Sample records for bacterium thermus aquaticus

  1. Diverse Thermus species inhabit a single hot spring microbial mat

    NASA Technical Reports Server (NTRS)

    Nold, S. C.; Ward, D. M.

    1995-01-01

    Through an effort to characterize aerobic chemoorganotrophic bacteria in the Octopus Spring cyano-bacterial mat community, we cultivated four Thermus isolates with unique 16S rRNA sequences. Isolates clustered within existing Thermus clades, including those containing Thermus ruber, Thermus aquaticus, and a subgroup closely related to T. aquaticus. One Octopus Spring isolate is nearly identical (99.9% similar) to isolates from Iceland, and two others are closely related to a T. ruber isolated from Russia. Octopus Spring isolates similar to T. aquaticus and T. ruber exhibited optimal growth rates at high (65-70 degrees C) and low (50 degrees C) temperatures, respectively, with the most abundant species best adapted to the temperature of the habitat (50-55 degrees C). Our results display a diversity of Thermus genotypes defined by 16S rRNA within one hot spring microbial community. We suggest that specialization to temperature and perhaps other local environmental features controls the abundance of Thermus populations.

  2. The effect of high pressure on the intracellular trehalose synthase activity of Thermus aquaticus.

    PubMed

    Dong, Yongsheng; Ma, Lei; Duan, Yuanliang

    2016-01-01

    To understand the effect of high pressure on the intracellular trehalose synthase activity, Thermus aquaticus (T. aquaticus) in the logarithmic growth phase was treated with high-pressure air, and its intracellular trehalose synthase (TSase) activity was determined. Our results indicated that pressure is a factor strongly affecting the cell growth. High pressure significantly attenuated the growth rate of T. aquaticus and shortened the duration of stationary phase. However, after 2 h of culture under 1.0 MPa pressure, the activity of intracellular TSase in T. aquaticus reached its maximum value, indicating that pressure can significantly increase the activity of intracellular TSase in T. aquaticus. Thus the present study provides an important guide for the enzymatic production of trehalose.

  3. The recA gene from the thermophile Thermus aquaticus YT-1: cloning, expression, and characterization.

    PubMed Central

    Angov, E; Camerini-Otero, R D

    1994-01-01

    We have cloned, expressed, and purified the RecA analog from the thermophilic eubacterium Thermus aquaticus YT-1. Analysis of the deduced amino acid sequence indicates that the T. aquaticus RecA is structurally similar to the Escherichia coli RecA and suggests that RecA-like function has been conserved in thermophilic organisms. Preliminary biochemical analysis indicates that the protein has an ATP-dependent single-stranded DNA binding activity and can pair and carry out strand exchange to form a heteroduplex DNA under reaction conditions previously described for E. coli RecA, but at 55 to 65 degrees C. Further characterization of a thermophilically derived RecA protein should yield important information concerning DNA-protein interactions at high temperatures. In addition, a thermostable RecA protein may have some general applicability in stabilizing DNA-protein interactions in reactions which occur at high temperatures by increasing the specificity (stringency) of annealing reactions. Images PMID:8113181

  4. Presence of Thermophilic Bacteria in Laundry and Domestic Hot-Water Heaters

    PubMed Central

    Brock, Thomas D.; Boylen, Kathryn L.

    1973-01-01

    Thermophilic bacteria resembling Thermus aquaticus were isolated from hot water taken from domestic and commercial hot-water tanks. Cold water from the same locations never yielded thermophilic bacteria, suggesting that the bacteria were growing in the tanks. In contrast to the T. aquaticus isolates from hot springs, the present isolates were rarely pigmented. In general, the hotter sources more frequently yielded bacteria. PMID:4568892

  5. Comparative analysis of ribosomal protein L5 sequences from bacteria of the genus Thermus.

    PubMed

    Jahn, O; Hartmann, R K; Boeckh, T; Erdmann, V A

    1991-06-01

    The genes for the ribosomal 5S rRNA binding protein L5 have been cloned from three extremely thermophilic eubacteria, Thermus flavus, Thermus thermophilus HB8 and Thermus aquaticus (Jahn et al, submitted). Genes for protein L5 from the three Thermus strains display 95% G/C in third positions of codons. Amino acid sequences deduced from the DNA sequence were shown to be identical for T flavus and T thermophilus, although the corresponding DNA sequences differed by two T to C transitions in the T thermophilus gene. Protein L5 sequences from T flavus and T thermophilus are 95% homologous to L5 from T aquaticus and 56.5% homologous to the corresponding E coli sequence. The lowest degrees of homology were found between the T flavus/T thermophilus L5 proteins and those of yeast L16 (27.5%), Halobacterium marismortui (34.0%) and Methanococcus vannielii (36.6%). From sequence comparison it becomes clear that thermostability of Thermus L5 proteins is achieved by an increase in hydrophobic interactions and/or by restriction of steric flexibility due to the introduction of amino acids with branched aliphatic side chains such as leucine. Alignment of the nine protein sequences equivalent to Thermus L5 proteins led to identification of a conserved internal segment, rich in acidic amino acids, which shows homology to subsequences of E coli L18 and L25. The occurrence of conserved sequence elements in 5S rRNA binding proteins and ribosomal proteins in general is discussed in terms of evolution and function.

  6. Properties of Thermus ruber Strains Isolated from Icelandic Hot Springs and DNA:DNA Homology of Thermus ruber and Thermus aquaticus

    PubMed Central

    Sharp, Richard J.; Williams, Ralph A. D.

    1988-01-01

    Seventeen pink-pigmented strains of the genus Thermus were isolated from samples collected from thermal areas of Iceland. The strains were examined by using phenotypic characterization and DNA:DNA homology and were compared with recognized strains. Visually, the strains could be divided into three groups based on their pigmentation; however, spectroscopic studies of the pigments indicated little difference among them. Most strains required a vitamin supplement for growth and used fructose, maltose, mannose, or sucrose as the sole carbon source. In the presence of nitrate, two strains were able to grow under anaerobic conditions. The optimum growth temperature was 60°C; growth did not occur at 30 or 70°C. PMID:16347714

  7. Physiological Properties and Genome Structure of the Hyperthermophilic Filamentous Phage φOH3 Which Infects Thermus thermophilus HB8.

    PubMed

    Nagayoshi, Yuko; Kumagae, Kenta; Mori, Kazuki; Tashiro, Kosuke; Nakamura, Ayano; Fujino, Yasuhiro; Hiromasa, Yasuaki; Iwamoto, Takeo; Kuhara, Satoru; Ohshima, Toshihisa; Doi, Katsumi

    2016-01-01

    A filamentous bacteriophage, φOH3, was isolated from hot spring sediment in Obama hot spring in Japan with the hyperthermophilic bacterium Thermus thermophilus HB8 as its host. Phage φOH3, which was classified into the Inoviridae family, consists of a flexible filamentous particle 830 nm long and 8 nm wide. φOH3 was stable at temperatures ranging from 70 to 90°C and at pHs ranging from 6 to 9. A one-step growth curve of the phage showed a 60-min latent period beginning immediately postinfection, followed by intracellular virus particle production during the subsequent 40 min. The released virion number of φOH3 was 109. During the latent period, both single stranded DNA (ssDNA) and the replicative form (RF) of phage DNA were multiplied from min 40 onward. During the release period, the copy numbers of both ssDNA and RF DNA increased sharply. The size of the φOH3 genome is 5688 bp, and eight putative open reading frames (ORFs) were annotated. These ORFs were encoded on the plus strand of RF DNA and showed no significant homology with any known phage genes, except ORF 5, which showed 60% identity with the gene VIII product of the Thermus filamentous phage PH75. All the ORFs were similar to predicted genes annotated in the Thermus aquaticus Y51MC23 and Meiothermus timidus DSM 17022 genomes at the amino acid sequence level. This is the first report of the whole genome structure and DNA multiplication of a filamentous T. thermophilus phage within its host cell.

  8. The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

    PubMed Central

    Hori, H; Osawa, S; Murao, K; Ishikura, H

    1980-01-01

    The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

  9. Thermo-reversible inhibition makes aqualysin 1 from Thermus aquaticus a potent tool for studying the contribution of the wheat gluten network to the crumb texture of fresh bread.

    PubMed

    Verbauwhede, Annelien E; Lambrecht, Marlies A; Fierens, Ellen; Hermans, Senne; Shegay, Oksana; Brijs, Kristof; Delcour, Jan A

    2018-10-30

    The thermo-active serine peptidase aqualysin 1 (Aq1) of Thermus aquaticus was applied in bread making to study the relative contribution of thermoset gluten to bread crumb texture. Aq1 is active between 30 °C and 90 °C with an optimum activity temperature of around 65 °C. It is inhibited by wheat endogenous serine peptidase inhibitors during dough mixing and fermentation and starts hydrolyzing gluten proteins during baking above 80 °C when the enzyme is no longer inhibited and most of the starch is gelatinized and contributes to structure formation. Aq1 activity reduced the molecular weight of gluten proteins and significantly increased their extractability in sodium dodecyl sulfate containing medium. While it had no impact on the specific bread volume and only limited impact on hardness, cohesiveness, springiness, resilience and chewiness, it impacted bread crumb coherence. We conclude that starch has a greater impact on crumb texture than thermoset gluten. Copyright © 2018 Elsevier Ltd. All rights reserved.

  10. Purification and Characterization of Taq Polymerase: A 9-Week Biochemistry Laboratory Project for Undergraduate Students

    ERIC Educational Resources Information Center

    Bellin, Robert M.; Bruno, Mary K.; Farrow, Melissa A.

    2010-01-01

    We have developed a 9-week undergraduate laboratory series focused on the purification and characterization of "Thermus aquaticus" DNA polymerase (Taq). Our aim was to provide undergraduate biochemistry students with a full-semester continuing project simulating a research-like experience, while having each week's procedure focus on a single…

  11. Thermus arciformis sp. nov., a thermophilic species from a geothermal area.

    PubMed

    Zhang, Xin-Qi; Ying, Yi; Ye, Ying; Xu, Xue-Wei; Zhu, Xu-Fen; Wu, Min

    2010-04-01

    Two aerobic, Gram-negative, non-motile, non-sporulating, yellow-pigmented bacteria, strains TH92(T) and TH91, were isolated from a hot spring located in Laibin, Guangxi, in the south-eastern geothermal area of China. The isolates grew at 40-77 degrees C (optimally at 70 degrees C) and at pH 6.0-9.5 (optimally at pH 7.5-8.0). Phylogenetic analysis of 16S rRNA gene sequences and levels of DNA-DNA relatedness together indicated that the new isolates represented a novel species of the genus Thermus with closest affinity to Thermus aquaticus, Thermus igniterrae and Thermus thermophilus. Compared with their closest relatives, strains TH92( T) and TH91 were able to assimilate a wider range of carbohydrates, amino acids and organic acids as sole carbon sources for growth, such as lactose and melibiose. The new isolates had lower combined levels of C(16 : 0 ) and iso-C(16 : 0) compared with their closest relatives. On the basis of polyphasic taxonomic characterization, strains TH92(T) and TH91 are considered to represent a single novel species of the genus Thermus, for which the name Thermus arciformis sp. nov. is proposed. The type strain is TH92(T) (=CGMCC 1.6992(T) =JCM 15153(T)).

  12. Conformational Dynamics of Thermus aquaticus DNA Polymerase I during Catalysis

    PubMed Central

    Suo, Zucai

    2014-01-01

    Despite the fact that DNA polymerases have been investigated for many years and are commonly used as tools in a number of molecular biology assays, many details of the kinetic mechanism they use to catalyze DNA synthesis remain unclear. Structural and kinetic studies have characterized a rapid, pre-catalytic open-to-close conformational change of the Finger domain during nucleotide binding for many DNA polymerases including Thermus aquaticus DNA polymerase I (Taq Pol), a thermostable enzyme commonly used for DNA amplification in PCR. However, little has been done to characterize the motions of other structural domains of Taq Pol or any other DNA polymerase during catalysis. Here, we used stopped-flow Förster resonance energy transfer (FRET) to investigate the conformational dynamics of all five structural domains of the full-length Taq Pol relative to the DNA substrate during nucleotide binding and incorporation. Our study provides evidence for a rapid conformational change step induced by dNTP binding and a subsequent global conformational transition involving all domains of Taq Pol during catalysis. Additionally, our study shows that the rate of the global transition was greatly increased with the truncated form of Taq Pol lacking the N-terminal domain. Finally, we utilized a mutant of Taq Pol containing a de novo disulfide bond to demonstrate that limiting protein conformational flexibility greatly reduced the polymerization activity of Taq Pol. PMID:24931550

  13. Draft Genome Sequence of the Deinococcus-Thermus Bacterium Meiothermus ruber Strain A

    DOE PAGES

    Thiel, Vera; Tomsho, Lynn P.; Burhans, Richard; ...

    2015-03-26

    The draft genome sequence of the Deinococcus-Thermus group bacterium Meiothermus ruber strain A, isolated from a cyanobacterial enrichment culture obtained from Octopus Spring (Yellowstone National Park, WY), comprises 2,968,099 bp in 170 contigs. It is predicted to contain 2,895 protein-coding genes, 44 tRNA-coding genes, and 2 rRNA operons.

  14. The Deinococcus-Thermus phylum and the effect of rRNA composition on phylogenetic tree construction

    NASA Technical Reports Server (NTRS)

    Weisburg, W. G.; Giovannoni, S. J.; Woese, C. R.

    1989-01-01

    Through comparative analysis of 16S ribosomal RNA sequences, it can be shown that two seemingly dissimilar types of eubacteria Deinococcus and the ubiquitous hot spring organism Thermus are distantly but specifically related to one another. This confirms an earlier report based upon 16S rRNA oligonucleotide cataloging studies (Hensel et al., 1986). Their two lineages form a distinctive grouping within the eubacteria that deserved the taxonomic status of a phylum. The (partial) sequence of T. aquaticus rRNA appears relatively close to those of other thermophilic eubacteria. e.g. Thermotoga maritima and Thermomicrobium roseum. However, this closeness does not reflect a true evolutionary closeness; rather it is due to a "thermophilic convergence", the result of unusually high G+C composition in the rRNAs of thermophilic bacteria. Unless such compositional biases are taken into account, the branching order and root of phylogenetic trees can be incorrectly inferred.

  15. Role of disulphide bonds in a thermophilic serine protease aqualysin I from Thermus aquaticus YT-1.

    PubMed

    Sakaguchi, Masayoshi; Takezawa, Makoto; Nakazawa, Rie; Nozawa, Kazutaka; Kusakawa, Taro; Nagasawa, Takeshi; Sugahara, Yasusato; Kawakita, Masao

    2008-05-01

    A thermophilic serine protease, Aqualysin I, from Thermus aquaticus YT-1 has two disulphide bonds, which are also found in a psychrophilic serine protease from Vibrio sp. PA-44 and a proteinase K-like enzyme from Serratia sp. at corresponding positions. To understand the significance of these disulphide bonds in aqualysin I, we prepared mutants C99S, C194S and C99S/C194S (WSS), in which Cys69-Cys99, Cys163-Cys194 and both of these disulphide bonds, respectively, were disrupted by replacing Cys residues with Ser residues. All mutants were expressed stably in Escherichia coli. The C99S mutant was 68% as active as the wild-type enzyme at 40 degrees C in terms of k(cat) value, while C194S and WSS were only 6 and 3%, respectively, as active, indicating that disulphide bond Cys163-Cys194 is critically important for maintaining proper catalytic site conformation. Mutants C194S and WSS were less thermostable than wild-type enzyme, with a half-life at 90 degrees C of 10 min as compared to 45 min of the latter and with transition temperatures on differential scanning calorimetry of 86.7 degrees C and 86.9 degrees C, respectively. Mutant C99S was almost as stable as the wild-type aqualysin I. These results indicate that the disulphide bond Cys163-Cys194 is more important for catalytic activity and conformational stability of aqualysin I than Cys67-Cys99.

  16. Gene cloning and overexpression of a geranylgeranyl diphosphate synthase of an extremely thermophilic bacterium, Thermus thermophilus.

    PubMed

    Ohto, C; Ishida, C; Koike-Takeshita, A; Yokoyama, K; Muramatsu, M; Nishino, T; Obata, S

    1999-02-01

    A geranylgeranyl diphosphate (GGPP) synthase gene of an extremely thermophilic bacterium, Thermus thermophilus, was cloned and sequenced. T. thermophilus GGPP synthase, overexpressed in Escherichia coli cells as a glutathione S-transferase fusion protein, was purified and characterized. The fusion protein, retaining thermostability, formed a homodimer, and showed higher specific activity than did a partially purified thermostable enzyme previously reported. Optimal reaction conditions and kinetic parameters were also examined. The deduced amino acid sequence indicated that T. thermophilus GGPP synthase was excluded from the group of bacterial type GGPP synthases and lacked the insertion amino acid residues in the first aspartate-rich motif as do archaeal and eukaryotic short-chain prenyltransferases.

  17. Coupling of anaerobic waste treatment to produce protein- and lipid-rich bacterial biomass.

    PubMed

    Steinberg, Lisa M; Kronyak, Rachel E; House, Christopher H

    2017-11-01

    Future long-term manned space missions will require effective recycling of water and nutrients as part of a life support system. Biological waste treatment is less energy intensive than physicochemical treatment methods, yet anaerobic methanogenic waste treatment has been largely avoided due to slow treatment rates and safety issues concerning methane production. However, methane is generated during atmosphere regeneration on the ISS. Here we propose waste treatment via anaerobic digestion followed by methanotrophic growth of Methylococcus capsulatus to produce a protein- and lipid-rich biomass that can be directly consumed, or used to produce other high-protein food sources such as fish. To achieve more rapid methanogenic waste treatment, we built and tested a fixed-film, flow-through, anaerobic reactor to treat an ersatz wastewater. During steady-state operation, the reactor achieved a 97% chemical oxygen demand (COD) removal rate with an organic loading rate of 1740 g d -1  m -3 and a hydraulic retention time of 12.25 d. The reactor was also tested on three occasions by feeding ca. 500 g COD in less than 12 h, representing 50x the daily feeding rate, with COD removal rates ranging from 56-70%, demonstrating the ability of the reactor to respond to overfeeding events. While investigating the storage of treated reactor effluent at a pH of 12, we isolated a strain of Halomonas desiderata capable of acetate degradation under high pH conditions. We then tested the nutritional content of the alkaliphilic Halomonas desiderata strain, as well as the thermophile Thermus aquaticus, as supplemental protein and lipid sources that grow in conditions that should preclude pathogens. The M. capsulatus biomass consisted of 52% protein and 36% lipids, the H. desiderata biomass consisted of 15% protein and 7% lipids, and the Thermus aquaticus biomass consisted of 61% protein and 16% lipids. This work demonstrates the feasibility of rapid waste treatment in a compact reactor design, and proposes recycling of nutrients back into foodstuffs via heterotrophic (including methanotrophic, acetotrophic, and thermophilic) microbial growth. Copyright © 2017. Published by Elsevier Ltd.

  18. Coupling of anaerobic waste treatment to produce protein- and lipid-rich bacterial biomass

    NASA Astrophysics Data System (ADS)

    Steinberg, Lisa M.; Kronyak, Rachel E.; House, Christopher H.

    2017-11-01

    Future long-term manned space missions will require effective recycling of water and nutrients as part of a life support system. Biological waste treatment is less energy intensive than physicochemical treatment methods, yet anaerobic methanogenic waste treatment has been largely avoided due to slow treatment rates and safety issues concerning methane production. However, methane is generated during atmosphere regeneration on the ISS. Here we propose waste treatment via anaerobic digestion followed by methanotrophic growth of Methylococcus capsulatus to produce a protein- and lipid-rich biomass that can be directly consumed, or used to produce other high-protein food sources such as fish. To achieve more rapid methanogenic waste treatment, we built and tested a fixed-film, flow-through, anaerobic reactor to treat an ersatz wastewater. During steady-state operation, the reactor achieved a 97% chemical oxygen demand (COD) removal rate with an organic loading rate of 1740 g d-1 m-3 and a hydraulic retention time of 12.25 d. The reactor was also tested on three occasions by feeding ca. 500 g COD in less than 12 h, representing 50x the daily feeding rate, with COD removal rates ranging from 56-70%, demonstrating the ability of the reactor to respond to overfeeding events. While investigating the storage of treated reactor effluent at a pH of 12, we isolated a strain of Halomonas desiderata capable of acetate degradation under high pH conditions. We then tested the nutritional content of the alkaliphilic Halomonas desiderata strain, as well as the thermophile Thermus aquaticus, as supplemental protein and lipid sources that grow in conditions that should preclude pathogens. The M. capsulatus biomass consisted of 52% protein and 36% lipids, the H. desiderata biomass consisted of 15% protein and 7% lipids, and the Thermus aquaticus biomass consisted of 61% protein and 16% lipids. This work demonstrates the feasibility of rapid waste treatment in a compact reactor design, and proposes recycling of nutrients back into foodstuffs via heterotrophic (including methanotrophic, acetotrophic, and thermophilic) microbial growth.

  19. Confounders of mutation-rate estimators: selection and phenotypic lag in Thermus thermophilus

    PubMed Central

    Kissling, Grace E.; Grogan, Dennis W.; Drake, John W.

    2015-01-01

    In a recent description of the rate and character of spontaneous mutation in the hyperthermophilic bacterium Thermus thermophilus, the mutation rate was observed to be substantially lower than seen in several mesophiles. Subsequently, a report appeared indicating that this bacterium maintains an average of about 4.5 genomes per cell. This number of genomes might result in a segregation lag for the expression of a recessive mutation and might therefore lead to an underestimate of the rate of mutation. Here we describe some kinds of problems that may arise when estimating mutation rates and outline ways to adjust the rates accordingly. The emphasis is mainly on differential rates of growth of mutants versus their parents and on various kinds of phenotypic lag. We then apply these methods to the T. thermophilus data and conclude that there is as yet no reliable impact on a previously described rate. PMID:23916418

  20. Thermus anatoliensis sp. nov., a thermophilic bacterium from geothermal waters of Buharkent, Turkey.

    PubMed

    Kacagan, Murat; Inan, Kadriye; Canakci, Sabriye; Guler, Halil Ibrahim; Belduz, Ali Osman

    2015-12-01

    A Gram-stain-negative, lack of motility, catalase- and oxidase- positive bacterium (strain MT1(T)) was isolated from Buharkent hot spring in Aydin, Turkey. Its taxonomy was investigated using a polyphasic approach. The strain was able to grow at 45-80 °C, pH 5.5-10.5 and with a NaCI tolerance up to 2.0% (w/v). Strain MT1(T) was able to utilize d-mannitol and l-arabinose, not able to utilize d-cellobiose as sole carbon source. 16S rRNA gene sequence analysis revealed that the strain belonged to the genus Thermus; strain MT1(T) detected low-level similarities of 16S rRNA gene sequences (below 97%) compared with all other species in this genus. The predominant fatty acids of strain MT1(T) were iso-C(15:0) (43.0%) and iso-C(17:0) (27.4%). Polar lipid analysis revealed a major phospholipid, one major glycolipid, one major aminophospholipid, two minor aminolipids, one minor phospholipid, and several minor glycolipids. The major isoprenoid quinone was MK-8. The DNA G+C content of MT1(T) was 69.6 mol%. On the basis of a taxonomic study using a polyphasic approach, strain MT1(T) is considered to represent a novel species of the genus Thermus, for which the name Thermus anatoliensis sp. nov. is proposed. The type strain is MT1(T) (=NCCB 100425(T) =LMG 26880(T)). © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Purification and crystallization of components of the protein-synthesizing system from Thermus thermophilus

    NASA Astrophysics Data System (ADS)

    Garber, M. B.; Agalarov, S. Ch.; Eliseikina, I. A.; Sedelnikova, S. E.; Tishchenko, S. V.; Shirokov, V. A.; Yusupov, M. M.; Reshetnikova, L. S.; Trakhanov, S. D.; Tukalo, M. A.; Yaremchuk, A. D.

    1991-03-01

    An extreme thermophilic bacterium Thermus thermophilus has been chosen as a source for the isolation of components of the protein-synthesizing system to investigate their structures by X-ray crystallographic methods. The scheme of simultaneous isolation of ribosomes, tRNA, three elongation factors, several aminoacyl-tRNA synthetases and several enzymes has been developed. Methods of purification of ribosomes and individual ribosomal proteins without denaturation were elaborated. Crystals of the elongation factor G, the 70S ribosome, the 30S ribosomal subunit, six ribosomal proteins and three aminoacyl-tRNA synthetases have been obtained. Structural investigations of EF-G and the 70S ribosome are underway.

  2. Thermus tengchongensis sp. nov., isolated from a geothermally heated soil sample in Tengchong, Yunnan, south-west China.

    PubMed

    Yu, Tian-Tian; Yao, Ji-Cheng; Ming, Hong; Yin, Yi-Rui; Zhou, En-Min; Liu, Min-Jiao; Tang, Shu-Kun; Li, Wen-Jun

    2013-03-01

    A Gram-stain negative aerobic bacterium, designated YIM 77924(T), was isolated from a geothermally heated soil sample collected at Rehai National Park, Tengchong, Yunnan province, south-west China. Growth was found to occur from 55 to 75 °C (optimum 65 °C), pH 6.0-8.0 (optimum pH 7.0) and 0-1 % NaCl (w/v). Cells were observed to be rod-shaped and the colonies convex, circular, smooth, yellow and non-transparent. Phylogenetic analysis based on the 16S rRNA gene sequence indicated that strain YIM 77924(T) belongs to the genus Thermus. The 16S rRNA gene sequence similarity values between strain YIM 77924(T) and other species of the genus Thermus were all below 97 %. The polar lipids of strain YIM 77924(T) were determined to be aminophospholipid, phospholipid and glycolipid. The predominant respiratory quinone was determined to be MK-8 and the G+C content was 66.64 mol%. The major fatty acids identified were iso-C(16:0), iso-C(15:0), iso-C(17:0) and C(16:0). On the basis of the morphological and chemotaxonomic characteristics as well as genotypic data, strain YIM 77924(T) is proposed to represent a novel species, Thermus tengchongensis sp. nov., in the genus Thermus. The type strain is YIM 77924(T) (=KCTC 32025(T) = CCTCC AB2012063(T)).

  3. Template-switching during DNA synthesis by Thermus aquaticus DNA polymerase I.

    PubMed Central

    Odelberg, S J; Weiss, R B; Hata, A; White, R

    1995-01-01

    Recombinant DNA molecules are often generated during the polymerase chain reaction (PCR) when partially homologous templates are available [e.g., see Pääbo et al. (1990) J. Biol. Chem. 265, 4718-4721]. It has been suggested that these recombinant molecules are a consequence of truncated extension products annealing to partially homologous templates on subsequent PCR cycles. However, we demonstrate here that recombinants can be generated during a single round of primer extension in the absence of subsequent heat denaturation, indicating that template-switching produces some of these recombinant molecules. Two types of template-switches were observed: (i) switches to pre-existing templates and (ii) switches to the complementary nascent strand. Recombination is reduced several fold when the complementary template strands are physically separated by attachment to streptavidin magnetic beads. This result supports the hypothesis that either the polymerase or at least one of the two extending strands switches templates during DNA synthesis and that interaction between the complementary template strands is necessary for efficient template-switching. Images PMID:7596836

  4. Structure of a bacterial RNA polymerase holoenzyme open promoter complex

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bae, Brian; Feklistov, Andrey; Lass-Napiorkowska, Agnieszka

    2015-09-08

    Initiation of transcription is a primary means for controlling gene expression. In bacteria, the RNA polymerase (RNAP) holoenzyme binds and unwinds promoter DNA, forming the transcription bubble of the open promoter complex (RPo). We have determined crystal structures, refined to 4.14 Å-resolution, of RPo containing Thermus aquaticus RNAP holoenzyme and promoter DNA that includes the full transcription bubble. The structures, combined with biochemical analyses, reveal key features supporting the formation and maintenance of the double-strand/single-strand DNA junction at the upstream edge of the -10 element where bubble formation initiates. The results also reveal RNAP interactions with duplex DNA just upstreammore » of the -10 element and potential protein/DNA interactions that direct the DNA template strand into the RNAP active site. Addition of an RNA primer to yield a 4 base-pair post-translocated RNA:DNA hybrid mimics an initially transcribing complex at the point where steric clash initiates abortive initiation and σA dissociation.« less

  5. Structure of a bacterial RNA polymerase holoenzyme open promoter complex

    DOE PAGES

    Bae, Brian; Feklistov, Andrey; Lass-Napiorkowska, Agnieszka; ...

    2015-09-08

    Initiation of transcription is a primary means for controlling gene expression. In bacteria, the RNA polymerase (RNAP) holoenzyme binds and unwinds promoter DNA, forming the transcription bubble of the open promoter complex (RPo). We have determined crystal structures, refined to 4.14 Å-resolution, of RPo containing Thermus aquaticus RNAP holoenzyme and promoter DNA that includes the full transcription bubble. The structures, combined with biochemical analyses, reveal key features supporting the formation and maintenance of the double-strand/single-strand DNA junction at the upstream edge of the -10 element where bubble formation initiates. The results also reveal RNAP interactions with duplex DNA just upstreammore » of the -10 element and potential protein/DNA interactions that direct the DNA template strand into the RNAP active site. Additionally a RNA primer to yield a 4 base-pair post-translocated RNA:DNA hybrid mimics an initially transcribing complex at the point where steric clash initiates abortive initiation and σ A dissociation.« less

  6. Structural Basis for NADH/NAD+ Redox Sensing by a Rex Family Repressor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    McLaughlin, K.J.; Soares, A.; Strain-Damerell, C. M.

    2010-05-28

    Nicotinamide adenine dinucleotides have emerged as key signals of the cellular redox state. Yet the structural basis for allosteric gene regulation by the ratio of reduced NADH to oxidized NAD{sup +} is poorly understood. A key sensor among Gram-positive bacteria, Rex represses alternative respiratory gene expression until a limited oxygen supply elevates the intracellular NADH:NAD{sup +} ratio. Here we investigate the molecular mechanism for NADH/NAD{sup +} sensing among Rex family members by determining structures of Thermus aquaticus Rex bound to (1) NAD{sup +}, (2) DNA operator, and (3) without ligand. Comparison with the Rex/NADH complex reveals that NADH releases Rexmore » from the DNA site following a 40{sup o} closure between the dimeric subunits. Complementary site-directed mutagenesis experiments implicate highly conserved residues in NAD-responsive DNA-binding activity. These rare views of a redox sensor in action establish a means for slight differences in the nicotinamide charge, pucker, and orientation to signal the redox state of the cell.« less

  7. Silica-Induced Protein (Sip) in Thermophilic Bacterium Thermus thermophilus Responds to Low Iron Availability

    PubMed Central

    Fujino, Yasuhiro; Nagayoshi, Yuko; Iwase, Makoto; Yokoyama, Takushi; Ohshima, Toshihisa

    2016-01-01

    ABSTRACT Thermus thermophilus HB8 expresses silica-induced protein (Sip) when cultured in medium containing supersaturated silicic acids. Using genomic information, Sip was identified as a Fe3+-binding ABC transporter. Detection of a 1-kb hybridized band in Northern analysis revealed that sip transcription is monocistronic and that sip has its own terminator and promoter. The sequence of the sip promoter showed homology with that of the σA-dependent promoter, which is known as a housekeeping promoter in HB8. Considering that sip is transcribed when supersaturated silicic acids are added, the existence of a repressor is presumed. DNA microarray analysis suggested that supersaturated silicic acids and iron deficiency affect Thermus cells similarly, and enhanced sip transcription was detected under both conditions. This suggested that sip transcription was initiated by iron deficiency and that the ferric uptake regulator (Fur) controlled the transcription. Three Fur gene homologues (TTHA0255, TTHA0344, and TTHA1292) have been annotated in the HB8 genome, and electrophoretic mobility shift assays revealed that the TTHA0344 product interacts with the sip promoter region. In medium containing supersaturated silicic acids, free Fe3+ levels were decreased due to Fe3+ immobilization on colloidal silica. This suggests that, because Fe3+ ions are captured by colloidal silica in geothermal water, Thermus cells are continuously exposed to the risk of iron deficiency. Considering that Sip is involved in iron acquisition, Sip production may be a strategy to survive under conditions of low iron availability in geothermal water. IMPORTANCE The thermophilic bacterium Thermus thermophilus HB8 produces silica-induced protein (Sip) in the presence of supersaturated silicic acids. Sip has homology with iron-binding ABC transporter; however, the mechanism by which Sip expression is induced by silicic acids remains unexplained. We demonstrate that Sip captures iron and its transcription is regulated by the repressor ferric uptake regulator (Fur). This implies that Sip is expressed with iron deficiency. In addition, it is suggested that negatively charged colloidal silica in supersaturated solution absorbs Fe3+ ions and decreases iron availability. Considering that geothermal water contains ample silicic acids, it is suggested that thermophilic bacteria are always facing iron starvation. Sip production may be a strategy for surviving under conditions of low iron availability in geothermal water. PMID:26994077

  8. Influence of Asellus aquaticus on Escherichia coli, Klebsiella pneumoniae, Campylobacter jejuni and naturally occurring heterotrophic bacteria in drinking water.

    PubMed

    Christensen, Sarah C B; Nissen, Erling; Arvin, Erik; Albrechtsen, Hans-Jørgen

    2012-10-15

    Water lice, Asellus aquaticus (isopoda), frequently occur in drinking water distribution systems where they are a nuisance to consumers and water utilities. Whether they are solely an aesthetic problem or also affect the microbial water quality is a matter of interest. We studied the influence of A. aquaticus on microbial water quality in non-chlorinated drinking water in controlled laboratory experiments. Pure cultures of the indicator organisms Escherichia coli and Klebsiella pneumoniae and the pathogen Campylobacter jejuni as well as naturally occurring heterotrophic drinking water bacteria (measured as heterotrophic plate counts, HPC) were investigated in microcosms at 7 °C, containing non-sterilised drinking water, drinking water sediment and A. aquaticus collected from a non-chlorinated ground water based drinking water supply system. Concentrations of E. coli, K. pneumoniae and C. jejuni decreased over time, following a first order decay with half lives of 5.3, 18.4 and 1.3 days, respectively. A. aquaticus did not affect survival of indicators and pathogens substantially whereas HPC were influenced by presence of dead A. aquaticus. Growth rates increased with an average of 48% for bacteria grown on R-2A agar and an average of 83% for bacteria grown on yeast extract agar when dead A. aquaticus were present compared to no and living A. aquaticus present. A. aquaticus associated E. coli, K. pneumoniae and C. jejuni were measured (up to 25 per living and 500 per dead A. aquaticus) and so were A. aquaticus associated heterotrophic bacteria (>1.8*10(4) CFU per living and >6*10(4) CFU per dead A. aquaticus). A. aquaticus did not serve as an optimised habitat that increased survival of indicators and pathogens, since A. aquaticus associated E. coli, K. pneumoniae and C. jejuni were only measured as long as the bacteria were also present in the water and sediment. Copyright © 2012 Elsevier Ltd. All rights reserved.

  9. Asellus aquaticus as a potential carrier of Escherichia coli and other coliform bacteria into drinking water distribution systems.

    PubMed

    Christensen, Sarah C B; Arvin, Erik; Nissen, Erling; Albrechtsen, Hans-Jørgen

    2013-03-01

    Individuals of the water louse, Asellus aquaticus, enter drinking water distribution systems in temperate parts of the world, where they establish breeding populations. We analysed populations of surface water A. aquaticus from two ponds for associated faecal indicator bacteria and assessed the risk of A. aquaticus transporting bacteria into distribution systems. Concentrations of up to two E. coli and five total coliforms·mL-1 were measured in the water and 200 E. coli and >240 total coliforms·mL-1 in the sediments of the investigated ponds. Concentrations of A. aquaticus associated bacteria never exceeded three E. coli and six total coliforms·A. aquaticus-1. During exposure to high concentrations of coliforms, concentrations reached 350 coliforms·A. aquaticus-1. A. aquaticus associated E. coli were only detected as long as E. coli were present in the water and sediment. The calculated probability of exceeding drinking water guideline values in non-disinfected systems by intrusion of A. aquaticus was low. Only in scenarios with narrow pipes and low flows, did total coliforms exceed guideline values, implying that the probability of detection by routine monitoring is also low. The study expands the knowledge base for evaluating incidents with presence of coliform indicators in drinking water by showing that intruding A. aquaticus were not important carriers of E. coli or other coliform bacteria even when emerging from faecally contaminated waters.

  10. Distribution of Asellus aquaticus and microinvertebrates in a non-chlorinated drinking water supply system--effects of pipe material and sedimentation.

    PubMed

    Christensen, Sarah C B; Nissen, Erling; Arvin, Erik; Albrechtsen, Hans-Jørgen

    2011-05-01

    Danish drinking water supplies based on ground water without chlorination were investigated for the presence of the water louse, Asellus aquaticus, microinvertebrates (<2 mm) and annelida. In total, 52 water samples were collected from fire hydrants at 31 locations, and two elevated tanks (6000 and 36,000 m(3)) as well as one clean water tank at a waterworks (700 m(3)) were inspected. Several types of invertebrates from the phyla: arthropoda, annelida (worms), plathyhelminthes (flatworms) and mollusca (snails) were found. Invertebrates were found at 94% of the sampling sites in the piped system with A. aquaticus present at 55% of the sampling sites. Populations of A. aquaticus were present in the two investigated elevated tanks but not in the clean water tank at a waterworks. Both adult and juvenile A. aquaticus (length of 2-10 mm) were found in tanks as well as in pipes. A. aquaticus was found only in samples collected from two of seven investigated distribution zones (zone 1 and 2), each supplied directly by one of the two investigated elevated tanks containing A. aquaticus. Microinvertebrates were distributed throughout all zones. The distribution pattern of A. aquaticus had not changed considerably over 20 years when compared to data from samples collected in 1988-89. Centrifugal pumps have separated the distribution zones during the whole period and may have functioned as physical barriers in the distribution systems, preventing large invertebrates such as A. aquaticus to pass alive. Another factor characterising zone 1 and 2 was the presence of cast iron pipes. The frequency of A. aquaticus was significantly higher in cast iron pipes than in plastic pipes. A. aquaticus caught from plastic pipes were mainly single living specimens or dead specimens, which may have been transported passively trough by the water flow, while cast iron pipes provided an environment suitable for relatively large populations of A. aquaticus. Sediment volume for each sample was measured and our study described for the first time a clear connection between sediment volume and living A. aquaticus since living A. aquaticus were nearly only found in samples with sediment contents higher than 100 ml/m(3) sample. Presence of A. aquaticus was not correlated to turbidity of the water. Measurements by ATP, heterotrophic plate counting and Colilert(®) showed that the microbial quality of the water was high at all locations with or without animals. Four other large Danish drinking water supplies were additionally sampled (nine pipe samples and one elevated tank), and invertebrates were found in all systems, three of four containing A. aquaticus, indicating a nationwide occurrence. Copyright © 2011 Elsevier Ltd. All rights reserved.

  11. Osmoregulated TAQ polymerase gene expression in Escherichia coli.

    PubMed

    Cabrera Artiles, Yeosvany; Martínez García, Duniesky; Pérez Cruz, Enrique R; Márquez Perera, Gabriel J; Feble, Manuel Luis

    2002-01-01

    The Thermus aquaticus DNA Polymerase I (Taq Pol I) gene was cloned into the pOSEX4 plasmid under the osmo-inducible promoter proU and subsequently expressed into the Escherichia coli MKH13 strain. The suitability of the enzyme in polymerase assays was determined in standard 35S dATP incorporation tests and by PCR. The Taq Pol I expression in this system, which is under the control of the osmotic pressure in the growth medium, was analyzed in different media and in different sodium chloride concentrations. A study of the osmolarity effects in the growth of the strain and in Taq Pol I expression shows that an increase in sodium chloride concentration limits the growth. At 0.25 M of NaCl maximum activity was observed; at higher values of osmolarity, we found an unexpected decline of activity. This is the first report of using the pOSEX vector for the expression of an heterologous protein and it is very advantageous to make a regulated, non toxic, simple and cost-effective manner of induction in a biotechnology process using just NaCl or other non-permeable osmolyte.

  12. Thermus thermophilus as a Source of Thermostable Lipolytic Enzymes

    PubMed Central

    López-López, Olalla; Cerdán, María-Esperanza; González-Siso, María-Isabel

    2015-01-01

    Lipolytic enzymes, esterases (EC 3.1.1.1) and lipases (EC 3.1.1.3), catalyze the hydrolysis of ester bonds between alcohols and carboxylic acids, and its formation in organic media. At present, they represent about 20% of commercialized enzymes for industrial use. Lipolytic enzymes from thermophilic microorganisms are preferred for industrial use to their mesophilic counterparts, mainly due to higher thermostability and resistance to several denaturing agents. However, the production at an industrial scale from the native organisms is technically complicated and expensive. The thermophilic bacterium Thermus thermophilus (T. thermophilus) has high levels of lipolytic activity, and its whole genome has been sequenced. One esterase from the T. thermophilus strain HB27 has been widely characterized, both in its native form and in recombinant forms, being expressed in mesophilic microorganisms. Other putative lipases/esterases annotated in the T. thermophilus genome have been explored and will also be reviewed in this paper. PMID:27682117

  13. Interaction of Thermus thermophilus, ArsC enzyme and gold nanoparticles naked-eye assays speciation between As(III) and As(V)

    NASA Astrophysics Data System (ADS)

    Politi, Jane; Spadavecchia, Jolanda; Fiorentino, Gabriella; Antonucci, Immacolata; Casale, Sandra; De Stefano, Luca

    2015-10-01

    The thermophilic bacterium Thermus thermophilus HB27 encodes chromosomal arsenate reductase (TtArsC), the enzyme responsible for resistance to the harmful effects of arsenic. We report on adsorption of TtArsC onto gold nanoparticles for naked-eye monitoring of biomolecular interaction between the enzyme and arsenic species. Synthesis of hybrid biological-metallic nanoparticles has been characterized by transmission electron microscopy (TEM), ultraviolet-visible (UV-vis), dynamic light scattering (DLS) and phase modulated infrared reflection absorption (PM-IRRAS) spectroscopies. Molecular interactions have been monitored by UV-vis and Fourier transform-surface plasmon resonance (FT-SPR). Due to the nanoparticles’ aggregation on exposure to metal salts, pentavalent and trivalent arsenic solutions can be clearly distinguished by naked-eye assay, even at 85 μM concentration. Moreover, the assay shows partial selectivity against other heavy metals.

  14. Asellus aquaticus as a Potential Carrier of Escherichia coli and Other Coliform Bacteria into Drinking Water Distribution Systems

    PubMed Central

    Christensen, Sarah C. B.; Arvin, Erik; Nissen, Erling; Albrechtsen, Hans-Jørgen

    2013-01-01

    Individuals of the water louse, Asellus aquaticus, enter drinking water distribution systems in temperate parts of the world, where they establish breeding populations. We analysed populations of surface water A. aquaticus from two ponds for associated faecal indicator bacteria and assessed the risk of A. aquaticus transporting bacteria into distribution systems. Concentrations of up to two E. coli and five total coliforms·mL−1 were measured in the water and 200 E. coli and >240 total coliforms·mL−1 in the sediments of the investigated ponds. Concentrations of A. aquaticus associated bacteria never exceeded three E. coli and six total coliforms·A. aquaticus−1. During exposure to high concentrations of coliforms, concentrations reached 350 coliforms·A. aquaticus−1. A. aquaticus associated E. coli were only detected as long as E. coli were present in the water and sediment. The calculated probability of exceeding drinking water guideline values in non-disinfected systems by intrusion of A. aquaticus was low. Only in scenarios with narrow pipes and low flows, did total coliforms exceed guideline values, implying that the probability of detection by routine monitoring is also low. The study expands the knowledge base for evaluating incidents with presence of coliform indicators in drinking water by showing that intruding A. aquaticus were not important carriers of E. coli or other coliform bacteria even when emerging from faecally contaminated waters. PMID:23455399

  15. Cloning, sequencing, and expression of dnaK-operon proteins from the thermophilic bacterium Thermus thermophilus.

    PubMed

    Osipiuk, J; Joachimiak, A

    1997-09-12

    We propose that the dnaK operon of Thermus thermophilus HB8 is composed of three functionally linked genes: dnaK, grpE, and dnaJ. The dnaK and dnaJ gene products are most closely related to their cyanobacterial homologs. The DnaK protein sequence places T. thermophilus in the plastid Hsp70 subfamily. In contrast, the grpE translated sequence is most similar to GrpE from Clostridium acetobutylicum, a Gram-positive anaerobic bacterium. A single promoter region, with homology to the Escherichia coli consensus promoter sequences recognized by the sigma70 and sigma32 transcription factors, precedes the postulated operon. This promoter is heat-shock inducible. The dnaK mRNA level increased more than 30 times upon 10 min of heat shock (from 70 degrees C to 85 degrees C). A strong transcription terminating sequence was found between the dnaK and grpE genes. The individual genes were cloned into pET expression vectors and the thermophilic proteins were overproduced at high levels in E. coli and purified to homogeneity. The recombinant T. thermophilus DnaK protein was shown to have a weak ATP-hydrolytic activity, with an optimum at 90 degrees C. The ATPase was stimulated by the presence of GrpE and DnaJ. Another open reading frame, coding for ClpB heat-shock protein, was found downstream of the dnaK operon.

  16. Astrobiological Significance of Microbial Extremophiles

    NASA Technical Reports Server (NTRS)

    Pikuta, Elena V.; Hoover, Richard B.

    2007-01-01

    The microflora of the cryosphere of planet Earth provides the best analogs for life forms that might be found in the permafrost or polar ice caps of Mars, near the surface of the cometary nuclei, or in the liquid water beneath and the ice crusts of icy moons of Jupiter and Saturn. The importance of study alkaliphilic microorganisms for astrobiology was enhanced by the findings of abundant carbonates and carbonate globules rimmed with possibly biogenic magnetites in association with the putative microfossils in the ALH84001 meteorite. Although the ALH84001 "nanofossils" were to small and simple to be unambiguously recognized as biogenic, they stimulated Astrobiology research and studies of microbial extremophiles and biomarkers in ancient rocks and meteorites. Recent studies of CI and CM carbonaceous meteorites have resulted in the detection of the well-preserved mineralized remains of coccoidal and filamentous microorganisms in cyanobacterial mats. Energy Dispersive X-ray Analysis has shown anomalous biogenic element ratios clearly indicating they are not recent biological contaminants. This paper reviews microbial extremophiles in context of their significance to Astrobiology. The study of halophilic microorganisms was started from work with saline soils and lakes, and one of the record of good growth for Haloferax mediterranei was shown at 30 percent NaC1. Although alkali-tolerant nitrifying bacteria had previously been reported, the first described alkaliphilic microorganism was the bacterium Streptococcus faecalis. Halophilic and alkaliphilic forms are relevant to conditions that might be found in closed impact basins and craters on Mars filled with evaporite deposits. The first obligately acidophilic bacterium described was Acidithiobacillus ferrooxydans (formally Thiobacillus ferrooxidans). Later thermophilic lithotrophic acidophiles were found, and the hyperacidophilic moderately thermophilic species of the genus Picrophilus were found to grow at negative pH. The epoch of study of thermophilic microorganisms starts with the discovery of Thermus aquaticus, and presently the maximum temperature for growth at 113 C was found for Pyrolobus fumarii. The microorganisms capable of growth at high temperatures and in hyperacidic environments on Earth are good analogs for life that might be able to survive in hot acidic droplets in the upper regimes of the atmosphere of Venus. The study of barophiles was made possible by engineering achievements leading to the development of the submersible crafts used to study the Black Smokers of the Deep-sea Hydrothermal vents. The first described radioresistant bacterium Deinococcus radiodurans can survive ionizing irradiation and other DNA-damaging assaults at doses that are lethal to all other organisms. These microbes are models for life that might endure high radiation environments in the ice near the surface of comets or on the icy moons of Jupiter and Saturn and in the seafloor deep beneath icy crusts Europa and Enceladus. This paper presents ESEM and FESEM images showing intact microbes preserved in the deep ice cores extracted from just above Lake Vostok, Antarctica that are considered analogs for life forms that might survive on comets and icy moons.

  17. Arsenate reductase from Thermus thermophilus conjugated to polyethylene glycol-stabilized gold nanospheres allow trace sensing and speciation of arsenic ions.

    PubMed

    Politi, Jane; Spadavecchia, Jolanda; Fiorentino, Gabriella; Antonucci, Immacolata; De Stefano, Luca

    2016-10-01

    Water sources pollution by arsenic ions is a serious environmental problem all around the world. Arsenate reductase enzyme (TtArsC) from Thermus thermophilus extremophile bacterium, naturally binds arsenic ions, As(V) and As (III), in aqueous solutions. In this research, TtArsC enzyme adsorption onto hybrid polyethylene glycol-stabilized gold nanoparticles (AuNPs) was studied at different pH values as an innovative nanobiosystem for metal concentration monitoring. Characterizations were performed by UV/Vis and circular dichroism spectroscopies, TEM images and in terms of surface charge changes. The molecular interaction between arsenic ions and the TtArsC-AuNPs nanobiosystem was also monitored at all pH values considered by UV/Vis spectroscopy. Tests performed revealed high sensitivities and limits of detection equal to 10 ± 3 M -12 and 7.7 ± 0.3 M -12 for As(III) and As(V), respectively. © 2016 The Author(s).

  18. High-quality draft genome sequence of the Thermus amyloliquefaciens type strain YIM 77409 T with an incomplete denitrification pathway

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhou, En -Min; Murugapiran, Senthil K.; Mefferd, Chrisabelle C.

    Thermus amyloliquefaciens type strain YIM 77409 T is a thermophilic, Gram-negative, non-motile and rod-shaped bacterium isolated from Niujie Hot Spring in Eryuan County, Yunnan Province, southwest China. In the present study we describe the features of strain YIM 77409 T together with its genome sequence and annotation. The genome is 2,160,855 bp long and consists of 6 scaffolds with 67.4 % average GC content. A total of 2,313 genes were predicted, comprising 2,257 protein-coding and 56 RNA genes. The genome is predicted to encode a complete glycolysis, pentose phosphate pathway, and tricarboxylic acid cycle. Additionally, a large number of transportersmore » and enzymes for heterotrophy highlight the broad heterotrophic lifestyle of this organism. Furthermore, a denitrification gene cluster included genes predicted to encode enzymes for the sequential reduction of nitrate to nitrous oxide, consistent with the incomplete denitrification phenotype of this strain.« less

  19. High-quality draft genome sequence of the Thermus amyloliquefaciens type strain YIM 77409 T with an incomplete denitrification pathway

    DOE PAGES

    Zhou, En -Min; Murugapiran, Senthil K.; Mefferd, Chrisabelle C.; ...

    2016-02-27

    Thermus amyloliquefaciens type strain YIM 77409 T is a thermophilic, Gram-negative, non-motile and rod-shaped bacterium isolated from Niujie Hot Spring in Eryuan County, Yunnan Province, southwest China. In the present study we describe the features of strain YIM 77409 T together with its genome sequence and annotation. The genome is 2,160,855 bp long and consists of 6 scaffolds with 67.4 % average GC content. A total of 2,313 genes were predicted, comprising 2,257 protein-coding and 56 RNA genes. The genome is predicted to encode a complete glycolysis, pentose phosphate pathway, and tricarboxylic acid cycle. Additionally, a large number of transportersmore » and enzymes for heterotrophy highlight the broad heterotrophic lifestyle of this organism. Furthermore, a denitrification gene cluster included genes predicted to encode enzymes for the sequential reduction of nitrate to nitrous oxide, consistent with the incomplete denitrification phenotype of this strain.« less

  20. Pyrococcus prefoldin stabilizes protein-folding intermediates and transfers them to chaperonins for correct folding.

    PubMed

    Okochi, Mina; Yoshida, Takao; Maruyama, Tadashi; Kawarabayasi, Yutaka; Kikuchi, Hisashi; Yohda, Masafumi

    2002-03-08

    A molecular chaperone prefoldin/GimC from the hyperthermophilic archaeum Pyrococcus horikoshii OT3 was characterized. Pyrococcus prefoldin protected porcine heart citrate synthase from thermal aggregation whereas each subunit alone afforded little protection. It also arrested the spontaneous refolding of acid-denatured green fluorescent protein and then transferred it not only to a group II chaperonin from the hyperthermophilic archaeum Thermococcus sp. strain KS-1, but also to a group I chaperonin from the thermophilic bacterium Thermus thermophilus HB8 for subsequent ATP dependent refolding.

  1. Thermus Thermophilus as a Model System for the Study of Ribosomal Antibiotic Resistance

    NASA Astrophysics Data System (ADS)

    Gregory, Steven T.

    2018-03-01

    Ribosomes are the intracellular ribonucleoprotein machines responsible for the translation of mRNA sequence into protein sequence. As an essential cell component, the ribosome is the target of numerous antibiotics that bind to critical functional sites to impair protein synthesis. Mutations causing resistance to antibiotics arise in antibiotic binding sites, and an understanding of the basis of resistance will be an essential component of efforts to develop new antibiotics by rational drug design. We have identified a number of antibiotic-resistance mutations in ribosomal genes of the thermophilic bacterium Thermus thermophilus. This species offers two primary advantages for examining the structural basis of antibiotic-resistance, in particular, its potential for genetic manipulation and the suitability of its ribosomes for analysis by X-ray crystallography. Mutations we have identified in this organism are in many instances identical to those found in other bacterial species, including important pathogens, a result of the extreme conservation of ribosome functional sites. Here I summarize the advantages of this organism as a model system to study antibiotic-resistance mechanisms at the molecular level.

  2. Pb2+ Effects on Growth, Lipids, and Protein and DNA Profiles of the Thermophilic Bacterium Thermus Thermophilus

    PubMed Central

    Nicolaus, Barbara; Poli, Annarita; Di Donato, Paola; Romano, Ida; Laezza, Giusi; Gioiello, Alessia; Ulgiati, Sergio; Fratianni, Florinda; Nazzaro, Filomena; Orlando, Pierangelo; Dumontet, Stefano

    2016-01-01

    Extremophiles are organisms able to thrive in extreme environmental conditions and some of them show the ability to survive high doses of heavy metals thanks to defensive mechanisms provided by primary and secondary metabolic products, i.e., extremolytes, lipids, and extremozymes. This is why there is a growing scientific and industrial interest in the use of thermophilic bacteria in a host of tasks, from the environmental detoxification of heavy metal to industrial activities, such as bio-machining and bio-metallurgy. In this work Thermus thermophilus was challenged against increasing Pb2+ concentrations spanning from 0 to 300 ppm in order to ascertain the sensitiveness of this bacteria to the Pb environmental pollution and to give an insight on its heavy metal resistance mechanisms. Analysis of growth parameters, enzyme activities, protein profiles, and lipid membrane modifications were carried out. In addition, genotyping analysis of bacteria grown in the presence of Pb2+, using random amplified polymorphic DNA-PCR and DNA melting evaluation, were also performed. A better knowledge of the response of thermophilic bacteria to the different pollutants, as heavy metals, is necessary for optimizing their use in remediation or decontamination processes. PMID:27929414

  3. Reproduction in the freshwater crustacean Asellus aquaticus along a gradient of radionuclide contamination at Chernobyl.

    PubMed

    Fuller, Neil; Ford, Alex T; Nagorskaya, Liubov L; Gudkov, Dmitri I; Smith, Jim T

    2018-07-01

    Nuclear accidents such as Chernobyl and Fukushima have led to contamination of the environment that will persist for many years. The consequences of chronic low-dose radiation exposure for non-human organisms inhabiting contaminated environments remain unclear. In radioecology, crustaceans are important model organisms for the development of environmental radioprotection. Previous laboratory studies have demonstrated deleterious effects of radiation exposure on crustacean reproduction. However, no studies have documented the effects of chronic radiation exposure on the reproduction of natural crustacean populations. Based on data from laboratory exposures, we hypothesised that populations of the freshwater isopod Asellus aquaticus exposed to radiation for thirty years at Chernobyl would display reduced reproductive output and altered timing of reproduction. To test this hypothesis, A. aquaticus was collected from six lakes at Chernobyl over two years with total dose rates ranging from 0.06-27.1μGy/h. No significant differences in the fecundity, mass of broods or proportion of reproducing female A. aquaticus were recorded. Significant differences in the body mass of gravid females were recorded suggesting different timings of reproduction, however this was not related to radiation contamination. No significant effect of a range of environmental parameters on A. aquaticus reproduction was recorded. Our data suggests current dose rates at Chernobyl are not causing discernible effects on the reproductive output of A. aquaticus. This study is the first to assess the effects of chronic low-dose radiation exposure on the reproductive output of an aquatic invertebrate at Chernobyl. These findings are consistent with proposed radiological protection benchmarks for the maintenance of wildlife populations and will assist in management of environments impacted by radiation. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

  4. Multi-wavelength colorimetric determination of large-ring cyclodextrin content for the cyclization activity of 4-α-glucanotransferase.

    PubMed

    Wang, Jinpeng; Wei, Ren; Tian, Yaoqi; Yang, Na; Xu, Xueming; Zimmermann, Wolfgang; Jin, Zhengyu

    2015-05-20

    Large-ring cyclodextrins (LR-CDs) have a number of intriguing properties for potential use in pharmaceutical and food industry. To date, no colorimetric method has been reported for LR-CD content quantification. In this study, triple wavelength colorimetry (TWC) and orthogonal-function spectrophotometry (OFS) have been successfully applied to determine ingredient concentrations in a mixture of amylose and LR-CDs. Both TWC and OFS yielded precise amylose content data in good agreement with expected values. For quantification of LR-CD content, OFS provided a higher accuracy than TWC, which resulted in a slight over-determination. As a comparison, single-wavelength colorimetry performed at the corresponding absorption maximum led to a significant over-determination of both amylose and LR-CD contents. The validity of TWC and OFS allowed their application for discriminative detection of the cyclization and total activity of a 4-α-glucanotransferase (4 αGTase) from Thermus aquaticus regarding the synthesis of LR-CDs and the conversion of amylose to small molecules, respectively. High pressure size exclusion chromatography analysis of the post-reaction mixtures following 4 αGTase-catalyzed conversion of amylose revealed the presence of linear malto-oligosaccharides in the LR-CD fraction. By introduction of a correction factor, the interference caused by linear malto-oligosaccharides was eliminated for a more accurate determination of LR-CD cyclization activity. Copyright © 2015 Elsevier Ltd. All rights reserved.

  5. Visualizing the phage T4 activated transcription complex of DNA and E. coli RNA polymerase

    PubMed Central

    James, Tamara D.; Cardozo, Timothy; Abell, Lauren E.; Hsieh, Meng-Lun; Jenkins, Lisa M. Miller; Jha, Saheli S.; Hinton, Deborah M.

    2016-01-01

    The ability of RNA polymerase (RNAP) to select the right promoter sequence at the right time is fundamental to the control of gene expression in all organisms. However, there is only one crystallized structure of a complete activator/RNAP/DNA complex. In a process called σ appropriation, bacteriophage T4 activates a class of phage promoters using an activator (MotA) and a co-activator (AsiA), which function through interactions with the σ70 subunit of RNAP. We have developed a holistic, structure-based model for σ appropriation using multiple experimentally determined 3D structures (Escherichia coli RNAP, the Thermus aquaticus RNAP/DNA complex, AsiA /σ70 Region 4, the N-terminal domain of MotA [MotANTD], and the C-terminal domain of MotA [MotACTD]), molecular modeling, and extensive biochemical observations indicating the position of the proteins relative to each other and to the DNA. Our results visualize how AsiA/MotA redirects σ, and therefore RNAP activity, to T4 promoter DNA, and demonstrate at a molecular level how the tactful interaction of transcriptional factors with even small segments of RNAP can alter promoter specificity. Furthermore, our model provides a rational basis for understanding how a mutation within the β subunit of RNAP (G1249D), which is far removed from AsiA or MotA, impairs σ appropriation. PMID:27458207

  6. Transcription activation mediated by a cyclic AMP receptor protein from Thermus thermophilus HB8.

    PubMed

    Shinkai, Akeo; Kira, Satoshi; Nakagawa, Noriko; Kashihara, Aiko; Kuramitsu, Seiki; Yokoyama, Shigeyuki

    2007-05-01

    The extremely thermophilic bacterium Thermus thermophilus HB8, which belongs to the phylum Deinococcus-Thermus, has an open reading frame encoding a protein belonging to the cyclic AMP (cAMP) receptor protein (CRP) family present in many bacteria. The protein named T. thermophilus CRP is highly homologous to the CRP family proteins from the phyla Firmicutes, Actinobacteria, and Cyanobacteria, and it forms a homodimer and interacts with cAMP. CRP mRNA and intracellular cAMP were detected in this strain, which did not drastically fluctuate during cultivation in a rich medium. The expression of several genes was altered upon disruption of the T. thermophilus CRP gene. We found six CRP-cAMP-dependent promoters in in vitro transcription assays involving DNA fragments containing the upstream regions of the genes exhibiting decreased expression in the CRP disruptant, indicating that the CRP is a transcriptional activator. The consensus T. thermophilus CRP-binding site predicted upon nucleotide sequence alignment is 5'-(C/T)NNG(G/T)(G/T)C(A/C)N(A/T)NNTCACAN(G/C)(G/C)-3'. This sequence is unique compared with the known consensus binding sequences of CRP family proteins. A putative -10 hexamer sequence resides at 18 to 19 bp downstream of the predicted T. thermophilus CRP-binding site. The CRP-regulated genes found in this study comprise clustered regularly interspaced short palindromic repeat (CRISPR)-associated (cas) ones, and the genes of a putative transcriptional regulator, a protein containing the exonuclease III-like domain of DNA polymerase, a GCN5-related acetyltransferase homolog, and T. thermophilus-specific proteins of unknown function. These results suggest a role for cAMP signal transduction in T. thermophilus and imply the T. thermophilus CRP is a cAMP-responsive regulator.

  7. A Flexible Domain-Domain Hinge Promotes an Induced-fit Dominant Mechanism for the Loading of Guide-DNA into Argonaute Protein in Thermus thermophilus.

    PubMed

    Zhu, Lizhe; Jiang, Hanlun; Sheong, Fu Kit; Cui, Xuefeng; Gao, Xin; Wang, Yanli; Huang, Xuhui

    2016-03-17

    Argonaute proteins (Ago) are core components of the RNA Induced Silencing Complex (RISC) that load and utilize small guide nucleic acids to silence mRNAs or cleave foreign DNAs. Despite the essential role of Ago in gene regulation and defense against virus, the molecular mechanism of guide-strand loading into Ago remains unclear. We explore such a mechanism in the bacterium Thermus thermophilus Ago (TtAgo), via a computational approach combining molecular dynamics, bias-exchange metadynamics, and protein-DNA docking. We show that apo TtAgo adopts multiple closed states that are unable to accommodate guide-DNA. Conformations able to accommodate the guide are beyond the reach of thermal fluctuations from the closed states. These results suggest an induced-fit dominant mechanism for guide-strand loading in TtAgo, drastically different from the two-step mechanism for human Ago 2 (hAgo2) identified in our previous study. Such a difference between TtAgo and hAgo2 is found to mainly originate from the distinct rigidity of their L1-PAZ hinge. Further comparison among known Ago structures from various species indicates that the L1-PAZ hinge may be flexible in general for prokaryotic Ago's but rigid for eukaryotic Ago's.

  8. Flooding impacts on responses of a riparian consumer to cross-ecosystem subsidies.

    PubMed

    Greenwood, Michelle J; McIntosh, Angus R

    2008-06-01

    Landscape-driven processes impact the magnitude and direction of cross-ecosystem resource subsidies, but they may also control consumers' numerical and functional responses by altering habitat availability. We investigated effects of the interaction between habitat availability and subsidy level on populations of a riparian fishing spider, Dolomedes aquaticus, using a flood disturbance gradient in the Waimakariri River catchment, New Zealand. D. aquaticus predominantly eat aquatic prey as they hunt from the water surface. However, D. aquaticus biomass peaked at rivers with intermediate flood disturbance, rather than at less flood-prone rivers where the biomass of aquatic insect prey was markedly higher. Flooding positively influenced spider habitat quality, and an experimental manipulation at stable rivers indicated that unembedded cobbles, preferred D. aquaticus habitat, were a limiting factor, preventing response to the increased prey resource at stable sites. Potential terrestrial prey abundance was low, did not vary across the disturbance gradient, and is likely to have been a much smaller component of the fishing spiders' diet than aquatic insect prey. Thus landscape-driven factors not only controlled the magnitude of resource subsidies, but also influenced the ability of consumers to respond to them by altering the physical nature of the ecosystem boundary.

  9. A Transcriptomic Analysis of Cave, Surface, and Hybrid Isopod Crustaceans of the Species Asellus aquaticus

    PubMed Central

    Stahl, Bethany A.; Gross, Joshua B.; Speiser, Daniel I.; Oakley, Todd H.; Patel, Nipam H.; Gould, Douglas B.; Protas, Meredith E.

    2015-01-01

    Cave animals, compared to surface-dwelling relatives, tend to have reduced eyes and pigment, longer appendages, and enhanced mechanosensory structures. Pressing questions include how certain cave-related traits are gained and lost, and if they originate through the same or different genetic programs in independent lineages. An excellent system for exploring these questions is the isopod, Asellus aquaticus. This species includes multiple cave and surface populations that have numerous morphological differences between them. A key feature is that hybrids between cave and surface individuals are viable, which enables genetic crosses and linkage analyses. Here, we advance this system by analyzing single animal transcriptomes of Asellus aquaticus. We use high throughput sequencing of non-normalized cDNA derived from the head of a surface-dwelling male, the head of a cave-dwelling male, the head of a hybrid male (produced by crossing a surface individual with a cave individual), and a pooled sample of surface embryos and hatchlings. Assembling reads from surface and cave head RNA pools yielded an integrated transcriptome comprised of 23,984 contigs. Using this integrated assembly as a reference transcriptome, we aligned reads from surface-, cave- and hybrid- head tissue and pooled surface embryos and hatchlings. Our approach identified 742 SNPs and placed four new candidate genes to an existing linkage map for A. aquaticus. In addition, we examined SNPs for allele-specific expression differences in the hybrid individual. All of these resources will facilitate identification of genes and associated changes responsible for cave adaptation in A. aquaticus and, in concert with analyses of other species, will inform our understanding of the evolutionary processes accompanying adaptation to the subterranean environment. PMID:26462237

  10. Sequence of the hyperplastic genome of the naturally competent Thermus scotoductus SA-01

    PubMed Central

    2011-01-01

    Background Many strains of Thermus have been isolated from hot environments around the world. Thermus scotoductus SA-01 was isolated from fissure water collected 3.2 km below surface in a South African gold mine. The isolate is capable of dissimilatory iron reduction, growth with oxygen and nitrate as terminal electron acceptors and the ability to reduce a variety of metal ions, including gold, chromate and uranium, was demonstrated. The genomes from two different Thermus thermophilus strains have been completed. This paper represents the completed genome from a second Thermus species - T. scotoductus. Results The genome of Thermus scotoductus SA-01 consists of a chromosome of 2,346,803 bp and a small plasmid which, together are about 11% larger than the Thermus thermophilus genomes. The T. thermophilus megaplasmid genes are part of the T. scotoductus chromosome and extensive rearrangement, deletion of nonessential genes and acquisition of gene islands have occurred, leading to a loss of synteny between the chromosomes of T. scotoductus and T. thermophilus. At least nine large inserts of which seven were identified as alien, were found, the most remarkable being a denitrification cluster and two operons relating to the metabolism of phenolics which appear to have been acquired from Meiothermus ruber. The majority of acquired genes are from closely related species of the Deinococcus-Thermus group, and many of the remaining genes are from microorganisms with a thermophilic or hyperthermophilic lifestyle. The natural competence of Thermus scotoductus was confirmed experimentally as expected as most of the proteins of the natural transformation system of Thermus thermophilus are present. Analysis of the metabolic capabilities revealed an extensive energy metabolism with many aerobic and anaerobic respiratory options. An abundance of sensor histidine kinases, response regulators and transporters for a wide variety of compounds are indicative of an oligotrophic lifestyle. Conclusions The genome of Thermus scotoductus SA-01 shows remarkable plasticity with the loss, acquisition and rearrangement of large portions of its genome compared to Thermus thermophilus. Its ability to naturally take up foreign DNA has helped it adapt rapidly to a subsurface lifestyle in the presence of a dense and diverse population which acted as source of nutrients. The genome of Thermus scotoductus illustrates how rapid adaptation can be achieved by a highly dynamic and plastic genome. PMID:22115438

  11. Exploration of Deinococcus-Thermus molecular diversity by novel group-specific PCR primers

    PubMed Central

    Theodorakopoulos, Nicolas; Bachar, Dipankar; Christen, Richard; Alain, Karine; Chapon, Virginie

    2013-01-01

    The deeply branching Deinococcus-Thermus lineage is recognized as one of the most extremophilic phylum of bacteria. In previous studies, the presence of Deinococcus-related bacteria in the hot arid Tunisian desert of Tataouine was demonstrated through combined molecular and culture-based approaches. Similarly, Thermus-related bacteria have been detected in Tunisian geothermal springs. The present work was conducted to explore the molecular diversity within the Deinococcus-Thermus phylum in these extreme environments. A set of specific primers was designed in silico on the basis of 16S rRNA gene sequences, validated for the specific detection of reference strains, and used for the polymerase chain reaction (PCR) amplification of metagenomic DNA retrieved from the Tataouine desert sand and Tunisian hot spring water samples. These analyses have revealed the presence of previously undescribed Deinococcus-Thermus bacterial sequences within these extreme environments. The primers designed in this study thus represent a powerful tool for the rapid detection of Deinococcus-Thermus in environmental samples and could also be applicable to clarify the biogeography of the Deinococcus-Thermus phylum. PMID:23996915

  12. Analysis of genomic rearrangements, horizontal gene transfer and role of plasmids in the evolution of industrial important Thermus species.

    PubMed

    Kumwenda, Benjamin; Litthauer, Derek; Reva, Oleg

    2014-09-25

    Bacteria of genus Thermus inhabit both man-made and natural thermal environments. Several Thermus species have shown biotechnological potential such as reduction of heavy metals which is essential for eradication of heavy metal pollution; removing of organic contaminants in water; opening clogged pipes, controlling global warming among many others. Enzymes from thermophilic bacteria have exhibited higher activity and stability than synthetic or enzymes from mesophilic organisms. Using Meiothermus silvanus DSM 9946 as a reference genome, high level of coordinated rearrangements has been observed in extremely thermophilic Thermus that may imply existence of yet unknown evolutionary forces controlling adaptive re-organization of whole genomes of thermo-extremophiles. However, no remarkable differences were observed across species on distribution of functionally related genes on the chromosome suggesting constraints imposed by metabolic networks. The metabolic network exhibit evolutionary pressures similar to levels of rearrangements as measured by the cross-clustering index. Using stratigraphic analysis of donor-recipient, intensive gene exchanges were observed from Meiothermus species and some unknown sources to Thermus species confirming a well established DNA uptake mechanism as previously proposed. Global genome rearrangements were found to play an important role in the evolution of Thermus bacteria at both genomic and metabolic network levels. Relatively higher level of rearrangements was observed in extremely thermophilic Thermus strains in comparison to the thermo-tolerant Thermus scotoductus. Rearrangements did not significantly disrupt operons and functionally related genes. Thermus species appeared to have a developed capability for acquiring DNA through horizontal gene transfer as shown by the donor-recipient stratigraphic analysis.

  13. In vivo monitoring of cellular energy metabolism using SoNar, a highly responsive sensor for NAD(+)/NADH redox state.

    PubMed

    Zhao, Yuzheng; Wang, Aoxue; Zou, Yejun; Su, Ni; Loscalzo, Joseph; Yang, Yi

    2016-08-01

    NADH and its oxidized form NAD(+) have a central role in energy metabolism, and their concentrations are often considered to be among the most important readouts of metabolic state. Here, we present a detailed protocol to image and monitor NAD(+)/NADH redox state in living cells and in vivo using a highly responsive, genetically encoded fluorescent sensor known as SoNar (sensor of NAD(H) redox). The chimeric SoNar protein was initially developed by inserting circularly permuted yellow fluorescent protein (cpYFP) into the NADH-binding domain of Rex protein from Thermus aquaticus (T-Rex). It functions by binding to either NAD(+) or NADH, thus inducing protein conformational changes that affect its fluorescent properties. We first describe steps for how to establish SoNar-expressing cells, and then discuss how to use the system to quantify the intracellular redox state. This approach is sensitive, accurate, simple and able to report subtle perturbations of various pathways of energy metabolism in real time. We also detail the application of SoNar to high-throughput chemical screening of candidate compounds targeting cell metabolism in a microplate-reader-based assay, along with in vivo fluorescence imaging of tumor xenografts expressing SoNar in mice. Typically, the approximate time frame for fluorescence imaging of SoNar is 30 min for living cells and 60 min for living mice. For high-throughput chemical screening in a 384-well-plate assay, the whole procedure generally takes no longer than 60 min to assess the effects of 380 compounds on cell metabolism.

  14. Rational protein engineering in action: The first crystal structure of a phenylalanine tRNA synthetase from Staphylococcus haemolyticus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Evdokimov, Artem G.; Mekel, Marlene; Hutchings, Kim

    2008-07-08

    In this article, we describe for the first time the high-resolution crystal structure of a phenylalanine tRNA synthetase from the pathogenic bacterium Staphylococcus haemolyticus. We demonstrate the subtle yet important structural differences between this enzyme and the previously described Thermus thermophilus ortholog. We also explain the structure-activity relationship of several recently reported inhibitors. The native enzyme crystals were of poor quality -- they only diffracted X-rays to 3--5 {angstrom} resolution. Therefore, we have executed a rational surface mutagenesis strategy that has yielded crystals of this 2300-amino acid multidomain protein, diffracting to 2 {angstrom} or better. This methodology is discussed andmore » contrasted with the more traditional domain truncation approach.« less

  15. A new method for early assessment of effects of exposing two non-target crustacean species, Asellus aquaticus and Gammarus fossarum, to pesticides, a laboratory study.

    PubMed

    Lukancic, Simon; Zibrat, Uros; Mezek, Tadej; Jerebic, Andreja; Simcic, Tatjana; Brancelj, Anton

    2010-05-01

    A reliable method is needed for assessing the condition of aquatic animals and their resistance to toxic pollutants. The physiological responses of two freshwater crustaceans, Asellus aquaticus and Gammarus fossarum, following in vitro exposure to two pesticides (atrazine and imidacloprid), were measured by a combination of electron transport system (ETS) activity and respiration (R). Short-term exposure concentrations were selected according to standard toxicity tests and ranged from 0.01 mg L(-1) to 10 mg L(-1). When pesticide concentration was greater than 1 mg l(- 1) (which is below the LC(50) [48 hours] determined for both species), A. aquaticus and G. fossarum responded to short-term exposure with elevated levels of R and/or lower levels of ETS activity. One hour exposure to concentrations of up to 10 mg L(-1) showed an effect in both test species. Laboratory tests confirmed that G. fossarum is more sensitive to short-term pesticide exposure than A. aquaticus. The combination of these two methods provides a useful and effective tool for assessing the general condition of aquatic animals. It also enables to determine toxic effects on freshwater biota of specific or combined pollutants. ETS/R ratio may be used as a quick predictor of effects on organisms exposed to pesticides and other stress factors such as changes in temperature, light, salinity, oxygen concentration and food.

  16. Complete Genome Analysis of Thermus parvatiensis and Comparative Genomics of Thermus spp. Provide Insights into Genetic Variability and Evolution of Natural Competence as Strategic Survival Attributes

    PubMed Central

    Tripathi, Charu; Mishra, Harshita; Khurana, Himani; Dwivedi, Vatsala; Kamra, Komal; Negi, Ram K.; Lal, Rup

    2017-01-01

    Thermophilic environments represent an interesting niche. Among thermophiles, the genus Thermus is among the most studied genera. In this study, we have sequenced the genome of Thermus parvatiensis strain RL, a thermophile isolated from Himalayan hot water springs (temperature >96°C) using PacBio RSII SMRT technique. The small genome (2.01 Mbp) comprises a chromosome (1.87 Mbp) and a plasmid (143 Kbp), designated in this study as pTP143. Annotation revealed a high number of repair genes, a squeezed genome but containing highly plastic plasmid with transposases, integrases, mobile elements and hypothetical proteins (44%). We performed a comparative genomic study of the group Thermus with an aim of analysing the phylogenetic relatedness as well as niche specific attributes prevalent among the group. We compared the reference genome RL with 16 Thermus genomes to assess their phylogenetic relationships based on 16S rRNA gene sequences, average nucleotide identity (ANI), conserved marker genes (31 and 400), pan genome and tetranucleotide frequency. The core genome of the analyzed genomes contained 1,177 core genes and many singleton genes were detected in individual genomes, reflecting a conserved core but adaptive pan repertoire. We demonstrated the presence of metagenomic islands (chromosome:5, plasmid:5) by recruiting raw metagenomic data (from the same niche) against the genomic replicons of T. parvatiensis. We also dissected the CRISPR loci wide all genomes and found widespread presence of this system across Thermus genomes. Additionally, we performed a comparative analysis of competence loci wide Thermus genomes and found evidence for recent horizontal acquisition of the locus and continued dispersal among members reflecting that natural competence is a beneficial survival trait among Thermus members and its acquisition depicts unending evolution in order to accomplish optimal fitness. PMID:28798737

  17. Identification of novel esterase-active enzymes from hot environments by use of the host bacterium Thermus thermophilus.

    PubMed

    Leis, Benedikt; Angelov, Angel; Mientus, Markus; Li, Haijuan; Pham, Vu T T; Lauinger, Benjamin; Bongen, Patrick; Pietruszka, Jörg; Gonçalves, Luís G; Santos, Helena; Liebl, Wolfgang

    2015-01-01

    Functional metagenomic screening strategies, which are independent of known sequence information, can lead to the identification of truly novel genes and enzymes. Since E. coli has been used exhaustively for this purpose as a host, it is important to establish alternative expression hosts and to use them for functional metagenomic screening for new enzymes. In this study we show that Thermus thermophilus HB27 is an excellent screening host and can be used as an alternative provider of truly novel biocatalysts. In a previous study we constructed mutant strain BL03 with multiple markerless deletions in genes for major extra- and intracellular lipolytic activities. This esterase-diminished strain was no longer able to grow on defined minimal medium supplemented with tributyrin as the sole carbon source and could be used as a host to screen for metagenomic DNA fragments that could complement growth on tributyrin. Several thousand single fosmid clones from thermophilic metagenomic libraries from heated compost and hot spring water samples were subjected to a comparative screening for esterase activity in both T. thermophilus strain BL03 and E. coli EPI300. We scored a greater number of active esterase clones in the thermophilic bacterium than in the mesophilic E. coli. From several thousand functionally screened clones only two thermostable α/β-fold hydrolase enzymes with high amino acid sequence similarity to already characterized enzymes were identifiable in E. coli. In contrast, five further fosmids were found that conferred lipolytic activities in T. thermophilus only. Four open reading frames (ORFs) were found which did not share significant similarity to known esterase enzymes but contained the conserved GXSXG motif regularly found in lipolytic enzymes. Two of the genes were expressed in both hosts and the novel thermophilic esterases, which based on their primary structures could not be assigned to known esterase or lipase families, were purified and preliminarily characterized. Our work underscores the benefit of using additional screening hosts other than E. coli for the identification of novel biocatalysts with industrial relevance.

  18. Crystallization and preliminary X-ray diffraction analysis of recombinant phosphoribosylpyrophosphate synthetase from the Thermophilic thermus thermophilus strain HB27

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Abramchik, Yu. A.; Timofeev, V. I., E-mail: tostars@mail.ru; Muravieva, T. I.

    2017-01-15

    Phosphoribosylpyrophosphate synthetases (PRPP synthetases) are among the key enzymes essential for vital functions of organisms and are involved in the biosynthesis of purine and pyrimidine nucleotides, coenzymes, and the amino acids histidine and tryptophan. These enzymes are used in biotechnology for the combined chemoenzymatic synthesis of natural nucleotide analogs. Recombinant phosphoribosylpyrophosphate synthetase I from the thermophilic strain HB27 of the bacterium Thermus thermophilus (T. th HB27) has high thermal stability and shows maximum activity at 75°Ð¡, due to which this enzyme holds promise for biotechnological applications. In order to grow crystals and study them by X-ray crystallography, an enzyme sample,more » which was produced using a highly efficient producer strain, was purified by affinity and gel-filtration chromatography. The screening of crystallization conditions was performed by the vapor-diffusion technique. The crystals of the enzyme suitable for X-ray diffraction were grown by the counter-diffusion method through a gel layer. These crystals were used to collect the X-ray diffraction data set at the SPring-8 synchrotron radiation facility (Japan) to 3-Å resolution. The crystals belong to sp. gr. P2{sub 1} and have the following unitcell parameters: a = 107.7 Å, b = 112.6 Å, c = 110.2 Å, α = γ = 90°, β = 116.6°. The X-ray diffraction data set is suitable for determining the three-dimensional structure of the enzyme at 3.0-Å resolution.« less

  19. Crystallization and preliminary X-ray diffraction analysis of recombinant phosphoribosylpyrophosphate synthetase from the Thermophilic thermus thermophilus strain HB27

    NASA Astrophysics Data System (ADS)

    Abramchik, Yu. A.; Timofeev, V. I.; Muravieva, T. I.; Sinitsyna, E. V.; Esipov, R. S.; Kuranova, I. P.

    2017-01-01

    Phosphoribosylpyrophosphate synthetases (PRPP synthetases) are among the key enzymes essential for vital functions of organisms and are involved in the biosynthesis of purine and pyrimidine nucleotides, coenzymes, and the amino acids histidine and tryptophan. These enzymes are used in biotechnology for the combined chemoenzymatic synthesis of natural nucleotide analogs. Recombinant phosphoribosylpyrophosphate synthetase I from the thermophilic strain HB27 of the bacterium Thermus thermophilus ( T. th HB27) has high thermal stability and shows maximum activity at 75°C, due to which this enzyme holds promise for biotechnological applications. In order to grow crystals and study them by X-ray crystallography, an enzyme sample, which was produced using a highly efficient producer strain, was purified by affinity and gel-filtration chromatography. The screening of crystallization conditions was performed by the vapor-diffusion technique. The crystals of the enzyme suitable for X-ray diffraction were grown by the counter-diffusion method through a gel layer. These crystals were used to collect the X-ray diffraction data set at the SPring-8 synchrotron radiation facility (Japan) to 3-Å resolution. The crystals belong to sp. gr. P21 and have the following unitcell parameters: a = 107.7 Å, b = 112.6 Å, c = 110.2 Å, α = γ = 90°, β = 116.6°. The X-ray diffraction data set is suitable for determining the three-dimensional structure of the enzyme at 3.0-Å resolution.

  20. Crystallization and preliminary X-ray diffraction study of recombinant adenine phosphoribosyltransferase from the thermophilic bacterium Thermus thermophilus strain HB27

    NASA Astrophysics Data System (ADS)

    Sinitsyna, E. V.; Timofeev, V. I.; Tuzova, E. S.; Kostromina, M. A.; Murav'eva, T. I.; Esipov, R. S.; Kuranova, I. P.

    2017-07-01

    Adenine phosphoribosyltransferase (APRT) belongs to the type I phosphoribosyltransferase family and catalyzes the formation of adenosine monophosphate via transfer of the 5-phosphoribosyl group from phosphoribosyl pyrophosphate to the nitrogen atom N9 of the adenine base. Proteins of this family are involved in a salvage pathway of nucleotide synthesis, thus providing purine base utilization and maintaining the optimal level of purine bases in the body. Adenine phosphoribosyltransferase from the extremely thermophilic Thermus thermophilus strain HB27 was produced using a highly efficient E. coli producer strain and was then purified by affinity and gel-filtration chromatography. This enzyme was successfully employed as a catalyst for the cascade biosynthesis of biologically important nucleotides. The screening of crystallization conditions for recombinant APRT from T. thermophilus HB27 was performed in order to determine the enzyme structure by X-ray diffraction. The crystallization conditions, which were found by the vapor-diffusion technique, were then optimized to apply the counter-diffusion technique. The crystals of the enzyme were grown by the capillary counter-diffusion method. The crystals belong to sp. gr. P1211 and have the following unitcell parameters: a = 69.86 Å, b = 82.16 Å, c = 91.39 Å, α = γ = 90°, β = 102.58°. The X-ray diffraction data set suitable for the determination of the APRT structure at 2.6 Å resolution was collected from the crystals at the SPring-8 synchrotron facility (Japan).

  1. Extension of base mispairs by Taq DNA polymerase: implications for single nucleotide discrimination in PCR.

    PubMed Central

    Huang, M M; Arnheim, N; Goodman, M F

    1992-01-01

    Thermus aquaticus (Taq) DNA polymerase was used to measure the extension efficiency for all configurations of matched and mismatched base pairs at template-primer 3'-termini. The transition mispairs, A(primer).C, C.A, G.T, and T.G were extended 10(-3) to 10(-4)-fold less efficiently than their correctly paired counterparts. Relative efficiencies for extending transversion mispairs were 10(-4) to 10(-5) for T.C and T.T, about 10(-6) for A.A, and less than 10(-6) for G.A, A.G, G.G and C.C. The transversion mispair C(primer).T was extended with high efficiency, about 10(-2) compared to a correct A.T basepair. The unexpected ease of extending the C.T mismatch was not likely to have been caused by primer-template misalignment. Taq polymerase was observed to bind with similar affinities to each of the correctly paired and mispaired primer-template 3'-ends. Thus, the failure of Taq polymerase to extend mismatches efficiently appears to be an intrinsic property of the enzyme and not due to an inability to bind to 3'-terminal mispairs. For almost all of the mispairs, C.T being the exception, Taq polymerase exhibits about 100 to 1000-fold greater discrimination against mismatch extension compared to avian myeloblastosis reverse transcriptase and HIV-1 reverse transcriptase which extend most mismatched basepairs permissively. Relative mismatch extension efficiencies for Taq polymerase were measured at 45 degrees C, 55 degrees C and 70 degrees C and found to be independent of temperature. The mispair extension data should be important in designing experiments using PCR to distinguish between sequences that vary by a single nucleotide. Images PMID:1408758

  2. Recent applications of THERMUS

    NASA Astrophysics Data System (ADS)

    Wheaton, S.; Hauer, M.

    2011-12-01

    Some of the most recent applications of the statistical-thermal model package, THERMUS, are reviewed. These applications focus on fluctuation and correlation observables in an ideal particle and anti-particle gas in limited momentum space segments, as well as in a hadron resonance gas. In the case of the latter, a Monte Carlo event generator, utilising THERMUS functionality and assuming thermal production of hadrons, is discussed. The system under consideration is sampled grand canonically in the Boltzmann approximation. A re-weighting scheme is then introduced to account for conservation of charges (baryon number, strangeness, electric charge) and energy and momentum, effectively allowing for extrapolation of grand canonical results to the micro canonical limit. The approach utilised in this and other applications suggests improvements to existing THERMUS calculations.

  3. Phylogenetic analysis of several Thermus strains from Rehai of Tengchong, Yunnan, China.

    PubMed

    Lin, Lianbing; Zhang, Jie; Wei, Yunlin; Chen, Chaoyin; Peng, Qian

    2005-10-01

    Several Thermus strains were isolated from 10 hot springs of the Rehai geothermal area in Tengchong, Yunnan province. The diversity of Thermus strains was examined by sequencing the 16S rRNA genes and comparing their sequences. Phylogenetic analysis showed that the 16S rDNA sequences from the Rehai geothermal isolates form four branches in the phylogenetic tree and had greater than 95.9% similarity in the phylogroup. Secondary structure comparison also indicated that the 16S rRNA from the Rehai geothermal isolates have unique secondary structure characteristics in helix 6, helix 9, and helix 10 (reference to Escherichia coli). This research is the first attempt to reveal the diversity of Thermus strains that are distributed in the Rehai geothermal area.

  4. Characterization of a promiscuous cadmium and arsenic resistance mechanism in Thermus thermophilus HB27 and potential application of a novel bioreporter system.

    PubMed

    Antonucci, Immacolata; Gallo, Giovanni; Limauro, Danila; Contursi, Patrizia; Ribeiro, Ana Luisa; Blesa, Alba; Berenguer, José; Bartolucci, Simonetta; Fiorentino, Gabriella

    2018-05-18

    The characterization of the molecular determinants of metal resistance has potential biotechnological application in biosensing and bioremediation. In this context, the bacterium Thermus thermophilus HB27 is a metal tolerant thermophile containing a set of genes involved in arsenic resistance which, differently from other microbes, are not organized into a single operon. They encode the proteins: arsenate reductase, TtArsC, arsenic efflux membrane transporter, TtArsX, and transcriptional repressor, TtSmtB. In this work we show that the arsenic efflux protein TtArsX and the arsenic responsive transcriptional repressor TtSmtB are required to provide resistance to cadmium. We analyzed the sensitivity to Cd(II) of mutants lacking TtArsX, finding that they are more sensitive to this metal than the wild type strain. In addition, using promoter probe reporter plasmids, we show that the transcription of TtarsX is also stimulated by the presence of Cd(II) in a TtSmtB-dependent way. Actually, a regulatory circuit composed of TtSmtB and a reporter gene expressed from the TtarsX promoter responds to variation in Cd(II), As(III) and As(V) concentrations. Our results demonstrate that the system composed by TtSmtB and TtArsX is responsible for both the arsenic and cadmium resistance in T. thermophilus. The data also support the use of T. thermophilus as a suitable chassis for the design and development of As-Cd biosensors.

  5. Bioenergetics at extreme temperature: Thermus thermophilus ba(3)- and caa(3)-type cytochrome c oxidases.

    PubMed

    Radzi Noor, Mohamed; Soulimane, Tewfik

    2012-04-01

    Seven years into the completion of the genome sequencing projects of the thermophilic bacterium Thermus thermophilus strains HB8 and HB27, many questions remain on its bioenergetic mechanisms. A key fact that is occasionally overlooked is that oxygen has a very limited solubility in water at high temperatures. The HB8 strain is a facultative anaerobe whereas its relative HB27 is strictly aerobic. This has been attributed to the absence of nitrate respiration genes from the HB27 genome that are carried on a mobilizable but highly-unstable plasmid. In T. thermophilus, the nitrate respiration complements the primary aerobic respiration. It is widely known that many organisms encode multiple biochemically-redundant components of the respiratory complexes. In this minireview, the presence of the two cytochrome c oxidases (CcO) in T. thermophilus, the ba(3)- and caa(3)-types, is outlined along with functional considerations. We argue for the distinct evolutionary histories of these two CcO including their respective genetic and molecular organizations, with the caa(3)-oxidase subunits having been initially 'fused'. Coupled with sequence analysis, the ba(3)-oxidase crystal structure has provided evolutionary and functional information; for example, its subunit I is more closely related to archaeal sequences than bacterial and the substrate-enzyme interaction is hydrophobic as the elevated growth temperature weakens the electrostatic interactions common in mesophiles. Discussion on the role of cofactors in intra- and intermolecular electron transfer and proton pumping mechanism is also included. Copyright © 2011 Elsevier B.V. All rights reserved.

  6. Modes of Action of Acarbose Hydrolysis and Transglycosylation Catalyzed by a Thermostable Maltogenic Amylase, the Gene for Which Was Cloned from a Thermus Strain

    PubMed Central

    Kim, Tae-Jip; Kim, Myo-Jeong; Kim, Byung-Cheon; Kim, Jae-Cherl; Cheong, Tae-Kyou; Kim, Jung-Wan; Park, Kwan-Hwa

    1999-01-01

    A maltogenic amylase gene was cloned in Escherichia coli from a gram-negative thermophilic bacterium, Thermus strain IM6501. The gene encoded an enzyme (ThMA) with a molecular mass of 68 kDa which was expressed by the expression vector p6xHis119. The optimal temperature of ThMA was 60°C, which was higher than those of other maltogenic amylases reported so far. Thermal inactivation kinetic analysis of ThMA indicated that it was stabilized in the presence of 10 mM EDTA. ThMA harbored both hydrolysis and transglycosylation activities. It hydrolyzed β-cyclodextrin and starch mainly to maltose and pullulan to panose. ThMA not only hydrolyzed acarbose, an amylase inhibitor, to glucose and pseudotrisaccharide (PTS) but also transferred PTS to 17 sugar acceptors, including glucose, fructose, maltose, cellobiose, etc. Structural analysis of acarbose transfer products by using methylation, thin-layer chromatography, high-performance ion chromatography, and nuclear magnetic resonance indicated that PTS was transferred primarily to the C-6 of the acceptors and at lower degrees to the C-3 and/or C-4. The transglycosylation of sugar to methyl-α-d-glucopyranoside by forming an α-(1,3)-glycosidic linkage was demonstrated for the first time by using acarbose and ThMA. Kinetic analysis of the acarbose transfer products showed that the C-4 transfer product formed most rapidly but readily hydrolyzed, while the C-6 transfer product was stable and accumulated in the reaction mixture as the main product. PMID:10103262

  7. Antibacterial screening of Rumex species native to the Carpathian Basin and bioactivity-guided isolation of compounds from Rumex aquaticus.

    PubMed

    Orbán-Gyapai, Orsolya; Liktor-Busa, Erika; Kúsz, Norbert; Stefkó, Dóra; Urbán, Edit; Hohmann, Judit; Vasas, Andrea

    2017-04-01

    Plants belonging to the genus Rumex (family Polygonaceae) are used worldwide in traditional medicine for the treatment of various diseases caused by different microorganisms (e.g. bacteria-related dermatologic conditions, dysentery and enteritis). The present study focused on the antibacterial screening of Rumex species native to the Carpathian Basin, and isolation of compounds from one of the most efficient species, Rumex aquaticus. The antibacterial effects of n-hexane, chloroform and aqueous fractions of methanol extracts prepared from different parts of 14 Rumex species (R. acetosella, R. acetosa, R. alpinus, R. aquaticus, R. conglomeratus, R. crispus, R. hydrolapathum, R. obtusifolius subsp. obtusifolius, R. obtusifolius subsp. subalpinus, R. patientia, R. pulcher, R. scutatus, R. stenophyllus and R. thyrsiflorus) were investigated against Staphylococcus epidermidis, S. aureus, MRSA, Bacillus subtilis, Moraxella catarrhalis, Streptococcus pyogenes, S. pneumoniae, S. agalactiae, Pseudomonas aeruginosa, Escherichia coli and Klebsiella pneumoniae using the disc diffusion method. Mainly the n-hexane and chloroform extracts prepared from the roots of the plants displayed high antibacterial activity (inhibition zones>15mm) against one or more bacterial strains. The highly active extracts of the aerial part and root of R. aquaticus were subjected to a multistep separation procedure. 19 Compounds, among them naphthalenes (musizin, and its glucoside, torachrysone-glucoside, 2-methoxystypandrone), anthraquinones (emodin, chrysophanol, physcion, citreorosein, chrysophanol-8-O-glucoside), flavonoids (quercetin, quercetin-3,3'-dimethylether, isokaempferide, quercetin 3-O-arabinoside, quercetin 3-O-galactoside, catechin), stilbenes (resveratrol, piceid), and 1-stearoylglycerol were isolated from the plant. The antibacterial activities of isolated compounds were determined, and it was observed that especially naphthalenes exerted remarkable antibacterial effects against several bacterial strains. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. Isolation of Thermus strains from hot composts (60 to 80 degrees C).

    PubMed Central

    Beffa, T; Blanc, M; Lyon, P F; Vogt, G; Marchiani, M; Fischer, J L; Aragno, M

    1996-01-01

    High numbers (10(7) to 10(10) cells per g [dry weight]) of heterotrophic, gram-negative, rod-shaped, non-sporeforming, aerobic, thermophilic bacteria related to the genus Thermus were isolated from thermogenic composts at temperatures between 65 and 82 degrees C. These bacteria were present in different types of wastes (garden and kitchen wastes and sewage sludge) and in all the industrial composting systems studied (open-air windows, boxes with automated turning and aeration, and closed bioreactors with aeration). Isolates grew fast on a rich complex medium at temperatures between 40 and 80 degrees C, with optimum growth between 65 and 75 degrees C. Nutritional characteristics, total protein profiles, DNA-DNA hybridization (except strain JT4), and restriction fragment length polymorphism profiles of the DNAs coding for the 16S rRNAs (16S rDNAs) showed that Thermus strains isolated from hot composts were closely related to Thermus thermophilus HB8. These newly isolated T. thermophilus strains have probably adapted to the conditions in the hot-compost ecosystem. Heterotrophic, ovalspore-forming, thermophilic bacilli were also isolated from hot composts, but none of the isolates was able to grow at temperatures above 70 degrees C. This is the first report of hot composts as habitats for a high number of thermophilic bacteria related to the genus Thermus. Our study suggests that Thermus strains play an important role in organic-matter degradation during the thermogenic phase (65 to 80 degrees C) of the composting process. PMID:8633870

  9. A Key Enzyme of the NAD+ Salvage Pathway in Thermus thermophilus: Characterization of Nicotinamidase and the Impact of Its Gene Deletion at High Temperatures

    PubMed Central

    Taniguchi, Hironori; Sungwallek, Sathidaphorn; Chotchuang, Phatcharin; Okano, Kenji

    2017-01-01

    ABSTRACT NAD (NAD+) is a cofactor related to many cellular processes. This cofactor is known to be unstable, especially at high temperatures, where it chemically decomposes to nicotinamide and ADP-ribose. Bacteria, yeast, and higher organisms possess the salvage pathway for reconstructing NAD+ from these decomposition products; however, the importance of the salvage pathway for survival is not well elucidated, except for in pathogens lacking the NAD+ de novo synthesis pathway. Herein, we report the importance of the NAD+ salvage pathway in the thermophilic bacterium Thermus thermophilus HB8 at high temperatures. We identified the gene encoding nicotinamidase (TTHA0328), which catalyzes the first reaction of the NAD+ salvage pathway. This recombinant enzyme has a high catalytic activity against nicotinamide (Km of 17 μM, kcat of 50 s−1, kcat/Km of 3.0 × 103 s−1 · mM−1). Deletion of this gene abolished nicotinamide deamination activity in crude extracts of T. thermophilus and disrupted the NAD+ salvage pathway in T. thermophilus. Disruption of the salvage pathway led to the severe growth retardation at a higher temperature (80°C), owing to the drastic decrease in the intracellular concentrations of NAD+ and NADH. IMPORTANCE NAD+ and other nicotinamide cofactors are essential for cell metabolism. These molecules are unstable and decompose, even under the physiological conditions in most organisms. Thermophiles can survive at high temperatures where NAD+ decomposition is, in general, more rapid. This study emphasizes that NAD+ instability and its homeostasis can be one of the important factors for thermophile survival in extreme temperatures. PMID:28630126

  10. A Key Enzyme of the NAD+ Salvage Pathway in Thermus thermophilus: Characterization of Nicotinamidase and the Impact of Its Gene Deletion at High Temperatures.

    PubMed

    Taniguchi, Hironori; Sungwallek, Sathidaphorn; Chotchuang, Phatcharin; Okano, Kenji; Honda, Kohsuke

    2017-09-01

    NAD (NAD + ) is a cofactor related to many cellular processes. This cofactor is known to be unstable, especially at high temperatures, where it chemically decomposes to nicotinamide and ADP-ribose. Bacteria, yeast, and higher organisms possess the salvage pathway for reconstructing NAD + from these decomposition products; however, the importance of the salvage pathway for survival is not well elucidated, except for in pathogens lacking the NAD + de novo synthesis pathway. Herein, we report the importance of the NAD + salvage pathway in the thermophilic bacterium Thermus thermophilus HB8 at high temperatures. We identified the gene encoding nicotinamidase (TTHA0328), which catalyzes the first reaction of the NAD + salvage pathway. This recombinant enzyme has a high catalytic activity against nicotinamide ( K m of 17 μM, k cat of 50 s -1 , k cat / K m of 3.0 × 10 3 s -1 · mM -1 ). Deletion of this gene abolished nicotinamide deamination activity in crude extracts of T. thermophilus and disrupted the NAD + salvage pathway in T. thermophilus Disruption of the salvage pathway led to the severe growth retardation at a higher temperature (80°C), owing to the drastic decrease in the intracellular concentrations of NAD + and NADH. IMPORTANCE NAD + and other nicotinamide cofactors are essential for cell metabolism. These molecules are unstable and decompose, even under the physiological conditions in most organisms. Thermophiles can survive at high temperatures where NAD + decomposition is, in general, more rapid. This study emphasizes that NAD + instability and its homeostasis can be one of the important factors for thermophile survival in extreme temperatures. Copyright © 2017 American Society for Microbiology.

  11. Distinctive Protein Signatures Provide Molecular Markers and Evidence for the Monophyletic Nature of the Deinococcus-Thermus Phylum

    PubMed Central

    Griffiths, Emma; Gupta, Radhey S.

    2004-01-01

    The Deinococcus-Thermus group of species is currently recognized as a distinct phylum solely on the basis of their branching in 16S rRNA trees. No unique biochemical or molecular characteristics that can distinguish this group from all other bacteria are known at present. In this work, we describe eight conserved indels (viz., inserts or deletions) in seven widely distributed proteins that are distinctive characteristics of the Deinococcus-Thermus phylum but are not found in any other group of bacteria. The identified signatures include a 7-amino-acid (aa) insert in threonyl-tRNA synthetase, 1- and 3-aa inserts in the RNA polymerase β′ subunit, a 5-aa deletion in signal recognition particle (Ffh/SR54), a 2-aa insert in major sigma factor 70 (σ70), a 2-aa insert in seryl-tRNA synthetase (SerRS), a 1-aa insert in ribosomal protein L1, and a 2-aa insert in UvrA homologs. By using PCR primers for conserved regions, fragments of these genes were amplified from a number of Deinococcus-Thermus species, and all such fragments (except SerRS in Deinococcus proteolyticus) were found to contain the indicated signatures. The presence of these signatures in various species from all three known genera within this phylum, viz., Deinococcus, Thermus, and Meiothermus, provide evidence that they are likely distinctive characteristics of the entire phylum which were introduced in a common ancestor of this group. The signature in SerRS, which is absent in D. proteolyticus, was likely introduced after the branching of this species. Phylogenetic studies as well as the nature of the inserts in some of these proteins (viz., σ70 and SerRS) also support a sister group relationship between the Thermus and the Meiothermus genera. The identified signatures provide strong evidence for the monophyletic nature of the Deinococcus-Thermus phylum. These molecular markers should prove very useful in the identification of new species related to this group. PMID:15126471

  12. Molecular characterization of the group II chaperonin from the hyperthermophilic archaeum Pyrococcus horikoshii OT3.

    PubMed

    Okochi, Mina; Matsuzaki, Hiroki; Nomura, Tomoko; Ishii, Noriyuki; Yohda, Masafumi

    2005-04-01

    The group II chaperonin from the hyperthermophilic archaeum Pyrococcus horikoshii OT3 (PhCPN) and its functional cooperation with the cognate prefoldin were investigated. PhCPN existed as a homo-oligomer in a double-ring structure, which protected the citrate synthase of a porcine heart from thermal aggregation at 45 degrees C, and did the same on the isopropylmalate dehydrogenase (IPMDH) of a thermophilic bacterium, Thermus thermophilus HB8, at 90 degrees C. PhCPN also enhanced the refolding of green fluorescent protein (GFP), which had been unfolded by low pH, in an ATP-dependent manner. Unexpectedly, functional cooperation between PhCPN and Pyrococcus prefoldin (PhPFD) in the refolding of GFP was not observed. Instead, cooperation between PhCPN and PhPFD was observed in the refolding of IPMDH unfolded with guanidine hydrochloride. Although PhCPN alone was not effective in the refolding of IPMDH, the refolding efficiency was enhanced by the cooperation of PhCPN with PhPFD.

  13. Microbial community structure in a thermophilic aerobic digester used as a sludge pretreatment process for the mesophilic anaerobic digestion and the enhancement of methane production.

    PubMed

    Jang, Hyun Min; Park, Sang Kyu; Ha, Jeong Hyub; Park, Jong Moon

    2013-10-01

    An effective two-stage sewage sludge digestion process, consisting of thermophilic aerobic digestion (TAD) followed by mesophilic anaerobic digestion (MAD), was developed for efficient sludge reduction and methane production. Using TAD as a biological pretreatment, the total volatile suspended solid reduction (VSSR) and methane production rate (MPR) in the MAD reactor were significantly improved. According to denaturing gradient gel electrophoresis (DGGE) analysis, the results indicated that the dominant bacteria species such as Ureibacillus thermophiles and Bacterium thermus in TAD were major routes for enhancing soluble organic matter. TAD pretreatment using a relatively short SRT of 1 day showed highly increased soluble organic products and positively affected an increment of bacteria populations which performed interrelated microbial metabolisms with methanogenic species in the MAD; consequently, a quantitative real-time PCR indicated greatly increased Methanosarcinales (acetate-utilizing methanogens) in the MAD, resulting in enhanced methane production. Copyright © 2013 Elsevier Ltd. All rights reserved.

  14. Directed evolution for thermostabilization of a hygromycin B phosphotransferase from Streptomyces hygroscopicus.

    PubMed

    Sugimoto, Naohisa; Takakura, Yasuaki; Shiraki, Kentaro; Honda, Shinya; Takaya, Naoki; Hoshino, Takayuki; Nakamura, Akira

    2013-01-01

    To obtain a selection marker gene functional in a thermophilic bacterium, Thermus thermophilus, an in vivo-directed evolutionary strategy was conducted on a hygromycin B phosphotransferase gene (hyg) from Streptomyces hygroscopicus. The expression of wild-type hyg in T. thermophilus provided hygromycin B (HygB) resistance up to 60 °C. Through selection of mutants showing HygB resistance at higher temperatures, eight amino acid substitutions and the duplication of three amino acids were identified. A variant containing seven substitutions and the duplication (HYG10) showed HygB resistance at a highest temperature of 74 °C. Biochemical and biophysical analyses of recombinant HYG and HYG10 revealed that HYG10 was in fact thermostabilized. Modeling of the three-dimensional structure of HYG10 suggests the possible roles of the various substitutions and the duplication on thermostabilization, of which three substitutions and the duplication located at the enzyme surface suggested that these mutations made the enzyme more hydrophilic and provided increased stability in aqueous solution.

  15. No evidence of genome editing activity from Natronobacterium gregoryi Argonaute (NgAgo) in human cells.

    PubMed

    Javidi-Parsijani, Parisa; Niu, Guoguang; Davis, Meghan; Lu, Pin; Atala, Anthony; Lu, Baisong

    2017-01-01

    The argonaute protein from the thermophilic bacterium Thermus thermophilus shows DNA-guided DNA interfering activity at high temperatures, complicating its application in mammalian cells. A recent work reported that the argonaute protein from Natronobacterium gregoryi (NgAgo) had DNA-guided genome editing activity in mammalian cells. We compared the genome editing activities of NgAgo and Staphylococcus aureus Cas9 (SaCas9) in human HEK293T cells side by side. EGFP reporter assays and DNA sequencing consistently revealed high genome editing activity from SaCas9. However, these assays did not demonstrate genome editing activity by NgAgo. We confirmed that the conditions allowed simultaneous transfection of the NgAgo expressing plasmid DNA and DNA guides, as well as heterologous expression of NgAgo in the HEK293T cells. Our data show that NgAgo is not a robust genome editing tool, although it may have such activity under other conditions.

  16. THERMUS—A thermal model package for ROOT

    NASA Astrophysics Data System (ADS)

    Wheaton, S.; Cleymans, J.; Hauer, M.

    2009-01-01

    THERMUS is a package of C++ classes and functions allowing statistical-thermal model analyses of particle production in relativistic heavy-ion collisions to be performed within the ROOT framework of analysis. Calculations are possible within three statistical ensembles; a grand-canonical treatment of the conserved charges B, S and Q, a fully canonical treatment of the conserved charges, and a mixed-canonical ensemble combining a canonical treatment of strangeness with a grand-canonical treatment of baryon number and electric charge. THERMUS allows for the assignment of decay chains and detector efficiencies specific to each particle yield, which enables sensible fitting of model parameters to experimental data. Program summaryProgram title: THERMUS, version 2.1 Catalogue identifier: AEBW_v1_0 Program summary URL:http://cpc.cs.qub.ac.uk/summaries/AEBW_v1_0.html Program obtainable from: CPC Program Library, Queen's University, Belfast, N. Ireland Licensing provisions: Standard CPC licence, http://cpc.cs.qub.ac.uk/licence/licence.html No. of lines in distributed program, including test data, etc.: 17 152 No. of bytes in distributed program, including test data, etc.: 93 581 Distribution format: tar.gz Programming language: C++ Computer: PC, Pentium 4, 1 GB RAM (not hardware dependent) Operating system: Linux: FEDORA, RedHat, etc. Classification: 17.7 External routines: Numerical Recipes in C [1], ROOT [2] Nature of problem: Statistical-thermal model analyses of heavy-ion collision data require the calculation of both primordial particle densities and contributions from resonance decay. A set of thermal parameters (the number depending on the particular model imposed) and a set of thermalized particles, with their decays specified, is required as input to these models. The output is then a complete set of primordial thermal quantities for each particle, together with the contributions to the final particle yields from resonance decay. In many applications of statistical-thermal models it is required to fit experimental particle multiplicities or particle ratios. In such analyses, the input is a set of experimental yields and ratios, a set of particles comprising the assumed hadron resonance gas formed in the collision and the constraints to be placed on the system. The thermal model parameters consistent with the specified constraints leading to the best-fit to the experimental data are then output. Solution method: THERMUS is a package designed for incorporation into the ROOT [2] framework, used extensively by the heavy-ion community. As such, it utilizes a great deal of ROOT's functionality in its operation. ROOT features used in THERMUS include its containers, the wrapper TMinuit implementing the MINUIT fitting package, and the TMath class of mathematical functions and routines. Arguably the most useful feature is the utilization of CINT as the control language, which allows interactive access to the THERMUS objects. Three distinct statistical ensembles are included in THERMUS, while additional options to include quantum statistics, resonance width and excluded volume corrections are also available. THERMUS provides a default particle list including all mesons (up to the K4∗ (2045)) and baryons (up to the Ω) listed in the July 2002 Particle Physics Booklet [3]. For each typically unstable particle in this list, THERMUS includes a text-file listing its decays. With thermal parameters specified, THERMUS calculates primordial thermal densities either by performing numerical integrations or else, in the case of the Boltzmann approximation without resonance width in the grand-canonical ensemble, by evaluating Bessel functions. Particle decay chains are then used to evaluate experimental observables (i.e. particle yields following resonance decay). Additional detector efficiency factors allow fine-tuning of the model predictions to a specific detector arrangement. When parameters are required to be constrained, use is made of the 'Numerical Recipes in C' [1] function which applies the Broyden globally convergent secant method of solving nonlinear systems of equations. Since the NRC software is not freely-available, it has to be purchased by the user. THERMUS provides the means of imposing a large number of constraints on the chosen model (amongst others, THERMUS can fix the baryon-to-charge ratio of the system, the strangeness density of the system and the primordial energy per hadron). Fits to experimental data are accomplished in THERMUS by using the ROOT TMinuit class. In its default operation, the standard χ function is minimized, yielding the set of best-fit thermal parameters. THERMUS allows the assignment of separate decay chains to each experimental input. In this way, the model is able to match the specific feed-down corrections of a particular data set. Running time: Depending on the analysis required, run-times vary from seconds (for the evaluation of particle multiplicities given a set of parameters) to several minutes (for fits to experimental data subject to constraints). References:W.H. Press, S.A. Teukolsky, W.T. Vetterling, B.P. Flannery, Numerical Recipes in C: The Art of Scientific Computing, Cambridge University Press, Cambridge, 2002. R. Brun, F. Rademakers, Nucl. Inst. Meth. Phys. Res. A 389 (1997) 81. See also http://root.cern.ch/. K. Hagiwara et al., Phys. Rev. D 66 (2002) 010001.

  17. Directed evolution of DNA polymerase, RNA polymerase and reverse transcriptase activity in a single polypeptide.

    PubMed

    Ong, Jennifer L; Loakes, David; Jaroslawski, Szymon; Too, Kathleen; Holliger, Philipp

    2006-08-18

    DNA polymerases enable key technologies in modern biology but for many applications, native polymerases are limited by their stringent substrate recognition. Here we describe short-patch compartmentalized self-replication (spCSR), a novel strategy to expand the substrate spectrum of polymerases in a targeted way. spCSR is based on the previously described CSR, but unlike CSR only a short region (a "patch") of the gene under investigation is diversified and replicated. This allows the selection of polymerases under conditions where catalytic activity and processivity are compromised to the extent that full self-replication is inefficient. We targeted two specific motifs involved in substrate recognition in the active site of DNA polymerase I from Thermus aquaticus (Taq) and selected for incorporation of both ribonucleotide- (NTP) and deoxyribonucleotide-triphosphates (dNTPs) using spCSR. This allowed the isolation of multiple variants of Taq with apparent dual substrate specificity. They were able to synthesize RNA, while still retaining essentially wild-type (wt) DNA polymerase activity as judged by PCR. One such mutant (AA40: E602V, A608V, I614M, E615G) was able to incorporate both NTPs and dNTPs with the same catalytic efficiency as the wt enzyme incorporates dNTPs. AA40 allowed the generation of mixed RNA-DNA amplification products in PCR demonstrating DNA polymerase, RNA polymerase as well as reverse transcriptase activity within the same polypeptide. Furthermore, AA40 displayed an expanded substrate spectrum towards other 2'-substituted nucleotides and was able to synthesize nucleic acid polymers in which each base bore a different 2'-substituent. Our results suggest that spCSR will be a powerful strategy for the generation of polymerases with altered substrate specificity for applications in nano- and biotechnology and in the enzymatic synthesis of antisense and RNAi probes.

  18. Influence of grass pellet production on pyrrolizidine alkaloids occurring in Senecio aquaticus-infested grassland.

    PubMed

    Gottschalk, Christoph; Ostertag, Johannes; Meyer, Karsten; Gehring, Klaus; Thyssen, Stefan; Gareis, Manfred

    2018-04-01

    1,2-Dehydro-pyrrolizidine alkaloids (PA) and their N-oxides (PANO) exhibit acute and chronic toxic effects on the liver and other organs and therefore are a hazard for animal and human health. In certain regions of Germany, an increasing spread of Senecio spp. (ragwort) on grassland and farmland areas has been observed during the last years leading to a PA/PANO-contamination of feed and food of animal and plant origin. This project was carried out to elucidate whether the process of grass pellet production applying hot air drying influences the content of PA and PANO. Samples of hay (n = 22) and grass pellets (n = 28) originated from naturally infested grassland (around 10% and 30% dominance of Senecio aquaticus) and from a trial plot with around 50% dominance. Grass pellets were prepared from grass originating from exactly the same plots as the hay samples. The samples were analysed by liquid chromatography-tandem mass spectrometry for PA/PANO typically produced by this weed. The results of the study revealed that PA/PANO levels (predominantly sum of senecionine, seneciphylline, erucifoline and their N-oxides) in hay ranged between 2.1 and 12.6 mg kg -1 dry matter in samples with 10% and 30% dominance of S. aquaticus, respectively. Samples from the trial plot (50% dominance) had levels of up to 52.9 mg kg -1 . Notably, the hot air drying process during the production of grass pellets did not lead to a reduction of PA/PANO levels. Instead, the levels in grass pellets with 10% and 30% S. aquaticus ranged from 3.1 to 55.1 mg kg -1 . Grass pellets from the trial plot contained up to 96.8 mg kg -1 . In conclusion, hot air drying and grass pellet production did not affect PA/PANO contents in plant material and therefore, heat-dried products cannot be regarded as safe in view of the toxic potential of 1,2-dehydro-pyrrolizidine alkaloids.

  19. Thermus and the Pink Discoloration Defect in Cheese

    PubMed Central

    Quigley, Lisa; O’Sullivan, Daniel J.; Daly, David; O’Sullivan, Orla; Burdikova, Zuzana; Vana, Rostislav; Beresford, Tom P.; Ross, R. Paul; Fitzgerald, Gerald F.; McSweeney, Paul L. H.; Giblin, Linda

    2016-01-01

    ABSTRACT A DNA sequencing-based strategy was applied to study the microbiology of Continental-type cheeses with a pink discoloration defect. The basis for this phenomenon has remained elusive, despite decades of research. The bacterial composition of cheese containing the defect was compared to that of control cheese using 16S rRNA gene and shotgun metagenomic sequencing as well as quantitative PCR (qPCR). Throughout, it was apparent that Thermus, a carotenoid-producing genus, was present at higher levels in defect-associated cheeses than in control cheeses. Prompted by this finding and data confirming the pink discoloration to be associated with the presence of a carotenoid, a culture-based approach was employed, and Thermus thermophilus was successfully cultured from defect-containing cheeses. The link between Thermus and the pinking phenomenon was then established through the cheese defect equivalent of Koch’s postulates when the defect was recreated by the reintroduction of a T. thermophilus isolate to a test cheese during the manufacturing process. IMPORTANCE Pink discoloration in cheese is a defect affecting many cheeses throughout the world, leading to significant financial loss for the dairy industry. Despite decades of research, the cause of this defect has remained elusive. The advent of high-throughput, next-generation sequencing has revolutionized the field of food microbiology and, with respect to this study, provided a means of testing a possible microbial basis for this defect. In this study, a combined 16S rRNA, whole-genome sequencing, and quantitative PCR approach was taken. This resulted in the identification of Thermus, a carotenoid-producing thermophile, in defect-associated cheeses and the recreation of the problem in cheeses to which Thermus was added. This finding has the potential to lead to new strategies to eliminate this defect, and our method represents an approach that can be employed to investigate the role of microbes in other food defects of unknown origin. PMID:27822529

  20. Kinetics of Bacterial Growth on Chlorinated Aliphatic Compounds

    PubMed Central

    van den Wijngaard, Arjan J.; Wind, Richèle D.; Janssen, Dick B.

    1993-01-01

    With the pure bacterial cultures Ancylobacter aquaticus AD20 and AD25, Xanthobacter autotrophicus GJ10, and Pseudomonas sp. strain AD1, Monod kinetics was observed during growth in chemostat cultures on 1,2-dichloroethane (AD20, AD25, and GJ10), 2-chloroethanol (AD20 and GJ10), and 1,3-dichloro-2-propanol (AD1). Both the Michaelis-Menten constants (Km) of the first catabolic (dehalogenating) enzyme and the Monod half-saturation constants (Ks) followed the order 2-chloroethanol, 1,3-dichloro-2-propanol, epichlorohydrin, and 1,2-dichloroethane. The Ks values of strains GJ10, AD20, and AD25 for 1,2-dichloroethane were 260, 222, and 24 μM, respectively. The low Ks value of strain AD25 was correlated with a higher haloalkane dehalogenase content of this bacterium. The growth rates of strains AD20 and GJ10 in continuous cultures on 1,2-dichloroethane were higher than the rates predicted from the kinetics of the haloalkane dehalogenase and the concentration of the enzyme in the cells. The results indicate that the efficiency of chlorinated compound removal is indeed influenced by the kinetic properties and cellular content of the first catabolic enzyme. The cell envelope did not seem to act as a barrier for permeation of 1,2-dichloroethane. PMID:16348981

  1. Thermus caliditerrae sp. nov., a novel thermophilic species isolated from a geothermal area.

    PubMed

    Ming, Hong; Yin, Yi-Rui; Li, Shuai; Nie, Guo-Xing; Yu, Tian-Tian; Zhou, En-Min; Liu, Lan; Dong, Lei; Li, Wen-Jun

    2014-02-01

    Two thermophilic bacterial strains, designated YIM 77925(T) and YIM 77777, were isolated from two hot springs, one in the Hydrothermal Explosion (Shuirebaozhaqu) area and Frog Mouth Spring in Tengchong county, Yunnan province, south-western China. The taxonomic positions of the two isolates were investigated by a polyphasic approach. Cells of the two strains were Gram-stain-negative, aerobic and rod-shaped. They were able to grow at 50-70 °C, pH 6.0-8.0 and with a NaCl tolerance up to 0.5% (w/v). Colonies are circular, convex, non-transparent and produce yellow pigment. Phylogenetic analyses based on 16S rRNA gene sequences comparison clearly demonstrated that strains YIM 77925(T) and YIM 77777 represent members of the genus Thermus, and they also detected low-level similarities of 16S rRNA gene sequences (below 97%) compared with all other species in this genus. Their predominant menaquinone was MK-8. The genomic DNA G+C contents of strains YIM 77925(T) and YIM 77777 were 65.6 mol% and 67.2 mol%, respectively. Based on the results of physiological and biochemical tests and phylogenetic analyses, strains YIM 77925(T) and YIM 77777 could not be classified as representing any species of the genus Thermus with a validly published name. Thus the two strains are considered to represent a novel species of the genus Thermus, for which the name Thermus caliditerrae sp. nov. is proposed. The type strain is YIM 77925(T) ( = DSM 25901(T) = CCTCC 2012061(T)).

  2. Sampling method, storage and pretreatment of sediment affect AVS concentrations with consequences for bioassay responses.

    PubMed

    De Lange, H J; Van Griethuysen, C; Koelmans, A A

    2008-01-01

    Sediment treatment and sediment storage may alter sediment toxicity, and consequently biotic response. Purpose of our study was to combine these three aspects (treatment-toxicity-biotic response) in one integrated approach. We used Acid Volatile Sulfide (AVS) concentrations as a proxy of the disturbance of the sediment. AVS and Simultaneously Extracted Metal (SEM) concentrations were compared to bioassay responses with the freshwater benthic macroinvertebrate Asellus aquaticus. Storage conditions and sediment treatment affected AVS but not SEM levels. AVS can be used as a proxy for sediment disturbance. The best way to pretreat the sediment for use in a bioassay in order to maintain initial AVS conditions was to sample the sediment with an Ekman grab, immediately store it in a jar without headspace, and freeze it as soon as possible. In a survey using seven different sediments, bioassay responses of A. aquaticus were correlated with SEM and AVS characteristics.

  3. Complete Genome Sequence of Thermus thermophilus TMY, Isolated from a Geothermal Power Plant

    PubMed Central

    Fujino, Yasuhiro; Nagayoshi, Yuko; Ohshima, Toshihisa; Ogata, Seiya

    2017-01-01

    ABSTRACT Thermus thermophilus TMY (JCM 10668) was isolated from silica scale formed at a geothermal power plant in Japan. Here, we report the complete genome sequence for this strain, which contains a chromosomal DNA of 2,121,526 bp with 2,500 predicted genes and a pTMY plasmid of 19,139 bp, with 28 predicted genes. PMID:28153912

  4. Draft Genome Sequence of Thermus scotoductus Strain K1, Isolated from a Geothermal Spring in Karvachar, Nagorno Karabakh

    PubMed Central

    Saghatelyan, Ani; Poghosyan, Lianna

    2015-01-01

    The 2,379,636-bp draft genome sequence of Thermus scotoductus strain K1, isolated from geothermal spring outlet located in the Karvachar region in Nagorno Karabakh is presented. Strain K1 shares about 80% genome sequence similarity with T. scotoductus strain SA-01, recovered from a deep gold mine in South Africa. PMID:26564055

  5. High-Quality Draft Genomes from Thermus caliditerrae YIM 77777 and T. tengchongensis YIM 77401, Isolates from Tengchong, China

    DOE PAGES

    Mefferd, Chrisabelle C.; Zhou, En-Min; Yu, Tian-Tian; ...

    2016-04-28

    The draft genomes ofThermus  tengchongensisYIM 77401 andT. caliditerraeYIM 77777 are 2,562,314 and 2,218,114 bp and encode 2,726 and 2,305 predicted genes, respectively. Gene content and growth experiments demonstrate broad metabolic capacity, including starch hydrolysis, thiosulfate oxidation, arsenite oxidation, incomplete denitrification, and polysulfide reduction.

  6. Adjustment of Conformational Flexibility is a Key Event in the Thermal Adaptation of Proteins

    NASA Astrophysics Data System (ADS)

    Zavodszky, Peter; Kardos, Jozsef; Svingor, Adam; Petsko, Gregory A.

    1998-06-01

    3-Isopropylmalate dehydrogenase (IPMDH, E.C. 1.1.1.85) from the thermophilic bacterium Thermus thermophilus HB8 is homologous to IPMDH from the mesophilic Escherichia coli, but has an approximately 17 degrees C higher melting temperature. Its temperature optimum is 22-25 degrees C higher than that of the E. coli enzyme; however, it is hardly active at room temperature. The increased conformational rigidity required to stabilize the thermophilic enzyme against heat denaturation might explain its different temperature-activity profile. Hydrogen/deuterium exchange studies were performed on this thermophilic-mesophilic enzyme pair to compare their conformational flexibilities. It was found that Th. thermophilus IPMDH is significantly more rigid at room temperature than E. coli IPMDH, whereas the enzymes have nearly identical flexibilities under their respective optimal working conditions, suggesting that evolutionary adaptation tends to maintain a ``corresponding state'' regarding conformational flexibility. These observations confirm that conformational fluctuations necessary for catalytic function are restricted at room temperature in the thermophilic enzyme, suggesting a close relationship between conformational flexibility and enzyme function.

  7. Draft Genome Sequence of Thermus scotoductus Strain K1, Isolated from a Geothermal Spring in Karvachar, Nagorno Karabakh.

    PubMed

    Saghatelyan, Ani; Poghosyan, Lianna; Panosyan, Hovik; Birkeland, Nils-Kåre

    2015-11-12

    The 2,379,636-bp draft genome sequence of Thermus scotoductus strain K1, isolated from geothermal spring outlet located in the Karvachar region in Nagorno Karabakh is presented. Strain K1 shares about 80% genome sequence similarity with T. scotoductus strain SA-01, recovered from a deep gold mine in South Africa. Copyright © 2015 Saghatelyan et al.

  8. Complete Genome Sequence of Thermus thermophilus TMY, Isolated from a Geothermal Power Plant.

    PubMed

    Fujino, Yasuhiro; Nagayoshi, Yuko; Ohshima, Toshihisa; Ogata, Seiya; Doi, Katsumi

    2017-02-02

    Thermus thermophilus TMY (JCM 10668) was isolated from silica scale formed at a geothermal power plant in Japan. Here, we report the complete genome sequence for this strain, which contains a chromosomal DNA of 2,121,526 bp with 2,500 predicted genes and a pTMY plasmid of 19,139 bp, with 28 predicted genes. Copyright © 2017 Fujino et al.

  9. Synthesis of rare sugars with L-fuculose-1-phosphate aldolase (FucA) from Thermus thermophilus HB8.

    PubMed

    Li, Zijie; Cai, Li; Qi, Qingsheng; Styslinger, Thomas J; Zhao, Guohui; Wang, Peng George

    2011-09-01

    We report herein a one-pot four-enzyme approach for the synthesis of the rare sugars d-psicose, d-sorbose, l-tagatose, and l-fructose with aldolase FucA from a thermophilic source (Thermus thermophilus HB8). Importantly, the cheap starting material DL-GP (DL-glycerol 3-phosphate), was used to significantly reduce the synthetic cost. Copyright © 2011 Elsevier Ltd. All rights reserved.

  10. Reconstructing the anterior part of the nervous system of Gordius aquaticus (Nematomorpha, cycloneuralia) by a multimethodological approach.

    PubMed

    Henne, Stephan; Friedrich, Frank; Hammel, Jörg U; Sombke, Andy; Schmidt-Rhaesa, Andreas

    2017-01-01

    The Nematomorpha (horsehair worms) and Nematoda (round worms) are sister taxa (together Nematoida) and closely related to Scalidophora (Priapulida, Kinorhyncha, Loricifera). To date, all species were assumed to possess a specific brain type, i.e., the "cycloneuralian" brain that forms a ring-shaped neuropil around the pharynx and is composed of anteriorly and posteriorly located somata. However, descriptions of the nematomorph nervous system are rare and somewhat variable, calling in to question the validity of the cycloneuralian condition. To clarify whether there is a typical cycloneuralian pattern in the nematomorph brain, we investigated the anterior end of Gordius aquaticus with different methods: histology, immunohistochemistry and micro-CT analysis. Three-dimensional reconstructions were made from histological serial sections. The brain is composed of a central neuropil and a ring-shaped structure with associated somata. The unpaired ventral nerve cord emerges from the posteroventral part of the brain. A pharynx/esophagus is absent. In addition to the brain, a peripheral nerve plexus was detected. In summary, we interpret the architecture of the brain as potentially derived from a cycloneuralian structure, but being highly modified. The central position of the neuropil is possibly a consequence of the reduction of the anterior intestinal system as a result of the parasitic lifestyle. The ring-shaped arrangement of the somata may be a remnant of a cycloneuralian arrangement, after the two rings of somata (= cycloneuralian condition) either fused or one ring was reduced to form one massive ring-shaped structure in G. aquaticus. J. Morphol. 278:106-118, 2017. ©© 2016 Wiley Periodicals,Inc. © 2016 Wiley Periodicals, Inc.

  11. Draft Genome Sequence of Thermus sp. Strain RL, Isolated from a Hot Water Spring Located atop the Himalayan Ranges at Manikaran, India

    PubMed Central

    Dwivedi, Vatsala; Sangwan, Naseer; Nigam, Aeshna; Garg, Nidhi; Niharika, Neha; Khurana, Paramjit; Khurana, Jitendra P.

    2012-01-01

    Thermus sp. strain RL was isolated from a hot water spring (90°C to 98°C) at Manikaran, Himachal Pradesh, India. Here we report the draft genome sequence (20,36,600 bp) of this strain. The draft genome sequence consists of 17 contigs and 1,986 protein-coding sequences and has an average G+C content of 68.77%. PMID:22689228

  12. New approach to real-time nucleic acids detection: folding polymerase chain reaction amplicons into a secondary structure to improve cleavage of Förster resonance energy transfer probes in 5′-nuclease assays

    PubMed Central

    Kutyavin, Igor V.

    2010-01-01

    The article describes a new technology for real-time polymerase chain reaction (PCR) detection of nucleic acids. Similar to Taqman, this new method, named Snake, utilizes the 5′-nuclease activity of Thermus aquaticus (Taq) DNA polymerase that cleaves dual-labeled Förster resonance energy transfer (FRET) probes and generates a fluorescent signal during PCR. However, the mechanism of the probe cleavage in Snake is different. In this assay, PCR amplicons fold into stem–loop secondary structures. Hybridization of FRET probes to one of these structures leads to the formation of optimal substrates for the 5′-nuclease activity of Taq. The stem–loop structures in the Snake amplicons are introduced by the unique design of one of the PCR primers, which carries a special 5′-flap sequence. It was found that at a certain length of these 5′-flap sequences the folded Snake amplicons have very little, if any, effect on PCR yield but benefit many aspects of the detection process, particularly the signal productivity. Unlike Taqman, the Snake system favors the use of short FRET probes with improved fluorescence background. The head-to-head comparison study of Snake and Taqman revealed that these two technologies have more differences than similarities with respect to their responses to changes in PCR protocol, e.g. the variations in primer concentration, annealing time, PCR asymmetry. The optimal PCR protocol for Snake has been identified. The technology’s real-time performance was compared to a number of conventional assays including Taqman, 3′-MGB-Taqman, Molecular Beacon and Scorpion primers. The test trial showed that Snake supersedes the conventional assays in the signal productivity and detection of sequence variations as small as single nucleotide polymorphisms. Due to the assay’s cost-effectiveness and simplicity of design, the technology is anticipated to quickly replace all known conventional methods currently used for real-time nucleic acid detection. PMID:19969535

  13. Polybacterial community analysis in human conjunctiva through 16S rRNA gene libraries.

    PubMed

    Deepthi, KrishnanNair Geetha; Jayasudha, Rajagopalaboopathi; Girish, Rameshan Nair; Manikandan, Palanisamy; Ram, Rammohan; Narendran, Venkatapathy; Prabagaran, Solai Ramatchandirane

    2018-05-14

    The conjunctival sac of healthy human harbours a variety of microorganisms. When the eye is compromised, an occasional inadvertent spread happens to the adjacent tissue, resulting in bacterial ocular infections. Microbiological investigation of the conjunctival swab is one of the broadly used modality to study the aetiological agent of conjunctiva. However, most of the time such methods yield unsatisfactory results. Hence, the present study intends to identify the bacterial community in human conjunctiva of pre-operative subjects through 16S rRNA gene libraries. Out of 45 samples collected from preoperative patients undergoing cataract surgery, 36 libraries were constructed with bacterial nested-PCR-positive samples. The representative clones with unique restriction pattern were generated through Amplified Ribosomal DNA Restriction Analysis (ARDRA) which were sequenced for phylogenetic affiliation. A total of 211 representative clones were obtained which were distributed in phyla Actinobacteria, Firmicutes, α-Proteobacteria, β-Proteobacteria, γ-Proteobacteria, Bacteroidetes, and Deinococcus-Thermus. Findings revealed the presence of polybacterial community, especially in some cases even though no bacterium or a single bacterium alone was identified through cultivable method. Remarkably, we identified 17 species which have never been reported in any ocular infections. The sequencing data reported 6 unidentified bacteria suggesting the possibility of novel organisms in the sample. Since, polybacterial community has been identified consisting of both gram positive and gram negative bacteria, a broad spectrum antibiotic therapy is advisable to the patients who are undergoing cataract surgery. Consolidated effort would significantly improve a clear understanding of the nature of microbial community in the human conjunctiva which will promote administration of appropriate antibiotic regimen and also help in the development of oligonucleotide probes to screen the predominant pathogens for early predisposition. Copyright © 2018 Elsevier Ltd. All rights reserved.

  14. Insight into the transition between the open and closed conformations of Thermus thermophilus carboxypeptidase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Okai, Masahiko; Tokyo University of Marine Science and Technology, 4-5-7 Konan, Minato-ku, Tokyo 108-8477; Yamamura, Akihiro

    Carboxypeptidase cleaves the C-terminal amino acid residue from proteins and peptides. Here, we report the functional and structural characterizations of carboxypeptidase belonging to the M32 family from the thermophilic bacterium Thermus thermophilus HB8 (TthCP). TthCP exhibits a relatively broad specificity for both hydrophilic (neutral and basic) and hydrophobic (aliphatic and aromatic) residues at the C-terminus and shows optimal activity in the temperature range of 75–80 °C and in the pH range of 6.8–7.2. Enzyme activity was significantly enhanced by cobalt or cadmium and was moderately inhibited by Tris at 25 °C. We also determined the crystal structure of TthCP at 2.6 Å resolution.more » Two dimer types of TthCP are present in the crystal. One type consists of two subunits in different states, open and closed, with a C{sup α} RMSD value of 2.2 Å; the other type consists of two subunits in the same open state. This structure enables us to compare the open and closed states of an M32 carboxypeptidase. The TthCP subunit can be divided into two domains, L and S, which are separated by a substrate-binding groove. The L and S domains in the open state are almost identical to those in the closed state, with C{sup α} RMSD values of 0.84 and 0.53 Å, respectively, suggesting that the transition between the open and closed states proceeds with a large hinge-bending motion. The superimposition between the closed states of TthCP and BsuCP, another M32 family member, revealed that most putative substrate-binding residues in the grooves are oriented in the same direction. - Highlights: • The enzyme activity of TthCP was inhibited moderately by Tris molecule. • We solved the crystal structure of TthCP at 2.6 Å resolution. • The crystal structure of TthCP revealed both the open and closed conformations.« less

  15. Microhabitat Characteristics of sites used by swamp rabbits

    Treesearch

    Patrick A. Zollner; Winston P. Smith; Leonard A. Brennan

    2000-01-01

    The swamp rabbit (Sylvilagus aquaticus) is one of the least studied North American lagomorphs; a better understanding of the habitat types it uses will improve management of this species. We studied microhabitat characteristics of sites associated with specific behaviors of the swamp rabbit. During spring-summer (15 April-1 October) and fall-winter (...

  16. Environmental Assessment: Mid-Bay Bridge Connector

    DTIC Science & Technology

    2008-11-01

    Wood Duck Aix sponsa Pine Barrens Tree Frog Hyla andersonii Northern Bobwhite Colinus virginianus Red -winged Blackbird Agelaius phoenicius...Megaceryle alcyon Feral Pig Sus scrofa Eastern Mole Scalopus aquaticus Red shouldered Hawk Buteo lineatus Salt Marsh Rabbit Sylvilagus...include: the Red -cockaded Woodpecker (RCW), bald eagle, piping plover, Okaloosa darter, Gulf sturgeon, flatwoods salamander, Eastern indigo snake

  17. Rapid changes in genetic architecture of behavioural syndromes following colonization of a novel environment.

    PubMed

    Karlsson Green, K; Eroukhmanoff, F; Harris, S; Pettersson, L B; Svensson, E I

    2016-01-01

    Behavioural syndromes, that is correlated behaviours, may be a result from adaptive correlational selection, but in a new environmental setting, the trait correlation might act as an evolutionary constraint. However, knowledge about the quantitative genetic basis of behavioural syndromes, and the stability and evolvability of genetic correlations under different ecological conditions, is limited. We investigated the quantitative genetic basis of correlated behaviours in the freshwater isopod Asellus aquaticus. In some Swedish lakes, A. aquaticus has recently colonized a novel habitat and diverged into two ecotypes, presumably due to habitat-specific selection from predation. Using a common garden approach and animal model analyses, we estimated quantitative genetic parameters for behavioural traits and compared the genetic architecture between the ecotypes. We report that the genetic covariance structure of the behavioural traits has been altered in the novel ecotype, demonstrating divergence in behavioural correlations. Thus, our study confirms that genetic correlations behind behaviours can change rapidly in response to novel selective environments. © 2015 European Society For Evolutionary Biology. Journal of Evolutionary Biology © 2015 European Society For Evolutionary Biology.

  18. Thermal and Spectroscopic Characterization of a Proton Pumping Rhodopsin from an Extreme Thermophile*

    PubMed Central

    Tsukamoto, Takashi; Inoue, Keiichi; Kandori, Hideki; Sudo, Yuki

    2013-01-01

    So far retinylidene proteins (∼rhodopsin) have not been discovered in thermophilic organisms. In this study we investigated and characterized a microbial rhodopsin derived from the extreme thermophilic bacterium Thermus thermophilus, which lives in a hot spring at around 75 °C. The gene for the retinylidene protein, named thermophilic rhodopsin (TR), was chemically synthesized with codon optimization. The codon optimized TR protein was functionally expressed in the cell membranes of Escherichia coli cells and showed active proton transport upon photoillumination. Spectroscopic measurements revealed that the purified TR bound only all-trans-retinal as a chromophore and showed an absorption maximum at 530 nm. In addition, TR exhibited both photocycle kinetics and pH-dependent absorption changes, which are characteristic of rhodopsins. Of note, time-dependent thermal denaturation experiments revealed that TR maintained its absorption even at 75 °C, and the denaturation rate constant of TR was much lower than those of other proton pumping rhodopsins such as archaerhodopsin-3 (200 ×), Haloquadratum walsbyi bacteriorhodopsin (by 10-times), and Gloeobacter rhodopsin (100 ×). Thus, these results suggest that microbial rhodopsins are also distributed among thermophilic organisms and have high stability. TR should allow the investigation of the molecular mechanisms of ion transport and protein folding. PMID:23740255

  19. Thermal and spectroscopic characterization of a proton pumping rhodopsin from an extreme thermophile.

    PubMed

    Tsukamoto, Takashi; Inoue, Keiichi; Kandori, Hideki; Sudo, Yuki

    2013-07-26

    So far retinylidene proteins (∼rhodopsin) have not been discovered in thermophilic organisms. In this study we investigated and characterized a microbial rhodopsin derived from the extreme thermophilic bacterium Thermus thermophilus, which lives in a hot spring at around 75 °C. The gene for the retinylidene protein, named thermophilic rhodopsin (TR), was chemically synthesized with codon optimization. The codon optimized TR protein was functionally expressed in the cell membranes of Escherichia coli cells and showed active proton transport upon photoillumination. Spectroscopic measurements revealed that the purified TR bound only all-trans-retinal as a chromophore and showed an absorption maximum at 530 nm. In addition, TR exhibited both photocycle kinetics and pH-dependent absorption changes, which are characteristic of rhodopsins. Of note, time-dependent thermal denaturation experiments revealed that TR maintained its absorption even at 75 °C, and the denaturation rate constant of TR was much lower than those of other proton pumping rhodopsins such as archaerhodopsin-3 (200 ×), Haloquadratum walsbyi bacteriorhodopsin (by 10-times), and Gloeobacter rhodopsin (100 ×). Thus, these results suggest that microbial rhodopsins are also distributed among thermophilic organisms and have high stability. TR should allow the investigation of the molecular mechanisms of ion transport and protein folding.

  20. Microplastic Effect Thresholds for Freshwater Benthic Macroinvertebrates

    PubMed Central

    2018-01-01

    Now that microplastics have been detected in lakes, rivers, and estuaries all over the globe, evaluating their effects on biota has become an urgent research priority. This is the first study that aims at determining the effect thresholds for a battery of six freshwater benthic macroinvertebrates with different species traits, using a wide range of microplastic concentrations. Standardized 28 days single species bioassays were performed under environmentally relevant exposure conditions using polystyrene microplastics (20–500 μm) mixed with sediment at concentrations ranging from 0 to 40% sediment dry weight (dw). Microplastics caused no effects on the survival of Gammarus pulex, Hyalella azteca, Asellus aquaticus, Sphaerium corneum, and Tubifex spp. and no effects were found on the reproduction of Lumbriculus variegatus. No significant differences in growth were found for H. azteca, A. aquaticus, S. corneum, L. variegatus, and Tubifex spp. However, G. pulex showed a significant reduction in growth (EC10 = 1.07% sediment dw) and microplastic uptake was proportional with microplastic concentrations in sediment. These results indicate that although the risks of environmentally realistic concentrations of microplastics may be low, they still may affect the biodiversity and the functioning of aquatic communities which after all also depend on the sensitive species. PMID:29337537

  1. Combined effects of metal mixtures and predator stress on the freshwater isopod Asellus aquaticus.

    PubMed

    Van Ginneken, M; Blust, R; Bervoets, L

    2018-04-30

    Biotic stressors have been demonstrated to change the toxicity of pollutants. While the combined effects of predator cues and pesticides are well documented, the interaction of predator stress with metals is a topic that has remained largely unexplored. In this laboratory experiment, the freshwater isopod Asellus aquaticus is exposed to predator cues and metal mixtures of Cd, Cu and Pb. We examined the effects on growth, respiration and, as behavioral parameters, feeding rate and activity. These were linked to the free ion activities (FIAs) in the water and the metal body concentrations. The findings reveal that Cu accumulation significantly influenced the growth rate, the feeding rate and the activity of isopods exposed to predator stress. Furthermore, we found a concentration-dependent interaction of the Cd + Pb mixtures on the feeding rate and a lower feeding rate for Cd and Pb predator exposed asellids. As several interactions were found between metals and predator stress, it demonstrates the importance of investigating how organisms and whole ecosystems respond to multiple stressors. A better understanding of these interactions will undoubtedly improve risk assessment and management. Copyright © 2018 Elsevier B.V. All rights reserved.

  2. Microplastic Effect Thresholds for Freshwater Benthic Macroinvertebrates.

    PubMed

    Redondo-Hasselerharm, Paula E; Falahudin, Dede; Peeters, Edwin T H M; Koelmans, Albert A

    2018-02-20

    Now that microplastics have been detected in lakes, rivers, and estuaries all over the globe, evaluating their effects on biota has become an urgent research priority. This is the first study that aims at determining the effect thresholds for a battery of six freshwater benthic macroinvertebrates with different species traits, using a wide range of microplastic concentrations. Standardized 28 days single species bioassays were performed under environmentally relevant exposure conditions using polystyrene microplastics (20-500 μm) mixed with sediment at concentrations ranging from 0 to 40% sediment dry weight (dw). Microplastics caused no effects on the survival of Gammarus pulex, Hyalella azteca, Asellus aquaticus, Sphaerium corneum, and Tubifex spp. and no effects were found on the reproduction of Lumbriculus variegatus. No significant differences in growth were found for H. azteca, A. aquaticus, S. corneum, L. variegatus, and Tubifex spp. However, G. pulex showed a significant reduction in growth (EC 10 = 1.07% sediment dw) and microplastic uptake was proportional with microplastic concentrations in sediment. These results indicate that although the risks of environmentally realistic concentrations of microplastics may be low, they still may affect the biodiversity and the functioning of aquatic communities which after all also depend on the sensitive species.

  3. Functional expression of a penicillin acylase from the extreme thermophile Thermus thermophilus HB27 in Escherichia coli

    PubMed Central

    2012-01-01

    Background Penicillin acylases (PACs) are enzymes of industrial relevance in the manufacture of β-lactam antibiotics. Development of a PAC with a longer half-life under the reaction conditions used is essential for the improvement of the operational stability of the process. A gene encoding a homologue to Escherichia coli PAC was found in the genome of the thermophilic bacterium Thermus thermophilus (Tth) HB27. Because of the nature of this PAC and its complex maturation that is crucial to reach its functional heterodimeric final conformation, the overexpression of this enzyme in a heterologous mesophilic host was a challenge. Here we describe the purification and characterization of the PAC protein from Tth HB27 overexpressed in Escherichia coli. Results Fusions to a superfolder green fluorescent protein and differential membrane solubilization assays indicated that the native enzyme remains attached through its amino-terminal end to the outer side of the cytoplasmic membrane of Tth cells. In order to overexpress this PAC in E. coli cells, a variant of the protein devoid of its membrane anchoring segment was constructed. The effect of the co-expression of chaperones and calcium supplementation of the culture medium was investigated. The total production of PAC was enhanced by the presence of DnaK/J and GrpE and even more by trigger factor and GroEL/ES. In addition, 10 mM calcium markedly improved both PAC specific and volumetric activities. Recombinant PAC was affinity-purified and proper maturation of the protein was confirmed by SDS-PAGE and MALDI-TOF analysis of the subunits. The recombinant protein was tested for activity towards several penicillins, cephalosporins and homoserine lactones. Hydrophobic acyl-chain penicillins were preferred over the rest of the substrates. Penicillin K (octanoyl penicillin) was the best substrate, with the highest specificity constant value (16.12 mM-1.seg-1). The optimum pH was aprox. 4 and the optimum temperature was 75 °C. The half-life of the enzyme at this temperature was 9.2 h. Conclusions This is the first report concerning the heterologous expression of a pac gene from a thermophilic microorganism in the mesophilic host E. coli. The recombinant protein was identified as a penicillin K-deacylating thermozyme. PMID:22876915

  4. Functional expression of a penicillin acylase from the extreme thermophile Thermus thermophilus HB27 in Escherichia coli.

    PubMed

    Torres, Leticia L; Ferreras, Eloy R; Cantero, Angel; Hidalgo, Aurelio; Berenguer, José

    2012-08-09

    Penicillin acylases (PACs) are enzymes of industrial relevance in the manufacture of β-lactam antibiotics. Development of a PAC with a longer half-life under the reaction conditions used is essential for the improvement of the operational stability of the process. A gene encoding a homologue to Escherichia coli PAC was found in the genome of the thermophilic bacterium Thermus thermophilus (Tth) HB27. Because of the nature of this PAC and its complex maturation that is crucial to reach its functional heterodimeric final conformation, the overexpression of this enzyme in a heterologous mesophilic host was a challenge. Here we describe the purification and characterization of the PAC protein from Tth HB27 overexpressed in Escherichia coli. Fusions to a superfolder green fluorescent protein and differential membrane solubilization assays indicated that the native enzyme remains attached through its amino-terminal end to the outer side of the cytoplasmic membrane of Tth cells. In order to overexpress this PAC in E. coli cells, a variant of the protein devoid of its membrane anchoring segment was constructed. The effect of the co-expression of chaperones and calcium supplementation of the culture medium was investigated. The total production of PAC was enhanced by the presence of DnaK/J and GrpE and even more by trigger factor and GroEL/ES. In addition, 10 mM calcium markedly improved both PAC specific and volumetric activities. Recombinant PAC was affinity-purified and proper maturation of the protein was confirmed by SDS-PAGE and MALDI-TOF analysis of the subunits. The recombinant protein was tested for activity towards several penicillins, cephalosporins and homoserine lactones. Hydrophobic acyl-chain penicillins were preferred over the rest of the substrates. Penicillin K (octanoyl penicillin) was the best substrate, with the highest specificity constant value (16.12 mM-1.seg-1). The optimum pH was aprox. 4 and the optimum temperature was 75 °C. The half-life of the enzyme at this temperature was 9.2 h. This is the first report concerning the heterologous expression of a pac gene from a thermophilic microorganism in the mesophilic host E. coli. The recombinant protein was identified as a penicillin K-deacylating thermozyme.

  5. Home range use by swamp rabbits (Sylvilagus aquaticus) in a frequently inundated bottomland forest

    Treesearch

    Patrick A. Zollner; Winston P. Smith; Leonard A. Brennan

    2000-01-01

    Home range size of six swamp rabbits in south-central Arkansas was estilnated by radio-telemetry from February 1991 through March 1992. The average home range size was significantly larger than previously reported estimates. This difference is partly attributable to the large number of observations per rabbit in our study, but may also be explained by our inclusion of...

  6. Environmental Assessment for Mid-Bay Bridge Connector, Eglin Air Force Base, Florida

    DTIC Science & Technology

    2008-12-05

    Eastern indigo snake (Drymarchon corais couperi), and have no effect on the red -cockaded woodpecker (Picoides borealis). Compliance with National 3...Picoides borealis Wood Duck Aix sponsa Pine Barrens Tree Frog Hyla andersonii Northern Bobwhite Colinus virginianus Red -winged Blackbird...Belted Kingfisher Megaceryle alcyon Feral Pig Sus scrofa Eastern Mole Scalopus aquaticus Red shouldered Hawk Buteo lineatus Salt Marsh Rabbit

  7. Single molecule analysis of Thermus thermophilus SSB protein dynamics on single-stranded DNA.

    PubMed

    Zhang, Jichuan; Zhou, Ruobo; Inoue, Jin; Mikawa, Tsutomu; Ha, Taekjip

    2014-04-01

    Single-stranded (ss) DNA binding (SSB) proteins play central roles in DNA replication, recombination and repair in all organisms. We previously showed that Escherichia coli (Eco) SSB, a homotetrameric bacterial SSB, undergoes not only rapid ssDNA-binding mode transitions but also one-dimensional diffusion (or migration) while remaining bound to ssDNA. Whereas the majority of bacterial SSB family members function as homotetramers, dimeric SSB proteins were recently discovered in a distinct bacterial lineage of extremophiles, the Thermus-Deinococcus group. Here we show, using single-molecule fluorescence resonance energy transfer (FRET), that homodimeric bacterial SSB from Thermus thermophilus (Tth) is able to diffuse spontaneously along ssDNA over a wide range of salt concentrations (20-500 mM NaCl), and that TthSSB diffusion can help transiently melt the DNA hairpin structures. Furthermore, we show that two TthSSB molecules undergo transitions among different DNA-binding modes while remaining bound to ssDNA. Our results extend our previous observations on homotetrameric SSBs to homodimeric SSBs, indicating that the dynamic features may be shared among different types of SSB proteins. These dynamic features of SSBs may facilitate SSB redistribution and removal on/from ssDNA, and help recruit other SSB-interacting proteins onto ssDNA for subsequent DNA processing in DNA replication, recombination and repair.

  8. Insight into the stereospecificity of short-chain thermus thermophilus alcohol dehydrogenase showing pro-S hydride transfer and prelog enantioselectivity.

    PubMed

    Pennacchio, Angela; Giordano, Assunta; Esposito, Luciana; Langella, Emma; Rossi, Mosè; Raia, Carlo A

    2010-04-01

    The stereochemistry of the hydride transfer in reactions catalyzed by NAD(H)-dependent alcohol dehydrogenase from Thermus thermophilus HB27 was determined by means of (1)H-NMR spectroscopy. The enzyme transfers the pro-S hydrogen of [4R-(2)H]NADH and exhibits Prelog specificity. Enzyme-substrate docking calculations provided structural details about the enantioselectivity of this thermophilic enzyme. These results give additional insights into the diverse active site architectures of the largely versatile short-chain dehydrogenase superfamily enzymes. A feasible protocol for the synthesis of [4R-(2)H]NADH with high yield was also set up by enzymatic oxidation of 2-propanol-d(8) catalyzed by Bacillus stearothermophilus alcohol dehydrogenase.

  9. Metagenomic analyses of the dominant bacterial community in the Fildes Peninsula, King George Island (South Shetland Islands)

    NASA Astrophysics Data System (ADS)

    Foong, Choon Pin; Wong Vui Ling, Clemente Michael; González, Marcelo

    2010-08-01

    There is little information on the bacterial diversity of the Fildes Peninsula, King George Island. Hence, this study was conducted to determine the bacterial population of sediments and soils from the lakes, river, glacier and an abandoned oil tank area in the Fildes Peninsula, using a metagenomic approach. DNA was extracted from the sediment and soil samples, and analyzed using the 16S rDNA polymerase chain reaction-denaturing gradient gel electrophoresis (PCR-DGGE). A total of 299 DNA fragments resolved using the DGGE were sequenced. The results of the analysis provided an overview of the predominant groups of bacteria and the diversity of the bacterial communities. The most abundant phyla of bacteria in Fildes Peninsula were Bacteroidetes, Proteobacteria, Acidobacteria, Gemmatimonadetes, Nitrospira, Firmicutes, Actinobacteria, Chloroflexi, Cyanobacteria, Spirochaetes, Deinococcus-Thermus, WS3 and BRC1. All of the sediment samples from the lakes had different representatives of dominant bacterial species. Interestingly, 15% of the operational taxonomic units (OTUs) did not group into any of the existing phyla in the Ribosomal Database Project (RDP). One of the OTUs had a similarity of <0.90 when compared to the GenBank sequences and probably was a novel bacterium specific to that location. The majority of the bacterial 16S rDNA sequences were found to be closely related to those found elsewhere.

  10. Nucleotide sequence of the phosphoglycerate kinase gene from the extreme thermophile Thermus thermophilus. Comparison of the deduced amino acid sequence with that of the mesophilic yeast phosphoglycerate kinase.

    PubMed Central

    Bowen, D; Littlechild, J A; Fothergill, J E; Watson, H C; Hall, L

    1988-01-01

    Using oligonucleotide probes derived from amino acid sequencing information, the structural gene for phosphoglycerate kinase from the extreme thermophile, Thermus thermophilus, was cloned in Escherichia coli and its complete nucleotide sequence determined. The gene consists of an open reading frame corresponding to a protein of 390 amino acid residues (calculated Mr 41,791) with an extreme bias for G or C (93.1%) in the codon third base position. Comparison of the deduced amino acid sequence with that of the corresponding mesophilic yeast enzyme indicated a number of significant differences. These are discussed in terms of the unusual codon bias and their possible role in enhanced protein thermal stability. Images Fig. 1. PMID:3052437

  11. Aquatic dissipation of triclopyr in Lake Seminole, Georgia

    USGS Publications Warehouse

    Woodburn, K.B.; Green, W.R.; Westerdahl, H.E.

    1993-01-01

    A field study was conducted to evaluate the environmental dissipation of triclopyr herbicide under aquatic-use conditions. Three 4-h plots in Lake Seminole, Georgia, were selected for use: one control, one aerial plot, and one subsurface plot; both applications were at the maximum aquatic-use rate of 2.5 mg/L. Water, sediment, plants, fish, clams, and crayfish were all analyzed for residues, and water temperature, oxygen levels, pH, and conductivity were monitored. The half-life for aqueous-phase triclopyr ranged from 0.5 to 3.6 days, and the dissipation in surface and bottom waters was equivalent. The intermediate decay product of triclopyr, 3,5,6-trichloro-2-pyridinol (TCP), had an observed aquatic half-life of less than 1 day. No accumulation of triclopyr or TCP on sediment was observed. The half-life of triclopyr metabolized by aquatic plants averaged 4 days. Fish species did not exhibit any bioconcentration of triclopyr or TCP, with only trace amounts of either compound found in fish tissue. Both clams and crayfish contained detectable residues of triclopyr. The elimination of triclopyr from clam tissue was more rapid, with an observed half-life of 1.5 days, vs 12 days for crayfish; retention of triclopyr in the crayfish carcass (carapace, chelopeds, and gills) may have been an important mechanism. There was no detectable decline in water quality in either treatment plot. ?? 1993 American Chemical Society.

  12. Crystallization and preliminary X-ray diffraction study of recombinant ribokinase from Thermus Species 2.9

    NASA Astrophysics Data System (ADS)

    Abramchik, Yu. A.; Timofeev, V. I.; Muravieva, T. I.; Esipov, R. S.; Kuranova, I. P.

    2016-11-01

    Ribokinase from a thermophilic strain of Thermus species 2.9 belonging to the carbohydrate ribokinase family (EC 2.7.1.15) was isolated, purified, and crystallized. The crystallization conditions were found by the vapor-diffusion technique and were then optimized to apply the capillary counter-diffusion technique. The X-ray diffraction data set was collected from the crystals, which were grown by the counter-diffusion technique, at the SPring-8 synchrotron radiation facility to 2.87 Å resolution. The crystals belong to sp. gr. P1211 and have the following unit-cell parameters: a = 81.613 Å, b = 156.132 Å, c = 87.714 Å, α = γ = 90°, β = 103.819°. The X-ray diffraction data set is suitable for determining the three-dimensional structure of the protein by the molecular-replacement method.

  13. Purification, crystallization and preliminary X-ray analysis of the regulatory subunit of aspartate kinase from Thermus thermophilus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yoshida, Ayako; Tomita, Takeo; Kuzuyama, Tomohisa

    2007-02-01

    To elucidate the mechanism of regulation of aspartate kinase, the regulatory subunit (the β subunit of T. thermophilus aspartate kinase) was crystallized in the presence of the inhibitor threonine. Aspartate kinase (AK) from Thermus thermophilus, which catalyzes the first step of threonine and methionine biosynthesis, is regulated via feedback inhibition by the end product threonine. To elucidate the mechanism of regulation of AK, the regulatory subunit (the β subunit of T. thermophilus AK) was crystallized in the presence of the inhibitor threonine. Diffraction data were collected to 2.15 Å at a synchrotron source. The crystal belongs to the cubic spacemore » group P4{sub 3}32 or P4{sub 1}32, with unit-cell parameters a = b = c = 141.8 Å.« less

  14. CarD uses a minor groove wedge mechanism to stabilize the RNA polymerase open promoter complex.

    PubMed

    Bae, Brian; Chen, James; Davis, Elizabeth; Leon, Katherine; Darst, Seth A; Campbell, Elizabeth A

    2015-09-08

    A key point to regulate gene expression is at transcription initiation, and activators play a major role. CarD, an essential activator in Mycobacterium tuberculosis, is found in many bacteria, including Thermus species, but absent in Escherichia coli. To delineate the molecular mechanism of CarD, we determined crystal structures of Thermus transcription initiation complexes containing CarD. The structures show CarD interacts with the unique DNA topology presented by the upstream double-stranded/single-stranded DNA junction of the transcription bubble. We confirm that our structures correspond to functional activation complexes, and extend our understanding of the role of a conserved CarD Trp residue that serves as a minor groove wedge, preventing collapse of the transcription bubble to stabilize the transcription initiation complex. Unlike E. coli RNAP, many bacterial RNAPs form unstable promoter complexes, explaining the need for CarD.

  15. Crystallization and preliminary X-ray diffraction study of recombinant ribokinase from Thermus Species 2.9

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Abramchik, Yu. A.; Timofeev, V. I., E-mail: tostars@mail.ru; Muravieva, T. I.

    2016-11-15

    Ribokinase from a thermophilic strain of Thermus species 2.9 belonging to the carbohydrate ribokinase family (EC 2.7.1.15) was isolated, purified, and crystallized. The crystallization conditions were found by the vapor-diffusion technique and were then optimized to apply the capillary counter-diffusion technique. The X-ray diffraction data set was collected from the crystals, which were grown by the counter-diffusion technique, at the SPring-8 synchrotron radiation facility to 2.87 Å resolution. The crystals belong to sp. gr. P12{sub 1}1 and have the following unit-cell parameters: a = 81.613 Å, b = 156.132 Å, c = 87.714 Å, α = γ = 90°, βmore » = 103.819°. The X-ray diffraction data set is suitable for determining the three-dimensional structure of the protein by the molecular-replacement method.« less

  16. Structure-based cleavage mechanism of Thermus thermophilus Argonaute DNA guide strand-mediated DNA target cleavage

    PubMed Central

    Sheng, Gang; Zhao, Hongtu; Wang, Jiuyu; Rao, Yu; Tian, Wenwen; Swarts, Daan C.; van der Oost, John; Patel, Dinshaw J.; Wang, Yanli

    2014-01-01

    We report on crystal structures of ternary Thermus thermophilus Argonaute (TtAgo) complexes with 5′-phosphorylated guide DNA and a series of DNA targets. These ternary complex structures of cleavage-incompatible, cleavage-compatible, and postcleavage states solved at improved resolution up to 2.2 Å have provided molecular insights into the orchestrated positioning of catalytic residues, a pair of Mg2+ cations, and the putative water nucleophile positioned for in-line attack on the cleavable phosphate for TtAgo-mediated target cleavage by a RNase H-type mechanism. In addition, these ternary complex structures have provided insights into protein and DNA conformational changes that facilitate transition between cleavage-incompatible and cleavage-compatible states, including the role of a Glu finger in generating a cleavage-competent catalytic Asp-Glu-Asp-Asp tetrad. Following cleavage, the seed segment forms a stable duplex with the complementary segment of the target strand. PMID:24374628

  17. A selection that reports on protein–protein interactions within a thermophilic bacterium

    PubMed Central

    Nguyen, Peter Q.; Silberg, Jonathan J.

    2010-01-01

    Many proteins can be split into fragments that exhibit enhanced function upon fusion to interacting proteins. While this strategy has been widely used to create protein-fragment complementation assays (PCAs) for discovering protein–protein interactions within mesophilic organisms, similar assays have not yet been developed for studying natural and engineered protein complexes at the temperatures where thermophilic microbes grow. We describe the development of a selection for protein–protein interactions within Thermus thermophilus that is based upon growth complementation by fragments of Thermotoga neapolitana adenylate kinase (AKTn). Complementation studies with an engineered thermophile (PQN1) that is not viable above 75°C because its adk gene has been replaced by a Geobacillus stearothermophilus ortholog revealed that growth could be restored at 78°C by a vector that coexpresses polypeptides corresponding to residues 1–79 and 80–220 of AKTn. In contrast, PQN1 growth was not complemented by AKTn fragments harboring a C156A mutation within the zinc-binding tetracysteine motif unless these fragments were fused to Thermotoga maritima chemotaxis proteins that heterodimerize (CheA and CheY) or homodimerize (CheX). This enhanced complementation is interpreted as arising from chemotaxis protein–protein interactions, since AKTn-C156A fragments having only one polypeptide fused to a chemotaxis protein did not complement PQN1 to the same extent. This selection increases the maximum temperature where a PCA can be used to engineer thermostable protein complexes and to map protein–protein interactions. PMID:20418388

  18. A selection that reports on protein-protein interactions within a thermophilic bacterium.

    PubMed

    Nguyen, Peter Q; Silberg, Jonathan J

    2010-07-01

    Many proteins can be split into fragments that exhibit enhanced function upon fusion to interacting proteins. While this strategy has been widely used to create protein-fragment complementation assays (PCAs) for discovering protein-protein interactions within mesophilic organisms, similar assays have not yet been developed for studying natural and engineered protein complexes at the temperatures where thermophilic microbes grow. We describe the development of a selection for protein-protein interactions within Thermus thermophilus that is based upon growth complementation by fragments of Thermotoga neapolitana adenylate kinase (AK(Tn)). Complementation studies with an engineered thermophile (PQN1) that is not viable above 75 degrees C because its adk gene has been replaced by a Geobacillus stearothermophilus ortholog revealed that growth could be restored at 78 degrees C by a vector that coexpresses polypeptides corresponding to residues 1-79 and 80-220 of AK(Tn). In contrast, PQN1 growth was not complemented by AK(Tn) fragments harboring a C156A mutation within the zinc-binding tetracysteine motif unless these fragments were fused to Thermotoga maritima chemotaxis proteins that heterodimerize (CheA and CheY) or homodimerize (CheX). This enhanced complementation is interpreted as arising from chemotaxis protein-protein interactions, since AK(Tn)-C156A fragments having only one polypeptide fused to a chemotaxis protein did not complement PQN1 to the same extent. This selection increases the maximum temperature where a PCA can be used to engineer thermostable protein complexes and to map protein-protein interactions.

  19. Heptameric (L12)6/L10 rather than canonical pentameric complexes are found by tandem MS of intact ribosomes from thermophilic bacteria.

    PubMed

    Ilag, Leopold L; Videler, Hortense; McKay, Adam R; Sobott, Frank; Fucini, Paola; Nierhaus, Knud H; Robinson, Carol V

    2005-06-07

    Ribosomes are universal translators of the genetic code into protein and represent macromolecular structures that are asymmetric, often heterogeneous, and contain dynamic regions. These properties pose considerable challenges for modern-day structural biology. Despite these obstacles, high-resolution x-ray structures of the 30S and 50S subunits have revealed the RNA architecture and its interactions with proteins for ribosomes from Thermus thermophilus, Deinococcus radiodurans, and Haloarcula marismortui. Some regions, however, remain inaccessible to these high-resolution approaches because of their high conformational dynamics and potential heterogeneity, specifically the so-called L7/L12 stalk complex. This region plays a vital role in protein synthesis by interacting with GTPase factors in translation. Here, we apply tandem MS, an approach widely applied to peptide sequencing for proteomic applications but not previously applied to MDa complexes. Isolation and activation of ions assigned to intact 30S and 50S subunits releases proteins S6 and L12, respectively. Importantly, this process reveals, exclusively while attached to ribosomes, a phosphorylation of L12, the protein located in multiple copies at the tip of the stalk complex. Moreover, through tandem MS we discovered a stoichiometry for the stalk protuberance on Thermus thermophilus and other thermophiles and contrast this assembly with the analogous one on ribosomes from mesophiles. Together with evidence for a potential interaction with the degradosome, these results show that important findings on ribosome structure, interactions, and modifications can be discovered by tandem MS, even on well studied ribosomes from Thermus thermophilus.

  20. Heptameric (L12)6/L10 rather than canonical pentameric complexes are found by tandem MS of intact ribosomes from thermophilic bacteria

    PubMed Central

    Ilag, Leopold L.; Videler, Hortense; McKay, Adam R.; Sobott, Frank; Fucini, Paola; Nierhaus, Knud H.; Robinson, Carol V.

    2005-01-01

    Ribosomes are universal translators of the genetic code into protein and represent macromolecular structures that are asymmetric, often heterogeneous, and contain dynamic regions. These properties pose considerable challenges for modern-day structural biology. Despite these obstacles, high-resolution x-ray structures of the 30S and 50S subunits have revealed the RNA architecture and its interactions with proteins for ribosomes from Thermus thermophilus, Deinococcus radiodurans, and Haloarcula marismortui. Some regions, however, remain inaccessible to these high-resolution approaches because of their high conformational dynamics and potential heterogeneity, specifically the so-called L7/L12 stalk complex. This region plays a vital role in protein synthesis by interacting with GTPase factors in translation. Here, we apply tandem MS, an approach widely applied to peptide sequencing for proteomic applications but not previously applied to MDa complexes. Isolation and activation of ions assigned to intact 30S and 50S subunits releases proteins S6 and L12, respectively. Importantly, this process reveals, exclusively while attached to ribosomes, a phosphorylation of L12, the protein located in multiple copies at the tip of the stalk complex. Moreover, through tandem MS we discovered a stoichiometry for the stalk protuberance on Thermus thermophilus and other thermophiles and contrast this assembly with the analogous one on ribosomes from mesophiles. Together with evidence for a potential interaction with the degradosome, these results show that important findings on ribosome structure, interactions, and modifications can be discovered by tandem MS, even on well studied ribosomes from Thermus thermophilus. PMID:15923259

  1. Characterization of Thermostable Cellulases Produced by Bacillus and Geobacillus Strains

    USDA-ARS?s Scientific Manuscript database

    Bacterial community composition of thermophilic (60 deg C) mixed cellulose-enrichment cultures was examined by constructing a 16S rDNA clone library which demonstrated major lineages affiliated to Actinobacteria, Bacteroidetes, Chloroflexi, Deinococcus-Thermus, Firmicutes, and Proteobacteria. A tot...

  2. Gordius gonzalezi, a new species of horsehair worms (Nematomorpha) from Spain.

    PubMed

    Schmidt-Rhaesa, Andreas; Martínez, Jesús

    2016-04-11

    A new species, Gordius gonzalezi, is described from the Iberian Peninsula, from the Sierra de los Tormantos in Central Spain. Characteristic for the species is the presence of multiple short spines on the cuticle, not present in this form in any other Gordius species. Additionally, two further specimens are reported, which could not be determined to species level. One male of the genus Gordius is close to G. aquaticus and one female with regular areoles could belong either to the genus Gordius or to Gordionus.

  3. Deciphering the Dynamics of Non-Covalent Interactions Affecting Thermal Stability of a Protein: Molecular Dynamics Study on Point Mutant of Thermus thermophilus Isopropylmalate Dehydrogenase.

    PubMed

    Sharma, Reetu; Sastry, G Narahari

    2015-01-01

    Thermus thermophilius isopropylmalate dehydrogenase catalyzes oxidative decarboxylation and dehydrogenation of isopropylmalate. Substitution of leucine to alanine at position 172 enhances the thermal stability among the known point mutants. Exploring the dynamic properties of non-covalent interactions such as saltbridges, hydrogen bonds and hydrophobic interactions to explain thermal stability of a protein is interesting in its own right. In this study dynamic changes in the non-covalent interactions are studied to decipher the deterministic features of thermal stability of a protein considering a case study of a point mutant in Thermus thermophilus isopropylmalate dehydrogenase. A total of four molecular dynamic simulations of 0.2 μs were carried out on wild type and mutant's functional dimers at 300 K and 337 K. Higher thermal stability of the mutant as compared to wild type is revealed by root mean square deviation, root mean square fluctuations and Cα-Cα distance with an increase in temperature from 300 K to 337 K. Most of the regions of wild type fluctuate higher than the corresponding regions of mutant with an increase in temperature. Cα-Cα distance analysis suggests that long distance networks are significantly affected in wild type as compared to the mutant. Short lived contacts are higher in wild type, while long lived contacts are lost at 337 K. The mutant forms less hydrogen bonds with water as compared to wild type at 337 K. In contrast to wild type, the mutant shows significant increase in unique saltbridges, hydrogen bonds and hydrophobic contacts at 337 K. The current study indicates that there is a strong inter-dependence of thermal stability on the way in which non-covalent interactions reorganize, and it is rewarding to explore this connection in single mutant studies.

  4. Crystal structures of a subunit of the formylglycinamide ribonucleotide amidotransferase, PurS, from Thermus thermophilus , Sulfolobus tokodaii and Methanocaldococcus jannaschii

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Watanabe, Yuzo; Yanai, Hisaaki; Kanagawa, Mayumi

    2016-07-27

    The crystal structures of a subunit of the formylglycinamide ribonucleotide amidotransferase, PurS, fromThermus thermophilus,Sulfolobus tokodaiiandMethanocaldococcus jannaschiiwere determined and their structural characteristics were analyzed. For PurS fromT. thermophilus, two structures were determined using two crystals that were grown in different conditions. The four structures in the dimeric form were almost identical to one another despite their relatively low sequence identities. This is also true for all PurS structures determined to date. A few residues were conserved among PurSs and these are located at the interaction site with PurL and PurQ, the other subunits of the formylglycinamide ribonucleotide amidotransferase. Molecular-dynamics simulations ofmore » the PurS dimer as well as a model of the complex of the PurS dimer, PurL and PurQ suggest that PurS plays some role in the catalysis of the enzyme by its bending motion.« less

  5. Analysis of Protein Thermostability Enhancing Factors in Industrially Important Thermus Bacteria Species

    PubMed Central

    Kumwenda, Benjamin; Litthauer, Derek; Bishop, Özlem Tastan; Reva, Oleg

    2013-01-01

    Elucidation of evolutionary factors that enhance protein thermostability is a critical problem and was the focus of this work on Thermus species. Pairs of orthologous sequences of T. scotoductus SA-01 and T. thermophilus HB27, with the largest negative minimum folding energy (MFE) as predicted by the UNAFold algorithm, were statistically analyzed. Favored substitutions of amino acids residues and their properties were determined. Substitutions were analyzed in modeled protein structures to determine their locations and contribution to energy differences using PyMOL and FoldX programs respectively. Dominant trends in amino acid substitutions consistent with differences in thermostability between orthologous sequences were observed. T. thermophilus thermophilic proteins showed an increase in non-polar, tiny, and charged amino acids. An abundance of alanine substituted by serine and threonine, as well as arginine substituted by glutamine and lysine was observed in T. thermophilus HB27. Structural comparison showed that stabilizing mutations occurred on surfaces and loops in protein structures. PMID:24023508

  6. Individual and joint toxicity of the herbicide S-metolachlor and a metabolite, deethylatrazine on aquatic crustaceans: Difference between ecological groups.

    PubMed

    Maazouzi, C; Coureau, C; Piscart, C; Saplairoles, M; Baran, N; Marmonier, P

    2016-12-01

    We studied the individual and joint acute toxicity of S-metolachlor (SMOC) and deethylatrazine (DEA - a metabolite of atrazine) on different non-target freshwater crustaceans. We used animals from different ecological groups: two amphipods from surface running water (Gammarus pulex and Gammarus cf. orinos), an isopod from surface stagnant water (Asellus aquaticus) and an amphipod living in groundwater (Niphargus rhenorhodanensis). Organisms were exposed to different levels of SMOC and DEA, alone or in binary mixture. Temperature effect on SMOC toxicity was assessed by exposing G. pulex and N. rhenorhodanensis to SMOC at 11 °C and 15 °C. Studying mortality as the biological endpoint, N. rhenorhodanensis was more resistant than surface water species towards SMOC and DEA. Among surface water species, G. pulex was the most sensitive while Gammarus cf. orinos and A. aquaticus showed similar responses to both compounds. Temperature increase did not change SMOC toxicity but modify the shape and steepness of the dose-response curve. We used a Model Deviation Ratio (MDR) approach to evaluate the predictability of Concentration Addition (CA) and Independent Action (IA) models to mixture toxicity. Results indicated either an additive or an antagonistic or a synergistic interaction depending on the concentrations combination and the test species. Our finding conclusively show the suitability of CA and IA in predicting mixture toxicities but results should be interpreted with caution according to ecological group of exposed species in risk assessment procedures. Copyright © 2016 Elsevier Ltd. All rights reserved.

  7. Predicting invasive species impacts: a community module functional response approach reveals context dependencies.

    PubMed

    Paterson, Rachel A; Dick, Jaimie T A; Pritchard, Daniel W; Ennis, Marilyn; Hatcher, Melanie J; Dunn, Alison M

    2015-03-01

    Predatory functional responses play integral roles in predator-prey dynamics, and their assessment promises greater understanding and prediction of the predatory impacts of invasive species. Other interspecific interactions, however, such as parasitism and higher-order predation, have the potential to modify predator-prey interactions and thus the predictive capability of the comparative functional response approach. We used a four-species community module (higher-order predator; focal native or invasive predators; parasites of focal predators; native prey) to compare the predatory functional responses of native Gammarus duebeni celticus and invasive Gammarus pulex amphipods towards three invertebrate prey species (Asellus aquaticus, Simulium spp., Baetis rhodani), thus, quantifying the context dependencies of parasitism and a higher-order fish predator on these functional responses. Our functional response experiments demonstrated that the invasive amphipod had a higher predatory impact (lower handling time) on two of three prey species, which reflects patterns of impact observed in the field. The community module also revealed that parasitism had context-dependent influences, for one prey species, with the potential to further reduce the predatory impact of the invasive amphipod or increase the predatory impact of the native amphipod in the presence of a higher-order fish predator. Partial consumption of prey was similar for both predators and occurred increasingly in the order A. aquaticus, Simulium spp. and B. rhodani. This was associated with increasing prey densities, but showed no context dependencies with parasitism or higher-order fish predator. This study supports the applicability of comparative functional responses as a tool to predict and assess invasive species impacts incorporating multiple context dependencies. © 2014 The Authors. Journal of Animal Ecology © 2014 British Ecological Society.

  8. Does Chernobyl-derived radiation impact the developmental stability of Asellus aquaticus 30years on?

    PubMed

    Fuller, Neil; Smith, Jim T; Nagorskaya, Liubov L; Gudkov, Dmitri I; Ford, Alex T

    2017-01-15

    Effects of long-term, environmentally relevant doses of radiation on biota remain unclear due to a lack of studies following chronic exposure in contaminated environments. The 1986 Chernobyl accident dispersed vast amounts of radioactivity into the environment which persists to date. Despite three decades of research, impacts of the incident on non-human organisms continues to be contested within the scientific literature. The present study assessed the impact of chronic radiation exposure from Chernobyl on the developmental stability of the model aquatic isopod, Asellus aquaticus using fluctuating asymmetry (FA) as an indicator. Fluctuating asymmetry, defined as random deviations from the expected perfect bilateral symmetry of an organism, has gained prominence as an indicator of developmental stability in ecotoxicology. Organisms were collected from six lakes along a gradient of radionuclide contamination in Belarus and the Ukraine. Calculated total dose rates ranged from 0.06-27.1μGy/h. Fluctuating asymmetry was assessed in four meristic and one metrical trait. Significant differences in levels of pooled asymmetry were recorded between sample sites independent of sex and specific trait measured. However, there was no correlation of asymmetry with radiation doses, suggesting that differences in asymmetry were not attributed to radionuclide contamination and were driven by elevated asymmetry at a single site. No correlation between FA and measured environmental parameters suggested a biotic factor driving observed FA differences. This study appears to be the first to record no evident increase in developmental stability of biota from the Chernobyl region. These findings will aid in understanding the response of organisms to chronic pollutant exposure and the long term effects of large scale nuclear incidents such as Chernobyl and Fukushima. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  9. Fontibacillus aquaticus gen. nov., sp. nov., isolated from a warm spring.

    PubMed

    Saha, P; Krishnamurthi, S; Bhattacharya, A; Sharma, R; Chakrabarti, T

    2010-02-01

    A novel facultatively anaerobic strain, designated GPTSA 19(T), was isolated from a warm spring and characterized using a polyphasic approach. The strain behaved as Gram-negative in the Gram staining procedure but showed a Gram-positive reaction in the aminopeptidase test. The novel strain was a mesophilic rod with ellipsoidal endospores. On the basis of 16S rRNA gene sequence analysis, the strain showed closest similarity (96.0 %) with Paenibacillus motobuensis MC10(T). The gene sequence similarity of the novel strain with other species of the genus Paenibacillus was <95.8 %. The novel strain also had PAEN 515F and 682F signature sequence stretches in the 16S rRNA gene that are usually found in most species of the genus Paenibacillus. The strain possessed anteiso-C(15 : 0) as the major fatty acid and MK-7 as the predominant menaquinone. Polar lipids included diphosphatidylglycerol (DPG), phosphatidylglycerol (PG), phosphatidylethanolamine (PE), six unknown phospholipids (PLs), one aminophospholipid (PN), three glycolipids (GLs), two aminolipids (ALs), one aminophosphoglycolipid (APGL) and three unknown lipids (ULs). The polar lipid profile of the novel strain, especially as regards ALs, GLs and PLs, distinguished it from the recognized type species of the genus Paenibacillus, Paenibacillus polymyxa, as well as from its closest relative P. motobuensis. Based on phenotypic and chemotaxonomic characteristics and analysis of the 16S rRNA gene sequence, the new strain merits the rank of a novel genus for which the name Fontibacillus gen. nov. is proposed. The type species of the new genus is Fontibacillus aquaticus gen. nov., sp. nov. with the type strain GPTSA 19(T) (=MTCC 7155(T)=DSM 17643(T)).

  10. Degradation of 1,2-dichloroethane by Ancylobacter aquaticus and other facultative methylotrophs.

    PubMed Central

    van den Wijngaard, A J; van der Kamp, K W; van der Ploeg, J; Pries, F; Kazemier, B; Janssen, D B

    1992-01-01

    Cultures of the newly isolated bacterial strains AD20, AD25, and AD27, identified as strains of Ancylobacter aquaticus, were capable of growth on 1,2-dichloroethane (DCE) as the sole carbon and energy source. These strains, as well as two other new DCE utilizers, were facultative methylotrophs and were also able to grow on 2-chloroethanol, chloroacetate, and 2-chloropropionate. In all strains tested, DCE was degraded by initial hydrolytic dehalogenation to 2-chloroethanol, followed by oxidation by a phenazine methosulfate-dependent alcohol dehydrogenase and an NAD-dependent aldehyde dehydrogenase. The resulting chloroacetic acid was converted to glycolate by chloroacetate dehalogenase. The alcohol dehydrogenase was induced during growth on methanol or DCE in strain AD20, but no activity was found during growth on glucose. However, in strain AD25 the enzyme was synthesized to a higher level during growth on glucose than on methanol, and it reached levels of around 2 U/mg of protein in late-exponential-phase cultures growing on glucose. The haloalkane dehalogenase was constitutively produced in all strains tested, but strain AD25 synthesized the enzyme at a level of 30 to 40% of the total cellular protein, which is much higher than that found in other DCE degraders. The nucleotide sequences of the haloalkane dehalogenase (dhlA) genes of strains AD20 and AD25 were the same as the sequence of dhlA from Xanthobacter autotrophicus GJ10 and GJ11. Hybridization experiments showed that the dhlA genes of six different DCE utilizers were all located on an 8.3-kb EcoRI restriction fragment, indicating that the organisms may have obtained the dhlA gene by horizontal gene transmission. Images PMID:1575500

  11. Daily Movements and Microhabitat Selection of Hantavirus Reservoirs and Other Sigmodontinae Rodent Species that Inhabit a Protected Natural Area of Argentina.

    PubMed

    Maroli, Malena; Vadell, María Victoria; Iglesias, Ayelén; Padula, Paula Julieta; Gómez Villafañe, Isabel Elisa

    2015-09-01

    Abundance, distribution, movement patterns, and habitat selection of a reservoir species influence the dispersal of zoonotic pathogens, and hence, the risk for humans. Movements and microhabitat use of rodent species, and their potential role in the transmission of hantavirus were studied in Otamendi Natural Reserve, Buenos Aires, Argentina. Movement estimators and qualitative characteristics of rodent paths were determined by means of a spool and line device method. Sampling was conducted during November and December 2011, and March, April, June, October, and December 2012. Forty-six Oxymycterus rufus, 41 Akodon azarae, 10 Scapteromys aquaticus and 5 Oligoryzomys flavescens were captured. Movement patterns and distances varied according to sex, habitat type, reproductive season, and body size among species. O. flavescens, reservoir of the etiologic agent of hantavirus pulmonary syndrome in the region, moved short distances, had the most linear paths and did not share paths with other species. A. azarae had an intermediate linearity index, its movements were longer in the highland grassland than in the lowland marsh and the salty grassland, and larger individuals traveled longer distances. O. rufus had the most tortuous paths and the males moved more during the non-breeding season. S. aquaticus movements were associated with habitat type with longer distances traveled in the lowland marsh than in the salty grassland. Hantavirus antibodies were detected in 20% of A. azarae and were not detected in any other species. Seropositive individuals were captured during the breeding season and 85% of them were males. A. azarae moved randomly and shared paths with all the other species, which could promote hantavirus spillover events.

  12. Morphology and ultrastructure of the chorioallantoic placenta of the Iberian mole (Talpa occidentalis) with special reference to heterophagous areolas and the nature of interhaemal barrier

    PubMed Central

    Siniza, Swetlana; Lupiañez, Dario G; Jiménez, Rafael; Zeller, Ulrich

    2012-01-01

    This study provides a contribution to the reconstruction of the eulipotyphlan placental morphotype and also may help resolving a long-standing conflict about the interhaemal barrier in moles. As detailed descriptions of talpid placentation, only available for Talpa europaea and Scalopus aquaticus, led to a controversial debate on the nature of interhaemal barrier, the collection of more placental data of further mole species was strongly desired. Hence, the placentas of six gestational stages of Talpa occidentalis have been studied concerning their morphogenesis and ultrastructure with special focus on the structure of the interhaemal barrier and heterophagous regions. Generally, the mode of placentation in T. occidentalis resembles that of T. europaea, including a broad, discoid, antimesometrial, definitive chorioallantoic placenta of labyrinthine type being still villous in earlier stages. Within the labyrinth, the zona intima shows an endotheliochorial interhaemal barrier with a two-layered trophoblast. This clearly contradicts former statements on the S. aquaticus placenta made by Prasad et al. (1979), although their findings cannot exclude a totally different interpretation. Regardless, the placenta of moles represents the least invasive mode of placentation among Eulipotyphla, which otherwise have highly invasive placentas. Although the phagocytic areolas situated above uterine gland openings are heterophagous, they mainly seem to serve fetal histiotrophic nutrition, at least early in pregnancy. In later stages the number of glands and areolas decreases. This special type of additional phagocytic region is usually most common in species with noninvasive, epitheliochorial placentation, which suggests a correlation between placental invasiveness and the occurrence and type of phagocytic placental structures. The compact and invasive mode of placentation of Talpidae and all other Eulipotyphla seems to be plesiomorphic within Laurasiatheria and is always correlated with an altricial neonate. PMID:22703538

  13. Acarviosine-simmondsin, a novel compound obtained from acarviosine-glucose and simmondsin by Thermus maltogenic amylase and its in vivo effect on food intake and hyperglycemia.

    PubMed

    Baek, Jin-Sook; Kim, Hye-Young; Abbott, Thomas P; Moon, Tae-Wha; Lee, Soo-Bok; Park, Cheon-Seok; Park, Kwan-Hwa

    2003-03-01

    Simmondsin was modified with acarviosine-glucose using the transglycosylation activity of Thermus maltogenic amylase to synthesize a novel compound with both antiobesity and hypoglycemic activity. The LC/MS and 13C NMR analyses confirmed that the structure of the major transglycosylation product was acarviosine-simmondsin (Acv-simmondsin), in which acarviosine was attached to the glucose moiety of simmondsin by an alpha-(1,6)-glycosidic linkage. It was found that Acv-simmondsin was a potent competitive inhibitor of alpha-glucosidase with the Ki value of 0.69 microM and a mixed type inhibitor of alpha-amylase with the Ki and KI of 20.78 microM and 26.31 microM, respectively. The administration of Acv-simmondsin (0.1 g/100 g diet/day) to mice for 5 days significantly reduced food intake by 35%, compared to 25% with simmondsin in control obese mice. Acv-simmondsin (50 mg/kg BW) suppressed the postprandial blood glucose response to sucrose (1 g/kg BW) by 74%, compared to 71% with acarbose, in normal rats.

  14. Reaction of cyanide with cytochrome ba3 from Thermus thermophilus: spectroscopic characterization of the Fe(II)a3-CN.Cu(II)B-CN complex suggests four 14N atoms are coordinated to CuB.

    PubMed Central

    Surerus, K K; Oertling, W A; Fan, C; Gurbiel, R J; Einarsdóttir, O; Antholine, W E; Dyer, R B; Hoffman, B M; Woodruff, W H; Fee, J A

    1992-01-01

    Cytochrome ba3 from Thermus thermophilus reacts slowly with excess HCN at pH 7.4 to create a form of the enzyme in which CuA, cytochrome b, and CuB remain oxidized, while cytochrome a3 is reduced by one electron, presumably with the formation of cyanogen. We have examined this form of the enzyme by UV-visible, resonance Raman, EPR, and electron nuclear double resonance spectroscopies in conjunction with permutations of 13C- and 15N-labeled cyanide. The results support a model in which one CN- binds through the carbon atom to ferrous a3, supporting a low-spin (S = 0) configuration on the Fe; bridging by this cyanide to the CuB is weak or absent. Four 14N atoms, presumably donated by histidine residues of the protein, provide a strong equatorial ligand field about CuB; a second CN- is coordinated through the carbon atom to CuB in an axial position. PMID:1314380

  15. Resolving stepping rotation in Thermus thermophilus H+-ATPase/synthase with an essentially drag-free probe

    PubMed Central

    Furuike, Shou; Nakano, Masahiro; Adachi, Kengo; Noji, Hiroyuki; Kinosita, Kazuhiko; Yokoyama, Ken

    2011-01-01

    Vacuole-type ATPases (VoV1) and FoF1 ATP synthases couple ATP hydrolysis/synthesis in the soluble V1 or F1 portion with proton (or Na+) flow in the membrane-embedded Vo or Fo portion through rotation of one common shaft. Here we show at submillisecond resolutions the ATP-driven rotation of isolated V1 and the whole VoV1 from Thermus thermophilus, by attaching a 40-nm gold bead for which viscous drag is almost negligible. V1 made 120° steps, commensurate with the presence of three catalytic sites. Dwells between the steps involved at least two events other than ATP binding, one likely to be ATP hydrolysis. VoV1 exhibited 12 dwell positions per revolution, consistent with the 12-fold symmetry of the Vo rotor in T. thermophilus. Unlike F1 that undergoes 80°–40° substepping, chemo-mechanical checkpoints in isolated V1 are all at the ATP-waiting position, and Vo adds further bumps through stator–rotor interactions outside and remote from V1. PMID:21407199

  16. Purification, crystallization and preliminary X-ray diffraction of SecDF, a translocon-associated membrane protein, from Thermus thermophilus

    PubMed Central

    Tsukazaki, Tomoya; Mori, Hiroyuki; Fukai, Shuya; Numata, Tomoyuki; Perederina, Anna; Adachi, Hiroaki; Matsumura, Hiroyoshi; Takano, Kazufumi; Murakami, Satoshi; Inoue, Tsuyoshi; Mori, Yusuke; Sasaki, Takatomo; Vassylyev, Dmitry G.; Nureki, Osamu; Ito, Koreaki

    2006-01-01

    Thermus thermophilus has a multi-path membrane protein, TSecDF, as a single-chain homologue of Escherichia coli SecD and SecF, which form a translocon-associated complex required for efficient preprotein translocation and membrane-protein integration. Here, the cloning, expression in E. coli, purification and crystallization of TSecDF are reported. Overproduced TSecDF was solubilized with dodecylmaltoside, chromatographically purified and crystallized by vapour diffusion in the presence of polyethylene glycol. The crystals yielded a maximum resolution of 4.2 Å upon X-ray irradiation, revealing that they belonged to space group P43212. Attempts were made to improve the diffraction quality of the crystals by combinations of micro-stirring, laser-light irradiation and dehydration, which led to the eventual collection of complete data sets at 3.74 Å resolution and preliminary success in the single-wavelength anomalous dispersion analysis. These results provide information that is essential for the determination of the three-dimensional structure of this important membrane component of the protein-translocation machinery. PMID:16582489

  17. The Effect of Different Oceanic Abiotic Factors on Prokaryotic Body Sizes

    NASA Astrophysics Data System (ADS)

    Pidathala, S.; Bellon, M.; Heim, N.; Payne, J.

    2016-12-01

    We are studying the impact of abiotic factors in the Pacific and Atlantic on prokaryotic body sizes and genome sizes because we are interested in the manner in which abiotic factors influence genome sizes independent of their influence on body sizes. Some research has been done in the past on marine bacterial evolution, including data collection on marine ecology in relation to bacterial body sizes (Straza 2009). We are using the abiotic factors: temperature, salinity, and pH to compare the biovolumes/genome sizes of different phyla by using R. We made 9 scatter plots to model these relationships. Regardless of the phyla or the ocean, we found that there is no relation between pH, temperature, and body size, with several exceptions: Deinococcus. thermus has an indirect relationship with size in respect to temperature; size only correlates to temperature for phyla that are thermophiles. We also found that bacteria like D. thermus and Thermotogae are taxa only found in higher temperatures. Additionally, almost all phyla have genome sizes restricted by certain pH levels:, Proteobacteria only reach genomes with acidity levels greater than 6. In terms of salinity levels, certain bacteria are only found within a small range, and others, like Proteobacteria, can only reach genomes at low salinity levels. Finally, Proteobacteria have large genome sizes between 30 and 40 °, and Crenarchaeota have constant genome sizes in higher temperatures. Conclusively, we discovered that these abiotic factors generally do not affect body size, with the exception of D. thermus' indirect relationship to temperature due to its small biovolume in high temperatures. However, we determined that these abiotic factors have a great impact on genome sizes. This is due to genome size independence from body size. Also, genome size could have served as an adaptive feature for bacteria in marine environments, explaining why different phyla may have diverged to accommodate their lifestyles.

  18. The Core of Allosteric Motion in Thermus caldophilus l-Lactate Dehydrogenase*

    PubMed Central

    Ikehara, Yoko; Arai, Kazuhito; Furukawa, Nayuta; Ohno, Tadashi; Miyake, Tatsuya; Fushinobu, Shinya; Nakajima, Masahiro; Miyanaga, Akimasa; Taguchi, Hayao

    2014-01-01

    For Thermus caldophilus l-lactate dehydrogenase (TcLDH), fructose 1,6-bisphosphate (FBP) reduced the pyruvate S0.5 value 103-fold and increased the Vmax value 4-fold at 30 °C and pH 7.0, indicating that TcLDH has a much more T state-sided allosteric equilibrium than Thermus thermophilus l-lactate dehydrogenase, which has only two amino acid replacements, A154G and H179Y. The inactive (T) and active (R) state structures of TcLDH were determined at 1.8 and 2.0 Å resolution, respectively. The structures indicated that two mobile regions, MR1 (positions 172–185) and MR2 (positions 211–221), form a compact core for allosteric motion, and His179 of MR1 forms constitutive hydrogen bonds with MR2. The Q4(R) mutation, which comprises the L67E, H68D, E178K, and A235R replacements, increased Vmax 4-fold but reduced pyruvate S0.5 only 5-fold in the reaction without FBP. In contrast, the P2 mutation, comprising the R173Q and R216L replacements, did not markedly increase Vmax, but 102-reduced pyruvate S0.5, and additively increased the FBP-independent activity of the Q4(R) enzyme. The two types of mutation consistently increased the thermal stability of the enzyme. The MR1-MR2 area is a positively charged cluster, and its center approaches another positively charged cluster (N domain cluster) across the Q-axis subunit interface by 5 Å, when the enzyme undergoes the T to R transition. Structural and kinetic analyses thus revealed the simple and unique allosteric machinery of TcLDH, where the MR1-MR2 area pivotally moves during the allosteric motion and mediates the allosteric equilibrium through electrostatic repulsion within the protein molecule. PMID:25258319

  19. Acoustic vibrations contribute to the diffuse scatter produced by ribosome crystals

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Polikanov, Yury S.; Moore, Peter B.

    2015-09-26

    The diffuse scattering pattern produced by frozen crystals of the 70S ribosome fromThermus thermophilusis as highly structured as it would be if it resulted entirely from domain-scale motions within these particles. However, the qualitative properties of the scattering pattern suggest that acoustic displacements of the crystal lattice make a major contribution to it.

  20. Metagenomic Evaluation of Bacterial and Archaeal Diversity in the Geothermal Hot Springs of Manikaran, India

    PubMed Central

    Pathak, Ashish; Green, Stefan J.; Joshi, Amit; Chauhan, Ashvini

    2015-01-01

    Bacterial and archaeal diversity in geothermal spring water were investigated using 16S rRNA gene amplicon metagenomic sequencing. This revealed the dominance of Firmicutes, Aquificae, and the Deinococcus-Thermus group in this thermophilic environment. A number of sequences remained taxonomically unresolved, indicating the presence of potentially novel microbes in this unique habitat. PMID:25700403

  1. Engineering of DNA polymerase I from Thermus thermophilus using compartmentalized self-replication.

    PubMed

    Aye, Seaim Lwin; Fujiwara, Kei; Ueki, Asuka; Doi, Nobuhide

    2018-05-05

    Although compartmentalized self-replication (CSR) and compartmentalized partnered replication (CPR) are powerful tools for directed evolution of proteins and gene circuits, limitations remain in the emulsion PCR process with the wild-type Taq DNA polymerase used so far, including long run times, low amounts of product, and false negative results due to inhibitors. In this study, we developed a high-efficiency mutant of DNA polymerase I from Thermus thermophilus HB27 (Tth pol) suited for CSR and CPR. We modified the wild-type Tth pol by (i) deletion of the N-terminal 5' to 3' exonuclease domain, (ii) fusion with the DNA-binding protein Sso7d, (iii) introduction of four known effective point mutations from other DNA polymerase mutants, and (iv) codon optimization to reduce the GC content. Consequently, we obtained a mutant that provides higher product yields than the conventional Taq pol without decreased fidelity. Next, we performed four rounds of CSR selection with a randomly mutated library of this modified Tth pol and obtained mutants that provide higher product yields in fewer cycles of emulsion PCR than the parent Tth pol as well as the conventional Taq pol. Copyright © 2018 Elsevier Inc. All rights reserved.

  2. A Cascade of Thermophilic Enzymes As an Approach to the Synthesis of Modified Nucleotides.

    PubMed

    Esipov, R S; Abramchik, Yu A; Fateev, I V; Konstantinova, I D; Kostromina, M A; Muravyova, T I; Artemova, K G; Miroshnikov, A I

    2016-01-01

    We propose a new approach for the synthesis of biologically important nucleotides which includes a multi-enzymatic cascade conversion of D -pentoses into purine nucleotides. The approach exploits nucleic acid exchange enzymes from thermophilic microorganisms: ribokinase, phosphoribosylpyrophosphate synthetase, and adenine phosphoribosyltransferase. We cloned the ribokinase gene from Thermus sp . 2.9, as well as two different genes of phosphoribosylpyrophosphate synthetase (PRPP-synthetase) and the adenine phosphoribosyltransferase (APR-transferase) gene from Thermus thermophilus HB27 into the expression vectors, generated high-yield E. coli producer strains, developed methods for the purification of the enzymes, and investigated enzyme substrate specificity. The enzymes were used for the conversion of D -pentoses into 5-phosphates that were further converted into 5-phospho-α- D -pentofuranose 1-pyrophosphates by means of ribokinase and PRPP-synthetases. Target nucleotides were obtained through the condensation of the pyrophosphates with adenine and its derivatives in a reaction catalyzed by APR-transferase. 2-Chloro- and 2-fluoroadenosine monophosphates were synthesized from D -ribose and appropriate heterobases in one pot using a system of thermophilic enzymes in the presence of ATP, ribokinase, PRPP-synthetase, and APR-transferase.

  3. Culturable bacterial diversity at the Princess Elisabeth Station (Utsteinen, Sør Rondane Mountains, East Antarctica) harbours many new taxa.

    PubMed

    Peeters, Karolien; Ertz, Damien; Willems, Anne

    2011-07-01

    We studied the culturable heterotrophic bacterial diversity present at the site of the new Princess Elisabeth Station at Utsteinen (Dronning Maud Land, East Antarctica) before construction. About 800 isolates were picked from two terrestrial microbial mat samples after incubation on several growth media at different temperatures. They were grouped using rep-PCR fingerprinting and partial 16S rRNA gene sequencing. Phylogenetic analysis of the complete 16S rRNA gene sequences of 93 representatives showed that the isolates belonged to five major phyla: Actinobacteria, Bacteroidetes, Proteobacteria, Firmicutes and Deinococcus-Thermus. Isolates related to the genus Arthrobacter were the most prevalent whereas the genera Hymenobacter, Deinococcus, Cryobacterium and Sphingomonas were also recovered in high numbers in both samples. A total of 35 different genera were found, the majority of which has previously been reported from Antarctica. For the genera Aeromicrobium, Aurantimonas, Rothia, Subtercola, Tessaracoccus and Xylophilus, this is the first report in Antarctica. In addition, numerous potential new species and new genera were recovered; many of them currently restricted to Antarctica, particularly in the phyla Bacteroidetes and Deinococcus-Thermus. Copyright © 2011 Elsevier GmbH. All rights reserved.

  4. Characterization and further stabilization of a new anti-prelog specific alcohol dehydrogenase from Thermus thermophilus HB27 for asymmetric reduction of carbonyl compounds.

    PubMed

    Rocha-Martín, Javier; Vega, Daniel; Bolivar, Juan M; Hidalgo, Aurelio; Berenguer, José; Guisán, José M; López-Gallego, Fernando

    2012-01-01

    The use of dehydrogenases in asymmetric chemistry has exponentially grown in the last decades facilitated by the genome mining. Here, a new short-chain alcohol dehydrogenase from Thermus thermophilus HB27 has been expressed, purified, characterized and stabilized by immobilization on solid supports. The enzyme catalyzes both oxidative and reductive reactions at neutral pH with a broad range of substrates. Its highest activity was found towards the reduction of 2,2',2″-trifluoroacetophenone (85 U/mg at 65 °C and pH 7). Moreover, the enzyme was stabilized more than 200-fold by multipoint covalent immobilization on agarose matrixes via glyoxyl chemistry. Such heterogeneous catalyst coupled to an immobilized cofactor recycling partner performed the quantitative asymmetric reduction of 2,2',2″-trifluoroacetophenone and rac-2-phenylpropanal to (S)-(+)-α-(trifluoromethyl)benzyl alcohol and (R)-2-phenyl-1-propanol with enantiomeric excesses of 96% and 71%, respectively. To our knowledge this is the first alcohol dehydrogenase from a thermophilic source with anti-Prelog selectivity for aryl ketones and that preferentially produces R-profens. Copyright © 2011 Elsevier Ltd. All rights reserved.

  5. Engineering the Substrate Specificity of a Thermophilic Penicillin Acylase from Thermus thermophilus

    PubMed Central

    Torres, Leticia L.; Cantero, Ángel; del Valle, Mercedes; Marina, Anabel; López-Gallego, Fernando; Guisán, José M.

    2013-01-01

    A homologue of the Escherichia coli penicillin acylase is encoded in the genomes of several thermophiles, including in different Thermus thermophilus strains. Although the natural substrate of this enzyme is not known, this acylase shows a marked preference for penicillin K over penicillin G. Three-dimensional models were created in which the catalytic residues and the substrate binding pocket were identified. Through rational redesign, residues were replaced to mimic the aromatic binding site of the E. coli penicillin G acylase. A set of enzyme variants containing between one and four amino acid replacements was generated, with altered catalytic properties in the hydrolyses of penicillins K and G. The introduction of a single phenylalanine residue in position α188, α189, or β24 improved the Km for penicillin G between 9- and 12-fold, and the catalytic efficiency of these variants for penicillin G was improved up to 6.6-fold. Structural models, as well as docking analyses, can predict the positioning of penicillins G and K for catalysis and can demonstrate how binding in a productive pose is compromised when more than one bulky phenylalanine residue is introduced into the active site. PMID:23263966

  6. Use of an Escherichia coli Recombinant Producing Thermostable Polyphosphate Kinase as an ATP Regenerator To Produce Fructose 1,6-Diphosphate▿ †

    PubMed Central

    Iwamoto, Seishi; Motomura, Kei; Shinoda, Yasuharu; Urata, Masaaki; Kato, Junichi; Takiguchi, Noboru; Ohtake, Hisao; Hirota, Ryuichi; Kuroda, Akio

    2007-01-01

    Heat-treated Escherichia coli producing Thermus polyphosphate kinase regenerated ATP by using exogenous polyphosphate. This recombinant could be used as a platform to produce valuable compounds in combination with thermostable phosphorylating or energy-requiring enzymes. In this work, we demonstrated the production of fructose 1,6-diphosphate from fructose and polyphosphate. PMID:17616610

  7. A Metagenomic Analysis of Microbial Contamination in Aviation Fuels

    DTIC Science & Technology

    2009-03-01

    classification by the RDP Classifier, sequences similar to members of the Acidobacteria, Actinobacteria , Bacteroidetes, Chloroflexi, Cyanobacteria... Actinobacteria 85 63 4 152 Bacteroidetes 5 0 0 5 Chloroflexi 7 0 0 7 Cyanobacteria 56 0 0 56 Deinococcus-Thermus 2 0 0 2 Firmicutes 83 99 2 184...Members of the Proteobacteria, Firmicutes and Actinobacteria were represented in all three fuel types; in Jet A and Biodiesel they were the only

  8. Microbiological investigations on the water of a thermal bath at Budapest.

    PubMed

    Szuróczki, Sára; Kéki, Zsuzsa; Káli, Szandra; Lippai, Anett; Márialigeti, Károly; Tóth, Erika

    2016-06-01

    Thermal baths are unique aquatic environments combining a wide variety of natural and anthropogenic ecological factors, which also appear in their microbiological state. There is limited information on the microbiology of thermal baths in their complexity, tracking community shifts from the thermal wells to the pools. In the present study, the natural microbial community of well and pool waters in Gellért bath was studied in detail by cultivation-based techniques. To isolate bacteria, 10% R2A and minimal synthetic media (with "bath water") with agar-agar and gellan gum were used after prolonged incubation time; moreover, polyurethane blocks covered with media were also applied. Strains were identified by sequencing their 16S rRNA gene after grouping them by amplified rDNA restriction analysis. From each sample, the dominance of Alphaproteobacteria was characteristic though their diversity differed among samples. Members of Actinobacteria, Firmicutes, Beta- and Gamma-proteobacteria, Deinococcus-Thermus, and Bacteroidetes were also identified. Representatives of Deinococcus-Thermus phylum appeared only in the pool water. The largest groups in the pool water belonged to the Tistrella and Chelatococcus genera. The most dominant member in the well water was a new taxon, its similarity to Hartmannibacter diazotrophicus as closest relative was 93.93%.

  9. Timing of electron and proton transfer in the ba(3) cytochrome c oxidase from Thermus thermophilus.

    PubMed

    von Ballmoos, Christoph; Lachmann, Peter; Gennis, Robert B; Ädelroth, Pia; Brzezinski, Peter

    2012-06-05

    Heme-copper oxidases are membrane-bound proteins that catalyze the reduction of O(2) to H(2)O, a highly exergonic reaction. Part of the free energy of this reaction is used for pumping of protons across the membrane. The ba(3) oxidase from Thermus thermophilus presumably uses a single proton pathway for the transfer of substrate protons used during O(2) reduction as well as for the transfer of the protons that are pumped across the membrane. The pumping stoichiometry (0.5 H(+)/electron) is lower than that of most other (mitochondrial-like) oxidases characterized to date (1 H(+)/electron). We studied the pH dependence and deuterium isotope effect of the kinetics of electron and proton transfer reactions in the ba(3) oxidase. The results from these studies suggest that the movement of protons to the catalytic site and movement to a site located some distance from the catalytic site [proposed to be a "proton-loading site" (PLS) for pumped protons] are separated in time, which allows individual investigation of these reactions. A scenario in which the uptake and release of a pumped proton occurs upon every second transfer of an electron to the catalytic site would explain the decreased proton pumping stoichiometry compared to that of mitochondrial-like oxidases.

  10. Efficient trans-cleavage by the Schistosoma mansoni SMα1 hammerhead ribozyme in the extreme thermophile Thermus thermophilus

    PubMed Central

    Vazquez-Tello, Alejandro; Castán, Pablo; Moreno, Renata; Smith, James M.; Berenguer, José; Cedergren, Robert

    2002-01-01

    The catalytic hammerhead structure has been found in association with repetitive DNA from several animals, including salamanders, crickets and schistosomes, and functions to process in cis the long multimer transcripts into monomer RNA in vivo. The cellular role of these repetitive elements and their transcripts is unknown. Moreover, none of these natural hammerheads have been shown to trans-cleave a host mRNA in vivo. We analyzed the cis- and trans-cleavage properties of the hammerhead ribozyme associated with the SMα DNA family from the human parasite Schistosoma mansoni. The efficiency of trans-cleavage of a target RNA in vitro was affected mainly by both the temperature-dependent chemical step and the ribozyme–product dissociation step. The optimal temperature for trans-cleavage was 70°C. This result was confirmed when both the SMα1 ribozyme and the target RNA were expressed in the extreme thermophile Thermus thermophilus. Moreover, SMα1 RNA showed a remarkable thermostability, equal or superior to that of the most stable RNAs in this species, suggesting that SMα1 RNA has been selected for stability. Computer analysis predicts that the monomer and multimer transcripts fold into highly compact secondary structures, which may explain their exceptional stability in vivo. PMID:11917021

  11. Plants of the fynbos biome harbour host species-specific bacterial communities.

    PubMed

    Miyambo, Tsakani; Makhalanyane, Thulani P; Cowan, Don A; Valverde, Angel

    2016-08-01

    The fynbos biome in South Africa is globally recognised as a plant biodiversity hotspot. However, very little is known about the bacterial communities associated with fynbos plants, despite interactions between primary producers and bacteria having an impact on the physiology of both partners and shaping ecosystem diversity. This study reports on the structure, phylogenetic composition and potential roles of the endophytic bacterial communities located in the stems of three fynbos plants (Erepsia anceps, Phaenocoma prolifera and Leucadendron laureolum). Using Illumina MiSeq 16S rRNA sequencing we found that different subpopulations of Deinococcus-Thermus, Alphaproteobacteria, Acidobacteria and Firmicutes dominated the endophytic bacterial communities. Alphaproteobacteria and Actinobacteria were prevalent in P. prolifera, whereas Deinococcus-Thermus dominated in L. laureolum, revealing species-specific host-bacteria associations. Although a high degree of variability in the endophytic bacterial communities within hosts was observed, we also detected a core microbiome across the stems of the three plant species, which accounted for 72% of the sequences. Altogether, it seems that both deterministic and stochastic processes shaped microbial communities. Endophytic bacterial communities harboured putative plant growth-promoting bacteria, thus having the potential to influence host health and growth. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  12. Proteogenomic Analysis of a Thermophilic Bacterial Consortium Adapted to Deconstruct Switchgrass

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    D'haeseleer, Patrik; Gladden, John M.; Allgaier, Martin

    2013-07-19

    Thermophilic bacteria are a potential source of enzymes for the deconstruction of lignocellulosic biomass. However, the complement of proteins used to deconstruct biomass and the specific roles of different microbial groups in thermophilic biomass deconstruction are not well-explored. Here we report on the metagenomic and proteogenomic analyses of a compost-derived bacterial consortium adapted to switchgrass at elevated temperature with high levels of glycoside hydrolase activities. Near-complete genomes were reconstructed for the most abundant populations, which included composite genomes for populations closely related to sequenced strains of Thermus thermophilus and Rhodothermus marinus, and for novel populations that are related to thermophilicmore » Paenibacilli and an uncultivated subdivision of the littlestudied Gemmatimonadetes phylum. Partial genomes were also reconstructed for a number of lower abundance thermophilic Chloroflexi populations. Identification of genes for lignocellulose processing and metabolic reconstructions suggested Rhodothermus, Paenibacillus and Gemmatimonadetes as key groups for deconstructing biomass, and Thermus as a group that may primarily metabolize low molecular weight compounds. Mass spectrometry-based proteomic analysis of the consortium was used to identify .3000 proteins in fractionated samples from the cultures, and confirmed the importance of Paenibacillus and Gemmatimonadetes to biomass deconstruction. These studies also indicate that there are unexplored proteins with important roles in bacterial lignocellulose deconstruction.« less

  13. Crystal structure of LysK, an enzyme catalyzing the last step of lysine biosynthesis in Thermus thermophilus, in complex with lysine: Insight into the mechanism for recognition of the amino-group carrier protein, LysW.

    PubMed

    Fujita, Satomi; Cho, Su-Hee; Yoshida, Ayako; Hasebe, Fumihito; Tomita, Takeo; Kuzuyama, Tomohisa; Nishiyama, Makoto

    2017-09-16

    LysK is an M20 peptidase family enzyme that hydrolyzes the isopeptide bond between the carrier protein LysW and lysine in order to release lysine, which is the last step of lysine biosynthesis in Thermus thermophilus. In the present study, we determined the crystal structure of LysK in complex with lysine at a resolution of 2.4 Å. The α-amino group of the bound lysine was oriented toward the catalytic center, which was composed of the residues coordinating divalent metal ions for the hydrolysis of the isopeptide bond. An 11 Å-long path was observed from the active site binding lysine to the protein surface, which may be responsible for recognizing the C-terminal extension domain of LysW with the conserved EDWGE sequence. A positively-charged surface region was detected around the exit of the path, similar to other lysine biosynthetic enzymes using LysW as the carrier protein. Mutational studies of the surface residues provided a plausible model for the electrostatic interaction with LysW. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. Properties of a novel thermostable glucose isomerase mined from Thermus oshimai and its application to preparation of high fructose corn syrup.

    PubMed

    Jia, Dong-Xu; Zhou, Lin; Zheng, Yu-Guo

    2017-04-01

    Glucose isomerase (GI) is used in vitro to convert d-glucose to d-fructose, which is capable of commercial producing high fructose corn syrup (HFCS). To manufacture HFCS at elevated temperature and reduce the cost of enriching syrups, novel refractory GIs from Thermoanaerobacterium xylanolyticum (TxGI), Thermus oshimai (ToGI), Geobacillus thermocatenulatus (GtGI) and Thermoanaerobacter siderophilus (TsGI) were screened via genome mining approach. The enzymatic characteristics research showed that ToGI had higher catalytic efficiency and superior thermostability toward d-glucose among the screened GIs. Its optimum temperature reached 95°C and could retain more than 80% of initial activity in the presence of 20mM Mn 2+ at 85°C for 48h. The K m and k cat /K m values for ToGI were 81.46mM and 21.77min -1 mM -1 , respectively. Furthermore, the maximum conversion yield of 400g/L d-glucose to d-fructose at 85°C was 52.16%. Considering its excellent high thermostability and ameliorable application performance, ToGI might be promising for realization of future industrial production of HFCS at elevated temperature. Copyright © 2017 Elsevier Inc. All rights reserved.

  15. Concentric-flow electrokinetic injector enables serial crystallography of ribosome and photosystem II

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sierra, Raymond G.; Gati, Cornelius; Laksmono, Hartawan

    We describe a concentric-flow electrokinetic injector for efficiently delivering microcrystals for serial femtosecond X-ray crystallography analysis that enables studies of challenging biological systems in their unadulterated mother liquor. We used the injector to analyze microcrystals of Geobacillus stearothermophilus thermolysin (2.2-Å structure), Thermosynechococcus elongatus photosystem II (<3-Å diffraction) and Thermus thermophilus small ribosomal subunit bound to the antibiotic paromomycin at ambient temperature (3.4-Å structure).

  16. Concentric-flow electrokinetic injector enables serial crystallography of ribosome and photosystem II.

    PubMed

    Sierra, Raymond G; Gati, Cornelius; Laksmono, Hartawan; Dao, E Han; Gul, Sheraz; Fuller, Franklin; Kern, Jan; Chatterjee, Ruchira; Ibrahim, Mohamed; Brewster, Aaron S; Young, Iris D; Michels-Clark, Tara; Aquila, Andrew; Liang, Mengning; Hunter, Mark S; Koglin, Jason E; Boutet, Sébastien; Junco, Elia A; Hayes, Brandon; Bogan, Michael J; Hampton, Christina Y; Puglisi, Elisabetta V; Sauter, Nicholas K; Stan, Claudiu A; Zouni, Athina; Yano, Junko; Yachandra, Vittal K; Soltis, S Michael; Puglisi, Joseph D; DeMirci, Hasan

    2016-01-01

    We describe a concentric-flow electrokinetic injector for efficiently delivering microcrystals for serial femtosecond X-ray crystallography analysis that enables studies of challenging biological systems in their unadulterated mother liquor. We used the injector to analyze microcrystals of Geobacillus stearothermophilus thermolysin (2.2-Å structure), Thermosynechococcus elongatus photosystem II (<3-Å diffraction) and Thermus thermophilus small ribosomal subunit bound to the antibiotic paromomycin at ambient temperature (3.4-Å structure).

  17. Production of 2-deoxyribose 5-phosphate from fructose to demonstrate a potential of artificial bio-synthetic pathway using thermophilic enzymes.

    PubMed

    Honda, Kohsuke; Maya, Shohei; Omasa, Takeshi; Hirota, Ryuichi; Kuroda, Akio; Ohtake, Hisao

    2010-08-02

    Six thermophilic enzymes from Thermus thermophilus were used to construct an 'artificial bio-synthetic pathway' for the production of 2-deoxyribose 5-phosphate from fructose. By a simple operation using six recombinant Escherichia coli strains producing the thermophilic enzymes, respectively, fructose was converted to 2-deoxyribose 5-phosphate with a molar yield of 55%. Copyright 2010 Elsevier B.V. All rights reserved.

  18. Microbiological monitoring in geothermal plants and a cold storage

    NASA Astrophysics Data System (ADS)

    Alawi, Mashal; Lerm, Stephanie; Vieth, Andrea; Vetter, Alexandra; Miethling-Graff, Rona; Seibt, Andrea; Wolfgramm, Markus; Würdemann, Hilke

    2010-05-01

    Enhanced process understanding of engineered geothermal systems is mandatory to optimize plant reliability and economy. In the scope of the research project 'AquiScreen' we investigated geothermally used groundwater systems under microbial, geochemical, mineralogical and petrological aspects. Geothermal systems located in the North German Basin and the Molasse Basin were analyzed by sampling of fluids and solid phases. The investigated sites were characterized by different temperatures, salinities and potential microbial substrates. The microbial population was analyzed by the use of genetic fingerprinting techniques based on PCR-amplified 16S rRNA genes. Sequencing of dominant bands of fingerprints from different sites and the subsequent comparison on public databases enables a correlation to metabolic classes and provides information about the biochemical processes. In all investigated geothermal plants covering a temperature range from 45° to 120° C microorganisms were found. Phylogenetic gene analyses indicate a broad diversity of microorganisms adapted to the specific conditions in the engineered system. Beside characterized bacteria like Thermus scotoductus, Siderooxidans lithoautotrophicus and the archaeon Methanothermobacter thermoautotrophicus a high number of so far uncultivated microorganisms was detected. As it is known that -in addition to abiotic factors- microbes like sulfate-reducing bacteria (SRB) are involved in the processes of corrosion and scaling in plant components we identified SRB by specific analyses of dissimilatoric sulfite reductase genes. The SRB detected are closely related to thermotolerant and thermophilic species of Desulfotomaculum, Thermodesulfovibrio and Thermodesulfobacterium, respectively. Overall, the detection of microbes known to be involved in biocorrosion and examined precipitation products like iron sulfides are indicating that microorganisms play an important role for the understanding of processes in engineered geothermal systems. Furthermore, an observed reduction of the filter operation times in a cold storage could be traced back to an enhanced growth of a filamentous iron-oxidizing bacterium related to Thiotrix. The further identificaton of crucial process parameters that are influencing microbial activities will help developing appropriate counter measures against microbial induced clogging and corrosion.

  19. Influence of thermophilic aerobic digestion as a sludge pre-treatment and solids retention time of mesophilic anaerobic digestion on the methane production, sludge digestion and microbial communities in a sequential digestion process.

    PubMed

    Jang, Hyun Min; Cho, Hyun Uk; Park, Sang Kyu; Ha, Jeong Hyub; Park, Jong Moon

    2014-01-01

    In this study, the changes in sludge reduction, methane production and microbial community structures in a process involving two-stage thermophilic aerobic digestion (TAD) and mesophilic anaerobic digestion (MAD) under different solid retention times (SRTs) between 10 and 40 days were investigated. The TAD reactor (RTAD) was operated with a 1-day SRT and the MAD reactor (RMAD) was operated at three different SRTs: 39, 19 and 9 days. For a comparison, control MAD (RCONTROL) was operated at three different SRTs of 40, 20 and 10 days. Our results reveal that the sequential TAD-MAD process has about 42% higher methane production rate (MPR) and 15% higher TCOD removal than those of RCONTROL when the SRT decreased from 40 to 20 days. Denaturing gradient gel electrophoresis (DGGE) and real-time PCR results indicate that RMAD maintained a more diverse bacteria and archaea population compared to RCONTROL, due to the application of the biological TAD pre-treatment process. In RTAD, Ureibacillus thermophiles and Bacterium thermus were the major contributors to the increase in soluble organic matter. In contrast, Methanosaeta concilii, a strictly aceticlastic methanogen, showed the highest population during the operation of overall SRTs in RMAD. Interestingly, as the SRT decreased to 20 days, syntrophic VFA oxidizing bacteria, Clostridium ultunense sp., and a hydrogenotrophic methanogen, Methanobacterium beijingense were detected in RMAD and RCONTROL. Meanwhile, the proportion of archaea to total microbe in RMAD and RCONTROL shows highest values of 10.5 and 6.5% at 20-d SRT operation, respectively. Collectively, these results demonstrate that the increased COD removal and methane production at different SRTs in RMAD might be attributed to the increased synergism among microbial species by improving the hydrolysis of the rate limiting step in sludge with the help of the biological TAD pre-treatment. Copyright © 2013 Elsevier Ltd. All rights reserved.

  20. Concentric-flow electrokinetic injector enables serial crystallography of ribosome and photosystem II

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sierra, Raymond G.; Gati, Cornelius; Laksmono, Hartawan

    In this paper, we describe a concentric-flow electrokinetic injector for efficiently delivering microcrystals for serial femtosecond X-ray crystallography analysis that enables studies of challenging biological systems in their unadulterated mother liquor. Finally, we used the injector to analyze microcrystals of Geobacillus stearothermophilus thermolysin (2.2-Å structure), Thermosynechococcus elongatus photosystem II (<3-Å diffraction) and Thermus thermophilus small ribosomal subunit bound to the antibiotic paromomycin at ambient temperature (3.4-Å structure).

  1. Concentric-flow electrokinetic injector enables serial crystallography of ribosome and photosystem II

    DOE PAGES

    Sierra, Raymond G.; Gati, Cornelius; Laksmono, Hartawan; ...

    2015-11-30

    In this paper, we describe a concentric-flow electrokinetic injector for efficiently delivering microcrystals for serial femtosecond X-ray crystallography analysis that enables studies of challenging biological systems in their unadulterated mother liquor. Finally, we used the injector to analyze microcrystals of Geobacillus stearothermophilus thermolysin (2.2-Å structure), Thermosynechococcus elongatus photosystem II (<3-Å diffraction) and Thermus thermophilus small ribosomal subunit bound to the antibiotic paromomycin at ambient temperature (3.4-Å structure).

  2. Structural asymmetry in the Thermus thermophilus RuvC dimer suggests a basis for sequential strand cleavages during Holliday junction resolution.

    PubMed

    Chen, Luan; Shi, Ke; Yin, Zhiqi; Aihara, Hideki

    2013-01-07

    Holliday junction (HJ) resolvases are structure-specific endonucleases that cleave four-way DNA junctions (HJs) generated during DNA recombination and repair. Bacterial RuvC, a prototypical HJ resolvase, functions as homodimer and nicks DNA strands precisely across the junction point. To gain insights into the mechanisms underlying symmetrical strand cleavages by RuvC, we performed crystallographic and biochemical analyses of RuvC from Thermus thermophilus (T.th. RuvC). The crystal structure of T.th. RuvC shows an overall protein fold similar to that of Escherichia coli RuvC, but T.th. RuvC has a more tightly associated dimer interface possibly reflecting its thermostability. The binding mode of a HJ-DNA substrate can be inferred from the shape/charge complementarity between the T.th. RuvC dimer and HJ-DNA, as well as positions of sulfate ions bound on the protein surface. Unexpectedly, the structure of T.th. RuvC homodimer refined at 1.28 Å resolution shows distinct asymmetry near the dimer interface, in the region harboring catalytically important aromatic residues. The observation suggests that the T.th. RuvC homodimer interconverts between two asymmetric conformations, with alternating subunits switched on for DNA strand cleavage. This model provides a structural basis for the 'nick-counter-nick' mechanism in HJ resolution, a mode of HJ processing shared by prokaryotic and eukaryotic HJ resolvases.

  3. Differences in Physical and Biochemical Properties of Thermus scotoductus SA-01 Cultured with Dielectric or Convection Heating.

    PubMed

    Cockrell, Allison L; Fitzgerald, Lisa A; Cusick, Kathleen D; Barlow, Daniel E; Tsoi, Stanislav D; Soto, Carissa M; Baldwin, Jeffrey W; Dale, Jason R; Morris, Robert E; Little, Brenda J; Biffinger, Justin C

    2015-09-01

    A thermophile, Thermus scotoductus SA-01, was cultured within a constant-temperature (65°C) microwave (MW) digester to determine if MW-specific effects influenced the growth and physiology of the organism. As a control, T. scotoductus cells were also cultured using convection heating at the same temperature as the MW studies. Cell growth was analyzed by optical density (OD) measurements, and cell morphologies were characterized using electron microscopy imaging (scanning electron microscopy [SEM] and transmission electron microscopy [TEM]), dynamic light scattering (DLS), and atomic force microscopy (AFM). Biophysical properties (i.e., turgor pressure) were also calculated with AFM, and biochemical compositions (i.e., proteins, nucleic acids, fatty acids) were analyzed by attenuated total reflectance-Fourier transform infrared (ATR-FTIR) spectroscopy. Gas chromatography-mass spectrometry (GC-MS) was used to analyze the fatty acid methyl esters extracted from cell membranes. Here we report successful cultivation of a thermophile with only dielectric heating. Under the MW conditions for growth, cell walls remained intact and there were no indications of membrane damage or cell leakage. Results from these studies also demonstrated that T. scotoductus cells grown with MW heating exhibited accelerated growth rates in addition to altered cell morphologies and biochemical compositions compared with oven-grown cells. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  4. Inactivation and unfolding of protein tyrosine phosphatase from Thermus thermophilus HB27 during urea and guanidine hydrochloride denaturation.

    PubMed

    Wang, Yejing; He, Huawei; Liu, Lina; Gao, Chunyan; Xu, Shui; Zhao, Ping; Xia, Qingyou

    2014-01-01

    The effects of urea and guanidine hydrochloride (GdnHCl) on the activity, conformation and unfolding process of protein tyrosine phosphatase (PTPase), a thermostable low molecular weight protein from Thermus thermophilus HB27, have been studied. Enzymatic activity assays showed both urea and GdnHCl resulted in the inactivation of PTPase in a concentration and time-dependent manner. Inactivation kinetics analysis suggested that the inactivation of PTPase induced by urea and GdnHCl were both monophasic and reversible processes, and the effects of urea and GdnHCl on PTPase were similar to that of mixed-type reversible inhibitors. Far-ultraviolet (UV) circular dichroism (CD), Tryptophan and 1-anilinonaphthalene -8-sulfonic acid (ANS) fluorescence spectral analyses indicated the existence of a partially active and an inactive molten globule-like intermediate during the unfolding processes induced by urea and GdnHCl, respectively. Based on the sequence alignment and the homolog Tt1001 protein structure, we discussed the possible conformational transitions of PTPase induced by urea and GdnHCl and compared the conformations of these unfolding intermediates with the transient states in bovine PTPase and its complex structures in detail. Our results may be able to provide some valuable clues to reveal the relationship between the structure and enzymatic activity, and the unfolding pathway and mechanism of PTPase.

  5. Inactivation and Unfolding of Protein Tyrosine Phosphatase from Thermus thermophilus HB27 during Urea and Guanidine Hydrochloride Denaturation

    PubMed Central

    Liu, Lina; Gao, Chunyan; Xu, Shui; Zhao, Ping; Xia, Qingyou

    2014-01-01

    The effects of urea and guanidine hydrochloride (GdnHCl) on the activity, conformation and unfolding process of protein tyrosine phosphatase (PTPase), a thermostable low molecular weight protein from Thermus thermophilus HB27, have been studied. Enzymatic activity assays showed both urea and GdnHCl resulted in the inactivation of PTPase in a concentration and time-dependent manner. Inactivation kinetics analysis suggested that the inactivation of PTPase induced by urea and GdnHCl were both monophasic and reversible processes, and the effects of urea and GdnHCl on PTPase were similar to that of mixed-type reversible inhibitors. Far-ultraviolet (UV) circular dichroism (CD), Tryptophan and 1-anilinonaphthalene -8-sulfonic acid (ANS) fluorescence spectral analyses indicated the existence of a partially active and an inactive molten globule-like intermediate during the unfolding processes induced by urea and GdnHCl, respectively. Based on the sequence alignment and the homolog Tt1001 protein structure, we discussed the possible conformational transitions of PTPase induced by urea and GdnHCl and compared the conformations of these unfolding intermediates with the transient states in bovine PTPase and its complex structures in detail. Our results may be able to provide some valuable clues to reveal the relationship between the structure and enzymatic activity, and the unfolding pathway and mechanism of PTPase. PMID:25255086

  6. In vivo directed evolution for thermostabilization of Escherichia coli hygromycin B phosphotransferase and the use of the gene as a selection marker in the host-vector system of Thermus thermophilus.

    PubMed

    Nakamura, Akira; Takakura, Yasuaki; Kobayashi, Hideo; Hoshino, Takayuki

    2005-08-01

    An in vivo-directed evolutionary strategy was used to obtain a thermostabilized Escherichia coli hygromycin B phosphotransferase, using a host-vector system of Thermus thermophilus. Introduction of the mutant gene containing two amino acid substitutions, S52T and W238C, which was previously reported by Cannio et al. [J. Bacteriol., 180, 3237-3240 (1998)], did not confer hygromycin resistance on T. thermophilus cells at 55 degrees C; however, five spontaneously-generated independent mutants were obtained by selection of the transformants at this temperature. Each mutant gene contained one amino acid substitution of either A118V or T246A. Further selection with increasing temperature, at 58 degrees C and then 61 degrees C, led to acquisition of three more substitutions: D20G, S225P and Q226L. These mutations cumulatively influenced the maximum growth temperature of the T. thermophilus transformants in the presence of hygromycin; T. thermophilus carrying a mutant gene containing all the five substitutions was able to grow at up to 67 degrees C. This mutant gene, hph5, proved useful as a selection marker in the T. thermophilus host-vector system, either on the plasmid or by genome integration, at temperatures up to 65 degrees C.

  7. A single amino acid limits the substrate specificity of Thermus thermophilus uridine-cytidine kinase to cytidine.

    PubMed

    Tomoike, Fumiaki; Nakagawa, Noriko; Kuramitsu, Seiki; Masui, Ryoji

    2011-05-31

    The salvage pathways of nucleotide biosynthesis are more diverse and are less well understood as compared with de novo pathways. Uridine-cytidine kinase (UCK) is the rate-limiting enzyme in the pyrimidine-nucleotide salvage pathway. In this study, we have characterized a UCK homologue of Thermus thermophilus HB8 (ttCK) biochemically and structurally. Unlike other UCKs, ttCK had substrate specificity toward only cytidine and showed no inhibition by UTP, suggesting uridine does not bind to ttCK as substrate. Structural analysis revealed that the histidine residue located near the functional group at position 4 of cytidine or uridine in most UCKs is substituted with tyrosine, Tyr93, in ttCK. Replacement of Tyr93 by histidine or glutamine endowed ttCK with phosphorylation activity toward uridine. These results suggested that a single amino acid residue, Tyr93, gives cytidine-limited specificity to ttCK. However, replacement of Tyr93 by Phe or Leu did not change the substrate specificity of ttCK. Therefore, we conclude that a residue at this position is essential for the recognition of uridine by UCK. In addition, thymidine phosphorylase from T. thermophilus HB8 was equally active with thymidine and uridine, which indicates that this protein is the sole enzyme metabolizing uridine in T. Thermophilus HB8. On the basis of these results, we discuss the pyrimidine-salvage pathway in T. thermophilus HB8.

  8. Models for the a subunits of the Thermus thermophilus V/A-ATPase and Saccharomyces cerevisiae V-ATPase enzymes by cryo-EM and evolutionary covariance

    PubMed Central

    Schep, Daniel G.; Rubinstein, John L.

    2016-01-01

    Rotary ATPases couple ATP synthesis or hydrolysis to proton translocation across a membrane. However, understanding proton translocation has been hampered by a lack of structural information for the membrane-embedded a subunit. The V/A-ATPase from the eubacterium Thermus thermophilus is similar in structure to the eukaryotic V-ATPase but has a simpler subunit composition and functions in vivo to synthesize ATP rather than pump protons. We determined the T. thermophilus V/A-ATPase structure by cryo-EM at 6.4 Å resolution. Evolutionary covariance analysis allowed tracing of the a subunit sequence within the map, providing a complete model of the rotary ATPase. Comparing the membrane-embedded regions of the T. thermophilus V/A-ATPase and eukaryotic V-ATPase from Saccharomyces cerevisiae allowed identification of the α-helices that belong to the a subunit and revealed the existence of previously unknown subunits in the eukaryotic enzyme. Subsequent evolutionary covariance analysis enabled construction of a model of the a subunit in the S. cerevisae V-ATPase that explains numerous biochemical studies of that enzyme. Comparing the two a subunit structures determined here with a structure of the distantly related a subunit from the bovine F-type ATP synthase revealed a conserved pattern of residues, suggesting a common mechanism for proton transport in all rotary ATPases. PMID:26951669

  9. Exploring the proton pump and exit pathway for pumped protons in cytochrome ba3 from Thermus thermophilus

    PubMed Central

    Chang, Hsin-Yang; Choi, Sylvia K.; Vakkasoglu, Ahmet Selim; Chen, Ying; Hemp, James; Fee, James A.; Gennis, Robert B.

    2012-01-01

    The heme-copper oxygen reductases are redox-driven proton pumps. In the current work, the effects of mutations in a proposed exit pathway for pumped protons are examined in the ba3-type oxygen reductase from Thermus thermophilus, leading from the propionates of heme a3 to the interface between subunits I and II. Recent studies have proposed important roles for His376 and Asp372, both of which are hydrogen-bonded to propionate-A of heme a3, and for Glu126II (subunit II), which is hydrogen-bonded to His376. Based on the current results, His376, Glu126II, and Asp372 are not essential for either oxidase activity or proton pumping. In addition, Tyr133, which is hydrogen-bonded to propionate-D of heme a3, was also shown not to be essential for function. However, two mutations of the residues hydrogen-bonded to propionate-A, Asp372Ile and His376Asn, retain high electron transfer activity and normal spectral features but, in different preparations, either do not pump protons or exhibit substantially diminished proton pumping. It is concluded that either propionate-A of heme a3 or possibly the cluster of groups centered about the conserved water molecule that hydrogen-bonds to both propionates-A and -D of heme a3 is a good candidate to be the proton loading site. PMID:22431640

  10. Exploring the proton pump and exit pathway for pumped protons in cytochrome ba3 from Thermus thermophilus.

    PubMed

    Chang, Hsin-Yang; Choi, Sylvia K; Vakkasoglu, Ahmet Selim; Chen, Ying; Hemp, James; Fee, James A; Gennis, Robert B

    2012-04-03

    The heme-copper oxygen reductases are redox-driven proton pumps. In the current work, the effects of mutations in a proposed exit pathway for pumped protons are examined in the ba(3)-type oxygen reductase from Thermus thermophilus, leading from the propionates of heme a(3) to the interface between subunits I and II. Recent studies have proposed important roles for His376 and Asp372, both of which are hydrogen-bonded to propionate-A of heme a(3), and for Glu126(II) (subunit II), which is hydrogen-bonded to His376. Based on the current results, His376, Glu126(II), and Asp372 are not essential for either oxidase activity or proton pumping. In addition, Tyr133, which is hydrogen-bonded to propionate-D of heme a(3), was also shown not to be essential for function. However, two mutations of the residues hydrogen-bonded to propionate-A, Asp372Ile and His376Asn, retain high electron transfer activity and normal spectral features but, in different preparations, either do not pump protons or exhibit substantially diminished proton pumping. It is concluded that either propionate-A of heme a(3) or possibly the cluster of groups centered about the conserved water molecule that hydrogen-bonds to both propionates-A and -D of heme a(3) is a good candidate to be the proton loading site.

  11. Structure of the beta-galactosidase gene from Thermus sp. strain T2: expression in Escherichia coli and purification in a single step of an active fusion protein.

    PubMed

    Vian, A; Carrascosa, A V; García, J L; Cortés, E

    1998-06-01

    The nucleotide sequence of both the bgaA gene, coding for a thermostable beta-galactosidase of Thermus sp. strain T2, and its flanking regions was determined. The deduced amino acid sequence of the enzyme predicts a polypeptide of 645 amino acids (Mr, 73,595). Comparative analysis of the open reading frames located in the flanking regions of the bgaA gene revealed that they might encode proteins involved in the transport and hydrolysis of sugars. The observed homology between the deduced amino acid sequences of BgaA and the beta-galactosidase of Bacillus stearothermophilus allows us to classify the new enzyme within family 42 of glycosyl hydrolases. BgaA was overexpressed in its active form in Escherichia coli, but more interestingly, an active chimeric beta-galactosidase was constructed by fusing the BgaA protein to the choline-binding domain of the major pneumococcal autolysin. This chimera illustrates a novel approach for producing an active and thermostable hybrid enzyme that can be purified in a single step by affinity chromatography on DEAE-cellulose, retaining the catalytic properties of the native enzyme. The chimeric enzyme showed a specific activity of 191,000 U/mg at 70 degrees C and a Km value of 1.6 mM with o-nitrophenyl-beta-D-galactopyranoside as a substrate, and it retained 50% of its initial activity after 1 h of incubation at 70 degrees C.

  12. Characterization of DNA polymerase X from Thermus thermophilus HB8 reveals the POLXc and PHP domains are both required for 3'-5' exonuclease activity.

    PubMed

    Nakane, Shuhei; Nakagawa, Noriko; Kuramitsu, Seiki; Masui, Ryoji

    2009-04-01

    The X-family DNA polymerases (PolXs) comprise a highly conserved DNA polymerase family found in all kingdoms. Mammalian PolXs are known to be involved in several DNA-processing pathways including repair, but the cellular functions of bacterial PolXs are less known. Many bacterial PolXs have a polymerase and histidinol phosphatase (PHP) domain at their C-termini in addition to a PolX core (POLXc) domain, and possess 3'-5' exonuclease activity. Although both domains are highly conserved in bacteria, their molecular functions, especially for a PHP domain, are unknown. We found Thermus thermophilus HB8 PolX (ttPolX) has Mg(2+)/Mn(2+)-dependent DNA/RNA polymerase, Mn(2+)-dependent 3'-5' exonuclease and DNA-binding activities. We identified the domains of ttPolX by limited proteolysis and characterized their biochemical activities. The POLXc domain was responsible for the polymerase and DNA-binding activities but exonuclease activity was not detected for either domain. However, the POLXc and PHP domains interacted with each other and a mixture of the two domains had Mn(2+)-dependent 3'-5' exonuclease activity. Moreover, site-directed mutagenesis revealed catalytically important residues in the PHP domain for the 3'-5' exonuclease activity. Our findings provide a molecular insight into the functional domain organization of bacterial PolXs, especially the requirement of the PHP domain for 3'-5' exonuclease activity.

  13. Single mutations that redirect internal proton transfer in the ba3 oxidase from Thermus thermophilus

    PubMed Central

    Smirnova, Irina; Chang, Hsin-Yang; von Ballmoos, Christoph; Ädelroth, Pia; Gennis, Robert B.; Brzezinski, Peter

    2014-01-01

    The ba3-type cytochrome c oxidase from Thermus thermophilus is a membrane-bound proton pump. Results from earlier studies have shown that with the aa3-type oxidases proton uptake to the catalytic site and “pump site” occur simultaneously. However, with the ba3 oxidase the pump site is loaded before proton transfer to the catalytic site because the proton transfer to the latter is slower than with the aa3 oxidases. In addition, the timing of formation and decay of catalytic intermediates is different in the two types of oxidases. In the present study, we have investigated two mutant ba3 CytcOs in which residues of the proton pathway leading to the catalytic site as well as the pump site were exchanged, Thr312Val and Tyr244Phe. Even though the ba3 CytcO uses only a single proton pathway for transfer of the substrate and “pumped” protons, the amino-acid residue substitutions had distinctly different effects on the kinetics of proton transfer to the catalytic site and the pump site, respectively. The results indicate that the rates of these reactions can be modified independently by replacement of single residues within the proton pathway. Furthermore, the data suggest that the Thr312Val and Tyr244Phe mutations interfere with a structural rearrangement in the proton pathway that is rate limiting for proton transfer to the catalytic site. PMID:24004023

  14. Metagenomic analysis of bacterial and archaeal assemblages in the soil-mousse surrounding a geothermal spring.

    PubMed

    Bhatia, Sonu; Batra, Navneet; Pathak, Ashish; Joshi, Amit; Souza, Leila; Almeida, Paulo; Chauhan, Ashvini

    2015-09-01

    The soil-mousse surrounding a geothermal spring was analyzed for bacterial and archaeal diversity using 16S rRNA gene amplicon metagenomic sequencing which revealed the presence of 18 bacterial phyla distributed across 109 families and 219 genera. Firmicutes, Actinobacteria, and the Deinococcus-Thermus group were the predominant bacterial assemblages with Crenarchaeota and Thaumarchaeota as the main archaeal assemblages in this largely understudied geothermal habitat. Several metagenome sequences remained taxonomically unassigned suggesting the presence of a repertoire of hitherto undescribed microbes in this geothermal soil-mousse econiche.

  15. Analysis of etiology and drug resistance of biliary infections.

    PubMed

    Wang, Xin; Li, Qiu; Zou, Shengquan; Sun, Ziyong; Zhu, Feng

    2004-01-01

    The bile was collected from fro patients with biliary infections, with the bacterium isolated to study the sensitivity of each kind of the bacterium to several antibiotics in common use. Except G- bacterium, we also found some kinds of G+ bacterium in infection bile. G- bacterium were not sensitive to Clindamycin, G+ bacterium were sensitive to Ciprofloxacin. Escherichia coli, Xanthomonas maltophilia, Enterobacter cloacae, Pseudomonas aeruginosa were sensitive to Ampicillin. G+ bacterium were not sensitive to Azactam. Enterococcus faecalis, Enterococcus faecium, Enterobacter cloacae were not sensitive to Ceftazidime. Enterococcus faecalis, Staphylococcus coagulase negative, Staphylococcus epidermidis, Pseudomonas aeruginosa were not sensitive to Ceftriaxone Sodium. We didn't found any bacterium resistance Imipenem. The possibility of the existence of G+ bacterium as well as drug resistance should be considered n patients with biliary infections. The value of susceptibility test should be respected to avoid drug abuse of antibiotics.

  16. An enigmatic aquatic snake from the Cenomanian of Northern South America

    PubMed Central

    Carrillo-Briceño, Jorge D.; Neenan, James M.

    2016-01-01

    We report the first record of a snake from the Cretaceous of northern South America. The remains come from the La Luna Formation (La Aguada Member, Cenomanian of Venezuela) and consist of several vertebrae, which belong to the precloacal region of the vertebral column. Comparisons to extant and extinct snakes show that the remains represent a new taxon, Lunaophis aquaticus gen. et sp nov. An aquatic mode of life is supported by the ventral position of the ribs, indicating a laterally compressed body. The systematic relationships of this new taxon are difficult to determine due to the scarcity of fossil material; it is, however, a representative of an early lineage of snakes that exploited tropical marine pelagic environments, as reflected by the depositional conditions of the La Aguada Member. Lunaophis is also the first aquatic snake from the Cenomanian found outside of the African and European Tethyan and Boreal Zones. PMID:27257536

  17. Time-resolved single-turnover of caa(3) oxidase from Thermus thermophilus. Fifth electron of the fully reduced enzyme converts O(H) into E(H) state.

    PubMed

    Siletsky, Sergey A; Belevich, Ilya; Belevich, Nikolai P; Soulimane, Tewfik; Verkhovsky, Michael I

    2011-09-01

    The oxidative part of the catalytic cycle of the caa(3)-type cytochrome c oxidase from Thermus thermophilus was followed by time-resolved optical spectroscopy. Rate constants, chemical nature and the spectral properties of the catalytic cycle intermediates (Compounds A, P, F) reproduce generally the features typical for the aa(3)-type oxidases with some distinctive peculiarities caused by the presence of an additional 5-th redox-center-a heme center of the covalently bound cytochrome c. Compound A was formed with significantly smaller yield compared to aa(3) oxidases in general and to ba(3) oxidase from the same organism. Two electrons, equilibrated between three input redox-centers: heme a, Cu(A) and heme c are transferred in a single transition to the binuclear center during reduction of the compound F, converting the binuclear center through the highly reactive O(H) state into the final product of the reaction-E(H) (one-electron reduced) state of the catalytic site. In contrast to previous works on the caa(3)-type enzymes, we concluded that the finally produced E(H) state of caa(3) oxidase is characterized by the localization of the fifth electron in the binuclear center, similar to the O(H)→E(H) transition of the aa(3)-type oxidases. So, the fully-reduced caa(3) oxidase is competent in rapid electron transfer from the input redox-centers into the catalytic heme-copper site. 2011 Elsevier B.V. All rights reserved.

  18. Crystallization screening test for the whole-cell project on Thermus thermophilus HB8

    PubMed Central

    Iino, Hitoshi; Naitow, Hisashi; Nakamura, Yuki; Nakagawa, Noriko; Agari, Yoshihiro; Kanagawa, Mayumi; Ebihara, Akio; Shinkai, Akeo; Sugahara, Mitsuaki; Miyano, Masashi; Kamiya, Nobuo; Yokoyama, Shigeyuki; Hirotsu, Ken; Kuramitsu, Seiki

    2008-01-01

    It was essential for the structural genomics of Thermus thermophilus HB8 to efficiently crystallize a number of proteins. To this end, three conventional robots, an HTS-80 (sitting-drop vapour diffusion), a Crystal Finder (hanging-drop vapour diffusion) and a TERA (modified microbatch) robot, were subjected to a crystallization condition screening test involving 18 proteins from T. thermophilus HB8. In addition, a TOPAZ (microfluidic free-interface diffusion) designed specifically for initial screening was also briefly examined. The number of diffraction-quality crystals and the time of appearance of crystals increased in the order HTS-80, Crystal Finder, TERA. With the HTS-80 and Crystal Finder, the time of appearance was short and the rate of salt crystallization was low. With the TERA, the number of diffraction-quality crystals was high, while the time of appearance was long and the rate of salt crystallization was relatively high. For the protein samples exhibiting low crystallization success rates, there were few crystallization conditions that were common to the robots used. In some cases, the success rate depended greatly on the robot used. The TOPAZ showed the shortest time of appearance and the highest success rate, although the crystals obtained were too small for diffraction studies. These results showed that the combined use of different robots significantly increases the chance of obtaining crystals, especially for proteins exhibiting low crystallization success rates. The structures of 360 of 944 purified proteins have been successfully determined through the combined use of an HTS-80 and a TERA. PMID:18540056

  19. Purification and characterization of a novel recombinant highly enantioselective short-chain NAD(H)-dependent alcohol dehydrogenase from Thermus thermophilus.

    PubMed

    Pennacchio, Angela; Pucci, Biagio; Secundo, Francesco; La Cara, Francesco; Rossi, Mosè; Raia, Carlo A

    2008-07-01

    The gene encoding a novel alcohol dehydrogenase (ADH) that belongs to the short-chain dehydrogenase/reductase (SDR) superfamily was identified in the extremely thermophilic, halotolerant gram-negative eubacterium Thermus thermophilus HB27. The T. thermophilus ADH gene (adh(Tt)) was heterologously overexpressed in Escherichia coli, and the protein (ADH(Tt)) was purified to homogeneity and characterized. ADH(Tt) is a tetrameric enzyme consisting of identical 26,961-Da subunits composed of 256 amino acids. The enzyme has remarkable thermophilicity and thermal stability, displaying activity at temperatures up to approximately 73 degrees C and a 30-min half-inactivation temperature of approximately 90 degrees C, as well as good tolerance to common organic solvents. ADH(Tt) has a strict requirement for NAD(H) as the coenzyme, a preference for reduction of aromatic ketones and alpha-keto esters, and poor activity on aromatic alcohols and aldehydes. This thermophilic enzyme catalyzes the following reactions with Prelog specificity: the reduction of acetophenone, 2,2,2-trifluoroacetophenone, alpha-tetralone, and alpha-methyl and alpha-ethyl benzoylformates to (S)-(-)-1-phenylethanol (>99% enantiomeric excess [ee]), (R)-alpha-(trifluoromethyl)benzyl alcohol (93% ee), (S)-alpha-tetralol (>99% ee), methyl (R)-(-)-mandelate (92% ee), and ethyl (R)-(-)-mandelate (95% ee), respectively, by way of an efficient in situ NADH-recycling system involving 2-propanol and a second thermophilic ADH. This study further supports the critical role of the D37 residue in discriminating NAD(H) from NADP(H) in members of the SDR superfamily.

  20. The role of the PHP domain associated with DNA polymerase X from Thermus thermophilus HB8 in base excision repair.

    PubMed

    Nakane, Shuhei; Nakagawa, Noriko; Kuramitsu, Seiki; Masui, Ryoji

    2012-11-01

    Base excision repair (BER) is one of the most commonly used DNA repair pathways involved in genome stability. X-family DNA polymerases (PolXs) play critical roles in BER, especially in filling single-nucleotide gaps. In addition to a polymerase core domain, bacterial PolXs have a polymerase and histidinol phosphatase (PHP) domain with phosphoesterase activity which is also required for BER. However, the role of the PHP domain of PolX in bacterial BER remains unresolved. We found that the PHP domain of Thermus thermophilus HB8 PolX (ttPolX) functions as two types of phosphoesterase in BER, including a 3'-phosphatase and an apurinic/apyrimidinic (AP) endonuclease. Experiments using T. thermophilus HB8 cell lysates revealed that the majority of the 3'-phosphatase and AP endonuclease activities are attributable to the another phosphoesterase in T. thermophilus HB8, endonuclease IV (ttEndoIV). However, ttPolX possesses significant 3'-phosphatase activity in ΔttendoIV cell lysate, indicating possible complementation. Our experiments also reveal that there are only two enzymes that display the 3'-phosphatase activity in the T. thermophilus HB8 cell, ttPolX and ttEndoIV. Furthermore, phenotypic analysis of ΔttpolX, ΔttendoIV, and ΔttpolX/ΔttendoIV using hydrogen peroxide and sodium nitrite supports the hypothesis that ttPolX functions as a backup for ttEndoIV in BER. Copyright © 2012 Elsevier B.V. All rights reserved.

  1. Transferable Denitrification Capability of Thermus thermophilus

    PubMed Central

    Alvarez, Laura; Bricio, Carlos; Blesa, Alba; Hidalgo, Aurelio

    2014-01-01

    Laboratory-adapted strains of Thermus spp. have been shown to require oxygen for growth, including the model strains T. thermophilus HB27 and HB8. In contrast, many isolates of this species that have not been intensively grown under laboratory conditions keep the capability to grow anaerobically with one or more electron acceptors. The use of nitrogen oxides, especially nitrate, as electron acceptors is one of the most widespread capabilities among these facultative strains. In this process, nitrate is reduced to nitrite by a reductase (Nar) that also functions as electron transporter toward nitrite and nitric oxide reductases when nitrate is scarce, effectively replacing respiratory complex III. In many T. thermophilus denitrificant strains, most electrons for Nar are provided by a new class of NADH dehydrogenase (Nrc). The ability to reduce nitrite to NO and subsequently to N2O by the corresponding Nir and Nor reductases is also strain specific. The genes encoding the capabilities for nitrate (nar) and nitrite (nir and nor) respiration are easily transferred between T. thermophilus strains by natural competence or by a conjugation-like process and may be easily lost upon continuous growth under aerobic conditions. The reason for this instability is apparently related to the fact that these metabolic capabilities are encoded in gene cluster islands, which are delimited by insertion sequences and integrated within highly variable regions of easily transferable extrachromosomal elements. Together with the chromosomal genes, these plasmid-associated genetic islands constitute the extended pangenome of T. thermophilus that provides this species with an enhanced capability to adapt to changing environments. PMID:24141123

  2. Analysis of the cooperative ATPase cycle of the AAA+ chaperone ClpB from Thermus thermophilus by using ordered heterohexamers with an alternating subunit arrangement.

    PubMed

    Yamasaki, Takashi; Oohata, Yukiko; Nakamura, Toshiki; Watanabe, Yo-hei

    2015-04-10

    The ClpB/Hsp104 chaperone solubilizes and reactivates protein aggregates in cooperation with DnaK/Hsp70 and its cofactors. The ClpB/Hsp104 protomer has two AAA+ modules, AAA-1 and AAA-2, and forms a homohexamer. In the hexamer, these modules form a two-tiered ring in which each tier consists of homotypic AAA+ modules. By ATP binding and its hydrolysis at these AAA+ modules, ClpB/Hsp104 exerts the mechanical power required for protein disaggregation. Although ATPase cycle of this chaperone has been studied by several groups, an integrated understanding of this cycle has not been obtained because of the complexity of the mechanism and differences between species. To improve our understanding of the ATPase cycle, we prepared many ordered heterohexamers of ClpB from Thermus thermophilus, in which two subunits having different mutations were cross-linked to each other and arranged alternately and measured their nucleotide binding, ATP hydrolysis, and disaggregation abilities. The results indicated that the ATPase cycle of ClpB proceeded as follows: (i) the 12 AAA+ modules randomly bound ATP, (ii) the binding of four or more ATP to one AAA+ ring was sensed by a conserved Arg residue and converted another AAA+ ring into the ATPase-active form, and (iii) ATP hydrolysis occurred cooperatively in each ring. We also found that cooperative ATP hydrolysis in at least one ring was needed for the disaggregation activity of ClpB. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  3. Roles of conserved arginines in ATP-binding domains of AAA+ chaperone ClpB from Thermus thermophilus.

    PubMed

    Yamasaki, Takashi; Nakazaki, Yosuke; Yoshida, Masasuke; Watanabe, Yo-hei

    2011-07-01

    ClpB, a member of the expanded superfamily of ATPases associated with diverse cellular activities (AAA+), forms a ring-shaped hexamer and cooperates with the DnaK chaperone system to reactivate aggregated proteins in an ATP-dependent manner. The ClpB protomer consists of an N-terminal domain, an AAA+ module (AAA-1), a middle domain, and a second AAA+ module (AAA-2). Each AAA+ module contains highly conserved WalkerA and WalkerB motifs, and two arginines (AAA-1) or one arginine (AAA-2). Here, we investigated the roles of these arginines (Arg322, Arg323, and Arg747) of ClpB from Thermus thermophilus in the ATPase cycle and chaperone function by alanine substitution. These mutations did not affect nucleotide binding, but did inhibit the hydrolysis of the bound ATP and slow the threading of the denatured protein through the central pore of the T. thermophilus ClpB ring, which severely impaired the chaperone functions. Previously, it was demonstrated that ATP binding to the AAA-1 module induced motion of the middle domain and stabilized the ClpB hexamer. However, the arginine mutations of the AAA-1 module destabilized the ClpB hexamer, even though ATP-induced motion of the middle domain was not affected. These results indicated that the three arginines are crucial for ATP hydrolysis and chaperone activity, but not for ATP binding. In addition, the two arginines in AAA-1 and the ATP-induced motion of the middle domain independently contribute to the stabilization of the hexamer. © 2011 The Authors Journal compilation © 2011 FEBS.

  4. Single Upconversion Nanoparticle-Bacterium Cotrapping for Single-Bacterium Labeling and Analysis.

    PubMed

    Xin, Hongbao; Li, Yuchao; Xu, Dekang; Zhang, Yueli; Chen, Chia-Hung; Li, Baojun

    2017-04-01

    Detecting and analyzing pathogenic bacteria in an effective and reliable manner is crucial for the diagnosis of acute bacterial infection and initial antibiotic therapy. However, the precise labeling and analysis of bacteria at the single-bacterium level are a technical challenge but very important to reveal important details about the heterogeneity of cells and responds to environment. This study demonstrates an optical strategy for single-bacterium labeling and analysis by the cotrapping of single upconversion nanoparticles (UCNPs) and bacteria together. A single UCNP with an average size of ≈120 nm is first optically trapped. Both ends of a single bacterium are then trapped and labeled with single UCNPs emitting green light. The labeled bacterium can be flexibly moved to designated locations for further analysis. Signals from bacteria of different sizes are detected in real time for single-bacterium analysis. This cotrapping method provides a new approach for single-pathogenic-bacterium labeling, detection, and real-time analysis at the single-particle and single-bacterium level. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Pseudorhodobacter sinensis sp. nov. and Pseudorhodobacter aquaticus sp. nov., isolated from crater lakes.

    PubMed

    Li, Ai-Hua; Liu, Hong-Can; Hou, Wei-Guo; Zhou, Yu-Guang

    2016-08-01

    Three Gram-stain negative, aerobic, non-motile, rod-shaped bacterial strains, Y1R2-4T, Y3R2-3 and DC2N1-10T, isolated from two crater lakes of the Daxinganling Mountains, northern China, were studied to determine their taxonomic position. They grew at 4-30 °C (optimally at 20-25 °C), at pH 6.0-7.5 (optimally at pH 7.0) and in the presence of 0-0.5 % (w/v) NaCl. On the basis of 16S rRNA gene sequence analysis, these strains showed 95.3-96.6 % similarity to members of the genus Pseudorhodobacter, including Pseudorhodobacter ferrugineus DSM 5888T, Pseudorhodobacter wandonensis WT-MW11T, Pseudorhodobacter antarcticus ZS3-33T and Pseudorhodobacter aquimaris HDW-19T. All strains contained Q-10 as the predominant ubiquinone and C18 : 1ω7c as the major fatty acid. The main polar lipids for strains Y1R2-4T and Y3R2-3 were phosphatidylglycerol, phosphatidylcholine, one unidentified aminophospholipid, one unidentified aminolipid, three unidentified phospholipids and two unidentified lipids, and those for strain DC2N1-10T were phosphatidylglycerol, phosphatidylcholine, one unidentified aminophospholipid, one unidentified aminolipid, one unidentified phospholipid and several unidentified lipids. The DNA G+C contents of strains Y1R2-4T, Y3R2-3 and DC2N1-10T were 61.9, 61.0 and 60.0 mol%, respectively. In addition, strain Y1R2-4T shared less than 50 % DNA-DNA relatedness to strain DC2N1-10T. Based on these differences in genetic, physiological and chemotaxonomic properties, strains Y1R2-4T, Y3R2-3 and DC2N1-10T were considered to represent two novel species of the genus Pseudorhodobacter, for which the names Pseudorhodobacter sinensis sp. nov. (type strain Y1R2-4T=CGMCC1.14435T=KCTC 52039T) and Pseudorhodobacter aquaticus sp. nov. (type strain DC2N1-10T=CGMCC1.14433T=KCTC 52040T) are proposed.

  6. Metagenomic analysis of bacterial and archaeal assemblages in the soil-mousse surrounding a geothermal spring

    PubMed Central

    Bhatia, Sonu; Batra, Navneet; Pathak, Ashish; Joshi, Amit; Souza, Leila; Almeida, Paulo; Chauhan, Ashvini

    2015-01-01

    The soil-mousse surrounding a geothermal spring was analyzed for bacterial and archaeal diversity using 16S rRNA gene amplicon metagenomic sequencing which revealed the presence of 18 bacterial phyla distributed across 109 families and 219 genera. Firmicutes, Actinobacteria, and the Deinococcus-Thermus group were the predominant bacterial assemblages with Crenarchaeota and Thaumarchaeota as the main archaeal assemblages in this largely understudied geothermal habitat. Several metagenome sequences remained taxonomically unassigned suggesting the presence of a repertoire of hitherto undescribed microbes in this geothermal soil-mousse econiche. PMID:26484255

  7. System and method for introduction and stabilization of genes in Thermus sp.

    DOEpatents

    Kayser, Kevin J.; Park, Ho-Shin; Kilbane, II, John J.

    2005-03-01

    A method for introducing and stabilizing heterologous and recombinant genes in a thermophilic host in which a characteristic gene defining a detectable host characteristic is inactivated or deleted from the thermophilic host, resulting in a modified thermophilic host expressing an absence of the detectable host characteristic. A DNA fragment of interest is inserted into the modified thermophilic host together with an intact characteristic gene, whereby the detectable host characteristic is restored to the thermophilic host, thereby enabling detection and confirmation of successful transformation using plasmid vectors and integration of the DNA fragment into the chromosome of the thermophilic host.

  8. NREL Researchers Discover How a Bacterium, Clostridium thermocellum,

    Science.gov Websites

    containing the bacterium actually promotes the growth of C. thermocellum, yet its mechanistic details remained a puzzle. This enhanced growth implied the bacterium had the ability to use CO2 and prompted NREL researchers to investigate the phenomena enhancing the bacterium's growth. "It took us by surprise that

  9. [Analysis of different pipe corrosion by ESEM and bacteria identification by API in pilot distribution network].

    PubMed

    Wu, Qing; Zhao, Xinhua; Yu, Qing; Li, Jun

    2008-07-01

    To understand the corrosion of different material water supply pipelines and bacterium in drinking water and biofilms. A pilot distribution network was built and water quality detection was made on popular pipelines of galvanized iron pipe, PPR and ABS plastic pipes by ESEM (environmental scanning electron microscopy). Bacterium in drinking water and biofilms were identified by API Bacteria Identification System 10s and 20E (Biomerieux, France), and pathogenicity of bacterium were estimated. Galvanized zinc pipes were seriously corroded; there were thin layers on inner face of PPR and ABS plastic pipes. 10 bacterium (got from water samples) were identified by API10S, in which 7 bacterium were opportunistic pathogens. 21 bacterium (got from water and biofilms samples) were identified by API20E, in which 5 bacterium were pathogens and 11 bacterium were opportunistic pathogens and 5 bacteria were not reported for their pathogenicities to human beings. The bacterial water quality of drinking water distribution networks were not good. Most bacterium in drinking water and biofilms on the inner face of pipeline of the drinking water distribution network were opportunistic pathogens, it could cause serious water supply accident, if bacteria spread in suitable conditions. In the aspect of pipe material, old pipelines should be changed by new material pipes.

  10. Overexpression of a novel thermostable and chloride-tolerant laccase from Thermus thermophilus SG0.5JP17-16 in Pichia pastoris and its application in synthetic dye decolorization.

    PubMed

    Liu, Huiping; Cheng, Yu; Du, Bing; Tong, Chaofan; Liang, Shuli; Han, Shuangyan; Zheng, Suiping; Lin, Ying

    2015-01-01

    Laccases have been used for the decolorization and detoxification of synthetic dyes due to their ability to oxidize a wide variety of dyes with water as the sole byproduct. A putative laccase gene (LacTT) from Thermus thermophilus SG0.5JP17-16 was screened using the genome mining approach, and it was highly expressed in Pichia pastoris, yielding a high laccase activity of 6130 U/L in a 10-L fermentor. The LacTT open reading frame encoded a protein of 466 amino acid residues with four putative Cu-binding regions. The optimal pH of the recombinant LacTT was 4.5, 6.0, 7.5 and 8.0 with 2,2'-azino-bis(3-ethylbenzothazoline-6-sulfonic acid) (ABTS), syringaldazine (SGZ), guaiacol, and 2,6-dimethoxyphenol (2,6-DMP) as the substrate, respectively. The optimal temperature of LacTT was 90°C with guaiacol as the substrate. LacTT was highly stable at pH 4.0-11.0 and thermostable at 40°C-90°C, confirming that it is a pH-stable and thermostable laccase. Furthermore, LacTT also exhibited high tolerance to halides such as NaCl, NaBr and NaF, and decolorized 100%, 94%, 94% and 73% of Congo Red, Reactive Black B and Reactive Black WNN, and Remazol Brilliant Blue R, respectively. Interestingly, addition of high concentration of NaCl increased the RBBR decolorization efficiency of LacTT. These results suggest that LacTT is a good candidate for industrial applications such as dyestuff processing and degradation of dyes in textile wastewaters.

  11. Overexpression of a Novel Thermostable and Chloride-Tolerant Laccase from Thermus thermophilus SG0.5JP17-16 in Pichia pastoris and Its Application in Synthetic Dye Decolorization

    PubMed Central

    Liu, Huiping; Cheng, Yu; Du, Bing; Tong, Chaofan; Liang, Shuli; Han, Shuangyan; Zheng, Suiping; Lin, Ying

    2015-01-01

    Laccases have been used for the decolorization and detoxification of synthetic dyes due to their ability to oxidize a wide variety of dyes with water as the sole byproduct. A putative laccase gene (LacTT) from Thermus thermophilus SG0.5JP17-16 was screened using the genome mining approach, and it was highly expressed in Pichia pastoris, yielding a high laccase activity of 6130 U/L in a 10-L fermentor. The LacTT open reading frame encoded a protein of 466 amino acid residues with four putative Cu-binding regions. The optimal pH of the recombinant LacTT was 4.5, 6.0, 7.5 and 8.0 with 2,2'-azino-bis(3-ethylbenzothazoline-6-sulfonic acid) (ABTS), syringaldazine (SGZ), guaiacol, and 2,6-dimethoxyphenol (2,6-DMP) as the substrate, respectively. The optimal temperature of LacTT was 90°C with guaiacol as the substrate. LacTT was highly stable at pH 4.0–11.0 and thermostable at 40°C–90°C, confirming that it is a pH-stable and thermostable laccase. Furthermore, LacTT also exhibited high tolerance to halides such as NaCl, NaBr and NaF, and decolorized 100%, 94%, 94% and 73% of Congo Red, Reactive Black B and Reactive Black WNN, and Remazol Brilliant Blue R, respectively. Interestingly, addition of high concentration of NaCl increased the RBBR decolorization efficiency of LacTT. These results suggest that LacTT is a good candidate for industrial applications such as dyestuff processing and degradation of dyes in textile wastewaters. PMID:25790466

  12. The fifth electron in the fully reduced caa(3) from Thermus thermophilus is competent in proton pumping.

    PubMed

    Siletsky, Sergey A; Belevich, Ilya; Soulimane, Tewfik; Verkhovsky, Michael I; Wikström, Mårten

    2013-01-01

    The time-resolved kinetics of membrane potential generation coupled to oxidation of the fully reduced (five-electron) caa(3) cytochrome oxidase from Thermus thermophilus by oxygen was studied in a single-turnover regime. In order to calibrate the number of charges that move across the vesicle membrane in the different reaction steps, the reverse electron transfer from heme a(3) to heme a and further to the cytochrome c/Cu(A) has been resolved upon photodissociation of CO from the mixed valence enzyme in the absence of oxygen. The reverse electron transfer from heme a(3) to heme a and further to the cytochrome c/Cu(A) pair is resolved as a single transition with τ~40 μs. In the reaction of the fully reduced cytochrome caa(3) with oxygen, the first electrogenic phase (τ~30 μs) is linked to OO bond cleavage and generation of the P(R) state. The next electrogenic component (τ~50 μs) is associated with the P(R)→F transition and together with the previous reaction step it is coupled to translocation of about two charges across the membrane. The three subsequent electrogenic phases, with time constants of ~0.25 ms, ~1.4 ms and ~4 ms, are linked to the conversion of the binuclear center through the F→O(H)→E(H) transitions, and result in additional transfer of four charges through the membrane dielectric. This indicates that the delivery of the fifth electron from heme c to the binuclear center is coupled to pumping of an additional proton across the membrane. Copyright © 2012 Elsevier B.V. All rights reserved.

  13. A Comparison of Structural and Evolutionary Attributes of Escherichia coli and Thermus thermophilus Small Ribosomal Subunits: Signatures of Thermal Adaptation

    PubMed Central

    Mallik, Saurav; Kundu, Sudip

    2013-01-01

    Here we compare the structural and evolutionary attributes of Thermus thermophilus and Escherichia coli small ribosomal subunits (SSU). Our results indicate that with few exceptions, thermophilic 16S ribosomal RNA (16S rRNA) is densely packed compared to that of mesophilic at most of the analogous spatial regions. In addition, we have located species-specific cavity clusters (SSCCs) in both species. E. coli SSCCs are numerous and larger compared to T. thermophilus SSCCs, which again indicates densely packed thermophilic 16S rRNA. Thermophilic ribosomal proteins (r-proteins) have longer disordered regions than their mesophilic homologs and they experience larger disorder-to-order transitions during SSU-assembly. This is reflected in the predicted higher conformational changes of thermophilic r-proteins compared to their mesophilic homologs during SSU-assembly. This high conformational change of thermophilic r-proteins may help them to associate with the 16S ribosomal RNA with high complementary interfaces, larger interface areas, and denser molecular contacts, compared to those of mesophilic. Thus, thermophilic protein-rRNA interfaces are tightly associated with 16S rRNA than their mesophilic homologs. Densely packed 16S rRNA interior and tight protein-rRNA binding of T. thermophilus (compared to those of E. coli) are likely the signatures of its thermal adaptation. We have found a linear correlation between the free energy of protein-RNA interface formation, interface size, and square of conformational changes, which is followed in both prokaryotic and eukaryotic SSU. Disorder is associated with high protein-RNA interface polarity. We have found an evolutionary tendency to maintain high polarity (thereby disorder) at protein-rRNA interfaces, than that at rest of the protein structures. However, some proteins exhibit exceptions to this general trend. PMID:23940533

  14. Trehalose biosynthesis in Thermus thermophilus RQ-1: biochemical properties of the trehalose-6-phosphate synthase and trehalose-6-phosphate phosphatase.

    PubMed

    Silva, Zélia; Alarico, Susana; da Costa, Milton S

    2005-02-01

    The genes for trehalose synthesis in Thermus thermophilus RQ-1, namely otsA [trehalose-phosphate synthase (TPS)], otsB [trehalose-phosphate phosphatase (TPP)], and treS [trehalose synthase (maltose converting) (TreS)] genes are structurally linked. The TPS/TPP pathway plays a role in osmoadaptation, since mutants unable to synthesize trehalose via this pathway were less osmotolerant, in trehalose-deprived medium, than the wild-type strain. The otsA and otsB genes have now been individually cloned and overexpressed in Escherichia coli and the corresponding recombinant enzymes purified. The apparent molecular masses of TPS and TPP were 52 and 26 kDa, respectively. The recombinant TPS utilized UDP-glucose, TDP-glucose, ADP-glucose, or GDP-glucose, in this order as glucosyl donors, and glucose-6-phosphate as the glucosyl acceptor to produce trehalose-6-phosphate (T6P). The recombinant TPP catalyzed the dephosphorylation of T6P to trehalose. This enzyme also dephosphorylated G6P, and this activity was enhanced by NDP-glucose. TPS had an optimal activity at about 98 degrees C and pH near 6.0; TPP had a maximal activity near 70 degrees C and at pH 7.0. The enzymes were extremely thermostable: at 100 degrees C, TPS had a half-life of 31 min, and TPP had a half-life of 40 min. The enzymes did not require the presence of divalent cations for activity; however, the presence of Co2+ and Mg2+ stimulates both TPS and TPP. This is the first report of the characterization of TPS and TPP from a thermophilic organism.

  15. Crystal structure studies of NADP{sup +} dependent isocitrate dehydrogenase from Thermus thermophilus exhibiting a novel terminal domain

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kumar, S.M.; Pampa, K.J.; Manjula, M.

    2014-06-20

    Highlights: • We determined the structure of isocitrate dehydrogenase with citrate and cofactor. • The structure reveals a unique novel terminal domain involved in dimerization. • Clasp domain shows significant difference, and catalytic residues are conserved. • Oligomerization of the enzyme is quantized with subunit-subunit interactions. • Novel domain of this enzyme is classified as subfamily of the type IV. - Abstract: NADP{sup +} dependent isocitrate dehydrogenase (IDH) is an enzyme catalyzing oxidative decarboxylation of isocitrate into oxalosuccinate (intermediate) and finally the product α-ketoglutarate. The crystal structure of Thermus thermophilus isocitrate dehydrogenase (TtIDH) ternary complex with citrate and cofactor NADP{supmore » +} was determined using X-ray diffraction method to a resolution of 1.80 Å. The overall fold of this protein was resolved into large domain, small domain and a clasp domain. The monomeric structure reveals a novel terminal domain involved in dimerization, very unique and novel domain when compared to other IDH’s. And, small domain and clasp domain showing significant differences when compared to other IDH’s of the same sub-family. The structure of TtIDH reveals the absence of helix at the clasp domain, which is mainly involved in oligomerization in other IDH’s. Also, helices/beta sheets are absent in the small domain, when compared to other IDH’s of the same sub family. The overall TtIDH structure exhibits closed conformation with catalytic triad residues, Tyr144-Asp248-Lys191 are conserved. Oligomerization of the protein is quantized using interface area and subunit–subunit interactions between protomers. Overall, the TtIDH structure with novel terminal domain may be categorized as a first structure of subfamily of type IV.« less

  16. Thermophilic bacterial communities inhabiting the microbial mats of "indifferent" and chalybeate (iron-rich) thermal springs: Diversity and biotechnological analysis.

    PubMed

    Selvarajan, Ramganesh; Sibanda, Timothy; Tekere, Memory

    2018-04-01

    Microbial mats are occasionally reported in thermal springs and information on such mats is very scarce. In this study, microbial mats were collected from two hot springs (Brandvlei (BV) and Calitzdorp (CA)), South Africa and subjected to scanning electron microscopy (SEM) and targeted 16S rRNA gene amplicon analysis using Next Generation Sequencing (NGS). Spring water temperature was 55°C for Brandvlei and 58°C for Calitzdorp while the pH of both springs was slightly acidic, with an almost identical pH range (6.2-6.3). NGS analysis resulted in a total of 4943 reads, 517 and 736 OTUs for BV and CA at, respectively, a combined total of 14 different phyla in both samples, 88 genera in CA compared to 45 in BV and 37.64% unclassified sequences in CA compared to 27.32% recorded in BV. Dominant bacterial genera in CA microbial mat were Proteobacteria (29.19%), Bacteroidetes (9.41%), Firmicutes (9.01%), Cyanobacteria (6.89%), Actinobacteria (2.65%), Deinococcus-Thermus (2.57%), and Planctomycetes (1.94%) while the BV microbial mat was dominated by Bacteroidetes (47.3%), Deinococcus-Thermus (12.35%), Proteobacteria (7.98%), and Planctomycetes (2.97%). Scanning electron microscopy results showed the presence of microbial filaments possibly resembling cyanobacteria, coccids, rod-shaped bacteria and diatoms in both microbial mats. Dominant genera that were detected in this study have been linked to different biotechnological applications including hydrocarbon degradation, glycerol fermentation, anoxic-fermentation, dehalogenation, and biomining processes. Overall, the results of this study exhibited thermophilic bacterial community structures with high diversity in microbial mats, which have a potential for biotechnological exploitation. © 2017 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.

  17. RNA and DNA Targeting by a Reconstituted Thermus thermophilus Type III-A CRISPR-Cas System.

    PubMed

    Liu, Tina Y; Iavarone, Anthony T; Doudna, Jennifer A

    2017-01-01

    CRISPR-Cas (clustered regularly interspaced short palindromic repeats-CRISPR-associated) systems are RNA-guided adaptive immunity pathways used by bacteria and archaea to defend against phages and plasmids. Type III-A systems use a multisubunit interference complex called Csm, containing Cas proteins and a CRISPR RNA (crRNA) to target cognate nucleic acids. The Csm complex is intriguing in that it mediates RNA-guided targeting of both RNA and transcriptionally active DNA, but the mechanism is not well understood. Here, we overexpressed the five components of the Thermus thermophilus (T. thermophilus) Type III-A Csm complex (TthCsm) with a defined crRNA sequence, and purified intact TthCsm complexes from E. coli cells. The complexes were thermophilic, targeting complementary ssRNA more efficiently at 65°C than at 37°C. Sequence-independent, endonucleolytic cleavage of single-stranded DNA (ssDNA) by TthCsm was triggered by recognition of a complementary ssRNA, and required a lack of complementarity between the first 8 nucleotides (5' tag) of the crRNA and the 3' flanking region of the ssRNA. Mutation of the histidine-aspartate (HD) nuclease domain of the TthCsm subunit, Cas10/Csm1, abolished DNA cleavage. Activation of DNA cleavage was dependent on RNA binding but not cleavage. This leads to a model in which binding of an ssRNA target to the Csm complex would stimulate cleavage of exposed ssDNA in the cell, such as could occur when the RNA polymerase unwinds double-stranded DNA (dsDNA) during transcription. Our findings establish an amenable, thermostable system for more in-depth investigation of the targeting mechanism using structural biology methods, such as cryo-electron microscopy and x-ray crystallography.

  18. N7-Methylguanine at position 46 (m7G46) in tRNA from Thermus thermophilus is required for cell viability at high temperatures through a tRNA modification network.

    PubMed

    Tomikawa, Chie; Yokogawa, Takashi; Kanai, Tamotsu; Hori, Hiroyuki

    2010-01-01

    N(7)-methylguanine at position 46 (m(7)G46) in tRNA is produced by tRNA (m(7)G46) methyltransferase (TrmB). To clarify the role of this modification, we made a trmB gene disruptant (DeltatrmB) of Thermus thermophilus, an extreme thermophilic eubacterium. The absence of TrmB activity in cell extract from the DeltatrmB strain and the lack of the m(7)G46 modification in tRNA(Phe) were confirmed by enzyme assay, nucleoside analysis and RNA sequencing. When the DeltatrmB strain was cultured at high temperatures, several modified nucleotides in tRNA were hypo-modified in addition to the lack of the m(7)G46 modification. Assays with tRNA modification enzymes revealed hypo-modifications of Gm18 and m(1)G37, suggesting that the m(7)G46 positively affects their formations. Although the lack of the m(7)G46 modification and the hypo-modifications do not affect the Phe charging activity of tRNA(Phe), they cause a decrease in melting temperature of class I tRNA and degradation of tRNA(Phe) and tRNA(Ile). (35)S-Met incorporation into proteins revealed that protein synthesis in DeltatrmB cells is depressed above 70 degrees C. At 80 degrees C, the DeltatrmB strain exhibits a severe growth defect. Thus, the m(7)G46 modification is required for cell viability at high temperatures via a tRNA modification network, in which the m(7)G46 modification supports introduction of other modifications.

  19. Role of the Conserved Valine 236 in Access of Ligands to the Active Site of Thermus thermophilus ba3 Cytochrome Oxidase.

    PubMed

    Funatogawa, Chie; Li, Yang; Chen, Ying; McDonald, William; Szundi, Istvan; Fee, James A; Stout, C David; Einarsdóttir, Ólöf

    2017-01-10

    Knowledge of the role of conserved residues in the ligand channel of heme-copper oxidases is critical for understanding how the protein scaffold modulates the function of these enzymes. In this study, we investigated the role of the conserved valine 236 in the ligand channel of ba 3 cytochrome c oxidase from Thermus thermophilus by mutating the residue to a more polar (V236T), smaller (V236A), or larger (V236I, V236N, V236L, V236M, and V236F) residue. The crystal structures of the mutants were determined, and the effects of the mutations on the rates of CO, O 2 , and NO binding were investigated. O 2 reduction and NO binding were unaffected in V236T, while the oxidation of heme b during O-O bond cleavage was not detected in V236A. The V236A results are attributed to a decrease in the rate of electron transfer between heme b and heme a 3 during O-O bond cleavage in V236A, followed by faster re-reduction of heme b by Cu A . This interpretation is supported by classical molecular dynamics simulations of diffusion of O 2 to the active site in V236A that indicated a larger distance between the two hemes compared to that in the wild type and increased contact of heme a 3 with water and weakened interactions with residues R444 and R445. As the size of the mutant side chain increased and protruded more into the ligand cavity, the rates of ligand binding decreased correspondingly. These results demonstrate the importance of V236 in facilitating access of ligands to the active site in T. thermophilus ba 3 .

  20. A molecular dynamics simulation study of amino acid selectivity of LeuRS editing domain from Thermus thermophilus.

    PubMed

    Rayevsky, Alexey; Sharifi, Mohsen; Tukalo, Michael

    2018-06-18

    The accuracy of protein synthesis is provided by the editing functions of aminoacyl-tRNA synthetases (aaRSs), a mechanism that eliminates misactivated amino acids or mischarged tRNAs. Despite research efforts, some molecular bases of these mechanisms are still unclear. The post-transfer editing pathway of leucyl-tRNA synthetase (LeuRS) carried out in a special insertion domain (the Connective Polypeptide 1 or CP1), as editing domain. Recently, it was shown by in vivo studies and was supported by mutagenesis, and the kinetics approaches that the CP1 domain of LeuRS has discriminatory power for different substrates. The goal of this work is to investigate the structural basis for amino acid recognition of LeuRS post-transfer editing processes with molecular dynamics (MD) simulation method. To pursue this aim, the molecular modeling studies on Thermus thermophiles LeuRS (LeuRSTT) with two post-transfer substrates (norvalyl-tRNA Leu and isoleucyl-tRNA Leu ) was performed. Our results revealed that post-transfer substrate norvalyl-tRNA Leu is more favorable. Moreover, the MD simulations show that branched side chain of Ile-A76 cannot allow water molecules to get close, which leads to a significant decrease in the rate of hydrolysis. Finally, the study showed that site mutation Asp347Ala has elucidated a number of fine structural differences in the binding mode of two post-transfer substrates to the active centre of LeuRS editing domain and two conserved threonines, namely Thr247 and Thr248, are responsible for the amino acid selection through the interaction with substrates. Copyright © 2018 Elsevier Inc. All rights reserved.

  1. Biofilm Formation by a Metabolically Versatile Bacterium

    DTIC Science & Technology

    2009-03-19

    ABSTRACT Rhodopseudomonas palustris is a photosynthetic bacterium that has good potential as a biocatalyst for the production ofhydrogen gas, a biofuel...Biofilm formation by a metabolically versatile bacterium: final report Report Title ABSTRACT Rhodopseudomonas palustris is a photosynthetic bacterium...agricultural waste. We characterized five new Rhodopseudomonas genome sequences and isolated and described R. palustris mutant strains that produce

  2. Three-dimensional crystals of ribosomes and their subunits from eu- and archaebacteria.

    PubMed

    Glotz, C; Müssig, J; Gewitz, H S; Makowski, I; Arad, T; Yonath, A; Wittmann, H G

    1987-11-01

    Ordered three-dimensional crystals of 70S ribosomes as well as of 30S and 50S ribosomal subunits from various bacteria (E. coli, Bacillus stearothermophilus, Thermus thermophilus and Halobacterium marismortui) have been grown by vapour diffusion in hanging drops using mono- and polyalcohols. A new compact crystal form of 50S subunits has been obtained, and it is suitable for crystallographic studies at medium resolution. In addition, from one crystal form large crystals could be grown in X-ray capillaries. In all cases the crystals were obtained from functionally active ribosomal particles, and the particles from dissolved crystals retained their integrity and biological activity.

  3. Detection of Salmonella bacterium in drinking water using microring resonator.

    PubMed

    Bahadoran, Mahdi; Noorden, Ahmad Fakhrurrazi Ahmad; Mohajer, Faeze Sadat; Abd Mubin, Mohamad Helmi; Chaudhary, Kashif; Jalil, Muhammad Arif; Ali, Jalil; Yupapin, Preecha

    2016-01-01

    A new microring resonator system is proposed for the detection of the Salmonella bacterium in drinking water, which is made up of SiO2-TiO2 waveguide embedded inside thin film layer of the flagellin. The change in refractive index due to the binding of the Salmonella bacterium with flagellin layer causes a shift in the output signal wavelength and the variation in through and drop port's intensities, which leads to the detection of Salmonella bacterium in drinking water. The sensitivity of proposed sensor for detecting of Salmonella bacterium in water solution is 149 nm/RIU and the limit of detection is 7 × 10(-4)RIU.

  4. Capsule-Transmitted Gut Symbiotic Bacterium of the Japanese Common Plataspid Stinkbug, Megacopta punctatissima

    PubMed Central

    Fukatsu, Takema; Hosokawa, Takahiro

    2002-01-01

    The Japanese common plataspid stinkbug, Megacopta punctatissima, deposits small brown particles, or symbiont capsules, on the underside of the egg mass for the purpose of transmission of symbiotic bacteria to the offspring. We investigated the microbiological aspects of the bacteria contained in the capsule, such as microbial diversity, phylogenetic placement, localization in vivo, and fitness effects on the host insect. Restriction fragment length polymorphism analysis of 16S ribosomal DNA clones revealed that a single bacterial species dominates the microbiota in the capsule. The bacterium was not detected in the eggs but in the capsules, which unequivocally demonstrated that the bacterium is transmitted to the offspring of the insect orally rather than transovarially, through probing of the capsule content. Molecular phylogenetic analysis showed that the bacterium belongs to the γ-subdivision of the Proteobacteria. In adult insects the bacterium was localized in the posterior section of the midgut. Deprivation of the bacterium from the nymphs resulted in retarded development, arrested growth, abnormal body coloration, and other symptoms, suggesting that the bacterium is essential for normal development and growth of the host insect. PMID:11772649

  5. [Diversity analysis of desulfuration bacterium from the oxidation ditch of city sewage treatment plant with SO2 gas].

    PubMed

    Huang, Bing; Zhang, Shi-Ling; Zhang, Jiang-Hong; Ao, Yong; Shi, Zhe

    2011-07-01

    A group of removing SO2 bacterium was obtained from the oxidation ditch of city sewage treatment plant by inductive domestication over 6 d with low concentration SO2 gas, and they have an ability with biodegradation rate of 888 mg x (L x h)(-1) and a degradation efficiency of 85% during 1.5 h for SO2 dissolved in water with their synergy. The clone library and two phylogenetic trees of the removing SO2 bacterium communities were obtained based on 16S rRNA DNA comparison by DNA extraction of the sample and in situ polymerase chain reaction (PCR). The phylogenetic analysis showed that 8 dominant desulfuration bacterium occupy about 69% of all removing SO2 bacterium, and some of them have a kindred with discovered desulfuration bacterium but not homogeneity, and there are four belong to alpha-Proteobacteria, another four belong to beta-Proteobacteria in them. The gene information about 16S rRNA sequence of the dominant desulfuration bacteria and domestication method provide a basic of looking for or domesticating removing SO2 bacterium for development microbial desulfurization technology of contained SO2 tail gas.

  6. Calculated Energy Deposits from the Decay of Tritium and Other Radioisotopes Incorporated into Bacteria

    PubMed Central

    Bockrath, Richard; Person, Stanley; Funk, Fred

    1968-01-01

    Transmutation of the radioisotope tritium occurs with the production of a low energy electron, having a range in biological material similar to the dimensions of a bacterium. A computer program was written to determine the radiation dose distributions which may be expected within a bacterium as a result of tritium decay, when the isotope has been incorporated into specific regions of the bacterium. A nonspherical model bacterium was used, represented by a cylinder with hemispherical ends. The energy distributions resulting from a wide variety of simulated labeled regions were determined; the results suggested that the nuclear region of a bacterium receives on the average significantly different per decay doses, if the labeled regions were those conceivably produced by the incorporation of thymidine-3H, uracil-3H, or 3H-amino acids. Energy distributions in the model bacterium were also calculated for the decay of incorporated 14carbon, 35sulfur, and 32phosphorous. PMID:5678319

  7. Effect of dielectrophoretic force on swimming bacteria.

    PubMed

    Tran, Ngoc Phu; Marcos

    2015-07-01

    Dielectrophoresis (DEP) has been applied widely in bacterial manipulation such as separating, concentrating, and focusing. Previous studies primarily focused on the collective effects of DEP force on the bacterial population. However, the influence of DEP force on the swimming of a single bacterium had not been investigated. In this study, we present a model to analyze the effect of DEP force on a swimming helically flagellated bacterium, particularly on its swimming direction and velocity. We consider a simple DEP force that acts along the X-direction, and its strength as well as direction varies with the X- and Y-positions. Resistive force theory is employed to compute the hydrodynamic force on the bacterium's flagellar bundle, and the effects of both DEP force and rotational diffusion on the swimming of the bacterium are simultaneously taken into consideration using the Fokker-Planck equation. We show the mechanism of how DEP force alters the orientation and velocity of the bacterium. In most cases, the DEP force dominantly influences the orientation of the swimming bacterium; however, when the DEP force strongly varies along the Y-direction, the rotational diffusion is also responsible for determining the bacterium's reorientation. More interestingly, the variance of DEP force along the Y-direction causes the bacterium to experience a translational velocity perpendicular to its primary axis, and this phenomenon could be utilized to focus the bacteria. Finally, we show the feasibility of applying our findings to achieve bacterial focusing. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Recent research advances on Chromobacterium violaceum.

    PubMed

    Kothari, Vijay; Sharma, Sakshi; Padia, Divya

    2017-08-01

    Chromobacterium violaceum is a gram-negative bacterium, which has been used widely in microbiology labs involved in quorum sensing (QS) research. Among the QS-regulated traits of this bacterium, violacein production has received the maximum attention. Violacein production in this organism, however is not under sole control of QS machinery, and other QS-regulated traits of this bacterium also need to be investigated in better detail. Though not often involved in human infections, this bacterium is being viewed as an emerging pathogen. This review attempts to highlight the recent research advances on C. violaceum, with respect to violacein biosynthesis, development of various applications of this bacterium and its bioactive metabolite violacein, and its pathogenicity. Copyright © 2017 Hainan Medical University. Production and hosting by Elsevier B.V. All rights reserved.

  9. Characterization of the cellulose-degrading bacterium NCIMB 10462

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dees, C.; Scott, T.C.; Phelps, T.J.

    The gram-negative cellulase-producing bacterium NCIMB 10462 has been previously named Pseudomonas fluorescens subsp. or var. cellulose. Because of renewed interest in cellulose-degrading bacteria for use in the bioconversion of cellulose to chemical feed stocks and fuels, we re-examined the characteristics of this microorganism to determine its true metabolic potential. Metabolic and physical characterization of NCIMB 10462 revealed that this is an alkalophilic, non-fermentative, gram-negative, oxidase-positive, motile, cellulose-degrading bacterium. The aerobic substrate utilization profile of this bacterium has few characteristics consistent with a classification of P. fluorescens and a very low probability match with the genus Sphingomonas. However, total lipid analysismore » did not reveal that any sphingolipid bases are produced by this bacterium. NCIMB 10462 grows best aerobically, but also grows well in complex media under reducing conditions. NCIMB 10462 grows slowly under anaerobic conditions on complex media, but growth on cellulosic media occurred only under aerobic conditions. Total fatty acid analysis (MIDI) of NCIMB 10462 failed to group this bacterium with a known pseudomonas species. However, fatty acid analysis of the bacteria when grown at temperatures below 37{degrees}C suggest that the organism is a pseudomonad. Since a predominant characteristic of this bacterium is its ability to degrade cellulose, we suggest that it be called Pseudomonas cellulosa.« less

  10. Understanding the interaction between an obligate hyperparasitic bacterium, Pasteuria penetrans and its obligate plant-parasitic nematode host, Meloidogyne spp.

    PubMed

    Davies, Keith G

    2009-01-01

    Pasteuria penetrans is an endospore-forming bacterium, which is a hyperparasite of root-knot nematodes Meloidogyne spp. that are economically important pests of a wide range of crops. The life cycle of the bacterium and nematode are described with emphasis on the bacterium's potential as a biocontrol agent. Two aspects that currently prohibit the commercial development of the bacterium as a biocontrol agent are the inability to culture it outside its host and its host specificity. Vegetative growth of the bacterium is possible in vitro; however, getting the vegetative stages of the bacterium to enter sporogenesis has been problematic. Insights from genomic survey sequences regarding the role of cation concentration and the phosphorylation of Spo0F have proved useful in inducing vegetative bacteria to sporulate. Similarly, genomic data have also proved useful in understanding the attachment of endospores to the cuticle of infective nematode juveniles, and a Velcro-like model of spore attachment is proposed that involves collagen-like fibres on the surface of the endospore interacting with mucins on the nematode cuticle. Ecological studies of the interactions between Daphnia and Pasteuria ramosa are examined and similarities are drawn between the co-evolution of virulence in the Daphnia system and that of plant-parasitic nematodes.

  11. Determination of phenanthrene bioavailability by using a self-dying reporter bacterium: test with model solids and soil.

    PubMed

    Shin, Doyun; Nam, Kyoungphile

    2012-02-20

    The present study was conducted to investigate the performance and feasibility of a self-dying reporter bacterium to visualize and quantify phenanthrene bioavailability in soil. The self-dying reporter bacterium was designed to die on the initiation of phenanthrene biodegradation. The viability of the reporter bacterium was determined by a fluorescence live/dead cell staining method and visualized by confocal laser scanning microscopic observation. Phenanthrene was spiked into four types of model solids and a sandy loam. The bioavailability of phenanthrene to the reporter bacterium was remarkably declined with the hydrophobicity of the model solids: essentially no phenanthrene was biodegraded in the presence of 9-nm pores and about 35.8% of initial phenanthrene was biodegraded without pores. Decrease in bioavailability was not evident in the nonporous hydrophilic bead, but a small decrease was observed in the porous hydrophilic bead at 1000 mg/kg of phenanthrene. The fluorescence intensity was commensurate with the extent of phenanthrene biodegradation by the reporter bacterium at the concentration range from 50 to 500 mg/kg. Such a quantitative relationship was also confirmed with a sandy loam spiked up to 1000 mg/kg of phenanthrene. This reporter bacterium may be a useful means to determine phenanthrene bioavailability in soil. Copyright © 2011 Elsevier B.V. All rights reserved.

  12. 76 FR 8603 - Citrus Seed Imports; Citrus Greening and Citrus Variegated Chlorosis

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-02-15

    ... strain of the bacterium Xylella fastidiosa, CVC causes severe chlorosis between veins on the leaves of...\\ ARS researchers did note, however, that the bacterium causing HLB remained at a very low titer in... these 769 seedlings tested positive for the disease. However, titer levels of the bacterium were low...

  13. Isolation and characterization of Leu[7]-Surfactin from the endophytic bacterium Bacillus mojavensis RRC 101, a biocontrol agent for Fusarium verticillioides

    USDA-ARS?s Scientific Manuscript database

    Bacillus mojavensis is an endophytic bacterium patented for control of fungal diseases in maize and other plants. Culture extracts and filtrates from this bacterium were antagonistic to the pathogenic and mycotoxic fungus Fusarium verticillioides. However, the identity of the inhibitory substance ...

  14. Structural characterization of the cell division cycle in Strigomonas culicis, an endosymbiont-bearing trypanosomatid.

    PubMed

    Brum, Felipe Lopes; Catta-Preta, Carolina Moura Costa; de Souza, Wanderley; Schenkman, Sergio; Elias, Maria Carolina; Motta, Maria Cristina Machado

    2014-02-01

    Strigomonas culicis (previously referred to as Blastocrithidia culicis) is a monoxenic trypanosomatid harboring a symbiotic bacterium, which maintains an obligatory relationship with the host protozoan. Investigations of the cell cycle in symbiont harboring trypanosomatids suggest that the bacterium divides in coordination with other host cell structures, particularly the nucleus. In this study we used light and electron microscopy followed by three-dimensional reconstruction to characterize the symbiont division during the cell cycle of S. culicis. We observed that during this process, the symbiotic bacterium presents different forms and is found at different positions in relationship to the host cell structures. At the G1/S phase of the protozoan cell cycle, the endosymbiont exhibits a constricted form that appears to elongate, resulting in the bacterium division, which occurs before kinetoplast and nucleus segregation. During cytokinesis, the symbionts are positioned close to each nucleus to ensure that each daughter cell will inherit a single copy of the bacterium. These observations indicated that the association of the bacterium with the protozoan nucleus coordinates the cell cycle in both organisms.

  15. Stable isotope labeling confirms mixotrophic nature of streamer biofilm communities at alkaline hot springs.

    PubMed

    Schubotz, Florence; Hays, Lindsay E; Meyer-Dombard, D'Arcy R; Gillespie, Aimee; Shock, Everett L; Summons, Roger E

    2015-01-01

    Streamer biofilm communities (SBC) are often observed within chemosynthetic zones of Yellowstone hot spring outflow channels, where temperatures exceed those conducive to photosynthesis. Nearest the hydrothermal source (75-88°C) SBC comprise thermophilic Archaea and Bacteria, often mixed communities including Desulfurococcales and uncultured Crenarchaeota, as well as Aquificae and Thermus, each carrying diagnostic membrane lipid biomarkers. We tested the hypothesis that SBC can alternate their metabolism between autotrophy and heterotrophy depending on substrate availability. Feeding experiments were performed at two alkaline hot springs in Yellowstone National Park: Octopus Spring and "Bison Pool," using various (13)C-labeled substrates (bicarbonate, formate, acetate, and glucose) to determine the relative uptake of these different carbon sources. Highest (13)C uptake, at both sites, was from acetate into almost all bacterial fatty acids, particularly into methyl-branched C15, C17 and C19 fatty acids that are diagnostic for Thermus/Meiothermus, and some Firmicutes as well as into universally common C16:0 and C18:0 fatty acids. (13)C-glucose showed a similar, but a 10-30 times lower uptake across most fatty acids. (13)C-bicarbonate uptake, signifying the presence of autotrophic communities was only significant at "Bison Pool" and was observed predominantly in non-specific saturated C16, C18, C20, and C22 fatty acids. Incorporation of (13)C-formate occurred only at very low rates at "Bison Pool" and was almost undetectable at Octopus Spring, suggesting that formate is not an important carbon source for SBC. (13)C-uptake into archaeal lipids occurred predominantly with (13)C-acetate, suggesting also that archaeal communities at both springs have primarily heterotrophic carbon assimilation pathways. We hypothesize that these communities are energy-limited and predominantly nurtured by input of exogenous organic material, with only a small fraction being sustained by autotrophic growth.

  16. Cre/lox-based multiple markerless gene disruption in the genome of the extreme thermophile Thermus thermophilus.

    PubMed

    Togawa, Yoichiro; Nunoshiba, Tatsuo; Hiratsu, Keiichiro

    2018-02-01

    Markerless gene-disruption technology is particularly useful for effective genetic analyses of Thermus thermophilus (T. thermophilus), which have a limited number of selectable markers. In an attempt to develop a novel system for the markerless disruption of genes in T. thermophilus, we applied a Cre/lox system to construct a triple gene disruptant. To achieve this, we constructed two genetic tools, a loxP-htk-loxP cassette and cre-expressing plasmid, pSH-Cre, for gene disruption and removal of the selectable marker by Cre-mediated recombination. We found that the Cre/lox system was compatible with the proliferation of the T. thermophilus HB27 strain at the lowest growth temperature (50 °C), and thus succeeded in establishing a triple gene disruptant, the (∆TTC1454::loxP, ∆TTC1535KpnI::loxP, ∆TTC1576::loxP) strain, without leaving behind a selectable marker. During the process of the sequential disruption of multiple genes, we observed the undesired deletion and inversion of the chromosomal region between multiple loxP sites that were induced by Cre-mediated recombination. Therefore, we examined the effects of a lox66-htk-lox71 cassette by exploiting the mutant lox sites, lox66 and lox71, instead of native loxP sites. We successfully constructed a (∆TTC1535::lox72, ∆TTC1537::lox72) double gene disruptant without inducing the undesired deletion of the 0.7-kbp region between the two directly oriented lox72 sites created by the Cre-mediated recombination of the lox66-htk-lox71 cassette. This is the first demonstration of a Cre/lox system being applicable to extreme thermophiles in a genetic manipulation. Our results indicate that this system is a powerful tool for multiple markerless gene disruption in T. thermophilus.

  17. Four second-sphere residues of Thermus thermophilus SG0.5JP17-16 laccase tune the catalysis by hydrogen-bonding networks.

    PubMed

    Liu, Huiping; Zhu, Yanyun; Yang, Xiaorong; Lin, Ying

    2018-05-01

    The multicopper oxidases catalyze 1-electron oxidation of four substrate molecules and concomitantly 4-electron reduction of dioxygen to water. The substrate loses the electrons at the type 1 copper (T1 Cu) site of the enzyme, while the dioxygen is reduced to water at the trinuclear copper center. A highly conserved Glu residue, which is at the dioxygen-entering channel, shuttles the proton to break the O-O bond of dioxygen. At the water-leaving channel, an Asp residue was found to be important in the protonation mechanism. In this study, laccase from Thermus thermophilus SG0.5JP17-16 (lacTT) was investigated to address how four second-sphere residues E356, E456, D106, and D423 affect the activity of the enzyme. Kinetic data indicate that catalytic activities of the enzyme are altered by site-directed mutagenesis on four second-sphere residues. The structural model of lacTT was generated by homology modeling. Structural and spectral data indicate that the E356 residue is situated at the substrate-binding site, responsible for the binding of the substrate and the geometry of the T1 Cu site by hydrogen-bonding networks; the E456 residue, located at the dioxygen-entering channel, plays a critical role in stabilizing the structure of all active copper centers and shuttling the proton to the trinuclear copper cluster (TNC) for the reductive reaction of dioxygen; the D106 and D423 residues are at the water-leaving channel, and they are important for the essential geometry of the TNC and the release of the water molecules. Altogether, this study contributes to the further understanding of the basic mechanism involving the oxidation of the substrate, electron transfer, and the reduction of dioxygen in lacTT.

  18. Randomized DNA libraries construction tool: a new 3-bp 'frequent cutter' TthHB27I/sinefungin endonuclease with chemically-induced specificity.

    PubMed

    Krefft, Daria; Papkov, Aliaksei; Prusinowski, Maciej; Zylicz-Stachula, Agnieszka; Skowron, Piotr M

    2018-05-11

    Acoustic or hydrodynamic shearing, sonication and enzymatic digestion are used to fragment DNA. However, these methods have several disadvantages, such as DNA damage, difficulties in fragmentation control, irreproducibility and under-representation of some DNA segments. The DNA fragmentation tool would be a gentle enzymatic method, offering cleavage frequency high enough to eliminate DNA fragments distribution bias and allow for easy control of partial digests. Only three such frequently cleaving natural restriction endonucleases (REases) were discovered: CviJI, SetI and FaiI. Therefore, we have previously developed two artificial enzymatic specificities, cleaving DNA approximately every ~ 3-bp: TspGWI/sinefungin (SIN) and TaqII/SIN. In this paper we present the third developed specificity: TthHB27I/SIN(SAM) - a new genomic tool, based on Type IIS/IIC/IIG Thermus-family REases-methyltransferases (MTases). In the presence of dimethyl sulfoxide (DMSO) and S-adenosyl-L-methionine (SAM) or its analogue SIN, the 6-bp cognate TthHB27I recognition sequence 5'-CAARCA-3' is converted into a combined 3.2-3.0-bp 'site' or its statistical equivalent, while a cleavage distance of 11/9 nt is retained. Protocols for various modes of limited DNA digestions were developed. In the presence of DMSO and SAM or SIN, TthHB27I is transformed from rare 6-bp cutter to a very frequent one, approximately 3-bp. Thus, TthHB27I/SIN(SAM) comprises a new tool in the very low-represented segment of such prototype REases specificities. Moreover, this modified TthHB27I enzyme is uniquely suited for controlled DNA fragmentation, due to partial DNA cleavage, which is an inherent feature of the Thermus-family enzymes. Such tool can be used for quasi-random libraries generation as well as for other DNA manipulations, requiring high frequency cleavage and uniform distribution of cuts along DNA.

  19. Endohyphal Bacterium Enhances Production of Indole-3-Acetic Acid by a Foliar Fungal Endophyte

    PubMed Central

    Hoffman, Michele T.; Gunatilaka, Malkanthi K.; Wijeratne, Kithsiri; Gunatilaka, Leslie; Arnold, A. Elizabeth

    2013-01-01

    Numerous plant pathogens, rhizosphere symbionts, and endophytic bacteria and yeasts produce the important phytohormone indole-3-acetic acid (IAA), often with profound effects on host plants. However, to date IAA production has not been documented among foliar endophytes -- the diverse guild of primarily filamentous Ascomycota that live within healthy, above-ground tissues of all plant species studied thus far. Recently bacteria that live within hyphae of endophytes (endohyphal bacteria) have been detected, but their effects have not been studied previously. Here we show not only that IAA is produced in vitro by a foliar endophyte (here identified as Pestalotiopsis aff. neglecta, Xylariales), but that IAA production is enhanced significantly when the endophyte hosts an endohyphal bacterium (here identified as Luteibacter sp., Xanthomonadales). Both the endophyte and the endophyte/bacterium complex appear to rely on an L-tryptophan dependent pathway for IAA synthesis. The bacterium can be isolated from the fungus when the symbiotic complex is cultivated at 36°C. In pure culture the bacterium does not produce IAA. Culture filtrate from the endophyte-bacterium complex significantly enhances growth of tomato in vitro relative to controls and to filtrate from the endophyte alone. Together these results speak to a facultative symbiosis between an endophyte and endohyphal bacterium that strongly influences IAA production, providing a new framework in which to explore endophyte-plant interactions. PMID:24086270

  20. Taxonomic characterization of the cellulose-degrading bacterium NCIB 10462

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dees, C.; Ringleberg, D.; Scott, T.C.

    The gram negative cellulase-producing bacterium NCIB 10462 has been previously named Pseudomonas fluorescens subsp. or var. cellulosa. Since there is renewed interest in cellulose-degrading bacteria for use in bioconversion of cellulose to chemical feed stocks and fuels, we re-examined the characteristics of this microorganism to determine its proper taxonomic characterization and to further define it`s true metabolic potential. Metabolic and physical characterization of NCIB 10462 revealed that this was an alkalophilic, non-fermentative, gram negative, oxidase positive, motile, cellulose-degrading bacterium. The aerobic substrate utilization profile of this bacterium was found to have few characteristics consistent with a classification of P. fluorescensmore » with a very low probability match with the genus Sphingomonas. Total lipid analysis did not reveal that any sphingolipid bases are produced by this bacterium. NCIB 10462 was found to grow best aerobically but also grows well in complex media under reducing conditions. NCIB 10462 grew slowly under full anaerobic conditions on complex media but growth on cellulosic media was found only under aerobic conditions. Total fatty acid analysis (MIDI) of NCIB 10462 failed to group this bacterium with a known pseudomonas species. However, fatty acid analysis of the bacteria when grown at temperatures below 37{degrees}C suggest that the organism is a pseudomonad. Since a predominant characteristic of this bacterium is it`s ability to degrade cellulose, we suggest it be called Pseudomonas cellulosa.« less

  1. Metabolomics evaluation of the impact of smokeless tobacco exposure on the oral bacterium Capnocytophaga sputigena

    PubMed Central

    Sun, Jinchun; Jin, Jinshan; Beger, Richard D.; Cerniglia, Carl E.; Yang, Maocheng; Chen, Huizhong

    2017-01-01

    The association between exposure to smokeless tobacco products (STP) and oral diseases is partially due to the physiological and pathological changes in the composition of the oral microbiome and its metabolic profile. However, it is not clear how STPs affect the physiology and ecology of oral microbiota. A UPLC/QTof-MS-based metabolomics study was employed to analyze metabolic alterations in oral bacterium, Capnocytophaga sputigena as a result of smokeless tobacco exposure and to assess the capability of the bacterium to metabolize nicotine. Pathway analysis of the metabolome profiles indicated that smokeless tobacco extracts caused oxidative stress in the bacterium. The metabolomics data also showed that the argininenitric oxide pathway was perturbed by the smokeless tobacco treatment. Results also showed that LC/MS was useful in identifying STP constituents and additives, including caffeine and many flavoring compounds. No significant changes in levels of nicotine and its major metabolites were found when C. sputigena was cultured in a nutrient rich medium, although hydroxylnicotine and cotinine N-oxide were detected in the bacterial metabolites suggesting that nicotine metabolism might be present as a minor degradation pathway in the bacterium. Study results provide new insights regarding the physiological and toxicological effects of smokeless tobacco on oral bacterium C. sputigena and associated oral health as well as measuring the ability of the oral bacterium to metabolize nicotine. PMID:27480511

  2. Metabolomics evaluation of the impact of smokeless tobacco exposure on the oral bacterium Capnocytophaga sputigena.

    PubMed

    Sun, Jinchun; Jin, Jinshan; Beger, Richard D; Cerniglia, Carl E; Yang, Maocheng; Chen, Huizhong

    2016-10-01

    The association between exposure to smokeless tobacco products (STP) and oral diseases is partially due to the physiological and pathological changes in the composition of the oral microbiome and its metabolic profile. However, it is not clear how STPs affect the physiology and ecology of oral microbiota. A UPLC/QTof-MS-based metabolomics study was employed to analyze metabolic alterations in oral bacterium, Capnocytophaga sputigena as a result of smokeless tobacco exposure and to assess the capability of the bacterium to metabolize nicotine. Pathway analysis of the metabolome profiles indicated that smokeless tobacco extracts caused oxidative stress in the bacterium. The metabolomics data also showed that the arginine-nitric oxide pathway was perturbed by the smokeless tobacco treatment. Results also showed that LC/MS was useful in identifying STP constituents and additives, including caffeine and many flavoring compounds. No significant changes in levels of nicotine and its major metabolites were found when C. sputigena was cultured in a nutrient rich medium, although hydroxylnicotine and cotinine N-oxide were detected in the bacterial metabolites suggesting that nicotine metabolism might be present as a minor degradation pathway in the bacterium. Study results provide new insights regarding the physiological and toxicological effects of smokeless tobacco on oral bacterium C. sputigena and associated oral health as well as measuring the ability of the oral bacterium to metabolize nicotine. Published by Elsevier Ltd.

  3. 77 FR 56237 - Notice of Permit Applications Received Under the Antarctic Conservation Act of 1978 (Pub. L. 95-541)

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-09-12

    ... use commercially available, freeze-dried marine bacterium, Vibrio fisheri, NRRL B-11177, for experimental use at the Crary Science and Engineering Center (CSEC) at McMurdo Station. This bacterium is used... bacterium is used with a reconstituting reagent to determine toxicity levels. All laboratory plastic-ware...

  4. Modified cyanobacteria

    DOEpatents

    Vermaas, Willem F J.

    2014-06-17

    Disclosed is a modified photoautotrophic bacterium comprising genes of interest that are modified in terms of their expression and/or coding region sequence, wherein modification of the genes of interest increases production of a desired product in the bacterium relative to the amount of the desired product production in a photoautotrophic bacterium that is not modified with respect to the genes of interest.

  5. Evolution and development in cave animals: from fish to crustaceans.

    PubMed

    Protas, Meredith; Jeffery, William R

    2012-01-01

    Cave animals are excellent models to study the general principles of evolution as well as the mechanisms of adaptation to a novel environment: the perpetual darkness of caves. In this article, two of the major model systems used to study the evolution and development (evo-devo) of cave animals are described: the teleost fish Astyanax mexicanus and the isopod crustacean Asellus aquaticus. The ways in which these animals match the major attributes expected of an evo-devo cave animal model system are described. For both species, we enumerate the regressive and constructive troglomorphic traits that have evolved during their adaptation to cave life, the developmental and genetic basis of these traits, the possible evolutionary forces responsible for them, and potential new areas in which these model systems could be used for further exploration of the evolution of cave animals. Furthermore, we compare the two model cave animals to investigate the mechanisms of troglomorphic evolution. Finally, we propose a few other cave animal systems that would be suitable for development as additional models to obtain a more comprehensive understanding of the developmental and genetic mechanisms involved in troglomorphic evolution.

  6. Shared Ancestry between a Newfound Mole-Borne Hantavirus and Hantaviruses Harbored by Cricetid Rodents ▿†

    PubMed Central

    Kang, Hae Ji; Bennett, Shannon N.; Hope, Andrew G.; Cook, Joseph A.; Yanagihara, Richard

    2011-01-01

    Discovery of genetically distinct hantaviruses in multiple species of shrews (order Soricomorpha, family Soricidae) and moles (family Talpidae) contests the conventional view that rodents (order Rodentia, families Muridae and Cricetidae) are the principal reservoir hosts and suggests that the evolutionary history of hantaviruses is far more complex than previously hypothesized. We now report on Rockport virus (RKPV), a hantavirus identified in archival tissues of the eastern mole (Scalopus aquaticus) collected in Rockport, TX, in 1986. Pairwise comparison of the full-length S, M, and L genomic segments indicated moderately low sequence similarity between RKPV and other soricomorph-borne hantaviruses. Phylogenetic analyses, using maximum-likelihood and Bayesian methods, showed that RKPV shared a most recent common ancestor with cricetid-rodent-borne hantaviruses. Distributed widely across the eastern United States, the fossorial eastern mole is sympatric and syntopic with cricetid rodents known to harbor hantaviruses, raising the possibility of host-switching events in the distant past. Our findings warrant more-detailed investigations on the dynamics of spillover and cross-species transmission of present-day hantaviruses within communities of rodents and moles. PMID:21632770

  7. Compartmentalized self-replication: a novel method for the directed evolution of polymerases and other enzymes.

    PubMed

    Ghadessy, Farid J; Holliger, Philipp

    2007-01-01

    Compartmentalized self-replication (CSR) is a novel method for the directed evolution of enzymes and, in particular, polymerases. In its simplest form, CSR consists of a simple feedback loop involving a polymerase that replicates only its own encoding gene (self-replication). Self-replication occurs in discrete, spatially separate, noncommunicating compartments formed by a heat-stable water-in-oil emulsion. Compartmentalization ensures the linkage of phenotype and genotype (i.e., it ensures that each polymerase replicates only its own encoding gene to the exclusion of those in the other compartments). As a result, adaptive gains by the polymerase directly (and proportionally) translate into genetic amplification of the encoding polymerase gene. CSR has proven to be a useful strategy for the directed evolution of polymerases directly from diverse repertoires of polymerase genes. In this chapter, we describe some of the CSR protocols used successfully to evolve variants of T. aquaticus Pol I (Taq) polymerase with novel and useful properties, such as increased thermostability or resistance to the potent inhibitor, heparin, from a repertoire of randomly mutated Taq polymerase genes.

  8. Predicting life-history adaptations to pollutants

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maltby, L.

    1995-12-31

    Animals may adapt to pollutant stress so that individuals from polluted environments are less susceptible than those from unpolluted environments. In addition to such direct adaptations, animals may respond to pollutant stress by life-history modifications; so-called indirect adaptations. This paper will demonstrate how, by combining life-history theory and toxicological data, it is possible to predict stress-induced alterations in reproductive output and offspring size. Pollutant-induced alterations in age-specific survival in favor of adults and reductions in juvenile growth, conditions are predicted to select for reduced investment in reproduction and the allocation of this investment into fewer, larger offspring. Field observations onmore » the freshwater crustaceans, Asellus aquaticus and Gammarus pulex, support these predictions. Females from metal-polluted sites had lower investment in reproduction and produced larger offspring than females of the same species from unpolluted sites. Moreover, interpopulation differences in reproductive biology persisted in laboratory cultures indicating that they had a genetic basis and were therefore due to adaptation rather than acclimation. The general applicability of this approach will be considered.« less

  9. Cortical organization in insectivora: the parallel evolution of the sensory periphery and the brain.

    PubMed

    Catania, K C

    2000-06-01

    Insectivores are traditionally described as a primitive group that has not changed much in the course of mammalian evolution. In contrast, recent studies reveal a great diversity of sensorimotor specializations among insectivores adapted to a number of different ecological niches, indicating that there has been significant diversification and change in the course of their evolution. Here the organization of sensory cortex is compared in the African hedgehog (Atelerix albiventris), the masked shrew (Sorex cinereus), the eastern mole (Scalopus aquaticus), and the star-nosed mole (Condylura cristata). Each of these four closely related species lives in a unique ecological niche, exhibits a different repertoire of behaviors, and has a different configuration of peripheral sensory receptors. Corresponding specializations of cortical sensory areas reveal a number of ways in which the cortex has evolved in parallel with changes to the sensory periphery. These specializations include expansion of cortical representations (cortical magnification), the addition or loss of cortical areas in the processing network, and the subdivision of areas into modules (barrels and stripes). Copyright 2000 S. Karger AG, Basel

  10. 75 FR 44291 - Notice of Permit Applications Received Under the Antarctic Conservation Act of 1978 (Pub. L. 95-541)

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-07-28

    ... available, freeze- dried marine bacterium, Vibrio fisher, NRRL B-11177, for experimental use at the McMurdo Station Crary Science and Engineering Center (CSEC). This bacterium is used as one of the reagents for the Microtox toxicity analyzer, Azur Environmental model 500, 0073486. The bacterium are used with a...

  11. Draft Genome Sequence of the Cellulolytic Bacterium Clostridium papyrosolvens C7 (ATCC 700395).

    PubMed

    Zepeda, Veronica; Dassa, Bareket; Borovok, Ilya; Lamed, Raphael; Bayer, Edward A; Cate, Jamie H D

    2013-09-12

    We report the draft genome sequence of the cellulose-degrading bacterium Clostridium papyrosolvens C7, originally isolated from mud collected below a freshwater pond in Massachusetts. This Gram-positive bacterium grows in a mesophilic anaerobic environment with filter paper as the only carbon source, and it has a simple cellulosome system with multiple carbohydrate-degrading enzymes.

  12. Draft Genome Sequence of the Cellulolytic Bacterium Clostridium papyrosolvens C7 (ATCC 700395)

    PubMed Central

    Zepeda, Veronica; Dassa, Bareket; Borovok, Ilya; Lamed, Raphael; Bayer, Edward A.

    2013-01-01

    We report the draft genome sequence of the cellulose-degrading bacterium Clostridium papyrosolvens C7, originally isolated from mud collected below a freshwater pond in Massachusetts. This Gram-positive bacterium grows in a mesophilic anaerobic environment with filter paper as the only carbon source, and it has a simple cellulosome system with multiple carbohydrate-degrading enzymes. PMID:24029755

  13. Oxidation of Ethylene Glycol by a Salt-Requiring Bacterium

    PubMed Central

    Caskey, William H.; Taber, Willard A.

    1981-01-01

    Bacterium T-52, cultured on ethylene glycol, readily oxidized glycolate and glyoxylate and exhibited elevated activities of ethylene glycol dehydrogenase and glycolate oxidase. Labeled glyoxylate was identified in reaction mixtures containing [14C]-ethylene glycol, but no glycolate was detected. The most likely pathway of ethylene glycol catabolism by bacterium T-52 is sequential oxidation to glycolate and glyoxylate. PMID:16345810

  14. Near-complete genome sequence of the cellulolytic Bacterium Bacteroides ( Pseudobacteroides) cellulosolvens ATCC 35603

    DOE PAGES

    Dassa, Bareket; Utturkar, Sagar M.; Hurt, Richard A.; ...

    2015-09-24

    We report the single-contig genome sequence of the anaerobic, mesophilic, cellulolytic bacterium, Bacteroides cellulosolvens. The bacterium produces a particularly elaborate cellulosome system, whereas the types of cohesin-dockerin interactions are opposite of other known cellulosome systems: cell-surface attachment is thus mediated via type-I interactions whereas enzymes are integrated via type-II interactions.

  15. Biomolecular Architectures Molecular Biology

    DTIC Science & Technology

    2013-08-31

    when the Salmonella beacon (13 nM) was tested in the presence of 800 ng bacterial genomic DNA in chicken broth (33%) (data not shown). Since it was...bacterium, Bacillus thuringiensis, transgenic tobacco containing the transgene, Bt cry1Ac, the Gram-negative bacterium, Salmonella Typhimurium, and the Gram... Salmonella Typhimurium, and the Gram-positive bacterium, Listeria monocytogenes, were monitored for detection by coupling molecular beacon (MB

  16. Cadherin Domains in the Polysaccharide-Degrading Marine Bacterium Saccharophagus degradans 2-40 Are Carbohydrate-Binding Modules▿

    PubMed Central

    Fraiberg, Milana; Borovok, Ilya; Bayer, Edward A.; Weiner, Ronald M.; Lamed, Raphael

    2011-01-01

    The complex polysaccharide-degrading marine bacterium Saccharophagus degradans strain 2-40 produces putative proteins that contain numerous cadherin and cadherin-like domains involved in intercellular contact interactions. The current study reveals that both domain types exhibit reversible calcium-dependent binding to different complex polysaccharides which serve as growth substrates for the bacterium. PMID:21036994

  17. Insect symbiotic bacteria harbour viral pathogens for transovarial transmission.

    PubMed

    Jia, Dongsheng; Mao, Qianzhuo; Chen, Yong; Liu, Yuyan; Chen, Qian; Wu, Wei; Zhang, Xiaofeng; Chen, Hongyan; Li, Yi; Wei, Taiyun

    2017-03-06

    Many insects, including mosquitoes, planthoppers, aphids and leafhoppers, are the hosts of bacterial symbionts and the vectors for transmitting viral pathogens 1-3 . In general, symbiotic bacteria can indirectly affect viral transmission by enhancing immunity and resistance to viruses in insects 3-5 . Whether symbiotic bacteria can directly interact with the virus and mediate its transmission has been unknown. Here, we show that an insect symbiotic bacterium directly harbours a viral pathogen and mediates its transovarial transmission to offspring. We observe rice dwarf virus (a plant reovirus) binding to the envelopes of the bacterium Sulcia, a common obligate symbiont of leafhoppers 6-8 , allowing the virus to exploit the ancient oocyte entry path of Sulcia in rice leafhopper vectors. Such virus-bacterium binding is mediated by the specific interaction of the viral capsid protein and the Sulcia outer membrane protein. Treatment with antibiotics or antibodies against Sulcia outer membrane protein interferes with this interaction and strongly prevents viral transmission to insect offspring. This newly discovered virus-bacterium interaction represents the first evidence that a viral pathogen can directly exploit a symbiotic bacterium for its transmission. We believe that such a model of virus-bacterium communication is a common phenomenon in nature.

  18. Structure of caa(3) cytochrome c oxidase--a nature-made enzyme-substrate complex.

    PubMed

    Noor, Mohamed Radzi; Soulimane, Tewfik

    2013-05-01

    Aerobic respiration, the energetically most favorable metabolic reaction, depends on the action of terminal oxidases that include cytochrome c oxidases. The latter forms a part of the heme-copper oxidase superfamily and consists of three different families (A, B, and C types). The crystal structures of all families have now been determined, allowing a detailed structural comparison from evolutionary and functional perspectives. The A2-type oxidase, exemplified by the Thermus thermophilus caa(3) oxidase, contains the substrate cytochrome c covalently bound to the enzyme complex. In this article, we highlight the various features of caa(3) enzyme and provide a discussion of their importance, including the variations in the proton and electron transfer pathways.

  19. Ab initio single and multideterminant methods used in the determination of reduction potentials and magnetic properties of Rieske ferredoxins

    NASA Astrophysics Data System (ADS)

    Powers, Nathan Lee

    2008-10-01

    The [Fe2S2]2+/[Fe2S 2]+ electronic structure of seven Rieske protein active sites (bovine mitochondrial cytochrome bc1 complex, spinach chloroplast cytochrome b6f complex, Rieske-type ferredoxin associated with biphenyl dioxygenase from Burkholderia cepacia, yeast cytochrome bcl complex from Saccharomyces cerevisiae, Rieske subunit of arsenite oxidase from Alcaligenes faecalis, respiratory-type Rieske protein from Thermus thermophilus, and Rieske protein II (soxF) from Sulfolobus acidocaldarius), which lie in a reduction potential range from -150 mV to 375 mV, have been studied by both single and multi-determinant quantum mechanical methods. Calculated reduction potentials and magnetic properties are found comparable to experimental values.

  20. A novel strategy for acetonitrile wastewater treatment by using a recombinant bacterium with biofilm-forming and nitrile-degrading capability.

    PubMed

    Li, Chunyan; Yue, Zhenlei; Feng, Fengzhao; Xi, Chuanwu; Zang, Hailian; An, Xuejiao; Liu, Keran

    2016-10-01

    There is a great need for efficient acetonitrile removal technology in wastewater treatment to reduce the discharge of this pollutant in untreated wastewater. In this study, a nitrilase gene (nit) isolated from a nitrile-degrading bacterium (Rhodococcus rhodochrous BX2) was cloned and transformed into a biofilm-forming bacterium (Bacillus subtilis N4) that expressed the recombinant protein upon isopropylthio-β-galactoside (IPTG) induction. The recombinant bacterium (B. subtilis N4-pHT01-nit) formed strong biofilms and had nitrile-degrading capability. Further testing demonstrated that biofilms formed by B. subtilis N4-pHT01-nit were highly resistant to loading shock from acetonitrile and almost completely degraded the initial concentration of acetonitrile (800 mg L(-1)) within 24 h in a moving bed biofilm reactor (MBBR) after operation for 35 d. The bacterial composition of the biofilm, identified by high-throughput sequencing, in a reactor in which the B. subtilis N4-pHT01-nit bacterium was introduced indicated that the engineered bacterium was successfully immobilized in the reactor and became dominant genus. This work demonstrates that an engineered bacterium with nitrile-degrading and biofilm-forming capacity can improve the degradation of contaminants in wastewater. This approach offers a novel strategy for enhancing the biological oxidation of toxic pollutants in wastewater. Copyright © 2016 Elsevier Ltd. All rights reserved.

  1. Draft Genome Sequence of an Anaerobic and Extremophilic Bacterium, Caldanaerobacter yonseiensis, Isolated from a Geothermal Hot Stream

    PubMed Central

    Lee, Sang-Jae; Lee, Yong-Jik; Park, Gun-Seok; Kim, Byoung-Chan; Lee, Sang Jun; Shin, Jae-Ho

    2013-01-01

    Caldanaerobacter yonseiensis is a strictly anaerobic, thermophilic, spore-forming bacterium, which was isolated from a geothermal hot stream in Indonesia. This bacterium utilizes xylose and produces a variety of proteases. Here, we report the draft genome sequence of C. yonseiensis, which reveals insights into the pentose phosphate pathway and protein degradation metabolism in thermophilic microorganisms. PMID:24201201

  2. A Pathway Closely Related to the d-Tagatose Pathway of Gram-Negative Enterobacteria Identified in the Gram-Positive Bacterium Bacillus licheniformis

    PubMed Central

    Van der Heiden, Edwige; Lebrun, Sarah; Freichels, Régine; Brans, Alain; Vastenavond, Christian M.; Galleni, Moreno; Joris, Bernard

    2013-01-01

    We report the first identification of a gene cluster involved in d-tagatose catabolism in Bacillus licheniformis. The pathway is closely related to the d-tagatose pathway of the Gram-negative bacterium Klebsiella oxytoca, in contrast to the d-tagatose 6-phosphate pathway described in the Gram-positive bacterium Staphylococcus aureus. PMID:23524682

  3. A pathway closely related to the (D)-tagatose pathway of gram-negative enterobacteria identified in the gram-positive bacterium Bacillus licheniformis.

    PubMed

    Van der Heiden, Edwige; Delmarcelle, Michaël; Lebrun, Sarah; Freichels, Régine; Brans, Alain; Vastenavond, Christian M; Galleni, Moreno; Joris, Bernard

    2013-06-01

    We report the first identification of a gene cluster involved in d-tagatose catabolism in Bacillus licheniformis. The pathway is closely related to the d-tagatose pathway of the Gram-negative bacterium Klebsiella oxytoca, in contrast to the d-tagatose 6-phosphate pathway described in the Gram-positive bacterium Staphylococcus aureus.

  4. Complete Genome Sequence of a thermotolerant sporogenic lactic acid bacterium, Bacillus coagulans strain 36D1

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Xie, Gary; Dalin, Eileen; Tice, Hope

    Bacillus coagulans is a ubiquitous soil bacterium that grows at 50-55 C and pH 5.0 and fer-ments various sugars that constitute plant biomass to L (+)-lactic acid. The ability of this sporogenic lactic acid bacterium to grow at 50-55 C and pH 5.0 makes this organism an attractive microbial biocatalyst for production of optically pure lactic acid at industrial scale not only from glucose derived from cellulose but also from xylose, a major constituent of hemi-cellulose. This bacterium is also considered as a potential probiotic. Complete genome squence of a representative strain, B. coagulans strain 36D1, is presented and discussed.

  5. Characterization of the promising poly(3-hydroxybutyrate) producing halophilic bacterium Halomonas halophila.

    PubMed

    Kucera, Dan; Pernicová, Iva; Kovalcik, Adriana; Koller, Martin; Mullerova, Lucie; Sedlacek, Petr; Mravec, Filip; Nebesarova, Jana; Kalina, Michal; Marova, Ivana; Krzyzanek, Vladislav; Obruca, Stanislav

    2018-05-01

    This work explores molecular, morphological as well as biotechnological features of the highly promising polyhydroxyalkanoates (PHA) producer Halomonas halophila. Unlike many other halophiles, this bacterium does not require expensive complex media components and it is capable to accumulate high intracellular poly(3-hydroxybutyrate) (PHB) fractions up to 82% of cell dry mass. Most remarkably, regulating the concentration of NaCl apart from PHB yields influences also the polymer's molecular mass and polydispersity. The bacterium metabolizes various carbohydrates including sugars predominant in lignocelluloses and other inexpensive substrates. Therefore, the bacterium was employed for PHB production on hydrolysates of cheese whey, spent coffee grounds, sawdust and corn stover, which were hydrolyzed by HCl; required salinity of cultivation media was set up during neutralization by NaOH. The bacterium was capable to use all the tested hydrolysates as well as sugar beet molasses for PHB biosynthesis, indicating its potential for industrial PHB production. Copyright © 2018 Elsevier Ltd. All rights reserved.

  6. Direct measurement of interaction forces between a single bacterium and a flat plate.

    PubMed

    Klein, Jonah D; Clapp, Aaron R; Dickinson, Richard B

    2003-05-15

    A technique for precisely measuring the equilibrium and viscous interaction forces between a single bacterium and a flat surface as functions of separation distance is described. A single-beam gradient optical trap was used to micromanipulate the bacterium against a flat surface while evanescent wave light scattering was used to measure separation distances. Calibrating the optical trap far from the surface allowed the trapped bacterium to be used as a force probe. Equilibrium force-distance profiles were determined by measuring the deflection of the cell from the center of the optical trap at various trap positions. Simultaneously, viscous forces were determined by measuring the relaxation time for the fluctuating bacterium. Absolute distances were determined using a best-fit approximation to the theoretical prediction for the hindered mobility of a diffusing sphere near a wall. Using this approach, forces in the range from 0.01 to 4 pN were measured at near-nanometer resolution between Staphylococcus aureus and glass that was bare or coated with adsorbed protein.

  7. Extracellular nucleic acids of the marine bacterium Rhodovulum sulfidophilum and recombinant RNA production technology using bacteria.

    PubMed

    Kikuchi, Yo; Umekage, So

    2018-02-01

    Extracellular nucleic acids of high molecular weight are detected ubiquitously in seawater. Recent studies have indicated that these nucleic acids are, at least in part, derived from active production by some bacteria. The marine bacterium Rhodovulum sulfidophilum is one of those bacteria. Rhodovulumsulfidophilum is a non-sulfur phototrophic marine bacterium that is known to form structured communities of cells called flocs, and to produce extracellular nucleic acids in culture media. Recently, it has been revealed that this bacterium produces gene transfer agent-like particles and that this particle production may be related to the extracellular nucleic acid production mechanism. This review provides a summary of recent physiological and genetic studies of these phenomena and also introduces a new method for extracellular production of artificial and biologically functional RNAs using this bacterium. In addition, artificial RNA production using Escherichia coli, which is related to this topic, will also be described. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  8. Genome Sequence of Lactobacillus delbrueckii subsp. lactis CNRZ327, a Dairy Bacterium with Anti-Inflammatory Properties.

    PubMed

    El Kafsi, Hela; Binesse, Johan; Loux, Valentin; Buratti, Julien; Boudebbouze, Samira; Dervyn, Rozenn; Hammani, Amal; Maguin, Emmanuelle; van de Guchte, Maarten

    2014-07-17

    Lactobacillus delbrueckii subsp. lactis CNRZ327 is a dairy bacterium with anti-inflammatory properties both in vitro and in vivo. Here, we report the genome sequence of this bacterium, which appears to contain no less than 215 insertion sequence (IS) elements, an exceptionally high number regarding the small genome size of the strain. Copyright © 2014 El Kafsi et al.

  9. Pathogenicity of Moraxella osloensis, a Bacterium Associated with the Nematode Phasmarhabditis hermaphrodita, to the Slug Deroceras reticulatum

    PubMed Central

    Tan, Li; Grewal, Parwinder S.

    2001-01-01

    Moraxella osloensis, a gram-negative bacterium, is associated with Phasmarhabditis hermaphrodita, a nematode parasite of slugs. This bacterium-feeding nematode has potential for the biological control of slugs, especially the grey garden slug, Deroceras reticulatum. Infective juveniles of P. hermaphrodita invade the shell cavity of the slug, develop into self-fertilizing hermaphrodites, and produce progeny, resulting in host death. However, the role of the associated bacterium in the pathogenicity of the nematode to the slug is unknown. We discovered that M. osloensis alone is pathogenic to D. reticulatum after injection into the shell cavity or hemocoel of the slug. The bacteria from 60-h cultures were more pathogenic than the bacteria from 40-h cultures, as indicated by the higher and more rapid mortality of the slugs injected with the former. Coinjection of penicillin and streptomycin with the 60-h bacterial culture reduced its pathogenicity to the slug. Further work suggested that the reduction and loss of pathogenicity of the aged infective juveniles of P. hermaphrodita to D. reticulatum result from the loss of M. osloensis from the aged nematodes. Also, axenic J1/J2 nematodes were nonpathogenic after injection into the shell cavity. Therefore, we conclude that the bacterium is the sole killing agent of D. reticulatum in the nematode-bacterium complex and that P. hermaphrodita acts only as a vector to transport the bacterium into the shell cavity of the slug. The identification of the toxic metabolites produced by M. osloensis is being pursued. PMID:11679319

  10. Pathogenicity of Moraxella osloensis, a bacterium associated with the nematode Phasmarhabditis hermaphrodita, to the slug Deroceras reticulatum.

    PubMed

    Tan, L; Grewal, P S

    2001-11-01

    Moraxella osloensis, a gram-negative bacterium, is associated with Phasmarhabditis hermaphrodita, a nematode parasite of slugs. This bacterium-feeding nematode has potential for the biological control of slugs, especially the grey garden slug, Deroceras reticulatum. Infective juveniles of P. hermaphrodita invade the shell cavity of the slug, develop into self-fertilizing hermaphrodites, and produce progeny, resulting in host death. However, the role of the associated bacterium in the pathogenicity of the nematode to the slug is unknown. We discovered that M. osloensis alone is pathogenic to D. reticulatum after injection into the shell cavity or hemocoel of the slug. The bacteria from 60-h cultures were more pathogenic than the bacteria from 40-h cultures, as indicated by the higher and more rapid mortality of the slugs injected with the former. Coinjection of penicillin and streptomycin with the 60-h bacterial culture reduced its pathogenicity to the slug. Further work suggested that the reduction and loss of pathogenicity of the aged infective juveniles of P. hermaphrodita to D. reticulatum result from the loss of M. osloensis from the aged nematodes. Also, axenic J1/J2 nematodes were nonpathogenic after injection into the shell cavity. Therefore, we conclude that the bacterium is the sole killing agent of D. reticulatum in the nematode-bacterium complex and that P. hermaphrodita acts only as a vector to transport the bacterium into the shell cavity of the slug. The identification of the toxic metabolites produced by M. osloensis is being pursued.

  11. Effect of arsenite-oxidizing bacterium B. laterosporus on arsenite toxicity and arsenic translocation in rice seedlings.

    PubMed

    Yang, Gui-Di; Xie, Wan-Ying; Zhu, Xi; Huang, Yi; Yang, Xiao-Jun; Qiu, Zong-Qing; Lv, Zhen-Mao; Wang, Wen-Na; Lin, Wen-Xiong

    2015-10-01

    Arsenite [As (III)] oxidation can be accelerated by bacterial catalysis, but the effects of the accelerated oxidation on arsenic toxicity and translocation in rice plants are poorly understood. Herein we investigated how an arsenite-oxidizing bacterium, namely Brevibacillus laterosporus, influences As (III) toxicity and translocation in rice plants. Rice seedlings of four cultivars, namely Guangyou Ming 118 (GM), Teyou Hang II (TH), Shanyou 63 (SY) and Minghui 63 (MH), inoculated with or without the bacterium were grown hydroponically with As (III) to investigate its effects on arsenic toxicity and translocation in the plants. Percentages of As (III) oxidation in the solutions with the bacterium (100%) were all significantly higher than those without (30-72%). The addition of the bacterium significantly decreased As (III) concentrations in SY root, GM root and shoot, while increased the As (III) concentrations in the shoot of SY, MH and TH and in the root of MH. Furthermore, the As (III) concentrations in the root and shoot of SY were both the lowest among the treatments with the bacterium. On the other hand, its addition significantly alleviated the As (III) toxicity on four rice cultivars. Among the treatments amended with B. laterosporus, the bacterium showed the best remediation on SY seedlings, with respect to the subdued As (III) toxicity and decreased As (III) concentration in its roots. These results indicated that As (III) oxidation accelerated by B. laterosporus could be an effective method to alleviate As (III) toxicity on rice seedlings. Copyright © 2015 Elsevier Inc. All rights reserved.

  12. A New Approach for the Control of Cockroaches Utilizing the Entomophilic Nematode DD-136 in Conjunction with Attractants.

    DTIC Science & Technology

    1982-08-01

    002 I. - Nematode Studies I nt roduc t io n: Nematodes are multicellular animals that, like insects, have evolved to occupy nearly every biological...hoemocoel, the nematodes release an associated bacterium from their intestinal lumen into the hemolymph . The bacterium multiplies rapidly, causing a...with members of either the Neoaplectana or Heterothabditis. The relationship between the nematode and its associated bacterium, Xenorhabdus

  13. Draft Genome Sequence of Arthrobacter sp. Strain SPG23, a Hydrocarbon-Degrading and Plant Growth-Promoting Soil Bacterium.

    PubMed

    Gkorezis, Panagiotis; Bottos, Eric M; Van Hamme, Jonathan D; Thijs, Sofie; Rineau, Francois; Franzetti, Andrea; Balseiro-Romero, Maria; Weyens, Nele; Vangronsveld, Jaco

    2015-12-23

    We report here the 4.7-Mb draft genome of Arthrobacter sp. SPG23, a hydrocarbonoclastic Gram-positive bacterium belonging to the Actinobacteria, isolated from diesel-contaminated soil at the Ford Motor Company site in Genk, Belgium. Strain SPG23 is a potent plant growth promoter useful for diesel fuel remediation applications based on plant-bacterium associations. Copyright © 2015 Gkorezis et al.

  14. Draft Genome Sequence of Bacillus licheniformis Strain GB2, a Hydrocarbon-Degrading and Plant Growth-Promoting Soil Bacterium.

    PubMed

    Gkorezis, Panagiotis; Van Hamme, Jonathan; Bottos, Eric; Thijs, Sofie; Balseiro-Romero, Maria; Monterroso, Carmela; Kidd, Petra Suzan; Rineau, Francois; Weyens, Nele; Sillen, Wouter; Vangronsveld, Jaco

    2016-06-23

    We report the 4.39 Mb draft genome of Bacillus licheniformis GB2, a hydrocarbonoclastic Gram-positive bacterium of the family Bacillaceae, isolated from diesel-contaminated soil at the Ford Motor Company site in Genk, Belgium. Strain GB2 is an effective plant-growth promoter useful for diesel fuel remediation applications based on plant-bacterium associations. Copyright © 2016 Gkorezis et al.

  15. Complete Genome Sequence of a thermotolerant sporogenic lactic acid bacterium, Bacillus coagulans strain 36D1

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rhee, Mun Su; Moritz, Brelan E.; Xie, Gary

    Bacillus coagulans is a ubiquitous soil bacterium that grows at 50-55 C and pH 5.0 and fer- ments various sugars that constitute plant biomass to L (+)-lactic acid. The ability of this spo- rogenic lactic acid bacterium to grow at 50-55 C and pH 5.0 makes this organism an attrac- tive microbial biocatalyst for production of optically pure lactic acid at industrial scale not only from glucose derived from cellulose but also from xylose, a major constituent of hemi- cellulose. This bacterium is also considered as a potential probiotic. Complete genome se- quence of a representative strain, B. coagulans strainmore » 36D1, is presented and discussed.« less

  16. Methods for dispersing hydrocarbons using autoclaved bacteria

    DOEpatents

    Tyndall, Richard L.

    1996-01-01

    A method of dispersing a hydrocarbon includes the steps: providing a bacterium selected from the following group: ATCC 85527, ATCC 75529, and ATCC 55638, a mutant of any one of these bacteria possessing all the identifying characteristics of any one of these bacteria, and mixtures thereof; autoclaving the bacterium to derive a dispersant solution therefrom; and contacting the dispersant solution with a hydrocarbon to disperse the hydrocarbon. Moreover, a method for preparing a dispersant solution includes the following steps: providing a bacterium selected from the following group: ATCC 75527, ATCC 75529, and ATCC 55638, a mutant of any one of these bacteria possessing all the identifying characteristics of any one of these bacteria, and mixtures thereof; and autoclaving the bacterium to derive a dispersant solution therefrom.

  17. Methods for dispersing hydrocarbons using autoclaved bacteria

    DOEpatents

    Tyndall, R.L.

    1996-11-26

    A method of dispersing a hydrocarbon includes the following steps: providing a bacterium selected from the following group: ATCC 85527, ATCC 75529, and ATCC 55638, a mutant of any one of these bacteria possessing all the identifying characteristics of any one of these bacteria, and mixtures; autoclaving the bacterium to derive a dispersant solution; and contacting the dispersant solution with a hydrocarbon to disperse the hydrocarbon. Moreover, a method for preparing a dispersant solution includes the following steps: providing a bacterium selected from the following group: ATCC 75527, ATCC 75529, and ATCC 55638, a mutant of any one of these bacteria possessing all the identifying characteristics of any one of these bacteria, and mixtures; and autoclaving the bacterium to derive a dispersant solution.

  18. Complete Genome Sequence of a thermotolerant sporogenic lactic acid bacterium, Bacillus coagulans strain 36D1

    PubMed Central

    Rhee, Mun Su; Moritz, Brélan E.; Xie, Gary; Glavina del Rio, T.; Dalin, E.; Tice, H.; Bruce, D.; Goodwin, L.; Chertkov, O.; Brettin, T.; Han, C.; Detter, C.; Pitluck, S.; Land, Miriam L.; Patel, Milind; Ou, Mark; Harbrucker, Roberta; Ingram, Lonnie O.; Shanmugam, K. T.

    2011-01-01

    Bacillus coagulans is a ubiquitous soil bacterium that grows at 50-55 °C and pH 5.0 and ferments various sugars that constitute plant biomass to L (+)-lactic acid. The ability of this sporogenic lactic acid bacterium to grow at 50-55 °C and pH 5.0 makes this organism an attractive microbial biocatalyst for production of optically pure lactic acid at industrial scale not only from glucose derived from cellulose but also from xylose, a major constituent of hemicellulose. This bacterium is also considered as a potential probiotic. Complete genome sequence of a representative strain, B. coagulans strain 36D1, is presented and discussed. PMID:22675583

  19. [Study on anti-bacterium activity of ginkgolic acids and their momomers].

    PubMed

    Yang, Xiaoming; Zhu, Wei; Chen, Jun; Qian, Zhiyu; Xie, Jimin

    2004-09-01

    Ginkgolic acids and their three monomers were separated from ginkgo sarcotestas. The anti-bacterium activity of ginkgolic acids were tested. The relation between the anti-bacterium activity and side chain of ginkgolic acid were studied. The MIC of ginkgolic acids and their three monomers and salicylic acid were tested. Ginkgolic acid has strong inhibitive effect on G+-bacterium. Salicylic acid has no side chain, so no anti-bacterial activity. When the length of gingkolic acid side chain is C13:0, it has the strongest anti-bacterial activity in three monomers. The side chain of ginkgolic acid is the key functional group that possessed anti-bacterial activity. The length of Ginkgolic acid was the main effective factor of anti-bacterial activity.

  20. 7 CFR 301.87-1 - Definitions.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... sugarcane which is caused by the highly infectious bacterium, Xanthomonas vasculorum (Cobb) Dowson, and... infectious bacterium, Xanthomonas albilineans (Ashby) Dowson, and which is not widely prevalent or...

  1. 7 CFR 301.87-1 - Definitions.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... sugarcane which is caused by the highly infectious bacterium, Xanthomonas vasculorum (Cobb) Dowson, and... infectious bacterium, Xanthomonas albilineans (Ashby) Dowson, and which is not widely prevalent or...

  2. 7 CFR 301.87-1 - Definitions.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... sugarcane which is caused by the highly infectious bacterium, Xanthomonas vasculorum (Cobb) Dowson, and... infectious bacterium, Xanthomonas albilineans (Ashby) Dowson, and which is not widely prevalent or...

  3. 21 CFR 866.3010 - Acinetobacter calcoaceticus serological reagents.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... this bacterium from cultured isolates derived from clinical specimens. The identification aids in the diagnosis of disease caused by the bacterium Acinetobacter calcoaceticus and provides epidemiological...

  4. 21 CFR 866.3010 - Acinetobacter calcoaceticus serological reagents.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... this bacterium from cultured isolates derived from clinical specimens. The identification aids in the diagnosis of disease caused by the bacterium Acinetobacter calcoaceticus and provides epidemiological...

  5. Clinical significance of the isolation of Staphylococcus epidermidis from bone biopsy in diabetic foot osteomyelitis.

    PubMed

    Aragón-Sánchez, Javier; Lázaro-Martínez, Jose Luis; Hernández-Herrero, María José; Quintana-Marrero, Yurena; Cabrera-Galván, Juan J

    2010-01-01

    Coagulase-negative staphylococci are considered as microorganisms with little virulence and usually as contaminants. In order to establish the role of Staphylococcus epidermidis as a pathogen in diabetic foot osteomyelitis, in addition to the isolation of the sole bacterium from the bone it will be necessary to demonstrate the histopathological changes caused by the infection. A consecutive series of 222 diabetic patients with foot osteomyelitis treated surgically in the Diabetic Foot Unit at La Paloma Hospital (Las Palmas de Gran Canaria, Canary Islands, Spain) between 1 October 2002 and 31 October 2008. From the entire series including 213 bone cultures with 241 isolated organisms, we have analyzed only the 139 cases where Staphylococci were found. We analyzed several variables between the two groups: Staphylococcus aureus versus Staphylococcus epidermidis. Of the 134 patients included in this study, Staphlylococcus epidermidis was found as the sole bacterium isolated in 11 cases and accompanied by other bacteria in 12 cases. Staphlylococcus aureus was found as the sole bacterium isolated in 72 cases and accompanied by other bacteria in 39 cases. Histopathological changes were found in the cases of osteomyelitis where Staphylococcus epidermidis was the sole bacterium isolated. Acute osteomyelitis was found to a lesser extent when Staphylococcus epidermidis was the sole bacterium isolated but without significant differences with the cases where Staphylococcus aureus was the sole bacterium isolated. Staphylococcus epidermidis should be considered as a real pathogen, not only a contaminant, in diabetic patients with foot osteomyelitis when the bacterium is isolated from the bone. No differences in the outcomes of surgical treatment have been found with cases which Staphlylococcus aureus was isolated.

  6. Clinical significance of the isolation of Staphylococcus epidermidis from bone biopsy in diabetic foot osteomyelitis

    PubMed Central

    Aragón-Sánchez, Javier; Lázaro-Martínez, Jose Luis; Hernández-Herrero, María José; Quintana-Marrero, Yurena; Cabrera-Galván, Juan J.

    2010-01-01

    Introduction Coagulase-negative staphylococci are considered as microorganisms with little virulence and usually as contaminants. In order to establish the role of Staphylococcus epidermidis as a pathogen in diabetic foot osteomyelitis, in addition to the isolation of the sole bacterium from the bone it will be necessary to demonstrate the histopathological changes caused by the infection. Methods A consecutive series of 222 diabetic patients with foot osteomyelitis treated surgically in the Diabetic Foot Unit at La Paloma Hospital (Las Palmas de Gran Canaria, Canary Islands, Spain) between 1 October 2002 and 31 October 2008. From the entire series including 213 bone cultures with 241 isolated organisms, we have analyzed only the 139 cases where Staphylococci were found. We analyzed several variables between the two groups: Staphylococcus aureus versus Staphylococcus epidermidis. Results Of the 134 patients included in this study, Staphlylococcus epidermidis was found as the sole bacterium isolated in 11 cases and accompanied by other bacteria in 12 cases. Staphlylococcus aureus was found as the sole bacterium isolated in 72 cases and accompanied by other bacteria in 39 cases. Histopathological changes were found in the cases of osteomyelitis where Staphylococcus epidermidis was the sole bacterium isolated. Acute osteomyelitis was found to a lesser extent when Staphylococcus epidermidis was the sole bacterium isolated but without significant differences with the cases where Staphylococcus aureus was the sole bacterium isolated. Conclusion Staphylococcus epidermidis should be considered as a real pathogen, not only a contaminant, in diabetic patients with foot osteomyelitis when the bacterium is isolated from the bone. No differences in the outcomes of surgical treatment have been found with cases which Staphlylococcus aureus was isolated. PMID:22396808

  7. Complete Genome Sequence of the p-Nitrophenol-Degrading Bacterium Pseudomonas putida DLL-E4

    PubMed Central

    Hu, Xiaojun; Wang, Jue; Wang, Fei; Chen, Qiongzhen; Huang, Yan

    2014-01-01

    The first complete genome sequence of a p-nitrophenol (PNP)-degrading bacterium is reported here. Pseudomonas putida DLL-E4, a Gram-negative bacterium isolated from methyl-parathion-polluted soil, can utilize PNP as the sole carbon and nitrogen source. P. putida DLL-E4 has a 6,484,062 bp circular chromosome that contains 5,894 genes, with a G+C content of 62.46%. PMID:24948765

  8. Yaws

    MedlinePlus

    ... is closely related to the bacterium that causes syphilis, but this form of the bacterium is not ... test for yaws. However, the blood test for syphilis is often positive in people with yaws because ...

  9. Vibrio vulnificus: death on the half shell. A personal journey with the pathogen and its ecology.

    PubMed

    Oliver, James D

    2013-05-01

    Vibrio vulnificus is an estuarine bacterium which occurs in high numbers in filter-feeding molluscan shellfish, such as oysters. In individuals with certain underlying diseases, ingestion of the bacterium, e.g., in raw or undercooked oysters, can lead to a rapid and extremely fatal infection. Indeed, this one bacterium is responsible for 95 % of all seafood-borne deaths. In addition, the bacterium is capable of entering a preexisting lesion or cut obtained during coastal recreational activities, resulting in potentially fatal wound infections. This brief review, which comprised a presentation made at the Gordon Research Conference on "Oceans and Human Health," reflects over 35 years of research on this bacterium in the author's laboratory. It describes some of the known virulence factors and why males account for ca 85 % of all V. vulnificus cases. It notes the two genotypes now known to exist and how this pathogen enters a dormant, "viable but nonculturable" state during the winter months. Finally, the review discusses how global warming may be causing worldwide increases in the frequency and geographical extent of Vibrio infections.

  10. 7 CFR 319.37-5 - Special foreign inspection and certification requirements.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... necrosis agent. (xxxiv) Flavescence-doree agent. (xxxv) Black wood agent (bois-noir). (xxxvi) Grapevine infectious necrosis bacterium. (xxxvii) Grapevine yellows disease bacterium. (xxxviii) Xanthomonas ampelina...

  11. 7 CFR 319.37-5 - Special foreign inspection and certification requirements.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... necrosis agent. (xxxiv) Flavescence-doree agent. (xxxv) Black wood agent (bois-noir). (xxxvi) Grapevine infectious necrosis bacterium. (xxxvii) Grapevine yellows disease bacterium. (xxxviii) Xanthomonas ampelina...

  12. 7 CFR 319.37-5 - Special foreign inspection and certification requirements.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... necrosis agent. (xxxiv) Flavescence-doree agent. (xxxv) Black wood agent (bois-noir). (xxxvi) Grapevine infectious necrosis bacterium. (xxxvii) Grapevine yellows disease bacterium. (xxxviii) Xanthomonas ampelina...

  13. Characterization of a bacterium of the genus Azospirillum from cellulolytic nitrogen-fixing mixed cultures.

    PubMed

    Wong, P P; Stenberg, N E; Edgar, L

    1980-03-01

    A bacterium with the taxonomic characteristics of the genus Azospirillum was isolated from celluloytic N2-fixing mixed cultures. Its characteristics fit the descriptions of both Azopirillum lipoferum (Beijerinck) comb. nov. and Azospirillum brasilense sp. nov. It may be a variant strain of A. lipoferum. In mixed cultures with cellulolytic organisms, the bacterium grew and fixed N2 with cellelose as a sole source of energy and carbon. The mixed cultures used cellulose from leaves of wheat (Triticum aestivum L.), corn (Zea mays L.), and big bluestem grass (Andropogon gerardii Vitm). Microaerophilic N2-fixing bacteria of the genus Azospirillum, such as the bacterium we isolated, may be important contributors of fixed N2 in soil with partial anaerobiosis and cellulose decomposition.

  14. Ethanologenic bacteria with increased resistance to furfural

    DOEpatents

    Miller, Elliot Norman; Jarboe, Laura R.; Yomano, Lorraine P.; York, Sean W.; Shanmugam, Keelnatham; Ingram, Lonnie O'Neal

    2015-10-06

    The invention relates to bacterium that have increased resistance to furfural and methods of preparation. The invention also relates to methods of producing ethanol using the bacterium and corresponding kits.

  15. Development of Effective Aerobic Cometabolic Systems for the In Situ Transformation of Problematic Chlorinated Solvent Mixtures

    DTIC Science & Technology

    2005-02-01

    vector contained the ampicillin resistance gene , only transformed colonies should grow on the plates and since the inserted DNA should have knocked...flava 340 209 203 69 2422 Nitrogen-fixing bacterium MI753 340 209 203 69 2571 Pseudomonas spinosa 340 209 203 217 2458 Xylophilus ampelinus 340 209...277 203 198 2767 Unidentified bacterium 340 277 203 198 2674 Type 0803 filamentous bacterium 340 277 203 198 2581 Xylophilus ampelinus 340 209 203 217

  16. [Chancroid].

    PubMed

    Holst, Helle; Hartmann-Petersen, Susanna; Dargis, Rimtas; Andresen, Keld; Christensen, Jens Jørgen; Kemp, Michael

    2007-05-28

    Chancroid is caused by the bacterium Haemophilus ducreyi. It is a sexually transmitted disease causing a soft chancre with a necrotic base and purulent exudate. The incidence of this illness is very low in Denmark and is probably underestimated. The bacterium is very fragile in transport, and culture is often negative. The chance of demonstrating the bacterium is greatly enhanced by the use of molecular techniques. In this case, we report on a specific PCR test for H. ducreyi that was used to establish the diagnosis in a 40-year-old male.

  17. Complete genome of Martelella sp. AD-3, a moderately halophilic polycyclic aromatic hydrocarbons-degrading bacterium.

    PubMed

    Cui, Changzheng; Li, Zhijie; Qian, Jiangchao; Shi, Jie; Huang, Ling; Tang, Hongzhi; Chen, Xin; Lin, Kuangfei; Xu, Ping; Liu, Yongdi

    2016-05-10

    Martelella sp. strain AD-3, a moderate halophilic bacterium, was isolated from a petroleum-contaminated soil with high salinity in China. Here, we report the complete genome of strain AD-3, which contains one circular chromosome and two circular plasmids. An array of genes related to metabolism of polycyclic aromatic hydrocarbons and halophilic mechanism in this bacterium was identified by the whole genome analysis. Copyright © 2016 Elsevier B.V. All rights reserved.

  18. Molecular Mechanisms Contributing to the Growth and Physiology of an Extremophile Cultured with Dielectric Heating

    PubMed Central

    Cusick, Kathleen D.; Lin, Baochuan; Malanoski, Anthony P.; Strycharz-Glaven, Sarah M.; Cockrell-Zugell, Allison; Fitzgerald, Lisa A.; Cramer, Jeffrey A.; Barlow, Daniel E.; Boyd, Thomas J.

    2016-01-01

    ABSTRACT The effect of microwave frequency electromagnetic fields on living microorganisms is an active and highly contested area of research. One of the major drawbacks to using mesophilic organisms to study microwave radiation effects is the unavoidable heating of the organism, which has limited the scale (<5 ml) and duration (<1 h) of experiments. However, the negative effects of heating a mesophile can be mitigated by employing thermophiles (organisms able to grow at temperatures of >60°C). This study identified changes in global gene expression profiles during the growth of Thermus scotoductus SA-01 at 65°C using dielectric (2.45 GHz, i.e., microwave) heating. RNA sequencing was performed on cultures at 8, 14, and 24 h after inoculation to determine the molecular mechanisms contributing to long-term cellular growth and survival under microwave heating conditions. Over the course of growth, genes associated with amino acid metabolism, carbohydrate metabolism, and defense mechanisms were upregulated; the number of repressed genes with unknown function increased; and at all time points, transposases were upregulated. Genes involved in cell wall biogenesis and elongation were also upregulated, consistent with the distinct elongated cell morphology observed after 24 h using microwave heating. Analysis of the global differential gene expression data enabled the identification of molecular processes specific to the response of T. scotoductus SA-01 to dielectric heating during growth. IMPORTANCE The residual heating of living organisms in the microwave region of the electromagnetic spectrum has complicated the identification of radiation-only effects using microorganisms for 50 years. A majority of the previous experiments used either mature cells or short exposure times with low-energy high-frequency radiation. Using global differential gene expression data, we identified molecular processes unique to dielectric heating using Thermus scotoductus SA-01 cultured over 30 h in a commercial microwave digestor. Genes associated with amino acid metabolism, carbohydrate metabolism, and defense mechanisms were upregulated; the number of repressed genes with unknown function increased; and at all time points, transposases were upregulated. These findings serve as a platform for future studies with mesophiles in order to better understand the response of microorganisms to microwave radiation. PMID:27520819

  19. Density functional study for the bridged dinuclear center based on a high-resolution X-ray crystal structure of ba3 cytochrome c oxidase from Thermus thermophilus.

    PubMed

    Du, Wen-Ge Han; Noodleman, Louis

    2013-12-16

    Strong electron density for a peroxide type dioxygen species bridging the Fea3 and CuB dinuclear center (DNC) was observed in the high-resolution (1.8 Å) X-ray crystal structures (PDB entries 3S8G and 3S8F) of ba3 cytochrome c oxidase (CcO) from Thermus thermophilus. The crystals represent the as-isolated X-ray photoreduced CcO structures. The bridging peroxide was proposed to arise from the recombination of two radiation-produced HO(•) radicals formed either very near to or even in the space between the two metals of the DNC. It is unclear whether this peroxide species is in the O2(2-), O2(•)(-), HO2(-), or the H2O2 form and what is the detailed electronic structure and binding geometry including the DNC. In order to answer what form of this dioxygen species was observed in the DNC of the 1.8 Å X-ray CcO crystal structure (3S8G), we have applied broken-symmetry density functional theory (BS-DFT) geometric and energetic calculations (using OLYP potential) on large DNC cluster models with different Fea3-CuB oxidation and spin states and with O2(2-), O2(•)(-), HO2(-), or H2O2 in the bridging position. By comparing the DFT optimized geometries with the X-ray crystal structure (3S8G), we propose that the bridging peroxide is HO2(-). The X-ray crystal structure is likely to represent the superposition of the Fea3(2+)-(HO2(-))-CuB(+) DNC's in different states (Fe(2+) in low spin (LS), intermediate spin (IS), or high spin (HS)) with the majority species having the proton of the HO2(-) residing on the oxygen atom (O1) which is closer to the Fea3(2+) site in the Fea3(2+)-(HO-O)(-)-CuB(+) conformation. Our calculations show that the side chain of Tyr237 is likely trapped in the deprotonated Tyr237(-) anion form in the 3S8G X-ray crystal structure.

  20. Nitric Oxide Accumulation: The Evolutionary Trigger for Phytopathogenesis

    PubMed Central

    Santana, Margarida M.; Gonzalez, Juan M.; Cruz, Cristina

    2017-01-01

    Many publications highlight the importance of nitric oxide (NO) in plant–bacteria interactions, either in the promotion of health and plant growth or in pathogenesis. However, the role of NO in the signaling between bacteria and plants and in the fate of their interaction, as well as the reconstruction of their interactive evolution, remains largely unknown. Despite the complexity of the evolution of life on Earth, we explore the hypothesis that denitrification and aerobic respiration were responsible for local NO accumulation, which triggered primordial antagonistic biotic interactions, namely the first phytopathogenic interactions. N-oxides, including NO, could globally accumulate via lightning synthesis in the early anoxic ocean and constitute pools for the evolution of denitrification, considered an early step of the biological nitrogen cycle. Interestingly, a common evolution may be proposed for components of denitrification and aerobic respiration pathways, namely for NO and oxygen reductases, a theory compatible with the presence of low amounts of oxygen before the great oxygenation event (GOE), which was generated by Cyanobacteria. During GOE, the increase in oxygen caused the decrease of Earth’s temperature and the consequent increase of oxygen dissolution and availability, making aerobic respiration an increasingly dominant trait of the expanding mesophilic lifestyle. Horizontal gene transfer was certainly important in the joint expansion of mesophily and aerobic respiration. First denitrification steps lead to NO formation through nitrite reductase activity, and NO may further accumulate when oxygen binds NO reductase, resulting in denitrification blockage. The consequent transient NO surplus in an oxic niche could have been a key factor for a successful outcome of an early denitrifying prokaryote able to scavenge oxygen by NO/oxygen reductase or by an independent heterotrophic aerobic respiration pathway. In fact, NO surplus could result in toxicity causing “the first disease” in oxygen-producing Cyanobacteria. We inspected in bacteria the presence of sequences similar to the NO-producing nitrite reductase nirS gene of Thermus thermophilus, an extreme thermophilic aerobe of the Thermus/Deinococcus group, which constitutes an ancient lineage related to Cyanobacteria. In silico analysis revealed the relationship between the presence of nirS genes and phytopathogenicity in Gram-negative bacteria. PMID:29067010

  1. Purification and Characterization of a Novel Thermo-Alkali-Stable Catalase from Thermus brockianus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Thompson, Vicki Sue; Schaller, Kastli Dianne; Apel, William Arnold

    2003-10-01

    A novel thermo-alkali-stable catalase from Thermus brockianus was purified and characterized. The protein was purified from a T. brockianus cell extract in a three-step procedure that resulted in 65-fold purification to a specific activity of 5300 U/mg. The enzyme consisted of four identical subunits of 42.5 kDa as determined by SDS-PAGE and a total molecular mass measured by gel filtration of 178 kDa. The catalase was active over a temperature range from 30 to 94 C and a pH range from 6 to 10, with optimum activity occurring at 90 C and pH 8. At pH 8, the enzyme wasmore » extremely stable at elevated temperatures with half-lives of 330 h at 80 C and 3 h at 90 C. The enzyme also demonstrated excellent stability at 70 C and alkaline pH with measured half-lives of 510 h and 360 h at pHs of 9 and 10, respectively. The enzyme had an unusual pyridine hemochrome spectrum and appears to utilize eight molecules of heme c per tetramer rather than protoheme IX present in the majority of catalases studied to date. The absorption spectrum suggested that the heme iron of the catalase was in a 6-coordinate low spin state rather than the typical 5-coordinate high spin state. A Km of 35.5 mM and a Vmax of 20.3 mM/min·mg protein for hydrogen peroxide was measured, and the enzyme was not inhibited by hydrogen peroxide at concentrations up to 450 mM. The enzyme was strongly inhibited by cyanide and the traditional catalase inhibitor 3-amino-1,2,4-triazole. The enzyme also showed no peroxidase activity to peroxidase substrates o-dianisidine and 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid), a trait of typical monofunctional catalases. However, unlike traditional monofunctional catalases, the T. brockianus catalase was easily reduced by dithionite, a characteristic of catalase-peroxidases. The above properties indicate that this catalase has potential for applications in industrial bleaching processes to remove residual hydrogen peroxide from process streams.« less

  2. Thermostable proteins bioprocesses: The activity of restriction endonuclease-methyltransferase from Thermus thermophilus (RM.TthHB27I) cloned in Escherichia coli is critically affected by the codon composition of the synthetic gene.

    PubMed

    Krefft, Daria; Papkov, Aliaksei; Zylicz-Stachula, Agnieszka; Skowron, Piotr M

    2017-01-01

    Obtaining thermostable enzymes (thermozymes) is an important aspect of biotechnology. As thermophiles have adapted their genomes to high temperatures, their cloned genes' expression in mesophiles is problematic. This is mainly due to their high GC content, which leads to the formation of unfavorable secondary mRNA structures and codon usage in Escherichia coli (E. coli). RM.TthHB27I is a member of a family of bifunctional thermozymes, containing a restriction endonuclease (REase) and a methyltransferase (MTase) in a single polypeptide. Thermus thermophilus HB27 (T. thermophilus) produces low amounts of RM.TthHB27I with a unique DNA cleavage specificity. We have previously cloned the wild type (wt) gene into E. coli, which increased the production of RM.TthHB27I over 100-fold. However, its enzymatic activities were extremely low for an ORF expressed under a T7 promoter. We have designed and cloned a fully synthetic tthHB27IRM gene, using a modified 'codon randomization' strategy. Codons with a high GC content and of low occurrence in E. coli were eliminated. We incorporated a stem-loop circuit, devised to negatively control the expression of this highly toxic gene by partially hiding the ribosome-binding site (RBS) and START codon in mRNA secondary structures. Despite having optimized 59% of codons, the amount of produced RM.TthHB27I protein was similar for both recombinant tthHB27IRM gene variants. Moreover, the recombinant wt RM.TthHB27I is very unstable, while the RM.TthHB27I resulting from the expression of the synthetic gene exhibited enzymatic activities and stability equal to the native thermozyme isolated from T. thermophilus. Thus, we have developed an efficient purification protocol using the synthetic tthHB27IRM gene variant only. This suggests the effect of co-translational folding kinetics, possibly affected by the frequency of translational errors. The availability of active RM.TthHB27I is of practical importance in molecular biotechnology, extending the palette of available REase specificities.

  3. Protective Effect of ECQ on Rat Reflux Esophagitis Model.

    PubMed

    Jang, Hyeon-Soon; Han, Jeong Hoon; Jeong, Jun Yeong; Sohn, Uy Dong

    2012-12-01

    This study was designed to determine the protective effect of Rumex Aquaticus Herba extracts containing quercetin-3-β-D-glucuronopyranoside (ECQ) on experimental reflux esophagitis. Reflux esophagitis was induced by surgical procedure. The rats were divided into seven groups, namely normal group, control group, ECQ (1, 3, 10, 30 mg/kg) group and omeprazole (30 mg/kg) group. ECQ and omeprazole groups received intraduodenal administration. The Rats were starved for 24 hours before the experiments, but were freely allowed to drink water. ECQ group attenuated the gross esophagitis significantly compared to that treated with omeprazole in a dose-dependent manner. ECQ decreased the volume of gastric juice and increased the gastric pH, which are similar to those of omeprazole group. In addition, ECQ inhibited the acid output effectively in reflux esophagitis. Significantly increased amounts of malondialdehyde (MDA), myeloperoxidase (MPO) activity and the mucosal depletion of reduced glutathione (GSH) were observed in the reflux esophagitis. ECQ administration attenuated the decrement of the GSH levels and affected the MDA levels and MPO activity. These results suggest that the ECQ has a protective effect which may be attributed to its multiple effects including anti-secretory, anti-oxidative and anti-inflammatory actions on reflux esophagitis in rats.

  4. Bioturbation and dissolved organic matter enhance contaminant fluxes from sediment treated with powdered and granular activated carbon.

    PubMed

    Kupryianchyk, D; Noori, A; Rakowska, M I; Grotenhuis, J T C; Koelmans, A A

    2013-05-21

    Sediment amendment with activated carbon (AC) is a promising technique for in situ sediment remediation. To date it is not clear whether this technique sufficiently reduces sediment-to-water fluxes of sediment-bound hydrophobic organic chemicals (HOCs) in the presence of bioturbators. Here, we report polychlorobiphenyl (PCB) pore water concentrations, fluxes, mass transfer coefficients, and survival data of two benthic species, for four treatments: no AC addition (control), powdered AC addition, granular AC addition and addition and subsequent removal of GAC (sediment stripping). AC addition decreased mass fluxes but increased apparent mass transfer coefficients because of dissolved organic carbon (DOC) facilitated transport across the benthic boundary layer (BBL). In turn, DOC concentrations depended on bioturbator activity which was high for the PAC tolerant species Asellus aquaticus and low for AC sensitive species Lumbriculus variegatus. A dual BBL resistance model combining AC effects on gradients, DOC facilitated transport and biodiffusion was evaluated against the data and showed how the type of resistance differs with treatment and chemical hydrophobicity. Data and simulations illustrate the complex interplay between AC and contaminant toxicity to benthic organisms and how differences in species tolerance affect mass fluxes from sediment to the water column.

  5. Convergence characteristics between a rodent, the South American lowland paca, and a ruminant, the African water chevrotain: An exemplary case study.

    PubMed

    Dubost, Gérard

    2017-03-01

    The level of convergence between a rodent, the South American lowland paca Cuniculus paca, and a ruminant, the African water chevrotain Hyemoschus aquaticus, is analysed using 231 characteristics belonging to different biological sectors. A convergence index is established based on the degree of rarity of each characteristic in each species compared to other members of its zoological group. Although the divergent characteristics are as numerous as the convergent ones, the two species are globally similar. Convergent characteristics occur in all biological categories, but their rate varies a great deal among them. From internal anatomy and osteology, through behaviour and ecology to the external appearance of the body, convergent characteristics are all the more frequent since the biological category is directly implicated in the adaptation of animals to their external environment (lowland rainforest). However, only the individuals' characteristics are concerned and not those of their population or social organisation. This could be due to differences between the communities of terrestrial mammals to which they belong. Copyright © 2017 Académie des sciences. Published by Elsevier Masson SAS. All rights reserved.

  6. Boron nitride nanotube-based biosensing of various bacterium/viruses: continuum modelling-based simulation approach.

    PubMed

    Panchal, Mitesh B; Upadhyay, Sanjay H

    2014-09-01

    In this study, the feasibility of single walled boron nitride nanotube (SWBNNT)-based biosensors has been ensured considering the continuum modelling-based simulation approach, for mass-based detection of various bacterium/viruses. Various types of bacterium or viruses have been taken into consideration at the free-end of the cantilevered configuration of the SWBNNT, as a biosensor. Resonant frequency shift-based analysis has been performed with the adsorption of various bacterium/viruses considered as additional mass to the SWBNNT-based sensor system. The continuum mechanics-based analytical approach, considering effective wall thickness has been considered to validate the finite element method (FEM)-based simulation results, based on continuum volume-based modelling of the SWBNNT. As a systematic analysis approach, the FEM-based simulation results are found in excellent agreement with the analytical results, to analyse the SWBNNTs for their wide range of applications such as nanoresonators, biosensors, gas-sensors, transducers and so on. The obtained results suggest that by using the SWBNNT of smaller size the sensitivity of the sensor system can be enhanced and detection of the bacterium/virus having mass of 4.28 × 10⁻²⁴ kg can be effectively performed.

  7. [Partial biological characteristics and algicidal activity of an algicidal bacterium].

    PubMed

    Li, San-Hua; Zhang, Qi-Ya

    2013-02-01

    An algicidal bacterium was isolated from freshwater (Lake Donghu in Wuhan) and coded as A01. The morphology of the algicidal bacterium was observed using optical microscope and electron microscopes, the results showed that A01 was rod-shaped, approximately 1.5 microm in length and 0.45 microm in width and with no flagella structure. A01 was Gram-negative and belongs to the family Acinetobacter sp. though identification by Gram's staining and 16S rDNA gene analysis. A01 exhibited strong algicidal activity on the bloom-forming cyanobacterium Anabaena eucompacta under laboratory conditions. The removal rate of chlorophyll a after 7-day incubation with the culture supernatant of A01 and thalli were 77% and 61%, respectively. Microscopic observation showed that almost all cyanobacterial cells were destroyed within 3 d of co-incubation with the supernatant of algicidal bacterium, but a mass of the cyanobacterial cell lysis was observed only after 5 d of co-incubation with the thalli of algicidal bacterium. These results indicated that the main algicidal component of A01 was in its culture supernatant. In other words, the strain A01 could secrete algicidal component against Anabaena eucompacta.

  8. ["Candidatus contubernalis alkalaceticum," an obligately syntrophic alkaliphilic bacterium capable of anaerobic acetate oxidation in a coculture with Desulfonatronum cooperativum].

    PubMed

    Zhilina, T N; Zavarzina, D G; Kolganova, T V; Turova, T P; Zavarzin, G A

    2005-01-01

    From the silty sediments of the Khadyn soda lake (Tuva), a binary sulfidogenic bacterial association capable of syntrophic acetate oxidation at pH 10.0 was isolated. An obligately syntrophic, gram-positive, spore-forming alkaliphilic rod-shaped bacterium performs acetate oxidation in a syntrophic association with a hydrogenotrophic, alkaliphilic sulfate-reducing bacterium; the latter organism was previously isolated and characterized as the new species Desulfonatronum cooperativum. Other sulfate-reducing bacteria of the genera Desulfonatronum and Desulfonatronovibrio can also act as the hydrogenotrophic partner. Apart from acetate, the syntrophic culture can oxidize ethanol, propanol, isopropanol, serine, fructose, and isobutyric acid. Selective amplification of 16S rRNA gene fragments of the acetate-utilizing syntrophic component of the binary culture was performed; it was found to cluster with clones of uncultured gram-positive bacteria within the family Syntrophomonadaceae. The acetate-oxidizing bacterium is thus the first representative of this cluster obtained in a laboratory culture. Based on its phylogenetic position, the new acetate-oxidizing syntrophic bacterium is proposed to be assigned, in a Candidate status, to a new genus and species: "Candidatus Contubernalis alkalaceticum."

  9. Bacillus anthracis (image)

    MedlinePlus

    ... aerobic spore-forming bacterium that causes disease in humans and animals. The bacteria is found in two forms: cutaneous anthrax and inhalation anthrax. Cutaneous anthrax is an infection of the skin caused by direct contact with the bacterium. Inhalation ...

  10. Revival and Identification of Bacterial Spores in 25- to 40-Million-Year-Old Dominican Amber

    NASA Astrophysics Data System (ADS)

    Cano, Raul J.; Borucki, Monica K.

    1995-05-01

    A bacterial spore was revived, cultured, and identified from the abdominal contents of extinct bees preserved for 25 to 40 million years in buried Dominican amber. Rigorous surface decontamination of the amber and aseptic procedures were used during the recovery of the bacterium. Several lines of evidence indicated that the isolated bacterium was of ancient origin and not an extant contaminant. The characteristic enzymatic, biochemical, and 16S ribosomal DNA profiles indicated that the ancient bacterium is most closely related to extant Bacillus sphaericus.

  11. Single Bacterium Detection Using Sers

    NASA Astrophysics Data System (ADS)

    Gonchukov, S. A.; Baikova, T. V.; Alushin, M. V.; Svistunova, T. S.; Minaeva, S. A.; Ionin, A. A.; Kudryashov, S. I.; Saraeva, I. N.; Zayarny, D. A.

    2016-02-01

    This work is devoted to the study of a single Staphylococcus aureus bacterium detection using surface-enhanced Raman spectroscopy (SERS) and resonant Raman spectroscopy (RS). It was shown that SERS allows increasing sensitivity of predominantly low frequency lines connected with the vibrations of Amide, Proteins and DNA. At the same time the lines of carotenoids inherent to this kind of bacterium are well-detected due to the resonance Raman scattering mechanism. The reproducibility and stability of Raman spectra strongly depend on the characteristics of nanostructured substrate, and molecular structure and size of the tested biological object.

  12. Isolation of Bartonella capreoli from elk

    USGS Publications Warehouse

    Bai, Y.; Cross, P.C.; Malania, L.; Kosoy, M.

    2011-01-01

    The aim of the present study was to investigate the presence of Bartonella infections in elk populations. We report the isolation of four Bartonella strains from 55 elk blood samples. Sequencing analysis demonstrated that all four strains belong to Bartonella capreoli, a bacterium that was originally described in the wild roe deer of Europe. Our finding first time demonstrated that B. capreoli has a wide geographic range, and that elk may be another host for this bacterium. Further investigations are needed to determine the impact of this bacterium on wildlife.

  13. Description of a bacterium associated with redmouth disease of rainbow trout (Salmo gairdneri)

    USGS Publications Warehouse

    Ross, A.J.; Rucker, R.R.; Ewing, W.H.

    1966-01-01

    A description was given of a gram-negative, peritrichously flagellated, fermentative bacterium that was isolated on numerous occasions from kidney tissues of rainbow trout (Salmo gairdneri) afflicted with redmouth disease. Although the bacteria apparently were members of the family Enterobacteriaceae, it was impossible to determine their taxonomic position within the family with certainty. Hence it was recommended that their taxonomic position remain sub judice for the present. As a temporary designation RM bacterium was used. Redmouth disease was transmitted from infected to normal fish through the medium of water.

  14. 77 FR 7122 - Notice of Decision To Authorize the Importation of Pomegranate From India Into the Continental...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-02-10

    ..., the false spider mite Tenuipalpus punicae, and the bacterium Xanthomonas axonopodis pv. punicae; If... spider mite Tenuipalpus punicae, and the bacterium Xanthomonas axonopodis pv. punicae; and The fresh...

  15. Draft Genome Sequence of Sphingobium fuliginis OMI, a Bacterium That Degrades Alkylphenols and Bisphenols

    PubMed Central

    Ogata, Yuka; Yahara, Tatsuya; Yokoyama, Takashi; Ishizawa, Hidehiro; Takada, Kazuki; Inoue, Daisuke; Sei, Kazunari

    2017-01-01

    ABSTRACT Sphingobium fuliginis OMI is a bacterium that can degrade a variety of recalcitrant alkylphenols and bisphenols. This study reports the draft genome sequence of S. fuliginis OMI. PMID:29167253

  16. Microorganisms from aphid honeydew attract and enhance the efficacy of natural enemies

    PubMed Central

    Leroy, Pascal D.; Sabri, Ahmed; Heuskin, Stéphanie; Thonart, Philippe; Lognay, Georges; Verheggen, François J.; Francis, Frédéric; Brostaux, Yves; Felton, Gary W.; Haubruge, Eric

    2011-01-01

    Aphids are one of the most serious pests of crops worldwide, causing major yield and economic losses. To control aphids, natural enemies could be an option but their efficacy is sometimes limited by their dispersal in natural environment. Here we report the first isolation of a bacterium from the pea aphid Acyrthosiphon pisum honeydew, Staphylococcus sciuri, which acts as a kairomone enhancing the efficiency of aphid natural enemies. Our findings represent the first case of a host-associated bacterium driving prey location and ovipositional preference for the natural enemy. We show that this bacterium has a key role in tritrophic interactions because it is the direct source of volatiles used to locate prey. Some specific semiochemicals produced by S. sciuri were also identified as significant attractants and ovipositional stimulants. The use of this host-associated bacterium could certainly provide a novel approach to control aphids in field and greenhouse systems. PMID:21673669

  17. Coiled to diffuse: Brownian motion of a helical bacterium.

    PubMed

    Butenko, Alexander V; Mogilko, Emma; Amitai, Lee; Pokroy, Boaz; Sloutskin, Eli

    2012-09-11

    We employ real-time three-dimensional confocal microscopy to follow the Brownian motion of a fixed helically shaped Leptospira interrogans (LI) bacterium. We extract from our measurements the translational and the rotational diffusion coefficients of this bacterium. A simple theoretical model is suggested, perfectly reproducing the experimental diffusion coefficients, with no tunable parameters. An older theoretical model, where edge effects are neglected, dramatically underestimates the observed rates of translation. Interestingly, the coiling of LI increases its rotational diffusion coefficient by a factor of 5, compared to a (hypothetical) rectified bacterium of the same contour length. Moreover, the translational diffusion coefficients would have decreased by a factor of ~1.5, if LI were rectified. This suggests that the spiral shape of the spirochaete bacteria, in addition to being employed for their active twisting motion, may also increase the ability of these bacteria to explore the surrounding fluid by passive Brownian diffusion.

  18. Deinococcus mumbaiensis sp. nov., a radiation-resistant pleomorphic bacterium isolated from Mumbai, India.

    PubMed

    Shashidhar, Ravindranath; Bandekar, Jayant R

    2006-01-01

    A radiation-resistant, Gram-negative and pleomorphic bacterium (CON-1) was isolated from a contaminated tryptone glucose yeast extract agar plate in the laboratory. It was red pigmented, nonmotile, nonsporulating, and aerobic, and contained MK-8 as respiratory quinone. The cell wall of this bacterium contained ornithine. The major fatty acids were C16:0, C16:1, C17:0, C18:1 and iso C18:0. The DNA of CON-1 had a G+C content of 70 mol%. Phylogenetic analysis based on 16S rRNA gene sequences showed that CON-1 exhibited a maximum similarity (94.72%) with Deinococcus grandis. Based on the genotypic, phenotypic and chemotaxonomic characteristics, the bacterium CON-1 was identified as a new species of the genus Deinococcus, for which the name Deinococcus mumbaiensis sp. nov. is proposed. The type strain of D. mumbaiensis is CON-1 (MTCC 7297(T)=DSM 17424(T)).

  19. Helicobacter pylori virulence factors in relation to gastrointestinal diseases in Iran.

    PubMed

    Safaralizadeh, Reza; Dastmalchi, Narges; Hosseinpourfeizi, MohammadAli; Latifi-Navid, Saeid

    2017-04-01

    Helicobacter pylori as an important pathogenic bacterium that colonizes in gastric mucosa, is one of the causative agents in development of some types of gastric diseases, such as chronic active gastritis, peptic ulcer disease (PUD) and gastric cancer (GC). In this review, the aim is studying different genotypes of H. pylori, and the extent of their participation in the pathogenesis of this bacterium which creates gastroduodenal disorders. Some genotypes of H. pylori have a major role in creation of gastroduodenal diseases, whereas some other genotypes of the bacterium do not cause gastric diseases in Iran. It was also reported that some genotypes of this bacterium in different conditions and among different ethnic groups demonstrate different effectiveness. Role of genotypes of H. pylori in creation of gastroduodenal diseases is different among various regions and ethnic groups of Iran. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. Halomonas maura is a physiologically versatile bacterium of both ecological and biotechnological interest.

    PubMed

    Llamas, Inmaculada; del Moral, Ana; Martínez-Checa, Fernando; Arco, Yolanda; Arias, Soledad; Quesada, Emilia

    2006-01-01

    Halomonas maura is a bacterium of great metabolic versatility. We summarise in this work some of the properties that make it a very interesting microorganism both from an ecological and biotechnological point of view. It plays an active role in the nitrogen cycle, is capable of anaerobic respiration in the presence of nitrate and has recently been identified as a diazotrophic bacterium. Of equal interest is mauran, the exopolysaccharide produced by H. maura, which contributes to the formation of biofilms and thus affords the bacterium advantages in the colonisation of its saline niches. Mauran is highly viscous, shows thixotropic and pseudoplastic behaviour, has the capacity to capture heavy metals and exerts a certain immunomodulator effect in medicine. All these attributes have prompted us to make further investigations into its molecular characteristics. To date we have described 15 open reading frames (ORF's) related to exopolysaccharide production, nitrogen fixation and nitrate reductase activity among others.

  1. Modeling dioxygen reduction at multicopper oxidase cathodes.

    PubMed

    Agbo, Peter; Heath, James R; Gray, Harry B

    2014-10-01

    We report a general kinetics model for catalytic dioxygen reduction on multicopper oxidase (MCO) cathodes. Our rate equation combines Butler-Volmer (BV) electrode kinetics and the Michaelis-Menten (MM) formalism for enzymatic catalysis, with the BV model accounting for interfacial electron transfer (ET) between the electrode surface and the MCO type 1 copper site. Extending the principles of MM kinetics to this system produced an analytical expression incorporating the effects of subsequent intramolecular ET and dioxygen binding to the trinuclear copper cluster into the cumulative model. We employed experimental electrochemical data on Thermus thermophilus laccase as benchmarks to validate our model, which we suggest will aid in the design of more efficient MCO cathodes. In addition, we demonstrate the model's utility in determining estimates for both the electronic coupling and average distance between the laccase type-1 active site and the cathode substrate.

  2. 76 FR 27303 - Monsanto Co.; Availability of Petition, Plant Pest Risk Assessment, and Environmental Assessment...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-05-11

    ..., derived from the bacterium Bacillus subtilis, appears to help maintain plant cellular functions and is... in any plant or plant product: A protozoan, a nonhuman animal, a parasitic plant, a bacterium, a...

  3. 76 FR 60450 - Notice of Availability of a Pest Risk Analysis for the Importation of Pomegranate From India Into...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-09-29

    ... Tenuipalpus granati, the false spider mite (Tenuipalpus punicae), and the bacterium Xanthomonas axonopodis pv... granati, the false spider mite (Tenuipalpus punicae), and the bacterium Xanthomonas axonopodis pv. Punicae...

  4. Genome Sequence of the Soil Bacterium Janthinobacterium sp. KBS0711

    PubMed Central

    Shoemaker, William R.; Muscarella, Mario E.

    2015-01-01

    We present a draft genome of Janthinobacterium sp. KBS0711 that was isolated from agricultural soil. The genome provides insight into the ecological strategies of this bacterium in free-living and host-associated environments. PMID:26089434

  5. Complete genome sequence of the haloalkaliphilic, hydrogen-producing bacterium Halanaerobium hydrogeniformans.

    PubMed

    Brown, Steven D; Begemann, Matthew B; Mormile, Melanie R; Wall, Judy D; Han, Cliff S; Goodwin, Lynne A; Pitluck, Samuel; Land, Miriam L; Hauser, Loren J; Elias, Dwayne A

    2011-07-01

    Halanaerobium hydrogenoformans is an alkaliphilic bacterium capable of biohydrogen production at pH 11 and 7% (wt/vol) salt. We present the 2.6-Mb genome sequence to provide insights into its physiology and potential for bioenergy applications.

  6. Isolation of Bacteriophages of the Marine Bacterium Beneckea natriegens from Coastal Salt Marshes1

    PubMed Central

    Zachary, Arthur

    1974-01-01

    Bacteriophages of the marine bacterium Beneckea natriegens were isolated from coastal marshes where they were limited to brackish and marine waters. The phages were widely distributed and morphologically diverse in the marshes. Images PMID:4133830

  7. Formalin treatment of Trichondina sp. reduced Flavobacterium columnare infection in tilapia

    USDA-ARS?s Scientific Manuscript database

    Bacterium Flavobacterium columnare and protozoan Trichodina spp. are common pathogens of cultured fish. Recent studies on parasite-bacterium interaction show evidence that concurrent infections increase severity of some infectious diseases, especially bacterial diseases. The effect of parasite treat...

  8. Draft Genome Sequence of Sphingobium fuliginis OMI, a Bacterium That Degrades Alkylphenols and Bisphenols.

    PubMed

    Kuroda, Masashi; Ogata, Yuka; Yahara, Tatsuya; Yokoyama, Takashi; Ishizawa, Hidehiro; Takada, Kazuki; Inoue, Daisuke; Sei, Kazunari; Ike, Michihiko

    2017-11-22

    Sphingobium fuliginis OMI is a bacterium that can degrade a variety of recalcitrant alkylphenols and bisphenols. This study reports the draft genome sequence of S. fuliginis OMI. Copyright © 2017 Kuroda et al.

  9. Investigations of Iron Minerals Formed by Dissimilatory Alkaliphilic Bacterium with 57Fe Mössbauer Spectroscopy

    NASA Astrophysics Data System (ADS)

    Chistyakova, N. I.; Rusakov, V. S.; Shapkin, A. A.; Zhilina, T. N.; Zavarzina, D. G.; Lančok, A.; Kohout, J.

    2010-07-01

    Anaerobic alkaliphilic bacterium of Geoalkalibacter ferrihydriticus type (strain Z-0531), isolated from a bottom sediment sample from the weakly mineralized soda Lake Khadyn, have been analyzed. The strain uses the amorphous Fe(III)-hydroxide (AFH) as an electron acceptor and acetate CH3COO- as an electron donor. Mössbauer investigations of solid phase samples obtained during the process of the bacterium growth were carried out at room temperature, 77.8 K, 4.2 K without and with the presence of an external magnetic field (6 T) applied perpendicular to the γ-bebam.

  10. From Genome to Function: Systematic Analysis of the Soil Bacterium Bacillus Subtilis

    PubMed Central

    Crawshaw, Samuel G.; Wipat, Anil

    2001-01-01

    Bacillus subtilis is a sporulating Gram-positive bacterium that lives primarily in the soil and associated water sources. Whilst this bacterium has been studied extensively in the laboratory, relatively few studies have been undertaken to study its activity in natural environments. The publication of the B. subtilis genome sequence and subsequent systematic functional analysis programme have provided an opportunity to develop tools for analysing the role and expression of Bacillus genes in situ. In this paper we discuss analytical approaches that are being developed to relate genes to function in environments such as the rhizosphere. PMID:18628943

  11. Gut bacterium of Dendrobaena veneta (Annelida: Oligochaeta) possesses antimycobacterial activity.

    PubMed

    Fiołka, Marta J; Zagaja, Mirosław P; Piersiak, Tomasz D; Wróbel, Marek; Pawelec, Jarosław

    2010-09-01

    The new bacterial strain with antimycobacterial activity has been isolated from the midgut of Dendrobaena veneta (Annelida). Biochemical and molecular characterization of isolates from 18 individuals identified all as Raoultella ornithinolytica genus with 99% similarity. The bacterium is a possible symbiont of the earthworm D. veneta. The isolated microorganism has shown the activity against four strains of fast-growing mycobacteria: Mycobacterium butiricum, Mycobacterium jucho, Mycobacterium smegmatis and Mycobacterium phlei. The multiplication of the gut bacterium on plates with Sauton medium containing mycobacteria has caused a lytic effect. After the incubation of the cell free extract prepared from the gut bacterium with four strains of mycobacteria in liquid Sauton medium, the cells of all tested strains were deformed and divided to small oval forms and sometimes created long filaments. The effect was observed by the use of light, transmission and scanning microscopy. Viability of all examined species of mycobacteria was significantly decreased. The antimycobacterial effect was probably the result of the antibiotic action produced by the gut bacterium of the earthworm. The application of ultrafiltration procedure allowed to demonstrate that antimicrobial substance with strong antimycobacterial activity from bacterial culture supernatant, is a protein with the molecular mass above 100 kDa. Copyright 2010 Elsevier Inc. All rights reserved.

  12. Brevibacillus laterosporus strain BPM3, a potential biocontrol agent isolated from a natural hot water spring of Assam, India.

    PubMed

    Saikia, R; Gogoi, D K; Mazumder, S; Yadav, A; Sarma, R K; Bora, T C; Gogoi, B K

    2011-03-20

    A bacterial strain designated as BPM3 isolated from mud of a natural hot water spring of Nambar Wild Life Sanctuary, Assam, India, strongly inhibited growth of phytopathogenic fungi (Fusarium oxysporum f. sp. ciceri, F. semitectum, Magnaporthe grisea and Rhizoctonia oryzae) and gram-positive bacterium (Staphylococcus aureus). The maximum growth and antagonistic activity was recorded at 30°C, pH 8.5 when starch and peptone were amended as carbon and nitrogen sources, respectively. In greenhouse experiment, this bacterium (BPM3) suppressed blast disease of rice by 30-67% and protected the weight loss by 35-56.5%. The maximum disease protection (67%) and weight loss protection (56.5%) were recorded when the bacterium was applied before 2 days of the pathogen inoculation. Antifungal and antibacterial compounds were isolated from the bacterium which also inhibited the growth of these targeted pathogens. The compounds were purified and on spectroscopic analysis of a purified fraction having R(f) 0.22 which showed strong antifungal and antibacterial activity indicated the presence of C-H, carbonyl group, dimethyl group, -CH(2) and methyl group. The bacterium was characterized by morphological, biochemical and molecular approaches and confirmed that the strain BPM3 is Brevibacillus laterosporus. Copyright © 2010 Elsevier GmbH. All rights reserved.

  13. Isolation and survey of novel fluoroacetate-degrading bacteria belonging to the phylum Synergistetes.

    PubMed

    Davis, Carl K; Webb, Richard I; Sly, Lindsay I; Denman, Stuart E; McSweeney, Chris S

    2012-06-01

    Microbial dehalogenation of chlorinated compounds in anaerobic environments is well known, but the degradation of fluorinated compounds under similar conditions has rarely been described. Here, we report on the isolation of a bovine rumen bacterium that metabolizes fluoroacetate under anaerobic conditions, the mode of degradation and its presence in gut ecosystems. The bacterium was identified using 16S rRNA gene sequence analysis as belonging to the phylum Synergistetes and was designated strain MFA1. Growth was stimulated by amino acids with greater quantities of amino acids metabolized in the presence of fluoroacetate, but sugars were not fermented. Acetate, formate, propionate, isobutryate, isovalerate, ornithine and H(2) were end products of amino acid metabolism. Acetate was the primary end product of fluoroacetate dehalogenation, and the amount produced correlated with the stoichiometric release of fluoride which was confirmed using fluorine nuclear magnetic resonance ((19) F NMR) spectroscopy. Hydrogen and formate produced in situ were consumed during dehalogenation. The growth characteristics of strain MFA1 indicated that the bacterium may gain energy via reductive dehalogenation. This is the first study to identify a bacterium that can anaerobically dehalogenate fluoroacetate. Nested 16S rRNA gene-specific PCR assays detected the bacterium at low numbers in the gut of several herbivore species. © 2012 Commonwealth of Australia.

  14. The construction of an engineered bacterium to remove cadmium from wastewater.

    PubMed

    Chang, S; Shu, H

    2014-01-01

    The removal of cadmium (Cd) from wastewater before it is released from factories is important for protecting human health. Although some researchers have developed engineered bacteria, the resistance of these engineered bacteria to Cd have not been improved. In this study, two key genes involved in glutathione synthesis (gshA and gshB), a serine acetyltransferase gene (cysE), a Thlaspi caerulescens phytochelatin synthase gene (TcPCS1), and a heavy metal ATPase gene (TcHMA3) were transformed into Escherichia coli BL21. The resistance of the engineered bacterium to Cd was significantly greater than that of the initial bacterium and the Cd accumulation in the engineered bacterium was much higher than in the initial bacterium. In addition, the Cd resistance of the bacteria harboring gshB, gshA, cysE, and TcPCS1 was higher than that of the bacteria harboring gshA, cysE, and TcPCS1. This finding demonstrated that gshB played an important role in glutathione synthesis and that the reaction catalyzed by glutathione synthase was the limiting step for producing phytochelatins. Furthermore, TcPCS1 had a greater specificity and a higher capacity for removing Cd than SpPCS1, and TcHMA3 not only played a role in T. caerulescens but also functioned in E. coli.

  15. Characterization of a Neochlamydia-like Bacterium Associated with Epitheliocystis in Cultured Artic Char Salvelinus alpinus

    USDA-ARS?s Scientific Manuscript database

    Infections of branchial epithelium by intracellular gram-negative bacteria, termed epitheliocystis, have limited culture of Arctic char (Salvelinus alpinus). To characterize a bacterium associated with epitheliocystis in cultured char, gills were sampled for histopathologic examination, conventional...

  16. IN SITU RT-PCR WITH A SULFATE-REDUCING BACTERIUM ISOLATED FROM SEAGRASS ROOTS

    EPA Science Inventory

    Bacteria considered to be obligate anaerobes internally colonize roots of the submerged macrophyte Halodule wrightii. A sulfate reducing bacterium, Summer lac 1, was isolated on lactate from H. wrightii roots. The isolate has physiological characteristics typical of Desulfovibri...

  17. Association between Lactobacillus species and bacterial vaginosis-related bacteria, and bacterial vaginosis scores in pregnant Japanese women

    PubMed Central

    Tamrakar, Renuka; Yamada, Takashi; Furuta, Itsuko; Cho, Kazutoshi; Morikawa, Mamoru; Yamada, Hideto; Sakuragi, Noriaki; Minakami, Hisanori

    2007-01-01

    Background Bacterial vaginosis (BV), the etiology of which is still uncertain, increases the risk of preterm birth. Recent PCR-based studies suggested that BV is associated with complex vaginal bacterial communities, including many newly recognized bacterial species in non-pregnant women. Methods To examine whether these bacteria are also involved in BV in pregnant Japanese women, vaginal fluid samples were taken from 132 women, classified as normal (n = 98), intermediate (n = 21), or BV (n = 13) using the Nugent gram stain criteria, and studied. DNA extracted from these samples was analyzed for bacterial sequences of any Lactobacillus, four Lactobacillus species, and four BV-related bacteria by PCR with primers for 16S ribosomal DNA including a universal Lactobacillus primer, Lactobacillus species-specific primers for L. crispatus, L. jensenii, L. gasseri, and L. iners, and BV-related bacterium-specific primers for BVAB2, Megasphaera, Leptotrichia, and Eggerthella-like bacterium. Results The prevalences of L. crispatus, L. jensenii, and L. gasseri were significantly higher, while those of BVAB2, Megasphaera, Leptotrichia, and Eggerthella-like bacterium were significantly lower in the normal group than in the BV group. Unlike other Lactobacillus species, the prevalence of L. iners did not differ between the three groups and women with L. iners were significantly more likely to have BVAB2, Megasphaera, Leptotrichia, and Eggerthella-like bacterium. Linear regression analysis revealed associations of BVAB2 and Megasphaera with Nugent score, and multivariate regression analyses suggested a close relationship between Eggerthella-like bacterium and BV. Conclusion The BV-related bacteria, including BVAB2, Megasphaera, Leptotrichia, and Eggerthella-like bacterium, are common in the vagina of pregnant Japanese women with BV. The presence of L. iners may be correlated with vaginal colonization by these BV-related bacteria. PMID:17986357

  18. Effects of Orange II and Sudan III azo dyes and their metabolites on Staphylococcus aureus

    PubMed Central

    Pan, Hongmiao; Feng, Jinhui; Cerniglia, Carl E.

    2018-01-01

    Azo dyes are widely used in the plastic, paper, cosmetics, food, and pharmaceutical industries. Some metabolites of these dyes are potentially genotoxic. The toxic effects of azo dyes and their potential reduction metabolites on Staphylococcus aureus ATCC BAA 1556 were studied. When the cultures were incubated with 6, 18, and 36 μg/ml of Orange II and Sudan III for 48 h, 76.3, 68.5, and 61.7% of Orange II and 97.8, 93.9, and 75.8% of Sudan III were reduced by the bacterium, respectively. In the presence of 36 μg/ml Sudan III, the cell viability of the bacterium decreased to 61.9% after 48 h of incubation, whereas the cell viability of the control culture without the dye was 71.5%. Moreover, the optical density of the bacterial cultures at 10 h decreased from 0.74 to 0.55, indicating that Sudan III is able to inhibit growth of the bacterium. However, Orange II had no significant effects on either cell growth or cell viability of the bacterium at the tested concentrations. 1-Amino-2-naphthol, a metabolite common to Orange II and Sudan III, was capable of inhibiting cell growth of the bacterium at 1 μg/ml and completely stopped bacterial cell growth at 24–48 μg/ml. On the other hand, the other metabolites of Orange II and Sudan III, namely sulfanilic acid, p-phenylenediamine, and aniline, showed no significant effects on cell growth. p-Phenylenediamine exhibited a synergistic effect with 1-amino-2-naphthol on cell growth inhibition. All of the dye metabolites had no significant effects on cell viability of the bacterium. PMID:21451978

  19. Molecular Analysis, Biochemical Characterization, Antimicrobial Activity, and Immunological Analysis of Proteus mirabilis Isolated from Broilers.

    PubMed

    Yeh, Hung-Yueh; Line, John E; Hinton, Arthur

    2018-03-01

    Proteus mirabilis, a Gram-negative bacterium, is ubiquitous in the environment and is considered as the normal microflora in the human gastrointestinal tract. However, this bacterium is an opportunistic pathogen in humans, often causing urinary tract infections. Moreover, Proteus has been frequently isolated from food animals, including poultry. Whether this bacterium contributes to the foodborne illness in humans is unclear. In this report, P. mirabilis isolates recovered from broilers during housing in the units were characterized, their antimicrobial activity was assayed, and broiler immune response to the soluble proteins was determined. Cecal contents and fecal droppings were treated according to the standard protocol for isolation. Speciation based on biochemical reactions and the antimicrobial activity of the isolates were carried out using commercial kits. Immunoblot was assayed to determine immune status of broilers against P. mirabilis. A total of 10 isolates of P. mirabilis were selected for further characterization. These isolates could grow in pH 6.0 and 1% NaCl conditions. They were resistant to sodium lactate, troleandomycin, rifamycin SV, vancomycin, but sensitive to nalidixic acid, cefotaxime and novobiocin. Moreover, the CTX, ACC, CMY-1, BIC, NDM, VEB, qnrB and qnrD genes were detected by PCR amplification in all isolates. Sera from broilers harboring this bacterium reacted to the P. mirabilis soluble proteins, but not from litter- and age-matched P. mirabilis negative and SPF chickens, indicating that this bacterium infected chickens that could have humoral immune response against P. mirabilis. This study provides a rationale for further monitoring P. mirabilis during poultry production to determine whether this bacterium poses potential threats to public health. Published 2018. This article is a U.S. Government work and is in the public domain in the USA.

  20. Evidence of carbon fixation pathway in a bacterium from candidate phylum SBR1093 revealed with genomic analysis.

    PubMed

    Wang, Zhiping; Guo, Feng; Liu, Lili; Zhang, Tong

    2014-01-01

    Autotrophic CO2 fixation is the most important biotransformation process in the biosphere. Research focusing on the diversity and distribution of relevant autotrophs is significant to our comprehension of the biosphere. In this study, a draft genome of a bacterium from candidate phylum SBR1093 was reconstructed with the metagenome of an industrial activated sludge. Based on comparative genomics, this autotrophy may occur via a newly discovered carbon fixation path, the hydroxypropionate-hydroxybutyrate (HPHB) cycle, which was demonstrated in a previous work to be uniquely possessed by some genera from Archaea. This bacterium possesses all of the thirteen enzymes required for the HPHB cycle; these enzymes share 30∼50% identity with those in the autotrophic species of Archaea that undergo the HPHB cycle and 30∼80% identity with the corresponding enzymes of the mixotrophic species within Bradyrhizobiaceae. Thus, this bacterium might have an autotrophic growth mode in certain conditions. A phylogenetic analysis based on the 16S rRNA gene reveals that the phylotypes within candidate phylum SBR1093 are primarily clustered into 5 clades with a shallow branching pattern. This bacterium is clustered with phylotypes from organically contaminated environments, implying a demand for organics in heterotrophic metabolism. Considering the types of regulators, such as FnR, Fur, and ArsR, this bacterium might be a facultative aerobic mixotroph with potential multi-antibiotic and heavy metal resistances. This is the first report on Bacteria that may perform potential carbon fixation via the HPHB cycle, thus may expand our knowledge of the distribution and importance of the HPHB cycle in the biosphere.

  1. Bivalent vaccination of sex reversed hybrid tilapia against Streptococcus iniae and Vibrio vulnificus

    USDA-ARS?s Scientific Manuscript database

    Streptococcus iniae, a Gram-positive bacterium, and Vibrio vulnificus, a halophilic Gram-negative bacterium, have been associated with severe disease impacting tilapia aquaculture. Recent reports suggest both bacteria have been associated independently and concomitantly with disease on commercial f...

  2. Phosphate enhances levan production in the endophytic bacterium Gluconacetobacter diazotrophicus Pal5

    PubMed Central

    Idogawa, Nao; Amamoto, Ryuta; Murata, Kousaku; Kawai, Shigeyuki

    2014-01-01

    Gluconacetobacter diazotrophicus is a gram-negative and endophytic nitrogen-fixing bacterium that has several beneficial effects in host plants; thus, utilization of this bacterium as a biofertilizer in agriculture may be possible. G. diazotrophicus synthesizes levan, a D-fructofuranosyl polymer with β-(2→6) linkages, as an exopolysaccharide and the synthesized levan improves the stress tolerance of the bacterium. In this study, we found that phosphate enhances levan production by G. diazotrophicus Pal5, a wild type strain that showed a stronger mucous phenotype on solid medium containing 28 mM phosphate than on solid medium containing 7 mM phosphate. A G. diazotrophicus Pal5 levansucrase disruptant showed only a weak mucous phenotype regardless of the phosphate concentration, indicating that the mucous phenotype observed on 28 mM phosphate medium was caused by levan. To our knowledge, this is the first report of the effect of a high concentration of phosphate on exopolysaccharide production. PMID:24717418

  3. Prevalence study of Simkania negevensis in cooling towers in Spain.

    PubMed

    Pérez, Leonardo Martín; Codony, Francesc; Ríos, Karina; Adrados, Bárbara; Fittipaldi, Mariana; De Dios, Gregori; Peñuela, Gustavo; Morató, Jordi

    2011-06-01

    Simkania negevensis is an obligate intracellular bacterium grouped into the order Chlamydiales. This new amoeba-resistant intracellular bacterium might represent a novel etiologic agent of bronchiolitis and community-acquired pneumonia and occurs in aquatic habitats such as drinking water and reclaimed wastewater. Another amoeba-related bacterium, Legionella pneumophila, is an etiologic agent of pneumonia transmitted by environmental aerosols or contaminated water/air cooling systems. These transmission pathways are important in the natural history of Legionellae infections and possibly other intracellular microorganisms such as Parachlamydiaceae; thus, understanding the feasibility of Simkania infection by these routes is relevant. In the present work, we investigated the prevalence of this newly identified pathogenic bacterium in cooling towers by quantitative PCR (qPCR) and its possible relationship with Legionella pneumophila co-infection. Our results show Simkania detection in 2 of 70 cooling towers analyzed. To our knowledge, this report is the first describing Simkania negevensis detection in this category of environmental water samples.

  4. Haemophilus influenzae and the lung (Haemophilus and the lung)

    PubMed Central

    2012-01-01

    Haemophilus influenzae is present as a commensal organism in the nasopharynx of most healthy adults from where it can spread to cause both systemic and respiratory tract infection. This bacterium is divided into typeable forms (such as type b) or nontypeable forms based on the presence or absence of a tough polysaccharide capsule. Respiratory disease is predominantly caused by the nontypeable forms (NTHi). Haemophilus influenzae has evolved a number of strategies to evade the host defense including the ability to invade into local tissue. Pathogenic properties of this bacterium as well as defects in host defense may result in the spread of this bacterium from the upper airway to the bronchi of the lung. This can result in airway inflammation and colonization particularly in chronic obstructive pulmonary disease. Treatment of respiratory tract infection with Haemophilus influenzae is often only partially successful with ongoing infection and inflammation. Improvement in patient outcome will be dependent on a better understanding of the pathogenesis and host immune response to this bacterium. PMID:23369277

  5. Isolation and Characterization of a Human Intestinal Bacterium Eggerthella sp. AUH-JLD49s for the Conversion of (-)-3'-Desmethylarctigenin.

    PubMed

    Wang, Ye; Yu, Fei; Liu, Ming-Yue; Zhao, Yi-Kai; Wang, Dong-Ming; Hao, Qing-Hong; Wang, Xiu-Ling

    2017-05-24

    Arctiin is the most abundant bioactive compound contained in the Arctium lappa plant. In our previous study, we isolated one single bacterium capable of bioconverting arctigenin, an aglycone of arctiin, to 3'-desmethylarctigenin (3'-DMAG) solely. However, to date, a specific bacterium capable of producing other arctiin metabolites has not been reported. In this study, we isolated one single bacterium, which we named Eggerthella sp. AUH-JLD49s, capable of bioconverting 3'-DMAG under anaerobic conditions. The metabolite of 3'-DMAG by strain AUH-JLD49s was identified as 3'-desmethyl-4'-dehydroxyarctigenin (DMDH-AG) based on electrospray ionization mass spectrometry (ESI-MS) and 1 H and 13 C nuclear magnetic resonance spectroscopy. The bioconversion kinetics and bioconversion capacity of strain AUH-JLD49s were investigated. In addition, the metabolite DMDH-AG showed an inhibitory effect on cell growth of human colon cancer cell line HCT116 and human breast cancer cell line MDA-MB-231.

  6. Establishment of an efficient fermentation system of gamma-aminobutyric acid by a lactic acid bacterium, Enterococcus avium G-15, isolated from carrot leaves.

    PubMed

    Tamura, Takayoshi; Noda, Masafumi; Ozaki, Moeko; Maruyama, Masafumi; Matoba, Yasuyuki; Kumagai, Takanori; Sugiyama, Masanori

    2010-01-01

    In the present study, we successfully isolated a carrot leaf-derived lactic acid bacterium that produces gamma-aminobutyric acid (GABA) from monosodium L-glutamate (L-MSG) at a hyper conversion rate. The GABA-producing bacterium, identified as Enterococcus (E.) avium G-15, produced 115.7±6.4 g/l GABA at a conversion rate of 86.0±5.0% from the added L-MSG under the optimum culture condition by a continuous L-MSG feeding method using a jar-fermentor, suggesting that the bacterium displays a great potential ability for the commercial-level fermentation production of GABA. Using the reverse transcription polymerase chain reaction (RT-PCR) method, we analyzed the expression of genes for the GABA transporter and glutamate decarboxylase, designated gadT and gadG, respectively, which were cloned from the E. avium G-15 chromosome. Both genes were expressed even without the added L-MSG, but their expression was enhanced by the addition of L-MSG.

  7. Application of luciferase assay for ATP to antimicrobial drug susceptibility

    NASA Technical Reports Server (NTRS)

    Chappelle, E. W.; Picciolo, G. L.; Vellend, H.; Tuttle, S. A.; Barza, M. J.; Weinstein, L. (Inventor)

    1977-01-01

    The susceptibility of bacteria, particularly those derived from body fluids, to antimicrobial agents is determined in terms of an ATP index measured by culturing a bacterium in a growth medium. The amount of ATP is assayed in a sample of the cultured bacterium by measuring the amount of luminescent light emitted when the bacterial ATP is reacted with a luciferase-luciferin mixture. The sample of the cultured bacterium is subjected to an antibiotic agent. The amount of bacterial adenosine triphosphate is assayed after treatment with the antibiotic by measuring the luminescent light resulting from the reaction. The ATP index is determined from the values obtained from the assay procedures.

  8. Enhancement of oil degradation by co-culture of hydrocarbon degrading and biosurfactant producing bacteria.

    PubMed

    Kumar, Manoj; Leon, Vladimir; Materano, Angela De Sisto; Ilzins, Olaf A

    2006-01-01

    In this study the biodegradation of oil by hydrocarbon degrading Pseudomonas putida in the presence of a biosurfactant-producing bacterium was investigated. The co-culture of test organisms exhibited improved degradation capacities, in a reproducible fashion, in aqueous and soil matrix in comparison to the individual bacterium culture. Results indicate that the in situ biosurfactant production not only resulted in increased emulsification of the oil but also change the adhesion of the hydrocarbon to cell surface of other bacterium. The understanding of interactions beetwen microbes may provide opportunities to further enhancement of contaminants biodegradation by making a suitable blend for bioaugmentation.

  9. Natural suppression of Meloidogyne incognita by Pasteuria penetrans in cotton

    USDA-ARS?s Scientific Manuscript database

    The endospore-forming bacterium Pasteuria penetrans is an obligate parasite of root-knot nematodes (Meloidogyne spp.). This bacterium is commonly found in agricultural soils and has been associated with suppression of Meloidogyne spp. In a field site naturally infested with both P. penetrans and M...

  10. Reactions of broiler sera to salmonella FlgK and FliD flagellar proteins

    USDA-ARS?s Scientific Manuscript database

    Introduction: Salmonella, a Gram-negative bacterium, is the leading foodborne pathogen. It causes human acute bacterial gastroenteritis worldwide. Poultry products are considered as one of major reservoirs of this bacterium. Because the bacterial flagellum is involved in motility, adhesion and o...

  11. Transcriptome analysis of the rhizosphere bacterium Azospirillum brasilense reveals an extensive auxin response.

    PubMed

    Van Puyvelde, Sandra; Cloots, Lore; Engelen, Kristof; Das, Frederik; Marchal, Kathleen; Vanderleyden, Jos; Spaepen, Stijn

    2011-05-01

    The rhizosphere bacterium Azospirillum brasilense produces the auxin indole-3-acetic acid (IAA) through the indole-3-pyruvate pathway. As we previously demonstrated that transcription of the indole-3-pyruvate decarboxylase (ipdC) gene is positively regulated by IAA, produced by A. brasilense itself or added exogenously, we performed a microarray analysis to study the overall effects of IAA on the transcriptome of A. brasilense. The transcriptomes of A. brasilense wild-type and the ipdC knockout mutant, both cultured in the absence and presence of exogenously added IAA, were compared.Interfering with the IAA biosynthesis/homeostasis in A. brasilense through inactivation of the ipdC gene or IAA addition results in much broader transcriptional changes than anticipated. Based on the multitude of changes observed by comparing the different transcriptomes, we can conclude that IAA is a signaling molecule in A. brasilense. It appears that the bacterium, when exposed to IAA, adapts itself to the plant rhizosphere, by changing its arsenal of transport proteins and cell surface proteins. A striking example of adaptation to IAA exposure, as happens in the rhizosphere, is the upregulation of a type VI secretion system (T6SS) in the presence of IAA. The T6SS is described as specifically involved in bacterium-eukaryotic host interactions. Additionally, many transcription factors show an altered regulation as well, indicating that the regulatory machinery of the bacterium is changing.

  12. An Endohyphal Bacterium (Chitinophaga, Bacteroidetes) Alters Carbon Source Use by Fusarium keratoplasticum (F. solani Species Complex, Nectriaceae)

    PubMed Central

    Shaffer, Justin P.; U'Ren, Jana M.; Gallery, Rachel E.; Baltrus, David A.; Arnold, A. Elizabeth

    2017-01-01

    Bacterial endosymbionts occur in diverse fungi, including members of many lineages of Ascomycota that inhabit living plants. These endosymbiotic bacteria (endohyphal bacteria, EHB) often can be removed from living fungi by antibiotic treatment, providing an opportunity to assess their effects on functional traits of their fungal hosts. We examined the effects of an endohyphal bacterium (Chitinophaga sp., Bacteroidetes) on substrate use by its host, a seed-associated strain of the fungus Fusarium keratoplasticum, by comparing growth between naturally infected and cured fungal strains across 95 carbon sources with a Biolog® phenotypic microarray. Across the majority of substrates (62%), the strain harboring the bacterium significantly outperformed the cured strain as measured by respiration and hyphal density. These substrates included many that are important for plant- and seed-fungus interactions, such as D-trehalose, myo-inositol, and sucrose, highlighting the potential influence of EHB on the breadth and efficiency of substrate use by an important Fusarium species. Cases in which the cured strain outperformed the strain harboring the bacterium were observed in only 5% of substrates. We propose that additive or synergistic substrate use by the fungus-bacterium pair enhances fungal growth in this association. More generally, alteration of the breadth or efficiency of substrate use by dispensable EHB may change fungal niches in short timeframes, potentially shaping fungal ecology and the outcomes of fungal-host interactions. PMID:28382021

  13. Isolation and characterization of a novel simazine-degrading bacterium from agricultural soil of central Chile, Pseudomonas sp. MHP41.

    PubMed

    Hernández, Marcela; Villalobos, Patricio; Morgante, Verónica; González, Myriam; Reiff, Caroline; Moore, Edward; Seeger, Michael

    2008-09-01

    s-Triazine herbicides are used extensively in South America in agriculture and forestry. In this study, a bacterium designated as strain MHP41, capable of degrading simazine and atrazine, was isolated from agricultural soil in the Quillota valley, central Chile. Strain MHP41 is able to grow in minimal medium, using simazine as the sole nitrogen source. In this medium, the bacterium exhibited a growth rate of mu=0.10 h(-1), yielding a high biomass of 4.2 x 10(8) CFU mL(-1). Resting cells of strain MHP41 degrade more than 80% of simazine within 60 min. The atzA, atzB, atzC, atzD, atzE and atzF genes encoding the enzymes of the simazine upper and lower pathways were detected in strain MHP41. The motile Gram-negative bacterium was identified as a Pseudomonas sp., based on the Biolog microplate system and comparative sequence analyses of the 16S rRNA gene. Amplified ribosomal DNA restriction analysis allowed the differentiation of strain MHP41 from Pseudomonas sp. ADP. The comparative 16S rRNA gene sequence analyses suggested that strain MHP41 is closely related to Pseudomonas nitroreducens and Pseudomonas multiresinovorans. This is the first s-triazine-degrading bacterium isolated in South America. Strain MHP41 is a potential biocatalyst for the remediation of s-triazine-contaminated environments.

  14. Effects of an equol-producing bacterium isolated from human faeces on isoflavone and lignan metabolism in mice.

    PubMed

    Tamura, Motoi; Hori, Sachiko; Nakagawa, Hiroyuki; Yamauchi, Satoshi; Sugahara, Takuya

    2016-07-01

    Equol is a metabolite of daidzein that is produced by intestinal microbiota. The oestrogenic activity of equol is stronger than daidzein. Equol-producing bacteria are believed to play an important role in the gut. The rod-shaped and Gram-positive anaerobic equol-producing intestinal bacterium Slackia TM-30 was isolated from healthy human faeces and its effects on urinary phyto-oestrogen, plasma and faecal lipids were assessed in adult mice. The urinary amounts of equol in urine were significantly higher in mice receiving the equol-producing bacterium TM-30 (BAC) group than in the control (CO) group (P < 0.05). However, no significant differences were observed between the urinary amounts of daidzein, dihydrodaidzein, enterodiol, and enterolactone between the BAC and CO groups. No significant differences in the plasma lipids were observed between the two groups. The lipid content (% dry weight) in the faeces sampled on the final day of the experiment tended to be higher in the BAC group than in the CO group (P = 0.07). Administration of equol-producing bacterium TM-30 affected the urinary amounts of phyto-oestrogens and the faecal lipid contents of mice. The equol-producing bacterium TM-30 likely influences the metabolism of phyto-oestrogen via changes in the gastrointestinal environment. © 2015 Society of Chemical Industry. © 2015 Society of Chemical Industry.

  15. Redirection of the Reaction Specificity of a Thermophilic Acetolactate Synthase toward Acetaldehyde Formation

    PubMed Central

    Cheng, Maria; Yoshiyasu, Hayato; Okano, Kenji; Ohtake, Hisao; Honda, Kohsuke

    2016-01-01

    Acetolactate synthase and pyruvate decarboxylase are thiamine pyrophosphate-dependent enzymes that convert pyruvate into acetolactate and acetaldehyde, respectively. Although the former are encoded in the genomes of many thermophiles and hyperthermophiles, the latter has been found only in mesophilic organisms. In this study, the reaction specificity of acetolactate synthase from Thermus thermophilus was redirected to catalyze acetaldehyde formation to develop a thermophilic pyruvate decarboxylase. Error-prone PCR and mutant library screening led to the identification of a quadruple mutant with 3.1-fold higher acetaldehyde-forming activity than the wild-type. Site-directed mutagenesis experiments revealed that the increased activity of the mutant was due to H474R amino acid substitution, which likely generated two new hydrogen bonds near the thiamine pyrophosphate-binding site. These hydrogen bonds might result in the better accessibility of H+ to the substrate-cofactor-enzyme intermediate and a shift in the reaction specificity of the enzyme. PMID:26731734

  16. Translesion synthesis across the (6-4) photoproduct and its Dewar valence isomer by the Y-family and engineered DNA polymerases.

    PubMed

    Yamamoto, Junpei; Loakes, David; Masutani, Chikahide; Simmyo, Shizu; Urabe, Kumiko; Hanaoka, Fumio; Holliger, Philipp; Iwai, Shigenori

    2008-01-01

    We analyzed the translesion synthesis across the UV-induced lesions, the (6-4) photoproduct and its Dewar valence isomer, by using human DNA polymerases eta and iota in vitro. The primer extension experiments revealed that pol eta tended to incorporate dG opposite the 3' component of both lesions, but the incorporation efficiency for the Dewar isomer was higher than that for the (6-4) photoproduct. On the other hand, pol iota was likely to incorporate dA opposite the 3' components of the (6-4) photoproduct and its Dewar isomer with a similar efficiency. Elongation after the incorporation opposite the UV lesions was not observed for these Y-family polymerases. We further analyzed the bypass ability of an engineered polymerase developed from Thermus DNA polymerase for the amplification of ancient DNA. This polymerase could bypass the Dewar isomer more efficiently than the (6-4) photoproduct.

  17. Effector region of the translation elongation factor EF-Tu.GTP complex stabilizes an orthoester acid intermediate structure of aminoacyl-tRNA in a ternary complex.

    PubMed Central

    Förster, C; Limmer, S; Zeidler, W; Sprinzl, M

    1994-01-01

    tRNA(Val) from Escherichia coli was aminoacylated with [1-13C]valine and its complex with Thermus thermophilus elongation factor EF-Tu.GTP was analyzed by 13C NMR spectroscopy. The results suggest that the aminoacyl residue of the valyl-tRNA in ternary complex with bacterial EF-Tu and GTP is not attached to tRNA by a regular ester bond to either a 2'- or 3'-hydroxyl group; instead, an intermediate orthoester acid structure with covalent linkage to both vicinal hydroxyls of the terminal adenosine-76 is formed. Mutation of arginine-59 located in the effector region of EF-Tu, a conserved residue in protein elongation factors and the alpha subunits of heterotrimeric guanine nucleotide-binding regulatory proteins (G proteins), abolishes the stabilization of the orthoester acid structure of aminoacyl-tRNA. PMID:8183898

  18. Autonomous generation and loading of DNA guides by bacterial Argonaute

    PubMed Central

    Chandradoss, Stanley D.; Zhu, Yifan; Timmers, Elizabeth M.; Zhang, Yong; Zhao, Hongtu; Lou, Jizhong; Wang, Yanli; Joo, Chirlmin; van der Oost, John

    2018-01-01

    Summary Several prokaryotic Argonaute proteins (pAgos) utilize small DNA guides to mediate host defense by targeting invading DNA complementary to the DNA guide. It is unknown how these DNA guides are being generated and loaded onto pAgo. Here we demonstrate that guide-free Argonaute from Thermus thermophilus (TtAgo) can degrade dsDNA, thereby generating small dsDNA fragments that subsequently are loaded onto TtAgo. Combining single-molecule fluorescence, molecular dynamic simulations and structural studies, we show that TtAgo loads dsDNA molecules with a preference towards a deoxyguanosine on the passenger strand at the position opposite to the 5’-end of the guide strand. This explains why in vivo TtAgo is preferentially loaded with guides with a 5’-end deoxycytidine. Our data demonstrate that TtAgo can independently generate and selectively load functional DNA guides. PMID:28262506

  19. The dynamic stator stalk of rotary ATPases

    PubMed Central

    Stewart, Alastair G.; Lee, Lawrence K.; Donohoe, Mhairi; Chaston, Jessica J.; Stock, Daniela

    2012-01-01

    Rotary ATPases couple ATP hydrolysis/synthesis with proton translocation across biological membranes and so are central components of the biological energy conversion machinery. Their peripheral stalks are essential components that counteract torque generated by rotation of the central stalk during ATP synthesis or hydrolysis. Here we present a 2.25-Å resolution crystal structure of the peripheral stalk from Thermus thermophilus A-type ATPase/synthase. We identify bending and twisting motions inherent within the structure that accommodate and complement a radial wobbling of the ATPase headgroup as it progresses through its catalytic cycles, while still retaining azimuthal stiffness necessary to counteract rotation of the central stalk. The conformational freedom of the peripheral stalk is dictated by its unusual right-handed coiled-coil architecture, which is in principle conserved across all rotary ATPases. In context of the intact enzyme, the dynamics of the peripheral stalks provides a potential mechanism for cooperativity between distant parts of rotary ATPases. PMID:22353718

  20. Exploration of freely available web-interfaces for comparative homology modelling of microbial proteins.

    PubMed

    Nema, Vijay; Pal, Sudhir Kumar

    2013-01-01

    This study was conducted to find the best suited freely available software for modelling of proteins by taking a few sample proteins. The proteins used were small to big in size with available crystal structures for the purpose of benchmarking. Key players like Phyre2, Swiss-Model, CPHmodels-3.0, Homer, (PS)2, (PS)(2)-V(2), Modweb were used for the comparison and model generation. Benchmarking process was done for four proteins, Icl, InhA, and KatG of Mycobacterium tuberculosis and RpoB of Thermus Thermophilus to get the most suited software. Parameters compared during analysis gave relatively better values for Phyre2 and Swiss-Model. This comparative study gave the information that Phyre2 and Swiss-Model make good models of small and large proteins as compared to other screened software. Other software was also good but is often not very efficient in providing full-length and properly folded structure.

  1. Diversity of bacteria in surface ice of Austre Lovénbreen glacier, Svalbard.

    PubMed

    Zeng, Yin-Xin; Yan, Ming; Yu, Yong; Li, Hui-Rong; He, Jian-Feng; Sun, Kun; Zhang, Fang

    2013-05-01

    Two 16S rRNA gene clone libraries Cores 1U and 2U were constructed using two ice core samples collected from Austre Lovénbreen glacier in Svalbard. The two libraries yielded a total of 262 clones belonging to 59 phylotypes. Sequences fell into 10 major lineages of the domain Bacteria, including Proteobacteria (alpha, beta, gamma and delta subdivisions), Bacteroidetes, Actinobacteria, Firmicutes, Acidobacteria, Deinococcus-Thermus, Chloroflexi, Planctomycetes, Cyanobacteria and candidate division TM7. Among them, Bacteroidetes, Actinobacteria, Alphaproteobacteria and Cyanobacteria were most abundant. UniFrac data showed no significant differences in community composition between the two ice cores. A total of nineteen bacterial strains from the genera Pseudoalteromonas and Psychrobacter were isolated from the ice cores. Phylogenetic and phenotypic analyses revealed a close relationship between the ice core isolates and bacteria in marine environments, indicating a wide distribution of some bacterial phylotypes in both terrestrial and marine ecosystems.

  2. Partial proteome of the corynetoxin-producing Gram-positive bacterium, Rathayibacter toxicus

    USDA-ARS?s Scientific Manuscript database

    Rathayibacter toxicus is a Gram-positive bacterium that is the causative agent of annual ryegrass toxicity (ARGT), a disease that causes devastating losses in the Australian livestock industry. R. toxicus exhibits a complex life cycle, using the nematode Anguina funesta as a physical vector to carry...

  3. Genome Sequence of Lysinibacillus sphaericus, a Lignin-Degrading Bacterium Isolated from Municipal Solid Waste Soil.

    PubMed

    Persinoti, Gabriela F; Paixão, Douglas A A; Bugg, Timothy D H; Squina, Fabio M

    2018-05-03

    We report here the draft genome sequence of Lysinibacillus sphaericus strain A1, a potential lignin-degrading bacterium isolated from municipal solid waste (MSW) soil and capable of enhancing gas release from lignocellulose-containing soil. Copyright © 2018 Persinoti et al.

  4. Molecular analysis, biochemical characterization, antimicrobial activity and immunological analysis of proteus mirabilis isolated from broilers

    USDA-ARS?s Scientific Manuscript database

    Proteus mirabilis, a peritrichously flagellated Gram-negative bacterium, is ubiquitous in the environment and is the normal microflora in the human gastrointestinal tract. However, this bacterium is an opportunistic pathogen for human, often causing urinary tract infection. Moreover, Proteus has b...

  5. Draft Genome Sequence of the Algicidal Bacterium Mangrovimonas yunxiaonensis Strain LY01

    PubMed Central

    Li, Yi; Zhu, Hong; Li, Chongping; Zhang, Huajun; Chen, Zhangran; Zheng, Wei

    2014-01-01

    Mangrovimonas yunxiaonensis LY01, a novel bacterium isolated from mangrove sediment, showed high algicidal effects on harmful algal blooms of Alexandrium tamarense. Here, we present the first draft genome sequence of this strain to further understanding of the functional genes related to algicidal activity. PMID:25428978

  6. Assessing the likelihood of transmission of ‘Candidatus Liberibacter solanacearum’ to carrot by potato psyllid, Bactericera cockerelli (Hemiptera: Triozidae)

    USDA-ARS?s Scientific Manuscript database

    ‘Candidatus Liberibacter solanacearum’ (Lso) is a phloem-limited bacterium that severely affects important Solanaceae and Apiaceae crops, including potato, tomato, pepper, tobacco, carrot and celery. This bacterium is transmitted to solanaceous species by potato psyllid, Bactericera cockerelli, and ...

  7. Draft genome sequences of four parasaccharibacter apium strains isolated from honey bees

    USDA-ARS?s Scientific Manuscript database

    Parasaccharibacter apium is a newly described bacterium of honey bees that exhibits multiple ecological strategies in their host, from beneficial to pathogenic. Using niche-specific 16S rRNA gene sequences and bacterial genomes, we describe the ecology of this bacterium and its relationship to other...

  8. Colwellia agarivorans sp. nov., an agar-digesting marine bacterium isolated from coastal seawater

    USDA-ARS?s Scientific Manuscript database

    A novel Gram-stain-negative, facultatively anaerobic, yellowish and agar-digesting marine bacterium, designated strain QM50**T, was isolated from coastal seawater in an aquaculture site near Qingdao, China. Phylogenetic analysis based on 16S rDNA sequences revealed that the novel isolate represented...

  9. Robinsoniella peoriensis: A model anaerobic commensal bacterium for acquisition of antibiotic resistance?

    USDA-ARS?s Scientific Manuscript database

    Background: R. peoriensis was characterized in our laboratories from swine manure and feces as a Gram-positive, anaerobic bacterium. Since then strains of this species have been identified from a variety of mammalian and other gastrointestinal (GI) tracts, suggesting it is a member of the commensal ...

  10. Complete genome of the cellulolytic ruminal bacterium Ruminococcus albus 7

    USDA-ARS?s Scientific Manuscript database

    Ruminococcus albus 7 is a highly cellulolytic rumen bacterium that is a member of the phylum Firmicutes. Here, we describe the complete genome for this microbe. This genome will be useful for rumen microbiology, cellulosome biology, and in biofuel production, as one of its major fermentation product...

  11. Complete genome sequences of two acetylene-fermenting Pelobacter acetylenicus strains

    USGS Publications Warehouse

    Sutton, John M.; Baesman, Shaun; Fierst, Janna L.; Poret-Peterson, Amisha T.; Oremland, Ronald S.; Dunlap, Darren S.; Akob, Denise M.

    2017-01-01

    Acetylene fermentation is a rare metabolism that was serendipitously discovered during C2H2-block assays of N2O reductase. Here, we report the genome sequences of two type strains of acetylene-fermenting Pelobacter acetylenicus, the freshwater bacterium DSM 3246 and the estuarine bacterium DSM 3247.

  12. Complete Genome Sequences of Lactobacillus johnsonii Strain N6.2 and Lactobacillus reuteri Strain TD1.

    PubMed

    Leonard, Michael T; Valladares, Ricardo B; Ardissone, Alexandria; Gonzalez, Claudio F; Lorca, Graciela L; Triplett, Eric W

    2014-05-08

    We report here the complete genome sequences of Lactobacillus johnsonii strain N6.2, a homofermentative lactic acid intestinal bacterium, and Lactobacillus reuteri strain TD1, a heterofermentative lactic acid intestinal bacterium, both isolated from a type 1 diabetes-resistant rat model.

  13. Identifying taxonomic and functional surrogates for spring biodiversity conservation.

    PubMed

    Jyväsjärvi, Jussi; Virtanen, Risto; Ilmonen, Jari; Paasivirta, Lauri; Muotka, Timo

    2018-02-27

    Surrogate approaches are widely used to estimate overall taxonomic diversity for conservation planning. Surrogate taxa are frequently selected based on rarity or charisma, whereas selection through statistical modeling has been applied rarely. We used boosted-regression-tree models (BRT) fitted to biological data from 165 springs to identify bryophyte and invertebrate surrogates for taxonomic and functional diversity of boreal springs. We focused on these 2 groups because they are well known and abundant in most boreal springs. The best indicators of taxonomic versus functional diversity differed. The bryophyte Bryum weigelii and the chironomid larva Paratrichocladius skirwithensis best indicated taxonomic diversity, whereas the isopod Asellus aquaticus and the chironomid Macropelopia spp. were the best surrogates of functional diversity. In a scoring algorithm for priority-site selection, taxonomic surrogates performed only slightly better than random selection for all spring-dwelling taxa, but they were very effective in representing spring specialists, providing a distinct improvement over random solutions. However, the surrogates for taxonomic diversity represented functional diversity poorly and vice versa. When combined with cross-taxon complementarity analyses, surrogate selection based on statistical modeling provides a promising approach for identifying groundwater-dependent ecosystems of special conservation value, a key requirement of the EU Water Framework Directive. © 2018 Society for Conservation Biology.

  14. Decoding how a soil bacterium extracts building blocks and metabolic energy from ligninolysis provides road map for lignin valorization (Towards Lignin valorization: How a soil bacterium extracts building blocks and metabolic energy from "Lignolysis")

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Varman, Arul M.; He, Lian; Follenfant, Rhiannon

    Lignin is a major resources for the production of next generation renewable aromatics. Sphingobium sp. SYK-6 is a bacterium that has been well-studied for the breakdown of lignin-derived compounds. There has been a lot of interest in SYK-6 lignolytic activity and many recent works have focused on understanding the unique catabolic pathway it possesses for the degradation of lignin derived monomers and oligomers. Furthermore, there has been no prior effort in understanding the central fluxome based on lignin derived substrates into value-added chemicals.

  15. Ammonificins C and D, Hydroxyethylamine Chromene Derivatives from a Cultured Marine Hydrothermal Vent Bacterium, Thermovibrio ammonificans

    PubMed Central

    Andrianasolo, Eric H.; Haramaty, Liti; Rosario-Passapera, Richard; Vetriani, Costantino; Falkowski, Paul; White, Eileen; Lutz, Richard

    2012-01-01

    Chemical and biological investigation of the cultured marine hydrothermal vent bacterium, Thermovibrio ammonifican led to the isolation of two hydroxyethylamine chromene derivatives, ammonificins C and D. Their structures were elucidated using combination of NMR and mass spectrometry. Absolute stereochemistry was ascertained by comparison of experimental and calculated CD spectra. Biological evaluation and assessment were determined using the patented ApopScreen cell-based screen for apoptosis-induction. Ammonificins C and D induce apoptosis in micromolar concentrations. To our knowledge, this finding is the first report of chemical compounds that induce apoptosis from the cultured deep-sea marine organism, hydrothermal vent bacterium, Thermovibrio ammonificans. PMID:23170085

  16. The heterocyclic ring fission and dehydroxylation of catechins and related compounds by Eubacterium sp. strain SDG-2, a human intestinal bacterium.

    PubMed

    Wang, L Q; Meselhy, M R; Li, Y; Nakamura, N; Min, B S; Qin, G W; Hattori, M

    2001-12-01

    A human intestinal bacterium, Eubacterium (E.) sp. strain SDG-2, was tested for its ability to metabolize various (3R)- and (3S)-flavan-3-ols and their 3-O-gallates. This bacterium cleaved the C-ring of (3R)- and (3S)-flavan-3-ols to give 1,3-diphenylpropan-2-ol derivatives, but not their 3-O-gallates. Furthermore, E. sp. strain SDG-2 had the ability of p-dehydroxylation in the B-ring of (3R)-flavan-3-ols, such as (-)-catechin, (-)-epicatechin, (-)-gallocatechin and (-)-epigallocatechin, but not of (3S)-flavan-3-ols, such as (+)-catechin and (+)-epicatechin.

  17. Decoding how a soil bacterium extracts building blocks and metabolic energy from ligninolysis provides road map for lignin valorization (Towards Lignin valorization: How a soil bacterium extracts building blocks and metabolic energy from "Lignolysis")

    DOE PAGES

    Varman, Arul M.; He, Lian; Follenfant, Rhiannon; ...

    2016-09-15

    Lignin is a major resources for the production of next generation renewable aromatics. Sphingobium sp. SYK-6 is a bacterium that has been well-studied for the breakdown of lignin-derived compounds. There has been a lot of interest in SYK-6 lignolytic activity and many recent works have focused on understanding the unique catabolic pathway it possesses for the degradation of lignin derived monomers and oligomers. Furthermore, there has been no prior effort in understanding the central fluxome based on lignin derived substrates into value-added chemicals.

  18. High-Quality Genome Sequence of the Highly Resistant Bacterium Staphylococcus haemolyticus, Isolated from a Neonatal Bloodstream Infection.

    PubMed

    Hosseinkhani, Farideh; Emaneini, Mohammad; van Leeuwen, Willem

    2017-07-20

    Using Illumina HiSeq and PacBio technologies, we sequenced the genome of the multidrug-resistant bacterium Staphylococcus haemolyticus , originating from a bloodstream infection in a neonate. The sequence data can be used as an accurate reference sequence. Copyright © 2017 Hosseinkhani et al.

  19. Draft Genome Sequence of the Algicidal Bacterium Mangrovimonas yunxiaonensis Strain LY01.

    PubMed

    Li, Yi; Zhu, Hong; Li, Chongping; Zhang, Huajun; Chen, Zhangran; Zheng, Wei; Xu, Hong; Zheng, Tianling

    2014-11-26

    Mangrovimonas yunxiaonensis LY01, a novel bacterium isolated from mangrove sediment, showed high algicidal effects on harmful algal blooms of Alexandrium tamarense. Here, we present the first draft genome sequence of this strain to further understanding of the functional genes related to algicidal activity. Copyright © 2014 Li et al.

  20. Genome sequence of the algicidal bacterium Kordia algicida OT-1.

    PubMed

    Lee, Hyun Sook; Kang, Sung Gyun; Kwon, Kae Kyoung; Lee, Jung-Hyun; Kim, Sang-Jin

    2011-08-01

    Kordia algicida OT-1 is an algicidal bacterium against the bloom-forming microalgae. The genome sequence of K. algicida revealed a number of interesting features, including the degradation of macromolecules, the biosynthesis of carotenoid pigment and secondary metabolites, and the capacity for gliding motility, which might facilitate the understanding of algicidal mechanisms.

  1. Aerobic mineralization of vinyl chlorides by a bacterium of the order Actinomycetales

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Phelps, T.J.; Malachowsky, K.; Schram, R.M.

    1991-04-01

    A gram-positive branched bacterium isolated from a trichloroethylene-degrading consortium mineralized vinyl chloride in growing cultures and cell suspensions. Greater than 67% of the (1,2-{sup 14}C)vinyl chloride was mineralized to carbon dioxide, with approximately 10% of the radioactivity appearing in {sup 14}C-aqueous-phase products.

  2. Nucleotide sequences specific to Yersinia pestis and methods for the detection of Yersinia pestis

    DOEpatents

    McCready, Paula M [Tracy, CA; Radnedge, Lyndsay [San Mateo, CA; Andersen, Gary L [Berkeley, CA; Ott, Linda L [Livermore, CA; Slezak, Thomas R [Livermore, CA; Kuczmarski, Thomas A [Livermore, CA; Motin, Vladinir L [League City, TX

    2009-02-24

    Nucleotide sequences specific to Yersinia pestis that serve as markers or signatures for identification of this bacterium were identified. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

  3. Treatment of colitis with a commensal gut bacterium engineered to secrete human TGF-beta1 under the control of dietary xylan

    USDA-ARS?s Scientific Manuscript database

    Background: Growth factors have shown promise in treating inflammatory bowel disease. They are unstable when administered orally and required in higher doses with systemic administration. In consideration of these problems, we have engineered the commensal bacterium Bacteroides ovatus for the con...

  4. Incidence of 'Candidatus Liberibacter asiaticus' in a Florida population of Asian citrus psyllid

    USDA-ARS?s Scientific Manuscript database

    A study was conducted to assess the incidence of a bacterium ‘Candidatus Liberibacter asiaticus’ in a Florida population of Asian citrus psyllid (ACP), Diaphorina citri. The bacterium is the presumed causal agent of Asiatic huanglongbing, a serious citrus disease also known as citrus greening or yel...

  5. A Mathematical model to investigate quorum sensing regulation and its heterogenecity in pseudomonas syringae on leaves

    USDA-ARS?s Scientific Manuscript database

    The bacterium Pseudomonas syringae is a plant-pathogen, which through quorum sensing (QS), controls virulence. In this paper, by means of mathematical modeling, we investigate QS of this bacterium when living on leaf surfaces. We extend an existing stochastic model for the formation of Pseudomonas s...

  6. Isolation of a New Polysaccharide-Digesting Bacterium from a Salt Marsh

    PubMed Central

    Andrykovitch, George; Marx, Irene

    1988-01-01

    A new marine bacterium that digested a variety of storage and structural polysaccharides, including agar, was isolated. Strain 2-40 is a nonfermentative gram-negative, polarly flagellated rod that sometimes grew as a filamentous helix and secreted a melaninlike pigment. Its characteristics conform to those of no previously described species. PMID:16347602

  7. Purification and characterization of Helicobacter mustelae urease.

    PubMed Central

    Dunn, B E; Sung, C C; Taylor, N S; Fox, J G

    1991-01-01

    Helicobacter mustelae is a urease-rich bacterium associated with gastritis in ferrets. The ureases of H. mustelae and Helicobacter pylori, a bacterium implicated in human gastritis, share many characteristics. Helicobacter sp. ureases appear to be unique among bacterial enzymes in exhibiting submillimolar Km values and in being composed of two subunits. Images PMID:1879950

  8. Draft genome sequence of ‘Candidatus Phytoplasma pruni’ strain CX, a plant pathogenic bacterium

    USDA-ARS?s Scientific Manuscript database

    ‘Candidatus Phytoplasma pruni’ strain CX, belonging to subgroup 16SrIII-A, is a plant pathogenic bacterium causing economically important diseases in many fruit crops. Here we report the draft genome sequence that consists of 598,508 bases, with a G+C content of 27.21 mol%. ...

  9. Development of a reliable and highly sensitive, digital PCR-based assay for early detection of HLB

    USDA-ARS?s Scientific Manuscript database

    Huanglongbing (HLB) is caused by a phloem-limited bacterium, Ca. Liberibacter asiaticus (Las) in the United States. The bacterium often is present at a low concentration and unevenly distributed in the early stage of infection, making reliable and early diagnosis a serious challenge. Conventional d...

  10. A reliable and highly sensitive, digital PCR-based assay for early detection of citrus Huanglongbing

    USDA-ARS?s Scientific Manuscript database

    Huanglongbing (HLB) is caused by a phloem-limited bacterium, Ca. Liberibacter asiaticus (Las) in the United States. The bacterium is often present at a low concentration and unevenly distributed in the early stage of infection, making reliable and early diagnosis a challenge. We have developed a pro...

  11. Recombinant expression of a putative prophage amidase cloned from the genome of Listeria monocytogenes that lyses the bacterium and its biofilm

    USDA-ARS?s Scientific Manuscript database

    Listeria monocytogenes is a Gram-positive, non-sporeforming, catalase-positive rod that is a major bacterial food-borne disease agent, causing listeriosis. Listeria can be associated with uncooked meats including poultry, uncooked vegetables, soft cheeses and unpasteurized milk. The bacterium can be...

  12. Population dynamics of Meloidogyne arenaria and Pasteuria penetrans in a long-term crop rotation study.

    USDA-ARS?s Scientific Manuscript database

    The endospore-forming bacterium Pasteuria penetrans is an obligate parasite of root-knot nematodes (Meloidogyne spp.). This study was a continuation of earlier research to determine the effect of crop sequence on abundance of the bacterium, and was conducted from 2000 to 2008 at a field site natura...

  13. Evidence for Reciprocal Selection between Populations of Meloidogyne arenaria and Pasteuria penetrans in a Field Study

    USDA-ARS?s Scientific Manuscript database

    Beginning in 1998, a bioassay using second-stage juveniles (J2) from a greenhouse (GH) population of Meloidogyne arenaria (Ma) was used to monitor endospore densities of the bacterium Pasteuria penetrans, which was parasitizing Ma in a crop rotation study. Spore densities of the bacterium were very...

  14. Method for the detection of Salmonella enterica serovar Enteritidis

    DOEpatents

    Agron, Peter G.; Andersen, Gary L.; Walker, Richard L.

    2008-10-28

    Described herein is the identification of a novel Salmonella enterica serovar Enteritidis locus that serves as a marker for DNA-based identification of this bacterium. In addition, three primer pairs derived from this locus that may be used in a nucleotide detection method to detect the presence of the bacterium are also disclosed herein.

  15. Nucleotide sequences specific to Brucella and methods for the detection of Brucella

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    McCready, Paula M; Radnedge, Lyndsay; Andersen, Gary L

    Nucleotide sequences specific to Brucella that serves as a marker or signature for identification of this bacterium were identified. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

  16. Complete genome sequences of two strains of the meat spoilage bacterium Brochothrix thermosphacta isolated from ground chicken

    USDA-ARS?s Scientific Manuscript database

    Brochothrix thermosphacta is an important meat spoilage bacterium. Here we report the genome sequences of two strains of B. thermosphacta isolated from ground chicken. The genome sequences were determined using long-read PacBio single-molecule real-time (SMRT©) technology and are the first complete ...

  17. Complete Genome of Enterobacteriaceae Bacterium Strain FGI 57, a Strain Associated with Leaf-Cutter Ant Fungus Gardens

    PubMed Central

    Aylward, Frank O.; Tremmel, Daniel M.; Bruce, David C.; Chain, Patrick; Chen, Amy; Walston Davenport, Karen; Detter, Chris; Han, Cliff S.; Han, James; Huntemann, Marcel; Ivanova, Natalia N.; Kyrpides, Nikos C.; Markowitz, Victor; Mavrommatis, Kostas; Nolan, Matt; Pagani, Ioanna; Pati, Amrita; Pitluck, Sam; Deshpande, Shweta; Goodwin, Lynne; Woyke, Tanja

    2013-01-01

    The Enterobacteriaceae bacterium strain FGI 57 was isolated from a fungus garden of the leaf-cutter ant Atta colombica. Analysis of its single 4.76-Mbp chromosome will shed light on community dynamics and plant biomass degradation in ant fungus gardens. PMID:23469353

  18. Analysis of Bacterial Population and Distribution in the Developing Strata of a Constructed Wetland Used for Chlorinated Ethene Bioremediation

    DTIC Science & Technology

    2006-03-01

    proteobacterium clone AKYG1580 16S ribosomal RNA uncultured alpha proteobacterium farm soil adjacent to a silage storage AY921940 Uncultured Actinobacteria ...bacterium clone AKYG1047 16S uncultured candidate division SPAM bacterium farm soil adjacent to a silage storage AY922024 Uncultured Actinobacteria

  19. Production and characterization of biodiesel from carbon dioxide concentrating chemolithotrophic bacteria, Serratia sp. ISTD04.

    PubMed

    Bharti, Randhir K; Srivastava, Shaili; Thakur, Indu Shekhar

    2014-02-01

    A chemolithotrophic bacterium, Serratia sp. ISTD04, enriched in the chemostat in presence of sodium bicarbonate as sole carbon source was evaluated for potential of carbon dioxide (CO2) sequestration and biofuel production. CO2 sequestration efficiency of the bacterium was determined by enzymatic activity of carbonic anhydrase and ribulose-1,5-bisphosphate carboxylase/oxygenase (RuBisCO). Further, Western blot analysis confirmed presence of RuBisCO. The bacterium produced 0.487 and 0.647mgmg(-1) per unit cell dry weight of hydrocarbons and lipids respectively. The hydrocarbons were within the range of C13-C24 making it equivalent to light oil. GC-MS analysis of lipids produced by the bacterium indicated presence of C15-C20 organic compounds that made it potential source of biodiesel after transesterification. GC-MS, FTIR and NMR spectroscopic characterization of the fatty acid methyl esters revealed the presence of 55% and 45% of unsaturated and saturated organic compounds respectively, thus making it a balanced biodiesel composition. Copyright © 2013 Elsevier Ltd. All rights reserved.

  20. Thermal Stress Triggers Broad Pocillopora damicornis Transcriptomic Remodeling, while Vibrio coralliilyticus Infection Induces a More Targeted Immuno-Suppression Response

    PubMed Central

    Vidal-Dupiol, Jeremie; Dheilly, Nolwenn M.; Rondon, Rodolfo; Grunau, Christoph; Cosseau, Céline; Smith, Kristina M.; Freitag, Michael; Adjeroud, Mehdi; Mitta, Guillaume

    2014-01-01

    Global change and its associated temperature increase has directly or indirectly changed the distributions of hosts and pathogens, and has affected host immunity, pathogen virulence and growth rates. This has resulted in increased disease in natural plant and animal populations worldwide, including scleractinian corals. While the effects of temperature increase on immunity and pathogen virulence have been clearly identified, their interaction, synergy and relative weight during pathogenesis remain poorly documented. We investigated these phenomena in the interaction between the coral Pocillopora damicornis and the bacterium Vibrio coralliilyticus, for which the infection process is temperature-dependent. We developed an experimental model that enabled unraveling the effects of thermal stress, and virulence vs. non-virulence of the bacterium. The physiological impacts of various treatments were quantified at the transcriptome level using a combination of RNA sequencing and targeted approaches. The results showed that thermal stress triggered a general weakening of the coral, making it more prone to infection, non-virulent bacterium induced an ‘efficient’ immune response, whereas virulent bacterium caused immuno-suppression in its host. PMID:25259845

  1. Bacillus subtilis biofilm induction by plant polysaccharides.

    PubMed

    Beauregard, Pascale B; Chai, Yunrong; Vlamakis, Hera; Losick, Richard; Kolter, Roberto

    2013-04-23

    Bacillus subtilis is a plant-beneficial Gram-positive bacterium widely used as a biofertilizer. However, relatively little is known regarding the molecular processes underlying this bacterium's ability to colonize roots. In contrast, much is known about how this bacterium forms matrix-enclosed multicellular communities (biofilms) in vitro. Here, we show that, when B. subtilis colonizes Arabidopsis thaliana roots it forms biofilms that depend on the same matrix genes required in vitro. B. subtilis biofilm formation was triggered by certain plant polysaccharides. These polysaccharides served as a signal for biofilm formation transduced via the kinases controlling the phosphorylation state of the master regulator Spo0A. In addition, plant polysaccharides are used as a source of sugars for the synthesis of the matrix exopolysaccharide. The bacterium's response to plant polysaccharides was observed across several different strains of the species, some of which are known to have beneficial effects on plants. These observations provide evidence that biofilm genes are crucial for Arabidopsis root colonization by B. subtilis and provide insights into how matrix synthesis may be triggered by this plant.

  2. Molecular Mechanisms Contributing to the Growth and Physiology of an Extremophile Cultured with Dielectric Heating.

    PubMed

    Cusick, Kathleen D; Lin, Baochuan; Malanoski, Anthony P; Strycharz-Glaven, Sarah M; Cockrell-Zugell, Allison; Fitzgerald, Lisa A; Cramer, Jeffrey A; Barlow, Daniel E; Boyd, Thomas J; Biffinger, Justin C

    2016-10-15

    The effect of microwave frequency electromagnetic fields on living microorganisms is an active and highly contested area of research. One of the major drawbacks to using mesophilic organisms to study microwave radiation effects is the unavoidable heating of the organism, which has limited the scale (<5 ml) and duration (<1 h) of experiments. However, the negative effects of heating a mesophile can be mitigated by employing thermophiles (organisms able to grow at temperatures of >60°C). This study identified changes in global gene expression profiles during the growth of Thermus scotoductus SA-01 at 65°C using dielectric (2.45 GHz, i.e., microwave) heating. RNA sequencing was performed on cultures at 8, 14, and 24 h after inoculation to determine the molecular mechanisms contributing to long-term cellular growth and survival under microwave heating conditions. Over the course of growth, genes associated with amino acid metabolism, carbohydrate metabolism, and defense mechanisms were upregulated; the number of repressed genes with unknown function increased; and at all time points, transposases were upregulated. Genes involved in cell wall biogenesis and elongation were also upregulated, consistent with the distinct elongated cell morphology observed after 24 h using microwave heating. Analysis of the global differential gene expression data enabled the identification of molecular processes specific to the response of T. scotoductus SA-01 to dielectric heating during growth. The residual heating of living organisms in the microwave region of the electromagnetic spectrum has complicated the identification of radiation-only effects using microorganisms for 50 years. A majority of the previous experiments used either mature cells or short exposure times with low-energy high-frequency radiation. Using global differential gene expression data, we identified molecular processes unique to dielectric heating using Thermus scotoductus SA-01 cultured over 30 h in a commercial microwave digestor. Genes associated with amino acid metabolism, carbohydrate metabolism, and defense mechanisms were upregulated; the number of repressed genes with unknown function increased; and at all time points, transposases were upregulated. These findings serve as a platform for future studies with mesophiles in order to better understand the response of microorganisms to microwave radiation. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  3. Bacterium-Induced CXCL10 Secretion by Osteoblasts Can Be Mediated in Part through Toll-Like Receptor 4

    PubMed Central

    Gasper, Nancy A.; Petty, Cynthia C.; Schrum, Laura W.; Marriott, Ian; Bost, Kenneth L.

    2002-01-01

    Two common pathogens known to cause bone infection, Salmonella and Staphylococcus aureus, were investigated to determine their abilities to induce chemokine expression in cultured mouse and human osteoblasts. While these cells are responsible for bone formation, we were surprised to find that they could respond to bacterial infection by upregulating expression of the chemokine CXCL10 (IP-10). However, there were significant differences in the abilities of the gram-negative bacterium Salmonella and the gram-positive bacterium S. aureus to induce expression of CXCL10. Reverse transcription-PCR and enzyme-linked immunosorbent assay analyses showed high levels of Salmonella-induced CXCL10 mRNA and protein expression, respectively, whereas the osteoblast response to S. aureus was significantly less. Consistent with these findings, Salmonella-derived lipopolysaccharide (LPS), but not S. aureus-derived peptidoglycan, could induce expression of CXCL10. An antibody against toll-like receptor 4 (TLR4) could block the LPS-induced CXCL10 production, demonstrating the functional expression of TLR4 by osteoblasts. Despite the inducible nature of TLR2 mRNA expression by bacterium-infected osteoblasts, peptidoglycan failed to stimulate CXCL10 secretion. Immunofluorescent staining of bacterium-infected calvaria (i.e., skull bone) demonstrated the presence of CXCL10 in osteoblasts. The fact that osteoblasts did not express CXCR3 mRNA, whereas T lymphocytes can express high levels of this receptor, suggests that osteoblast-derived CXCL10 may recruit T lymphocytes to the sites of bone infections. PMID:12117914

  4. Development of multiplex polymerase chain reaction assay for simultaneous detection of clostero-, badna- and mandari-viruses along with huanglongbing bacterium in citrus trees.

    PubMed

    Meena, Ram Prasnna; Baranwal, V K

    2016-09-01

    Citrus trees harbor a large number of viral and bacterial pathogens. Citrus yellow vein clearing virus (CYVCV), Indian citrus ringspot virus (ICRSV), Citrus yellow mosaic virus (CYMV), Citrus tristeza virus (CTV) and a bacterium, Candidatus Liberibacter asiaticus (CLa) associated with huanglongbing (HLB) disease, the most prevalent pathogens in citrus orchards of different regions in India and are responsible for debilitating citriculture. For detection of these viral and bacterial pathogens a quick, sensitive and cost effective detection method is required. With this objective a multiplex polymerase chain reaction (mPCR) assay was developed for simultaneous detection of four viruses and a bacterium in citrus. Several sets of primers were designed for each virus based on the retrieved reference sequences from the GenBank. A primer pair published previously was used for greening bacterium. Each pair of primers was evaluated for their sensitivity and differentiation by simplex and mPCR. The constant amplified products were identified on the basis of molecular size in mPCR and were compared with standard PCR. The amplicons were cloned and results were confirmed with sequencing analysis. The mPCR assay was validated using naturally infected field samples for one or more citrus viruses and the huanglongbing bacterium. The mPCR assay developed here will aid in the production of virus free planting materials and rapid indexing for certification of citrus budwood programme. Copyright © 2016 Elsevier B.V. All rights reserved.

  5. Hexavalent chromium reduction potential of Cellulosimicrobium sp. isolated from common effluent treatment plant of tannery industries.

    PubMed

    Bharagava, Ram Naresh; Mishra, Sandhya

    2018-01-01

    Present study deals with the isolation and characterization of a bacterium capable for the effective reduction of Cr(VI) from tannery wastewater. Based on the 16S rRNA gene sequence analysis, this bacterium was identified as Cellulosimicrobium sp. (KX710177). During the Cr(VI) reduction experiment performed at 50, 100, 200,and 300mg/L of Cr(VI) concentrations, the bacterium showed 99.33% and 96.98% reduction at 50 and 100mg/L at 24 and 96h, respectively. However, at 200 and 300mg/L concentration of Cr(VI), only 84.62% and 62.28% reduction was achieved after 96h, respectively. The SEM analysis revealed that bacterial cells exposed to Cr(VI) showed increased cell size in comparison to unexposed cells, which might be due to either the precipitation or adsorption of reduced Cr(III) on bacterial cells. Further, the Energy Dispersive X-ray (EDX) analysis showed some chromium peaks for cells exposed to Cr(VI), which might be either due to the presence of precipitated reduced Cr(III) on cells or complexation of Cr(III) with cell surface molecules. The bacterium also showed resistance and sensitivity against the tested antibiotics with a wide range of MIC values ranging from 250 to 800mg/L for different heavy metals. Thus, this multi-drug and multi-metal resistant bacterium can be used as a potential agent for the effective bioremediation of metal contaminated sites. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. A Comparative biochemical study on two marine endophytes, Bacterium SRCnm and Bacillus sp. JS, Isolated from red sea algae.

    PubMed

    Ahmed, Eman Fadl; Hassan, Hossam Mokhtar; Rateb, Mostafa Ezzat; Abdel-Wahab, Noha; Sameer, Somayah; Aly Taie, Hanan Anwar; Abdel-Hameed, Mohammed Sayed; Hammouda, Ola

    2016-01-01

    Two marine endophytic bacteria were isolated from the Red Sea algae; a red alga; Acanthophora dendroides and the brown alga Sargassum sabrepandum. The isolates were identified based on their 16SrRNA sequences as Bacterium SRCnm and Bacillus sp. JS. The objective of this study was to investigate the potential anti-microbial and antioxidant activities of the extracts of the isolated bacteria grown in different nutrient conditions. Compared to amoxicillin (25μg/disk) and erythromycin (15μg/disk), the extracts of Bacterium SRCn min media II, III, IV and V were potent inhibitors of the gram-positive bacterium Sarcina maxima even at low concentrations. Also, the multidrug resistant Staphylococcus aureus(MRSA) was more sensitive to the metabolites produced in medium (II) of the same endophyte than erythromycin (15μg/disk). A moderate activity of the Bacillus sp. JS extracts of media I and II was obtained against the same pathogen. The total compounds (500ug/ml) of both isolated endophytes showed moderate antioxidant activities (48.9% and 46.1%, respectively). LC/MS analysis of the bacterial extracts was carried out to investigate the likely natural products produced. Cyclo(D-cis-Hyp-L-Leu), dihydrosphingosine and 2-Amino-1,3-hexadecanediol were identified in the fermentation medium of Bacterium SRCnm, whereas cyclo (D-Pro-L-Tyr) and cyclo (L-Leu-L-Pro) were the suggested compounds of Bacillus sp. JS.

  7. Fate of Escherichia coli O157:H7 on Fresh-Cut Apple Tissue and Its Potential for Transmission by Fruit Flies

    PubMed Central

    Janisiewicz, W. J.; Conway, W. S.; Brown, M. W.; Sapers, G. M.; Fratamico, P.; Buchanan, R. L.

    1999-01-01

    Pathogenic Escherichia coli O157:H7, as well as nonpathogenic strains ATCC 11775 and ATCC 23716, grew exponentially in wounds on Golden Delicious apple fruit. The exponential growth occurred over a longer time period on fruit inoculated with a lower concentration of the bacterium than on fruit inoculated with a higher concentration. The bacterium reached the maximum population supported in the wounds regardless of the initial inoculum concentrations. Populations of E. coli O157:H7 in various concentrations of sterilized apple juice and unsterilized cider declined over time and declined more quickly in diluted juice and cider. The decline was greater in the unsterilized cider than in juice, which may have resulted from the interaction of E. coli O157:H7 with natural populations of yeasts that increased with time. Experiments on the transmission of E. coli by fruit flies, collected from a compost pile of decaying apples and peaches, were conducted with strain F-11775, a fluorescent transformant of nonpathogenic E. coli ATCC 11775. Fruit flies were easily contaminated externally and internally with E. coli F-11775 after contact with the bacterium source. The flies transmitted this bacterium to uncontaminated apple wounds, resulting in a high incidence of contaminated wounds. Populations of the bacterium in apple wounds increased significantly during the first 48 h after transmission. Further studies under commercial conditions are necessary to confirm these findings. PMID:9872751

  8. Strategies used by helicobacter pylori to establish persistent infection

    PubMed Central

    Abadi, Amin Talebi Bezmin

    2017-01-01

    Helicobacter pylori (H. pylori) is a Gram-negative and motile bacterium that colonizes the hostile microniche of the human stomach, then persists for the host’s entire life, if not effectively treated. Clinically, H. pylori plays a causative role in the development of a wide spectrum of diseases including chronic active gastritis, peptic ulceration, gastric adenocarcinoma, and gastric mucosa-associated lymphoid tissue lymphoma. Due to the global distribution of H. pylori, it is no exaggeration to conclude that smart strategies are contributing to adaptation of the bacterium to its permanent host. Thirty-four years after the discovery of this bacterium, there are still many unanswered questions. For example, which strategies help the bacterium to survive in this inhospitable microniche? This question is slightly easier to answer if we presume the same clinical concept for both persistent infection and disease. Understanding the mechanisms governing H. pylori persistence will improve identification of the increased risk of diseases such as gastric cancer in patients infected with this bacterium. A well-defined and long-term equilibrium between the human host and H. pylori allows bacterial persistence in the gastric microniche; although this coexistence leads to a high risk of severe diseases such as gastric cancer. To escape the bactericidal activity of stomach acid, H. pylori secretes large amounts of surface-associated and cytosolic urease. The potential to avoid acidic conditions and immune evasion are discussed in order to explain the persistence of H. pylori colonization in the gastric mucosa, and data on bacterial genetic diversity are included. Information on the mechanisms related to H. pylori persistence can also provide the direction for future research concerning effective therapy and management of gastroduodenal disorders. The topics presented in the current review are important for elucidating the strategies used by H. pylori to help the bacterium persist in relation to the immune system and the many unfavorable features of living in the gastric microniche. PMID:28522905

  9. Studying the Symbiotic Bacterium Xenorhabdus nematophila in Individual, Living Steinernema carpocapsae Nematodes Using Microfluidic Systems.

    PubMed

    Stilwell, Matthew D; Cao, Mengyi; Goodrich-Blair, Heidi; Weibel, Douglas B

    2018-01-01

    Animal-microbe symbioses are ubiquitous in nature and scientifically important in diverse areas, including ecology, medicine, and agriculture. Steinernema nematodes and Xenorhabdus bacteria compose an established, successful model system for investigating microbial pathogenesis and mutualism. The bacterium Xenorhabdus nematophila is a species-specific mutualist of insect-infecting Steinernema carpocapsae nematodes. The bacterium colonizes a specialized intestinal pocket within the infective stage of the nematode, which transports the bacteria between insects that are killed and consumed by the pair for reproduction. Current understanding of the interaction between the infective-stage nematode and its bacterial colonizers is based largely on population-level, snapshot time point studies on these organisms. This limitation arises because investigating temporal dynamics of the bacterium within the nematode is impeded by the difficulty of isolating and maintaining individual living nematodes and tracking colonizing bacterial cells over time. To overcome this challenge, we developed a microfluidic system that enables us to spatially isolate and microscopically observe individual, living Steinernema nematodes and monitor the growth and development of the associated X. nematophila bacterial communities-starting from a single cell or a few cells-over weeks. Our data demonstrate, to our knowledge, the first direct, temporal, in vivo visual analysis of a symbiosis system and the application of this system to reveal continuous dynamics of the symbiont population in the living host animal. IMPORTANCE This paper describes an experimental system for directly investigating population dynamics of a symbiotic bacterium, Xenorhabdus nematophila , in its host-the infective stage of the entomopathogenic nematode Steinernema carpocapsae . Tracking individual and groups of bacteria in individual host nematodes over days and weeks yielded insight into dynamic growth and topology changes of symbiotic bacterial populations within infective juvenile nematodes. Our approach for studying symbioses between bacteria and nematodes provides a system to investigate long-term host-microbe interactions in individual nematodes and extrapolate the lessons learned to other bacterium-animal interactions.

  10. 78 FR 66751 - Office of Science Policy, Office of Biotechnology Activities; Recombinant or Synthetic Nucleic...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-11-06

    ... aeruginosa Bacteria belonging to the genus Pseudomonas are ubiquitous in the environment. They are generally...-wear contact lenses'' ( http://www.cdc.gov/hai/organisms/pseudomonas.html ). Because this bacterium... OBA will add it to Appendix B as an RG2 bacterium. This is consistent with other assessments of the RG...

  11. Draft Genome Sequence of Limnobacter sp. Strain CACIAM 66H1, a Heterotrophic Bacterium Associated with Cyanobacteria

    PubMed Central

    da Silva, Fábio Daniel Florêncio; Lima, Alex Ranieri Jerônimo; Moraes, Pablo Henrique Gonçalves; Siqueira, Andrei Santos; Dall’Agnol, Leonardo Teixeira; Baraúna, Anna Rafaella Ferreira; Martins, Luisa Carício; Oliveira, Karol Guimarães; de Lima, Clayton Pereira Silva; Nunes, Márcio Roberto Teixeira; Vianez-Júnior, João Lídio Silva Gonçalves

    2016-01-01

    Ecological interactions between cyanobacteria and heterotrophic prokaryotes are poorly known. To improve the genomic studies of heterotrophic bacterium-cyanobacterium associations, the draft genome sequence (3.2 Mbp) of Limnobacter sp. strain CACIAM 66H1, found in a nonaxenic culture of Synechococcus sp. (cyanobacteria), is presented here. PMID:27198027

  12. Draft Genome Sequence of Aquitalea magnusonii Strain H3, a Plant Growth-Promoting Bacterium of Duckweed (Lemna minor)

    PubMed Central

    Ishizawa, Hidehiro; Kuroda, Masashi

    2017-01-01

    ABSTRACT Aquitalea magnusonii strain H3 is a promising plant growth-promoting bacterium for duckweed. Here, we report the draft genome sequence of strain H3 comprising 4,750,601 bp in 73 contigs. Several genes associated with plant root colonization were identified. PMID:28818906

  13. Draft Genome Sequence of Aquitalea magnusonii Strain H3, a Plant Growth-Promoting Bacterium of Duckweed (Lemna minor).

    PubMed

    Ishizawa, Hidehiro; Kuroda, Masashi; Ike, Michihiko

    2017-08-17

    Aquitalea magnusonii strain H3 is a promising plant growth-promoting bacterium for duckweed. Here, we report the draft genome sequence of strain H3 comprising 4,750,601 bp in 73 contigs. Several genes associated with plant root colonization were identified. Copyright © 2017 Ishizawa et al.

  14. Diversity of the citrus HLB bacterium, ‘Candidatus Liberibacter asiaticus’, in psyllids (Diaphorina citri) collected from Murraya paniculata and citrus spp. in Thailand

    USDA-ARS?s Scientific Manuscript database

    ‘Candidatus Liberibacter asiaticus’ (Las) is a phloem inhabiting bacterium that causes huanglongbing disease (HLB), also known as citrus greening associated with three species of a-Proteobacteria in the genus ‘Candidatus Liberibacter sp’. Prophage is an important genetic element of bacterial genomes...

  15. Overproduction of Hydrogen From an Anaerobic Bacterium

    DTIC Science & Technology

    2008-12-01

    fixation of nitrogen ( Haber - Bosch process), mostly to produce fertilizer. Nitrogenase provides a catalytic alternative to the commercial fixation of...the culture and suggests a uniquely simple hydrogen reactor design based on renewable feedstocks. 1. INTRODUCTION Hydrogen is an ideal... renewable feedstocks. Clostridium phytofermentans is a recently- discovered anaerobic bacterium, reported to possess cellulase enzymes that degrade

  16. Spleen size and plasma levels of mannose binding lectin in channel catfish Ictalurus punctatus families exhibiting different susceptibilities to Flavobacterium columnare and Edwardsiella ictaluri

    USDA-ARS?s Scientific Manuscript database

    Two major problems in the channel catfish (Ictalurus punctatus) aquaculture industry have been high disease losses to enteric septicemia of catfish (ESC), caused by the bacterium Edwardsiella ictaluri and columnaris disease, caused by the bacterium Flavobacterium columnare. Methods to control these...

  17. Genome Sequence of the Algicidal Bacterium Kordia algicida OT-1 ▿

    PubMed Central

    Lee, Hyun Sook; Kang, Sung Gyun; Kwon, Kae Kyoung; Lee, Jung-Hyun; Kim, Sang-Jin

    2011-01-01

    Kordia algicida OT-1 is an algicidal bacterium against the bloom-forming microalgae. The genome sequence of K. algicida revealed a number of interesting features, including the degradation of macromolecules, the biosynthesis of carotenoid pigment and secondary metabolites, and the capacity for gliding motility, which might facilitate the understanding of algicidal mechanisms. PMID:21622754

  18. Draft Genome Sequence of a Bacillus Bacterium from the Atacama Desert Wetlands Metagenome

    PubMed Central

    Vilo, Claudia; Galetovic, Alexandra; Araya, Jorge E.; Dong, Qunfeng

    2015-01-01

    We report here the draft genome sequence of a Bacillus bacterium isolated from the microflora of Nostoc colonies grown at the Andean wetlands in northern Chile. We consider this genome sequence to be a molecular tool for exploring microbial relationships and adaptation strategies to the prevailing extreme conditions at the Atacama Desert. PMID:26294639

  19. Genome Sequence of Pseudomonas sp. Strain S9, an Extracellular Arylsulfatase-Producing Bacterium Isolated from Mangrove Soil ▿

    PubMed Central

    Long, Mengxian; Ruan, Lingwei; Yu, Ziniu; Xu, Xun

    2011-01-01

    Pseudomonas sp. strain S9 was originally isolated from mangrove soil in Xiamen, China. It is an aerobic bacterium which shows extracellular arylsulfatase activity. Here, we describe the 4.8-Mb draft genome sequence of Pseudomonas sp. S9, which exhibits novel cysteine-type sulfatases. PMID:21622746

  20. Draft Genome Sequence of the 2-Chloro-4-Nitrophenol-Degrading Bacterium Arthrobacter sp. Strain SJCon

    PubMed Central

    Vikram, Surendra; Kumar, Shailesh; Vaidya, Bhumika; Pinnaka, Anil Kumar

    2013-01-01

    We report the 4.39-Mb draft genome sequence of the 2-chloro-4-nitrophenol-degrading bacterium Arthrobacter sp. strain SJCon, isolated from a pesticide-contaminated site. The draft genome sequence of strain SJCon will be helpful in studying the genetic pathways involved in the degradation of several aromatic compounds. PMID:23516196

  1. Partial heterologous protection against Glässer’s disease in pigs colonized with an avirulent isolate of Haemophilus parasuis

    USDA-ARS?s Scientific Manuscript database

    Haemophilus parasuis is a Gram-negative bacterium belonging to the Pasteurellaceae family. This bacterium can exist as a commensal in the upper respiratory tract in swine, but can also cause pneumonia and can systemically invade causing Glässer’s disease, which is characterized by polyserositis, men...

  2. Genome Sequence of Sphingobium indicum B90A, a Hexachlorocyclohexane-Degrading Bacterium

    PubMed Central

    Anand, Shailly; Sangwan, Naseer; Lata, Pushp; Kaur, Jasvinder; Dua, Ankita; Singh, Amit Kumar; Verma, Mansi; Kaur, Jaspreet; Khurana, Jitendra P.; Khurana, Paramjit; Mathur, Saloni

    2012-01-01

    Sphingobium indicum B90A, an efficient degrader of hexachlorocyclohexane (HCH) isomers, was isolated in 1990 from sugarcane rhizosphere soil in Cuttack, India. Here we report the draft genome sequence of this bacterium, which has now become a model system for understanding the genetics, biochemistry, and physiology of HCH degradation. PMID:22843598

  3. A new species of Proteus isolated from larvae of the gypsy moth, Porthetria dispar (L.)

    Treesearch

    B.J. Cosenza; J.D. Podgwaite

    1966-01-01

    Characteristics of a slime-producing bacterium isolated from living and dead gypsy moth larvae were determined. The bacterium was found to be a motile, gram-negative rod, which fermented glucose, but not lactose. It was oxidase-negative, hydrolyzed urea, deaminated phenylalanine and produced H2S. These characteristics are common to several...

  4. Complete Genome Sequence of the Thermophilic Bacterium Geobacillus thermoleovorans CCB_US3_UF5

    PubMed Central

    Abdul Rahman, Ahmad Yamin; Saito, Jennifer A.; Hou, Shaobin

    2012-01-01

    Geobacillus thermoleovorans CCB_US3_UF5 is a thermophilic bacterium isolated from a hot spring in Malaysia. Here, we report the complete genome of G. thermoleovorans CCB_US3_UF5, which shows high similarity to the genome of Geobacillus kaustophilus HTA 426 in terms of synteny and orthologous genes. PMID:22328744

  5. Expression of a Clostridium perfringens genome-encoded putative N-acetylmuramoyl-L-alanine amidase as a potential antimicrobial to control the bacterium

    USDA-ARS?s Scientific Manuscript database

    Clostridium perfringens is a Gram-positive, spore-forming anaerobic bacterium that plays a substantial role in non-foodborne human, animal and avian diseases as well as human foodborne disease. Previously discovered C. perfringens bacteriophage lytic enzyme amino acid sequences were utilized to iden...

  6. Draft Genome Sequence of a Pseudomonas aeruginosa NA04 Bacterium Isolated from an Entomopathogenic Nematode.

    PubMed

    Salgado-Morales, Rosalba; Rivera-Gómez, Nancy; Lozano-Aguirre Beltrán, Luis Fernando; Hernández-Mendoza, Armando; Dantán-González, Edgar

    2017-09-07

    We report the draft genome sequence of Gram-negative bacterium Pseudomonas aeruginosa NA04, isolated from the entomopathogenic nematode Heterorhabditis indica MOR03. The draft genome consists of 54 contigs, a length of 6.37 Mb, and a G+C content 66.49%. Copyright © 2017 Salgado-Morales et al.

  7. Draft Genome Sequence of the Efficient Bioflocculant-Producing Bacterium Paenibacillus sp. Strain A9

    PubMed Central

    Liu, Jin-liang; Hu, Xiao-min

    2013-01-01

    Paenibacillus sp. strain A9 is an important bioflocculant-producing bacterium, isolated from a soil sample, and is pale pink-pigmented, aerobic, and Gram-positive. Here, we report the draft genome sequence and the initial findings from a preliminary analysis of strain A9, which is a novel species of Paenibacillus. PMID:23618713

  8. Remediation of TCE-contaminated groundwater using nanocatalyst and bacteria.

    PubMed

    Kang, Ser Ku; Seo, Hyunhee; Sun, Eunyoung; Kim, Inseon; Roh, Yul

    2011-08-01

    The objective of this study was to develop and evaluate the remediation of trichloroethene (TCE)-contaminated groundwater using both a nanocatalyst (bio-Zn-magnetite) and bacterium (similar to Clostridium quinii) in anoxic environments. Of the 7 nanocatalysts tested, bio-Zn-magnetite showed the highest TCE dechlorination efficiency, with an average of ca. 90% within 8 days in a batch experiment. The column tests confirmed that the application of bio-Zn-magnetite in combination with the bacterium achieved high degradation efficiency (ca. 90%) of TCE within 5 days compared to the nanocatalyst only, which degraded only 30% of the TCE. These results suggest that the application of a nanocatalyst and the bacterium have potential for the remediation of TCE-contaminated groundwater in subsurface environments.

  9. Characterization of Actinomyces Isolates from Infected Root Canals of Teeth: Description of Actinomyces radicidentis sp. nov.

    PubMed Central

    Collins, Matthew D.; Hoyles, Lesley; Kalfas, Sotos; Sundquist, Goran; Monsen, Tor; Nikolaitchouk, Natalia; Falsen, Enevold

    2000-01-01

    Two strains of a previously undescribed Actinomyces-like bacterium were recovered in pure culture from infected root canals of teeth. Analysis by biochemical testing and polyacrylamide gel electrophoresis of whole-cell proteins indicated that the strains closely resembled each other phenotypically but were distinct from previously described Actinomyces and Arcanobacterium species. Comparative 16S rRNA gene-sequencing studies showed the bacterium to be a hitherto unknown subline within a group of Actinomyces species which includes Actinomyces bovis, the type species of the genus. Based on phylogenetic and phenotypic evidence, we propose that the unknown bacterium isolated from human clinical specimens be classified as Actinomyces radicidentis sp. nov. The type strain of Actinomyces radicidentis is CCUG 36733. PMID:10970390

  10. Corynebacterium riegelii sp. nov., an Unusual Species Isolated from Female Patients with Urinary Tract Infections

    PubMed Central

    Funke, Guido; Lawson, Paul A.; Collins, Matthew D.

    1998-01-01

    Four strains of an unknown coryneform bacterium were isolated in pure culture from females with urinary tract infections. Strong urease activity and the ability to slowly ferment maltose but not glucose were the most significant phenotypic features of this catalase-positive, nonmotile, nonlipophilic, rod-shaped bacterium which served to distinguish it from all other presently defined coryneform bacteria. Chemotaxonomic investigations demonstrated that the unknown bacterium belonged to the genus Corynebacterium. Comparative 16S rRNA gene sequence analysis revealed that the isolates were genealogically identical and represented a new subline within the genus Corynebacterium, for which the designation Corynebacterium riegelii sp. nov. is proposed. The type strain of Corynebacterium riegelii is CCUG 38180 (DSM 44326, CIP 105310). PMID:9508284

  11. In Situ Gene Expression Responsible for Sulfide Oxidation and CO2 Fixation of an Uncultured Large Sausage-Shaped Aquificae Bacterium in a Sulfidic Hot Spring

    PubMed Central

    Tamazawa, Satoshi; Yamamoto, Kyosuke; Takasaki, Kazuto; Mitani, Yasuo; Hanada, Satoshi; Kamagata, Yoichi; Tamaki, Hideyuki

    2016-01-01

    We investigated the in situ gene expression profile of sulfur-turf microbial mats dominated by an uncultured large sausage-shaped Aquificae bacterium, a key metabolic player in sulfur-turfs in sulfidic hot springs. A reverse transcription-PCR analysis revealed that the genes responsible for sulfide, sulfite, and thiosulfate oxidation and carbon fixation via the reductive TCA cycle were continuously expressed in sulfur-turf mats taken at different sampling points, seasons, and years. These results suggest that the uncultured large sausage-shaped bacterium has the ability to grow chemolithoautotrophically and plays key roles as a primary producer in the sulfidic hot spring ecosystem in situ. PMID:27297893

  12. Carbohydrase Systems of Saccharophagus degradans Degrading Marine Complex Polysaccharides

    PubMed Central

    Hutcheson, Steven W.; Zhang, Haitao; Suvorov, Maxim

    2011-01-01

    Saccharophagus degradans 2–40 is a γ-subgroup proteobacterium capable of using many of the complex polysaccharides found in the marine environment for growth. To utilize these complex polysaccharides, this bacterium produces a plethora of carbohydrases dedicated to the processing of a carbohydrate class. Aiding in the identification of the contributing genes and enzymes is the known genome sequence for this bacterium. This review catalogs the genes and enzymes of the S. degradans genome that are likely to function in the systems for the utilization of agar, alginate, α- and β-glucans, chitin, mannans, pectins, and xylans and discusses the cell biology and genetics of each system as it functions to transfer carbon back to the bacterium. PMID:21731555

  13. Burkholderia vietnamiensis isolated from root tissues of Nipa Palm (Nypa fruticans) in Sarawak, Malaysia, proved to be its major endophytic nitrogen-fixing bacterium.

    PubMed

    Tang, Sui-Yan; Hara, Shintaro; Melling, Lulie; Goh, Kah-Joo; Hashidoko, Yasuyuki

    2010-01-01

    Root-associating bacteria of the nipa palm (Nypa fruticans), preferring brackish-water affected mud in Sarawak, Malaysia, were investigated. In a comparison of rhizobacterial microbiota between the nipa and the sago (Metroxylon sagu) palm, it was found that the nipa palm possessed a group of Burkholderia vietnamiensis as its main active nitrogen-fixing endophytic bacterium. Acetylene reduction by the various isolates of B. vietnamiensis was constant (44 to 68 nmol h(-1) in ethylene production rate) in soft gel medium containing 0.2% sucrose as sole carbon source, and the bacterium also showed motility and biofilm-forming capacity. This is the first report of endophytic nitrogen-fixing bacteria from nipa palm.

  14. In Situ Gene Expression Responsible for Sulfide Oxidation and CO2 Fixation of an Uncultured Large Sausage-Shaped Aquificae Bacterium in a Sulfidic Hot Spring.

    PubMed

    Tamazawa, Satoshi; Yamamoto, Kyosuke; Takasaki, Kazuto; Mitani, Yasuo; Hanada, Satoshi; Kamagata, Yoichi; Tamaki, Hideyuki

    2016-06-25

    We investigated the in situ gene expression profile of sulfur-turf microbial mats dominated by an uncultured large sausage-shaped Aquificae bacterium, a key metabolic player in sulfur-turfs in sulfidic hot springs. A reverse transcription-PCR analysis revealed that the genes responsible for sulfide, sulfite, and thiosulfate oxidation and carbon fixation via the reductive TCA cycle were continuously expressed in sulfur-turf mats taken at different sampling points, seasons, and years. These results suggest that the uncultured large sausage-shaped bacterium has the ability to grow chemolithoautotrophically and plays key roles as a primary producer in the sulfidic hot spring ecosystem in situ.

  15. 'Cand. Actinochlamydia clariae' gen. nov., sp. nov., a unique intracellular bacterium causing epitheliocystis in catfish (Clarias gariepinus) in Uganda.

    PubMed

    Steigen, Andreas; Nylund, Are; Karlsbakk, Egil; Akoll, Peter; Fiksdal, Ingrid U; Nylund, Stian; Odong, Robinson; Plarre, Heidrun; Semyalo, Ronald; Skår, Cecilie; Watanabe, Kuninori

    2013-01-01

    Epitheliocystis, caused by bacteria infecting gill epithelial cells in fish, is common among a large range of fish species in both fresh- and seawater. The aquaculture industry considers epitheliocystis an important problem. It affects the welfare of the fish and the resulting gill disease may lead to mortalities. In a culture facility in Kampala, Uganda, juveniles of the African sharptooth catfish (Clarias gariepinus) was observed swimming in the surface, sometimes belly up, showing signs of respiratory problems. Histological examination of gill tissues from this fish revealed large amounts of epitheliocysts, and also presence of a few Ichthyobodo sp. and Trichodina sp. Sequencing of the epitheliocystis bacterium 16S rRNA gene shows 86.3% similarity with Candidatus Piscichlamydia salmonis causing epitheliocystis in Atlantic salmon (Salmo salar). Transmission electron microscopy showed that the morphology of the developmental stages of the bacterium is similar to that of members of the family Chlamydiaceae. The similarity of the bacterium rRNA gene sequences compared with other chlamydia-like bacteria ranged between 80.5% and 86.3%. Inclusions containing this new bacterium have tubules/channels (termed actinae) that are radiating from the inclusion membrane and opening on the cell surface or in neighbouring cells. Radiation of tubules/channels (actinae) from the inclusion membrane has never been described in any of the other members of Chlamydiales. It seems to be a completely new character and an apomorphy. We propose the name Candidatus Actinochlamydia clariae gen. nov., sp. nov. (Actinochlamydiaceae fam. nov., order Chlamydiales, phylum Chlamydiae) for this new agent causing epitheliocystis in African sharptooth catfish.

  16. Sexual Transmission of a Plant Pathogenic Bacterium, Candidatus Liberibacter asiaticus, between Conspecific Insect Vectors during Mating

    PubMed Central

    Mann, Rajinder S.; Pelz-Stelinski, Kirsten; Hermann, Sara L.; Tiwari, Siddharth; Stelinski, Lukasz L.

    2011-01-01

    Candidatus Liberibacter asiaticus is a fastidious, phloem-inhabiting, gram-negative bacterium transmitted by Asian citrus psyllid, Diaphorina citri Kuwayama (Hemiptera: Psyllidae). The bacterium is the presumed causal agent of huanglongbing (HLB), one of the most destructive and economically important diseases of citrus. We investigated whether Las is transmitted between infected and uninfected D. citri adults during courtship. Our results indicate that Las was sexually transmitted from Las-infected male D. citri to uninfected females at a low rate (<4%) during mating. Sexual transmission was not observed following mating of infected females and uninfected males or among adult pairs of the same sex. Las was detected in genitalia of both sexes and also in eggs of infected females. A latent period of 7 days or more was required to detect the bacterium in recipient females. Rod shaped as well as spherical structures resembling Las were observed in ovaries of Las-infected females with transmission electron microscopy, but were absent in ovaries from uninfected D. citri females. The size of the rod shaped structures varied from 0.39 to 0.67 µm in length and 0.19 to 0.39 µm in width. The spherical structures measured from 0.61 to 0.80 µm in diameter. This investigation provides convincing evidence that a plant pathogenic bacterium is sexually transmitted from male to female insects during courtship and established evidence that bacteria persist in reproductive organs. Moreover, these findings provide an alternative sexually horizontal mechanism for the spread of Las within populations of D. citri, even in the absence of infected host trees. PMID:22216209

  17. Lipid transfer proteins and protease inhibitors as key factors in the priming of barley responses to Fusarium head blight disease by a biocontrol strain of Pseudomonas fluorescens.

    PubMed

    Petti, Carloalberto; Khan, Mojibur; Doohan, Fiona

    2010-11-01

    Strains of non-pathogenic pseudomonad bacteria, can elicit host defence responses against pathogenic microorganisms. Pseudomonas fluorescens strain MKB158 can protect cereals from pathogenesis by Fusarium fungi, including Fusarium head blight which is an economically important disease due to its association with both yield loss and mycotoxin contamination of grain. Using the 22 K barley Affymetrix chip, trancriptome studies were undertaken to determine the local effect of P. fluorescens strain MKB158 on the transcriptome of barley head tissue, and to discriminate transcripts primed by the bacterium to respond to challenge by Fusarium culmorum, a causal agent of the economically important Fusarium head blight disease of cereals. The bacterium significantly affected the accumulation of 1203 transcripts and primed 74 to positively, and 14 to negatively, respond to the pathogen (P = 0.05). This is the first study to give insights into bacterium priming in the Triticeae tribe of grasses and associated transcripts were classified into 13 functional classes, associated with diverse functions, including detoxification, cell wall biosynthesis and the amplification of host defence responses. In silico analysis of Arabidopsis homologs of bacterium-primed barley genes indicated that, as is the case in dicots, jasmonic acid plays a role in pseudomonad priming of host responses. Additionally, the transcriptome studies described herein also reveal new insights into bacterium-mediated priming of host defences against necrotrophs, including the positive effects on grain filling, lignin deposition, oxidative stress responses, and the inhibition of protease inhibitors and proteins that play a key role in programmed cell death.

  18. Phenotypic and genotypic properties of Microbacterium yannicii, a recently described multidrug resistant bacterium isolated from a lung transplanted patient with cystic fibrosis in France.

    PubMed

    Sharma, Poonam; Diene, Seydina M; Thibeaut, Sandrine; Bittar, Fadi; Roux, Véronique; Gomez, Carine; Reynaud-Gaubert, Martine; Rolain, Jean-Marc

    2013-05-03

    Cystic fibrosis (CF) lung microbiota consists of diverse species which are pathogens or opportunists or have unknown pathogenicity. Here we report the full characterization of a recently described multidrug resistant bacterium, Microbacterium yannicii, isolated from a CF patient who previously underwent lung transplantation. Our strain PS01 (CSUR-P191) is an aerobic, rod shaped, non-motile, yellow pigmented, gram positive, oxidase negative and catalase positive bacterial isolate. Full length 16S rRNA gene sequence showed 98.8% similarity with Microbacterium yannicii G72T type strain, which was previously isolated from Arabidopsis thaliana. The genome size is 3.95Mb, with an average G+C content of 69.5%. In silico DNA-DNA hybridization analysis between our Microbacterium yannicii PS01isolate in comparison with Microbacterium testaceum StLB037 and Microbacterium laevaniformans OR221 genomes revealed very weak relationship with only 28% and 25% genome coverage, respectively. Our strain, as compared to the type strain, was resistant to erythromycin because of the presence of a new erm 43 gene encoding a 23S rRNA N-6-methyltransferase in its genome which was not detected in the reference strain. Interestingly, our patient received azithromycin 250 mg daily for bronchiolitis obliterans syndrome for more than one year before the isolation of this bacterium. Although significance of isolating this bacterium remains uncertain in terms of clinical evolution, this bacterium could be considered as an opportunistic human pathogen as previously reported for other species in this genus, especially in immunocompromised patients.

  19. Draft Genome Sequence of Limnobacter sp. Strain CACIAM 66H1, a Heterotrophic Bacterium Associated with Cyanobacteria.

    PubMed

    da Silva, Fábio Daniel Florêncio; Lima, Alex Ranieri Jerônimo; Moraes, Pablo Henrique Gonçalves; Siqueira, Andrei Santos; Dall'Agnol, Leonardo Teixeira; Baraúna, Anna Rafaella Ferreira; Martins, Luisa Carício; Oliveira, Karol Guimarães; de Lima, Clayton Pereira Silva; Nunes, Márcio Roberto Teixeira; Vianez-Júnior, João Lídio Silva Gonçalves; Gonçalves, Evonnildo Costa

    2016-05-19

    Ecological interactions between cyanobacteria and heterotrophic prokaryotes are poorly known. To improve the genomic studies of heterotrophic bacterium-cyanobacterium associations, the draft genome sequence (3.2 Mbp) of Limnobacter sp. strain CACIAM 66H1, found in a nonaxenic culture of Synechococcus sp. (cyanobacteria), is presented here. Copyright © 2016 da Silva et al.

  20. Draft Genome Sequence of Acinetobacter calcoaceticus Strain P23, a Plant Growth-Promoting Bacterium of Duckweed

    PubMed Central

    Hosoyama, Akira; Yamazoe, Atsushi; Morikawa, Masaaki

    2015-01-01

    Acinetobacter calcoaceticus strain P23 is a plant growth-promoting bacterium, which was isolated from the surface of duckweed. We report here the draft genome sequence of strain P23. The genome data will serve as a valuable reference for understanding the molecular mechanism of plant growth promotion in aquatic plants. PMID:25720680

  1. Complete Genome Sequence of Spiroplasma floricola 23-6T (ATCC 29989), a Bacterium Isolated from a Tulip Tree (Liriodendron tulipifera L.).

    PubMed

    Tsai, Yi-Ming; Wu, Pei-Shan; Lo, Wen-Sui; Kuo, Chih-Horng

    2018-04-19

    Spiroplasma floricola 23-6 T (ATCC 29989) was isolated from the flower surface of a tulip tree ( Liriodendron tulipifera L.). Here, we report the complete genome sequence of this bacterium to facilitate the investigation of its biology and the comparative genomics among Spiroplasma species. Copyright © 2018 Tsai et al.

  2. Nucleotide sequences specific to Francisella tularensis and methods for the detection of Francisella tularensis

    DOEpatents

    McCready, Paula M [Tracy, CA; Radnedge, Lyndsay [San Mateo, CA; Andersen, Gary L [Berkeley, CA; Ott, Linda L [Livermore, CA; Slezak, Thomas R [Livermore, CA; Kuczmarski, Thomas A [Livermore, CA; Vitalis, Elizabeth A [Livermore, CA

    2007-02-06

    Described herein is the identification of nucleotide sequences specific to Francisella tularensis that serves as a marker or signature for identification of this bacterium. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

  3. Nucleotide sequences specific to Francisella tularensis and methods for the detection of Francisella tularensis

    DOEpatents

    McCready, Paula M [Tracy, CA; Radnedge, Lyndsay [San Mateo, CA; Andersen, Gary L [Berkeley, CA; Ott, Linda L [Livermore, CA; Slezak, Thomas R [Livermore, CA; Kuczmarski, Thomas A [Livermore, CA; Vitalis, Elizabeth A [Livermore, CA

    2009-02-24

    Described herein is the identification of nucleotide sequences specific to Francisella tularensis that serves as a marker or signature for identification of this bacterium. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

  4. A novel molecular diagnostic tool for improved sensitivity and reliability detection of “Candidatus Liberibacter asiaticus”, bacterium associated with huanglongbing (HLB) bacterium Candidatus Liberibacter.

    USDA-ARS?s Scientific Manuscript database

    Sensitive and accurate detection is a prerequisite for efficient management and regulatory responses to prevent the introduction and spread of HLB-associated “Candidatus Liberibacter species to unaffected areas. To improve the current detection limit of HLB-associated “Ca. Liberibacter” spp, we deve...

  5. Complete genome sequence of Pseudoalteromononas piscicida strain DE2-B, a bacterium with broad inhibitory activity toward human and fish pathogens

    USDA-ARS?s Scientific Manuscript database

    Pseudoalteromonas piscicida strain DE2-B is a halophilic bacterium which has broad inhibitory activity toward vibrios and other human and fish pathogens. We report the first closed genome sequence for this species which consists of two chromosomes (4,128,210 and 1,188,838 bp). Annotation revealed ...

  6. Genome Sequence of the Enterobacter mori Type Strain, LMG 25706, a Pathogenic Bacterium of Morus alba L. ▿

    PubMed Central

    Zhu, Bo; Zhang, Guo-Qing; Lou, Miao-Miao; Tian, Wen-Xiao; Li, Bin; Zhou, Xue-Ping; Wang, Guo-Feng; Liu, He; Xie, Guan-Lin; Jin, Gu-Lei

    2011-01-01

    Enterobacter mori is a plant-pathogenic enterobacterium responsible for the bacterial wilt of Morus alba L. Here we present the draft genome sequence of the type strain, LMG 25706. To the best of our knowledge, this is the first genome sequence of a plant-pathogenic bacterium in the genus Enterobacter. PMID:21602328

  7. Whole-genome sequence of Cupriavidus sp. strain BIS7, a heavy-metal-resistant bacterium.

    PubMed

    Hong, Kar Wai; Thinagaran, Dinaiz al; Gan, Han Ming; Yin, Wai-Fong; Chan, Kok-Gan

    2012-11-01

    Cupriavidus sp. strain BIS7 is a Malaysian tropical soil bacterium that exhibits broad heavy-metal resistance [Co(II), Zn(II), Ni(II), Se(IV), Cu(II), chromate, Co(III), Fe(II), and Fe(III)]. It is particularly resistant to Fe(II), Fe(III), and Zn(II). Here we present the assembly and annotation of its genome.

  8. Aerobic mineralization of vinyl chloride by a bacterium of the order Actinomycetales.

    PubMed Central

    Phelps, T J; Malachowsky, K; Schram, R M; White, D C

    1991-01-01

    A gram-positive branched bacterium isolated from a trichloroethylene-degrading consortium mineralized vinyl chloride in growing cultures and cell suspensions. Greater than 67% of the [1,2-14C]vinyl chloride was mineralized to carbon dioxide, with approximately 10% of the radioactivity appearing in cell biomass and another 10% appearing in 14C-aqueous-phase products. PMID:1905522

  9. Draft Genome Sequence of Bacillus amyloliquefaciens EBL11, a New Strain of Plant Growth-Promoting Bacterium Isolated from Rice Rhizosphere

    PubMed Central

    Wang, Yinghuan; Greenfield, Paul; Jin, Decai

    2014-01-01

    Bacillus amyloliquefaciens strain EBL11 is a bacterium that can promote plant growth by inhibiting the growth of fungi on plant surfaces and providing nutrients as a nonchemical biofertilizer. The estimated genome of this strain is 4.05 Mb in size and harbors 3,683 coding genes (CDSs). PMID:25059875

  10. Draft Genome Sequence of Lactobacillus paracasei DmW181, a Bacterium Isolated from Wild Drosophila.

    PubMed

    Hammer, Austin J; Walters, Amber; Carroll, Courtney; Newell, Peter D; Chaston, John M

    2017-07-06

    The draft genome sequence of Lactobacillus paracasei DmW181, an anaerobic bacterium isolate from wild Drosophila flies, is reported here. Strain DmW181 possesses genes for sialic acid and mannose metabolism. The assembled genome is 3,201,429 bp, with 3,454 predicted genes. Copyright © 2017 Hammer et al.

  11. Quantitative analysis of growth and volatile fatty acid production by the anaerobic ruminal bacterium Megasphaera elsdenii T81

    USDA-ARS?s Scientific Manuscript database

    Megaspheara elsdenii T81 grew on either DL-lactate or D-glucose at similar rates (0.85 per h), but displayed major differences in the fermentation of these substrates. Lactate was fermented at up to 210-mM concentration to yield acetic, propionic, butyric, and valeric acids. The bacterium was able t...

  12. Formulations of the endophytic bacterium Bacillus subtilis Tu-100 suppress Sclerotinia sclerotiorum on oilseed rape and improve plant vigor in field trials conducted at separate locations

    USDA-ARS?s Scientific Manuscript database

    Sclerotinia sclerotiorum causes serious yield losses in crops in The People’s Republic of China. Two formulations of oilseed rape seed containing the endophytic bacterium Bacillus subtilis Tu-100 were evaluated for suppression of this pathogen in field trials conducted at two independent locations....

  13. Complete genome sequence of the bioleaching bacterium Leptospirillum sp. group II strain CF-1.

    PubMed

    Ferrer, Alonso; Bunk, Boyke; Spröer, Cathrin; Biedendieck, Rebekka; Valdés, Natalia; Jahn, Martina; Jahn, Dieter; Orellana, Omar; Levicán, Gloria

    2016-03-20

    We describe the complete genome sequence of Leptospirillum sp. group II strain CF-1, an acidophilic bioleaching bacterium isolated from an acid mine drainage (AMD). This work provides data to gain insights about adaptive response of Leptospirillum spp. to the extreme conditions of bioleaching environments. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. Characterization of bacteriophages virulent for Clostridium perfringens and identification of phage lytic enzymes as alternatives to antibiotics for potential control of the bacterium

    USDA-ARS?s Scientific Manuscript database

    There has been a resurgent interest in the use of bacteriophages or their gene products to control bacterial pathogens as alternatives to currently utilized antibiotics. Clostridium perfringens is a Gram-positive, spore-forming anaerobic bacterium that plays a significant role in human food-borne di...

  15. Characterization of bacteriophages virulent for Clostridium perfringens and identification of phage lytic enzymes as alternatives to antibiotics for potential control of the bacterium

    USDA-ARS?s Scientific Manuscript database

    There has been a resurgent interest in the use of bacteriophages or their gene products to control bacterial pathogens as alternatives to currently utilized antibiotics. Clostridium perfringens is a Gram-positive, spore-forming anaerobic bacterium that plays a significant role in human food-borne d...

  16. Complete Genome Sequence of Nitrosomonas cryotolerans ATCC 49181, a Phylogenetically Distinct Ammonia-Oxidizing Bacterium Isolated from Arctic Waters

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rice, Marlen C.; Norton, Jeanette M.; Stein, Lisa Y.

    ABSTRACT Nitrosomonas cryotoleransATCC 49181 is a cold-tolerant marine ammonia-oxidizing bacterium isolated from seawater collected in the Gulf of Alaska. The high-quality complete genome contains a 2.87-Mbp chromosome and a 56.6-kbp plasmid. Chemolithoautotrophic modules encoding ammonia oxidation and CO 2 fixation were identified.

  17. Complete Genome Sequence of Alkaliphilus metalliredigens QYMF, an Alkaliphilic and Metal-Reducing Bacterium Isolated from Borax-contaminated Leachate Ponds

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hwang, C.; Copeland, A.; Lucas, Susan

    Alkaliphilus metalliredigens QYMF is an anaerobic, alkaliphilic, and metal-reducing bacterium associated with phylum Firmicutes. QYMF was isolated from alkaline borax leachate ponds. The genome sequence will help elucidate the role of metal-reducing microorganisms under alkaline environments, a capability that is not commonly observed in metal respiring-microorganisms.

  18. Complete Genome Sequence of the Naphthalene-Degrading Bacterium Pseudomonas stutzeri AN10 (CCUG 29243)

    PubMed Central

    Brunet-Galmés, Isabel; Busquets, Antonio; Peña, Arantxa; Gomila, Margarita; Nogales, Balbina; García-Valdés, Elena; Lalucat, Jorge; Bennasar, Antonio

    2012-01-01

    Pseudomonas stutzeri AN10 (CCUG 29243) can be considered a model strain for aerobic naphthalene degradation. We report the complete genome sequence of this bacterium. Its 4.71-Mb chromosome provides insights into other biodegradative capabilities of strain AN10 (i.e., benzoate catabolism) and suggests a high number of horizontal gene transfer events. PMID:23144395

  19. Draft Genome Sequence and Description of Janthinobacterium sp. Strain CG3, a Psychrotolerant Antarctic Supraglacial Stream Bacterium

    PubMed Central

    Smith, Heidi; Akiyama, Tatsuya; Franklin, Michael; Woyke, Tanja; Teshima, Hazuki; Davenport, Karen; Daligault, Hajnalka; Erkkila, Tracy; Goodwin, Lynne; Gu, Wei; Xu, Yan; Chain, Patrick

    2013-01-01

    Here we present the draft genome sequence of Janthinobacterium sp. strain CG3, a psychrotolerant non-violacein-producing bacterium that was isolated from the Cotton Glacier supraglacial stream. The genome sequence of this organism will provide insight as to the mechanisms necessary for bacteria to survive in UV-stressed icy environments. PMID:24265494

  20. Draft Genome Sequence of Burkholderia gladioli Coa14, a Bacterium with Petroleum Bioremediation Potential Isolated from Coari Lake, Amazonas, Brazil

    PubMed Central

    Da Costa, Josemar Gurgel; Wolf, Ivan Rodrigo; Lima, José Paulo de Araújo; Astolfi-Filho, Spartaco

    2018-01-01

    ABSTRACT Burkholderia gladioli Coa14 is a bacterium isolated from water collected from Coari Lake (Amazonas, Brazil) that shows a capacity for survival in a medium containing only oil as a carbon source. Here, we report its draft genome sequence, highlighting some genes involved with petroleum derivative degradation. PMID:29674552

  1. Five new amicoumacins isolated from a marine-derived bacterium Bacillus subtilis.

    PubMed

    Li, Yongxin; Xu, Ying; Liu, Lingli; Han, Zhuang; Lai, Pok Yui; Guo, Xiangrong; Zhang, Xixiang; Lin, Wenhan; Qian, Pei-Yuan

    2012-02-01

    Four novel amicoumacins, namely lipoamicoumacins A-D (1-4), and one new bacilosarcin analog (5) were isolated from culture broth of a marine-derived bacterium Bacillus subtilis, together with six known amicoumacins. Their structures were elucidated on the basis of extensive spectroscopic (2D NNR, IR, CD and MS) analysis and in comparison with data in literature.

  2. Draft Genome Sequence of the Obligately Alkaliphilic Sulfate-Reducing Bacterium Desulfonatronum thiodismutans Strain MLF1

    PubMed Central

    Trubitsyn, Denis; Geurink, Corey; Pikuta, Elena; Lefèvre, Christopher T.; McShan, W. Michael; Gillaspy, Allison F.

    2014-01-01

    Desulfonatronum thiodismutans strain MLF1, an alkaliphilic bacterium capable of sulfate reduction, was isolated from Mono Lake, California. Here we report the 3.92-Mb draft genome sequence comprising 34 contigs and some results of its automated annotation. These data will improve our knowledge of mechanisms by which bacteria withstand extreme environments. PMID:25081260

  3. Complete Genome Sequence of Alkaliphilus metalliredigens QYMF, an Alkaliphilic and Metal-Reducing Bacterium Isolated from Borax-contaminated Leachate Ponds

    DOE PAGES

    Hwang, C.; Copeland, A.; Lucas, Susan; ...

    2016-11-03

    Alkaliphilus metalliredigens QYMF is an anaerobic, alkaliphilic, and metal-reducing bacterium associated with phylum Firmicutes. QYMF was isolated from alkaline borax leachate ponds. The genome sequence will help elucidate the role of metal-reducing microorganisms under alkaline environments, a capability that is not commonly observed in metal respiring-microorganisms.

  4. Draft Genome Sequence of Chryseobacterium sp. Strain GSE06, a Biocontrol Endophytic Bacterium Isolated from Cucumber (Cucumis sativus)

    PubMed Central

    Jeong, Jin-Ju; Park, Byeong Hyeok; Park, Hongjae

    2016-01-01

    Chryseobacterium sp. strain GSE06 is a biocontrol endophytic bacterium against the destructive soilborne oomycete Phytophthora capsici, which causes Phytophthora blight of pepper. Here, we present its draft genome sequence, which contains genes related to biocontrol traits, such as colonization, antimicrobial activity, plant growth promotion, and abiotic or biotic stress adaptation. PMID:27313310

  5. Complete Genome Sequence of Nitrosomonas cryotolerans ATCC 49181, a Phylogenetically Distinct Ammonia-Oxidizing Bacterium Isolated from Arctic Waters

    DOE PAGES

    Rice, Marlen C.; Norton, Jeanette M.; Stein, Lisa Y.; ...

    2017-03-16

    ABSTRACT Nitrosomonas cryotoleransATCC 49181 is a cold-tolerant marine ammonia-oxidizing bacterium isolated from seawater collected in the Gulf of Alaska. The high-quality complete genome contains a 2.87-Mbp chromosome and a 56.6-kbp plasmid. Chemolithoautotrophic modules encoding ammonia oxidation and CO 2 fixation were identified.

  6. Performance and mechanism of standard nano-TiO2(P-25) in photocatalytic disinfection of foodborne microorganisms - salmonella typhimurium and listeria monocytogenes

    USDA-ARS?s Scientific Manuscript database

    In this paper, effects of disinfection by nano-TiO2 were studied on the two typical foodborne microorganisms, Gram-negative bacterium Salmonella typhimurium and Gram-positive bacterium-Listeria monocytogenes, in meat products. The performance of nano-TiO2 against the foodborne pathogens was evaluate...

  7. Biofilm Formation by a Metabolically Versatile Bacterium

    DTIC Science & Technology

    2005-10-02

    Rhodopseudomonas palustris is a photosynthetic bacterium that has good potential to be developed as a biocatalyst for the production of hydrogen, a...A for none) Samanta, S. K and C. S. Harwood. 2005. Use of the Rhodopseudomonas palustris genome to identify a single amino acid that contributes to...operon from Rhodopseudomonas palustris mediates dicarboxylic acid degradation and participates in anaerobic benzoate degradation. Microbiology 151

  8. Draft Genome Sequence of Pontibacter sp. nov. BAB1700, a Halotolerant, Industrially Important Bacterium

    PubMed Central

    Joshi, M. N.; Sharma, A. C.; Pandya, R. V.; Patel, R. P.; Saiyed, Z. M.; Saxena, A. K.

    2012-01-01

    Pontibacter sp. nov. BAB1700 is a halotolerant, Gram-negative, rod-shaped, pink-pigmented, menaquinone-7-producing bacterium isolated from sediments of a drilling well. The draft genome sequence of the strain, consisting of one chromosome of 4.5 Mb, revealed vital gene clusters involved in vitamin biosynthesis and resistance against various metals and antibiotics. PMID:23105068

  9. Hypersensitive response and acyl‐homoserine lactone production of the fire blight antagonists Erwinia tasmaniensis and Erwinia billingiae

    PubMed Central

    Jakovljevic, Vladimir; Jock, Susanne; Du, Zhiqiang; Geider, Klaus

    2008-01-01

    Summary Fire blight caused by the Gram‐negative bacterium Erwinia amylovora can be controlled by antagonistic microorganisms. We characterized epiphytic bacteria isolated from healthy apple and pear trees in Australia, named Erwinia tasmaniensis, and the epiphytic bacterium Erwinia billingiae from England for physiological properties, interaction with plants and interference with growth of E. amylovora. They reduced symptom formation by the fire blight pathogen on immature pears and the colonization of apple flowers. In contrast to E. billingiae, E. tasmaniensis strains induced a hypersensitive response in tobacco leaves and synthesized levan in the presence of sucrose. With consensus primers deduced from lsc as well as hrpL, hrcC and hrcR of the hrp region of E. amylovora and of related bacteria, these genes were successfully amplified from E. tasmaniensis DNA and alignment of the encoded proteins to other Erwinia species supported a role for environmental fitness of the epiphytic bacterium. Unlike E. tasmaniensis, the epiphytic bacterium E. billingiae produced an acyl‐homoserine lactone for bacterial cell‐to‐cell communication. Their competition with the growth of E. amylovora may be involved in controlling fire blight. PMID:21261861

  10. Enhancement of Survival and Electricity Production in an Engineered Bacterium by Light-Driven Proton Pumping▿ †

    PubMed Central

    Johnson, Ethan T.; Baron, Daniel B.; Naranjo, Belén; Bond, Daniel R.; Schmidt-Dannert, Claudia; Gralnick, Jeffrey A.

    2010-01-01

    Microorganisms can use complex photosystems or light-dependent proton pumps to generate membrane potential and/or reduce electron carriers to support growth. The discovery that proteorhodopsin is a light-dependent proton pump that can be expressed readily in recombinant bacteria enables development of new strategies to probe microbial physiology and to engineer microbes with new light-driven properties. Here, we describe functional expression of proteorhodopsin and light-induced changes in membrane potential in the bacterium Shewanella oneidensis strain MR-1. We report that there were significant increases in electrical current generation during illumination of electrochemical chambers containing S. oneidensis expressing proteorhodopsin. We present evidence that an engineered strain is able to consume lactate at an increased rate when it is illuminated, which is consistent with the hypothesis that proteorhodopsin activity enhances lactate uptake by increasing the proton motive force. Our results demonstrate that there is coupling of a light-driven process to electricity generation in a nonphotosynthetic engineered bacterium. Expression of proteorhodopsin also preserved the viability of the bacterium under nutrient-limited conditions, providing evidence that fulfillment of basic energy needs of organisms may explain the widespread distribution of proteorhodopsin in marine environments. PMID:20453141

  11. Enhancement of survival and electricity production in an engineered bacterium by light-driven proton pumping.

    PubMed

    Johnson, Ethan T; Baron, Daniel B; Naranjo, Belén; Bond, Daniel R; Schmidt-Dannert, Claudia; Gralnick, Jeffrey A

    2010-07-01

    Microorganisms can use complex photosystems or light-dependent proton pumps to generate membrane potential and/or reduce electron carriers to support growth. The discovery that proteorhodopsin is a light-dependent proton pump that can be expressed readily in recombinant bacteria enables development of new strategies to probe microbial physiology and to engineer microbes with new light-driven properties. Here, we describe functional expression of proteorhodopsin and light-induced changes in membrane potential in the bacterium Shewanella oneidensis strain MR-1. We report that there were significant increases in electrical current generation during illumination of electrochemical chambers containing S. oneidensis expressing proteorhodopsin. We present evidence that an engineered strain is able to consume lactate at an increased rate when it is illuminated, which is consistent with the hypothesis that proteorhodopsin activity enhances lactate uptake by increasing the proton motive force. Our results demonstrate that there is coupling of a light-driven process to electricity generation in a nonphotosynthetic engineered bacterium. Expression of proteorhodopsin also preserved the viability of the bacterium under nutrient-limited conditions, providing evidence that fulfillment of basic energy needs of organisms may explain the widespread distribution of proteorhodopsin in marine environments.

  12. The genome sequence of the plant pathogen Xylella fastidiosa. The Xylella fastidiosa Consortium of the Organization for Nucleotide Sequencing and Analysis.

    PubMed

    Simpson, A J; Reinach, F C; Arruda, P; Abreu, F A; Acencio, M; Alvarenga, R; Alves, L M; Araya, J E; Baia, G S; Baptista, C S; Barros, M H; Bonaccorsi, E D; Bordin, S; Bové, J M; Briones, M R; Bueno, M R; Camargo, A A; Camargo, L E; Carraro, D M; Carrer, H; Colauto, N B; Colombo, C; Costa, F F; Costa, M C; Costa-Neto, C M; Coutinho, L L; Cristofani, M; Dias-Neto, E; Docena, C; El-Dorry, H; Facincani, A P; Ferreira, A J; Ferreira, V C; Ferro, J A; Fraga, J S; França, S C; Franco, M C; Frohme, M; Furlan, L R; Garnier, M; Goldman, G H; Goldman, M H; Gomes, S L; Gruber, A; Ho, P L; Hoheisel, J D; Junqueira, M L; Kemper, E L; Kitajima, J P; Krieger, J E; Kuramae, E E; Laigret, F; Lambais, M R; Leite, L C; Lemos, E G; Lemos, M V; Lopes, S A; Lopes, C R; Machado, J A; Machado, M A; Madeira, A M; Madeira, H M; Marino, C L; Marques, M V; Martins, E A; Martins, E M; Matsukuma, A Y; Menck, C F; Miracca, E C; Miyaki, C Y; Monteriro-Vitorello, C B; Moon, D H; Nagai, M A; Nascimento, A L; Netto, L E; Nhani, A; Nobrega, F G; Nunes, L R; Oliveira, M A; de Oliveira, M C; de Oliveira, R C; Palmieri, D A; Paris, A; Peixoto, B R; Pereira, G A; Pereira, H A; Pesquero, J B; Quaggio, R B; Roberto, P G; Rodrigues, V; de M Rosa, A J; de Rosa, V E; de Sá, R G; Santelli, R V; Sawasaki, H E; da Silva, A C; da Silva, A M; da Silva, F R; da Silva, W A; da Silveira, J F; Silvestri, M L; Siqueira, W J; de Souza, A A; de Souza, A P; Terenzi, M F; Truffi, D; Tsai, S M; Tsuhako, M H; Vallada, H; Van Sluys, M A; Verjovski-Almeida, S; Vettore, A L; Zago, M A; Zatz, M; Meidanis, J; Setubal, J C

    2000-07-13

    Xylella fastidiosa is a fastidious, xylem-limited bacterium that causes a range of economically important plant diseases. Here we report the complete genome sequence of X. fastidiosa clone 9a5c, which causes citrus variegated chlorosis--a serious disease of orange trees. The genome comprises a 52.7% GC-rich 2,679,305-base-pair (bp) circular chromosome and two plasmids of 51,158 bp and 1,285 bp. We can assign putative functions to 47% of the 2,904 predicted coding regions. Efficient metabolic functions are predicted, with sugars as the principal energy and carbon source, supporting existence in the nutrient-poor xylem sap. The mechanisms associated with pathogenicity and virulence involve toxins, antibiotics and ion sequestration systems, as well as bacterium-bacterium and bacterium-host interactions mediated by a range of proteins. Orthologues of some of these proteins have only been identified in animal and human pathogens; their presence in X. fastidiosa indicates that the molecular basis for bacterial pathogenicity is both conserved and independent of host. At least 83 genes are bacteriophage-derived and include virulence-associated genes from other bacteria, providing direct evidence of phage-mediated horizontal gene transfer.

  13. Differential gene expression in Xylella fastidiosa 9a5c during co-cultivation with the endophytic bacterium Methylobacterium mesophilicum SR1.6/6.

    PubMed

    Dourado, Manuella Nóbrega; Santos, Daiene Souza; Nunes, Luiz Roberto; Costa de Oliveira, Regina Lúcia Batista da; de Oliveira, Marcus Vinicius; Araújo, Welington Luiz

    2015-12-01

    Xylella fastidiosa, the causal agent of citrus variegated chlorosis (CVC), colonizes plant xylem, reducing sap flow, and inducing internerval chlorosis, leaf size reduction, necrosis, and harder and smaller fruits. This bacterium may be transmitted from plant to plant by sharpshooter insects, including Bucephalogonia xanthopis. The citrus endophytic bacterium Methylobacterium mesophilicum SR1.6/6 colonizes citrus xylem and previous studies showed that this strain is also transferred from plant to plant by B. xanthopis (Insecta), suggesting that this endophytic bacterium may interact with X. fastidiosa in planta and inside the insect vector during co-transmission by the same insect vector. To better understand the X. fastidiosa behavior in the presence of M. mesophilicum, we evaluated the X. fastidiosa transcriptional profile during in vitro interaction with M. mesophilicum SR1.6/6. The results showed that during co-cultivation, X. fastidiosa down-regulated genes related to growth and up-regulated genes related to energy production, stress, transport, and motility, suggesting the existence of a specific adaptive response to the presence of M. mesophilicum in the culture medium. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. The gene transfer agent-like particle of the marine phototrophic bacterium Rhodovulum sulfidophilum.

    PubMed

    Nagao, Nobuyoshi; Yamamoto, Junya; Komatsu, Hiroyuki; Suzuki, Hiromichi; Hirose, Yuu; Umekage, So; Ohyama, Takashi; Kikuchi, Yo

    2015-12-01

    Gene transfer agents (GTAs) are shaped like bacteriophage particles but have many properties that distinguish them from bacteriophages. GTAs play a role in horizontal gene transfer in nature and thus affect the evolution of prokaryotic genomes. In the course of studies on the extracellular production of designed RNAs using the marine bacterium Rhodovulum sulfidophilum , we found that this bacterium produces a GTA-like particle. The particle contains DNA fragments of 4.5 kb, which consist of randomly fragmented genomic DNA from the bacterium. This 4.5-kb DNA production was prevented while quorum sensing was inhibited. Direct observation of the particle by transmission electron microscopy revealed that the particle resembles a tailed phage and has a head diameter of about 40 nm and a tail length of about 60 nm. We also identified the structural genes for the GTA in the genome. Translated amino acid sequences and gene positions are closely related to those of the genes that encode the Rhodobacter capsulatus GTA. This is the first report of a GTA-like particle from the genus Rhodovulum . However, gene transfer activity of this particle has not yet been confirmed. The differences between this particle and other GTAs are discussed.

  15. Fine Structure and Host-Virus Relationship of a Marine Bacterium and Its Bacteriophage

    PubMed Central

    Valentine, Artrice F.; Chapman, George B.

    1966-01-01

    Valentine, Artrice F. (Georgetown University, Washington, D.C.), and George B. Chapman. Fine structure and host-virus relationship of a marine bacterium and its bacteriophage. J. Bacteriol. 92:1535–1554. 1966.—The fine structure of a gram-negative marine bacterium, Cytophaga marinoflava sp. n., has been revealed by ultrathin sectioning and electron microscopy. Stages in the morphogenesis of the bacterial virus NCMB 385, which has been shown to be highly specific for this organism, were also demonstrated in bacterial cells fixed according to the Kellenberger technique. The bacterium possessed a cell wall, cytoplasmic membrane, and nuclear and cytoplasmic regions typical of bacterial cells. Both the cell wall and the cytoplasmic membrane showed a tripartite structure, i.e., each was composed of two dense layers separated by a low-density zone. Intracytoplasmic membrane systems were also observed, especially in dividing cells and in cells in which new viruses were being formed. As many as 18 hexagonally shaped, empty phage heads (membranes only) were observed in untreated, infected bacterial cells. Phage heads, intermediate in density to empty heads and fully condensed ones, possibly representing stages in the morphological development of the virus, were also seen. Images PMID:5924277

  16. Combination of a recombinant bacterium with organonitrile-degrading and biofilm-forming capability and a positively charged carrier for organonitriles removal.

    PubMed

    Li, Chunyan; Sun, Yueling; Yue, Zhenlei; Huang, Mingyan; Wang, Jinming; Chen, Xi; An, Xuejiao; Zang, Hailian; Li, Dapeng; Hou, Ning

    2018-04-10

    The immobilization of organonitrile-degrading bacteria via the addition of biofilm-forming bacteria represents a promising technology for the treatment of organonitrile-containing wastewater, but biofilm-forming bacteria simply mixed with degrading bacteria may reduce the biodegradation efficiency. Nitrile hydratase and amidase genes, which play critical roles in organonitriles degradation, were cloned and transformed into the biofilm-forming bacterium Bacillus subtilis N4 to construct a recombinant bacterium B. subtilis N4/pHTnha-ami. Modified polyethylene carriers with positive charge was applied to promote bacterial adherence and biofilm formation. The immobilized B. subtilis N4/pHTnha-ami was resistant to organonitriles loading shocks and could remove organic cyanide ion with a initial concentration of 392.6 mg/L for 24 h in a moving bed biofilm reactor. The imputed quorum-sensing signal and the high-throughput sequencing analysis of the biofilm indicated that B. subtilis N4/pHTnha-ami was successfully immobilized and became dominant. The successful application of the immobilized recombinant bacterium offers a novel strategy for the biodegradation of recalcitrant compounds. Copyright © 2018 Elsevier B.V. All rights reserved.

  17. Dynamic analysis of fixed-free single-walled carbon nanotube-based bio-sensors because of various viruses.

    PubMed

    Gupta, A; Joshi, A Y; Sharma, S C; Harsha, S P

    2012-09-01

    In the present study, the vibrations of the fixed-free single-walled carbon nanotube (SWCNT) with attached bacterium/virus on the tip have been investigated. To explore the suitability of the SWCNT as a bacterium/virus detector device, first the various types of virus have been taken for the study and then the resonant frequencies of fixed-free SWCNT with attachment of those viruses have been simulated. These resonant frequencies are compared with the published analytical data, and it is shown that the finite element method (FEM) simulation results are in good agreement with the analytical data. The results showed the sensitivity and suitability of the SWCNT having different length and different masses (attached at the tip SWCNT) to identify the bacterium or virus.

  18. [The plant growth-promoting rhizobacterium Arthrobacter agilis UMCV2 endophytically colonizes Medicago truncatula].

    PubMed

    Aviles-Garcia, Maria Elizabeth; Flores-Cortez, Idolina; Hernández-Soberano, Christian; Santoyo, Gustavo; Valencia-Cantero, Eduardo

    Arthrobacter agilis UMCV2 is a rhizosphere bacterium that promotes legume growth by solubilization of iron, which is supplied to the plant. A second growth promotion mechanism produces volatile compounds that stimulate iron uptake activities. Additionally, A. agilis UMCV2 is capable of inhibiting the growth of phytopathogens. A combination of quantitative polymerase chain reaction and fluorescence in situ hybridization techniques were used here to detect and quantify the presence of the bacterium in the internal tissues of the legume Medicago truncatula. Our results demonstrate that A. agilis UMCV2 behaves as an endophytic bacterium of M. truncatula, particularly in environments where iron is available. Copyright © 2016 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.

  19. Clostridium difficile in Food and Animals: A Comprehensive Review.

    PubMed

    Rodriguez, C; Taminiau, B; Van Broeck, J; Delmée, M; Daube, G

    2016-01-01

    Zoonoses are infections or diseases that can be transmitted between animals and humans through direct contact, close proximity or the environment. Clostridium difficile is ubiquitous in the environment, and the bacterium is able to colonise the intestinal tract of both animals and humans. Since domestic and food animals frequently test positive for toxigenic C. difficile, even without showing any signs of disease, it seems plausible that C. difficile could be zoonotic. Therefore, animals could play an essential role as carriers of the bacterium. In addition, the presence of the spores in different meats, fish, fruits and vegetables suggests a risk of foodborne transmission. This review summarises the current available data on C. difficile in animals and foods, from when the bacterium was first described up to the present.

  20. Characterization of a novel extremely alkalophilic bacterium

    NASA Technical Reports Server (NTRS)

    Souza, K. A.; Deal, P. H.

    1977-01-01

    A new alkalophilic bacterium, isolated from a natural spring of high pH is characterized. It is a Gram-positive, non-sporulating, motile rod requiring aerobic and alkaline conditions for growth. The characteristics of this organism resemble those of the coryneform group of bacteria; however, there are no accepted genera within this group with which this organism can be closely matched. Therefore, a new genus may be warranted.

  1. Feeding Behaviors That Promote Inoculation Of Xylella fastidiosa Are Performed Less By Glassy-winged Sharpshooters on Resistant Vitis Candicans Than On Susceptible V. vinifera cv. ‘Chardonnay’

    USDA-ARS?s Scientific Manuscript database

    Development of grape varieties resistant to Pierce’s Disease, caused by the lethal bacterium Xylella fastidiosa (Xf), is considered the most sustainable, long-term solution to the disease. Grape breeders are working to develop varieties resistant to multiplication and spread of the bacterium, by in...

  2. The Production, Purification and Properties of the Biopolymer Levan Produced by the Bacterium Erwinia Herbicola

    DTIC Science & Technology

    1989-08-01

    standard and an inulin standard provided by Dr. Elwin Reese of this laboratory and a sample of levan from a different bacterium provided by the USDA.23 A...polymyxa 24 Levan standard Continuous culture Tangential Flow purified levan (this study) >■• <-■-’•«■ i-I-» r Inulin standard tu 25 Figure 5. NMR

  3. Whole-Genome Sequence of Cupriavidus sp. Strain BIS7, a Heavy-Metal-Resistant Bacterium

    PubMed Central

    Hong, Kar Wai; Thinagaran, Dinaiz a/l; Gan, Han Ming; Yin, Wai-Fong

    2012-01-01

    Cupriavidus sp. strain BIS7 is a Malaysian tropical soil bacterium that exhibits broad heavy-metal resistance [Co(II), Zn(II), Ni(II), Se(IV), Cu(II), chromate, Co(III), Fe(II), and Fe(III)]. It is particularly resistant to Fe(II), Fe(III), and Zn(II). Here we present the assembly and annotation of its genome. PMID:23115161

  4. Antimicrobial product and process

    DOEpatents

    Barrett, Karen B.

    1997-01-01

    A composition for controlling a plant disease caused by a plant pathogenic bacterium is disclosed. The composition comprises an activity for inhibiting the growth of the plant pathogenic bacterium and is extracted in an aqueous solvent from particles of malted cereal grain. The composition is used either in dry or wet form by application to plant parts, such as potato seed pieces, that are to be protected from the pathogenic bacteria.

  5. Genome Sequence of Pedobacter arcticus sp. nov., a Sea Ice Bacterium Isolated from Tundra Soil

    PubMed Central

    Yin, Ye; Yue, Guidong; Gao, Qiang; Wang, Zhiyong; Peng, Fang; Fang, Chengxiang; Yang, Xu

    2012-01-01

    Pedobacter arcticus sp. nov. was originally isolated from tundra soil collected from Ny-Ålesund, in the Arctic region of Norway. It is a Gram-negative bacterium which shows bleb-shaped appendages on the cell surface. Here, we report the draft annotated genome sequence of Pedobacter arcticus sp. nov., which belongs to the genus Pedobacter. PMID:23144423

  6. Expression of Heterogenous Arsenic Resistance Genes in the Obligately Autotrophic Biomining Bacterium Thiobacillus ferrooxidans.

    PubMed

    Peng, J B; Yan, W M; Bao, X Z

    1994-07-01

    Two arsenic-resistant plasmids were constructed and introduced into Thiobacillus ferrooxidans strains by conjugation. The plasmids with the replicon of wide-host-range plasmid RSF1010 were stable in T. ferrooxidans. The arsenic resistance genes originating from the heterotroph were expressed in this obligately autotrophic bacterium, but the promoter derived from T. ferrooxidans showed no special function in its original host.

  7. Catalytic Biomineralization of Fluorescent Calcite by the Thermophilic Bacterium Geobacillus thermoglucosidasius▿

    PubMed Central

    Yoshida, Naoto; Higashimura, Eiji; Saeki, Yuichi

    2010-01-01

    The thermophilic Geobacillus bacterium catalyzed the formation of 100-μm hexagonal crystals at 60°C in a hydrogel containing sodium acetate, calcium chloride, and magnesium sulfate. Under fluorescence microscopy, crystals fluoresced upon excitation at 365 ± 5, 480 ± 20, or 545 ± 15 nm. X-ray diffraction indicated that the crystals were magnesium-calcite in calcite-type calcium carbonate. PMID:20851984

  8. Complete Genome Sequence of Alkaliphilus metalliredigens Strain QYMF, an Alkaliphilic and Metal-Reducing Bacterium Isolated from Borax-Contaminated Leachate Ponds

    PubMed Central

    Copeland, A.; Lucas, S.; Lapidus, A.; Barry, K.; Detter, J. C.; Glavina del Rio, T.; Hammon, N.; Israni, S.; Dalin, E.; Tice, H.; Pitluck, S.; Chertkov, O.; Brettin, T.; Bruce, D.; Han, C.; Schmutz, J.; Larimer, F.; Land, M. L.; Hauser, L.; Kyrpides, N.; Mikhailova, N.; Ye, Q.; Zhou, J.; Richardson, P.; Fields, M. W.

    2016-01-01

    Alkaliphilus metalliredigens strain QYMF is an anaerobic, alkaliphilic, and metal-reducing bacterium associated with phylum Firmicutes. QYMF was isolated from alkaline borax leachate ponds. The genome sequence will help elucidate the role of metal-reducing microorganisms under alkaline environments, a capability that is not commonly observed in metal respiring-microorganisms. PMID:27811105

  9. Hydrogen Production by Co-cultures of Rhizopus oryzae and a Photosynthetic Bacterium, Rhodobacter sphaeroides RV

    NASA Astrophysics Data System (ADS)

    Asada, Yasuo; Ishimi, Katsuhiro; Nagata, Yoko; Wakayama, Tatsuki; Miyake, Jun; Kohno, Hideki

    Hydrogen production with glucose by using co-immobilized cultures of a fungus, Rhizopus oryzae NBRC5384, and a photosynthetic bacterium, Rhodobacter sphaeroides RV, in agar gels was studied. The co-immobilized cultures converted glucose to hydrogen via lactate in a high molar yield of about 8moles of hydrogen per glucose at a maximum under illuminated conditions.

  10. Characterization of Bacteriophages Virulent for Clostridium perfringens and Identification of Phage Lytic Enzymes as Alternatives to Antibiotics for Potential Control of the Bacterium

    USDA-ARS?s Scientific Manuscript database

    Clostridium perfringens is a Gram-positive, spore-forming anaerobic bacterium that plays a significant role in human food-borne disease as well as non-food-borne human, animal, and poultry diseases. There has been a resurgent interest in the use of bacteriophages or their gene products to control b...

  11. Characterization of Bacteriophages Virulent for Clostridium perfringens and Identification of Phage Lytic Enzymes as Alternatives to Antibiotics for Potential Control of the Bacterium.

    USDA-ARS?s Scientific Manuscript database

    Clostridium perfringens is a Gram-positive, spore-forming anaerobic bacterium that plays a significant role in human food-borne disease as well as non-food-borne human, animal, and poultry diseases. There has been a resurgent interest in the use of bacteriophages or their gene products to control b...

  12. Draft genome sequence of Paenisporosarcina sp. strain TG-14, a psychrophilic bacterium isolated from sediment-laden stratified basal ice from Taylor Glacier, McMurdo Dry Valleys, Antarctica.

    PubMed

    Koh, Hye Yeon; Lee, Sung Gu; Lee, Jun Hyuck; Doyle, Shawn; Christner, Brent C; Kim, Hak Jun

    2012-12-01

    The psychrophilic bacterium Paenisporosarcina sp. TG-14 was isolated from sediment-laden stratified basal ice from Taylor Glacier, McMurdo Dry Valleys, Antarctica. Here we report the draft genome sequence of this strain, which may provide useful information on the cold adaptation mechanism in extremely variable environments.

  13. Rathayibacter toxicus: how a bacterium hitches a ride on a nematode to invade grass seeds and produce a toxin harmful to livestock

    USDA-ARS?s Scientific Manuscript database

    Rathayibacter toxicus is a forage grass associated Gram-positive bacterium of major concern to food safety and agriculture. This species is listed by USDA-APHIS as a plant pathogen select agent because it produces a tunicamycin-like toxin that is lethal to livestock and may be vectored by nematode s...

  14. Draft Genome Sequence of Caenibacillus caldisaponilyticus B157T, a Thermophilic and Phospholipase-Producing Bacterium Isolated from Acidulocompost

    PubMed Central

    Tsujimoto, Yoshiyuki; Saito, Ryo; Sahara, Takehiko; Kimura, Nobutada; Tsuruoka, Naoki; Shigeri, Yasushi

    2017-01-01

    ABSTRACT Caenibacillus caldisaponilyticus B157T (= NBRC 111400T = DSM 101100T), in the family Sporolactobacillaceae, was isolated from acidulocompost as a thermophilic and phospholipid-degrading bacterium. Here, we report the 3.36-Mb draft genome sequence, with a G+C content of 51.8%, to provide the genetic information coding for phospholipases. PMID:28360164

  15. Draft genome sequence of a strictly anaerobic dichloromethane-degrading bacterium

    DOE PAGES

    Kleindienst, Sara; Higgins, Steven A.; Tsementzi, Despina; ...

    2016-03-03

    Here, an anaerobic, dichloromethane-degrading bacterium affiliated with novel Peptococcaceae was maintained in a microbial consortium. The organism originated from pristine freshwater sediment collected from Rio Mameyes in Luquillo, Puerto Rico, in October 2009 (latitude 18°21'43.9", longitude –65°46'8.4"). The draft genome sequence is 2.1 Mb and has a G+C content of 43.5%.

  16. Invasive Species - A Threat to the Homeland?

    DTIC Science & Technology

    2003-04-07

    sharpshooter, an invasive insect that hosts the bacterium Xylella Fastidiosa . The insect was first detected in California in 1990. Although it is...uncertain how it arrived in California, it is believed to have arrived on plants imported from an infected area. The bacterium Xylella Fastidiosa causes...United States may modify the genetics of an invasive species to increase its competitiveness, virulence , lethality, or resistance to control measures

  17. Draft Genome Sequence of the Obligately Alkaliphilic Sulfate-Reducing Bacterium Desulfonatronum thiodismutans Strain MLF1.

    PubMed

    Trubitsyn, Denis; Geurink, Corey; Pikuta, Elena; Lefèvre, Christopher T; McShan, W Michael; Gillaspy, Allison F; Bazylinski, Dennis A

    2014-07-31

    Desulfonatronum thiodismutans strain MLF1, an alkaliphilic bacterium capable of sulfate reduction, was isolated from Mono Lake, California. Here we report the 3.92-Mb draft genome sequence comprising 34 contigs and some results of its automated annotation. These data will improve our knowledge of mechanisms by which bacteria withstand extreme environments. Copyright © 2014 Trubitsyn et al.

  18. Draft Genome Sequence of the Extremely Halophilic Bacterium Halomonas salina Strain CIFRI1, Isolated from the East Coast of India

    PubMed Central

    Das, Priyanka; Maharana, Jitendra; Paria, Prasenjit; Mandal, Shambhu Nath; Meena, Dharmendra Kumar; Sharma, Anil Prakash; Jayarajan, Rijith; Dixit, Vishal; Verma, Ankit; Vellarikkal, Shamsudheen Karuthedath; Scaria, Vinod; Sivasubbu, Sridhar; Rao, Atmakuri Ramakrishna; Mohapatra, Trilochan

    2015-01-01

    Halomonas salina strain CIFRI1 is an extremely salt-stress-tolerant bacterium isolated from the salt crystals of the east coast of India. Here we report the annotated 3.45-Mb draft genome sequence of strain CIFRI1 having 86 contigs with 3,139 protein coding loci, including 62 RNA genes. PMID:25573926

  19. Response to comments on "A bacterium that can grow using arsenic instead of phosphorus"

    USGS Publications Warehouse

    Wolfe-Simon, Felisa; Blum, Jodi Switzer; Kulp, Thomas R.; Gordon, Gwyneth W.; Hoeft, Shelley E.; Pett-Ridge, Jennifer; Stolz, John F.; Webb, Samuel M.; Weber, Peter K.; Davies, Paul C.W.; Anbar, Ariel D.; Oremland, Ronald S.

    2011-01-01

    Concerns have been raised about our recent study suggesting that arsenic (As) substitutes for phosphorus in major biomolecules of a bacterium that tolerates extreme As concentrations. We welcome the opportunity to better explain our methods and results and to consider alternative interpretations. We maintain that our interpretation of As substitution, based on multiple congruent lines of evidence, is viable.

  20. Draft Genome Sequence of Lactobacillus delbrueckii subsp. bulgaricus CFL1, a Lactic Acid Bacterium Isolated from French Handcrafted Fermented Milk.

    PubMed

    Meneghel, Julie; Dugat-Bony, Eric; Irlinger, Françoise; Loux, Valentin; Vidal, Marie; Passot, Stéphanie; Béal, Catherine; Layec, Séverine; Fonseca, Fernanda

    2016-03-03

    Lactobacillus delbrueckii subsp. bulgaricus (L. bulgaricus) is a lactic acid bacterium widely used for the production of yogurt and cheeses. Here, we report the genome sequence of L. bulgaricus CFL1 to improve our knowledge on its stress-induced damages following production and end-use processes. Copyright © 2016 Meneghel et al.

  1. Draft Genome Sequence of Burkholderia gladioli Coa14, a Bacterium with Petroleum Bioremediation Potential Isolated from Coari Lake, Amazonas, Brazil.

    PubMed

    Lopes, Eraldo Ferreira; Da Costa, Josemar Gurgel; Wolf, Ivan Rodrigo; Lima, José Paulo de Araújo; Astolfi-Filho, Spartaco

    2018-04-19

    Burkholderia gladioli Coa14 is a bacterium isolated from water collected from Coari Lake (Amazonas, Brazil) that shows a capacity for survival in a medium containing only oil as a carbon source. Here, we report its draft genome sequence, highlighting some genes involved with petroleum derivative degradation. Copyright © 2018 Lopes et al.

  2. Complete Genome Sequence of the Endophytic Bacterium Burkholderia sp. Strain KJ006

    PubMed Central

    Kwak, Min-Jung; Song, Ju Yeon; Kim, Seon-Young; Jeong, Haeyoung; Kang, Sung Gyun; Kim, Byung Kwon; Kwon, Soon-Kyeong; Lee, Choong Hoon; Yu, Dong Su

    2012-01-01

    Endophytes live inside plant tissues without causing any harm and may even benefit plants. Here, we provide the high-quality genome sequence of Burkholderia sp. strain KJ006, an endophytic bacterium of rice with antifungal activity. The 6.6-Mb genome, consisting of three chromosomes and a single plasmid, contains genes related to plant growth promotion or degradation of aromatic compounds. PMID:22843575

  3. Draft genome sequence of Inquilinus limosus strain MP06, a multidrug-resistant clinical isolate

    PubMed Central

    Pino, Marylú; Conza, José Di; Gutkind, Gabriel

    2015-01-01

    The bacterium, Inquilinus limosus, with its remarkable antimicrobial multiresistant profile, has increasingly been isolated in cystic fibrosis patients. We report draft genome sequence of a strain MP06, which is of considerable interest in elucidating the associated mechanisms of antibiotic resistance in this bacterium and for an insight about its persistence in airways of these patients. PMID:26691451

  4. Processing of cellulosic material by a cellulase-containing cell-free fermentate produced from cellulase-producing bacteria, ATCC 55702

    DOEpatents

    Dees, H.C.

    1998-08-04

    Bacteria which produce large amounts of a cellulase-containing cell-free fermentate, have been identified. The original bacterium (ATCC 55703) was genetically altered using nitrosoguanidine (MNNG) treatment to produce the enhanced cellulase degrading bacterium ATCC 55702, which was identified through replicate plating. ATCC 55702 has improved characteristics and qualities for the degradation of cellulosic materials. 5 figs.

  5. Processing of cellulosic material by a cellulase-containing cell-free fermentate produced from cellulase-producing bacteria, ATCC 55702

    DOEpatents

    Dees, H. Craig

    1998-01-01

    Bacteria which produce large amounts of a cellulase-containing cell-free fermentate, have been identified. The original bacterium (ATCC 55703) was genetically altered using nitrosoguanidine (MNNG) treatment to produce the enhanced cellulase degrading bacterium ATCC 55702, which was identified through replicate plating. ATCC 55702 has improved characteristics and qualities for the degradation of cellulosic materials.

  6. Complete genome sequence of the xylan-degrading subseafloor bacterium Microcella alkaliphila JAM-AC0309.

    PubMed

    Kurata, Atsushi; Hirose, Yuu; Misawa, Naomi; Wakazuki, Sachiko; Kishimoto, Noriaki; Kobayashi, Tohru

    2016-03-10

    Here we report the complete genome sequence of Microcella alkaliphila JAM-AC0309, which was newly isolated from the deep subseafloor core sediment from offshore of the Shimokita Peninsula of Japan. An array of genes related to utilization of xylan in this bacterium was identified by whole genome analysis. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. Draft Genome Sequence of the Sulfate-Reducing Bacterium Desulfotomaculum copahuensis Strain CINDEFI1 Isolated from the Geothermal Copahue System, Neuquén, Argentina

    PubMed Central

    Yaakop, Amira Suriaty; Chan, Chia Sing; Urbieta, M. Sofía; Ee, Robson; Tan-Guan-Sheng, Adrian; Donati, Edgardo R.

    2016-01-01

    Desulfotomaculum copahuensis strain CINDEFI1 is a novel spore-forming sulfate-reducing bacterium isolated from the Copahue volcano area, Argentina. Here, we present its draft genome in which we found genes related with the anaerobic respiration of sulfur compounds similar to those present in the Copahue environment. PMID:27540078

  8. Draft Genome Sequence of Acinetobacter calcoaceticus Strain GK1, a Hydrocarbon-Degrading Plant Growth-Promoting Rhizospheric Bacterium.

    PubMed

    Gkorezis, Panagiotis; Bottos, Eric M; Van Hamme, Jonathan D; Franzetti, Andrea; Abbamondi, Gennaro Roberto; Balseiro-Romero, Maria; Weyens, Nele; Rineau, Francois; Vangronsveld, Jaco

    2015-08-13

    The 3.94-Mb draft genome of Acinetobacter calcoaceticus GK1, a hydrocarbonoclastic plant growth-promoting Gram-negative rhizospheric bacterium, is presented here. Isolated at the Ford Motor Company site in Genk, Belgium, from poplar trees planted on a diesel-contaminated plume, GK1 is useful for enhancing hydrocarbon phytoremediation. Copyright © 2015 Gkorezis et al.

  9. Auxin as a player in the biocontrol of Fusarium head blight disease of barley and its potential as a disease control agent.

    PubMed

    Petti, Carloalberto; Reiber, Kathrin; Ali, Shahin S; Berney, Margaret; Doohan, Fiona M

    2012-11-22

    Mechanisms involved in the biological control of plant diseases are varied and complex. Hormones, including the auxin indole acetic acid (IAA) and abscisic acid (ABA), are essential regulators of a multitude of biological functions, including plant responses to biotic and abiotic stressors. This study set out to determine what hormones might play a role in Pseudomonas fluorescens -mediated control of Fusarium head blight (FHB) disease of barley and to determine if biocontrol-associated hormones directly affect disease development. A previous study distinguished bacterium-responsive genes from bacterium-primed genes, distinguished by the fact that the latter are only up-regulated when both P. fluorescens and the pathogen Fusarium culmorum are present. In silico analysis of the promoter sequences available for a subset of the bacterium-primed genes identified several hormones, including IAA and ABA as potential regulators of transcription. Treatment with the bacterium or pathogen resulted in increased IAA and ABA levels in head tissue; both microbes had additive effects on the accumulation of IAA but not of ABA. The microbe-induced accumulation of ABA preceded that of IAA. Gene expression analysis showed that both hormones up-regulated the accumulation of bacterium-primed genes. But IAA, more than ABA up-regulated the transcription of the ABA biosynthesis gene NCED or the signalling gene Pi2, both of which were previously shown to be bacterium-responsive rather than primed. Application of IAA, but not of ABA reduced both disease severity and yield loss caused by F. culmorum, but neither hormone affect in vitro fungal growth. Both IAA and ABA are involved in the P. fluorescens-mediated control of FHB disease of barley. Gene expression studies also support the hypothesis that IAA plays a role in the primed response to F. culmorum. This hypothesis was validated by the fact that pre-application of IAA reduced both symptoms and yield loss asssociated with the disease. This is the first evidence that IAA plays a role in the control of FHB disease and in the bacterial priming of host defences.

  10. Auxin as a player in the biocontrol of Fusarium head blight disease of barley and its potential as a disease control agent

    PubMed Central

    2012-01-01

    Background Mechanisms involved in the biological control of plant diseases are varied and complex. Hormones, including the auxin indole acetic acid (IAA) and abscisic acid (ABA), are essential regulators of a multitude of biological functions, including plant responses to biotic and abiotic stressors. This study set out to determine what hormones might play a role in Pseudomonas fluorescens –mediated control of Fusarium head blight (FHB) disease of barley and to determine if biocontrol-associated hormones directly affect disease development. Results A previous study distinguished bacterium-responsive genes from bacterium-primed genes, distinguished by the fact that the latter are only up-regulated when both P. fluorescens and the pathogen Fusarium culmorum are present. In silico analysis of the promoter sequences available for a subset of the bacterium-primed genes identified several hormones, including IAA and ABA as potential regulators of transcription. Treatment with the bacterium or pathogen resulted in increased IAA and ABA levels in head tissue; both microbes had additive effects on the accumulation of IAA but not of ABA. The microbe-induced accumulation of ABA preceded that of IAA. Gene expression analysis showed that both hormones up-regulated the accumulation of bacterium-primed genes. But IAA, more than ABA up-regulated the transcription of the ABA biosynthesis gene NCED or the signalling gene Pi2, both of which were previously shown to be bacterium-responsive rather than primed. Application of IAA, but not of ABA reduced both disease severity and yield loss caused by F. culmorum, but neither hormone affect in vitro fungal growth. Conclusions Both IAA and ABA are involved in the P. fluorescens-mediated control of FHB disease of barley. Gene expression studies also support the hypothesis that IAA plays a role in the primed response to F. culmorum. This hypothesis was validated by the fact that pre-application of IAA reduced both symptoms and yield loss asssociated with the disease. This is the first evidence that IAA plays a role in the control of FHB disease and in the bacterial priming of host defences. PMID:23173736

  11. ‘Cand. Actinochlamydia clariae’ gen. nov., sp. nov., a Unique Intracellular Bacterium Causing Epitheliocystis in Catfish (Clarias gariepinus) in Uganda

    PubMed Central

    Steigen, Andreas; Nylund, Are; Karlsbakk, Egil; Akoll, Peter; Fiksdal, Ingrid U.; Nylund, Stian; Odong, Robinson; Plarre, Heidrun; Semyalo, Ronald; Skår, Cecilie; Watanabe, Kuninori

    2013-01-01

    Background and Objectives Epitheliocystis, caused by bacteria infecting gill epithelial cells in fish, is common among a large range of fish species in both fresh- and seawater. The aquaculture industry considers epitheliocystis an important problem. It affects the welfare of the fish and the resulting gill disease may lead to mortalities. In a culture facility in Kampala, Uganda, juveniles of the African sharptooth catfish (Clarias gariepinus) was observed swimming in the surface, sometimes belly up, showing signs of respiratory problems. Histological examination of gill tissues from this fish revealed large amounts of epitheliocysts, and also presence of a few Ichthyobodo sp. and Trichodina sp. Methods and Results Sequencing of the epitheliocystis bacterium 16S rRNA gene shows 86.3% similarity with Candidatus Piscichlamydia salmonis causing epitheliocystis in Atlantic salmon (Salmo salar). Transmission electron microscopy showed that the morphology of the developmental stages of the bacterium is similar to that of members of the family Chlamydiaceae. The similarity of the bacterium rRNA gene sequences compared with other chlamydia-like bacteria ranged between 80.5% and 86.3%. Inclusions containing this new bacterium have tubules/channels (termed actinae) that are radiating from the inclusion membrane and opening on the cell surface or in neighbouring cells. Conclusions Radiation of tubules/channels (actinae) from the inclusion membrane has never been described in any of the other members of Chlamydiales. It seems to be a completely new character and an apomorphy. We propose the name Candidatus Actinochlamydia clariae gen. nov., sp. nov. (Actinochlamydiaceae fam. nov., order Chlamydiales, phylum Chlamydiae) for this new agent causing epitheliocystis in African sharptooth catfish. PMID:23826156

  12. Intracellular Propionibacterium acnes Infection in Glandular Epithelium and Stromal Macrophages of the Prostate with or without Cancer

    PubMed Central

    Bae, Yuan; Ito, Takashi; Iida, Tadatsune; Uchida, Keisuke; Sekine, Masaki; Nakajima, Yutaka; Kumagai, Jiro; Yokoyama, Tetsuji; Kawachi, Hiroshi; Akashi, Takumi; Eishi, Yoshinobu

    2014-01-01

    Background Recent reports on Propionibacterium acnes (P. acnes) suggest that this bacterium is prevalent in the prostate, is associated with acute and chronic prostatic inflammation, and might have a role in prostate carcinogenesis. Methods To evaluate the pathogenic role of this indigenous bacterium, we screened for the bacterium in radical prostatectomy specimens using enzyme immunohistochemistry with a novel P. acnes-specific monoclonal antibody (PAL antibody), together with an anti-nuclear factor-kappa B (NF-κB) antibody. We examined formalin-fixed and paraffin-embedded tissue sections of radical prostatectomy specimens from 28 patients with prostate cancer and 18 age-matched control patients with bladder cancer, but without prostate cancer. Results Immunohistochemistry with the PAL antibody revealed small round bodies within some non-cancerous glandular epithelium and stromal macrophages in most prostate samples. Prostate cancer samples had higher frequencies of either cytoplasmic P. acnes or nuclear NF-κB expression of glandular epithelium and higher numbers of stromal macrophages with P. acnes than control samples. These parameters were also higher in the peripheral zone than in the transitional zone of the prostate, especially in prostate cancer samples. Nuclear NF-κB expression was more frequent in glands with P. acnes than in glands without P. acnes. The number of stromal macrophages with the bacterium correlated with the grade of chronic inflammation in both the PZ and TZ areas and with the grade of acute inflammation in the TZ area. Conclusions Immunohistochemical analysis with a novel monoclonal antibody for detecting P. acnes in the prostate suggested that intraepithelial P. acnes infection in non-cancerous prostate glands and inflammation caused by the bacterium may contribute to the development of prostate cancer. PMID:24587325

  13. Measurement of Fe2+ ion by coulometry method at incubation of Thiobacillus ferrooxidans.

    PubMed

    Tsuda, I; Kato, K; Nozaki, K

    1996-12-01

    Thiobacillus ferrooxidans is a chemoautotrophic bacterium that is capable of using Fe2+ oxidation by O2 as the sole source of energy for growth and CO2 fixation. The idea of the solar bacterial biomass farm by using of this bacterium is proposed. The incubation experiment of these bacteria was carried out, and the 9K culture medium as the standard medium for T. ferrooxidans was used. The measurement of Fe2+ in the growth stage was carried out as the first step of the experiments to clarify the possibility of this system. The items of measurement were Fe2+ ion density, pH of the medium, bacterium density and quantity of total organic carbon (TOC). The density of Fe2+ ion in the medium was measured by coulometry method. This method has the following advantage, high accuracy (<1%), easy operation, short measurement time (a few minutes) and small sample quantity (about 0.1 ml). The experimental results show that the Fe 2+ ion density is measured as same as the accuracy of pH measurement. At the final stage of the growth, the pH decreased due to the generation of the iron hydroxide (Fe(OH)3). The bacterium density and TOC slightly increased after that Fe2+ runs short. This result shows that the CO2 fixation speed is slower than Fe2+ oxidation speed. It is shown by the experiment that the growth limit of T. ferrooxidans is caused by the disappearance of the Fe2+ ion. It may be possible that the bacterium density increases by the continuous supply of Fe2+ ion.

  14. Swimming efficiency of bacterium Escherichia coli

    PubMed Central

    Chattopadhyay, Suddhashil; Moldovan, Radu; Yeung, Chuck; Wu, X. L.

    2006-01-01

    We use measurements of swimming bacteria in an optical trap to determine fundamental properties of bacterial propulsion. In particular, we directly measure the force required to hold the bacterium in the optical trap and determine the propulsion matrix, which relates the translational and angular velocity of the flagellum to the torques and forces propelling the bacterium. From the propulsion matrix, dynamical properties such as torques, swimming speed, and power can be obtained by measuring the angular velocity of the motor. We find significant heterogeneities among different individuals even though all bacteria started from a single colony. The propulsive efficiency, defined as the ratio of the propulsive power output to the rotary power input provided by the motors, is found to be ≈2%, which is consistent with the efficiency predicted theoretically for a rigid helical coil. PMID:16954194

  15. Metabolism of hexadecyltrimethylammonium chloride in Pseudomonas strain B1.

    PubMed Central

    van Ginkel, C G; van Dijk, J B; Kroon, A G

    1992-01-01

    A bacterium (strain B1) utilizing hexadecyltrimethylammonium chloride as a carbon and energy source was isolated from activated sludge and tentatively identified as a Pseudomonas sp. This bacterium only grew on alkyltrimethylammonium salts (C12 to C22) and possible intermediates of hexadecyltrimethylammonium chloride breakdown such as hexadecanoate and acetate. Pseudomonas strain B1 did not grow on amines. Simultaneous adaptation studies suggested that the bacterium oxidized only the alkyl chain of hexadecyltrimethylammonium chloride. This was confirmed by the stoichiometric formation of trimethylamine from hexadecyltrimethylammonium chloride. The initial hexadecyltrimethylammonium chloride oxygenase activity, measured by its ability to form trimethylamine, was NAD(P)H and O2 dependent. Finally, assays of aldehyde dehydrogenase, hexadecanoyl-coenzyme A dehydrogenase, and isocitrate lyase in cell extracts revealed the potential of Pseudomonas strain B1 to metabolize the alkyl chain via beta-oxidation. PMID:1444422

  16. Complete Genome Sequence of the Complex Carbohydrate-Degrading Marine Bacterium, Saccharophagus degradans Strain 2-40T

    PubMed Central

    Weiner, Ronald M.; Taylor, Larry E.; Henrissat, Bernard; Hauser, Loren; Land, Miriam; Coutinho, Pedro M.; Rancurel, Corinne; Saunders, Elizabeth H.; Longmire, Atkinson G.; Zhang, Haitao; Bayer, Edward A.; Gilbert, Harry J.; Larimer, Frank; Zhulin, Igor B.; Ekborg, Nathan A.; Lamed, Raphael; Richardson, Paul M.; Borovok, Ilya; Hutcheson, Steven

    2008-01-01

    The marine bacterium Saccharophagus degradans strain 2-40 (Sde 2-40) is emerging as a vanguard of a recently discovered group of marine and estuarine bacteria that recycles complex polysaccharides. We report its complete genome sequence, analysis of which identifies an unusually large number of enzymes that degrade >10 complex polysaccharides. Not only is this an extraordinary range of catabolic capability, many of the enzymes exhibit unusual architecture including novel combinations of catalytic and substrate-binding modules. We hypothesize that many of these features are adaptations that facilitate depolymerization of complex polysaccharides in the marine environment. This is the first sequenced genome of a marine bacterium that can degrade plant cell walls, an important component of the carbon cycle that is not well-characterized in the marine environment. PMID:18516288

  17. Plant growth-promoting bacterium Acinetobacter calcoaceticus P23 increases the chlorophyll content of the monocot Lemna minor (duckweed) and the dicot Lactuca sativa (lettuce).

    PubMed

    Suzuki, Wakako; Sugawara, Masayuki; Miwa, Kyoko; Morikawa, Masaaki

    2014-07-01

    Acinetobacter calcoaceticus P23 is a plant growth-promoting bacterium that was isolated from the surface of duckweed (Lemna aoukikusa). The bacterium was observed to colonize on the plant surfaces and increase the chlorophyll content of not only the monocotyledon Lemna minor but also the dicotyledon Lactuca sativa in a hydroponic culture. This effect on the Lactuca sativa was significant in nutrient-poor (×1/100 dilution of H2 medium) and not nutrient-rich (×1 or ×1/10 dilutions of H2 medium) conditions. Strain P23 has the potential to play a part in the future development of fertilizers and energy-saving hydroponic agricultural technologies. Copyright © 2013 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  18. Trichloroethylene Biodegradation by a Methane-Oxidizing Bacterium †

    PubMed Central

    Little, C. Deane; Palumbo, Anthony V.; Herbes, Stephen E.; Lidstrom, Mary E.; Tyndall, Richard L.; Gilmer, Penny J.

    1988-01-01

    Trichloroethylene (TCE), a common groundwater contaminant, is a suspected carcinogen that is highly resistant to aerobic biodegradation. An aerobic, methane-oxidizing bacterium was isolated that degrades TCE in pure culture at concentrations commonly observed in contaminated groundwater. Strain 46-1, a type I methanotrophic bacterium, degraded TCE if grown on methane or methanol, producing CO2 and water-soluble products. Gas chromatography and 14C radiotracer techniques were used to determine the rate, methane dependence, and mechanism of TCE biodegradation. TCE biodegradation by strain 46-1 appears to be a cometabolic process that occurs when the organism is actively metabolizing a suitable growth substrate such as methane or methanol. It is proposed that TCE biodegradation by methanotrophs occurs by formation of TCE epoxide, which breaks down spontaneously in water to form dichloroacetic and glyoxylic acids and one-carbon products. Images PMID:16347616

  19. Experimental study of the quasi 1d motion of a ``robot bacterium'' within a tube

    NASA Astrophysics Data System (ADS)

    Liu, Kai; Jiao, Yusheng; Li, Shutong; Ding, Yang; Xu, Xinliang; Complex Fluids Team

    2017-11-01

    Understanding how solid boundary influences the motion of a micro-swimmer can be quite important. Here we experimentally study the problem with a system of centi-meter size ``robot bacterium'' immersed in the solvent silicon oil. Equipped with build-in battery and motor, the robot mimics a free swimmer and the overall Reynolds number of the system is kept very small as we use silicon oil with very high viscosity. The motion of centi-meter size ``robot bacterium'' within cylindrical tube is experimentally studied in detail. Our results show that robot bacteria with different shapes respond very different to the solid boundary. For certain shapes the swimmers actually swim much faster within a tube, when compared to their motions without any confinement, in good agreement with our numerical evaluations of the hydrodynamics of the system.

  20. [Phylogenetic diversity of airborne microbes in Qingdao downtown in autumn].

    PubMed

    Wang, Lin; Song, Zhi-wen; Xu, Ai-ling; Wu, Deng-deng; Xia, Yan

    2015-04-01

    To determine the community structure of airborne microbes in Qingdao downtown in autumn, the airborne bacteria and fungi were collected by the KC-6120 air sampler and analyzed using the 16S/18S rDNA gene clone library method. Phylogenetic analysis of airborne bacteria showed that they belonged to six major phylogenetic groups: Proteobacteria (78. 8%), Firmicutes (14.6%), Actinobacteria (4.0%), Planctomycetes (1.3%), Cyanobacteria (0.7%), and Deinococcus-Thermus (0.7%). The dominant genera of airborne bacteria included Acinetobacter (39.7%), Staphylococcus (11.3%), Sphingomonas (8.6%), Paracoccus (6.0%) and Massilia (5.3%). The main types of airborne fungi were Ascomycota (97.5%) and Basidiomycota (2.5%). Dominant genera of airborne fungi included Pyrenophora (76.5%), Xylaria (13.6%) and Exophiala (2.5%). The pathogens or conditioned pathogens, such as Acinetobacter, Staphylococcus, or Sphingomonas were detected in the airborne bacteria, whereas certain kinds of fungi, such as P. graminea, X. hypoxylon and Zasmidium angulare that could cause a variety of crop diseases were also detected.

Top