Ford Motor Company site in Genk, Belgium, from poplar trees planted on a diesel-contaminated plume, GK1 is useful for enhancing hydrocarbon phytoremediation. Copyright © 2015 Gkorezis et al.

  1. Global Analysis of Protein Lysine Succinylation Profiles and Their Overlap with Lysine Acetylation in the Marine Bacterium Vibrio parahemolyticus.

    PubMed

    Pan, Jianyi; Chen, Ran; Li, Chuchu; Li, Weiyan; Ye, Zhicang

    2015-10-02

    Protein lysine acylation, including acetylation and succinylation, has been found to be a major post-translational modification (PTM) and is associated with the regulation of cellular processes that are widespread in bacteria. Vibrio parahemolyticus is a model marine bacterium that causes seafood-borne illness in humans worldwide. The lysine acetylation of V. parahemolyticus has been extensively characterized in our previous work, and here, we report the first global analysis of lysine succinylation and the overlap between the two types of acylation in this bacterium. Using high-accuracy nano liquid chromatography-tandem mass spectrometry combined with affinity purification, we identified 1931 lysine succinylated peptides matched on 642 proteins, with the quantity of the succinyl-proteins accounting for 13.3% of the total proteins in cells. Bioinformatics analysis results showed that these succinylated proteins are involved in almost every cellular process, particularly in protein biosynthesis and metabolism, and are distributed in diverse subcellular compartments. Moreover, several sequence motifs were identified, including succinyl-lysine flanked by a lysine or arginine residue at the -8, -7, or +7 position and without these residues at the -1 or +2 position, and these motifs differ from those found in other bacteria and eukaryotic cells. Furthermore, a total of 517 succinyl-lysine sites (26.7%) on 288 proteins (44.9%) were also found to be acetylated, suggesting extensive overlap between succinylation and acetylation in this bacterium. This systematic analysis provides a promising starting point for further investigations of the physiologic and pathogenic roles of lysine succinylation and acetylation in V. parahemolyticus.

  2. Complete genome sequence of Agarivorans gilvus WH0801(T), an agarase-producing bacterium isolated from seaweed.

    PubMed

    Zhang, Pujuan; Rui, Junpeng; Du, Zongjun; Xue, Changhu; Li, Xiangzhen; Mao, Xiangzhao

    2016-02-10

    Agarivorans gilvus WH0801(T), an agarase-producing bacterium, was isolated from the surface of seaweed. Here, we present the complete genome sequence, which consists of one circular chromosome of 4,416,600 bp with a GC content of 45.9%. This genetic information will provide insight into biotechnological applications of producing agar for food and industry. Copyright © 2015 Elsevier B.V. All rights reserved.

  3. A microsensor for the detection of a single pathogenic bacterium using magnetotactic bacteria-based bio-carriers: simulations and preliminary experiments.

    PubMed

    Denomme, Ryan C; Lu, Zhao; Martel, Sylvain

    2007-01-01

    The proposed Magnetotactic Bacteria (MTB) based bio-carrier has the potential to greatly improve pathogenic bacteria detection time, specificity, and sensitivity. Microbeads are attached to the MTB and are modified with a coating of an antibody or phage that is specific to the target pathogenic bacteria. Using magnetic fields, the modified MTB are swept through a solution and the target bacteria present become attached to the microbeads (due to the coating). Then, the MTB are brought to the detection region and the number of pathogenic bacteria is determined. The high swimming speed and controllability of the MTB make this method ideal for the fast detection of small concentrations of specific bacteria. This paper focuses on an impedimetric detection system that will be used to identify if a target bacterium is attached to the microbead. The proposed detection system measures changes in electrical impedance as objects (MTB, microbeads, and pathogenic bacteria) pass through a set of microelectrodes embedded in a microfluidic device. FEM simulation is used to acquire the optimized parameters for the design of such a system. Specifically, factors such as electrode/detection channel geometry, object size and position, which have direct effects on the detection sensitivity for a single bacterium or microparticle, are investigated. Polymer microbeads and the MTB system with an E. coli bacterium are considered to investigate their impedance variations. Furthermore, preliminary experimental data using a microfabricated microfluidic device connected to an impedance analyzer are presented.

  4. Complete Genome Sequence of Nitrosomonas cryotolerans ATCC 49181, a Phylogenetically Distinct Ammonia-Oxidizing Bacterium Isolated from Arctic Waters

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rice, Marlen C.; Norton, Jeanette M.; Stein, Lisa Y.

    ABSTRACT Nitrosomonas cryotoleransATCC 49181 is a cold-tolerant marine ammonia-oxidizing bacterium isolated from seawater collected in the Gulf of Alaska. The high-quality complete genome contains a 2.87-Mbp chromosome and a 56.6-kbp plasmid. Chemolithoautotrophic modules encoding ammonia oxidation and CO 2 fixation were identified.

  5. Complete Genome Sequence of Nitrosomonas cryotolerans ATCC 49181, a Phylogenetically Distinct Ammonia-Oxidizing Bacterium Isolated from Arctic Waters

    DOE PAGES

    Rice, Marlen C.; Norton, Jeanette M.; Stein, Lisa Y.; ...

    2017-03-16

    ABSTRACT Nitrosomonas cryotoleransATCC 49181 is a cold-tolerant marine ammonia-oxidizing bacterium isolated from seawater collected in the Gulf of Alaska. The high-quality complete genome contains a 2.87-Mbp chromosome and a 56.6-kbp plasmid. Chemolithoautotrophic modules encoding ammonia oxidation and CO 2 fixation were identified.

  6. A marine bacterium, Micrococcus MCCB 104, antagonistic to vibrios in prawn larval rearing systems.

    PubMed

    Jayaprakash, N S; Pai, S Somnath; Anas, A; Preetha, R; Philip, Rosamma; Singh, I S Bright

    2005-12-30

    A marine bacterium, Micrococcus MCCB 104, isolated from hatchery water, demonstrated extracellular antagonistic properties against Vibrio alginolyticus, V. parahaemolyticus, V. vulnificus, V. fluviallis, V. nereis, V. proteolyticus, V. mediterranei, V cholerae and Aeromonas sp., bacteria associated with Macrobrachium rosenbergii larval rearing systems. The isolate inhibited the growth of V. alginolyticus during co-culture. The antagonistic component of the extracellular product was heat-stable and insensitive to proteases, lipase, catalase and alpha-amylase. Micrococcus MCCB 104 was demonstrated to be non-pathogenic to M. rosenbergii larvae.

  7. Genome Sequence of the Enterobacter mori Type Strain, LMG 25706, a Pathogenic Bacterium of Morus alba L. ▿

    PubMed Central

    Zhu, Bo; Zhang, Guo-Qing; Lou, Miao-Miao; Tian, Wen-Xiao; Li, Bin; Zhou, Xue-Ping; Wang, Guo-Feng; Liu, He; Xie, Guan-Lin; Jin, Gu-Lei

    2011-01-01

    Enterobacter mori is a plant-pathogenic enterobacterium responsible for the bacterial wilt of Morus alba L. Here we present the draft genome sequence of the type strain, LMG 25706. To the best of our knowledge, this is the first genome sequence of a plant-pathogenic bacterium in the genus Enterobacter. PMID:21602328

  8. Draft Genome Sequence of Chryseobacterium sp. Strain GSE06, a Biocontrol Endophytic Bacterium Isolated from Cucumber (Cucumis sativus)

    PubMed Central

    Jeong, Jin-Ju; Park, Byeong Hyeok; Park, Hongjae

    2016-01-01

    Chryseobacterium sp. strain GSE06 is a biocontrol endophytic bacterium against the destructive soilborne oomycete Phytophthora capsici, which causes Phytophthora blight of pepper. Here, we present its draft genome sequence, which contains genes related to biocontrol traits, such as colonization, antimicrobial activity, plant growth promotion, and abiotic or biotic stress adaptation. PMID:27313310

  9. Quantitative analysis of growth and volatile fatty acid production by the anaerobic ruminal bacterium Megasphaera elsdenii T81

    USDA-ARS?s Scientific Manuscript database

    Megaspheara elsdenii T81 grew on either DL-lactate or D-glucose at similar rates (0.85 per h), but displayed major differences in the fermentation of these substrates. Lactate was fermented at up to 210-mM concentration to yield acetic, propionic, butyric, and valeric acids. The bacterium was able t...

  10. Draft Genome Sequence and Description of Janthinobacterium sp. Strain CG3, a Psychrotolerant Antarctic Supraglacial Stream Bacterium

    PubMed Central

    Smith, Heidi; Akiyama, Tatsuya; Franklin, Michael; Woyke, Tanja; Teshima, Hazuki; Davenport, Karen; Daligault, Hajnalka; Erkkila, Tracy; Goodwin, Lynne; Gu, Wei; Xu, Yan; Chain, Patrick

    2013-01-01

    Here we present the draft genome sequence of Janthinobacterium sp. strain CG3, a psychrotolerant non-violacein-producing bacterium that was isolated from the Cotton Glacier supraglacial stream. The genome sequence of this organism will provide insight as to the mechanisms necessary for bacteria to survive in UV-stressed icy environments. PMID:24265494

  11. The FPase properties and morphology changes of a cellulolytic bacterium, Sporocytophaga sp. JL-01, on decomposing filter paper cellulose.

    PubMed

    Wang, Xiuran; Peng, Zhongqi; Sun, Xiaoling; Liu, Dongbo; Chen, Shan; Li, Fan; Xia, Hongmei; Lu, Tiancheng

    2012-01-01

    Sporocytophaga sp. JL-01 is a sliding cellulose degrading bacterium that can decompose filter paper (FP), carboxymethyl cellulose (CMC) and cellulose CF11. In this paper, the morphological characteristics of S. sp. JL-01 growing in FP liquid medium was studied by Scanning Electron Microscope (SEM), and one of the FPase components of this bacterium was analyzed. The results showed that the cell shapes were variable during the process of filter paper cellulose decomposition and the rod shape might be connected with filter paper decomposing. After incubating for 120 h, the filter paper was decomposed significantly, and it was degraded absolutely within 144 h. An FPase1 was purified from the supernatant and its characteristics were analyzed. The molecular weight of the FPase1 was 55 kDa. The optimum pH was pH 7.2 and optimum temperature was 50°C under experiment conditions. Zn(2+) and Co(2+) enhanced the enzyme activity, but Fe(3+) inhibited it.

  12. Fourier transform infrared spectroscopic study of intact cells of the nitrogen-fixing bacterium Azospirillum brasilense

    NASA Astrophysics Data System (ADS)

    Kamnev, A. A.; Ristić, M.; Antonyuk, L. P.; Chernyshev, A. V.; Ignatov, V. V.

    1997-06-01

    The data of Fourier transform infrared (FTIR) spectroscopic measurements performed on intact cells of the soil nitrogen-fixing bacterium Azospirillum brasilense grown in a standard medium and under the conditions of an increased metal uptake are compared and discussed. The structural FTIR information obtained is considered together with atomic absorption spectrometry (AAS) data on the content of metal cations in the bacterial cells. Some methodological aspects concerning preparation of bacterial cell samples for FTIR measurements are also discussed.

  13. Engineering cellulolytic bacterium Clostridium thermocellum to co-ferment cellulose- and hemicellulose-derived sugars simultaneously

    DOE PAGES

    Xiong, Wei; Reyes, Luis H.; Michener, William E.; ...

    2018-04-10

    Here, cellulose and hemicellulose are the most abundant components in plant biomass. A preferred Consolidated Bioprocessing (CBP) system is one which can directly convert both cellulose and hemicellulose into target products without adding the costly hydrolytic enzyme cocktail. In this work, the thermophilic, cellulolytic, and anaerobic bacterium, Clostridium thermocellum DSM 1313, was engineered to grow on xylose in addition to cellulose. Both xylA (encoding for xylose isomerase) and xylB (encoding for xylulokinase) genes from the thermophilic anaerobic bacterium Thermoanaerobacter ethanolicus were introduced to enable xylose utilization while still retaining its inherent ability to grow on 6-carbon substrates. Targeted integration ofmore » xylAB into C. thermocellum genome realized simultaneous fermentation of xylose with glucose, with cellobiose (glucose dimer), and with cellulose, respectively, without carbon catabolite repression. We also showed that the respective H 2 and ethanol production were twice as much when both xylose and cellulose were consumed simultaneously than when consuming cellulose alone. Moreover, the engineered xylose consumer can also utilize xylo-oligomers (with degree of polymerization of 2-7) in the presence of xylose. Isotopic tracer studies also revealed that the engineered xylose catabolism contributed to the production of ethanol from xylan which is a model hemicellulose in mixed sugar fermentation, demonstrating immense potential of this enhanced CBP strain in co-utilizing both cellulose and hemicellulose for the production of fuels and chemicals.« less

  14. Engineering cellulolytic bacterium Clostridium thermocellum to co-ferment cellulose- and hemicellulose-derived sugars simultaneously

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Xiong, Wei; Reyes, Luis H.; Michener, William E.

    Here, cellulose and hemicellulose are the most abundant components in plant biomass. A preferred Consolidated Bioprocessing (CBP) system is one which can directly convert both cellulose and hemicellulose into target products without adding the costly hydrolytic enzyme cocktail. In this work, the thermophilic, cellulolytic, and anaerobic bacterium, Clostridium thermocellum DSM 1313, was engineered to grow on xylose in addition to cellulose. Both xylA (encoding for xylose isomerase) and xylB (encoding for xylulokinase) genes from the thermophilic anaerobic bacterium Thermoanaerobacter ethanolicus were introduced to enable xylose utilization while still retaining its inherent ability to grow on 6-carbon substrates. Targeted integration ofmore » xylAB into C. thermocellum genome realized simultaneous fermentation of xylose with glucose, with cellobiose (glucose dimer), and with cellulose, respectively, without carbon catabolite repression. We also showed that the respective H 2 and ethanol production were twice as much when both xylose and cellulose were consumed simultaneously than when consuming cellulose alone. Moreover, the engineered xylose consumer can also utilize xylo-oligomers (with degree of polymerization of 2-7) in the presence of xylose. Isotopic tracer studies also revealed that the engineered xylose catabolism contributed to the production of ethanol from xylan which is a model hemicellulose in mixed sugar fermentation, demonstrating immense potential of this enhanced CBP strain in co-utilizing both cellulose and hemicellulose for the production of fuels and chemicals.« less

  15. Whole-Genome Sequence of Chryseobacterium oranimense, a Colistin-Resistant Bacterium Isolated from a Cystic Fibrosis Patient in France

    PubMed Central

    Sharma, Poonam; Gupta, Sushim Kumar; Diene, Seydina M.

    2015-01-01

    For the first time, we report the whole-genome sequence analysis of Chryseobacterium oranimense G311, a multidrug-resistant bacterium, from a cystic fibrosis patient in France, including resistance to colistin. Whole-genome sequencing of C. oranimense G311 was performed using Ion Torrent PGM, and RAST, the EMBL-EBI server, and the Antibiotic Resistance Gene-ANNOTation (ARG-ANNOT) database were used for annotation of all genes, including antibiotic resistance (AR) genes. General features of the C. oranimense G311 draft genome were compared to the other available genomes of Chryseobacterium gleum and Chryseobacterium sp. strain CF314. C. oranimense G311 was found to be resistant to all β-lactams, including imipenem, and to colistin. The genome size of C. oranimense G311 is 4,457,049 bp in length, with 37.70% GC content. We found 27 AR genes in the genome, including β-lactamase genes which showed little similarity to the known β-lactamase genes and could likely be novel. We found the type I polyketide synthase operon followed by a zeaxanthin glycosyltransferase gene in the genome, which could impart the yellow pigmentation of the isolate. We located the O-antigen biosynthesis cluster, and we also discovered a novel capsular polysaccharide biosynthesis cluster. We also found known mutations in the orthologs of the pmrA (E8D), pmrB (L208F and P360Q), and lpxA (G68D) genes. We speculate that the presence of the capsular cluster and mutations in these genes could explain the resistance of this bacterium to colistin. We demonstrate that whole-genome sequencing was successfully applied to decipher the resistome of a multidrug resistance bacterium associated with cystic fibrosis patients. PMID:25583710

  16. Whole-genome sequence of Chryseobacterium oranimense, a colistin-resistant bacterium isolated from a cystic fibrosis patient in France.

    PubMed

    Sharma, Poonam; Gupta, Sushim Kumar; Diene, Seydina M; Rolain, Jean-Marc

    2015-03-01

    For the first time, we report the whole-genome sequence analysis of Chryseobacterium oranimense G311, a multidrug-resistant bacterium, from a cystic fibrosis patient in France, including resistance to colistin. Whole-genome sequencing of C. oranimense G311 was performed using Ion Torrent PGM, and RAST, the EMBL-EBI server, and the Antibiotic Resistance Gene-ANNOTation (ARG-ANNOT) database were used for annotation of all genes, including antibiotic resistance (AR) genes. General features of the C. oranimense G311 draft genome were compared to the other available genomes of Chryseobacterium gleum and Chryseobacterium sp. strain CF314. C. oranimense G311 was found to be resistant to all β-lactams, including imipenem, and to colistin. The genome size of C. oranimense G311 is 4,457,049 bp in length, with 37.70% GC content. We found 27 AR genes in the genome, including β-lactamase genes which showed little similarity to the known β-lactamase genes and could likely be novel. We found the type I polyketide synthase operon followed by a zeaxanthin glycosyltransferase gene in the genome, which could impart the yellow pigmentation of the isolate. We located the O-antigen biosynthesis cluster, and we also discovered a novel capsular polysaccharide biosynthesis cluster. We also found known mutations in the orthologs of the pmrA (E8D), pmrB (L208F and P360Q), and lpxA (G68D) genes. We speculate that the presence of the capsular cluster and mutations in these genes could explain the resistance of this bacterium to colistin. We demonstrate that whole-genome sequencing was successfully applied to decipher the resistome of a multidrug resistance bacterium associated with cystic fibrosis patients. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  17. Draft Genome Sequence of Caenibacillus caldisaponilyticus B157T, a Thermophilic and Phospholipase-Producing Bacterium Isolated from Acidulocompost

    PubMed Central

    Tsujimoto, Yoshiyuki; Saito, Ryo; Sahara, Takehiko; Kimura, Nobutada; Tsuruoka, Naoki; Shigeri, Yasushi

    2017-01-01

    ABSTRACT Caenibacillus caldisaponilyticus B157T (= NBRC 111400T = DSM 101100T), in the family Sporolactobacillaceae, was isolated from acidulocompost as a thermophilic and phospholipid-degrading bacterium. Here, we report the 3.36-Mb draft genome sequence, with a G+C content of 51.8%, to provide the genetic information coding for phospholipases. PMID:28360164

  18. Production of polyhydroxybutyrate by the marine photosynthetic bacterium Rhodovulum sulfidophilum P5

    NASA Astrophysics Data System (ADS)

    Cai, Jinling; Wei, Ying; Zhao, Yupeng; Pan, Guanghua; Wang, Guangce

    2012-07-01

    The effects of different NaCl concentrations, nitrogen sources, carbon sources, and carbon to nitrogen molar ratios on biomass accumulation and polyhydroxybutyrate (PHB) production were studied in batch cultures of the marine photosynthetic bacterium Rhodovulum sulfidophilum P5 under aerobic-dark conditions. The results show that the accumulation of PHB in strain P5 is a growth-associated process. Strain P5 had maximum biomass and PHB accumulation at 2%-3% NaCl, suggesting that the bacterium can maintain growth and potentially produce PHB at natural seawater salinity. In the nitrogen source test, the maximum biomass accumulation (8.10±0.09 g/L) and PHB production (1.11±0.13 g/L and 14.62%±2.2 of the cell dry weight) were observed when peptone and ammonium chloride were used as the sole nitrogen source. NH{4/+}-N was better for PHB production than other nitrogen sources. In the carbon source test, the maximum biomass concentration (7.65±0.05 g/L) was obtained with malic acid as the sole carbon source, whereas the maximum yield of PHB (5.03±0.18 g/L and 66.93%±1.69% of the cell dry weight) was obtained with sodium pyruvate as the sole carbon source. In the carbon to nitrogen ratios test, sodium pyruvate and ammonium chloride were selected as the carbon and nitrogen sources, respectively. The best carbon to nitrogen molar ratio for biomass accumulation (8.77±0.58 g/L) and PHB production (6.07±0.25 g/L and 69.25%±2.05% of the cell dry weight) was 25. The results provide valuable data on the production of PHB by R. sulfidophilum P5 and further studies are on-going for best cell growth and PHB yield.

  19. Reduction of Mo(VI) by the bacterium Serratia sp. strain DRY5.

    PubMed

    Rahman, M F A; Shukor, M Y; Suhaili, Z; Mustafa, S; Shamaan, N A; Syed, M A

    2009-01-01

    The need to isolate efficient heavy metal reducers for cost effective bioremediation strategy have resulted in the isolation of a potent molybdenum-reducing bacterium. The isolate was tentatively identified as Serratia sp. strain DRY5 based on the Biolog GN carbon utilization profiles and partial 16S rDNA molecular phylogeny. Strain DRY5 produced 2.3 times the amount of Mo-blue than S. marcescens strain Dr.Y6, 23 times more than E. coli K12 and 7 times more than E. cloacae strain 48. Strain DRY5 required 37 degrees C and pH 7.0 for optimum molybdenum reduction. Carbon sources such as sucrose, maltose, glucose and glycerol, supported cellular growth and molybdate reduction after 24 hr of static incubation. The most optimum carbon source that supported reduction was sucrose at 1.0% (w/v). Ammonium sulphate, ammonium chloride, glutamic acid, cysteine, and valine supported growth and molybdate reduction with ammonium sulphate as the optimum nitrogen source at 0. 2% (w/v). Molybdate reduction was optimally supported by 30 mM molybdate. The optimum concentration of phosphate for molybdate reduction was 5 mM when molybdate concentration was fixed at 30 mM and molybdate reduction was totally inhibited at 100 mM phosphate. Mo-blue produced by this strain shows a unique characteristic absorption profile with a maximum peak at 865 nm and a shoulder at 700 nm, Dialysis tubing experiment showed that 95.42% of Mo-blue was found in the dialysis tubing suggesting that the molybdate reduction seen in this bacterium was catalyzed by enzyme(s). The characteristics of isolate DRY5 suggest that it would be useful in the bioremediation ofmolybdenum-containing waste.

  20. Biological reduction of uranium coupled with oxidation of ammonium by Acidimicrobiaceae bacterium A6 under iron reducing conditions.

    PubMed

    Gilson, Emily R; Huang, Shan; Jaffé, Peter R

    2015-11-01

    This study investigated the possibility of links between the biological immobilization of uranium (U) and ammonium oxidation under iron (Fe) reducing conditions. The recently-identified Acidimicrobiaceae bacterium A6 (ATCC, PTA-122488) derives energy from ammonium oxidation coupled with Fe reduction. This bacterium has been found in various soil and wetland environments, including U-contaminated wetland sediments. Incubations of Acidimicrobiaceae bacteria A6 with nontronite, an Fe(III)-rich clay, and approximately 10 µM U indicate that these bacteria can use U(VI) in addition to Fe(III) as an electron acceptor in the presence of ammonium. Measurements of Fe(II) production and ammonium oxidation support this interpretation. Concentrations of approximately 100 µM U were found to entirely inhibit Acidimicrobiaceae bacteria A6 activity. These results suggest that natural sites of active ammonium oxidation under Fe reducing conditions by Acidimicrobiaceae bacteria A6 could be hotspots of U immobilization by bioreduction. This is the first report of biological U reduction that is not coupled to carbon oxidation.

  1. Molecular stress responses to nano-sized zero-valent iron (nZVI) particles in the soil bacterium Pseudomonas stutzeri.

    PubMed

    Saccà, Maria Ludovica; Fajardo, Carmen; Martinez-Gomariz, Montserrat; Costa, Gonzalo; Nande, Mar; Martin, Margarita

    2014-01-01

    Nanotoxicological studies were performed in vitro using the common soil bacterium Pseudomonas stutzeri to assess the potentially toxic impact of commercial nano-sized zero-valent iron (nZVI) particles, which are currently used for environmental remediation projects. The phenotypic response of P. stutzeri to nZVI toxicity includes an initial insult to the cell wall, as evidenced by TEM micrographs. Transcriptional analyses using genes of particular relevance in cellular activity revealed that no significant changes occurred among the relative expression ratios of narG, nirS, pykA or gyrA following nZVI exposure; however, a significant increase in katB expression was indicative of nZVI-induced oxidative stress in P. stutzeri. A proteomic approach identified two major defence mechanisms that occurred in response to nZVI exposure: a downregulation of membrane proteins and an upregulation of proteins involved in reducing intracellular oxidative stress. These biomarkers served as early indicators of nZVI response in this soil bacterium, and may provide relevant information for environmental hazard assessment.

  2. Molecular Stress Responses to Nano-Sized Zero-Valent Iron (nZVI) Particles in the Soil Bacterium Pseudomonas stutzeri

    PubMed Central

    Saccà, Maria Ludovica; Fajardo, Carmen; Martinez-Gomariz, Montserrat; Costa, Gonzalo; Nande, Mar; Martin, Margarita

    2014-01-01

    Nanotoxicological studies were performed in vitro using the common soil bacterium Pseudomonas stutzeri to assess the potentially toxic impact of commercial nano-sized zero-valent iron (nZVI) particles, which are currently used for environmental remediation projects. The phenotypic response of P. stutzeri to nZVI toxicity includes an initial insult to the cell wall, as evidenced by TEM micrographs. Transcriptional analyses using genes of particular relevance in cellular activity revealed that no significant changes occurred among the relative expression ratios of narG, nirS, pykA or gyrA following nZVI exposure; however, a significant increase in katB expression was indicative of nZVI-induced oxidative stress in P. stutzeri. A proteomic approach identified two major defence mechanisms that occurred in response to nZVI exposure: a downregulation of membrane proteins and an upregulation of proteins involved in reducing intracellular oxidative stress. These biomarkers served as early indicators of nZVI response in this soil bacterium, and may provide relevant information for environmental hazard assessment. PMID:24586957

  3. Unexplained agglutination of stored red blood cells in Alsever's solution caused by the gram-negative bacterium Serratia liquefaciens.

    PubMed

    Martincic, I; Mastronardi, C; Chung, A; Ramirez-Arcos, S

    2008-01-01

    Alsever's solution has been used for decades as a preservative solution for storage of RBCs. From October 2005 to January 2006, unexplained hemagglutination of approximately 10 to 20 percent of RBCs stored for several days in a modified version of Alsever's solution was noticed in quality control testing at the Canadian Blood Services Serology Laboratory. An investigation, including microbial testing, was initiated to determine the cause of the unexplained hemagglutination. The gram-negative bacterium Serratia liquefaciens was isolated from supernatant solutions of agglutinated RBCs. Further characterization of this strain revealed that it has the ability to form biofilms; presents high levels of resistance to chloramphenicol, neomycin, and gentamicin; and causes mannose-sensitive hemagglutination. The source of S. liquefaciens contamination in RBC supernatants was not found. However, this bacterium has not been isolated since January 2006 after enhanced cleaning practices were implemented in the serology laboratory where the RBCs are stored. This biofilm-forming, antibiotic-resistant S. liquefaciens strain could be directly linked to the unexplained hemagglutination observed in stored RBCs.

  4. Complete Genome Sequence of Alkaliphilus metalliredigens QYMF, an Alkaliphilic and Metal-Reducing Bacterium Isolated from Borax-contaminated Leachate Ponds

    DOE PAGES

    Hwang, C.; Copeland, A.; Lucas, Susan; ...

    2016-11-03

    Alkaliphilus metalliredigens QYMF is an anaerobic, alkaliphilic, and metal-reducing bacterium associated with phylum Firmicutes. QYMF was isolated from alkaline borax leachate ponds. The genome sequence will help elucidate the role of metal-reducing microorganisms under alkaline environments, a capability that is not commonly observed in metal respiring-microorganisms.

  5. Complete Genome Sequence of Alkaliphilus metalliredigens QYMF, an Alkaliphilic and Metal-Reducing Bacterium Isolated from Borax-contaminated Leachate Ponds

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hwang, C.; Copeland, A.; Lucas, Susan

    Alkaliphilus metalliredigens QYMF is an anaerobic, alkaliphilic, and metal-reducing bacterium associated with phylum Firmicutes. QYMF was isolated from alkaline borax leachate ponds. The genome sequence will help elucidate the role of metal-reducing microorganisms under alkaline environments, a capability that is not commonly observed in metal respiring-microorganisms.

  6. Transcriptional Changes Underlying Elemental Stoichiometry Shifts in a Marine Heterotrophic Bacterium

    PubMed Central

    Chan, Leong-Keat; Newton, Ryan J.; Sharma, Shalabh; Smith, Christa B.; Rayapati, Pratibha; Limardo, Alexander J.; Meile, Christof; Moran, Mary Ann

    2012-01-01

    Marine bacteria drive the biogeochemical processing of oceanic dissolved organic carbon (DOC), a 750-Tg C reservoir that is a critical component of the global C cycle. Catabolism of DOC is thought to be regulated by the biomass composition of heterotrophic bacteria, as cells maintain a C:N:P ratio of ∼50:10:1 during DOC processing. Yet a complicating factor in stoichiometry-based analyses is that bacteria can change the C:N:P ratio of their biomass in response to resource composition. We investigated the physiological mechanisms of resource-driven shifts in biomass stoichiometry in continuous cultures of the marine heterotrophic bacterium Ruegeria pomeroyi (a member of the Roseobacter clade) under four element limitation regimes (C, N, P, and S). Microarray analysis indicated that the bacterium scavenged for alternate sources of the scarce element when cells were C-, N-, or P-limited; reworked the ratios of biomolecules when C- and P- limited; and exerted tighter control over import/export and cytoplasmic pools when N-limited. Under S limitation, a scenario not existing naturally for surface ocean microbes, stress responses dominated transcriptional changes. Resource-driven changes in C:N ratios of up to 2.5-fold and in C:P ratios of up to sixfold were measured in R. pomeroyi biomass. These changes were best explained if the C and P content of the cells was flexible in the face of shifting resources but N content was not, achieved through the net balance of different transcriptional strategies. The cellular-level metabolic trade-offs that govern biomass stoichiometry in R. pomeroyi may have implications for global carbon cycling if extendable to other heterotrophic bacteria. Strong homeostatic responses to N limitation by marine bacteria would intensify competition with autotrophs. Modification of cellular inventories in C- and P-limited heterotrophs would vary the elemental ratio of particulate organic matter sequestered in the deep ocean. PMID:22783226

  7. Isolation and characterization of an algicidal bacterium indigenous to lake Taihu with a red pigment able to lyse microcystis aeruginosa.

    PubMed

    Yang, Fei; Wei, Hai Yan; Li, Xiao Qin; Li, Yun Hui; Li, Xiao Bo; Yin, Li Hong; Pu, Yue Pu

    2013-02-01

    To isolate and characterize indigenous algicidal bacteria and their algae-lysing compounds active against Microcystis aeruginosa, strains TH1, TH2, and FACHB 905. The bacteria were identified using the Biolog automated microbial identification system and 16S rDNA sequence analysis. The algae-lysing compounds were isolated and purified by silica gel column chromatography and reverse-phase high performance liquid chromatography. Their structures were confirmed by Nuclear Magnetic Resonance (NMR) and Fourier Transform Infrared (FT-IR) spectroscopy. Algae-lysing activity was observed using microscopy. The algae-lysing bacterium LTH-2 isolated from Lake Taihu was identified as Serratia marcescens. Strain LTH-2 secreted a red pigment identified as prodigiosin (C20H25N3O), which showed strong lytic activity with algal strains M. aeruginosa TH1, TH2, and FACHB 905 in a concentration-dependent manner. The 50% inhibitory concentration (IC50) of prodigiosin with the algal strains was 4.8 (± 0.4)× 10⁻² μg/mL, 8.9 (± 1.1)× 10⁻² μg/mL, and 1.7 (± 0.1)× 10⁻¹ μg/mL in 24 h, respectively. The bacterium LTH-2 and its pigment had strong Microcystis-lysing activity probably related to damage of cell membranes. The bacterium LTH-2 and its red pigment are potentially useful for regulating blooms of harmful M. aeruginosa. Copyright © 2013 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.

  8. Refractory Chronic Pleurisy Caused by Helicobacter equorum-Like Bacterium in a Patient with X-Linked Agammaglobulinemia ▿

    PubMed Central

    Funato, Michinori; Kaneko, Hideo; Ohkusu, Kiyofumi; Sasai, Hideo; Kubota, Kazuo; Ohnishi, Hidenori; Kato, Zenichiro; Fukao, Toshiyuki; Kondo, Naomi

    2011-01-01

    We describe a 35-year-old man with X-linked agammaglobulinemia who had refractory chronic pleurisy caused by a Helicobacter equorum-like bacterium. Broad-range bacterial PCR targeting the 16S and 23S rRNA genes and in situ hybridization targeting the 16S rRNA gene of H. equorum confirmed the presence of this pathogen in a human for the first time. PMID:21677071

  9. Whole-Genome Shotgun Sequence of the Keratinolytic Bacterium Lysobacter sp. A03, Isolated from the Antarctic Environment.

    PubMed

    Pereira, Jamile Queiroz; Ambrosini, Adriana; Sant'Anna, Fernando Hayashi; Tadra-Sfeir, Michele; Faoro, Helisson; Pedrosa, Fábio Oliveira; Souza, Emanuel Maltempi; Brandelli, Adriano; Passaglia, Luciane M P

    2015-04-02

    Lysobacter sp. strain A03 is a protease-producing bacterium isolated from decomposing-penguin feathers collected in the Antarctic environment. This strain has the ability to degrade keratin at low temperatures. The A03 genome sequence provides the possibility of finding new genes with biotechnological potential to better understand its cold-adaptation mechanism and survival in cold environments. Copyright © 2015 Pereira et al.

  10. Virus-Bacterium Interactions in Water and Sediment of West African Inland Aquatic Systems

    PubMed Central

    Bettarel, Yvan; Bouvy, Marc; Dumont, Claire; Sime-Ngando, Télesphore

    2006-01-01

    The ecology of virioplankton in tropical aquatic ecosystems is poorly documented, and in particular, there are no references concerning African continental waters in the literature. In this study, we examined virus-bacterium interactions in the pelagic and benthic zones of seven contrasting shallow inland waters in Senegal, including one hypersaline lake. SYBR Gold-stained samples revealed that in the surface layers of the sites, the numbers of viruses were in the same range as the numbers of viruses reported previously for productive temperate systems. Despite high bacterial production rates, the percentages of visibly infected cells (as determined by transmission electron microscopy) were similar to the lowest percentages (range, 0.3 to 1.1%; mean, 0.5%) found previously at pelagic freshwater or marine sites, presumably because of the local environmental and climatic conditions. Since the percentages of lysogenic bacteria were consistently less than 8% for pelagic and benthic samples, lysogeny did not appear to be a dominant strategy for virus propagation at these sites. In the benthic samples, viruses were highly concentrated, but paradoxically, no bacteria were visibly infected. This suggests that sediment provides good conditions for virus preservation but ironically is an unfavorable environment for proliferation. In addition, given the comparable size distributions of viruses in the water and sediment samples, our results support the paradigm that aquatic viruses are ubiquitous and may have moved between the two compartments of the shallow systems examined. Overall, this study provides additional information about the relevance of viruses in tropical areas and indicates that the intensity of virus-bacterium interactions in benthic habitats may lower than the intensity in the adjacent bodies of water. PMID:16885276

  11. Aminomonas paucivorans gen. nov., sp. nov., a mesophilic, anaerobic, amino-acid-utilizing bacterium.

    PubMed

    Baena, S; Fardeau, M L; Ollivier, B; Labat, M; Thomas, P; Garcia, J L; Patel, B K

    1999-07-01

    A novel, asaccharolytic, amino-acid-degrading bacterium, designated strain GLU-3T, was isolated from an anaerobic lagoon of a dairy wastewater treatment plant. Strain GLU-3T stained Gram-negative and was an obligately anaerobic, non-spore-forming, slightly curved, rod-shaped bacterium (0.3 x 4.0-6.0 microns) which existed singly or in pairs. The DNA G+C content was 43 mol%. Optimum growth occurred at 35 degrees C and pH 7.5 on arginine with a generation time of 16 h. Good growth was obtained on arginine, histidine, threonine and glycine. Acetate was the end-product formed from all these substrates, but in addition, a trace of formate was detected from arginine and histidine, and ornithine was produced from arginine. Strain GLU-3T grew slowly on glutamate and produced acetate, carbon dioxide, formate, hydrogen and traces of propionate as the end-products. In syntrophic association with Methanobacterium formicicum, strain GLU-3T oxidized arginine, histidine and glutamate to give propionate as the major product; acetate, carbon dioxide and methane were also produced. Strain GLU-3T did not degrade alanine and the branched-chain amino acids valine, leucine and isoleucine either in pure culture or in association with M. formicicum. The nearest phylogenetic relative of strain GLU-3T was the thermophile Selenomonas acidaminovorans (similarity value of 89.5%). As strain GLU-3T is phylogenetically, physiologically and genotypically different from other amino-acid-degrading genera, it is proposed that it should be designated a new species of a new genus Aminomonas paucivorans gen. nov., sp. nov. (DSM 12260T).

  12. Ca2+-stabilized adhesin helps an Antarctic bacterium reach out and bind ice.

    PubMed

    Vance, Tyler D R; Olijve, Luuk L C; Campbell, Robert L; Voets, Ilja K; Davies, Peter L; Guo, Shuaiqi

    2014-07-04

    The large size of a 1.5-MDa ice-binding adhesin [MpAFP (Marinomonas primoryensis antifreeze protein)] from an Antarctic Gram-negative bacterium, M. primoryensis, is mainly due to its highly repetitive RII (Region II). MpAFP_RII contains roughly 120 tandem copies of an identical 104-residue repeat. We have previously determined that a single RII repeat folds as a Ca2+-dependent immunoglobulin-like domain. Here, we solved the crystal structure of RII tetra-tandemer (four tandem RII repeats) to a resolution of 1.8 Å. The RII tetra-tandemer reveals an extended (~190-Å × ~25-Å), rod-like structure with four RII-repeats aligned in series with each other. The inter-repeat regions of the RII tetra-tandemer are strengthened by Ca2+ bound to acidic residues. SAXS (small-angle X-ray scattering) profiles indicate the RII tetra-tandemer is significantly rigidified upon Ca2+ binding, and that the protein's solution structure is in excellent agreement with its crystal structure. We hypothesize that >600 Ca2+ help rigidify the chain of ~120 104-residue repeats to form a ~0.6 μm rod-like structure in order to project the ice-binding domain of MpAFP away from the bacterial cell surface. The proposed extender role of RII can help the strictly aerobic, motile bacterium bind ice in the upper reaches of the Antarctic lake where oxygen and nutrients are most abundant. Ca2+-induced rigidity of tandem Ig-like repeats in large adhesins might be a general mechanism used by bacteria to bind to their substrates and help colonize specific niches.

  13. Treatment of colitis with a commensal gut bacterium engineered to secrete human TGF-beta1 under the control of dietary xylan

    USDA-ARS?s Scientific Manuscript database

    Background: Growth factors have shown promise in treating inflammatory bowel disease. They are unstable when administered orally and required in higher doses with systemic administration. In consideration of these problems, we have engineered the commensal bacterium Bacteroides ovatus for the con...

  14. In Situ Gene Expression Responsible for Sulfide Oxidation and CO2 Fixation of an Uncultured Large Sausage-Shaped Aquificae Bacterium in a Sulfidic Hot Spring

    PubMed Central

    Tamazawa, Satoshi; Yamamoto, Kyosuke; Takasaki, Kazuto; Mitani, Yasuo; Hanada, Satoshi; Kamagata, Yoichi; Tamaki, Hideyuki

    2016-01-01

    We investigated the in situ gene expression profile of sulfur-turf microbial mats dominated by an uncultured large sausage-shaped Aquificae bacterium, a key metabolic player in sulfur-turfs in sulfidic hot springs. A reverse transcription-PCR analysis revealed that the genes responsible for sulfide, sulfite, and thiosulfate oxidation and carbon fixation via the reductive TCA cycle were continuously expressed in sulfur-turf mats taken at different sampling points, seasons, and years. These results suggest that the uncultured large sausage-shaped bacterium has the ability to grow chemolithoautotrophically and plays key roles as a primary producer in the sulfidic hot spring ecosystem in situ. PMID:27297893

  15. In Situ Gene Expression Responsible for Sulfide Oxidation and CO2 Fixation of an Uncultured Large Sausage-Shaped Aquificae Bacterium in a Sulfidic Hot Spring.

    PubMed

    Tamazawa, Satoshi; Yamamoto, Kyosuke; Takasaki, Kazuto; Mitani, Yasuo; Hanada, Satoshi; Kamagata, Yoichi; Tamaki, Hideyuki

    2016-06-25

    We investigated the in situ gene expression profile of sulfur-turf microbial mats dominated by an uncultured large sausage-shaped Aquificae bacterium, a key metabolic player in sulfur-turfs in sulfidic hot springs. A reverse transcription-PCR analysis revealed that the genes responsible for sulfide, sulfite, and thiosulfate oxidation and carbon fixation via the reductive TCA cycle were continuously expressed in sulfur-turf mats taken at different sampling points, seasons, and years. These results suggest that the uncultured large sausage-shaped bacterium has the ability to grow chemolithoautotrophically and plays key roles as a primary producer in the sulfidic hot spring ecosystem in situ.

  16. Sulfate-Reducing Bacterium with Unusual Morphology and Pigment Content

    PubMed Central

    Jones, H. E.

    1971-01-01

    A dissimilatory sulfate-reducing bacterium was isolated which differed in morphology and pigment content from previously described species. The organism was mesophilic, obligately anaerobic, gram-negative, nonsporulating, long, and slender with one polar flagellum. Whole cells fluoresced red at neutral pH when excited with light at 365 nm owing to the presence of a pink pigment. Desulfoviridin was present. Reduced minus oxidized spectra of whole cells showed peaks in the position of a c-type cytochrome characteristic of Desulfovibrio species and peaks at about 629 and 603 nm. CO difference spectra showed the presence of a CO-binding pigment with a peak at 593 nm. Lactate and pyruvate supported growth in the presence of sulfate but not in its absence. Sulfate, sulfite, and thiosulfate served as electron acceptors for growth. Hydrogenase was present. The deoxyribonucleic acid had a buoyant density of 1.722 g/cm3 and a guanosine plus cystosine molar percentage of total bases calculated by two different methods of 61.2 or 63.2. Images PMID:4929856

  17. Novel Trypanosomatid-Bacterium Association: Evolution of Endosymbiosis in Action

    PubMed Central

    Kostygov, Alexei Y.; Dobáková, Eva; Grybchuk-Ieremenko, Anastasiia; Váhala, Dalibor; Maslov, Dmitri A.; Votýpka, Jan

    2016-01-01

    ABSTRACT We describe a novel symbiotic association between a kinetoplastid protist, Novymonas esmeraldas gen. nov., sp. nov., and an intracytoplasmic bacterium, “Candidatus Pandoraea novymonadis” sp. nov., discovered as a result of a broad-scale survey of insect trypanosomatid biodiversity in Ecuador. We characterize this association by describing the morphology of both organisms, as well as their interactions, and by establishing their phylogenetic affinities. Importantly, neither partner is closely related to other known organisms previously implicated in eukaryote-bacterial symbiosis. This symbiotic association seems to be relatively recent, as the host does not exert a stringent control over the number of bacteria harbored in its cytoplasm. We argue that this unique relationship may represent a suitable model for studying the initial stages of establishment of endosymbiosis between a single-cellular eukaryote and a prokaryote. Based on phylogenetic analyses, Novymonas could be considered a proxy for the insect-only ancestor of the dixenous genus Leishmania and shed light on the origin of the two-host life cycle within the subfamily Leishmaniinae. PMID:26980834

  18. Decoding how a soil bacterium extracts building blocks and metabolic energy from ligninolysis provides road map for lignin valorization (Towards Lignin valorization: How a soil bacterium extracts building blocks and metabolic energy from "Lignolysis")

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Varman, Arul M.; He, Lian; Follenfant, Rhiannon

    Lignin is a major resources for the production of next generation renewable aromatics. Sphingobium sp. SYK-6 is a bacterium that has been well-studied for the breakdown of lignin-derived compounds. There has been a lot of interest in SYK-6 lignolytic activity and many recent works have focused on understanding the unique catabolic pathway it possesses for the degradation of lignin derived monomers and oligomers. Furthermore, there has been no prior effort in understanding the central fluxome based on lignin derived substrates into value-added chemicals.

  19. Decoding how a soil bacterium extracts building blocks and metabolic energy from ligninolysis provides road map for lignin valorization (Towards Lignin valorization: How a soil bacterium extracts building blocks and metabolic energy from "Lignolysis")

    DOE PAGES

    Varman, Arul M.; He, Lian; Follenfant, Rhiannon; ...

    2016-09-15

    Lignin is a major resources for the production of next generation renewable aromatics. Sphingobium sp. SYK-6 is a bacterium that has been well-studied for the breakdown of lignin-derived compounds. There has been a lot of interest in SYK-6 lignolytic activity and many recent works have focused on understanding the unique catabolic pathway it possesses for the degradation of lignin derived monomers and oligomers. Furthermore, there has been no prior effort in understanding the central fluxome based on lignin derived substrates into value-added chemicals.

  20. Recombinant expression of a putative prophage amidase cloned from the genome of Listeria monocytogenes that lyses the bacterium and its biofilm

    USDA-ARS?s Scientific Manuscript database

    Listeria monocytogenes is a Gram-positive, non-sporeforming, catalase-positive rod that is a major bacterial food-borne disease agent, causing listeriosis. Listeria can be associated with uncooked meats including poultry, uncooked vegetables, soft cheeses and unpasteurized milk. The bacterium can be...

  1. Expression of a Clostridium perfringens genome-encoded putative N-acetylmuramoyl-L-alanine amidase as a potential antimicrobial to control the bacterium

    USDA-ARS?s Scientific Manuscript database

    Clostridium perfringens is a Gram-positive, spore-forming anaerobic bacterium that plays a substantial role in non-foodborne human, animal and avian diseases as well as human foodborne disease. Previously discovered C. perfringens bacteriophage lytic enzyme amino acid sequences were utilized to iden...

  2. Isolation and identification of berberine and berberrubine metabolites by berberine-utilizing bacterium Rhodococcus sp. strain BD7100.

    PubMed

    Ishikawa, Kazuki; Takeda, Hisashi; Wakana, Daigo; Sato, Fumihiko; Hosoe, Tomoo

    2016-05-01

    Based on the finding of a novel berberine (BBR)-utilizing bacterium, Rhodococcus sp. strain BD7100, we investigated the degradation of BBR and its analog berberrubine (BRU). Resting cells of BD7100 demethylenated BBR and BRU, yielding benzeneacetic acid analogs. Isolation of benzeneacetic acid analogs suggested that BD7100 degraded the isoquinoline ring of the protoberberine skeleton. This work represents the first report of cleavage of protoberberine skeleton by a microorganism.

  3. Corky root of lettuce caused by strains of a gram-negative bacterium from muck soils of Florida, new york, and wisconsin.

    PubMed

    van Bruggen, A H; Brown, P R; Jochimsen, K N

    1989-10-01

    Slow-growing bacteria similar to the bacterium causing lettuce corky root (CR) in California (strain CA1) were isolated from muck soils of Florida, New York, and Wisconsin, using lettuce seedlings as bait. All strains were tested for reaction with polyclonal antibodies produced against strain CA1 and for pathogenicity on CR-susceptible (Salinas) and CR-resistant (Green Lake) lettuce cultivars in a greenhouse. Five strains from Florida, three from New York, and three from Wisconsin induced severe CR symptoms on Salinas and mild symptoms on Green Lake. All strains were gram-negative, aerobic, oxidase positive, and catalase positive and reduced nitrate to ammonia. Whole-cell fatty acid compositions were similar for all strains and resembled that of Pseudomonas paucimobilis. Since this fatty acid pattern is unique, it is suggested that CR of lettuce is caused by strains of the same bacterium in Florida, New York, Wisconsin, and California.

  4. First report of a lipopeptide biosurfactant from thermophilic bacterium Aneurinibacillus thermoaerophilus MK01 newly isolated from municipal landfill site.

    PubMed

    Sharafi, Hakimeh; Abdoli, Mahya; Hajfarajollah, Hamidreza; Samie, Nima; Alidoust, Leila; Abbasi, Habib; Fooladi, Jamshid; Zahiri, Hossein Shahbani; Noghabi, Kambiz Akbari

    2014-07-01

    A biosurfactant-producing thermophile was isolated from the Kahrizak landfill of Tehran and identified as a bacterium belonging to the genus Aneurinibacillus. A thermostable lipopeptide-type biosurfactant was purified from the culture medium of this bacterium and showed stability in the temperature range of 20-90 °C and pH range of 5-10. The produced biosurfactant could reduce the surface tension of water from 72 to 43 mN/m with a CMC of 1.21 mg/mL. The strain growing at a temperature of 45 °C produces a substantial amount of 5 g/L of biosurfactant in the medium supplemented with sunflower oil as the sole carbon source. Response surface methodology was employed to optimize the biosurfactant production using sunflower oil, sodium nitrate, and yeast extract as variables. The optimization resulted in 6.75 g/L biosurfactant production, i.e., 35% improved as compared to the unoptimized condition. Thin-layer chromatography, FTIR spectroscopy, 1H-NMR spectroscopy, and biochemical composition analysis confirmed the lipopeptide structure of the biosurfactant.

  5. Enterococcus faecium QU 50: a novel thermophilic lactic acid bacterium for high-yield l-lactic acid production from xylose.

    PubMed

    Abdel-Rahman, Mohamed Ali; Tashiro, Yukihiro; Zendo, Takeshi; Sakai, Kenji; Sonomoto, Kenji

    2015-01-01

    Production of optically pure lactic acid from lignocellulosic material for commercial purposes is hampered by several difficulties, including heterofermentation of pentose sugars and high energy consumption by mesophilic lactic acid bacteria. Here, we report a novel lactic acid bacterium, strain QU 50, that has the potential to produce optically pure l-lactic acid (≥99.2%) in a homofermentative manner from xylose under thermophilic conditions. Strain QU 50 was isolated from Egyptian fertile soil and identified as Enterococcus faecium QU 50 by analyzing its sugar fermentation pattern and 16S rRNA gene sequence. Enterococcus faecium QU 50 fermented xylose efficiently to produce lactic acid over wide pH (6.0-10.0) and temperature ranges (30-52°C), with a pH of 6.5 and temperature of 50°C being optimal. To our knowledge, this is the first report of homofermentative lactic acid production from xylose by a thermophilic lactic acid bacterium. © FEMS 2014. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  6. Genome sequence analysis of a flocculant-producing bacterium, Paenibacillus shenyangensis.

    PubMed

    Fu, Lili; Jiang, Binhui; Liu, Jinliang; Zhao, Xin; Liu, Qian; Hu, Xiaomin

    2016-03-01

    To explore the metabolic process of Paenibacillus shenyangensis that is an efficient bioflocculant-producing bacterium. The biosynthesis mechanism of bioflocculation was used to enrich the genome of Paenibacillus shenyangensis and provide a basis for molecular genetics and functional genomics analyses. According to the analysis of de novo assembly, a total of 5,501,467 bp clean reads were generated, and were assembled into 92 contigs. 4800 unigenes were predicted of which 4393 were annotated showing a specific gene function in the NCBI-Nr database. 3423 genes were found in the database of cluster of orthologous groups. Among the 168 Kyoto Encyclopedia of Genes and Genomes database, cell growth and metabolism were the main biological processes, and a potential metabolic pathway was predicted from glucose to exopolysaccharide within the starch and sucrose metabolism pathway. By using the high-throughput sequencing technology, we provide a genome analysis of Paenibacillus shenyangensis that predicts the main metabolic processes and a potential pathway of exopolysaccharide biosynthesis.

  7. Enhanced bactericidal potency of nanoliposomes by modification of the fusion activity between liposomes and bacterium.

    PubMed

    Ma, Yufan; Wang, Zhao; Zhao, Wen; Lu, Tingli; Wang, Rutao; Mei, Qibing; Chen, Tao

    2013-01-01

    Pseudomonas aeruginosa represents a good model of antibiotic resistance. These organisms have an outer membrane with a low level of permeability to drugs that is often combined with multidrug efflux pumps, enzymatic inactivation of the drug, or alteration of its molecular target. The acute and growing problem of antibiotic resistance of Pseudomonas to conventional antibiotics made it imperative to develop new liposome formulations to overcome these mechanisms, and investigate the fusion between liposome and bacterium. The rigidity, stability and charge properties of phospholipid vesicles were modified by varying the cholesterol, 1,2-dioleoyl-sn-glycero-3-phosphatidylethanolamine (DOPE), and negatively charged lipids 1,2-dimyristoyl-sn-glycero-3-phosphoglycerol sodium salt (DMPG), 1,2-dimyristoyl-sn-glycero-3-phopho-L-serine sodium salt (DMPS), 1,2-dimyristoyl-sn-glycero-3-phosphate monosodium salt (DMPA), nature phosphatidylserine sodium salt from brain and nature phosphatidylinositol sodium salt from soybean concentrations in liposomes. Liposomal fusion with intact bacteria was monitored using a lipid-mixing assay. It was discovered that the fluid liposomes-bacterium fusion is not dependent on liposomal size and lamellarity. A similar degree of fusion was observed for liposomes with a particle size from 100 to 800 nm. The fluidity of liposomes is an essential pre-request for liposomes fusion with bacteria. Fusion was almost completely inhibited by incorporation of cholesterol into fluid liposomes. The increase in the amount of negative charges in fluid liposomes reduces fluid liposomes-bacteria fusion when tested without calcium cations due to electric repulsion, but addition of calcium cations brings the fusion level of fluid liposomes to similar or higher levels. Among the negative phospholipids examined, DMPA gave the highest degree of fusion, DMPS and DMPG had intermediate fusion levels, and PI resulted in the lowest degree of fusion. Furthermore, the fluid

  8. Enhanced bactericidal potency of nanoliposomes by modification of the fusion activity between liposomes and bacterium

    PubMed Central

    Ma, Yufan; Wang, Zhao; Zhao, Wen; Lu, Tingli; Wang, Rutao; Mei, Qibing; Chen, Tao

    2013-01-01

    Background Pseudomonas aeruginosa represents a good model of antibiotic resistance. These organisms have an outer membrane with a low level of permeability to drugs that is often combined with multidrug efflux pumps, enzymatic inactivation of the drug, or alteration of its molecular target. The acute and growing problem of antibiotic resistance of Pseudomonas to conventional antibiotics made it imperative to develop new liposome formulations to overcome these mechanisms, and investigate the fusion between liposome and bacterium. Methods The rigidity, stability and charge properties of phospholipid vesicles were modified by varying the cholesterol, 1,2-dioleoyl-sn-glycero-3-phosphatidylethanolamine (DOPE), and negatively charged lipids 1,2-dimyristoyl-sn-glycero-3-phosphoglycerol sodium salt (DMPG), 1,2-dimyristoyl-sn-glycero-3-phopho-L-serine sodium salt (DMPS), 1,2-dimyristoyl-sn-glycero-3-phosphate monosodium salt (DMPA), nature phosphatidylserine sodium salt from brain and nature phosphatidylinositol sodium salt from soybean concentrations in liposomes. Liposomal fusion with intact bacteria was monitored using a lipid-mixing assay. Results It was discovered that the fluid liposomes-bacterium fusion is not dependent on liposomal size and lamellarity. A similar degree of fusion was observed for liposomes with a particle size from 100 to 800 nm. The fluidity of liposomes is an essential pre-request for liposomes fusion with bacteria. Fusion was almost completely inhibited by incorporation of cholesterol into fluid liposomes. The increase in the amount of negative charges in fluid liposomes reduces fluid liposomes-bacteria fusion when tested without calcium cations due to electric repulsion, but addition of calcium cations brings the fusion level of fluid liposomes to similar or higher levels. Among the negative phospholipids examined, DMPA gave the highest degree of fusion, DMPS and DMPG had intermediate fusion levels, and PI resulted in the lowest degree of fusion

  9. Partial genome sequence of the haloalkaliphilic soda lake bacterium Thioalkalivibrio thiocyanoxidans ARh 2 T

    DOE PAGES

    Berben, Tom; Sorokin, Dimitry Y.; Ivanova, Natalia; ...

    2015-10-26

    Thioalkalivibrio thiocyanoxidans strain ARh 2 T is a sulfur-oxidizing bacterium isolated from haloalkaline soda lakes. It is a motile, Gram-negative member of the Gammaproteobacteria. Remarkable properties include the ability to grow on thiocyanate as the sole energy, sulfur and nitrogen source, and the capability of growth at salinities of up to 4.3 M total Na +. This draft genome sequence consists of 61 scaffolds comprising 2,765,337 bp, and contains 2616 protein-coding and 61 RNA-coding genes. In conclusion, this organism was sequenced as part of the Community Science Program of the DOE Joint Genome Institute.

  10. Axenic Culture of a Candidate Division TM7 Bacterium from the Human Oral Cavity and Biofilm Interactions with Other Oral Bacteria

    PubMed Central

    Soro, Valeria; Dutton, Lindsay C.; Sprague, Susan V.; Nobbs, Angela H.; Ireland, Anthony J.; Sandy, Jonathan R.; Jepson, Mark A.; Micaroni, Massimo; Splatt, Peter R.; Dymock, David

    2014-01-01

    The diversity of bacterial species in the human oral cavity is well recognized, but a high proportion of them are presently uncultivable. Candidate division TM7 bacteria are almost always detected in metagenomic studies but have not yet been cultivated. In this paper, we identified candidate division TM7 bacterial phylotypes in mature plaque samples from around orthodontic bonds in subjects undergoing orthodontic treatment. Successive rounds of enrichment in laboratory media led to the isolation of a pure culture of one of these candidate division TM7 phylotypes. The bacteria formed filaments of 20 to 200 μm in length within agar plate colonies and in monospecies biofilms on salivary pellicle and exhibited some unusual morphological characteristics by transmission electron microscopy, including a trilaminated cell surface layer and dense cytoplasmic deposits. Proteomic analyses of cell wall protein extracts identified abundant polypeptides predicted from the TM7 partial genomic sequence. Pleiomorphic phenotypes were observed when the candidate division TM7 bacterium was grown in dual-species biofilms with representatives of six different oral bacterial genera. The TM7 bacterium formed long filaments in dual-species biofilm communities with Actinomyces oris or Fusobacterium nucleatum. However, the TM7 isolate grew as short rods or cocci in dual-species biofilms with Porphyromonas gingivalis, Prevotella intermedia, Parvimonas micra, or Streptococcus gordonii, forming notably robust biofilms with the latter two species. The ability to cultivate TM7 axenically should majorly advance understanding of the physiology, genetics, and virulence properties of this novel candidate division oral bacterium. PMID:25107981

  11. Axenic culture of a candidate division TM7 bacterium from the human oral cavity and biofilm interactions with other oral bacteria.

    PubMed

    Soro, Valeria; Dutton, Lindsay C; Sprague, Susan V; Nobbs, Angela H; Ireland, Anthony J; Sandy, Jonathan R; Jepson, Mark A; Micaroni, Massimo; Splatt, Peter R; Dymock, David; Jenkinson, Howard F

    2014-10-01

    The diversity of bacterial species in the human oral cavity is well recognized, but a high proportion of them are presently uncultivable. Candidate division TM7 bacteria are almost always detected in metagenomic studies but have not yet been cultivated. In this paper, we identified candidate division TM7 bacterial phylotypes in mature plaque samples from around orthodontic bonds in subjects undergoing orthodontic treatment. Successive rounds of enrichment in laboratory media led to the isolation of a pure culture of one of these candidate division TM7 phylotypes. The bacteria formed filaments of 20 to 200 μm in length within agar plate colonies and in monospecies biofilms on salivary pellicle and exhibited some unusual morphological characteristics by transmission electron microscopy, including a trilaminated cell surface layer and dense cytoplasmic deposits. Proteomic analyses of cell wall protein extracts identified abundant polypeptides predicted from the TM7 partial genomic sequence. Pleiomorphic phenotypes were observed when the candidate division TM7 bacterium was grown in dual-species biofilms with representatives of six different oral bacterial genera. The TM7 bacterium formed long filaments in dual-species biofilm communities with Actinomyces oris or Fusobacterium nucleatum. However, the TM7 isolate grew as short rods or cocci in dual-species biofilms with Porphyromonas gingivalis, Prevotella intermedia, Parvimonas micra, or Streptococcus gordonii, forming notably robust biofilms with the latter two species. The ability to cultivate TM7 axenically should majorly advance understanding of the physiology, genetics, and virulence properties of this novel candidate division oral bacterium. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  12. Characterization of a new oligoalginate lyase from marine bacterium Vibrio sp.

    PubMed

    Yu, Zuochen; Zhu, Benwei; Wang, Wenxia; Tan, Haidong; Yin, Heng

    2018-06-01

    A new oligoalginate lyase encoding gene, designed oal17A, was cloned from marine bacterium Vibrio sp. W13, and then expressed in Escherichia coli. The recombinant Oal17A was purified by NTA-Ni resin with maximal activity at 30°C and pH7.0. Oal17A exhibited broad substrate specificity, and preferred to degrade alginate than polyM or polyG into monosaccharide acid. The specific activity of Oal17A toward alginate, polyM and polyG was 21.14U/mg, 12.31U/mg and 7.43U/mg, respectively. With features of high-level expression and broad substrate specificity, Oal17A would be a potential tool for alginate monomer production process of alginate utilizing for biofuels and bioethanol production. Copyright © 2018 Elsevier B.V. All rights reserved.

  13. Photoinhibition of Phaeocystis globosa resulting from oxidative stress induced by a marine algicidal bacterium Bacillus sp. LP-10.

    PubMed

    Guan, Chengwei; Guo, Xiaoyun; Li, Yi; Zhang, Huajun; Lei, Xueqian; Cai, Guanjing; Guo, Jiajia; Yu, Zhiming; Zheng, Tianling

    2015-11-25

    Harmful algal blooms caused by Phaeocystis globosa have resulted in staggering losses to coastal countries because of their world-wide distribution. Bacteria have been studied for years to control the blooms of harmful alga, however, the action mechanism of them against harmful algal cells is still not well defined. Here, a previously isolated algicidal bacterium Bacillus sp. LP-10 was used to elucidate the potential mechanism involved in the dysfunction of P. globosa algal cells at physiological and molecular levels. Our results showed Bacillus sp. LP-10 induced an obvious rise of reactive oxygen species (ROS), which was supposed to be major reason for algal cell death. Meanwhile, the results revealed a significant decrease of photosynthetic physiological indexes and apparent down-regulated of photosynthesis-related genes (psbA and rbcS) and protein (PSII reaction center protein D1), after treated by Bacillus sp. LP-10 filtrates, suggesting photoinhibition occurred in the algal cells. Furthermore, our results indicated that light played important roles in the algal cell death. Our work demonstrated that the major lethal reason of P. globosa cells treated by the algicidal bacterium was the photoinhibition resulted from oxidative stress induced by Bacillus sp. LP-10.

  14. Recovery of a fish pathogenic bacterium, Aeromonas salmonicida, from ebonyshell mussels Fusconaia ebena using nondestructive sample collection procedures

    USGS Publications Warehouse

    Starliper, C.E.

    2008-01-01

    Refugia are increasingly being used to maintain and propagate imperiled freshwater mussels for future population augmentations. Success for this endeavor is dependent on good husbandry, including a holistic program of resource health management. A significant aspect to optimal health is the prevention or control of infectious diseases. Describing and monitoring pathogens and diseases in mussels involves examination of tissues or samples collected from an appropriate number of individuals that satisfies a certain confidence level for expected prevalences of infections. In the present study, ebonyshell mussels Fusconaia ebena were infected with a fish pathogenic bacterium, Aeromonas salmonicida, through their cohabitation with diseased brook trout Salvelinus fontinalis. At a 100% prevalence of infection, the F. ebena were removed from the cohabitation tank to clean tanks that were supplied with pathogen-free water, which initiated their depuration of A. salmonicida. Three samples (nondestructive fluid, mantle, hemolymph) collected using nondestructive procedures were compared with fluids and soft tissue homogenates collected after sacrificing the mussels for recovery of the bacterium during this period of depuration. Nondestructive sample collections, especially ND fluid, provide a comparable alternative to sacrificing mussels to determine pathogen status.

  15. Amino Acid and Peptide Utilization Profiles of the Fluoroacetate-Degrading Bacterium Synergistetes Strain MFA1 Under Varying Conditions.

    PubMed

    Leong, Lex E X; Denman, Stuart E; Hugenholtz, Philip; McSweeney, Christopher S

    2016-02-01

    Synergistetes strain MFA1 is an asaccharolytic ruminal bacterium isolated based on its ability to degrade fluoroacetate, a plant toxin. The amino acid and peptide requirements of the bacterium were investigated under different culturing conditions. The growth of strain MFA1 and its fluoroacetate degradation rate were enhanced by peptide-rich protein hydrolysates (tryptone and yeast extract) compared to casamino acid, an amino acid-rich protein hydrolysate. Complete utilization and preference for arginine, asparagine, glutamate, glycine, and histidine as free amino acids from yeast extract were observed, while the utilization of serine, threonine, and lysine in free form and peptide-bound glutamate was stimulated during growth on fluoroacetate. A predominant peptide in yeast extract preferentially utilized by strain MFA1 was partially characterized by high-liquid performance chromatography-mass spectrometry as a hepta-glutamate oligopeptide. Similar utilization profiles of amino acids were observed between the co-culture of strain MFA1 with Methanobrevibacter smithii without fluoroacetate and pure strain MFA1 culture with fluoroacetate. This suggests that growth of strain MFA1 could be enhanced by a reduction of hydrogen partial pressure as a result of hydrogen removal by a methanogen or reduction of fluoroacetate.

  16. Draft Genome Sequence of Bacillus amyloliquefaciens EBL11, a New Strain of Plant Growth-Promoting Bacterium Isolated from Rice Rhizosphere

    PubMed Central

    Wang, Yinghuan; Greenfield, Paul; Jin, Decai

    2014-01-01

    Bacillus amyloliquefaciens strain EBL11 is a bacterium that can promote plant growth by inhibiting the growth of fungi on plant surfaces and providing nutrients as a nonchemical biofertilizer. The estimated genome of this strain is 4.05 Mb in size and harbors 3,683 coding genes (CDSs). PMID:25059875

  17. Draft Genome Sequence of Burkholderia gladioli Coa14, a Bacterium with Petroleum Bioremediation Potential Isolated from Coari Lake, Amazonas, Brazil

    PubMed Central

    Da Costa, Josemar Gurgel; Wolf, Ivan Rodrigo; Lima, José Paulo de Araújo; Astolfi-Filho, Spartaco

    2018-01-01

    ABSTRACT Burkholderia gladioli Coa14 is a bacterium isolated from water collected from Coari Lake (Amazonas, Brazil) that shows a capacity for survival in a medium containing only oil as a carbon source. Here, we report its draft genome sequence, highlighting some genes involved with petroleum derivative degradation. PMID:29674552

  18. Tepidimonas arfidensis Sp. Nov., a Novel Gram-negative and thermophilic bacterium isolated from the bone marrow of a patient with leukemia in Korea.

    PubMed

    Ko, Kwan Soo; Lee, Nam Yong; Oh, Won Sup; Lee, Jang Ho; Ki, Hyun Kyun; Peck, Kyong Ran; Song, Jae-Hoon

    2005-01-01

    A Gram-negative bacillus, SMC-6271(T), which was isolated from the bone marrow of a patient with leukemia but could not be identified by a conventional microbiologic method, was characterized by a genotypic analysis of 16S rRNA gene. Sequences of the 16S rRNA gene revealed that this bacterium was closely related to Tepidimonas ignava and other slightly thermophilic isolates but diverged distinctly from them. Analyses of cellular fatty acid composition and performance of biochemical tests confirmed that this bacterium is a distinct species from the other Tepidimonas species. Based on the evaluated phenotypic and genotypic characteristics, it is proposed that SMC-6271T (=ABB 0301T =KCTC 12412T =JCM 13232T) should be classified as a new species, namely Tepidimonas arfidensis sp. nov.

  19. Thermophilic anaerobic degradation of butyrate by a butyrate-utilizing bacterium in coculture and triculture with methanogenic bacteria.

    PubMed

    Ahring, B K; Westermann, P

    1987-02-01

    We studied syntrophic butyrate degradation in thermophilic mixed cultures containing a butyrate-degrading bacterium isolated in coculture with Methanobacterium thermoautotrophicum or in triculture with M. thermoautotrophicum and the TAM organism, a thermophilic acetate-utilizing methanogenic bacterium. Butyrate was beta-oxidized to acetate with protons as the electron acceptors. Acetate was used concurrently with its production in the triculture. We found a higher butyrate degradation rate in the triculture, in which both hydrogen and acetate were utilized, than in the coculture, in which acetate accumulated. Yeast extract, rumen fluid, and clarified digestor fluid stimulated butyrate degradation, while the effect of Trypticase was less pronounced. Penicillin G, d-cycloserine, and vancomycin caused complete inhibition of butyrate utilization by the cultures. No growth or degradation of butyrate occurred when 2-bromoethanesulfonic acid or chloroform, specific inhibitors of methanogenic bacteria, was added to the cultures and common electron acceptors such as sulfate, nitrate, and fumarate were not used with butyrate as the electron donor. Addition of hydrogen or oxygen to the gas phase immediately stopped growth and butyrate degradation by the cultures. Butyrate was, however, metabolized at approximately the same rate when hydrogen was removed from the cultures and was metabolized at a reduced rate in the cultures previously exposed to hydrogen.

  20. Discovery of a Novel Periodontal Disease-Associated Bacterium.

    PubMed

    Torres, Pedro J; Thompson, John; McLean, Jeffrey S; Kelley, Scott T; Edlund, Anna

    2018-06-02

    One of the world's most common infectious disease, periodontitis (PD), derives from largely uncharacterized communities of oral bacteria growing as biofilms (a.k.a. plaque) on teeth and gum surfaces in periodontal pockets. Bacteria associated with periodontal disease trigger inflammatory responses in immune cells, which in later stages of the disease cause loss of both soft and hard tissue structures supporting teeth. Thus far, only a handful of bacteria have been characterized as infectious agents of PD. Although deep sequencing technologies, such as whole community shotgun sequencing have the potential to capture a detailed picture of highly complex bacterial communities in any given environment, we still lack major reference genomes for the oral microbiome associated with PD and other diseases. In recent work, by using a combination of supervised machine learning and genome assembly, we identified a genome from a novel member of the Bacteroidetes phylum in periodontal samples. Here, by applying a comparative metagenomics read-classification approach, including 272 metagenomes from various human body sites, and our previously assembled draft genome of the uncultivated Candidatus Bacteroides periocalifornicus (CBP) bacterium, we show CBP's ubiquitous distribution in dental plaque, as well as its strong association with the well-known pathogenic "red complex" that resides in deep periodontal pockets.

  1. Yersinia ruckeri sp. nov., the redmouth (RM) bacterium

    USGS Publications Warehouse

    Ewing, W.H.; Ross, A.J.; Brenner, Don J.; Fanning, G. R.

    1978-01-01

    Cultures of the redmouth (RM) bacterium, one of the etiological agents of redmouth disease in rainbow trout (Salmo gairdneri) and certain other fishes, were characterized by means of their biochemical reactions, by deoxyribonucleic acid (DNA) hybridization, and by determination of guanine-plus-cytosine (G+C) ratios in DNA. The DNA relatedness studies confirmed the fact that the RM bacteria are members of the family Enterobacteriaceae and that they comprise a single species that is not closely related to any other species of Enterobacteriaceae. They are about 30% related to species of both Serratia and Yersinia. A comparison of the biochemical reactions of RM bacteria and serratiae indicated that there are many differences between these organisms and that biochemically the RM bacteria are most closely related to yersiniae. The G+C ratios of RM bacteria were approximated to be between 47.5 and 48.5% These values are similar to those of yersiniae but markedly different from those of serratiae. On the basis of their biochemical reactions and their G+C ratios, the RM bacteria are considered to be a new species of Yersinia, for which the name Yersinia ruckeri is proposed. Strain 2396-61 (= ATCC 29473) is designated the type strain of the species.

  2. Plant growth-promoting bacterium Acinetobacter calcoaceticus P23 increases the chlorophyll content of the monocot Lemna minor (duckweed) and the dicot Lactuca sativa (lettuce).

    PubMed

    Suzuki, Wakako; Sugawara, Masayuki; Miwa, Kyoko; Morikawa, Masaaki

    2014-07-01

    Acinetobacter calcoaceticus P23 is a plant growth-promoting bacterium that was isolated from the surface of duckweed (Lemna aoukikusa). The bacterium was observed to colonize on the plant surfaces and increase the chlorophyll content of not only the monocotyledon Lemna minor but also the dicotyledon Lactuca sativa in a hydroponic culture. This effect on the Lactuca sativa was significant in nutrient-poor (×1/100 dilution of H2 medium) and not nutrient-rich (×1 or ×1/10 dilutions of H2 medium) conditions. Strain P23 has the potential to play a part in the future development of fertilizers and energy-saving hydroponic agricultural technologies. Copyright © 2013 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  3. Genetic diversity in natural populations of a soil bacterium across a landscape gradient

    PubMed Central

    McArthur, J. Vaun; Kovacic, David A.; Smith, Michael H.

    1988-01-01

    Genetic diversity in natural populations of the bacterium Pseudomonas cepacia was surveyed in 10 enzymes from 70 clones isolated along a landscape gradient. Estimates of genetic diversity, ranging from 0.54 to 0.70, were higher than any previously reported values of which we are aware and were positively correlated with habitat variability. Patterns of bacterial genetic diversity were correlated with habitat variability. Findings indicate that the source of strains used in genetic engineering will greatly affect the outcome of planned releases in variable environments. Selection of generalist strains may confer a large advantage to engineered populations, while selection of laboratory strains may result in quick elimination of the engineered strains. PMID:16594009

  4. Complete Genome Sequence of Alkaliphilus metalliredigens Strain QYMF, an Alkaliphilic and Metal-Reducing Bacterium Isolated from Borax-Contaminated Leachate Ponds

    PubMed Central

    Copeland, A.; Lucas, S.; Lapidus, A.; Barry, K.; Detter, J. C.; Glavina del Rio, T.; Hammon, N.; Israni, S.; Dalin, E.; Tice, H.; Pitluck, S.; Chertkov, O.; Brettin, T.; Bruce, D.; Han, C.; Schmutz, J.; Larimer, F.; Land, M. L.; Hauser, L.; Kyrpides, N.; Mikhailova, N.; Ye, Q.; Zhou, J.; Richardson, P.; Fields, M. W.

    2016-01-01

    Alkaliphilus metalliredigens strain QYMF is an anaerobic, alkaliphilic, and metal-reducing bacterium associated with phylum Firmicutes. QYMF was isolated from alkaline borax leachate ponds. The genome sequence will help elucidate the role of metal-reducing microorganisms under alkaline environments, a capability that is not commonly observed in metal respiring-microorganisms. PMID:27811105

  5. Draft Genome Sequence of the Extremely Halophilic Bacterium Halomonas salina Strain CIFRI1, Isolated from the East Coast of India

    PubMed Central

    Das, Priyanka; Maharana, Jitendra; Paria, Prasenjit; Mandal, Shambhu Nath; Meena, Dharmendra Kumar; Sharma, Anil Prakash; Jayarajan, Rijith; Dixit, Vishal; Verma, Ankit; Vellarikkal, Shamsudheen Karuthedath; Scaria, Vinod; Sivasubbu, Sridhar; Rao, Atmakuri Ramakrishna; Mohapatra, Trilochan

    2015-01-01

    Halomonas salina strain CIFRI1 is an extremely salt-stress-tolerant bacterium isolated from the salt crystals of the east coast of India. Here we report the annotated 3.45-Mb draft genome sequence of strain CIFRI1 having 86 contigs with 3,139 protein coding loci, including 62 RNA genes. PMID:25573926

  6. Draft Genome Sequence of Lactobacillus delbrueckii subsp. bulgaricus CFL1, a Lactic Acid Bacterium Isolated from French Handcrafted Fermented Milk.

    PubMed

    Meneghel, Julie; Dugat-Bony, Eric; Irlinger, Françoise; Loux, Valentin; Vidal, Marie; Passot, Stéphanie; Béal, Catherine; Layec, Séverine; Fonseca, Fernanda

    2016-03-03

    Lactobacillus delbrueckii subsp. bulgaricus (L. bulgaricus) is a lactic acid bacterium widely used for the production of yogurt and cheeses. Here, we report the genome sequence of L. bulgaricus CFL1 to improve our knowledge on its stress-induced damages following production and end-use processes. Copyright © 2016 Meneghel et al.

  7. Draft Genome Sequence of Burkholderia gladioli Coa14, a Bacterium with Petroleum Bioremediation Potential Isolated from Coari Lake, Amazonas, Brazil.

    PubMed

    Lopes, Eraldo Ferreira; Da Costa, Josemar Gurgel; Wolf, Ivan Rodrigo; Lima, José Paulo de Araújo; Astolfi-Filho, Spartaco

    2018-04-19

    Burkholderia gladioli Coa14 is a bacterium isolated from water collected from Coari Lake (Amazonas, Brazil) that shows a capacity for survival in a medium containing only oil as a carbon source. Here, we report its draft genome sequence, highlighting some genes involved with petroleum derivative degradation. Copyright © 2018 Lopes et al.

  8. Corky Root of Lettuce Caused by Strains of a Gram-Negative Bacterium from Muck Soils of Florida, New York, and Wisconsin

    PubMed Central

    van Bruggen, Ariena H. C.; Brown, Philip R.; Jochimsen, Kenneth N.

    1989-01-01

    Slow-growing bacteria similar to the bacterium causing lettuce corky root (CR) in California (strain CA1) were isolated from muck soils of Florida, New York, and Wisconsin, using lettuce seedlings as bait. All strains were tested for reaction with polyclonal antibodies produced against strain CA1 and for pathogenicity on CR-susceptible (Salinas) and CR-resistant (Green Lake) lettuce cultivars in a greenhouse. Five strains from Florida, three from New York, and three from Wisconsin induced severe CR symptoms on Salinas and mild symptoms on Green Lake. All strains were gram-negative, aerobic, oxidase positive, and catalase positive and reduced nitrate to ammonia. Whole-cell fatty acid compositions were similar for all strains and resembled that of Pseudomonas paucimobilis. Since this fatty acid pattern is unique, it is suggested that CR of lettuce is caused by strains of the same bacterium in Florida, New York, Wisconsin, and California. Images PMID:16348032

  9. Genome Sequence of the Plant Growth Promoting Endophytic Bacterium Enterobacter sp. 638

    PubMed Central

    Taghavi, Safiyh; van der Lelie, Daniel; Hoffman, Adam; Zhang, Yian-Biao; Walla, Michael D.; Vangronsveld, Jaco; Newman, Lee; Monchy, Sébastien

    2010-01-01

    Enterobacter sp. 638 is an endophytic plant growth promoting gamma-proteobacterium that was isolated from the stem of poplar (Populus trichocarpa×deltoides cv. H11-11), a potentially important biofuel feed stock plant. The Enterobacter sp. 638 genome sequence reveals the presence of a 4,518,712 bp chromosome and a 157,749 bp plasmid (pENT638-1). Genome annotation and comparative genomics allowed the identification of an extended set of genes specific to the plant niche adaptation of this bacterium. This includes genes that code for putative proteins involved in survival in the rhizosphere (to cope with oxidative stress or uptake of nutrients released by plant roots), root adhesion (pili, adhesion, hemagglutinin, cellulose biosynthesis), colonization/establishment inside the plant (chemiotaxis, flagella, cellobiose phosphorylase), plant protection against fungal and bacterial infections (siderophore production and synthesis of the antimicrobial compounds 4-hydroxybenzoate and 2-phenylethanol), and improved poplar growth and development through the production of the phytohormones indole acetic acid, acetoin, and 2,3-butanediol. Metabolite analysis confirmed by quantitative RT–PCR showed that, the production of acetoin and 2,3-butanediol is induced by the presence of sucrose in the growth medium. Interestingly, both the genetic determinants required for sucrose metabolism and the synthesis of acetoin and 2,3-butanediol are clustered on a genomic island. These findings point to a close interaction between Enterobacter sp. 638 and its poplar host, where the availability of sucrose, a major plant sugar, affects the synthesis of plant growth promoting phytohormones by the endophytic bacterium. The availability of the genome sequence, combined with metabolome and transcriptome analysis, will provide a better understanding of the synergistic interactions between poplar and its growth promoting endophyte Enterobacter sp. 638. This information can be further exploited to

  10. Helicobacter pylori infection and chronic immune thrombocytopenic purpura: long-term results of bacterium eradication and association with bacterium virulence profiles.

    PubMed

    Emilia, Giovanni; Luppi, Mario; Zucchini, Patrizia; Morselli, Monica; Potenza, Leonardo; Forghieri, Fabio; Volzone, Francesco; Jovic, Gordana; Leonardi, Giovanna; Donelli, Amedea; Torelli, Giuseppe

    2007-12-01

    Eradication of Helicobacter pylori may lead to improvement of chronic immune thrombocytopenic purpura (ITP), although its efficacy over time is uncertain. We report the results of H pylori screening and eradication in 75 consecutive adult patients with ITP. We also used molecular methods to investigate lymphocyte clonality and H pylori genotypes in the gastric biopsies from 10 H pylori-positive patients with ITP and 19 H pylori-positive patients without ITP with chronic gastritis. Active H pylori infection was documented in 38 (51%) patients and successfully eradicated in 34 (89%) patients. After a median follow-up of 60 months, a persistent platelet response in 23 (68%) of patients with eradicated infection was observed; 1 relapse occurred. No differences in mucosal B- or T-cell clonalities were observed between patients with ITP and control participants. Of note, the frequency of the H pylori cagA gene (P = .02) and the frequency of concomitant H pylori cagA, vacAs1, and iceA genes (triple-positive strains; P = .015) resulted statistically higher in patients with ITP than in control participants. All asymptomatic H pylori-positive patients with ITP were suffering from chronic gastritis. Our data suggest a sustained platelet recovery in a proportion of patients with ITP by H pylori eradication alone. Overrepresentation of specific H pylori genotypes in ITP suggests a possible role for bacterium-related factors in the disease pathogenesis.

  11. Effects of Calcium Ions on the Thermostability and Spectroscopic Properties of the LH1-RC Complex from a New Thermophilic Purple Bacterium Allochromatium tepidum.

    PubMed

    Kimura, Yukihiro; Lyu, Shuwen; Okoshi, Akira; Okazaki, Koudai; Nakamura, Natsuki; Ohashi, Akira; Ohno, Takashi; Kobayashi, Manami; Imanishi, Michie; Takaichi, Shinichi; Madigan, Michael T; Wang-Otomo, Zheng-Yu

    2017-05-18

    The light harvesting-reaction center (LH1-RC) complex from a new thermophilic purple sulfur bacterium Allochromatium (Alc.) tepidum was isolated and characterized by spectroscopic and thermodynamic analyses. The purified Alc. tepidum LH1-RC complex showed a high thermostability comparable to that of another thermophilic purple sulfur bacterium Thermochromatium tepidum, and spectroscopic characteristics similar to those of a mesophilic bacterium Alc. vinosum. Approximately 4-5 Ca 2+ per LH1-RC were detected by inductively coupled plasma atomic emission spectroscopy and isothermal titration calorimetry. Upon removal of Ca 2+ , the denaturing temperature of the Alc. tepidum LH1-RC complex dropped accompanied by a blue-shift of the LH1 Q y absorption band. The effect of Ca 2+ was also observed in the resonance Raman shift of the C3-acetyl νC═O band of bacteriochlorophyll-a, indicating changes in the hydrogen-bonding interactions between the pigment and LH1 polypeptides. Thermodynamic parameters for the Ca 2+ -binding to the Alc. tepidum LH1-RC complex indicated that this reaction is predominantly driven by the largely favorable electrostatic interactions that counteract the unfavorable negative entropy change. Our data support a hypothesis that Alc. tepidum may be a transitional organism between mesophilic and thermophilic purple bacteria and that Ca 2+ is one of the major keys to the thermostability of LH1-RC complexes in purple bacteria.

  12. Characterization of Marinomonas algicida sp. nov., a novel algicidal marine bacterium isolated from seawater.

    PubMed

    Kristyanto, Sylvia; Chaudhary, Dhiraj Kumar; Lee, Sang-Seob; Kim, Jaisoo

    2017-11-01

    A novel Marinomonas-like, aerobic, Gram-reaction-negative, moderately halophilic, acidophilic, motile by a single polar flagellum, non-spore-forming, rod-shaped bacterium that showed algalytic activity, designated strain Yeongu 1-4 T , was isolated from surface seawater of Geoje Island in the South Sea, Republic of Korea. The strain was oxidase-negative and weakly positive for catalase. Growth of this bacterium was observed at temperatures from 4 to 42 °C, at salinities from 0 to 12 % and at pH from 4.5 to 9.0, and it was not able to degrade starch, gelatin, casein or Tween 80. Phylogenetic analysis based on 16S rRNA gene sequences showed that strain Yeongu 1-4 T was related most closely to Marinomonas spartinae SMJ19 T with similarity of 99.3 %. However, levels of DNA-DNA relatedness between strain Yeongu 1-4 T and the most closely related species were lower than 70 %, confirming that they represent distinct genomic species. The genomic DNA G+C content of strain Yeongu 1-4 T was 44.2 mol%. The organism used Q-8 as the predominant respiratory quinone, and C16 : 1ω7c, C18 : 1ω7c and C16 : 0 as major cellular fatty acids. Based on data from this polyphasic taxonomic study, strain Yeongu 1-4 T belongs to a novel species of the genus Marinomonas, within the family Oceanospirillaceae, for which the name Marinomonas algicida is proposed. The type strain is Yeongu 1-4 T (=KEMB 9005-327 T =MCCC 1K00609 T ).

  13. Osmoregulation in the Halophilic Bacterium Halomonas elongata: A Case Study for Integrative Systems Biology.

    PubMed

    Kindzierski, Viktoria; Raschke, Silvia; Knabe, Nicole; Siedler, Frank; Scheffer, Beatrix; Pflüger-Grau, Katharina; Pfeiffer, Friedhelm; Oesterhelt, Dieter; Marin-Sanguino, Alberto; Kunte, Hans-Jörg

    2017-01-01

    Halophilic bacteria use a variety of osmoregulatory methods, such as the accumulation of one or more compatible solutes. The wide diversity of compounds that can act as compatible solute complicates the task of understanding the different strategies that halophilic bacteria use to cope with salt. This is specially challenging when attempting to go beyond the pathway that produces a certain compatible solute towards an understanding of how the metabolic network as a whole addresses the problem. Metabolic reconstruction based on genomic data together with Flux Balance Analysis (FBA) is a promising tool to gain insight into this problem. However, as more of these reconstructions become available, it becomes clear that processes predicted by genome annotation may not reflect the processes that are active in vivo. As a case in point, E. coli is unable to grow aerobically on citrate in spite of having all the necessary genes to do it. It has also been shown that the realization of this genetic potential into an actual capability to metabolize citrate is an extremely unlikely event under normal evolutionary conditions. Moreover, many marine bacteria seem to have the same pathways to metabolize glucose but each species uses a different one. In this work, a metabolic network inferred from genomic annotation of the halophilic bacterium Halomonas elongata and proteomic profiling experiments are used as a starting point to motivate targeted experiments in order to find out some of the defining features of the osmoregulatory strategies of this bacterium. This new information is then used to refine the network in order to describe the actual capabilities of H. elongata, rather than its genetic potential.

  14. Metabolism of Kaempferia parviflora polymethoxyflavones by human intestinal bacterium Bautia sp. MRG-PMF1.

    PubMed

    Kim, Mihyang; Kim, Nayoung; Han, Jaehong

    2014-12-24

    Poylmethoxyflavones (PMFs) are major bioactive flavonoids, which exhibit various biological activities, such as anticancer effects. The biotransformation of PMFs and characterization of a PMF-metabolizing human intestinal bacterium were studied herein for the first time. Hydrolysis of aryl methyl ether functional groups by human fecal samples was observed from the bioconversion of various PMFs. Activity-guided screening for PMF-metabolizing intestinal bacteria under anaerobic conditions resulted in the isolation of a strict anaerobic bacterium, which was identified as Blautia sp. MRG-PMF1. The isolated MRG-PMF1 was able to metabolize various PMFs to the corresponding demethylated flavones. The microbial conversion of bioactive 5,7-dimethoxyflavone (5,7-DMF) and 5,7,4'-trimethoxyflavone (5,7,4'-TMF) was studied in detail. 5,7-DMF and 5,7,4'-TMF were completely metabolized to 5,7-dihydroxyflavone (chrysin) and 5,7,4'-trihydroxyflavone (apigenin), respectively. From a kinetics study, the methoxy group on the flavone C-7 position was found to be preferentially hydrolyzed. 5-Methoxychrysin, the intermediate of 5,7-DMF metabolism by Blautia sp. MRG-PMF1, was isolated and characterized by nuclear magnetic resonance spectroscopy. Apigenin was produced from the sequential demethylation of 5,7,4'-TMF, via 5,4'-dimethoxy-7-hydroxyflavone and 7,4'-dihydroxy-5-methoxyflavone (thevetiaflavone). Not only demethylation activity but also deglycosylation activity was exhibited by Blautia sp. MRG-PMF1, and various flavonoids, including isoflavones, flavones, and flavanones, were found to be metabolized to the corresponding aglycones. The unprecedented PMF demethylation activity of Blautia sp. MRG-PMF1 will expand our understanding of flavonoid metabolism in the human intestine and lead to novel bioactive compounds.

  15. Isolation and characterization of a new hydrogen-utilizing bacterium from the rumen.

    PubMed

    Rieu-Lesme, F; Fonty, G; Doré, J

    1995-01-01

    A new H2/CO2-utilizing acetogenic bacterium was isolated from the rumen of a mature deer. This is the first report of a spore-forming Gram-negative bacterial species from the rumen. The organism was a strictly anaerobic, motile rod and was able to grow autotrophically on hydrogen and carbon dioxide. Acetate was the major product detected. Glucose, fructose and lactate were also fermented heterotrophically. The optimum pH for growth was 7.0-7.5, and the optimum temperature was 37-42 degrees C. Yeast extract was required for growth and rumen fluid was highly stimulatory. The DNA base ratio was 52.9 +/- 0.5 mol% G+C. On the basis of these characteristics and fermentation products, the isolate was considered to be different from acetogenic bacteria described previously.

  16. Complete genome sequence of Pseudoalteromononas piscicida strain DE2-B, a bacterium with broad inhibitory activity toward human and fish pathogens

    USDA-ARS?s Scientific Manuscript database

    Pseudoalteromonas piscicida strain DE2-B is a halophilic bacterium which has broad inhibitory activity toward vibrios and other human and fish pathogens. We report the first closed genome sequence for this species which consists of two chromosomes (4,128,210 and 1,188,838 bp). Annotation revealed ...

  17. Genome Sequence of the Plant Growth Promoting Endophytic Bacterium Enterobacter sp. 638

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Taghavi, S.; van der Lelie, D.; Hoffman, A.

    2010-05-13

    Enterobacter sp. 638 is an endophytic plant growth promoting gamma-proteobacterium that was isolated from the stem of poplar (Populus trichocarpa x deltoides cv. H11-11), a potentially important biofuel feed stock plant. The Enterobacter sp. 638 genome sequence reveals the presence of a 4,518,712 bp chromosome and a 157,749 bp plasmid (pENT638-1). Genome annotation and comparative genomics allowed the identification of an extended set of genes specific to the plant niche adaptation of this bacterium. This includes genes that code for putative proteins involved in survival in the rhizosphere (to cope with oxidative stress or uptake of nutrients released by plantmore » roots), root adhesion (pili, adhesion, hemagglutinin, cellulose biosynthesis), colonization/establishment inside the plant (chemiotaxis, flagella, cellobiose phosphorylase), plant protection against fungal and bacterial infections (siderophore production and synthesis of the antimicrobial compounds 4-hydroxybenzoate and 2-phenylethanol), and improved poplar growth and development through the production of the phytohormones indole acetic acid, acetoin, and 2,3-butanediol. Metabolite analysis confirmed by quantitative RT-PCR showed that, the production of acetoin and 2,3-butanediol is induced by the presence of sucrose in the growth medium. Interestingly, both the genetic determinants required for sucrose metabolism and the synthesis of acetoin and 2,3-butanediol are clustered on a genomic island. These findings point to a close interaction between Enterobacter sp. 638 and its poplar host, where the availability of sucrose, a major plant sugar, affects the synthesis of plant growth promoting phytohormones by the endophytic bacterium. The availability of the genome sequence, combined with metabolome and transcriptome analysis, will provide a better understanding of the synergistic interactions between poplar and its growth promoting endophyte Enterobacter sp. 638. This information can be further

  18. A predicted physicochemically distinct sub-proteome associated with the intracellular organelle of the anammox bacterium Kuenenia stuttgartiensis.

    PubMed

    Medema, Marnix H; Zhou, Miaomiao; van Hijum, Sacha A F T; Gloerich, Jolein; Wessels, Hans J C T; Siezen, Roland J; Strous, Marc

    2010-05-12

    Anaerobic ammonium-oxidizing (anammox) bacteria perform a key step in global nitrogen cycling. These bacteria make use of an organelle to oxidize ammonia anaerobically to nitrogen (N2) and so contribute approximately 50% of the nitrogen in the atmosphere. It is currently unknown which proteins constitute the organellar proteome and how anammox bacteria are able to specifically target organellar and cell-envelope proteins to their correct final destinations. Experimental approaches are complicated by the absence of pure cultures and genetic accessibility. However, the genome of the anammox bacterium Candidatus "Kuenenia stuttgartiensis" has recently been sequenced. Here, we make use of these genome data to predict the organellar sub-proteome and address the molecular basis of protein sorting in anammox bacteria. Two training sets representing organellar (30 proteins) and cell envelope (59 proteins) proteins were constructed based on previous experimental evidence and comparative genomics. Random forest (RF) classifiers trained on these two sets could differentiate between organellar and cell envelope proteins with ~89% accuracy using 400 features consisting of frequencies of two adjacent amino acid combinations. A physicochemically distinct organellar sub-proteome containing 562 proteins was predicted with the best RF classifier. This set included almost all catabolic and respiratory factors encoded in the genome. Apparently, the cytoplasmic membrane performs no catabolic functions. We predict that the Tat-translocation system is located exclusively in the organellar membrane, whereas the Sec-translocation system is located on both the organellar and cytoplasmic membranes. Canonical signal peptides were predicted and validated experimentally, but a specific (N- or C-terminal) signal that could be used for protein targeting to the organelle remained elusive. A physicochemically distinct organellar sub-proteome was predicted from the genome of the anammox bacterium K

  19. Effect of UV radiation on a thermostable superoxide dismutase purified from a thermophilic bacterium isolated from a sterilization drying oven.

    PubMed

    Monsalves, María T; Amenábar, Maximiliano J; Ollivet-Besson, Gabriela P; Blamey, Jenny M

    2013-07-01

    A thermostable superoxide dismutase from a thermophilic bacterium, called Geobacillus wiegeli (GWE1), isolated from the interior of a sterilization drying oven, was purified by anion-exchange and molecular size-exclusion liquid chromatography. On the basis of SDS-PAGE, the purified enzyme was found to be homogeneous and showed an estimated subunit molecular mass of 23.9 kDa. The holoenzyme is a homotetramer of 97.3 kDa. Superoxide dismutase exhibited maximal activity at pH 8.5 and at temperature around 60 ºC. The enzyme was thermostable maintaining 50% of its activity even after 4.5 hours incubation at 60 ºC and more than 70% of its activity after 30 min at 80 ºC. When the microorganism was irradiated with UVA, an increase in the specific activity of superoxide dismutase was observed which was correlated with decreasing levels of anion superoxide, indicating the direct involvement of this enzyme in the capture of reactive oxygen species. This study reports the effects of UV radiation on a superoxide dismutase from a thermophilic bacterium isolated from an anthropogenic environment.

  20. Genome sequence of the pink-pigmented marine bacterium Loktanella hongkongensis type strain (UST950701-009P(T)), a representative of the Roseobacter group.

    PubMed

    Lau, Stanley Ck; Riedel, Thomas; Fiebig, Anne; Han, James; Huntemann, Marcel; Petersen, Jörn; Ivanova, Natalia N; Markowitz, Victor; Woyke, Tanja; Göker, Markus; Kyrpides, Nikos C; Klenk, Hans-Peter; Qian, Pei-Yuan

    2015-01-01

    Loktanella hongkongensis UST950701-009P(T) is a Gram-negative, non-motile and rod-shaped bacterium isolated from a marine biofilm in the subtropical seawater of Hong Kong. When growing as a monospecies biofilm on polystyrene surfaces, this bacterium is able to induce larval settlement and metamorphosis of a ubiquitous polychaete tubeworm Hydroides elegans. The inductive cues are low-molecular weight compounds bound to the exopolymeric matrix of the bacterial cells. In the present study we describe the features of L. hongkongensis strain DSM 17492(T) together with its genome sequence and annotation and novel aspects of its phenotype. The 3,198,444 bp long genome sequence encodes 3104 protein-coding genes and 57 RNA genes. The two unambiguously identified extrachromosomal replicons contain replication modules of the RepB and the Rhodobacteraceae-specific DnaA-like type, respectively.

  1. Characterization of a flavin reductase from a thermophilic dibenzothiophene-desulfurizing bacterium, Bacillus subtilis WU-S2B.

    PubMed

    Takahashi, Shusuke; Furuya, Toshiki; Ishii, Yoshitaka; Kino, Kuniki; Kirimura, Kohtaro

    2009-01-01

    Bacillus subtilis WU-S2B is a thermophilic dibenzothiophene (DBT)-desulfurizing bacterium and produces a flavin reductase (Frb) that couples with DBT and DBT sulfone monooxygenases. The recombinant Frb was purified from Escherichia coli cells expressing the frb gene and was characterized. The purified Frb exhibited high stability over wide temperature and pH ranges of 20-55 degrees C and 2-12, respectively. Frb contained FMN and exhibited both flavin reductase and nitroreductase activities.

  2. [Isolation and identification of a lactate-utilizing, butyrate-producing bacterium and its primary metabolic characteristics].

    PubMed

    Liu, Wei; Zhu, Wei-yun; Yao, Wen; Mao, Sheng-yong

    2007-06-01

    The distal mammalian gut harbors prodigiously abundant microbes, which provide unique metabolic traits to host. A lactate-utilizing, butyrate-producing bacterium, strain LB01, was isolated from adult swine feces by utilizing modified Hungate technique with rumen liquid-independent YCFA medium supplemented with lactate as the single carbon source. It was an obligate anaerobic, Gram positive bacterium, and could utilize glucose, fructose, maltose and lactate with a large amount of gas products. 16S rRNA sequence analysis revealed that it had the high similarity with members of the genus Megasphaera. The metabolic characteristics of strain LB01 was investigated by using in vitro fermentation system. Lactate at the concentration of 65 mmol/L in YCFA medium was rapidly consumed within 9 hours and was mainly converted to propionate and butyrate after 24h. As the level of acetate declined, the concentration of butyrate rose only in the presence of glucose, suggesting that butyrate could possibly be synthesized by the acetyl CoA: butyryl CoA transferase. When co-cultured with lactic acid bacteria strain K9, strain LB01 evidently reduced the concentration of lactate produced by strain K9 and decelerated the rapid pH drop, finally producing 12.11 mmol/L butyrate and 4.06 mmol/L propionate. The metabolic characteristics that strain LB01 efficiently converts toxic lactate and excessive acetate to butyrate can prevent lactate and acetate accumulation in the large intestine and maintain the slightly acidic environment of the large intestine, consequently revealing that stain LB01 could act as a potential probiotics.

  3. Serpentine endophytic bacterium Pseudomonas azotoformans ASS1 accelerates phytoremediation of soil metals under drought stress.

    PubMed

    Ma, Ying; Rajkumar, Mani; Moreno, António; Zhang, Chang; Freitas, Helena

    2017-10-01

    This study evaluates the potential of serpentine endophytic bacterium to foster phytoremediation efficiency of Trifolium arvense grown on multi-metal (Cu, Zn and Ni) contaminated soils under drought stress. A drought resistant endophytic bacterial strain ASS1 isolated from the leaves of Alyssum serpyllifolium grown in serpentine soils was identified as Pseudomonas azotoformans based on biochemical tests and partial 16S rRNA gene sequencing. P. azotoformans ASS1 possessed abiotic stress resistance (heavy metals, drought, salinity, antibiotics and extreme temperature) and plant growth promoting (PGP) properties (phosphate solubilization, nitrogen fixation, production of 1-aminocyclopropane-1-carboxylate deaminase, siderophore and ammonia). Inoculation of T. arvense with ASS1 considerably increased the plant biomass and leaf relative water content in both roll towel assay and pot experiments in the absence and presence of drought stress (DS). In the pot experiments, ASS1 greatly enhanced chlorophyll content, catalase, peroxidase, superoxide dismutase activities, and proline content (only in the absence of drought) in plant leaves, whereas they decreased the concentrations of malondialdehyde. Irrespective of water stress, ASS1 significantly improved accumulation, total removal, bio-concentration factor and biological accumulation coefficient of metals (Cu, Zn and Ni), while decreased translocation factors of Cu. The effective colonization and survival in the rhizosphere and tissue interior assured improved plant growth and successful metal phytoremediation under DS. These results demonstrate the potential of serpentine endophytic bacterium ASS1 for protecting plants against abiotic stresses and helping plants to thrive in semiarid ecosystems and accelerate phytoremediation process in metal polluted soils. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Bacillus flexus strain As-12, a new arsenic transformer bacterium isolated from contaminated water resources.

    PubMed

    Jebeli, Mohammad Ahmadi; Maleki, Afshin; Amoozegar, Mohammad Ali; Kalantar, Enayatollah; Izanloo, Hassan; Gharibi, Fardin

    2017-02-01

    A total of 14 arsenic-resistant bacteria were isolated from an arsenic-contaminated travertine spring water in the central district of Qorveh county, Kurdistan Province, Iran. One of strains designated As-12 was selected for further investigation because of its ability to transform arsenic. The strain was identified by cultural, morphological and biochemical tests, and 16S rRNA gene sequencing. Finally, the growth characteristics of the isolate were investigated in a chemically defined medium which included varied ranges of environmental factors such as pH, temperature and salinity. Moreover, the resistance of this strain to some heavy metals was evaluated. The bacterium was a Gram-positive, endospore-forming with all other characteristics of the genus Bacillus. It revealed maximum similarity at the 16S rRNA gene level with Bacillus flexus. The optimum growth of the strain was observed at 38 °C, pH 9 and 2% salinity. This strain was resistant to heavy metals such as zinc, chromium, lead, nickel, copper, mercuric and cadmium at concentrations of 15 mM, 15.5 mM, 11.5 mM, 12 mM, 11 mM, 5.5 mM, and 1 mM, respectively. The isolated bacterium was able to reduce As (V) to As (III) (about 28%) and oxidize As (III) to As (V) (about 45%) after 48 h of incubation at 37 °C. In conclusion, Bacillus flexus strain As-12, was identified as an arsenic transformer, for the first time. Copyright © 2016 Elsevier Ltd. All rights reserved.

  5. Antagonistic Effect of Monovalent Cations in Maintenance of Cellular Integrity of a Marine Bacterium1

    PubMed Central

    De Voe, Irving W.; Oginsky, Evelyn L.

    1969-01-01

    The susceptibility of a marine bacterium, designated isolate c-A1, to lysis in distilled water and in salt solutions has been found to be a function of Na+ concentration. Optical densities of cells pre-exposed to 0.05 m MgCl2 were maintained in 1.0 m KCl, whereas those of cells pre-exposed to 1.0 m NaCl were not maintained at any KCl concentration tested. Cells transferred from MgCl2 to low concentrations of NaCl underwent more extensive lysis than did those transferred to distilled water. The degree of disruption of cells transferred to distilled water from mixtures of 0.05 m MgCl2 and NaCl (0 to 1.0 m) was dependent on the concentration of NaCl; similar results were obtained with LiCl, but not with KCl. In electron micrographs of thin sections, c-A1 cell envelopes consisted of two double-track layers which fractured and peeled apart on lysis after pre-exposure to NaCl-MgCl2 mixtures. Envelope eruptions or “hernias” occurred only in lysed cells pre-exposed to NaCl alone. No evidence for a functional lytic enzyme was found. Comparative studies on a terrestrial pseudomonad with a multilayered envelope indicated that preexposure to NaCl did not enhance the susceptibility of this cell to lysis in distilled water. The lytic susceptibility of the marine bacterium is considered to be the consequence of competition between specific monovalent cations and Mg++ for electrostatic interactions with components of the cell envelope of this organism. Images PMID:5788707

  6. Complete Genome Sequence of Spiroplasma floricola 23-6T (ATCC 29989), a Bacterium Isolated from a Tulip Tree (Liriodendron tulipifera L.).

    PubMed

    Tsai, Yi-Ming; Wu, Pei-Shan; Lo, Wen-Sui; Kuo, Chih-Horng

    2018-04-19

    Spiroplasma floricola 23-6 T (ATCC 29989) was isolated from the flower surface of a tulip tree ( Liriodendron tulipifera L.). Here, we report the complete genome sequence of this bacterium to facilitate the investigation of its biology and the comparative genomics among Spiroplasma species. Copyright © 2018 Tsai et al.

  7. Transcriptional and proteomic stress responses of a soil bacterium Bacillus cereus to nanosized zero-valent iron (nZVI) particles.

    PubMed

    Fajardo, C; Saccà, M L; Martinez-Gomariz, M; Costa, G; Nande, M; Martin, M

    2013-10-01

    Nanosized zero valent iron (nZVI) is emerging as an option for treating contaminated soil and groundwater even though the potentially toxic impact exerted by nZVI on soil microorganisms remains uncertain. In this work, we focus on nanotoxicological studies performed in vitro using commercial nZVI and one common soil bacterium (Bacillus cereus). Results showed a negative impact of nZVI on B. cereus growth capability, consistent with the entrance of cells in an early sporulation stage, observed by TEM. Despite no changes at the transcriptional level are detected in genes of particular relevance in cellular activity (narG, nirS, pykA, gyrA and katB), the proteomic approach used highlights differentially expressed proteins in B. cereus under nZVI exposure. We demonstrate that proteins involved in oxidative stress-response and tricarboxilic acid cycle (TCA) modulation are overexpressed; moreover proteins involved in motility and wall biosynthesis are repressed. Our results enable to detect a molecular-level response as early warning signal, providing new insight into first line defense response of a soil bacterium after nZVI exposure. Copyright © 2013 Elsevier Ltd. All rights reserved.

  8. Versatile plasmid-based expression systems for Gram-negative bacteria--General essentials exemplified with the bacterium Ralstonia eutropha H16.

    PubMed

    Gruber, Steffen; Schwab, Helmut; Koefinger, Petra

    2015-12-25

    The Gram-negative bacterium Escherichia coli is currently the most efficient and widely used prokaryotic host for recombinant protein and metabolite production. However, due to some limitations and to various interesting features of other Gram-negative bacteria efficient vector systems applicable to a broad range are desired. Basic building blocks for plasmid-based vectors include besides the need for a suitable selection marker in the first line a proper replication and maintenance system. In addition to these basic requirements, further elements are needed for Gram-negative bacteria beyond E. coli, such as Pseudomonas pudita, Ralstonia eutropha, Burkholderia glumae or Acinetobacter sp.. Established building blocks have to be adapted and new building blocks providing the desired functions need to be identified and exploited. This minireview addresses so far described and used genetic elements for broad host range replication, efficient plasmid maintenance, and conjugative plasmid transfer as well as expression elements and protein secretion signals. The industrially important bacterium R. eutropha H16 was chosen as a model organism to provide specific data on the effectivity and utility of building blocks based on such genetic elements. Copyright © 2015 Elsevier B.V. All rights reserved.

  9. Systematic mapping of two component response regulators to gene targets in a model sulfate reducing bacterium.

    PubMed

    Rajeev, Lara; Luning, Eric G; Dehal, Paramvir S; Price, Morgan N; Arkin, Adam P; Mukhopadhyay, Aindrila

    2011-10-12

    Two component regulatory systems are the primary form of signal transduction in bacteria. Although genomic binding sites have been determined for several eukaryotic and bacterial transcription factors, comprehensive identification of gene targets of two component response regulators remains challenging due to the lack of knowledge of the signals required for their activation. We focused our study on Desulfovibrio vulgaris Hildenborough, a sulfate reducing bacterium that encodes unusually diverse and largely uncharacterized two component signal transduction systems. We report the first systematic mapping of the genes regulated by all transcriptionally acting response regulators in a single bacterium. Our results enabled functional predictions for several response regulators and include key processes of carbon, nitrogen and energy metabolism, cell motility and biofilm formation, and responses to stresses such as nitrite, low potassium and phosphate starvation. Our study also led to the prediction of new genes and regulatory networks, which found corroboration in a compendium of transcriptome data available for D. vulgaris. For several regulators we predicted and experimentally verified the binding site motifs, most of which were discovered as part of this study. The gene targets identified for the response regulators allowed strong functional predictions to be made for the corresponding two component systems. By tracking the D. vulgaris regulators and their motifs outside the Desulfovibrio spp. we provide testable hypotheses regarding the functions of orthologous regulators in other organisms. The in vitro array based method optimized here is generally applicable for the study of such systems in all organisms.

  10. Preparation of genomic DNA from a single species of uncultured magnetotactic bacterium by multiple-displacement amplification.

    PubMed

    Arakaki, Atsushi; Shibusawa, Mie; Hosokawa, Masahito; Matsunaga, Tadashi

    2010-03-01

    Magnetotactic bacteria comprise a phylogenetically diverse group that is capable of synthesizing intracellular magnetic particles. Although various morphotypes of magnetotactic bacteria have been observed in the environment, bacterial strains available in pure culture are currently limited to a few genera due to difficulties in their enrichment and cultivation. In order to obtain genetic information from uncultured magnetotactic bacteria, a genome preparation method that involves magnetic separation of cells, flow cytometry, and multiple displacement amplification (MDA) using phi29 polymerase was used in this study. The conditions for the MDA reaction using samples containing 1 to 100 cells were evaluated using a pure-culture magnetotactic bacterium, "Magnetospirillum magneticum AMB-1," whose complete genome sequence is available. Uniform gene amplification was confirmed by quantitative PCR (Q-PCR) when 100 cells were used as a template. This method was then applied for genome preparation of uncultured magnetotactic bacteria from complex bacterial communities in an aquatic environment. A sample containing 100 cells of the uncultured magnetotactic coccus was prepared by magnetic cell separation and flow cytometry and used as an MDA template. 16S rRNA sequence analysis of the MDA product from these 100 cells revealed that the amplified genomic DNA was from a single species of magnetotactic bacterium that was phylogenetically affiliated with magnetotactic cocci in the Alphaproteobacteria. The combined use of magnetic separation, flow cytometry, and MDA provides a new strategy to access individual genetic information from magnetotactic bacteria in environmental samples.

  11. Evaluation of Arthrobacter aurescens Strain TC1 as Bioaugmentation Bacterium in Soils Contaminated with the Herbicidal Substance Terbuthylazine

    PubMed Central

    Silva, Vera P.; Moreira-Santos, Matilde; Mateus, Carla; Teixeira, Tânia; Ribeiro, Rui; Viegas, Cristina A.

    2015-01-01

    In the last years the chloro-s-triazine active substance terbuthylazine has been increasingly used as an herbicide and may leave residues in the environment which can be of concern. The present study aimed at developing a bioaugmentation tool based on the soil bacterium Arthrobacter aurescens strain TC1 for the remediation of terbuthylazine contaminated soils and at examining its efficacy for both soil and aquatic compartments. First, the feasibility of growing the bioaugmentation bacterium inocula on simple sole nitrogen sources (ammonium and nitrate) instead of atrazine, while still maintaining its efficiency to biodegrade terbuthylazine was shown. In sequence, the successful and quick (3 days) bioremediation efficacy of ammonium-grown A. aurescens TC1 cells was proven in a natural soil freshly spiked or four-months aged with commercial terbuthylazine at a dose 10× higher than the recommended in corn cultivation, to mimic spill situations. Ecotoxicity assessment of the soil eluates towards a freshwater microalga supported the effectiveness of the bioaugmentation tool. Obtained results highlight the potential to decontaminate soil while minimizing terbuthylazine from reaching aquatic compartments via the soil-water pathway. The usefulness of this bioaugmentation tool to provide rapid environment decontamination is particularly relevant in the event of accidental high herbicide contamination. Its limitations and advantages are discussed. PMID:26662024

  12. Photoinhibition of Phaeocystis globosa resulting from oxidative stress induced by a marine algicidal bacterium Bacillus sp. LP-10

    PubMed Central

    Guan, Chengwei; Guo, Xiaoyun; Li, Yi; Zhang, Huajun; Lei, Xueqian; Cai, Guanjing; Guo, Jiajia; Yu, Zhiming; Zheng, Tianling

    2015-01-01

    Harmful algal blooms caused by Phaeocystis globosa have resulted in staggering losses to coastal countries because of their world-wide distribution. Bacteria have been studied for years to control the blooms of harmful alga, however, the action mechanism of them against harmful algal cells is still not well defined. Here, a previously isolated algicidal bacterium Bacillus sp. LP-10 was used to elucidate the potential mechanism involved in the dysfunction of P. globosa algal cells at physiological and molecular levels. Our results showed Bacillus sp. LP-10 induced an obvious rise of reactive oxygen species (ROS), which was supposed to be major reason for algal cell death. Meanwhile, the results revealed a significant decrease of photosynthetic physiological indexes and apparent down-regulated of photosynthesis-related genes (psbA and rbcS) and protein (PSII reaction center protein D1), after treated by Bacillus sp. LP-10 filtrates, suggesting photoinhibition occurred in the algal cells. Furthermore, our results indicated that light played important roles in the algal cell death. Our work demonstrated that the major lethal reason of P. globosa cells treated by the algicidal bacterium was the photoinhibition resulted from oxidative stress induced by Bacillus sp. LP-10. PMID:26601700

  13. A monogalactosyldiacylglycerol synthase found in the green sulfur bacterium Chlorobaculum tepidum reveals important roles for galactolipids in photosynthesis.

    PubMed

    Masuda, Shinji; Harada, Jiro; Yokono, Makio; Yuzawa, Yuichi; Shimojima, Mie; Murofushi, Kazuhiro; Tanaka, Hironori; Masuda, Hanako; Murakawa, Masato; Haraguchi, Tsuyoshi; Kondo, Maki; Nishimura, Mikio; Yuasa, Hideya; Noguchi, Masato; Oh-Oka, Hirozo; Tanaka, Ayumi; Tamiaki, Hitoshi; Ohta, Hiroyuki

    2011-07-01

    Monogalactosyldiacylglycerol (MGDG), which is conserved in almost all photosynthetic organisms, is the most abundant natural polar lipid on Earth. In plants, MGDG is highly accumulated in the chloroplast membranes and is an important bulk constituent of thylakoid membranes. However, precise functions of MGDG in photosynthesis have not been well understood. Here, we report a novel MGDG synthase from the green sulfur bacterium Chlorobaculum tepidum. This enzyme, MgdA, catalyzes MGDG synthesis using UDP-Gal as a substrate. The gene encoding MgdA was essential for this bacterium; only heterozygous mgdA mutants could be isolated. An mgdA knockdown mutation affected in vivo assembly of bacteriochlorophyll c aggregates, suggesting the involvement of MGDG in the construction of the light-harvesting complex called chlorosome. These results indicate that MGDG biosynthesis has been independently established in each photosynthetic organism to perform photosynthesis under different environmental conditions. We complemented an Arabidopsis thaliana MGDG synthase mutant by heterologous expression of MgdA. The complemented plants showed almost normal levels of MGDG, although they also had abnormal morphological phenotypes, including reduced chlorophyll content, no apical dominance in shoot growth, atypical flower development, and infertility. These observations provide new insights regarding the importance of regulated MGDG synthesis in the physiology of higher plants.

  14. Cloacibacterium normanense gen. nov., sp. nov., a novel bacterium in the family Flavobacteriaceae isolated from municipal wastewater.

    PubMed

    Allen, Toby D; Lawson, Paul A; Collins, Matthew D; Falsen, Enevold; Tanner, Ralph S

    2006-06-01

    Phenotypic and phylogenetic studies were performed on three isolates of an unknown Gram-negative, facultatively anaerobic, non-motile, yellow-pigmented, rod-shaped organism isolated from raw sewage. 16S rRNA gene sequence analysis indicated that these strains were members of the Bergeyella-Chryseobacterium-Riemerella branch of the family Flavobacteriaceae. The unknown bacterium was readily distinguished from reference strains by 16S rRNA gene sequencing and biochemical tests. The organism contained menaquinone MK-6 as the predominant respiratory quinone and had a DNA G+C content of 31 mol%. A most probable number-PCR approach was developed to detect, and estimate the numbers of, this organism. Untreated wastewater from one plant yielded an estimated count of 1.4 x 10(5) cells ml(-1), and untreated wastewater from a second plant yielded an estimated count of 1.4 x 10(4) cells ml(-1). Signal was not detected from treated effluent or from human stool specimens. On the basis of the results of the study presented, it is proposed that the unknown bacterium be classified in a novel genus Cloacibacterium, as Cloacibacterium normanense gen. nov., sp. nov., which is also the type species. The type strain of Cloacibacterium normanense is strain NRS1(T) (=CCUG 46293(T) = CIP 108613(T) = ATCC BAA-825(T) = DSM 15886(T)).

  15. Insights into plant biomass conversion from the genome of the anaerobic thermophilic bacterium Caldicellulosiruptor bescii DSM 6725

    PubMed Central

    Dam, Phuongan; Kataeva, Irina; Yang, Sung-Jae; Zhou, Fengfeng; Yin, Yanbin; Chou, Wenchi; Poole, Farris L.; Westpheling, Janet; Hettich, Robert; Giannone, Richard; Lewis, Derrick L.; Kelly, Robert; Gilbert, Harry J.; Henrissat, Bernard; Xu, Ying; Adams, Michael W. W.

    2011-01-01

    Caldicellulosiruptor bescii DSM 6725 utilizes various polysaccharides and grows efficiently on untreated high-lignin grasses and hardwood at an optimum temperature of ∼80°C. It is a promising anaerobic bacterium for studying high-temperature biomass conversion. Its genome contains 2666 protein-coding sequences organized into 1209 operons. Expression of 2196 genes (83%) was confirmed experimentally. At least 322 genes appear to have been obtained by lateral gene transfer (LGT). Putative functions were assigned to 364 conserved/hypothetical protein (C/HP) genes. The genome contains 171 and 88 genes related to carbohydrate transport and utilization, respectively. Growth on cellulose led to the up-regulation of 32 carbohydrate-active (CAZy), 61 sugar transport, 25 transcription factor and 234 C/HP genes. Some C/HPs were overproduced on cellulose or xylan, suggesting their involvement in polysaccharide conversion. A unique feature of the genome is enrichment with genes encoding multi-modular, multi-functional CAZy proteins organized into one large cluster, the products of which are proposed to act synergistically on different components of plant cell walls and to aid the ability of C. bescii to convert plant biomass. The high duplication of CAZy domains coupled with the ability to acquire foreign genes by LGT may have allowed the bacterium to rapidly adapt to changing plant biomass-rich environments. PMID:21227922

  16. Cloning and characterization of a novel chondroitin sulfate/dermatan sulfate 4-O-endosulfatase from a marine bacterium.

    PubMed

    Wang, Wenshuang; Han, Wenjun; Cai, Xingya; Zheng, Xiaoyu; Sugahara, Kazuyuki; Li, Fuchuan

    2015-03-20

    Sulfatases are potentially useful tools for structure-function studies of glycosaminoglycans (GAGs). To date, various GAG exosulfatases have been identified in eukaryotes and prokaryotes. However, endosulfatases that act on GAGs have rarely been reported. Recently, a novel HA and CS lyase (HCLase) was identified for the first time from a marine bacterium (Han, W., Wang, W., Zhao, M., Sugahara, K., and Li, F. (2014) J. Biol. Chem. 289, 27886-27898). In this study, a putative sulfatase gene, closely linked to the hclase gene in the genome, was recombinantly expressed and characterized in detail. The recombinant protein showed a specific N-acetylgalactosamine-4-O-sulfatase activity that removes 4-O-sulfate from both disaccharides and polysaccharides of chondroitin sulfate (CS)/dermatan sulfate (DS), suggesting that this sulfatase represents a novel endosulfatase. The novel endosulfatase exhibited maximal reaction rate in a phosphate buffer (pH 8.0) at 30 °C and effectively removed 17-65% of 4-O-sulfates from various CS and DS and thus significantly inhibited the interactions of CS and DS with a positively supercharged fluorescent protein. Moreover, this endosulfatase significantly promoted the digestion of CS by HCLase, suggesting that it enhances the digestion of CS/DS by the bacterium. Therefore, this endosulfatase is a potential tool for use in CS/DS-related studies and applications. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  17. Albibacter methylovorans gen. nov., sp. nov., a novel aerobic, facultatively autotrophic and methylotrophic bacterium that utilizes dichloromethane.

    PubMed

    Doronina, N V; Trotsenko, Y A; Tourova, T P; Kuznetsov, B B; Leisinger, T

    2001-05-01

    A novel genus, Albibacter, with one species, Albibacter methylovorans sp. nov., is proposed for a facultatively chemolithotrophic and methylotrophic bacterium (strain DM10T) with the ribulose bisphosphate (RuBP) pathway of C1 assimilation. The bacterium is a Gram-negative, aerobic, asporogenous, nonmotile, colourless rod that multiplies by binary fission. The organism utilizes dichloromethane, methanol, methylamine, formate and CO2/H2, as well as a variety of polycarbon compounds, as carbon and energy sources. It is neutrophilic and mesophilic. The major cellular fatty acids are straight-chain unsaturated C18:1, saturated C16:0 and cyclopropane C19:0 acids. The main ubiquinone is Q-10. The dominant phospholipids are phosphatidyl ethanolamine, phosphatidyl glycerol, phosphatidyl choline and cardiolipin. The DNA G+C content is 66.7 mol%. Strain DM10T has a very low degree of DNA-DNA hybridization (4-7%) with the type species of the genera Paracoccus, Xanthobacter, Blastobacter, Angulomicrobium, Ancylobacter and Ralstonia of RuBP pathway methylobacteria. Another approach, involving comparative 16S rDNA analysis, has shown that the novel isolate represents a separate branch within the alpha-2 subgroup of the Proteobacteria. The type species of the new genus is Albibacter methylovorans sp. nov.; the type strain is DM10T (= VKM B-2236T = DSM 13819T).

  18. Thalassospira povalilytica sp. nov., a polyvinyl-alcohol-degrading marine bacterium.

    PubMed

    Nogi, Yuichi; Yoshizumi, Masaki; Miyazaki, Masayuki

    2014-04-01

    A polyvinyl-alcohol-degrading marine bacterium was isolated from plastic rope litter found in Tokyo Bay, Japan. The isolated strain, Zumi 95(T), was a Gram-reaction-negative, non-spore-forming and facultatively anaerobic chemo-organotroph. The major respiratory quinone was Q-10. The predominant fatty acids were C18 : 1ω7c and C16 : 0. On the basis of 16S rRNA gene sequence analysis, the isolated strain was closely affiliated with members of the genus Thalassospira in the class Alphaproteobacteria. The DNA G+C content of the novel strain was 55.1 mol%. The hybridization values for DNA-DNA relatedness between this strain and four reference strains representing species of the genus Thalassospira were significantly lower than that accepted as the phylogenetic definition of a species. On the basis of differences in taxonomic characteristics, the isolated strain represents a novel species of the genus Thalassospira for which the name Thalassospira povalilytica sp. nov. (type strain Zumi 95(T) = JCM 18746(T) = DSM 26719(T)) is proposed.

  19. Novel Rickettsiella Bacterium in the Leafhopper Orosius albicinctus (Hemiptera: Cicadellidae)

    PubMed Central

    Iasur-Kruh, Lilach; Weintraub, Phyllis G.; Mozes-Daube, Netta; Robinson, Wyatt E.; Perlman, Steve J.

    2013-01-01

    Bacteria in the genus Rickettsiella (Coxiellaceae), which are mainly known as arthropod pathogens, are emerging as excellent models to study transitions between mutualism and pathogenicity. The current report characterizes a novel Rickettsiella found in the leafhopper Orosius albicinctus (Hemiptera: Cicadellidae), a major vector of phytoplasma diseases in Europe and Asia. Denaturing gradient gel electrophoresis (DGGE) and pyrosequencing were used to survey the main symbionts of O. albicinctus, revealing the obligate symbionts Sulcia and Nasuia, and the facultative symbionts Arsenophonus and Wolbachia, in addition to Rickettsiella. The leafhopper Rickettsiella is allied with bacteria found in ticks. Screening O. albicinctus from the field showed that Rickettsiella is highly prevalent, with over 60% of individuals infected. A stable Rickettsiella infection was maintained in a leafhopper laboratory colony for at least 10 generations, and fluorescence microscopy localized bacteria to accessory glands of the female reproductive tract, suggesting that the bacterium is vertically transmitted. Future studies will be needed to examine how Rickettsiella affects host fitess and its ability to vector phytopathogens. PMID:23645190

  20. A Novel Enzyme Portfolio for Red Algal Polysaccharide Degradation in the Marine Bacterium Paraglaciecola hydrolytica S66T Encoded in a Sizeable Polysaccharide Utilization Locus.

    PubMed

    Schultz-Johansen, Mikkel; Bech, Pernille K; Hennessy, Rosanna C; Glaring, Mikkel A; Barbeyron, Tristan; Czjzek, Mirjam; Stougaard, Peter

    2018-01-01

    Marine microbes are a rich source of enzymes for the degradation of diverse polysaccharides. Paraglaciecola hydrolytica S66 T is a marine bacterium capable of hydrolyzing polysaccharides found in the cell wall of red macroalgae. In this study, we applied an approach combining genomic mining with functional analysis to uncover the potential of this bacterium to produce enzymes for the hydrolysis of complex marine polysaccharides. A special feature of P. hydrolytica S66 T is the presence of a large genomic region harboring an array of carbohydrate-active enzymes (CAZymes) notably agarases and carrageenases. Based on a first functional characterization combined with a comparative sequence analysis, we confirmed the enzymatic activities of several enzymes required for red algal polysaccharide degradation by the bacterium. In particular, we report for the first time, the discovery of novel enzyme activities targeting furcellaran, a hybrid carrageenan containing both β-carrageenan and κ/β-carrageenan motifs. Some of these enzymes represent a new subfamily within the CAZy classification. From the combined analyses, we propose models for the complete degradation of agar and κ/β-type carrageenan by P. hydrolytica S66 T . The novel enzymes described here may find value in new bio-based industries and advance our understanding of the mechanisms responsible for recycling of red algal polysaccharides in marine ecosystems.