Microbial Reduction and Precipitation of Vanadium by Shewanella oneidensis
Carpentier, W.; Sandra, K.; De Smet, I.; Brigé, A.; De Smet, L.; Van Beeumen, J.
2003-01-01
Shewanella oneidensis couples anaerobic oxidation of lactate, formate, and pyruvate to the reduction of vanadium pentoxide (VV). The bacterium reduces VV (vanadate ion) to VIV (vanadyl ion) in an anaerobic atmosphere. The resulting vanadyl ion precipitates as a VIV-containing solid. PMID:12788772
Roles of Two Shewanella oneidensis MR-1 Extracellular Endonucleases ▿ †
Gödeke, Julia; Heun, Magnus; Bubendorfer, Sebastian; Paul, Kristina; Thormann, Kai M.
2011-01-01
The dissimilatory iron-reducing bacterium Shewanella oneidensis MR-1 is capable of using extracellular DNA (eDNA) as the sole source of carbon, phosphorus, and nitrogen. In addition, we recently demonstrated that S. oneidensis MR-1 requires eDNA as a structural component during all stages of biofilm formation. In this study, we characterize the roles of two Shewanella extracellular endonucleases, ExeS and ExeM. While ExeS is likely secreted into the medium, ExeM is predicted to remain associated with the cell envelope. Both exeM and exeS are highly expressed under phosphate-limited conditions. Mutants lacking exeS and/or exeM exhibit decreased eDNA degradation; however, the capability of S. oneidensis MR-1 to use DNA as the sole source of phosphorus is only affected in mutants lacking exeM. Neither of the two endonucleases alleviates toxic effects of increased eDNA concentrations. The deletion of exeM and/or exeS significantly affects biofilm formation of S. oneidensis MR-1 under static conditions, and expression of exeM and exeS drastically increases during static biofilm formation. Under hydrodynamic conditions, a deletion of exeM leads to altered biofilms that consist of densely packed structures which are covered by a thick layer of eDNA. Based on these results, we hypothesize that a major role of ExeS and, in particular, ExeM of S. oneidensis MR-1, is to degrade eDNA as a matrix component during biofilm formation to improve nutrient supply and to enable detachment. PMID:21705528
Polyphasic taxonomy of the genus Shewanella and description of Shewanella oneidensis sp. nov
NASA Technical Reports Server (NTRS)
Venkateswaran, K.; Moser, D. P.; Dollhopf, M. E.; Lies, D. P.; Saffarini, D. A.; MacGregor, B. J.; Ringelberg, D. B.; White, D. C.; Nishijima, M.; Sano, H.;
1999-01-01
The genus Shewanella has been studied since 1931 with regard to a variety of topics of relevance to both applied and environmental microbiology. Recent years have seen the introduction of a large number of new Shewanella-like isolates, necessitating a coordinated review of the genus. In this work, the phylogenetic relationships among known shewanellae were examined using a battery of morphological, physiological, molecular and chemotaxonomic characterizations. This polyphasic taxonomy takes into account all available phenotypic and genotypic data and integrates them into a consensus classification. Based on information generated from this study and obtained from the literature, a scheme for the identification of Shewanella species has been compiled. Key phenotypic characteristics were sulfur reduction and halophilicity. Fatty acid and quinone profiling were used to impart an additional layer of information. Molecular characterizations employing small-subunit 16S rDNA sequences were at the limits of resolution for the differentiation of species in some cases. As a result, DNA-DNA hybridization and sequence analyses of a more rapidly evolving molecule (gyrB gene) were performed. Species-specific PCR probes were designed for the gyrB gene and used for the rapid screening of closely related strains. With this polyphasic approach, in addition to the ten described Shewanella species, two new species, Shewanella oneidensis and 'Shewanella pealeana', were recognized; Shewanella oneidensis sp. nov. is described here for the first time.
The utilization of Eschericia coli and Shewanella oneidensis for microbial fuel cell
NASA Astrophysics Data System (ADS)
Juliastuti, S. R.; Darmawan, R.; Ayuningtyas, A.; Ellyza, N.
2018-03-01
Microbial Fuel Cell (MFC) is a technology that convert chemical energy into electrical energy with catalytic reaction from microorganism. The research method using bacteria in organic waste on anode compartment and ferricyanide solution on cathode compartment. Wastewater from sugar factory was used as organic waste with bacterial concentration of 10%, 12.5%, 15%, 17.5% (v/v) and with bacteria mixture ratio 1:1, 1:2, 2:1. The result of the research showed that the best voltage of bacteria concentration was 12.5% for Eschericia coli and Shewanella oneidensis bacteria, which were 847 mV and 988 mV, and for the mixed bacteria variable was 1:2 ratio with the voltage was 1261 mV. For 12 days, the largest percentage of the decrease of BOD5 was 12.5% Eschericia coli bacteria concentration variable reached 84.531% and 17.5% Shewanella oneidensis was 73.779%. The best Fe3+ reduction was 53.52% for Escherichia coli at 10% concentration (v/v), and for Shewanella oneidensis bacteria reached out of 62.22% at 15% concentration (v/v). In the variable with mixed bacteria was obtained the best reduction result on the ratio of Eschericia coli : Shewanella oneidensis 1:2 was 77,44%.
Anaerobic Decolorization and Detoxification of Cationic Red X-GRL by Shewanella oneidensis MR-1.
Li, Qian; Feng, Xiao-Li; Li, Ting-Ting; Lu, Xue-Rong; Liu, Qiu-Yue; Han, Xue; Feng, Yu-Jie; Liu, Zhao-Ying; Zhang, Xi-Jia; Xiao, Xiang
2017-07-14
The ability of a electrochemically active bacterium, Shewanella oneidensis MR-1, to decolorize azo dye cationic red X-GRL (X-GRL) was investigated. S. oneidensis MR-1 showed a high decolorization capability for X-GRL under anaerobic conditions. The Mtr respiratory pathway was proved to be involved in the extracellular decolorization of X-GRL. The decolorization efficiency of S. oneidensis MR-1 was significantly inhibited when initial X-GRL concentration was over 200 mg L -1 . Increasing the inoculum volume of S. oneidensis MR-1 could obviously promote the X-GRL decolorization. The 100 mg L -1 X-GRL and 6% (v/v) inoculum volume were chosen as the optimal parameter. Under such a condition, almost all of X-GRL (100 mg L -1 ) could be completely reduced after 12-h incubation at the pH range of 5.5∼8.0 and temperature range of 30∼40 °C. Salinity in the medium also affected X-GRL decolorization. Lactate and citric acid were found to be the suitable electron donors for X-GRL decolorization. Although the genotoxicity increased slightly, the phytotoxicity of X-GRL in the decolorization process was significantly reduced by S. oneidensis MR-1.
Kim, Dong-Hun; Kanaly, Robert A; Hur, Hor-Gil
2012-12-01
The dissimilatory metal-reducing bacterium, Shewanella oneidensis MR-1, reduced tellurite (Te(IV), TeO(3)(2-)) to elemental tellurium under anaerobic conditions resulting in the intracellular accumulation of needle shaped crystalline Te(0) nanorods. Fatty acid analyses showed that toxic Te(IV) increased the unsaturated fatty acid composition of the lipid components of the cell membrane, implying a deconstruction of the integrity of the cellular membrane structure. The current results suggest that dissimilatory metal reducing bacteria such as S. oneidensis MR-1 may play an important role in recycling toxic tellurium elements, and may be applied as a novel selective biological filter via the accumulation of industry-applicable rare materials, Te(0) nanorods, in the cell. Copyright © 2012 Elsevier Ltd. All rights reserved.
Reduced Heme Levels Underlie the Exponential Growth Defect of the Shewanella oneidensis hfq Mutant
Mezoian, Taylor; Hunt, Taylor M.; Keane, Meaghan L.; Leonard, Jessica N.; Scola, Shelby E.; Beer, Emma N.; Perdue, Sarah; Pellock, Brett J.
2014-01-01
The RNA chaperone Hfq fulfills important roles in small regulatory RNA (sRNA) function in many bacteria. Loss of Hfq in the dissimilatory metal reducing bacterium Shewanella oneidensis strain MR-1 results in slow exponential phase growth and a reduced terminal cell density at stationary phase. We have found that the exponential phase growth defect of the hfq mutant in LB is the result of reduced heme levels. Both heme levels and exponential phase growth of the hfq mutant can be completely restored by supplementing LB medium with 5-aminolevulinic acid (5-ALA), the first committed intermediate synthesized during heme synthesis. Increasing expression of gtrA, which encodes the enzyme that catalyzes the first step in heme biosynthesis, also restores heme levels and exponential phase growth of the hfq mutant. Taken together, our data indicate that reduced heme levels are responsible for the exponential growth defect of the S. oneidensis hfq mutant in LB medium and suggest that the S. oneidensis hfq mutant is deficient in heme production at the 5-ALA synthesis step. PMID:25356668
USDA-ARS?s Scientific Manuscript database
We studied the effects of aeration of Shewanella oneidensis on potentiostatic current production, iron(III) reduction, hydrogen production in a microbial electrolysis cell, and electric power generation in a microbial fuel cell. The potentiostatic performance of aerated S. oneidensis was considerab...
Exploring the roles of DNA methylation in the metal-reducing bacterium Shewanella oneidensis MR-1
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bendall, Matthew L.; Luong, Khai; Wetmore, Kelly M.
2013-08-30
We performed whole genome analyses of DNA methylation in Shewanella 17 oneidensis MR-1 to examine its possible role in regulating gene expression and 18 other cellular processes. Single-Molecule Real Time (SMRT) sequencing 19 revealed extensive methylation of adenine (N6mA) throughout the 20 genome. These methylated bases were located in five sequence motifs, 21 including three novel targets for Type I restriction/modification enzymes. The 22 sequence motifs targeted by putative methyltranferases were determined via 23 SMRT sequencing of gene knockout mutants. In addition, we found S. 24 oneidensis MR-1 cultures grown under various culture conditions displayed 25 different DNA methylation patterns.more » However, the small number of differentially 26 methylated sites could not be directly linked to the much larger number of 27 differentially expressed genes in these conditions, suggesting DNA methylation is 28 not a major regulator of gene expression in S. oneidensis MR-1. The enrichment 29 of methylated GATC motifs in the origin of replication indicate DNA methylation 30 may regulate genome replication in a manner similar to that seen in Escherichia 31 coli. Furthermore, comparative analyses suggest that many 32 Gammaproteobacteria, including all members of the Shewanellaceae family, may 33 also utilize DNA methylation to regulate genome replication.« less
Iron Reduction and Carbonate Precipitation by Shewanella oneidensis
NASA Astrophysics Data System (ADS)
Zeng, Z.; Tice, M. M.
2011-12-01
This study is to contribute to better understanding of how Archean microbes induced carbonate diagenesis in mats and stromatolites. Previous studies showed sulfate reduction, a common promoter of carbonate precipitation in modern mats[1], is likely to have been less effective in Archean mats in marine fluids lower in sulfate[2]. Alternatively, iron reduction produces far more alkalinity per unit carbon respired than sulfate reduction. Therefore, we hypothesize iron reduction can promote much more carbonate precipitation than sulfate reduction. Our study might also have some relevance to banded iron formation on which microbial iron reduction played a potential role[3]. To test our hypothesis, Shewanella oneidensis MR-1, a dissimilatory iron reducing bacterium will be cultured anaerobically (79%N2, 20%CO2 and 1%H2) in basal medium to trigger iron reduction. Lactate will be used as electron donor, and the electron acceptor will be fresh ferrihydrite. Culture medium will be added with various metal ions, such as Ca2+ and Mg2+, to obtain potential carbonate precipitate. Escherichia coli (with fumarate added as an electron acceptor) will be used to provide a comparison to live but non-iron- reduction cells. After 20 days incubation, precipitate will be collected, washed and identified by X-ray diffraction (XRD). Besides, iron reduction rate (ferrozine assay)[4], PH and amount of precipitate (carbonate and oxidize fractions)[5] will be measured over time to well understand how S. oneidensis drives carbonate precipitation.
Iodate Reduction by Shewanella oneidensis Does Not Involve Nitrate Reductase
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mok, Jung Kee; Toporek, Yael J.; Shin, Hyun-Dong
Microbial iodate (IO 3 -) reduction is a major component of the iodine biogeochemical reaction network and is the basis of alternative strategies for remediation of iodine-contaminated environments. The molecular mechanism of microbial IO 3 - reduction, however, is not well understood. In microorganisms displaying IO 3 - and nitrate (NO 3 -) reduction activities, NO 3 - reductase is postulated to reduce IO 3 - as alternate electron acceptor. In the present study, whole genome analyses of 25 NO 3 --reducing Shewanella strains identified various combinations of genes encoding one assimilatory (cytoplasmic Nas) and three dissimilatory (membrane-associated Nar andmore » periplasmic Napα and Napβ) NO 3 - reductases. S. oneidensis was the only Shewanella strain whose genome encoded a single NO 3 - reductase (Napβ). Terminal electron acceptor competition experiments in S. oneidensis batch cultures amended with both NO 3 - and IO 3 - demonstrated that neither NO 3 - nor IO 3 - reduction activities were competitively inhibited by the presence of the competing electron acceptor. The lack of involvement of S. oneidensis Napβ in IO 3 - reduction was confirmed via phenotypic analysis of an in-frame gene deletion mutant lacking napβΑ (encoding the NO 3 --reducing NapβA catalytic subunit). S. oneidensis ΔnapβA was unable to reduce NO 3 -, yet reduced IO 3 - at rates higher than the wild-type strain. Thus, NapβA is required for dissimilatory NO 3 - reduction by S. oneidensis, while neither the assimilatory (Nas) nor dissimilatory (Napα, Napβ, and Nar) NO 3 - reductases are required for IO 3 - reduction. These findings oppose the traditional view that NO 3 - reductase reduces IO 3 - as alternate electron acceptor and indicate that S. oneidensis reduces IO 3 - via an as yet undiscovered enzymatic mechanism.« less
Respiratory Nitrate Ammonification by Shewanella oneidensis MR-1▿
Cruz-García, Claribel; Murray, Alison E.; Klappenbach, Joel A.; Stewart, Valley; Tiedje, James M.
2007-01-01
Anaerobic cultures of Shewanella oneidensis MR-1 grown with nitrate as the sole electron acceptor exhibited sequential reduction of nitrate to nitrite and then to ammonium. Little dinitrogen and nitrous oxide were detected, and no growth occurred on nitrous oxide. A mutant with the napA gene encoding periplasmic nitrate reductase deleted could not respire or assimilate nitrate and did not express nitrate reductase activity, confirming that the NapA enzyme is the sole nitrate reductase. Hence, S. oneidensis MR-1 conducts respiratory nitrate ammonification, also termed dissimilatory nitrate reduction to ammonium, but not respiratory denitrification. PMID:17098906
Functional Specificity of Extracellular Nucleases of Shewanella oneidensis MR-1
Heun, Magnus; Binnenkade, Lucas; Kreienbaum, Maximilian
2012-01-01
Bacterial species such as Shewanella oneidensis MR-1 require extracellular nucleolytic activity for the utilization of extracellular DNA (eDNA) as a source of nutrients and for the turnover of eDNA as a structural matrix component during biofilm formation. We have previously characterized two extracellular nucleases of S. oneidensis MR-1, ExeM and ExeS. Although both are involved in biofilm formation, they are not specifically required for the utilization of eDNA as a nutrient. Here we identified and characterized EndA, a third extracellular nuclease of Shewanella. The heterologously overproduced and purified protein was highly active and rapidly degraded linear and supercoiled DNAs of various origins. Divalent metal ions (Mg2+ or Mn2+) were required for function. endA is cotranscribed with phoA, an extracellular phosphatase, and is not upregulated upon phosphostarvation. Deletion of endA abolished both extracellular degradation of DNA by S. oneidensis MR-1 and the ability to use eDNA as a sole source of phosphorus. PhoA is not strictly required for the exploitation of eDNA as a nutrient. The activity of EndA prevents the formation of large cell aggregates during planktonic growth. However, in contrast to the findings for ExeM, endA deletion had only minor effects on biofilm formation. The findings strongly suggest that the extracellular nucleases of S. oneidensis exert specific functions required under different conditions. PMID:22492434
Transcriptome Analysis of Shewanella oneidensis MR-1 in Response to Elevated Salt Conditions
Liu, Yongqing; Gao, Weimin; Wang, Yue; Wu, Liyou; Liu, Xueduan; Yan, Tinfeng; Alm, Eric; Arkin, Adam; Thompson, Dorothea K.; Fields, Matthew W.; Zhou, Jizhong
2005-01-01
Whole-genomic expression patterns were examined in Shewanella oneidensis cells exposed to elevated sodium chloride. Genes involved in Na+ extrusion and glutamate biosynthesis were significantly up-regulated, and the majority of chemotaxis/motility-related genes were significantly down-regulated. The data also suggested an important role for metabolic adjustment in salt stress adaptation in S. oneidensis. PMID:15774893
USDA-ARS?s Scientific Manuscript database
The iron-reducing bacterium Shewanella oneidensis MR-1 has the capacity to contribute to iron cycling over the long term by respiring on crystalline iron oxides such as hematite when poorly crystalline phases are depleted. The ability of outer membrane cytochromes OmcA and MtrC of MR-1 to bind to an...
Engineering Shewanella oneidensis enables xylose-fed microbial fuel cell.
Li, Feng; Li, Yuanxiu; Sun, Liming; Li, Xiaofei; Yin, Changji; An, Xingjuan; Chen, Xiaoli; Tian, Yao; Song, Hao
2017-01-01
The microbial fuel cell (MFC) is a green and sustainable technology for electricity energy harvest from biomass, in which exoelectrogens use metabolism and extracellular electron transfer pathways for the conversion of chemical energy into electricity. However, Shewanella oneidensis MR-1, one of the most well-known exoelectrogens, could not use xylose (a key pentose derived from hydrolysis of lignocellulosic biomass) for cell growth and power generation, which limited greatly its practical applications. Herein, to enable S. oneidensis to directly utilize xylose as the sole carbon source for bioelectricity production in MFCs, we used synthetic biology strategies to successfully construct four genetically engineered S. oneidensis (namely XE, GE, XS, and GS) by assembling one of the xylose transporters (from Candida intermedia and Clostridium acetobutylicum ) with one of intracellular xylose metabolic pathways (the isomerase pathway from Escherichia coli and the oxidoreductase pathway from Scheffersomyces stipites ), respectively. We found that among these engineered S. oneidensis strains, the strain GS (i.e. harbouring Gxf1 gene encoding the xylose facilitator from C. intermedi , and XYL1 , XYL2 , and XKS1 genes encoding the xylose oxidoreductase pathway from S. stipites ) was able to generate the highest power density, enabling a maximum electricity power density of 2.1 ± 0.1 mW/m 2 . To the best of our knowledge, this was the first report on the rationally designed Shewanella that could use xylose as the sole carbon source and electron donor to produce electricity. The synthetic biology strategies developed in this study could be further extended to rationally engineer other exoelectrogens for lignocellulosic biomass utilization to generate electricity power.
Cheng, Yuan-Yuan; Li, Bing-Bing; Li, Dao-Bo; Chen, Jie-Jie; Li, Wen-Wei; Tong, Zhong-Hua; Wu, Chao; Yu, Han-Qing
2013-01-01
The dissimilatory metal reducing bacterium Shewanella oneidensis MR-1, known for its capacity of reducing iron and manganese oxides, has great environmental impacts. The iron oxides reducing process is affected by the coexistence of alternative electron acceptors in the environment, while investigation into it is limited so far. In this work, the impact of dimethyl sulphoxide (DMSO), a ubiquitous chemical in marine environment, on the reduction of hydrous ferric oxide (HFO) by S. oneidensis MR-1 was investigated. Results show that DMSO promoted HFO reduction by both wild type and ΔdmsE, but had no effect on the HFO reduction by ΔdmsB, indicating that such a promotion was dependent on the DMSO respiration. With the DMSO dosing, the levels of extracellular flavins and omcA expression were significantly increased in WT and further increased in ΔdmsE. Bioelectrochemical analysis show that DMSO also promoted the extracellular electron transfer of WT and ΔdmsE. These results demonstrate that DMSO could stimulate the HFO reduction through metabolic and genetic regulation in S. oneidensis MR-1, rather than compete for electrons with HFO. This may provide a potential respiratory pathway to enhance the microbial electron flows for environmental and engineering applications. PMID:24244312
Miller, Robert Bertram; Sadek, Anwar; Rodriguez, Alvaro; Iannuzzi, Mariano; Giai, Carla; Senko, John M.; Monty, Chelsea N.
2016-01-01
Microbially induced corrosion (MIC) is a complex problem that affects various industries. Several techniques have been developed to monitor corrosion and elucidate corrosion mechanisms, including microbiological processes that induce metal deterioration. We used zero resistance ammetry (ZRA) in a split chamber configuration to evaluate the effects of the facultatively anaerobic Fe(III) reducing bacterium Shewanella oneidensis MR-1 on the corrosion of UNS G10180 carbon steel. We show that activities of S. oneidensis inhibit corrosion of steel with which that organism has direct contact. However, when a carbon steel coupon in contact with S. oneidensis was electrically connected to a second coupon that was free of biofilm (in separate chambers of the split chamber assembly), ZRA-based measurements indicated that current moved from the S. oneidensis-containing chamber to the cell-free chamber. This electron transfer enhanced the O2 reduction reaction on the coupon deployed in the cell free chamber, and consequently, enhanced oxidation and corrosion of that electrode. Our results illustrate a novel mechanism for MIC in cases where metal surfaces are heterogeneously covered by biofilms. PMID:26824529
Miller, Robert Bertram; Sadek, Anwar; Rodriguez, Alvaro; Iannuzzi, Mariano; Giai, Carla; Senko, John M; Monty, Chelsea N
2016-01-01
Microbially induced corrosion (MIC) is a complex problem that affects various industries. Several techniques have been developed to monitor corrosion and elucidate corrosion mechanisms, including microbiological processes that induce metal deterioration. We used zero resistance ammetry (ZRA) in a split chamber configuration to evaluate the effects of the facultatively anaerobic Fe(III) reducing bacterium Shewanella oneidensis MR-1 on the corrosion of UNS G10180 carbon steel. We show that activities of S. oneidensis inhibit corrosion of steel with which that organism has direct contact. However, when a carbon steel coupon in contact with S. oneidensis was electrically connected to a second coupon that was free of biofilm (in separate chambers of the split chamber assembly), ZRA-based measurements indicated that current moved from the S. oneidensis-containing chamber to the cell-free chamber. This electron transfer enhanced the O2 reduction reaction on the coupon deployed in the cell free chamber, and consequently, enhanced oxidation and corrosion of that electrode. Our results illustrate a novel mechanism for MIC in cases where metal surfaces are heterogeneously covered by biofilms.
Methods for Imaging Shewanella Oneidensis MR-1 Nanofilaments
2010-01-01
R.E., 1980. Flagella on Legionnaires ’ disease bacteria: ultrastructural observations. Ann. Intern. Med. 93, 711–714. Choi, C.Q., 2006. Nanowires...Perspective paper Methods for imaging Shewanella oneidensis MR-1 nanofilaments R. Ray a, S . Lizewski b, L.A. Fitzgerald b, B. Little a, B.R...Research Laboratory, 4555 Overlook Avenue, SW, Washington, DC. 20375, USA a b s t r a c ta r t i c l e i n f o Article history: Received 21 May 2010
Enhancing Bidirectional Electron Transfer of Shewanella oneidensis by a Synthetic Flavin Pathway.
Yang, Yun; Ding, Yuanzhao; Hu, Yidan; Cao, Bin; Rice, Scott A; Kjelleberg, Staffan; Song, Hao
2015-07-17
Flavins regulate the rate and direction of extracellular electron transfer (EET) in Shewanella oneidensis. However, low concentration of endogenously secreted flavins by the wild-type S. oneidensis MR-1 limits its EET efficiency in bioelectrochemical systems (BES). Herein, a synthetic flavin biosynthesis pathway from Bacillus subtilis was heterologously expressed in S. oneidensis MR-1, resulting in ∼25.7 times' increase in secreted flavin concentration. This synthetic flavin module enabled enhanced bidirectional EET rate of MR-1, in which its maximum power output in microbial fuel cells increased ∼13.2 times (from 16.4 to 233.0 mW/m(2)), and the inward current increased ∼15.5 times (from 15.5 to 255.3 μA/cm(2)).
Le, Quang Anh Tuan; Kim, Hee Gon; Kim, Yong Hwan
2018-09-01
The electro-biocatalytic conversion of CO 2 into formic acid using whole-cell and isolated biocatalysts is useful as an alternative route for CO 2 sequestration. In this study, Shewanella oneidensis MR-1 (S. oneidensis MR-1), a facultative aerobic bacterium that has been extensively studied for its utility as biofuel cells as well as for the detoxification of heavy metal oxides (i.e., MnO 2 , uranium), has been applied for the first time as a whole-cell biocatalyst for formic acid synthesis from gaseous CO 2 and electrons supplied from an electrode. S. oneidensis MR-1, when aerobically grown in Luria-Bertani (LB) medium, exhibited its ability as a whole-cell biocatalyst for the conversion of CO 2 into formic acid with moderate productivity of 0.59 mM h -1 for 24 h. In addition, an optimization of growth conditions of S. oneidensis MR-1 resulted in a remarkable increase in productivity. The CO 2 reduction reaction catalyzed by S. oneidensis MR-1, when anaerobically grown in newly optimized LB medium supplemented with fumarate and nitrate, exhibited 3.2-fold higher productivity (1.9 mM h -1 for 72 h) compared to that grown aerobically in only LB medium. Furthermore, the average conversion rate of formic acid synthesis catalyzed by S. oneidensis MR-1 when grown in the optimal medium over a period of 72 h was 3.8 mM h -1 g -1 wet-cell, which is 9.6-fold higher than that catalyzed by Methylobacterium extorquens AM1 whole-cells in our previous study. Copyright © 2018 Elsevier Inc. All rights reserved.
Kane, Aunica L; Brutinel, Evan D; Joo, Heena; Maysonet, Rebecca; VanDrisse, Chelsey M; Kotloski, Nicholas J; Gralnick, Jeffrey A
2016-04-01
Shewanella oneidensis strain MR-1 is a facultative anaerobe that thrives in redox-stratified environments due to its ability to utilize a wide array of terminal electron acceptors. Conversely, the electron donors utilized by S. oneidensis are more limited and include products of primary fermentation such as lactate, pyruvate, formate, and hydrogen. Lactate, pyruvate, and hydrogen metabolisms inS. oneidensis have been described previously, but little is known about the role of formate oxidation in the ecophysiology of these bacteria. Formate is produced by S. oneidensis through pyruvate formate lyase during anaerobic growth on carbon sources that enter metabolism at or above the level of pyruvate, and the genome contains three gene clusters predicted to encode three complete formate dehydrogenase complexes. To determine the contribution of each complex to formate metabolism, strains lacking one, two, or all three annotated formate dehydrogenase gene clusters were generated and examined for growth rates and yields on a variety of carbon sources. Here, we report that formate oxidation contributes to both the growth rate and yield of S. oneidensis through the generation of proton motive force. Exogenous formate also greatly accelerated growth on N-acetylglucosamine, a carbon source normally utilized very slowly by S. oneidensis under anaerobic conditions. Surprisingly, deletion of all three formate dehydrogenase gene clusters enabled growth of S. oneidensis using pyruvate in the absence of a terminal electron acceptor, a mode of growth never before observed in these bacteria. Our results demonstrate that formate oxidation is a fundamental strategy under anaerobic conditions for energy conservation inS. oneidensis. Shewanella species have garnered interest in biotechnology applications for their ability to respire extracellular terminal electron acceptors, such as insoluble iron oxides and electrodes. While much effort has gone into studying the proteins for
Kane, Aunica L.; Brutinel, Evan D.; Joo, Heena; Maysonet, Rebecca; VanDrisse, Chelsey M.; Kotloski, Nicholas J.
2016-01-01
ABSTRACT Shewanella oneidensis strain MR-1 is a facultative anaerobe that thrives in redox-stratified environments due to its ability to utilize a wide array of terminal electron acceptors. Conversely, the electron donors utilized by S. oneidensis are more limited and include products of primary fermentation such as lactate, pyruvate, formate, and hydrogen. Lactate, pyruvate, and hydrogen metabolisms in S. oneidensis have been described previously, but little is known about the role of formate oxidation in the ecophysiology of these bacteria. Formate is produced by S. oneidensis through pyruvate formate lyase during anaerobic growth on carbon sources that enter metabolism at or above the level of pyruvate, and the genome contains three gene clusters predicted to encode three complete formate dehydrogenase complexes. To determine the contribution of each complex to formate metabolism, strains lacking one, two, or all three annotated formate dehydrogenase gene clusters were generated and examined for growth rates and yields on a variety of carbon sources. Here, we report that formate oxidation contributes to both the growth rate and yield of S. oneidensis through the generation of proton motive force. Exogenous formate also greatly accelerated growth on N-acetylglucosamine, a carbon source normally utilized very slowly by S. oneidensis under anaerobic conditions. Surprisingly, deletion of all three formate dehydrogenase gene clusters enabled growth of S. oneidensis using pyruvate in the absence of a terminal electron acceptor, a mode of growth never before observed in these bacteria. Our results demonstrate that formate oxidation is a fundamental strategy under anaerobic conditions for energy conservation in S. oneidensis. IMPORTANCE Shewanella species have garnered interest in biotechnology applications for their ability to respire extracellular terminal electron acceptors, such as insoluble iron oxides and electrodes. While much effort has gone into studying the
Li, Feng; Yin, Changji; Sun, Liming; Li, Yuanxiu; Guo, Xuewu; Song, Hao
2018-05-01
Microbial fuel cell (MFC) is an eco-friendly bio-electrochemical sys-tem that uses microorganism as biocatalyst to convert biomass into electricity. Glycerol, as a waste in the biodiesel refinery processes, is an appealing substrate for MFC. Nevertheless, glycerol cannot be utilized as carbon source by well-known exoelectrogens such as Shewanella oneidensis. Herein, to generate electricity by rapidly harnessing glycerol, the authors rationally constructed a Klebsiella pneumoniae-Shewanella oneidensis microbial consortium to efficiently harvest electricity from glyc-erol, in which K. pneumoniae converted glycerol into lactate, fed to S. oneidensis as carbon source and electron donor. To improve electricity output, the authors systematically engineered the consortium in terms of carbon flux distribution and efficiency of extracellular electron transfer (EET). To direct more carbon flux to lactate biosynthesis in K. pneumoniae, the authors eliminated the ethanol pathway by knocking out the alcohol dehydrogenase gene (adhE), and enhanced lactate biosynthesis by heterologously expressing a lactate dehydrogen-ase gene (ldhD) from Lactobacillus bulgaricus and a lactate transporter gene (lldP) from Escherichia coli. To facilitate EET between S. oneidensis and anode surfaces, a biosynthetic flavins pathway from Bacillus subtilis is introduced into S. oneidensis. The author further optimized the glycerol concentration, thus S. oneidensis could be continuously fed with lactate synthesized from K. pneumoniae at a constant rate. Our glycerol-fed MFC generated a maximum power density of 19.9 mW/m 2 , significantly higher than that of the wild-type consor-tium. This work suggested that engineering microbial consortia is an effi-cient strategy to expand the spectrum of usable carbon sources and promote electricity power production in MFCs. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
USDA-ARS?s Scientific Manuscript database
Shewanella oneidensis MR-1 was grown in a chemostatic, continuously-fed bioelectrochemical cell under slightly aerated conditions. The start-up phase was controlled potentiostatically (0.4 V vs. SHE). When a stable performance was achieved, the reactor was switched to bio-electrocatalytic producti...
Current Production and Metal Oxide Reduction by Shewanella oneidensis MR-1 Wild Type and Mutants▿ †
Bretschger, Orianna; Obraztsova, Anna; Sturm, Carter A.; Chang, In Seop; Gorby, Yuri A.; Reed, Samantha B.; Culley, David E.; Reardon, Catherine L.; Barua, Soumitra; Romine, Margaret F.; Zhou, Jizhong; Beliaev, Alexander S.; Bouhenni, Rachida; Saffarini, Daad; Mansfeld, Florian; Kim, Byung-Hong; Fredrickson, James K.; Nealson, Kenneth H.
2007-01-01
Shewanella oneidensis MR-1 is a gram-negative facultative anaerobe capable of utilizing a broad range of electron acceptors, including several solid substrates. S. oneidensis MR-1 can reduce Mn(IV) and Fe(III) oxides and can produce current in microbial fuel cells. The mechanisms that are employed by S. oneidensis MR-1 to execute these processes have not yet been fully elucidated. Several different S. oneidensis MR-1 deletion mutants were generated and tested for current production and metal oxide reduction. The results showed that a few key cytochromes play a role in all of the processes but that their degrees of participation in each process are very different. Overall, these data suggest a very complex picture of electron transfer to solid and soluble substrates by S. oneidensis MR-1. PMID:17644630
Methods for imaging Shewanella oneidensis MR-1 nanofilaments.
Ray, R; Lizewski, S; Fitzgerald, L A; Little, B; Ringeisen, B R
2010-08-01
Nanofilament production by Shewanella oneidensis MR-1 was evaluated as a function of lifestyle (planktonic vs. sessile) under aerobic and anaerobic conditions using different sample preparation techniques prior to imaging with scanning electron microscopy. Nanofilaments could be imaged on MR-1 cells grown in biofilms or planktonically under both aerobic and anaerobic batch culture conditions after fixation, critical point drying and coating with a conductive metal. Critical point drying was a requirement for imaging nanofilaments attached to planktonically grown MR-1 cells, but not for cells grown in a biofilm. Techniques described in this paper cannot be used to differentiate nanowires from pili or flagella.
Oxygen exposure promotes fuel diversity for Shewanella oneidensis microbial fuel cells.
Biffinger, Justin C; Byrd, Jacqueline N; Dudley, Breanna L; Ringeisen, Bradley R
2008-01-18
Miniature microbial fuel cells (mini-MFCs) were used to monitor the current generated by Shewanella oneidensis DSP10 under both anaerobic and aerobic conditions when exposed to glucose as a potential electron donor. In addition to glucose, other carbon fuels including fructose, sucrose, acetate, and ascorbic acid were also tested. When the anolyte containing S. oneidensis was grown in the presence of oxygen, power densities of 270+/-10, 350+/-20, and 120+/-10 W/m(3) were recorded from the mini-MFC for glucose, fructose, and ascorbic acid electron donors, respectively, while sucrose and acetate produced no response. The power produced from glucose decreased considerably (
Syed, Mustafa H; Karpinets, Tatiana V; Leuze, Michael R; Kora, Guruprasad H; Romine, Margaret R; Uberbacher, Edward C
2009-01-01
Shewanella oneidensis MR-1 is an important model organism for environmental research as it has an exceptional metabolic and respiratory versatility regulated by a complex regulatory network. We have developed a database to collect experimental and computational data relating to regulation of gene and protein expression, and, a visualization environment that enables integration of these data types. The regulatory information in the database includes predictions of DNA regulator binding sites, sigma factor binding sites, transcription units, operons, promoters, and RNA regulators including non-coding RNAs, riboswitches, and different types of terminators. Availability http://shewanella-knowledgebase.org:8080/Shewanella/gbrowserLanding.jsp PMID:20198195
2010-01-01
investigate extracellu- lar electron transfer in Shewanella oneidensisMR-1,where an array of nanoholes precludes or single window allows for direct...the single-cell level (Fig. 1B) highlights the re- lative sizes of the nanohole and window openings in the insulating layer deposited over electrodes...relative to individual bacteria such as Shewanella. The nanoholes are sufficiently small to preclude direct contact of the bacterial cell body to the
Kim, Dong-Hun; Kim, Min-Gyu; Jiang, Shenghua; Lee, Ji-Hoon; Hur, Hor-Gil
2013-08-06
The reduction of tellurite (Te(IV)) by dissimilatory metal reducing bacterium, Shewanella oneidensis MR-1, was promoted in the presence of Fe(III) in comparison with Te(IV) bioreduction in the absence of Fe(III). Electron microscopic analyses revealed that iron promoted Te(IV) reduction led to form exclusively extracellular crystalline Te(0) nanorods, as compared to the mostly intracellular formation of Te(0) nanorods in the absence of Fe(III). The Te K-edge X-ray absorption spectrometric analyses demonstrated that S. oneidensis MR-1 in the presence of Fe(III) reduced Te(IV) to less harmful metallic Te(0) nanorods through the precipitation of tellurite (Te(IV)Ox) complex by the bacterial respiration of Fe(III) to Fe(II) under anaerobic conditions. However, Fe(II) ion itself was only able to precipitate the solid tellurite (Te(IV)Ox) complex from the Te(IV) solution, which was not further reduced to Te(0). The results clearly indicated that bacterial S. oneidensis MR-1 plays important roles in the reduction and crystallization of Te(0) nanorods by as yet undetermined biochemical mechanisms. As compared to the slow bacterial Te(IV) reduction in the absence of Fe(III), the rapid reduction of Te(IV) to Te(0) by the concerted biogeochemical reaction between Fe(II) and S. oneidensis MR-1 could be applied for the sequestration and detoxification of Te(IV) in the environments as well as for the preparation of extracellular Te(0) nanorod structures.
Phage-induced lysis enhances biofilm formation in Shewanella oneidensis MR-1
Gödeke, Julia; Paul, Kristina; Lassak, Jürgen; Thormann, Kai M
2011-01-01
Shewanella oneidensis MR-1 is capable of forming highly structured surface-attached communities. By DNase I treatment, we demonstrated that extracellular DNA (eDNA) serves as a structural component in all stages of biofilm formation under static and hydrodynamic conditions. We determined whether eDNA is released through cell lysis mediated by the three prophages LambdaSo, MuSo1 and MuSo2 that are harbored in the genome of S. oneidensis MR-1. Mutant analyses and infection studies revealed that all three prophages may individually lead to cell lysis. However, only LambdaSo and MuSo2 form infectious phage particles. Phage release and cell lysis already occur during early stages of static incubation. A mutant devoid of the prophages was significantly less prone to lysis in pure culture. In addition, the phage-less mutant was severely impaired in biofilm formation through all stages of development, and three-dimensional growth occurred independently of eDNA as a structural component. Thus, we suggest that in S. oneidensis MR-1 prophage-mediated lysis results in the release of crucial biofilm-promoting factors, in particular eDNA. PMID:20962878
Cao, Yingxiu; Li, Xiaofei; Li, Feng; Song, Hao
2017-09-15
Extracellular electron transfer (EET) in Shewanella oneidensis MR-1, which is one of the most well-studied exoelectrogens, underlies many microbial electrocatalysis processes, including microbial fuel cells, microbial electrolysis cells, and microbial electrosynthesis. However, regulating the efficiency of EET remains challenging due to the lack of efficient genome regulation tools that regulate gene expression levels in S. oneidensis. Here, we systematically established a transcriptional regulation technology, i.e., clustered regularly interspaced short palindromic repeats interference (CRISPRi), in S. oneidensis MR-1 using green fluorescent protein (GFP) as a reporter. We used this CRISPRi technology to repress the expression levels of target genes, individually and in combination, in the EET pathways (e.g., the MtrCAB pathway and genes affecting the formation of electroactive biofilms in S. oneidensis), which in turn enabled the efficient regulation of EET efficiency. We then established a translational regulation technology, i.e., Hfq-dependent small regulatory RNA (sRNA), in S. oneidensis by repressing the GFP reporter and mtrA, which is a critical gene in the EET pathways in S. oneidensis. To achieve coordinated transcriptional and translational regulation at the genomic level, the CRISPRi and Hfq-dependent sRNA systems were incorporated into a single plasmid harbored in a recombinant S. oneidensis strain, which enabled an even higher efficiency of mtrA gene repression in the EET pathways than that achieved by the CRISPRi and Hfq-dependent sRNA system alone, as exhibited by the reduced electricity output. Overall, we developed a combined CRISPRi-sRNA method that enabled the synergistic transcriptional and translational regulation of target genes in S. oneidensis. This technology involving CRISPRi-sRNA transcriptional-translational regulation of gene expression at the genomic level could be applied to other microorganisms.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Turick, C; Amy Ekechukwu, A
2007-06-01
While mechanistic details of dissimilatory metal reduction are far from being understood, it is postulated that the electron transfer to solid metal oxides is mediated by outer membrane-associated c-type cytochromes and redox active electron shuttling compounds. This study focuses on the production of homogensitate in Shewanella oneidensis MR-1, an intermediate of tyrosine degradation pathway, which is a precursor of a redox cycling metabolite, pyomelanin. In this study, we determined that two enzymes involved in this pathway, 4-hydroxyphenylpyruvate dioxygenase (4HPPD) and homogentisate 1,2-dioxygenase are responsible for homogentisate production and oxidation, respectively. Inhibition of 4-HPPD activity with the specific inhibitor sulcotrione (2-(2-chloro-4-methanemore » sulfonylbenzoyl)-1,3-cyclohexanedione), and deletion of melA, a gene encoding 4-HPPD, resulted in no pyomelanin production by S. oneidensis MR-1. Conversely, deletion of hmgA which encodes the putative homogentisate 1,2-dioxygenase, resulted in pyomelanin overproduction. The efficiency and rates, with which MR-1 reduces hydrous ferric oxide, were directly linked to the ability of mutant strains to produce pyomelanin. Electrochemical studies with whole cells demonstrated that pyomelanin substantially increases the formal potential (E{sup o}{prime}) of S. oneidensis MR-1. Based on this work, environmental production of pyomelanin likely contributes to an increased solid-phase metal reduction capacity in Shewanella oneidensis.« less
A near-infrared light responsive c-di-GMP module-based AND logic gate in Shewanella oneidensis.
Hu, Yidan; Wu, Yichao; Mukherjee, Manisha; Cao, Bin
2017-01-31
A novel, biofilm-based AND logic gate was constructed in Shewanella oneidensis through a near-infrared (NIR) light responsive c-di-GMP module. The logic gate was demonstrated in microbial fuel cells with isopropyl β-d-thiogalactoside (IPTG) and NIR light as the inputs and electrical signals as the output.
Myers, Judith M.; Antholine, William E.; Myers, Charles R.
2004-01-01
The metal-reducing bacterium Shewanella oneidensis MR-1 displays remarkable anaerobic respiratory plasticity, which is reflected in the extensive number of electron transport components encoded in its genome. In these studies, several cell components required for the reduction of vanadium(V) were determined. V(V) reduction is mediated by an electron transport chain which includes cytoplasmic membrane components (menaquinone and the tetraheme cytochrome CymA) and the outer membrane (OM) cytochrome OmcB. A partial role for the OM cytochrome OmcA was evident. Electron spin resonance spectroscopy demonstrated that V(V) was reduced to V(IV). V(V) reduction did not support anaerobic growth. This is the first report delineating specific electron transport components that are required for V(V) reduction and of a role for OM cytochromes in the reduction of a soluble metal species. PMID:15006760
Survival of Shewanella Oneidensis MR-1 to GPa pressures
NASA Astrophysics Data System (ADS)
Hazael, Rachael; Foglia, Fabrizia; Leighs, James; Appleby-Thomas, Gareth; Daniel, Isabelle; Eakins, Daniel; Meersman, Filip; McMillian, Paul
2013-06-01
Most life on Earth is thought to occupy near-surface environments under relatively mild conditions of temperature, pressure, pH, salinity etc. That view is changing following discovery of extremophile organisms that prefer environments based on high or low T, extreme chemistries, or very high pressures. Over the past three decades, geomicrobiologists have discovered an extensive subsurface biosphere, that may account for between 1/10 to 1/3 of Earth's living biomass. We subjected samples of Shewanella oneidensis to several pressure cycles to examine its survival to static high pressures to above 1.5 GPa. Shewanella forms part of a genus that contains several piezophile species like S. violacea and S. benthica. We have obtained growth curves for populations recovered from high P conditions and cultured in the laboratory, before being subjected to even higher pressures. We have also carried out dynamic shock experiments using a specially designed cell to maintain high-P, low-T conditions during shock-recovery experiments and observe colony formation among the survivors. Colony counts, shape and growth curves allow us to compare the static vs dynamic pressure resistance of wild type vs pressure-adapted strains. Leverhulme
Wang, Li; Chen, Siyuan; Ding, Yiming; Zhu, Qiang; Zhang, Nijia; Yu, Shuqing
2018-01-01
The present work determines the anticancer activity of bio-mediated synthesized cadmium sulfide nanoparticles using the ionic liquid and bacterial cells (Shewanella oneidensis). Bacterial cells have been exposed to be important resources that hold huge potential as ecofriendly, cost-effective, evading toxic of dangerous chemicals and the alternative of conventional physiochemical synthesis. The Shewanella oneidensis is an important kind of metal reducing bacterium, known as its special anaerobic respiratory and sulfate reducing capacity. The crystalline nature, phase purity and surface morphology of biosynthesized cadmium sulfide nanoparticles were analyzed by Fourier transform infrared spectroscopy, X-ray diffraction, Field emission scanning electron microscopy, Energy dispersive spectroscopy and Transmission electron microscopy. The use of imidazolium based ionic liquids as soft templating agent for controlling self-assembly and crystal growth direction of metal sulfide nanoparticles has also advanced as an important method. The microscopic techniques showed that the nanoparticles are designed on the nano form and have an excellent spherical morphology, due to the self-assembled mechanism of ionic liquid assistance. The antitumor efficiency of the cadmium sulfide nanoparticles was investigated against brain cancer cell lines using rat glioma cell lines. The effectively improved nano-crystalline and morphological structure of CdS nanoparticles in the presence of IL exhibit excellent cytotoxicity and dispersion ability on the cell shape is completely spread out showing a nice toxic environment against cancer cells. The cytotoxicity effect of cadmium sulfide nanoparticles was discussed with a diagrammatic representation. Copyright © 2017. Published by Elsevier B.V.
Cellular Response of Shewanella oneidensis to Strontium Stress†
Brown, Steven D.; Martin, Madhavi; Deshpande, Sameer; Seal, Sudipta; Huang, Katherine; Alm, Eric; Yang, Yunfeng; Wu, Liyou; Yan, Tingfen; Liu, Xueduan; Arkin, Adam; Chourey, Karuna; Zhou, Jizhong; Thompson, Dorothea K.
2006-01-01
The physiology and transcriptome dynamics of the metal ion-reducing bacterium Shewanella oneidensis strain MR-1 in response to nonradioactive strontium (Sr) exposure were investigated. Studies indicated that MR-1 was able to grow aerobically in complex medium in the presence of 180 mM SrCl2 but showed severe growth inhibition at levels above that concentration. Temporal gene expression profiles were generated from aerobically grown, mid-exponential-phase MR-1 cells shocked with 180 mM SrCl2 and analyzed for significant differences in mRNA abundance with reference to data for nonstressed MR-1 cells. Genes with annotated functions in siderophore biosynthesis and iron transport were among the most highly induced (>100-fold [P < 0.05]) open reading frames in response to acute Sr stress, and a mutant (SO3032::pKNOCK) defective in siderophore production was found to be hypersensitive to SrCl2 exposure, compared to parental and wild-type strains. Transcripts encoding multidrug and heavy metal efflux pumps, proteins involved in osmotic adaptation, sulfate ABC transporters, and assimilative sulfur metabolism enzymes also were differentially expressed following Sr exposure but at levels that were several orders of magnitude lower than those for iron transport genes. Precipitate formation was observed during aerobic growth of MR-1 in broth cultures amended with 50, 100, or 150 mM SrCl2 but not in cultures of the SO3032::pKNOCK mutant or in the abiotic control. Chemical analysis of this precipitate using laser-induced breakdown spectroscopy and static secondary ion mass spectrometry indicated extracellular solid-phase sequestration of Sr, with at least a portion of the heavy metal associated with carbonate phases. PMID:16391131
Hu, Yidan; Yang, Yun; Katz, Evgeny; Song, Hao
2015-03-11
An AND logic gate based on a synthetic quorum-sensing (QS) module was constructed in a Shewanella oneidensis MR-1 mtrA knockout mutant. The presence of two input signals activated the expression of a periplasmic decaheme cytochrome MtrA to regenerate the extracellular electron transfer conduit, enabling the construction of AND-gated microbial fuel cells.
NASA Technical Reports Server (NTRS)
Ozawa, K.; Tsapin, A. I.; Nealson, K. H.; Cusanovich, M. A.; Akutsu, H.
2000-01-01
Cytochrome c(3) from Desulfovibrio vulgaris Miyazaki F was successfully expressed in the facultative aerobe Shewanella oneidensis MR-1 under anaerobic, microaerophilic, and aerobic conditions, with yields of 0.3 to 0.5 mg of cytochrome/g of cells. A derivative of the broad-host-range plasmid pRK415 containing the cytochrome c(3) gene from D. vulgaris Miyazaki F was used for transformation of S. oneidensis MR-1, resulting in the production of protein product that was indistinguishable from that produced by D. vulgaris Miyazaki F, except for the presence of one extra alanine residue at the N terminus.
Involvement of Shewanella oneidensis MR-1 LuxS in Biofilm Development and Sulfur Metabolism
DOE Office of Scientific and Technical Information (OSTI.GOV)
Learman, Deric R.; Yi, Haakrho; Brown, Steven D.
2009-01-05
The role of LuxS in Shewanella oneidensis MR-1 has been examined by transcriptomic profiling, biochemical, and physiological experiments. The results indicate that a mutation in luxS alters biofilm development, not by altering quorum-sensing abilities but by disrupting the activated methyl cycle (AMC). The S. oneidensis wild type can produce a luminescence response in the AI-2 reporter strain Vibrio harveyi MM32. This luminescence response is abolished upon the deletion of luxS. The deletion of luxS also alters biofilm formations in static and flowthrough conditions. Genetic complementation restores the mutant biofilm defect, but the addition of synthetic AI-2 has no effect. Thesemore » results suggest that AI-2 is not used as a quorum-sensing signal to regulate biofilm development in S. oneidensis. Growth on various sulfur sources was examined because of the involvement of LuxS in the AMC. A mutation in luxS produced a reduced ability to grow with methionine as the sole sulfur source. Methionine is a key metabolite used in the AMC to produce a methyl source in the cell and to recycle homocysteine. These data suggest that LuxS is important to metabolizing methionine and the AMC in S. oneidensis.« less
The role of Shewanella oneidensis MR-1 outer surface structures in extracellular electron transfer
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bouhenni, Rachida; Vora, Gary J.; Biffinger, Justin C.
2010-04-20
Shewanella oneidensis is a facultative anaerobe that uses more than 14 different terminal electron acceptors for respiration. These include metal oxides and hydroxyoxides, and toxic metals such as uranium and chromium. Mutants deficient in metal reduction were isolated using the mariner transposon derivative, minihimar RB1. These included mutants with transposon insertions in the prepilin peptidase and type II secretion system genes. All mutants were deficient in Fe(III) and Mn(IV) reduction, and exhibited slow growth when DMSO was used as the electron acceptor. The genome sequence of S. oneidensis contains one prepilin peptidase gene, pilD. A similar prepilin peptidase that maymore » function in the processing of type II secretion prepilins was not found. Single and multiple chromosomal deletions of four putative type IV pilin genes did not affect Fe(III) and Mn(IV) reduction. These results indicate that PilD in S. oneidensis is responsible for processing both type IV and type II secretion prepilin proteins. Type IV pili do not appear to be required for Fe(III) and Mn(IV) reduction.« less
Deletion of degQ gene enhances outer membrane vesicle production of Shewanella oneidensis cells.
Ojima, Yoshihiro; Mohanadas, Thivagaran; Kitamura, Kosei; Nunogami, Shota; Yajima, Reiki; Taya, Masahito
2017-04-01
Shewanella oneidensis is a Gram-negative facultative anaerobe that can use a wide variety of terminal electron acceptors for anaerobic respiration. In this study, S. oneidensis degQ gene, encoding a putative periplasmic serine protease, was cloned and expressed. The activity of purified DegQ was inhibited by diisopropyl fluorophosphate, a typical serine protease-specific inhibitor, indicating that DegQ is a serine protease. In-frame deletion and subsequent complementation of the degQ were carried out to examine the effect of envelope stress on the production of outer membrane vesicles (OMVs). Analysis of periplasmic proteins from the resulting S. oneidensis strain showed that deletion of degQ induced protein accumulation and resulted in a significant decrease in protease activity within the periplasmic space. OMVs from the wild-type and mutant strains were purified and observed by transmission electron microscopy. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis analysis of the OMVs showed a prominent band at ~37 kDa. Nanoliquid chromatography-tandem mass spectrometry analysis identified three outer membrane porins (SO3896, SO1821, and SO3545) as dominant components of the band, suggesting that these proteins could be used as indices for comparing OMV production by S. oneidensis strains. Quantitative evaluation showed that degQ-deficient cells had a fivefold increase in OMV production compared with wild-type cells. Thus, the increased OMV production following the deletion of DegQ in S. oneidensis may be responsible for the increase in envelope stress.
Fapetu, Segun; Keshavarz, Taj; Clements, Mark; Kyazze, Godfrey
2016-09-01
To investigate the contribution of direct electron transfer mechanisms to electricity production in microbial fuel cells by physically retaining Shewanella oneidensis cells close to or away from the anode electrode. A maximum power output of 114 ± 6 mWm(-2) was obtained when cells were retained close to the anode using a dialysis membrane. This was 3.5 times more than when the cells were separated away from the anode. Without the membrane the maximum power output was 129 ± 6 mWm(-2). The direct mechanisms of electron transfer contributed significantly to overall electron transfer from S. oneidensis to electrodes, a result that was corroborated by another experiment where S. oneidensis cells were entrapped in alginate gels. S. oneidensis transfers electrons primarily by direct electron transfer as opposed to mediated electron transfer.
USDA-ARS?s Scientific Manuscript database
Background. Shewanella oneidensis is a target of extensive research efforts in the fields of bioelectrochemical systems and bioremediation because of its versatile metabolic capabilities, especially in regards to the respiration with extracellular electron acceptors. Here, we took a global approach ...
Electrochemical Measurement of Electron Transfer Kinetics by Shewanella oneidensis MR-1*
Baron, Daniel; LaBelle, Edward; Coursolle, Dan; Gralnick, Jeffrey A.; Bond, Daniel R.
2009-01-01
Shewanella oneidensis strain MR-1 can respire using carbon electrodes and metal oxyhydroxides as electron acceptors, requiring mechanisms for transferring electrons from the cell interior to surfaces located beyond the cell. Although purified outer membrane cytochromes will reduce both electrodes and metals, S. oneidensis also secretes flavins, which accelerate electron transfer to metals and electrodes. We developed techniques for detecting direct electron transfer by intact cells, using turnover and single turnover voltammetry. Metabolically active cells attached to graphite electrodes produced thin (submonolayer) films that demonstrated both catalytic and reversible electron transfer in the presence and absence of flavins. In the absence of soluble flavins, electron transfer occurred in a broad potential window centered at ∼0 V (versus standard hydrogen electrode), and was altered in single (ΔomcA, ΔmtrC) and double deletion (ΔomcA/ΔmtrC) mutants of outer membrane cytochromes. The addition of soluble flavins at physiological concentrations significantly accelerated electron transfer and allowed catalytic electron transfer to occur at lower applied potentials (−0.2 V). Scan rate analysis indicated that rate constants for direct electron transfer were slower than those reported for pure cytochromes (∼1 s−1). These observations indicated that anodic current in the higher (>0 V) window is due to activation of a direct transfer mechanism, whereas electron transfer at lower potentials is enabled by flavins. The electrochemical dissection of these activities in living cells into two systems with characteristic midpoint potentials and kinetic behaviors explains prior observations and demonstrates the complementary nature of S. oneidensis electron transfer strategies. PMID:19661057
Roy, Jared N; Luckarift, Heather R; Sizemore, Susan R; Farrington, Karen E; Lau, Carolin; Johnson, Glenn R; Atanassov, Plamen
2013-07-10
In this work we present a biological fuel cell fabricated by combining a Shewanella oneidensis microbial anode and a laccase-modified air-breathing cathode. This concept is devised as an extension to traditional biochemical methods by incorporating diverse biological catalysts with the aim of powering small devices. In preparing the biological fuel cell anode, novel hierarchical-structured architectures and biofilm configurations were investigated. A method for creating an artificial biofilm based on encapsulating microorganisms in a porous, thin film of silica was compared with S. oneidensis biofilms that were allowed to colonize naturally. Results indicate comparable current and power densities for artificial and natural biofilm formations, based on growth characteristics. As a result, this work describes methods for creating controllable and reproducible bio-anodes and demonstrates the versatility of hybrid biological fuel cells. Copyright © 2013 Elsevier Inc. All rights reserved.
Effect of Thiols, Zinc, and Redox Conditions on Hg Uptake in Shewanella oneidensis
Szczuka, Aleksandra; Morel, Francois M. M.; Schaefer, Jeffra K.
2015-05-18
Mercury uptake in bacteria represents a key first step in the production and accumulation Of methylmercury in biota. Previous experiments with mercury methylating bacteria have shown that Hg uptake is enhanced by some thiols, in particular cysteine, and that it is an energy-dependent process through heavy Metal TA transporters. In this study, we examine Hg uptake in the nonmethylating facultative aerobe, Shewanella oneidensis, under both anaerobic and aerobic conditions. Our results demonstrate similar characteristics of the Hg uptake system to those of the Hg methylating strains: uptake is enhanced in the presence of some thiols but not others; uptake ismore » energy dependent as evidenced by inhibition by a protonophore; and uptake is inhibited by high Zn(II) concentrations. Initial cellular uptake rates in S. oneidensis were remarkably similar under aerobic and fumarate-reducing conditions. In conclusion, these data support a similar Hg(II) uptake mechanism within the proteobacteria of accidental Hg(II) transport through heavy metal transporters with similar rates of uptake but differences in the ability to take up Hg bound to different thiols.« less
Deutschbauer, Adam; Price, Morgan N.; Wetmore, Kelly M.; Shao, Wenjun; Baumohl, Jason K.; Xu, Zhuchen; Nguyen, Michelle; Tamse, Raquel; Davis, Ronald W.; Arkin, Adam P.
2011-01-01
Most genes in bacteria are experimentally uncharacterized and cannot be annotated with a specific function. Given the great diversity of bacteria and the ease of genome sequencing, high-throughput approaches to identify gene function experimentally are needed. Here, we use pools of tagged transposon mutants in the metal-reducing bacterium Shewanella oneidensis MR-1 to probe the mutant fitness of 3,355 genes in 121 diverse conditions including different growth substrates, alternative electron acceptors, stresses, and motility. We find that 2,350 genes have a pattern of fitness that is significantly different from random and 1,230 of these genes (37% of our total assayed genes) have enough signal to show strong biological correlations. We find that genes in all functional categories have phenotypes, including hundreds of hypotheticals, and that potentially redundant genes (over 50% amino acid identity to another gene in the genome) are also likely to have distinct phenotypes. Using fitness patterns, we were able to propose specific molecular functions for 40 genes or operons that lacked specific annotations or had incomplete annotations. In one example, we demonstrate that the previously hypothetical gene SO_3749 encodes a functional acetylornithine deacetylase, thus filling a missing step in S. oneidensis metabolism. Additionally, we demonstrate that the orphan histidine kinase SO_2742 and orphan response regulator SO_2648 form a signal transduction pathway that activates expression of acetyl-CoA synthase and is required for S. oneidensis to grow on acetate as a carbon source. Lastly, we demonstrate that gene expression and mutant fitness are poorly correlated and that mutant fitness generates more confident predictions of gene function than does gene expression. The approach described here can be applied generally to create large-scale gene-phenotype maps for evidence-based annotation of gene function in prokaryotes. PMID:22125499
ArcS, the cognate sensor kinase in an atypical Arc system of Shewanella oneidensis MR-1.
Lassak, Jürgen; Henche, Anna-Lena; Binnenkade, Lucas; Thormann, Kai M
2010-05-01
The availability of oxygen is a major environmental factor for many microbes, in particular for bacteria such as Shewanella species, which thrive in redox-stratified environments. One of the best-studied systems involved in mediating the response to changes in environmental oxygen levels is the Arc two-component system of Escherichia coli, consisting of the sensor kinase ArcB and the cognate response regulator ArcA. An ArcA ortholog was previously identified in Shewanella, and as in Escherichia coli, Shewanella ArcA is involved in regulating the response to shifts in oxygen levels. Here, we identified the hybrid sensor kinase SO_0577, now designated ArcS, as the previously elusive cognate sensor kinase of the Arc system in Shewanella oneidensis MR-1. Phenotypic mutant characterization, transcriptomic analysis, protein-protein interaction, and phosphotransfer studies revealed that the Shewanella Arc system consists of the sensor kinase ArcS, the single phosphotransfer domain protein HptA, and the response regulator ArcA. Phylogenetic analyses suggest that HptA might be a relict of ArcB. Conversely, ArcS is substantially different with respect to overall sequence homologies and domain organizations. Thus, we speculate that ArcS might have adopted the role of ArcB after a loss of the original sensor kinase, perhaps as a consequence of regulatory adaptation to a redox-stratified environment.
De Windt, Wim; Boon, Nico; Siciliano, Steven D; Verstraete, Willy
2003-11-01
In the absence of oxygen, a protective H2 film is formed around an Fe(0) surface, inhibiting the electron flow from this surface. Our study of anoxic corrosion of Fe(0) beads revealed that, in the presence of Shewanella oneidensis MR-1, H2 removal and precipitation of Fe mineral particles on the cell surface are determining processes for corrosion. These two biologically mediated processes were governed by cell density. H2 removal by Shewanella oneidensis was detected at cell concentrations of 1.0 x 10(6) live cells ml-1 and higher and H2 was electron donor for denitrification of NO3-. The removal of the protective H2 layer from Fe(0) beads by Shewanella oneidensis, resulted in an increase of Fe release out of the Fe(0) beads from 153 +/- 25 mg l(-1) to 196 +/- 7 mg l-1 after 20 h. When the cell concentration exceeded 1.0 x 10(8) live cells ml-1, precipitation of iron minerals on the cell surface was characteristic for the greatest percentage of MR-1 cells, whereas micrometre-scale iron precipitates not associated with culturable cell biomass significantly decreased in number. Addition of supernatant of a corrosion assay with high cell concentration induced metabolic activity in a corrosion assay with low cell concentration, resulting in increased H2 consumption and Fe release from Fe(0) beads. Homoserine lactone-like molecules were detected in the supernatant by a bio-assay, suggesting the involvement of a quorum-sensing regulatory mechanism.
Growth Trade-Offs Accompany the Emergence of Glycolytic Metabolism in Shewanella oneidensis MR-1
Chubiz, Lon M.; Marx, Christopher J.
2017-03-13
Bacteria increase their metabolic capacity via the acquisition of genetic material or by the mutation of genes already present in the genome. Here, we explore the mechanisms and trade-offs involved whenShewanella oneidensis, a bacterium that typically consumes small organic and amino acids, rapidly evolves to expand its metabolic capacity to catabolize glucose after a short period of adaptation to a glucose-rich environment. Using whole-genome sequencing and genetic approaches, we discovered that deletions in a region including the transcriptional repressor (nagR) that regulates the expression of genes associated with catabolism ofN-acetylglucosamine are the common basis for evolved glucose metabolism across populations.more » The loss ofnagRresults in the constitutive expression of genes for anN-acetylglucosamine permease (nagP) and kinase (nagK). We demonstrate that promiscuous activities of both NagP and NagK toward glucose allow for the transport and phosphorylation of glucose to glucose-6-phosphate, the initial events of glycolysis otherwise thought to be absent inS. oneidensis. 13C-based metabolic flux analysis uncovered that subsequent utilization was mediated by the Entner-Doudoroff pathway. This is an example whereby gene loss and preexisting enzymatic promiscuity, and not gain-of-function mutations, were the drivers of increased metabolic capacity. However, we observed a significant decrease in the growth rate on lactate after adaptation to glucose catabolism, suggesting that trade-offs may explain why glycolytic function may not be readily observed inS. oneidensisin natural environments despite it being readily accessible through just a single mutational event.Gains in metabolic capacity are frequently associated with the acquisition of novel genetic material via natural or engineered horizontal gene transfer events. Here, we explored how a bacterium that typically consumes small organic acids and amino acids expands its metabolic capacity to include
Growth Trade-Offs Accompany the Emergence of Glycolytic Metabolism in Shewanella oneidensis MR-1
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chubiz, Lon M.; Marx, Christopher J.
Bacteria increase their metabolic capacity via the acquisition of genetic material or by the mutation of genes already present in the genome. Here, we explore the mechanisms and trade-offs involved whenShewanella oneidensis, a bacterium that typically consumes small organic and amino acids, rapidly evolves to expand its metabolic capacity to catabolize glucose after a short period of adaptation to a glucose-rich environment. Using whole-genome sequencing and genetic approaches, we discovered that deletions in a region including the transcriptional repressor (nagR) that regulates the expression of genes associated with catabolism ofN-acetylglucosamine are the common basis for evolved glucose metabolism across populations.more » The loss ofnagRresults in the constitutive expression of genes for anN-acetylglucosamine permease (nagP) and kinase (nagK). We demonstrate that promiscuous activities of both NagP and NagK toward glucose allow for the transport and phosphorylation of glucose to glucose-6-phosphate, the initial events of glycolysis otherwise thought to be absent inS. oneidensis. 13C-based metabolic flux analysis uncovered that subsequent utilization was mediated by the Entner-Doudoroff pathway. This is an example whereby gene loss and preexisting enzymatic promiscuity, and not gain-of-function mutations, were the drivers of increased metabolic capacity. However, we observed a significant decrease in the growth rate on lactate after adaptation to glucose catabolism, suggesting that trade-offs may explain why glycolytic function may not be readily observed inS. oneidensisin natural environments despite it being readily accessible through just a single mutational event.Gains in metabolic capacity are frequently associated with the acquisition of novel genetic material via natural or engineered horizontal gene transfer events. Here, we explored how a bacterium that typically consumes small organic acids and amino acids expands its metabolic capacity to include
Investigations of structure and metabolism within Shewanella oneidensis MR-1 biofilms.
McLean, Jeffrey S; Majors, Paul D; Reardon, Catherine L; Bilskis, Christina L; Reed, Samantha B; Romine, Margaret F; Fredrickson, James K
2008-07-01
Biofilms possess spatially and temporally varying metabolite concentration profiles at the macroscopic and microscopic scales. This results in varying growth environments that may ultimately drive species diversity, determine biofilm structure and the spatial distribution of the community members. Using non-invasive nuclear magnetic resonance (NMR) microscopic imaging/spectroscopy and confocal imaging, we investigated the kinetics and stratification of anaerobic metabolism within live biofilms of the dissimilatory metal-reducing bacterium Shewanella oneidensis strain MR-1. Biofilms were pre-grown using a defined minimal medium in a constant-depth film bioreactor and subsequently transferred to an in-magnet sample chamber under laminar flow for NMR measurements. Biofilms generated in this manner were subjected to changing substrate/electron acceptor combinations (fumarate, dimethyl sulfoxide, and nitrate) and the metabolic responses measured. Localized NMR spectroscopy was used to non-invasively measure hydrogen-containing metabolites at high temporal resolution (4.5 min) under O(2)-limited conditions. Reduction of electron acceptor under anaerobic conditions was immediately observed upon switching feed solutions indicating that no gene induction (transcriptional response) was needed for MR-1 to switch metabolism from O(2) to fumarate, dimethyl sulfoxide or nitrate. In parallel experiments, confocal microscopy was used with constitutively expressed fluorescent reporters to independently investigate changes in population response to the availability of electron acceptor and to probe metabolic competition under O(2)-limited conditions. A clearer understanding of the metabolic diversity and plasticity of the biofilm mode of growth as well as how these factors relate to environmental fitness is made possible through the use of non-invasive and non-destructive techniques such as described herein.
NASA Astrophysics Data System (ADS)
Gelabert, A.; Wang, Y.; Gescher, J.; Ha, J.; Cordova, C. D.; Singer, D. M.; Spormann, A. M.; Trainor, T. P.; Eng, P. J.; Brown, G. E.
2006-12-01
Fe- and Al-(oxyhydr)oxides are among the most reactive mineral surfaces contacted by surface and ground waters, and thus they constitute important sorbents for heavy metal and metalloid ions. As microbial biofilms may be present as coatings on these minerals, they are likely to induce major changes in surface charges and sorption capacities for metal(loid) ions compared to biofilm-free mineral surfaces. In addition, the micro- environments in biofilms can be quite different from those in bulk solutions, which can enhance (or inhibit) metal adsorption on mineral surfaces and produce biominerals that are not predicted by equilibrium thermodynamics based on the bulk solution values. In order to provide a more quantitative understanding of these effects, we have carried out a study of the interaction of Zn(II), Pb(II), and As(V) with Shewanella oneidensis (wild type, EPS-deficient mutant, and ppx- and ppk-deficient mutants) grown on highly polished and oriented single crystal surfaces of α-Al2O3 (1-102) and α-Fe2O3 (0001). This gram-negative bacterium commonly found in soil and sediments can use a wide range of electron donors and terminal electron acceptors including Fe(III) and Mn(IV) oxides under anaerobic conditions. In-situ ATR-FTIR analyses and potentiometric titrations of S. oneidensis biofilm collected from a glass bead-filled column inoculated with S. oneidensis were conducted in order to determine the nature of functional groups present on the bacterial surfaces, to quantify the site densities and protonation constants for these groups, and to determine the electrostatic parameters for S. oneidensis surfaces. GI-XAFS analyses performed on BL 11-2 at SSRL, together with macroscopic metal adsorption experiments as a function of pH (2 to 6.5), metal concentration (10-3 to 10-7 M), and ionic strength (10-1 to 10-3 M), were used to determine ion speciation and local coordination environments in the biofilm and to develop a surface complexation model describing
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nissen, Silke; Liu, Xiaoxin; Chourey, Karuna
2012-01-01
The genomes of Shewanella oneidensis strain MR-1 and Anaeromyxobacter dehalogenans strain 2CP-C encode 40 and 69 putative c-type cytochrome genes, respectively. Deletion mutant and biochemical studies have assigned specific functions to a few c-type cytochromes involved in electron transfer to oxidised metals in Shewanella oneidensis strain MR-1. Although promising, the genetic approach is limited to gene deletions that produce a distinct phenotype, and organism for which a genetic system is available. To more comprehensively investigate and compare c-type cytochrome expression in Shewanella oneidensis strain MR-1 and Anaeromyxobacter dehalogenans strain 2CP-C, proteomic measurements were used to characterise lysates of cells grownmore » with soluble Fe(III) (as ferric citrate) and insoluble Mn(IV) (as MnO2) as electron acceptors. Strain MR-1 expressed 19 and 20, and strain 2CP-C expressed 27 and 25 c-type cytochromes when grown with Fe(III) and Mn(IV), respectively. The majority of c-type cytochromes (77% for strain MR-1 and 63% for strain 2CP-C) were expressed under both growth conditions; however, the analysis also revealed unique c-type cytochromes that were specifically expressed in cells grown with soluble Fe(III) or insoluble Mn(IV). Proteomic characterisation proved to be a promising approach for determining the c-type cytochrome complement expressed under different growth conditions, and will help elucidating the specific functions of more c-type cytochromes that are the basis for Shewanella and Anaeromyxobacter respiratory versatility.« less
Elegheert, Jonathan; Brigé, Ann; Van Beeumen, Jozef; Savvides, Savvas N
2017-10-01
Shewanella oneidensis, a Gram-negative γ-proteobacterium with an extensive redox capacity, possesses four old yellow enzyme (OYE) homologs. Of these, Shewanella yellow enzyme 4 (SYE4) is implicated in resistance to oxidative stress. Here, we present a series of high-resolution crystal structures for SYE4 in the oxidized and reduced states, and in complex with phenolic ligands and the nitro-aromatic explosive picric acid. The structures unmask new features, including the identification of a binding platform for long-chain hydrophobic molecules. Furthermore, we present the first structural observation of a hydride-Meisenheimer complex of picric acid with a flavoenzyme. Overall, our study exposes the binding promiscuity of SYE4 toward a variety of electrophilic substrates and is consistent with a general detoxification function for SYE4. © 2017 Federation of European Biochemical Societies.
Leaphart, Adam B.; Thompson, Dorothea K.; Huang, Katherine; Alm, Eric; Wan, Xiu-Feng; Arkin, Adam; Brown, Steven D.; Wu, Liyou; Yan, Tingfen; Liu, Xueduan; Wickham, Gene S.; Zhou, Jizhong
2006-01-01
The molecular response of Shewanella oneidensis MR-1 to variations in extracellular pH was investigated based on genomewide gene expression profiling. Microarray analysis revealed that cells elicited both general and specific transcriptome responses when challenged with environmental acid (pH 4) or base (pH 10) conditions over a 60-min period. Global responses included the differential expression of genes functionally linked to amino acid metabolism, transcriptional regulation and signal transduction, transport, cell membrane structure, and oxidative stress protection. Response to acid stress included the elevated expression of genes encoding glycogen biosynthetic enzymes, phosphate transporters, and the RNA polymerase sigma-38 factor (rpoS), whereas the molecular response to alkaline pH was characterized by upregulation of nhaA and nhaR, which are predicted to encode an Na+/H+ antiporter and transcriptional activator, respectively, as well as sulfate transport and sulfur metabolism genes. Collectively, these results suggest that S. oneidensis modulates multiple transporters, cell envelope components, and pathways of amino acid consumption and central intermediary metabolism as part of its transcriptome response to changing external pH conditions. PMID:16452448
Synthetic and Evolutionary Construction of a Chlorate-Reducing Shewanella oneidensis MR-1.
Clark, Iain C; Melnyk, Ryan A; Youngblut, Matthew D; Carlson, Hans K; Iavarone, Anthony T; Coates, John D
2015-05-19
Despite evidence for the prevalence of horizontal gene transfer of respiratory genes, little is known about how pathways functionally integrate within new hosts. One example of a mobile respiratory metabolism is bacterial chlorate reduction, which is frequently encoded on composite transposons. This implies that the essential components of the metabolism are encoded on these mobile elements. To test this, we heterologously expressed genes for chlorate reduction from Shewanella algae ACDC in the non-chlorate-reducing Shewanella oneidensis MR-1. The construct that ultimately endowed robust growth on chlorate included cld, a cytochrome c gene, clrABDC, and two genes of unknown function. Although strain MR-1 was unable to grow on chlorate after initial insertion of these genes into the chromosome, 11 derived strains capable of chlorate respiration were obtained through adaptive evolution. Genome resequencing indicated that all of the evolved chlorate-reducing strains replicated a large genomic region containing chlorate reduction genes. Contraction in copy number and loss of the ability to reduce chlorate were also observed, indicating that this phenomenon was extremely dynamic. Although most strains contained more than six copies of the replicated region, a single strain with less duplication also grew rapidly. This strain contained three additional mutations that we hypothesized compensated for the low copy number. We remade the mutations combinatorially in the unevolved strain and determined that a single nucleotide polymorphism (SNP) upstream of cld enabled growth on chlorate and was epistatic to a second base pair change in the NarP binding sequence between narQP and nrfA that enhanced growth. The ability of chlorate reduction composite transposons to form functional metabolisms after transfer to a new host is an important part of their propagation. To study this phenomenon, we engineered Shewanella oneidensis MR-1 into a chlorate reducer. We defined a set of
Lee, Calvin K; Kim, Alexander J; Santos, Giancarlo S; Lai, Peter Y; Lee, Stella Y; Qiao, David F; Anda, Jaime De; Young, Thomas D; Chen, Yujie; Rowe, Annette R; Nealson, Kenneth H; Weiss, Paul S; Wong, Gerard C L
2016-09-06
Cell size control and homeostasis are fundamental features of bacterial metabolism. Recent work suggests that cells add a constant size between birth and division ("adder" model). However, it is not known how cell size homeostasis is influenced by the existence of heterogeneous microenvironments, such as those during biofilm formation. Shewanella oneidensis MR-1 can use diverse energy sources on a range of surfaces via extracellular electron transport (EET), which can impact growth, metabolism, and size diversity. Here, we track bacterial surface communities at single-cell resolution to show that not only do bacterial motility appendages influence the transition from two- to three-dimensional biofilm growth and control postdivisional cell fates, they strongly impact cell size homeostasis. For every generation, we find that the average growth rate for cells that stay on the surface and continue to divide (nondetaching population) and that for cells that detach before their next division (detaching population) are roughly constant. However, the growth rate distribution is narrow for the nondetaching population, but broad for the detaching population in each generation. Interestingly, the appendage deletion mutants (ΔpilA, ΔmshA-D, Δflg) have significantly broader growth rate distributions than that of the wild type for both detaching and nondetaching populations, which suggests that Shewanella appendages are important for sensing and integrating environmental inputs that contribute to size homeostasis. Moreover, our results suggest multiplexing of appendages for sensing and motility functions contributes to cell size dysregulation. These results can potentially provide a framework for generating metabolic diversity in S. oneidensis populations to optimize EET in heterogeneous environments.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Turick, Charles E.; Beliaev, Alex S.; Zakrajsek, Brian A.
2009-05-01
ABSTRACT - While mechanistic details of dissimilatory metal reduction are far from being understood, it is postulated that the electron transfer to solid metal oxides is mediated by outer membrane associated c-type cytochromes and electron shuttling compounds. This study focuses on the production of homogensitate in Shewanella oneidensis MR-1, an intermediate of the tyrosine degradation pathway, which is a precursor of a redox cycling metabolite, pyomelanin. We determined that two enzymes involved in this pathway, 4-hydroxyphenylpyruvate dioxygenase (4HPPD) and homogentisate 1,2-dioxygenase are responsible for homogentisate production and oxidation, respectively. Inhibition of 4-HPPD activity with the specific inhibitor sulcotrione ([2-(2- chloro-more » 4- methane sulfonylbenzoyl)-1,3-cyclohexanedione), and deletion of melA, a gene encoding 4-HPPD, resulted in no pyomelanin production by S. oneidensis MR-1. Conversely, deletion of hmgA, which encodes the putative homogentisate 1,2-dioxygenase, resulted in pyomelanin overproduction. The efficiency and rates at which MR-1 reduces hydrous ferric oxide were directly linked to the ability of mutant strains to produce pyomelanin. Electrochemical studies with whole cells demonstrated that pyomelanin substantially increases the formal potential (E°') of S. oneidensis MR-1. Based on our findings, environmental production of pyomelanin likely contributes to an increased solid-phase metal reduction capacity in S. oneidensis MR-1.« less
Ding, Yuanzhao; Peng, Ni; Du, Yonghua; Ji, Lianghui
2014-01-01
Although biofilm-based bioprocesses have been increasingly used in various applications, the long-term robust and efficient biofilm performance remains one of the main bottlenecks. In this study, we demonstrated that biofilm cohesiveness and performance of Shewanella oneidensis can be enhanced through disrupting putrescine biosynthesis. Through random transposon mutagenesis library screening, one hyperadherent mutant strain, CP2-1-S1, exhibiting an enhanced capability in biofilm formation, was obtained. Comparative analysis of the performance of biofilms formed by S. oneidensis MR-1 wild type (WT) and CP2-1-S1 in removing dichromate (Cr2O72−), i.e., Cr(VI), from the aqueous phase showed that, compared with the WT biofilms, CP2-1-S1 biofilms displayed a substantially lower rate of cell detachment upon exposure to Cr(VI), suggesting a higher cohesiveness of the mutant biofilms. In addition, the amount of Cr(III) immobilized by CP2-1-S1 biofilms was much larger, indicating an enhanced performance in Cr(VI) bioremediation. We further showed that speF, a putrescine biosynthesis gene, was disrupted in CP2-1-S1 and that the biofilm phenotypes could be restored by both genetic and chemical complementations. Our results also demonstrated an important role of putrescine in mediating matrix disassembly in S. oneidensis biofilms. PMID:24362428
Sivakumar, Krishnakumar; Mukherjee, Manisha; Cheng, Hsin-I; Zhang, Yingdan; Ji, Lianghui; Cao, Bin
2015-03-01
Biofilms are the most ubiquitous and resilient form of microbial life on earth. One most important feature of a biofilm is the presence of a self-produced matrix, which creates highly heterogeneous and dynamic microenvironments within biofilms. Redox status in biofilm microenvironments plays a critical role in biofilm development and function. However, there is a lack of non-intrusive tools to quantify extracellular redox status of microenvironments within a biofilm matrix. In this study, using Shewanella oneidensis as a model organism, we demonstrated a novel approach to monitor extracellular redox status in biofilm microenvironments. Specifically, we displayed a redox sensitive fluorescence protein roGFP onto the cell surface of S. oneidensis by fusing it to the C-terminus of BpfA, a large surface protein, and used the surface displayed roGFP as a sensor to quantify the extracellular redox status in the matrix of S. oneidensis biofilms. The fusion of roGFP into BpfA has no negative impacts on cell growth and biofilm formation. Upon exposure to oxidizing agents such as H2 O2 , Ag(+) , and SeO3 (2-) , S. oneidensis BpfA-roGFP cells exhibited a characteristic fluorescence of roGFP. Proteinase treatment assay and super-resolution structured illumination microscopy confirmed the surface localization of BpfA-roGFP. We further used the surface displayed roGFP monitored the extracellular redox status in the matrix at different depths of a biofilm exposed to H2 O2 . This study provides a novel approach to non-invasively monitor extracellular redox status in microenvironments within biofilms, which can be used to understand redox responses of biofilms to environmental perturbations. © 2014 Wiley Periodicals, Inc.
NASA Astrophysics Data System (ADS)
Cooper, Rebecca Elizabeth; Eusterhues, Karin; Wegner, Carl-Eric; Totsche, Kai Uwe; Küsel, Kirsten
2017-11-01
The formation of Fe(III) oxides in natural environments occurs in the presence of natural organic matter (OM), resulting in the formation of OM-mineral complexes that form through adsorption or coprecipitation processes. Thus, microbial Fe(III) reduction in natural environments most often occurs in the presence of OM-mineral complexes rather than pure Fe(III) minerals. This study investigated to what extent does the content of adsorbed or coprecipitated OM on ferrihydrite influence the rate of Fe(III) reduction by Shewanella oneidensis MR-1, a model Fe(III)-reducing microorganism, in comparison to a microbial consortium extracted from the acidic, Fe-rich Schlöppnerbrunnen fen. We found that increased OM content led to increased rates of microbial Fe(III) reduction by S. oneidensis MR-1 in contrast to earlier findings with the model organism Geobacter bremensis. Ferrihydrite-OM coprecipitates were reduced slightly faster than ferrihydrites with adsorbed OM. Surprisingly, the complex microbial consortia stimulated by a mixture of electrons donors (lactate, acetate, and glucose) mimics S. oneidensis under the same experimental Fe(III)-reducing conditions suggesting similar mechanisms of electron transfer whether or not the OM is adsorbed or coprecipitated to the mineral surfaces. We also followed potential shifts of the microbial community during the incubation via 16S rRNA gene sequence analyses to determine variations due to the presence of adsorbed or coprecipitated OM-ferrihydrite complexes in contrast to pure ferrihydrite. Community profile analyses showed no enrichment of typical model Fe(III)-reducing bacteria, such as Shewanella or Geobacter sp., but an enrichment of fermenters (e.g., Enterobacteria) during pure ferrihydrite incubations which are known to use Fe(III) as an electron sink. Instead, OM-mineral complexes favored the enrichment of microbes including Desulfobacteria and Pelosinus sp., both of which can utilize lactate and acetate as an electron
c-Type Cytochrome-Dependent Formation of U(IV) Nanoparticles by Shewanella oneidensis
Marshall, Matthew J; Dohnalkova, Alice C; Kennedy, David W; Shi, Liang; Wang, Zheming; Boyanov, Maxim I; Lai, Barry; Kemner, Kenneth M; McLean, Jeffrey S; Reed, Samantha B; Culley, David E; Bailey, Vanessa L; Simonson, Cody J; Saffarini, Daad A; Romine, Margaret F; Zachara, John M
2006-01-01
Modern approaches for bioremediation of radionuclide contaminated environments are based on the ability of microorganisms to effectively catalyze changes in the oxidation states of metals that in turn influence their solubility. Although microbial metal reduction has been identified as an effective means for immobilizing highly-soluble uranium(VI) complexes in situ, the biomolecular mechanisms of U(VI) reduction are not well understood. Here, we show that c-type cytochromes of a dissimilatory metal-reducing bacterium, Shewanella oneidensis MR-1, are essential for the reduction of U(VI) and formation of extracelluar UO 2 nanoparticles. In particular, the outer membrane (OM) decaheme cytochrome MtrC (metal reduction), previously implicated in Mn(IV) and Fe(III) reduction, directly transferred electrons to U(VI). Additionally, deletions of mtrC and/or omcA significantly affected the in vivo U(VI) reduction rate relative to wild-type MR-1. Similar to the wild-type, the mutants accumulated UO 2 nanoparticles extracellularly to high densities in association with an extracellular polymeric substance (EPS). In wild-type cells, this UO 2-EPS matrix exhibited glycocalyx-like properties and contained multiple elements of the OM, polysaccharide, and heme-containing proteins. Using a novel combination of methods including synchrotron-based X-ray fluorescence microscopy and high-resolution immune-electron microscopy, we demonstrate a close association of the extracellular UO 2 nanoparticles with MtrC and OmcA (outer membrane cytochrome). This is the first study to our knowledge to directly localize the OM-associated cytochromes with EPS, which contains biogenic UO 2 nanoparticles. In the environment, such association of UO 2 nanoparticles with biopolymers may exert a strong influence on subsequent behavior including susceptibility to oxidation by O 2 or transport in soils and sediments. PMID:16875436
Youngblut, Matthew; Judd, Evan T.; Srajer, Vukica; Sayyed, Bilal; Goelzer, Tyler; Elliott, Sean J.; Schmidt, Marius; Pacheco, A. Andrew
2012-01-01
The high-yield expression and purification of Shewanella oneidensis cytochrome c nitrite reductase (ccNiR), and its characterization by a variety of methods, notably Laue crystallography, is reported. A key component of the expression system is an artificial ccNiR gene in which the N-terminal signal peptide from the highly expressed S. oneidensis protein “Small Tetra-heme c” replaces the wild-type signal peptide. This gene, inserted into the plasmid pHSG298 and expressed in S. oneidensis TSP-1 strain, generated ~20 mg crude ccNiR/L culture, compared with 0.5–1 mg/L for untransformed cells. Purified ccNiR has nitrite and hydroxylamine reductase activities comparable to those previously reported for E. coli ccNiR, and is stable for over two weeks in pH 7 solution at 4° C. UV/Vis spectropotentiometric titrations and protein film voltammetry identified 5 independent 1-electron reduction processes. Global analysis of the spectropotentiometric data also allowed determination of the extinction coefficient spectra for the 5 reduced ccNiR species. The characteristics of the individual extinction coefficient spectra suggest that, within each reduced species, the electrons are distributed amongst the various hemes, rather than being localized on specific heme centers. The purified ccNiR yielded good quality crystals, with which the 2.59 Å resolution structure was solved at room temperature using the Laue diffraction method. The structure is similar to that of E. coli ccNiR, except in the region where the enzyme interacts with its physiological electron donor (CymA in the case of S. oneidensis ccNiR, NrfB in the case of the E. coli protein). PMID:22382353
Pirbadian, Sahand; Barchinger, Sarah E.; Leung, Kar Man; Byun, Hye Suk; Jangir, Yamini; Bouhenni, Rachida A.; Reed, Samantha B.; Romine, Margaret F.; Saffarini, Daad A.; Shi, Liang; Gorby, Yuri A.; Golbeck, John H.; El-Naggar, Mohamed Y.
2014-01-01
Bacterial nanowires offer an extracellular electron transport (EET) pathway for linking the respiratory chain of bacteria to external surfaces, including oxidized metals in the environment and engineered electrodes in renewable energy devices. Despite the global, environmental, and technological consequences of this biotic–abiotic interaction, the composition, physiological relevance, and electron transport mechanisms of bacterial nanowires remain unclear. We report, to our knowledge, the first in vivo observations of the formation and respiratory impact of nanowires in the model metal-reducing microbe Shewanella oneidensis MR-1. Live fluorescence measurements, immunolabeling, and quantitative gene expression analysis point to S. oneidensis MR-1 nanowires as extensions of the outer membrane and periplasm that include the multiheme cytochromes responsible for EET, rather than pilin-based structures as previously thought. These membrane extensions are associated with outer membrane vesicles, structures ubiquitous in Gram-negative bacteria, and are consistent with bacterial nanowires that mediate long-range EET by the previously proposed multistep redox hopping mechanism. Redox-functionalized membrane and vesicular extensions may represent a general microbial strategy for electron transport and energy distribution. PMID:25143589
Pirbadian, Sahand; Barchinger, Sarah E; Leung, Kar Man; Byun, Hye Suk; Jangir, Yamini; Bouhenni, Rachida A; Reed, Samantha B; Romine, Margaret F; Saffarini, Daad A; Shi, Liang; Gorby, Yuri A; Golbeck, John H; El-Naggar, Mohamed Y
2014-09-02
Bacterial nanowires offer an extracellular electron transport (EET) pathway for linking the respiratory chain of bacteria to external surfaces, including oxidized metals in the environment and engineered electrodes in renewable energy devices. Despite the global, environmental, and technological consequences of this biotic-abiotic interaction, the composition, physiological relevance, and electron transport mechanisms of bacterial nanowires remain unclear. We report, to our knowledge, the first in vivo observations of the formation and respiratory impact of nanowires in the model metal-reducing microbe Shewanella oneidensis MR-1. Live fluorescence measurements, immunolabeling, and quantitative gene expression analysis point to S. oneidensis MR-1 nanowires as extensions of the outer membrane and periplasm that include the multiheme cytochromes responsible for EET, rather than pilin-based structures as previously thought. These membrane extensions are associated with outer membrane vesicles, structures ubiquitous in Gram-negative bacteria, and are consistent with bacterial nanowires that mediate long-range EET by the previously proposed multistep redox hopping mechanism. Redox-functionalized membrane and vesicular extensions may represent a general microbial strategy for electron transport and energy distribution.
Yang, Xin-Wei; Jian, Hua-Hua; Wang, Feng-Ping
2015-08-15
A low-temperature-inducible protein expression vector (pSW2) based on a filamentous phage (SW1) of the deep-sea bacterium Shewanella piezotolerans WP3 was constructed. This vector replicated stably in Escherichia coli and Shewanella species, and its copy number increased at low temperatures. The pSW2 vector can be utilized as a complementation plasmid in WP3, and it can also be used for the production of complex cytochromes with multiple heme groups, which has the potential for application for metal ion recovery or bioremediation. Promoters of low-temperature-inducible genes in WP3 were fused into the vector to construct a series of vectors for enhancing protein expression at low temperature. The maximum green fluorescent protein intensity was obtained when the promoter for the hfq gene was used. The WP3/pSW2 system can efficiently produce a patatin-like protein (PLP) from a metagenomic library that tends to form inclusion bodies in E. coli. The yields of PLP in the soluble fraction were 8.3 mg/liter and 4.7 mg/liter of culture at 4°C and 20°C, respectively. Moreover, the pSW2 vector can be broadly utilized in other Shewanella species, such as S. oneidensis and S. psychrophila. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
High power density from a miniature microbial fuel cell using Shewanella oneidensis DSP10.
Ringeisen, Bradley R; Henderson, Emily; Wu, Peter K; Pietron, Jeremy; Ray, Ricky; Little, Brenda; Biffinger, Justin C; Jones-Meehan, Joanne M
2006-04-15
A miniature microbial fuel cell (mini-MFC) is described that demonstrates high output power per device cross-section (2.0 cm2) and volume (1.2 cm3). Shewanella oneidensis DSP10 in growth medium with lactate and buffered ferricyanide solutions were used as the anolyte and catholyte, respectively. Maximum power densities of 24 and 10 mW/m2 were measured using the true surface areas of reticulated vitreous carbon (RVC) and graphite felt (GF) electrodes without the addition of exogenous mediators in the anolyte. Current densities at maximum power were measured as 44 and 20 mA/m2 for RVC and GF, while short circuit current densities reached 32 mA/m2 for GF anodes and 100 mA/m2 for RVC. When the power density for GF was calculated using the cross sectional area of the device or the volume of the anode chamber, we found values (3 W/m2, 500 W/m3) similar to the maxima reported in the literature. The addition of electron mediators resulted in current and power increases of 30-100%. These power densities were surprisingly high considering a pure S. oneidensis culture was used. We found that the short diffusion lengths and high surface-area-to-chamber volume ratio utilized in the mini-MFC enhanced power density when compared to output from similar macroscopic MFCs.
Le Laz, Sébastien; Kpebe, Arlette; Bauzan, Marielle; Lignon, Sabrina; Rousset, Marc; Brugna, Myriam
2014-01-01
The genome of the facultative anaerobic γ-proteobacterium Shewanella oneidensis MR-1 encodes for three terminal oxidases: a bd-type quinol oxidase and two heme-copper oxidases, a A-type cytochrome c oxidase and a cbb 3-type oxidase. In this study, we used a biochemical approach and directly measured oxidase activities coupled to mass-spectrometry analysis to investigate the physiological role of the three terminal oxidases under aerobic and microaerobic conditions. Our data revealed that the cbb 3-type oxidase is the major terminal oxidase under aerobic conditions while both cbb 3-type and bd-type oxidases are involved in respiration at low-O2 tensions. On the contrary, the low O2-affinity A-type cytochrome c oxidase was not detected in our experimental conditions even under aerobic conditions and would therefore not be required for aerobic respiration in S. oneidensis MR-1. In addition, the deduced amino acid sequence suggests that the A-type cytochrome c oxidase is a ccaa 3-type oxidase since an uncommon extra-C terminal domain contains two c-type heme binding motifs. The particularity of the aerobic respiratory pathway and the physiological implication of the presence of a ccaa 3-type oxidase in S. oneidensis MR-1 are discussed. PMID:24466040
Multi-heme Cytochromes in Shewanella oneidensis MR-1: Structures, functions and opportunities
DOE Office of Scientific and Technical Information (OSTI.GOV)
Breuer, Marian; Rosso, Kevin M.; Blumberger, Jochen
Multi-heme cytochromes are employed by a range of microorganisms to transport electrons over distances of up to tens of nanometers. Perhaps the most spectacular utilization of these proteins is in the reduction of extracellular solid substrates, including electrodes and insoluble mineral oxides of Fe(III) and Mn(III/IV), by species of Shewanella and Geobacter. However, multi-heme cytochromes are found in numerous and phylogenetically diverse prokaryotes where they participate in electron transfer and redox catalysis that contributes to biogeochemical cycling of N, S and Fe on the global scale. These properties of multi-heme cytochromes have attracted much interest and contributed to advances inmore » bioenergy applications and bioremediation of contaminated soils. Looking forward there are opportunities to engage multi-heme cytochromes for biological photovoltaic cells, microbial electrosynthesis and developing bespoke molecular devices. As a consequence it is timely to review our present understanding of these proteins and we do this here with a focus on the multitude of functionally diverse multi-heme cytochromes in Shewanella oneidensis MR-1. We draw on findings from experimental and computational approaches which ideally complement each other in the study of these systems: computational methods can interpret experimentally determined properties in terms of molecular structure to cast light on the relation between structure and function. We show how this synergy has contributed to our understanding of multi-heme cytochromes and can be expected to continue to do so for greater insight into natural processes and their informed exploitation in biotechnologies.« less
Multi-haem cytochromes in Shewanella oneidensis MR-1: structures, functions and opportunities
Breuer, Marian; Rosso, Kevin M.; Blumberger, Jochen; Butt, Julea N.
2015-01-01
Multi-haem cytochromes are employed by a range of microorganisms to transport electrons over distances of up to tens of nanometres. Perhaps the most spectacular utilization of these proteins is in the reduction of extracellular solid substrates, including electrodes and insoluble mineral oxides of Fe(III) and Mn(III/IV), by species of Shewanella and Geobacter. However, multi-haem cytochromes are found in numerous and phylogenetically diverse prokaryotes where they participate in electron transfer and redox catalysis that contributes to biogeochemical cycling of N, S and Fe on the global scale. These properties of multi-haem cytochromes have attracted much interest and contributed to advances in bioenergy applications and bioremediation of contaminated soils. Looking forward, there are opportunities to engage multi-haem cytochromes for biological photovoltaic cells, microbial electrosynthesis and developing bespoke molecular devices. As a consequence, it is timely to review our present understanding of these proteins and we do this here with a focus on the multitude of functionally diverse multi-haem cytochromes in Shewanella oneidensis MR-1. We draw on findings from experimental and computational approaches which ideally complement each other in the study of these systems: computational methods can interpret experimentally determined properties in terms of molecular structure to cast light on the relation between structure and function. We show how this synergy has contributed to our understanding of multi-haem cytochromes and can be expected to continue to do so for greater insight into natural processes and their informed exploitation in biotechnologies. PMID:25411412
Synthetic and Evolutionary Construction of a Chlorate-Reducing Shewanella oneidensis MR-1
Clark, Iain C.; Melnyk, Ryan A.; Youngblut, Matthew D.; Carlson, Hans K.; Iavarone, Anthony T.
2015-01-01
ABSTRACT Despite evidence for the prevalence of horizontal gene transfer of respiratory genes, little is known about how pathways functionally integrate within new hosts. One example of a mobile respiratory metabolism is bacterial chlorate reduction, which is frequently encoded on composite transposons. This implies that the essential components of the metabolism are encoded on these mobile elements. To test this, we heterologously expressed genes for chlorate reduction from Shewanella algae ACDC in the non-chlorate-reducing Shewanella oneidensis MR-1. The construct that ultimately endowed robust growth on chlorate included cld, a cytochrome c gene, clrABDC, and two genes of unknown function. Although strain MR-1 was unable to grow on chlorate after initial insertion of these genes into the chromosome, 11 derived strains capable of chlorate respiration were obtained through adaptive evolution. Genome resequencing indicated that all of the evolved chlorate-reducing strains replicated a large genomic region containing chlorate reduction genes. Contraction in copy number and loss of the ability to reduce chlorate were also observed, indicating that this phenomenon was extremely dynamic. Although most strains contained more than six copies of the replicated region, a single strain with less duplication also grew rapidly. This strain contained three additional mutations that we hypothesized compensated for the low copy number. We remade the mutations combinatorially in the unevolved strain and determined that a single nucleotide polymorphism (SNP) upstream of cld enabled growth on chlorate and was epistatic to a second base pair change in the NarP binding sequence between narQP and nrfA that enhanced growth. PMID:25991681
Uno, Megumi; Phansroy, Nichanan; Aso, Yuji; Ohara, Hitomi
2017-08-01
Shewanella oneidensis MR-1 generates electricity from lactic acid, but cannot utilize starch. On the other hand, Streptococcus bovis 148 metabolizes starch and produces lactic acid. Therefore, two methods were trialed for starch-fueled microbial fuel cell (MFC) in this study. In electric generation by two-step fermentation (EGT) method, starch was first converted to lactic acid by S. bovis 148. The S. bovis 148 were then removed by centrifugation, and the fermented broth was preserved for electricity generation by S. oneidensis MR-1. Another method was electric generation by parallel fermentation (EGP) method. In this method, the cultivation and subsequent fermentation processes of S. bovis 148 and S. oneidensis MR-1 were performed simultaneously. After 1, 2, and 3 terms (5-day intervals) of S. oneidensis MR-1 in the EGT fermented broth of S. bovis 148, the maximum currents at each term were 1.8, 2.4, and 2.8 mA, and the maximum current densities at each term were 41.0, 43.6, and 49.9 mW/m 2 , respectively. In the EGP method, starch was also converted into lactic acid with electricity generation. The maximum current density was 140-200 mA/m 2 , and the maximum power density of this method was 12.1 mW/m 2 . Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Schkolnik, Gal; Schmidt, Matthias; Mazza, Marco G.; Harnisch, Falk; Musat, Niculina
2015-01-01
Shewanella oneidensis MR-1 is an electroactive bacterium, capable of reducing extracellular insoluble electron acceptors, making it important for both nutrient cycling in nature and microbial electrochemical technologies, such as microbial fuel cells and microbial electrosynthesis. When allowed to anaerobically colonize an Ag/AgCl solid interface, S. oneidensis has precipitated silver nanoparticles (AgNp), thus providing the means for a surface enhanced confocal Raman microscopy (SECRaM) investigation of its biofilm. The result is the in-situ chemical mapping of the biofilm as it developed over time, where the distribution of cytochromes, reduced and oxidized flavins, polysaccharides and phosphate in the undisturbed biofilm is monitored. Utilizing AgNp bio-produced by the bacteria colonizing the Ag/AgCl interface, we could perform SECRaM while avoiding the use of a patterned or roughened support or the introduction of noble metal salts and reducing agents. This new method will allow a spatially and temporally resolved chemical investigation not only of Shewanella biofilms at an insoluble electron acceptor, but also of other noble metal nanoparticle-precipitating bacteria in laboratory cultures or in complex microbial communities in their natural habitats. PMID:26709923
Bailey, Kathryn L; Tilton, Fred; Jansik, Danielle P; Ergas, Sarina J; Marshall, Matthew J; Miracle, Ann L; Wellman, Dawn M
2012-06-01
Foam delivery technology (FDT) uses surfactant based foam to immobilize subsurface contaminants in situ. Where traditional approaches are impractical, FDT has the potential to overcome many of the technical challenges facing the remediation of contaminated deep vadose zone environments. However, little is known about the effects these reactive chemicals may have on microorganisms inhabiting the contaminated subsurface. In addition, there are currently no standard assays to assess microbial responses to subsurface remedial treatments while these agents are under development. The objective of this study was to develop a rapid laboratory assay to assess the potential growth inhibition and/or stimulation of microorganisms following exposure to candidate FDT components. Calcium polysulfide (CPS) and several surfactants (i.e. sodium laureth sulfate (SLES), sodium dodecyl sulfate (SDS), cocamidopropyl betaine (CAPB) and NINOL40-CO) have diverse chemistries and are candidate components of FDT. Shewanella oneidensis MR-1 cultures were exposed to a range of concentrations of these chemicals to determine the minimum bactericidal concentration (MBC) and the growth and viability potential of these components. Concentrations of SDS higher than 700 μM were toxic to S. oneidensis MR-1 growth over the course of four days of exposure. The relative acute toxicity order for these compounds was SDS > CPS > NINOL 40-CO>SLES≥CAPB. Dose dependent growth decreases (20-100mM) were observed in the CAPB and SLES treated cultures and both CPS and NINOL 40-CO were toxic at all concentrations tested (1.45-7.25 mM CPS). Both SLES (20-100mM) and SDS at lower concentrations (20-500 μM) were stimulatory to S. oneidensis MR-1 indicating a capacity to be used as a carbon source. These studies also identified potentially key component characteristics, such as precipitate formation and oxygen availability, which may prove valuable in assessing the response of subsurface microorganisms. This benchtop
Pearce, C.I.; Pattrick, R.A.D.; Law, N.; Charnock, J.M.; Coker, V.S.; Fellowes, J.W.; Oremland, R.S.; Lloyd, J.R.
2009-01-01
The metal-reducing bacteria Geobacter sulfurreducens, Shewanella oneidensis and Veillonella atypica, use different mechanisms to transform toxic, bioavailable sodium selenite to less toxic, non-mobile elemental selenium and then to selenide in anaerobic environments, offering the potential for in situ and ex situ bioremediation of contaminated soils, sediments, industrial effluents, and agricultural drainage waters. The products of these reductive transformations depend on both the organism involved and the reduction conditions employed, in terms of electron donor and exogenous extracellular redox mediator. The intermediary phase involves the precipitation of elemental selenium nanospheres and the potential role of proteins in the formation of these structures is discussed. The bionanomineral phases produced during these transformations, including both elemental selenium nanospheres and metal selenide nanoparticles, have catalytic, semiconducting and light-emitting properties, which may have unique applications in the realm of nanophotonics. This research offers the potential to combine remediation of contaminants with the development of environmentally friendly manufacturing pathways for novel bionanominerals. ?? 2009 Taylor & Francis.
Kataeva, Irina; Chang, Jessie; Xu, Hao; Luan, Chi-Hao; Zhou, Jizhong; Uversky, Vladimir N; Lin, Dawei; Horanyi, Peter; Liu, Z J; Ljungdahl, Lars G; Rose, John; Luo, Ming; Wang, Bi-Cheng
2005-01-01
Low solubility of proteins overexpressed in E. coli is a frequent problem in high-throughput structural genomics. To improve solubility of proteins from mesophilic Shewanella oneidensis MR-1 and thermophilic Clostridium thermocellum JW20, an approach was attempted that included a fusion of the target protein to a maltose-binding protein (MBP) and a decrease of induction temperature. The MBP was selected as the most efficient solubilizing carrier when compared to a glutathione S-transferase and a Nus A protein. A tobacco etch virus (TEV) protease recognition site was introduced between fused proteins using a double polymerase-chain reaction and four primers. In this way, 79 S. oneidensis proteins have been expressed in one case with an N-terminal 30-residue tag and in another case as a fusion protein with MBP. A foreign tag might significantly affect the properties of the target polypeptide. At 37 degrees C and 18 degrees C induction temperatures, only 5 and 17 tagged proteins were soluble, respectively. In fusion with MBP 4, 34, and 38 proteins were soluble upon induction at 37 degrees, 28 degrees, and 18 degrees C, respectively. The MBP is assumed to increase stability and solubility of a target protein by changing both the mechanism and the cooperativity of folding/unfolding. The 66 C. thermocellum proteins were expressed as fusion proteins with MBP. Induction at 37 degrees, 28 degrees, and 18 degrees C produced 34, 57, and 60 soluble proteins, respectively. The higher solubility of C. thermocellum proteins in comparison with the S. oneidensis proteins under similar conditions of induction correlates with the thermophilicity of the host. The two-factor Wilkinson-Harrison statistical model was used to identify soluble and insoluble proteins. Theoretical and experimental data showed good agreement for S. oneidensis proteins; however, the model failed to identify soluble/insoluble Clostridium proteins. A suggestion has been made that the Wilkinson-Harrison model is
Li, Xiaoping; Schilkey, Faye; Smith, Geoffrey B.
2018-01-01
Natural ionizing background radiation has exerted a constant pressure on organisms since the first forms of life appeared on Earth, so that cells have developed molecular mechanisms to avoid or repair damages caused directly by radiation or indirectly by radiation-induced reactive oxygen species (ROS). In the present study, we investigated the transcriptional effect of depriving Shewanella oneidensis cultures of background levels of radiation by growing the cells in a mine 655 m underground, thus reducing the dose rate from 72.1 to 0.9 nGy h-1 from control to treatment, respectively. RNASeq transcriptome analysis showed the differential expression of 4.6 and 7.6% of the S. oneidensis genome during early- and late-exponential phases of growth, respectively. The greatest change observed in the treatment was the downregulation of ribosomal proteins (21% of all annotated ribosomal protein genes during early- and 14% during late-exponential) and tRNA genes (14% of all annotated tRNA genes in early-exponential), indicating a marked decrease in protein translation. Other significant changes were the upregulation of membrane transporters, implying an increase in the traffic of substrates across the cell membrane, as well as the up and downregulation of genes related to respiration, which could be interpreted as a response to insufficient oxidants in the cells. In other reports, there is evidence in multiple species that some ROS not just lead to oxidative stress, but act as signaling molecules to control cellular metabolism at the transcriptional level. Consistent with these reports, several genes involved in the metabolism of carbon and biosynthesis of amino acids were also regulated, lending support to the idea of a wide metabolic response. Our results indicate that S. oneidensis is sensitive to the withdrawal of background levels of ionizing radiation and suggest that a transcriptional response is required to maintain homeostasis and retain normal growth. PMID:29768440
DOE Office of Scientific and Technical Information (OSTI.GOV)
Xiong, Yijia; Chen, Baowei; Shi, Liang
2011-10-14
Development of efficient microbial biofuel cells requires an ability to exploit interfacial electron transfer reactions to external electron acceptors, such as metal oxides; such reactions occur in the facultative anaerobic gram-negative bacterium Shewanella oneidensis MR-1 through the catalytic activity of the outer membrane decaheme c-type cytochrome MtrC. Central to the utility of this pathway to synthetic biology is an understanding of cellular mechanisms that maintain optimal MtrC function, cellular localization, and renewal by degradation and resynthesis. In order to monitor trafficking to the outer membrane, and the environmental sensitivity of MtrC, we have engineered a tetracysteine tag (i.e., CCPGCC) atmore » its C-terminus that permits labeling by the cell impermeable biarsenical fluorophore, carboxy-FlAsH (CrAsH) of MtrC at the surface of living Shewanella oneidensis MR-1 cells. In comparison, the cell permeable reagent FlAsH permits labeling of the entire population of MtrC, including proteolytic fragments resulting from incorrect maturation. We demonstrate specific labeling by CrAsH of engineered MtrC which is dependent on the presence of a functional type-2 secretion system (T2S), as evidenced by T2S system gspD or gspG deletion mutants which are incapable of CrAsH labeling. Under these latter conditions, MtrC undergoes proteolytic degradation to form a large 35-38 kDa fragment; this degradation product is also resolved during normal turnover of the CrAsH-labeled MtrC protein. No MtrC protein is released into the medium during turnover, suggesting the presence of cellular turnover systems involving MtrC reuptake and degradation. The mature MtrC localized on the outer membrane is a long-lived protein, with a turnover rate of 0.043 hr-1 that is insensitive to O2 concentration. Maturation of MtrC is relatively inefficient, with substantial rates of turnover of the immature protein prior to export to the outer membrane (i.e., 0.028 hr-1) that are
Baym, Michael; Shaket, Lev; Anzai, Isao A; Adesina, Oluwakemi; Barstow, Buz
2016-11-10
Whole-genome knockout collections are invaluable for connecting gene sequence to function, yet traditionally, their construction has required an extraordinary technical effort. Here we report a method for the construction and purification of a curated whole-genome collection of single-gene transposon disruption mutants termed Knockout Sudoku. Using simple combinatorial pooling, a highly oversampled collection of mutants is condensed into a next-generation sequencing library in a single day, a 30- to 100-fold improvement over prior methods. The identities of the mutants in the collection are then solved by a probabilistic algorithm that uses internal self-consistency within the sequencing data set, followed by rapid algorithmically guided condensation to a minimal representative set of mutants, validation, and curation. Starting from a progenitor collection of 39,918 mutants, we compile a quality-controlled knockout collection of the electroactive microbe Shewanella oneidensis MR-1 containing representatives for 3,667 genes that is functionally validated by high-throughput kinetic measurements of quinone reduction.
Lu, Mengqian; Chan, Shirley; Babanova, Sofia
2016-01-01
ABSTRACT Extracellular electron transfer (EET) is a mechanism that enables microbes to respire solid‐phase electron acceptors. These EET reactions most often occur in the absence of oxygen, since oxygen can act as a competitive electron acceptor for many facultative microbes. However, for Shewanella oneidensis MR‐1, oxygen may increase biomass development, which could result in an overall increase in EET activity. Here, we studied the effect of oxygen on S. oneidensis MR‐1 EET rates using bioelectrochemical systems (BESs). We utilized optically accessible BESs to monitor real‐time biomass growth, and studied the per‐cell EET rate as a function of oxygen and riboflavin concentrations in BESs of different design and operational conditions. Our results show that oxygen exposure promotes biomass development on the electrode, but significantly impairs per‐cell EET rates even though current production does not always decrease with oxygen exposure. Additionally, our results indicated that oxygen can affect the role of riboflavin in EET. Under anaerobic conditions, both current density and per‐cell EET rate increase with the riboflavin concentration. However, as the dissolved oxygen (DO) value increased to 0.42 mg/L, riboflavin showed very limited enhancement on per‐cell EET rate and current generation. Since it is known that oxygen can promote flavins secretion in S. oneidensis, the role of riboflavin may change under anaerobic and aerobic conditions. Biotechnol. Bioeng. 2017;114: 96–105. © 2016 The Authors. Biotechnology and Bioengineering Published by Wiley Periodicals, Inc. PMID:27399911
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bailey, Kathryn L.; Tilton, Fred A.; Jansik, Danielle P.
2012-06-14
Foam delivery technology (FDT) uses surfactant based foam to immobilize subsurface contaminants in situ. Where traditional approaches are impractical, FDT has the potential to overcome many of the technical challenges facing the remediation of contaminated deep vadose zone environments. However, little is known about the effects these reactive chemicals may have on microorganisms inhabiting the contaminated subsurface. In addition, there are currently no standard assays to assess microbial responses to subsurface remedial treatments while these agents are under development. The objective of this study was to develop a rapid laboratory assay to assess the potential growth inhibition and/or stimulation ofmore » microorganisms following exposure to candidate FDT components. Calcium polysulfide (CPS) and several surfactants (i.e. sodium laureth sulfate (SLES), sodium dodecyl sulfate (SDS), cocamidopropyl betaine (CAPB) and NINOL40-CO) have diverse chemistries and are candidate components of FDT. Shewanella oneidensis MR-1 cultures were exposed to a range of concentrations of these chemicals to determine the minimum bactericidal concentration (MBC) and the growth and viability potential of these components. Concentrations of SDS higher than 700 {micro}M were toxic to S. oneidensis MR-1 growth over the course of four days of exposure. The relative acute toxicity order for these compounds was SDS>>CPS>>NINOL40-CO>SLES-CAPB. Dose dependent growth decreases (20 to 100 mM) were observed in the CAPB and SLES treated cultures and both CPS and NINOL 40-CO were toxic at all concentrations tested (1.45 to 7.25 mM CPS). Both SLES (20 to 100 mM) and SDS at lower concentrations (20 to 500 {micro}M) were stimulatory to S. oneidensis MR-1 indicating a capacity to be used as a carbon source. These studies also identified potentially key component characteristics, such as precipitate formation and oxygen availability, which may prove valuable in assessing the response of subsurface
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tang, Yinjie J.; Laidlaw, David; Gani, Kishen
2006-03-16
The growth and Cr(VI) reduction by Shewanella oneidensisMR-1 was examined using a mini-bioreactor system that independentlymonitors and controls pH, dissolved oxygen, and temperature for each ofits 24, 10-mL reactors. Independent monitoring and control of eachreactor in the cassette allows the exploration of a matrix ofenvironmental conditions known to influence S. oneidensis chromiumreduction. S. oneidensis MR-1 grew in minimal medium without amino acidor vitamin supplementation under aerobic conditions but required serineand glycine supplementation under anaerobic conditions. Growth wasinhibited by dissolved oxygen concentrations>80 percent. Lactatetransformation to acetate was enhanced by low concentration of dissolvedoxygen during the logarithmic growth phase. Between 11 andmore » 35oC, thegrowth rate obeyed the Arrhenius reaction rate-temperature relationship,with a maximum growth rate occurring at 35oC. S. oneidensis MR-1 was ableto grow over a wide range of pH (6-9). At neutral pH and temperaturesranging from 30-35oC, S. oneidensis MR-1 reduced 100 mu M Cr(VI) toCr(III) within 20 minutes in the exponential growth phase, and the growthrate was not affected by the addition of chromate; it reduced chromateeven faster at temperatures between 35 and 39oC. At low temperatures(<25oC), acidic (pH<6.5), or alkaline (pH>8.5) conditions, 100mu M Cr(VI) strongly inhibited growth and chromate reduction. Themini-bioreactor system enabled the rapid determination of theseparameters reproducibly and easily by performing very few experiments.Besides its use for examining parameters of interest to environmentalremediation, the device will also allow one to quickly assess parametersfor optimal production of recombinant proteins or secondarymetabolites« less
Johnson, Ethan T; Baron, Daniel B; Naranjo, Belén; Bond, Daniel R; Schmidt-Dannert, Claudia; Gralnick, Jeffrey A
2010-07-01
Microorganisms can use complex photosystems or light-dependent proton pumps to generate membrane potential and/or reduce electron carriers to support growth. The discovery that proteorhodopsin is a light-dependent proton pump that can be expressed readily in recombinant bacteria enables development of new strategies to probe microbial physiology and to engineer microbes with new light-driven properties. Here, we describe functional expression of proteorhodopsin and light-induced changes in membrane potential in the bacterium Shewanella oneidensis strain MR-1. We report that there were significant increases in electrical current generation during illumination of electrochemical chambers containing S. oneidensis expressing proteorhodopsin. We present evidence that an engineered strain is able to consume lactate at an increased rate when it is illuminated, which is consistent with the hypothesis that proteorhodopsin activity enhances lactate uptake by increasing the proton motive force. Our results demonstrate that there is coupling of a light-driven process to electricity generation in a nonphotosynthetic engineered bacterium. Expression of proteorhodopsin also preserved the viability of the bacterium under nutrient-limited conditions, providing evidence that fulfillment of basic energy needs of organisms may explain the widespread distribution of proteorhodopsin in marine environments.
Kipf, Elena; Koch, Julia; Geiger, Bettina; Erben, Johannes; Richter, Katrin; Gescher, Johannes; Zengerle, Roland; Kerzenmacher, Sven
2013-10-01
We present a systematic screening of carbon-based anode materials for microbial fuel cells with Shewanella oneidensis MR-1. Under anoxic conditions nanoporous activated carbon cloth is a superior anode material in terms of current density normalized to the projected anode area and anode volume (24.0±0.3 μA cm(-2) and 482±7 μA cm(-3) at -0.2 vs. SCE, respectively). The good performance can be attributed to the high specific surface area of the material, which is available for mediated electron transfer through self-secreted flavins. Under aerated conditions no influence of the specific surface area is observed, which we attribute to a shift from primary indirect electron transfer by mediators to direct electron transfer via adherent cells. Furthermore, we show that an aerated initial growth phase enhances the current density under subsequent anoxic conditions fivefold when compared to a similar experiment that was conducted under permanently anoxic conditions. Copyright © 2013 Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Yu, Qiang; Fein, Jeremy B.
2015-10-01
The adsorption and desorption of Cd onto Shewanella oneidensis bacterial cells with and without blocking of sulfhydryl sites was measured in order to determine the effect of metal loading and to understand the role of sulfhydryl sites in the adsorption reactions. The observed adsorption/desorption behaviors display strong dependence on metal loading. Under a high loading of 40 μmol Cd/g bacterial cells, blocking the sulfhydryl sites within the cell envelope by exposure of the biomass to monobromo(trimethylammonio)bimane bromide (qBBr) does not significantly affect the extent of Cd adsorption, and we observed fully reversible adsorption under this condition. In contrast, under a low metal loading of 1.3 μmol Cd/g bacterial cells, the extent of Cd adsorption onto sulfhydryl-blocked S. oneidensis cells was significantly lower than that onto untreated cells, and only approximately 50-60% of the adsorbed Cd desorbed from the cells upon acidification. In conjunction with previous EXAFS results, our findings demonstrate that Cd adsorption onto S. oneidensis under low metal loading conditions is dominated by sulfhydryl binding, and thus is controlled by a distinct adsorption mechanism from the non-sulfhydryl site binding which controls Cd adsorption under high metal loading conditions. We use the data to develop a surface complexation model that constrains the values of the stability constants for individual Cd-sulfhydryl and Cd-non-sulfhydryl bacterial complexes, and we use this approach to account for the Cd adsorption behavior as a function of both pH and metal loading. This approach is crucial in order to predict metal adsorption onto bacteria under environmentally relevant metal loading conditions where sulfhydryl binding sites can dominate the adsorption reaction.
Yin, Jianhua; Sun, Yiyang; Mao, Yinting; Jin, Miao
2015-01-01
β-Lactamase production is one of the most important strategies for Gram-negative bacteria to combat β-lactam antibiotics. Studies of the regulation of β-lactamase expression have largely been focused on the class C β-lactamase AmpC, whose induction by β-lactams requires LysR-type regulator AmpR and permease AmpG-dependent peptidoglycan recycling intermediates. In Shewanella, which is ubiquitous in aquatic environments and is a reservoir for antibiotic resistance, production of the class D β-lactamase BlaA confers bacteria with natural resistance to many β-lactams. Expression of the blaA gene in the genus representative Shewanella oneidensis is distinct from the AmpC paradigm because of the lack of an AmpR homologue and the presence of an additional AmpG-independent regulatory pathway. In this study, using transposon mutagenesis, we identify proteins that are involved in blaA regulation. Inactivation of mrcA and lpoA, which encode penicillin binding protein 1a (PBP1a) and its lipoprotein cofactor, LpoA, respectively, drastically enhances blaA expression in the absence of β-lactams. Although PBP1b and its cognate, LpoB, also exist in S. oneidensis, their roles in blaA induction are dispensable. We further show that the mrcA-mediated blaA expression is independent of AmpG. PMID:25824223
Reduction of jarosite by Shewanella oneidensis MR-1 and secondary mineralization
NASA Astrophysics Data System (ADS)
Bingjie, Ouyang; Xiancai, Lu; Huan, Liu; Juan, Li; Tingting, Zhu; Xiangyu, Zhu; Jianjun, Lu; Rucheng, Wang
2014-01-01
Jarosite is a common mineral in a variety of environments formed by the oxidation of iron sulfide normally accompanying with the generation of acid mine drainage (AMD) in mining areas or acid rock drainages (ARD) in many localities. Decomposition of jarosite by dissimilatory iron reducing bacteria (DIRB) influences the mobility of many heavy metals generally accommodated in natural jarosite. This study examined the anaerobic reduction of synthesized jarosite by Shewanella oneidensis strain MR-1, a typical facultative bacteria. The release of ferrous and ferric ion, as well as sulfate and potassium, in the inoculated experimental group lasting 80 days is much higher than that in abiotic control groups. The detection of bicarbonate and acetate in experimental solution further confirms the mechanism of microbial reduction of jarosite, in which lactate acts as the electron donor. The produced ferrous iron stimulates the subsequent secondary mineralization, leading to precipitation and transformation of various iron-containing minerals. Green rust and goethite are the intermediate minerals of the microbial reduction process under anoxic conditions, and the end products include magnetite and siderite. In aerobic environments, goethite, magnetite and siderite were also detected, but the contents were relatively lower. While in abiotic experiments, only goethite has been detected as a product. Thus, the microbial reduction and subsequent mineral transformation can remarkably influence the geochemical cycling of iron and sulfur in supergene environments, as well as the mobility of heavy metals commonly accommodated in jarosite.
Endogenous generation of hydrogen sulfide and its regulation in Shewanella oneidensis
Wu, Genfu; Li, Ning; Mao, Yinting; Zhou, Guangqi; Gao, Haichun
2015-01-01
Hydrogen sulfide (H2S) has been recognized as a physiological mediator with a variety of functions across all domains of life. In this study, mechanisms of endogenous H2S generation in Shewanella oneidensis were investigated. As a research model with highly diverse anaerobic respiratory pathways, the microorganism is able to produce H2S by respiring on a variety of sulfur-containing compounds with SirACD and PsrABC enzymatic complexes, as well as through cysteine degradation with three enzymes, MdeA, SO_1095, and SseA. We showed that the SirACD and PsrABC complexes, which are predominantly, if not exclusively, responsible for H2S generation via respiration of sulfur species, do not interplay with each other. Strikingly, a screen for regulators controlling endogenous H2S generation by transposon mutagenesis identified global regulator Crp to be essential to all H2S-generating processes. In contrast, Fnr and Arc, two other global regulators that have a role in respiration, are dispensable in regulating H2S generation via respiration of sulfur species. Interestingly, Arc is involved in the H2S generation through cysteine degradation by repressing expression of the mdeA gene. We further showed that expression of the sirA and psrABC operons is subjected to direct regulation of Crp, but the mechanisms underlying the requirement of Crp for H2S generation through cysteine degradation remain elusive. PMID:25972854
Production of Manganese Oxide Nanoparticles by Shewanella Species
Farooqui, Saad M.; White, Alan R.
2016-01-01
ABSTRACT Several species of the bacterial genus Shewanella are well-known dissimilatory reducers of manganese under anaerobic conditions. In fact, Shewanella oneidensis is one of the most well studied of all metal-reducing bacteria. In the current study, a number of Shewanella strains were tested for manganese-oxidizing capacity under aerobic conditions. All were able to oxidize Mn(II) and to produce solid dark brown manganese oxides. Shewanella loihica strain PV-4 was the strongest oxidizer, producing oxides at a rate of 20.3 mg/liter/day and oxidizing Mn(II) concentrations of up to 9 mM. In contrast, S. oneidensis MR-1 was the weakest oxidizer tested, producing oxides at 4.4 mg/liter/day and oxidizing up to 4 mM Mn(II). Analysis of products from the strongest oxidizers, i.e., S. loihica PV-4 and Shewanella putrefaciens CN-32, revealed finely grained, nanosize, poorly crystalline oxide particles with identical Mn oxidation states of 3.86. The biogenic manganese oxide products could be subsequently reduced within 2 days by all of the Shewanella strains when culture conditions were made anoxic and an appropriate nutrient (lactate) was added. While Shewanella species were detected previously as part of manganese-oxidizing consortia in natural environments, the current study has clearly shown manganese-reducing Shewanella species bacteria that are able to oxidize manganese in aerobic cultures. IMPORTANCE Members of the genus Shewanella are well known as dissimilatory manganese-reducing bacteria. This study shows that a number of species from Shewanella are also capable of manganese oxidation under aerobic conditions. Characterization of the products of the two most efficient oxidizers, S. loihica and S. putrefaciens, revealed finely grained, nanosize oxide particles. With a change in culture conditions, the manganese oxide products could be subsequently reduced by the same bacteria. The ability of Shewanella species both to oxidize and to reduce manganese indicates
Johnson, Ethan T.; Baron, Daniel B.; Naranjo, Belén; Bond, Daniel R.; Schmidt-Dannert, Claudia; Gralnick, Jeffrey A.
2010-01-01
Microorganisms can use complex photosystems or light-dependent proton pumps to generate membrane potential and/or reduce electron carriers to support growth. The discovery that proteorhodopsin is a light-dependent proton pump that can be expressed readily in recombinant bacteria enables development of new strategies to probe microbial physiology and to engineer microbes with new light-driven properties. Here, we describe functional expression of proteorhodopsin and light-induced changes in membrane potential in the bacterium Shewanella oneidensis strain MR-1. We report that there were significant increases in electrical current generation during illumination of electrochemical chambers containing S. oneidensis expressing proteorhodopsin. We present evidence that an engineered strain is able to consume lactate at an increased rate when it is illuminated, which is consistent with the hypothesis that proteorhodopsin activity enhances lactate uptake by increasing the proton motive force. Our results demonstrate that there is coupling of a light-driven process to electricity generation in a nonphotosynthetic engineered bacterium. Expression of proteorhodopsin also preserved the viability of the bacterium under nutrient-limited conditions, providing evidence that fulfillment of basic energy needs of organisms may explain the widespread distribution of proteorhodopsin in marine environments. PMID:20453141
Ainsworth, Emma V.; Lockwood, Colin W. J.; White, Gaye F.; Hwang, Ee Taek; Sakai, Tsubasa; Gross, Manuela A.; Richardson, David J.; Clarke, Thomas A.
2016-01-01
Abstract The transfer of photoenergized electrons from extracellular photosensitizers across a bacterial cell envelope to drive intracellular chemical transformations represents an attractive way to harness nature's catalytic machinery for solar‐assisted chemical synthesis. In Shewanella oneidensis MR‐1 (MR‐1), trans‐outer‐membrane electron transfer is performed by the extracellular cytochromes MtrC and OmcA acting together with the outer‐membrane‐spanning porin⋅cytochrome complex (MtrAB). Here we demonstrate photoreduction of solutions of MtrC, OmcA, and the MtrCAB complex by soluble photosensitizers: namely, eosin Y, fluorescein, proflavine, flavin, and adenine dinucleotide, as well as by riboflavin and flavin mononucleotide, two compounds secreted by MR‐1. We show photoreduction of MtrC and OmcA adsorbed on RuII‐dye‐sensitized TiO2 nanoparticles and that these protein‐coated particles perform photocatalytic reduction of solutions of MtrC, OmcA, and MtrCAB. These findings provide a framework for informed development of strategies for using the outer‐membrane‐associated cytochromes of MR‐1 for solar‐driven microbial synthesis in natural and engineered bacteria. PMID:27685371
Alves, Mónica N.; Neto, Sónia E.; Alves, Alexandra S.; Fonseca, Bruno M.; Carrêlo, Afonso; Pacheco, Isabel; Paquete, Catarina M.; Soares, Cláudio M.; Louro, Ricardo O.
2015-01-01
The versatile anaerobic metabolism of the Gram-negative bacterium Shewanella oneidensis MR-1 (SOMR-1) relies on a multitude of redox proteins found in its periplasm. Most are multiheme cytochromes that carry electrons to terminal reductases of insoluble electron acceptors located at the cell surface, or bona fide terminal reductases of soluble electron acceptors. In this study, the interaction network of several multiheme cytochromes was explored by a combination of NMR spectroscopy, activity assays followed by UV-visible spectroscopy and comparison of surface electrostatic potentials. From these data the small tetraheme cytochrome (STC) emerges as the main periplasmic redox shuttle in SOMR-1. It accepts electrons from CymA and distributes them to a number of terminal oxidoreductases involved in the respiration of various compounds. STC is also involved in the electron transfer pathway to reduce nitrite by interaction with the octaheme tetrathionate reductase (OTR), but not with cytochrome c nitrite reductase (ccNiR). In the main pathway leading the metal respiration STC pairs with flavocytochrome c (FccA), the other major periplasmic cytochrome, which provides redundancy in this important pathway. The data reveals that the two proteins compete for the binding site at the surface of MtrA, the decaheme cytochrome inserted on the periplasmic side of the MtrCAB–OmcA outer-membrane complex. However, this is not observed for the MtrA homologues. Indeed, neither STC nor FccA interact with MtrD, the best replacement for MtrA, and only STC is able to interact with the decaheme cytochrome DmsE of the outer-membrane complex DmsEFABGH. Overall, these results shown that STC plays a central role in the anaerobic respiratory metabolism of SOMR-1. Nonetheless, the trans-periplasmic electron transfer chain is functionally resilient as a consequence of redundancies that arise from the presence of alternative pathways that bypass/compete with STC. PMID:26175726
Castillo, Hugo; Schoderbek, Donald; Dulal, Santosh; Escobar, Gabriela; Wood, Jeffrey; Nelson, Roger; Smith, Geoffrey
2015-01-01
The 'Linear no-threshold' (LNT) model predicts that any amount of radiation increases the risk of organisms to accumulate negative effects. Several studies at below background radiation levels (4.5-11.4 nGy h(-1)) show decreased growth rates and an increased susceptibility to oxidative stress. The purpose of our study is to obtain molecular evidence of a stress response in Shewanella oneidensis and Deinococcus radiodurans grown at a gamma dose rate of 0.16 nGy h(-1), about 400 times less than normal background radiation. Bacteria cultures were grown at a dose rate of 0.16 or 71.3 nGy h(-1) gamma irradiation. Total RNA was extracted from samples at early-exponential and stationary phases for the rt-PCR relative quantification (radiation-deprived treatment/background radiation control) of the stress-related genes katB (catalase), recA (recombinase), oxyR (oxidative stress transcriptional regulator), lexA (SOS regulon transcriptional repressor), dnaK (heat shock protein 70) and SOA0154 (putative heavy metal efflux pump). Deprivation of normal levels of radiation caused a reduction in growth of both bacterial species, accompanied by the upregulation of katB, recA, SOA0154 genes in S. oneidensis and the upregulation of dnaK in D. radiodurans. When cells were returned to background radiation levels, growth rates recovered and the stress response dissipated. Our results indicate that below-background levels of radiation inhibited growth and elicited a stress response in two species of bacteria, contrary to the LNT model prediction.
Expression of Shewanella oneidensis MR-1 [FeFe]-Hydrogenase Genes in Anabaena sp. Strain PCC 7120
Gärtner, Katrin; Lechno-Yossef, Sigal; Cornish, Adam J.; Wolk, C. Peter
2012-01-01
H2 generated from renewable resources holds promise as an environmentally innocuous fuel that releases only energy and water when consumed. In biotechnology, photoautotrophic oxygenic diazotrophs could produce H2 from water and sunlight using the cells' endogenous nitrogenases. However, nitrogenases have low turnover numbers and require large amounts of ATP. [FeFe]-hydrogenases found in other organisms can have 1,000-fold higher turnover numbers and no specific requirement for ATP but are very O2 sensitive. Certain filamentous cyanobacteria protect nitrogenase from O2 by sequestering the enzyme within internally micro-oxic, differentiated cells called heterocysts. We heterologously expressed the [FeFe]-hydrogenase operon from Shewanella oneidensis MR-1 in Anabaena sp. strain PCC 7120 using the heterocyst-specific promoter PhetN. Active [FeFe]-hydrogenase was detected in and could be purified from aerobically grown Anabaena sp. strain PCC 7120, but only when the organism was grown under nitrate-depleted conditions that elicited heterocyst formation. These results suggest that the heterocysts protected the [FeFe]-hydrogenase against inactivation by O2. PMID:23023750
Foglia, Fabrizia; Hazael, Rachael; Simeoni, Giovanna G; Appavou, Marie-Sousai; Moulin, Martine; Haertlein, Michael; Trevor Forsyth, V; Seydel, Tilo; Daniel, Isabelle; Meersman, Filip; McMillan, Paul F
2016-01-07
Quasielastic neutron scattering (QENS) is an ideal technique for studying water transport and relaxation dynamics at pico- to nanosecond timescales and at length scales relevant to cellular dimensions. Studies of high pressure dynamic effects in live organisms are needed to understand Earth's deep biosphere and biotechnology applications. Here we applied QENS to study water transport in Shewanella oneidensis at ambient (0.1 MPa) and high (200 MPa) pressure using H/D isotopic contrast experiments for normal and perdeuterated bacteria and buffer solutions to distinguish intracellular and transmembrane processes. The results indicate that intracellular water dynamics are comparable with bulk diffusion rates in aqueous fluids at ambient conditions but a significant reduction occurs in high pressure mobility. We interpret this as due to enhanced interactions with macromolecules in the nanoconfined environment. Overall diffusion rates across the cell envelope also occur at similar rates but unexpected narrowing of the QENS signal appears between momentum transfer values Q = 0.7-1.1 Å(-1) corresponding to real space dimensions of 6-9 Å. The relaxation time increase can be explained by correlated dynamics of molecules passing through Aquaporin water transport complexes located within the inner or outer membrane structures.
Phansroy, Nichanan; Khawdas, Wichean; Watanabe, Keigo; Aso, Yuji; Ohara, Hitomi
2018-05-12
A single chamber type microbial fuel cell (MFC) with 100 mL of chamber volume and 50 cm 2 of air-cathode was developed in this study wherein a developed iron-plated carbon-felt anode and Shewanella oneidensis MR-1 were used. The performance of the iron-plated carbon-felt anode and the possibility of corn steep liquor (CSL) as a fuel, which was the byproduct of corn wet milling and contained lactic acid, was investigated here. MFCs equipped with iron-plated or non-plated carbon-felt anodes exhibited maximum current densities of 443 or 302 mA/m 2 using 10 g/L of reagent-grade lactic acid, respectively. In addition, using centrifuged CSL without insoluble ingredients or non-centrifuged CSL as a fuel, the maximum current densities of the MFCs with iron-plated carbon-felt anode were 321 or 158 mA/m 2 , respectively. This report demonstrated the effect of iron-plated carbon-felt anode for electricity generation of MFC using S. oneidensis MR-1 and the performance of CSL as a fuel. Copyright © 2018 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Fitzgerald, Lisa A; Petersen, Emily R; Leary, Dagmar H; Nadeau, Lloyd J; Soto, Carissa M; Ray, Richard I; Little, Brenda J; Ringeisen, Bradley R; Johnson, Glenn R; Vora, Gary J; Biffinger, Justin C
2013-02-15
The genes involved in the proposed pathway for Shewanella extracellular electron transfer (EET) are highly conserved. While extensive studies involving EET from a fresh water Shewanella microbe (S. oneidensis MR-1) to soluble and insoluble electron acceptors have been published, only a few reports have examined EET from marine strains of Shewanella. Thus, Shewanella frigidimarina (an isolate from Antarctic Sea ice) was used within miniature microbial fuel cells (mini-MFC) to evaluate potential power output. During the course of this study several distinct differences were observed between S. oneidensis MR-1 and S. frigidimarina under comparable conditions. The maximum power density with S. frigidimarina was observed when the anolyte was half-strength marine broth (1/2 MB) (0.28 μW/cm(2)) compared to Luria-Bertani (LB) (0.07 μW/cm(2)) or a defined growth minimal medium (MM) (0.02 μW/cm(2)). The systematic modification of S. frigidimarina cultured in 1/2 MB and LB with divalent cations shows that a maximum current output can be generated independent of internal ionic ohmic losses and the presence of external mediators. Published by Elsevier B.V.
Furukawa, Yoko; Dale, Jason R
2013-04-08
We investigated the surface characteristics of two strains of Shewanella sp., S. oneidensis MR-1 and S. putrefaciens 200, that were grown under aerobic conditions as well as under anaerobic conditions with trimethylamine oxide (TMAO) as the electron acceptor. The investigation focused on the experimental determination of electrophoretic mobility (EPM) under a range of pH and ionic strength, as well as by subsequent modeling in which Shewanella cells were considered to be soft particles with water- and ion-permeable outermost layers. The soft layer of p200 is significantly more highly charged (i.e., more negative) than that of MR-1. The effect of electron acceptor on the soft particle characteristics of Shewanella sp. is complex. The fixed charge density, which is a measure of the deionized and deprotonated functional groups in the soft layer polymers, is slightly greater (i.e., more negative) for aerobically grown p200 than for p200 grown with TMAO. On the other hand, the fixed charge density of aerobically grown MR1 is slightly less than that of p200 grown with TMAO. The effect of pH on the soft particle characteristics is also complex, and does not exhibit a clear pH-dependent trend. The Shewanella surface characteristics were attributed to the nature of the outermost soft layer, the extracellular polymeric substances (EPS) in case of p200 and lypopolysaccharides (LPS) in case of MR1 which generally lacks EPS. The growth conditions (i.e., aerobic vs. anaerobic TMAO) have an influence on the soft layer characteristics of Shewanella sp. cells. Meanwhile, the clear pH dependency of the mechanical and morphological characteristics of EPS and LPS layers, observed in previous studies through atomic force microscopy, adhesion tests and spectroscopies, cannot be corroborated by the electrohydrodynamics-based soft particle characteristics which does not exhibited a clear pH dependency in this study. While the electrohydrodynamics-based soft-particle model is a useful tool
Cao, Xinhua; Qi, Yueling; Xu, Chen; Yang, Yuyi; Wang, Jun
2017-04-01
Shewanella oneidensis MR-1 degrades various azo dyes under microaerophilic and anaerobic conditions, but this process is inhibited under aerobic conditions. The mechanisms underlying azo dye biodegradation and inhibition remain unknown. Therefore, we investigated metabolic and transcriptional changes in strain MR-1, which was cultured under different conditions, to elucidate these mechanisms. At the transcriptional level, genes involved in certain metabolic processes, particularly the tricarboxylic acid (TCA) cycle, amino acid biodegradation, and the electron transfer system, were significantly altered (M ≧ 2, p > 0.8 ) in the presence of methyl orange (MO). Moreover, a high concentration of dissolved oxygen heavily impacted the expression levels of genes involved in fatty acid biodegradation. Metabolome analysis revealed significant alteration (p < 0.05) in the concentrations of nine metabolites when strain MR-1 was cultured under aerobic conditions; the majority of these metabolites were closely associated with amino acid metabolism and DNA replication. Accordingly, we propose a possible pathway for MO biodegradation and discuss the most likely causes of biodegradation inhibition due to dissolved oxygen.
Dai, Jingcheng; Wei, Hehong; Tian, Chunyuan; ...
2015-01-01
Background: Bacteria use alternative sigma factors (σs) to regulate condition-specific gene expression for survival and Shewanella harbors multiple ECF (extracytoplasmic function) σ genes and cognate anti-sigma factor genes. Here we comparatively analyzed two of the rpoE-like operons in the strain MR-1: rpoE-rseA-rseB-rseC and rpoE2-chrR. Results: RpoE was important for bacterial growth at low and high temperatures, in the minimal medium, and high salinity. The degP/htrA orthologue, required for growth of Escherichia coli and Pseudomonas aeruginosa at high temperature, is absent in Shewanella, while the degQ gene is RpoE-regulated and is required for bacterial growth at high temperature. RpoE2 was essentialmore » for the optimal growth in oxidative stress conditions because the rpoE2 mutant was sensitive to hydrogen peroxide and paraquat. The operon encoding a ferrochelatase paralogue (HemH2) and a periplasmic glutathione peroxidase (PgpD) was identified as RpoE2-dependent. PgpD exhibited higher activities and played a more important role in the oxidative stress responses than the cytoplasmic glutathione peroxidase CgpD under tested conditions. The rpoE2-chrR operon and the identified regulon genes, including pgpD and hemH2, are coincidently absent in several psychrophilic and/or deep-sea Shewanella strains. Conclusion: In S. oneidensis MR-1, the RpoE-dependent degQ gene is required for optimal growth under high temperature. The rpoE2 and RpoE2-dependent pgpD gene encoding a periplasmic glutathione peroxidase are involved in oxidative stress responses. But rpoE2 is not required for bacterial growth at low temperature and it even affected bacterial growth under salt stress, indicating that there is a tradeoff between the salt resistance and RpoE2-mediated oxidative stress responses.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dai, Jingcheng; Wei, Hehong; Tian, Chunyuan
Background: Bacteria use alternative sigma factors (σs) to regulate condition-specific gene expression for survival and Shewanella harbors multiple ECF (extracytoplasmic function) σ genes and cognate anti-sigma factor genes. Here we comparatively analyzed two of the rpoE-like operons in the strain MR-1: rpoE-rseA-rseB-rseC and rpoE2-chrR. Results: RpoE was important for bacterial growth at low and high temperatures, in the minimal medium, and high salinity. The degP/htrA orthologue, required for growth of Escherichia coli and Pseudomonas aeruginosa at high temperature, is absent in Shewanella, while the degQ gene is RpoE-regulated and is required for bacterial growth at high temperature. RpoE2 was essentialmore » for the optimal growth in oxidative stress conditions because the rpoE2 mutant was sensitive to hydrogen peroxide and paraquat. The operon encoding a ferrochelatase paralogue (HemH2) and a periplasmic glutathione peroxidase (PgpD) was identified as RpoE2-dependent. PgpD exhibited higher activities and played a more important role in the oxidative stress responses than the cytoplasmic glutathione peroxidase CgpD under tested conditions. The rpoE2-chrR operon and the identified regulon genes, including pgpD and hemH2, are coincidently absent in several psychrophilic and/or deep-sea Shewanella strains. Conclusion: In S. oneidensis MR-1, the RpoE-dependent degQ gene is required for optimal growth under high temperature. The rpoE2 and RpoE2-dependent pgpD gene encoding a periplasmic glutathione peroxidase are involved in oxidative stress responses. But rpoE2 is not required for bacterial growth at low temperature and it even affected bacterial growth under salt stress, indicating that there is a tradeoff between the salt resistance and RpoE2-mediated oxidative stress responses.« less
NASA Astrophysics Data System (ADS)
Foglia, Fabrizia; Hazael, Rachael; Simeoni, Giovanna G.; Appavou, Marie-Sousai; Moulin, Martine; Haertlein, Michael; Trevor Forsyth, V.; Seydel, Tilo; Daniel, Isabelle; Meersman, Filip; McMillan, Paul F.
2016-01-01
Quasielastic neutron scattering (QENS) is an ideal technique for studying water transport and relaxation dynamics at pico- to nanosecond timescales and at length scales relevant to cellular dimensions. Studies of high pressure dynamic effects in live organisms are needed to understand Earth’s deep biosphere and biotechnology applications. Here we applied QENS to study water transport in Shewanella oneidensis at ambient (0.1 MPa) and high (200 MPa) pressure using H/D isotopic contrast experiments for normal and perdeuterated bacteria and buffer solutions to distinguish intracellular and transmembrane processes. The results indicate that intracellular water dynamics are comparable with bulk diffusion rates in aqueous fluids at ambient conditions but a significant reduction occurs in high pressure mobility. We interpret this as due to enhanced interactions with macromolecules in the nanoconfined environment. Overall diffusion rates across the cell envelope also occur at similar rates but unexpected narrowing of the QENS signal appears between momentum transfer values Q = 0.7-1.1 Å-1 corresponding to real space dimensions of 6-9 Å. The relaxation time increase can be explained by correlated dynamics of molecules passing through Aquaporin water transport complexes located within the inner or outer membrane structures.
Luo, Shuai; Guo, Weihua; H. Nealson, Kenneth; Feng, Xueyang; He, Zhen
2016-01-01
Microbial fuel cell (MFC) is a promising technology for direct electricity generation from organics by microorganisms. The type of electron donors fed into MFCs affects the electrical performance, and mechanistic understanding of such effects is important to optimize the MFC performance. In this study, we used a model organism in MFCs, Shewanella oneidensis MR-1, and 13C pathway analysis to investigate the role of formate in electricity generation and the related microbial metabolism. Our results indicated a synergistic effect of formate and lactate on electricity generation, and extra formate addition on the original lactate resulted in more electrical output than using formate or lactate as a sole electron donor. Based on the 13C tracer analysis, we discovered decoupled cell growth and electricity generation in S. oneidensis MR-1 during co-utilization of lactate and formate (i.e., while the lactate was mainly metabolized to support the cell growth, the formate was oxidized to release electrons for higher electricity generation). To our best knowledge, this is the first time that 13C tracer analysis was applied to study microbial metabolism in MFCs and it was demonstrated to be a valuable tool to understand the metabolic pathways affected by electron donors in the selected electrochemically-active microorganisms. PMID:26868848
Harris, H Wayne; El-Naggar, Mohamed Y; Nealson, Kenneth H
2012-12-01
Shewanella oneidensis MR-1 cells utilize a behaviour response called electrokinesis to increase their speed in the vicinity of IEAs (insoluble electron acceptors), including manganese oxides, iron oxides and poised electrodes [Harris, El-Naggar, Bretschger, Ward, Romine, Obraztsova and Nealson (2010) Proc. Natl. Acad. Sci. U.S.A. 107, 326-331]. However, it is not currently understood how bacteria remain in the vicinity of the IEA and accumulate both on the surface and in the surrounding medium. In the present paper, we provide results indicating that cells that have contacted the IEAs swim faster than those that have not recently made contact. In addition, fast-swimming cells exhibit an enhancement of swimming reversals leading to rapid non-random accumulation of cells on, and adjacent to, mineral particles. We call the observed accumulation near IEAs 'congregation'. Congregation is eliminated by the loss of a critical gene involved with EET (extracellular electron transport) (cymA, SO_4591) and is altered or eliminated in several deletion mutants of homologues of genes that are involved with chemotaxis or energy taxis in Escherichia coli. These genes include chemotactic signal transduction protein (cheA-3, SO_3207), methyl-accepting chemotaxis proteins with the Cache domain (mcp_cache, SO_2240) or the PAS (Per/Arnt/Sim) domain (mcp_pas, SO_1385). In the present paper, we report studies of S. oneidensis MR-1 that lend some insight into how microbes in this group can 'sense' the presence of a solid substrate such as a mineral surface, and maintain themselves in the vicinity of the mineral (i.e. via congregation), which may ultimately lead to attachment and biofilm formation.
Enhanced Shewanella biofilm promotes bioelectricity generation.
Liu, Ting; Yu, Yang-Yang; Deng, Xiao-Peng; Ng, Chun Kiat; Cao, Bin; Wang, Jing-Yuan; Rice, Scott A; Kjelleberg, Staffan; Song, Hao
2015-10-01
Electroactive biofilms play essential roles in determining the power output of microbial fuel cells (MFCs). To engineer the electroactive biofilm formation of Shewanella oneidensis MR-1, a model exoelectrogen, we herein heterologously overexpressed a c-di-GMP biosynthesis gene ydeH in S. oneidensis MR-1, constructing a mutant strain in which the expression of ydeH is under the control of IPTG-inducible promoter, and a strain in which ydeH is under the control of a constitutive promoter. Such engineered Shewanella strains had significantly enhanced biofilm formation and bioelectricity generation. The MFCs inoculated with these engineered strains accomplished a maximum power density of 167.6 ± 3.6 mW/m(2) , which was ∼ 2.8 times of that achieved by the wild-type MR-1 (61.0 ± 1.9 mW/m(2) ). In addition, the engineered strains in the bioelectrochemical system at poised potential of 0.2 V vs. saturated calomel electrode (SCE) generated a stable current density of 1100 mA/m(2) , ∼ 3.4 times of that by wild-type MR-1 (320 mA/m(2) ). © 2015 Wiley Periodicals, Inc.
Metabolically engineered glucose-utilizing Shewanella strains under anaerobic conditions.
Choi, Donggeon; Lee, Sae Bom; Kim, Sohyun; Min, Byoungnam; Choi, In-Geol; Chang, In Seop
2014-02-01
Comparative genome analysis of Shewanella strains predicted that the strains metabolize preferably two- and three-carbon carbohydrates as carbon/electron source because many Shewanella genomes are deficient of the key enzymes in glycolysis (e.g., glucokinase). In addition, all Shewanella genomes are known to have only one set of genes associated with the phosphotransferase system required to uptake sugars. To engineer Shewanella strains that can utilize five- and six-carbon carbohydrates, we constructed glucose-utilizing Shewanella oneidensis MR-1 by introducing the glucose facilitator (glf; ZMO0366) and glucokinase (glk; ZMO0369) genes of Zymomonas mobilis. The engineered MR-1 strain was able to grow on glucose as a sole carbon/electron source under anaerobic conditions. The glucose affinity (Ks) and glucokinase activity in the engineered MR-1 strain were 299.46 mM and 0.259 ± 0.034 U/g proteins. The engineered strain was successfully applied to a microbial fuel cell system and exhibited current generation using glucose as the electron source. Copyright © 2013 Elsevier Ltd. All rights reserved.
Ding, Dewu; Sun, Xiao
2018-01-16
Shewanella oneidensis MR-1 can transfer electrons from the intracellular environment to the extracellular space of the cells to reduce the extracellular insoluble electron acceptors (Extracellular Electron Transfer, EET). Benefiting from this EET capability, Shewanella has been widely used in different areas, such as energy production, wastewater treatment, and bioremediation. Genome-wide proteomics data was used to determine the active proteins involved in activating the EET process. We identified 1012 proteins with decreased expression and 811 proteins with increased expression when the EET process changed from inactivation to activation. We then networked these proteins to construct the active protein networks, and identified the top 20 key active proteins by network centralization analysis, including metabolism- and energy-related proteins, signal and transcriptional regulatory proteins, translation-related proteins, and the EET-related proteins. We also constructed the integrated protein interaction and transcriptional regulatory networks for the active proteins, then found three exclusive active network motifs involved in activating the EET process-Bi-feedforward Loop, Regulatory Cascade with a Feedback, and Feedback with a Protein-Protein Interaction (PPI)-and identified the active proteins involved in these motifs. Both enrichment analysis and comparative analysis to the whole-genome data implicated the multiheme c -type cytochromes and multiple signal processing proteins involved in the process. Furthermore, the interactions of these motif-guided active proteins and the involved functional modules were discussed. Collectively, by using network-based methods, this work reported a proteome-wide search for the key active proteins that potentially activate the EET process.
Luo, Shuai; Guo, Weihua; Nealson, Kenneth H; Feng, Xueyang; He, Zhen
2016-02-12
Microbial fuel cell (MFC) is a promising technology for direct electricity generation from organics by microorganisms. The type of electron donors fed into MFCs affects the electrical performance, and mechanistic understanding of such effects is important to optimize the MFC performance. In this study, we used a model organism in MFCs, Shewanella oneidensis MR-1, and (13)C pathway analysis to investigate the role of formate in electricity generation and the related microbial metabolism. Our results indicated a synergistic effect of formate and lactate on electricity generation, and extra formate addition on the original lactate resulted in more electrical output than using formate or lactate as a sole electron donor. Based on the (13)C tracer analysis, we discovered decoupled cell growth and electricity generation in S. oneidensis MR-1 during co-utilization of lactate and formate (i.e., while the lactate was mainly metabolized to support the cell growth, the formate was oxidized to release electrons for higher electricity generation). To our best knowledge, this is the first time that (13)C tracer analysis was applied to study microbial metabolism in MFCs and it was demonstrated to be a valuable tool to understand the metabolic pathways affected by electron donors in the selected electrochemically-active microorganisms.
Zhang, Yingdan; Ng, Chun Kiat; Cohen, Yehuda; Cao, Bin
2014-05-01
The performance of biofilm-based bioprocesses is difficult to predict and control because of the intrinsic heterogeneous and dynamic properties of microbial biofilms. Biofilm mimics, such as microbial cells entrapped in polymeric scaffolds that are permeable for nutrients, have been proposed to replace real biofilms to achieve long-term robust performance in engineering applications. However, the physiological differences between cells that are physically entrapped in a synthetic polymeric matrix and biofilm cells that are encased in a self-produced polymeric matrix remain unknown. In this study, using Shewanella oneidensis as a model organism and alginate hydrogel as a model synthetic matrix, we compared the cell growth and protein expression in entrapped cultures and biofilms. The hydrogel-entrapped cultures were found to exhibit a growth rate comparable with biofilms. There was no substantial difference in cell viability, surface charge, as well as hydrophobicity between the cells grown in alginate hydrogel and those grown in biofilms. However, the gel-entrapped cultures were found to be physiologically different from biofilms. The gel-entrapped cultures had a higher demand for metabolic energy. The siderophore-mediated iron uptake was repressed in the gel-entrapped cells. The presence of the hydrogel matrix decreased the expression of proteins involved in biofilm formation, while inducing the production of extracellular DNA (eDNA) in the gel-entrapped cultures. These results advance the fundamental understanding of the physiology of hydrogel-entrapped cells, which can lead to more efficient biofilm mimic-based applications.
Yin, Jianhua; Jin, Miao; Zhang, Haiyan; Ju, Lili; Zhang, Lili; Gao, Haichun
2015-01-01
Cytochrome c proteins, as enzymes to exchange electrons with substrates or as pure electron carriers to shuttle electrons, play vital roles in bacterial respiration and photosynthesis. In Shewanella oneidensis, a research model for the respiratory diversity, at least 42 c-type cytochromes are predicted to be encoded in the genome and are regarded to be the foundation of its highly branched electron transport pathways. However, only a small number of c-type cytochromes have been extensively studied. In this study, we identify soluble cytochrome c ScyA as an important factor influencing the nitrite resistance of a strain devoid of the bd oxidase by utilizing a newly developed transposon mutagenesis vector, which enables overexpression of the gene(s) downstream of the insertion site. We show that when in overabundance ScyA facilitates growth against nitrite inhibition by enhancing nitrite resistance of the cbb3 oxidase. Based on the data presented in this study, we suggest two possible mechanisms underlying the observed effect of ScyA: (1) ScyA increases electron flow to the cbb3 oxidase; (2) ScyA promotes nitrite resistance of the cbb3 oxidase, possibly by direct interaction. PMID:25417822
The genus Shewanella: from the briny depths below to human pathogen.
Janda, J Michael; Abbott, Sharon L
2014-11-01
The genus Shewanella is currently composed of more than 50 species that inhabit a range of marine environs and ecosystems. Several members of this genus, including S. oneidensis, have been identified that could potentially play key roles in environmental processes such as bioremediation of toxic elements and heavy metals and serving as microbial fuel cells. In contrast to this beneficial role, shewanellae are increasingly being implicated as human pathogens in persons exposed through occupational or recreational activities to marine niches containing shewanellae. Documented illnesses linked to Shewanella include skin and soft tissue infections, bacteremia, and otitis media. At present, it is unclear exactly how many Shewanella species are truly bona fide human pathogens. Recent advances in the taxonomy and phylogenetic relatedness of members of this genus, however, support the concept that most human infections are caused by a single species, S. algae. Some phylogenetic data further suggest that some current members of the genus are not true Shewanella species sensu stricto. The current review summarizes our present knowledge of the distribution, epidemiology, disease spectrum, and identification of microbial species focusing on a clinical perspective.
Gomaa, Ola M; Fapetu, Segun; Kyazze, Godfrey; Keshavarz, Tajalli
2017-03-01
Dissimilatory metal reducing bacteria can exchange electrons extracellularly and hold great promise for their use in simultaneous wastewater treatment and electricity production. This study investigated the role of riboflavin, an electron carrier, in the decolourisation of Congo red in microbial fuel cells (MFCs) using Shewanella oneidensis MR-1 as a model organism. The contribution of the membrane-bound protein MtrC to the decolourisation process was also investigated. Within the range of riboflavin concentrations tested, 20 µM was found to be the best with >95% of the dye (initial concentration 200 mg/L) decolourised in MFCs within 50 h compared to 90% in the case where no riboflavin was added. The corresponding maximum power density was 45 mW/m 2 . There was no significant difference in the overall decolourisation efficiencies of Shewanela oneidensis MR-1 ΔMtrC mutants compared to the wild type. However, in terms of power production the mutant produced more power (P max 76 mW/m 2 ) compared to the wild type (P max 46 mW/m 2 ) which was attributed to higher levels of riboflavin secreted in solution. Decolourisation efficiencies in non-MFC systems (anaerobic bottles) were similar to those under MFC systems indicating that electricity generation in MFCs does not impair dye decolourisation efficiencies. The results suggest that riboflavin enhances both decolourisation of dyes and simultaneous electricity production in MFCs.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Qiu, D.; Tu, Q.; He, Zhili
2010-05-17
Respiratory versatility and psychrophily are the hallmarks of Shewanella. The ability to utilize a wide range of electron acceptors for respiration is due to the large number of c-type cytochrome genes present in the genome of Shewanella strains. More recently the dissimilatory metal reduction of Shewanella species has been extensively and intensively studied for potential applications in the bioremediation of radioactive wastes of groundwater and subsurface environments. Multiple Shewanella genome sequences are now available in the public databases (Fredrickson et al., 2008). Most of the sequenced Shewanella strains were isolated from marine environments and this genus was believed to bemore » of marine origin (Hau and Gralnick, 2007). However, the well-characterized model strain, S. oneidensis MR-1, was isolated from the freshwater lake sediment of Lake Oneida, New York (Myers and Nealson, 1988) and similar bacteria have also been isolated from other freshwater environments (Venkateswaran et al., 1999). Here we comparatively analyzed the genome sequence and physiological characteristics of S. putrefaciens W3-18-1 and S. oneidensis MR-1, isolated from the marine and freshwater lake sediments, respectively. The anaerobic respirations, carbon source utilization, and cell motility have been experimentally investigated. Large scale horizontal gene transfers have been revealed and the genetic divergence between these two strains was considered to be critical to the bacterial adaptation to specific habitats, freshwater or marine sediments.« less
NASA Astrophysics Data System (ADS)
Ye, Zhou; Ellis, Michael W.; Nain, Amrinder S.; Behkam, Bahareh
2017-04-01
Microbial fuel cells (MFCs) are envisioned to serve as compact and sustainable sources of energy; however, low current and power density have hindered their widespread use. Introduction of 3D micro/nanostructures on the MFC anode is known to improve its performance by increasing the surface area available for bacteria attachment; however, the role of the feature size remains poorly understood. To delineate the role of feature size from the ensuing surface area increase, nanostructures with feature heights of 115 nm and 300 nm, both at a height to width aspect ratio of 0.3, are fabricated in a grid pattern on glassy carbon electrodes (GCEs). Areal current densities and bacteria attachment densities of the patterned and unpatterned GCEs are compared using Shewanella oneidensis Δbfe in a three-electrode bioreactor. The 115 nm features elicit a remarkable 40% increase in current density and a 78% increase in bacterial attachment density, whereas the GCE with 300 nm pattern does not exhibit significant change in current density or bacterial attachment density. The current density dependency on feature size is maintained over the entire 160 h experiment. Thus, optimally sized surface features have a substantial effect on current production that is independent of their effect on surface area.
NASA Astrophysics Data System (ADS)
Mitchell, A. C.; Geesey, G. G.
2006-12-01
Current understanding of bacterial respiration by dissimilatory iron (Fe) reduction is based primarily on studies of closed systems using soluble Fe(III). However, natural environments likely to support Fe reduction are typically open systems and contain Fe(III) primarily in the form of crystalline (hydr)oxides. Mechanisms by which electrons are transported between bacteria and mineral terminal electron acceptors (TEAs) under open system conditions are still poorly understood. However, a number of cytochromes have been identified as potentially playing a critical role in the electron transport system of some Fe reducing bacteria. Experiments were performed using (i) omcA, (ii) mtrC, or (iii) omcA and mtrC cytochrome deficient mutants of the Fe-reducing bacteria, Shewanella oneidensis MR-1, in transparent-window flow- reactors containing hematite as the only TEA. These were operated under defined hydrodynamic and anaerobic conditions. Cells expressed green fluorescent protein (gfp), allowing real time measurement of cells at the mineral surface by epifluorescence microscopy. Cytochromes which play a critical role in the anaerobic growth of S. Oneidensis by Fe reduction under open system natural-flow conditions could then be identified. Differences in the accumulation, maximum density, detachment and total production of surface-associated cells growing on hematite surfaces were apparent between the mutants, and between the mutants and the wild-type. Mutants deficient in cytochromes grew to a lower max density by up to 2 orders of magnitude than the wild-type, and exhibited no reduced Fe in the reactor effluent or at the surface of the hematite at the conclusion of the experiment, as revealed by X-Ray photoelectron spectroscopy (XPS). Therefore omcA and / or mtrC cytochromes appear critical for electron shuttling and anaerobic growth of S. Oneidensis on hematite under natural-flow conditions.
Purification and Characterization of [NiFe]-Hydrogenase of Shewanella oneidensis MR-1
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shi, Liang; Belchik, Sara M.; Plymale, Andrew E.
2011-08-02
The γ-proteobacterium Shewanella oneidensis MR-1 possesses a periplasmic [NiFe]-hydrogenase (MR-1 [NiFe]-H2ase) that was implicated in both H2 production and oxidation as well as technetium [Tc(VII)] reduction. To characterize the roles of MR-1 [NiFe]-H2ase in these proposed reactions, the genes encoding both subunits of MR-1 [NiFe]-H2ase were cloned into a protein expression vector. The resulting plasmid was transformed into a MR-1 mutant deficient in H2 formation. Expression of MR-1 [NiFe]-H2ase in trans restored the mutant’s ability to produce H2 at 37% of that for wild type. Following expression, MR-1 [NiFe]-H2ase was purified to near homogeneity. The purified MR-1 [NiFe]-H2ase could couplemore » H2 oxidation to reduction of Tc(VII) and methyl viologen directly. Change of the buffers used affected MR-1 [NiFe]-H2ase-mediated Tc(VII) but not methyl viologen reductions. Under the conditions tested, Tc(VII) reduction was complete in Tris buffer but not in HEPES buffer. The reduced Tc(IV) was soluble in Tris buffer but insoluble in HEPES buffer. Transmission electron microscopy analysis revealed that Tc(IV) precipitates formed in HEPES buffer were packed with crystallites. Although X-ray absorption near-edge spectroscopy measurements confirmed that the reduction products found in both buffers were Tc(IV), extended X-ray adsorption fine-structure measurements revealed that these products were very different. While the product in Tris buffer could not be determined, the Tc(IV) product in HEPES buffer was very similar to Tc(IV)O2•nH2O. These results shows for the first time that MR-1 [NiFe]-H2ase is a bidirectional enzyme that catalyzes both H2 formation and oxidation as well as Tc(VII) reduction directly by coupling H2 oxidation.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mitchell, Andrew C.; Peterson, L.; Reardon, Catherine L.
2012-07-01
Solid phase iron oxides are considered to be important terminal electron acceptors for microbial respiration in many anoxic environments. Besides the knowledge that cells attach to and reduce these substrates, other aspects of surface-associated cell behavior and the related cell surface components that influence cell-mineral interactions are not well understood. In the present study, wild-type cells of the dissimilatory iron-reducing bacterium Shewanella oneidensis MR-1 formed thin biofilms one-to-two cell layers in thickness when respiring on natural specular hematite under flow conditions similar to those which exist in aquatic sediments and subsurface environments. The distribution of cells within the biofilm indicatedmore » that direct contact was not required for electron transfer from cells to the mineral surface. Detached biomass in the form of single cells represented >99% of the surface-associated wild-type cell production from respiration on hematite over the biofilm life cycle. A mutant deficient in the outer membrane c35 type cytochrome OmcA, while still able to respire and replicate on hematite, established a lower steady-state cell density on the mineral surface than that of the wild-type strain. A mutant deficient in MtrC, another outer membrane c-type cytochrome, and a mutant deficient in both cytochromes were unable to reduce sufficient amounts of hematite to support detectable growth on the mineral surface. When considered in the context of previous work, the results support a growing body of evidence that the relative importance of OmcA and MtrC to cell respiration and replication depends on the form of iron oxide available as terminal electron acceptor.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mishra, B.; Boyanov, M.; Bunker, B. A.
2010-08-01
Bulk Cd adsorption isotherm experiments, thermodynamic equilibrium modeling, and Cd K edge EXAFS were used to constrain the mechanisms of proton and Cd adsorption to bacterial cells of the commonly occurring Gram-positive and Gram-negative bacteria, Bacillus subtilis and Shewanella oneidensis, respectively. Potentiometric titrations were used to characterize the functional group reactivity of the S. oneidensis cells, and we model the titration data using the same type of non-electrostatic surface complexation approach as was applied to titrations of B. subtilis suspensions by Fein et al. (2005). Similar to the results for B. subtilis, the S. oneidensis cells exhibit buffering behavior frommore » approximately pH 3-9 that requires the presence of four distinct sites, with pK{sub a} values of 3.3 {+-} 0.2, 4.8 {+-} 0.2, 6.7 {+-} 0.4, and 9.4 {+-} 0.5, and site concentrations of 8.9({+-}2.6) x 10{sup -5}, 1.3({+-}0.2) x 10{sup -4}, 5.9({+-}3.3) x 10{sup -5}, and 1.1({+-}0.6) x 10{sup -4} moles/g bacteria (wet mass), respectively. The bulk Cd isotherm adsorption data for both species, conducted at pH 5.9 as a function of Cd concentration at a fixed biomass concentration, were best modeled by reactions with a Cd:site stoichiometry of 1:1. EXAFS data were collected for both bacterial species as a function of Cd concentration at pH 5.9 and 10 g/L bacteria. The EXAFS results show that the same types of binding sites are responsible for Cd sorption to both bacterial species at all Cd loadings tested (1-200 ppm). Carboxyl sites are responsible for the binding at intermediate Cd loadings. Phosphoryl ligands are more important than carboxyl ligands for Cd binding at high Cd loadings. For the lowest Cd loadings studied here, a sulfhydryl site was found to dominate the bound Cd budgets for both species, in addition to the carboxyl and phosphoryl sites that dominate the higher loadings. The EXAFS results suggest that both Gram-positive and Gram-negative bacterial cell walls
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cao, Bin; Shi, Liang; Brown, Roslyn N.
This study characterizes the composition of extracellular polymeric substances (EPS) from Shewanella sp. HRCR-1 biofilms to provide insight into potential interactions of EPS with redox-active metals and radionuclides. Both bound and loosely associated EPS were extracted from Shewanella sp. HRCR-1 biofilms prepared using a hollow-fiber membrane biofilm reactor (HfMBR). FTIR spectra revealed the presence of proteins, polysaccharides, nucleic acids, membrane lipids, and fatty acids in both bound and loosely associated EPS. Using a global proteomic approach, a total of 58 extracellular and outer membrane proteins were identified in the EPS. These included homologues of multiple S. oneidensis MR-1 proteins thatmore » potentially contribute to key physiological biofilm processes, such as biofilm-promoting protein BpfA, surface-associated serine protease, nucleotidases (CpdB and UshA), an extracellular lipase, and oligopeptidases (PtrB and a M13 family oligopeptidase lipoprotein). In addition, 20 redox proteins were found in extracted EPS. Among the detected redox proteins were the homologues of two S. oneidensis MR-1 c-type cytochromes, MtrC and OmcA, which have been implicated in extracellular electron transfer. Given their detection in the EPS of Shewanella sp. HRCR 1 biofilms, c-type cytochromes may contribute to the possible redox activity of the biofilm matrix and play important roles in extracellular electron transfer reactions.« less
Xafenias, Nikolaos; Zhang, Yue; Banks, Charles J
2013-05-07
Biocathodes for the reduction of the highly toxic hexavalent chromium (Cr(VI)) were investigated using Shewanella oneidensis MR-1 (MR-1) as a biocatalyst and performance was assessed in terms of current production and Cr(VI) reduction. Potentiostatically controlled experiments (-500 mV vs Ag/AgCl) showed that a mediatorless MR-1 biocathode started up under aerated conditions in the presence of lactate, received 5.5 and 1.7 times more electrons for Cr(VI) reduction over a 4 h operating period than controls without lactate and with lactate but without MR-1, respectively. Cr(VI) reduction was also enhanced, with a decrease in concentration over the 4 h operating period of 9 mg/L Cr(VI), compared to only 1 and 3 mg/L, respectively, in the controls. Riboflavin, an electron shuttle mediator naturally produced by MR-1, was also found to have a positive impact in potentiostatically controlled cathodes. Additionally, a microbial fuel cell (MFC) with MR-1 and lactate present in both anode and cathode produced a maximum current density of 32.5 mA/m(2) (1000 Ω external load) after receiving a 10 mg/L Cr(VI) addition in the cathode, and cathodic efficiency increased steadily over an 8 day operation period with successive Cr(VI) additions. In conclusion, effective and continuous Cr(VI) reduction with associated current production were achieved when MR-1 and lactate were both present in the biocathodes.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Simpson, Philippa J.L.; Codd, Rachel, E-mail: rachel.codd@sydney.edu.au; School of Medical Sciences
2011-11-04
Highlights: Black-Right-Pointing-Pointer Cold-adapted phenotype of NapA from the Antarctic bacterium Shewanella gelidimarina. Black-Right-Pointing-Pointer Protein homology model of NapA from S. gelidimarina and mesophilic homologue. Black-Right-Pointing-Pointer Six amino acid residues identified as lead candidates governing NapA cold adaptation. Black-Right-Pointing-Pointer Molecular-level understanding of designing cool-temperature in situ oxyanion sensors. -- Abstract: The reduction of nitrate to nitrite is catalysed in bacteria by periplasmic nitrate reductase (Nap) which describes a system of variable protein subunits encoded by the nap operon. Nitrate reduction occurs in the NapA subunit, which contains a bis-molybdopterin guanine dinucleotide (Mo-MGD) cofactor and one [4Fe-4S] iron-sulfur cluster. The activity ofmore » periplasmic nitrate reductase (Nap) isolated as native protein from the cold-adapted (psychrophilic) Antarctic bacterium Shewanella gelidimarina (Nap{sub Sgel}) and middle-temperature adapted (mesophilic) Shewanella putrefaciens (Nap{sub Sput}) was examined at varied temperature. Irreversible deactivation of Nap{sub Sgel} and Nap{sub Sput} occurred at 54.5 and 65 Degree-Sign C, respectively. When Nap{sub Sgel} was preincubated at 21-70 Degree-Sign C for 30 min, the room-temperature nitrate reductase activity was maximal and invariant between 21 and 54 Degree-Sign C, which suggested that Nap{sub Sgel} was poised for optimal catalysis at modest temperatures and, unlike Nap{sub Sput}, did not benefit from thermally-induced refolding. At 20 Degree-Sign C, Nap{sub Sgel} reduced selenate at 16% of the rate of nitrate reduction. Nap{sub Sput} did not reduce selenate. Sequence alignment showed 46 amino acid residue substitutions in Nap{sub Sgel} that were conserved in NapA from mesophilic Shewanella, Rhodobacter and Escherichia species and could be associated with the Nap{sub Sgel} cold-adapted phenotype. Protein homology modeling of Nap{sub Sgel
Wan, Fen; Mao, Yinting; Dong, Yangyang; Ju, Lili; Wu, Genfu; Gao, Haichun
2015-01-01
Oxidative stress is one of the major challenges that Shewanella encounter routinely because they thrive in redox-stratified environments prone to reactive oxygen species (ROS) formation, letting alone that ROS can be generated endogenously. As respiration is the predominant process for endogenous ROS, regulators mediating respiration have been demonstrated and/or implicated to play a role in oxidative stress response. In our efforts to unveil the involvement of global regulators for respiration in the oxidative stress response, we found that loss of the Arc system increases S. oneidensis sensitivity to H2O2 whereas neither Fnr nor Crp has a significant role. A comparison of transcriptomic profiles of the wild-type and its isogenic arcA mutant revealed that the OxyR regulon is independent of the Arc system. We then provided evidence that the enhanced H2O2 sensitivity of the arcA mutant is due to an increased H2O2 uptake rate, a result of a cell envelope defect. Although one of three proteases of the ArcA regulon when in excess is partially accountable for the envelope defect, the major contributors remain elusive. Overall, our data indicate that the Arc system influences the bacterial cell envelope biosynthesis, a physiological aspect that has not been associated with the regulator before. PMID:25975178
Purification and Characterization of the [NiFe]-Hydrogenase of Shewanella oneidensis MR-1 ▿
Shi, Liang; Belchik, Sara M.; Plymale, Andrew E.; Heald, Steve; Dohnalkova, Alice C.; Sybirna, Kateryna; Bottin, Hervé; Squier, Thomas C.; Zachara, John M.; Fredrickson, James K.
2011-01-01
Shewanella oneidensis MR-1 possesses a periplasmic [NiFe]-hydrogenase (MR-1 [NiFe]-H2ase) that has been implicated in H2 production and oxidation as well as technetium [Tc(VII)] reduction. To characterize the roles of MR-1 [NiFe]-H2ase in these proposed reactions, the genes encoding both subunits of MR-1 [NiFe]-H2ase were cloned and then expressed in an MR-1 mutant without hyaB and hydA genes. Expression of recombinant MR-1 [NiFe]-H2ase in trans restored the mutant's ability to produce H2 at 37% of that for the wild type. Following purification, MR-1 [NiFe]-H2ase coupled H2 oxidation to reduction of Tc(VII)O4− and methyl viologen. Change of the buffers used affected MR-1 [NiFe]-H2ase-mediated reduction of Tc(VII)O4− but not methyl viologen. Under the conditions tested, all Tc(VII)O4− used was reduced in Tris buffer, while in HEPES buffer, only 20% of Tc(VII)O4− was reduced. The reduced products were soluble in Tris buffer but insoluble in HEPES buffer. Transmission electron microscopy analysis revealed that Tc precipitates reduced in HEPES buffer were aggregates of crystallites with diameters of ∼5 nm. Measurements with X-ray absorption near-edge spectroscopy revealed that the reduction products were a mixture of Tc(IV) and Tc(V) in Tris buffer but only Tc(IV) in HEPES buffer. Measurements with extended X-ray adsorption fine structure showed that while the Tc bonding environment in Tris buffer could not be determined, the Tc(IV) product in HEPES buffer was very similar to Tc(IV)O2·nH2O, which was also the product of Tc(VII)O4− reduction by MR-1 cells. These results shows for the first time that MR-1 [NiFe]-H2ase catalyzes Tc(VII)O4− reduction directly by coupling to H2 oxidation. PMID:21724888
Jiang, Xiaocheng; Hu, Jinsong; Fitzgerald, Lisa A.; Biffinger, Justin C.; Xie, Ping; Ringeisen, Bradley R.; Lieber, Charles M.
2010-01-01
Microbial fuel cells (MFCs) represent a promising approach for sustainable energy production as they generate electricity directly from metabolism of organic substrates without the need for catalysts. However, the mechanisms of electron transfer between microbes and electrodes, which could ultimately limit power extraction, remain controversial. Here we demonstrate optically transparent nanoelectrodes as a platform to investigate extracellular electron transfer in Shewanella oneidensis MR-1, where an array of nanoholes precludes or single window allows for direct microbe-electrode contacts. Following addition of cells, short-circuit current measurements showed similar amplitude and temporal response for both electrode configurations, while in situ optical imaging demonstrates that the measured currents were uncorrelated with the cell number on the electrodes. High-resolution imaging showed the presence of thin, 4- to 5-nm diameter filaments emanating from cell bodies, although these filaments do not appear correlated with current generation. Both types of electrodes yielded similar currents at longer times in dense cell layers and exhibited a rapid drop in current upon removal of diffusible mediators. Reintroduction of the original cell-free media yielded a rapid increase in current to ∼80% of original level, whereas imaging showed that the positions of > 70% of cells remained unchanged during solution exchange. Together, these measurements show that electron transfer occurs predominantly by mediated mechanism in this model system. Last, simultaneous measurements of current and cell positions showed that cell motility and electron transfer were inversely correlated. The ability to control and image cell/electrode interactions down to the single-cell level provide a powerful approach for advancing our fundamental understanding of MFCs. PMID:20837546
Groh, Jennifer L.; Luo, Qingwei; Ballard , Jimmy D.; Krumholz, Lee R.
2005-01-01
Signature-tagged mutagenesis (STM) is a powerful technique that can be used to identify genes expressed by bacteria during exposure to conditions in their natural environments. To date, there have been no reports of studies in which this approach was used to study organisms of environmental, rather than pathogenic, significance. We used a mini-Tn10 transposon-bearing plasmid, pBSL180, that efficiently and randomly mutagenized Desulfovibrio desulfuricans G20 in addition to Shewanella oneidensis MR-1. Using these organisms as model sediment-dwelling anaerobic bacteria, we developed a new screening system, modified from former STM procedures, to identify genes that are critical for sediment survival. The screening system uses microarray technology to visualize tags from input and output pools, allowing us to identify those lost during sediment incubations. While the majority of data on survival genes identified will be presented in future papers, we report here on chemotaxis-related genes identified by our STM method in both bacteria in order to validate our method. This system may be applicable to the study of numerous environmental bacteria, allowing us to identify functions and roles of survival genes in various habitats.
NASA Astrophysics Data System (ADS)
Koo, T. H.; Kogure, T.; Kim, J. W.
2017-12-01
The biogeochemical modification of chemistry/structure of smectite associated with microbial Fe(III) respiration is a major process of promoting smectite-to-illite reaction (S-I reaction). Direct evidence of illitization including K-fixation and changes in Al/Si, formation of K-nontronite/illite-like structure has not been suggested systematically. Nontronite (NAu-1) was inoculated with Fe-reducing bacteria (FeRB), Shewanella oneidensis MR-1 at 30 ° with pH buffered (7.0 and 8.0) M1 medium in the anaerobic chamber, and the evidence of illitization was suggested by microscopic/spectroscopic measurements as well as aqueous chemistry in the supernatant with various incubation time. A progressive morphological change in bio-reduced notnronite (altered nontronite → K-nontronite → illite) corresponded to chemical modification in solid phase (Al/Si 0.16 to 0.28). Fe and Al contents in the supernatant increased continuously up to 70 days of incubation (3.4 to 20 and 1.7 to 13 20 mmol/mg of NAu-1, respectively) then decreased in 120 days of incubation (20 to 8 and 13 to 3 mmol/mg of NAu-1, respectively) indicating new mineral phase precipitated. Si contents showed slightly decreased in 7 days (133 to 100 mmol/mg of NAu-1) then showed fluctuated pattern (increased to 183 mmol/mg of NAu-1 in 70 days, then decreased to 102 mmol/mg of NAu-1 in 120 days of incubation). Formation of biotic silica globule within 120-day incubation supported the dissolution of bio-reduced notnronite. Indeed, modification in structure (appearance of 10-Å shoulder in X-ray diffraction profile) and formation of discrete illite-like packet (d001=1.0 nm) in the wavy bio-reduced nontronite matrix (d001=1.2-1.3 nm) strongly suggest that bio-reduced nontronite underwent the reductive dissolution and precipitated the newly formed illite
Binnenkade, Lucas; Teichmann, Laura; Thormann, Kai M
2014-09-01
Prophages are ubiquitous elements within bacterial chromosomes and affect host physiology and ecology in multiple ways. We have previously demonstrated that phage-induced lysis is required for extracellular DNA (eDNA) release and normal biofilm formation in Shewanella oneidensis MR-1. Here, we investigated the regulatory mechanisms of prophage λSo spatiotemporal induction in biofilms. To this end, we used a functional fluorescence fusion to monitor λSo activation in various mutant backgrounds and in response to different physiological conditions. λSo induction occurred mainly in a subpopulation of filamentous cells in a strictly RecA-dependent manner, implicating oxidative stress-induced DNA damage as the major trigger. Accordingly, mutants affected in the oxidative stress response (ΔoxyR) or iron homeostasis (Δfur) displayed drastically increased levels of phage induction and abnormal biofilm formation, while planktonic cells were not or only marginally affected. To further investigate the role of oxidative stress, we performed a mutant screen and identified two independent amino acid substitutions in OxyR (T104N and L197P) that suppress induction of λSo by hydrogen peroxide (H2O2). However, λSo induction was not suppressed in biofilms formed by both mutants, suggesting a minor role of intracellular H2O2 in this process. In contrast, addition of iron to biofilms strongly enhanced λSo induction and eDNA release, while both processes were significantly suppressed at low iron levels, strongly indicating that iron is the limiting factor. We conclude that uptake of iron during biofilm formation triggers λSo-mediated lysis of a subpopulation of cells, likely by an increase in iron-mediated DNA damage sensed by RecA. Copyright © 2014, American Society for Microbiology. All Rights Reserved.
Shewanella halifaxensis sp. nov., a novel obligately respiratory and denitrifying psychrophile.
Zhao, Jian-Shen; Manno, Dominic; Leggiadro, Cindy; O'Neil, David; Hawari, Jalal
2006-01-01
Indigenous bacteria found in the sediment of the Emerald Basin (depth of 215 m, Atlantic Ocean) located offshore of Halifax Harbour (Nova Scotia, Canada) were previously found to be able to degrade the explosive compound hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX). In the present study, a novel obligately respiratory, denitrifying and RDX-mineralizing bacterium, designated strain HAW-EB4(T), was isolated from the marine sediment. This bacterium utilized peptone, yeast extract, Casamino acids, esters (Tweens 20, 40 and 80), sugars (N-acetyl-D-glucosamine, ribose), several C2 and C3 acids (acetate, pyruvate, lactate, propionate) and amino acids (serine, proline) as sole carbon and energy sources. Aerobically grown cells (in marine broth 2216 at 10 degrees C) contained C(14 : 0) (6 %), iso-C(15 : 0) (12 %), C(16 : 0) (20 %), C(16 : 1)omega7 (37 %), C(18 : 1)omega7 (7 %) and C(20 : 5)omega3 (7 %) as major membrane fatty acids, and Q7 (28.1 %) and MK-7 (60.9 %) as dominant respiratory quinones, consistent with deep-sea species of Shewanella. The novel bacterium had a DNA G+C content of 45 mol% and showed similarity to Shewanella species in terms of 16S rRNA and gyrB gene sequences (93-99 and 67.3-88.4 % similarity, respectively), with Shewanella pealeana being the most closely related species. Genomic DNA-DNA hybridization between strain HAW-EB4T and S. pealeana revealed a level of relatedness of 17.9 %, lower than the 70 % species cut-off value, indicating that strain HAW-EB4T (= NCIMB 14093T = DSM 17350T) is the type strain of a novel species of Shewanella, for which the name Shewanella halifaxensis sp. nov. is proposed.
Pinto, David; Coradin, Thibaud; Laberty-Robert, Christel
2018-04-01
In microbial fuel cells, electricity generation is assumed by bacterial degradation of low-grade organics generating electrons that are transferred to an electrode. The nature and efficiency of the electron transfer from the bacteria to the electrodes are determined by several chemical, physical and biological parameters. Specifically, the application of a specific potential at the bioanode has been shown to stimulate the formation of an electro-active biofilm, but the underlying mechanisms remain poorly understood. In this study, we have investigated the effect of an applied potential on the formation and electroactivity of biofilms established by Shewanella oneidensis bacteria on graphite felt electrodes in single- and double-chamber reactor configurations in oxic conditions. Using amperometry, cyclic voltammetry, and OCP/Power/Polarization curves techniques, we showed that a potential ranging between -0.3V and +0.5V (vs. Ag/AgCl/KCl sat.) and its converse application to a couple of electrodes leads to different electrochemical behaviors, anodic currents and biofilm architectures. For example, when the bacteria were confined in the anodic compartment of a double-chamber cell, a negative applied potential (-0.3V) at the bioanode favors a mediated electron transfer correlated with the progressive formation of a biofilm that fills the felt porosity and bridges the graphite fibers. In contrast, a positive applied potential (+0.3V) at the bioanode stimulates a direct electron transfer resulting in the fast-bacterial colonization of the fibers only. These results provide significant insight for the understanding of the complex bacteria-electrode interactions in microbial fuel cells. Copyright © 2017 Elsevier B.V. All rights reserved.
Bioremediation of nanomaterials
Chen, Frank Fanqing; Keasling, Jay D; Tang, Yinjie J
2013-05-14
The present invention provides a method comprising the use of microorganisms for nanotoxicity study and bioremediation. In some embodiment, the microorganisms are bacterial organisms such as Gram negative bacteria, which are used as model organisms to study the nanotoxicity of the fullerene compounds: E. coli W3110, a human related enterobacterium and Shewanella oneidensis MR-1, an environmentally important bacterium with versatile metabolism.
Kitayama, Miho; Koga, Ryota; Kasai, Takuya; Kouzuma, Atsushi
2017-01-01
ABSTRACT An electrochemical flow cell equipped with a graphite working electrode (WE) at the bottom was inoculated with Shewanella oneidensis MR-1 expressing an anaerobic fluorescent protein, and biofilm formation on the WE was observed over time during current generation at WE potentials of +0.4 and 0 V (versus standard hydrogen electrodes), under electrolyte-flow conditions. Electrochemical analyses suggested the presence of unique electron-transfer mechanisms in the +0.4-V biofilm. Microscopic analyses revealed that, in contrast to aerobic biofilms, current-generating biofilm (at +0.4 V) was thin and flat (∼10 μm in thickness), and cells were evenly and densely distributed in the biofilm. In contrast, cells were unevenly distributed in biofilm formed at 0 V. In situ fluorescence staining and biofilm recovery experiments showed that the amounts of extracellular polysaccharides (EPSs) in the +0.4-V biofilm were much smaller than those in the aerobic and 0-V biofilms, suggesting that Shewanella cells suppress the production of EPSs at +0.4 V under flow conditions. We suggest that Shewanella cells perceive electrode potentials and modulate the structure and composition of biofilms to efficiently transfer electrons to electrodes. IMPORTANCE A promising application of microbial fuel cells (MFCs) is to save energy in wastewater treatment. Since current is generated in these MFCs by biofilm microbes under horizontal flows of wastewater, it is important to understand the mechanisms for biofilm formation and current generation under water-flow conditions. Although massive work has been done to analyze the molecular mechanisms for current generation by model exoelectrogenic bacteria, such as Shewanella oneidensis, limited information is available regarding the formation of current-generating biofilms over time under water-flow conditions. The present study developed electrochemical flow cells and used them to examine the electrochemical and structural features of
Kitayama, Miho; Koga, Ryota; Kasai, Takuya; Kouzuma, Atsushi; Watanabe, Kazuya
2017-09-01
An electrochemical flow cell equipped with a graphite working electrode (WE) at the bottom was inoculated with Shewanella oneidensis MR-1 expressing an anaerobic fluorescent protein, and biofilm formation on the WE was observed over time during current generation at WE potentials of +0.4 and 0 V (versus standard hydrogen electrodes), under electrolyte-flow conditions. Electrochemical analyses suggested the presence of unique electron-transfer mechanisms in the +0.4-V biofilm. Microscopic analyses revealed that, in contrast to aerobic biofilms, current-generating biofilm (at +0.4 V) was thin and flat (∼10 μm in thickness), and cells were evenly and densely distributed in the biofilm. In contrast, cells were unevenly distributed in biofilm formed at 0 V. In situ fluorescence staining and biofilm recovery experiments showed that the amounts of extracellular polysaccharides (EPSs) in the +0.4-V biofilm were much smaller than those in the aerobic and 0-V biofilms, suggesting that Shewanella cells suppress the production of EPSs at +0.4 V under flow conditions. We suggest that Shewanella cells perceive electrode potentials and modulate the structure and composition of biofilms to efficiently transfer electrons to electrodes. IMPORTANCE A promising application of microbial fuel cells (MFCs) is to save energy in wastewater treatment. Since current is generated in these MFCs by biofilm microbes under horizontal flows of wastewater, it is important to understand the mechanisms for biofilm formation and current generation under water-flow conditions. Although massive work has been done to analyze the molecular mechanisms for current generation by model exoelectrogenic bacteria, such as Shewanella oneidensis , limited information is available regarding the formation of current-generating biofilms over time under water-flow conditions. The present study developed electrochemical flow cells and used them to examine the electrochemical and structural features of current
Wang, Yingge; Gelabert, Alexandre; Michel, F. Marc; ...
2016-05-30
Microbial biofilms are often present as coatings on metal-oxide surfaces in natural and industrial environments and may induce significant changes in the partitioning behavior and speciation of aqueous metal ions, which in turn can impact their transport and fate. In this study, long-period X-ray standing wave-fluorescence yield (LP-XSW-FY) spectroscopy was used to measure under in situ conditions the partitioning of aqueous Pb(II) and Zn(II) between multilayer Shewanella oneidensis MR-1 biofilms and highly polished, oriented single-crystal surfaces of α-Al 2O 3 and α-Fe 2O 3 as a function of metal-ion concentration and time at pH 6.0. We show that after 3-hmore » exposure time, Pb(II) binds preferentially to the alpha-Al 2O 3 (1-102) and α-Fe 2O 3 (0001) surfaces at low Pb concentration ([Pb] = 10 –7 M) and then increasingly partitions into the biofilm coatings at higher concentrations (10 –6 to 10 –4 M). In contrast, Zn(II) partitions preferentially into the biofilm coating for both surfaces at all Zn concentrations studied (10 –7 to 10 –4 M). In comparison, the α-Al 2O 3 (0001) surface has a low affinity for both Pb(II) and Zn(II), and the biofilm coatings are the dominant sink for both ions. These findings suggest that in the presence of S. oneidensis biofilm coatings, α-Al 2O 3 (0001) is the least reactive surface for Pb(II) and Zn(II) compared to α-Al 2O 3 (1-102) and α-Fe 2O 3 (0001). They also show that Zn(II) has a lower affinity than Pb(II) for reactive sites on α-Al 2O 3 (1-102) and α-Fe 2O 3 (0001) at [Me(II)] of 10 –7 M; at 10 –5 M, the bulk of the metal ions partition into the biofilm coatings. At longer exposure times (20-24 h), both Pb(II) and Zn(II) increasingly partition to the metal-oxide surfaces at [Me(II)] = 10 –5 M and pH 6.0, indicating possible reaction/diffusion-controlled sorption processes. Pb L-III-edge and Zn K-edge grazing-incidence extended X-ray absorption fine structure (GI-EXAFS) measurements suggest
NASA Astrophysics Data System (ADS)
Wang, Yingge; Gélabert, Alexandre; Michel, F. Marc; Choi, Yongseong; Gescher, Johannes; Ona-Nguema, Georges; Eng, Peter J.; Bargar, John R.; Farges, Francois; Spormann, Alfred M.; Brown, Gordon E.
2016-09-01
Microbial biofilms are often present as coatings on metal-oxide surfaces in natural and industrial environments and may induce significant changes in the partitioning behavior and speciation of aqueous metal ions, which in turn can impact their transport and fate. In this study, long-period X-ray standing wave-fluorescence yield (LP-XSW-FY) spectroscopy was used to measure under in situ conditions the partitioning of aqueous Pb(II) and Zn(II) between multilayer Shewanella oneidensis MR-1 biofilms and highly polished, oriented single-crystal surfaces of α-Al2O3 and α-Fe2O3 as a function of metal-ion concentration and time at pH 6.0. We show that after 3-h exposure time, Pb(II) binds preferentially to the α-Al2O3 (1-102) and α-Fe2O3 (0 0 0 1) surfaces at low Pb concentration ([Pb] = 10-7 M) and then increasingly partitions into the biofilm coatings at higher concentrations (10-6 to 10-4 M). In contrast, Zn(II) partitions preferentially into the biofilm coating for both surfaces at all Zn concentrations studied (10-7 to 10-4 M). In comparison, the α-Al2O3 (0 0 0 1) surface has a low affinity for both Pb(II) and Zn(II), and the biofilm coatings are the dominant sink for both ions. These findings suggest that in the presence of S. oneidensis biofilm coatings, α-Al2O3 (0 0 0 1) is the least reactive surface for Pb(II) and Zn(II) compared to α-Al2O3 (1-102) and α-Fe2O3 (0 0 0 1). They also show that Zn(II) has a lower affinity than Pb(II) for reactive sites on α-Al2O3 (1-102) and α-Fe2O3 (0 0 0 1) at [Me(II)] of 10-7 M; at 10-5 M, the bulk of the metal ions partition into the biofilm coatings. At longer exposure times (20-24 h), both Pb(II) and Zn(II) increasingly partition to the metal-oxide surfaces at [Me(II)] = 10-5 M and pH 6.0, indicating possible reaction/diffusion-controlled sorption processes. Pb LIII-edge and Zn K-edge grazing-incidence extended X-ray absorption fine structure (GI-EXAFS) measurements suggest that both Pb(II) and Zn(II) ions may be
The Molecular Density of States in Bacterial Nanowires
El-Naggar, Mohamed Y.; Gorby, Yuri A.; Xia, Wei; Nealson, Kenneth H.
2008-01-01
The recent discovery of electrically conductive bacterial appendages has significant physiological, ecological, and biotechnological implications, but the mechanism of electron transport in these nanostructures remains unclear. We here report quantitative measurements of transport across bacterial nanowires produced by the dissimilatory metal-reducing bacterium, Shewanella oneidensis MR-1, whose electron transport system is being investigated for renewable energy recovery in microbial fuel cells and bioremediation of heavy metals and radionuclides. The Shewanella nanowires display a surprising nonlinear electrical transport behavior, where the voltage dependence of the conductance reveals peaks indicating discrete energy levels with higher electronic density of states. Our results indicate that the molecular constituents along the Shewanella nanowires possess an intricate electronic structure that plays a role in mediating transport. PMID:18441026
Shewanella secretes flavins that mediate extracellular electron transfer
Marsili, Enrico; Baron, Daniel B.; Shikhare, Indraneel D.; Coursolle, Dan; Gralnick, Jeffrey A.; Bond, Daniel R.
2008-01-01
Bacteria able to transfer electrons to metals are key agents in biogeochemical metal cycling, subsurface bioremediation, and corrosion processes. More recently, these bacteria have gained attention as the transfer of electrons from the cell surface to conductive materials can be used in multiple applications. In this work, we adapted electrochemical techniques to probe intact biofilms of Shewanella oneidensis MR-1 and Shewanella sp. MR-4 grown by using a poised electrode as an electron acceptor. This approach detected redox-active molecules within biofilms, which were involved in electron transfer to the electrode. A combination of methods identified a mixture of riboflavin and riboflavin-5′-phosphate in supernatants from biofilm reactors, with riboflavin representing the dominant component during sustained incubations (>72 h). Removal of riboflavin from biofilms reduced the rate of electron transfer to electrodes by >70%, consistent with a role as a soluble redox shuttle carrying electrons from the cell surface to external acceptors. Differential pulse voltammetry and cyclic voltammetry revealed a layer of flavins adsorbed to electrodes, even after soluble components were removed, especially in older biofilms. Riboflavin adsorbed quickly to other surfaces of geochemical interest, such as Fe(III) and Mn(IV) oxy(hydr)oxides. This in situ demonstration of flavin production, and sequestration at surfaces, requires the paradigm of soluble redox shuttles in geochemistry to be adjusted to include binding and modification of surfaces. Moreover, the known ability of isoalloxazine rings to act as metal chelators, along with their electron shuttling capacity, suggests that extracellular respiration of minerals by Shewanella is more complex than originally conceived. PMID:18316736
Shi, Liang; Squier, Thomas C; Zachara, John M; Fredrickson, James K
2007-01-01
Dissimilatory reduction of metal (e.g. Fe, Mn) (hydr)oxides represents a challenge for microorganisms, as their cell envelopes are impermeable to metal (hydr)oxides that are poorly soluble in water. To overcome this physical barrier, the Gram-negative bacteria Shewanella oneidensis MR-1 and Geobacter sulfurreducens have developed electron transfer (ET) strategies that require multihaem c-type cytochromes (c-Cyts). In S. oneidensis MR-1, multihaem c-Cyts CymA and MtrA are believed to transfer electrons from the inner membrane quinone/quinol pool through the periplasm to the outer membrane. The type II secretion system of S. oneidensis MR-1 has been implicated in the reduction of metal (hydr)oxides, most likely by translocating decahaem c-Cyts MtrC and OmcA across outer membrane to the surface of bacterial cells where they form a protein complex. The extracellular MtrC and OmcA can directly reduce solid metal (hydr)oxides. Likewise, outer membrane multihaem c-Cyts OmcE and OmcS of G. sulfurreducens are suggested to transfer electrons from outer membrane to type IV pili that are hypothesized to relay the electrons to solid metal (hydr)oxides. Thus, multihaem c-Cyts play critical roles in S. oneidensis MR-1- and G. sulfurreducens-mediated dissimilatory reduction of solid metal (hydr)oxides by facilitating ET across the bacterial cell envelope. PMID:17581116
Youngblut, Matthew; Pauly, Daniel J; Stein, Natalia; Walters, Daniel; Conrad, John A; Moran, Graham R; Bennett, Brian; Pacheco, A Andrew
2014-04-08
Cytochrome c nitrite reductase (ccNiR) from Shewanella oneidensis, which catalyzes the six-electron reduction of nitrite to ammonia in vivo, was shown to oxidize hydroxylamine in the presence of large quantities of this substrate, yielding nitrite as the sole free nitrogenous product. UV-visible stopped-flow and rapid-freeze-quench electron paramagnetic resonance data, along with product analysis, showed that the equilibrium between hydroxylamine and nitrite is fairly rapidly established in the presence of high initial concentrations of hydroxylamine, despite said equilibrium lying far to the left. By contrast, reduction of hydroxylamine to ammonia did not occur, even though disproportionation of hydroxylamine to yield both nitrite and ammonia is strongly thermodynamically favored. This suggests a kinetic barrier to the ccNiR-catalyzed reduction of hydroxylamine to ammonia. A mechanism for hydroxylamine reduction is proposed in which the hydroxide group is first protonated and released as water, leaving what is formally an NH2(+) moiety bound at the heme active site. This species could be a metastable intermediate or a transition state but in either case would exist only if it were stabilized by the donation of electrons from the ccNiR heme pool into the empty nitrogen p orbital. In this scenario, ccNiR does not catalyze disproportionation because the electron-donating hydroxylamine does not poise the enzyme at a sufficiently low potential to stabilize the putative dehydrated hydroxylamine; presumably, a stronger reductant is required for this.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Suresh, Anil K; Wang, Wei; Pelletier, Dale A
Microorganisms have long been known to develop resistance to metal ions either by sequestering metals inside the cell or by effluxing them into the extracellular media. Here we report the biosynthesis of extracellular silver based single nanocrystallites of well-defined composition and homogeneous morphology utilizing the -proteobacterium, Shewanella oneidensis strain MR-1, upon incubation with an aqueous solution of silver nitrate. Further characterization of these particles revealed that the crystals consist of small, reasonably monodispersed spheres in the size range 2 11 nm (with an average of 4 1.5 nm). The bactericidal effect of these biologically synthesized silver nanoparticles (biogenic-Ag) are comparedmore » to similar chemically synthesized nanoparticles (colloidal silver [colloidal-Ag] and oleate capped silver [oleate-Ag]). The determination of the bactericidal effect of these different silver nanoparticles was assessed using both Gram-negative (E. coli) and Gram-positive (B. subtilis) bacteria and based on the diameter of the inhibition zone in disc diffusion tests, minimum inhibitory concentrations, Live/Dead staining assays, and atomic force microscopy. From a toxicity perspective, a clear synthesis procedure, and a surface coat- and strain-dependent inhibition were observed for silver nanoparticles. Biogenic-Ag was found to be of higher toxicity when compared to colloidal-Ag for both E. coli and B. subtilis. E. coli was found to be more resistant to either of these nanoparticles than B. subtilis. In contrast, Oleate-Ag was not toxic to either of the bacteria. These findings have important implications for the potential uses of Ag nanomaterials and for their fate in biological and environmental systems.« less
Wang, Yingge; Gelabert, Alexandre; Michel, F. Marc; ...
2016-05-07
Competitive sorption of Pb(II) and Zn(II) on Shewanella oneidensis MR-1 biofilm-coated single-crystal α-Al 2O 3 (1 –1 0 2) and α-Fe 2O 3 (0 0 0 1) surfaces was investigated using long-period X-ray standing wave-florescence yield (LP-XSW-FY) spectroscopy. In situ partitioning of aqueous Pb(II) and Zn(II) between the biofilms and underlying metal-oxide substrates was probed following exposure of these complex interfaces to equi-molar Pb and Zn solutions (0.01 M NaNO 3 as background electrolyte, pH = 6.0, and 3-h equilibration time). At higher Pb and Zn concentrations (≥10 –5 M), more than 99% of these ions partitioned into the biofilmsmore » at S. oneidensis/α-Al 2O 3 (1 –1 0 2)/water interfaces, which is consistent with the partitioning behavior of both Pb(II) or Zn(II) in single-metal-ion experiments. Furthermore, no apparent competitive effects were found in this system at these relatively high metal-ion concentrations. However, at lower equi-molar concentrations (≤10 –6 M), Pb(II) and Zn(II) partitioning in the same system changed significantly compared to the single-metal-ion systems. The presence of Zn(II) decreased Pb(II) partitioning onto α-Al 2O 3 (1 –1 0 2) substantially (~52% to ~13% at 10 –7 M, and ~23% to ~5% at 10–6 M), whereas the presence of Pb(II) caused more Zn(II) to partition onto α-Al 2O 3 (1 –1 0 2) surfaces (~15% to ~28% at 10 –7 M, and ~1% to ~7% at 10 –6 M) .The higher observed partitioning of Zn(II) (~28%) at the α-Al 2O 3 (1 –1 0 2) surfaces compared to Pb(II) (~13%) in the mixed-metal-ion systems at the lowest concentration (10 –7 M) suggests that Zn(II) is slightly favored over Pb(II) for sorption sites on α-Al 2O 3 (1 –1 0 2) surfaces under our experimental conditions.« less
Xiong, Lei; Jian, Huahua
2017-01-01
ABSTRACT Dimethyl sulfoxide (DMSO) acts as a substantial sink for dimethyl sulfide (DMS) in deep waters and is therefore considered a potential electron acceptor supporting abyssal ecosystems. Shewanella piezotolerans WP3 was isolated from west Pacific deep-sea sediments, and two functional DMSO respiratory subsystems are essential for maximum growth of WP3 under in situ conditions (4°C/20 MPa). However, the relationship between these two subsystems and the electron transport pathway underlying DMSO reduction by WP3 remain unknown. In this study, both DMSO reductases (type I and type VI) in WP3 were found to be functionally independent despite their close evolutionary relationship. Moreover, immunogold labeling of DMSO reductase subunits revealed that the type I DMSO reductase was localized on the outer leaflet of the outer membrane, whereas the type VI DMSO reductase was located within the periplasmic space. CymA, a cytoplasmic membrane-bound tetraheme c-type cytochrome, served as a preferential electron transport protein for the type I and type VI DMSO reductases, in which type VI accepted electrons from CymA in a DmsE- and DmsF-independent manner. Based on these results, we proposed a core electron transport model of DMSO reduction in the deep-sea bacterium S. piezotolerans WP3. These results collectively suggest that the possession of two sets of DMSO reductases with distinct subcellular localizations may be an adaptive strategy for WP3 to achieve maximum DMSO utilization in deep-sea environments. IMPORTANCE As the dominant methylated sulfur compound in deep oceanic water, dimethyl sulfoxide (DMSO) has been suggested to play an important role in the marine biogeochemical cycle of the volatile anti-greenhouse gas dimethyl sulfide (DMS). Two sets of DMSO respiratory systems in the deep-sea bacterium Shewanella piezotolerans WP3 have previously been identified to mediate DMSO reduction under in situ conditions (4°C/20 MPa). Here, we report that the two DMSO
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kreuzer, Helen W.; Hill, Eric A.; Moran, James J.
2014-03-01
Shewanella oneidensis MR-1 encodes both a [NiFe]- and an [FeFe]-hydrogenase. While the output of these proteins has been characterized in mutant strains expressing only one of the enzymes, the contribution of each to H2 synthesis in the wild-type organism is not clear. Here we use stable isotope analysis of H2 in the culture headspace, along with transcription data and measurements of the concentrations of gases in the headspace, to characterize H2 production in the wild-type strain. After most of the O2 in the headspace had been consumed, H2 was produced and then consumed by the bidirectional [NiFe]-hydrogenase. Once the culturesmore » were completely anaerobic, a new burst of H2 synthesis catalyzed by both enzymes took place. Our data is consistent with the hypothesis that at this point in the culture cycle, a pool of electrons is shunted toward both hydrogenases in the wild-type organism, but that in the absence of one of the hydrogenases, the flux is redirected to the available enzyme. To our knowledge, this is the first use of stable isotope analysis of a metabolic product to elucidate substrate flux through two alternative enzymes in the same cellular system.« less
NASA Astrophysics Data System (ADS)
Ruebush, Shane S.; Icopini, Gary A.; Brantley, Susan L.; Tien, Ming
2006-01-01
This study documents the first example of in vitro solid-phase mineral oxide reduction by enzyme-containing membrane fractions. Previous in vitro studies have only reported the reduction of aqueous ions. Total membrane (TM) fractions from iron-grown cultures of Shewanella oneidensis MR-1 were isolated and shown to catalyze the reduction of goethite, hematite, birnessite, and ramsdellite/pyrolusite using formate. In contrast, nicotinamide adenine dinucleotide (NADH) and succinate cannot function as electron donors. The significant implications of observations related to this cell-free system are: (i) both iron and manganese mineral oxides are reduced by the TM fraction, but aqueous U(VI) is not; (ii) TM fractions from anaerobically grown, but not aerobically grown, cells can reduce the mineral oxides; (iii) electron shuttles and iron chelators are not needed for this in vitro reduction, documenting conclusively that reduction can occur by direct contact with the mineral oxide; (iv) electron shuttles and EDTA stimulate the in vitro Fe(III) reduction, documenting that exogenous molecules can enhance rates of enzymatic mineral reduction; and (v) multiple membrane components are involved in solid-phase oxide reduction. The membrane fractions, consisting of liposomes of cytoplasmic and outer membrane segments, contain at least 100 proteins including the enzyme that oxidizes formate, formate dehydrogenase. Mineral oxide reduction was inhibited by the addition of detergent Triton X-100, which solubilizes membranes and their associated proteins, consistent with the involvement of multiple electron carriers that are disrupted by detergent addition. In contrast, formate dehydrogenase activity was not inhibited by Triton X-100. The addition of anthraquinone-2,6-disulfonate (AQDS) and menaquinone-4 was unable to restore activity; however, menadione (MD) restored 33% of the activity. The addition of AQDS and MD to reactions without added detergent increased the rate of goethite
DOE Office of Scientific and Technical Information (OSTI.GOV)
Liu, Juan; Pearce, Carolyn I.; Shi, Liang
The cycling of iron at the Earth’s near surface is profoundly influenced by dissimilatory metal reducing microorganisms, and many studies have focused on unraveling electron transfer mechanisms between these bacteria and Fe(III)-(oxyhydr)oxides. However, these efforts have been complicated by the fact that these minerals often occur in the micro- to nanosize regime, and in relevant natural environments as well as in the laboratory are subject to aggregation. The nature of the physical interface between the cellular envelope, the outer-membrane cytochromes responsible for facilitating the interfacial electron transfer step, and these complex mineral particulates is thus difficult to probe. Previous studiesmore » using whole cells have reported reduction rates that do not correlate with particle size. In the present study we isolate the interaction between the decaheme outer-membrane cytochrome OmcA of Shewanella oneidensis and nanoparticulate hematite, examining the reduction rate as a function of particle size and reaction products through detailed characterization of the electron balance and the structure and valence of iron at particle surfaces. By comparison with abiotic reduction via the smaller molecule ascorbic acid, we show that the reduction rate is systematically controlled by the sterically accessible interfacial contact area between OmcA and hematite in particle aggregates; rates increase once pore throat sizes in aggregates become as large as OmcA. Simultaneous measure of OmcA oxidation against Fe(II) release shows a ratio of 1:10, consistent with a cascade OmcA oxidation mechanism heme by heme. X-ray absorption spectroscopies reveal incipient magnetite on the reacted surfaces of the hematite nanoparticles after reaction. The collective findings establish the importance of accessibility of physical contact between the terminal reductases and iron oxide surfaces, and through apparent consistency of observations help reconcile behavior reported at the
NASA Astrophysics Data System (ADS)
Liu, Juan; Pearce, Carolyn I.; Shi, Liang; Wang, Zheming; Shi, Zhi; Arenholz, Elke; Rosso, Kevin M.
2016-11-01
The cycling of iron at the Earth's near surface is profoundly influenced by dissimilatory metal reducing microorganisms, and many studies have focused on unraveling electron transfer mechanisms between these bacteria and Fe(III)-(oxyhydr)oxides. However, these efforts have been complicated by the fact that these minerals often occur in the micro- to nanosize regime, and in relevant natural environments as well as in the laboratory are subject to aggregation. The nature of the physical interface between the cellular envelope, the outer-membrane cytochromes responsible for facilitating the interfacial electron transfer step, and these complex mineral particulates is thus difficult to probe. Previous studies using whole cells have reported reduction rates that do not correlate with particle size. In the present study we isolate the interaction between the decaheme outer-membrane cytochrome OmcA of Shewanella oneidensis and nanoparticulate hematite, examining the reduction rate as a function of particle size and reaction products through detailed characterization of the electron balance and the structure and valence of iron at particle surfaces. By comparison with abiotic reduction via the smaller molecule ascorbic acid, we show that the reduction rate is systematically controlled by the sterically accessible interfacial contact area between OmcA and hematite in particle aggregates; rates increase once pore throat sizes in aggregates become as large as OmcA. Simultaneous measure of OmcA oxidation against Fe(II) release shows a ratio of 1:10, consistent with a cascade OmcA oxidation mechanism heme by heme. X-ray absorption spectroscopies reveal incipient magnetite on the reacted surfaces of the hematite nanoparticles after reaction. The collective findings establish the importance of accessibility of physical contact between the terminal reductases and iron oxide surfaces, and through apparent consistency of observations help reconcile behavior reported at the larger
Fonnesbech Vogel, Birte; Venkateswaran, Kasthuri; Satomi, Masataka; Gram, Lone
2005-11-01
Shewanella putrefaciens has been considered the main spoilage bacteria of low-temperature stored marine seafood. However, psychrotropic Shewanella have been reclassified during recent years, and the purpose of the present study was to determine whether any of the new Shewanella species are important in fish spoilage. More than 500 H2S-producing strains were isolated from iced stored marine fish (cod, plaice, and flounder) caught in the Baltic Sea during winter or summer time. All strains were identified as Shewanella species by phenotypic tests. Different Shewanella species were present on newly caught fish. During the warm summer months the mesophilic human pathogenic S. algae dominated the H2S-producing bacterial population. After iced storage, a shift in the Shewanella species was found, and most of the H2S-producing strains were identified as S. baltica. The 16S rRNA gene sequence analysis confirmed the identification of these two major groups. Several isolates could only be identified to the genus Shewanella level and were separated into two subgroups with low (44%) and high (47%) G+C mol%. The low G+C% group was isolated during winter months, whereas the high G+C% group was isolated on fish caught during summer and only during the first few days of iced storage. Phenotypically, these strains were different from the type strains of S. putrefaciens, S. oneidensis, S. colwelliana, and S. affinis, but the high G+C% group clustered close to S. colwelliana by 16S rRNA gene sequence comparison. The low G+C% group may constitute a new species. S. baltica, and the low G+C% group of Shewanella spp. strains grew well in cod juice at 0 degrees C, but three high G+C Shewanella spp. were unable to grow at 0 degrees C. In conclusion, the spoilage reactions of iced Danish marine fish remain unchanged (i.e., trimethylamine-N-oxide reduction and H2S production); however, the main H2S-producing organism was identified as S. baltica.
Konishi, Yasuhiro; Tsukiyama, Takeshi; Saitoh, Norizoh; Nomura, Toshiyuki; Nagamine, Shinsuke; Takahashi, Yoshio; Uruga, Tomoya
2007-06-01
X-ray absorption near-edge structure spectroscopy (XANES) was successfully employed to determine the gold valence in the metal-reducing bacterium Shewanella algae after exposure to a 1 mM aqueous HAuCl4 solution for 10-120 min. XANES spectra revealed the oxidation state of gold in the bacterial cells to be Au(0) without any contribution from Au(III), demonstrating that S. algae cells can reduce AuCl4- ions to elemental gold. Transmission electron microscopy (TEM) and energy dispersive X-ray (EDX) analysis confirmed that gold nanoparticles 5-15 nm in size were deposited in the periplasmic space of the bacterial cells; a preferable, cell surface location for the easy recovery of biogenic nanoparticles.
Wu, Bing; Shao, Hongbo; Wang, Zhipeng; Hu, Yandi; Tang, Yinjie J; Jun, Young-Shin
2010-12-01
To study potential ecological impacts of CO(2) leakage to shallow groundwater and soil/sediments from geologic CO(2) sequestration (GCS) sites, this work investigated the viability and metal reduction of Shewanella oneidensis MR-1 under CO(2) stress. While MR-1 could grow under high-pressure nitrogen gas (500 psi), the mix of 1% CO(2) with N(2) at total pressures of 15 or 150 psi significantly suppressed the growth of MR-1, compared to the N(2) control. When CO(2) partial pressures were over 15 psi, the growth of MR-1 stopped. The reduced bacterial viability was consistent with the pH decrease and cellular membrane damage under high pressure CO(2). After exposure to 150 psi CO(2) for 5 h, no viable cells survived, the cellular contents were released, and microscopy images confirmed significant cell structure deformation. However, after a relatively short exposure (25 min) to 150 psi CO(2), MR-1 could fully recover their growth within 24 h after the stress was removed, and the reduction of MnO(2) by MR-1 was observed right after the stress was removed. Furthermore, MR-1 survived better if the cells were aggregated rather than suspended, or if pH buffering minerals, such as calcite, were present. To predict the cell viability under different CO(2) pressures and exposure times, a two-parameter mathematical model was developed.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Trindade, Inês B.; Fonseca, Bruno M.; Matias, Pedro M.
The gene encoding a putative siderophore-interacting protein from the marine bacterium S. frigidimarina was successfully cloned, followed by expression and purification of the gene product. Optimized crystals diffracted to 1.35 Å resolution and preliminary crystallographic analysis is promising with respect to structure determination and increased insight into the poorly understood molecular mechanisms underlying iron acquisition. Siderophore-binding proteins (SIPs) perform a key role in iron acquisition in multiple organisms. In the genome of the marine bacterium Shewanella frigidimarina NCIMB 400, the gene tagged as SFRI-RS12295 encodes a protein from this family. Here, the cloning, expression, purification and crystallization of this proteinmore » are reported, together with its preliminary X-ray crystallographic analysis to 1.35 Å resolution. The SIP crystals belonged to the monoclinic space group P2{sub 1}, with unit-cell parameters a = 48.04, b = 78.31, c = 67.71 Å, α = 90, β = 99.94, γ = 90°, and are predicted to contain two molecules per asymmetric unit. Structure determination by molecular replacement and the use of previously determined ∼2 Å resolution SIP structures with ∼30% sequence identity as templates are ongoing.« less
Wu, Gang; Liu, Wen; Berka, Vladimir; Tsai, Ah-Lim
2017-09-01
To delineate the commonalities and differences in gaseous ligand discrimination among the heme-based sensors with Heme Nitric oxide/OXygen binding protein (H-NOX) scaffold, the binding kinetic parameters for gaseous ligands NO, CO, and O 2 , including K D , k on , and k off , of Shewanella oneidensis H-NOX (So H-NOX) were characterized in detail in this study and compared to those of previously characterized H-NOXs from Clostridium botulinum (Cb H-NOX), Nostoc sp. (Ns H-NOX), Thermoanaerobacter tengcongensis (Tt H-NOX), Vibrio cholera (Vc H-NOX), and human soluble guanylyl cyclase (sGC), an H-NOX analogue. The K D (NO) and K D (CO) of each bacterial H-NOX or sGC follow the "sliding scale rule"; the affinities of the bacterial H-NOXs for NO and CO vary in a small range but stronger than those of sGC by at least two orders of magnitude. On the other hand, each bacterial H-NOX exhibits different characters in the stability of its 6c NO complex, reactivity with secondary NO, stability of oxyferrous heme and autoxidation to ferric heme. A facile access channel for gaseous ligands is also identified, implying that ligand access has only minimal effect on gaseous ligand selectivity of H-NOXs or sGC. This comparative study of the binding parameters of the bacterial H-NOXs and sGC provides a basis to guide future new structural and functional studies of each specific heme sensor with the H-NOX protein fold. Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.
Trindade, Inês B.; Fonseca, Bruno M.; Matias, Pedro M.; Louro, Ricardo O.; Moe, Elin
2016-01-01
Siderophore-binding proteins (SIPs) perform a key role in iron acquisition in multiple organisms. In the genome of the marine bacterium Shewanella frigidimarina NCIMB 400, the gene tagged as SFRI_RS12295 encodes a protein from this family. Here, the cloning, expression, purification and crystallization of this protein are reported, together with its preliminary X-ray crystallographic analysis to 1.35 Å resolution. The SIP crystals belonged to the monoclinic space group P21, with unit-cell parameters a = 48.04, b = 78.31, c = 67.71 Å, α = 90, β = 99.94, γ = 90°, and are predicted to contain two molecules per asymmetric unit. Structure determination by molecular replacement and the use of previously determined ∼2 Å resolution SIP structures with ∼30% sequence identity as templates are ongoing. PMID:27599855
NASA Astrophysics Data System (ADS)
Rachanamol, R. S.; Lipton, A. P.; Thankamani, V.; Sarika, A. R.; Selvin, J.
2014-06-01
The pigmented, rod-shaped, Gram-negative, motile bacteria isolated from marine sponge Callyspongia diffusa exhibiting bioactivity was characterized as Shewanella algae (GenBank: KC623651). The 16S rRNA gene sequence-based phylogenetic analysis showed its similarity with the member of Shewanella and placed in a separate cluster with the recognized bacteria S. algae (PSB-05 FJ86678) with which it showed 99.0 % sequence similarity. Growth of the strain was optimum at temperature 30 °C, pH 8.0 in the presence of 2.0-4.0 % of NaCl. High antibiotic activity against microbes such as Escherichia coli (MTCC 40), S. typhii (MTCC 98), P. vulgaris (MTCC 426), V. fluvialis, V. anguillarum, E. cloacae, and L. lactis was recorded. The growth of fungal pathogens such as Aspergillus niger, Aspergillus fumigatus, Saccharomyces cerevisiae, and Colletotrichum gloeosporioides was effectively controlled.
Wang, Yan; Chen, Hongli; Liu, Zhenhua; Ming, Hong; Zhou, Chenyan; Zhu, Xinshu; Zhang, Peng; Jing, Changqin; Feng, Huigen
2016-08-01
A novel Gram-stain-negative, straight or slightly curved rod-shaped, non-spore-forming, facultatively anaerobic bacterium with a single polar flagellum, designated RZB5-4T, was isolated from a sample of the red algae Gelidium amansii collected from the coastal region of Rizhao, PR China (119.625° E 35.517° N). The organism grew optimally between 24 and 28 °C, at pH 7.0 and in the presence of 2-3 % (w/v) NaCl. The strain required seawater or artificial seawater for growth, and NaCl alone did not support growth. Strain RZB5-4T contained C16 : 1ω7c and/or C16 : 1ω6c, C16 : 0 and iso-C15 : 0 as the dominant fatty acids. The respiratory quinones detected in strain RZB5-4T were ubiquinone 7, ubiquinone 8, menaquinone 7 and methylmenaquinone 7. The polar lipids of strain RZB5-4T comprised phosphatidylethanolamine, phosphatidylglycerol, phosphatidylmonomethylethanolamine, one unidentified glycolipid, one unidentified phospholipid and one unknown lipid. The DNA G+C content of strain RZB5-4T was 47 mol %. Phylogenetic analysis based on 16S rRNA and gyrase B (gyrB) gene sequences showed that strain RZB5-4T belonged to the genus Shewanella, clustering with Shewanella waksmanii ATCC BAA-643T. Strain RZB5-4T exhibited the highest 16S rRNA gene sequence similarity value (96.6 %) and the highest gyrB gene sequence similarity value (80.7 %), respectively, to S. waksmanii ATCC BAA-643T. On the basis of polyphasic analyses, strain RZB5-4T represents a novel species of the genus Shewanella, for which the name Shewanella gelidii sp. nov. is proposed. The type strain is RZB5-4T (=JCM 30804T=KCTC 42663T=MCCC 1K00697T).
Adhesion and formation of microbial biofilms in complex microfluidic devices
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kumar, Aloke; Karig, David K; Neethirajan, Suresh
2012-01-01
Shewanella oneidensis is a metal reducing bacterium, which is of interest for bioremediation and clean energy applications. S. oneidensis biofilms play a critical role in several situations such as in microbial energy harvesting devices. Here, we use a microfluidic device to quantify the effects of hydrodynamics on the biofilm morphology of S. oneidensis. For different rates of fluid flow through a complex microfluidic device, we studied the spatiotemporal dynamics of biofilms, and we quantified several morphological features such as spatial distribution, cluster formation and surface coverage. We found that hydrodynamics resulted in significant differences in biofilm dynamics. The baffles inmore » the device created regions of low and high flow in the same device. At higher flow rates, a nonuniform biofilm develops, due to unequal advection in different regions of the microchannel. However, at lower flow rates, a more uniform biofilm evolved. This depicts competition between adhesion events, growth and fluid advection. Atomic force microscopy (AFM) revealed that higher production of extra-cellular polymeric substances (EPS) occurred at higher flow velocities.« less
Sivolodsky, E P
2015-01-01
Development of a selective-differential nutrient medium for isolation of Shewanella genus bacteria. 73 strains of Shewanella bacteria (S. algae--3, S. baltica--26, S. putrefaciens--44) and 80 strains of 22 other bacteria genera were used. Shewanella species were identified by methods and criteria proposed by Nozue H. et al., 1992; Khashe S. et al., 1998. Nutrient media "Shewanella IRHLS Agar" for shewanella isolation was developed. Medium selective factors: irgazan DP-300 (I). 0.14-0.2 g/l and rifampicin (R) 0.0005-0.001 g/l. Shevanella colonies were detected by the production of hydrogen sulfide (H), lipase presence (L), lack of sorbitol fermentation (S). The medium suppressed the growth of hydrogen sulfide producers (Salmonella, Proteus) and blocked hydrogen sulfide production by Citrobacter. Growth of Escherichia, Enterobacter, Klebsiella, Shigella, Staphylococcus, Bacillus was also suppressed, Analytical sensitivity of the medium was 1-2 CFU/ml for Shewanella and Stenotrophomonas, Aerombnas, Serratia genera bacteria. 72 strains of Shewanella were isolated from water of Neva river in this medium, 91.7 ± 3.2% of those produced H2S. 1 strain of S. algae was isolated from clinical material. The developed media allows to use it in a complex for Stenotrophomo- nas sp., Aeromonas sp., Serratia sp., Citrobactersp. and Shewanella bacteria isolation.
Outer membrane cytochromes/flavin interactions in Shewanella spp.—A molecular perspective
Babanova, Sofia; Matanovic, Ivana; Cornejo, Jose; ...
2017-05-31
Extracellular electron transfer (EET) is intrinsically associated with the core phenomena of energy harvesting/energy conversion in natural ecosystems and biotechnology applications. But, the mechanisms associated with EET are complex and involve molecular interactions that take place at the “bionano interface” where biotic/abiotic interactions are usually explored. Our work provides molecular perspective on the electron transfer mechanism(s) employed by Shewanella oneidensis MR-1. Molecular docking simulations were used to explain the interfacial relationships between two outer-membrane cytochromes (OMC) OmcA and MtrC and riboflavin (RF) and flavin mononucleotide (FMN), respectively. OMC-flavin interactions were analyzed by studying the electrostatic potential, the hydrophilic/hydrophobic surface properties,more » and the van der Waals surface of the OMC proteins. As a result, it was proposed that the interactions between flavins and OMCs are based on geometrical recognition event. The possible docking positions of RF and FMN to OmcA and MtrC were also shown.« less
Pessanha, Miguel; Louro, Ricardo O; Correia, Ilídio J; Rothery, Emma L; Pankhurst, Kate L; Reid, Graeme A; Chapman, Stephen K; Turner, David L; Salgueiro, Carlos A
2003-01-01
The facultative aerobic bacterium Shewanella frigidimarina produces a small c-type tetrahaem cytochrome (86 residues) under anaerobic growth conditions. This protein is involved in the respiration of iron and shares 42% sequence identity with the N-terminal domain of a soluble flavocytochrome, isolated from the periplasm of the same bacterium, which also contains four c -type haem groups. The thermodynamic properties of the redox centres and of an ionizable centre in the tetrahaem cytochrome were determined using NMR and visible spectroscopy techniques. This is the first detailed thermodynamic study performed on a tetrahaem cytochrome isolated from a facultative aerobic bacterium and reveals that this protein presents unique features. The redox centres have negative and different redox potentials, which are modulated by redox interactions between the four haems (covering a range of 8-56 mV) and by redox-Bohr interactions between the haems and an ionizable centre (-4 to -36 mV) located in close proximity to haem III. All of the interactions between the five centres are clearly dominated by electrostatic effects and the microscopic reduction potential of haem III is the one most affected by the oxidation of the other haems and by the protonation state of the molecule. Altogether, this study indicates that the tetrahaem cytochrome isolated from S. frigidimarina (Sfc) has the thermodynamic properties to work as an electron wire between its redox partners. Considering the high degree of sequence identity between Sfc and the cytochrome domain of flavocytochrome c(3), the structural similarities of the haem core, and that the macroscopic potentials are also identical, the results obtained in this work are rationalized in order to put forward a putative redox model for flavocytochrome c(3). PMID:12413396
DOE Office of Scientific and Technical Information (OSTI.GOV)
Watrous, Jeramie D.; Roach, Patrick J.; Heath, Brandi S.
2013-11-05
Understanding molecular interaction pathways in complex biological systems constitutes a treasure trove of knowledge that might facilitate the specific, chemical manipulation of the countless microbiological systems that occur throughout our world. However, there is a lack of methodologies that allow the direct investigation of chemical gradients and interactions in living biological systems, in real time. Here, we report the use of nanospray desorption electrospray ionization (nanoDESI) imaging mass spectrometry for in vivo metabolic profiling of living bacterial colonies directly from the Petri dish with absolutely no sample preparation needed. Using this technique, we investigated single colonies of Shewanella oneidensis MR-1,more » Bacillus subtilis 3610, and Streptomyces coelicolor A3(2) as well as a mixed biofilm of S. oneidensis MR-1 and B. subtilis 3610. Data from B. subtilis 3610 and S. coelicolor A3(2) provided a means of validation for the method while data from S. oneidensis MR-1 and the mixed biofilm showed a wide range of compounds that this bacterium uses for the dissimilatory reduction of extracellular metal oxides, including riboflavin, iron-bound heme and heme biosynthetic intermediates, and the siderophore putrebactin.« less
Accumulation of Mn(II) in Deinococcus radiodurans Facilitates Gamma-Radiation Resistance
DOE Office of Scientific and Technical Information (OSTI.GOV)
Daly, Michael J.; Gaidamakova, E; Matrosova, V
2004-11-05
Deinococcus radiodurans is extremely resistant to ionizing radiation. How this bacterium can grow under chronic gamma-radiation (50 Gy/hour) or recover from acute doses greater than 10 kGy is unknown. We show that D. radiodurans accumulates very high intracellular manganese and low iron levels compared to radiation sensitive bacteria, and resistance exhibits a concentration-dependent response to Mn(II). Among the most radiation-resistant bacterial groups reported, Deinococcus, Enterococcus, Lactobacillus and cyanobacteria spp. accumulate Mn(II). In contrast, Shewanella oneidensis and Pseudomonas putida have high Fe but low intracellular Mn concentrations and are very sensitive. We propose that Mn(II) accumulation facilitates recovery from radiation injury.
Aigle, Axel; Bonin, Patricia; Iobbi-Nivol, Chantal; Méjean, Vincent; Michotey, Valérie
2017-03-20
To explain anaerobic nitrite/nitrate production at the expense of ammonium mediated by manganese oxide (Mn(IV)) in sediment, nitrate and manganese respirations were investigated in a strain (Shewanella algae C6G3) presenting these features. In contrast to S. oneidensis MR-1, a biotic transitory nitrite accumulation at the expense of ammonium was observed in S. algae during anaerobic growth with Mn(IV) under condition of limiting electron acceptor, concomitantly, with a higher electron donor stoichiometry than expected. This low and reproducible transitory accumulation is the result of production and consumption since the strain is able to dissimilative reduce nitrate into ammonium. Nitrite production in Mn(IV) condition is strengthened by comparative expression of the nitrate/nitrite reductase genes (napA, nrfA, nrfA-2), and rates of the nitrate/nitrite reductase activities under Mn(IV), nitrate or fumarate conditions. Compared with S. oneidensis MR-1, S. algae contains additional genes that encode nitrate and nitrite reductases (napA-α and nrfA-2) and an Outer Membrane Cytochrome (OMC)(mtrH). Different patterns of expression of the OMC genes (omcA, mtrF, mtrH and mtrC) were observed depending on the electron acceptor and growth phase. Only gene mtrF-2 (SO1659 homolog) was specifically expressed under the Mn(IV) condition. Nitrate and Mn(IV) respirations seem connected at the physiological and transcriptional levels.
NASA Astrophysics Data System (ADS)
Aigle, Axel; Bonin, Patricia; Iobbi-Nivol, Chantal; Méjean, Vincent; Michotey, Valérie
2017-03-01
To explain anaerobic nitrite/nitrate production at the expense of ammonium mediated by manganese oxide (Mn(IV)) in sediment, nitrate and manganese respirations were investigated in a strain (Shewanella algae C6G3) presenting these features. In contrast to S. oneidensis MR-1, a biotic transitory nitrite accumulation at the expense of ammonium was observed in S. algae during anaerobic growth with Mn(IV) under condition of limiting electron acceptor, concomitantly, with a higher electron donor stoichiometry than expected. This low and reproducible transitory accumulation is the result of production and consumption since the strain is able to dissimilative reduce nitrate into ammonium. Nitrite production in Mn(IV) condition is strengthened by comparative expression of the nitrate/nitrite reductase genes (napA, nrfA, nrfA-2), and rates of the nitrate/nitrite reductase activities under Mn(IV), nitrate or fumarate conditions. Compared with S. oneidensis MR-1, S. algae contains additional genes that encode nitrate and nitrite reductases (napA-α and nrfA-2) and an Outer Membrane Cytochrome (OMC)(mtrH). Different patterns of expression of the OMC genes (omcA, mtrF, mtrH and mtrC) were observed depending on the electron acceptor and growth phase. Only gene mtrF-2 (SO1659 homolog) was specifically expressed under the Mn(IV) condition. Nitrate and Mn(IV) respirations seem connected at the physiological and transcriptional levels.
Physiological and Growth Characteristics of Shewanella Species
2016-05-01
AFCEC-CX-TY-TR-2016-0016 PHYSIOLOGICAL AND GROWTH CHARACTERISTICS OF SHEWANELLA SPECIES Karen Farrington, D. Matthew Eby, Susan Sizemore...Technical Report 01 March 2012 - 01 March 2014 Physiological and growth characteristics of Shewanella species FA4819-11-C-0003 Karen Farrington (1...unconventional operating temperatures. Secondly, the unusual growth characteristics of another Shewanella sp., Shewanella japonica, were investigated
Biogenic formation of photoactive arsenic-sulfide nanotubes by Shewanella sp. strain HN-41
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lee, Ji-Hoon; Kim, Min-Gyu; Yoo, Bongyoung
2007-12-18
Microorganisms facilitate the formation of a wide range of minerals that have unique physical and chemical properties as well as morphologies that are not produced by abiotic processes. Here, we report the production of an extensive extracellular network of filamentous, arsenic-sulfide (As-S) nanotubes (20–100 nm in diameter by 30 µm in length) by the dissimilatory metal-reducing bacterium Shewanella sp. HN-41. The As-S nanotubes, formed via the reduction of As(V) and S2O, were initially amorphous As2S3 but evolved with increasing incubation time toward polycrystalline phases of the chalcogenide minerals realgar (AsS) and duranusite (As4S). Upon maturation, the As-S nanotubes behaved asmore » metals and semiconductors in terms of their electrical and photoconductive properties, respectively. The As-S nanotubes produced by Shewanella may provide useful materials for novel nano- and opto-electronic devices.« less
Integrated genome-based studies of Shewanella Ecophysiology
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tiedje, James M.; Konstantinidis, Kostas; Worden, Mark
2014-01-08
The aim of the work reported is to study Shewanella population genomics, and to understand the evolution, ecophysiology, and speciation of Shewanella. The tasks supporting this aim are: to study genetic and ecophysiological bases defining the core and diversification of Shewanella species; to determine gene content patterns along redox gradients; and to Investigate the evolutionary processes, patterns and mechanisms of Shewanella.
Zhou, Guangqi; Yin, Jianhua; Chen, Haijiang; Hua, Yijie; Sun, Linlin; Gao, Haichun
2013-09-01
Shewanella species are a group of facultative Gram-negative microorganisms with remarkable respiration abilities that allow the use of a diverse array of terminal electron acceptors (EA). Like most bacteria, S. oneidensis possesses multiple terminal oxidases, including two heme-copper oxidases (caa3- and cbb3-type) and a bd-type quinol oxidase. As aerobic respiration is energetically favored, mechanisms underlying the fact that these microorganisms thrive in redox-stratified environments remain vastly unexplored. In this work, we discovered that the cbb3-type oxidase is the predominant system for respiration of oxygen (O2), especially when O2 is abundant. Under microaerobic conditions, the bd-type quinol oxidase has a significant role in addition to the cbb3-type oxidase. In contrast, multiple lines of evidence suggest that under test conditions the caa3-type oxidase, an analog to the mitochondrial enzyme, has no physiological significance, likely because of its extremely low expression. In addition, expression of both cbb3- and bd-type oxidases is under direct control of Crp (cAMP receptor protein) but not the well-established redox regulator Fnr (fumarate nitrate regulator) of canonical systems typified in Escherichia coli. These data, collectively, suggest that adaptation of S. oneidensis to redox-stratified environments is likely due to functional loss of the caa3-type oxidase and switch of the regulatory system for respiration.
Rapid electron exchange between surface-exposed bacterial cytochromes and Fe(III) minerals
White, Gaye F.; Shi, Zhi; Shi, Liang; Wang, Zheming; Dohnalkova, Alice C.; Marshall, Matthew J.; Fredrickson, James K.; Zachara, John M.; Butt, Julea N.; Richardson, David J.; Clarke, Thomas A.
2013-01-01
The mineral-respiring bacterium Shewanella oneidensis uses a protein complex, MtrCAB, composed of two decaheme cytochromes, MtrC and MtrA, brought together inside a transmembrane porin, MtrB, to transport electrons across the outer membrane to a variety of mineral-based electron acceptors. A proteoliposome system containing a pool of internalized electron carriers was used to investigate how the topology of the MtrCAB complex relates to its ability to transport electrons across a lipid bilayer to externally located Fe(III) oxides. With MtrA facing the interior and MtrC exposed on the outer surface of the phospholipid bilayer, the established in vivo orientation, electron transfer from the interior electron carrier pool through MtrCAB to solid-phase Fe(III) oxides was demonstrated. The rates were 103 times higher than those reported for reduction of goethite, hematite, and lepidocrocite by S. oneidensis, and the order of the reaction rates was consistent with those observed in S. oneidensis cultures. In contrast, established rates for single turnover reactions between purified MtrC and Fe(III) oxides were 103 times lower. By providing a continuous flow of electrons, the proteoliposome experiments demonstrate that conduction through MtrCAB directly to Fe(III) oxides is sufficient to support in vivo, anaerobic, solid-phase iron respiration. PMID:23538304
Sato, Hiroshi; Nakasone, Kaoru; Yoshida, Takao; Kato, Chiaki; Maruyama, Tadashi
2015-07-01
When non-extremophiles encounter extreme environmental conditions, which are natural for the extremophiles, stress reactions, e.g., expression of heat shock proteins (HSPs), are thought to be induced for survival. To understand how the extremophiles live in such extreme environments, we studied the effects of high hydrostatic pressure on cellular contents of HSPs and their mRNAs during growth in a piezophilic bacterium, Shewanella violacea. HSPs increased at high hydrostatic pressures even when optimal for growth. The mRNAs and proteins of these HSPs significantly increased at higher hydrostatic pressure in S. violacea. In the non-piezophilic Escherichia coli, however, their mRNAs decreased, while their proteins did not change. Several transcriptional start sites (TSSs) for HSP genes were determined by the primer extension method and some of them showed hydrostatic pressure-dependent increase of the mRNAs. A major refolding target of one of the HSPs, chaperonin, at high hydrostatic pressure was shown to be RplB, a subunit of the 50S ribosome. These results suggested that in S. violacea, HSPs play essential roles, e.g., maintaining protein complex machinery including ribosomes, in the growth and viability at high hydrostatic pressure, and that, in their expression, the transcription is under the control of σ(32).
In Situ Characterization of Shewanella oneidensis MR1 Biofilms by SALVI and ToF-SIMS
DOE Office of Scientific and Technical Information (OSTI.GOV)
Komorek, Rachel; Wei, Wenchao; Yu, Xiaofei
Bacterial biofilms are surface-associated communities that are vastly studied to understand their self-produced extracellular polymeric substances (EPS) and their roles in environmental microbiology. This study outlines a method to cultivate biofilm attachment to the System for Analysis at the Liquid Vacuum Interface (SALVI) and achieve in situ chemical mapping of a living biofilm by time-of-flight secondary ion mass spectrometry (ToF-SIMS). This is done through the culturing of bacteria both outside and within the SALVI channel with our specialized setup, as well as through optical imaging techniques to detect the biofilm presence and thickness before ToF-SIMS analysis. Our results show themore » characteristic peaks of the Shewanella biofilm in its natural hydrated state, highlighting upon its localized water cluster environment, as well as EPS fragments, which are drastically different from the same biofilm’s dehydrated state. These results demonstrate the breakthrough capability of SALVI that allows for in situ biofilm imaging with a vacuum-based chemical imaging instrument.« less
Aigle, Axel; Bonin, Patricia; Iobbi-Nivol, Chantal; Méjean, Vincent; Michotey, Valérie
2017-01-01
To explain anaerobic nitrite/nitrate production at the expense of ammonium mediated by manganese oxide (Mn(IV)) in sediment, nitrate and manganese respirations were investigated in a strain (Shewanella algae C6G3) presenting these features. In contrast to S. oneidensis MR-1, a biotic transitory nitrite accumulation at the expense of ammonium was observed in S. algae during anaerobic growth with Mn(IV) under condition of limiting electron acceptor, concomitantly, with a higher electron donor stoichiometry than expected. This low and reproducible transitory accumulation is the result of production and consumption since the strain is able to dissimilative reduce nitrate into ammonium. Nitrite production in Mn(IV) condition is strengthened by comparative expression of the nitrate/nitrite reductase genes (napA, nrfA, nrfA-2), and rates of the nitrate/nitrite reductase activities under Mn(IV), nitrate or fumarate conditions. Compared with S. oneidensis MR-1, S. algae contains additional genes that encode nitrate and nitrite reductases (napA-α and nrfA-2) and an Outer Membrane Cytochrome (OMC)(mtrH). Different patterns of expression of the OMC genes (omcA, mtrF, mtrH and mtrC) were observed depending on the electron acceptor and growth phase. Only gene mtrF-2 (SO1659 homolog) was specifically expressed under the Mn(IV) condition. Nitrate and Mn(IV) respirations seem connected at the physiological and transcriptional levels. PMID:28317859
Stoichiometry of mercury-thiol complexes on bacterial cell envelopes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mishra, Bhoopesh; Shoenfelt, Elizabeth; Yu, Qiang
We have examined the speciation of Hg(II) complexed with intact cell suspensions (1013 cells L- 1) of Bacillus subtilis, a common gram-positive soil bacterium, Shewanella oneidensis MR-1, a facultative gram-negative aquatic organism, and Geobacter sulfurreducens, a gram-negative anaerobic bacterium capable of Hg-methylation at Hg(II) loadings spanning four orders of magnitude (120 nM to 350 μM) at pH 5.5 (± 0.2). The coordination environments of Hg on bacterial cells were analyzed using synchrotron based X-ray Absorption Near Edge Structure (XANES) and Extended X-ray Absorption Fine Structure (EXAFS) spectroscopy at the Hg LIII edge. The abundance of thiols on intact cells wasmore » determined by a fluorescence-spectroscopy based method using a soluble bromobimane, monobromo(trimethylammonio)bimane (qBBr) to block thiol sites, and potentiometric titrations of biomass with and without qBBr treatment. The chemical forms of S on intact bacterial cells were determined using S k-edge XANES spectroscopy.« less
Rajeev, Pournami; Jain, Abhiney; Pirbadian, Sahand; Okamoto, Akihiro; Gralnick, Jeffrey A.; El-Naggar, Mohamed Y.; Nealson, Kenneth H.
2018-01-01
ABSTRACT While typically investigated as a microorganism capable of extracellular electron transfer to minerals or anodes, Shewanella oneidensis MR-1 can also facilitate electron flow from a cathode to terminal electron acceptors, such as fumarate or oxygen, thereby providing a model system for a process that has significant environmental and technological implications. This work demonstrates that cathodic electrons enter the electron transport chain of S. oneidensis when oxygen is used as the terminal electron acceptor. The effect of electron transport chain inhibitors suggested that a proton gradient is generated during cathode oxidation, consistent with the higher cellular ATP levels measured in cathode-respiring cells than in controls. Cathode oxidation also correlated with an increase in the cellular redox (NADH/FMNH2) pool determined with a bioluminescence assay, a proton uncoupler, and a mutant of proton-pumping NADH oxidase complex I. This work suggested that the generation of NADH/FMNH2 under cathodic conditions was linked to reverse electron flow mediated by complex I. A decrease in cathodic electron uptake was observed in various mutant strains, including those lacking the extracellular electron transfer components necessary for anodic-current generation. While no cell growth was observed under these conditions, here we show that cathode oxidation is linked to cellular energy acquisition, resulting in a quantifiable reduction in the cellular decay rate. This work highlights a potential mechanism for cell survival and/or persistence on cathodes, which might extend to environments where growth and division are severely limited. PMID:29487241
Cimmino, Teresa; Olaitan, Abiola Olumuyiwa; Rolain, Jean-Marc
2016-01-01
We characterize and decipher the resistome and the virulence factors of Shewanella algae MARS 14, a multidrug-resistant clinical strain using the whole genome sequencing (WGS) strategy. The bacteria were isolated from the bronchoalveolar lavage of a hospitalized patient in the Timone Hospital in Marseille, France who developed pneumonia after plunging into the Mediterranean Sea. The genome size of S. algae MARS 14 was 5,005,710 bp with 52.8% guanine cytosine content. The resistome includes members of class C and D beta-lactamases and numerous multidrug-efflux pumps. We also found the presence of several hemolysins genes, a complete flagellum system gene cluster and genes responsible for biofilm formation. Moreover, we reported for the first time in a clinical strain of Shewanella spp. the presence of a bacteriocin (marinocin). The WGS analysis of this pathogen provides insight into its virulence factors and resistance to antibiotics.
Conservation of Transcription Start Sites within Genes across a Bacterial Genus
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shao, Wenjun; Price, Morgan N.; Deutschbauer, Adam M.
Transcription start sites (TSSs) lying inside annotated genes, on the same or opposite strand, have been observed in diverse bacteria, but the function of these unexpected transcripts is unclear. Here, we use the metal-reducing bacterium Shewanella oneidensis MR-1 and its relatives to study the evolutionary conservation of unexpected TSSs. Using high-resolution tiling microarrays and 5'-end RNA sequencing, we identified 2,531 TSSs in S. oneidensis MR-1, of which 18% were located inside coding sequences (CDSs). Comparative transcriptome analysis with seven additional Shewanella species revealed that the majority (76%) of the TSSs within the upstream regions of annotated genes (gTSSs) were conserved.more » Thirty percent of the TSSs that were inside genes and on the sense strand (iTSSs) were also conserved. Sequence analysis around these iTSSs showed conserved promoter motifs, suggesting that many iTSS are under purifying selection. Furthermore, conserved iTSSs are enriched for regulatory motifs, suggesting that they are regulated, and they tend to eliminate polar effects, which confirms that they are functional. In contrast, the transcription of antisense TSSs located inside CDSs (aTSSs) was significantly less likely to be conserved (22%). However, aTSSs whose transcription was conserved often have conserved promoter motifs and drive the expression of nearby genes. Overall, our findings demonstrate that some internal TSSs are conserved and drive protein expression despite their unusual locations, but the majority are not conserved and may reflect noisy initiation of transcription rather than a biological function.« less
Castillo, Daniel; Gram, Lone; Dailey, Frank E
2018-06-21
We present here the genome sequences of Shewanella baltica strain CW2 and Shewanella morhuae strain CW7, isolated from the gastrointestinal tract of Salvelinus namaycush (lean lake trout) and Coregonus clupeaformis (whitefish), respectively. These genome sequences provide insights into the niche adaptation of these specific species in freshwater systems. Copyright © 2018 Castillo et al.
Structure of a bacterial cell surface decaheme electron conduit
USDA-ARS?s Scientific Manuscript database
Some bacterial species are able to utilize extracellular mineral forms of iron and manganese as respiratory electron acceptors. In Shewanella oneidensis this involves decaheme cytochromes that are located on the bacterial cell surface at the termini of trans-outer-membrane electron transfer conduits...
Activity-Based Screening of Metagenomic Libraries for Hydrogenase Enzymes.
Adam, Nicole; Perner, Mirjam
2017-01-01
Here we outline how to identify hydrogenase enzymes from metagenomic libraries through an activity-based screening approach. A metagenomic fosmid library is constructed in E. coli and the fosmids are transferred into a hydrogenase deletion mutant of Shewanella oneidensis (ΔhyaB) via triparental mating. If a fosmid exhibits hydrogen uptake activity, S. oneidensis' phenotype is restored and hydrogenase activity is indicated by a color change of the medium from yellow to colorless. This new method enables screening of 48 metagenomic fosmid clones in parallel.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Galeazzi, Luca; Bocci, Paolo; Amici, Adolfo
2011-09-27
The pyridine nucleotide cycle (PNC) is a network of salvage and recycling routes maintaining homeostasis of NAD(P) cofactor pool in the cell. Nicotinamide mononucleotide (NMN) deamidase (EC 3.5.1.42), one of the key enzymes of the bacterial PNC was originally described in Enterobacteria, but the corresponding gene eluded identification for over 30 years. A genomics-based reconstruction of NAD metabolism across hundreds bacterial species suggested that NMN deamidase reaction is the only possible way of nicotinamide salvage in the marine bacterium Shewanella oneidensis. This prediction was verified via purification of native NMN deamidase from S. oneidensis followed by the identification of themore » respective gene, termed pncC. Enzymatic characterization of the PncC protein, as well as phenotype analysis of deletion mutants, confirmed its proposed biochemical and physiological function in S. oneidensis. Of the three PncC homologs present in E. coli, NMN deamidase activity was confirmed only for the recombinant purified product of the ygaD gene. A comparative analysis at the level of sequence and three dimensional structure, which is available for one of the PncC family member, shows no homology with any previously described amidohydrolases. Multiple alignment analysis of functional and non functional PncC homologs, together with NMN docking experiments, allowed us to tentatively identify the active site area and conserved residues therein. An observed broad phylogenomic distribution of predicted functional PncCs in bacterial kingdom is consistent with a possible role in detoxification of NMN, resulting from NAD utilization by DNA ligase.« less
A new regulatory mechanism for bacterial lipoic acid synthesis
Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun
2015-01-01
Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID
A new regulatory mechanism for bacterial lipoic acid synthesis.
Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun
2015-01-22
Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. © 2015
Zhao, Jian-Shen; Manno, Dominic; Thiboutot, Sonia; Ampleman, Guy; Hawari, Jalal
2007-09-01
Two strains belonging to the genus Shewanella, HAW-EB2(T) and HAW-EB5(T), were isolated previously from marine sediment sampled from the Atlantic Ocean, near Halifax harbour in Canada, for their potential to degrade explosive hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX). In the present study, strains HAW-EB2(T) and HAW-EB5(T) were found to display high 16S rRNA gene sequence similarity (90-99.5 %) to species of Shewanella, but their gyrB sequences were significantly different from each other and from species of Shewanella (79-87.6 %). Furthermore, DNA-DNA hybridization showed that the genomic DNA of the two strains was only 22 % related and showed less than 41 % relatedness to closely related species of Shewanella. In comparison to other species of Shewanella, strains HAW-EB2(T) and HAW-EB5(T) were also unique in some phenotypic properties such as activities of beta-galactosidase and tyrosine arylamidase and the ability to metabolize certain organic acids and sugars. Both strains HAW-EB2(T) and HAW-EB5(T) utilize malate, valerate, peptone and yeast extract as sole carbon and energy sources. The major membrane fatty acids of the two strains were C(14 : 0), iso-C(15 : 0), C(16 : 0), C(16 : 1)omega7, C(18 : 1)omega7 and C(20 : 5)omega3 and their major quinones were Q-7, Q-8 and MK-7. On the basis of these results, strain HAW-EB2(T) (=NCIMB 14238(T) =CCUG 54553(T)) is proposed as the type strain of Shewanella canadensis sp. nov. and strain HAW-EB5(T) (=NCIMB 14239(T) =CCUG 54554(T)) is proposed as the type strain of Shewanella atlantica sp. nov.
Microbial Iron Respiration Can Protect Steel from Corrosion
Dubiel, M.; Hsu, C. H.; Chien, C. C.; Mansfeld, F.; Newman, D. K.
2002-01-01
Microbiologically influenced corrosion (MC) of steel has been attributed to the activity of biofilms that include anaerobic microorganisms such as iron-respiring bacteria, yet the mechanisms by which these organisms influence corrosion have been unclear. To study this process, we generated mutants of the iron-respiring bacterium Shewanella oneidensis strain MR-1 that were defective in biofilm formation and/or iron reduction. Electrochemical impedance spectroscopy was used to determine changes in the corrosion rate and corrosion potential as a function of time for these mutants in comparison to the wild type. Counter to prevailing theories of MC, our results indicate that biofilms comprising iron-respiring bacteria may reduce rather than accelerate the corrosion rate of steel. Corrosion inhibition appears to be due to reduction of ferric ions to ferrous ions and increased consumption of oxygen, both of which are direct consequences of microbial respiration. PMID:11872499
Wang, I-Kuan; Lee, Ming-Hsun; Chen, Yu-Ming; Huang, Chiu-Ching
2004-09-01
Edwardsiella tarda, a member of Enterobacteriaceae, is found in freshwater and marine environments and in animals living in these environments. This bacterium is primarily associated with gastrointestinal diseases, and has been isolated from stool specimens obtained from persons with or without clinical infectious diseases. Shewanella putrefaciens, a saprophytic gram-negative rod, is rarely responsible for clinical syndromes in humans. Debilitated status and exposure to aquatic environments are the major predisposing factors for E. tarda or S. putrefaciens infection. A 61-year-old woman was febrile with diarrhea 8 hours after ingesting shark meat, and two sets of blood cultures grew Escherichia coli, E. tarda and S. putrefaciens at the same time. She was successfully treated with antibiotics. We present this rare case of polymicrobial bacteremia caused by E. coli, E. tarda and S. putrefaciens without underlying disease, which is the first found in Taiwan. This rare case of febrile diarrhea with consequent polymicrobial bacteremia emphasizes that attention should always be extended to these unusual pathogens.
Liu, Ting; Yu, Yang-Yang; Chen, Tao; Chen, Wei Ning
2017-03-01
In this study, a synthetic microbial consortium containing exoelectrogen Shewanella oneidensis MR-1 and riboflavin-producing strain, Bacillus subtilis RH33, was rationally designed and successfully constructed, enabling a stable, multiple cycles of microbial fuel cells (MFCs) operation for more than 500 h. The maximum power density of MFCs with this synthetic microbial consortium was 277.4 mW/m 2 , which was 4.9 times of that with MR-1 (56.9 mW/m 2 ) and 40.2 times of RH33 (6.9 mW/m 2 ), separately. At the same time, the Coulombic efficiency of the synthetic microbial consortium (5.6%) was higher than MR-1 (4.1%) and RH33 (2.3%). Regardless the high concentration of riboflavin produced by RH33, the power density of RH33 was rather low. The low bioelectricity generation can be ascribed to the low efficiency of RH33 in utilizing riboflavin for extracellular electron transfer (EET). In the synthetic microbial consortium of MR-1 and RH33, it was found that both mediated and direct electron transfer efficiencies were enhanced. By exchanging the anolyte of MR-1 and RH33, it was confirmed that the improved MFC performance with the synthetic microbial consortium was because MR-1 could efficiently utilize the high concentration of riboflavin produced by RH33. Biotechnol. Bioeng. 2017;114: 526-532. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Microfabricated Microbial Fuel Cell Arrays Reveal Electrochemically Active Microbes
Cho, Younghak; de Figueiredo, Paul; Han, Arum
2009-01-01
Microbial fuel cells (MFCs) are remarkable “green energy” devices that exploit microbes to generate electricity from organic compounds. MFC devices currently being used and studied do not generate sufficient power to support widespread and cost-effective applications. Hence, research has focused on strategies to enhance the power output of the MFC devices, including exploring more electrochemically active microbes to expand the few already known electricigen families. However, most of the MFC devices are not compatible with high throughput screening for finding microbes with higher electricity generation capabilities. Here, we describe the development of a microfabricated MFC array, a compact and user-friendly platform for the identification and characterization of electrochemically active microbes. The MFC array consists of 24 integrated anode and cathode chambers, which function as 24 independent miniature MFCs and support direct and parallel comparisons of microbial electrochemical activities. The electricity generation profiles of spatially distinct MFC chambers on the array loaded with Shewanella oneidensis MR-1 differed by less than 8%. A screen of environmental microbes using the array identified an isolate that was related to Shewanella putrefaciens IR-1 and Shewanella sp. MR-7, and displayed 2.3-fold higher power output than the S. oneidensis MR-1 reference strain. Therefore, the utility of the MFC array was demonstrated. PMID:19668333
Enabling Unbalanced Fermentations by Using Engineered Electrode-Interfaced Bacteria
Flynn, Jeffrey M.; Ross, Daniel E.; Hunt, Kristopher A.; Bond, Daniel R.; Gralnick, Jeffrey A.
2010-01-01
Cellular metabolism is a series of tightly linked oxidations and reductions that must be balanced. Recycling of intracellular electron carriers during fermentation often requires substrate conversion to undesired products, while respiration demands constant addition of electron acceptors. The use of electrode-based electron acceptors to balance biotransformations may overcome these constraints. To test this hypothesis, the metal-reducing bacterium Shewanella oneidensis was engineered to stoichiometrically convert glycerol into ethanol, a biotransformation that will not occur unless two electrons are removed via an external reaction, such as electrode reduction. Multiple modules were combined into a single plasmid to alter S. oneidensis metabolism: a glycerol module, consisting of glpF, glpK, glpD, and tpiA from Escherichia coli, and an ethanol module containing pdc and adh from Zymomonas mobilis. A further increase in product yields was accomplished through knockout of pta, encoding phosphate acetyltransferase, shifting flux toward ethanol and away from acetate production. In this first-generation demonstration, conversion of glycerol to ethanol required the presence of an electrode to balance the reaction, and electrode-linked rates were on par with volumetric conversion rates observed in engineered E. coli. Linking microbial biocatalysis to current production can eliminate redox constraints by shifting other unbalanced reactions to yield pure products and serve as a new platform for next-generation bioproduction strategies. PMID:21060736
NASA Astrophysics Data System (ADS)
Kemner, Ken; O'Loughlin, Ed; Kelly, Shelly; Ravel, Bruce; Boyanov, Maxim; Sholto-Douglas, Deirdre; Lai, Barry; Cook, Russ; Carpenter, Everett; Harris, Vince; Nealson, Ken
2007-02-01
The microenvironment at and adjacent to surfaces of actively metabolizing cells, whether in a planktonic state or adhered to mineral surfaces, can be significantly different from the bulk environment. Microbial polymers (polysaccharides, DNA, RNA, and proteins), whether attached to or released from the cell, can contribute to the development of steep chemical gradients over very short distances. It is currently difficult to predict the behavior of contaminant radionuclides and metals in such microenvironments, because the chemistry there has been difficult or impossible to define. The behavior of contaminants in such microenvironments can ultimately affect their macroscopic fates. We have successfully performed a series of U LIII edge x-ray absorption fine structure (XAFS) spectroscopy, hard x-ray fluorescence (XRF) microprobe (150 nm resolution), and electron microscopy (EM) measurements on lepidocrocite thin films (˜1 micron thickness) deposited on kapton films that have been inoculated with the dissimilatory metal reducing bacterium Shewanella oneidensis MR-1 and exposed to 0.05 mM uranyl acetate under anoxic conditions. Similarly, we have performed a series of U LIII edge EXAFS measurements on lepidocrocite powders exposed to 0.05 mM uranyl acetate and exopolymeric components harvested from S. oneidensis MR-1 grown under aerobic conditions. These results demonstrate the utility of combining bulk XAFS with x-ray and electron microscopies.
Okamoto, Akihiro; Hashimoto, Kazuhito; Nealson, Kenneth H
2014-10-06
The iron-reducing bacterium Shewanella oneidensis MR-1 has a dual directional electronic conduit involving 40 heme redox centers in flavin-binding outer-membrane c-type cytochromes (OM c-Cyts). While the mechanism for electron export from the OM c-Cyts to an anode is well understood, how the redox centers in OM c-Cyts take electrons from a cathode has not been elucidated at the molecular level. Electrochemical analysis of live cells during switching from anodic to cathodic conditions showed that altering the direction of electron flow does not require gene expression or protein synthesis, but simply redox potential shift about 300 mV for a flavin cofactor interacting with the OM c-Cyts. That is, the redox bifurcation of the riboflavin cofactor in OM c-Cyts switches the direction of electron conduction in the biological conduit at the cell-electrode interface to drive bacterial metabolism as either anode or cathode catalysts. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Species-dependent hydrodynamics of flagellum-tethered bacteria in early biofilm development.
Bennett, Rachel R; Lee, Calvin K; De Anda, Jaime; Nealson, Kenneth H; Yildiz, Fitnat H; O'Toole, George A; Wong, Gerard C L; Golestanian, Ramin
2016-02-01
Monotrichous bacteria on surfaces exhibit complex spinning movements. Such spinning motility is often a part of the surface detachment launch sequence of these cells. To understand the impact of spinning motility on bacterial surface interactions, we develop a hydrodynamic model of a surface-bound bacterium, which reproduces behaviours that we observe in Pseudomonas aeruginosa, Shewanella oneidensis and Vibrio cholerae, and provides a detailed dictionary for connecting observed spinning behaviour to bacteria-surface interactions. Our findings indicate that the fraction of the flagellar filament adhered to the surface, the rotation torque of this appendage, the flexibility of the flagellar hook and the shape of the bacterial cell dictate the likelihood that a microbe will detach and the optimum orientation that it should have during detachment. These findings are important for understanding species-specific reversible attachment, the key transition event between the planktonic and biofilm lifestyle for motile, rod-shaped organisms. © 2016 The Author(s).
Fatty acid and hydrocarbon composition in tropical marine Shewanella amazonensis strain SB2B(T).
Motoigi, Taro; Okuyama, Hidetoshi
2011-10-01
Shewanella amazonensis strain SB2B(T) is an isolate from shallow-water marine sediments derived from the Amazon River delta. This bacterium contained a long-chain polyunsaturated hydrocarbon, all-cis -3,6,9,12,16,19,22,25,28 hentriacontanonaene (C31:9), constituting 1-2% of the total fatty acid methyl ester and hydrocarbon fraction, which was produced dependently of decreased growth temperature. Analysis of its cellular fatty acid composition demonstrated that isopentadecanoic acid was the major fatty acid component and that all the main monounsaturated fatty acids had straight chains with a cis configuration. However, monoenoic cyclopropyl fatty acids, which were previously reported to be present in this bacterium, were not detected by mass spectrometric analysis. The growth temperature affected the content of Δ9-cis -hexadecenoic [16:1(Δ9c)], palmitic, and heptadecanoic acids. These results suggest that C31:9, as well as 16:1(Δ9c) might be involved in adaptation to low temperature in S. amazonensis strain SB2B(T) . Our result suggests that polyunsaturated fatty acid synthase protein complex may be involved in synthesis of C31:9 but not in production of eicosapentaenoic acid. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Electrokinesis is a microbial behavior that requires extracellular electron transport
Harris, H. W.; El-Naggar, M. Y.; Bretschger, O.; Ward, M. J.; Romine, M. F.; Obraztsova, A. Y.; Nealson, K. H.
2009-01-01
We report a previously undescribed bacterial behavior termed electrokinesis. This behavior was initially observed as a dramatic increase in cell swimming speed during reduction of solid MnO2 particles by the dissimilatory metal-reducing bacterium Shewanella oneidensis MR-1. The same behavioral response was observed when cells were exposed to small positive applied potentials at the working electrode of a microelectrochemical cell and could be tuned by adjusting the potential on the working electrode. Electrokinesis was found to be different from both chemotaxis and galvanotaxis but was absent in mutants defective in electron transport to solid metal oxides. Using in situ video microscopy and cell tracking algorithms, we have quantified the response for different strains of Shewanella and shown that the response correlates with current-generating capacity in microbial fuel cells. The electrokinetic response was only exhibited by a subpopulation of cells closest to the MnO2 particles or electrodes. In contrast, the addition of 1 mM 9,10-anthraquinone-2,6-disulfonic acid, a soluble electron shuttle, led to increases in motility in the entire population. Electrokinesis is defined as a behavioral response that requires functional extracellular electron transport and that is observed as an increase in cell swimming speeds and lengthened paths of motion that occur in the proximity of a redox active mineral surface or the working electrode of an electrochemical cell. PMID:20018675
Microbial mediated iron redox cycling in Fe (hydr)oxides for nitrite removal.
Lu, Yongsheng; Xu, Lu; Shu, Weikang; Zhou, Jizhi; Chen, Xueping; Xu, Yunfeng; Qian, Guangren
2017-01-01
Nitrite, at an environmentally relevant concentration, was significantly reduced with iron (hydr)oxides mediated by Shewanella oneidensis MR-1. The average nitrite removal rates of 1.28±0.08 and 0.65±0.02(mgL -1 )h -1 were achieved with ferrihydrite and magnetite, respectively. The results showed that nitrite removal was able to undergo multiple redox cycles with iron (hydr)oxides mediated by Shewanella oneidensis MR-1. During the bioreduction of the following cycles, biogenic Fe(II) was subsequently chemically oxidized to Fe(III), which is associated with nitrite reduction. There was 11.18±1.26mgL -1 of NH 4 + -N generated in the process of redox cycling of ferrihydrite. Additionally, results obtained by using X-ray diffraction showed that ferrihydrite and magnetite remained mainly stable in the system. This study indicated that redox cycling of Fe in iron (hydr)oxides was a potential process associated with NO 2 - -N removal from solution, and reduced most nitrite abiotically to gaseous nitrogen species. Copyright © 2016 Elsevier Ltd. All rights reserved.
Myers, C R; Nealson, K H
1990-01-01
An oxidant pulse technique, with lactate as the electron donor, was used to study respiration-linked proton translocation in the manganese- and iron-reducing bacterium Shewanella putrefaciens MR-1. Cells grown anaerobically with fumarate or nitrate as the electron acceptor translocated protons in response to manganese (IV), fumarate, or oxygen. Cells grown anaerobically with fumarate also translocated protons in response to iron(III) and thiosulfate, whereas those grown with nitrate did not. Aerobically grown cells translocated protons only in response to oxygen. Proton translocation with all electron acceptors was abolished in the presence of the protonophore carbonyl cyanide m-chlorophenylhydrazone (20 microM) and was partially to completely inhibited by the electron transport inhibitor 2-n-heptyl-4-hydroxyquinoline N-oxide (50 microM). PMID:2172208
Synergistic microbial consortium for bioenergy generation from complex natural energy sources.
Wang, Victor Bochuan; Yam, Joey Kuok Hoong; Chua, Song-Lin; Zhang, Qichun; Cao, Bin; Chye, Joachim Loo Say; Yang, Liang
2014-01-01
Microbial species have evolved diverse mechanisms for utilization of complex carbon sources. Proper combination of targeted species can affect bioenergy production from natural waste products. Here, we established a stable microbial consortium with Escherichia coli and Shewanella oneidensis in microbial fuel cells (MFCs) to produce bioenergy from an abundant natural energy source, in the form of the sarcocarp harvested from coconuts. This component is mostly discarded as waste. However, through its usage as a feedstock for MFCs to produce useful energy in this study, the sarcocarp can be utilized meaningfully. The monospecies S. oneidensis system was able to generate bioenergy in a short experimental time frame while the monospecies E. coli system generated significantly less bioenergy. A combination of E. coli and S. oneidensis in the ratio of 1:9 (v:v) significantly enhanced the experimental time frame and magnitude of bioenergy generation. The synergistic effect is suggested to arise from E. coli and S. oneidensis utilizing different nutrients as electron donors and effect of flavins secreted by S. oneidensis. Confocal images confirmed the presence of biofilms and point towards their importance in generating bioenergy in MFCs.
Synergistic Microbial Consortium for Bioenergy Generation from Complex Natural Energy Sources
Yam, Joey Kuok Hoong; Chua, Song-Lin; Zhang, Qichun; Cao, Bin; Chye, Joachim Loo Say
2014-01-01
Microbial species have evolved diverse mechanisms for utilization of complex carbon sources. Proper combination of targeted species can affect bioenergy production from natural waste products. Here, we established a stable microbial consortium with Escherichia coli and Shewanella oneidensis in microbial fuel cells (MFCs) to produce bioenergy from an abundant natural energy source, in the form of the sarcocarp harvested from coconuts. This component is mostly discarded as waste. However, through its usage as a feedstock for MFCs to produce useful energy in this study, the sarcocarp can be utilized meaningfully. The monospecies S. oneidensis system was able to generate bioenergy in a short experimental time frame while the monospecies E. coli system generated significantly less bioenergy. A combination of E. coli and S. oneidensis in the ratio of 1 : 9 (v : v) significantly enhanced the experimental time frame and magnitude of bioenergy generation. The synergistic effect is suggested to arise from E. coli and S. oneidensis utilizing different nutrients as electron donors and effect of flavins secreted by S. oneidensis. Confocal images confirmed the presence of biofilms and point towards their importance in generating bioenergy in MFCs. PMID:25097866
Beleneva, Irina A; Magarlamov, T Yu; Eliseikina, Marina G; Zhukova, Natalia V
2009-11-01
Pathogenic properties of the natural isolate of Shewanella algae from the coelomic fluid of the sea cucumber Apostichopus japonicus (Peter the Great Bay, Sea of Japan) were investigated. The isolate had oxydative metabolism, was positive for ornithine decarboxylase, cytochrome oxidase, catalase, DNase and gelatinase, hemolytically active, did not produce acid from carbohydrates, and did not hydrolyze urea and esculin. The strain was resistant to penicillin, amoxicillin, and ampicillin and susceptible to tetracycline and carbenicillin. Among cellular fatty acids, 13:0-i, 15:0-i, 16:0, 16:1(n-7), 17:0-i, and 17:0-ai dominated. These biochemical properties made it possible to attribute the isolated bacteria to the genus Shewanella and identified as S. algae. The cells of this bacterium were introduced into the coelomic cavity of another echinoderm, the sea urchin Strongylocentrotus nudus. As a result, in about 24h the animals became slow and 3-8days after the inoculation died. Dividing bacteria were being found during the experiment in the coelomic fluid as well as in the phagosomes of amoebocytes, i.e. cells acting as phagocytes in the coelomic fluid. The studies of the invasive properties of strain 156 showed that bacterial cells entered the subcuticular space of S. nudus and A. japonicus through the cuticle and stayed there for a long time without penetrating epithelium and exerting toxic effect upon the organisms of the laboratory animals. Pathogenic effect of S. algae can be manifested only if the cutaneous epithelium is destroyed permitting it to penetrate the lower tissue layers. The toxicity of S. algae is confirmed by in vitro experiments. The inoculation of the embryonic cells of S. nudus with samples of this bacterium caused the death of 10% of cells within an hour and 100% of cells within 12h after inoculation. The results of the investigations demonstrate that S. algae could produce opportunistic infection in the sea cucumber A. japonicus and the sea
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ni, Shuisong; Robinson, Howard; Marsing, Gregory C.
2004-11-01
prohibited a definitive analysis of the identity and mode of binding of the bound molecule. Kishida et al. (2003) reported that no cavity existed in a 1.6Å structure of the SO3437 homolog from Thermus thermophilus, presumably due to tighter packing of the protein from the thermophilic organism. Steinbacher et al. (2002) make no description of a hydrophobic cavity in a lower resolution (2.5-3.2Å) of the Escherichia coli protein. Here, we report a high-resolution (1.6Å) structure of MECDP synthase from Shewanella oneidensis in the absence of substrate in the active site. We provide unambiguous data that confirms the presence of Zn2+ in one of the metal binding sites and observe what appears to be farnesyl diphosphate (FPP) bound in the hydrophobic cavity along the non-crystallographic three-fold symmetry axis of the homotrimer. The high-resolution structure clarifies the mode of binding of the pyrophosphate of FPP in the arginine cluster that caps the hydrophobic cavity.« less
Li, Bing-Bing; Cheng, Yuan-Yuan; Fan, Yang-Yang; Liu, Dong-Feng; Fang, Cai-Yun; Wu, Chao; Li, Wen-Wei; Yang, Zong-Chuang; Yu, Han-Qing
2018-05-12
Shewanella species have a diverse respiratory ability and wide distribution in environments and play an important role in bioremediation and the biogeochemical cycles of elements. Primers with more accuracy and broader coverage are required with consideration of the increasing number of Shewanella species and evaluation of their roles in various environments. In this work, a new primer set of 640F/815R was developed to quantify the abundance of Shewanella species in natural and engineered environments. In silico tools for primer evaluation, quantitative polymerase chain reaction (qPCR) and clone library results showed that 640F/815R had a higher specificity and coverage than the previous primers in quantitative analysis of Shewanella. Another newly developed primer pair of 211F/815cR was also adopted to analyze the Shewanella diversity and demonstrated to be the best candidate in terms of specificity and coverage. We detected more Shewanella-related species in freshwater environments and found them to be substantially different from those in marine environments. Abundance and diversity of Shewanella species in wastewater treatment plants were largely affected by the process and operating conditions. Overall, this study suggests that investigations of abundance and diversity of Shewanella in various environments are of great importance to evaluate their ecophysiology and potential ecological roles. Copyright © 2018 Elsevier B.V. All rights reserved.
A New Perspective on Radiation Resistance Based on Deinococcus radiodurans
2009-03-01
Halobacterium sp. NRc-1 | Lactobacillus plantarum | Micrococcus luteus | Pyrococcus furiosus | Shewanella oneidensis | Synechocystis sp. Pcc... Lactobacillus plantarum16,47, which lacks the enzyme superoxide dismutase, and Synechocystis sp. PCC 68034 (Ref. 48) accumulated exceptionally high levels...high specificity for Mn2+, has been detected in L. plantarum , but has not been found in D. radiodurans. Manganese transport in D. radiodurans is
Current trends of human infections and antibiotic resistance of the genus Shewanella.
Yousfi, K; Bekal, S; Usongo, V; Touati, A
2017-08-01
Shewanella spp. are commonly known as environmental bacteria and are most frequently isolated from aquatic areas. Currently, diseases syndromes and multidrug resistance have increasingly been reported in the genus Shewanella. Some species are associated with various infections, such as skin and soft tissue infections, as well as bacteremia. Generally, these bacteria are opportunistic and mostly affect people with an impaired immune system. This genus is also a probable vehicle and progenitor of antibiotic resistance genes. In fact, several resistance genes and mobile genetic elements have been identified in some resistant species isolated from environmental or clinical settings. These genes confer resistance to different antibiotic classes, including those used in therapies such as β-lactams and quinolones, and are generally located on the chromosome. Recently, a multidrug-resistant (MDR) plasmid harboring several drug resistance genes associated with transposons and integrons has been identified in Shewanella xiamenensis. These antibiotic resistance genes can circulate in the environment and contribute to the emergence of antibiotic resistance. This review describes different aspects of Shewanella, focusing on the infections caused by this genus, as well as their role in the propagation of antibiotic resistance via mobile genetic elements.
Vogel, B F; Jørgensen, K; Christensen, H; Olsen, J E; Gram, L
1997-01-01
Seventy-six presumed Shewanella putrefaciens isolates from fish, oil drillings, and clinical specimens, the type strain of Shewanella putrefaciens (ATCC 8071), the type strain of Shewanella alga (IAM 14159), and the type strain of Shewanella hanedai (ATCC 33224) were compared by several typing methods. Numerical analysis of sodium dodecyl sulfate-polyacrylamide gel electrophoresis of whole-cell protein and ribotyping patterns showed that the strains were separated into two distinct clusters with 56% +/- 10% and 40% +/- 14% similarity for whole-cell protein profiling and ribotyping, respectively. One cluster consisted of 26 isolates with 52 to 55 mol% G + C and included 15 human isolates, mostly clinical specimens, 8 isolates from marine waters, and the type strain of S. alga. This homogeneous cluster of mesophilic, halotolerant strains was by all analyses identical to the recently defined species S. alga (U. Simidu et al., Int. J. Syst. Bacteriol, 40:331-336, 1990). Fifty-two typically psychrotolerant strains formed the other, more heterogeneous major cluster, with 43 to 47 mol% G + C. The type strain of S. putrefaciens was included in this group. The two groups were confirmed by 16S rRNA gene sequence analysis. It is concluded that the isolates must be considered two different species, S. alga and S. putrefaciens, and that most mesophilic isolates formerly identified as S. putrefaciens belong to S. alga. The ecological role and potential pathogenicity of S. alga can be evaluated only if the organism is correctly identified. PMID:9172338
Tacão, Marta; Araújo, Susana; Vendas, Maria; Alves, Artur; Henriques, Isabel
2018-03-01
Chromosome-encoded beta-lactamases of Shewanella spp. have been indicated as probable progenitors of bla OXA-48 -like genes. However, these have been detected in few Shewanella spp. and dissemination mechanisms are unclear. Thus, our main objective was to confirm the role of Shewanella species as progenitors of bla OXA-48 -like genes. In silico analysis of Shewanella genomes was performed to detect bla OXA-48 -like genes and context, and 43 environmental Shewanella spp. were characterised. Clonal relatedness was determined by BOX-PCR. Phylogenetic affiliation was assessed by 16S rDNA and gyrB sequencing. Antibiotic susceptibility phenotypes were determined. The bla OXA-48 -like genes and genetic context were inspected by PCR, hybridisation and sequence analysis. Gene variants were cloned in Escherichia coli and MICs were determined. Shewanella isolates were screened for integrons, plasmids and insertion sequences. Analysis of Shewanella spp. genomes showed that putative bla OXA-48 -like is present in the majority and in an identical context. Isolates presenting unique BOX profiles affiliated with 11 Shewanella spp. bla OXA-48 -like genes were detected in 22 isolates from 6 species. Genes encoded enzymes identical to OXA-48, OXA-204, OXA-181, and 7 new variants differing from OXA-48 from 2 to 82 amino acids. IS1999 was detected in 24 isolates, although not in the vicinity of bla OXA-48 genes. Recombinant E. coli strains presented altered MICs. The presence/absence of bla OXA-48 -like genes was species-related. Gene variants encoded enzymes with hydrolytic spectra similar to OXA-48-like from non-shewanellae. From the mobile elements previously described in association with bla OXA-48 -like genes, only the IS1999 was found in Shewanella, which indicates its relevance in bla OXA-48 -like genes transfer to other hosts. Copyright © 2017 Elsevier B.V. and International Society of Chemotherapy. All rights reserved.
NASA Technical Reports Server (NTRS)
Venkateswaran, K.; Dollhopf, M. E.; Aller, R.; Stackebrandt, E.; Nealson, K. H.
1998-01-01
A new bacterial species belonging to the genus Shewanella is described on the basis of phenotypic characterization and sequence analysis of its 16S rRNA-encoding and gyrase B (gyrB) genes. This organism, isolated from shallow-water marine sediments derived from the Amazon River delta, is a Gram-negative, motile, polarly flagellated, facultatively anaerobic, rod-shaped eubacterium and has a G&C content of 51.7 mol%. Strain SB2BT is exceptionally active in the anaerobic reduction of iron, manganese and sulfur compounds. SB2BT grows optimally at 35 degrees C, with 1-3% NaCl and over a pH range of 7-8. Analysis of the 16S rDNA sequence revealed a clear affiliation between strain SB2BT and members of the gamma subclass of the class Proteobacteria. High similarity values were found with certain members of the genus Shewanella, especially with Shewanella putrefaciens, and this was supported by cellular fatty acid profiles and phenotypic characterization. DNA-DNA hybridization between strain SB2BT and its phylogenetically closest relatives revealed low similarity values (24.6-42.7%) which indicated species status for strain SB2BT. That SB2BT represents a distinct bacterial species within the genus Shewanella is also supported by gyrB sequence analysis. Considering the source of the isolate, the name Shewanella amazonensis sp. nov. is proposed and strain SB2BT (= ATCC 700329T) is designated as the type strain.
Electrogenic Single-Species Biocomposites as Anodes for Microbial Fuel Cells.
Kaiser, Patrick; Reich, Steffen; Leykam, Daniel; Willert-Porada, Monika; Greiner, Andreas; Freitag, Ruth
2017-07-01
Integration of electrogenic microorganisms remains a challenge in biofuel cell technology. Here, synthetic biocomposites ("artificial biofilms") are proposed. Bacteria (Shewanella oneidensis) are embedded in a hydrogel matrix (poly(vinyl alcohol)) via wet- and electrospinning, creating fibers and nonwoven gauzes. The bacteria remain viable and metabolically active. The performance is compared to S. oneidensis suspension cultures and "natural" biofilms. While lower than with the suspension cultures, the power output from the fuel cells with the artificial biofilms is higher than with the natural one. Handling, reproducibility, and stability are also better. Artificial biofilms can therefore contribute to resolving fundamental issues of design, scale up, and monosepsis in biofuel cell technology. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Zhang, Jinwei; Burgess, J Grant
2017-01-01
Omega-3 fatty acids are products of secondary metabolism, essential for growth and important for human health. Although there are numerous reports of bacterial production of omega-3 fatty acids, less information is available on the biotechnological production of these compounds from bacteria. The production of eicosapentaenoic acid (EPA, 20:5ω3) by a new species of marine bacteria Shewanella electrodiphila MAR441T was investigated under different fermentation conditions. This strain produced a high percentage (up to 26%) of total fatty acids and high yields (mg / g of biomass) of EPA at or below the optimal growth temperature. At higher growth temperatures these values decreased greatly. The amount of EPA produced was affected by the carbon source, which also influenced fatty acid composition. This strain required Na+ for growth and EPA synthesis and cells harvested at late exponential or early stationary phase had a higher EPA content. Both the highest amounts (20 mg g-1) and highest percent EPA content (18%) occurred with growth on L-proline and (NH4)2SO4. The addition of cerulenin further enhanced EPA production to 30 mg g-1. Chemical mutagenesis using NTG allowed the isolation of mutants with improved levels of EPA content (from 9.7 to 15.8 mg g-1) when grown at 15°C. Thus, the yields of EPA could be substantially enhanced without the need for recombinant DNA technology, often a commercial requirement for food supplement manufacture.
Burgess, J. Grant
2017-01-01
Omega-3 fatty acids are products of secondary metabolism, essential for growth and important for human health. Although there are numerous reports of bacterial production of omega-3 fatty acids, less information is available on the biotechnological production of these compounds from bacteria. The production of eicosapentaenoic acid (EPA, 20:5ω3) by a new species of marine bacteria Shewanella electrodiphila MAR441T was investigated under different fermentation conditions. This strain produced a high percentage (up to 26%) of total fatty acids and high yields (mg / g of biomass) of EPA at or below the optimal growth temperature. At higher growth temperatures these values decreased greatly. The amount of EPA produced was affected by the carbon source, which also influenced fatty acid composition. This strain required Na+ for growth and EPA synthesis and cells harvested at late exponential or early stationary phase had a higher EPA content. Both the highest amounts (20 mg g-1) and highest percent EPA content (18%) occurred with growth on L-proline and (NH4)2SO4. The addition of cerulenin further enhanced EPA production to 30 mg g-1. Chemical mutagenesis using NTG allowed the isolation of mutants with improved levels of EPA content (from 9.7 to 15.8 mg g-1) when grown at 15°C. Thus, the yields of EPA could be substantially enhanced without the need for recombinant DNA technology, often a commercial requirement for food supplement manufacture. PMID:29176835
McGraw, Joseph E.; Jensen, Brittany J.; Bishop, Sydney S.; Lokken, James P.; Dorff, Kellen J.; Ripley, Michael P.; Munro, James B.
2015-01-01
Approximately 30 years ago, it was discovered that free-living bacteria isolated from cold ocean depths could produce polyunsaturated fatty acids (PUFA) such as eicosapentaenoic acid (EPA) (20:5n-3) or docosahexaenoic acid (DHA) (22:6n-3), two PUFA essential for human health. Numerous laboratories have also discovered that EPA- and/or DHA-producing bacteria, many of them members of the Shewanella genus, could be isolated from the intestinal tracts of omega-3 fatty acid-rich marine fish. If bacteria contribute omega-3 fatty acids to the host fish in general or if they assist some bacterial species in adaptation to cold, then cold freshwater fish or habitats should also harbor these producers. Thus, we undertook a study to see if these niches also contained omega-3 fatty acid producers. We were successful in isolating and characterizing unique EPA-producing strains of Shewanella from three strictly freshwater native fish species, i.e., lake whitefish (Coregonus clupeaformis), lean lake trout (Salvelinus namaycush), and walleye (Sander vitreus), and from two other freshwater nonnative fish, i.e., coho salmon (Oncorhynchus kisutch) and seeforellen brown trout (Salmo trutta). We were also able to isolate four unique free-living strains of EPA-producing Shewanella from freshwater habitats. Phylogenetic and phenotypic analyses suggest that one producer is clearly a member of the Shewanella morhuae species and another is sister to members of the marine PUFA-producing Shewanella baltica species. However, the remaining isolates have more ambiguous relationships, sharing a common ancestor with non-PUFA-producing Shewanella putrefaciens isolates rather than marine S. baltica isolates despite having a phenotype more consistent with S. baltica strains. PMID:26497452
Wetmore, Kelly M.; Price, Morgan N.; Waters, Robert J.; Lamson, Jacob S.; He, Jennifer; Hoover, Cindi A.; Blow, Matthew J.; Bristow, James; Butland, Gareth
2015-01-01
ABSTRACT Transposon mutagenesis with next-generation sequencing (TnSeq) is a powerful approach to annotate gene function in bacteria, but existing protocols for TnSeq require laborious preparation of every sample before sequencing. Thus, the existing protocols are not amenable to the throughput necessary to identify phenotypes and functions for the majority of genes in diverse bacteria. Here, we present a method, random bar code transposon-site sequencing (RB-TnSeq), which increases the throughput of mutant fitness profiling by incorporating random DNA bar codes into Tn5 and mariner transposons and by using bar code sequencing (BarSeq) to assay mutant fitness. RB-TnSeq can be used with any transposon, and TnSeq is performed once per organism instead of once per sample. Each BarSeq assay requires only a simple PCR, and 48 to 96 samples can be sequenced on one lane of an Illumina HiSeq system. We demonstrate the reproducibility and biological significance of RB-TnSeq with Escherichia coli, Phaeobacter inhibens, Pseudomonas stutzeri, Shewanella amazonensis, and Shewanella oneidensis. To demonstrate the increased throughput of RB-TnSeq, we performed 387 successful genome-wide mutant fitness assays representing 130 different bacterium-carbon source combinations and identified 5,196 genes with significant phenotypes across the five bacteria. In P. inhibens, we used our mutant fitness data to identify genes important for the utilization of diverse carbon substrates, including a putative d-mannose isomerase that is required for mannitol catabolism. RB-TnSeq will enable the cost-effective functional annotation of diverse bacteria using mutant fitness profiling. PMID:25968644
Okamoto, Akihiro; Tokunou, Yoshihide; Saito, Junki
2016-01-01
Outer-membrane c-type cytochrome (OM c-Cyt) complexes in several genera of iron-reducing bacteria, such as Shewanella and Geobacter, are capable of transporting electrons from the cell interior to extracellular solids as a terminal step of anaerobic respiration. The kinetics of this electron transport has implications for controlling the rate of microbial electron transport during bioenergy or biochemical production, iron corrosion, and natural mineral cycling. Herein, we review the findings from in-vivo and in-vitro studies examining electron transport kinetics through single OM c-Cyt complexes in Shewanella oneidensis MR-1. In-vitro electron flux via a purified OM c-Cyt complex, comprised of MtrA, B, and C proteins from S. oneidensis MR-1, embedded in a proteoliposome system is reported to be 10- to 100-fold faster compared with in-vivo estimates based on measurements of electron flux per cell and OM c-Cyts density. As the proteoliposome system is estimated to have 10-fold higher cation flux via potassium channels than electrons, we speculate that the slower rate of electron-coupled cation transport across the OM is responsible for the significantly lower electron transport rate that is observed in-vivo. As most studies to date have primarily focused on the energetics or kinetics of interheme electron hopping in OM c-Cyts in this microbial electron transport mechanism, the proposed model involving cation transport provides new insight into the rate detemining step of EET, as well as the role of self-secreted flavin molecules bound to OM c-Cyt and proton management for energy conservation and production in S. oneidensis MR-1. PMID:27924259
Dailey, Frank E; McGraw, Joseph E; Jensen, Brittany J; Bishop, Sydney S; Lokken, James P; Dorff, Kellen J; Ripley, Michael P; Munro, James B
2016-01-01
Approximately 30 years ago, it was discovered that free-living bacteria isolated from cold ocean depths could produce polyunsaturated fatty acids (PUFA) such as eicosapentaenoic acid (EPA) (20:5n-3) or docosahexaenoic acid (DHA) (22:6n-3), two PUFA essential for human health. Numerous laboratories have also discovered that EPA- and/or DHA-producing bacteria, many of them members of the Shewanella genus, could be isolated from the intestinal tracts of omega-3 fatty acid-rich marine fish. If bacteria contribute omega-3 fatty acids to the host fish in general or if they assist some bacterial species in adaptation to cold, then cold freshwater fish or habitats should also harbor these producers. Thus, we undertook a study to see if these niches also contained omega-3 fatty acid producers. We were successful in isolating and characterizing unique EPA-producing strains of Shewanella from three strictly freshwater native fish species, i.e., lake whitefish (Coregonus clupeaformis), lean lake trout (Salvelinus namaycush), and walleye (Sander vitreus), and from two other freshwater nonnative fish, i.e., coho salmon (Oncorhynchus kisutch) and seeforellen brown trout (Salmo trutta). We were also able to isolate four unique free-living strains of EPA-producing Shewanella from freshwater habitats. Phylogenetic and phenotypic analyses suggest that one producer is clearly a member of the Shewanella morhuae species and another is sister to members of the marine PUFA-producing Shewanella baltica species. However, the remaining isolates have more ambiguous relationships, sharing a common ancestor with non-PUFA-producing Shewanella putrefaciens isolates rather than marine S. baltica isolates despite having a phenotype more consistent with S. baltica strains. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Cristóbal, Héctor Antonio; Poma, Hugo Ramiro; Abate, Carlos Mauricio; Rajal, Verónica Beatriz
2016-06-01
Shewanella sp. G5, a psychrotolerant marine bacterium, has a cold-shock protein (CspA) and three β-glucosidases, two of which were classified in the glycosyl hydrolase families 1 and 3 and are encoded by bgl-A and bgl genes, respectively. Shewanella sp. G5 was cultured on Luria-Bertani (LB) and Mineral Medium Brunner (MMB) media with glucose and cellobiose at various temperatures and pH 6 and 8. Relative quantification of the expression levels of all three genes was studied by real-time PCR with the comparative Ct method (2(-ΔΔCt)) using the gyrB housekeeping gene as a normalizer. Results showed that the genes had remarkably different genetic expression levels under the conditions evaluated, with increased expression of all genes obtained on MMB with cellobiose at 30 °C. Specific growth rate and specific β-glucosidase activity were also determined for all the culture conditions. Shewanella sp. G5 was able to grow on both media at 4 °C, showing the maximum specific growth rate on LB with cellobiose at 37 °C. The specific β-glucosidase activity obtained on MMB with cellobiose at 30 °C was 25 to 50 % higher than for all other conditions. At pH 8, relative activity was 34, 60, and 63 % higher at 30 °C than at 10 °C, with three peaks at 10, 25, and 37 °C on both media. Enzyme activity increased by 61 and 47 % in the presence of Ca(2+) and by 24 and 31 % in the presence of Mg(2+) on LB and MMB at 30 °C, respectively, but it was totally inhibited by Hg(2+), Cu(2+), and EDTA. Moreover, this activity was slightly decreased by SDS, Zn(2+), and DTT, all at 5 mM. Ethanol (14 % v/v) and glucose (100 mM) also reduced the activity by 63 and 60 %, respectively.
Kinetics of microbial reduction of Solid phase U(VI).
Liu, Chongxuan; Jeon, Byong-Hun; Zachara, John M; Wang, Zheming; Dohnalkova, Alice; Fredrickson, James K
2006-10-15
Sodium boltwoodite (NaUO2SiO3OH x 1.5 H2O) was used to assess the kinetics of microbial reduction of solid-phase U(VI) by a dissimilatory metal-reducing bacterium (DMRB), Shewanella oneidensis strain MR-1. The bioreduction kinetics was studied with Na-boltwoodite in suspension or within alginate beads in a nongrowth medium with lactate as electron donor at pH 6.8 buffered with PIPES. Concentrations of U(VI)tot and cell number were varied to evaluate the coupling of U(VI) dissolution, diffusion, and microbial activity. Microscopic and spectroscopic analyses with transmission electron microscopy (TEM), energy dispersive spectroscopy (EDS), and laser-induced fluorescence spectroscopy (LIFS) collectively indicated that solid-phase U(VI) was first dissolved and diffused out of grain interiors before it was reduced on bacterial surfaces and/or within the periplasm. The kinetics of solid-phase U(VI) bioreduction was well described by a coupled model of bicarbonate-promoted dissolution of Na-boltwoodite, intragrain uranyl diffusion, and Monod type bioreduction kinetics with respect to dissolved U(VI) concentration. The results demonstrated that microbial reduction of solid-phase U(VI) is controlled by coupled biological, chemical, and physical processes.
Mohanty, Anee; Kathawala, Mustafa Hussain; Zhang, Jianhua; Chen, Wei Ning; Loo, Joachim Say Chye; Kjelleberg, Staffan; Yang, Liang; Cao, Bin
2014-05-01
While antibiotic resistance in bacteria is rapidly increasing, the development of new antibiotics has decreased in recent years. Antivirulence drugs disarming rather than killing pathogens have been proposed to alleviate the problem of resistance inherent to existing biocidal antibiotics. Here, we report a nontoxic biogenic nanomaterial as a novel antivirulence agent to combat bacterial infections caused by Pseudomonas aeruginosa. We synthesized, in an environmentally benign fashion, tellurium nanorods (TeNRs) using the metal-reducing bacterium Shewanella oneidensis, and found that the biogenic TeNRs could effectively inhibit the production of pyoverdine, one of the most important virulence factors in P. aeruginosa. Our results suggest that amyloids and extracellular polysaccharides Pel and Psl are not involved in the interactions between P. aeruginosa and the biogenic TeNRs, while flagellar movement plays an important role in the cell-TeNRs interaction. We further showed that the TeNRs (up to 100 µg/mL) did not exhibit cytotoxicity to human bronchial epithelial cells and murine macrophages. Thus, biogenic TeNRs hold promise as a novel antivirulence agent against P. aeruginosa. © 2013 Wiley Periodicals, Inc.
Vance, Tyler D R; Graham, Laurie A; Davies, Peter L
2018-04-01
Out of the dozen different ice-binding protein (IBP) structures known, the DUF3494 domain is the most widespread, having been passed many times between prokaryotic and eukaryotic microorganisms by horizontal gene transfer. This ~25-kDa β-solenoid domain with an adjacent parallel α-helix is most commonly associated with an N-terminal secretory signal peptide. However, examples of the DUF3494 domain preceded by tandem Bacterial Immunoglobulin-like (BIg) domains are sometimes found, though uncharacterized. Here, we present one such protein (SfIBP_1) from the Antarctic bacterium Shewanella frigidimarina. We have confirmed and characterized the ice-binding activity of its ice-binding domain using thermal hysteresis measurements, fluorescent ice plane affinity analysis, and ice recrystallization inhibition assays. X-ray crystallography was used to solve the structure of the SfIBP_1 ice-binding domain, to further characterize its ice-binding surface and unique method of stabilizing or 'capping' the ends of the solenoid structure. The latter is formed from the interaction of two loops mediated by a combination of tandem prolines and electrostatic interactions. Furthermore, given their domain architecture and membrane association, we propose that these BIg-containing DUF3494 IBPs serve as ice-binding adhesion proteins that are capable of adsorbing their host bacterium onto ice. Submitted new structure to the Protein Data Bank (PDB: 6BG8). © 2018 Federation of European Biochemical Societies.
NASA Astrophysics Data System (ADS)
Santillan, E. U.; Franks, M. A.; Omelon, C. R.; Bennett, P.
2011-12-01
When carbon dioxide is captured and stored in deep saline aquifers, many biogeochemical changes will occur in these reservoirs. High concentrations of aqueous CO2 itself can be toxic to microorganisms as the gas easily enters cell membranes and alters intracellular cell functions. Because of this, we expect CO2 to be a perturbation that will alter microbial community composition. Microbes that are capable of withstanding CO2 stress will be selected for and their subsequent growth and metabolism will further affect brine chemistry. For this study, we examined three organisms representing metabolic functions and cellular structures potentially found in deep saline aquifers: the Gram-negative dissimilatory iron reducing bacterium Shewanella oneidensis strain MR-1, the aerobic Gram-positive hydrocarbon degrading Geobacillus stearothermophilus, and the methanogenic archaeon Methanothermobacter thermoautotrophicus. Organisms were grown in batch cultures and subsequently exposed to high PCO2 ranging from 25 atm to 60 atm for 2 to 24 hours. Cultures were then plated for viability or tested for metabolic activity such as methane production. Following CO2 stress, organisms were also examined for membrane changes through phospholipid fatty acid analysis and for morphological changes by transmission electron microscopy. After only 2 hours of incubation in 30 atm of CO2, no viable cells were found in planktonic cultures of Shewanella. In contrast, cultures of Geobacillus remained viable (less than a log 2 reduction from initial counts) even after exposure to double the CO2 pressure and for 17 hours. However, when grown in the presence of quartz sandstone, biofilm formation on the rock surface occurred in Shewanella cultures, resulting in survival times greater than 8 hours. Our results suggest that biofilm formation and cell wall thickness may be two very important factors in resisting CO2 toxicity as they create a reactive barrier that slows the diffusion of CO2 into
Modeling biofilms with dual extracellular electron transfer mechanisms
DOE Office of Scientific and Technical Information (OSTI.GOV)
Renslow, Ryan S.; Babauta, Jerome T.; Kuprat, Andrew P.
2013-11-28
Electrochemically active biofilms have a unique form of respiration in which they utilize solid external materials as their terminal electron acceptor for metabolism. Currently, two primary mechanisms have been identified for long-range extracellular electron transfer (EET): a diffusion- and a conduction-based mechanism. Evidence in the literature suggests that some biofilms, particularly Shewanella oneidensis, produce components requisite for both mechanisms. In this study, a generic model is presented that incorporates both diffusion- and conduction-based mechanisms and allows electrochemically active biofilms to utilize both simultaneously. The model was applied to Shewanella oneidensis and Geobacter sulfurreducens biofilms using experimentally generated data found themore » literature. Our simulation results showed that 1) biofilms having both mechanisms available, especially if they can interact, may have metabolic advantage over biofilms that can use only a single mechanism; 2) the thickness of Geobacter sulfurreducens biofilms is likely not limited by conductivity; 3) accurate intrabiofilm diffusion coefficient values are critical for current generation predictions; and 4) the local biofilm potential and redox potential are two distinct measurements and cannot be assumed to have identical values. Finally, we determined that cyclic and squarewave voltammetry are currently not good tools to determine the specific percentage of extracellular electron transfer mechanisms used by biofilms. The developed model will be a critical tool in designing experiments to explain EET mechanisms.« less
Shewanella spp. Genomic Evolution for a Cold Marine Lifestyle and In-Situ Explosive Biodegradation
Zhao, Jian-Shen; Deng, Yinghai; Manno, Dominic; Hawari, Jalal
2010-01-01
Shewanella halifaxensis and Shewanella sediminis were among a few aquatic γ-proteobacteria that were psychrophiles and the first anaerobic bacteria that degraded hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX). Although many mesophilic or psychrophilic strains of Shewanella and γ-proteobacteria were sequenced for their genomes, the genomic evolution pathways for temperature adaptation were poorly understood. On the other hand, the genes responsible for anaerobic RDX mineralization pathways remain unknown. To determine the unique genomic properties of bacteria responsible for both cold-adaptation and RDX degradation, the genomes of S. halifaxensis and S. sediminis were sequenced and compared with 108 other γ-proteobacteria including Shewanella that differ in temperature and Na+ requirements, as well as RDX degradation capability. Results showed that for coping with marine environments their genomes had extensively exchanged with deep sea bacterial genomes. Many genes for Na+-dependent nutrient transporters were recruited to use the high Na+ content as an energy source. For coping with low temperatures, these two strains as well as other psychrophilic strains of Shewanella and γ-proteobacteria were found to decrease their genome G+C content and proteome alanine, proline and arginine content (p-value <0.01) to increase protein structural flexibility. Compared to poorer RDX-degrading strains, S. halifaxensis and S. sediminis have more number of genes for cytochromes and other enzymes related to RDX metabolic pathways. Experimentally, one cytochrome was found induced in S. halifaxensis by RDX when the chemical was the sole terminal electron acceptor. The isolated protein degraded RDX by mono-denitration and was identified as a multiheme 52 kDa cytochrome using a proteomic approach. The present analyses provided the first insight into divergent genomic evolution of bacterial strains for adaptation to the specific cold marine conditions and to the degradation of the
The quest to achieve the detailed structural and functional characterization of CymA.
Louro, Ricardo O; Paquete, Catarina M
2012-12-01
Shewanella oneidensis MR-1 is a sediment organism capable of dissimilatory reduction of insoluble metal compounds such as those of Fe(II) and Mn(IV). This bacterium has been used as a model organism for potential applications in bioremediation of contaminated environments and in the production of energy in microbial fuel cells. The capacity of Shewanella to perform extracellular reduction of metals is linked to the action of several multihaem cytochromes that may be periplasmic or can be associated with the inner or outer membrane. One of these cytochromes is CymA, a membrane-bound tetrahaem cytochrome localized in the periplasm that mediates the electron transfer between the quinone pool in the cytoplasmic membrane and several periplasmic proteins. Although CymA has the capacity to regulate multiple anaerobic respiratory pathways, little is known about the structure and functional mechanisms of this focal protein. Understanding the structure and function of membrane proteins is hampered by inherent difficulties associated with their purification since the choice of the detergents play a critical role in the protein structure and stability. In the present mini-review, we detail the current state of the art in the characterization of CymA, and add recent information on haem structural behaviour for CymA solubilized in different detergents. These structural differences are deduced from NMR spectroscopy data that provide information on the geometry of the haem axial ligands. At least two different conformational forms of CymA are observed for different detergents, which seem to be related to the micelle size. These results provide guidance for the discovery of the most promising detergent that mimics the native lipid bilayer and is compatible with biochemical and structural studies.
A comparative analysis of tellurite detoxification by members of the genus Shewanella.
Valdivia-González, M A; Díaz-Vásquez, W A; Ruiz-León, D; Becerra, A A; Aguayo, D R; Pérez-Donoso, J M; Vásquez, C C
2018-03-01
The increasing industrial utilization of tellurium has resulted in an important environmental pollution with the soluble, extremely toxic oxyanion tellurite. In this context, the use of microorganisms for detoxifying tellurite or tellurium biorecovery has gained great interest. The ability of different Shewanella strains to reduce tellurite to elemental tellurium was assessed; the results showed that the reduction process is dependent on electron transport and the ∆pH gradient. While S. baltica OS155 showed the highest tellurite resistance, S. putrefaciens was the most efficient in reducing tellurite. Moreover, pH-dependent tellurite transformation was associated with tellurium precipitation as tellurium dioxide. In summary, this work highlights the high tellurite reduction/detoxification ability exhibited by a number of Shewanella species, which could represent the starting point to develop friendly methods for the recovery of elemental tellurium (or tellurium dioxide).
Szeinbaum, Nadia; Kellum, Cailin E; Glass, Jennifer B; Janda, J Michael; DiChristina, Thomas J
2018-04-01
Previously, experimental DNA-DNA hybridization (DDH) between Shewanellahaliotis JCM 14758 T and Shewanellaalgae JCM 21037 T had suggested that the two strains could be considered different species, despite minimal phenotypic differences. The recent isolation of Shewanella sp. MN-01, with 99 % 16S rRNA gene identity to S. algae and S. haliotis, revealed a potential taxonomic problem between these two species. In this study, we reassessed the nomenclature of S. haliotis and S. algae using available whole-genome sequences. The whole-genome sequence of S. haliotis JCM 14758 T and ten S. algae strains showed ≥97.7 % average nucleotide identity and >78.9 % digital DDH, clearly above the recommended species thresholds. According to the rules of priority and in view of the results obtained, S. haliotis is to be considered a later heterotypic synonym of S. algae. Because the whole-genome sequence of Shewanella sp. strain MN-01 shares >99 % ANI with S. algae JCM 14758 T , it can be confidently identified as S. algae.
Kinetics of Microbial Reduction of Solid Phase U(VI)
DOE Office of Scientific and Technical Information (OSTI.GOV)
Liu, Chongxuan; Jeon, Byong Hun; Zachara, John M.
2006-10-01
Sodium boltwoodite (NaUO2SiO3OH ?1.5H2O) was used to assess the kinetics of microbial reduction of solid phase U(VI) by a dissimilatory metal-reducing bacterium (DMRB), Shewanella oneidensis strain MR-1. The bioreduction kinetics was studied with Na-boltwoodite in suspension or within alginate beads. Concentrations of U(VI)tot and cell number were varied to evaluate the coupling of U(VI) dissolution, diffusion, and microbial activity. Batch experiments were performed in a non-growth medium with lactate as electron donor at pH 6.8 buffered with PIPES. Microscopic and spectroscopic analyses with transmission electron microscopy (TEM), energy dispersive spectroscopy (EDS), and laser-induced fluorescence spectroscopy (LIFS) collectively indicated that solidmore » phase U(VI) was first dissolved and diffused out of grain interiors before it was reduced on bacterial surfaces and/or within the periplasm. The kinetics of solid phase U(VI) bioreduction was well described by a coupled model of bicarbonate-promoted dissolution of Na-boltwoodite, intraparticle uranyl diffusion, and Monod type bioreduction kinetics with respect to dissolved U(VI) concentration. The results demonstrated the intimate coupling of biological, chemical, and physical processes in microbial reduction of solid phase U(VI).« less
Single-Cell Imaging and Spectroscopic Analyses of Cr(VI) Reduction on the Surface of Bacterial Cells
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wang, Yuanmin; Sevinc, Papatya C.; Belchik, Sara M.
2013-01-22
We investigate single-cell reduction of toxic Cr(VI) by the dissimilatory metal-reducing bacterium Shewanella oneidensis MR-1 (MR-1), an important bioremediation process, using Raman spectroscopy and scanning electron microscopy (SEM) combined with energy-dispersive X-ray spectroscopy (EDX). Our experiments indicate that the toxic and highly soluble Cr(VI) can be efficiently reduced to the less toxic and non-soluble Cr2O3 nanoparticles by MR-1. Cr2O3 is observed to emerge as nanoparticles adsorbed on the cell surface and its chemical nature is identified by EDX imaging and Raman spectroscopy. Co-localization of Cr2O3 and cytochromes by EDX imaging and Raman spectroscopy suggests a terminal reductase role for MR-1more » surface-exposed cytochromes MtrC and OmcA. Our experiments revealed that the cooperation of surface proteins OmcA and MtrC makes the reduction reaction most efficient, and the sequence of the reducing reactivity of the MR-1 is: wild type > single mutant @mtrC or mutant @omcA > double mutant (@omcA-@mtrC). Moreover, our results also suggest that the direct microbial Cr(VI) reduction and Fe(II) (hematite)-mediated Cr(VI) reduction mechanisms may co-exist in the reduction processes.« less
A universal TagModule collection for parallel genetic analysis of microorganisms
Oh, Julia; Fung, Eula; Price, Morgan N.; Dehal, Paramvir S.; Davis, Ronald W.; Giaever, Guri; Nislow, Corey; Arkin, Adam P.; Deutschbauer, Adam
2010-01-01
Systems-level analyses of non-model microorganisms are limited by the existence of numerous uncharacterized genes and a corresponding over-reliance on automated computational annotations. One solution to this challenge is to disrupt gene function using DNA tag technology, which has been highly successful in parallelizing reverse genetics in Saccharomyces cerevisiae and has led to discoveries in gene function, genetic interactions and drug mechanism of action. To extend the yeast DNA tag methodology to a wide variety of microorganisms and applications, we have created a universal, sequence-verified TagModule collection. A hallmark of the 4280 TagModules is that they are cloned into a Gateway entry vector, thus facilitating rapid transfer to any compatible genetic system. Here, we describe the application of the TagModules to rapidly generate tagged mutants by transposon mutagenesis in the metal-reducing bacterium Shewanella oneidensis MR-1 and the pathogenic yeast Candida albicans. Our results demonstrate the optimal hybridization properties of the TagModule collection, the flexibility in applying the strategy to diverse microorganisms and the biological insights that can be gained from fitness profiling tagged mutant collections. The publicly available TagModule collection is a platform-independent resource for the functional genomics of a wide range of microbial systems in the post-genome era. PMID:20494978
Ratiometric Gas Reporting: A Nondisruptive Approach To Monitor Gene Expression in Soils.
Cheng, Hsiao-Ying; Masiello, Caroline A; Del Valle, Ilenne; Gao, Xiaodong; Bennett, George N; Silberg, Jonathan J
2018-03-16
Fluorescent proteins are ubiquitous tools that are used to monitor the dynamic functions of natural and synthetic genetic circuits. However, these visual reporters can only be used in transparent settings, a limitation that complicates nondisruptive measurements of gene expression within many matrices, such as soils and sediments. We describe a new ratiometric gas reporting method for nondisruptively monitoring gene expression within hard-to-image environmental matrices. With this approach, C 2 H 4 is continuously synthesized by ethylene forming enzyme to provide information on viable cell number, and CH 3 Br is conditionally synthesized by placing a methyl halide transferase gene under the control of a conditional promoter. We show that ratiometric gas reporting enables the creation of Escherichia coli biosensors that report on acylhomoserine lactone (AHL) autoinducers used for quorum sensing by Gram-negative bacteria. Using these biosensors, we find that an agricultural soil decreases the bioavailable concentration of a long-chain AHL up to 100-fold. We also demonstrate that these biosensors can be used in soil to nondisruptively monitor AHLs synthesized by Rhizobium leguminosarum and degraded by Bacillus thuringiensis. Finally, we show that this new reporting approach can be used in Shewanella oneidensis, a bacterium that lives in sediments.
Byun, Jung-Hyun; Park, Hyunwoong; Kim, Sunjoo
2017-03-24
Although Shewanella algae has been known to have weak pathogenicity, case reports on infections with this species have been steadily increasing. S. algae and S. haliotis are difficult to distinguish from each other with conventional phenotypic methods. We reviewed the microbiological and clinical features of S. algae and S. haliotis infections at our institute. Bacterial culture and identification reports from patient samples from 2010 to 2014 were reviewed to screen the cases of Shewanella infections. In addition to conventional biochemical tests, 16S rRNA gene sequence analysis and matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry were performed for 19 stored bacterial isolates. Medical records were reviewed for clinical characteristics and laboratory findings. All isolates were identified as S. algae by using VITEK 2. MALDI-TOF also identified all isolates as S. algae with a 99.9 confidence value. In contrast, 16S rRNA analysis identified 10 isolates as S. algae and 9 isolates as S. haliotis. Both S. algae (60%) and S. haliotis (77%) infections were strongly associated with diseases of the hepatobiliary tract and pancreas. To distinguish between S. algae and S. haliotis, 16S rRNA gene sequence analysis seems more accurate than biochemical tests or MALDI-TOF. Patients with underlying diseases in the hepatobiliary tract and pancreas seem to be susceptible to these marine pathogens.
Single Upconversion Nanoparticle-Bacterium Cotrapping for Single-Bacterium Labeling and Analysis.
Xin, Hongbao; Li, Yuchao; Xu, Dekang; Zhang, Yueli; Chen, Chia-Hung; Li, Baojun
2017-04-01
Detecting and analyzing pathogenic bacteria in an effective and reliable manner is crucial for the diagnosis of acute bacterial infection and initial antibiotic therapy. However, the precise labeling and analysis of bacteria at the single-bacterium level are a technical challenge but very important to reveal important details about the heterogeneity of cells and responds to environment. This study demonstrates an optical strategy for single-bacterium labeling and analysis by the cotrapping of single upconversion nanoparticles (UCNPs) and bacteria together. A single UCNP with an average size of ≈120 nm is first optically trapped. Both ends of a single bacterium are then trapped and labeled with single UCNPs emitting green light. The labeled bacterium can be flexibly moved to designated locations for further analysis. Signals from bacteria of different sizes are detected in real time for single-bacterium analysis. This cotrapping method provides a new approach for single-pathogenic-bacterium labeling, detection, and real-time analysis at the single-particle and single-bacterium level. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Richardson, David J.; Edwards, Marcus; White, Gaye F.
2012-06-01
Many species of the bacterial Shewanella genus are notable for their ability to respire in anoxic environments utilizing insoluble minerals of Fe(III) and Mn(IV) as extracellular electron acceptors. In Shewanella oneidensis, the process is dependent on the decahaem electron-transport proteins that lie at the extracellular face of the outer membrane where they can contact the insoluble mineral substrates. These extracellular proteins are charged with electrons provided by an inter-membrane electron-transfer pathway that links the extracellular face of the outer membrane with the inner cytoplasmic membrane and thereby intracellular electron sources. In the present paper, we consider the common structural featuresmore » of two of these outermembrane decahaem cytochromes, MtrC and MtrF, and bring this together with biochemical, spectroscopic and voltammetric data to identify common and distinct properties of these prototypical members of different clades of the outer-membrane decahaem cytochrome superfamily.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cao, Bin; Ahmed, B.; Kennedy, David W.
2011-06-05
The goal of this study was to quantify the contribution of extracellular polymeric substances (EPS) in U(VI) immobilization by Shewanella sp. HRCR-1. Through comparison of U(VI) immobilization using cells with bound EPS (bEPS) and cells without EPS, we showed that i) bEPS from Shewanella sp. HRCR-1 biofilms contributed significantly to U(VI) immobilization, especially at low initial U(VI) concentrations, through both sorption and reduction; ii) bEPS could be considered as a functional extension of the cells for U(VI) immobilization and they likely play more important roles at initial U(VI) concentrations; and iii) U(VI) reduction efficiency was found to be dependent uponmore » initial U(VI) concentration and the efficiency decreased at lower concentrations. To quantify relative contribution of sorption and reduction in U(VI) immobilization by EPS fractions, we isolated loosely associated EPS (laEPS) and bEPS from Shewanella sp. HRCR-1 biofilms grown in a hollow fiber membrane biofilm reactor and tested their reactivity with U(V). We found that, when in reduced form, the isolated cell-free EPS fractions could reduce U(VI). Polysaccharides in the EPS likely contributed to U(VI) sorption and dominated reactivity of laEPS while redox active components (e.g., outer membrane c-type cytochromes), especially in bEPS, might facilitate U(VI) reduction.« less
Cao, Bin; Ahmed, Bulbul; Kennedy, David W; Wang, Zheming; Shi, Liang; Marshall, Matthew J; Fredrickson, Jim K; Isern, Nancy G; Majors, Paul D; Beyenal, Haluk
2011-07-01
The goal of this study was to quantify the contribution of extracellular polymeric substances (EPS) to U(VI) immobilization by Shewanella sp. HRCR-1. Through comparison of U(VI) immobilization using cells with bound EPS (bEPS) and cells with minimal EPS, we show that (i) bEPS from Shewanella sp. HRCR-1 biofilms contribute significantly to U(VI) immobilization, especially at low initial U(VI) concentrations, through both sorption and reduction; (ii) bEPS can be considered a functional extension of the cells for U(VI) immobilization and they likely play more important roles at lower initial U(VI) concentrations; and (iii) the U(VI) reduction efficiency is dependent upon the initial U(VI) concentration and decreases at lower concentrations. To quantify the relative contributions of sorption and reduction to U(VI) immobilization by EPS fractions, we isolated loosely associated EPS (laEPS) and bEPS from Shewanella sp. HRCR-1 biofilms grown in a hollow fiber membrane biofilm reactor and tested their reactivity with U(VI). We found that, when reduced, the isolated cell-free EPS fractions could reduce U(VI). Polysaccharides in the EPS likely contributed to U(VI) sorption and dominated the reactivity of laEPS, while redox active components (e.g., outer membrane c-type cytochromes), especially in bEPS, possibly facilitated U(VI) reduction.
Modeling of Sustainable Base Production by Microbial Electrolysis Cell.
Blatter, Maxime; Sugnaux, Marc; Comninellis, Christos; Nealson, Kenneth; Fischer, Fabian
2016-07-07
A predictive model for the microbial/electrochemical base formation from wastewater was established and compared to experimental conditions within a microbial electrolysis cell. A Na2 SO4 /K2 SO4 anolyte showed that model prediction matched experimental results. Using Shewanella oneidensis MR-1, a strong base (pH≈13) was generated using applied voltages between 0.3 and 1.1 V. Due to the use of bicarbonate, the pH value in the anolyte remained unchanged, which is required to maintain microbial activity. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Microbial activity at gigapascal pressures.
Sharma, Anurag; Scott, James H; Cody, George D; Fogel, Marilyn L; Hazen, Robert M; Hemley, Russell J; Huntress, Wesley T
2002-02-22
We observed physiological and metabolic activity of Shewanella oneidensis strain MR1 and Escherichia coli strain MG1655 at pressures of 68 to 1680 megapascals (MPa) in diamond anvil cells. We measured biological formate oxidation at high pressures (68 to 1060 MPa). At pressures of 1200 to 1600 MPa, living bacteria resided in fluid inclusions in ice-VI crystals and continued to be viable upon subsequent release to ambient pressures (0.1 MPa). Evidence of microbial viability and activity at these extreme pressures expands by an order of magnitude the range of conditions representing the habitable zone in the solar system.
In situ nuclear magnetic resonance microimaging of live biofilms in a microchannel
DOE Office of Scientific and Technical Information (OSTI.GOV)
Renslow, R. S.; Marshall, M. J.; Tucker, A. E.
Nuclear magnetic resonance (NMR) microimaging and spectroscopy was used to interrogate fluids of biological importance (e.g., water, buffer, medium solution) and live biofilms in a microchannel compatible for analyses at ambient pressure and under vacuum. Studies using buffer, growth medium, and actively growing Shewanella oneidensis biofilms were used to demonstrate in situ NMR microimaging measurement capabilities including velocity mapping, diffusion coefficient mapping, relaxometry, localized spectroscopy, and 2D and 3D imaging within a microchannel suitable for different analytical platforms. This technique is promising for diverse applications of correlative imaging using a portable microfluidic platform.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wu, Liyou; Yi, T. Y.; Van Nostrand, Joy
Phylogenetic analyses were done for the Shewanella strains isolated from Baltic Sea (38 strains), US DOE Hanford Uranium bioremediation site [Hanford Reach of the Columbia River (HRCR), 11 strains], Pacific Ocean and Hawaiian sediments (8 strains), and strains from other resources (16 strains) with three out group strains, Rhodopseudomonas palustris, Clostridium cellulolyticum, and Thermoanaerobacter ethanolicus X514, using DNA relatedness derived from WCGA-based DNA-DNA hybridizations, sequence similarities of 16S rRNA gene and gyrB gene, and sequence similarities of 6 loci of Shewanella genome selected from a shared gene list of the Shewanella strains with whole genome sequenced based on the averagemore » nucleotide identity of them (ANI). The phylogenetic trees based on 16S rRNA and gyrB gene sequences, and DNA relatedness derived from WCGA hybridizations of the tested Shewanella strains share exactly the same sub-clusters with very few exceptions, in which the strains were basically grouped by species. However, the phylogenetic analysis based on DNA relatedness derived from WCGA hybridizations dramatically increased the differentiation resolution at species and strains level within Shewanella genus. When the tree based on DNA relatedness derived from WCGA hybridizations was compared to the tree based on the combined sequences of the selected functional genes (6 loci), we found that the resolutions of both methods are similar, but the clustering of the tree based on DNA relatedness derived from WMGA hybridizations was clearer. These results indicate that WCGA-based DNA-DNA hybridization is an idea alternative of conventional DNA-DNA hybridization methods and it is superior to the phylogenetics methods based on sequence similarities of single genes. Detailed analysis is being performed for the re-classification of the strains examined.« less
Diffusion in biofilms respiring on electrodes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Renslow, Ryan S.; Babauta, Jerome T.; Majors, Paul D.
2012-11-15
The goal of this study was to measure spatially and temporally resolved effective diffusion coefficients (De) in biofilms respiring on electrodes. Two model electrochemically active biofilms, Geobacter sulfurreducens PCA and Shewanella oneidensis MR-1, were investigated. A novel nuclear magnetic resonance microimaging perfusion probe capable of simultaneous electrochemical and pulsed-field gradient nuclear magnetic resonance (PFG-NMR) techniques was used. PFG-NMR allowed for noninvasive, nondestructive, high spatial resolution in situ De measurements in living biofilms respiring on electrodes. The electrodes were polarized so that they would act as the sole terminal electron acceptor for microbial metabolism. We present our results as both two-dimensionalmore » De heat maps and surface-averaged relative effective diffusion coefficient (Drs) depth profiles. We found that (1) Drs decreases with depth in G. sulfurreducens biofilms, following a sigmoid shape; (2) Drs at a given location decreases with G. sulfurreducens biofilm age; (3) average De and Drs profiles in G. sulfurreducens biofilms are lower than those in S. oneidensis biofilms—the G. sulfurreducens biofilms studied here were on average 10 times denser than the S. oneidensis biofilms; and (4) halting the respiration of a G. sulfurreducens biofilm decreases the De values. Density, reflected by De, plays a major role in the extracellular electron transfer strategies of electrochemically active biofilms.« less
Flavins secreted by bacterial cells of Shewanella catalyze cathodic oxygen reduction.
Liu, Huan; Matsuda, Shoichi; Hashimoto, Kazuhito; Nakanishi, Shuji
2012-06-01
On Her Majesty's Secrete Service: Oxygen reduction is an important process for microbial fuel cells (MFCs) and microbiologically-influenced corrosion (MIC). We demonstrate that flavins secreted by anode-respiring Shewanella cells can catalyze cathodic oxygen reduction via adsorption on the cathode. The findings will provide new insight for developing methods to improve MFC performance and to prevent MIC. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Influence of Calcium on Microbial Reduction of Solid Phase Uranium (VI)
DOE Office of Scientific and Technical Information (OSTI.GOV)
Liu, Chongxuan; Jeon, Byong-Hun; Zachara, John M.
2007-06-27
The effect of calcium on microbial reduction of a solid phase U(VI), sodium boltwoodite (NaUO2SiO3OH ∙1.5H2O), was evaluated in a culture of a dissimilatory metal-reducing bacterium (DMRB), Shewanella oneidensis strain MR-1. Batch experiments were performed in a non-growth bicarbonate medium with lactate as electron donor at pH 7 buffered with PIPES. Calcium increased both the rate and extent of Na-boltwoodite dissolution by increasing its solubility through the formation of a ternary aqueous calcium-uranyl-carbonate species. The ternary species, however, decreased the rates of microbial reduction of aqueous U(VI). Laser-induced fluorescence spectroscopy (LIFS) and transmission electron microscopy (TEM) revealed that microbial reductionmore » of solid phase U(VI) is a sequentially coupled process of Na-boltwoodite dissolution, U(VI) aqueous speciation, and microbial reduction of dissolved U(VI) to U(IV) that accumulated on bacterial surfaces/periplasm. The overall rates of microbial reduction of solid phase U(VI) can be described by the coupled rates of dissolution and microbial reduction that were both influenced by calcium. The results demonstrated that dissolved U(VI) concentration during microbial reduction was a complex function of solid phase U(VI) dissolution kinetics, aqueous U(VI) speciation, and microbial activity.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sharma, Seema; Simpson, David C.; Tolic, Nikola
We investigated the combination of weak anion exchange (WAX) fractionation and on-line reversed phase liquid chromatography (RPLC) separation using a 12 T FTICR mass spectrometer for the detection of intact proteins from a Shewanella oneidensis MR-1 cell lysate. 715 intact proteins were detected and the combined results from the WAX fractions and the unfractionated cell lysate were aligned using LC-MS features to facilitate protein abundance measurements. Protein identifications and post translational modifications were assigned for ~10% of the detected proteins by comparing intact protein mass measurements to proteins identified in peptide MS/MS analysis of an aliquot of the same fraction.more » Intact proteins were also detected for S. oneidensis lysates obtained from cells grown on 13C, 15N depleted media under aerobic and sub-oxic conditions. This work aimed at optimizing intact protein detection for profiling proteins at a level that incorporates their modification complement. The strategy can be readily applied for measuring differential protein abundances, and provides a platform for high-throughput selection of biologically relevant targets for further characterization.« less
Recovery of Elemental Palladium by Shewanella putrefaciens
NASA Astrophysics Data System (ADS)
Akasaka, S.; Xia, X.; Sawada, K.; Enokida, Y.; Yamamoto, I.; Ohnuki, T.
2006-12-01
Microbial reduction of metals plays an important role in environmental behavior and provides a technique for the recovery of metals from industrial wastewater. Recently, demand for platinum group metals (PGMs) increases by their catalytic properties. The extreme rarity of PGMs have led to a growing interest in their recovery. Palladium, one of PGMs, has different oxidation states of Pd(II) and Pd(0). The oxidized form of Pd(II) is soluble, while the reduced form of Pd(0) is insoluble. In this study, microbial reduction of palladium by Fe(III)- reducing bacterium, Shewanella putrefaceins was conducted. This bacterium is known to be capable of reducing metals, such as Mn(IV), U(VI), or Tc(VII) with organic C or H2 as an electron donor. In order to investigate the potential of S. putrefaciens to reduce Pd(II) in solution, resting cells or heat-killed cells were suspended under anaerobic conditions with lactate or H2 as an electron donor. The cells of S. putrefaciens (NBRC3908) were grown in aerobic medium, harvested by centrifugation, and then washed with 25 mmol/dm3 HEPES and 100 mmol/dm3 NaCl (HEPES-NaCl) solution (pH 7.0). The heat-killed cells were autoclaved for 20 min at 121 degrees C. The cell suspension (21.5 mg in dry weight) was resuspended in the HEPES-NaCl solution which contained 1.0 mmol/dm3 Na2PdCl4 (Wako Pure chemical Industries, Ltd). The suspensions were bubbled with N2 for 15 min before 10 mmol/dm3 lactate or 4.8 v/v% H2 was added. The suspensions were then incubated at 30 degrees C. Redox potential (Eh) and pH of the solutions were measured in an inert glove box with Ar gas. Concentration of Pd(II) was measured by Inductively Coupled Plasma Atomic Emission Spectrometer (ICP-AES). Deposited Pd and cells were analyzed by X-ray powder diffraction (XRD) and Scanning Electron Microscope (SEM) with Energy-Dispersive Spectroscopy (EDS). Approximately 86% of Pd(II) of the initial concentration was removed from solution by the resting cells within 24 h when
2012-01-01
Kan, J. B. Flood, J.P. McCrow, J.S. Kim, L. Tan , and K.H. Nealson. 2011. A rapid fingerprinting approach to distinguish between closely related...strains of Shewanella. J. Microbiol. Methods. 86: 62-68. 33. Kan, J. Wang, Y., A. Obraztsova, G. Rosen, J. Leather , K.G. Scheckel, K.H. Nealson, and Y.M
NASA Technical Reports Server (NTRS)
Saffarini, Daad A.; Nelson, Kenneth H.
1993-01-01
An electron transport regulatory gene, etrA, has been isolated and characterized from the obligate respiratory bacterium Shewanella putrefaciens MR-l. The deduced amino acid sequence of etrA (EtrA) shows a high degree of identity to both the Fnr of Escherichia coli (73.6%) and the analogous protein (ANR) of Pseudomonas aeruginosa (50.8%). The four active cysteine residues of Fnr are conserved in EtrA, and the amino acid sequence of the DNA-binding domains of the two proteins are identical. Further, S.putrefaciens etrA is able to complement an fnr mutant of E.coli. In contrast to fnr, there is no recognizable Fnr box upstream of the etrA sequence. Gene replacement etr.A mutants of MR-1 were deficient in growth on nitrite, thiosulfate, sulfite, trimethylamine-N-oxide, dimethyl sulfoxide, Fe(III), and fumarate, suggesting that EtrA is involved in the regulation of the corresponding reductase genes. However, the mutants were all positive for reduction of and growth on nitrate and Mn(IV), indicating that EtrA is not involved in the regulation of these two systems. Southern blots of S.putrefaciens DNA with use of etrA as a probe revealed the expected etrA bands and a second set of hybridization signals whose genetic and functional properties remain to be determined.
Yang, Yunfeng; Zhu, Mengxia; Wu, Liyou; Zhou, Jizhong
2008-09-16
Using genomic DNA as common reference in microarray experiments has recently been tested by different laboratories. Conflicting results have been reported with regard to the reliability of microarray results using this method. To explain it, we hypothesize that data processing is a critical element that impacts the data quality. Microarray experiments were performed in a gamma-proteobacterium Shewanella oneidensis. Pair-wise comparison of three experimental conditions was obtained either with two labeled cDNA samples co-hybridized to the same array, or by employing Shewanella genomic DNA as a standard reference. Various data processing techniques were exploited to reduce the amount of inconsistency between both methods and the results were assessed. We discovered that data quality was significantly improved by imposing the constraint of minimal number of replicates, logarithmic transformation and random error analyses. These findings demonstrate that data processing significantly influences data quality, which provides an explanation for the conflicting evaluation in the literature. This work could serve as a guideline for microarray data analysis using genomic DNA as a standard reference.
Song, Rong-Bin; Zhao, Cui-E; Jiang, Li-Ping; Abdel-Halim, Essam Sayed; Zhang, Jian-Rong; Zhu, Jun-Jie
2016-06-29
Promoting the performance of microbial fuel cells (MFCs) relies heavily on the structure design and composition tailoring of electrode materials. In this work, three-dimensional (3D) macroporous graphene foams incorporated with intercalated spacer of multiwalled carbon nanotubes (MWCNTs) and bacterial anchor of Fe3O4 nanospheres (named as G/MWCNTs/Fe3O4 foams) were first synthesized and used as anodes for Shewanella-inoculated microbial fuel cells (MFCs). Thanks to the macroporous structure of 3D graphene foams, the expanded electrode surface by MWCNTs spacing, as well as the high affinity of Fe3O4 nanospheres toward Shewanella oneidensis MR-1, the anode exhibited high bacterial loading capability. In addition to spacing graphene nanosheets for accommodating bacterial cells, MWCNTs paved a smoother way for electron transport in the electrode substrate of MFCs. Meanwhile, the embedded bioaffinity Fe3O4 nanospheres capable of preserving the bacterial metabolic activity provided guarantee for the long-term durability of the MFCs. With these merits, the constructed MFC possessed significantly higher power output and stronger stability than that with conventional graphite rod anode.
Li, Chao; Xu, Ming; Lu, Yi; Fang, Fang; Cao, Jiashun
2016-01-01
Two types of cathodic biofilm in microbial fuel cells (MFC) were established for comparison on their performance and microbial communities. Complete autotrophic simultaneous nitrification and denitrification (SND) without organics addition was achieved in nitrifying-MFC (N-MFC) with a total nitrogen (TN) removal rate of 0.35 mg/(L·h), which was even higher than that in denitrifying-MFC (D-MFC) at same TN level. Integrated denaturing gradient gel electrophoresis analysis based on both 16S rRNA and nirK genes showed that Alpha-, Gammaproteobacteria were the main denitrifier communities. Some potential autotrophic denitrifying bacteria which can use electrons and reducing power from cathodes, such as Shewanella oneidensis, Shewanella loihica, Pseudomonas aeruginosa, Starkeya novella and Rhodopseudomonas palustris were identified and selectively enriched on cathode biofilms. Further, relative abundance of denitrifying bacteria characterized by nirK/16S ratios was much higher in biofilm than suspended sludge according to real-time polymerase chain reaction. The highest enrichment efficiency for denitrifiers was obtained in N-MFC cathode biofilms, which confirmed autotrophic denitrifying bacteria enrichment is the key factor for a D-MFC system.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tang, Yinjie J.; Ashcroft, Jared M.; Chen, Ding
2007-01-23
The effects of four types of fullerene compounds (C60,C60-OH, C60-COOH, C60-NH2) were examined on two model microorganisms(Escherichia coli W3110 and Shewanella oneidensis MR-1). Positivelycharged C60-NH2 at concentrations as low as 10 mg/L inhibited growth andreduced substrate uptake for both microorganisms. Scanning ElectronMicroscopy (SEM) revealed damage to cellular structures.Neutrally-charged C60 and C60-OH had mild negative effects on S.oneidensis MR-1, whereas the negatively-charged C60-COOH did not affecteither microorganism s growth. The effect of fullerene compounds onglobal metabolism was further investigated using [3-13C]L-lactateisotopic labeling, which tracks perturbations to metabolic reaction ratesin bacteria by examining the change in the isotopic labeling pattern inthe resultingmore » metabolites (often amino acids).1-3 The 13C isotopomeranalysis from all fullerene-exposed cultures revealed no significantdifferences in isotopomer distributions from unstressed cells. Thisresult indicates that microbial central metabolism is robust toenvironmental stress inflicted by fullerene nanoparticles. In addition,although C60-NH2 compounds caused mechanical stress on the cell wall ormembrane, both S. oneidensis MR-1 and E. coli W3110 can efficientlyalleviate such stress by cell aggregation and precipitation of the toxicnanoparticles. The results presented here favor the hypothesis thatfullerenes cause more membrane stress4, 5, 6 than perturbation to energymetabolism7« less
USDA-ARS?s Scientific Manuscript database
Shewanella marisflavi isolate AP629 was characterized as a novel pathogen of sea cucumber. The LD50 values (14 days) in sea cucumber and swordtail fish were 3.89 × 106 and 4.85 × 104 CFU g-1 body weight, respectively. Studies on S. marisflavi had been conducted, including morphology, physiological a...
Parmeciano Di Noto, Gisela; Jara, Eugenio; Iriarte, Andrés; Centrón, Daniela; Quiroga, Cecilia
2016-08-01
Shewanella spp. are currently considered to be emerging pathogens that can code for a blaOXA carbapenemase in their chromosome. Complete genome analysis of the clinical isolate Shewanella sp. Sh95 revealed that this strain is a novel species, which shares a lineage with marine isolates. Characterization of its resistome showed that it codes for genes drfA15, qacH and blaOXA-48. We propose that Shewanella sp. Sh95 acts as reservoir of blaOXA-48. Moreover, analysis of mobilome showed that it contains a novel integrative and conjugative element (ICE), named ICESh95. Comparative analysis between the close relatives ICESpuPO1 from Shewanella sp. W3-18-1 and ICE SXTMO10 from Vibrio cholerae showed that ICESh95 encompassed two new regions, a type III restriction modification system and a multidrug resistance integron. The integron platform contained a novel arrangement formed by gene cassettes drfA15 and qacH, and a class C-attC group II intron. Furthermore, insertion of ICESh95 occurred at a unique target site, which correlated with the presence of a different xis/int module. Mobility of ICESh95 was assessed and demonstrated its ability to self-transfer with high efficiency to different species of bacteria. Our results show that ICESh95 is a self-transmissible, mobile element, which can contribute to the dissemination of antimicrobial resistance; this is clearly a threat when natural bacteria from water ecosystems, such as Shewanella, act as vectors in its propagation.
Bräuer, S. L.; Adams, C.; Kranzler, K.; Murphy, D.; Xu, M.; Zuber, P.; Simon, H. M.; Baptista, A. M.; Tebo, B. M.
2017-01-01
Summary Measurements of dissolved, ascorbate-reducible and total Mn by ICP-OES revealed significantly higher concentrations during estuarine turbidity maxima (ETM) events, compared with non-events in the Columbia River. Most probable number (MPN) counts of Mn-oxidizing or Mn-reducing heterotrophs were not statistically different from that of other heterotrophs (103–104 cells ml−1) when grown in defined media, but counts of Mn oxidizers were significantly lower in nutrient-rich medium (13 cells ml−1). MPN counts of Mn oxidizers were also significantly lower on Mn(III)-pyrophosphate and glycerol (21 cells ml−1). Large numbers of Rhodobacter spp. were cultured from dilutions of 10−2 to 10−5, and many of these were capable of Mn(III) oxidation. Up to c. 30% of the colonies tested LBB positive, and all 77 of the successfully sequenced LBB positive colonies (of varying morphology) yielded sequences related to Rhodobacter spp. qPCR indicated that a cluster of Rhodobacter isolates and closely related strains (95–99% identity) represented approximately 1–3% of the total Bacteria, consistent with clone library results. Copy numbers of SSU rRNA genes for either Rhodobacter spp. or Bacteria were four to eightfold greater during ETM events compared with non-events. Strains of a Shewanella sp. were retrieved from the highest dilutions (10−5) of Mn reducers, and were also capable of Mn oxidation. The SSU rRNA gene sequences from these strains shared a high identity score (98%) with sequences obtained in clone libraries. Our results support previous findings that ETMs are zones with high microbial activity. Results indicated that Shewanella and Rhodobacter species were present in environmentally relevant concentrations, and further demonstrated that a large proportion of culturable bacteria, including Shewanella and Rhodobacter spp., were capable of Mn cycling in vitro. PMID:20977571
Yang, Yonggang; Sun, Guoping; Guo, Jun; Xu, Meiying
2011-07-01
Biofilms formation capacities of Shewanella species in microbial fuel cells (MFCs) and their roles in current generation have been documented to be species-dependent. Understandings of the biofilms growth and metabolism are essential to optimize the current generation of MFCs. Shewanella decolorationis S12 was used in both closed-circuit and open-circuit MFCs in this study. The anodic S. decolorationis S12 biofilms could generate fivefold more current than the planktonic cells, playing a dominant role in current generation. Anodic biofilms viability was sustained at 98 ± 1.2% in closed-circuit while biofilms viability in open-circuit decreased to 72 ± 7% within 96 h. The unviable domain in open-circuit MFCs biofilms majorly located at the inner layer of biofilm. The decreased biofilms viability in open-circuit MFCs could be recovered by switching into closed-circuit, indicating that the current-generating anode in MFCs could serve as a favorable electron acceptor and provide sufficient energy to support cell growth and metabolism inside biofilms. Copyright © 2011 Elsevier Ltd. All rights reserved.
Brigé, Ann; Motte, Bart; Borloo, Jimmy; Buysschaert, Géraldine; Devreese, Bart; Van Beeumen, Jozef J.
2008-01-01
Summary Many studies have reported microorganisms as efficient biocatalysts for colour removal of dye‐containing industrial wastewaters. We present the first comprehensive study to identify all molecular components involved in decolorization by bacterial cells. Mutants from the model organism Shewanella oneidensis MR‐1, generated by random transposon and targeted insertional mutagenesis, were screened for defects in decolorization of an oxazine and diazo dye. We demonstrate that decolorization is an extracellular reduction process requiring a multicomponent electron transfer pathway that consists of cytoplasmic membrane, periplasmic and outer membrane components. The presence of melanin, a redox‐active molecule excreted by S. oneidensis, was shown to enhance the dye reduction rates. Menaquinones and the cytochrome CymA are the crucial cytoplasmic membrane components of the pathway, which then branches off via a network of periplasmic cytochromes to three outer membrane cytochromes. The key proteins of this network are MtrA and OmcB in the periplasm and outer membrane respectively. A model of the complete dye reduction pathway is proposed in which the dye molecules are reduced by the outer membrane cytochromes either directly or indirectly via melanin. PMID:21261820
Nile Red Detection of Bacterial Hydrocarbons and Ketones in a High-Throughput Format
Pinzon, Neissa M.; Aukema, Kelly G.; Gralnick, Jeffrey A.; Wackett, Lawrence P.
2011-01-01
ABSTRACT A method for use in high-throughput screening of bacteria for the production of long-chain hydrocarbons and ketones by monitoring fluorescent light emission in the presence of Nile red is described. Nile red has previously been used to screen for polyhydroxybutyrate (PHB) and fatty acid esters, but this is the first report of screening for recombinant bacteria making hydrocarbons or ketones. The microtiter plate assay was evaluated using wild-type and recombinant strains of Shewanella oneidensis and Escherichia coli expressing the enzyme OleA, previously shown to initiate hydrocarbon biosynthesis. The strains expressing exogenous Stenotrophomonas maltophilia oleA, with increased levels of ketone production as determined by gas chromatography-mass spectrometry, were distinguished with Nile red fluorescence. Confocal microscopy images of S. oneidensis oleA-expressing strains stained with Nile red were consistent with a membrane localization of the ketones. This differed from Nile red staining of bacterial PHB or algal lipid droplets that showed intracellular inclusion bodies. These results demonstrated the applicability of Nile red in a high-throughput technique for the detection of bacterial hydrocarbons and ketones. PMID:21712420
Oxygen Consumption Rates of Bacteria under Nutrient-Limited Conditions
Riedel, Timothy E.; Nealson, Kenneth H.; Finkel, Steven E.
2013-01-01
Many environments on Earth experience nutrient limitation and as a result have nongrowing or very slowly growing bacterial populations. To better understand bacterial respiration under environmentally relevant conditions, the effect of nutrient limitation on respiration rates of heterotrophic bacteria was measured. The oxygen consumption and population density of batch cultures of Escherichia coli K-12, Shewanella oneidensis MR-1, and Marinobacter aquaeolei VT8 were tracked for up to 200 days. The oxygen consumption per CFU (QO2) declined by more than 2 orders of magnitude for all three strains as they transitioned from nutrient-abundant log-phase growth to the nutrient-limited early stationary phase. The large reduction in QO2 from growth to stationary phase suggests that nutrient availability is an important factor in considering environmental respiration rates. Following the death phase, during the long-term stationary phase (LTSP), QO2 values of the surviving population increased with time and more cells were respiring than formed colonies. Within the respiring population, a subpopulation of highly respiring cells increased in abundance with time. Apparently, as cells enter LTSP, there is a viable but not culturable population whose bulk community and per cell respiration rates are dynamic. This result has a bearing on how minimal energy requirements are met, especially in nutrient-limited environments. The minimal QO2 rates support the extension of Kleiber's law to the mass of a bacterium (100-fg range). PMID:23770901
López-Ferrer, Daniel; Hixson, Kim K.; Smallwood, Heather; Squier, Thomas C.; Petritis, Konstantinos; Smith, Richard D.
2009-01-01
A new method that uses immobilized trypsin concomitant with ultrasonic irradiation results in ultra-rapid digestion and thorough 18O labeling for quantitative protein comparisons. The reproducible and highly efficient method provided effective digestions in <1 min with a minimized amount of enzyme required compared to traditional methods. This method was demonstrated for digestion of both simple and complex protein mixtures, including bovine serum albumin, a global proteome extract from the bacteria Shewanella oneidensis, and mouse plasma, as well as 18O labeling of such complex protein mixtures, which validated the application of this method for differential proteomic measurements. This approach is simple, reproducible, cost effective, rapid, and thus well-suited for automation. PMID:19555078
Osipiuk, Jerzy; Mulligan, Rory; Bargassa, Monireh; Hamilton, John E; Cunningham, Mark A; Joachimiak, Andrzej
2012-06-01
The crystal structure of SO1698 protein from Shewanella oneidensis was determined by a SAD method and refined to 1.57 Å. The structure is a β sandwich that unexpectedly consists of two polypeptides; the N-terminal fragment includes residues 1-116, and the C-terminal one includes residues 117-125. Electron density also displayed the Lys-98 side chain covalently linked to Asp-116. The putative active site residues involved in self-cleavage were identified; point mutants were produced and characterized structurally and in a biochemical assay. Numerical simulations utilizing molecular dynamics and hybrid quantum/classical calculations suggest a mechanism involving activation of a water molecule coordinated by a catalytic aspartic acid.
Osipiuk, Jerzy; Mulligan, Rory; Bargassa, Monireh; Hamilton, John E.; Cunningham, Mark A.; Joachimiak, Andrzej
2012-01-01
The crystal structure of SO1698 protein from Shewanella oneidensis was determined by a SAD method and refined to 1.57 Å. The structure is a β sandwich that unexpectedly consists of two polypeptides; the N-terminal fragment includes residues 1–116, and the C-terminal one includes residues 117–125. Electron density also displayed the Lys-98 side chain covalently linked to Asp-116. The putative active site residues involved in self-cleavage were identified; point mutants were produced and characterized structurally and in a biochemical assay. Numerical simulations utilizing molecular dynamics and hybrid quantum/classical calculations suggest a mechanism involving activation of a water molecule coordinated by a catalytic aspartic acid. PMID:22493430
NASA Astrophysics Data System (ADS)
Chubar, Natalia; Visser, Tom; Avramut, Cristina; de Waard, Helen
2013-01-01
The sorption of Mn(II) by viable and inactivated cells of Shewanella putrefaciens, a non-pathogenic, facultative anaerobic, gram-negative bacterium characterised as a Mn(IV) and Fe(III) reducer, was studied under aerobic conditions, as a function of pH, bacterial density and metal loading. During a short contact time (3-24 h), the adsorptive behaviour of live and dead bacteria toward Mn(II) was sufficiently similar, an observation that was reflected in the studies on adsorption kinetics at various metal loadings, effects of pH, bacteria density, isotherms and drifting of pH during adsorption. Continuing the experiment for an additional 2-30 days demonstrated that the Mn(II) sorption by suspensions of viable and autoclaved cells differed significantly from one another. The sorption to dead cells was characterised by a rapid equilibration and was described by an isotherm. In contrast, the sorption (uptake) to live bacteria exhibited a complex time-dependent uptake. This uptake began as adsorption and ion exchange processes followed by bioprecipitation, and it was accompanied by the formation of polymeric sugars (EPS) and the release of dissolved organic substances. FTIR, EXAFS/XANES and XPS demonstrated that manganese(II) phosphate was the main precipitate formed in 125 ml batches, which is the first evidence of the ability of microbes to synthesise manganese phosphates. XPS and XANES spectra did not detect Mn(II) oxidation. Although the release of protein-like compounds by the viable bacteria increased in the presence of Mn2+ (and, by contrast, the release of carbohydrates did not change), electrochemical analyses did not indicate any aqueous complexation of Mn(II) by the organic ligands.
Parnell, J Jacob; Callister, Stephen J; Rompato, Giovanni; Nicora, Carrie D; Paša-Tolić, Ljiljana; Williamson, Ashley; Pfrender, Michael E
2011-01-01
Shewanellae are microbial models for environmental stress response; however, the sequential expression of mechanisms in response to stress is poorly understood. Here we experimentally determine the response mechanisms of Shewanella amazonensis SB2B during sodium chloride stress using a novel liquid chromatography and accurate mass-time tag mass spectrometry time-course proteomics approach. The response of SB2B involves an orchestrated sequence of events comprising increased signal transduction associated with motility and restricted growth. Following a metabolic shift to branched chain amino acid degradation, motility and cellular replication proteins return to pre-perturbed levels. Although sodium chloride stress is associated with a change in the membrane fatty acid composition in other organisms, this is not the case for SB2B as fatty acid degradation pathways are not expressed and no change in the fatty acid profile is observed. These findings suggest that shifts in membrane composition may be an indirect physiological response to high NaCl stress.
Growth of the facultative anaerobe Shewanella putrefaciens by elemental sulfur reduction
NASA Technical Reports Server (NTRS)
Moser, D. P.; Nealson, K. H.
1996-01-01
The growth of bacteria by dissimilatory elemental sulfur reduction is generally associated with obligate anaerobes and thermophiles in particular. Here we describe the sulfur-dependent growth of the facultatively anaerobic mesophile Shewanella putrefaciens. Six of nine representative S. putrefaciens isolates from a variety of environments proved able to grow by sulfur reduction, and strain MR-1 was chosen for further study. Growth was monitored in a minimal medium (usually with 0.05% Casamino Acids added as a growth stimulant) containing 30 mM lactate and limiting concentrations of elemental sulfur. When mechanisms were provided for the removal of the metabolic end product, H2S, measurable growth was obtained at sulfur concentrations of from 2 to 30 mM. Initial doubling times were ca. 1.5 h and substrate independent over the range of sulfur concentrations tested. In the cultures with the highest sulfur concentrations, cell numbers increased by greater than 400-fold after 48 h, reaching a maximum density of 6.8 x 10(8) cells ml-1. Yields were determined as total cell carbon and ranged from 1.7 to 5.9 g of C mol of S(0) consumed-1 in the presence of the amino acid supplement and from 0.9 to 3.4 g of C mol of S(0-1) in its absence. Several lines of evidence indicate that cell-to-sulfur contact is not required for growth. Approaches for the culture of sulfur-metabolizing bacteria and potential ecological implications of sulfur reduction in Shewanella-like heterotrophs are discussed.
The Influence of Acidity on Microbial Fuel Cells Containing Shewanella Oneidensis (PREPRINT)
2008-09-01
d a fi b i s a h t s p t o m d C H p F 8 ig. 4. Cyclic voltammetry of filter sterilized media after 4 days of growth of S. neidensis MR-1 or S...of autologous mediators in the rowthmedium changeswith pH.We analyzed filter sterilized cul- ure supernatants by cyclic voltammetry (Fig. 4), and HPLC...Marsili et al., 2008). Cyclic voltammetrywas used to detect redox-active compounds n growthmedia supernatants fromMR-1 andDSP10 cultures. Fig. 4 hows
USDA-ARS?s Scientific Manuscript database
Shewanella marisflavi strain AP629 was certified as a novel pathogen of the sea cucumber Apostichopus japonicus. In this study, four monoclonal antibodies (MAbs) (3C1, 3D9, 2F2, 2A8) against strain AP629 were developed by immunizing Balb/C mice. 3C1 and 3D9 recognized S. marisflavi only, showing no ...
DOE Office of Scientific and Technical Information (OSTI.GOV)
Byun, H. S.; Pirbadian, S.; Nakano, Aiichiro
2014-09-05
Microorganisms overcome the considerable hurdle of respiring extracellular solid substrates by deploying large multiheme cytochrome complexes that form 20 nanometer conduits to traffic electrons through the periplasm and across the cellular outer membrane. Here we report the first kinetic Monte Carlo simulations and single-molecule scanning tunneling microscopy (STM) measurements of the Shewanella oneidensis MR-1 outer membrane decaheme cytochrome MtrF, which can perform the final electron transfer step from cells to minerals and microbial fuel cell anodes. We find that the calculated electron transport rate through MtrF is consistent with previously reported in vitro measurements of the Shewanella Mtr complex, asmore » well as in vivo respiration rates on electrode surfaces assuming a reasonable (experimentally verified) coverage of cytochromes on the cell surface. The simulations also reveal a rich phase diagram in the overall electron occupation density of the hemes as a function of electron injection and ejection rates. Single molecule tunneling spectroscopy confirms MtrF's ability to mediate electron transport between an STM tip and an underlying Au(111) surface, but at rates higher than expected from previously calculated heme-heme electron transfer rates for solvated molecules.« less
Budiman, Cahyo; Koga, Yuichi; Takano, Kazufumi; Kanaya, Shigenori
2011-01-01
Adaptation of microorganisms to low temperatures remains to be fully elucidated. It has been previously reported that peptidyl prolyl cis-trans isomerases (PPIases) are involved in cold adaptation of various microorganisms whether they are hyperthermophiles, mesophiles or phsycrophiles. The rate of cis-trans isomerization at low temperatures is much slower than that at higher temperatures and may cause problems in protein folding. However, the mechanisms by which PPIases are involved in cold adaptation remain unclear. Here we used FK506-binding protein 22, a cold shock protein from the psychrophilic bacterium Shewanella sp. SIB1 (SIB1 FKBP22) as a model protein to decipher the involvement of PPIases in cold adaptation. SIB1 FKBP22 is homodimer that assumes a V-shaped structure based on a tertiary model. Each monomer consists of an N-domain responsible for dimerization and a C-catalytic domain. SIB1 FKBP22 is a typical cold-adapted enzyme as indicated by the increase of catalytic efficiency at low temperatures, the downward shift in optimal temperature of activity and the reduction in the conformational stability. SIB1 FKBP22 is considered as foldase and chaperone based on its ability to catalyze refolding of a cis-proline containing protein and bind to a folding intermediate protein, respectively. The foldase and chaperone activites of SIB1 FKBP22 are thought to be important for cold adaptation of Shewanella sp. SIB1. These activities are also employed by other PPIases for being involved in cold adaptation of various microorganisms. Despite other biological roles of PPIases, we proposed that foldase and chaperone activities of PPIases are the main requirement for overcoming the cold-stress problem in microorganisms due to folding of proteins. PMID:21954357
DOE Office of Scientific and Technical Information (OSTI.GOV)
NEALSON, KENNETH H.
This project had as its goals the understanding of the ecophysiology of the genus Shewanella using various genomics approaches. As opposed to other programs involving Shewanella, this one branched out into the various areas in which Shewanella cells are active, and included both basic and applied studies. All of the work was, to some extent, related to the ability of the bacteria to accomplish electron exchange between the cell and solid state electron acceptors and/or electron donors, a process we call Extracellular Electron Transport, or EET. The major accomplishments related to several different areas: Basic Science Studies: 1. Genetics andmore » genomics of nitrate reduction, resulting in elucidation of atypical nitrate reduction systems in Shewanella oneidensis (MR-1)[2]. 2. Influence of bacterial strain and growth conditions on iron reduction, showing that rates of reduction, extents of reduction, and the formation of secondary minerals were different for different strains of Shewanella [3,4,9]. 3. Comparative genomics as a tool for comparing metabolic capacities of different Shewanella strains, and for predicting growth and metabolism [6,10,15]. In these studies, collaboration with ORNL, PNNL, and 4. Basic studies of electron transport in strain MR-1, both to poised electrodes, and via conductive nanowires [12,13]. This included the first accurate measurements of electrical energy generation by a single cell during electrode growth [12], and the demonstration of electrical conductivity along the length of bacterial nanowires [13]. 5. Impact of surface charge and electron flow on cell movement, cell attachment, cell growth, and biofilm formation [7.18]. The demonstration that interaction with solid state electron acceptors resulted in increased motility [7] led to the description of a phenomenon called electrokinesis. The importance of this for biofilm formation and for electron flow was hypothesized by Nealson & Finkel [18], and is now under study in
Rodrigues, Jorge L. M.; Serres, Margrethe H.; Tiedje, James M.
2011-01-01
The use of comparative genomics for the study of different microbiological species has increased substantially as sequence technologies become more affordable. However, efforts to fully link a genotype to its phenotype remain limited to the development of one mutant at a time. In this study, we provided a high-throughput alternative to this limiting step by coupling comparative genomics to the use of phenotype arrays for five sequenced Shewanella strains. Positive phenotypes were obtained for 441 nutrients (C, N, P, and S sources), with N-based compounds being the most utilized for all strains. Many genes and pathways predicted by genome analyses were confirmed with the comparative phenotype assay, and three degradation pathways believed to be missing in Shewanella were confirmed as missing. A number of previously unknown gene products were predicted to be parts of pathways or to have a function, expanding the number of gene targets for future genetic analyses. Ecologically, the comparative high-throughput phenotype analysis provided insights into niche specialization among the five different strains. For example, Shewanella amazonensis strain SB2B, isolated from the Amazon River delta, was capable of utilizing 60 C compounds, whereas Shewanella sp. strain W3-18-1, isolated from deep marine sediment, utilized only 25 of them. In spite of the large number of nutrient sources yielding positive results, our study indicated that except for the N sources, they were not sufficiently informative to predict growth phenotypes from increasing evolutionary distances. Our results indicate the importance of phenotypic evaluation for confirming genome predictions. This strategy will accelerate the functional discovery of genes and provide an ecological framework for microbial genome sequencing projects. PMID:21642407
Daneshvar Alavi, Hessam Edin; Truelstrup Hansen, Lisbeth
2013-01-01
This study investigated the dynamics of static biofilm formation (100% RH, 15 °C, 48-72 h) and desiccation survival (43% RH, 15 °C, 21 days) of Listeria monocytogenes, in dual species biofilms with the common spoilage bacteria, Pseudomonas fluorescens, Serratia proteamaculans and Shewanella baltica, on the surface of food grade stainless steel. The Gram-negative bacteria reduced the maximum biofilm population of L. monocytogenes in dual species biofilms and increased its inactivation during desiccation. However, due to the higher desiccation resistance of Listeria relative to P. fluorescens and S. baltica, the pathogen survived in greater final numbers. In contrast, S. proteamaculans outcompeted the pathogen during the biofilm formation and exhibited similar desiccation survival, causing the N21 days of Serratia to be ca 3 Log10(CFU cm(-2)) greater than that of Listeria in the dual species biofilm. Microscopy revealed biofilm morphologies with variable amounts of exopolymeric substance and the presence of separate microcolonies. Under these simulated food plant conditions, the fate of L. monocytogenes during formation of mixed biofilms and desiccation depended on the implicit characteristics of the co-cultured bacterium.
Li, Wen-Wei; Sheng, Guo-Ping; Liu, Xian-Wei; Cai, Pei-Jie; Sun, Min; Xiao, Xiang; Wang, Yun-Kun; Tong, Zhong-Hua; Dong, Fang; Yu, Han-Qing
2011-06-15
The electricity production of Shewanella-inoculated microbial fuel cells (MFCs) under magnetic field (MF) exposure was investigated in different reactor systems. The persistency of the MF effect and the influences of MF intensity and direction on MFC performance were also studied. Application of a 100-mT static MF to the MFCs improved electricity production considerably, with an increase in the maximum voltage by 20-27% in both single- and two-chamber MFCs, while a more conspicuous improvement in the electricity generation was observed in a three-electrode cell. The MF effects were found to be immediate and reversible, and adverse effects seemed to occur when the MF was suddenly removed. The medium components analysis demonstrated that the application of MF led to an enhanced bioelectrochemical activity of Shewanella, and no significant promotion in mediator secretion was found. The improvement in the electricity production of MFCs under MF was mainly attributed to the enhanced bioelectrochemical activity, possibly through the oxidative stress mechanism. An accelerated cell growth under MF might also contribute to the enhanced substrate degradation and power generation. Copyright © 2010 Elsevier B.V. All rights reserved.
Facile method to stain the bacterial cell surface for super-resolution fluorescence microscopy†
Gunsolus, Ian L.; Hu, Dehong; Mihai, Cosmin; Lohse, Samuel E.; Lee, Chang-soo; Torelli, Marco D.; Hamers, Robert J.; Murhpy, Catherine J.; Orr, Galya
2015-01-01
A method to fluorescently stain the surfaces of both Gram-negative and Gram-positive bacterial cells compatible with super-resolution fluorescence microscopy is presented. This method utilizes a commercially-available fluorescent probe to label primary amines at the surface of the cell. We demonstrate eficient staining of two bacterial strains, the Gram-negative Shewanella oneidensis MR-1 and the Gram-positive Bacillus subtilis 168. Using structured illumination microscopy and stochastic optical reconstruction microscopy, which require high quantum yield or specialized dyes, we show that this staining method may be used to resolve the bacterial cell surface with sub-diffraction-limited resolution. We further use this method to identify localization patterns of nanomaterials, specifically cadmium selenide quantum dots, following interaction with bacterial cells. PMID:24816810
Facile method to stain the bacterial cell surface for super-resolution fluorescence microscopy
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gunsolus, Ian L.; Hu, Dehong; Mihai, Cosmin
A method to fluorescently stain the surfaces of both Gram-negative and Gram-positive bacterial cells compatible with super-resolution fluorescence microscopy is presented. This method utilizes a commercially-available fluorescent probe to label primary amines at the surface of the cell. We demonstrate efficient staining of two bacterial strains, the Gram-negative Shewanella oneidensis MR-1 and the Gram-positive Bacillus subtilis 168. Using structured illumination microscopy and stochastic optical reconstruction microscopy, which require high quantum yield or specialized dyes, we show that this staining method may be used to resolve the bacterial cell surface with sub-diffraction-limited resolution. We further use this method to identify localizationmore » patterns of nanomaterials, specifically cadmium selenide quantum dots, following interaction with bacterial cells.« less
Jiang, Shenghua; Ho, Cuong Tu; Lee, Ji-Hoon; Duong, Hieu Van; Han, Seunghee; Hur, Hor-Gil
2012-05-01
Shewanella putrefaciens 200, resistant to high concentration of Hg(II), was selected for co-removal of mercury and selenium from aqueous medium. Biogenic Hg(0) reduced from Hg(II) by S. putrefaciens 200 was captured into extracellular amorphous selenium nanospheres, resulting in the formation of stable HgSe nanoparticles. This bacterial reduction could be a new strategy for mercury removal from aquatic environments without secondary pollution of mercury methylation or Hg(0) volatilization. Copyright © 2012 Elsevier Ltd. All rights reserved.
Biosupported Bimetallic Pd Au Nanocatalysts for Dechlorination of Environmental Contaminants
DOE Office of Scientific and Technical Information (OSTI.GOV)
De Corte, S.; Fitts, J.; Hennebel, T.
2011-08-30
Biologically produced monometallic palladium nanoparticles (bio-Pd) have been shown to catalyze the dehalogenation of environmental contaminants, but fail to efficiently catalyze the degradation of other important recalcitrant halogenated compounds. This study represents the first report of biologically produced bimetallic Pd/Au nanoparticle catalysts. The obtained catalysts were tested for the dechlorination of diclofenac and trichloroethylene. When aqueous bivalent Pd(II) and trivalent Au(III) ions were both added to concentrations of 50 mg L{sup -1} and reduced simultaneously by Shewanella oneidensis in the presence of H{sub 2}, the resulting cell-associated bimetallic nanoparticles (bio-Pd/Au) were able to dehalogenate 78% of the initially added diclofenacmore » after 24 h; in comparison, no dehalogenation was observed using monometallic bio-Pd or bio-Au. Other catalyst-synthesis strategies did not show improved dehalogenation of TCE and diclofenac compared with bio-Pd. Synchrotron-based X-ray diffraction, (scanning) transmission electron microscopy and energy dispersive X-ray spectroscopy indicated that the simultaneous reduction of Pd and Au supported on cells of S. oneidensis resulted in the formation of a unique bimetallic crystalline structure. This study demonstrates that the catalytic activity and functionality of possibly environmentally more benign biosupported Pd-catalysts can be improved by coprecipitation with Au.« less
Changes in Microbial Energy Metabolism Measured by Nanocalorimetry during Growth Phase Transitions
Robador, Alberto; LaRowe, Douglas E.; Finkel, Steven E.; Amend, Jan P.; Nealson, Kenneth H.
2018-01-01
Calorimetric measurements of the change in heat due to microbial metabolic activity convey information about the kinetics, as well as the thermodynamics, of all chemical reactions taking place in a cell. Calorimetric measurements of heat production made on bacterial cultures have recorded the energy yields of all co-occurring microbial metabolic reactions, but this is a complex, composite signal that is difficult to interpret. Here we show that nanocalorimetry can be used in combination with enumeration of viable cell counts, oxygen consumption rates, cellular protein content, and thermodynamic calculations to assess catabolic rates of an isolate of Shewanella oneidensis MR-1 and infer what fraction of the chemical energy is assimilated by the culture into biomass and what fraction is dissipated in the form of heat under different limiting conditions. In particular, our results demonstrate that catabolic rates are not necessarily coupled to rates of cell division, but rather, to physiological rearrangements of S. oneidensis MR-1 upon growth phase transitions. In addition, we conclude that the heat released by growing microorganisms can be measured in order to understand the physiochemical nature of the energy transformation and dissipation associated with microbial metabolic activity in conditions approaching those found in natural systems. PMID:29449836
Influence of calcium on microbial reduction of solid phase uranium(VI).
Liu, Chongxuan; Jeon, Byong-Hun; Zachara, John M; Wang, Zheming
2007-08-15
The effect of calcium on the dissolution and microbial reduction of a representative solid phase uranyl [U(VI)], sodium boltwoodite (NaUO(2)SiO(3)OH . 1.5H(2)O), was investigated to evaluate the rate-limiting step of microbial reduction of the solid phase U(VI). Microbial reduction experiments were performed in a culture of a dissimilatory metal-reducing bacterium (DMRB), Shewanella oneidensis strain MR-1, in a bicarbonate medium with lactate as electron donor at pH 6.8 buffered with PIPES. Calcium increased the rate of Na-boltwoodite dissolution and U(VI) bioavailability by increasing its solubility through the formation of a ternary aqueous calcium-uranyl-carbonate species. The ternary species, however, decreased the rates of microbial reduction of aqueous U(VI). Laser-induced fluorescence spectroscopy (LIFS) and transmission electron microscopy (TEM) collectively revealed that microbial reduction of solid phase U(VI) was a sequentially coupled process of Na-boltwoodite dissolution, U(VI) aqueous speciation, and microbial reduction of dissolved U(VI) to U(IV) that accumulated on bacterial surfaces/periplasm. Under studied experimental conditions, the overall rate of microbial reduction of solid phase U(VI) was limited by U(VI) dissolution reactions in solutions without calcium and limited by microbial reduction in solutions with calcium. Generally, the overall rate of microbial reduction of solid phase U(VI) was determined by the coupling of solid phase U(VI) dissolution, U(VI) aqueous speciation, and microbial reduction of dissolved U(VI) that were all affected by calcium. (c) 2007 Wiley Periodicals, Inc.
Gross, Benjamin J; El-Naggar, Mohamed Y
2015-06-01
Metal-reducing bacteria gain energy by extracellular electron transfer to external solids, such as naturally abundant minerals, which substitute for oxygen or the other common soluble electron acceptors of respiration. This process is one of the earliest forms of respiration on earth and has significant environmental and technological implications. By performing electron transfer to electrodes instead of minerals, these microbes can be used as biocatalysts for conversion of diverse chemical fuels to electricity. Understanding such a complex biotic-abiotic interaction necessitates the development of tools capable of probing extracellular electron transfer down to the level of single cells. Here, we describe an experimental platform for single cell respiration measurements. The design integrates an infrared optical trap, perfusion chamber, and lithographically fabricated electrochemical chips containing potentiostatically controlled transparent indium tin oxide microelectrodes. Individual bacteria are manipulated using the optical trap and placed on the microelectrodes, which are biased at a suitable oxidizing potential in the absence of any chemical electron acceptor. The potentiostat is used to detect the respiration current correlated with cell-electrode contact. We demonstrate the system with single cell measurements of the dissimilatory-metal reducing bacterium Shewanella oneidensis MR-1, which resulted in respiration currents ranging from 15 fA to 100 fA per cell under our measurement conditions. Mutants lacking the outer-membrane cytochromes necessary for extracellular respiration did not result in any measurable current output upon contact. In addition to the application for extracellular electron transfer studies, the ability to electronically measure cell-specific respiration rates may provide answers for a variety of fundamental microbial physiology questions.
Phenazines and Other Redox-Active Antibiotics Promote Microbial Mineral Reduction
Hernandez, Maria E.; Kappler, Andreas; Newman, Dianne K.
2004-01-01
Natural products with important therapeutic properties are known to be produced by a variety of soil bacteria, yet the ecological function of these compounds is not well understood. Here we show that phenazines and other redox-active antibiotics can promote microbial mineral reduction. Pseudomonas chlororaphis PCL1391, a root isolate that produces phenazine-1-carboxamide (PCN), is able to reductively dissolve poorly crystalline iron and manganese oxides, whereas a strain carrying a mutation in one of the phenazine-biosynthetic genes (phzB) is not; the addition of purified PCN restores this ability to the mutant strain. The small amount of PCN produced relative to the large amount of ferric iron reduced in cultures of P. chlororaphis implies that PCN is recycled multiple times; moreover, poorly crystalline iron (hydr)oxide can be reduced abiotically by reduced PCN. This ability suggests that PCN functions as an electron shuttle rather than an iron chelator, a finding that is consistent with the observation that dissolved ferric iron is undetectable in culture fluids. Multiple phenazines and the glycopeptidic antibiotic bleomycin can also stimulate mineral reduction by the dissimilatory iron-reducing bacterium Shewanella oneidensis MR1. Because diverse bacterial strains that cannot grow on iron can reduce phenazines, and because thermodynamic calculations suggest that phenazines have lower redox potentials than those of poorly crystalline iron (hydr)oxides in a range of relevant environmental pH (5 to 9), we suggest that natural products like phenazines may promote microbial mineral reduction in the environment. PMID:14766572
NASA Astrophysics Data System (ADS)
Gross, Benjamin J.; El-Naggar, Mohamed Y.
2015-06-01
Metal-reducing bacteria gain energy by extracellular electron transfer to external solids, such as naturally abundant minerals, which substitute for oxygen or the other common soluble electron acceptors of respiration. This process is one of the earliest forms of respiration on earth and has significant environmental and technological implications. By performing electron transfer to electrodes instead of minerals, these microbes can be used as biocatalysts for conversion of diverse chemical fuels to electricity. Understanding such a complex biotic-abiotic interaction necessitates the development of tools capable of probing extracellular electron transfer down to the level of single cells. Here, we describe an experimental platform for single cell respiration measurements. The design integrates an infrared optical trap, perfusion chamber, and lithographically fabricated electrochemical chips containing potentiostatically controlled transparent indium tin oxide microelectrodes. Individual bacteria are manipulated using the optical trap and placed on the microelectrodes, which are biased at a suitable oxidizing potential in the absence of any chemical electron acceptor. The potentiostat is used to detect the respiration current correlated with cell-electrode contact. We demonstrate the system with single cell measurements of the dissimilatory-metal reducing bacterium Shewanella oneidensis MR-1, which resulted in respiration currents ranging from 15 fA to 100 fA per cell under our measurement conditions. Mutants lacking the outer-membrane cytochromes necessary for extracellular respiration did not result in any measurable current output upon contact. In addition to the application for extracellular electron transfer studies, the ability to electronically measure cell-specific respiration rates may provide answers for a variety of fundamental microbial physiology questions.
Rohman, Muhammad S; Tadokoro, Takashi; Angkawidjaja, Clement; Abe, Yumi; Matsumura, Hiroyoshi; Koga, Yuichi; Takano, Kazufumi; Kanaya, Shigenori
2009-01-01
The Arg97 --> Gly and Asp136 --> His mutations stabilized So-RNase HI from the psychrotrophic bacterium Shewanella oneidensis MR-1 by 5.4 and 9.7 degrees C, respectively, in T(m), and 3.5 and 6.1 kJ x mol(-1), respectively, in DeltaG(H2O). These mutations also stabilized the So-RNase HI derivative (4x-RNase HI) with quadruple thermostabilizing mutations in an additive manner. As a result, the resultant sextuple mutant protein (6x-RNase HI) was more stable than the wild-type protein by 28.8 degrees C in T(m) and 27.0 kJ x mol(-1) in DeltaG(H2O). To analyse the effects of the mutations on the protein structure, the crystal structure of the 6x-RNase HI protein was determined at 2.5 A resolution. The main chain fold and interactions of the side-chains of the 6x-RNase HI protein were basically identical to those of the wild-type protein, except for the mutation sites. These results indicate that all six mutations independently affect the protein structure, and are consistent with the fact that the thermostabilizing effects of the mutations are roughly additive. The introduction of favourable interactions and the elimination of unfavourable interactions by the mutations contribute to the stabilization of the 6x-RNase HI protein. We propose that So-RNase HI is destabilized when compared with its mesophilic and thermophilic counterparts in a localized fashion by increasing the number of amino acid residues unfavourable for protein stability.
Temporal Expression-based Analysis of Metabolism
Segrè, Daniel
2012-01-01
Metabolic flux is frequently rerouted through cellular metabolism in response to dynamic changes in the intra- and extra-cellular environment. Capturing the mechanisms underlying these metabolic transitions in quantitative and predictive models is a prominent challenge in systems biology. Progress in this regard has been made by integrating high-throughput gene expression data into genome-scale stoichiometric models of metabolism. Here, we extend previous approaches to perform a Temporal Expression-based Analysis of Metabolism (TEAM). We apply TEAM to understanding the complex metabolic dynamics of the respiratorily versatile bacterium Shewanella oneidensis grown under aerobic, lactate-limited conditions. TEAM predicts temporal metabolic flux distributions using time-series gene expression data. Increased predictive power is achieved by supplementing these data with a large reference compendium of gene expression, which allows us to take into account the unique character of the distribution of expression of each individual gene. We further propose a straightforward method for studying the sensitivity of TEAM to changes in its fundamental free threshold parameter θ, and reveal that discrete zones of distinct metabolic behavior arise as this parameter is changed. By comparing the qualitative characteristics of these zones to additional experimental data, we are able to constrain the range of θ to a small, well-defined interval. In parallel, the sensitivity analysis reveals the inherently difficult nature of dynamic metabolic flux modeling: small errors early in the simulation propagate to relatively large changes later in the simulation. We expect that handling such “history-dependent” sensitivities will be a major challenge in the future development of dynamic metabolic-modeling techniques. PMID:23209390
Wildung, R. E.; Gorby, Y. A.; Krupka, K. M.; Hess, N. J.; Li, S. W.; Plymale, A. E.; McKinley, J. P.; Fredrickson, J. K.
2000-01-01
To help provide a fundamental basis for use of microbial dissimilatory reduction processes in separating or immobilizing 99Tc in waste or groundwaters, the effects of electron donor and the presence of the bicarbonate ion on the rate and extent of pertechnetate ion [Tc(VII)O4−] enzymatic reduction by the subsurface metal-reducing bacterium Shewanella putrefaciens CN32 were determined, and the forms of aqueous and solid-phase reduction products were evaluated through a combination of high-resolution transmission electron microscopy, X-ray absorption spectroscopy, and thermodynamic calculations. When H2 served as the electron donor, dissolved Tc(VII) was rapidly reduced to amorphous Tc(IV) hydrous oxide, which was largely associated with the cell in unbuffered 0.85% NaCl and with extracellular particulates (0.2 to 0.001 μm) in bicarbonate buffer. Cell-associated Tc was present principally in the periplasm and outside the outer membrane. The reduction rate was much lower when lactate was the electron donor, with extracellular Tc(IV) hydrous oxide the dominant solid-phase reduction product, but in bicarbonate systems much less Tc(IV) was associated directly with the cell and solid-phase Tc(IV) carbonate may have been present. In the presence of carbonate, soluble (<0.001 μm) electronegative, Tc(IV) carbonate complexes were also formed that exceeded Tc(VII)O4− in electrophoretic mobility. Thermodynamic calculations indicate that the dominant reduced Tc species identified in the experiments would be stable over a range of Eh and pH conditions typical of natural waters. Thus, carbonate complexes may represent an important pathway for Tc transport in anaerobic subsurface environments, where it has generally been assumed that Tc mobility is controlled by low-solubility Tc(IV) hydrous oxide and adsorptive, aqueous Tc(IV) hydrolysis products. PMID:10831424
Biofilm Formation by a Metabolically Versatile Bacterium
2009-03-19
ABSTRACT Rhodopseudomonas palustris is a photosynthetic bacterium that has good potential as a biocatalyst for the production ofhydrogen gas, a biofuel...Biofilm formation by a metabolically versatile bacterium: final report Report Title ABSTRACT Rhodopseudomonas palustris is a photosynthetic bacterium...agricultural waste. We characterized five new Rhodopseudomonas genome sequences and isolated and described R. palustris mutant strains that produce
Electron energy loss spectroscopy techniques for the study of microbial chromium(VI) reduction
NASA Technical Reports Server (NTRS)
Daulton, Tyrone L.; Little, Brenda J.; Lowe, Kristine; Jones-Meehan, Joanne
2002-01-01
Electron energy loss spectroscopy (EELS) techniques were used to determine oxidation state, at high spatial resolution, of chromium associated with the metal-reducing bacteria, Shewanella oneidensis, in anaerobic cultures containing Cr(VI)O4(2-). These techniques were applied to fixed cells examined in thin section by conventional transmission electron microscopy (TEM) as well as unfixed, hydrated bacteria examined by environmental cell (EC)-TEM. Two distinct populations of bacteria were observed by TEM: bacteria exhibiting low image contrast and bacteria exhibiting high contrast in their cell membrane (or boundary) structure which was often encrusted with high-contrast precipitates. Measurements by EELS demonstrated that cell boundaries became saturated with low concentrations of Cr and the precipitates encrusting bacterial cells contained a reduced form of Cr in oxidation state + 3 or lower.
MicroSPE-nanoLC-ESI-MS/MS Using 10-μm-i.d. Silica-Based Monolithic Columns for Proteomics
DOE Office of Scientific and Technical Information (OSTI.GOV)
Luo, Quanzhou; Page, Jason S.; Tang, Keqi
2007-01-01
Silica-based monolithic narrow bore capillary columns (25 cm x 10 µm i.d.) with an integrated nanoESI emitter has been developed to provide high quality and robust microSPE-nanoLC-ESI-MS analyses. The integrated nanoESI emitter adds no dead volume to the LC separation, allowing stable electrospray performance to be obtained at flow rates of ~10 nL/min. In an initial application we identified 5510 unique peptides covering 1443 distinct Shewanella oneidensis proteins from a 300 ng tryptic digest sample in a single 4-h LC-MS/MS analysis using a linear ion trap MS (LTQ). We found the use of an integrated monolithic ESI emitter provided enhancedmore » resistance to clogging and good run-to-run reproducibility.« less
Moore, Priscilla A; Kery, Vladimir
2009-01-01
High-throughput protein purification is a complex, multi-step process. There are several technical challenges in the course of this process that are not experienced when purifying a single protein. Among the most challenging are the high-throughput protein concentration and buffer exchange, which are not only labor-intensive but can also result in significant losses of purified proteins. We describe two methods of high-throughput protein concentration and buffer exchange: one using ammonium sulfate precipitation and one using micro-concentrating devices based on membrane ultrafiltration. We evaluated the efficiency of both methods on a set of 18 randomly selected purified proteins from Shewanella oneidensis. While both methods provide similar yield and efficiency, the ammonium sulfate precipitation is much less labor intensive and time consuming than the ultrafiltration.
NREL Researchers Discover How a Bacterium, Clostridium thermocellum,
containing the bacterium actually promotes the growth of C. thermocellum, yet its mechanistic details remained a puzzle. This enhanced growth implied the bacterium had the ability to use CO2 and prompted NREL researchers to investigate the phenomena enhancing the bacterium's growth. "It took us by surprise that
Yang, Yuan; Wang, Yan-Zhai; Fang, Zhen; Yu, Yang-Yang; Yong, Yang-Chun
2018-02-01
Toxicity assessment of water is of great important to the safety of human health and to social security because of more and more toxic compounds that are spilled into the aquatic environment. Therefore, the development of fast and reliable toxicity assessment methods is of great interest and attracts much attention. In this study, by using the electrochemical activity of Shewanella oneidensis MR-1 cells as the toxicity indicator, 3,5-dichlorophenol (DCP) as the model toxic compound, a new biosensor for water toxicity assessment was developed. Strikingly, the presence of DCP in the water significantly inhibited the maximum current output of the S. oneidensis MR-1 in a three-electrode system and also retarded the current evolution by the cells. Under the optimized conditions, the maximum current output of the biosensor was proportional to the concentration of DCP up to 30 mg/L. The half maximal inhibitory concentration of DCP determined by this biosensor is about 14.5 mg/L. Furthermore, simultaneous monitoring of the retarded time (Δt) for current generation allowed the identification of another biosensor signal in response to DCP which could be employed to verify the electrochemical result by dual confirmation. Thus, the present study has provided a reliable and promising approach for water quality assessment and risk warning of water toxicity.
A miniature microbial fuel cell with conducting nanofibers-based 3D porous biofilm
NASA Astrophysics Data System (ADS)
Jiang, Huawei; Halverson, Larry J.; Dong, Liang
2015-12-01
Miniature microbial fuel cell (MFC) technology has received growing interest due to its potential applications in high-throughput screening of bacteria and mutants to elucidate mechanisms of electricity generation. This paper reports a novel miniature MFC with an improved output power density and short startup time, utilizing electrospun conducting poly(3,4-ethylenedioxythiophene) (PEDOT) nanofibers as a 3D porous anode within a 12 μl anolyte chamber. This device results in 423 μW cm-3 power density based on the volume of the anolyte chamber, using Shewanella oneidensis MR-1 as a model biocatalyst without any optimization of bacterial culture. The device also excels in a startup time of only 1hr. The high conductivity of the electrospun nanofibers makes them suitable for efficient electron transfer. The mean pore size of the conducting nanofibers is several micrometers, which is favorable for bacterial penetration and colonization of surfaces of the nanofibers. We demonstrate that S. oneidensis can fully colonize the interior region of this nanofibers-based porous anode. This work represents a new attempt to explore the use of electrospun PEDOT nanofibers as a 3D anode material for MFCs. The presented miniature MFC potentially will provide a high-sensitivity, high-throughput tool to screen suitable bacterial species and mutant strains for use in large-size MFCs.
McAuliffe, Gary N.; Hennessy, Jann; Baird, Robert W.
2015-01-01
Vibrio, Aeromonas, Chromobacterium violaceum, and Shewanella (VACS) are water-associated Gram-negative organisms that can cause a variety of infections. The frequency, patient characteristics, and antimicrobial susceptibilities for 468 isolates from 442 patients from the Northern Territory were reviewed. Aeromonas spp. (312 of 468; 67%) were most commonly isolated followed by Vibrio spp. (71 of 468; 15%), Shewanella spp. (61 of 468; 13%), and C. violaceum (24 of 468; 5%). A strong male predominance was found (male to female ratio of 2.3:1). Skin and soft tissue isolations (373 of 468; 80%) from lower limb infections (222 of 371; 60%) were the most common clinical manifestation. The episodes were usually polymicrobial (281 of 468; 60%). Coisolates included Staphylococcus aureus (137 of 468; 29%), β-hemolytic streptococci (74 of 468; 16%), enterobacteriaceae (111 of 468; 24%), non-fermentative Gram-negative bacilli (35 of 468; 7%), and other VACS organisms (37 of 468; 8%). Antimicrobial resistance of VACS organisms to ciprofloxacin (0–4%), cefepime (0–3%), and gentamicin (0–0.8%) and Vibrio spp., Aeromonas spp., and Shewanella to cotrimoxazole (0–3%) was rarely shown. For water-associated lower limb skin and soft tissue infections in the tropics, clinicians should consider empirical antimicrobial therapy with agents active against S. aureus and VACS organisms. PMID:25548380
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gross, Benjamin J.; El-Naggar, Mohamed Y., E-mail: mnaggar@usc.edu; Molecular and Computational Biology Section, Department of Biological Sciences, University of Southern California, Los Angeles, California 90089-0484
2015-06-15
Metal-reducing bacteria gain energy by extracellular electron transfer to external solids, such as naturally abundant minerals, which substitute for oxygen or the other common soluble electron acceptors of respiration. This process is one of the earliest forms of respiration on earth and has significant environmental and technological implications. By performing electron transfer to electrodes instead of minerals, these microbes can be used as biocatalysts for conversion of diverse chemical fuels to electricity. Understanding such a complex biotic-abiotic interaction necessitates the development of tools capable of probing extracellular electron transfer down to the level of single cells. Here, we describe anmore » experimental platform for single cell respiration measurements. The design integrates an infrared optical trap, perfusion chamber, and lithographically fabricated electrochemical chips containing potentiostatically controlled transparent indium tin oxide microelectrodes. Individual bacteria are manipulated using the optical trap and placed on the microelectrodes, which are biased at a suitable oxidizing potential in the absence of any chemical electron acceptor. The potentiostat is used to detect the respiration current correlated with cell-electrode contact. We demonstrate the system with single cell measurements of the dissimilatory-metal reducing bacterium Shewanella oneidensis MR-1, which resulted in respiration currents ranging from 15 fA to 100 fA per cell under our measurement conditions. Mutants lacking the outer-membrane cytochromes necessary for extracellular respiration did not result in any measurable current output upon contact. In addition to the application for extracellular electron transfer studies, the ability to electronically measure cell-specific respiration rates may provide answers for a variety of fundamental microbial physiology questions.« less
Kostka, Joel E.; Dalton, Dava D.; Skelton, Hayley; Dollhopf, Sherry; Stucki, Joseph W.
2002-01-01
Smectite clay minerals are abundant in soils and sediments worldwide and are typically rich in Fe. While recent investigations have shown that the structural Fe(III) bound in clay minerals is reduced by microorganisms, previous studies have not tested growth with clay minerals as the sole electron acceptor. Here we have demonstrated that a pure culture of Shewanella oneidensis strain MR-1 as well as enrichment cultures of Fe(III)-reducing bacteria from rice paddy soil and subsurface sediments are capable of conserving energy for growth with the structural Fe(III) bound in smectite clay as the sole electron acceptor. Pure cultures of S. oneidensis were used for more detailed growth rate and yield experiments on various solid- and soluble-phase electron acceptors [smectite, Fe(III) oxyhydroxide FeOOH, Fe(III) citrate, and oxygen] in the same minimal medium. Growth was assessed as direct cell counts or as an increase in cell carbon (measured as particulate organic carbon). Cell counts showed that similar growth of S. oneidensis (108 cells ml−1) occurred with smectitic Fe(III) and on other Fe forms [amorphous Fe(III) oxyhydroxide, and Fe citrate] or oxygen as the electron acceptor. In contrast, cell yields of S. oneidensis measured as the increase in cell carbon were similar on all Fe forms tested while yields on oxygen were five times higher, in agreement with thermodynamic predictions. Over a range of particle loadings (0.5 to 4 g liter−1), the increase in cell number was highly correlated to the amount of structural Fe in smectite reduced. From phylogenetic analysis of the complete 16S rRNA gene sequences, a predominance of clones retrieved from the clay mineral-reducing enrichment cultures were most closely related to the low-G+C gram-positive members of the Bacteria (Clostridium and Desulfitobacterium) and the δ-Proteobacteria (members of the Geobacteraceae). Results indicate that growth with smectitic Fe(III) is similar in magnitude to that with Fe
The Role of Shewanella oneidensis MR-1 Outer Surface Structures in Extracellular Electron Transfer
2010-01-01
Supernatants from the wells of the air-exposed VBSA that had been in operation for 220 h were harvested and planktonic cells were removed via...prepilins. In some bacteria, such as Pseudomonas aerugino- sa and Vibrio cholerae, PilD plays a dual role and processes type IVand T2SS prepilins [38 – 41... harvested from the VBSA at the times indicated by arrows in Fig. 4 (100 h data not shown). Fig. 6. Presence of riboflavin in cell-free supernatants
Characterization of the cellulose-degrading bacterium NCIMB 10462
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dees, C.; Scott, T.C.; Phelps, T.J.
The gram-negative cellulase-producing bacterium NCIMB 10462 has been previously named Pseudomonas fluorescens subsp. or var. cellulose. Because of renewed interest in cellulose-degrading bacteria for use in the bioconversion of cellulose to chemical feed stocks and fuels, we re-examined the characteristics of this microorganism to determine its true metabolic potential. Metabolic and physical characterization of NCIMB 10462 revealed that this is an alkalophilic, non-fermentative, gram-negative, oxidase-positive, motile, cellulose-degrading bacterium. The aerobic substrate utilization profile of this bacterium has few characteristics consistent with a classification of P. fluorescens and a very low probability match with the genus Sphingomonas. However, total lipid analysismore » did not reveal that any sphingolipid bases are produced by this bacterium. NCIMB 10462 grows best aerobically, but also grows well in complex media under reducing conditions. NCIMB 10462 grows slowly under anaerobic conditions on complex media, but growth on cellulosic media occurred only under aerobic conditions. Total fatty acid analysis (MIDI) of NCIMB 10462 failed to group this bacterium with a known pseudomonas species. However, fatty acid analysis of the bacteria when grown at temperatures below 37{degrees}C suggest that the organism is a pseudomonad. Since a predominant characteristic of this bacterium is its ability to degrade cellulose, we suggest that it be called Pseudomonas cellulosa.« less
Ghosh, Dhritiman; Bal, Bijay; Kashyap, V. K.; Pal, Subrata
2003-01-01
The bacterial diversity of a hot spring in Bakreshwar, India, was investigated by a culture-independent approach. 16S ribosomal DNA clones derived from the sediment samples were found to be associated with gamma-Proteobacteria, cyanobacteria, and green nonsulfur and low-GC gram-positive bacteria. The first of the above phylotypes cobranches with Shewanella, a well-known iron reducer. This phylogenetic correlation has been exploited to develop culture conditions for thermophilic iron-reducing microorganisms. PMID:12839826
Protein Oxidation Implicated as the Primary Determinant of Bacterial Radioresistance
2007-04-01
the facultative anaerobic, radio- resistant bacterium Lactobacillus plantarum [1,22] accumulates 20–25 mM Mn(II) [23]. For an irradiated cell...in dH2O at 0 8C and pre-conditioned to be anaerobic, H2O2 was released by D. radiodurans (;23 105 M) and L. plantarum (;6 3 105 M), in which the...non-irradiated D. radiodurans or L. plantarum control samples, nor by irradiated S. oneidensis (Figure 5A), which accumulates substantially more Fe
Single Bacterium Detection Using Sers
NASA Astrophysics Data System (ADS)
Gonchukov, S. A.; Baikova, T. V.; Alushin, M. V.; Svistunova, T. S.; Minaeva, S. A.; Ionin, A. A.; Kudryashov, S. I.; Saraeva, I. N.; Zayarny, D. A.
2016-02-01
This work is devoted to the study of a single Staphylococcus aureus bacterium detection using surface-enhanced Raman spectroscopy (SERS) and resonant Raman spectroscopy (RS). It was shown that SERS allows increasing sensitivity of predominantly low frequency lines connected with the vibrations of Amide, Proteins and DNA. At the same time the lines of carotenoids inherent to this kind of bacterium are well-detected due to the resonance Raman scattering mechanism. The reproducibility and stability of Raman spectra strongly depend on the characteristics of nanostructured substrate, and molecular structure and size of the tested biological object.
Anaerobic electron acceptor chemotaxis in Shewanella putrefaciens
NASA Technical Reports Server (NTRS)
Nealson, K. H.; Moser, D. P.; Saffarini, D. A.
1995-01-01
Shewanella putrefaciens MR-1 can grow either aerobically or anaerobically at the expense of many different electron acceptors and is often found in abundance at redox interfaces in nature. Such redox interfaces are often characterized by very strong gradients of electron acceptors resulting from rapid microbial metabolism. The coincidence of S. putrefaciens abundance with environmental gradients prompted an examination of the ability of MR-1 to sense and respond to electron acceptor gradients in the laboratory. In these experiments, taxis to the majority of the electron acceptors that S. putrefaciens utilizes for anaerobic growth was seen. All anaerobic electron acceptor taxis was eliminated by the presence of oxygen, nitrate, nitrite, elemental sulfur, or dimethyl sulfoxide, even though taxis to the latter was very weak and nitrate and nitrite respiration was normal in the presence of dimethyl sulfoxide. Studies with respiratory mutants of MR-1 revealed that several electron acceptors that could not be used for anaerobic growth nevertheless elicited normal anaerobic taxis. Mutant M56, which was unable to respire nitrite, showed normal taxis to nitrite, as well as the inhibition of taxis to other electron acceptors by nitrite. These results indicate that electron acceptor taxis in S. putrefaciens does not conform to the paradigm established for Escherichia coli and several other bacteria. Carbon chemo-taxis was also unusual in this organism: of all carbon compounds tested, the only positive response observed was to formate under anaerobic conditions.
Guo, Zhaoyan; Ren, Guangyuan; Jiang, Congcong; Lu, Xianyong; Zhu, Ying; Jiang, Lei; Dai, Liming
2015-11-25
A novel heteroatoms (N, P, S and Fe) quaternary-doped carbon (HQDC-X, X refers to the pyrolysis temperature) can be fabricated by directly pyrolyzing a gram-negative bacteria, S. oneidensis MR-1 as precursors at 800 °C, 900 °C and 1000 °C under argon atmosphere. These HQDC-X catalysts maintain the cylindrical shape of bacteria after pyrolysis under high temperatures, while heteroatoms including N, P, S and Fe distribute homogeneously on the carbon frameworks. As a result, HQDC-X catalysts exhibit excellent electrocatalytic activity for ORR via a dominant four-electron oxygen reduction pathway in alkaline medium, which is comparable with that of commercial Pt/C. More importantly, HQDC-X catalysts show better tolerance for methanol crossover and CO poisoning effects, long-term durability than commercial Pt/C, which could be promising alternatives to costly Pt-based electrocatalysts for ORR. The method may provide a promising avenue to develop cheap ORR catalysts from inexpensive, scalable and biological recursors.
Jensen, Heather M.; TerAvest, Michaela A.; Kokish, Mark G.; ...
2016-03-22
Introducing extracellular electron transfer pathways into heterologous organisms offers the opportunity to explore fundamental biogeochemical processes and to biologically alter redox states of exogenous metals for various applications. While expression of the MtrCAB electron nanoconduit from Shewanella oneidensis MR-1 permits extracellular electron transfer in Escherichia coli, the low electron flux and absence of growth in these cells limits their practicality for such applications. In this paper, we investigate how the rate of electron transfer to extracellular Fe(III) and cell survival in engineered E. coli are affected by mimicking different features of the S. oneidensis pathway: the number of electron nanoconduits,more » the link between the quinol pool and MtrA, and the presence of flavin-dependent electron transfer. While increasing the number of pathways does not significantly improve the extracellular electron transfer rate or cell survival, using the native inner membrane component, CymA, significantly improves the reduction rate of extracellular acceptors and increases cell viability. Strikingly, introducing both CymA and riboflavin to Mtr-expressing E. coli also allowed these cells to couple metal reduction to growth, which is the first time an increase in biomass of an engineered E. coli has been observed under Fe 2O 3 (s) reducing conditions. Overall and finally, this work provides engineered E. coli strains for modulating extracellular metal reduction and elucidates critical factors for engineering extracellular electron transfer in heterologous organisms.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jensen, Heather M.; TerAvest, Michaela A.; Kokish, Mark G.
Introducing extracellular electron transfer pathways into heterologous organisms offers the opportunity to explore fundamental biogeochemical processes and to biologically alter redox states of exogenous metals for various applications. While expression of the MtrCAB electron nanoconduit from Shewanella oneidensis MR-1 permits extracellular electron transfer in Escherichia coli, the low electron flux and absence of growth in these cells limits their practicality for such applications. In this paper, we investigate how the rate of electron transfer to extracellular Fe(III) and cell survival in engineered E. coli are affected by mimicking different features of the S. oneidensis pathway: the number of electron nanoconduits,more » the link between the quinol pool and MtrA, and the presence of flavin-dependent electron transfer. While increasing the number of pathways does not significantly improve the extracellular electron transfer rate or cell survival, using the native inner membrane component, CymA, significantly improves the reduction rate of extracellular acceptors and increases cell viability. Strikingly, introducing both CymA and riboflavin to Mtr-expressing E. coli also allowed these cells to couple metal reduction to growth, which is the first time an increase in biomass of an engineered E. coli has been observed under Fe 2O 3 (s) reducing conditions. Overall and finally, this work provides engineered E. coli strains for modulating extracellular metal reduction and elucidates critical factors for engineering extracellular electron transfer in heterologous organisms.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Renslow, Ryan S.; Babauta, Jerome T.; Kuprat, Andrew P.
Electrochemically active biofilms have a unique form of respiration in which they utilize solid external materials as terminal electron acceptors for their metabolism. Currently, two primary mechanisms have been identified for long-range extracellular electron transfer (EET): a diffusion- and a conduction-based mechanism. Evidence in the literature suggests that some biofilms, particularly Shewanella oneidensis, produce the requisite components for both mechanisms. In this study, a generic model is presented that incorporates the diffusion- and the conduction-based mechanisms and allows electrochemically active biofilms to utilize both simultaneously. The model was applied to S. oneidensis and Geobacter sulfurreducens biofilms using experimentally generated datamore » found in the literature. Our simulation results show that 1) biofilms having both mechanisms available, especially if they can interact, may have a metabolic advantage over biofilms that can use only a single mechanism; 2) the thickness of G. sulfurreducens biofilms is likely not limited by conductivity; 3) accurate intrabiofilm diffusion coefficient values are critical for current generation predictions; and 4) the local biofilm potential and redox potential are two distinct parameters and cannot be assumed to have identical values. Finally, we determined that simulated cyclic and squarewave voltammetry based on our model are currently not capable of determining the specific percentages of extracellular electron transfer mechanisms in a biofilm. The developed model will be a critical tool for designing experiments to explain EET mechanisms.« less
Wetmore, Kelly M.; Price, Morgan N.; Waters, Robert J.; ...
2015-05-12
Transposon mutagenesis with next-generation sequencing (TnSeq) is a powerful approach to annotate gene function in bacteria, but existing protocols for TnSeq require laborious preparation of every sample before sequencing. Thus, the existing protocols are not amenable to the throughput necessary to identify phenotypes and functions for the majority of genes in diverse bacteria. Here, we present a method, random bar code transposon-site sequencing (RB-TnSeq), which increases the throughput of mutant fitness profiling by incorporating random DNA bar codes into Tn5 and mariner transposons and by using bar code sequencing (BarSeq) to assay mutant fitness. RB-TnSeq can be used with anymore » transposon, and TnSeq is performed once per organism instead of once per sample. Each BarSeq assay requires only a simple PCR, and 48 to 96 samples can be sequenced on one lane of an Illumina HiSeq system. We demonstrate the reproducibility and biological significance of RB-TnSeq with Escherichia coli, Phaeobacter inhibens, Pseudomonas stutzeri, Shewanella amazonensis, and Shewanella oneidensis. To demonstrate the increased throughput of RB-TnSeq, we performed 387 successful genome-wide mutant fitness assays representing 130 different bacterium-carbon source combinations and identified 5,196 genes with significant phenotypes across the five bacteria. In P. inhibens, we used our mutant fitness data to identify genes important for the utilization of diverse carbon substrates, including a putative D-mannose isomerase that is required for mannitol catabolism. RB-TnSeq will enable the cost-effective functional annotation of diverse bacteria using mutant fitness profiling. A large challenge in microbiology is the functional assessment of the millions of uncharacterized genes identified by genome sequencing. Transposon mutagenesis coupled to next-generation sequencing (TnSeq) is a powerful approach to assign phenotypes and functions to genes. However, the current strategies for TnSeq are
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wetmore, Kelly M.; Price, Morgan N.; Waters, Robert J.
Transposon mutagenesis with next-generation sequencing (TnSeq) is a powerful approach to annotate gene function in bacteria, but existing protocols for TnSeq require laborious preparation of every sample before sequencing. Thus, the existing protocols are not amenable to the throughput necessary to identify phenotypes and functions for the majority of genes in diverse bacteria. Here, we present a method, random bar code transposon-site sequencing (RB-TnSeq), which increases the throughput of mutant fitness profiling by incorporating random DNA bar codes into Tn5 and mariner transposons and by using bar code sequencing (BarSeq) to assay mutant fitness. RB-TnSeq can be used with anymore » transposon, and TnSeq is performed once per organism instead of once per sample. Each BarSeq assay requires only a simple PCR, and 48 to 96 samples can be sequenced on one lane of an Illumina HiSeq system. We demonstrate the reproducibility and biological significance of RB-TnSeq with Escherichia coli, Phaeobacter inhibens, Pseudomonas stutzeri, Shewanella amazonensis, and Shewanella oneidensis. To demonstrate the increased throughput of RB-TnSeq, we performed 387 successful genome-wide mutant fitness assays representing 130 different bacterium-carbon source combinations and identified 5,196 genes with significant phenotypes across the five bacteria. In P. inhibens, we used our mutant fitness data to identify genes important for the utilization of diverse carbon substrates, including a putative D-mannose isomerase that is required for mannitol catabolism. RB-TnSeq will enable the cost-effective functional annotation of diverse bacteria using mutant fitness profiling. A large challenge in microbiology is the functional assessment of the millions of uncharacterized genes identified by genome sequencing. Transposon mutagenesis coupled to next-generation sequencing (TnSeq) is a powerful approach to assign phenotypes and functions to genes. However, the current strategies for TnSeq are
An innovative miniature microbial fuel cell fabricated using photolithography.
Chen, You-Peng; Zhao, Yue; Qiu, Ke-Qiang; Chu, Jian; Lu, Rui; Sun, Min; Liu, Xian-Wei; Sheng, Guo-Ping; Yu, Han-Qing; Chen, Jie; Li, Wen-Jie; Liu, Gang; Tian, Yang-Chao; Xiong, Ying
2011-02-15
Recently microbial fuel cells (MFCs) have attracted increasing interests in both environmental and energy fields. Among the various MFC configurations, miniature microbial fuel cell (mini-MFC) has a great potential for the application in medical, communication and other areas because of its miniature volume and high output power density. In this work, a 25-μL single-chamber mini-MFC was fabricated using the photolithography technique. The plate-shaped gold anodic electrode in the mini-MFC showed a higher electrochemical activity than the stripe-shaped one. A biofilm of Shewanella oneidensis MR-1 was formed on the surface of gold electrode in this micro-liter-scale MFCs. As a result, a maximum power density of 29 mW/m(2) and a maximum current density of 2148 mA/m(2) were achieved by this single-chamber mini-MFC. Copyright © 2010 Elsevier B.V. All rights reserved.
2017-01-01
The decaheme cytochrome MtrC from Shewanella oneidensis MR-1 immobilized on an ITO electrode displays unprecedented H2O2 reduction activity. Although MtrC showed lower peroxidase activity in solution compared to horseradish peroxidase, the ten heme cofactors enable excellent electronic communication and a superior activity on the electrode surface. A hierarchical ITO electrode enabled optimal immobilization of MtrC and a high current density of 1 mA cm–2 at 0.4 V vs SHE could be obtained at pH 6.5 (Eonset = 0.72 V). UV–visible and Resonance Raman spectroelectrochemical studies suggest the formation of a high valent iron-oxo species as the catalytic intermediate. Our findings demonstrate the potential of multiheme cytochromes to catalyze technologically relevant reactions and establish MtrC as a new benchmark in biotechnological H2O2 reduction with scope for applications in fuel cells and biosensors. PMID:28221032
Detection of Salmonella bacterium in drinking water using microring resonator.
Bahadoran, Mahdi; Noorden, Ahmad Fakhrurrazi Ahmad; Mohajer, Faeze Sadat; Abd Mubin, Mohamad Helmi; Chaudhary, Kashif; Jalil, Muhammad Arif; Ali, Jalil; Yupapin, Preecha
2016-01-01
A new microring resonator system is proposed for the detection of the Salmonella bacterium in drinking water, which is made up of SiO2-TiO2 waveguide embedded inside thin film layer of the flagellin. The change in refractive index due to the binding of the Salmonella bacterium with flagellin layer causes a shift in the output signal wavelength and the variation in through and drop port's intensities, which leads to the detection of Salmonella bacterium in drinking water. The sensitivity of proposed sensor for detecting of Salmonella bacterium in water solution is 149 nm/RIU and the limit of detection is 7 × 10(-4)RIU.
NASA Astrophysics Data System (ADS)
Michotey, V.; Aigle, A.; Armougom, F.; Mejean, V.; Guasco, S.; Bonin, P.
2016-02-01
In sedimentary systems, the repartition of terminal electron-accepting molecules is often stratified on a permanent or seasonal basis. Just below to oxic zone, the suboxic one is characterized by high concentrations of oxidized inorganic compounds such as nitrate, manganese oxides (MnIII/IV) and iron oxides that are in close vicinity. Several studies have reported unexpected anaerobic nitrite/nitrate production at the expense of ammonium mediated by MnIII/IV, however this transient processes is difficult to discern and poorly understood. In the frame of this study, genes organization of nitrate and MnIII/IV respiration was investigated in S.algae. Additional genes were identified in S. algae compare to S. oneidensis: genes coding for nitrate and nitrite reductase (napA-a and nrfA-2) and an OMC protein (mtrH). In contrast to S. oneidensis, an anaerobic transitory nitrite accumulation at the expense of ammonium was observed in S. algae during growth with MnIII/IV, concomitantly with expression of nitrate/nitrite reductase genes (napA, nrfA, nrfA-2). Among the hypothesis explaining this data, the potential putative expression of unidentified gene able to perform ammonium oxidation was not observed on the global transcriptional level, however several signs of oxidative stress were detected and the existence of a secondary reaction generated by a putative oxidative s could not be excluded. Another option could be the action of reverse reaction by an enzyme such as NrfA or NrfA-2 due to the electron flow equilibrium. Whatever the electron acceptor (Nitrate/ MnIII/IV), the unexpected expression level of of omcA, mtrF, mtrH, mtrC was observed and peaked at the end of the exponential phase. Different expression patterns of the omc genes were observed depending on electron acceptor and growth phase. Only mtrF-2 gene was specifically expressed in Mn(III/IV) condition. Nitrate and Mn(III/IV) respirations seem connected at physiological as well as at transcriptional level
Taxonomic characterization of the cellulose-degrading bacterium NCIB 10462
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dees, C.; Ringleberg, D.; Scott, T.C.
The gram negative cellulase-producing bacterium NCIB 10462 has been previously named Pseudomonas fluorescens subsp. or var. cellulosa. Since there is renewed interest in cellulose-degrading bacteria for use in bioconversion of cellulose to chemical feed stocks and fuels, we re-examined the characteristics of this microorganism to determine its proper taxonomic characterization and to further define it`s true metabolic potential. Metabolic and physical characterization of NCIB 10462 revealed that this was an alkalophilic, non-fermentative, gram negative, oxidase positive, motile, cellulose-degrading bacterium. The aerobic substrate utilization profile of this bacterium was found to have few characteristics consistent with a classification of P. fluorescensmore » with a very low probability match with the genus Sphingomonas. Total lipid analysis did not reveal that any sphingolipid bases are produced by this bacterium. NCIB 10462 was found to grow best aerobically but also grows well in complex media under reducing conditions. NCIB 10462 grew slowly under full anaerobic conditions on complex media but growth on cellulosic media was found only under aerobic conditions. Total fatty acid analysis (MIDI) of NCIB 10462 failed to group this bacterium with a known pseudomonas species. However, fatty acid analysis of the bacteria when grown at temperatures below 37{degrees}C suggest that the organism is a pseudomonad. Since a predominant characteristic of this bacterium is it`s ability to degrade cellulose, we suggest it be called Pseudomonas cellulosa.« less
Jia, Xuanyan; Yao, Jianyun; Gao, Zengqiang; Liu, Guangfeng; Dong, Yu-Hui; Wang, Xiaoxue; Zhang, Heng
2018-05-04
Toxin-antitoxin (TA) loci in bacteria are small genetic modules that regulate various cellular activities, including cell growth and death. The two-gene module encoding a HEPN (higher eukaryotes and prokaryotes nucleotide-binding) domain and a cognate MNT (minimal nucleotidyltransferase) domain have been predicted to represent a novel type II TA system prevalent in archaea and bacteria. However, the neutralization mechanism and cellular targets of the TA family remain unclear. The toxin SO_3166 having a HEPN domain and its cognate antitoxin SO_3165 with an MNT domain constitute a typical type II TA system that regulates cell motility and confers plasmid stability in the bacterium Shewanella oneidensis Here, we report the crystal structure and solution conformation of the SO_3166-SO_3165 pair, representing the first complex structures in this TA family. The structures revealed that SO_3165 and SO_3166 form a tight heterooctamer (at a 2:6 ratio), an organization that is very rare in other TA systems. We also observed that SO_3166 dimerization enables the formation of a deep cleft at the HEPN-domain interface harboring a composite R X 4-6H active site that functions as an RNA-cleaving RNase. SO_3165 bound SO_3166 mainly through its two α-helices (α2 and α4), functioning as molecular recognition elements. Moreover, their insertion into the SO_3166 cleft sterically blocked the R X 4-6H site or narrowed the cleft to inhibit RNA substrate binding. Structure-based mutagenesis confirmed the important roles of these α-helices in SO_3166 binding and inhibition. Our structure-function analysis provides first insights into the neutralization mechanism of the HEPN-MNT TA family. © 2018 Jia et al.
Tadokoro, Takashi; Matsushita, Kyoko; Abe, Yumi; Rohman, Muhammad Saifur; Koga, Yuichi; Takano, Kazufumi; Kanaya, Shigenori
2008-08-05
Ribonuclease HI from the psychrotrophic bacterium Shewanella oneidensis MR-1 (So-RNase HI) is much less stable than Escherichia coli RNase HI (Ec-RNase HI) by 22.4 degrees C in T m and 12.5 kJ mol (-1) in Delta G(H 2O), despite their high degrees of structural and functional similarity. To examine whether the stability of So-RNase HI increases to a level similar to that of Ec-RNase HI via introduction of several mutations, the mutations that stabilize So-RNase HI were identified by the suppressor mutation method and combined. So-RNase HI and its variant with a C-terminal four-residue truncation (154-RNase HI) complemented the RNase H-dependent temperature-sensitive (ts) growth phenotype of E. coli strain MIC3001, while 153-RNase HI with a five-residue truncation could not. Analyses of the activity and stability of these truncated proteins suggest that 153-RNase HI is nonfunctional in vivo because of a great decrease in stability. Random mutagenesis of 153-RNase HI using error-prone PCR, followed by screening for the revertants, allowed us to identify six single suppressor mutations that make 153-RNase HI functional in vivo. Four of them markedly increased the stability of the wild-type protein by 3.6-6.7 degrees C in T m and 1.7-5.2 kJ mol (-1) in Delta G(H 2O). The effects of these mutations were nearly additive, and combination of these mutations increased protein stability by 18.7 degrees C in T m and 12.2 kJ mol (-1) in Delta G(H 2O). These results suggest that several residues are not optimal for the stability of So-RNase HI, and their replacement with other residues strikingly increases it to a level similar to that of the mesophilic counterpart.
Soe, Cho Z; Codd, Rachel
2014-04-18
To acquire iron essential for growth, the bacterium Shewanella putrefaciens produces the macrocyclic dihydroxamic acid putrebactin (pbH2; [M + H(+)](+), m/zcalc 373.2) as its native siderophore. The assembly of pbH2 requires endogenous 1,4-diaminobutane (DB), which is produced from the ornithine decarboxylase (ODC)-catalyzed decarboxylation of l-ornithine. In this work, levels of endogenous DB were attenuated in S. putrefaciens cultures by augmenting the medium with the ODC inhibitor 1,4-diamino-2-butanone (DBO). The presence in the medium of DBO together with alternative exogenous non-native diamine substrates, (15)N2-1,4-diaminobutane ((15)N2-DB) or 1,4-diamino-2(E)-butene (E-DBE), resulted in the respective biosynthesis of (15)N-labeled pbH2 ((15)N4-pbH2; [M + H(+)](+), m/zcalc 377.2, m/zobs 377.2) or the unsaturated pbH2 variant, named here: E,E-putrebactene (E,E-pbeH2; [M + H(+)](+), m/zcalc 369.2, m/zobs 369.2). In the latter system, remaining endogenous DB resulted in the parallel biosynthesis of the monounsaturated DB-E-DBE hybrid, E-putrebactene (E-pbxH2; [M + H(+)](+), m/zcalc 371.2, m/zobs 371.2). These are the first identified unsaturated macrocyclic dihydroxamic acid siderophores. LC-MS measurements showed 1:1 complexes formed between Fe(III) and pbH2 ([Fe(pb)](+); [M](+), m/zcalc 426.1, m/zobs 426.2), (15)N4-pbH2 ([Fe((15)N4-pb)](+); [M](+), m/zcalc 430.1, m/zobs 430.1), E,E-pbeH2 ([Fe(E,E-pbe)](+); [M](+), m/zcalc 422.1, m/zobs 422.0), or E-pbxH2 ([Fe(E-pbx)](+); [M](+), m/zcalc 424.1, m/zobs 424.2). The order of the gain in siderophore-mediated Fe(III) solubility, as defined by the difference in retention time between the free ligand and the Fe(III)-loaded complex, was pbH2 (ΔtR = 8.77 min) > E-pbxH2 (ΔtR = 6.95 min) > E,E-pbeH2 (ΔtR = 6.16 min), which suggests one possible reason why nature has selected for saturated rather than unsaturated siderophores as Fe(III) solubilization agents. The potential to conduct multiple types of ex situ chemical
Assessing the potential of spectral induced polarization to detect in situ changes in iron reduction
NASA Astrophysics Data System (ADS)
Rosier, C. L.; Price, A.; Sharma, S.; Atekwana, E. A.
2016-12-01
The near surface geophysical technique Spectral Induced Polarization (SIP), provides promise as an effective method measuring in situ biofilm formation/development. Yet, potential mechanisms responsible for observed shifts in SIP response due to biofilm are not clearly understood. In order to address possible mechanisms we assessed the influence of Shewanella oneidensis (MR1) cell density (colony forming units; CFU), biofilm production (Bradford assay) and iron reduction metabolism (colorimetric assay) on SIP response. Laboratory measurements were collected over three months on columns packed with either iron-coated or iron-free sands and amended with artificial ground water and acetate in order to stimulate biofilm production and microbial iron reduction. Additionally, scanning electron microscopy (SEM) was used to confirm the presence of S. oneidensis cells and biofilm. Our results suggest that during early/initial stage (<30 days) of the iron-coated column incubations, both phase and imaginary conductivity response increased 4-fold as concentrations of reduced iron increased from 0-50 mM. In the later stages (>75 days) of column incubation, SIP measurements revealed that phase and imaginary conductivity responses decreased as the concentration of reduced iron decreased below 2.0 mM. In contrast, we observed only a moderate increase in phase and imaginary conductivity ( 30%) within iron-free columns as a result of increases in S. oneidensis cells (CFU 1.5 x 1011) and biofilm production (7.0 mg ml-1). SEM analysis confirmed the presence of biofilm and cells within both iron-coated and iron-free columns. We hypothesize that the production of microbial metabolic byproducts is a potential mechanism explaining large phase shits observed in previous studies ( 50 mrads) rather than the conductivity of cells or biofilm. Our findings provide support for the following: i) ratio of cells to biofilm production only moderately influences both phase and imaginary conductivity
Plymale, Andrew E; Bailey, Vanessa L; Fredrickson, James K; Heald, Steve M; Buck, Edgar C; Shi, Liang; Wang, Zheming; Resch, Charles T; Moore, Dean A; Bolton, Harvey
2012-02-21
This study measured reductive solubilization of plutonium(IV) hydrous oxide (Pu(IV)O(2)·xH(2)O((am))) with hydrogen (H(2)) as electron donor, in the presence or absence of dissimilatory metal-reducing bacteria (DMRB), anthraquinone-2,6-disulfonate (AQDS), and ethylenediaminetetraacetate (EDTA). In PIPES buffer at pH 7 with excess H(2), Shewanella oneidensis and Geobacter sulfurreducens both solubilized <0.001% of 0.5 mM Pu(IV)O(2)·xH(2)O((am)) over 8 days, with or without AQDS. However, Pu((aq)) increased by an order of magnitude in some treatments, and increases in solubility were associated with production of Pu(III)((aq)). The solid phase of these treatments contained Pu(III)(OH)(3(am)), with more in the DMRB treatments compared with abiotic controls. In the presence of EDTA and AQDS, PuO(2)·xH(2)O((am)) was completely solubilized by S. oneidensis and G. sulfurreducens in ∼24 h. Without AQDS, bioreductive solubilization was slower (∼22 days) and less extensive (∼83-94%). In the absence of DMRB, EDTA facilitated reductive solubilization of 89% (without AQDS) to 98% (with AQDS) of the added PuO(2)·xH(2)O((am)) over 418 days. An in vitro assay demonstrated electron transfer to PuO(2)·xH(2)O((am)) from the S. oneidensis outer-membrane c-type cytochrome MtrC. Our results (1) suggest that PuO(2)·xH(2)O((am)) reductive solubilization may be important in reducing environments, especially in the presence of complexing ligands and electron shuttles, (2) highlight the environmental importance of polynuclear, colloidal Pu, (3) provide additional evidence that Pu(III)-EDTA is a more likely mobile form of Pu than Pu(IV)-EDTA, and (4) provide another example of outer-membrane cytochromes and electron-shuttling compounds facilitating bioreduction of insoluble electron acceptors in geologic environments.
Yoon, Sukhwan; Cruz-García, Claribel; Sanford, Robert; Ritalahti, Kirsti M; Löffler, Frank E
2015-01-01
Denitrification and respiratory ammonification are two competing, energy-conserving NO3−/NO2− reduction pathways that have major biogeochemical consequences for N retention, plant growth and climate. Batch and continuous culture experiments using Shewanella loihica strain PV-4, a bacterium possessing both the denitrification and respiratory ammonification pathways, revealed factors that determine NO3−/NO2− fate. Denitrification dominated at low carbon-to-nitrogen (C/N) ratios (that is, electron donor-limiting growth conditions), whereas ammonium was the predominant product at high C/N ratios (that is, electron acceptor-limiting growth conditions). pH and temperature also affected NO3−/NO2− fate, and incubation above pH 7.0 and temperatures of 30 °C favored ammonium formation. Reverse-transcriptase real-time quantitative PCR analyses correlated the phenotypic observations with nirK and nosZ transcript abundances that decreased up to 1600-fold and 27-fold, respectively, under conditions favoring respiratory ammonification. Of the two nrfA genes encoded on the strain PV-4 genome, nrfA0844 transcription decreased only when the chemostat reactor received medium with the lowest C/N ratio of 1.5, whereas nrfA0505 transcription occurred at low levels (≤3.4 × 10−2 transcripts per cell) under all growth conditions. At intermediate C/N ratios, denitrification and respiratory ammonification occurred concomitantly, and both nrfA0844 (5.5 transcripts per cell) and nirK (0.88 transcripts per cell) were transcribed. Recent findings suggest that organisms with both the denitrification and respiratory ammonification pathways are not uncommon in soil and sediment ecosystems, and strain PV-4 offers a tractable experimental system to explore regulation of dissimilatory NO3−/NO2− reduction pathways. PMID:25350157
High-pressure-induced water penetration into 3-isopropylmalate dehydrogenase
Nagae, Takayuki; Kawamura, Takashi; Chavas, Leonard M. G.; Niwa, Ken; Hasegawa, Masashi; Kato, Chiaki; Watanabe, Nobuhisa
2012-01-01
Hydrostatic pressure induces structural changes in proteins, including denaturation, the mechanism of which has been attributed to water penetration into the protein interior. In this study, structures of 3-isopropylmalate dehydrogenase (IPMDH) from Shewanella oneidensis MR-1 were determined at about 2 Å resolution under pressures ranging from 0.1 to 650 MPa using a diamond anvil cell (DAC). Although most of the protein cavities are monotonically compressed as the pressure increases, the volume of one particular cavity at the dimer interface increases at pressures over 340 MPa. In parallel with this volume increase, water penetration into the cavity could be observed at pressures over 410 MPa. In addition, the generation of a new cleft on the molecular surface accompanied by water penetration could also be observed at pressures over 580 MPa. These water-penetration phenomena are considered to be initial steps in the pressure-denaturation process of IPMDH. PMID:22349232
Zubieta, Chloe; Krishna, S Sri; Kapoor, Mili; Kozbial, Piotr; McMullan, Daniel; Axelrod, Herbert L; Miller, Mitchell D; Abdubek, Polat; Ambing, Eileen; Astakhova, Tamara; Carlton, Dennis; Chiu, Hsiu-Ju; Clayton, Thomas; Deller, Marc C; Duan, Lian; Elsliger, Marc-André; Feuerhelm, Julie; Grzechnik, Slawomir K; Hale, Joanna; Hampton, Eric; Han, Gye Won; Jaroszewski, Lukasz; Jin, Kevin K; Klock, Heath E; Knuth, Mark W; Kumar, Abhinav; Marciano, David; Morse, Andrew T; Nigoghossian, Edward; Okach, Linda; Oommachen, Silvya; Reyes, Ron; Rife, Christopher L; Schimmel, Paul; van den Bedem, Henry; Weekes, Dana; White, Aprilfawn; Xu, Qingping; Hodgson, Keith O; Wooley, John; Deacon, Ashley M; Godzik, Adam; Lesley, Scott A; Wilson, Ian A
2007-11-01
BtDyP from Bacteroides thetaiotaomicron (strain VPI-5482) and TyrA from Shewanella oneidensis are dye-decolorizing peroxidases (DyPs), members of a new family of heme-dependent peroxidases recently identified in fungi and bacteria. Here, we report the crystal structures of BtDyP and TyrA at 1.6 and 2.7 A, respectively. BtDyP assembles into a hexamer, while TyrA assembles into a dimer; the dimerization interface is conserved between the two proteins. Each monomer exhibits a two-domain, alpha+beta ferredoxin-like fold. A site for heme binding was identified computationally, and modeling of a heme into the proposed active site allowed for identification of residues likely to be functionally important. Structural and sequence comparisons with other DyPs demonstrate a conservation of putative heme-binding residues, including an absolutely conserved histidine. Isothermal titration calorimetry experiments confirm heme binding, but with a stoichiometry of 0.3:1 (heme:protein). (c) 2007 Wiley-Liss, Inc.
Kaiser, Patrick; Reich, Steffen; Greiner, Andreas; Freitag, Ruth
2018-06-12
Biocomposites, i.e., materials consisting of metabolically active microorganisms embedded in a synthetic extracellular matrix, may find applications as highly specific catalysts in bioproduction and bioremediation. 3D constructs based on fibrous biocomposites, so-called "artificial biofilms," are of particular interest in this context. The inability to produce biocomposite fibers of sufficient mechanical strength for processing into bioactive fabrics has so far hindered progress in the area. Herein a method is proposed for the direct wet spinning of microfibers suitable for weaving and knitting. Metabolically active bacteria (either Shewanella oneidensis or Nitrobacter winogradskyi (N. winogradskyi)) are embedded in these fibers, using poly(vinyl alcohol) as matrix. The produced microfibers have a partially crystalline structure and are stable in water without further treatment, such as coating. In a first application, their potential for nitrite removal (N. winogradskyi) is demonstrated, a typical challenge in potable water treatment. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Okamoto, Akihiro; Kalathil, Shafeer; Deng, Xiao; Hashimoto, Kazuhito; Nakamura, Ryuhei; Nealson, Kenneth H
2014-07-11
The variety of solid surfaces to and from which microbes can deliver electrons by extracellular electron transport (EET) processes via outer-membrane c-type cytochromes (OM c-Cyts) expands the importance of microbial respiration in natural environments and industrial applications. Here, we demonstrate that the bifurcated EET pathway of OM c-Cyts sustains the diversity of the EET surface in Shewanella oneidensis MR-1 via specific binding with cell-secreted flavin mononucleotide (FMN) and riboflavin (RF). Microbial current production and whole-cell differential pulse voltammetry revealed that RF and FMN enhance EET as bound cofactors in a similar manner. Conversely, FMN and RF were clearly differentiated in the EET enhancement by gene-deletion of OM c-Cyts and the dependency of the electrode potential and pH. These results indicate that RF and FMN have specific binding sites in OM c-Cyts and highlight the potential roles of these flavin-cytochrome complexes in controlling the rate of electron transfer to surfaces with diverse potential and pH.
Analysis of Structural MtrC Models Based on Homology with the Crystal Structure of MtrF
DOE Office of Scientific and Technical Information (OSTI.GOV)
Edwards, Marcus; Fredrickson, Jim K.; Zachara, John M.
2012-12-01
The outer-membrane decahaem cytochrome MtrC is part of the transmembrane MtrCAB complex required for mineral respiration by Shewanella oneidensis. MtrC has significant sequence similarity to the paralogous decahaem cytochrome MtrF, which has been structurally solved through X-ray crystallography. This now allows for homology-based models of MtrC to be generated. The structure of these MtrC homology models contain ten bis-histidine-co-ordinated c-type haems arranged in a staggered cross through a four-domain structure. This model is consistent with current spectroscopic data and shows that the areas around haem 5 and haem 10, at the termini of an octahaem chain, are likely to havemore » functions similar to those of the corresponding haems in MtrF. The electrostatic surfaces around haem 7, close to the β-barrels, are different in MtrF and MtrC, indicating that these haems may have different potentials and interact with substrates differently.« less
Characterization of microbial current production as a function of microbe-electrode-interaction.
Dolch, Kerstin; Danzer, Joana; Kabbeck, Tobias; Bierer, Benedikt; Erben, Johannes; Förster, Andreas H; Maisch, Jan; Nick, Peter; Kerzenmacher, Sven; Gescher, Johannes
2014-04-01
Microbe-electrode-interactions are keys for microbial fuel cell technology. Nevertheless, standard measurement routines to analyze the interplay of microbial physiology and material characteristics have not been introduced yet. In this study, graphite anodes with varying surface properties were evaluated using pure cultures of Shewanella oneidensis and Geobacter sulfurreducens, as well as defined and undefined mixed cultures. The evaluation routine consisted of a galvanostatic period, a current sweep and an evaluation of population density. The results show that surface area correlates only to a certain extent with population density and anode performance. Furthermore, the study highlights a strain-specific microbe-electrode-interaction, which is affected by the introduction of another microorganism. Moreover, evidence is provided for the possibility of translating results from pure culture to undefined mixed species experiments. This is the first study on microbe-electrode-interaction that systematically integrates and compares electrochemical and biological data. Copyright © 2014 Elsevier Ltd. All rights reserved.
Metagenomic insights into the ecology and physiology of microbes in bioelectrochemical systems.
Kouzuma, Atsushi; Ishii, Shun'ichi; Watanabe, Kazuya
2018-05-01
In bioelectrochemical systems (BESs), electrons are transferred between electrochemically active microbes (EAMs) and conductive materials, such as electrodes, via extracellular electron transfer (EET) pathways, and electrons thus transferred stimulate intracellular catabolic reactions. Catabolic and EET pathways have extensively been studied for several model EAMs, such as Shewanella oneidensis MR-1 and Geobacter sulfurreducens PCA, whereas it is also important to understand the ecophysiology of EAMs in naturally occurring microbiomes, such as those in anode biofilms in microbial fuel cells treating wastewater. Recent studies have exploited metagenomics and metatranscriptomics (meta-omics) approaches to characterize EAMs in BES-associated microbiomes. Here we review recent BES studies that used meta-omics approaches and show that these studies have discovered unexpected features of EAMs and deepened our understanding of functions and behaviors of microbes in BESs. It is desired that more studies will employ meta-omics approaches for advancing our knowledge on microbes in BESs. Copyright © 2018 Elsevier Ltd. All rights reserved.
Biological Recovery of Platinum Complexes from Diluted Aqueous Streams by Axenic Cultures
Maes, Synthia; Props, Ruben; Fitts, Jeffrey P.; De Smet, Rebecca; Vanhaecke, Frank; Boon, Nico; Hennebel, Tom
2017-01-01
The widespread use of platinum in high-tech and catalytic applications has led to the production of diverse Pt loaded wastewaters. Effective recovery strategies are needed for the treatment of low concentrated waste streams to prevent pollution and to stimulate recovery of this precious resource. The biological recovery of five common environmental Pt-complexes was studied under acidic conditions; the chloro-complexes PtCl42- and PtCl62-, the amine-complex Pt(NH3)4Cl2 and the pharmaceutical complexes cisplatin and carboplatin. Five bacterial species were screened on their platinum recovery potential; the Gram-negative species Shewanella oneidensis MR-1, Cupriavidus metallidurans CH34, Geobacter metallireducens, and Pseudomonas stutzeri, and the Gram-positive species Bacillus toyonensis. Overall, PtCl42- and PtCl62- were completely recovered by all bacterial species while only S. oneidensis and C. metallidurans were able to recover cisplatin quantitatively (99%), all in the presence of H2 as electron donor at pH 2. Carboplatin was only partly recovered (max. 25% at pH 7), whereas no recovery was observed in the case of the Pt-tetraamine complex. Transmission electron microscopy (TEM) revealed the presence of both intra- and extracellular platinum particles. Flow cytometry based microbial viability assessment demonstrated the decrease in number of intact bacterial cells during platinum reduction and indicated C. metallidurans to be the most resistant species. This study showed the effective and complete biological recovery of three common Pt-complexes, and estimated the fate and transport of the Pt-complexes in wastewater treatment plants and the natural environment. PMID:28046131
Biological Recovery of Platinum Complexes from Diluted Aqueous Streams by Axenic Cultures.
Maes, Synthia; Props, Ruben; Fitts, Jeffrey P; De Smet, Rebecca; Vanhaecke, Frank; Boon, Nico; Hennebel, Tom
2017-01-01
The widespread use of platinum in high-tech and catalytic applications has led to the production of diverse Pt loaded wastewaters. Effective recovery strategies are needed for the treatment of low concentrated waste streams to prevent pollution and to stimulate recovery of this precious resource. The biological recovery of five common environmental Pt-complexes was studied under acidic conditions; the chloro-complexes PtCl42- and PtCl62-, the amine-complex Pt(NH3)4Cl2 and the pharmaceutical complexes cisplatin and carboplatin. Five bacterial species were screened on their platinum recovery potential; the Gram-negative species Shewanella oneidensis MR-1, Cupriavidus metallidurans CH34, Geobacter metallireducens, and Pseudomonas stutzeri, and the Gram-positive species Bacillus toyonensis. Overall, PtCl42- and PtCl62- were completely recovered by all bacterial species while only S. oneidensis and C. metallidurans were able to recover cisplatin quantitatively (99%), all in the presence of H2 as electron donor at pH 2. Carboplatin was only partly recovered (max. 25% at pH 7), whereas no recovery was observed in the case of the Pt-tetraamine complex. Transmission electron microscopy (TEM) revealed the presence of both intra- and extracellular platinum particles. Flow cytometry based microbial viability assessment demonstrated the decrease in number of intact bacterial cells during platinum reduction and indicated C. metallidurans to be the most resistant species. This study showed the effective and complete biological recovery of three common Pt-complexes, and estimated the fate and transport of the Pt-complexes in wastewater treatment plants and the natural environment.
Ceccarelli, Daniela; van Essen-Zandbergen, Alieda; Veldman, Kees T; Tafro, Nedzib; Haenen, Olga; Mevius, Dik J
2017-02-01
Carbapenems are considered last-resort antibiotics in health care. Increasing reports of carbapenemase-producing bacteria in food-producing animals and in the environment indicate the importance of this phenomenon in public health. Surveillance for carbapenemase genes and carbapenemase-producing bacteria in Dutch food-producing animals, environmental freshwater, and imported ornamental fish revealed several chromosome-based bla OXA-48 -like variants in Shewanella spp., including two new alleles, bla OXA-514 and bla OXA-515 Carbapenemase genes were not associated with mobile genetic elements or Enterobacteriaceae. Copyright © 2017 American Society for Microbiology.
Oxidation of Ethylene Glycol by a Salt-Requiring Bacterium
Caskey, William H.; Taber, Willard A.
1981-01-01
Bacterium T-52, cultured on ethylene glycol, readily oxidized glycolate and glyoxylate and exhibited elevated activities of ethylene glycol dehydrogenase and glycolate oxidase. Labeled glyoxylate was identified in reaction mixtures containing [14C]-ethylene glycol, but no glycolate was detected. The most likely pathway of ethylene glycol catabolism by bacterium T-52 is sequential oxidation to glycolate and glyoxylate. PMID:16345810
[A rare cause of pneumonia: Shewanella putrefaciens].
Durdu, Bülent; Durdu, Yasemin; Güleç, Nuray; Islim, Filiz; Biçer, Mualla
2012-01-01
Shewanella putrefaciens is a gram-negative, non-fermentative, oxidase positive, motile bacillus that produces hydrogen sulphide. It is found widely in the nature especially in marine environments. Although it is accepted as saprophytic, different clinical syndromes, most commonly skin or soft tissue infections, have been associated with S.putrefaciens, mainly in immunocompromised cases and patients with underlying diseases. However, pneumonia cases due to S.putrefaciens are quite limited in the literature. In this report, a case of pneumonia caused by S.putrefaciens was presented. A 43-year-old female patient was admitted to our hospital with the complaints of fever, cough, sputum and weakness. The patient has had brochiectasis since childhood and has used periodical antibiotic therapies due to pneumoniae episodes. She was diagnosed to have pneumonia based on the clinical, radiological and laboratory findings, and empirical antibiotic treatment with ciprofloxacin and ceftazidime combination was initiated. Gram-stained smear of sputum yielded abundant leucocytes and gram-negative bacteria, and the isolate grown in the sputum culture was identified as S.putrefaciens by conventional methods and API 20 NE (BioMerieux, France) system. The isolate was found susceptible to ceftriaxone, ceftazidime, cefepime, ciprofloxacin, piperacillin-tazobactam, cephoperazon-sulbactam, imipenem, amikacin, gentamicin and trimethoprime-sulphametoxazole; whereas resistant to ampicillin, amoxycillin-clavulanate, cefazolin and cefuroxime, by Kirby-Bauer disk diffusion method. According to the antibiogram results, the therapy was changed to ceftriaxone (1 x 2 g, intravenous). The patient was discharged with complete cure after 14 days of therapy. In conclusion, S.putrefaciens should be considered in patients with predisposing factors as an unusual cause of pneumonia and the characteristics such as H2S production and sensitivity to third generation cephalosporins and penicillins should be used
2011-01-01
Background L-arabinose isomerases catalyse the isomerization of L-arabinose into L-ribulose at insight biological systems. At industrial scale of this enzyme is used for the bioconversion of D-galactose into D-tagatose which has many applications in pharmaceutical and agro-food industries. The isomerization reaction is thermodynamically equilibrated, and therefore the bioconversion rates is shifted towards tagatose when the temperature is increased. Moreover, to prevent secondary reactions it will be of interest to operate at low pH. The profitability of this D-tagatose production process is mainly related to the use of lactose as cheaper raw material. In many dairy products it will be interesting to produce D-tagatose during storage. This requires an efficient L-arabinose isomerase acting at low temperature and pH values. Results The gene encoding the L-arabinose isomerase from Shewanella sp. ANA-3 was cloned and overexpressed in Escherichia coli. The purified protein has a tetrameric arrangement composed by four identical 55 kDa subunits. The biochemical characterization of this enzyme showed that it was distinguishable by its maximal activity at low temperatures comprised between 15-35°C. Interestingly, this biocatalyst preserves more than 85% of its activity in a broad range of temperatures from 4.0 to 45°C. Shewanella sp. ANA-3 L-arabinose isomerase was also optimally active at pH 5.5-6.5 and maintained over 80% of its activity at large pH values from 4.0 to 8.5. Furthermore, this enzyme exhibited a weak requirement for metallic ions for its activity evaluated at 0.6 mM Mn2+. Stability studies showed that this protein is highly stable mainly at low temperature and pH values. Remarkably, T268K mutation clearly enhances the enzyme stability at low pH values. Use of this L-arabinose isomerase for D-tagatose production allows the achievement of attractive bioconversion rates of 16% at 4°C and 34% at 35°C. Conclusions Here we reported the purification and the
Physiology and enzymology involved in denitrification by Shewanella putrefaciens
NASA Technical Reports Server (NTRS)
Krause, B.; Nealson, K. H.
1997-01-01
Nitrate reduction to N2O was investigated in batch cultures of Shewanella putrefaciens MR-1, MR-4, and MR-7. All three strains reduced nitrate to nitrite to N2O, and this reduction was coupled to growth, whereas ammonium accumulation was very low (0 to 1 micromol liter-1). All S. putrefaciens isolates were also capable of reducing nitrate aerobically; under anaerobic conditions, nitrite levels were three- to sixfold higher than those found under oxic conditions. Nitrate reductase activities (31 to 60 micromol of nitrite min-1 mg of protein-1) detected in intact cells of S. putrefaciens were equal to or higher than those seen in Escherichia coli LE 392. Km values for nitrate reduction ranged from 12 mM for MR-1 to 1.3 mM for MR-4 with benzyl viologen as an artifical electron donor. Nitrate and nitrite reductase activities in cell-free preparations were demonstrated in native gels by using reduced benzyl viologen. Detergent treatment of crude and membrane extracts suggested that the nitrate reductases of MR-1 and MR-4 are membrane bound. When the nitrate reductase in MR-1 was partially purified, three subunits (90, 70, and 55 kDa) were detected in denaturing gels. The nitrite reductase of MR-1 is also membrane bound and appeared as a 60-kDa band in sodium dodecyl sulfate-polyacrylamide gels after partial purification.
NASA Astrophysics Data System (ADS)
Hamzah, Haider Mousa
In the microbial fuel cell (MFC) project, power generation from Shewanella oneidensis MR-1 was analyzed looking for a novel system for both energy generation and sustainability. The results suggest the possibility of generating electricity from different organic substances, which include agricultural and industrial by-products. Shewanella oneidensis MR-1 generates usable electrons at 30°C using both submerged and solid state cultures. In the MFC biocathode experiment, most of the CO2 generated at the anodic chamber was converted into bicarbonate due the activity of carbonic anhydrase (CA) of the Gluconobacter sp.33 strain. These findings demonstrate the possibility of generation of electricity while at the same time allowing the biomimetic sequestration of CO2 using bacterial CA. In the mitochondrial genomes project, the filamentous fungal species Fusarium oxysporum was used as a model. This species causes wilt of several important agricultural crops. A previous study revealed that a highly variable region (HVR) in the mitochondrial DNA (mtDNA) of three species of Fusarium contained a large, variable unidentified open reading frame (LV-uORF). Using specific primers for two regions of the LV-uORF, six strains were found to contain the ORF by PCR and database searches identified 18 other strains outside of the Fusarium oxysporum species complex. The LV-uORF was also identified in three isolates of the F. oxysporum species complex. Interestingly, several F. oxysporum isolates lack the LV-uORF and instead contain 13 ORFs in the HVR, nine of which are unidentified. The high GC content and codon usage of the LV-uORF indicate that it did not co-evolve with other mt genes and was horizontally acquired and was introduced to the Fusarium lineage prior to speciation. The nonsynonymous/synonymous (dN/dS) ratio of the LV-uORFs (0.43) suggests it is under purifying selection and the putative polypeptide is predicted to be located in the mitochondrial membrane. Growth assays
2008-05-01
A second approach is the use of soluble mediators such as, quinones, phenazines , and riboflavin, which are able to shuttle electrons from the cell...done using the equivalent graphite felt or graphite felt coated with platinum nanoparticles . Fuel cell chambers were separated using a gas-permeable
Rütschlin, Sina; Gunesch, Sandra; Böttcher, Thomas
2017-05-18
Shewanella algae B516 produces avaroferrin, an asymmetric hydroxamate siderophore, which has been shown to inhibit swarming motility of Vibrio alginolyticus. We aimed to elucidate the biosynthesis of this siderophore and to investigate how S. algae coordinates the production of avaroferrin and its two symmetric counterparts. We reconstituted the reaction in vitro with the main enzyme AvbD and the putative biosynthetic precursors, and demonstrate that multispecificity of this enzyme results in the production of all three cyclic hydroxamate siderophores that were previously isolated as natural products from S. algae. Surprisingly, purified AvbD exhibited a clear preference for the larger cadaverine-derived substrate. In live cells, however, siderophore ratios are maximized toward avaroferrin production, and we demonstrate that these siderophore ratios are the result of a regulation on substrate pool level, which may allow rapid evolutionary adaptation to environmental changes. Our results thereby give insights into a unique evolutionary strategy toward metabolite diversity. Copyright © 2017 Elsevier Ltd. All rights reserved.
Fukatsu, Takema; Hosokawa, Takahiro
2002-01-01
The Japanese common plataspid stinkbug, Megacopta punctatissima, deposits small brown particles, or symbiont capsules, on the underside of the egg mass for the purpose of transmission of symbiotic bacteria to the offspring. We investigated the microbiological aspects of the bacteria contained in the capsule, such as microbial diversity, phylogenetic placement, localization in vivo, and fitness effects on the host insect. Restriction fragment length polymorphism analysis of 16S ribosomal DNA clones revealed that a single bacterial species dominates the microbiota in the capsule. The bacterium was not detected in the eggs but in the capsules, which unequivocally demonstrated that the bacterium is transmitted to the offspring of the insect orally rather than transovarially, through probing of the capsule content. Molecular phylogenetic analysis showed that the bacterium belongs to the γ-subdivision of the Proteobacteria. In adult insects the bacterium was localized in the posterior section of the midgut. Deprivation of the bacterium from the nymphs resulted in retarded development, arrested growth, abnormal body coloration, and other symptoms, suggesting that the bacterium is essential for normal development and growth of the host insect. PMID:11772649
Swimming efficiency of bacterium Escherichia coli
Chattopadhyay, Suddhashil; Moldovan, Radu; Yeung, Chuck; Wu, X. L.
2006-01-01
We use measurements of swimming bacteria in an optical trap to determine fundamental properties of bacterial propulsion. In particular, we directly measure the force required to hold the bacterium in the optical trap and determine the propulsion matrix, which relates the translational and angular velocity of the flagellum to the torques and forces propelling the bacterium. From the propulsion matrix, dynamical properties such as torques, swimming speed, and power can be obtained by measuring the angular velocity of the motor. We find significant heterogeneities among different individuals even though all bacteria started from a single colony. The propulsive efficiency, defined as the ratio of the propulsive power output to the rotary power input provided by the motors, is found to be ≈2%, which is consistent with the efficiency predicted theoretically for a rigid helical coil. PMID:16954194
Comparative systems biology across an evolutionary gradient within the Shewanella genus.
Konstantinidis, Konstantinos T; Serres, Margrethe H; Romine, Margaret F; Rodrigues, Jorge L M; Auchtung, Jennifer; McCue, Lee-Ann; Lipton, Mary S; Obraztsova, Anna; Giometti, Carol S; Nealson, Kenneth H; Fredrickson, James K; Tiedje, James M
2009-09-15
To what extent genotypic differences translate to phenotypic variation remains a poorly understood issue of paramount importance for several cornerstone concepts of microbiology including the species definition. Here, we take advantage of the completed genomic sequences, expressed proteomic profiles, and physiological studies of 10 closely related Shewanella strains and species to provide quantitative insights into this issue. Our analyses revealed that, despite extensive horizontal gene transfer within these genomes, the genotypic and phenotypic similarities among the organisms were generally predictable from their evolutionary relatedness. The power of the predictions depended on the degree of ecological specialization of the organisms evaluated. Using the gradient of evolutionary relatedness formed by these genomes, we were able to partly isolate the effect of ecology from that of evolutionary divergence and to rank the different cellular functions in terms of their rates of evolution. Our ranking also revealed that whole-cell protein expression differences among these organisms, when the organisms were grown under identical conditions, were relatively larger than differences at the genome level, suggesting that similarity in gene regulation and expression should constitute another important parameter for (new) species description. Collectively, our results provide important new information toward beginning a systems-level understanding of bacterial species and genera.
Coiled to diffuse: Brownian motion of a helical bacterium.
Butenko, Alexander V; Mogilko, Emma; Amitai, Lee; Pokroy, Boaz; Sloutskin, Eli
2012-09-11
We employ real-time three-dimensional confocal microscopy to follow the Brownian motion of a fixed helically shaped Leptospira interrogans (LI) bacterium. We extract from our measurements the translational and the rotational diffusion coefficients of this bacterium. A simple theoretical model is suggested, perfectly reproducing the experimental diffusion coefficients, with no tunable parameters. An older theoretical model, where edge effects are neglected, dramatically underestimates the observed rates of translation. Interestingly, the coiling of LI increases its rotational diffusion coefficient by a factor of 5, compared to a (hypothetical) rectified bacterium of the same contour length. Moreover, the translational diffusion coefficients would have decreased by a factor of ~1.5, if LI were rectified. This suggests that the spiral shape of the spirochaete bacteria, in addition to being employed for their active twisting motion, may also increase the ability of these bacteria to explore the surrounding fluid by passive Brownian diffusion.
[Partial biological characteristics and algicidal activity of an algicidal bacterium].
Li, San-Hua; Zhang, Qi-Ya
2013-02-01
An algicidal bacterium was isolated from freshwater (Lake Donghu in Wuhan) and coded as A01. The morphology of the algicidal bacterium was observed using optical microscope and electron microscopes, the results showed that A01 was rod-shaped, approximately 1.5 microm in length and 0.45 microm in width and with no flagella structure. A01 was Gram-negative and belongs to the family Acinetobacter sp. though identification by Gram's staining and 16S rDNA gene analysis. A01 exhibited strong algicidal activity on the bloom-forming cyanobacterium Anabaena eucompacta under laboratory conditions. The removal rate of chlorophyll a after 7-day incubation with the culture supernatant of A01 and thalli were 77% and 61%, respectively. Microscopic observation showed that almost all cyanobacterial cells were destroyed within 3 d of co-incubation with the supernatant of algicidal bacterium, but a mass of the cyanobacterial cell lysis was observed only after 5 d of co-incubation with the thalli of algicidal bacterium. These results indicated that the main algicidal component of A01 was in its culture supernatant. In other words, the strain A01 could secrete algicidal component against Anabaena eucompacta.
Below-Background Ionizing Radiation as an Environmental Cue for Bacteria
Castillo, Hugo; Smith, Geoffrey B.
2017-02-14
All organisms on earth grow under the influence of a natural and relatively constant dose of ionizing radiation referred to as background radiation, and so cells have different mechanisms to prevent the accumulation of damage caused by its different components. However, current knowledge of the deleterious effects of radiation on cells is based on the exposure to acute and high or to chronic, above background doses of radiation and therefore is not appropriate to explain the cellular and biochemical mechanisms that cells employ to sense and respond to chronic below-background levels. Studies at below-background radiation doses can provide insight intomore » the biological role of radiation, as suggested by several examples of what appears to be a stress response in cells grown at doses that range from 10 to 79 times lower than background. Here, we discuss some of the technical constraints to shield cells from radiation to below-background levels, as well as different approaches used to detect and measure responses to such unusual environmental conditions. Then, we present data from Shewanella oneidensis and Deinococcus radiodurans experiments that show how two taxonomically distant bacterial species sense and respond to unnaturally low levels of radiation. Finally, in brief, we grew S. oneidensis and D. radiodurans in liquid culture at dose rates of 72.05 (control) and 0.91 (treatment) nGy hr -1 (including radon) for up to 72 h and measured cell density and the expression of stress-related genes. Our results suggest that a stress response is triggered in the absence of normal levels of radiation.« less
Below-Background Ionizing Radiation as an Environmental Cue for Bacteria
DOE Office of Scientific and Technical Information (OSTI.GOV)
Castillo, Hugo; Smith, Geoffrey B.
All organisms on earth grow under the influence of a natural and relatively constant dose of ionizing radiation referred to as background radiation, and so cells have different mechanisms to prevent the accumulation of damage caused by its different components. However, current knowledge of the deleterious effects of radiation on cells is based on the exposure to acute and high or to chronic, above background doses of radiation and therefore is not appropriate to explain the cellular and biochemical mechanisms that cells employ to sense and respond to chronic below-background levels. Studies at below-background radiation doses can provide insight intomore » the biological role of radiation, as suggested by several examples of what appears to be a stress response in cells grown at doses that range from 10 to 79 times lower than background. Here, we discuss some of the technical constraints to shield cells from radiation to below-background levels, as well as different approaches used to detect and measure responses to such unusual environmental conditions. Then, we present data from Shewanella oneidensis and Deinococcus radiodurans experiments that show how two taxonomically distant bacterial species sense and respond to unnaturally low levels of radiation. Finally, in brief, we grew S. oneidensis and D. radiodurans in liquid culture at dose rates of 72.05 (control) and 0.91 (treatment) nGy hr -1 (including radon) for up to 72 h and measured cell density and the expression of stress-related genes. Our results suggest that a stress response is triggered in the absence of normal levels of radiation.« less
Kondo, Katsuhito; Okamoto, Akihiro; Hashimoto, Kazuhito; Nakamura, Ryuhei
2015-07-07
In addition to serving as an energy source for microbial growth, iron sulfides are proposed to act as naturally occurring electrical wires that mediate long-distance extracellular electron transfer (EET) and bridge spatially discrete redox environments. These hypothetical EET reactions stand on the abilities of microbes to use the interfacial electrochemistry of metallic/semiconductive iron sulfides to maintain metabolisms; however, the mechanisms of these phenomena remain unexplored. To obtain insight into EET to iron sulfides, we monitored EET at the interface between Shewanella oneidensis MR-1 cells and biomineralized iron sulfides in an electrochemical cell. Respiratory current steeply increased with the concomitant formation of poorly crystalline mackinawite (FeS) minerals, indicating that S. oneidensis has the ability to exploit extracellularly formed metallic FeS for long-distance EET. Deletion of major proteins of the metal-reduction (Mtr) pathway (OmcA, MtrC, CymA, and PilD) caused only subtle effects on the EET efficiency, a finding that sharply contrasts the majority of studies that report that the Mtr pathway is indispensable for the reduction of metal oxides and electrodes. The gene expression analyses of polysulfide and thiosulfate reductase suggest the existence of a sulfur-mediated electron-shuttling mechanism by which HS(-) ions and water-soluble polysulfides (HS(n)(-), where n ≥ 2) generated in the periplasmic space deliver electrons from cellular metabolic processes to cell surface-associated FeS. The finding of this Mtr-independent pathway indicates that polysulfide reductases complement the function of outer-membrane cytochromes in EET reactions and, thus, significantly expand the number of microbial species potentially capable of long-distance EET in sulfur-rich anoxic environments.
NASA Astrophysics Data System (ADS)
Zhang, Chi; Keating, Kristina; Revil, Andre
2015-04-01
Microbes and microbial activities in the Earth's subsurface play a significant role in shaping subsurface environments and are involved in environmental applications such as remediation of contaminants in groundwater and oil fields biodegradation. Stimulated microbial growth in such applications could cause wide variety of changes of physical/chemical properties in the subsurface. It is critical to monitor and determine the fate and transportation of microorganisms in the subsurface during such applications. Recent geophysical studies demonstrate the potential of two innovative techniques, spectral induced polarization (SIP) and low-field nuclear magnetic resonance (NMR), for monitoring microbial growth and activities in porous media. The SIP measures complex dielectric properties of porous media at low frequencies of exciting electric field, and NMR studies the porous structure of geologic media and characterizes fluids subsurface. In this laboratory study, we examined both SIP and NMR responses from bacterial growth suspension as well as suspension mixed with silica sands. We focus on the direct contribution of microbes to the SIP and NMR signals in the absence of biofilm formation or biomineralization. We used Zymomonas mobilis and Shewanella oneidensis (MR-1) for SIP and NMR measurements, respectively. The SIP measurements were collected over the frequency range of 0.1 - 1 kHz on Z. mobilis growth suspension and suspension saturated sands at different cell densities. SIP data show two distinct peaks in imaginary conductivity spectra, and both imaginary and real conductivities increased as microbial density increased. NMR data were collected using both CPMG pulse sequence and D-T2 mapping to determine the T2-distribution and diffusion properties on S. oneidensis suspension, pellets (live and dead), and suspension mixed with silica sands. NMR data show a decrease in the T2-distribution in S. oneidensis suspension saturated sands as microbial density increase. A
Gut bacterium of Dendrobaena veneta (Annelida: Oligochaeta) possesses antimycobacterial activity.
Fiołka, Marta J; Zagaja, Mirosław P; Piersiak, Tomasz D; Wróbel, Marek; Pawelec, Jarosław
2010-09-01
The new bacterial strain with antimycobacterial activity has been isolated from the midgut of Dendrobaena veneta (Annelida). Biochemical and molecular characterization of isolates from 18 individuals identified all as Raoultella ornithinolytica genus with 99% similarity. The bacterium is a possible symbiont of the earthworm D. veneta. The isolated microorganism has shown the activity against four strains of fast-growing mycobacteria: Mycobacterium butiricum, Mycobacterium jucho, Mycobacterium smegmatis and Mycobacterium phlei. The multiplication of the gut bacterium on plates with Sauton medium containing mycobacteria has caused a lytic effect. After the incubation of the cell free extract prepared from the gut bacterium with four strains of mycobacteria in liquid Sauton medium, the cells of all tested strains were deformed and divided to small oval forms and sometimes created long filaments. The effect was observed by the use of light, transmission and scanning microscopy. Viability of all examined species of mycobacteria was significantly decreased. The antimycobacterial effect was probably the result of the antibiotic action produced by the gut bacterium of the earthworm. The application of ultrafiltration procedure allowed to demonstrate that antimicrobial substance with strong antimycobacterial activity from bacterial culture supernatant, is a protein with the molecular mass above 100 kDa. Copyright 2010 Elsevier Inc. All rights reserved.
Kucera, Dan; Pernicová, Iva; Kovalcik, Adriana; Koller, Martin; Mullerova, Lucie; Sedlacek, Petr; Mravec, Filip; Nebesarova, Jana; Kalina, Michal; Marova, Ivana; Krzyzanek, Vladislav; Obruca, Stanislav
2018-05-01
This work explores molecular, morphological as well as biotechnological features of the highly promising polyhydroxyalkanoates (PHA) producer Halomonas halophila. Unlike many other halophiles, this bacterium does not require expensive complex media components and it is capable to accumulate high intracellular poly(3-hydroxybutyrate) (PHB) fractions up to 82% of cell dry mass. Most remarkably, regulating the concentration of NaCl apart from PHB yields influences also the polymer's molecular mass and polydispersity. The bacterium metabolizes various carbohydrates including sugars predominant in lignocelluloses and other inexpensive substrates. Therefore, the bacterium was employed for PHB production on hydrolysates of cheese whey, spent coffee grounds, sawdust and corn stover, which were hydrolyzed by HCl; required salinity of cultivation media was set up during neutralization by NaOH. The bacterium was capable to use all the tested hydrolysates as well as sugar beet molasses for PHB biosynthesis, indicating its potential for industrial PHB production. Copyright © 2018 Elsevier Ltd. All rights reserved.
Liu, Xianshu; Ding, Jie; Ren, Nanqi; Tong, Qingyue; Zhang, Luyan
2016-01-01
In this study, the high-production-volume chemical benzothiazole (BTH) from synthetic water was fully degraded into less toxic intermediates of simple organic acids using an up-flow internal circulation microbial electrolysis reactor (UICMER) under the hydraulic retention time (HRT) of 24 h. The bioelectrochemical system was operated at 25 ± 2 °C and continuous-flow mode. The BTH loading rate varied during experiments from 20 g·m−3·day−1 to 110 g·m−3·day−1. BTH and soluble COD (Chemical Oxygen Demand) removal efficiency reached 80% to 90% under all BTH loading rates. Bioluminescence based Shewanella oneidensis strain MR-1 ecotoxicity testing demonstrated that toxicity was largely decreased compared to the BTH wastewater influent and effluent of two control experiments. The results indicated that MEC (Microbial Electrolysis Cell) was useful and reliable for improving BTH wastewater treatment efficiency, enabling the microbiological reactor to more easily respond to the requirements of higher loading rate, which is meaningful for economic and efficient operation in future scale-up. PMID:27999421
Liu, Xianshu; Ding, Jie; Ren, Nanqi; Tong, Qingyue; Zhang, Luyan
2016-12-20
In this study, the high-production-volume chemical benzothiazole (BTH) from synthetic water was fully degraded into less toxic intermediates of simple organic acids using an up-flow internal circulation microbial electrolysis reactor (UICMER) under the hydraulic retention time (HRT) of 24 h. The bioelectrochemical system was operated at 25 ± 2 °C and continuous-flow mode. The BTH loading rate varied during experiments from 20 g·m -3 ·day -1 to 110 g·m -3 ·day -1 . BTH and soluble COD (Chemical Oxygen Demand) removal efficiency reached 80% to 90% under all BTH loading rates. Bioluminescence based Shewanella oneidensis strain MR-1 ecotoxicity testing demonstrated that toxicity was largely decreased compared to the BTH wastewater influent and effluent of two control experiments. The results indicated that MEC (Microbial Electrolysis Cell) was useful and reliable for improving BTH wastewater treatment efficiency, enabling the microbiological reactor to more easily respond to the requirements of higher loading rate, which is meaningful for economic and efficient operation in future scale-up.
Hennebel, Tom; Verhagen, Pieter; Simoen, Henri; De Gusseme, Bart; Vlaeminck, Siegfried E; Boon, Nico; Verstraete, Willy
2009-08-01
Trichloroethylene is a toxic and recalcitrant groundwater pollutant. Palladium nanoparticles bio-precipitated on Shewanella oneidensis were encapsulated in polyurethane, polyacrylamide, alginate, silica or coated on zeolites. The reactivity of these bio-Pd beads and zeolites was tested in batch experiments and trichloroethylene dechlorination followed first order reaction kinetics. The calculated k-values of the encapsulated catalysts were a factor of six lower compared to non-encapsulated bio-Pd. Bio-Pd, used as a catalyst, was able to dechlorinate 100 mgL(-1) trichloroethylene within a time period of 1h. The main reaction product was ethane; yet small levels of chlorinated intermediates were detected. Subsequently polyurethane cubes empowered with bio-Pd were implemented in a fixed bed reactor for the treatment of water containing trichloroethylene. The influent recycle configuration resulted in a cumulative removal of 98% after 22 h. The same reactor in a flow through configuration achieved removal rates up to 1059 mg trichloroethylene g Pd(-1)d(-1). This work showed that fixed bed reactors with bio-Pd polyurethane cubes can be instrumental for remediation of water contaminated with trichloroethylene.
A framework for stochastic simulations and visualization of biological electron-transfer dynamics
NASA Astrophysics Data System (ADS)
Nakano, C. Masato; Byun, Hye Suk; Ma, Heng; Wei, Tao; El-Naggar, Mohamed Y.
2015-08-01
Electron transfer (ET) dictates a wide variety of energy-conversion processes in biological systems. Visualizing ET dynamics could provide key insight into understanding and possibly controlling these processes. We present a computational framework named VizBET to visualize biological ET dynamics, using an outer-membrane Mtr-Omc cytochrome complex in Shewanella oneidensis MR-1 as an example. Starting from X-ray crystal structures of the constituent cytochromes, molecular dynamics simulations are combined with homology modeling, protein docking, and binding free energy computations to sample the configuration of the complex as well as the change of the free energy associated with ET. This information, along with quantum-mechanical calculations of the electronic coupling, provides inputs to kinetic Monte Carlo (KMC) simulations of ET dynamics in a network of heme groups within the complex. Visualization of the KMC simulation results has been implemented as a plugin to the Visual Molecular Dynamics (VMD) software. VizBET has been used to reveal the nature of ET dynamics associated with novel nonequilibrium phase transitions in a candidate configuration of the Mtr-Omc complex due to electron-electron interactions.
Zhang, Qinghua; Zhang, Yanyan; Li, Daping
2017-04-01
The performance of a microbial fuel cell (MFC) in terms of degradation of chloramphenicol (CAP) was investigated. Approximately 84% of 50mg/L CAP was degraded within 12h in the MFC. A significant interaction of pH, temperature, and initial CAP concentration was found on removal of CAP, and a maximum degradation rate of 96.53% could theoretically be achieved at 31.48°C, a pH of 7.12, and an initial CAP concentration of 106.37mg/L. Moreover, CAP was further degraded through a ring-cleavage pathway. The antibacterial activity of CAP towards Escherichia coli ATCC 25922 and Shewanella oneidensis MR-1 was largely eliminated by MFC treatment. High-throughput sequencing analysis indicated that Azonexus, Comamonas, Nitrososphaera, Chryseobacterium, Azoarcus, Rhodococcus, and Dysgonomonas were the predominant genera in the MFC anode biofilm. In conclusion, the MFC shows potential for the treatment of antibiotic residue-containing wastewater due to its high rates of CAP removal and energy recovery. Copyright © 2017 Elsevier Ltd. All rights reserved.
Microbial fuel cells using Cellulomonas spp. with cellulose as fuel.
Takeuchi, Yuya; Khawdas, Wichean; Aso, Yuji; Ohara, Hitomi
2017-03-01
Cellulomonas fimi, Cellulomonas biazotea, and Cellulomonas flavigena are cellulose-degrading microorganisms chosen to compare the degradation of cellulose. C. fimi degraded 2.5 g/L of cellulose within 4 days, which was the highest quantity among the three microorganisms. The electric current generation by the microbial fuel cell (MFC) using the cellulose-containing medium with C. fimi was measured over 7 days. The medium in the MFC was sampled every 24 h to quantify the degradation of cellulose, and the results showed that the electric current increased with the degradation of cellulose. The maximum electric power generated by the MFC was 38.7 mW/m 2 , and this numeric value was 63% of the electric power generated by an MFC with Shewanella oneidensis MR-1, a well-known current-generating microorganism. Our results showed that C. fimi was an excellent candidate to produce the electric current from cellulose via MFCs. Copyright © 2016 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
[Study on anti-bacterium activity of ginkgolic acids and their momomers].
Yang, Xiaoming; Zhu, Wei; Chen, Jun; Qian, Zhiyu; Xie, Jimin
2004-09-01
Ginkgolic acids and their three monomers were separated from ginkgo sarcotestas. The anti-bacterium activity of ginkgolic acids were tested. The relation between the anti-bacterium activity and side chain of ginkgolic acid were studied. The MIC of ginkgolic acids and their three monomers and salicylic acid were tested. Ginkgolic acid has strong inhibitive effect on G+-bacterium. Salicylic acid has no side chain, so no anti-bacterial activity. When the length of gingkolic acid side chain is C13:0, it has the strongest anti-bacterial activity in three monomers. The side chain of ginkgolic acid is the key functional group that possessed anti-bacterial activity. The length of Ginkgolic acid was the main effective factor of anti-bacterial activity.
Reduction of Fe(III) colloids by Shewanella putrefaciens: A kinetic model
NASA Astrophysics Data System (ADS)
Bonneville, Steeve; Behrends, Thilo; van Cappellen, Philippe; Hyacinthe, Christelle; Röling, Wilfred F. M.
2006-12-01
A kinetic model for the microbial reduction of Fe(III) oxyhydroxide colloids in the presence of excess electron donor is presented. The model assumes a two-step mechanism: (1) attachment of Fe(III) colloids to the cell surface and (2) reduction of Fe(III) centers at the surface of attached colloids. The validity of the model is tested using Shewanella putrefaciens and nanohematite as model dissimilatory iron reducing bacteria and Fe(III) colloidal particles, respectively. Attachment of nanohematite to the bacteria is formally described by a Langmuir isotherm. Initial iron reduction rates are shown to correlate linearly with the relative coverage of the cell surface by nanohematite particles, hence supporting a direct electron transfer from membrane-bound reductases to mineral particles attached to the cells. Using internally consistent parameter values for the maximum attachment capacity of Fe(III) colloids to the cells, Mmax, the attachment constant, KP, and the first-order Fe(III) reduction rate constant, k, the model reproduces the initial reduction rates of a variety of fine-grained Fe(III) oxyhydroxides by S. putrefaciens. The model explains the observed dependency of the apparent Fe(III) half-saturation constant, Km∗, on the solid to cell ratio, and it predicts that initial iron reduction rates exhibit saturation with respect to both the cell density and the abundance of the Fe(III) oxyhydroxide substrate.
Cr isotope fractionation factors for Cr(VI) reduction by a metabolically diverse group of bacteria
NASA Astrophysics Data System (ADS)
Basu, Anirban; Johnson, Thomas M.; Sanford, Robert A.
2014-10-01
Reduction of Cr(VI) is an important process that determines the geochemical behavior, mobility and bioavailability of Cr in both terrestrial and marine environments. Many metabolically diverse microorganisms possess Cr(VI) reduction capacity. Cr(VI) reduction fractionates Cr isotopes and thus 53Cr/52Cr ratios can be used to monitor Cr(VI) reduction and redox conditions. The magnitude of isotopic fractionation (ε) for a variety of microbial reduction mechanisms must be known for accurate interpretation of observed shifts in 53Cr/52Cr ratios. We determined isotopic fractionation factors for Cr(VI) reduction by metal reducers Geobacter sulfurreducens and Shewanella sp. strain NR, a denitrifying soil bacterium Pseudomonas stutzeri DCP-Ps1, and a sulfate reducer Desulfovibrio vulgaris. All bacteria investigated in this study produced significant Cr isotope fractionation. The fractionation (ε) for G. sulfurreducens, Shewanella sp. (NR), P. stutzeri DCP-Ps1, and D. vulgaris were -3.03‰ ± 0.12‰, -2.17‰ ± 0.22‰, -3.14‰ ± 0.13‰, and -3.01‰ ± 0.11‰, respectively. Despite differences in microbial strains in this study, the ε did not vary significantly except for Shewanella sp. (NR). Our results suggest that strong isotopic fractionation is induced during Cr(VI) reduction under electron donor poor (∼300 μM) conditions.
Simultaneous microbial reduction of vanadium (V) and chromium (VI) by Shewanella loihica PV-4.
Wang, Guangyu; Zhang, Baogang; Li, Shuang; Yang, Meng; Yin, Changcheng
2017-03-01
Toxic vanadium (V) and chromium (VI) often co-exist in wastewater from vanadium ore smelting and their reductions by bacterial strain Shewanella loihica PV-4 is realized simultaneously. After 27-d operation, 71.3% of V(V) and 91.2% of Cr(VI) were removed respectively, with citrate as organic carbon source. Enhancement of Cr(VI) bioreduction was observed with the suppressed V(V) reduction. V(IV) and Cr(III), the main reduction products, precipitated inside the organisms and attached on cell surfaces. Both membrane components containing cytochrome c and cytoplasmic fractions containing soluble proteins as well as NADH may contribute to these microbial reductions. Most Cr(VI) were reduced extracellularly and V(V) tended to be reduced through intracellular process, as revealed by mapping the microbial surface and a line scan across the cell, performed by scanning transmission electron microscopy. This study provides an efficient alternative for controlling combined pollution caused by these two metals based on microbial technology. Copyright © 2016 Elsevier Ltd. All rights reserved.
2007-01-15
law, no person shall be subject to any penalty for failing to comply with a collection of information if it does not display a currently valid OMB...report, we focus on the rapid bio- life because much of our current understanding of early life mineralization of amorphous silica. comes from...matter. The Nanoplast-embedded sample was atomic emission spectroscopy (ICP). After pH analysis ultrathin-sectioned, and examined with JEOL3010 TEM with a
2016-06-06
toxic chemicals,4 protection of steel from corrosion,5 or in bioremediation .6 Of special interest is the potential use of the exoelectrogens in... Bioremediation of Uranium-Contaminated Groundwater: A Systems Approach to Subsurface Biogeochemistry. Curr. Opin. Biotechnol. 2013, 24, 489−497. (7
Endohyphal Bacterium Enhances Production of Indole-3-Acetic Acid by a Foliar Fungal Endophyte
Hoffman, Michele T.; Gunatilaka, Malkanthi K.; Wijeratne, Kithsiri; Gunatilaka, Leslie; Arnold, A. Elizabeth
2013-01-01
Numerous plant pathogens, rhizosphere symbionts, and endophytic bacteria and yeasts produce the important phytohormone indole-3-acetic acid (IAA), often with profound effects on host plants. However, to date IAA production has not been documented among foliar endophytes -- the diverse guild of primarily filamentous Ascomycota that live within healthy, above-ground tissues of all plant species studied thus far. Recently bacteria that live within hyphae of endophytes (endohyphal bacteria) have been detected, but their effects have not been studied previously. Here we show not only that IAA is produced in vitro by a foliar endophyte (here identified as Pestalotiopsis aff. neglecta, Xylariales), but that IAA production is enhanced significantly when the endophyte hosts an endohyphal bacterium (here identified as Luteibacter sp., Xanthomonadales). Both the endophyte and the endophyte/bacterium complex appear to rely on an L-tryptophan dependent pathway for IAA synthesis. The bacterium can be isolated from the fungus when the symbiotic complex is cultivated at 36°C. In pure culture the bacterium does not produce IAA. Culture filtrate from the endophyte-bacterium complex significantly enhances growth of tomato in vitro relative to controls and to filtrate from the endophyte alone. Together these results speak to a facultative symbiosis between an endophyte and endohyphal bacterium that strongly influences IAA production, providing a new framework in which to explore endophyte-plant interactions. PMID:24086270
Shewanella putrefaciens Adhesion and Biofilm Formation on Food Processing Surfaces
Bagge, Dorthe; Hjelm, Mette; Johansen, Charlotte; Huber, Ingrid; Gram, Lone
2001-01-01
Laboratory model systems were developed for studying Shewanella putrefaciens adhesion and biofilm formation under batch and flow conditions. S. putrefaciens plays a major role in food spoilage and may cause microbially induced corrosion on steel surfaces. S. putrefaciens bacteria suspended in buffer adhered readily to stainless steel surfaces. Maximum numbers of adherent bacteria per square centimeter were reached in 8 h at 25°C and reflected the cell density in suspension. Numbers of adhering bacteria from a suspension containing 108 CFU/ml were much lower in a laminar flow system (modified Robbins device) (reaching 102 CFU/cm2) than in a batch system (reaching 107 CFU/cm2), and maximum numbers were reached after 24 h. When nutrients were supplied, S. putrefaciens grew in biofilms with layers of bacteria. The rate of biofilm formation and the thickness of the film were not dependent on the availability of carbohydrate (lactate or glucose) or on iron starvation. The number of S. putrefaciens bacteria on the surface was partly influenced by the presence of other bacteria (Pseudomonas fluorescens) which reduced the numbers of S. putrefaciens bacteria in the biofilm. Numbers of bacteria on the surface must be quantified to evaluate the influence of environmental factors on adhesion and biofilm formation. We used a combination of fluorescence microscopy (4′,6′-diamidino-2-phenylindole staining and in situ hybridization, for mixed-culture studies), ultrasonic removal of bacteria from surfaces, and indirect conductometry and found this combination sufficient to quantify bacteria on surfaces. PMID:11319118
Direct measurement of interaction forces between a single bacterium and a flat plate.
Klein, Jonah D; Clapp, Aaron R; Dickinson, Richard B
2003-05-15
A technique for precisely measuring the equilibrium and viscous interaction forces between a single bacterium and a flat surface as functions of separation distance is described. A single-beam gradient optical trap was used to micromanipulate the bacterium against a flat surface while evanescent wave light scattering was used to measure separation distances. Calibrating the optical trap far from the surface allowed the trapped bacterium to be used as a force probe. Equilibrium force-distance profiles were determined by measuring the deflection of the cell from the center of the optical trap at various trap positions. Simultaneously, viscous forces were determined by measuring the relaxation time for the fluctuating bacterium. Absolute distances were determined using a best-fit approximation to the theoretical prediction for the hindered mobility of a diffusing sphere near a wall. Using this approach, forces in the range from 0.01 to 4 pN were measured at near-nanometer resolution between Staphylococcus aureus and glass that was bare or coated with adsorbed protein.
Leigh, Brittany; Karrer, Charlotte; Cannon, John P.; Breitbart, Mya; Dishaw, Larry J.
2017-01-01
Outnumbering all other biological entities on earth, bacteriophages (phages) play critical roles in structuring microbial communities through bacterial infection and subsequent lysis, as well as through horizontal gene transfer. While numerous studies have examined the effects of phages on free-living bacterial cells, much less is known regarding the role of phage infection in host-associated biofilms, which help to stabilize adherent microbial communities. Here we report the cultivation and characterization of a novel strain of Shewanella fidelis from the gut of the marine tunicate Ciona intestinalis, inducible prophages from the S. fidelis genome, and a strain-specific lytic phage recovered from surrounding seawater. In vitro biofilm assays demonstrated that lytic phage infection affects biofilm formation in a process likely influenced by the accumulation and integration of the extracellular DNA released during cell lysis, similar to the mechanism that has been previously shown for prophage induction. PMID:28327522
Physiological changes induced in four bacterial strains following oxidative stress.
Baatout, S; De Boever, P; Mergeay, M
2006-01-01
In order to study the behaviour and resistance of bacteria under extreme conditions, physiological changes associated with oxidative stress were monitored using flow cytometry. The study was conducted to assess the maintenance of membrane integrity and potential as well as the esterase activity, the intracellular pH and the production of superoxide anions in four bacterial strains (Ralstonia metallidurans, Escherichia coli, Shewanella oneidensis and Deinococcus radiodurans). The strains were chosen for their potential usefulness in bioremediation. Suspensions of R. metallidurans, E. coli, S. oneidensis and D. radiodurans were submitted to 1 h oxidative stress (H2O2 at various concentrations from 0 to 880 mM). Cell membrane permeability (propidium iodide) and potential (rhodamine-123, 3,3'-dihexyloxacarbocyanine iodide), intracellular esterase activity (fluorescein diacetate), intracellular reactive oxygen species concentration (hydroethidine) and intracellular pH (carboxyflurorescein diacetate succinimidyl ester (5(6)) were monitored to evaluate the physiological state and the overall fitness of individual bacterial cells under oxidative stress. The four bacterial strains exhibited varying sensitivities towards H2O2. However, for all bacterial strains, some physiological damage could already be observed from 13.25 mM H2O2 onwards, in particular with regard to their membrane permeability. Depending on the bacterial strains, moderate to high physiological damage could be observed between 13.25 mM and 220 mM H2O2. Membrane potential, esterase activity, intracellular pH and production of superoxide anion production were considerably modified at high H2O2 concentrations in all four strains. In conclusion, we show that a range of significant physiological alterations occurs when bacteria are challenged with H2O2 and fluorescent staining methods coupled with flow cytometry are useful for monitoring the changes induced not only by oxidative stress but also by other
NASA Astrophysics Data System (ADS)
Zegeye, A.; Yahaya, S.; Fialips, C. I.; White, M.; Manning, D. A.; Gray, N.
2008-12-01
Biogeochemical evidence exists to support the potential importance of crystalline or amorphous Fe minerals as electron acceptor for Fe reducing bacteria in soils and subsurface sediments. This microbial metabolic activity can be exploited as alternative method in different industrial applications. For instance, the removal of ferric iron impurities from minerals for the glass and paper industries currently rely on physical and chemical treatments having substantial economical and environmental disadvantages. The ability to remove iron by other means, such as bacterial iron reduction, may reduce costs, allow lower grade material to be mined, and improve the efficiency of mineral processing. Kaolin clay and silica sand are used in a wide range of industrial applications, particularly in paper, ceramics and glass manufacturing. Depending on the geological conditions of deposition, they are often associated with iron (hydr)oxides that are either adsorbed to the mineral surfaces or admixed as separate iron bearing minerals. In this study, we have examined the Fe(III) removal efficiency from kaolin and silica sand by a series of iron- reducing bacteria from the Shewanella species (S. alga BrY, S. oneidensis MR-1, S. putrefaciens CN32 and S. putrefaciens ATCC 8071) in the presence of anthraquinone 2,6 disulfonate (AQDS). We have also investigated the effectiveness of a natural organic matter, extracted with the silica sand, as a substitute to AQDS for enhancing Fe(III) reduction kinetics. The microbial reduction of Fe(III) was achieved using batch cultures under non-growth conditions. The rate and the extent of Fe(III) reduction was monitored as a function of the initial Fe(III) content, Shewanella species and temperature. The bacterially- treated minerals were analyzed by transmission electron microscopy (TEM) and X-ray diffraction (XRD) to observe any textural and mineralogical transformation. The whiteness and ISO brightness of the kaolin was also measured by
The construction of an engineered bacterium to remove cadmium from wastewater.
Chang, S; Shu, H
2014-01-01
The removal of cadmium (Cd) from wastewater before it is released from factories is important for protecting human health. Although some researchers have developed engineered bacteria, the resistance of these engineered bacteria to Cd have not been improved. In this study, two key genes involved in glutathione synthesis (gshA and gshB), a serine acetyltransferase gene (cysE), a Thlaspi caerulescens phytochelatin synthase gene (TcPCS1), and a heavy metal ATPase gene (TcHMA3) were transformed into Escherichia coli BL21. The resistance of the engineered bacterium to Cd was significantly greater than that of the initial bacterium and the Cd accumulation in the engineered bacterium was much higher than in the initial bacterium. In addition, the Cd resistance of the bacteria harboring gshB, gshA, cysE, and TcPCS1 was higher than that of the bacteria harboring gshA, cysE, and TcPCS1. This finding demonstrated that gshB played an important role in glutathione synthesis and that the reaction catalyzed by glutathione synthase was the limiting step for producing phytochelatins. Furthermore, TcPCS1 had a greater specificity and a higher capacity for removing Cd than SpPCS1, and TcHMA3 not only played a role in T. caerulescens but also functioned in E. coli.
NASA Astrophysics Data System (ADS)
Lian, Yingli; Yang, Yonggang; Guo, Jun; Wang, Yan; Li, Xiaojing; Fang, Yun; Gan, Lixia; Xu, Meiying
2016-08-01
Electron acceptor redox potential (EARP) was presumed to be a determining factor for microbial metabolism in many natural and engineered processes. However, little is known about the potentially global effects of EARP on bacteria. In this study, we compared the physiological and transcriptomic properties of Shewanella decolorationis S12 respiring with different EARPs in microbial electrochemical systems to avoid the effects caused by the other physicochemical properties of real electron acceptor. Results showed that the metabolic activities of strain S12 were nonlinear responses to EARP. The tricarboxylic acid cycle for central carbon metabolism was down-regulated while glyoxylate shunt was up-regulated at 0.8 V compared to 0.2 and -0.2 V, which suggested that EARP is an important but not the only determinant for metabolic pathways of strain S12. Moreover, few cytochrome c genes were differentially expressed at different EARPs. The energy intensive flagella assembly and assimilatory sulfur metabolism pathways were significantly enriched at 0.8 V, which suggested strain S12 had stronger electrokinesis behavior and oxidative stress-response at high EARP. This study provides the first global information of EARP regulations on microbial metabolism, which will be helpful for understanding microorganism respiration.
Sun, Jinchun; Jin, Jinshan; Beger, Richard D.; Cerniglia, Carl E.; Yang, Maocheng; Chen, Huizhong
2017-01-01
The association between exposure to smokeless tobacco products (STP) and oral diseases is partially due to the physiological and pathological changes in the composition of the oral microbiome and its metabolic profile. However, it is not clear how STPs affect the physiology and ecology of oral microbiota. A UPLC/QTof-MS-based metabolomics study was employed to analyze metabolic alterations in oral bacterium, Capnocytophaga sputigena as a result of smokeless tobacco exposure and to assess the capability of the bacterium to metabolize nicotine. Pathway analysis of the metabolome profiles indicated that smokeless tobacco extracts caused oxidative stress in the bacterium. The metabolomics data also showed that the argininenitric oxide pathway was perturbed by the smokeless tobacco treatment. Results also showed that LC/MS was useful in identifying STP constituents and additives, including caffeine and many flavoring compounds. No significant changes in levels of nicotine and its major metabolites were found when C. sputigena was cultured in a nutrient rich medium, although hydroxylnicotine and cotinine N-oxide were detected in the bacterial metabolites suggesting that nicotine metabolism might be present as a minor degradation pathway in the bacterium. Study results provide new insights regarding the physiological and toxicological effects of smokeless tobacco on oral bacterium C. sputigena and associated oral health as well as measuring the ability of the oral bacterium to metabolize nicotine. PMID:27480511
Sun, Jinchun; Jin, Jinshan; Beger, Richard D; Cerniglia, Carl E; Yang, Maocheng; Chen, Huizhong
2016-10-01
The association between exposure to smokeless tobacco products (STP) and oral diseases is partially due to the physiological and pathological changes in the composition of the oral microbiome and its metabolic profile. However, it is not clear how STPs affect the physiology and ecology of oral microbiota. A UPLC/QTof-MS-based metabolomics study was employed to analyze metabolic alterations in oral bacterium, Capnocytophaga sputigena as a result of smokeless tobacco exposure and to assess the capability of the bacterium to metabolize nicotine. Pathway analysis of the metabolome profiles indicated that smokeless tobacco extracts caused oxidative stress in the bacterium. The metabolomics data also showed that the arginine-nitric oxide pathway was perturbed by the smokeless tobacco treatment. Results also showed that LC/MS was useful in identifying STP constituents and additives, including caffeine and many flavoring compounds. No significant changes in levels of nicotine and its major metabolites were found when C. sputigena was cultured in a nutrient rich medium, although hydroxylnicotine and cotinine N-oxide were detected in the bacterial metabolites suggesting that nicotine metabolism might be present as a minor degradation pathway in the bacterium. Study results provide new insights regarding the physiological and toxicological effects of smokeless tobacco on oral bacterium C. sputigena and associated oral health as well as measuring the ability of the oral bacterium to metabolize nicotine. Published by Elsevier Ltd.
Dassa, Bareket; Utturkar, Sagar M.; Hurt, Richard A.; ...
2015-09-24
We report the single-contig genome sequence of the anaerobic, mesophilic, cellulolytic bacterium, Bacteroides cellulosolvens. The bacterium produces a particularly elaborate cellulosome system, whereas the types of cohesin-dockerin interactions are opposite of other known cellulosome systems: cell-surface attachment is thus mediated via type-I interactions whereas enzymes are integrated via type-II interactions.
[A rarely isolated bacterium in microbiology laboratories: Streptococcus uberis].
Eryıldız, Canan; Bukavaz, Şebnem; Gürcan, Şaban; Hatipoğlu, Osman
2017-04-01
Streptococcus uberis is a gram-positive bacterium that is mostly responsible for mastitis in cattle. The bacterium rarely has been associated with human infections. Conventional phenotyphic methods can be inadequate for the identification of S.uberis; and in microbiology laboratories S.uberis is confused with the other streptococci and enterococci isolates. Recently, molecular methods are recommended for the accurate identification of S.uberis isolates. The aim of this report is to present a lower respiratory tract infection case caused by S.uberis and the microbiological methods for identification of this bacterium. A 66-year-old male patient with squamous cell lung cancer who received radiotherapy was admitted in our hospital for the control. According to the chest X-Ray, patient was hospitalized with the prediagnosis of ''cavitary tumor, pulmonary abscess''. In the first day of the hospitalization, blood and sputum cultures were drawn. Blood culture was negative, however, Candida albicans was isolated in the sputum culture and it was estimated to be due to oral lesions. After two weeks from the hospitalization, sputum sample was taken from the patient since he had abnormal respiratory sounds and cough complaint. In the Gram stained smear of the sputum there were abundant leucocytes and gram-positive cocci, and S.uberis was isolated in both 5% sheep blood and chocolate agar media. Bacterial identification and antibiotic susceptibility tests were performed by VITEK 2 (Biomerieux, France) and also, the bacterium was identified by matrix assisted laser desorption/ionization time of flight mass spectrometry (MALDI-TOF MS) based VITEK MS system as S.uberis. The isolate was determined susceptible to ampicillin, erythromycin, clindamycin, levofloxacin, linezolid, penicillin, cefotaxime, ceftriaxone, tetracycline and vancomycin. 16S, 23S ribosomal RNA and 16S-23S intergenic spacer gene regions were amplified with specific primers and partial DNA sequence analysis of 16S
Trichloroethylene Biodegradation by a Methane-Oxidizing Bacterium †
Little, C. Deane; Palumbo, Anthony V.; Herbes, Stephen E.; Lidstrom, Mary E.; Tyndall, Richard L.; Gilmer, Penny J.
1988-01-01
Trichloroethylene (TCE), a common groundwater contaminant, is a suspected carcinogen that is highly resistant to aerobic biodegradation. An aerobic, methane-oxidizing bacterium was isolated that degrades TCE in pure culture at concentrations commonly observed in contaminated groundwater. Strain 46-1, a type I methanotrophic bacterium, degraded TCE if grown on methane or methanol, producing CO2 and water-soluble products. Gas chromatography and 14C radiotracer techniques were used to determine the rate, methane dependence, and mechanism of TCE biodegradation. TCE biodegradation by strain 46-1 appears to be a cometabolic process that occurs when the organism is actively metabolizing a suitable growth substrate such as methane or methanol. It is proposed that TCE biodegradation by methanotrophs occurs by formation of TCE epoxide, which breaks down spontaneously in water to form dichloroacetic and glyoxylic acids and one-carbon products. Images PMID:16347616
Draft Genome Sequence of the Cellulolytic Bacterium Clostridium papyrosolvens C7 (ATCC 700395).
Zepeda, Veronica; Dassa, Bareket; Borovok, Ilya; Lamed, Raphael; Bayer, Edward A; Cate, Jamie H D
2013-09-12
We report the draft genome sequence of the cellulose-degrading bacterium Clostridium papyrosolvens C7, originally isolated from mud collected below a freshwater pond in Massachusetts. This Gram-positive bacterium grows in a mesophilic anaerobic environment with filter paper as the only carbon source, and it has a simple cellulosome system with multiple carbohydrate-degrading enzymes.
Draft Genome Sequence of the Cellulolytic Bacterium Clostridium papyrosolvens C7 (ATCC 700395)
Zepeda, Veronica; Dassa, Bareket; Borovok, Ilya; Lamed, Raphael; Bayer, Edward A.
2013-01-01
We report the draft genome sequence of the cellulose-degrading bacterium Clostridium papyrosolvens C7, originally isolated from mud collected below a freshwater pond in Massachusetts. This Gram-positive bacterium grows in a mesophilic anaerobic environment with filter paper as the only carbon source, and it has a simple cellulosome system with multiple carbohydrate-degrading enzymes. PMID:24029755
Aigle, Axel; Bonin, Patricia; -Nunez, Nicolas Fernandez; Loriod, Béatrice; Guasco, Sophie; Bergon, Aurélie; Armougom, Fabrice; Iobbi-Nivol, Chantal; Imbert, Jean; Michotey, Valérie
2018-03-16
Shewanella algae C6G3 can reduce dissimilatively nitrate into ammonium and manganese-oxide (MnIV) into MnII. It has the unusual ability to produce anaerobically nitrite from ammonium in the presence of MnIV. To gain insight into their metabolic capabilities, global mRNA expression patterns were investigated by RNA-seq and qRT-PCR in cells growing with lactate and ammonium as carbon and nitrogen sources and with either MnIV or nitrate as electron acceptors. Gene exhibiting higher expression levels in the presence of MnIV belonged to functional categories of carbohydrate, coenzyme, lipid metabolisms and inorganic ion transport. Comparative transcriptomic pattern between MnIV and NO3 revealed that the strain presented an ammonium limitation status with MnIV, despite the presence of non-limiting concentration of ammonium under both culture conditions. In addition, in presence of MnIV, ntrB/nrtC regulators, ammonium channel, nitrogen regulatory protein P-II, glutamine synthetase and asparagine synthetase glutamine dependent genes were over-represented. Under nitrate condition, the expression of genes involved in the synthesis of several amino acids was increased. Finally, expression level of genes associated with the general stress response was also amplified and among them, katE, a putative catalase/peroxidase present on several Shewanella genomes, was highly expressed with a relative median value higher in MnIV condition.
Periplasmic Manganese in a Subsurface Bacterium During Anaerobic Growth on Birnessite
NASA Astrophysics Data System (ADS)
Langley, S.; Glasauer, S.; Beveridge, T.
2002-12-01
In subsurface environments, where oxygen is not metabolically available for energy production, bacteria use alternate terminal electron acceptors (TEAs) to respire and grow. Anaerobic TEAs include, but are not limited to, Fe3+ and Mn4+. These metals can be present as mineral phases (e.g., ferrihydrite and hematite in the case of iron; birnessite and pyrolusite in the case of manganese). Bacteria bind strongly to minerals and reduce the metal by a process called dissimilatory metal reduction (DMR). Shewanella putrefaciens strain CN32 is a Gram-negative bacterium capable of DMR. In previous reports, when this organism was grown on birnessite, we observed cytoplasmic granules of a Mn-rich mineral phase, and an unusual deposition of electron-dense material within the periplasm (that region of the cell located between the inner and outer membranes). In an attempt to characterize the periplasmic precipitates, CN32 was inoculated into an anaerobic defined medium (DM), supplemented with 20 mM Mn (birnessite) and incubated in an anaerobic chamber. Reduced and total Mn concentrations were monitored using atomic absorption spectrophotometry, and cell numbers determined by viable counts on trypticase soy agar. TEM, combined with energy dispersive X-ray spectroscopy (EDS), was used to localize and confirm the presence of any Mn-rich depositions. Soluble Mn concentration increased steadily after inoculation, indicating active metabolism and metal reduction by the cells. Viable counts indicated that the cells reached their maximum number on day 9. Stained thin sections from 4-day-old samples examined with TEM showed cells in close association with the mineral. Secondary mineral products derived from birnessite reduction were evident (e.g., manganese phosphate). TEM-EDS also revealed the presence of ~30 nm-thick deposits of electron-dense material in the periplasm of some cells. However, examination of similar sections which had not been previously stained with osmium tetroxide
Overproduction of Hydrogen From an Anaerobic Bacterium
2008-12-01
fixation of nitrogen ( Haber - Bosch process), mostly to produce fertilizer. Nitrogenase provides a catalytic alternative to the commercial fixation of...the culture and suggests a uniquely simple hydrogen reactor design based on renewable feedstocks. 1. INTRODUCTION Hydrogen is an ideal... renewable feedstocks. Clostridium phytofermentans is a recently- discovered anaerobic bacterium, reported to possess cellulase enzymes that degrade
Bion M1. Peculiarities of life activities of microbes in 30-day spaceflight
NASA Astrophysics Data System (ADS)
Viacheslav, Ilyin; Korshunov, Denis; Morozova, Julia; Voeikova, Tatiana; Tyaglov, Boris; Novikova, Liudmila; Krestyanova, Irina; Emelyanova, Lydia
The aim of this work was to analyze the influence of space flight factors ( SFF) to microorganism strains , exposed inside unmanned spacecraft Bion M-1 during the 30- day space flight. Objectives of the work - the study of the influence of the SFF exchange chromosomal DNA in crosses microorganisms of the genus Streptomyces; the level of spontaneous phage induction of lysogenic strains fS31 from Streptomyces lividans 66 and Streptomyces coelicolor A3 ( 2 ) on the biosynthesis of the antibiotic tylosin strain of Streptomyces fradiae; survival electrogenic bacteria Shewanella oneidensis MR- 1 is used in the microbial fuel cell As a result of this work it was found that the SFF affect the exchange of chromosomal DNA by crossing strains of Streptomyces. Was detected polarity crossing , expressed in an advantageous contribution chromosome fragment of one of the parent strains in recombinant offspring. This fact may indicate a more prolonged exposure of cells in microgravity and , as a consequence, the transfer of longer fragments of chromosomal DNA This feature is the transfer of genetic material in microgravity could lead to wider dissemination and horizontal transfer of chromosomal and plasmid DNA of symbiotic microflora astronauts and other strains present in the spacecraft. It was shown no effect on the frequency of recombination PCF and the level of mutation model reversion of auxotrophic markers to prototrophy It was demonstrated that PCF increase the level of induction of cell actinophage fS31 lysogenic strain of S. lividans 66, but did not affect the level of induction of this phage cells S. coelicolor A3 ( 2). It is shown that the lower the level of synthesis PCF antibiotic aktinorodina (actinorhodin) in lysogenic strain S. coelicolor A3 ( 2). 66 Strains of S. lividans and S. coelicolor A3 ( 2 ) can be used as a biosensor for studying the effect on microorganisms PCF It is shown that the effect of the PCF reduces synthesis of tylosin and desmicosyn S. fradiae at
Qiu, Dongru; Xie, Ming; Dai, Jingcheng; ...
2016-06-10
Determining the function and regulation of paralogues is important in understanding microbial functional genomics and environmental adaptation. Heme homeostasis is crucial for the survival of environmental microorganisms. MostShewanellaspecies encode two paralogues of ferrochelatase, the terminal enzyme in the heme biosynthesis pathway. The function and transcriptional regulation of two ferrochelatase genes, hemH1 and hemH2, were investigated inShewanellaloihicaPV-4. The disruption of hemH1 but not hemH2 resulted in a significant accumulation of extracellular protoporphyrin IX (PPIX), the precursor to heme, and decreased intracellular heme levels.hemH1 was constitutively expressed, and the expression of hemH2 increased when hemH1 was disrupted. The transcription ofhemH1was regulated bymore » the housekeeping sigma factor RpoD and potentially regulated by OxyR, while hemH2 appeared to be regulated by the oxidative stress-associated sigma factor RpoE2. When an oxidative stress condition was mimicked by adding H 2O 2 to the medium or exposing the culture to light, PPIX accumulation was suppressed in the Δ hemH1 mutant. Consistently, transcriptome analysis indicated enhanced iron uptake and suppressed heme synthesis in the ΔhemH1 mutant. These data indicate that the two paralogues are functional in the heme synthesis pathway but regulated by environmental conditions, providing insights into the understanding of bacterial response to environmental stresses and a great potential to commercially produce porphyrin compounds.Shewanella is capable of utilizing a variety of electron acceptors for anaerobic respiration because of the existence of multiple c -type cytochromes in which heme is an essential component. The cytochrome-mediated electron transfer across cellular membranes could potentially be used for biotechnological purposes, such as electricity generation in microbial fuel cells and dye decolorization. However, the mechanism underlying the regulation of
DOE Office of Scientific and Technical Information (OSTI.GOV)
Qiu, Dongru; Xie, Ming; Dai, Jingcheng
Determining the function and regulation of paralogues is important in understanding microbial functional genomics and environmental adaptation. Heme homeostasis is crucial for the survival of environmental microorganisms. MostShewanellaspecies encode two paralogues of ferrochelatase, the terminal enzyme in the heme biosynthesis pathway. The function and transcriptional regulation of two ferrochelatase genes, hemH1 and hemH2, were investigated inShewanellaloihicaPV-4. The disruption of hemH1 but not hemH2 resulted in a significant accumulation of extracellular protoporphyrin IX (PPIX), the precursor to heme, and decreased intracellular heme levels.hemH1 was constitutively expressed, and the expression of hemH2 increased when hemH1 was disrupted. The transcription ofhemH1was regulated bymore » the housekeeping sigma factor RpoD and potentially regulated by OxyR, while hemH2 appeared to be regulated by the oxidative stress-associated sigma factor RpoE2. When an oxidative stress condition was mimicked by adding H 2O 2 to the medium or exposing the culture to light, PPIX accumulation was suppressed in the Δ hemH1 mutant. Consistently, transcriptome analysis indicated enhanced iron uptake and suppressed heme synthesis in the ΔhemH1 mutant. These data indicate that the two paralogues are functional in the heme synthesis pathway but regulated by environmental conditions, providing insights into the understanding of bacterial response to environmental stresses and a great potential to commercially produce porphyrin compounds.Shewanella is capable of utilizing a variety of electron acceptors for anaerobic respiration because of the existence of multiple c -type cytochromes in which heme is an essential component. The cytochrome-mediated electron transfer across cellular membranes could potentially be used for biotechnological purposes, such as electricity generation in microbial fuel cells and dye decolorization. However, the mechanism underlying the regulation of
Exploring the molecular mechanisms of electron shuttling across the microbe/metal space
Paquete, Catarina M.; Fonseca, Bruno M.; Cruz, Davide R.; Pereira, Tiago M.; Pacheco, Isabel; Soares, Cláudio M.; Louro, Ricardo O.
2014-01-01
Dissimilatory metal reducing organisms play key roles in the biogeochemical cycle of metals as well as in the durability of submerged and buried metallic structures. The molecular mechanisms that support electron transfer across the microbe-metal interface in these organisms remain poorly explored. It is known that outer membrane proteins, in particular multiheme cytochromes, are essential for this type of metabolism, being responsible for direct and indirect, via electron shuttles, interaction with the insoluble electron acceptors. Soluble electron shuttles such as flavins, phenazines, and humic acids are known to enhance extracellular electron transfer. In this work, this phenomenon was explored. All known outer membrane decaheme cytochromes from Shewanella oneidensis MR-1 with known metal terminal reductase activity and a undecaheme cytochrome from Shewanella sp. HRCR-6 were expressed and purified. Their interactions with soluble electron shuttles were studied using stopped-flow kinetics, NMR spectroscopy, and molecular simulations. The results show that despite the structural similarities, expected from the available structural data and sequence homology, the detailed characteristics of their interactions with soluble electron shuttles are different. MtrC and OmcA appear to interact with a variety of different electron shuttles in the close vicinity of some of their hemes, and with affinities that are biologically relevant for the concentrations typical found in the medium for this type of compounds. All data support a view of a distant interaction between the hemes of MtrF and the electron shuttles. For UndA a clear structural characterization was achieved for the interaction with AQDS a humic acid analog. These results provide guidance for future work of the manipulation of these proteins toward modulation of their role in metal attachment and reduction. PMID:25018753
[Effects of iron on azoreduction by Shewanella decolorationis S12].
Chen, Xing-Juan; Xu, Mei-Ying; Sun, Guo-Ping
2010-01-01
The effects of soluble and insoluble Fe(III) on anaerobic azoreduction by Shewanella decolorationis S12 were examined in a series of experiments. Results showed that the effects of iron on anaerobic azoreduction depended on the solubility and concentration of the compounds. Azoreduction was inhibited by insoluble Fe(III) and 0.05-2 mmol/L Fe2 O3 all decelerated the azoreduction activity of 0.2 mmol/L amaranth, but the increase in the concentrations of Fe2O3 did not cause an increasing inhibition. Soluble Fe(III) of which concentration less than 0.4 mmol/L enhanced azoreduction activity of 0.2 mmol/L amaranth but there was no linear relationship between the concentration of soluble Fe(III) and azoreduction activity. Soluble Fe(III) of which concentration more than 1 mmol/L inhibited azoreduction activity of 0.2 mmol/L amaranth and an increasing concentration resulted in an increased inhibition. The inhibition was strengthened under the conditions of limited electron donor. On the other hand, soluble Fe(III) and Fe(II) could relieve the inhibition of azoreduction by dicumarol which blocked quinone cycle. It suggests that in addition to quinone cycle, there is a Fe(III) <--> Fe(II) cycle shuttling electrons in cytoplasmic and periplasmic environment. That is the reason why low concentration of soluble Fe(III) or Fe (II) can enhance azoreduction of S. decolorationis S12. It also indicates that insoluble Fe(III) and high concentration of soluble Fe(III) do compete with azo dye for electrons once it acts as electron acceptor. Thus, when iron and azo dye coexisted, iron could serve as an electron transfer agent or electron competitive inhibitor for anaerobic azoreduction under different conditions. High efficiency of azoreduction can be achieved through controlling the solubility and concentration of irons.
Interference activity of a minimal Type I CRISPR–Cas system from Shewanella putrefaciens
Dwarakanath, Srivatsa; Brenzinger, Susanne; Gleditzsch, Daniel; Plagens, André; Klingl, Andreas; Thormann, Kai; Randau, Lennart
2015-01-01
Type I CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)–Cas (CRISPR-associated) systems exist in bacterial and archaeal organisms and provide immunity against foreign DNA. The Cas protein content of the DNA interference complexes (termed Cascade) varies between different CRISPR-Cas subtypes. A minimal variant of the Type I-F system was identified in proteobacterial species including Shewanella putrefaciens CN-32. This variant lacks a large subunit (Csy1), Csy2 and Csy3 and contains two unclassified cas genes. The genome of S. putrefaciens CN-32 contains only five Cas proteins (Cas1, Cas3, Cas6f, Cas1821 and Cas1822) and a single CRISPR array with 81 spacers. RNA-Seq analyses revealed the transcription of this array and the maturation of crRNAs (CRISPR RNAs). Interference assays based on plasmid conjugation demonstrated that this CRISPR-Cas system is active in vivo and that activity is dependent on the recognition of the dinucleotide GG PAM (Protospacer Adjacent Motif) sequence and crRNA abundance. The deletion of cas1821 and cas1822 reduced the cellular crRNA pool. Recombinant Cas1821 was shown to form helical filaments bound to RNA molecules, which suggests its role as the Cascade backbone protein. A Cascade complex was isolated which contained multiple Cas1821 copies, Cas1822, Cas6f and mature crRNAs. PMID:26350210
Bae, Sungjun; Lee, Yoonhwa; Kwon, Man Jae; Lee, Woojin
2014-06-15
The potential of riboflavin for the reductive degradation of a cyclic nitramine, hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX), was investigated in the presence of lepidocrocite and/or Shewanella putrefaciens CN32. RDX reduction by CN32 alone or CN32 with lepidocrocite was insignificant, while 110 μM RDX was completely reduced by CN32 with riboflavin in 78 h. The transformation products identified included nitroso metabolites, formaldehyde, and ammonium, indicating the ring cleavage of RDX. UV and visible light analysis revealed that riboflavin was microbially reduced by CN32, and that the reduced riboflavin was linked to the complete degradation of RDX. In the presence of both CN32 and lepidocrocite (γ-FeOOH), 100 μM-riboflavin increased the rate and extent of Fe(II) production as well as RDX reduction. An abiotic study also showed that Fe(II)-riboflavin complex, and Fe(II) adsorbed on lepidocrocite, reduced RDX by 48% and 21%, respectively. The findings in this study suggest that riboflavin-mediated RDX degradation pathways in subsurface environments are diverse and complex. However, riboflavin, either from bacteria or exogenous sources, can significantly increase RDX degradation. This will provide a sustainable clean-up option for explosive-contaminated subsurface environments. Copyright © 2014 Elsevier B.V. All rights reserved.
Comparative multi-goal tradeoffs in systems engineering of microbial metabolism
2012-01-01
Background Metabolic engineering design methodology has evolved from using pathway-centric, random and empirical-based methods to using systems-wide, rational and integrated computational and experimental approaches. Persistent during these advances has been the desire to develop design strategies that address multiple simultaneous engineering goals, such as maximizing productivity, while minimizing raw material costs. Results Here, we use constraint-based modeling to systematically design multiple combinations of medium compositions and gene-deletion strains for three microorganisms (Escherichia coli, Saccharomyces cerevisiae, and Shewanella oneidensis) and six industrially important byproducts (acetate, D-lactate, hydrogen, ethanol, formate, and succinate). We evaluated over 435 million simulated conditions and 36 engineering metabolic traits, including product rates, costs, yields and purity. Conclusions The resulting metabolic phenotypes can be classified into dominant clusters (meta-phenotypes) for each organism. These meta-phenotypes illustrate global phenotypic variation and sensitivities, trade-offs associated with multiple engineering goals, and fundamental differences in organism-specific capabilities. Given the increasing number of sequenced genomes and corresponding stoichiometric models, we envisage that the proposed strategy could be extended to address a growing range of biological questions and engineering applications. PMID:23009214
Improving the Molecular Ion Signal Intensity for In Situ Liquid SIMS Analysis
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhou, Yufan; Yao, Juan; Ding, Yuanzhao
In situ liquid secondary ion mass spectrometry (SIMS) enabled by system for analysis at the liquid vacuum interface (SALVI) has proven to be a promising new tool to provide molecular information at solid–liquid and liquid–vacuum interfaces. However, the initial data showed that useful signals in positive ion spectra are too weak to be meaningful in most cases. In addition, it is difficult to obtain strong negative molecular ion signals when m/z>200. These two drawbacks have been the biggest obstacle towards practical use of this new analytical approach. In this study, we report that strong and reliable positive and negative molecularmore » signals are achievable after optimizing the SIMS experimental conditions. Four model systems, including a 1,8-diazabicycloundec-7-ene (DBU)-base switchable ionic liquid, a live Shewanella oneidensis biofilm, a hydrated mammalian epithelia cell, and an electrolyte popularly used in Li ion batteries were studied. A signal enhancement of about two orders of magnitude was obtained in comparison with non-optimized conditions. Therefore, molecular ion signal intensity has become very acceptable to use for in situ liquid SIMS to study solid–liquid and liquid–vacuum interfaces.« less
Electron Transfer Strategies Regulate Carbonate Mineral and Micropore Formation
NASA Astrophysics Data System (ADS)
Zeng, Zhirui; Tice, Michael M.
2018-01-01
Some microbial carbonates are robust biosignatures due to their distinct morphologies and compositions. However, whether carbonates induced by microbial iron reduction have such features is unknown. Iron-reducing bacteria use various strategies to transfer electrons to iron oxide minerals (e.g., membrane-bound enzymes, soluble electron shuttles, nanowires, as well as different mechanisms for moving over or attaching to mineral surfaces). This diversity has the potential to create mineral biosignatures through manipulating the microenvironments in which carbonate precipitation occurs. We used Shewanella oneidensis MR-1, Geothrix fermentans, and Geobacter metallireducens GS-15, representing three different strategies, to reduce solid ferric hydroxide in order to evaluate their influence on carbonate and micropore formation (micro-size porosity in mineral rocks). Our results indicate that electron transfer strategies determined the morphology (rhombohedral, spherical, or long-chained) of precipitated calcium-rich siderite by controlling the level of carbonate saturation and the location of carbonate formation. Remarkably, electron transfer strategies also produced distinctive cell-shaped micropores in both carbonate and hydroxide minerals, thus producing suites of features that could potentially serve as biosignatures recording information about the sizes, shapes, and physiologies of iron-reducing organisms.
Improving the Molecular Ion Signal Intensity for In Situ Liquid SIMS Analysis.
Zhou, Yufan; Yao, Juan; Ding, Yuanzhao; Yu, Jiachao; Hua, Xin; Evans, James E; Yu, Xiaofei; Lao, David B; Heldebrant, David J; Nune, Satish K; Cao, Bin; Bowden, Mark E; Yu, Xiao-Ying; Wang, Xue-Lin; Zhu, Zihua
2016-12-01
In situ liquid secondary ion mass spectrometry (SIMS) enabled by system for analysis at the liquid vacuum interface (SALVI) has proven to be a promising new tool to provide molecular information at solid-liquid and liquid-vacuum interfaces. However, the initial data showed that useful signals in positive ion spectra are too weak to be meaningful in most cases. In addition, it is difficult to obtain strong negative molecular ion signals when m/z>200. These two drawbacks have been the biggest obstacle towards practical use of this new analytical approach. In this study, we report that strong and reliable positive and negative molecular signals are achievable after optimizing the SIMS experimental conditions. Four model systems, including a 1,8-diazabicycloundec-7-ene (DBU)-base switchable ionic liquid, a live Shewanella oneidensis biofilm, a hydrated mammalian epithelia cell, and an electrolyte popularly used in Li ion batteries were studied. A signal enhancement of about two orders of magnitude was obtained in comparison with non-optimized conditions. Therefore, molecular ion signal intensity has become very acceptable for use of in situ liquid SIMS to study solid-liquid and liquid-vacuum interfaces. Graphical Abstract ᅟ.
Tolerance of anaerobic bacteria to chlorinated solvents.
Koenig, Joanna C; Groissmeier, Kathrin D; Manefield, Mike J
2014-01-01
The aim of this research was to evaluate the effects of four chlorinated aliphatic hydrocarbons (CAHs), perchloroethene (PCE), carbon tetrachloride (CT), chloroform (CF) and 1,2-dichloroethane (1,2-DCA), on the growth of eight anaerobic bacteria: four fermentative species (Escherichia coli, Klebsiella sp., Clostridium sp. and Paenibacillus sp.) and four respiring species (Pseudomonas aeruginosa, Geobacter sulfurreducens, Shewanella oneidensis and Desulfovibrio vulgaris). Effective concentrations of solvents which inhibited growth rates by 50% (EC50) were determined. The octanol-water partition coefficient or log Po/w of a CAH proved a generally satisfactory measure of its toxicity. Most species tolerated approximately 3-fold and 10-fold higher concentrations of the two relatively more polar CAHs CF and 1,2-DCA, respectively, than the two relatively less polar compounds PCE and CT. EC50 values correlated well with growth rates observed in solvent-free cultures, with fast-growing organisms displaying higher tolerance levels. Overall, fermentative bacteria were more tolerant to CAHs than respiring species, with iron- and sulfate-reducing bacteria in particular appearing highly sensitive to CAHs. These data extend the current understanding of the impact of CAHs on a range of anaerobic bacteria, which will benefit the field of bioremediation.
Ramasamy, Mohankandhasamy; Lee, Jin-Hyung; Lee, Jintae
2016-09-01
The objective of this study was to develop a bimetallic nanoparticle with enhanced antibacterial activity that would improve the therapeutic efficacy against bacterial biofilms. Bimetallic gold-silver nanoparticles were bacteriogenically synthesized using γ-proteobacterium, Shewanella oneidensis MR-1. The antibacterial activities of gold-silver nanoparticles were assessed on the planktonic and biofilm phases of individual and mixed multi-cultures of pathogenic Gram negative (Escherichia coli and Pseudomonas aeruginosa) and Gram positive bacteria (Enterococcus faecalis and Staphylococcus aureus), respectively. The minimum inhibitory concentration of gold-silver nanoparticles was 30-50 µM than that of other nanoparticles (>100 µM) for the tested bacteria. Interestingly, gold-silver nanoparticles were more effective in inhibiting bacterial biofilm formation at 10 µM concentration. Both scanning and transmission electron microscopy results further accounted the impact of gold-silver nanoparticles on biocompatibility and bactericidal effect that the small size and bio-organic materials covering on gold-silver nanoparticles improves the internalization and thus caused bacterial inactivation. Thus, bacteriogenically synthesized gold-silver nanoparticles appear to be a promising nanoantibiotic for overcoming the bacterial resistance in the established bacterial biofilms. © The Author(s) 2016.
Shin, Doyun; Nam, Kyoungphile
2012-02-20
The present study was conducted to investigate the performance and feasibility of a self-dying reporter bacterium to visualize and quantify phenanthrene bioavailability in soil. The self-dying reporter bacterium was designed to die on the initiation of phenanthrene biodegradation. The viability of the reporter bacterium was determined by a fluorescence live/dead cell staining method and visualized by confocal laser scanning microscopic observation. Phenanthrene was spiked into four types of model solids and a sandy loam. The bioavailability of phenanthrene to the reporter bacterium was remarkably declined with the hydrophobicity of the model solids: essentially no phenanthrene was biodegraded in the presence of 9-nm pores and about 35.8% of initial phenanthrene was biodegraded without pores. Decrease in bioavailability was not evident in the nonporous hydrophilic bead, but a small decrease was observed in the porous hydrophilic bead at 1000 mg/kg of phenanthrene. The fluorescence intensity was commensurate with the extent of phenanthrene biodegradation by the reporter bacterium at the concentration range from 50 to 500 mg/kg. Such a quantitative relationship was also confirmed with a sandy loam spiked up to 1000 mg/kg of phenanthrene. This reporter bacterium may be a useful means to determine phenanthrene bioavailability in soil. Copyright © 2011 Elsevier B.V. All rights reserved.
Idogawa, Nao; Amamoto, Ryuta; Murata, Kousaku; Kawai, Shigeyuki
2014-01-01
Gluconacetobacter diazotrophicus is a gram-negative and endophytic nitrogen-fixing bacterium that has several beneficial effects in host plants; thus, utilization of this bacterium as a biofertilizer in agriculture may be possible. G. diazotrophicus synthesizes levan, a D-fructofuranosyl polymer with β-(2→6) linkages, as an exopolysaccharide and the synthesized levan improves the stress tolerance of the bacterium. In this study, we found that phosphate enhances levan production by G. diazotrophicus Pal5, a wild type strain that showed a stronger mucous phenotype on solid medium containing 28 mM phosphate than on solid medium containing 7 mM phosphate. A G. diazotrophicus Pal5 levansucrase disruptant showed only a weak mucous phenotype regardless of the phosphate concentration, indicating that the mucous phenotype observed on 28 mM phosphate medium was caused by levan. To our knowledge, this is the first report of the effect of a high concentration of phosphate on exopolysaccharide production. PMID:24717418
Huang, Bing; Zhang, Shi-Ling; Zhang, Jiang-Hong; Ao, Yong; Shi, Zhe
2011-07-01
A group of removing SO2 bacterium was obtained from the oxidation ditch of city sewage treatment plant by inductive domestication over 6 d with low concentration SO2 gas, and they have an ability with biodegradation rate of 888 mg x (L x h)(-1) and a degradation efficiency of 85% during 1.5 h for SO2 dissolved in water with their synergy. The clone library and two phylogenetic trees of the removing SO2 bacterium communities were obtained based on 16S rRNA DNA comparison by DNA extraction of the sample and in situ polymerase chain reaction (PCR). The phylogenetic analysis showed that 8 dominant desulfuration bacterium occupy about 69% of all removing SO2 bacterium, and some of them have a kindred with discovered desulfuration bacterium but not homogeneity, and there are four belong to alpha-Proteobacteria, another four belong to beta-Proteobacteria in them. The gene information about 16S rRNA sequence of the dominant desulfuration bacteria and domestication method provide a basic of looking for or domesticating removing SO2 bacterium for development microbial desulfurization technology of contained SO2 tail gas.
Wong, P P; Stenberg, N E; Edgar, L
1980-03-01
A bacterium with the taxonomic characteristics of the genus Azospirillum was isolated from celluloytic N2-fixing mixed cultures. Its characteristics fit the descriptions of both Azopirillum lipoferum (Beijerinck) comb. nov. and Azospirillum brasilense sp. nov. It may be a variant strain of A. lipoferum. In mixed cultures with cellulolytic organisms, the bacterium grew and fixed N2 with cellelose as a sole source of energy and carbon. The mixed cultures used cellulose from leaves of wheat (Triticum aestivum L.), corn (Zea mays L.), and big bluestem grass (Andropogon gerardii Vitm). Microaerophilic N2-fixing bacteria of the genus Azospirillum, such as the bacterium we isolated, may be important contributors of fixed N2 in soil with partial anaerobiosis and cellulose decomposition.
Biofilm Formation by a Metabolically Versatile Bacterium
2005-10-02
Rhodopseudomonas palustris is a photosynthetic bacterium that has good potential to be developed as a biocatalyst for the production of hydrogen, a...A for none) Samanta, S. K and C. S. Harwood. 2005. Use of the Rhodopseudomonas palustris genome to identify a single amino acid that contributes to...operon from Rhodopseudomonas palustris mediates dicarboxylic acid degradation and participates in anaerobic benzoate degradation. Microbiology 151
Panchal, Mitesh B; Upadhyay, Sanjay H
2014-09-01
In this study, the feasibility of single walled boron nitride nanotube (SWBNNT)-based biosensors has been ensured considering the continuum modelling-based simulation approach, for mass-based detection of various bacterium/viruses. Various types of bacterium or viruses have been taken into consideration at the free-end of the cantilevered configuration of the SWBNNT, as a biosensor. Resonant frequency shift-based analysis has been performed with the adsorption of various bacterium/viruses considered as additional mass to the SWBNNT-based sensor system. The continuum mechanics-based analytical approach, considering effective wall thickness has been considered to validate the finite element method (FEM)-based simulation results, based on continuum volume-based modelling of the SWBNNT. As a systematic analysis approach, the FEM-based simulation results are found in excellent agreement with the analytical results, to analyse the SWBNNTs for their wide range of applications such as nanoresonators, biosensors, gas-sensors, transducers and so on. The obtained results suggest that by using the SWBNNT of smaller size the sensitivity of the sensor system can be enhanced and detection of the bacterium/virus having mass of 4.28 × 10⁻²⁴ kg can be effectively performed.
Yang, Gui-Di; Xie, Wan-Ying; Zhu, Xi; Huang, Yi; Yang, Xiao-Jun; Qiu, Zong-Qing; Lv, Zhen-Mao; Wang, Wen-Na; Lin, Wen-Xiong
2015-10-01
Arsenite [As (III)] oxidation can be accelerated by bacterial catalysis, but the effects of the accelerated oxidation on arsenic toxicity and translocation in rice plants are poorly understood. Herein we investigated how an arsenite-oxidizing bacterium, namely Brevibacillus laterosporus, influences As (III) toxicity and translocation in rice plants. Rice seedlings of four cultivars, namely Guangyou Ming 118 (GM), Teyou Hang II (TH), Shanyou 63 (SY) and Minghui 63 (MH), inoculated with or without the bacterium were grown hydroponically with As (III) to investigate its effects on arsenic toxicity and translocation in the plants. Percentages of As (III) oxidation in the solutions with the bacterium (100%) were all significantly higher than those without (30-72%). The addition of the bacterium significantly decreased As (III) concentrations in SY root, GM root and shoot, while increased the As (III) concentrations in the shoot of SY, MH and TH and in the root of MH. Furthermore, the As (III) concentrations in the root and shoot of SY were both the lowest among the treatments with the bacterium. On the other hand, its addition significantly alleviated the As (III) toxicity on four rice cultivars. Among the treatments amended with B. laterosporus, the bacterium showed the best remediation on SY seedlings, with respect to the subdued As (III) toxicity and decreased As (III) concentration in its roots. These results indicated that As (III) oxidation accelerated by B. laterosporus could be an effective method to alleviate As (III) toxicity on rice seedlings. Copyright © 2015 Elsevier Inc. All rights reserved.
Characterization of a novel extremely alkalophilic bacterium
NASA Technical Reports Server (NTRS)
Souza, K. A.; Deal, P. H.
1977-01-01
A new alkalophilic bacterium, isolated from a natural spring of high pH is characterized. It is a Gram-positive, non-sporulating, motile rod requiring aerobic and alkaline conditions for growth. The characteristics of this organism resemble those of the coryneform group of bacteria; however, there are no accepted genera within this group with which this organism can be closely matched. Therefore, a new genus may be warranted.
Kikuchi, Yo; Umekage, So
2018-02-01
Extracellular nucleic acids of high molecular weight are detected ubiquitously in seawater. Recent studies have indicated that these nucleic acids are, at least in part, derived from active production by some bacteria. The marine bacterium Rhodovulum sulfidophilum is one of those bacteria. Rhodovulumsulfidophilum is a non-sulfur phototrophic marine bacterium that is known to form structured communities of cells called flocs, and to produce extracellular nucleic acids in culture media. Recently, it has been revealed that this bacterium produces gene transfer agent-like particles and that this particle production may be related to the extracellular nucleic acid production mechanism. This review provides a summary of recent physiological and genetic studies of these phenomena and also introduces a new method for extracellular production of artificial and biologically functional RNAs using this bacterium. In addition, artificial RNA production using Escherichia coli, which is related to this topic, will also be described. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Complete Genome Sequence of the p-Nitrophenol-Degrading Bacterium Pseudomonas putida DLL-E4
Hu, Xiaojun; Wang, Jue; Wang, Fei; Chen, Qiongzhen; Huang, Yan
2014-01-01
The first complete genome sequence of a p-nitrophenol (PNP)-degrading bacterium is reported here. Pseudomonas putida DLL-E4, a Gram-negative bacterium isolated from methyl-parathion-polluted soil, can utilize PNP as the sole carbon and nitrogen source. P. putida DLL-E4 has a 6,484,062 bp circular chromosome that contains 5,894 genes, with a G+C content of 62.46%. PMID:24948765
Tan, L; Grewal, P S
2001-11-01
Moraxella osloensis, a gram-negative bacterium, is associated with Phasmarhabditis hermaphrodita, a nematode parasite of slugs. This bacterium-feeding nematode has potential for the biological control of slugs, especially the grey garden slug, Deroceras reticulatum. Infective juveniles of P. hermaphrodita invade the shell cavity of the slug, develop into self-fertilizing hermaphrodites, and produce progeny, resulting in host death. However, the role of the associated bacterium in the pathogenicity of the nematode to the slug is unknown. We discovered that M. osloensis alone is pathogenic to D. reticulatum after injection into the shell cavity or hemocoel of the slug. The bacteria from 60-h cultures were more pathogenic than the bacteria from 40-h cultures, as indicated by the higher and more rapid mortality of the slugs injected with the former. Coinjection of penicillin and streptomycin with the 60-h bacterial culture reduced its pathogenicity to the slug. Further work suggested that the reduction and loss of pathogenicity of the aged infective juveniles of P. hermaphrodita to D. reticulatum result from the loss of M. osloensis from the aged nematodes. Also, axenic J1/J2 nematodes were nonpathogenic after injection into the shell cavity. Therefore, we conclude that the bacterium is the sole killing agent of D. reticulatum in the nematode-bacterium complex and that P. hermaphrodita acts only as a vector to transport the bacterium into the shell cavity of the slug. The identification of the toxic metabolites produced by M. osloensis is being pursued.
Interference activity of a minimal Type I CRISPR-Cas system from Shewanella putrefaciens.
Dwarakanath, Srivatsa; Brenzinger, Susanne; Gleditzsch, Daniel; Plagens, André; Klingl, Andreas; Thormann, Kai; Randau, Lennart
2015-10-15
Type I CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)-Cas (CRISPR-associated) systems exist in bacterial and archaeal organisms and provide immunity against foreign DNA. The Cas protein content of the DNA interference complexes (termed Cascade) varies between different CRISPR-Cas subtypes. A minimal variant of the Type I-F system was identified in proteobacterial species including Shewanella putrefaciens CN-32. This variant lacks a large subunit (Csy1), Csy2 and Csy3 and contains two unclassified cas genes. The genome of S. putrefaciens CN-32 contains only five Cas proteins (Cas1, Cas3, Cas6f, Cas1821 and Cas1822) and a single CRISPR array with 81 spacers. RNA-Seq analyses revealed the transcription of this array and the maturation of crRNAs (CRISPR RNAs). Interference assays based on plasmid conjugation demonstrated that this CRISPR-Cas system is active in vivo and that activity is dependent on the recognition of the dinucleotide GG PAM (Protospacer Adjacent Motif) sequence and crRNA abundance. The deletion of cas1821 and cas1822 reduced the cellular crRNA pool. Recombinant Cas1821 was shown to form helical filaments bound to RNA molecules, which suggests its role as the Cascade backbone protein. A Cascade complex was isolated which contained multiple Cas1821 copies, Cas1822, Cas6f and mature crRNAs. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Llamas, Inmaculada; del Moral, Ana; Martínez-Checa, Fernando; Arco, Yolanda; Arias, Soledad; Quesada, Emilia
2006-01-01
Halomonas maura is a bacterium of great metabolic versatility. We summarise in this work some of the properties that make it a very interesting microorganism both from an ecological and biotechnological point of view. It plays an active role in the nitrogen cycle, is capable of anaerobic respiration in the presence of nitrate and has recently been identified as a diazotrophic bacterium. Of equal interest is mauran, the exopolysaccharide produced by H. maura, which contributes to the formation of biofilms and thus affords the bacterium advantages in the colonisation of its saline niches. Mauran is highly viscous, shows thixotropic and pseudoplastic behaviour, has the capacity to capture heavy metals and exerts a certain immunomodulator effect in medicine. All these attributes have prompted us to make further investigations into its molecular characteristics. To date we have described 15 open reading frames (ORF's) related to exopolysaccharide production, nitrogen fixation and nitrate reductase activity among others.
Shashidhar, Ravindranath; Bandekar, Jayant R
2006-01-01
A radiation-resistant, Gram-negative and pleomorphic bacterium (CON-1) was isolated from a contaminated tryptone glucose yeast extract agar plate in the laboratory. It was red pigmented, nonmotile, nonsporulating, and aerobic, and contained MK-8 as respiratory quinone. The cell wall of this bacterium contained ornithine. The major fatty acids were C16:0, C16:1, C17:0, C18:1 and iso C18:0. The DNA of CON-1 had a G+C content of 70 mol%. Phylogenetic analysis based on 16S rRNA gene sequences showed that CON-1 exhibited a maximum similarity (94.72%) with Deinococcus grandis. Based on the genotypic, phenotypic and chemotaxonomic characteristics, the bacterium CON-1 was identified as a new species of the genus Deinococcus, for which the name Deinococcus mumbaiensis sp. nov. is proposed. The type strain of D. mumbaiensis is CON-1 (MTCC 7297(T)=DSM 17424(T)).
From Genome to Function: Systematic Analysis of the Soil Bacterium Bacillus Subtilis
Crawshaw, Samuel G.; Wipat, Anil
2001-01-01
Bacillus subtilis is a sporulating Gram-positive bacterium that lives primarily in the soil and associated water sources. Whilst this bacterium has been studied extensively in the laboratory, relatively few studies have been undertaken to study its activity in natural environments. The publication of the B. subtilis genome sequence and subsequent systematic functional analysis programme have provided an opportunity to develop tools for analysing the role and expression of Bacillus genes in situ. In this paper we discuss analytical approaches that are being developed to relate genes to function in environments such as the rhizosphere. PMID:18628943
DOE Office of Scientific and Technical Information (OSTI.GOV)
Xie, Gary; Dalin, Eileen; Tice, Hope
Bacillus coagulans is a ubiquitous soil bacterium that grows at 50-55 C and pH 5.0 and fer-ments various sugars that constitute plant biomass to L (+)-lactic acid. The ability of this sporogenic lactic acid bacterium to grow at 50-55 C and pH 5.0 makes this organism an attractive microbial biocatalyst for production of optically pure lactic acid at industrial scale not only from glucose derived from cellulose but also from xylose, a major constituent of hemi-cellulose. This bacterium is also considered as a potential probiotic. Complete genome squence of a representative strain, B. coagulans strain 36D1, is presented and discussed.
Genome Sequence of the Soil Bacterium Janthinobacterium sp. KBS0711
Shoemaker, William R.; Muscarella, Mario E.
2015-01-01
We present a draft genome of Janthinobacterium sp. KBS0711 that was isolated from agricultural soil. The genome provides insight into the ecological strategies of this bacterium in free-living and host-associated environments. PMID:26089434
Sparks, N.H.C.; Mann, S.; Bazylinski, D.A.; Lovley, D.R.; Jannasch, H.W.; Frankel, R.B.
1990-01-01
Intracellular crystals of magnetite synthesized by cells of the magnetotactic vibroid organism, MV-1, and extracellular crystals of magnetite produced by the non-magnetotactic dissimilatory iron-reducing bacterium strain GS-15, were examined using high-resolution transmission electron microscopy, electron diffraction and 57Fe Mo??ssbauer spectroscopy. The magnetotactic bacterium contained a single chain of approximately 10 crystals aligned along the long axis of the cell. The crystals were essentially pure stoichiometric magnetite. When viewed along the crystal long axis the particles had a hexagonal cross-section whereas side-on they appeared as rectangules or truncated rectangles of average dimension, 53 ?? 35 nm. These findings are explained in terms of a three-dimensional morphology comprising a hexagonal prism of {110} faces which are capped and truncated by {111} end faces. Electron diffraction and lattice imaging studies indicated that the particles were structurally well-defined single crystals. In contrast, magnetite particles produced by the strain, GS-15 were irregular in shape and had smaller mean dimensions (14 nm). Single crystals were imaged but these were not of high structural perfection. These results highlight the influence of intracellular control on the crystallochemical specificity of bacterial magnetites. The characterization of these crystals is important in aiding the identification of biogenic magnetic materials in paleomagnetism and in studies of sediment magnetization. ?? 1990.
Van Puyvelde, Sandra; Cloots, Lore; Engelen, Kristof; Das, Frederik; Marchal, Kathleen; Vanderleyden, Jos; Spaepen, Stijn
2011-05-01
The rhizosphere bacterium Azospirillum brasilense produces the auxin indole-3-acetic acid (IAA) through the indole-3-pyruvate pathway. As we previously demonstrated that transcription of the indole-3-pyruvate decarboxylase (ipdC) gene is positively regulated by IAA, produced by A. brasilense itself or added exogenously, we performed a microarray analysis to study the overall effects of IAA on the transcriptome of A. brasilense. The transcriptomes of A. brasilense wild-type and the ipdC knockout mutant, both cultured in the absence and presence of exogenously added IAA, were compared.Interfering with the IAA biosynthesis/homeostasis in A. brasilense through inactivation of the ipdC gene or IAA addition results in much broader transcriptional changes than anticipated. Based on the multitude of changes observed by comparing the different transcriptomes, we can conclude that IAA is a signaling molecule in A. brasilense. It appears that the bacterium, when exposed to IAA, adapts itself to the plant rhizosphere, by changing its arsenal of transport proteins and cell surface proteins. A striking example of adaptation to IAA exposure, as happens in the rhizosphere, is the upregulation of a type VI secretion system (T6SS) in the presence of IAA. The T6SS is described as specifically involved in bacterium-eukaryotic host interactions. Additionally, many transcription factors show an altered regulation as well, indicating that the regulatory machinery of the bacterium is changing.
Tan, Li; Grewal, Parwinder S.
2001-01-01
Moraxella osloensis, a gram-negative bacterium, is associated with Phasmarhabditis hermaphrodita, a nematode parasite of slugs. This bacterium-feeding nematode has potential for the biological control of slugs, especially the grey garden slug, Deroceras reticulatum. Infective juveniles of P. hermaphrodita invade the shell cavity of the slug, develop into self-fertilizing hermaphrodites, and produce progeny, resulting in host death. However, the role of the associated bacterium in the pathogenicity of the nematode to the slug is unknown. We discovered that M. osloensis alone is pathogenic to D. reticulatum after injection into the shell cavity or hemocoel of the slug. The bacteria from 60-h cultures were more pathogenic than the bacteria from 40-h cultures, as indicated by the higher and more rapid mortality of the slugs injected with the former. Coinjection of penicillin and streptomycin with the 60-h bacterial culture reduced its pathogenicity to the slug. Further work suggested that the reduction and loss of pathogenicity of the aged infective juveniles of P. hermaphrodita to D. reticulatum result from the loss of M. osloensis from the aged nematodes. Also, axenic J1/J2 nematodes were nonpathogenic after injection into the shell cavity. Therefore, we conclude that the bacterium is the sole killing agent of D. reticulatum in the nematode-bacterium complex and that P. hermaphrodita acts only as a vector to transport the bacterium into the shell cavity of the slug. The identification of the toxic metabolites produced by M. osloensis is being pursued. PMID:11679319
Davies, Keith G
2009-01-01
Pasteuria penetrans is an endospore-forming bacterium, which is a hyperparasite of root-knot nematodes Meloidogyne spp. that are economically important pests of a wide range of crops. The life cycle of the bacterium and nematode are described with emphasis on the bacterium's potential as a biocontrol agent. Two aspects that currently prohibit the commercial development of the bacterium as a biocontrol agent are the inability to culture it outside its host and its host specificity. Vegetative growth of the bacterium is possible in vitro; however, getting the vegetative stages of the bacterium to enter sporogenesis has been problematic. Insights from genomic survey sequences regarding the role of cation concentration and the phosphorylation of Spo0F have proved useful in inducing vegetative bacteria to sporulate. Similarly, genomic data have also proved useful in understanding the attachment of endospores to the cuticle of infective nematode juveniles, and a Velcro-like model of spore attachment is proposed that involves collagen-like fibres on the surface of the endospore interacting with mucins on the nematode cuticle. Ecological studies of the interactions between Daphnia and Pasteuria ramosa are examined and similarities are drawn between the co-evolution of virulence in the Daphnia system and that of plant-parasitic nematodes.
Description of a bacterium associated with redmouth disease of rainbow trout (Salmo gairdneri)
Ross, A.J.; Rucker, R.R.; Ewing, W.H.
1966-01-01
A description was given of a gram-negative, peritrichously flagellated, fermentative bacterium that was isolated on numerous occasions from kidney tissues of rainbow trout (Salmo gairdneri) afflicted with redmouth disease. Although the bacteria apparently were members of the family Enterobacteriaceae, it was impossible to determine their taxonomic position within the family with certainty. Hence it was recommended that their taxonomic position remain sub judice for the present. As a temporary designation RM bacterium was used. Redmouth disease was transmitted from infected to normal fish through the medium of water.
Fraiberg, Milana; Borovok, Ilya; Bayer, Edward A.; Weiner, Ronald M.; Lamed, Raphael
2011-01-01
The complex polysaccharide-degrading marine bacterium Saccharophagus degradans strain 2-40 produces putative proteins that contain numerous cadherin and cadherin-like domains involved in intercellular contact interactions. The current study reveals that both domain types exhibit reversible calcium-dependent binding to different complex polysaccharides which serve as growth substrates for the bacterium. PMID:21036994
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rhee, Mun Su; Moritz, Brelan E.; Xie, Gary
Bacillus coagulans is a ubiquitous soil bacterium that grows at 50-55 C and pH 5.0 and fer- ments various sugars that constitute plant biomass to L (+)-lactic acid. The ability of this spo- rogenic lactic acid bacterium to grow at 50-55 C and pH 5.0 makes this organism an attrac- tive microbial biocatalyst for production of optically pure lactic acid at industrial scale not only from glucose derived from cellulose but also from xylose, a major constituent of hemi- cellulose. This bacterium is also considered as a potential probiotic. Complete genome se- quence of a representative strain, B. coagulans strainmore » 36D1, is presented and discussed.« less
Rhee, Mun Su; Moritz, Brélan E.; Xie, Gary; Glavina del Rio, T.; Dalin, E.; Tice, H.; Bruce, D.; Goodwin, L.; Chertkov, O.; Brettin, T.; Han, C.; Detter, C.; Pitluck, S.; Land, Miriam L.; Patel, Milind; Ou, Mark; Harbrucker, Roberta; Ingram, Lonnie O.; Shanmugam, K. T.
2011-01-01
Bacillus coagulans is a ubiquitous soil bacterium that grows at 50-55 °C and pH 5.0 and ferments various sugars that constitute plant biomass to L (+)-lactic acid. The ability of this sporogenic lactic acid bacterium to grow at 50-55 °C and pH 5.0 makes this organism an attractive microbial biocatalyst for production of optically pure lactic acid at industrial scale not only from glucose derived from cellulose but also from xylose, a major constituent of hemicellulose. This bacterium is also considered as a potential probiotic. Complete genome sequence of a representative strain, B. coagulans strain 36D1, is presented and discussed. PMID:22675583
Paradigms: examples from the bacterium Xylella fastidiosa.
Purcell, Alexander
2013-01-01
The history of advances in research on Xylella fastidiosa provides excellent examples of how paradigms both advance and limit our scientific understanding of plant pathogens and the plant diseases they cause. I describe this from a personal perspective, having been directly involved with many persons who made paradigm-changing discoveries, beginning with the discovery that a bacterium, not a virus, causes Pierce's disease of grape and other plant diseases in numerous plant species, including important crop and forest species.
Possible Dynamically Gated Conductance along Heme Wires in Bacterial Multiheme Cytochromes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Smith, Dayle MA; Rosso, Kevin M.
2014-07-24
The staggered cross decaheme configuration of electron transfer co-factors in the outer-membrane cytochrome MtrF may serve as a prototype for conformationally-gated multi-heme electron transport. Derived from the bacterium Shewanella oneidensis, the staggered cross configuration reveals intersecting c-type octaheme and tetraheme “wires” containing thermodynamic “hills” and “valleys”, suggesting that the protein structure may include a dynamical mechanism for conductance and pathway switching depending on enzymatic functional need. Recent molecular simulations have established the pair-wise electronic couplings, redox potentials, and reorganization energies to predict the maximum conductance along the various heme wire pathways by sequential hopping of a single electron (PNAS (2014)more » 11,611-616). Here, we expand this information with classical molecular and statistical mechanics calculations of large-amplitude protein dynamics in MtrF, to address its potential to modulate pathway conductance, including assessment of the effect of the total charge state. Explicit solvent molecular dynamics simulations of fully oxidized and fully reduced MtrF employing ten independent 50-ns simulations at 300 K and 1 atm showed that reduced MtrF is more expanded and explores more conformational space than oxidized MtrF, and that heme reduction leads to increased heme solvent exposure. The slowest mode of collective decaheme motion is 90% similar between the oxidized and reduced states, and consists primarily of inter-heme separation with minor rotational contributions. The frequency of this motion is 1.7×107 s 1 for fully-oxidized and fully-reduced MtrF, respectively, slower than the downhill electron transfer rates between stacked heme pairs at the octaheme termini and faster than the electron transfer rates between parallel hemes in the tetraheme chain. This implies that MtrF uses slow conformational fluctuations to modulate electron flow along the octaheme
Li, Chunyan; Yue, Zhenlei; Feng, Fengzhao; Xi, Chuanwu; Zang, Hailian; An, Xuejiao; Liu, Keran
2016-10-01
There is a great need for efficient acetonitrile removal technology in wastewater treatment to reduce the discharge of this pollutant in untreated wastewater. In this study, a nitrilase gene (nit) isolated from a nitrile-degrading bacterium (Rhodococcus rhodochrous BX2) was cloned and transformed into a biofilm-forming bacterium (Bacillus subtilis N4) that expressed the recombinant protein upon isopropylthio-β-galactoside (IPTG) induction. The recombinant bacterium (B. subtilis N4-pHT01-nit) formed strong biofilms and had nitrile-degrading capability. Further testing demonstrated that biofilms formed by B. subtilis N4-pHT01-nit were highly resistant to loading shock from acetonitrile and almost completely degraded the initial concentration of acetonitrile (800 mg L(-1)) within 24 h in a moving bed biofilm reactor (MBBR) after operation for 35 d. The bacterial composition of the biofilm, identified by high-throughput sequencing, in a reactor in which the B. subtilis N4-pHT01-nit bacterium was introduced indicated that the engineered bacterium was successfully immobilized in the reactor and became dominant genus. This work demonstrates that an engineered bacterium with nitrile-degrading and biofilm-forming capacity can improve the degradation of contaminants in wastewater. This approach offers a novel strategy for enhancing the biological oxidation of toxic pollutants in wastewater. Copyright © 2016 Elsevier Ltd. All rights reserved.
El Kafsi, Hela; Binesse, Johan; Loux, Valentin; Buratti, Julien; Boudebbouze, Samira; Dervyn, Rozenn; Hammani, Amal; Maguin, Emmanuelle; van de Guchte, Maarten
2014-07-17
Lactobacillus delbrueckii subsp. lactis CNRZ327 is a dairy bacterium with anti-inflammatory properties both in vitro and in vivo. Here, we report the genome sequence of this bacterium, which appears to contain no less than 215 insertion sequence (IS) elements, an exceptionally high number regarding the small genome size of the strain. Copyright © 2014 El Kafsi et al.
Chitin utilization by the insect-transmitted bacterium Xylella fastidiosa.
Killiny, Nabil; Prado, Simone S; Almeida, Rodrigo P P
2010-09-01
Xylella fastidiosa is an insect-borne bacterium that colonizes xylem vessels of a large number of host plants, including several crops of economic importance. Chitin is a polysaccharide present in the cuticle of leafhopper vectors of X. fastidiosa and may serve as a carbon source for this bacterium. Biological assays showed that X. fastidiosa reached larger populations in the presence of chitin. Additionally, chitin induced phenotypic changes in this bacterium, notably increasing adhesiveness. Quantitative PCR assays indicated transcriptional changes in the presence of chitin, and an enzymatic assay demonstrated chitinolytic activity by X. fastidiosa. An ortholog of the chitinase A gene (chiA) was identified in the X. fastidiosa genome. The in silico analysis revealed that the open reading frame of chiA encodes a protein of 351 amino acids with an estimated molecular mass of 40 kDa. chiA is in a locus that consists of genes implicated in polysaccharide degradation. Moreover, this locus was also found in the genomes of closely related bacteria in the genus Xanthomonas, which are plant but not insect associated. X. fastidiosa degraded chitin when grown on a solid chitin-yeast extract-agar medium and grew in liquid medium with chitin as the sole carbon source; ChiA was also determined to be secreted. The gene encoding ChiA was cloned into Escherichia coli, and endochitinase activity was detected in the transformant, showing that the gene is functional and involved in chitin degradation. The results suggest that X. fastidiosa may use its vectors' foregut surface as a carbon source. In addition, chitin may trigger X. fastidiosa's gene regulation and biofilm formation within vectors. Further work is necessary to characterize the role of chitin and its utilization in X. fastidiosa.
ARSENIC MOBILIZATION BY THE DISSIMILATORY FE(III)-REDUCING BACTERIUM SHEWANELLA ALGA BRY. (R825399)
The mobility of arsenic commonly increases as reducing conditions are
established within sediments or flooded soils. Although the reduction of arsenic
increases its solubility at circumneutral pH, hydrous ferric oxides (HFO)
strongly sorb both As(V) (arsenate) and ...
Cui, Changzheng; Li, Zhijie; Qian, Jiangchao; Shi, Jie; Huang, Ling; Tang, Hongzhi; Chen, Xin; Lin, Kuangfei; Xu, Ping; Liu, Yongdi
2016-05-10
Martelella sp. strain AD-3, a moderate halophilic bacterium, was isolated from a petroleum-contaminated soil with high salinity in China. Here, we report the complete genome of strain AD-3, which contains one circular chromosome and two circular plasmids. An array of genes related to metabolism of polycyclic aromatic hydrocarbons and halophilic mechanism in this bacterium was identified by the whole genome analysis. Copyright © 2016 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Zhang, C.; Keating, K.
2014-12-01
Microbes and microbial processes play a significant role in shaping subsurface environments and are involved in applications ranging from microbially enhanced oil recovery to soil and groundwater contaminant remediation. Stimulated microbial growth in such applications could cause wide variety of changes of physical/chemical properties in the subsurface; however, due to the complexity of subsurface systems,it is difficult to monitor the growth of microbes and microbial activity in porous media. The focus of this research is to determine if low-field nuclear magnetic resonance (NMR), a method used in well logging to characterize fluids in hydrocarbon reservoirs or water in aquifers, can be used to directly detect the presence and the growth of microbes in geologic media. In this laboratory study, low-field NMR (2 MHz) relaxation measurements were collected on microbial suspensions with measured densities (i.e. biomasses), microbial pellets (live and dead), and inoculated silica. We focus on the direct contribution of microbes to the NMR signals in the absence of biomineralization. Shewanella oneidensis (MR-1), a facultative metal reducer known to play an important role in subsurface environments, were used as a model organism and were inoculated under aerobic condition. Data were collected using a CPMG pulse sequence, which was to determine the T2-distribution, and using a gradient spin-echo (PGSE) plus CPMG pulse sequence, which was used to encode diffusion properties and determine the effective diffusion-spin-spin relaxation correlation (D-T2) plot. Our data show no obvious change in the T2-distribution as S. oneidensis density varied in suspension, but show a clear distinction in the T2-distribution and D-T2 plots between live and dead cell pellets. A decrease in the T2-distribution is observed in the inoculated sand column. These results will provide a basis for understanding the effect of microbes within geologic media on low-field NMR measurements. This
Complete genome of the cellulolytic ruminal bacterium Ruminococcus albus 7
USDA-ARS?s Scientific Manuscript database
Ruminococcus albus 7 is a highly cellulolytic rumen bacterium that is a member of the phylum Firmicutes. Here, we describe the complete genome for this microbe. This genome will be useful for rumen microbiology, cellulosome biology, and in biofuel production, as one of its major fermentation product...
Lee, Sang-Jae; Lee, Yong-Jik; Park, Gun-Seok; Kim, Byoung-Chan; Lee, Sang Jun; Shin, Jae-Ho
2013-01-01
Caldanaerobacter yonseiensis is a strictly anaerobic, thermophilic, spore-forming bacterium, which was isolated from a geothermal hot stream in Indonesia. This bacterium utilizes xylose and produces a variety of proteases. Here, we report the draft genome sequence of C. yonseiensis, which reveals insights into the pentose phosphate pathway and protein degradation metabolism in thermophilic microorganisms. PMID:24201201
Fine Structure and Host-Virus Relationship of a Marine Bacterium and Its Bacteriophage
Valentine, Artrice F.; Chapman, George B.
1966-01-01
Valentine, Artrice F. (Georgetown University, Washington, D.C.), and George B. Chapman. Fine structure and host-virus relationship of a marine bacterium and its bacteriophage. J. Bacteriol. 92:1535–1554. 1966.—The fine structure of a gram-negative marine bacterium, Cytophaga marinoflava sp. n., has been revealed by ultrathin sectioning and electron microscopy. Stages in the morphogenesis of the bacterial virus NCMB 385, which has been shown to be highly specific for this organism, were also demonstrated in bacterial cells fixed according to the Kellenberger technique. The bacterium possessed a cell wall, cytoplasmic membrane, and nuclear and cytoplasmic regions typical of bacterial cells. Both the cell wall and the cytoplasmic membrane showed a tripartite structure, i.e., each was composed of two dense layers separated by a low-density zone. Intracytoplasmic membrane systems were also observed, especially in dividing cells and in cells in which new viruses were being formed. As many as 18 hexagonally shaped, empty phage heads (membranes only) were observed in untreated, infected bacterial cells. Phage heads, intermediate in density to empty heads and fully condensed ones, possibly representing stages in the morphological development of the virus, were also seen. Images PMID:5924277
Brown, Steven D; Begemann, Matthew B; Mormile, Melanie R; Wall, Judy D; Han, Cliff S; Goodwin, Lynne A; Pitluck, Samuel; Land, Miriam L; Hauser, Loren J; Elias, Dwayne A
2011-07-01
Halanaerobium hydrogenoformans is an alkaliphilic bacterium capable of biohydrogen production at pH 11 and 7% (wt/vol) salt. We present the 2.6-Mb genome sequence to provide insights into its physiology and potential for bioenergy applications.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Merkley, Eric D.; Baker, Erin S.; Crowell, Kevin L.
2013-02-20
Chemical cross-linking of proteins followed by proteolysis and mass spectrometric analysis of the resulting cross-linked peptides can provide insights into protein structure and protein-protein interactions. However, cross-linked peptides are by necessity of low stoichometry and have different physicochemical properties than linear peptides, routine unambiguous identification of the cross-linked peptides has remained difficult. To address this challenge, we demonstrated the use of liquid chromatography and ion mobility separations coupled with mass spectrometry in combination with a heavy-isotope labeling method. The combination of mixed-isotope cross-linking and ion mobility provided unique and easily interpretable spectral multiplet features for the intermolecular cross-linked peptides. Applicationmore » of the method to two different homodimeric proteins - SrfN, a virulence factor from Salmonella Typhimurium and SO_2176, a protein of unknown function from Shewanella oneidensis- revealed several cross-linked peptides from both proteins that were identified with a low false discovery rate (estimated using a decoy approach). A greater number of cross-linked peptides were identified using ion mobility drift time information in the analysis than when the data were summed across the drift time dimension before analysis. The identified cross-linked peptides migrated more quickly in the ion mobility drift tube than the unmodified peptides.« less
Integrated Microfluidic Flow-Through Microbial Fuel Cells
Jiang, Huawei; Ali, Md. Azahar; Xu, Zhen; Halverson, Larry J.; Dong, Liang
2017-01-01
This paper reports on a miniaturized microbial fuel cell with a microfluidic flow-through configuration: a porous anolyte chamber is formed by filling a microfluidic chamber with three-dimensional graphene foam as anode, allowing nutritional medium to flow through the chamber to intimately interact with the colonized microbes on the scaffolds of the anode. No nutritional media flow over the anode. This allows sustaining high levels of nutrient utilization, minimizing consumption of nutritional substrates, and reducing response time of electricity generation owing to fast mass transport through pressure-driven flow and rapid diffusion of nutrients within the anode. The device provides a volume power density of 745 μW/cm3 and a surface power density of 89.4 μW/cm2 using Shewanella oneidensis as a model biocatalyst without any optimization of bacterial culture. The medium consumption and the response time of the flow-through device are reduced by 16.4 times and 4.2 times, respectively, compared to the non-flow-through counterpart with its freeway space volume six times the volume of graphene foam anode. The graphene foam enabled microfluidic flow-through approach will allow efficient microbial conversion of carbon-containing bioconvertible substrates to electricity with smaller space, less medium consumption, and shorter start-up time. PMID:28120875
Electron Transfer Strategies Regulate Carbonate Mineral and Micropore Formation.
Zeng, Zhirui; Tice, Michael M
2018-01-01
Some microbial carbonates are robust biosignatures due to their distinct morphologies and compositions. However, whether carbonates induced by microbial iron reduction have such features is unknown. Iron-reducing bacteria use various strategies to transfer electrons to iron oxide minerals (e.g., membrane-bound enzymes, soluble electron shuttles, nanowires, as well as different mechanisms for moving over or attaching to mineral surfaces). This diversity has the potential to create mineral biosignatures through manipulating the microenvironments in which carbonate precipitation occurs. We used Shewanella oneidensis MR-1, Geothrix fermentans, and Geobacter metallireducens GS-15, representing three different strategies, to reduce solid ferric hydroxide in order to evaluate their influence on carbonate and micropore formation (micro-size porosity in mineral rocks). Our results indicate that electron transfer strategies determined the morphology (rhombohedral, spherical, or long-chained) of precipitated calcium-rich siderite by controlling the level of carbonate saturation and the location of carbonate formation. Remarkably, electron transfer strategies also produced distinctive cell-shaped micropores in both carbonate and hydroxide minerals, thus producing suites of features that could potentially serve as biosignatures recording information about the sizes, shapes, and physiologies of iron-reducing organisms. Key Words: Microbial iron reduction-Micropore-Electron transfer strategies-Microbial carbonate. Astrobiology 18, 28-36.
In Situ Molecular Imaging of the Biofilm and Its Matrix.
Ding, Yuanzhao; Zhou, Yufan; Yao, Juan; Szymanski, Craig; Fredrickson, James; Shi, Liang; Cao, Bin; Zhu, Zihua; Yu, Xiao-Ying
2016-11-15
Molecular mapping of live biofilms at submicrometer resolution presents a grand challenge. Here, we present the first chemical mapping results of biofilm extracellular polymeric substance (EPS) in biofilms using correlative imaging between super resolution fluorescence microscopy and liquid time-of-flight secondary ion mass spectrometry (TOF-SIMS). Shewanella oneidensis is used as a model organism. Heavy metal chromate (Cr 2 O 7 2- ) anions consisting of chromium Cr(VI) was used as a model environmental stressor to treat the biofilms. Of particular interest, biologically relevant water clusters have been first observed in the biofilms. Characteristic fragments of biofilm matrix components such as proteins, polysaccharides, and lipids can be spatially imaged. Furthermore, characteristic fatty acids (e.g., palmitic acid), quinolone signal, and riboflavin fragments were found to respond after the biofilm is treated with Cr(VI), leading to biofilm dispersal. Significant changes in water clusters and quorum sensing signals indicative of intercellular communication in the aqueous environment were observed, suggesting that they might result in fatty acid synthesis and inhibition of riboflavin production. The Cr(VI) reduction seems to follow the Mtr pathway leading to Cr(III) formation. Our approach potentially opens a new avenue for mechanistic insight of microbial community processes and communications using in situ imaging mass spectrometry and super resolution optical microscopy.
Tolerance of Anaerobic Bacteria to Chlorinated Solvents
Koenig, Joanna C.; Groissmeier, Kathrin D.; Manefield, Mike J.
2014-01-01
The aim of this research was to evaluate the effects of four chlorinated aliphatic hydrocarbons (CAHs), perchloroethene (PCE), carbon tetrachloride (CT), chloroform (CF) and 1,2-dichloroethane (1,2-DCA), on the growth of eight anaerobic bacteria: four fermentative species (Escherichia coli, Klebsiella sp., Clostridium sp. and Paenibacillus sp.) and four respiring species (Pseudomonas aeruginosa, Geobacter sulfurreducens, Shewanella oneidensis and Desulfovibrio vulgaris). Effective concentrations of solvents which inhibited growth rates by 50% (EC50) were determined. The octanol-water partition coefficient or log Po/w of a CAH proved a generally satisfactory measure of its toxicity. Most species tolerated approximately 3-fold and 10-fold higher concentrations of the two relatively more polar CAHs CF and 1,2-DCA, respectively, than the two relatively less polar compounds PCE and CT. EC50 values correlated well with growth rates observed in solvent-free cultures, with fast-growing organisms displaying higher tolerance levels. Overall, fermentative bacteria were more tolerant to CAHs than respiring species, with iron- and sulfate-reducing bacteria in particular appearing highly sensitive to CAHs. These data extend the current understanding of the impact of CAHs on a range of anaerobic bacteria, which will benefit the field of bioremediation. PMID:24441515
Integrated Microfluidic Flow-Through Microbial Fuel Cells
NASA Astrophysics Data System (ADS)
Jiang, Huawei; Ali, Md. Azahar; Xu, Zhen; Halverson, Larry J.; Dong, Liang
2017-01-01
This paper reports on a miniaturized microbial fuel cell with a microfluidic flow-through configuration: a porous anolyte chamber is formed by filling a microfluidic chamber with three-dimensional graphene foam as anode, allowing nutritional medium to flow through the chamber to intimately interact with the colonized microbes on the scaffolds of the anode. No nutritional media flow over the anode. This allows sustaining high levels of nutrient utilization, minimizing consumption of nutritional substrates, and reducing response time of electricity generation owing to fast mass transport through pressure-driven flow and rapid diffusion of nutrients within the anode. The device provides a volume power density of 745 μW/cm3 and a surface power density of 89.4 μW/cm2 using Shewanella oneidensis as a model biocatalyst without any optimization of bacterial culture. The medium consumption and the response time of the flow-through device are reduced by 16.4 times and 4.2 times, respectively, compared to the non-flow-through counterpart with its freeway space volume six times the volume of graphene foam anode. The graphene foam enabled microfluidic flow-through approach will allow efficient microbial conversion of carbon-containing bioconvertible substrates to electricity with smaller space, less medium consumption, and shorter start-up time.
Bioleaching of arsenic in contaminated soil using metal-reducing bacteria
NASA Astrophysics Data System (ADS)
Lee, So-Ra; Lee, Jong-Un; Chon, Hyo-Taek
2014-05-01
A study on the extraction of arsenic in the contaminated soil collected from an old smelting site in Korea was carried out using metal-reducing bacteria. Two types of batch-type experiments, biostimulation and bioaugmentation, were conducted for 28 days under anaerobic conditions. The biostimulation experiments were performed through activation of indigenous bacteria by supply with glucose or lactate as a carbon source. The contaminated, autoclaved soil was inoculated with metal-reducing bacteria, Shewanella oneidensis MR-1 and S. algae BrY, in the bioaugmentation experiments. The results indicated that the maximum concentration of the extracted As was 11.2 mg/L at 4 days from the onset of the experiment when 20 mM glucose was supplied and the extraction efficiency of As ranged 60~63% in the biostimulation experiments. In the case of bioaugmentation, the highest dissolved As concentration was 24.4 mg/L at 2 days, though it dramatically decreased over time through re-adsorption onto soil particles. After both treatments, mode of As occurrence in the soil appeared to be changed to readily extractable fractions. This novel technique of bioleaching may be practically applied for remediation of As-contaminated soil after determination of optimum operational conditions such as operation time and proper carbon source and its concentration.
Isolation and biological characteristics of aerobic marine magnetotactic bacterium YSC-1
NASA Astrophysics Data System (ADS)
Gao, Jun; Pan, Hongmiao; Yue, Haidong; Song, Tao; Zhao, Yong; Chen, Guanjun; Wu, Longfei; Xiao, Tian
2006-12-01
Magnetotactic bacteria have become a hot spot of research in microbiology attracting intensive interest of researchers in multiple disciplinary fields. However, the studies were limited in few fastidious bacteria. The objective of this study aims at isolating new marine magnetic bacteria and better comprehension of magnetotactic bacteria. In this study, an aerobic magnetotactic bacterium YSC-1 was isolated from sediments in the Yellow Sea Cold Water Mass (YSCWM). In TEM, magnetic cells have one or several circular magnetosomes in diameter of 100nm, and consist of Fe and Co shown on energy dispersive X-ray spectrum. The biological and physiological characteristics of this bacterium were also described. The colour of YSC-1 colony is white in small rod. The gram stain is negative. Results showed that Strain YSC-1 differs from microaerophile magnetotactic bacteria MS-1 and WD-1 in biology.
Polysaccharide degradation systems of the saprophytic bacterium Cellvibrio japonicus
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gardner, Jeffrey G.
Study of recalcitrant polysaccharide degradation by bacterial systems is critical for understanding biological processes such as global carbon cycling, nutritional contributions of the human gut microbiome, and the production of renewable fuels and chemicals. One bacterium that has a robust ability to degrade polysaccharides is the Gram-negative saprophyte Cellvibrio japonicus. A bacterium with a circuitous history, C. japonicus underwent several taxonomy changes from an initially described Pseudomonas sp. Most of the enzymes described in the pre-genomics era have also been renamed. Furthermore, this review aims to consolidate the biochemical, structural, and genetic data published on C. japonicus and its remarkablemore » ability to degrade cellulose, xylan, and pectin substrates. Initially, C. japonicus carbohydrate-active enzymes were studied biochemically and structurally for their novel polysaccharide binding and degradation characteristics, while more recent systems biology approaches have begun to unravel the complex regulation required for lignocellulose degradation in an environmental context. Also included is a discussion for the future of C. japonicus as a model system, with emphasis on current areas unexplored in terms of polysaccharide degradation and emerging directions for C. japonicus in both environmental and biotechnological applications.« less
Polysaccharide degradation systems of the saprophytic bacterium Cellvibrio japonicus
Gardner, Jeffrey G.
2016-06-04
Study of recalcitrant polysaccharide degradation by bacterial systems is critical for understanding biological processes such as global carbon cycling, nutritional contributions of the human gut microbiome, and the production of renewable fuels and chemicals. One bacterium that has a robust ability to degrade polysaccharides is the Gram-negative saprophyte Cellvibrio japonicus. A bacterium with a circuitous history, C. japonicus underwent several taxonomy changes from an initially described Pseudomonas sp. Most of the enzymes described in the pre-genomics era have also been renamed. Furthermore, this review aims to consolidate the biochemical, structural, and genetic data published on C. japonicus and its remarkablemore » ability to degrade cellulose, xylan, and pectin substrates. Initially, C. japonicus carbohydrate-active enzymes were studied biochemically and structurally for their novel polysaccharide binding and degradation characteristics, while more recent systems biology approaches have begun to unravel the complex regulation required for lignocellulose degradation in an environmental context. Also included is a discussion for the future of C. japonicus as a model system, with emphasis on current areas unexplored in terms of polysaccharide degradation and emerging directions for C. japonicus in both environmental and biotechnological applications.« less
Biodegradation of polyethylene by the thermophilic bacterium Brevibacillus borstelensis.
Hadad, D; Geresh, S; Sivan, A
2005-01-01
To select a polyethylene-degrading micro-organism and to study the factors affecting its biodegrading activity. A thermophilic bacterium Brevibaccillus borstelensis strain 707 (isolated from soil) utilized branched low-density polyethylene as the sole carbon source and degraded it. Incubation of polyethylene with B. borstelensis (30 days, 50 degrees C) reduced its gravimetric and molecular weights by 11 and 30% respectively. Brevibaccillus borstelensis also degraded polyethylene in the presence of mannitol. Biodegradation of u.v. photo-oxidized polyethylene increased with increasing irradiation time. Fourier Transform Infra-Red (FTIR) analysis of photo-oxidized polyethylene revealed a reduction in carbonyl groups after incubation with the bacteria. This study demonstrates that polyethylene--considered to be inert--can be biodegraded if the right microbial strain is isolated. Enrichment culture methods were effective for isolating a thermophilic bacterium capable of utilizing polyethylene as the sole carbon and energy source. Maximal biodegradation was obtained in combination with photo-oxidation, which showed that carbonyl residues formed by photo-oxidation play a role in biodegradation. Brevibaccillus borstelensis also degraded the CH2 backbone of nonirradiated polyethylene. Biodegradation of polyethylene by a single bacterial strain contributes to our understanding of the process and the factors affecting polyethylene biodegradation.
Aerobic Reduction of Arsenate by a Bacterium Isolated From Activated Sludge
NASA Astrophysics Data System (ADS)
Kozai, N.; Ohnuki, T.; Hanada, S.; Nakamura, K.; Francis, A. J.
2006-12-01
Microlunatus phosphovorus strain NM-1 is a polyphosphate-accumulating bacterium isolated from activated sludge. This bacterium takes up a large amount of polyphosphate under aerobic conditions and release phosphate ions by hydrolysis of polyphosphate to orthophosphate under anaerobic conditions to derive energy for taking up substrates. To understand the nature of this strain, especially, influence of potential contaminants in sewage and wastewater on growth, we have been investigating behavior of this bacterium in media containing arsenic. The present paper mainly reports reduction of arsenate by this bacterium under aerobic conditions. The strain NM-1 (JCM 9379) was aerobically cultured at 30 °C in a nutrient medium containing 2.5 g/l peptone, 0.5 g/l glucose, 1.5 g/l yeast extract, and arsenic [Na2HAsO4 (As(V)) or Na3AsO3 (As(III))] at concentrations between 0 and 50 mM. The cells collected from arsenic-free media were dispersed in buffer solutions containing 2mM HEPES, 10mM NaCl, prescribed concentrations of As(V), and 0-0.2 percent glucose. Then, this cell suspension was kept at 20 °C under aerobic or anaerobic conditions. The speciation of arsenic was carried out by ion chromatography and ICP-MS. The growth of the strain under aerobic conditions was enhanced by the addition of As(V) at the concentration between 1 and 10 mM. The maximum optical density of the culture in the medium containing 5mM As(V) was 1.4 times greater than that of the control culture. Below the As(V) concentration of 10mM, most of the As(V) was reduced to As(III). The growth of the strain under anaerobic conditions has not been observed so far. The cells in the buffer solutions reduced As(V) under aerobic condition. The reduction was enhanced by the addition of glucose. However, the cell did not reduce As(V) under anaerobic conditions. The strain NM-1 showed high resistance to As(V) and As(III). The maximum optical density of the culture grown in a medium containing 50 mM As(V) was only
Thermostable purified endoglucanase from thermophilic bacterium acidothermus cellulolyticus
Tucker, Melvin P.; Grohmann, Karel; Himmel, Michael E.; Mohagheghi, Ali
1992-01-01
A substantially purified high molecular weight cellulase enzyme having a molecular weight of between about 156,000 to about 203,400 daltons isolated from the bacterium Acidothermus cellulolyticus (ATCC 43068) and a method of producing it are disclosed. The enzyme is water soluble, possesses both C.sub.1 and C.sub.x types of enzymatic activity, has a high degree of stability toward heat and exhibits both a high optimum temperature activity and high inactivation characteristics.
Genome sequence of the algicidal bacterium Kordia algicida OT-1.
Lee, Hyun Sook; Kang, Sung Gyun; Kwon, Kae Kyoung; Lee, Jung-Hyun; Kim, Sang-Jin
2011-08-01
Kordia algicida OT-1 is an algicidal bacterium against the bloom-forming microalgae. The genome sequence of K. algicida revealed a number of interesting features, including the degradation of macromolecules, the biosynthesis of carotenoid pigment and secondary metabolites, and the capacity for gliding motility, which might facilitate the understanding of algicidal mechanisms.
Wang, Zhiping; Guo, Feng; Liu, Lili; Zhang, Tong
2014-01-01
Autotrophic CO2 fixation is the most important biotransformation process in the biosphere. Research focusing on the diversity and distribution of relevant autotrophs is significant to our comprehension of the biosphere. In this study, a draft genome of a bacterium from candidate phylum SBR1093 was reconstructed with the metagenome of an industrial activated sludge. Based on comparative genomics, this autotrophy may occur via a newly discovered carbon fixation path, the hydroxypropionate-hydroxybutyrate (HPHB) cycle, which was demonstrated in a previous work to be uniquely possessed by some genera from Archaea. This bacterium possesses all of the thirteen enzymes required for the HPHB cycle; these enzymes share 30∼50% identity with those in the autotrophic species of Archaea that undergo the HPHB cycle and 30∼80% identity with the corresponding enzymes of the mixotrophic species within Bradyrhizobiaceae. Thus, this bacterium might have an autotrophic growth mode in certain conditions. A phylogenetic analysis based on the 16S rRNA gene reveals that the phylotypes within candidate phylum SBR1093 are primarily clustered into 5 clades with a shallow branching pattern. This bacterium is clustered with phylotypes from organically contaminated environments, implying a demand for organics in heterotrophic metabolism. Considering the types of regulators, such as FnR, Fur, and ArsR, this bacterium might be a facultative aerobic mixotroph with potential multi-antibiotic and heavy metal resistances. This is the first report on Bacteria that may perform potential carbon fixation via the HPHB cycle, thus may expand our knowledge of the distribution and importance of the HPHB cycle in the biosphere.
Chantigian, Daniel P.; Thoden, James B.; Holden, Hazel M.
2014-01-01
Unusual N-acetylated sugars have been observed on the O-antigens of some Gram-negative bacteria and on the S-layers of both Gram-positive and Gram-negative bacteria. One such sugar is 3-acetamido-3,6-dideoxy-α-d-galactose or Fuc3NAc. The pathway for its production requires five enzymes with the first step involving the attachment of dTMP to glucose-1-phosphate. Here we report a structural and biochemical characterization of a bifunctional enzyme from Shewanella denitificans thought to be involved in the biosynthesis of dTDP-Fuc3NAc. On the basis of a bioinformatics analysis, the enzyme, hereafter referred to as FdtD, has been postulated to catalyze the third and fifth steps in the pathway, namely a 3,4-keto isomerization and an N-acetyltransferase reaction. For the X-ray analysis reported here, the enzyme was crystallized in the presence of dTDP and CoA. The crystal structure shows that FdtD adopts a hexameric quaternary structure with 322 symmetry. Each subunit of the hexamer folds into two distinct domains connected by a flexible loop. The N-terminal domain adopts a left-handed β-helix motif and is responsible for the N-acetylation reaction. The C-terminal domain folds into an antiparallel flattened β-barrel that harbors the active site responsible for the isomerization reaction. Biochemical assays verify the two proposed catalytic activities of the enzyme and reveal that the 3,4-keto isomerization event leads to inversion of configuration about the hexose C-4' carbon. PMID:24128043
Characterization of a potentially novel 'blown pack' spoilage bacterium isolated from bovine hide.
Moschonas, G; Bolton, D J
2013-03-01
To characterize a psychrotrophic bacterium, designated TC1, previously isolated from a cattle hide in Ireland, and to investigate the ability of this strain to cause 'blown pack' spoilage (BPS) of vacuum-packaged beef primals. TC1 was characterized using a combination of phenotypic, chemotaxonomic and genotypic analyses and was assessed for its ability to spoil vacuum-packaged beef at refrigerated temperatures. TC1 was Gram-positive and formed elliptical subterminal endospores. The strain was able to grow between 0 and 33 °C, with optimal growth between 23 and 24 °C. TC1 could be differentiated from its phylogenetically closest neighbour (Clostridium lituseburense DSM 797(T)) by 16S rRNA gene sequencing, pulsed-field gel electrophoresis and cellular fatty acid composition. TC1 spoiled (BPS) beef within 42 days when inoculated in cold-stored (1 °C) vacuum-packed beef. The phenotypic, chemotaxonomic and genotypic characterization indicated that TC1 may represent a potentially novel, cold-tolerant, gas-producing bacterium of considerable economic significance to the beef industry. This study reports and characterizes an emerging BPS bacterium, which should be considered in future activities designed to minimize the psychrophilic and psychrotrophic spoilage of vacuum-packaged beef. © 2012 The Society for Applied Microbiology.
The gene transfer agent-like particle of the marine phototrophic bacterium Rhodovulum sulfidophilum.
Nagao, Nobuyoshi; Yamamoto, Junya; Komatsu, Hiroyuki; Suzuki, Hiromichi; Hirose, Yuu; Umekage, So; Ohyama, Takashi; Kikuchi, Yo
2015-12-01
Gene transfer agents (GTAs) are shaped like bacteriophage particles but have many properties that distinguish them from bacteriophages. GTAs play a role in horizontal gene transfer in nature and thus affect the evolution of prokaryotic genomes. In the course of studies on the extracellular production of designed RNAs using the marine bacterium Rhodovulum sulfidophilum , we found that this bacterium produces a GTA-like particle. The particle contains DNA fragments of 4.5 kb, which consist of randomly fragmented genomic DNA from the bacterium. This 4.5-kb DNA production was prevented while quorum sensing was inhibited. Direct observation of the particle by transmission electron microscopy revealed that the particle resembles a tailed phage and has a head diameter of about 40 nm and a tail length of about 60 nm. We also identified the structural genes for the GTA in the genome. Translated amino acid sequences and gene positions are closely related to those of the genes that encode the Rhodobacter capsulatus GTA. This is the first report of a GTA-like particle from the genus Rhodovulum . However, gene transfer activity of this particle has not yet been confirmed. The differences between this particle and other GTAs are discussed.
Chitin Utilization by the Insect-Transmitted Bacterium Xylella fastidiosa▿ †
Killiny, Nabil; Prado, Simone S.; Almeida, Rodrigo P. P.
2010-01-01
Xylella fastidiosa is an insect-borne bacterium that colonizes xylem vessels of a large number of host plants, including several crops of economic importance. Chitin is a polysaccharide present in the cuticle of leafhopper vectors of X. fastidiosa and may serve as a carbon source for this bacterium. Biological assays showed that X. fastidiosa reached larger populations in the presence of chitin. Additionally, chitin induced phenotypic changes in this bacterium, notably increasing adhesiveness. Quantitative PCR assays indicated transcriptional changes in the presence of chitin, and an enzymatic assay demonstrated chitinolytic activity by X. fastidiosa. An ortholog of the chitinase A gene (chiA) was identified in the X. fastidiosa genome. The in silico analysis revealed that the open reading frame of chiA encodes a protein of 351 amino acids with an estimated molecular mass of 40 kDa. chiA is in a locus that consists of genes implicated in polysaccharide degradation. Moreover, this locus was also found in the genomes of closely related bacteria in the genus Xanthomonas, which are plant but not insect associated. X. fastidiosa degraded chitin when grown on a solid chitin-yeast extract-agar medium and grew in liquid medium with chitin as the sole carbon source; ChiA was also determined to be secreted. The gene encoding ChiA was cloned into Escherichia coli, and endochitinase activity was detected in the transformant, showing that the gene is functional and involved in chitin degradation. The results suggest that X. fastidiosa may use its vectors' foregut surface as a carbon source. In addition, chitin may trigger X. fastidiosa's gene regulation and biofilm formation within vectors. Further work is necessary to characterize the role of chitin and its utilization in X. fastidiosa. PMID:20656858
NASA Astrophysics Data System (ADS)
Chistyakova, N. I.; Rusakov, V. S.; Shapkin, A. A.; Zhilina, T. N.; Zavarzina, D. G.; Lančok, A.; Kohout, J.
2010-07-01
Anaerobic alkaliphilic bacterium of Geoalkalibacter ferrihydriticus type (strain Z-0531), isolated from a bottom sediment sample from the weakly mineralized soda Lake Khadyn, have been analyzed. The strain uses the amorphous Fe(III)-hydroxide (AFH) as an electron acceptor and acetate CH3COO- as an electron donor. Mössbauer investigations of solid phase samples obtained during the process of the bacterium growth were carried out at room temperature, 77.8 K, 4.2 K without and with the presence of an external magnetic field (6 T) applied perpendicular to the γ-bebam.
Yi, Yue; Xie, Beizhen; Zhao, Ting; Liu, Hong
2018-06-13
Microbial fuel cell based biosensors (MFC-biosensors) utilize anode biofilms as biological recognition elements to monitor biochemical oxygen demand (BOD) and biotoxicity. However, the relatively poor sensitivity constrains the application of MFC-biosensors. To address this limitation, this study provided a systematic comparison of sensitivity between the MFC-biosensors constructed with two inocula. Higher biomass density and viability were both observed in the anode biofilm of the mixed culture MFC, which resulted in better sensitivity for BOD assessment. Compared with using mixed culture as inoculum, the anode biofilm developed with Shewanella loihica PV-4 presented lower content of extracellular polymeric substances and poorer ability to secrete protein under toxic shocks. Moreover, the looser structure in the S. loihica PV-4 biofilm further facilitated its susceptibilities to toxic agents. Therefore, the MFC-biosensor with a pure culture of S. loihica PV-4 delivered higher sensitivity for biotoxicity monitoring. This study proposed a new perspective to enhance sensor performance. Copyright © 2018 Elsevier Ltd. All rights reserved.
Mitra, Sayani; Gachhui, Ratan; Mukherjee, Joydeep
2015-01-01
A direct relationship between biofilm formation and melanogenesis in Shewanella colwelliana with increased oyster recruitment is already established. Previously, S. colwelliana was grown in a newly patented biofilm-cultivation device, the conico-cylindrical flask (CCF), offering interchangeable hydrophobic/hydrophilic surfaces. Melanization was enhanced when S. colwelliana was cultivated in a hydrophobic vessel compared with a hydrophilic vessel. In the present study, melanogenesis in the CCF was positively correlated with increased architectural parameters of the biofilm (mean thickness and biovolume obtained by confocal laser scanning microscopy) and melanin gene (melA) expression observed by densitometry. Niche intertidal conditions were mimicked in a process operated in an ultra-low-speed rotating disk bioreactor, which demonstrated enhanced biofilm formation, melanogenesis, exopolysaccharide synthesis and melA gene expression compared with a process where 12-h periodic immersion and emersion was prevented. The wettability properties of the settling plane as well as intermittent wetting and drying, which influenced biofilm formation and melA expression, may affect oyster settlement in nature.
Stilwell, Matthew D; Cao, Mengyi; Goodrich-Blair, Heidi; Weibel, Douglas B
2018-01-01
Animal-microbe symbioses are ubiquitous in nature and scientifically important in diverse areas, including ecology, medicine, and agriculture. Steinernema nematodes and Xenorhabdus bacteria compose an established, successful model system for investigating microbial pathogenesis and mutualism. The bacterium Xenorhabdus nematophila is a species-specific mutualist of insect-infecting Steinernema carpocapsae nematodes. The bacterium colonizes a specialized intestinal pocket within the infective stage of the nematode, which transports the bacteria between insects that are killed and consumed by the pair for reproduction. Current understanding of the interaction between the infective-stage nematode and its bacterial colonizers is based largely on population-level, snapshot time point studies on these organisms. This limitation arises because investigating temporal dynamics of the bacterium within the nematode is impeded by the difficulty of isolating and maintaining individual living nematodes and tracking colonizing bacterial cells over time. To overcome this challenge, we developed a microfluidic system that enables us to spatially isolate and microscopically observe individual, living Steinernema nematodes and monitor the growth and development of the associated X. nematophila bacterial communities-starting from a single cell or a few cells-over weeks. Our data demonstrate, to our knowledge, the first direct, temporal, in vivo visual analysis of a symbiosis system and the application of this system to reveal continuous dynamics of the symbiont population in the living host animal. IMPORTANCE This paper describes an experimental system for directly investigating population dynamics of a symbiotic bacterium, Xenorhabdus nematophila , in its host-the infective stage of the entomopathogenic nematode Steinernema carpocapsae . Tracking individual and groups of bacteria in individual host nematodes over days and weeks yielded insight into dynamic growth and topology changes
Tyrosine sulfation in a Gram-negative bacterium
Han, Sang-Wook; Lee, Sang-Won; Bahar, Ofir; Schwessinger, Benjamin; Robinson, Michelle R.; Shaw, Jared B.; Madsen, James A.; Brodbelt, Jennifer S.; Ronald, Pamela C.
2015-01-01
Tyrosine sulfation, a well-characterized post-translation modification in eukaryotes, has not previously been reported in prokaryotes. Here we demonstrate that the RaxST protein from the Gram-negative bacterium, Xanthomonas oryzae pv. oryzae, is a tyrosine sulfotransferase. We used a newly developed sulfotransferase assay and ultraviolet photodissociation mass spectrometry (UVPD) to demonstrate that RaxST catalyzes sulfation of tyrosine 22 of the Xoo Ax21 (activator of XA21-mediated immunity). These results demonstrate a previously undescribed post-translational modification in a prokaryotic species with implications extending to host immune response and bacterial cell-cell communication system. PMID:23093190
Partial proteome of the corynetoxin-producing Gram-positive bacterium, Rathayibacter toxicus
USDA-ARS?s Scientific Manuscript database
Rathayibacter toxicus is a Gram-positive bacterium that is the causative agent of annual ryegrass toxicity (ARGT), a disease that causes devastating losses in the Australian livestock industry. R. toxicus exhibits a complex life cycle, using the nematode Anguina funesta as a physical vector to carry...
Application of agglomerative clustering for analyzing phylogenetically on bacterium of saliva
NASA Astrophysics Data System (ADS)
Bustamam, A.; Fitria, I.; Umam, K.
2017-07-01
Analyzing population of Streptococcus bacteria is important since these species can cause dental caries, periodontal, halitosis (bad breath) and more problems. This paper will discuss the phylogenetically relation between the bacterium Streptococcus in saliva using a phylogenetic tree of agglomerative clustering methods. Starting with the bacterium Streptococcus DNA sequence obtained from the GenBank, then performed characteristic extraction of DNA sequences. The characteristic extraction result is matrix form, then performed normalization using min-max normalization and calculate genetic distance using Manhattan distance. Agglomerative clustering technique consisting of single linkage, complete linkage and average linkage. In this agglomerative algorithm number of group is started with the number of individual species. The most similar species is grouped until the similarity decreases and then formed a single group. Results of grouping is a phylogenetic tree and branches that join an established level of distance, that the smaller the distance the more the similarity of the larger species implementation is using R, an open source program.
Melanin from the Nitrogen-Fixing Bacterium Azotobacter chroococcum: A Spectroscopic Characterization
Banerjee, Raja
2014-01-01
Melanins, the ubiquitous hetero-polymer pigments found widely dispersed among various life forms, are usually dark brown/black in colour. Although melanins have variety of biological functions, including protection against ultraviolet radiation of sunlight and are used in medicine, cosmetics, extraction of melanin from the animal and plant kingdoms is not an easy task. Using complementary physicochemical techniques (i.e. MALDI-TOF, FTIR absorption and cross-polarization magic angle spinning solid-state 13C NMR), we report here the characterization of melanins extracted from the nitrogen-fixing non-virulent bacterium Azotobacter chroococcum, a safe viable source. Moreover, considering dihydroxyindole moiety as the main constituent, an effort is made to propose the putative molecular structure of the melanin hetero-polymer extracted from the bacterium. Characterization of the melanin obtained from Azotobacter chroococcum would provide an inspiration in extending research activities on these hetero-polymers and their use as protective agent against UV radiation. PMID:24416247
Gkorezis, Panagiotis; Bottos, Eric M; Van Hamme, Jonathan D; Thijs, Sofie; Rineau, Francois; Franzetti, Andrea; Balseiro-Romero, Maria; Weyens, Nele; Vangronsveld, Jaco
2015-12-23
We report here the 4.7-Mb draft genome of Arthrobacter sp. SPG23, a hydrocarbonoclastic Gram-positive bacterium belonging to the Actinobacteria, isolated from diesel-contaminated soil at the Ford Motor Company site in Genk, Belgium. Strain SPG23 is a potent plant growth promoter useful for diesel fuel remediation applications based on plant-bacterium associations. Copyright © 2015 Gkorezis et al.
Gkorezis, Panagiotis; Van Hamme, Jonathan; Bottos, Eric; Thijs, Sofie; Balseiro-Romero, Maria; Monterroso, Carmela; Kidd, Petra Suzan; Rineau, Francois; Weyens, Nele; Sillen, Wouter; Vangronsveld, Jaco
2016-06-23
We report the 4.39 Mb draft genome of Bacillus licheniformis GB2, a hydrocarbonoclastic Gram-positive bacterium of the family Bacillaceae, isolated from diesel-contaminated soil at the Ford Motor Company site in Genk, Belgium. Strain GB2 is an effective plant-growth promoter useful for diesel fuel remediation applications based on plant-bacterium associations. Copyright © 2016 Gkorezis et al.
Zhilina, T N; Zavarzina, D G; Kolganova, T V; Turova, T P; Zavarzin, G A
2005-01-01
From the silty sediments of the Khadyn soda lake (Tuva), a binary sulfidogenic bacterial association capable of syntrophic acetate oxidation at pH 10.0 was isolated. An obligately syntrophic, gram-positive, spore-forming alkaliphilic rod-shaped bacterium performs acetate oxidation in a syntrophic association with a hydrogenotrophic, alkaliphilic sulfate-reducing bacterium; the latter organism was previously isolated and characterized as the new species Desulfonatronum cooperativum. Other sulfate-reducing bacteria of the genera Desulfonatronum and Desulfonatronovibrio can also act as the hydrogenotrophic partner. Apart from acetate, the syntrophic culture can oxidize ethanol, propanol, isopropanol, serine, fructose, and isobutyric acid. Selective amplification of 16S rRNA gene fragments of the acetate-utilizing syntrophic component of the binary culture was performed; it was found to cluster with clones of uncultured gram-positive bacteria within the family Syntrophomonadaceae. The acetate-oxidizing bacterium is thus the first representative of this cluster obtained in a laboratory culture. Based on its phylogenetic position, the new acetate-oxidizing syntrophic bacterium is proposed to be assigned, in a Candidate status, to a new genus and species: "Candidatus Contubernalis alkalaceticum."
USDA-ARS?s Scientific Manuscript database
Bacillus mojavensis is an endophytic bacterium patented for control of fungal diseases in maize and other plants. Culture extracts and filtrates from this bacterium were antagonistic to the pathogenic and mycotoxic fungus Fusarium verticillioides. However, the identity of the inhibitory substance ...
Stress of algicidal substances from a bacterium Exiguobacterium sp. h10 on Microcystis aeruginosa.
Li, Y; Liu, L; Xu, Y; Li, P; Zhang, K; Jiang, X; Zheng, T; Wang, H
2017-01-01
Microcystis aeruginosa is a cyanobacterial bloom-causing species and is considered a serious threat to human health and biological safety. In this study, the algicidal bacterium h10 showed high algicidal effects on M. aeruginosa 7820, and strain h10 was confirmed to belong to the genus Exiguobacterium, for which the name Exiguobacterium sp. h10 is proposed. Algicidal activity and mode analysis revealed that the supernatant, rather than the bacterial cells, was responsible for the algicidal activity, indicating that the algicidal mode of strain h10 is by indirect attack through the production of algicidal substances. Analysis of the algicidal substance characteristics showed a molecular weight of <1000 Da and that algicidal substances exhibit high thermal stability and pH instability, and the characteristic functional groups of the algicidal substance mainly included carbonyl, amino and hydroxyl groups. Under the effects of the algicidal substance, the cellular pigment content was significantly decreased, and the algal cell structure and morphology were seriously damaged. The results indicate that the algicidal bacterium Exiguobacterium sp. h10 could be a potential bio-agent for controlling cyanobacterial blooms of M. aeruginosa. In this study, the effects of algicidal substances from an algicidal bacterium Exiguobacterium sp. h10 on the toxic cyanobacterium, Microcystis aeruginosa 7820, were first investigated. The algicidal mode of action was confirmed as an indirect attack through the production of algicidal substances. The characteristics of the algicidal substance were determined, especially the functional groups analysis that confirmed the algicidal substances were glycolipid mixtures. With the stress of algicidal substances, the algal chlorophyll a synthesis, cell structure and morphology were seriously damaged. This study proved that algicidal bacteria are promising sources of potential cyanobacterial bloom-control, and provided good procedures for the
Wu, Wenguo; Xie, Ronggang; Bai, Linling; Tang, Zuming; Gu, Zhongze
2012-05-01
Microbial Fuel Cells (MFCs) are robust devices capable of taping biological energy, converting pollutants into electricity through renewable biomass. The fabrication of nanostructured electrodes with good bio- and electrochemical activity, play a profound role in promoting power generation of MFCs. Au nanoparticles (AuNPs)-modified Boron-Doped Diamond (BDD) electrodes are fabricated by layer-by-layer (LBL) self-assembly technique and used for the direct electrochemistry of Shewanella loihica PV-4 in an electrochemical cell. Experimental results show that the peak current densities generated on the Au/PAH multilayer-modified BDD electrodes increased from 1.25 to 2.93 microA/cm(-2) as the layer increased from 0 to 6. Different cell morphologies of S. loihica PV-4 were also observed on the electrodes and the highest density of cells was attached on the (Au/PAH)6/BDD electrode with well-formed three-dimensional nanostructure. The electrochemistry of S. loihica PV-4 was enhanced on the (Au/PAH)4/BDD electrode due to the appropriate amount of AuNPsand thickness of PAH layer.
Biodegradation of Ethylene Glycol by a Salt-Requiring Bacterium1
Gonzalez, Carlos F.; Taber, Willard A.; Zeitoun, M. A.
1972-01-01
A gram-negative nonmotile rod which was capable of using 1,2-14C-ethylene glycol as a sole carbon source for growth was isolated from a brine pond, Great Salt Lake, Utah. The bacterium (ATCC 27042) required at least 0.85% NaCl for growth and, although the chloride ion was replaceable by sulfate ion, the sodium ion was not replaceable by potassium ion. The maximal concentration of salt tolerated for growth was approximately 12%. The bacterium was oxidase-negative when N,N-dimethyl-p-phenylenediamine was used and weakly positive when N,N,N′,N′-tetramethyl-p-phenylenediamine was used. It grows on many sugars but does not ferment them, it does not have an exogenous vitamin requirement, and it possesses a guanine plus cytosine ratio of 64.3%. Incorporation of ethylene glycol carbon into cell and respired CO2 was quantitated by use of radioactive ethylene glycol and a force-aerated fermentor. Glucose suppressed ethylene glycol metabolism. Cells grown on ethylene and propylene glycol respired ethylene glycol in a Warburg respirometer more rapidly than cells grown on glucose. Spectrophotometric evidence was obtained for oxidation of glycolate to glyoxylate by a dialyzed cell extract. PMID:4568254
Chromatin organization and radio resistance in the bacterium Gemmata obscuriglobus.
Lieber, Arnon; Leis, Andrew; Kushmaro, Ariel; Minsky, Abraham; Medalia, Ohad
2009-03-01
The organization of chromatin has a major impact on cellular activities, such as gene expression. For bacteria, it was suggested that the spatial organization of the genetic material correlates with transcriptional levels, implying a specific architecture of the chromosome within the cytoplasm. Accordingly, recent technological advances have emphasized the organization of the genetic material within nucleoid structures. Gemmata obscuriglobus, a member of the phylum Planctomycetes, exhibits a distinctive nucleoid structure in which chromatin is encapsulated within a discrete membrane-bound compartment. Here, we show that this soil and freshwater bacterium tolerates high doses of UV and ionizing radiation. Cryoelectron tomography of frozen hydrated sections and electron microscopy of freeze-substituted cells have indicated a more highly ordered condensed-chromatin organization in actively dividing and stationary-phase G. obscuriglobus cells. These three-dimensional analyses revealed a complex network of double membranes that engulf the condensed DNA. Bioinformatics analysis has revealed the existence of a putative component involved in nonhomologous DNA end joining that presumably plays a role in maintaining chromatin integrity within the bacterium. Thus, our observations further support the notion that packed chromatin organization enhances radiation tolerance.
Isolation of a New Polysaccharide-Digesting Bacterium from a Salt Marsh
Andrykovitch, George; Marx, Irene
1988-01-01
A new marine bacterium that digested a variety of storage and structural polysaccharides, including agar, was isolated. Strain 2-40 is a nonfermentative gram-negative, polarly flagellated rod that sometimes grew as a filamentous helix and secreted a melaninlike pigment. Its characteristics conform to those of no previously described species. PMID:16347602
Shaffer, Justin P.; U'Ren, Jana M.; Gallery, Rachel E.; Baltrus, David A.; Arnold, A. Elizabeth
2017-01-01
Bacterial endosymbionts occur in diverse fungi, including members of many lineages of Ascomycota that inhabit living plants. These endosymbiotic bacteria (endohyphal bacteria, EHB) often can be removed from living fungi by antibiotic treatment, providing an opportunity to assess their effects on functional traits of their fungal hosts. We examined the effects of an endohyphal bacterium (Chitinophaga sp., Bacteroidetes) on substrate use by its host, a seed-associated strain of the fungus Fusarium keratoplasticum, by comparing growth between naturally infected and cured fungal strains across 95 carbon sources with a Biolog® phenotypic microarray. Across the majority of substrates (62%), the strain harboring the bacterium significantly outperformed the cured strain as measured by respiration and hyphal density. These substrates included many that are important for plant- and seed-fungus interactions, such as D-trehalose, myo-inositol, and sucrose, highlighting the potential influence of EHB on the breadth and efficiency of substrate use by an important Fusarium species. Cases in which the cured strain outperformed the strain harboring the bacterium were observed in only 5% of substrates. We propose that additive or synergistic substrate use by the fungus-bacterium pair enhances fungal growth in this association. More generally, alteration of the breadth or efficiency of substrate use by dispensable EHB may change fungal niches in short timeframes, potentially shaping fungal ecology and the outcomes of fungal-host interactions. PMID:28382021
Tamura, Motoi; Hori, Sachiko; Nakagawa, Hiroyuki; Yamauchi, Satoshi; Sugahara, Takuya
2016-07-01
Equol is a metabolite of daidzein that is produced by intestinal microbiota. The oestrogenic activity of equol is stronger than daidzein. Equol-producing bacteria are believed to play an important role in the gut. The rod-shaped and Gram-positive anaerobic equol-producing intestinal bacterium Slackia TM-30 was isolated from healthy human faeces and its effects on urinary phyto-oestrogen, plasma and faecal lipids were assessed in adult mice. The urinary amounts of equol in urine were significantly higher in mice receiving the equol-producing bacterium TM-30 (BAC) group than in the control (CO) group (P < 0.05). However, no significant differences were observed between the urinary amounts of daidzein, dihydrodaidzein, enterodiol, and enterolactone between the BAC and CO groups. No significant differences in the plasma lipids were observed between the two groups. The lipid content (% dry weight) in the faeces sampled on the final day of the experiment tended to be higher in the BAC group than in the CO group (P = 0.07). Administration of equol-producing bacterium TM-30 affected the urinary amounts of phyto-oestrogens and the faecal lipid contents of mice. The equol-producing bacterium TM-30 likely influences the metabolism of phyto-oestrogen via changes in the gastrointestinal environment. © 2015 Society of Chemical Industry. © 2015 Society of Chemical Industry.
Huang, Yao-Ting; Cheng, Jan-Fang; Chen, Shi-Yu; Hong, Yu-Kai; Wu, Zong-Yen; Liu, Po-Yu
2018-06-19
Shewanella algae is an environmental marine bacteria and an emerging opportunistic human pathogen. Moreover, there are increasing reports of strains showing multi-drug resistance, particularly carbapenem-resistant isolates. Although S. algae have been found in bivalve shellfish aquaculture, there is very little genome-wide data on resistant determinants in S. algae from shellfish. In the study, we aimed to determine the whole genome sequence of carbapenem-resistant S. algae strain AC isolated from small abalone in Taiwan. Genome DNA was sequenced using an Illumina MiSeq platform using 250bp paired-end reads. De novo genome assembly was performed using Velvet v1.2.07. The whole genome was annotated and several candidate genes for antimicrobial resistance were identified. The genome size was calculated at 4,751,156bp, with a mean G+C content of 53.09%. A total of 4,164 protein-coding sequences, 7 rRNAs, 85 tRNAs, and 5 non-coding RNAs were identified. The genome contains genes associated with resistance to β-lactams, trimethoprim, tetracycline, colistin, and quinolone resistance. Multiple efflux pump genes were also detected. Small abalone is a potential source of foodborne drug resistant S. algae. The genome sequence of a carbapenem-resistant S. algae strain AC isolated from small abalone will provide valuable information for further study of the dissemination of resistance genes at the human-animal interface. Copyright © 2018. Published by Elsevier Ltd.
Halobacterium saccharovorum sp. nov., a carbohydrate-metabolizing, extremely halophilic bacterium
NASA Technical Reports Server (NTRS)
Tomlinson, G. A.; Hochstein, L. I.
1976-01-01
The previously described extremely halophilic bacterium, strain M6, metabolizes a variety of carbohydrates with the production of acid. In addition, the organism produces nitrite (but no gas) from nitrate, is motile, and grows most rapidly at about 50 C. These characteristics distinguish it from all previously described halophilic bacteria in the genus Halobacterium. It is suggested that it be designated as a new species, Halobacterium saccharovorum.
Draft genome sequence of a strictly anaerobic dichloromethane-degrading bacterium
Kleindienst, Sara; Higgins, Steven A.; Tsementzi, Despina; ...
2016-03-03
Here, an anaerobic, dichloromethane-degrading bacterium affiliated with novel Peptococcaceae was maintained in a microbial consortium. The organism originated from pristine freshwater sediment collected from Rio Mameyes in Luquillo, Puerto Rico, in October 2009 (latitude 18°21'43.9", longitude –65°46'8.4"). The draft genome sequence is 2.1 Mb and has a G+C content of 43.5%.
Genome Sequence of the Algicidal Bacterium Kordia algicida OT-1 ▿
Lee, Hyun Sook; Kang, Sung Gyun; Kwon, Kae Kyoung; Lee, Jung-Hyun; Kim, Sang-Jin
2011-01-01
Kordia algicida OT-1 is an algicidal bacterium against the bloom-forming microalgae. The genome sequence of K. algicida revealed a number of interesting features, including the degradation of macromolecules, the biosynthesis of carotenoid pigment and secondary metabolites, and the capacity for gliding motility, which might facilitate the understanding of algicidal mechanisms. PMID:21622754
Physiological characterization of strain DCB-1, a unique dehalogenating sulfidogenic bacterium.
Stevens, T O; Linkfield, T G; Tiedje, J M
1988-01-01
Strain DCB-1 is an obligately anaerobic bacterium which carries out the reductive dehalogenation of halobenzoates and was previously known to grow only on pyruvate plus 20% ruminal fluid. When various electron acceptors were supplied, thiosulfate and sulfite were found to stimulate growth. Sulfide was produced from thiosulfate. Cytochrome c and desulfoviridin were detected. The mol% G+C was 49 (at the thermal denaturation temperature). Of 55 carbon sources tested, only pyruvate supported growth as the sole carbon source in mineral medium. Lactate, acetate, L- and D-malate, glycerol, and L- and D-arabinose stimulated growth when supplemented with 10% ruminal fluid and 20 mM thiosulfate. In mineral medium, pyruvate was converted to acetate and lactate, with small amounts of succinate and fumarate accumulating transiently. During growth with thiosulfate, all of these products accumulated transiently. Addition of excess hydrogen to pyruvate-grown cultures resulted in diversion of carbon to formate, lactate, and butyrate, which caused a decrease in cell yield. We conclude that strain DCB-1 is a new type of sulfidogenic bacterium. PMID:3223760
A novel marine bacterium algicidal to the toxic dinoflagellate Alexandrium tamarense.
Wang, B X; Zhou, Y Y; Bai, S J; Su, J Q; Tian, Y; Zheng, T L; Yang, X R
2010-11-01
This work is aiming at investigating algicidal characterization of a bacterium isolate DHQ25 against harmful alga Alexandrium tamarense. 16S rDNA sequence analysis showed that the most probable affiliation of DHQ25 belongs to the γ-proteobacteria subclass and the genus Vibrio. Bacterial isolate DHQ25 showed algicidal activity through an indirect attack. Xenic culture of A. tamarense was susceptible to the culture filtrate of DHQ25 by algicidal activity assay. Algicidal process demonstrated that the alga cell lysed and cellular substances released under the visual field of microscope. DHQ25 was a challenge controller of A. tamarense by the above characterizations of algicidal activity assay and algicidal process. Interactions between bacteria and harmful algal bloom (HAB) species proved to be an important factor regulating the population of these algae. This is the first report of a Vibrio sp. bacterium algicidal to the toxic dinoflagellate A. tamarense. The findings increase our knowledge of the role of bacteria in algal-bacterial interaction. © 2010 The Authors. © 2010 The Society for Applied Microbiology.
Epifanio, Monica; Inguva, Saikumar; Kitching, Michael; Mosnier, Jean-Paul; Marsili, Enrico
2015-12-01
The attachment of electrochemically active microorganisms (EAM) on an electrode is determined by both the chemistry and topography of the electrode surface. Pre-treatment of the electrode surface by atmospheric air plasma introduces hydrophilic functional groups, thereby increasing cell attachment and electroactivity in short-term experiments. In this study, we use graphite and carbon felt electrodes to grow the model EAM Shewanella loihica PV-4 at oxidative potential (0.2 V vs. Ag/AgCl). Cell attachment and electroactivity are measured through electrodynamic methods. Atmospheric air plasma pre-treatment increases cell attachment and current output at graphite electrodes by 25%, while it improves the electroactivity of the carbon felt electrodes by 450%. Air plasma pre-treatment decreased the coulombic efficiency on both carbon felt and graphite electrodes by 60% and 80%, respectively. Microbially produced flavins adsorb preferentially at the graphite electrode, and air plasma pre-treatment results in lower flavin adsorption at both graphite and carbon felt electrodes. Results show that air plasma pre-treatment is a feasible option to increase current output in bioelectrochemical systems. Copyright © 2015 Elsevier B.V. All rights reserved.
Draft Genome Sequence of the Algicidal Bacterium Mangrovimonas yunxiaonensis Strain LY01
Li, Yi; Zhu, Hong; Li, Chongping; Zhang, Huajun; Chen, Zhangran; Zheng, Wei
2014-01-01
Mangrovimonas yunxiaonensis LY01, a novel bacterium isolated from mangrove sediment, showed high algicidal effects on harmful algal blooms of Alexandrium tamarense. Here, we present the first draft genome sequence of this strain to further understanding of the functional genes related to algicidal activity. PMID:25428978
USDA-ARS?s Scientific Manuscript database
Background: R. peoriensis was characterized in our laboratories from swine manure and feces as a Gram-positive, anaerobic bacterium. Since then strains of this species have been identified from a variety of mammalian and other gastrointestinal (GI) tracts, suggesting it is a member of the commensal ...
Mann, Rajinder S.; Pelz-Stelinski, Kirsten; Hermann, Sara L.; Tiwari, Siddharth; Stelinski, Lukasz L.
2011-01-01
Candidatus Liberibacter asiaticus is a fastidious, phloem-inhabiting, gram-negative bacterium transmitted by Asian citrus psyllid, Diaphorina citri Kuwayama (Hemiptera: Psyllidae). The bacterium is the presumed causal agent of huanglongbing (HLB), one of the most destructive and economically important diseases of citrus. We investigated whether Las is transmitted between infected and uninfected D. citri adults during courtship. Our results indicate that Las was sexually transmitted from Las-infected male D. citri to uninfected females at a low rate (<4%) during mating. Sexual transmission was not observed following mating of infected females and uninfected males or among adult pairs of the same sex. Las was detected in genitalia of both sexes and also in eggs of infected females. A latent period of 7 days or more was required to detect the bacterium in recipient females. Rod shaped as well as spherical structures resembling Las were observed in ovaries of Las-infected females with transmission electron microscopy, but were absent in ovaries from uninfected D. citri females. The size of the rod shaped structures varied from 0.39 to 0.67 µm in length and 0.19 to 0.39 µm in width. The spherical structures measured from 0.61 to 0.80 µm in diameter. This investigation provides convincing evidence that a plant pathogenic bacterium is sexually transmitted from male to female insects during courtship and established evidence that bacteria persist in reproductive organs. Moreover, these findings provide an alternative sexually horizontal mechanism for the spread of Las within populations of D. citri, even in the absence of infected host trees. PMID:22216209
Isolation and Characterization of a Novel, Highly Selective Astaxanthin-Producing Marine Bacterium.
Asker, Dalal
2017-10-18
A high-throughput screening approach for astaxanthin-producing bacteria led to the discovery of a novel, highly selective astaxanthin-producing marine bacterium (strain N-5). Phylogenetic analysis based on partial 16S rRNA gene and phenotypic metabolic testing indicated it belongs to the genus Brevundimonas. Therefore, it was designated as Brevundimonas sp. strain N-5. To identify and quantify carotenoids produced by strain N-5, HPLC-DAD and HPLC-MS methods were used. The culture conditions including media, shaking, and time had significant effects on cell growth and carotenoids production including astaxanthin. The total carotenoids were ∼601.2 μg g -1 dry cells including a remarkable amount (364.6 μg g -1 dry cells) of optically pure astaxanthin (3S, 3'S) isomer, with high selectivity (∼60.6%) under medium aeration conditions. Notably, increasing the culture aeration enhanced astaxanthin production up to 85% of total carotenoids. This is the first report that describes a natural, highly selective astaxanthin-producing marine bacterium.
IN SITU RT-PCR WITH A SULFATE-REDUCING BACTERIUM ISOLATED FROM SEAGRASS ROOTS
Bacteria considered to be obligate anaerobes internally colonize roots of the submerged macrophyte Halodule wrightii. A sulfate reducing bacterium, Summer lac 1, was isolated on lactate from H. wrightii roots. The isolate has physiological characteristics typical of Desulfovibri...
The chemical formula of a magnetotactic bacterium.
Naresh, Mohit; Das, Sayoni; Mishra, Prashant; Mittal, Aditya
2012-05-01
Elucidation of the chemical logic of life is one of the grand challenges in biology, and essential to the progress of the upcoming field of synthetic biology. Treatment of microbial cells explicitly as a "chemical" species in controlled reaction (growth) environments has allowed fascinating discoveries of elemental formulae of a few species that have guided the modern views on compositions of a living cell. Application of mass and energy balances on living cells has proved to be useful in modeling of bioengineering systems, particularly in deriving optimized media compositions for growing microorganisms to maximize yields of desired bio-derived products by regulating intra-cellular metabolic networks. In this work, application of elemental mass balance during growth of Magnetospirillum gryphiswaldense in bioreactors has resulted in the discovery of the chemical formula of the magnetotactic bacterium. By developing a stoichiometric equation characterizing the formation of a magnetotactic bacterial cell, coupled with rigorous experimental measurements and robust calculations, we report the elemental formula of M. gryphiswaldense cell as CH(2.06)O(0.13)N(0.28)Fe(1.74×10(-3)). Remarkably, we find that iron metabolism during growth of this magnetotactic bacterium is much more correlated individually with carbon and nitrogen, compared to carbon and nitrogen with each other, indicating that iron serves more as a nutrient during bacterial growth rather than just a mineral. Magnetotactic bacteria have not only invoked some interest in the field of astrobiology for the last two decades, but are also prokaryotes having the unique ability of synthesizing membrane bound intracellular organelles. Our findings on these unique prokaryotes are a strong addition to the limited repertoire, of elemental compositions of living cells, aimed at exploring the chemical logic of life. Copyright © 2011 Wiley Periodicals, Inc.
Five new amicoumacins isolated from a marine-derived bacterium Bacillus subtilis.
Li, Yongxin; Xu, Ying; Liu, Lingli; Han, Zhuang; Lai, Pok Yui; Guo, Xiangrong; Zhang, Xixiang; Lin, Wenhan; Qian, Pei-Yuan
2012-02-01
Four novel amicoumacins, namely lipoamicoumacins A-D (1-4), and one new bacilosarcin analog (5) were isolated from culture broth of a marine-derived bacterium Bacillus subtilis, together with six known amicoumacins. Their structures were elucidated on the basis of extensive spectroscopic (2D NNR, IR, CD and MS) analysis and in comparison with data in literature.
Ogata, Yuka; Yahara, Tatsuya; Yokoyama, Takashi; Ishizawa, Hidehiro; Takada, Kazuki; Inoue, Daisuke; Sei, Kazunari
2017-01-01
ABSTRACT Sphingobium fuliginis OMI is a bacterium that can degrade a variety of recalcitrant alkylphenols and bisphenols. This study reports the draft genome sequence of S. fuliginis OMI. PMID:29167253
Van der Heiden, Edwige; Delmarcelle, Michaël; Lebrun, Sarah; Freichels, Régine; Brans, Alain; Vastenavond, Christian M; Galleni, Moreno; Joris, Bernard
2013-06-01
We report the first identification of a gene cluster involved in d-tagatose catabolism in Bacillus licheniformis. The pathway is closely related to the d-tagatose pathway of the Gram-negative bacterium Klebsiella oxytoca, in contrast to the d-tagatose 6-phosphate pathway described in the Gram-positive bacterium Staphylococcus aureus.
Magnetic guidance of the magnetotactic bacterium Magnetospirillum gryphiswaldense.
Loehr, Johannes; Pfeiffer, Daniel; Schüler, Dirk; Fischer, Thomas M
2016-04-21
Magnetospirillum gryphiswaldense is a magnetotactic bacterium with a permanent magnetic moment capable of swimming using two bipolarly located flagella. In their natural environment these bacteria swim along the field lines of the homogeneous geomagnetic field in a typical run and reversal pattern and thereby create non-differentiable trajectories with sharp edges. In the current work we nevertheless achieve stable guidance along curved lines of mechanical instability by using a heterogeneous magnetic field of a garnet film. The successful guidance of the bacteria depends on the right balance between motility and the magnetic moment of the magnetosome chain.
Gasper, Nancy A.; Petty, Cynthia C.; Schrum, Laura W.; Marriott, Ian; Bost, Kenneth L.
2002-01-01
Two common pathogens known to cause bone infection, Salmonella and Staphylococcus aureus, were investigated to determine their abilities to induce chemokine expression in cultured mouse and human osteoblasts. While these cells are responsible for bone formation, we were surprised to find that they could respond to bacterial infection by upregulating expression of the chemokine CXCL10 (IP-10). However, there were significant differences in the abilities of the gram-negative bacterium Salmonella and the gram-positive bacterium S. aureus to induce expression of CXCL10. Reverse transcription-PCR and enzyme-linked immunosorbent assay analyses showed high levels of Salmonella-induced CXCL10 mRNA and protein expression, respectively, whereas the osteoblast response to S. aureus was significantly less. Consistent with these findings, Salmonella-derived lipopolysaccharide (LPS), but not S. aureus-derived peptidoglycan, could induce expression of CXCL10. An antibody against toll-like receptor 4 (TLR4) could block the LPS-induced CXCL10 production, demonstrating the functional expression of TLR4 by osteoblasts. Despite the inducible nature of TLR2 mRNA expression by bacterium-infected osteoblasts, peptidoglycan failed to stimulate CXCL10 secretion. Immunofluorescent staining of bacterium-infected calvaria (i.e., skull bone) demonstrated the presence of CXCL10 in osteoblasts. The fact that osteoblasts did not express CXCR3 mRNA, whereas T lymphocytes can express high levels of this receptor, suggests that osteoblast-derived CXCL10 may recruit T lymphocytes to the sites of bone infections. PMID:12117914
Diversity in bacterium-host interactions within the species Helicobacter heilmannii sensu stricto
2013-01-01
Helicobacter (H.) heilmannii sensu stricto (s.s.) is a zoonotic bacterium that naturally colonizes the stomach of dogs and cats. In humans, this microorganism has been associated with gastritis, peptic ulcer disease and mucosa associated lymphoid tissue (MALT) lymphoma. Little information is available about the pathogenesis of H. heilmannii s.s. infections in humans and it is unknown whether differences in virulence exist within this species. Therefore, a Mongolian gerbil model was used to study bacterium-host interactions of 9 H. heilmannii s.s. strains. The colonization ability of the strains, the intensity of gastritis and gene expression of various inflammatory cytokines in the stomach were determined at 9 weeks after experimental infection. The induction of an antrum-dominant chronic active gastritis with formation of lymphocytic aggregates was shown for 7 strains. High-level antral colonization was seen for 4 strains, while colonization of 4 other strains was more restricted and one strain was not detected in the stomach at 9 weeks post infection. All strains inducing a chronic active gastritis caused an up-regulation of the pro-inflammatory cytokine IL-1β in the antrum. A reduced antral expression of H+/K+ ATPase was seen in the stomach after infection with 3 highly colonizing strains and 2 highly colonizing strains caused an increased gastrin expression in the fundus. In none of the H. heilmannii s.s.-infected groups, IFN-γ expression was up-regulated. This study demonstrates diversity in bacterium-host interactions within the species H. heilmannii s.s. and that the pathogenesis of gastric infections with this microorganism is not identical to that of an H. pylori infection. PMID:23895283
Chakraborty, Kajal; Thilakan, Bini; Raola, Vamshi Krishna
2017-10-01
Brown seaweed Anthophycus longifolius (Turner) Kützing (family Sargassaceae) associated heterotrophic bacterium Bacillus subtilis MTCC 10403 was found to be a potent isolate with broad range of antibacterial activity against important perceptive food pathogens Vibrio parahaemolyticus, V. vulnificus, and Aeromonas hydrophila. This bacterium was positive for polyketide synthetase gene (KC589397), and therefore, was selected to bioprospect specialized metabolites bearing polyketide backbone. Bioactivity-guided chromatographic fractionation of the ethyl acetate extract of the seaweed-associated bacterium segregated four homologous polyketide furanoterpenoids with potential antibacterial activities against clinically important pathogens. The minimum inhibitory concentration (MIC) assay showed that the referral antibiotics tetracycline and ampicillin were active at 25 μg/mL against the test pathogens, whereas the previously undescribed (4E)-methyl 13-((16-(furan-2-yl) ethyl)-octahydro-7-hydroxy-4-((E)-23-methylbut-21-enyl)-2H-chromen-6-yl)-4-methylpent-4-enoate (compound 1) and methyl 3-(hexahydro-9-((E)-3-methylpent-1-enyl)-4H-furo[3,2-g]isochromen-6-yl) propanoate (compound 3) displayed antibacterial activities against the test pathogens at a lesser concentration (MIC < 7 μg/mL). The title compounds were characterized by comprehensive nuclear magnetic resonance and mass spectroscopic experiments. Polyketide synthase catalyzed putative biosynthetic mechanism additionally corroborated the structural ascriptions of the hitherto undescribed furanoterpenoids from seaweed-associated bacterial symbiont. The electronic and hydrophobic parameters appeared to hold a conspicuous part in directing the antibacterial properties of the compounds. Seaweed-associated B. subtilis MTCC 10403 demonstrated to represent a potential source of antimicrobial polyketides for pharmaceutical applications. Copyright © 2017 Elsevier Ltd. All rights reserved.
Lee, Seung Ho; Ban, Ju Yeon; Oh, Chung-Hun; Park, Hun-Kuk; Choi, Samjin
2016-06-23
We present the fabrication of an ultra-low cost, disposable, solvent-free air cathode all-paper microbial fuel cell (MFC) that does not utilize any chemical treatments. The anode and cathode were fabricated by depositing graphite particles by drawing them on paper with a pencil (four strokes). Hydrophobic parchment paper was used as a proton exchange membrane (PEM) to allow only H(+) to pass. Air cathode MFC technology, where O2 was used as an electron acceptor, was implemented on the paper platform. The bioelectric current was generated by an electrochemical process involving the redox couple of microbial-activated extracellular electron transferred electrons, PEM-passed H(+), and O2 in the cathode. A fully micro-integrated pencil-traced MFC showed a fast start-time, producing current within 10 s after injection of bacterial cells. A single miniaturized all-paper air cathode MFC generated a maximum potential of 300 mV and a maximum current of 11 μA during 100 min after a single injection of Shewanella oneidensis. The micro-fabricated solvent-free air cathode all-paper MFC generated a power of 2,270 nW (5.68 mW/m(2)). The proposed solvent-free air cathode paper-based MFC device could be used for environmentally-friendly energy storage as well as in single-use medical power supplies that use organic matter.
Lee, Seung Ho; Ban, Ju Yeon; Oh, Chung-Hun; Park, Hun-Kuk; Choi, Samjin
2016-01-01
We present the fabrication of an ultra-low cost, disposable, solvent-free air cathode all-paper microbial fuel cell (MFC) that does not utilize any chemical treatments. The anode and cathode were fabricated by depositing graphite particles by drawing them on paper with a pencil (four strokes). Hydrophobic parchment paper was used as a proton exchange membrane (PEM) to allow only H+ to pass. Air cathode MFC technology, where O2 was used as an electron acceptor, was implemented on the paper platform. The bioelectric current was generated by an electrochemical process involving the redox couple of microbial-activated extracellular electron transferred electrons, PEM-passed H+, and O2 in the cathode. A fully micro-integrated pencil-traced MFC showed a fast start-time, producing current within 10 s after injection of bacterial cells. A single miniaturized all-paper air cathode MFC generated a maximum potential of 300 mV and a maximum current of 11 μA during 100 min after a single injection of Shewanella oneidensis. The micro-fabricated solvent-free air cathode all-paper MFC generated a power of 2,270 nW (5.68 mW/m2). The proposed solvent-free air cathode paper-based MFC device could be used for environmentally-friendly energy storage as well as in single-use medical power supplies that use organic matter. PMID:27333815
Jacobson, Kurt H.; Gunsolus, Ian L.; Kuech, Thomas R.; ...
2015-07-24
We report that design of nanomedicines and nanoparticle-based antimicrobial and antifouling formulations, and assessment of the potential implications of nanoparticle release into the environment require understanding nanoparticle interaction with bacterial surfaces. Here we demonstrate electrostatically driven association of functionalized nanoparticles with lipopolysaccharides of Gram-negative bacterial outer membranes and find that lipopolysaccharide structure influences the extent and location of binding relative to the lipid-solution interface. By manipulating the lipopolysaccharide content in Shewanella oneidensis outer membranes, we observed electrostatically driven interaction of cationic gold nanoparticles with the lipopolysaccharide-containing leaflet. We probed this interaction by quartz crystal microbalance with dissipation monitoring (QCM-D) andmore » second harmonic generation (SHG) using solid-supported lipopolysaccharide-containing bilayers. Association of cationic nanoparticles increased with lipopolysaccharide content, while no association of anionic nanoparticles was observed. The harmonic-dependence of QCM-D measurements suggested that a population of the cationic nanoparticles was held at a distance from the outer leaflet-solution interface of bilayers containing smooth lipopolysaccharides (those bearing a long O-polysaccharide). Additionally, smooth lipopolysaccharides held the bulk of the associated cationic particles outside of the interfacial zone probed by SHG. Lastly, our results demonstrate that positively charged nanoparticles are more likely to interact with Gram-negative bacteria than are negatively charged particles, and this interaction occurs primarily through lipopolysaccharides.« less
Mellage, Adrian; Smeaton, Christina M; Furman, Alex; Atekwana, Estella A; Rezanezhad, Fereidoun; Van Cappellen, Philippe
2018-02-20
Geophysical techniques, such as spectral induced polarization (SIP), offer potentially powerful approaches for in situ monitoring of subsurface biogeochemistry. The successful implementation of these techniques as monitoring tools for reactive transport phenomena, however, requires the deconvolution of multiple contributions to measured signals. Here, we present SIP spectra and complementary biogeochemical data obtained in saturated columns packed with alternating layers of ferrihydrite-coated and pure quartz sand, and inoculated with Shewanella oneidensis supplemented with lactate and nitrate. A biomass-explicit diffusion-reaction model is fitted to the experimental biogeochemical data. Overall, the results highlight that (1) the temporal response of the measured imaginary conductivity peaks parallels the microbial growth and decay dynamics in the columns, and (2) SIP is sensitive to changes in microbial abundance and cell surface charging properties, even at relatively low cell densities (<10 8 cells mL -1 ). Relaxation times (τ) derived using the Cole-Cole model vary with the dominant electron accepting process, nitrate or ferric iron reduction. The observed range of τ values, 0.012-0.107 s, yields effective polarization diameters in the range 1-3 μm, that is, 2 orders of magnitude smaller than the smallest quartz grains in the columns, suggesting that polarization of the bacterial cells controls the observed chargeability and relaxation dynamics in the experiments.
A miniature microbial fuel cell operating with an aerobic anode chamber
NASA Astrophysics Data System (ADS)
Ringeisen, Bradley R.; Ray, Ricky; Little, Brenda
A miniature microbial fuel cell (mini-MFC) is described that utilizes an aerobic culture of Shewanella oneidensis DSP10 as the active electrochemical species in the anode chamber. We find that the maximum aerobic mini-MFC power without the addition of exogenous mediators was 0.40 mW, a 33% decrease when compared with an anaerobic DSP10 culture (0.6 mW) operating in the mini-MFC. This decrease is most likely due to the presence of dissolved oxygen in the anode chamber that scavenges electrons to form water, thereby reducing the number of electrons donated to the anode. Aerobic power and current density at maximum power using the true surface area of the anode (611 cm 2) were calculated to be 6.5 mW m -2 and 13 mA m -2. The power density rises to 2.0 W m -2 and 330 W m -3 when calculated using the cross-sectional area and volume of the device (2 cm 2, 1.2 cm 3). The Coulombic efficiency was also reduced from 11 to 5% when using the aerobic versus anaerobic culture. Similar results were found when the external mediator anthraquinone-2,6-disulfonate (AQDS) was added to the aerobic culture, resulting in a maximum power of 0.54 mW, a 37% drop in power when compared to the anaerobic mediated system.
In Situ Molecular Imaging of the Biofilm and Its Matrix
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ding, Yuanzhao; Zhou, Yufan; Yao, Juan
2016-11-15
Molecular mapping of live biofilms at submicron resolution presents a grand challenge. Here, we present the first chemical mapping results of biofilm extracellular polymeric sub-stance (EPS) components in biofilms using correlative imaging be-tween super resolution florescence microscopy and liquid time-of-flight secondary ion mass spectrometry (ToF-SIMS). Shewanella oneidensis is used as a model organism. Heavy metal anions chro-mate (Cr2O72-) consisting of chromium Cr (VI) was a model envi-ronmental stressor used to treat the biofilms. Of particular interest, biologically relevant water clusters have been first observed in the biofilms. Characteristic fragments of biofilm matrix components such as proteins, polysaccharides, and lipids canmore » be spatially im-aged. Furthermore, characteristic fatty acids (e.g., palmitic acid), quinolone signal, and riboflavin fragments are found to respond af-ter the biofilm is treated with Cr (VI), leading to biofilm dispersion. Significant changes in water clusters and quorum sensing signals indicative of intercellular communication in the aqueous environ-ment are observed, suggesting that they might result in fatty acid synthesis and inhibit riboflavin production. The Cr (VI) reduction seems to follow the Mtr pathway leading to Cr (III) formation. Our approach potentially opens a new avenue for mechanistic insight of microbial community processes and communications using in situ imaging mass spectrometry and superresolution optical micros-copy.« less
A Decaheme Cytochrome as a Molecular Electron Conduit in Dye-Sensitized Photoanodes
Hwang, Ee Taek; Sheikh, Khizar; Orchard, Katherine L; Hojo, Daisuke; Radu, Valentin; Lee, Chong-Yong; Ainsworth, Emma; Lockwood, Colin; Gross, Manuela A; Adschiri, Tadafumi; Reisner, Erwin; Butt, Julea N; Jeuken, Lars J C
2015-01-01
In nature, charge recombination in light-harvesting reaction centers is minimized by efficient charge separation. Here, it is aimed to mimic this by coupling dye-sensitized TiO2 nanocrystals to a decaheme protein, MtrC from Shewanella oneidensis MR-1, where the 10 hemes of MtrC form a ≈7-nm-long molecular wire between the TiO2 and the underlying electrode. The system is assembled by forming a densely packed MtrC film on an ultra-flat gold electrode, followed by the adsorption of approximately 7 nm TiO2 nanocrystals that are modified with a phosphonated bipyridine Ru(II) dye (RuP). The step-by-step construction of the MtrC/TiO2 system is monitored with (photo)electrochemistry, quartz-crystal microbalance with dissipation (QCM-D), and atomic force microscopy (AFM). Photocurrents are dependent on the redox state of the MtrC, confirming that electrons are transferred from the TiO2 nanocrystals to the surface via the MtrC conduit. In other words, in these TiO2/MtrC hybrid photodiodes, MtrC traps the conduction-band electrons from TiO2 before transferring them to the electrode, creating a photobioelectrochemical system in which a redox protein is used to mimic the efficient charge separation found in biological photosystems. PMID:26180522
Cervini-Silva, Javiera; Kostka, Joel E; Larson, Richard A; Stucki, Joseph W; Wu, Jun
2003-05-01
Reduction of structural Fe(III) in smectite clay minerals has been identified as a means to promote dechlorination of polychlorinated ethanes, but its environmental significance has yet to be fully assessed because Fe reduction has normally been achieved by agents uncommon in the environment (e.g., dithionite). This study reports the dehydrochlorination of pentachloroethane and 1,1,1-trichloroethane in the presence of ferruginous smectite reduced by two cultures of microorganisms, Shewanella oneidensis strain MR-1 (MR-R) and an enrichment culture from rice paddy soils (PS-R), in aqueous suspension under anoxic conditions. Microbially reduced ferruginous smectite facilitated dehydrochlorination of 1,1,1-trichloroethane to 1,1-dichloroethene with up to 60% conversion within 3 h of incubation time. In contrast, no formation of 1,1-dichloroethene was observed after incubation of 1,1,1-trichloroethane with chemically reduced ferruginous smectite for 24 h. Microbially reduced ferruginous smectite by MR-R and PS-R promoted the dehydrochlorination of pentachloroethane to tetrachloroethene by 80 and 15%, respectively, after 3 h of incubation time. The conversion of pentachloroethane to tetrachloroethene in the presence of chemically reduced ferruginous smectite after 24 h was 65%. These results indicate that structural Fe(II) in clay minerals has the potential to be an important reductant controlling the fate of organic chemicals in contaminated sediments.
NASA Astrophysics Data System (ADS)
Lee, Seung Ho; Ban, Ju Yeon; Oh, Chung-Hun; Park, Hun-Kuk; Choi, Samjin
2016-06-01
We present the fabrication of an ultra-low cost, disposable, solvent-free air cathode all-paper microbial fuel cell (MFC) that does not utilize any chemical treatments. The anode and cathode were fabricated by depositing graphite particles by drawing them on paper with a pencil (four strokes). Hydrophobic parchment paper was used as a proton exchange membrane (PEM) to allow only H+ to pass. Air cathode MFC technology, where O2 was used as an electron acceptor, was implemented on the paper platform. The bioelectric current was generated by an electrochemical process involving the redox couple of microbial-activated extracellular electron transferred electrons, PEM-passed H+, and O2 in the cathode. A fully micro-integrated pencil-traced MFC showed a fast start-time, producing current within 10 s after injection of bacterial cells. A single miniaturized all-paper air cathode MFC generated a maximum potential of 300 mV and a maximum current of 11 μA during 100 min after a single injection of Shewanella oneidensis. The micro-fabricated solvent-free air cathode all-paper MFC generated a power of 2,270 nW (5.68 mW/m2). The proposed solvent-free air cathode paper-based MFC device could be used for environmentally-friendly energy storage as well as in single-use medical power supplies that use organic matter.
Yuan, Ying; Tan, Wen-Bing; He, Xiao-Song; Xi, Bei-Dou; Gao, Ru-Tai; Zhang, Hui; Dang, Qiu-Ling; Li, Dan
2016-11-01
Composting is widely used for recycling of kitchen waste to improve soil properties, which is mainly attributed to the nutrient and structural functions of compost-derived humic acids (HAs). However, the redox properties of compost-derived HAs are not fully explored. Here, a unique framework is employed to investigate the electron exchange capacity (EEC) of HAs during kitchen waste composting. Most components of compost-derived HAs hold EEC, but nearly two-thirds of them are found to be easily destroyed by Shewanella oneidensis MR-1 and thus result in an EEC lower than the electron - donating capacity in compost-derived HAs. Fortunately, a refractory component also existed within compost-derived HAs and could serve as a stable and effective electron shuttle to promote the MR-1 involved in Fe(III) reduction, and its EEC was significantly correlated with the aromaticity and the amount of quinones. Nevertheless, with the increase of composting time, the EEC of the refractory component did not show an increasing trend. These results implied that there was an optimal composting time to maximize the production of HAs with more refractory and redox molecules. Recognition of the heterogeneity of EEC of the compost-derived HAs enables an efficient utilization of the composts for a variety of environmental applications. Graphical abstract Microbial reduction of compost-derived HAs.
Van der Heiden, Edwige; Lebrun, Sarah; Freichels, Régine; Brans, Alain; Vastenavond, Christian M.; Galleni, Moreno; Joris, Bernard
2013-01-01
We report the first identification of a gene cluster involved in d-tagatose catabolism in Bacillus licheniformis. The pathway is closely related to the d-tagatose pathway of the Gram-negative bacterium Klebsiella oxytoca, in contrast to the d-tagatose 6-phosphate pathway described in the Gram-positive bacterium Staphylococcus aureus. PMID:23524682
Geovibrio ferrireducens, a phylogenetically distinct dissimilatory Fe(III)-reducing bacterium
Caccavo, F.; Coates, J.D.; Rossello-Mora, R. A.; Ludwig, W.; Schleifer, K.H.; Lovley, D.R.; McInerney, M.J.
1996-01-01
A new, phylogenetically distinct, dissimilatory, Fe(III)-reducing bacterium was isolated from surface sediment of a hydrocarbon-contaminated ditch. The isolate, designated strain PAL-1, was an obligately anaerobic, non-fermentative, motile, gram-negative vibrio. PAL-1 grew in a defined medium with acetate as electron donor and ferric pyrophosphate, ferric oxyhydroxide, ferric citrate, Co(III)-EDTA, or elemental sulfur as sole electron acceptor. PAL-1 also used proline, hydrogen, lactate, propionate, succinate, fumarate, pyruvate, or yeast extract as electron donors for Fe(III) reduction. It is the first bacterium known to couple the oxidation of an amino acid to Fe(III) reduction. PAI-1 did not reduce oxygen, Mn(IV), U(VI), Cr(VI), nitrate, sulfate, sulfite, or thiosulfate with acetate as the electron donor. Cell suspensions of PAL-1 exhibited dithionite-reduced minus air-oxidized difference spectra that were characteristic of c-type cytochromes. Analysis of the 16S rRNA gene sequence of PAL-1 showed that the strain is not related to any of the described metal-reducing bacteria in the Proteobacteria and, together with Flexistipes sinusarabici, forms a separate line of descent within the Bacteria. Phenotypically and phylogenetically, strain PAI-1 differs from all other described bacteria, and represents the type strain of a new genus and species. Geovibrio ferrireducens.
Draft Genome Sequence of the Algicidal Bacterium Mangrovimonas yunxiaonensis Strain LY01.
Li, Yi; Zhu, Hong; Li, Chongping; Zhang, Huajun; Chen, Zhangran; Zheng, Wei; Xu, Hong; Zheng, Tianling
2014-11-26
Mangrovimonas yunxiaonensis LY01, a novel bacterium isolated from mangrove sediment, showed high algicidal effects on harmful algal blooms of Alexandrium tamarense. Here, we present the first draft genome sequence of this strain to further understanding of the functional genes related to algicidal activity. Copyright © 2014 Li et al.
Aerobic mineralization of vinyl chlorides by a bacterium of the order Actinomycetales
DOE Office of Scientific and Technical Information (OSTI.GOV)
Phelps, T.J.; Malachowsky, K.; Schram, R.M.
1991-04-01
A gram-positive branched bacterium isolated from a trichloroethylene-degrading consortium mineralized vinyl chloride in growing cultures and cell suspensions. Greater than 67% of the (1,2-{sup 14}C)vinyl chloride was mineralized to carbon dioxide, with approximately 10% of the radioactivity appearing in {sup 14}C-aqueous-phase products.
Kuroda, Masashi; Ogata, Yuka; Yahara, Tatsuya; Yokoyama, Takashi; Ishizawa, Hidehiro; Takada, Kazuki; Inoue, Daisuke; Sei, Kazunari; Ike, Michihiko
2017-11-22
Sphingobium fuliginis OMI is a bacterium that can degrade a variety of recalcitrant alkylphenols and bisphenols. This study reports the draft genome sequence of S. fuliginis OMI. Copyright © 2017 Kuroda et al.
Mohammed, Haitham H; Peatman, Eric
2018-06-07
Unusual persistent natural mortality occurred in a floating in-pond raceway system intensively stocked with channel and hybrid catfish beginning in early November 2016 up until March 2017. The temperature during the period of outbreak ranged from 7.2 to 23.7°C. Gross examination of freshly dead and moribund fish revealed pale gills, slight abdominal distension and swollen inflamed vents. Comprehensive necropsy of 20 fish demonstrated vast amounts of bloody ascitic fluid in the coelomic cavity, visceral congestion, splenomegaly and pale friable livers but macroscopically normal kidneys, suggesting systemic bacterial infection. Bacterial cultures were initiated from skin, gills and major internal organs. Following incubation, a mixture of three bacterial colony phenotypes was observed on agar plates. Presumptive biochemical characterization of the isolates followed by 16S-rRNA sequence analysis resulted in the identification of Aeromonas veronii, Streptococcus parauberis and Shewanella putrefaciens. Channel catfish juveniles were experimentally infected with the recovered isolates to fulfil Koch's postulates. Moreover, an antibiogram was used to evaluate the susceptibility of the isolates to antimicrobial drugs approved for use in aquaculture. Aquaflor was used successfully for treatment. Here, we report bacterial coinfection lead by A. veronii and the first identification of S. parauberis and S. putrefaciens from cultured catfish in North America. © 2018 John Wiley & Sons Ltd.
Isolation of Bacteriophages of the Marine Bacterium Beneckea natriegens from Coastal Salt Marshes1
Zachary, Arthur
1974-01-01
Bacteriophages of the marine bacterium Beneckea natriegens were isolated from coastal marshes where they were limited to brackish and marine waters. The phages were widely distributed and morphologically diverse in the marshes. Images PMID:4133830
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bhupathiraju, V.K.; Sharma, P.K.; Tanner, R.S.
A strictly anaerobic, moderately halophilic, gram-negative bacterium was isolated from a highly saline oil field brine. The bacterium was a non-spore-forming, nonmotile rod, appearing singly, in pairs, or occasionally as long chains, and measured 0.3 to 0.4 by 2.6 to 4 {micro}m. The bacterium had a specific requirement for NaCl and grew at NaCl concentrations of between 6 and 24%, with optimal growth at 9% NaCl. The isolate grew at temperatures of between 22 and 51 C and pH values of between 5.6 and 8.0. The doubling time in a complex medium containing 10% NaCl was 9 h. Growth wasmore » inhibited by chloramphenicol, tetracycline, and penicillin but not by cycloheximide or azide. Fermentable substrates were predominantly carbohydrates. The end products of glucose fermentation were acetate, ethanol, CO{sub 2}, and H{sub 2}. The major components of the cellular fatty acids were C{sub 14:0}, C{sub 16:0}, C{sub 16:1}, and C{sub 17:0 cyc} acids. The DNA base composition of the isolate was 34 mol% G+C. Oligonucleotide catalog and sequence analyses of the 16S rRNA showed that strain VS-752{sup T} was most closely related to Haloanaerobium praevalens GSL{sup T} (ATCC 33744), the sole member of the genus Haloanaerobium. The authors propose that strain VS-752 (ATCC 51327) by established as the type strain of a new species, Haloanaerobium salsugo, in the genus Haloanaerobium. 40 refs., 3 figs, 5 tabs.« less
Genome Sequence of Sphingobium indicum B90A, a Hexachlorocyclohexane-Degrading Bacterium
Anand, Shailly; Sangwan, Naseer; Lata, Pushp; Kaur, Jasvinder; Dua, Ankita; Singh, Amit Kumar; Verma, Mansi; Kaur, Jaspreet; Khurana, Jitendra P.; Khurana, Paramjit; Mathur, Saloni
2012-01-01
Sphingobium indicum B90A, an efficient degrader of hexachlorocyclohexane (HCH) isomers, was isolated in 1990 from sugarcane rhizosphere soil in Cuttack, India. Here we report the draft genome sequence of this bacterium, which has now become a model system for understanding the genetics, biochemistry, and physiology of HCH degradation. PMID:22843598
Andrianasolo, Eric H.; Haramaty, Liti; Rosario-Passapera, Richard; Vetriani, Costantino; Falkowski, Paul; White, Eileen; Lutz, Richard
2012-01-01
Chemical and biological investigation of the cultured marine hydrothermal vent bacterium, Thermovibrio ammonifican led to the isolation of two hydroxyethylamine chromene derivatives, ammonificins C and D. Their structures were elucidated using combination of NMR and mass spectrometry. Absolute stereochemistry was ascertained by comparison of experimental and calculated CD spectra. Biological evaluation and assessment were determined using the patented ApopScreen cell-based screen for apoptosis-induction. Ammonificins C and D induce apoptosis in micromolar concentrations. To our knowledge, this finding is the first report of chemical compounds that induce apoptosis from the cultured deep-sea marine organism, hydrothermal vent bacterium, Thermovibrio ammonificans. PMID:23170085