Novel baculovirus-derived p67 subunit vaccines efficacious against East Coast fever in cattle.

PubMed

Kaba, Stephen A; Musoke, Anthony J; Schaap, Dick; Schetters, Theo; Rowlands, John; Vermeulen, Arno N; Nene, Vishvanath; Vlak, Just M; van Oers, Monique M

2005-04-15

Two novel baculovirus-derived recombinant Theileria parva p67 constructs were tested for their vaccine potential against East Coast fever. Boran calves were immunized with a his-GFP-p67 fusion protein (GFP:p67deltaSS) or with GP64:p67C, a protein fusion between a C-terminal domain of p67 and the baculovirus envelope protein GP64. Both GFP:p67deltaSS and GP64:p67C induced antibodies with high ELISA titers that neutralized T. parva sporozoites with high efficiency. Upon challenge, a correlation was observed between the in vitro neutralizing capacity and the reduction in severe ECF for individual animals. A protection level upto 85% was obtained. This level of protection was achieved with only two inoculations of 100 microg per dose, which is a major improvement over previous recombinant p67 products.

A baculovirus dual expression vector derived from the Autographa californica nuclear polyhedrosis virus polyhedrin and p10 promoters: co-expression of two influenza virus genes in insect cells.

PubMed

Weyer, U; Possee, R D

1991-12-01

A baculovirus transfer vector, pAcUW3, was developed to facilitate the insertion of two influenza virus genes, those encoding the haemagglutinin (HA) and neuraminidase (NA) membrane glycoproteins, into the Autographa californica nuclear polyhedrosis virus genome in a single cotransfection experiment. The NA gene was inserted in place of the polyhedrin coding sequences under the control of the polyhedrin promoter, whereas the HA gene was placed under the control of a copy of the p10 promoter at a site upstream of and in opposite orientation to the polyhedrin promoter. After infection of Spodoptera frugiperda cells with the recombinant virus, AcUW3HANA, both HA and NA were expressed in the very late phase of infection and were shown to be functional in appropriate assays. Immunofluorescence assays demonstrated their localization at the surface of infected insect cells. The expression of both foreign genes in the recombinant virus was found to be stable for at least 12 passages in cell culture.

Expression, Delivery and Function of Insecticidal Proteins Expressed by Recombinant Baculoviruses

PubMed Central

Kroemer, Jeremy A.; Bonning, Bryony C.; Harrison, Robert L.

2015-01-01

Since the development of methods for inserting and expressing genes in baculoviruses, a line of research has focused on developing recombinant baculoviruses that express insecticidal peptides and proteins. These recombinant viruses have been engineered with the goal of improving their pesticidal potential by shortening the time required for infection to kill or incapacitate insect pests and reducing the quantity of crop damage as a consequence. A wide variety of neurotoxic peptides, proteins that regulate insect physiology, degradative enzymes, and other potentially insecticidal proteins have been evaluated for their capacity to reduce the survival time of baculovirus-infected lepidopteran host larvae. Researchers have investigated the factors involved in the efficient expression and delivery of baculovirus-encoded insecticidal peptides and proteins, with much effort dedicated to identifying ideal promoters for driving transcription and signal peptides that mediate secretion of the expressed target protein. Other factors, particularly translational efficiency of transcripts derived from recombinant insecticidal genes and post-translational folding and processing of insecticidal proteins, remain relatively unexplored. The discovery of RNA interference as a gene-specific regulation mechanism offers a new approach for improvement of baculovirus biopesticidal efficacy through genetic modification. PMID:25609310

Expression, delivery and function of insecticidal proteins expressed by recombinant baculoviruses.

PubMed

Kroemer, Jeremy A; Bonning, Bryony C; Harrison, Robert L

2015-01-21

Since the development of methods for inserting and expressing genes in baculoviruses, a line of research has focused on developing recombinant baculoviruses that express insecticidal peptides and proteins. These recombinant viruses have been engineered with the goal of improving their pesticidal potential by shortening the time required for infection to kill or incapacitate insect pests and reducing the quantity of crop damage as a consequence. A wide variety of neurotoxic peptides, proteins that regulate insect physiology, degradative enzymes, and other potentially insecticidal proteins have been evaluated for their capacity to reduce the survival time of baculovirus-infected lepidopteran host larvae. Researchers have investigated the factors involved in the efficient expression and delivery of baculovirus-encoded insecticidal peptides and proteins, with much effort dedicated to identifying ideal promoters for driving transcription and signal peptides that mediate secretion of the expressed target protein. Other factors, particularly translational efficiency of transcripts derived from recombinant insecticidal genes and post-translational folding and processing of insecticidal proteins, remain relatively unexplored. The discovery of RNA interference as a gene-specific regulation mechanism offers a new approach for improvement of baculovirus biopesticidal efficacy through genetic modification.

Bioengineered baculoviruses as new class of therapeutics using micro and nanotechnologies: principles, prospects and challenges.

PubMed

Paul, Arghya; Hasan, Anwarul; Rodes, Laetitia; Sangaralingam, Mugundhine; Prakash, Satya

2014-05-01

Designing a safe and efficient gene delivery system is required for success of gene therapy trials. Although a wide variety of viral, non-viral and polymeric nanoparticle based careers have been widely studied, the current gene delivery vehicles are limited by their suboptimal, non-specific therapeutic efficacy and acute immunological reactions, leading to unwanted side effects. Recently, there has been a growing interest in insect-cell-originated baculoviruses as gene delivery vehicles for diverse biomedical applications. Specifically, the emergence of diverse types of surface functionalized and bioengineered baculoviruses is posed to edge over currently available gene delivery vehicles. This is primarily because baculoviruses are comparatively non-pathogenic and non-toxic as they cannot replicate in mammalian cells and do not invoke any cytopathic effect. Moreover, emerging advanced studies in this direction have demonstrated that hybridizing the baculovirus surface with different kinds of bioactive therapeutic molecules, cell-specific targeting moieties, protective polymeric grafts and nanomaterials can significantly improve the preclinical efficacy of baculoviruses. This review presents a comprehensive overview of the recent advancements in the field of bioengineering and biotherapeutics to engineer baculovirus hybrids for tailored gene therapy, and articulates in detail the potential and challenges of these strategies for clinical realization. In addition, the article illustrates the rapid evolvement of microfluidic devices as a high throughput platform for optimizing baculovirus production and treatment conditions. Copyright © 2014 Elsevier B.V. All rights reserved.

The Genome of Gryllus bimaculatus Nudivirus Indicates an Ancient Diversification of Baculovirus-Related Nonoccluded Nudiviruses of Insects▿

PubMed Central

Wang, Yongjie; Kleespies, Regina G.; Huger, Alois M.; Jehle, Johannes A.

2007-01-01

The Gryllus bimaculatus nudivirus (GbNV) infects nymphs and adults of the cricket Gryllus bimaculatus (Orthoptera: Gryllidae). GbNV and other nudiviruses such as Heliothis zea nudivirus 1 (HzNV-1) and Oryctes rhinoceros nudivirus (OrNV) were previously called “nonoccluded baculoviruses” as they share some similar structural, genomic, and replication aspects with members of the family Baculoviridae. Their relationships to each other and to baculoviruses are elucidated by the sequence of the complete genome of GbNV, which is 96,944 bp, has an AT content of 72%, and potentially contains 98 predicted protein-coding open reading frames (ORFs). Forty-one ORFs of GbNV share sequence similarities with ORFs found in OrNV, HzNV-1, baculoviruses, and bacteria. Most notably, 15 GbNV ORFs are homologous to the baculovirus core genes, which are associated with transcription (lef-8, lef-9, lef-4, vlf-1, and lef-5), replication (dnapol), structural proteins (p74, pif-1, pif-2, pif-3, vp91, and odv-e56), and proteins of unknown function (38K, ac81, and 19kda). Homologues to these baculovirus core genes have been predicted in HzNV-1 as well. Six GbNV ORFs are homologous to nonconserved baculovirus genes dnaligase, helicase 2, rr1, rr2, iap-3, and desmoplakin. However, the remaining 57 ORFs revealed no homology or poor similarities to the current gene databases. No homologous repeat (hr) sequences but fourteen short direct repeat (dr) regions were detected in the GbNV genome. Gene content and sequence similarity suggest that the nudiviruses GbNV, HzNV-1, and OrNV form a monophyletic group of nonoccluded double-stranded DNA viruses, which separated from the baculovirus lineage before this radiated into dipteran-, hymenopteran-, and lepidopteran-specific clades of occluded nucleopolyhedroviruses and granuloviruses. The accumulated information on the GbNV genome suggests that nudiviruses form a highly diverse and phylogenetically ancient sister group of the baculoviruses, which have

Insecticidal activity of two proteases against Spodoptera frugiperda larvae infected with recombinant baculoviruses

PubMed Central

2010-01-01

Background Baculovirus comprise the largest group of insect viruses most studied worldwide, mainly because they efficiently kill agricutural insect pests. In this study, two recombinant baculoviruses containing the ScathL gene from Sarcophaga peregrina (vSynScathL), and the Keratinase gene from the fungus Aspergillus fumigatus (vSynKerat), were constructed. and their insecticidal properties analysed against Spodoptera frugiperda larvae. Results Bioassays of third-instar and neonate S. frugiperda larvae with vSynScathL and vSynKerat showed a decrease in the time needed to kill the infected insects when compared to the wild type virus. We have also shown that both recombinants were able to increase phenoloxidase activity in the hemolymph of S. frugiperda larvae. The expression of proteases in infected larvae resulted in destruction of internal tissues late in infection, which could be the reason for the increased viral speed of kill. Conclusions Baculoviruses and their recombinant forms constitute viable alternatives to chemical insecticides. Recombinant baculoviruses containing protease genes can be added to the list of engineered baculoviruses with great potential to be used in integrated pest management programs. PMID:20587066

Baculovirus phylogeny and evolution.

PubMed

Herniou, Elisabeth A; Jehle, Johannes A

2007-10-01

The family Baculoviridae represents one of the largest and most diverse groups of viruses and a unique model for studying the forces driving the evolution and biodiversity of double-stranded DNA viruses with large genomes. With the advent of comparative genomics, the phylogenetic relationships of baculoviruses have been put on solid bases. This, as well as improved bioinformatic approaches, has provided a detailed picture of baculovirus phylogeny and evolution. According to the present knowledge, baculoviruses can be classified into at least four evolutionary lineages: the most ancestral dipteran nucleopolyhedroviruses, the hymenopteran nucleopolyhedroviruses and the lepidopteran nucleopolyhedroviruses and granuloviruses. Despite the growing understanding of baculovirus phylogeny and macro-evolution, our knowledge of the micro-evolutionary processes within baculovirus species and virus populations is still limited. Here we present the state of the art on baculovirus phylogeny and evolution.

Construction of a highly efficient display system for baculovirus and its application on multigene co-display.

PubMed

Zheng, Hao; Wang, Xiong; Ren, Feifei; Zou, Shenglong; Feng, Min; Xu, Liangliang; Yao, Lunguang; Sun, Jingchen

2018-06-19

The classical baculovirus display system (BDS) has often recruited fields including gene delivery, gene therapy, and the genetic engineering of vaccines, as it is capable of presenting foreign polypeptides on the membranes of recombinant baculovirus through a transmembrane protein. However, classical BDS's high cost, complicated operation, low display efficiency and its inability to simultaneously display multiple gene products impede its practicality. In this study, we present a novel and highly efficient display system based on ires-dependent gp64 for rescuing gp64-null Bacmid of baculovirus construction without affecting the viral replication cycle, which we name the baculovirus multigene display system (BMDS). Laser scanning confocal microscopy demonstrated that eGFP, eYFP, and mCherry were translocated on the membrane of Spodoptera frugiperda 9 cell successfully as expected. Western blot analysis further confirmed the presence of the fluorescent proteins on the budded, mature viral particles. The results showed the display efficiency of target gene on cell surface is fourfold that of classical BDS. In addition, a recombinant baculovirus displaying three kinds of fluorescent proteins simultaneously was constructed, thereby demonstrating the effectiveness of BMDS as a co-display system.

Characterization of a baculovirus lacking the DBP (DNA-binding protein) gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vanarsdall, Adam L.; Mikhailov, Victor S.; N.K. Koltzov Institute of Developmental Biology, Russian Academy of Sciences, Moscow 117808

2007-08-01

Autographa californica multiple nucleopolyhedrovirus (AcMNPV) encodes two proteins that possess properties typical of single-stranded DNA-binding proteins (SSBs), late expression factor-3 (LEF-3), and a protein referred to as DNA-binding protein (DBP). Whereas LEF-3 is a multi-functional protein essential for viral DNA replication, transporting helicase into the nucleus, and forms a stable complex with the baculovirus alkaline nuclease, the role for DBP in baculovirus replication remains unclear. Therefore, to better understand the functional role of DBP in viral replication, a DBP knockout virus was generated from an AcMNPV bacmid and analyzed. The results of a growth curve analysis indicated that the dbpmore » knockout construct was unable to produce budded virus indicating that dbp is essential. The lack of DBP does not cause a general shutdown of the expression of viral genes, as was revealed by accumulation of early (LEF-3), late (VP39), and very late (P10) proteins in cells transfected with the dbp knockout construct. To investigate the role of DBP in DNA replication, a real-time PCR-based assay was employed and showed that, although viral DNA synthesis occurred in cells transfected with the dbp knockout, the levels were less than that of the control virus suggesting that DBP is required for normal levels of DNA synthesis or for stability of nascent viral DNA. In addition, analysis of the viral DNA replicated by the dbp knockout by using field inversion gel electrophoresis failed to detect the presence of genome-length DNA. Furthermore, analysis of DBP from infected cells indicated that similar to LEF-3, DBP was tightly bound to viral chromatin. Assessment of the cellular localization of DBP relative to replicated viral DNA by immunoelectron microscopy indicated that, at 24 h post-infection, DBP co-localized with nascent DNA at distinct electron-dense regions within the nucleus. Finally, immunoelectron microscopic analysis of cells transfected with the dbp

Effect of baculovirus P35 protein on apoptosis in brain tissue of rats with acute cerebral infarction.

PubMed

Ji, J F; Ma, X H

2015-08-10

We explored the effect of baculovirus P35 protein on apoptosis in the brain tissue of rats with acute cerebral infarction (ACI). A rat model of middle cerebral artery infarction was created. The rats were randomly divided into sham, model, and treatment groups. Baculovirus P35 protein was injected into the intracranial arteries of the treatment group rats. The rats in the model group were given an equal volume of phosphate-buffered saline. The rats were sacrificed after 72 h and the brain tissue was separated. The levels of caspase-3, Bcl-2, and Bax mRNA, the brain cell apoptosis index, and the infarct size were determined. After 72 h, the levels of caspase-3 and Bax mRNA in the model and treatment groups were significantly greater than in the sham group, and the levels of Bcl-2 mRNA were significantly smaller (P < 0.05). The levels of caspase-3 and Bax mRNA were significantly lower in the treatment group than in the model group, and the level of Bcl-2 mRNA was significantly greater (P < 0.05). Compared with the sham group, the brain tissue apoptosis index and the cerebral infarction area increased significantly in the model and treatment groups (P < 0.05). The brain tissue apoptosis index and cerebral infarction area in the treatment group were significantly lower than in the model group (P < 0.05). Baculovirus P35 protein can effectively inhibit brain cell apoptosis in rats with ACI. It delayed apoptosis and necrosis in subjects with ACI tissue and had a protective effect on brain tissue.

Characterization of canine herpesvirus glycoprotein C expressed by a recombinant baculovirus in insect cells.

PubMed

Xuan, X; Maeda, K; Mikami, T; Otsuka, H

1996-12-01

The gene encoding the canine herpesvirus (CHV) glycoprotein C (gC) homologue has been identified by sequence homology analyses with other well studied herpesviruses. Previously, we have identified three CHV glycoproteins, gp145/112, gp80 and gp47 using a panel of monoclonal antibodies (MAbs). To determine which CHV glycoprotein corresponds to gC, a recombinant baculovirus which contains the putative CHV gC structural gene under the baculovirus polyhedrin promoter was constructed. The recombinant baculovirus expressed gC-related polypeptides (44-62 kDa), which reacted only with MAbs against CHV gp80, indicating that the previously identified CHV gp80 is the translation product of the gC gene. The baculovirus expressed gC was glycosylated and transported to the surface of infected cells. At least seven neutralizing epitopes were conserved on the gC produced in insect cells. It was found that the recombinant baculovirus infected cells adsorbed murine erythrocytes as is the case for CHV-infected cells. The hemadsorption activity was inhibited by heparin, indicating that the CHV gC binds to heparan sulfate on the surface of murine erythrocytes. Mice immunized with the recombinant gC produced strong neutralizing antibodies. Our results suggest that CHV gC produced in insect cells may be useful as a subunit vaccine to control CHV infections.

Genome-wide screen identifies a novel p97/CDC-48-dependent pathway regulating ER-stress-induced gene transcription.

PubMed

Marza, Esther; Taouji, Saïd; Barroso, Kim; Raymond, Anne-Aurélie; Guignard, Léo; Bonneu, Marc; Pallares-Lupon, Néstor; Dupuy, Jean-William; Fernandez-Zapico, Martin E; Rosenbaum, Jean; Palladino, Francesca; Dupuy, Denis; Chevet, Eric

2015-03-01

The accumulation of misfolded proteins in the endoplasmic reticulum (ER) activates the Unfolded Protein Response (UPR(ER)) to restore ER homeostasis. The AAA(+) ATPase p97/CDC-48 plays key roles in ER stress by promoting both ER protein degradation and transcription of UPR(ER) genes. Although the mechanisms associated with protein degradation are now well established, the molecular events involved in the regulation of gene transcription by p97/CDC-48 remain unclear. Using a reporter-based genome-wide RNAi screen in combination with quantitative proteomic analysis in Caenorhabditis elegans, we have identified RUVB-2, a AAA(+) ATPase, as a novel repressor of a subset of UPR(ER) genes. We show that degradation of RUVB-2 by CDC-48 enhances expression of ER stress response genes through an XBP1-dependent mechanism. The functional interplay between CDC-48 and RUVB-2 in controlling transcription of select UPR(ER) genes appears conserved in human cells. Together, these results describe a novel role for p97/CDC-48, whereby its role in protein degradation is integrated with its role in regulating expression of ER stress response genes. © 2015 The Authors.

Genome-wide screen identifies a novel p97/CDC-48-dependent pathway regulating ER-stress-induced gene transcription

PubMed Central

Marza, Esther; Taouji, Saïd; Barroso, Kim; Raymond, Anne-Aurélie; Guignard, Léo; Bonneu, Marc; Pallares-Lupon, Néstor; Dupuy, Jean-William; Fernandez-Zapico, Martin E; Rosenbaum, Jean; Palladino, Francesca; Dupuy, Denis; Chevet, Eric

2015-01-01

The accumulation of misfolded proteins in the endoplasmic reticulum (ER) activates the Unfolded Protein Response (UPRER) to restore ER homeostasis. The AAA+ ATPase p97/CDC-48 plays key roles in ER stress by promoting both ER protein degradation and transcription of UPRER genes. Although the mechanisms associated with protein degradation are now well established, the molecular events involved in the regulation of gene transcription by p97/CDC-48 remain unclear. Using a reporter-based genome-wide RNAi screen in combination with quantitative proteomic analysis in Caenorhabditis elegans, we have identified RUVB-2, a AAA+ ATPase, as a novel repressor of a subset of UPRER genes. We show that degradation of RUVB-2 by CDC-48 enhances expression of ER stress response genes through an XBP1-dependent mechanism. The functional interplay between CDC-48 and RUVB-2 in controlling transcription of select UPRER genes appears conserved in human cells. Together, these results describe a novel role for p97/CDC-48, whereby its role in protein degradation is integrated with its role in regulating expression of ER stress response genes. PMID:25652260

DNA microarrays of baculovirus genomes: differential expression of viral genes in two susceptible insect cell lines.

PubMed

Yamagishi, J; Isobe, R; Takebuchi, T; Bando, H

2003-03-01

We describe, for the first time, the generation of a viral DNA chip for simultaneous expression measurements of nearly all known open reading frames (ORFs) in the best-studied members of the family Baculoviridae, Autographa californica multiple nucleopolyhedrovirus (AcMNPV) and Bombyx mori nucleopolyhedrovirus (BmNPV). In this study, a viral DNA chip (Ac-BmNPV chip) was fabricated and used to characterize the viral gene expression profile for AcMNPV in different cell types. The viral chip is composed of microarrays of viral DNA prepared by robotic deposition of PCR-amplified viral DNA fragments on glass for ORFs in the NPV genome. Viral gene expression was monitored by hybridization to the DNA fragment microarrays with fluorescently labeled cDNAs prepared from infected Spodoptera frugiperda, Sf9 cells and Trichoplusia ni, TnHigh-Five cells, the latter a major producer of baculovirus and recombinant proteins. A comparison of expression profiles of known ORFs in AcMNPV elucidated six genes (ORF150, p10, pk2, and three late gene expression factor genes lef-3, p35 and lef- 6) the expression of each of which was regulated differently in the two cell lines. Most of these genes are known to be closely involved in the viral life cycle such as in DNA replication, late gene expression and the release of polyhedra from infected cells. These results imply that the differential expression of these viral genes accounts for the differences in viral replication between these two cell lines. Thus, these fabricated microarrays of NPV DNA which allow a rapid analysis of gene expression at the viral genome level should greatly speed the functional analysis of large genomes of NPV.

The Env-like open reading frame of the baculovirus-integrated retrotransposon TED encodes a retrovirus-like envelope protein.

PubMed

Ozers, M S; Friesen, P D

1996-12-15

TED is a 7.5-kbp member of the gypsy family of retrotransposons that was first identified by its integration within the baculovirus DNA genome. This lepidopteran (moth) transposon contains three retrovirus-like genes, including functional gag and pol that yield reverse transcriptase-containing virus-like particles. To identify and characterize the product(s) of the third env-like open reading frame, TED ORF3 was expressed in homologous lepidopteran cells by using a baculovirus vector, vENV. Immunoblots and immunoprecipitations with antiserum raised against a bacterial ORF3-fusion protein detected two ORF3-encoded proteins, p68env and gp75env. On the basis of selective incorporation of [3H]mannose and inhibition of modification by tunicamycin which blocks N-linked glycosylation, gp75env is a glycoprotein derived from core precursor p68env. As predicted by the presence of a transmembrane domain near the carboxyl terminus, both p68env and gp75env were associated with heavy membranes of vENV-infected cells. Thus, TED ORF3 encodes a membrane glycoprotein with properties characteristic of retroviral env proteins. These data are consistent with the hypothesis that TED is an invertebrate retrovirus. Moreover, TED integration within the baculovirus genome provides an example of retroelement-mediated acquisition of host genes that may contribute to virus evolution.

Baculovirus LEF-11 nuclear localization signal is important for viral DNA replication.

PubMed

Chen, Tingting; Dong, Zhanqi; Hu, Nan; Hu, Zhigang; Dong, Feifan; Jiang, Yaming; Li, Jun; Chen, Peng; Lu, Cheng; Pan, Minhui

2017-06-15

Baculovirus LEF-11 is a small nuclear protein that is involved in viral late gene transcription and DNA replication. However, the characteristics of its nuclear localization signal and its impact on viral DNA replication are unknown. In the present study, systemic bioinformatics analysis showed that the baculovirus LEF-11 contains monopartite and bipartite classical nuclear localization signal sequences (cNLSs), which were also detected in a few alphabaculovirus species. Localization of representative LEF-11 proteins of four baculovirus genera indicated that the nuclear localization characteristics of baculovirus LEF-11 coincided with the predicted results. Moreover, Bombyx mori nucleopolyhedrovirus (BmNPV) LEF-11 could be transported into the nucleus during viral infection in the absence of a cNLSs. Further investigations demonstrated that the NLS of BmNPV LEF-11 is important for viral DNA replication. The findings of the present study indicate that the characteristics of the baculovirus LEF-11 protein and the NLS is essential to virus DNA replication and nuclear transport mechanisms. Copyright © 2017 Elsevier B.V. All rights reserved.

Baculovirus GP64-mediated entry into mammalian cells.

PubMed

Kataoka, Chikako; Kaname, Yuuki; Taguwa, Shuhei; Abe, Takayuki; Fukuhara, Takasuke; Tani, Hideki; Moriishi, Kohji; Matsuura, Yoshiharu

2012-03-01

The baculovirus Autographa californica multiple nucleopolyhedrovirus (AcMNPV) serves as an efficient viral vector, not only for abundant gene expression in insect cells, but also for gene delivery into mammalian cells. Lentivirus vectors pseudotyped with the baculovirus envelope glycoprotein GP64 have been shown to acquire more potent gene transduction than those with vesicular stomatitis virus (VSV) envelope glycoprotein G. However, there are conflicting hypotheses about the molecular mechanisms of the entry of AcMNPV. Moreover, the mechanisms of the entry of pseudotyped viruses bearing GP64 into mammalian cells are not well characterized. Determination of the entry mechanisms of AcMNPV and the pseudotyped viruses bearing GP64 is important for future development of viral vectors that can deliver genes into mammalian cells with greater efficiency and specificity. In this study, we generated three pseudotyped VSVs, NPVpv, VSVpv, and MLVpv, bearing envelope proteins of AcMNPV, VSV, and murine leukemia virus, respectively. Depletion of membrane cholesterol by treatment with methyl-β-cyclodextrin, which removes cholesterol from cellular membranes, inhibited GP64-mediated internalization in a dose-dependent manner but did not inhibit attachment to the cell surface. Treatment of cells with inhibitors or the expression of dominant-negative mutants for dynamin- and clathrin-mediated endocytosis abrogated the internalization of AcMNPV and NPVpv into mammalian cells, whereas inhibition of caveolin-mediated endocytosis did not. Furthermore, inhibition of macropinocytosis reduced GP64-mediated internalization. These results suggest that cholesterol in the plasma membrane, dynamin- and clathrin-dependent endocytosis, and macropinocytosis play crucial roles in the entry of viruses bearing baculovirus GP64 into mammalian cells.

HSP70 induction during baculovirus infection

USDA-ARS?s Scientific Manuscript database

Baculoviruses are arthropod-specific double-stranded DNA viruses that have been employed as bio-insecticides against crop pests and to produce heterologous proteins in baculovirus expression systems. Although a consensus has emerged on the dominant molecular events driving baculovirus replication i...

Baculovirus-mediated vascular endothelial growth factor-D(ΔNΔC) gene transfer induces angiogenesis in rabbit skeletal muscle.

PubMed

Heikura, Tommi; Nieminen, Tiina; Roschier, Miia M; Karvinen, Henna; Kaikkonen, Minna U; Mähönen, Anssi J; Lesch, Hanna P; Rissanen, Tuomas T; Laitinen, Olli H; Airenne, Kari J; Ylä-Herttuala, Seppo

2012-01-01

Occluded arteries and ischemic tissues cannot always be treated by angioplasty, stenting or by-pass-surgery. Under such circumstances, viral gene therapy may be useful in inducing increased blood supply to ischemic area. There is evidence of improved blood flow in ischemic skeletal muscle and myocardium in both animal and human studies using adenoviral vascular endothelial growth factor (VEGF) gene therapy. However, the expression is transient and repeated gene transfers with the same vector are inefficient due to immune responses. Different baculoviral vectors pseudotyped with or without vesicular stomatitis virus glycoprotein (VSV-G) and/or carrying woodchuck hepatitis virus post-transcriptional regulatory element (Wpre) were tested both in vitro and in vivo. VEGF-D(ΔNΔC) was used as therapeutic transgene and lacZ as a control. In vivo efficacy was evaluated as capillary enlargement and transgene expression in New Zealand White (NZW) rabbit skeletal muscle. A statistically significant capillary enlargement was detected 6 days after gene transfer in transduced areas compared to the control gene transfers with baculovirus and adenovirus encoding β-galactosidase (lacZ). Substantially improved gene transfer efficiency was achieved with a modified baculovirus pseudotyped with VSV-G and carrying Wpre. Dose escalation experiments revealed that either too large volume or too many virus particles caused inflammation and necrosis in the target tissue, whereas 10(9) plaque forming units injected in multiple aliquots resulted in transgene expression with only mild immune reactions. We show the first evidence of biologically significant baculoviral gene transfer in skeletal muscle of NZW rabbits using VEGF-D(ΔNΔC) as a therapeutic transgene. Copyright © 2012 John Wiley & Sons, Ltd.

Pseudotyped baculovirus is an effective gene expression tool for studying molecular function during axolotl limb regeneration.

PubMed

Oliveira, Catarina R; Lemaitre, Regis; Murawala, Prayag; Tazaki, Akira; Drechsel, David N; Tanaka, Elly M

2018-01-15

Axolotls can regenerate complex structures through recruitment and remodeling of cells within mature tissues. Accessing the underlying mechanisms at a molecular resolution is crucial to understand how injury triggers regeneration and how it proceeds. However, gene transformation in adult tissues can be challenging. Here we characterize the use of pseudotyped baculovirus (BV) as an effective gene transfer method both for cells within mature limb tissue and within the blastema. These cells remain competent to participate in regeneration after transduction. We further characterize the effectiveness of BV for gene overexpression studies by overexpressing Shh in the blastema, which yields a high penetrance of classic polydactyly phenotypes. Overall, our work establishes BV as a powerful tool to access gene function in axolotl limb regeneration. Copyright © 2017 Elsevier Inc. All rights reserved.

Trypsin cleavage of the baculovirus occlusion-derived virus attachment protein P74 is prerequisite in per os infection.

PubMed

Slack, Jeffrey M; Lawrence, Susan D; Krell, Peter J; Arif, Basil M

2008-10-01

Baculovirus occlusion-derived virions (ODVs) contain a number of infectivity factors essential for the initiation of infection in larval midgut cells. Deletion of any of these factors neutralizes infectivity by the per os route. We have observed that P74 of the group I alphabaculovirus Autographa californica multiple nucleopolyhedrovirus (AcMNPV) is N-terminally cleaved when a soluble form of the protein was incubated with insect midgut tissues under alkaline conditions and that cleavage was prevented by soybean trypsin inhibitor (SBTI). Presently, biological assays were carried out that suggest SBTI inhibits and trypsin enhances baculovirus per os infectivity. We developed a method to rescue per os infectivity of a P74 null virus involving co-transfection of viral DNA with a plasmid that transiently expresses p74. We used this plasmid rescue method to functionally characterize P74. A series of site-directed mutants were generated at the N terminus to evaluate if trypsin cleavage sites were necessary for function. Mutagenesis of R195, R196 and R199 compromised per os infectivity and rendered P74 resistant to midgut trypsin.

Transduction of cultured fish cells with recombinant baculoviruses.

PubMed

Leisy, Douglas J; Lewis, Teresa D; Leong, Jo-Ann C; Rohrmann, George F

2003-05-01

Five fish cell lines were tested for their ability to be transduced by Ac-CAlacZ, a recombinant baculovirus that is capable of expressing a beta-galactosidase reporter gene from the CAG promoter (consisting of a cytomegalovirus enhancer element, a chicken actin promoter and rabbit beta-globin termination sequences). TO (Tilapia ovary), EPC (carp), CHH-1 (Chum salmon heart fibroblast) and CHSE-214 (chinook salmon embryo) cells were transducible, as demonstrated by an in situ beta-galactosidase assay, whereas RTG-2 (rainbow trout gonad) cells were not. The EPC cell line was used for more detailed studies on baculovirus transduction. The transduction frequency was found to be higher at 28 degrees C than at 21 degrees C. Addition of the histone deacetylase inhibitor sodium butyrate increased the number of blue cells detected 5- to 7-fold. The m.o.i. was positively correlated with transduction frequency, although the relationship did not appear to be strictly linear, as has been observed with mammalian cells. The temperature at which baculoviruses were adsorbed to EPC cells did not affect levels of beta-galactosidase expression. We also examined expression levels of beta-galactosidase in EPC cells after infection with a baculovirus construct that overexpresses the vesicular stomatitis virus G protein and displays it on the virion surface. Expression levels with this virus were approximately 15-fold higher than were observed with Ac-CAlacZ.

[Expression of goat IL-18 mature protein in insect/baculovirus and determination of bioactivity of the recombinant protein].

PubMed

Wang, Ting-Ting; Wang, Xi-Hui; Fan, Zhong-Ling; Chen, Jin-Long; Cao, Bing-Lei; Kong, Na; Hu, Jing-Dong; Zhao, Hong-Kun

2011-02-01

To express goat IL-18 in insect/baculovirus and detect the bioactivity of the recombinant protein. The mature goat interleukin-18(gIL-18) gene was cloned into the baculovirus transfer vector pFastBac Dual, and then the resulting eukaryotic expression plasmid pFastBac Dual-gIL18 was transformed into DH10Bac, followed by the identification of Bacmid-gIL18 recombinat plosmid by three antibiotics and blue-white patch. Finally, the recombinant bacmid was transfected into sf9 insect cells by Cellfectin and the transfected cells were harvested at different times. Then the expressed protein was identified by SDS-PAGE, Western blot and bioactivity assay. The recombinant protein recognized and bound to its specific antibody. Bioactivity assay showed that the recombinant protein stimulated the proliferation of lymphocytes and induced IFN-γproduction in spleen lymphocytes. The mature gIL-18 protein has been expressed successfully in insect/baculovirus expression system, and have good immunogenicity and bioactivity. The study paves a way for application of gIL-18 as an immunomodulator or immune adjuvant.

Structural divergence among genomes of closely related baculoviruses and its implications for baculovirus evolution

USDA-ARS?s Scientific Manuscript database

Baculoviruses are members of a large, well-characterized family of dsDNA viruses that have been identified from insects of the orders Lepidoptera, Hymenoptera, and Diptera. Baculovirus genomes from different virus species generally exhibit a considerable degree of structural diversity. However, so...

Covert Infection of Insects by Baculoviruses.

PubMed

Williams, Trevor; Virto, Cristina; Murillo, Rosa; Caballero, Primitivo

2017-01-01

Baculoviruses ( Baculoviridae ) are occluded DNA viruses that are lethal pathogens of the larval stages of some lepidopterans, mosquitoes, and sawflies (phytophagous Hymenoptera). These viruses have been developed as biological insecticides for control of insect pests and as expression vectors in biotechnological applications. Natural and laboratory populations frequently harbor covert infections by baculoviruses, often at a prevalence exceeding 50%. Covert infection can comprise either non-productive latency or sublethal infection involving low level production of virus progeny. Latency in cell culture systems involves the expression of a small subset of viral genes. In contrast, covert infection in lepidopterans is associated with differential infection of cell types, modulation of virus gene expression and avoidance of immune system clearance. The molecular basis for covert infection may reside in the regulation of host-virus interactions through the action of microRNAs (miRNA). Initial findings suggest that insect nudiviruses and vertebrate herpesviruses may provide useful analogous models for exploring the mechanisms of covert infection by baculoviruses. These pathogens adopt mixed-mode transmission strategies that depend on the relative fitness gains that accrue through vertical and horizontal transmission. This facilitates virus persistence when opportunities for horizontal transmission are limited and ensures virus dispersal in migratory host species. However, when host survival is threatened by environmental or physiological stressors, latent or persistent infections can be activated to produce lethal disease, followed by horizontal transmission. Covert infection has also been implicated in population level effects on host-pathogen dynamics due to the reduced reproductive capacity of infected females. We conclude that covert infections provide many opportunities to examine the complexity of insect-virus pathosystems at the organismal level and to explore

Covert Infection of Insects by Baculoviruses

PubMed Central

Williams, Trevor; Virto, Cristina; Murillo, Rosa; Caballero, Primitivo

2017-01-01

Baculoviruses (Baculoviridae) are occluded DNA viruses that are lethal pathogens of the larval stages of some lepidopterans, mosquitoes, and sawflies (phytophagous Hymenoptera). These viruses have been developed as biological insecticides for control of insect pests and as expression vectors in biotechnological applications. Natural and laboratory populations frequently harbor covert infections by baculoviruses, often at a prevalence exceeding 50%. Covert infection can comprise either non-productive latency or sublethal infection involving low level production of virus progeny. Latency in cell culture systems involves the expression of a small subset of viral genes. In contrast, covert infection in lepidopterans is associated with differential infection of cell types, modulation of virus gene expression and avoidance of immune system clearance. The molecular basis for covert infection may reside in the regulation of host–virus interactions through the action of microRNAs (miRNA). Initial findings suggest that insect nudiviruses and vertebrate herpesviruses may provide useful analogous models for exploring the mechanisms of covert infection by baculoviruses. These pathogens adopt mixed-mode transmission strategies that depend on the relative fitness gains that accrue through vertical and horizontal transmission. This facilitates virus persistence when opportunities for horizontal transmission are limited and ensures virus dispersal in migratory host species. However, when host survival is threatened by environmental or physiological stressors, latent or persistent infections can be activated to produce lethal disease, followed by horizontal transmission. Covert infection has also been implicated in population level effects on host–pathogen dynamics due to the reduced reproductive capacity of infected females. We conclude that covert infections provide many opportunities to examine the complexity of insect–virus pathosystems at the organismal level and to

Reaching the Melting Point: Degradative Enzymes and Protease Inhibitors Involved in Baculovirus Infection and Dissemination

PubMed Central

Ishimwe, Egide; Hodgson, Jeffrey J.; Clem, Rollie J.; Passarelli, A. Lorena

2015-01-01

Baculovirus infection of a host insect involves several steps, beginning with initiation of virus infection in the midgut, followed by dissemination of infection from the midgut to other tissues in the insect, and finally culminating in “melting” or liquefaction of the host, which allows for horizontal spread of infection to other insects. While all of the viral gene products are involved in ultimately reaching this dramatic infection endpoint, this review focuses on two particular types of baculovirus-encoded proteins: degradative enzymes and protease inhibitors. Neither of these types of proteins is commonly found in other virus families, but they both play important roles in baculovirus infection. The types of degradative enzymes and protease inhibitors encoded by baculoviruses are discussed, as are the roles of these proteins in the infection process. PMID:25724418

A baculovirus-mediated strategy for full-length plant virus coat protein expression and purification.

PubMed

Ardisson-Araújo, Daniel Mendes Pereira; Rocha, Juliana Ribeiro; da Costa, Márcio Hedil Oliveira; Bocca, Anamélia Lorenzetti; Dusi, André Nepomuceno; de Oliveira Resende, Renato; Ribeiro, Bergmann Morais

2013-08-15

Garlic production is severely affected by virus infection, causing a decrease in productivity and quality. There are no virus-free cultivars and garlic-infecting viruses are difficult to purify, which make specific antibody production very laborious. Since high quality antisera against plant viruses are important tools for serological detection, we have developed a method to express and purify full-length plant virus coat proteins using baculovirus expression system and insects as bioreactors. In this work, we have fused the full-length coat protein (cp) gene from the Garlic Mite-borne Filamentous Virus (GarMbFV) to the 3'-end of the Polyhedrin (polh) gene of the baculovirus Autographa californica multiple nucleopolyhedrovirus (AcMNPV). The recombinant baculovirus was amplified in insect cell culture and the virus was used to infect Spodoptera frugiperda larvae. Thus, the recombinant fused protein was easily purified from insect cadavers using sucrose gradient centrifugation and analyzed by Western Blotting. Interestingly, amorphous crystals were produced in the cytoplasm of cells infected with the recombinant virus containing the chimeric-protein gene but not in cells infected with the wild type and recombinant virus containing the hexa histidine tagged Polh. Moreover, the chimeric protein was used to immunize rats and generate antibodies against the target protein. The antiserum produced was able to detect plants infected with GarMbFV, which had been initially confirmed by RT-PCR. The expression of a plant virus full-length coat protein fused to the baculovirus Polyhedrin in recombinant baculovirus-infected insects was shown to produce high amounts of the recombinant protein which was easily purified and efficiently used to generate specific antibodies. Therefore, this strategy can potentially be used for the development of plant virus diagnostic kits for those viruses that are difficult to purify, are present in low titers or are present in mix infection in

A pH-sensitive heparin-binding sequence from Baculovirus gp64 protein is important for binding to mammalian cells but not to Sf9 insect cells.

PubMed

Wu, Chunxiao; Wang, Shu

2012-01-01

Binding to heparan sulfate is essential for baculovirus transduction of mammalian cells. Our previous study shows that gp64, the major glycoprotein on the virus surface, binds to heparin in a pH-dependent way, with a stronger binding at pH 6.2 than at 7.4. Using fluorescently labeled peptides, we mapped the pH-dependent heparin-binding sequence of gp64 to a 22-amino-acid region between residues 271 and 292. Binding of this region to the cell surface was also pH dependent, and peptides containing this sequence could efficiently inhibit baculovirus transduction of mammalian cells at pH 6.2. When the heparin-binding peptide was immobilized onto the bead surface to mimic the high local concentration of gp64 on the virus surface, the peptide-coated magnetic beads could efficiently pull down cells expressing heparan sulfate but not cells pretreated with heparinase or cells not expressing heparan sulfate. Interestingly, although this heparin-binding function is essential for baculovirus transduction of mammalian cells, it is dispensable for infection of Sf9 insect cells. Virus infectivity on Sf9 cells was not reduced by the presence of heparin or the identified heparin-binding peptide, even though the peptide could bind to Sf9 cell surface and be efficiently internalized. Thus, our data suggest that, depending on the availability of the target molecules on the cell surface, baculoviruses can use two different methods, electrostatic interaction with heparan sulfate and more specific receptor binding, for cell attachment.

Baculovirus display of functional antibody Fab fragments.

PubMed

Takada, Shinya; Ogawa, Takafumi; Matsui, Kazusa; Suzuki, Tasuku; Katsuda, Tomohisa; Yamaji, Hideki

2015-08-01

The generation of a recombinant baculovirus that displays antibody Fab fragments on the surface was investigated. A recombinant baculovirus was engineered so that the heavy chain (Hc; Fd fragment) of a mouse Fab fragment was expressed as a fusion to the N-terminus of baculovirus gp64, while the light chain of the Fab fragment was simultaneously expressed as a secretory protein. Following infection of Sf9 insect cells with the recombinant baculovirus, the culture supernatant was analyzed by enzyme-linked immunosorbent assay using antigen-coated microplates and either an anti-mouse IgG or an anti-gp64 antibody. A relatively strong signal was obtained in each case, showing antigen-binding activity in the culture supernatant. In western blot analysis of the culture supernatant using the anti-gp64 antibody, specific protein bands were detected at an electrophoretic mobility that coincided with the molecular weight of the Hc-gp64 fusion protein as well as that of gp64. Flow cytometry using a fluorescein isothiocyanate-conjugated antibody specific to mouse IgG successfully detected the Fab fragments on the surface of the Sf9 cells. These results suggest that immunologically functional antibody Fab fragments can be displayed on the surface of baculovirus particles, and that a fluorescence-activated cell sorter with a fluorescence-labeled antigen can isolate baculoviruses displaying specific Fab fragments. This successful baculovirus display of antibody Fab fragments may offer a novel approach for the efficient selection of specific antibodies.

THE EFFECT OF BACULOVIRUS INFECTION ON ECDYSTEROID TITER IN GYPSY MOTH LARVAE (LYMANTRIA DISPAR).

EPA Science Inventory

Insect baculovirus carries a gene refered to as egt. This gene encodes an enzyme known as ecdysteroid UDP-glucosyl transferase which catalyzes the sugar conjugation of ecdysteroids. Using a gypsy moth embryonic cell line EGT activity of Lymantria dispar nuclear polyhedrosis virus...

Development of antiviral gene therapy for Monodon baculovirus using dsRNA loaded chitosan-dextran sulfate nanocapsule delivery system in Penaeus monodon post-larvae.

PubMed

Ramesh Kumar, D; Elumalai, Rajasegaran; Raichur, Ashok M; Sanjuktha, M; Rajan, J J; Alavandi, S V; Vijayan, K K; Poornima, M; Santiago, T C

2016-07-01

In the present study, a suitable carrier system was developed for the delivery of dsRNA into Penaeus monodon (P. monodon) post larvae to silence the Monodon baculovirus (MBV) structural gene of p74. The carrier system was developed by layer by layer adsorption of oppositely charged chitosan-dextran sulfate, on charged silica nanoparticles. The silica template was removedto produce multilayered hollow nanocapsules (CS-DS) that were utilized for dsRNA loading at an alkaline pH. The capsule's surface was modified by conjugating with shrimp feed for enhanced cellular uptake. In vivo cellular uptake of CS-DS/FITC loaded nanocapsules conjugated with feed was studied after oral administration into post-larvae. The results revealed that the encapsulated FITC was effectively delivered and exhibited a sustained release into the cytoplasm of shrimp post-larvae. The MBV challenge study for structural gene p74was conducted after 3-25 days of post infection (dpi) with respective CS-DS/dsRNA coated with feed. The results showed a significant survival rate of 86.63% and effective gene silencing in P. monodon. Our findings indicated that the delivery of dsRNA using shrimp feed coatedCS-DSnanocapsules could be a novel approach to prevent viral infections in shrimp. Copyright © 2016 Elsevier B.V. All rights reserved.

PAMAM dendrimer-baculovirus nanocomplex for microencapsulated adipose stem cell-gene therapy: in vitro and in vivo functional assessment.

PubMed

Paul, Arghya; Shao, Wei; Abbasi, Sana; Shum-Tim, Dominique; Prakash, Satya

2012-09-04

The present study aims to develop a new stem cell based gene delivery system consisting of human adipose tissue derived stem cells (hASCs) genetically modified with self-assembled nanocomplex of recombinant baculovirus and PAMAM dendrimer (Bac-PAMAM) to overexpress the vascular endothelial growth factor (VEGF). Cells were enveloped into branched PEG surface functionalized polymeric microcapsules for efficient transplantation. In vitro analysis confirmed efficient transduction of hASCs expressing 7.65 ± 0.86 ng functionally active VEGF per 10(6) microencapsulated hASCs (ASC-VEGF). To determine the potential of the developed system, chronically infarcted rat hearts were treated with either empty microcapsules (MC), microencapsulated hASCs expressing MGFP reporter protein (MC+ASC-MGFP), or MC+ASC-VEGF, and analyzed for 10 weeks. Post-transplantation data confirmed higher myocardial VEGF expressions with significantly enhanced neovasculature in the MC+ASC-VEGF group. In addition, the cardiac performance, as measured by percentage ejection fraction, also improved significantly in the MC+ASC-VEGF group (48.6 ± 6.1%) compared to that in MC+ASC-MGFP (38.8 ± 5.3%) and MC groups (31.5 ± 3.3%). Collectively, these data demonstrate the feasibility of this system for improved stem cell therapy applications.

A baculovirus (Bombyx mori nuclear polyhedrosis virus) repeat element functions as a powerful constitutive enhancer in transfected insect cells.

PubMed

Lu, M; Farrell, P J; Johnson, R; Iatrou, K

1997-12-05

It has been previously reported that baculovirus homologous regions, the regions of baculovirus genomes that contain the origins of DNA replication, can augment the expression of a small number of baculovirus genes in vitro. We are now reporting that a region of the genome of Bombyx mori nuclear polyhedrosis virus (BmNPV) containing the homologous region 3 (HR3) acts as an enhancer for the promoter of a nonviral gene, the cytoplasmic actin gene of the silkmoth B. mori. Incorporation of the HR3 sequences of BmNPV into an actin promoter-based expression cassette results in an augmentation of transgene expression in transfected cells by two orders of magnitude relative to the control recombinant expression cassette. This increase is due to a corresponding increase in the rate of transcription from the actin promoter and not to replication of the expression cassette and occurs only when the HR3 element is linked to the expression cassette in cis. A comparable degree of enhancement in the activity of the silkworm actin promoter occurs also in heterologous lepidopteran cells. Concomitant supplementation of transfected cells with the BmIE1 trans-activator, which was previously shown to be capable of functioning in vitro as a transcriptional co-activator of the cytoplasmic actin gene promoter, results in more than a 1,000-fold increase in the level of expression of recombinant proteins placed under the control of the actin gene promoter. These findings provide the foundation for the development of a nonlytic insect cell expression system for continuous high-level expression of recombinant proteins. Such a system should provide levels of expression of recombinant proteins comparable to those obtained from baculovirus expression systems and should also have the additional advantage of continuous production in a cellular environment that, in contrast to that generated by a baculovirus infection, supports continuously proper posttranslational modifications of recombinant

Heterozygous Submicroscopic Inversions Involving Olfactory Receptor–Gene Clusters Mediate the Recurrent t(4;8)(p16;p23) Translocation

PubMed Central

Giglio, Sabrina; Calvari, Vladimiro; Gregato, Giuliana; Gimelli, Giorgio; Camanini, Silvia; Giorda, Roberto; Ragusa, Angela; Guerneri, Silvana; Selicorni, Angelo; Stumm, Marcus; Tonnies, Holger; Ventura, Mario; Zollino, Marcella; Neri, Giovanni; Barber, John; Wieczorek, Dagmar; Rocchi, Mariano; Zuffardi, Orsetta

2002-01-01

The t(4;8)(p16;p23) translocation, in either the balanced form or the unbalanced form, has been reported several times. Taking into consideration the fact that this translocation may be undetected in routine cytogenetics, we find that it may be the most frequent translocation after t(11q;22q), which is the most common reciprocal translocation in humans. Case subjects with der(4) have the Wolf-Hirschhorn syndrome, whereas case subjects with der(8) show a milder spectrum of dysmorphic features. Two pairs of the many olfactory receptor (OR)–gene clusters are located close to each other, on both 4p16 and 8p23. Previously, we demonstrated that an inversion polymorphism of the OR region at 8p23 plays a crucial role in the generation of chromosomal imbalances through unusual meiotic exchanges. These findings prompted us to investigate whether OR-related inversion polymorphisms at 4p16 and 8p23 might also be involved in the origin of the t(4;8)(p16;p23) translocation. In seven case subjects (five of whom both represented de novo cases and were of maternal origin), including individuals with unbalanced and balanced translocations, we demonstrated that the breakpoints fell within the 4p and 8p OR-gene clusters. FISH experiments with appropriate bacterial-artificial-chromosome probes detected heterozygous submicroscopic inversions of both 4p and 8p regions in all the five mothers of the de novo case subjects. Heterozygous inversions on 4p16 and 8p23 were detected in 12.5% and 26% of control subjects, respectively, whereas 2.5% of them were scored as doubly heterozygous. These novel data emphasize the importance of segmental duplications and large-scale genomic polymorphisms in the evolution and pathology of the human genome. PMID:12058347

Dengue-1 Virus Envelope Glycoprotein Gene Expressed in Recombinant Baculovirus Elicits Virus-Neutralizing Antibody in Mice and Protects them from Virus Challenge

DTIC Science & Technology

1991-01-01

8217 terminus of E. When the recombinant virus was grown in Spodoptera frugiperda cells. about I mg of E antigen was made per 10’ cells. Recombinant E antigen...assay with DEN-I virus coprotein gene and its expression in Spodoptera hyperimmune mouse ascitic fluid. This heat-in- frugiperda cells activated...immunization, S. frugiperda cells infected with tion with BstNI (cuts at nucleotides 801 and recombinant baculovirus were pelleted. lysed by 2150). The

Cloning and baculovirus expression of a desiccation stress gene from the beetle, Tenebrio molitor.

PubMed

Graham, L A; Bendena, W G; Walker, V K

1996-02-01

The cDNA sequence encoding a novel desiccation stress protein (dsp28) found in the hemolymph of the common yellow mealworm beetle, Tenebrio molitor, has been determined. The sequence encodes a 225 amino acid protein containing a 20 amino acid signal peptide. Dsp28 shows no significant similarity to any known nucleic acid or protein sequence. Levels of dsp28 mRNA were found to increase approx 5-fold following desiccation. Dsp28 cDNA has been cloned into a baculovirus expression vector and the expressed protein was compared to native dsp28. Both dsp28 expressed by recombinant baculovirus and native dsp28 are glycosylated and N-terminally processed. Although dsp28 is induced by cold in addition to desiccation stress, it does not contribute to the freezing point depression (thermal hysteresis) observed in Tenebrio hemolymph.

Baculovirus enhancins and their role in viral pathogenicity. Chapter 9

Treesearch

James M. Slavicek

2012-01-01

Baculoviruses are a large group of viruses pathogenic to arthropods, primarily insects from the order Lepidoptera and also insects in the orders Hymenoptera and Diptera. Baculoviruses have been used to control insect pests on agricultural crops and forests around the world. Efforts have been ongoing for the last two decades to develop strains of baculoviruses with...

Identification and molecular characterization of the Choristoneura fumiferana multicapsid nucleopolyhedrovirus genomic region encoding the regulatory genes pkip, p47, lef-12, and gta.

PubMed

Lapointe, R; Back, D W; Ding, Q; Carstens, E B

2000-05-25

Choristoneura fumiferana multicapsid nucleopolyhedrovirus (CfMNPV) is a baculovirus pathogenic to spruce budworm, the most damaging insect pest in Canadian forestry. CfMNPV is less virulent to its host insect and its replication cycle is slower than the baculovirus type species Autographa californica multicapsid nucleopolyhedrovirus (AcMNPV) but the basis of these characteristics is not known. We have now identified, localized, and determined the sequence of the region of CfMNPV carrying potentially important regulatory genes including p47, lef-12, gta, and pkip. DNA database searches revealed that this region of CfMNPV is most closely related to the homologous OpMNPV genes. Transcription analysis demonstrated that CfMNPV P47 is encoded by a 1.6-kb transcript, LEF-12 is encoded by a 2.6-kb transcript, and GTA is encoded by a 2.1-kb transcript. Transcripts for these genes were detectable at 6 h postinfection but all of them showed a burst in expression levels between 12 and 24 h postinfection corresponding to the time of initiation of CfMNPV DNA replication. A polyclonal antibody, raised against CfMNPV P47, detected a nuclear 43-kDa polypeptide from 12 to 72 h postinfection, demonstrating that the CfMNPV p47 gene product is first expressed at a time corresponding to the burst of transcriptional activity between the early and the late phases. Both AcMNPV and CfMNPV P47 translocate to the nucleus of infected cells. Copyright 2000 Academic Press.

Baculovirus IE2 Stimulates the Expression of Heat Shock Proteins in Insect and Mammalian Cells to Facilitate Its Proper Functioning.

PubMed

Tung, Hsuan; Wei, Sung-Chan; Lo, Huei-Ru; Chao, Yu-Chan

2016-01-01

Baculoviruses have gained popularity as pest control agents and for protein production in insect systems. These viruses are also becoming popular for gene expression, tissue engineering and gene therapy in mammalian systems. Baculovirus infection triggers a heat shock response, and this response is crucial for its successful infection of host insect cells. However, the viral protein(s) or factor(s) that trigger this response are not yet clear. Previously, we revealed that IE2-an early gene product of the baculovirus-could form unique nuclear bodies for the strong trans-activation of various promoters in mammalian cells. Here, we purified IE2 nuclear bodies from Vero E6 cells and investigated the associated proteins by using mass spectrometry. Heat shock proteins (HSPs) were found to be one of the major IE2-associated proteins. Our experiments show that HSPs are greatly induced by IE2 and are crucial for the trans-activation function of IE2. Interestingly, blocking both heat shock protein expression and the proteasome pathway preserved the IE2 protein and its nuclear body structure, and revived its function. These observations reveal that HSPs do not function directly to assist the formation of the nuclear body structure, but may rather protect IE2 from proteasome degradation. Aside from functional studies in mammalian cells, we also show that HSPs were stimulated and required to determine IE2 protein levels, in insect cells infected with baculovirus. Upon inhibiting the expression of heat shock proteins, baculovirus IE2 was substantially suppressed, resulting in a significantly suppressed viral titer. Thus, we demonstrate a unique feature in that IE2 can function in both insect and non-host mammalian cells to stimulate HSPs, which may be associated with IE2 stabilization and lead to the protection of the its strong gene activation function in mammalian cells. On the other hand, during viral infection in insect cells, IE2 could also strongly stimulate HSPs and

A New theraphosid Spider Toxin Causes Early Insect Cell Death by Necrosis When Expressed In Vitro during Recombinant Baculovirus Infection

PubMed Central

Ardisson-Araújo, Daniel Mendes Pereira; Morgado, Fabrício Da Silva; Schwartz, Elisabeth Ferroni; Corzo, Gerardo; Ribeiro, Bergmann Morais

2013-01-01

Baculoviruses are the most studied insect viruses in the world and are used for biological control of agricultural and forest insect pests. They are also used as versatile vectors for expression of heterologous proteins. One of the major problems of their use as biopesticides is their slow speed to kill insects. Thus, to address this shortcoming, insect-specific neurotoxins from arachnids have been introduced into the baculovirus genome solely aiming to improve its virulence. In this work, an insecticide-like toxin gene was obtained from a cDNA derived from the venom glands of the theraphosid spider Brachypelma albiceps. The mature form of the peptide toxin (called Ba3) has a high content of basic amino acid residues, potential for three possible disulfide bonds, and a predicted three-stranded β-sheetDifferent constructions of the gene were engineered for recombinant baculovirus Autographa californica multiple nuclepolyhedrovirus (AcMNPV) expression. Five different forms of Ba3 were assessed; (1) the full-length sequence, (2) the pro-peptide and mature region, (3) only the mature region, and the mature region fused to an (4) insect or a (5) virus-derived signal peptide were inserted separately into the genome of the baculovirus. All the recombinant viruses induced cell death by necrosis earlier in infection relative to a control virus lacking the toxin gene. However, the recombinant virus containing the mature portion of the toxin gene induced a faster cell death than the other recombinants. We found that the toxin construct with the signal peptide and/or pro-peptide regions delayed the necrosis phenotype. When infected cells were subjected to ultrastructural analysis, the cells showed loss of plasma membrane integrity and structural changes in mitochondria before death. Our results suggest this use of baculovirus is a potential tool to help understand or to identify the effect of insect-specific toxic peptides when produced during infection of insect cells. PMID

Insect cells-baculovirus system for the production of difficult to express proteins.

PubMed

Osz-Papai, Judit; Radu, Laura; Abdulrahman, Wassim; Kolb-Cheynel, Isabelle; Troffer-Charlier, Nathalie; Birck, Catherine; Poterszman, Arnaud

2015-01-01

The production of sufficient quantities of homogenous protein not only is an essential prelude for structural investigations but also represents a rate-limiting step for many human functional studies. Although technologies for expression of recombinant proteins and complexes have been improved tremendously, in many cases, protein production remains a challenge and can be associated with considerable investment. This chapter describes simple and efficient protocols for expression screening and optimization of protein production in insect cells using the baculovirus expression system. We describe the procedure, starting from the cloning of a gene of interest into an expression transfer baculovirus vector, followed by generation of the recombinant virus by homologous recombination, evaluation of protein expression, and scale-up. Handling of insect cell cultures and preparation of bacmid for co-transfection are also detailed.

Baculovirus expression of the avian paramyxovirus 2 HN gene for diagnostic applications.

PubMed

Choi, Kang-Seuk; Kye, Soo-Jeong; Kim, Ji-Ye; Seul, Hee-Jeong; Lee, Hee-Soo; Kwon, Hyuk-Moo; Sung, Haan-Woo

2014-03-01

Avian paramyxovirus 2 (APMV-2) infections are associated with respiratory diseases in poultry worldwide. The hemagglutination inhibition (HI) test is a useful tool for surveillance and monitoring of this virus. In this study, full-length hemagglutinin (HN) gene of APMV-2 was chemically synthesized based on its published sequence, cloned and expressed in Spodoptera frugiperda insect cells using recombinant baculoviruses. The biological, antigenic and immunogenic properties of the expressed protein were evaluated to assess its ability to produce diagnostic reagents for HI testing. Recombinant APMV-2 HN protein showed two distinct bands with molecular masses of 64 and 75kDa, which showed hemagglutination (HA) and neuraminidase activities, respectively. The recombinant HN (rHN) protein extracted from infected cells produced high HA titers (2(13) per 25μL). HA activity of the protein was inhibited by APMV-2 antiserum, although there were weak cross reactions with other APMV serotype antisera. The rHN protein induced high titers of APMV-2-specific antibodies in immunized chickens based on the HI test. These results indicated that recombinant APMV-2 HN protein is a useful alternative to the APMV-2 antigen in HI assays. Copyright © 2013 Elsevier B.V. All rights reserved.

Baculovirus-based genome editing in primary cells.

PubMed

Mansouri, Maysam; Ehsaei, Zahra; Taylor, Verdon; Berger, Philipp

2017-03-01

Genome editing in eukaryotes became easier in the last years with the development of nucleases that induce double strand breaks in DNA at user-defined sites. CRISPR/Cas9-based genome editing is currently one of the most powerful strategies. In the easiest case, a nuclease (e.g. Cas9) and a target defining guide RNA (gRNA) are transferred into a target cell. Non-homologous end joining (NHEJ) repair of the DNA break following Cas9 cleavage can lead to inactivation of the target gene. Specific repair or insertion of DNA with Homology Directed Repair (HDR) needs the simultaneous delivery of a repair template. Recombinant Lentivirus or Adenovirus genomes have enough capacity for a nuclease coding sequence and the gRNA but are usually too small to also carry large targeting constructs. We recently showed that a baculovirus-based multigene expression system (MultiPrime) can be used for genome editing in primary cells since it possesses the necessary capacity to carry the nuclease and gRNA expression constructs and the HDR targeting sequences. Here we present new Acceptor plasmids for MultiPrime that allow simplified cloning of baculoviruses for genome editing and we show their functionality in primary cells with limited life span and induced pluripotent stem cells (iPS). Copyright © 2017 Elsevier Inc. All rights reserved.

The baculovirus-integrated retrotransposon TED encodes gag and pol proteins that assemble into viruslike particles with reverse transcriptase.

PubMed Central

Lerch, R A; Friesen, P D

1992-01-01

TED is a lepidopteran retrotransposon found inserted within the DNA genome of the Autographa californica nuclear polyhedrosis virus mutant, FP-D. To examine the proteins and functions encoded by this representative of the gypsy family of retrotransposons, the gag- and pol-like open reading frames (ORFs 1 and 2) were expressed in homologous lepidopteran cells by using recombinant baculovirus vectors. Expression of ORF 1 resulted in synthesis of an abundant TED-specific protein (Pr55gag) that assembled into viruslike particles with a diameter of 55 to 60 nm. Expression of ORF 2, requiring a -1 translational frameshift, resulted in synthesis of a protease that mediated cleavage of Pr55gag to generate p37, the major protein component of the resulting particles. Expression of ORF 2 also produced reverse transcriptase that associated with these particles. Both protease and reverse transcriptase activities mapped to domains within ORF 2 that contain sequence similarities with the corresponding functional domains of the pol gene of the vertebrate retroviruses. These results indicated that TED ORFs 1 and 2 functionally resemble the retrovirus gag and pol genes and demonstrated for the first time that an invertebrate member of the gypsy family of elements encodes active forms of the structural and enzymatic functions necessary for transposition via an RNA intermediate. TED integration within the baculovirus genome thus represents one of the first examples of transposon-mediated transfer of host-derived genes to an eukaryotic virus. Images PMID:1371168

Baculovirus infection induces disruption of the nuclear lamina.

PubMed

Zhang, Xiaomei; Xu, Kaiyan; Wei, Denghui; Wu, Wenbi; Yang, Kai; Yuan, Meijin

2017-08-10

Baculovirus nucleocapsids egress from the nucleus primarily via budding at the nuclear membrane. The nuclear lamina underlying the nuclear membrane represents a substantial barrier to nuclear egress. Whether the nuclear lamina undergoes disruption during baculovirus infection remains unknown. In this report, we generated a clonal cell line, Sf9-L, that stably expresses GFP-tagged Drosophila lamin B. GFP autofluorescence colocalized with immunofluorescent anti-lamin B at the nuclear rim of Sf9-L cells, indicating GFP-lamin B was incorporated into the nuclear lamina. Meanwhile, virus was able to replicate normally in Sf9-L cells. Next, we investigated alterations to the nuclear lamina during baculovirus infection in Sf9-L cells. A portion of GFP-lamin B localized diffusely at the nuclear rim, and some GFP-lamin B was redistributed within the nucleus during the late phase of infection, suggesting the nuclear lamina was partially disrupted. Immunoelectron microscopy revealed associations between GFP-lamin B and the edges of the electron-dense stromal mattes of the virogenic stroma, intranuclear microvesicles, and ODV envelopes and nucleocapsids within the nucleus, indicating the release of some GFP-lamin B from the nuclear lamina. Additionally, GFP-lamin B phosphorylation increased upon infection. Based on these data, baculovirus infection induced lamin B phosphorylation and disruption of the nuclear lamina.

Evaluation of the Insecticidal Efficacy of Wild Type and Recombinant Baculoviruses.

PubMed

Popham, Holly J R; Ellersieck, Mark R; Li, Huarong; Bonning, Bryony C

2016-01-01

A considerable amount of work has been undertaken to genetically enhance the efficacy of baculovirus insecticides. Following construction of a genetically altered baculovirus, laboratory bioassays are used to quantify various parameters of insecticidal activity such as the median lethal concentration (or dose) required to kill 50 % of infected larvae (LC50 or LD50), median survival of larvae infected (ST50), and feeding damage incurred by infected larvae. In this chapter, protocols are described for a variety of bioassays and the corresponding data analyses for assessment of the insecticidal activity of baculovirus insecticides.

The baculovirus expression vector system: A commercial manufacturing platform for viral vaccines and gene therapy vectors.

PubMed

Felberbaum, Rachael S

2015-05-01

The baculovirus expression vector system (BEVS) platform has become an established manufacturing platform for the production of viral vaccines and gene therapy vectors. Nine BEVS-derived products have been approved - four for human use (Cervarix(®), Provenge(®), Glybera(®) and Flublok(®)) and five for veterinary use (Porcilis(®) Pesti, BAYOVAC CSF E2(®), Circumvent(®) PCV, Ingelvac CircoFLEX(®) and Porcilis(®) PCV). The BEVS platform offers many advantages, including manufacturing speed, flexible product design, inherent safety and scalability. This combination of features and product approvals has previously attracted interest from academic researchers, and more recently from industry leaders, to utilize BEVS to develop next generation vaccines, vectors for gene therapy, and other biopharmaceutical complex proteins. In this review, we explore the BEVS platform, detailing how it works, platform features and limitations and important considerations for manufacturing and regulatory approval. To underscore the growth in opportunities for BEVS-derived products, we discuss the latest product developments in the gene therapy and influenza vaccine fields that follow in the wake of the recent product approvals of Glybera(®) and Flublok(®), respectively. We anticipate that the utility of the platform will expand even further as new BEVS-derived products attain licensure. Finally, we touch on some of the areas where new BEVS-derived products are likely to emerge. Copyright © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

DEVELOPMENT OF AN IN SITU TOXICITY ASSAY SYSTEM USING RECOMBINANT BACULOVIRUSES. (R825433)

EPA Science Inventory

<p>A new method for experimentally analyzing the role of enzymes involved in metabolizing mutagenic, carcinogenic, or cytotoxic chemicals is described. Spodoptera fugiperda (SF-21) cells infected with recombinant baculoviruses are used for high level expression of one or m...

The AAA-ATPase molecular chaperone Cdc48/p97 disassembles sumoylated centromeres, decondenses heterochromatin, and activates ribosomal RNA genes.

PubMed

Mérai, Zsuzsanna; Chumak, Nina; García-Aguilar, Marcelina; Hsieh, Tzung-Fu; Nishimura, Toshiro; Schoft, Vera K; Bindics, János; Slusarz, Lucyna; Arnoux, Stéphanie; Opravil, Susanne; Mechtler, Karl; Zilberman, Daniel; Fischer, Robert L; Tamaru, Hisashi

2014-11-11

Centromeres mediate chromosome segregation and are defined by the centromere-specific histone H3 variant (CenH3)/centromere protein A (CENP-A). Removal of CenH3 from centromeres is a general property of terminally differentiated cells, and the persistence of CenH3 increases the risk of diseases such as cancer. However, active mechanisms of centromere disassembly are unknown. Nondividing Arabidopsis pollen vegetative cells, which transport engulfed sperm by extended tip growth, undergo loss of CenH3; centromeric heterochromatin decondensation; and bulk activation of silent rRNA genes, accompanied by their translocation into the nucleolus. Here, we show that these processes are blocked by mutations in the evolutionarily conserved AAA-ATPase molecular chaperone, CDC48A, homologous to yeast Cdc48 and human p97 proteins, both of which are implicated in ubiquitin/small ubiquitin-like modifier (SUMO)-targeted protein degradation. We demonstrate that CDC48A physically associates with its heterodimeric cofactor UFD1-NPL4, known to bind ubiquitin and SUMO, as well as with SUMO1-modified CenH3 and mutations in NPL4 phenocopy cdc48a mutations. In WT vegetative cell nuclei, genetically unlinked ribosomal DNA (rDNA) loci are uniquely clustered together within the nucleolus and all major rRNA gene variants, including those rDNA variants silenced in leaves, are transcribed. In cdc48a mutant vegetative cell nuclei, however, these rDNA loci frequently colocalized with condensed centromeric heterochromatin at the external periphery of the nucleolus. Our results indicate that the CDC48A(NPL4) complex actively removes sumoylated CenH3 from centromeres and disrupts centromeric heterochromatin to release bulk rRNA genes into the nucleolus for ribosome production, which fuels single nucleus-driven pollen tube growth and is essential for plant reproduction.

The AAA-ATPase molecular chaperone Cdc48/p97 disassembles sumoylated centromeres, decondenses heterochromatin, and activates ribosomal RNA genes

PubMed Central

Mérai, Zsuzsanna; Chumak, Nina; García-Aguilar, Marcelina; Hsieh, Tzung-Fu; Nishimura, Toshiro; Schoft, Vera K.; Bindics, János; Ślusarz, Lucyna; Arnoux, Stéphanie; Opravil, Susanne; Mechtler, Karl; Zilberman, Daniel; Fischer, Robert L.; Tamaru, Hisashi

2014-01-01

Centromeres mediate chromosome segregation and are defined by the centromere-specific histone H3 variant (CenH3)/centromere protein A (CENP-A). Removal of CenH3 from centromeres is a general property of terminally differentiated cells, and the persistence of CenH3 increases the risk of diseases such as cancer. However, active mechanisms of centromere disassembly are unknown. Nondividing Arabidopsis pollen vegetative cells, which transport engulfed sperm by extended tip growth, undergo loss of CenH3; centromeric heterochromatin decondensation; and bulk activation of silent rRNA genes, accompanied by their translocation into the nucleolus. Here, we show that these processes are blocked by mutations in the evolutionarily conserved AAA-ATPase molecular chaperone, CDC48A, homologous to yeast Cdc48 and human p97 proteins, both of which are implicated in ubiquitin/small ubiquitin-like modifier (SUMO)-targeted protein degradation. We demonstrate that CDC48A physically associates with its heterodimeric cofactor UFD1-NPL4, known to bind ubiquitin and SUMO, as well as with SUMO1-modified CenH3 and mutations in NPL4 phenocopy cdc48a mutations. In WT vegetative cell nuclei, genetically unlinked ribosomal DNA (rDNA) loci are uniquely clustered together within the nucleolus and all major rRNA gene variants, including those rDNA variants silenced in leaves, are transcribed. In cdc48a mutant vegetative cell nuclei, however, these rDNA loci frequently colocalized with condensed centromeric heterochromatin at the external periphery of the nucleolus. Our results indicate that the CDC48ANPL4 complex actively removes sumoylated CenH3 from centromeres and disrupts centromeric heterochromatin to release bulk rRNA genes into the nucleolus for ribosome production, which fuels single nucleus-driven pollen tube growth and is essential for plant reproduction. PMID:25344531

Co-expression of human cytochrome P4501A1 (CYP1A1) variants and human NADPH-cytochrome P450 reductase in the baculovirus/insect cell system.

PubMed

Schwarz, D; Kisselev, P; Honeck, H; Cascorbi, I; Schunck, W H; Roots, I

2001-06-01

1. Three human cytochrome P4501A1 (CYP1A1) variants, wild-type (CYP1A1.1), CYP1A1.2 (1462V) and CYP1A1.4 (T461N), were co-expressed with human NADPH-P450 reductase (OR) in Spodoptera frugiperda (Sf9) insect cells by baculovirus co-infection to elaborate a suitable system for studying the role of CYPA1 polymorphism in the metabolism of exogenous and endogenous substrates. 2. A wide range of conditions was examined to optimize co-expression with regard to such parameters as relative multiplicity of infection (MOI), time of harvest, haem precursor supplementation and post-translational stabilization. tinder optimized conditions, almost identical expression levels and molar OR/CYP1A1 ratios (20:1) were attained for all CYP1A1 variants. 3. Microsomes isolated from co-infected cells demonstrated ethoxyresorufin deethlylase activities (nmol/min(-1) nmol(-1) CYP1A1) of 16.0 (CYP1A1.1), 20.5 (CYP1A1.2) and 22.5 (CYP1A1.4). Pentoxyresorufin was dealkylated approximately 10-20 times slower with all enzyme variants. 4. All three CYP1A1 variants were active in metabolizing the precarcinogen benzo[a]pyrene (B[a]P), with wild-type enzyme showing the highest activity, followed by CYP1A1.4 (60%) and CYP1A1.2 (40%). Each variant produced all major metabolites including B[a]P-7,8-dihydrodiol, the precursor of the ultimate carcinogenic species. 5. These studies demonstrate that the baculovirus-mediated co-expression-by-co-infection approach all CYP1A1 variants yields functionally active enzyme systems with similar molar OR/CYP1A1 ratios, thus providing suitable preconditions to examine the metabolism of and environmental chemicals by the different CY1A1 variants.

Enzyme-linked immunosorbent assay using a recombinant baculovirus-expressed Bacillus anthracis protective antigen (PA): measurement of human anti-PA antibodies.

PubMed Central

Iacono-Connors, L C; Novak, J; Rossi, C; Mangiafico, J; Ksiazek, T

1994-01-01

We developed an antigen capture enzyme-linked immunosorbent assay (ELISA) which does not require purified protective antigen (PA) for detection of human antibodies to Bacillus anthracis PA. Lysates of Spodoptera frugiperda (Sf-9) cells infected with recombinant baculovirus containing the PA gene were used as the source of PA to develop the ELISA. Recombinant PA from crude Sf-9 cell lysates or PA purified from B. anthracis Sterne strain was captured by an anti-PA monoclonal antibody coated onto microtiter plates. We demonstrated that human serum antibody titers to PA were identical in the ELISA whether we used crude Sf-9 cell lysates containing recombinant baculovirus-expressed PA or purified Sterne PA. Finally, false-positive results observed in a direct ELISA were eliminated with this antigen capture ELISA. Thus, the antigen capture ELISA with crude preparations of baculovirus-expressed PA is reliable, safe, and inexpensive for determining anti-PA antibody levels in human sera. PMID:7496927

MicroRNAome of Spodoptera frugiperda cells (Sf9) and its alteration following baculovirus infection.

PubMed

Mehrabadi, Mohammad; Hussain, Mazhar; Asgari, Sassan

2013-06-01

MicroRNAs (miRNAs) as small non-coding RNAs play important roles in many biological processes such as development, cell signalling and immune response. Studies also suggest that miRNAs are important in host-virus interactions where the host limits virus infection by differentially expressing miRNAs that target essential viral genes. Here, we identified conserved and new miRNAs from Spodoptera frugiperda cells (Sf9) using a combination of deep sequencing and bioinformatics as well as experimental approaches. S. frugiperda miRNAs share common features of miRNAs in other organisms, such as uracil (U) at the 5' end of miRNA. The 5' ends of the miRNAs were more conserved than the 3' ends, revealing evolutionary protection of the seed region in miRNAs. The predominant miRNAs were found to be conserved among arthropods. The majority of homologous miRNAs were found in Bombyx mori, with 76 of the 90 identified miRNAs. We found that seed shifting and arm switching have happened in this insect's miRNAs. Expression levels of the majority of miRNAs changed following baculovirus infection. Results revealed that baculovirus infection mainly led to an overall suppression of cellular miRNAs. We found four different genes being regulated by sfr-miR-184 at the post-transcriptional level. The data presented here further support conservation of miRNAs in insects and other organisms. In addition, the results reveal a differential expression of host miRNAs upon baculovirus infection, suggesting their potential roles in host-virus interactions. Seed shifting and arm switching happened during evolution of miRNAs in different insects and caused miRNA diversification, which led to changes in the target repository of miRNAs.

Orgyia pseudotsugata baculovirus p10 and polyhedron envelope protein genes: analysis of their relative expression levels and role in polyhedron structure.

PubMed

Gross, C H; Russell, R L; Rohrmann, G F

1994-05-01

To investigate the regulation of p10 and polyhedron envelope protein (PEP) gene expression and their role in polyhedron development, Orgyia pseudotsugata multinucleocapsid nuclear polyhedrosis viruses lacking these genes were constructed. Recombinant viruses were produced, in which the p10 gene, the PEP gene or both genes were disrupted with the beta-glucuronidase (GUS) or beta-galactosidase (lacZ) genes. GUS activity under the control of the PEP protein promoter was observed later in infection and its maximal expression was less than 10% the level for p10 promoter-GUS constructs. Tissues from O. pseudotsugata larvae infected with these recombinants were examined by electron microscopy. Cells from insects infected with the p10- viruses lacked p10-associated fibrillar structures, but fragments of polyhedron envelope-like structures were observed on the surface of some polyhedra. Immunogold labelling of cells infected with the p10-GUS+ virus with an antibody directed against PEP showed that the PEP was concentrated at the surface of polyhedra. Although polyhedra produced by p10 and PEP gene deletion mutants demonstrated what appeared to be a polyhedron envelope by transmission electron microscopy, scanning electron microscopy showed that they had irregular, pitted surfaces that were different from wild-type polyhedra. These data suggested that both p10 and PEP are important for the proper formation of the periphery of polyhedra.

Display of a maize cDNA library on baculovirus infected insect cells.

PubMed

Meller Harel, Helene Y; Fontaine, Veronique; Chen, Hongying; Jones, Ian M; Millner, Paul A

2008-08-12

Maize is a good model system for cereal crop genetics and development because of its rich genetic heritage and well-characterized morphology. The sequencing of its genome is well advanced, and new technologies for efficient proteomic analysis are needed. Baculovirus expression systems have been used for the last twenty years to express in insect cells a wide variety of eukaryotic proteins that require complex folding or extensive posttranslational modification. More recently, baculovirus display technologies based on the expression of foreign sequences on the surface of Autographa californica (AcMNPV) have been developed. We investigated the potential of a display methodology for a cDNA library of maize young seedlings. We constructed a full-length cDNA library of young maize etiolated seedlings in the transfer vector pAcTMVSVG. The library contained a total of 2.5 x 10(5) independent clones. Expression of two known maize proteins, calreticulin and auxin binding protein (ABP1), was shown by western blot analysis of protein extracts from insect cells infected with the cDNA library. Display of the two proteins in infected insect cells was shown by selective biopanning using magnetic cell sorting and demonstrated proof of concept that the baculovirus maize cDNA display library could be used to identify and isolate proteins. The maize cDNA library constructed in this study relies on the novel technology of baculovirus display and is unique in currently published cDNA libraries. Produced to demonstrate proof of principle, it opens the way for the development of a eukaryotic in vivo display tool which would be ideally suited for rapid screening of the maize proteome for binding partners, such as proteins involved in hormone regulation or defence.

Construction of a recombinant baculovirus expressing swine hepatitis E Virus ORF2 and preliminary research on its immune effect.

PubMed

Yang, Z; Hu, Y; Yuan, P; Yang, Y; Wang, K; Xie, L Y; Huang, S L; Liu, J; Ran, L; Song, Z H

2018-03-01

In the swine hepatitis E virus (HEV), open reading frame 2 (ORF2) is rich in antigenic determinants and neutralizing epitopes that could induce immune protection. We chose the Bac-to-Bac® Baculovirus Expression System to express fragments containing the critical neutralizing antigenic sites within the HEV ORF2 protein of pigs to obtain a recombinant baculovirus. The fragment of swine HEV ORF2 region (1198-1881bp) was cloned into vector pFastBacTM. A recombinant baculovirus, rBacmid-ORF2, was obtained after transposition and transfection. The molecular mass of the recombinant protein was 26 kDa. Mice were immunized by the intraperitoneal and oral routes with cell lysates of recombinant baculovirus rBacmid-ORF2. Serum and feces of the mice were collected separately at 0, 14, 28, and 42 d after immunization and the antibody levels of IgG and secretory IgA against swine HEV were determined using an enzyme-linked immunosorbent assay. The results suggested that rBacmid-ORF2 induced antibodies of the humoral and mucosal immune responses in mice and that the oral route was significantly superior to the intraperitoneal route. This is the first study to demonstrate that that recombinant baculovirus swine HEV ORF2 could induce humoral and mucosal immune responses in mice. Copyright© by the Polish Academy of Sciences.

Utilizing the virus-induced blocking of apoptosis in an easy baculovirus titration method

PubMed Central

Niarchos, Athanasios; Lagoumintzis, George; Poulas, Konstantinos

2015-01-01

Baculovirus-mediated protein expression is a robust experimental technique for producing recombinant higher-eukaryotic proteins because it combines high yields with considerable post-translational modification capabilities. In this expression system, the determination of the titer of recombinant baculovirus stocks is important to achieve the correct multiplicity of infection for effective amplification of the virus and high expression of the target protein. To overcome the drawbacks of existing titration methods (e.g., plaque assay, real-time PCR), we present a simple and reliable assay that uses the ability of baculoviruses to block apoptosis in their host cells to accurately titrate virus samples. Briefly, after incubation with serial dilutions of baculovirus samples, Sf9 cells were UV irradiated and, after apoptosis induction, they were viewed via microscopy; the presence of cluster(s) of infected cells as islets indicated blocked apoptosis. Subsequently, baculovirus titers were calculated through the determination of the 50% endpoint dilution. The method is simple, inexpensive, and does not require unique laboratory equipment, consumables or expertise; moreover, it is versatile enough to be adapted for the titration of every virus species that can block apoptosis in any culturable host cells which undergo apoptosis under specific conditions. PMID:26490731

Identification and characterization of the ecdysteroid UDPglucosyltransferase gene of the Lymantria dispar multinucleocapsid nuclear polyhedrosis virus

Treesearch

Christopher I. Riegel; Carita Lanner-Herrera; James M. Slavicek

1994-01-01

We have located, cloned, sequenced and characterized the ecdysteroid UDP-glucosyltransferase gene (egt) gene from the baculovirus Lymantria dispar multinucleocapsid nuclear polyhedrosis virus,(LdMNPV), which is specific for the gypsy moth (L. dispar). The egt gene from the related baculovirus Autographa californica...

A nanobiohybrid complex of recombinant baculovirus and Tat/DNA nanoparticles for delivery of Ang-1 transgene in myocardial infarction therapy.

PubMed

Paul, Arghya; Binsalamah, Zyad M; Khan, Afshan A; Abbasia, Sana; Elias, Cynthia B; Shum-Tim, Dominique; Prakash, Satya

2011-11-01

The study aims to design a new gene delivery method utilizing the complementary strengths of baculovirus, such as relatively high transduction efficiency and easy scale-up, and non-viral nanodelivery systems, such as low immunogenicity. This formulation was developed by generating a self assembled binary complex of negatively charged baculovirus (Bac) and positively charged endosomolytic histidine rich Tat peptide/DNA nanoparticles (NP). The synergistic effect of this hybrid (Bac-NP) system to induce myocardial angiogenesis in acute myocardial infarction (AMI) model has been explored in this study, using Angiopoietin-1 (Ang-1) as the transgene carried by both vector components. Under optimal transduction conditions, Bac-NP(Ang1) showed 1.75 times higher and sustained Ang-1 expression in cardiomyocytes than Bac(Ang1), with significantly high angiogenic potential as confirmed by functional assays. For in vivo analysis, we intramyocardially delivered Bac-NP(Ang1) to AMI rat model. 3 weeks post AMI, data showed increase in capillary density (p < 0.01) and reduction in infarct sizes (p < 0.05) in Bac-NP(Ang1) compared to Bac(Ang1), NP(Ang1) and control groups due to enhanced myocardial Ang-1 expression at peri-infarct regions (1.65 times higher than Bac(Ang1)). Furthermore, the Bac-NP(Ang1) group showed significantly higher cardiac performance in echocardiography than Bac(Ang1) (44.2 ± 4.77% vs 37.46 ± 5.2%, p < 0.01), NP(Ang1) and the control group (32.26 ± 2.49% and 31.58 ± 2.26%). Collectively, this data demonstrates hybrid Bac-NP as a new and improved gene delivery system for therapeutic applications. Crown Copyright © 2011. Published by Elsevier Ltd. All rights reserved.

Identification and characterization of the p35 gene of Bombyx mori nuclear polyhedrosis virus that prevents virus-induced apoptosis.

PubMed Central

Kamita, S G; Majima, K; Maeda, S

1993-01-01

Nucleotide sequence analysis of the Bombyx mori nuclear polyhedrosis virus (BmNPV) genome revealed the existence of a gene homologous to the p35 gene of Autographa californica NPV (AcNPV), which has been shown to prevent virus-induced apoptosis. The BmNPV p35 gene showed 96.1% nucleotide and 89.6% predicted amino acid sequence identity to the AcNPV p35 gene. A mutant BmNPV (BmP35Z) lacking a functional p35 gene induced apoptosis-like cell degradation in infected BmN cells. However, unlike the p35-deleted AcNPV mutant (vAcAnh), BmP35Z replicated normally and produced polyhedral inclusion bodies. The patterns of protein synthesis and the percentages of viable BmN cells remaining following infection with either wild-type BmNPV or BmP35Z were nearly identical. BmP35Z also replicated in silkworm larvae without showing any apparent apoptotic response in infected hemocytes, fat body, or other tissues. Time to death of larvae infected with BmP35Z was similar to that for wild-type-infected larvae, and significant numbers of polyhedral inclusion bodies were produced. These results indicate that viral factors (or genes) other than p35 or host cell factors play a role in inducing, accelerating, or interfering with apoptotic processes. The evolution of baculovirus genomes is also discussed with reference to comparative analysis of the p35 and p94 gene sequences. The p94 gene is found immediately upstream of p35 in AcNPV; in BmNPV, however, the p94 gene was nearly completely missing, presumably because of large deletions in a BmNPV ancestor virus having a gene similar to the AcNPV p94 gene. Images PMID:8416377

A Conserved Role for p48 Homologs in Protecting Dopaminergic Neurons from Oxidative Stress

PubMed Central

Bou Dib, Peter; Gnägi, Bettina; Daly, Fiona; Sabado, Virginie; Tas, Damla; Glauser, Dominique A.; Meister, Peter; Nagoshi, Emi

2014-01-01

Parkinson's disease (PD) is the most common neurodegenerative movement disorder characterized by the progressive loss of dopaminergic (DA) neurons. Both environmental and genetic factors are thought to contribute to the pathogenesis of PD. Although several genes linked to rare familial PD have been identified, endogenous risk factors for sporadic PD, which account for the majority of PD cases, remain largely unknown. Genome-wide association studies have identified many single nucleotide polymorphisms associated with sporadic PD in neurodevelopmental genes including the transcription factor p48/ptf1a. Here we investigate whether p48 plays a role in the survival of DA neurons in Drosophila melanogaster and Caenorhabditis elegans. We show that a Drosophila p48 homolog, 48-related-2 (Fer2), is expressed in and required for the development and survival of DA neurons in the protocerebral anterior medial (PAM) cluster. Loss of Fer2 expression in adulthood causes progressive PAM neuron degeneration in aging flies along with mitochondrial dysfunction and elevated reactive oxygen species (ROS) production, leading to the progressive locomotor deficits. The oxidative stress challenge upregulates Fer2 expression and exacerbates the PAM neuron degeneration in Fer2 loss-of-function mutants. hlh-13, the worm homolog of p48, is also expressed in DA neurons. Unlike the fly counterpart, hlh-13 loss-of-function does not impair development or survival of DA neurons under normal growth conditions. Yet, similar to Fer2, hlh-13 expression is upregulated upon an acute oxidative challenge and is required for the survival of DA neurons under oxidative stress in adult worms. Taken together, our results indicate that p48 homologs share a role in protecting DA neurons from oxidative stress and degeneration, and suggest that loss-of-function of p48 homologs in flies and worms provides novel tools to study gene-environmental interactions affecting DA neuron survival. PMID:25340742

The xeroderma pigmentosum group B protein ERCC3 produced in the baculovirus system exhibits DNA helicase activity.

PubMed Central

Ma, L; Siemssen, E D; Noteborn, H M; van der Eb, A J

1994-01-01

The XPB/ERCC3 gene corrects the nucleotide excision-repair defect in the human hereditary disease xeroderma pigmentosum group B and encodes the largest subunit of the basal transcription factor BTF2/TFIIH. The primary sequence of the XPB/ERCC3 protein features the hallmarks of seven helicase motifs found in many known and putative helicases or helicase-related proteins. Recently, the multiprotein BTF2/TFIIH complex has been found to be associated with DNA helicase activity. To explore the properties and functions of XPB/ERCC3, we have used the baculovirus/insect-cell expression system to produce recombinant protein. We report here the construction and analysis of recombinant baculovirus expressing XPB/ERCC3. The XPB/ERCC3 protein is synthesized at a relatively high level in baculovirus-infected insect cells. While the majority of XPB/ERCC3 end up in the insoluble fraction of insect cell lysates, a minor fraction of recombinant protein is present in soluble form which can be purified under native conditions. We have found that a DNA helicase activity is associated with the purified XPB/ERCC3 protein, suggesting that XPB/ERCC3 may function as a DNA helicase in local unwinding of DNA template both in the context of transcription and nucleotide excision repair. Images PMID:7937133

Characterization of viral proteins of Oryctes baculovirus and comparison between two geographical isolates.

PubMed

Mohan, K S; Gopinathan, K P

1989-01-01

Bacilliform Oryctes baculovirus particles have been visualized in electron micrographs of midgut sections from virus infected Oryctes rhinoceros beetles. Morphologically the Indian isolate (Oryctes baculovirus, KI) resembled the previously reported Oryctes baculovirus, isolate PV505. The constituent proteins of baculovirus KI have been analysed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and by Western blots using polyclonal antibodies raised against the complete viral particles, as probes. A total of forty eight viral proteins have been identified. Fourteen viral proteins were located on the viral envelope. Among the proteins constituting the nucleocapsid, three were located internally within the capsid. A 23.5 kDa protein was tightly associated with viral DNA in the nucleocapsid core. Two envelope and seven capsid proteins of KI and PV505 revealed differences in SDS-PAGE profiles and glycosylation patterns. Immunoblotting of KI and PV505 proteins with anti KI antiserum demonstrated antigenic differences between the two viral isolates.

A Novel Ideal Radionuclide Imaging System for Non-invasively Cell Monitoring built on Baculovirus Backbone by Introducing Sleeping Beauty Transposon

PubMed Central

Lv, Jing; Pan, Yu; Ju, Huijun; Zhou, Jinxin; Cheng, Dengfeng; Shi, Hongcheng; Zhang, Yifan

2017-01-01

Sleeping Beauty (SB) transposon is an attractive tool in stable transgene integration both in vitro and in vivo; and we introduced SB transposon into recombinant sodium-iodide symporter baculovirus system (Bac-NIS system) to facilitate long-term expression of recombinant sodium-iodide symporter. In our study, two hybrid baculovirus systems (Bac-eGFP-SB-NeoR and Bac-NIS-SB-NeoR) were successfully constructed and used to infect U87 glioma cells. After G418 selection screening, the Bac-eGFP-SB-NeoR-U87 cells remained eGFP positive, at the 18th and 196th day post transfection (96.03 ± 0.21% and 97.43 ± 0.81%), while eGFP positive population declined significantly at 18 days in cells transfected with unmodified baculovirus construct. NIS gene expression by Bac-NIS-SB-NeoR-U87 cells was also maintained for 28 weeks as determined by radioiodine uptake assay, reverse transcription-polymerase chain reaction (RT-PCR) and Western Blot (WB) assay. When transplanted in mice, Bac-NIS-SB-NeoR-U87 cells also expressed NIS gene stably as monitored by SPECT imaging for 43 days until the tumor-bearing mice were sacrificed. Herein, we showed that incorporation of SB in Bac-NIS system (hybrid Bac-NIS-SB-NeoR) can achieve a long-term transgene expression and can improve radionuclide imaging in cell tracking and monitoring in vivo. PMID:28262785

CRISPR-Cas9 vectors for genome editing and host engineering in the baculovirus-insect cell system.

PubMed

Mabashi-Asazuma, Hideaki; Jarvis, Donald L

2017-08-22

The baculovirus-insect cell system (BICS) has been widely used to produce many different recombinant proteins for basic research and is being used to produce several biologics approved for use in human or veterinary medicine. Early BICS were technically complex and constrained by the relatively primordial nature of insect cell protein glycosylation pathways. Since then, recombination has been used to modify baculovirus vectors-which has simplified the system-and transform insect cells, which has enhanced its protein glycosylation capabilities. Now, CRISPR-Cas9 tools for site-specific genome editing are needed to facilitate further improvements in the BICS. Thus, in this study, we used various insect U6 promoters to construct CRISPR-Cas9 vectors and assessed their utility for site-specific genome editing in two insect cell lines commonly used as hosts in the BICS. We demonstrate the use of CRISPR-Cas9 to edit an endogenous insect cell gene and alter protein glycosylation in the BICS.

BACULOVIRUS REPLICATION ALTERS HORMONE-REGULATED HOST DEVELOPMENT.

EPA Science Inventory

The baculovirus Lymantria dispar nuclear polyhedrosis virus interferes with insect larval development by altering the host's hormonal system. The level of haemolymph ecdysteroids, the insect moulting hormone, was found to be higher in virus-infected larvae than in uninfected cont...

Baculovirus Insecticides in Latin America: Historical Overview, Current Status and Future Perspectives

PubMed Central

Haase, Santiago; Sciocco-Cap, Alicia; Romanowski, Víctor

2015-01-01

Baculoviruses are known to regulate many insect populations in nature. Their host-specificity is very high, usually restricted to a single or a few closely related insect species. They are amongst the safest pesticides, with no or negligible effects on non-target organisms, including beneficial insects, vertebrates and plants. Baculovirus-based pesticides are compatible with integrated pest management strategies and the expansion of their application will significantly reduce the risks associated with the use of synthetic chemical insecticides. Several successful baculovirus-based pest control programs have taken place in Latin American countries. Sustainable agriculture (a trend promoted by state authorities in most Latin American countries) will benefit from the wider use of registered viral pesticides and new viral products that are in the process of registration and others in the applied research pipeline. The success of baculovirus-based control programs depends upon collaborative efforts among government and research institutions, growers associations, and private companies, which realize the importance of using strategies that protect human health and the environment at large. Initiatives to develop new regulations that promote the use of this type of ecological alternatives tailored to different local conditions and farming systems are underway. PMID:25941826

Baculovirus replication induces the expression of heat shock proteins in vivo and in vitro

USDA-ARS?s Scientific Manuscript database

A recent handful of studies have linked baculovirus infection with the induction of heat shock proteins, a highly conserved family of cytoprotective proteins. Here, we demonstrate baculovirus-stimulated upregulation of hsp70 transcription in the natural host, Helicoverpa zea. Larvae lethally infec...

Gene gymnastics

PubMed Central

Vijayachandran, Lakshmi S; Thimiri Govinda Raj, Deepak B; Edelweiss, Evelina; Gupta, Kapil; Maier, Josef; Gordeliy, Valentin; Fitzgerald, Daniel J; Berger, Imre

2013-01-01

Most essential activities in eukaryotic cells are catalyzed by large multiprotein assemblies containing up to ten or more interlocking subunits. The vast majority of these protein complexes are not easily accessible for high resolution studies aimed at unlocking their mechanisms, due to their low cellular abundance and high heterogeneity. Recombinant overproduction can resolve this bottleneck and baculovirus expression vector systems (BEVS) have emerged as particularly powerful tools for the provision of eukaryotic multiprotein complexes in high quality and quantity. Recently, synthetic biology approaches have begun to make their mark in improving existing BEVS reagents by de novo design of streamlined transfer plasmids and by engineering the baculovirus genome. Here we present OmniBac, comprising new custom designed reagents that further facilitate the integration of heterologous genes into the baculovirus genome for multiprotein expression. Based on comparative genome analysis and data mining, we herein present a blueprint to custom design and engineer the entire baculovirus genome for optimized production properties using a bottom-up synthetic biology approach. PMID:23328086

The silencing suppressor (NSs) protein of the plant virus Tomato spotted wilt virus enhances heterologous protein expression and baculovirus pathogenicity in cells and lepidopteran insects.

PubMed

de Oliveira, Virgínia Carla; da Silva Morgado, Fabricio; Ardisson-Araújo, Daniel Mendes Pereira; Resende, Renato Oliveira; Ribeiro, Bergmann Morais

2015-11-01

In this work, we showed that cell death induced by a recombinant (vAcNSs) Autographa californica multiple nucleopolyhedrovirus (AcMNPV) expressing the silencing suppressor (NSs) protein of Tomato spotted wilt virus (TSWV) was enhanced on permissive and semipermissive cell lines. The expression of a heterologous gene (firefly luciferase) during co-infection of insect cells with vAcNSs and a second recombinant baculovirus (vAgppolhfluc) was shown to increase when compared to single vAgppolhfluc infections. Furthermore, the vAcNSs mean time-to-death values were significantly lower than those for wild-type AcMNPV on larvae of Spodoptera frugiperda and Anticarsia gemmatalis. These results showed that the TSWV-NSs protein could efficiently increase heterologous protein expression in insect cells as well as baculovirus pathogenicity and virulence, probably by suppressing the gene-silencing machinery in insects.

Comparative studies of lepidopteran baculovirus-specific protein FP25K: development of a novel Bombyx mori nucleopolyhedrovirus-based vector with a modified fp25K gene.

PubMed

Nakanishi, Tadashi; Goto, Chie; Kobayashi, Michihiro; Kang, Wonkyung; Suzuki, Takehiro; Dohmae, Naoshi; Matsumoto, Shogo; Shimada, Toru; Katsuma, Susumu

2010-05-01

Lepidopteran baculovirus-specific protein FP25K performs many roles during the infection cycle, including functions in the production of occlusion bodies (OBs) and budded viruses (BVs), oral infection, and postmortem host degradation. To explore the common and specific functions of FP25K proteins among lepidopteran baculoviruses, we performed comparative analyses of FP25K proteins from group I and group II nucleopolyhedroviruses (NPVs) and granulovirus (GV). Using recombinant Bombyx mori NPVs (BmNPVs), we showed that the FP25Ks from NPVs were able to eliminate all the phenotypic defects observed in an infection with a BmNPV mutant lacking functional fp25K but that FP25K from GV did not show abilities to recover oral infectivity and postmortem host degradation. We also observed that introduction of Autographa californica multiple NPV (AcMNPV) fp25K into the BmNPV genome enhanced OB and BV production. According to these results, we generated a novel BmNPV-based expression vector with AcMNPV fp25K and examined its potential in BmN cells and B. mori larvae. Our results showed that the introduction of AcMNPV fp25K significantly increases the expression of foreign gene products in cultured cells and shortens the time for obtaining the secreted recombinant proteins from larval hemolymph.

Improved Production Efficiency of Virus-Like Particles by the Baculovirus Expression Vector System.

PubMed

López-Vidal, Javier; Gómez-Sebastián, Silvia; Bárcena, Juan; Nuñez, Maria del Carmen; Martínez-Alonso, Diego; Dudognon, Benoit; Guijarro, Eva; Escribano, José M

2015-01-01

Vaccines based on virus-like particles (VLPs) have proven effective in humans and animals. In this regard, the baculovirus expression vector system (BEVS) is one of the technologies of choice to generate such highly immunogenic vaccines. The extended use of these vaccines for human and animal populations is constrained because of high production costs, therefore a significant improvement in productivity is crucial to ensure their commercial viability. Here we describe the use of the previously described baculovirus expression cassette, called TB, to model the production of two VLP-forming vaccine antigens in insect cells. Capsid proteins from porcine circovirus type 2 (PCV2 Cap) and from the calicivirus that causes rabbit hemorrhagic disease (RHDV VP60) were expressed in insect cells using baculoviruses genetically engineered with the TB expression cassette. Productivity was compared to that obtained using standard counterpart vectors expressing the same proteins under the control of the polyhedrin promoter. Our results demonstrate that the use of the TB expression cassette increased the production yields of these vaccine antigens by around 300% with respect to the standard vectors. The recombinant proteins produced by TB-modified vectors were fully functional, forming VLPs identical in size and shape to those generated by the standard baculoviruses, as determined by electron microscopy analysis. The use of the TB expression cassette implies a simple modification of the baculovirus vectors that significantly improves the cost efficiency of VLP-based vaccine production, thereby facilitating the commercial viability and broad application of these vaccines for human and animal health.

Improved Production Efficiency of Virus-Like Particles by the Baculovirus Expression Vector System

PubMed Central

Bárcena, Juan; Nuñez, Maria del Carmen; Martínez-Alonso, Diego; Dudognon, Benoit; Guijarro, Eva; Escribano, José M.

2015-01-01

Vaccines based on virus-like particles (VLPs) have proven effective in humans and animals. In this regard, the baculovirus expression vector system (BEVS) is one of the technologies of choice to generate such highly immunogenic vaccines. The extended use of these vaccines for human and animal populations is constrained because of high production costs, therefore a significant improvement in productivity is crucial to ensure their commercial viability. Here we describe the use of the previously described baculovirus expression cassette, called TB, to model the production of two VLP-forming vaccine antigens in insect cells. Capsid proteins from porcine circovirus type 2 (PCV2 Cap) and from the calicivirus that causes rabbit hemorrhagic disease (RHDV VP60) were expressed in insect cells using baculoviruses genetically engineered with the TB expression cassette. Productivity was compared to that obtained using standard counterpart vectors expressing the same proteins under the control of the polyhedrin promoter. Our results demonstrate that the use of the TB expression cassette increased the production yields of these vaccine antigens by around 300% with respect to the standard vectors. The recombinant proteins produced by TB-modified vectors were fully functional, forming VLPs identical in size and shape to those generated by the standard baculoviruses, as determined by electron microscopy analysis. The use of the TB expression cassette implies a simple modification of the baculovirus vectors that significantly improves the cost efficiency of VLP-based vaccine production, thereby facilitating the commercial viability and broad application of these vaccines for human and animal health. PMID:26458221

Baculovirus expression system and method for high throughput expression of genetic material

DOEpatents

Clark, Robin; Davies, Anthony

2001-01-01

The present invention provides novel recombinant baculovirus expression systems for expressing foreign genetic material in a host cell. Such expression systems are readily adapted to an automated method for expression foreign genetic material in a high throughput manner. In other aspects, the present invention features a novel automated method for determining the function of foreign genetic material by transfecting the same into a host by way of the recombinant baculovirus expression systems according to the present invention.

[Analysis of horizontal transfer gene of Bombyx mori NPV].

PubMed

Duan, Hai-Rong; Qiu, De-Bin; Gong, Cheng-Liang; Huang, Mo-Li

2011-06-01

For research on genetic characters and evolutionary origin of the genome of baculoviruses, a comprehensive homology search and phylogenetic analysis of the complete genomes of Bombyx mori NPV and Bombyx mori were used. Three horizontally transferred genes (inhibitor of apoptosis, chitinase, and UDP-glucosyltransferase) were identified, and there was evidence that all of these genes were derived from the insect host. The results of analysis showed lots of differences between the features of horizontal transferred genes and the ones of whole genomic genes, such as nucleotide composition, codon usagebias and selection pressure. These results reconfirmed that the horizontally transferred genes are exogenous. The analysis of gene function suggested that horizontally transferred genes acquired from an ancestral host insect can increase the efficiency of baculoviruses transmission.

Patterns of Proteins that Associate with p53 or with p53 Binding Sites Present in the Ribosomal Gene Cluster and MDM2 (P2) Promoter

DTIC Science & Technology

2000-08-01

Spodoptera frugiperda (Sf21) cells were infected with a recombinant baculovirus expressing the wild-type human p53. 3-4 and 10-1 cells were grown at 37 ’C in...for further use. Spodoptera fugiperda (Sf21) cells were grown at 27 0C in TC-100 medium (GIBCO), supplemented with 10% of heat inactivated Fetal

Antigenic evaluation of a recombinant baculovirus-expressed Sarcocystis neurona SAG1 antigen.

PubMed

Gupta, G D; Lakritz, J; Saville, W J; Livingston, R S; Dubey, J P; Middleton, J R; Marsh, A E

2004-10-01

Sarcocystis neurona is the primary parasite associated with equine protozoal myeloencephalitis (EPM). This is a commonly diagnosed neurological disorder in the Americas that infects the central nervous system of horses. Current serologic assays utilize culture-derived parasites as antigen. This method requires large numbers of parasites to be grown in culture, which is labor intensive and time consuming. Also, a culture-derived whole-parasite preparation contains conserved antigens that could cross-react with antibodies against other Sarcocystis species and members of Sarcocystidae such as Neospora spp., Hammondia spp., and Toxoplasma gondii. Therefore, there is a need to develop an improved method for the detection of S. neurona-specific antibodies. The sera of infected horses react strongly to surface antigen 1 (SnSAG1), an approximately 29-kDa protein, in immunoblot analysis, suggesting that it is an immunodominant antigen. The SnSAG1 gene of S. neurona was cloned, and recombinant S. neurona SAG1 protein (rSnSAG1-Bac) was expressed with the use of a baculovirus system. By immunoblot analysis, the rSnSAG1-Bac antigen detected antibodies to S. neurona from naturally infected and experimentally inoculated equids, cats, rabbit, mice, and skunk. This is the first report of a baculovirus-expressed recombinant S. neurona antigen being used to detect anti-S. neurona antibodies in a variety of host species.

Purification of functional baculovirus particles from silkworm larval hemolymph and their use as nanoparticles for the detection of human prorenin receptor (PRR) binding

PubMed Central

2011-01-01

Background Baculovirus, which has a width of 40 nm and a length of 250-300 nm, can display functional peptides, receptors and antigens on its surface by their fusion with a baculovirus envelop protein, GP64. In addition, some transmembrane proteins can be displayed without GP64 fusion, using the native transmembrane domains of the baculovirus. We used this functionality to display human prorenin receptor fused with GFPuv (GFPuv-hPRR) on the surface of silkworm Bombyx mori nucleopolyhedrovirus (BmNPV) and then tested whether these baculovirus particles could be used to detect protein-protein interactions. Results BmNPV displaying GFPuv-hPRR (BmNPV-GFPuv-hPRR) was purified from hemolymph by using Sephacryl S-1000 column chromatography in the presence of 0.01% Triton X-100. Its recovery was 86% and the final baculovirus particles number was 4.98 × 108 pfu. Based on the results of enzyme-linked immunosorbent assay (ELISA), 3.1% of the total proteins in BmNPV-GFPuv-hPRR were GFPuv-hPRR. This value was similar to that calculated from the result of western blot by a densitometry (2.7%). To determine whether BmNPV-GFPuv-hPRR particles were bound to human prorenin, ELISA results were compared with those from ELISAs using protease negative BmNPV displaying β1,3-N-acetylglucosaminyltransferase 2 fused with the gene encoding GFPuv (GGT2) (BmNPV-CP--GGT2) particles, which do not display hPRR on their surfaces. Conclusion The display of on the surface of the BmNPV particles will be useful for the detection of protein-protein interactions and the screening of inhibitors and drugs in their roles as nanobioparticles. PMID:21635720

A silencing suppressor protein (NSs) of a tospovirus enhances baculovirus replication in permissive and semipermissive insect cell lines.

PubMed

Oliveira, Virgínia Carla; Bartasson, Lorrainy; de Castro, Maria Elita Batista; Corrêa, José Raimundo; Ribeiro, Bergmann Morais; Resende, Renato Oliveira

2011-01-01

The nonstructural protein (NSs) of the Tomato spotted wilt virus (TSWV) has been identified as an RNAi suppressor in plant cells. A recombinant Autographa californica multiple nucleopolyhedrovirus (AcMNPV) designated vAcNSs, containing the NSs gene under the control of the viral polyhedrin (polh) gene promoter, was constructed and the effects of NSs in permissive, semipermissive and nonpermissive insect cells to vAcNSs infection were evaluated. vAcNSs produced more budded virus when compared to wild type in semipermissive cells. Co-infection of vAcNSs with wild type baculoviruses clearly enhanced polyhedra production in all host cells. Confocal microscopy analysis showed that NSs accumulated in abundance in the cytoplasm of permissive and semipermissive cells. In contrast, high amounts of NSs were detected in the nuclei of nonpermissive cells. Co-infection of vAcNSs with a recombinant AcMNPV containing the enhanced green fluorescent protein (egfp) gene, significantly increased EGFP expression in semipermissive cells and in Anticarsia gemmatalis-hemocytes. Absence of small RNA molecules of egfp transcripts in this cell line and in a permissive cell line indicates the suppression of gene silencing activity. On the other hand, vAcNSs was not able to suppress RNAi in a nonpermissive cell line. Our data showed that NSs protein of TSWV facilitates baculovirus replication in different lepidopteran cell lines, and these results indicate that NSs could play a similar role during TSWV-infection in its thrips vector. Copyright © 2010 Elsevier B.V. All rights reserved.

Glycobiotechnology of the Insect Cell-Baculovirus Expression System Technology.

PubMed

Palomares, Laura A; Srivastava, Indresh K; Ramírez, Octavio T; Cox, Manon M J

2018-06-10

The insect cell-baculovirus expression system technology (BEST) has a prominent role in producing recombinant proteins to be used as research and diagnostic reagents and vaccines. The glycosylation profile of proteins produced by the BEST is composed predominantly of terminal mannose glycans, and, in Trichoplusia ni cell lines, core α3 fucosylation, a profile different to that in mammals. Insects contain all the enzymatic activities needed for complex N- and O-glycosylation and sialylation, although few reports of complex glycosylation and sialylation by the BEST exist. The insect cell line and culture conditions determine the glycosylation profile of proteins produced by the BEST. The promoter used, dissolved oxygen tension, presence of sugar precursors, bovine serum or hemolymph, temperature, and the time of harvest all influence glycosylation, although more research is needed. The lack of activity of glycosylation enzymes possibly results from the transcription regulation and stress imposed by baculovirus infection. To solve this limitation, the glycosylation pathway of insect cells has been engineered to produce complex sialylated glycans and to eliminate α3 fucosylation, either by generating transgenic cell lines or by using baculovirus vectors. These strategies have been successful. Complex glycosylation, sialylation, and inhibition of α3 fucosylation have been achieved, although the majority of glycans still have terminal mannose residues. The implication of insect glycosylation in the proteins produced by the BEST is discussed. Graphical Abstract.

Caenorhabditis elegans UBX cofactors for CDC-48/p97 control spermatogenesis.

PubMed

Sasagawa, Yohei; Yamanaka, Kunitoshi; Saito-Sasagawa, Yuko; Ogura, Teru

2010-12-01

UBX (ubiquitin regulatory X) domain-containing proteins act as cofactors for CDC-48/p97. CDC-48/p97 is essential for various cellular processes including retro-translocation in endoplasmic reticulum-associated degradation, homotypic membrane fusion, nuclear envelope assembly, degradation of ubiquitylated proteins, and cell cycle progression. CDC-48/p97-dependent processes are determined by differential binding of cofactors including UBX proteins, but the cellular functions of UBX proteins have not yet been elucidated, especially in multicellular organisms. Therefore, we investigated the functions of UBX family members using Caenorhabditis elegans, which expresses six UBX proteins, UBXN-1 to UBXN-6. All six UBXN proteins directly interacted with CDC-48.1 and CDC-48.2, and simultaneous knockdown of the expression of three genes, ubxn-1, ubxn-2 and ubxn-3, induced embryonic lethal and sterile phenotypes, but knockdown of either one or two did not. The sterile worms had a feminized germ-line phenotype, producing oocytes but no sperm. UBXN-1, UBXN-2 and UBXN-3 colocalized with CDC-48 in spermatocytes but not mature sperm. TRA-1A, which is a key factor in the sex determination pathway and inhibits spermatogenesis, accumulated in worms in which UBXN-1, UBXN-2 and UBXN-3 had been simultaneously knocked down. Taken together, these results suggest that UBXN-1, UBXN-2 and UBXN-3 are redundant cofactors for CDC-48/p97 and control spermatogenesis via the degradation of TRA-1A. © 2010 The Authors. Journal compilation © 2010 by the Molecular Biology Society of Japan/Blackwell Publishing Ltd.

How baculovirus polyhedra fit square pegs into round holes to robustly package viruses.

PubMed

Ji, Xiaoyun; Sutton, Geoff; Evans, Gwyndaf; Axford, Danny; Owen, Robin; Stuart, David I

2010-01-20

Natural protein crystals (polyhedra) armour certain viruses, allowing them to survive for years under hostile conditions. We have determined the structure of polyhedra of the baculovirus Autographa californica multiple nucleopolyhedrovirus (AcMNPV), revealing a highly symmetrical covalently cross-braced robust lattice, the subunits of which possess a flexible adaptor enabling this supra-molecular assembly to specifically entrap massive baculoviruses. Inter-subunit chemical switches modulate the controlled release of virus particles in the unusual high pH environment of the target insect's gut. Surprisingly, the polyhedrin subunits are more similar to picornavirus coat proteins than to the polyhedrin of cytoplasmic polyhedrosis virus (CPV). It is, therefore, remarkable that both AcMNPV and CPV polyhedra possess identical crystal lattices and crystal symmetry. This crystalline arrangement must be particularly well suited to the functional requirements of the polyhedra and has been either preserved or re-selected during evolution. The use of flexible adaptors to generate a powerful system for packaging irregular particles is characteristic of the AcMNPV polyhedrin and may provide a vehicle to sequester a wide range of objects such as biological nano-particles.

The pnk/pnl gene (ORF 86) of Autographa californica nucleopolyhedrovirus is a non-essential, immediate early gene.

PubMed

Durantel, D; Croizier, L; Ayres, M D; Croizier, G; Possee, R D; López-Ferber, M

1998-03-01

Autographa californica nucleopolyhedrovirus (AcMNPV) ORF 86, located within the HindIII C fragment, potentially encodes a protein which shares sequence similarity with two T4 bacteriophage gene products, RNA ligase and polynucleotide kinase. This AcMNPV gene has been designated pnk/pnl but has yet to be assigned a function in virus replication. It has been classified as an immediate early virus gene, since the promoter was active in uninfected insect cells and mRNA transcripts were detectable from 4 to 48 h post-infection and in the presence of cycloheximide or aphidicolin in virus-infected cells. The extremities of the transcript have been mapped by primer extension and 3' RACE-PCR to positions -18 from the translational start codon and +15 downstream of the stop codon. The function of pnk/pnl was investigated by producing a recombinant virus (Acdel86lacZ) with the coding region replaced with that of lacZ. This virus replicated normally in Spodoptera frugiperda (Sf 21) cells, indicating that pnk/pnl is not essential for propagation in these cells. Virus protein production in Acdel86lacZ-infected Sf 21 cells also appeared to be unaffected, with normal synthesis of the IE-1, GP64, VP39 and polyhedrin proteins. Shut-down of host protein synthesis was not abolished in recombinant infection. When other baculovirus genomes were examined for the presence of pnk/pnl by restriction enzyme digestion and PCR, a deletion was found in AcMNPV 1.2, Galleria mellonella NPV (GmMNPV) and Bombyx mori NPV (BmNPV), suggesting that in many isolates this gene has either never been acquired or has been lost during genome evolution. This is one of the first baculovirus immediate early genes that appears to be nonessential for virus survival.

Construction of baculovirus expression vector of miRNAs and its expression in insect cells.

PubMed

Huang, Yong; Zou, Quan; Shen, Xing Jia; Yu, Xue Li; Wang, Zhan Bin; Cheng, Xiang Chao

2012-01-01

MicroRNAs (miRNAs) are endogenous small non-protein coding RNAs that play important regulatory roles in animals and plants by binding to target transcripts for cleavage or translational repression. The miR-9a is very conservative in animals from flies to humans. Studies indicated that miR-9a is involved in the regulation of neurogenesis in animals. In our study, the baculovirus expression system was used to transcribe a recombinant vector containing miR-9a for further analysis the function ofmiR-9a. The sequence ofpre-miR-9a from silkworm DNA was first cloned into the donor pFastBac. The enhanced green fluorescent protein (EGFP) was used as reporter gene. The recombinant donor plasmid pFastBac-miR-9a was transformed into E.coli DH10Bac/AcNPV forming Bacmid-9a which was transfected into insect cells with cational lipofectin. The transcription of mature miR-9a was detected by Real-time PCR. The results show the recombinant Bacmid-9a was successfully constructed and effectively transcribed miR-9a in infected Sf21 insect cells.

Recombinant ELISA using baculovirus-expressed VP2 for detection of antibodies against canine parvovirus.

PubMed

Elia, Gabriella; Desario, Costantina; Pezzoni, Giulia; Camero, Michele; Brocchi, Emiliana; Decaro, Nicola; Martella, Vito; Buonavoglia, Canio

2012-09-01

The gene encoding the VP2 protein of canine parvovirus type 2 was expressed in an insect-baculovirus system. The recombinant (r) VP2 was similar antigenically/functionally to the native capsid protein as demonstrated by hemagglutination, Western blotting and hemagglutination inhibition test, using Canine parvovirus type-2 (CPV-2) positive sera. An enzyme-linked immunosorbent assay (ELISA) using the rVP2 was used for testing CPV-2 positive and negative sera from dogs and for determining the threshold of maternally derived antibodies interfering with successful vaccination of pups against CPV-2. Copyright © 2012 Elsevier B.V. All rights reserved.

Targeted deletion of p97 (VCP/CDC48) in mouse results in early embryonic lethality.

PubMed

Müller, J M M; Deinhardt, K; Rosewell, I; Warren, G; Shima, D T

2007-03-09

The highly conserved AAA ATPase p97 (VCP/CDC48) has well-established roles in cell cycle progression, proteasome degradation and membrane dynamics. Gene disruption in Saccromyces cerevisiae, Drosophila melanogaster and Trypanosoma brucei demonstrated that p97 is essential in unicellular and multicellular organisms. To explore the requirement for p97 in mammalian cell function and embryogenesis, we disrupted the p97 locus by gene targeting. Heterozygous p97+/- mice were indistinguishable from their wild-type littermates, whereas homozygous mutants did not survive to birth and died at a peri-implantation stage. These results show that p97 is an essential gene for early mouse development.

Effect of spray drying processing parameters on the insecticidal activity of two encapsulated formulations of baculovirus

USDA-ARS?s Scientific Manuscript database

The aim of this work was to evaluate the effect of spray dryer processing parameters on the process yield and insecticidal activity of baculovirus to support the development of this beneficial group of microbes as biopesticides. For each of two baculoviruses [granulovirus (GV) from Pieris rapae (L....

Combining stable insect cell lines with baculovirus-mediated expression for multi-HA influenza VLP production.

PubMed

Sequeira, Daniela P; Correia, Ricardo; Carrondo, Manuel J T; Roldão, António; Teixeira, Ana P; Alves, Paula M

2018-05-24

Safer and broadly protective vaccines are needed to cope with the continuous evolution of circulating influenza virus strains and promising approaches based on the expression of multiple hemagglutinins (HA) in a virus-like particle (VLP) have been proposed. However, expression of multiple genes in the same vector can lead to its instability due to tandem repetition of similar sequences. By combining stable with transient expression systems we can rationally distribute the number of genes to be expressed per platform and thus mitigate this risk. In this work, we developed a modular system comprising stable and baculovirus-mediated expression in insect cells for production of multi-HA influenza enveloped VLPs. First, a stable insect High Five cell population expressing two different HA proteins from subtype H3 was established. Infection of this cell population with a baculovirus vector encoding three other HA proteins from H3 subtype proved to be as competitive as traditional co-infection approaches in producing a pentavalent H3 VLP. Aiming at increasing HA expression, the stable insect cell population was infected at increasingly higher cell concentrations (CCI). However, cultures infected at CCI of 3×10 6 cells/mL showed lower HA titers per cell in comparison to standard CCI of 2×10 6 cells/mL, a phenomenon named "cell density effect". To lessen the negative impact of this phenomenon, a tailor-made refeed strategy was designed based on the exhaustion of key nutrients during cell growth. Noteworthy, cultures supplemented and infected at a CCI of 4×10 6 cells/mL showed comparable HA titers per cell to those of CCI of 2×10 6 cells/mL, thus leading to an increase of up to 4-fold in HA titers per mL. Scalability of the modular strategy herein proposed was successfully demonstrated in 2L stirred tank bioreactors with comparable HA protein levels observed between bioreactor and shake flasks cultures. Overall, this work demonstrates the suitability of combining stable

Improved replication of the baculovirus Anticarsia gemmatalis nucleopolyhedrovirus (AgMNPV) in vitro using proteins from Lonomia obliqua hemolymph.

PubMed

Sousa, Álvaro P B; Moraes, Roberto H P; Mendonça, Ronaldo Z

2015-03-01

The baculovirus Anticarsia gemmatalis nucleopolyhedrovirus (AgMNPV), a member of the family Baculoviridae, has been widely applied as a biopesticide for the control of the velvetbean caterpillar, a pest of soybean crop field. Baculoviruses are considered safe and efficient agents for this purpose, because they do not infect vertebrates, being safe for the health of humans and animals, as well as to the environment. The objective of this work was to identify proteins obtained from Lonomia obliqua hemolymph with potential application in the optimization of baculovirus AgMNPV replication in Sf9 insect cell culture. In this work the improvement of the cell culture and viral replication of the AgMNPV baculovirus was observed when Grace medium was supplemented with 10 % (v/v) Fetal Bovine Serum (FBS), 1 % (v/v) hemolymph extract, or 3 % (v/v) of hemolymph fractions or hemolymph sub-fractions obtained by purifying hemolymph through High Performance Liquid Chromatography. Hemolymph presented a positive effect on the synthesis of polyhedra and enhanced baculovirus replication in Spodoptera frugiperda (Sf9) cells (TCID50/mL), and led to Sf9 cell culture improvement. Grace medium supplemented with 10 % (v/v) FBS and 1 % (v/v) hemolymph provided an increase of baculovirus replication, when the cells were infected with multiplicity of infection of 1. In this case, the baculovirus replication was 6,443.91 times greater than that obtained with the control: Grace medium supplemented with 10 % (v/v) FBS. In addition, this work suggests that hemolymph from L. obliqua could have an interesting application in biotechnology, due to an increase in the viability of the cells and virus replication.

Structural Organization of Baculovirus Occlusion Bodies and Protective Role of Multilayered Polyhedron Envelope Protein.

PubMed

Sajjan, Dayanand B; Hinchigeri, Shivayogeppa B

2016-03-01

Baculoviruses are the ingenious insect pathogens. Outside the host, baculovirus occlusion bodies (OB) provide stability to occlusion-derived viruses (ODV) embedded within. The OB is an organized structure, chiefly composed of proteins namely polyhedrin, polyhedron envelope protein (PEP) and P10. Currently, the structural organization of OB is poorly understood and the role of OB proteins in conferring the stability to ODV is unknown. Here we have shown that the assembly of polyhedrin unit cells into an OB is a rapid process; the PEP forms in multiple layers; the PEP layers predominantly contribute to ODV viability. Full-grown OBs (n = 36) were found to be 4.0 ± 1.0 µm in diameter and possessed a peculiar geometry of a truncated rhombic dodecahedron. The atomic force microscopy (AFM) study on the structure of OBs at different stages of growth in insect cells revealed polyhedrin assembly and thickness of PEP layers. The thickness of PEP layers at 53 h post-transfection (hpt) ranged from 56 to 80 nm. Mature PEP layers filled up approximately one third of the OB volume. The size of ODV nucleocapsid was found to be 433 ± 10 nm in length. The zeta potential and particle size distribution study of viruses revealed the protective role of PEP layers. The presence of a multilayered PEP confers a viable advantage to the baculoviruses compared to single-layered PEP. Thus, these findings may help in developing PEP layer-based biopolymers for protein-based nanodevices, nanoelectrodes and more stable biopesticides.

Genetically-engineered baculovirus pesticides and their environmental safety

Treesearch

H. Alan Wood; Yu Zailin

1991-01-01

Baculoviruses such as the Lymantria dispar nuclear polyhedrosis virus (LdMNPV) are ecologically attractive alternatives to chemical insect pesticides but have a slow rate of control. To overcome this we have developed and are field testing an environmentally acceptable strategy which can be used for the introduction and expression of pesticide-...

Roles of silkworm endoplasmic reticulum chaperones in the secretion of recombinant proteins expressed by baculovirus system.

PubMed

Imai, Saki; Kusakabe, Takahiro; Xu, Jian; Li, Zhiqing; Shirai, Shintaro; Mon, Hiroaki; Morokuma, Daisuke; Lee, Jae Man

2015-11-01

Baculovirus expression vector system (BEVS) is widely used for production of recombinant eukaryotic proteins in insect larvae or cultured cells. BEVS has advantages over bacterial expression system in producing post-translationally modified secreted proteins. However, for some unknown reason, it is very difficult for insects to secrete sufficiently for certain proteins of interest. To understand the reasons why insect cells fail to secrete some kinds of recombinant proteins, we here employed three mammalian proteins as targets, EPO, HGF, and Wnt3A, with different secretion levels in BEVS and investigated their mRNA transcriptions from the viral genome, subcellular localizations, and interactions with silkworm ER chaperones. Moreover, we observed that no significantly influence on the secretion amounts of all three proteins when depleting or overexpressing most endogenous ER chaperone genes in cultured silkworm cells. However, among all detected ER chaperones, the depletion of BiP severely decreased the recombinant protein secretion in BEVS, indicating the possible central role of Bip in silkworm secretion pathway.

The Pacific White Shrimp β-actin Promoter: Functional Properties and the Potential Application for Transduction System Using Recombinant Baculovirus.

PubMed

Shi, Yingli; Xiang, Jianhai; Zhou, Guangzhou; Ron, Tetsuzan Benny; Tong, Hsin-I; Kang, Wen; Sun, Si; Lu, Yuanan

2016-06-01

A newly isolated Pacific white shrimp (Litopenaeus vannamei) beta-actin promoter SbaP and its derivative compact construct SbaP (ENX) have recently been demonstrated to promote ectopic gene expression in vitro and in vivo. To further explore the potential transduction application, this newly isolated shrimp promoter SbaP was comparatively tested with cytomegalovirus (CMV), simian virus 40 (SV40), polyhedrin (Polh), and white spot syndrome virus immediate early gene 1 (WSSV ie1) four constitutive promoters and a beta-actin promoter (TbaP) from tilapia fish to characterize its promoting function in eight different cell lines. Luciferase quantitation assays revealed that SbaP can drive luciferase gene expression in all eight cell lines including sf21 (insect), PAC2 (zebrafish), EPC (carp), CHSE-214 (chinook salmon), GSTEF (green sea turtle), MS-1 (monk seal), 293T (human), and HeLa (human), but at different levels. Comparative analysis revealed that the promoting activity of SbaP was lower (≤10-fold) than CMV but higher (2-20 folds) than Polh in most of these cell lines tested. Whereas, SbaP mediated luciferase expression in sf21 cells was over 20-fold higher than CMV, SV40, Polh, and TbaP promoter. Compared to the SbaP, SbaP (ENX), which was constructed on the basis of SbaP by deletion of two "negative" regulatory elements, exhibited no significant change of promoting activity in EPC and PAC2 cells, but a 5 and 16 % lower promoting effect in 293T and HeLa cells, respectively. Additionally, a recombinant baculovirus was constructed under the control of SbaP (ENX), and efficient promoter activity of newly generated baculoviral vector was detected both in vitro of infected sf21 cells and in vivo of injected indicator shrimp. These results warrant the potential application of SbaP, particularly SbaP (ENX) in ectopic gene expression in future.

Inhibition of melanization by serpin-5 and serpin-9 promotes baculovirus infection in cotton bollworm Helicoverpa armigera

PubMed Central

Wang, Manli; Wang, Xi; Yin, Mengyi; Wang, Qianran; Hu, Zhihong

2017-01-01

Melanization, an important insect defense mechanism, is mediated by clip-domain serine protease (cSP) cascades and is regulated by serpins. Here we show that proteolytic activation of prophenoloxidase (PPO) and PO-catalyzed melanization kill the baculovirus in vitro. Our quantitative proteomics and biochemical experiments revealed that baculovirus infection of the cotton bollworm, Helicoverpa armigera, reduced levels of most cascade members in the host hemolymph and PO activity. By contrast, serpin-9 and serpin-5 were sequentially upregulated after the viral infection. The H. armigera serpin-5 and serpin-9 regulate melanization by directly inhibiting their target proteases cSP4 and cSP6, respectively and cSP6 activates PPO purified from hemolymph. Furthermore, serpin-5/9-depleted insects exhibited high PO activities and showed resistance to baculovirus infection. Together, our results characterize a part of the melanization cascade in H. armigera, and suggest that natural insect virus baculovirus has evolved a distinct strategy to suppress the host immune system. PMID:28953952

High-yield production of canine parvovirus virus-like particles in a baculovirus expression system.

PubMed

Jin, Hongli; Xia, Xiaohong; Liu, Bing; Fu, Yu; Chen, Xianping; Wang, Huihui; Xia, Zhenqiang

2016-03-01

An optimized VP2 gene from the current prevalent CPV strain (new CPV-2a) in China was expressed in a baculovirus expression system. It was found that the VP2 proteins assembled into virus-like particles (VLPs) with antigenic properties similar to those of natural CPV and with an especially high hemagglutination (HA) titer (1:2(20)). Dogs intramuscularly or orally immunized with VLPs produced antibodies against CPV with >1:80 hemagglutination inhibition (HI) units for at least 3 months. The CPV VLPs could be considered for use as a vaccine against CPV or as a platform for research on chimeric VLP vaccines against other diseases.

How baculovirus polyhedra fit square pegs into round holes to robustly package viruses

PubMed Central

Ji, Xiaoyun; Sutton, Geoff; Evans, Gwyndaf; Axford, Danny; Owen, Robin; Stuart, David I

2010-01-01

Natural protein crystals (polyhedra) armour certain viruses, allowing them to survive for years under hostile conditions. We have determined the structure of polyhedra of the baculovirus Autographa californica multiple nucleopolyhedrovirus (AcMNPV), revealing a highly symmetrical covalently cross-braced robust lattice, the subunits of which possess a flexible adaptor enabling this supra-molecular assembly to specifically entrap massive baculoviruses. Inter-subunit chemical switches modulate the controlled release of virus particles in the unusual high pH environment of the target insect's gut. Surprisingly, the polyhedrin subunits are more similar to picornavirus coat proteins than to the polyhedrin of cytoplasmic polyhedrosis virus (CPV). It is, therefore, remarkable that both AcMNPV and CPV polyhedra possess identical crystal lattices and crystal symmetry. This crystalline arrangement must be particularly well suited to the functional requirements of the polyhedra and has been either preserved or re-selected during evolution. The use of flexible adaptors to generate a powerful system for packaging irregular particles is characteristic of the AcMNPV polyhedrin and may provide a vehicle to sequester a wide range of objects such as biological nano-particles. PMID:19959989

Shewanella species as the origin of blaOXA-48 genes: insights into gene diversity, associated phenotypes and possible transfer mechanisms.

PubMed

Tacão, Marta; Araújo, Susana; Vendas, Maria; Alves, Artur; Henriques, Isabel

2018-03-01

Chromosome-encoded beta-lactamases of Shewanella spp. have been indicated as probable progenitors of bla OXA-48 -like genes. However, these have been detected in few Shewanella spp. and dissemination mechanisms are unclear. Thus, our main objective was to confirm the role of Shewanella species as progenitors of bla OXA-48 -like genes. In silico analysis of Shewanella genomes was performed to detect bla OXA-48 -like genes and context, and 43 environmental Shewanella spp. were characterised. Clonal relatedness was determined by BOX-PCR. Phylogenetic affiliation was assessed by 16S rDNA and gyrB sequencing. Antibiotic susceptibility phenotypes were determined. The bla OXA-48 -like genes and genetic context were inspected by PCR, hybridisation and sequence analysis. Gene variants were cloned in Escherichia coli and MICs were determined. Shewanella isolates were screened for integrons, plasmids and insertion sequences. Analysis of Shewanella spp. genomes showed that putative bla OXA-48 -like is present in the majority and in an identical context. Isolates presenting unique BOX profiles affiliated with 11 Shewanella spp. bla OXA-48 -like genes were detected in 22 isolates from 6 species. Genes encoded enzymes identical to OXA-48, OXA-204, OXA-181, and 7 new variants differing from OXA-48 from 2 to 82 amino acids. IS1999 was detected in 24 isolates, although not in the vicinity of bla OXA-48 genes. Recombinant E. coli strains presented altered MICs. The presence/absence of bla OXA-48 -like genes was species-related. Gene variants encoded enzymes with hydrolytic spectra similar to OXA-48-like from non-shewanellae. From the mobile elements previously described in association with bla OXA-48 -like genes, only the IS1999 was found in Shewanella, which indicates its relevance in bla OXA-48 -like genes transfer to other hosts. Copyright © 2017 Elsevier B.V. and International Society of Chemotherapy. All rights reserved.

Dynamic Interactions between Bombyx mori Nucleopolyhedrovirus and Its Host Cells Revealed by Transcriptome Analysis

PubMed Central

Xue, Jian; Qiao, Nan; Zhang, Wei; Cheng, Ruo-Lin; Zhang, Xiao-Qin; Bao, Yan-Yuan; Xu, Yi-Peng; Gu, Lin-Zhu

2012-01-01

Although microarray and expressed sequence tag (EST)-based approaches have been used to profile gene expression during baculovirus infection, the response of host genes to baculovirus infection and the interaction between baculovirus and its host remain largely unknown. To determine the host response to Bombyx mori nucleopolyhedrovirus infection and the dynamic interaction between the virus and its host, eight digital gene expression libraries were examined in a Bm5 cell line before infection and at 1.5, 3, 6, 12, 24, 48, and 96 h postinfection. Gene set enrichment analysis of differentially expressed genes at each time point following infection showed that gene sets including cytoskeleton, transcription, translation, energy metabolism, iron ion metabolism, and the ubiquitin-proteasome pathway were altered after viral infection. In addition, a time course depicting protein-protein interaction networks between the baculovirus and the host were constructed and revealed that viral proteins interact with a multitude of cellular machineries, such as the proteasome, cytoskeleton, and spliceosome. Several viral proteins, including IE2, CG30, PE38, and PK-1/2, were predicted to play key roles in mediating virus-host interactions. Based on these results, we tested the role of the ubiquitin-proteasome pathway and iron ion metabolism in the viral infection cycle. Treatment with a proteasome inhibitor and deferoxamine mesylate in vitro and in vivo confirmed that these pathways regulate viral infection. Taken together, these findings provide new insights into the interaction between the baculovirus and its host and identify molecular mechanisms that can be used to block viral infection and improve baculovirus expression systems. PMID:22532689

Aberrant p15, p16, p53, and DAPK Gene Methylation in Myelomagenesis: Clinical and Prognostic Implications.

PubMed

Geraldes, Catarina; Gonçalves, Ana Cristina; Cortesão, Emília; Pereira, Marta Isabel; Roque, Adriana; Paiva, Artur; Ribeiro, Letícia; Nascimento-Costa, José Manuel; Sarmento-Ribeiro, Ana Bela

2016-12-01

Aberrant DNA methylation is considered a crucial mechanism in the pathogenesis of monoclonal gammopathies. We aimed to investigate the contribution of hypermethylation of 4 tumor suppressor genes to the multistep process of myelomagenesis. The methylation status of p15, p16, p53, and DAPK genes was evaluated in bone marrow samples from 94 patients at diagnosis: monoclonal gammopathy of uncertain significance (MGUS) (n = 48), smoldering multiple myeloma (SMM) (n = 8) and symptomatic multiple myeloma (MM) (n = 38), and from 8 healthy controls by methylation-specific polymerase chain reaction analysis. Overall, 63% of patients with MM and 39% of patients with MGUS presented at least 1 hypermethylated gene (P < .05). No aberrant methylation was detected in normal bone marrow. The frequency of methylation for individual genes in patients with MGUS, SMM, and MM was p15, 15%, 50%, 21%; p16, 15%, 13%, 32%; p53, 2%, 12,5%, 5%, and DAPK, 19%, 25%, 39%, respectively (P < .05). No correlation was found between aberrant methylation and immunophenotypic markers, cytogenetic features, progression-free survival, and overall survival in patients with MM. The current study supports a relevant role for p15, p16, and DAPK hypermethylation in the genesis of the plasma cell neoplasm. DAPK hypermethylation also might be an important step in the progression from MGUS to MM. Copyright © 2016 Elsevier Inc. All rights reserved.

GPR48 Increases Mineralocorticoid Receptor Gene Expression

PubMed Central

Wang, Jiqiu; Li, Xiaoying; Ke, Yingying; Lu, Yan; Wang, Feng; Fan, Nengguang; Sun, Haiyan; Zhang, Huijie; Liu, Ruixin; Yang, Jun; Ye, Lei; Liu, Mingyao

2012-01-01

Aldosterone and the mineralocorticoid receptor (MR) are critical to the maintenance of electrolyte and BP homeostasis. Mutations in the MR cause aldosterone resistance known as pseudohypoaldosteronism type 1 (PHA1); however, some cases consistent with PHA1 do not exhibit known gene mutations, suggesting the possibility of alternative genetic variants. We observed that G protein–coupled receptor 48 (Gpr48/Lgr4) hypomorphic mutant (Gpr48m/m) mice had hyperkalemia and increased water loss and salt excretion despite elevated plasma aldosterone levels, suggesting aldosterone resistance. When we challenged the mice with a low-sodium diet, these features became more obvious; the mice also developed hyponatremia and increased renin expression and activity, resembling a mild state of PHA1. There was marked renal downregulation of MR and its downstream targets (e.g., the α-subunit of the amiloride-sensitive epithelial sodium channel), which could provide a mechanism for the aldosterone resistance. We identified a noncanonical cAMP-responsive element located in the MR promoter and demonstrated that GPR48 upregulates MR expression via the cAMP/protein kinase A pathway in vitro. Taken together, our data demonstrate that GPR48 enhances aldosterone responsiveness by activating MR expression, suggesting that GPR48 contributes to homeostasis of electrolytes and BP and may be a candidate gene for PHA1. PMID:22135314

Antigenic characterization of bovine ephemeral fever rhabdovirus G and GNS glycoproteins expressed from recombinant baculoviruses.

PubMed

Johal, Jasjit; Gresty, Karryn; Kongsuwan, Kritaya; Walker, Peter J

2008-01-01

Recombinant baculoviruses expressing the BEFV envelope glycoprotein G and non-structural glycoprotein G(NS) were constructed. The G protein expressed in insect cells was located on the cell surface and induced spontaneous cell fusion at mildly acidic pH. The expressed G protein reacted with MAbs to continuous and conformational neutralization sites (G1, G2, G3b and G4), but not to conformational site G3a. The expressed G(NS) protein was also located on the cell surface but did not exhibit fusogenic activity. The G(NS) protein reacted with polyclonal antiserum produced from vaccinia-virus-expressed recombinant G(NS) but did not react with G protein antibodies. A His(6)-tagged, soluble form of the G protein was expressed and purified by Ni(2+)-NTA chromatography. The purified G protein reacted with BEFV-neutralizing MAbs to all continuous and conformational antigenic sites. The highly protective characteristics of the native BEFV G protein suggest that the secreted, baculovirus-expressed product may be a useful vaccine antigen.

Acetylcholinesterase of the sand fly, Phlebotomus papatasi (Scopoli): cDNA sequence, baculovirus expression, and biochemical properties

PubMed Central

2013-01-01

Background Millions of people and domestic animals around the world are affected by leishmaniasis, a disease caused by various species of flagellated protozoans in the genus Leishmania that are transmitted by several sand fly species. Insecticides are widely used for sand fly population control to try to reduce or interrupt Leishmania transmission. Zoonotic cutaneous leishmaniasis caused by L. major is vectored mainly by Phlebotomus papatasi (Scopoli) in Asia and Africa. Organophosphates comprise a class of insecticides used for sand fly control, which act through the inhibition of acetylcholinesterase (AChE) in the central nervous system. Point mutations producing an altered, insensitive AChE are a major mechanism of organophosphate resistance in insects and preliminary evidence for organophosphate-insensitive AChE has been reported in sand flies. This report describes the identification of complementary DNA for an AChE in P. papatasi and the biochemical characterization of recombinant P. papatasi AChE. Methods A P. papatasi Israeli strain laboratory colony was utilized to prepare total RNA utilized as template for RT-PCR amplification and sequencing of cDNA encoding acetylcholinesterase 1 using gene specific primers and 3’-5’-RACE. The cDNA was cloned into pBlueBac4.5/V5-His TOPO, and expressed by baculovirus in Sf21 insect cells in serum-free medium. Recombinant P. papatasi acetylcholinesterase was biochemically characterized using a modified Ellman’s assay in microplates. Results A 2309 nucleotide sequence of PpAChE1 cDNA [GenBank: JQ922267] of P. papatasi from a laboratory colony susceptible to insecticides is reported with 73-83% nucleotide identity to acetylcholinesterase mRNA sequences of Culex tritaeniorhynchus and Lutzomyia longipalpis, respectively. The P. papatasi cDNA ORF encoded a 710-amino acid protein [GenBank: AFP20868] exhibiting 85% amino acid identity with acetylcholinesterases of Cx. pipiens, Aedes aegypti, and 92% amino acid identity for

Combined radiation and p53 gene therapy of malignant glioma cells.

PubMed

Badie, B; Goh, C S; Klaver, J; Herweijer, H; Boothman, D A

1999-01-01

More than half of malignant gliomas reportedly have alterations in the p53 tumor suppressor gene. Because p53 plays a key role in the cellular response to DNA-damaging agents, we investigated the role of p53 gene therapy before ionizing radiation in cultured human glioma cells containing normal or mutated p53. Three established human glioma cell lines expressing the wild-type (U87 MG, p53wt) or mutant (A172 and U373 MG, p53mut) p53 gene were transduced by recombinant adenoviral vectors bearing human p53 (Adp53) and Escherichia coli beta-galactosidase genes (AdLacZ, control virus) before radiation (0-20 Gy). Changes in p53, p21, and Bax expression were studied by Western immunoblotting, whereas cell cycle alterations and apoptosis were investigated by flow cytometry and nuclear staining. Survival was assessed by clonogenic assays. Within 48 hours of Adp53 exposure, all three cell lines demonstrated p53 expression at a viral multiplicity of infection of 100. p21, which is a p53-inducible downstream effector gene, was overexpressed, and cells were arrested in the G1 phase. Bax expression, which is thought to play a role in p53-induced apoptosis, did not change with either radiation or Adp53. Apoptosis and survival after p53 gene therapy varied. U87 MG (p53wt) cells showed minimal apoptosis after Adp53, irradiation, or combined treatments. U373 MG (p53mut) cells underwent massive apoptosis and died within 48 hours of Adp53 treatment, independent of irradiation. Surprisingly, A172 (p53mut) cells demonstrated minimal apoptosis after Adp53 exposure; however, unlike U373 MG cells, apoptosis increased with radiation dose. Survival of all three cell lines was reduced dramatically after >10 Gy. Although Adp53 transduction significantly reduced the survival of U373 MG cells and inhibited A172 growth, it had no effect on the U87 MG cell line. Transduction with AdLacZ did not affect apoptosis or cell cycle progression and only minimally affected survival in all cell lines. We

Enhanced effect of fluorescent whitening agent on peroral infection for recombinant baculovirus in the host Bombyx mori L.

PubMed

Wang, Bing; Shang, Jinyan; Liu, Xunli; Cui, Weizheng; Wu, Xiaofeng; Zhao, Na

2007-01-01

The low efficiency of the oral infectivity of recombinant polyhedrin-negative baculovirus is a major bottleneck in the application of the baculovirus expression system in the silkworm (Bombyx mori L). In this study, the effects of a fluorescent whitening agent on improving the oral infection for the recombinant Bombyx mori nuclear polyhedrosis virus in silkworm larva and their possible mechanism were investigated. The results showed that the peroral infection can be remarkably enhanced by adding VBL into the larval artificial diet. The maximum infection rate reached as high as 90% with the concentration of VBL (1%), which was then considered as optimal. The total protease activity and pH value of the larval intestinal juice were found to be lower when compared to the control, indicating an abnormal physiological change of the larval digestive system by VBL, which, in turn, resulted in improved peroral infection of recombinant virus.

Localization of VP28 on the baculovirus envelope and its immunogenicity against white spot syndrome virus in Penaeus monodon

DOE Office of Scientific and Technical Information (OSTI.GOV)

Syed Musthaq, S.; Madhan, Selvaraj; Sahul Hameed, A.S.

2009-09-01

White spot syndrome virus (WSSV) is a large dsDNA virus responsible for white spot disease in shrimp and other crustaceans. VP28 is one of the major envelope proteins of WSSV and plays a crucial role in viral infection. In an effort to develop a vaccine against WSSV, we have constructed a recombinant baculovirus with an immediate early promoter 1 which expresses VP28 at an early stage of infection in insect cells. Baculovirus expressed rVP28 was able to maintain its structural and antigenic conformity as indicated by immunofluorescence assay and western blot analysis. Interestingly, our results with confocal microscopy revealed thatmore » rVP28 was able to localize on the plasma membrane of insect cells infected with recombinant baculovirus. In addition, we demonstrated with transmission electron microscopy that baculovirus successfully acquired rVP28 from the insect cell membrane via the budding process. Using this baculovirus displaying VP28 as a vaccine against WSSV, we observed a significantly higher survival rate of 86.3% and 73.5% of WSSV-infected shrimp at 3 and 15 days post vaccination respectively. Quantitative real-time PCR also indicated that the WSSV viral load in vaccinated shrimp was significantly reduced at 7 days post challenge. Furthermore, our RT-PCR and immunohistochemistry results demonstrated that the recombinant baculovirus was able to express VP28 in vivo in shrimp tissues. This study will be of considerable significance in elucidating the morphogenesis of WSSV and will pave the way for new generation vaccines against WSSV.« less

Chaperokine function of recombinant Hsp72 produced in insect cells using a baculovirus expression system is retained.

PubMed

Zheng, Hongying; Nagaraja, Ganachari M; Kaur, Punit; Asea, Edwina E; Asea, Alexzander

2010-01-01

Extracellular heat shock protein 72 (Hsp72; inducible form of the 70-kDa heat shock protein) plays a critical role in innate and adaptive immune responses and has shown promise as an ideal adjuvant for the optimization of antigen-specific anti-tumor vaccines. Recent studies suggest that to correctly elucidate the mechanisms by which Hsp72 exerts its beneficial effects in vitro, great care must be taken to ensure that endotoxin by-products do not invalidate the findings. In this study, we have taken advantage of the baculovirus expression vector system for production of endotoxin-free recombinant Hsp72. The coding sequence of human hsp72 was recombined into the baculovirus immediately downstream of the strong polyhedron gene promoter. Ninety-six h post-infection of Sf9 insect cells with recombinant baculovirus, maximal levels of Hsp72 protein were detected. The recombinant human Hsp72 was purified by affinity chromatography from insect cells, and purity was confirmed by SDS-PAGE and mass spectrometry. The purified human recombinant Hsp72(bv) (Hsp72 produced using the BEVS) was demonstrated to have no endotoxin contamination and was shown to have stimulated potent calcium flux in the human monocytic cell line. Furthermore, recombinant Hsp72(bv) enhanced the tolerance of neuroblastoma cells to heat stress-induced cell death and displayed classical chaperokine functions including augmentation of inflammatory cytokine productions in mouse splenocytes. The production of functional, endotoxin-free recombinant human Hsp72(bv) in insect cells is inexpensive and convenient and eliminates the need of special procedures for endotoxin depletion. Endotoxin-free recombinant human Hsp72(bv) can now be used to unlock the important role Hsp72 plays in modulating immune function.

Chaperokine Function of Recombinant Hsp72 Produced in Insect Cells Using a Baculovirus Expression System Is Retained*

PubMed Central

Zheng, Hongying; Nagaraja, Ganachari M.; Kaur, Punit; Asea, Edwina E.; Asea, Alexzander

2010-01-01

Extracellular heat shock protein 72 (Hsp72; inducible form of the 70-kDa heat shock protein) plays a critical role in innate and adaptive immune responses and has shown promise as an ideal adjuvant for the optimization of antigen-specific anti-tumor vaccines. Recent studies suggest that to correctly elucidate the mechanisms by which Hsp72 exerts its beneficial effects in vitro, great care must be taken to ensure that endotoxin by-products do not invalidate the findings. In this study, we have taken advantage of the baculovirus expression vector system for production of endotoxin-free recombinant Hsp72. The coding sequence of human hsp72 was recombined into the baculovirus immediately downstream of the strong polyhedron gene promoter. Ninety-six h post-infection of Sf9 insect cells with recombinant baculovirus, maximal levels of Hsp72 protein were detected. The recombinant human Hsp72 was purified by affinity chromatography from insect cells, and purity was confirmed by SDS-PAGE and mass spectrometry. The purified human recombinant Hsp72bv (Hsp72 produced using the BEVS) was demonstrated to have no endotoxin contamination and was shown to have stimulated potent calcium flux in the human monocytic cell line. Furthermore, recombinant Hsp72bv enhanced the tolerance of neuroblastoma cells to heat stress-induced cell death and displayed classical chaperokine functions including augmentation of inflammatory cytokine productions in mouse splenocytes. The production of functional, endotoxin-free recombinant human Hsp72bv in insect cells is inexpensive and convenient and eliminates the need of special procedures for endotoxin depletion. Endotoxin-free recombinant human Hsp72bv can now be used to unlock the important role Hsp72 plays in modulating immune function. PMID:19861412

The genome sequence of Condylorrhiza vestigialis NPV, a novel baculovirus for the control of the Alamo moth on Populus spp. in Brazil.

PubMed

Castro, Maria Elita B; Melo, Fernando L; Tagliari, Marina; Inglis, Peter W; Craveiro, Saluana R; Ribeiro, Zilda Maria A; Ribeiro, Bergmann M; Báo, Sônia N

2017-09-01

Condylorrhiza vestigialis (Lepidoptera: Cambridae), commonly known as the Brazilian poplar moth or Alamo moth, is a serious defoliating pest of poplar, a crop of great economic importance for the production of wood, fiber, biofuel and other biomaterials as well as its significant ecological and environmental value. The complete genome sequence of a new alphabaculovirus isolated from C. vestigialis was determined and analyzed. Condylorrhiza vestigialis nucleopolyhedrovirus (CoveNPV) has a circular double-stranded DNA genome of 125,767bp with a GC content of 42.9%. One hundred and thirty-eight putative open reading frames were identified and annotated in the CoveNPV genome, including 38 core genes and 9 bros. Four homologous regions (hrs), a feature common to most baculoviruses, and 19 perfect and imperfect direct repeats (drs) were found. Phylogenetic analysis confirmed that CoveNPV is a Group I Alphabaculovirus and is most closely related to Anticarsia gemmatalis multiple nucleopolyhedrovirus (AgMNPV) and Choristoneura fumiferana DEF multiple nucleopolyhedrovirus CfDEFMNPV. The gp37 gene was not detected in the CoveNPV genome, although this gene is found in many NPVs. Two other common NPV genes, chitinase (v-chiA) and cathepsin (v-cath), that are responsible for host insect liquefaction and melanization, were also absent, where phylogenetic analysis suggests that the loss these genes occurred in the common ancestor of AgMNPV, CfDEFMNPV and CoveNPV, with subsequent reacquisition of these genes by CfDEFMNPV. The molecular biology and genetics of CoveNPV was formerly very little known and our expectation is that the findings presented here should accelerate research on this baculovirus, which will facilitate the use of CoveNPV in integrated pest management programs in Poplar crops. Copyright © 2017 Elsevier Inc. All rights reserved.

The spread of bla OXA-48 and bla OXA-244 carbapenemase genes among Klebsiella pneumoniae, Proteus mirabilis and Enterobacter spp. isolated in Moscow, Russia.

PubMed

Fursova, Nadezhda K; Astashkin, Eugeny I; Knyazeva, Anastasia I; Kartsev, Nikolay N; Leonova, Ekaterina S; Ershova, Olga N; Alexandrova, Irina A; Kurdyumova, Natalia V; Sazikina, Svetlana Yu; Volozhantsev, Nikolay V; Svetoch, Edward A; Dyatlov, Ivan A

2015-11-02

The spread of carbapenemase-producing Enterobacteriaceae (CPE) is a great problem of healthcare worldwide. Study of the spread for bla OXA-48-like genes coding epidemically significant carbapenemases among hospital pathogens is important for the regional and global epidemiology of antimicrobial resistance. Antibacterial resistant isolates of Klebsiella pneumoniae (n = 95) from 54 patients, P. mirabilis (n = 32) from 20 patients, Enterobacter aerogenes (n = 6) from four patients, and Enterobacter cloacae (n = 4) from four patients were collected from January, 2013 to October, 2014 in neurosurgical intensive care unit (ICU) of the Burdenko Neurosurgery Institute, Moscow. Characteristics of the isolates were done using susceptibility tests, PCR detection of the resistance genes, genotyping, conjugation, DNA sequencing, and bioinformatic analysis. Major strains under study were multi drug resistant (MDR), resistant to three or more functional classes of drugs simultaneously-98.9 % K. pneumoniae, 100 % P. mirabilis, one E. aerogenes isolate, and one E. cloacae isolate. Molecular-genetic mechanism of MDR in K. pneumoniae and P. mirabilis isolates were based on carrying of epidemic extended-spectrum beta-lactamase bla CTX-M-15 gene (87.2 and 90.6 % accordingly), carbapenemase bla OXA-48-like gene (55.3 and 23.3 % accordingly), and class 1 (54.8 and 31.3 % accordingly) and class 2 (90.6 % P. mirabilis) integrons. The bla OXA-48-like-positive K. pneumoniae were collected during whole two-year surveillance period, while P. mirabilis and Enterobacter spp. carrying bla OXA-48-like genes were detected only after four and 18 months after the research start, respectively. The bla OXA-48-like gene acquisition was shown for P. mirabilis isolates collected from five patients and for E. cloacae isolate collected from one patient during their stay in the ICU, presumably from bla OXA-48-like-positive K. pneumoniae. The source of the bla OXA-244 gene acquired by E

Essential function of VCP/p97 in infection cycle of the nucleopolyhedrovirus AcMNPV in Spodoptera frugiperda Sf9 cells.

PubMed

Lyupina, Yulia V; Erokhov, Pavel A; Kravchuk, Oksana I; Finoshin, Alexander D; Abaturova, Svetlana B; Orlova, Olga V; Beljelarskaya, Svetlana N; Kostyuchenko, Margarita V; Mikhailov, Victor S

2018-06-08

The protein VCP/p97 (also named CDC48 and TER94) belongs to a type II subfamily of the AAA+ATPases and controls cellular proteostasis by acting upstream of proteasomes in the ubiquitin-proteasome protein degradation pathway. The function of VCP/p97 in the baculovirus infection cycle in insect cells remains unknown. Here, we identified VCP/p97 in the fall armyworm Spodoptera frugiperda (Sf9) cells and analyzed the replication of the Autographa californica multiple nucleopolyhedrovirus, AcMNPV, in Sf9 cells in which the VCP/p97 function was inhibited. The specific allosteric inhibitor of the VCP/p97 ATPase activity, NMS-873, did not deplete VCP/p97 in infected cells but caused a dose-dependent inhibition of viral DNA synthesis and efficiently suppressed expression of viral proteins and production of budded virions. NMS-873 caused accumulation of ubiquitinated proteins in a manner similar to the inhibitor of proteasome activity, Bortezomib. This suggests the essential function of VCP/p97 in the baculovirus infection cycle might be associated, at least in part, with the ubiquitin-proteasome system. Copyright © 2018 Elsevier B.V. All rights reserved.

DEPENDENCE OF ECDYSTEROID METABOLISM AND DEVELOPMENT IN HOST LARVAE ON THE TIME OF BACULOVIRUS INFECTION AND THE ACTIVITY OF THE UDP-GLUCOSYL TRANSFERASE GENE.

EPA Science Inventory

Infection of fourth-instar gypsy moth (Lymantria dispar, Lepidoptera: Lymantriidae) larvae with the wild-type (Wt) gypsy moth baculovirus, LdNPV on the first day post-molt, or infection of fifth instars on the fifth day post-molt, results in elevated ecdysteroid levels in both he...

The complete genome sequence of a third distinct baculovirus isolated from the true armyworm, Mythimna unipuncta, contains two copies of the lef-7 gene

USDA-ARS?s Scientific Manuscript database

A baculovirus isolate from a USDA Forest Service collection was examined by electron microscopy and analysis of its genome sequence. The isolate, formerly referred to as Pseudoletia (Mythimna) sp. nucleopolyhedrovirus #7 (MyspNPV#7), was determined by barcoding PCR to derive from the host species My...

Genome sequence of an enhancin gene-rich nucleopolyhedrovirus (NPV) from Agrotis segetum: collinearity with Spodoptera exigua multiple NPV.

PubMed

Jakubowska, Agata K; Peters, Sander A; Ziemnicka, Jadwiga; Vlak, Just M; van Oers, Monique M

2006-03-01

The genome sequence of a Polish isolate of Agrotis segetum nucleopolyhedrovirus (AgseNPV-A) was determined and analysed. The circular genome is composed of 147,544 bp and has a G+C content of 45.7 mol%. It contains 153 putative, non-overlapping open reading frames (ORFs) encoding predicted proteins of more than 50 aa, together making up 89.8 % of the genome. The remaining 10.2 % of the DNA constitutes non-coding regions and homologous-repeat regions. One hundred and forty-three AgseNPV-A ORFs are homologues of previously reported baculovirus gene sequences. There are ten unique ORFs and they account for 3 % of the genome in total. All 62 lepidopteran baculovirus genes, including the 29 core baculovirus genes, were found in the AgseNPV-A genome. The gene content and gene order of AgseNPV-A are most similar to those of Spodoptera exigua (Se) multiple NPV and their shared homologous genes are 100 % collinear. Three putative enhancin genes were identified in the AgseNPV-A genome. In phylogenetic analysis, the AgseNPV-A enhancins form a cluster separated from enhancins of the Mamestra species NPVs.

Expression of the hemagglutinin HA1 subunit of the equine influenza virus using a baculovirus expression system.

PubMed

Sguazza, Guillermo H; Fuentealba, Nadia A; Tizzano, Marco A; Galosi, Cecilia M; Pecoraro, Marcelo R

2013-01-01

Equine influenza virus is a leading cause of respiratory disease in horses worldwide. Disease prevention is by vaccination with inactivated whole virus vaccines. Most current influenza vaccines are generated in embryonated hens' eggs. Virions are harvested from allantoic fluid and chemically inactivated. Although this system has served well over the years, the use of eggs as the substrate for vaccine production has several well-recognized disadvantages (cost, egg supply, waste disposal and yield in eggs). The aim of this study was to evaluate a baculovirus system as a potential method for producing recombinant equine influenza hemagglutinin to be used as a vaccine. The hemagglutinin ectodomain (HA1 subunit) was cloned and expressed using a baculovirus expression vector. The expression was determined by SDS-PAGE and immunoblotting. A high yield, 20μg/ml of viral protein, was obtained from recombinant baculovirus-infected cells. The immune response in BALB/c mice was examined following rHA1 inoculation. Preliminary results show that recombinant hemagglutinin expressed from baculovirus elicits a strong antibody response in mice; therefore it could be used as an antigen for subunit vaccines and diagnostic tests. Copyright © 2013 Asociación Argentina de Microbiología. Publicado por Elsevier España. All rights reserved.

Sequence analysis of the complete genome of Trichoplusia ni single nucleopolyhedrovirus and the identification of a baculoviral photolyase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Willis, Leslie G.; Siepp, Robyn; Stewart, Taryn M.

2005-08-01

The genome of the Trichoplusia ni single nucleopolyhedrovirus (TnSNPV), a group II NPV which infects the cabbage looper (T. ni), has been completely sequenced and analyzed. The TnSNPV DNA genome consists of 134,394 bp and has an overall G + C content of 39%. Gene analysis predicted 144 open reading frames (ORFs) of 150 nucleotides or greater that showed minimal overlap. Comparisons with previously sequenced baculoviruses indicate that 119 TnSNPV ORFs were homologues of previously reported viral gene sequences. Ninety-four TnSNPV ORFs returned an Autographa californica multiple NPV (AcMNPV) homologue while 25 ORFs returned poor or no sequence matches withmore » the current databases. A putative photolyase gene was also identified that had highest amino acid identity to the photolyase genes of Chrysodeixis chalcites NPV (ChchNPV) (47%) and Danio rerio (zebrafish) (40%). In addition unlike all other baculoviruses no obvious homologous repeat (hr) sequences were identified. Comparison of the TnSNPV and AcMNPV genomes provides a unique opportunity to examine two baculoviruses that are highly virulent for a common insect host (T. ni) yet belong to diverse baculovirus taxonomic groups and possess distinct biological features. In vitro fusion assays demonstrated that the TnSNPV F protein induces membrane fusion and syncytia formation and were compared to syncytia formed by AcMNPV GP64.« less

Iron levels change in larval Heliothis virescens tissues following baculovirus infection

USDA-ARS?s Scientific Manuscript database

Inductively-coupled plasma mass spectrometry (ICP-MS) and 59Fe radiotracers were used to investigate changes in levels of iron (Fe) in the tissues of Heliothis virescens following baculovirus infection. Fe concentrations were determined by ICP-MS in hemolymph collected from 4th instar larvae infect...

Meiotic and pedigree segregation analyses in carriers of t(4;8)(p16;p23.1) differing in localization of breakpoint positions at 4p subband 4p16.3 and 4p16.1.

PubMed

Midro, Alina T; Zollino, Marcella; Wiland, Ewa; Panasiuk, Barbara; Iwanowski, Piotr S; Murdolo, Marina; Śmigiel, Robert; Sąsiadek, Maria; Pilch, Jacek; Kurpisz, Maciej

2016-02-01

The purpose of this study was to compare meiotic segregation in sperm cells from two carriers with t(4;8)(p16;p23.1) reciprocal chromosome translocations (RCTs), differing in localization of the breakpoint positions at the 4p subband-namely, 4p16.3 (carrier 1) and 4p16.1 (carrier 2)-and to compare data of the pedigree analyses performed by direct method. Three-color fluorescent in situ hybridization (FISH) on sperm cells and FISH mapping for the evaluation of the breakpoint positions, data from pedigrees, and direct segregation analysis of the pedigrees were performed. Similar proportions of normal/balanced and unbalanced sperm cells were found in both carriers. The most common was an alternate type of segregation (about 52 % and about 48 %, respectively). Unbalanced adjacent I and adjacent II karyotypes were found in similar proportions about 15 %. The direct segregation analysis (following Stengel-Rutkowski) of the pedigree of carriers of t(4;8)(p16.1;p23.1) was performed and results were compared with the data of the pedigree segregation analysis obtained earlier through the indirect method. The probability of live-born progeny with unbalanced karyotype for carriers of t(4;8)(p16.1;p23.1) was moderately high at 18.8 %-comparable to the value obtained using the indirect method for the same carriership, which was 12 %. This was, however, markedly lower than the value of 41.2 % obtained through the pedigree segregation indirect analysis estimated for carriers of t(4;8)(p16.3;p23.1), perhaps due to the unique composition of genes present within the 4p16.1-4p 16.3 region. Revealed differences in pedigree segregation analysis did not correspond to the very similar profile of meiotic segregation patterns presented by carrier 1 and carrier 2. Most probably, such discordances may be due to differences in embryo survival rates arising from different genetic backgrounds.

MEMBRANOUS LABYRINTH IN BACULOVIRUS-INFECTED CRUSTRACEAN CELLS: POSSIBLE ROLES IN VIRAL REPRODUCTION

EPA Science Inventory

The origins and morphogenesis of the membranous labyrinth (ML) in Baculovirus penaei (BP) infected cells of penaeid shrimps (Crustacea:Decapoda) are described. t is hypothesized that, because of the close parallel and concurrent development of the ML and virus reproduction, and o...

Comparison of two eukaryotic systems for the expression of VP6 protein of rotavirus specie A: transient gene expression in HEK293-T cells and insect cell-baculovirus system.

PubMed

da Silva Junior, Haroldo Cid; da Silva E Mouta Junior, Sérgio; de Mendonça, Marcos César Lima; de Souza Pereira, Mirian Claudia; da Rocha Nogueira, Alanderson; de Azevedo, Maria Luiza Borges; Leite, José Paulo Gagliardi; de Moraes, Márcia Terezinha Baroni

2012-09-01

The VP6 protein of rotavirus A (RVA) is a target antigen used for diagnostic assays and also for the development of new RVA vaccines. We have compared the expression of VP6 protein in human embryonic kidney (HEK293-T) cells with results obtained using a well-established insect cell-baculovirus system. The recombinant VP6 (rVP6) expressed in HEK293-T cells did not present degradation and also retained the ability to form trimers. In the insect cell-baculovirus system, rVP6 was expressed at higher levels and with protein degradation as well as partial loss of ability to form trimers was observed. Therefore, HEK293-T cells represent a less laborious alternative system than insect cells for expression of rVP6 from human RVA.

N-TERMINALLY ELONGATED SpliInx2 AND SpliInx3 REDUCE BACULOVIRUS-TRIGGERED APOPTOSIS VIA HEMICHANNEL CLOSURE.

PubMed

Chen, Ya-Bin; Xiao, Wei; Li, Ming; Zhang, Yan; Yang, Yang; Hu, Jian-Sheng; Luo, Kai-Jun

2016-05-01

The hemichannel and gap junction channel are major portals for the release of factors responsible for the effects of apoptotic cells on the spread of apoptosis to neighboring cells and apoptotic corpse clearance, typically by phagocytes. The N-terminal cytoplasmic domain in the connexins, gap junction proteins in vertebrate, has been implicated in regulating channel closure. However, little is known about how the hemichannel close responds to apoptotic signaling transduction leading to the reduction of neighboring cellular apoptosis in an invertebrate. An insect Bac-to-Bac expression system, pFastBac(TM) HT A, allows us to construct an N-terminally elongated SpliInx2 (Nte-Inx2) and SpliInx3 (Nte-Inx3). Here, we demonstrated that recombinant baculovirus Bac-Nte-Inx2 (reBac-Net-Inx2) and Bac-Nte-Inx3 (reBac-Nte-Inx3) closed the endogenous hemichannel on the Sf9 cell surface. Importantly, primary baculovirus infections significantly caused early apoptosis, and this apoptosis was reduced by hemichannel-closed Sf9 cells at 24-h post-infection (PI). Although N-terminal-elongated residue led to the increase in the phosphorylated sites in both Nte-Inx2 and Nte-Inx3 and an additional transmembrane domain in Nte-Inx3, both the proteins localized on the cell surface, suggesting Nte-Inxs proteins could mediate hemichannel closure. Further supporting evidence showed that hemichannel closure was dependent on N-Inxs expressed by baculovirus polyhedrin promoter, which began to express at 18-24 h PI. These results identify an unconventional function of N-terminal-elongated innexins that could act as a plug to manipulate hemichannel closure and provide a mechanism connecting the effect of hemichannel closure directly to apoptotic signaling transduction from intracellular to extracellular compartment. © 2016 Wiley Periodicals, Inc.

Contiguous gene deletion of chromosome 2p16.3-p21 as a cause of Lynch syndrome.

PubMed

Salo-Mullen, Erin E; Lynn, Patricio B; Wang, Lu; Walsh, Michael; Gopalan, Anuradha; Shia, Jinru; Tran, Christina; Man, Fung Ying; McBride, Sean; Schattner, Mark; Zhang, Liying; Weiser, Martin R; Stadler, Zsofia K

2018-01-01

Lynch syndrome is an autosomal dominant condition caused by pathogenic mutations in the DNA mismatch repair (MMR) genes. Although commonly associated with clinical features such as intellectual disability and congenital anomalies, contiguous gene deletions may also result in cancer predisposition syndromes. We report on a 52-year-old male with Lynch syndrome caused by deletion of chromosome 2p16.3-p21. The patient had intellectual disability and presented with a prostatic adenocarcinoma with an incidentally identified synchronous sigmoid adenocarcinoma that exhibited deficient MMR with an absence of MSH2 and MSH6 protein expression. Family history was unrevealing. Physical exam revealed short stature, brachycephaly with a narrow forehead and short philtrum, brachydactyly of the hands, palmar transverse crease, broad and small feet with hyperpigmentation of the soles. The patient underwent total colectomy with ileorectal anastomosis for a pT3N1 sigmoid adenocarcinoma. Germline genetic testing of the MSH2, MSH6, and EPCAM genes revealed full gene deletions. SNP-array based DNA copy number analysis identified a deletion of 4.8 Mb at 2p16.3-p21. In addition to the three Lynch syndrome associated genes, the deleted chromosomal section encompassed genes including NRXN1, CRIPT, CALM2, FBXO11, LHCGR, MCFD2, TTC7A, EPAS1, PRKCE, and 15 others. Contiguous gene deletions have been described in other inherited cancer predisposition syndromes, such as Familial Adenomatous Polyposis. Our report and review of the literature suggests that contiguous gene deletion within the 2p16-p21 chromosomal region is a rare cause of Lynch syndrome, but presents with distinct phenotypic features, highlighting the need for recognition and awareness of this syndromic entity.

Mapping of novel powdery mildew resistance gene(s) from Agropyron cristatum chromosome 2P.

PubMed

Li, Huanhuan; Jiang, Bo; Wang, Jingchang; Lu, Yuqing; Zhang, Jinpeng; Pan, Cuili; Yang, Xinming; Li, Xiuquan; Liu, Weihua; Li, Lihui

2017-01-01

A physical map of Agropyron cristatum 2P chromosome was constructed for the first time and the novel powdery mildew resistance gene(s) from chromosome 2P was(were) also mapped. Agropyron cristatum (L.) Gaertn. (2n = 28, PPPP), a wild relative of common wheat, is highly resistant to powdery mildew. Previous studies showed that wheat-A. cristatum 2P disomic addition line II-9-3 displayed high resistance to powdery mildew, and the resistance was attributable to A. cristatum chromosome 2P. To utilize and physically map the powdery mildew resistance gene(s), 15 wheat-A. cristatum 2P translocation lines and three A. cristatum 2P deletion lines with different chromosomal segment sizes, obtained from II-9-3 using 60 Co-γ ray irradiation, were characterized using cytogenetic and molecular marker analysis. A. cristatum 2P chromosomal segments in the translocations were translocated to different wheat chromosomes, including 1A, 4A, 5A, 6A, 7A, 1B, 2B, 3B, 7B, 3D, 4D, and 6D. A physical map of the 2P chromosome was constructed with 82 STS markers, consisting of nine bins with 34 markers on 2PS and eight bins with 48 markers on 2PL. The BC 1 F 2 populations of seven wheat-A. cristatum 2P translocation lines (2PT-3, 2PT-4, 2PT-5, 2PT-6, 2PT-8, 2PT-9, and 2PT-10) were developed by self-pollination, tested with powdery mildew and genotyped with 2P-specific STS markers. From these results, the gene(s) conferring powdery mildew resistance was(were) located on 2PL bin FL 0.66-0.86 and 19 2P-specific markers were identified in this bin. Moreover, two new powdery mildew-resistant translocation lines (2PT-4 and 2PT-5) with small 2PL chromosome segments were obtained. The newly developed wheat lines with powdery mildew resistance and the closely linked molecular markers will be valuable for wheat disease breeding in the future.

Genome of Epinotia aporema granulovirus (EpapGV), a polyorganotropic fast killing betabaculovirus with a novel thymidylate kinase gene

PubMed Central

2012-01-01

Background Epinotia aporema (Lepidoptera: Tortricidae) is an important pest of legume crops in South America. Epinotia aporema granulovirus (EpapGV) is a baculovirus that causes a polyorganotropic infection in the host larva. Its high pathogenicity and host specificity make EpapGV an excellent candidate to be used as a biological control agent. Results The genome of Epinotia aporema granulovirus (EpapGV) was sequenced and analyzed. Its circular double-stranded DNA genome is 119,082 bp in length and codes for 133 putative genes. It contains the 31 baculovirus core genes and a set of 19 genes that are GV exclusive. Seventeen ORFs were unique to EpapGV in comparison with other baculoviruses. Of these, 16 found no homologues in GenBank, and one encoded a thymidylate kinase. Analysis of nucleotide sequence repeats revealed the presence of 16 homologous regions (hrs) interspersed throughout the genome. Each hr was characterized by the presence of 1 to 3 clustered imperfect palindromes which are similar to previously described palindromes of tortricid-specific GVs. Also, one of the hrs (hr4) has flanking sequences suggestive of a putative non-hr ori. Interestingly, two more complex hrs were found in opposite loci, dividing the circular dsDNA genome in two halves. Gene synteny maps showed the great colinearity of sequenced GVs, being EpapGV the most dissimilar as it has a 20 kb-long gene block inversion. Phylogenetic study performed with 31 core genes of 58 baculoviral genomes suggests that EpapGV is the baculovirus isolate closest to the putative common ancestor of tortricid specific betabaculoviruses. Conclusions This study, along with previous characterization of EpapGV infection, is useful for the better understanding of the pathology caused by this virus and its potential utilization as a bioinsecticide. PMID:23051685

Angiopoietin-1-expressing adipose stem cells genetically modified with baculovirus nanocomplex: investigation in rat heart with acute infarction.

PubMed

Paul, Arghya; Nayan, Madhur; Khan, Afshan Afsar; Shum-Tim, Dominique; Prakash, Satya

2012-01-01

The objective of this study was to develop angiopoietin-1 (Ang1)-expressing genetically modified human adipose tissue derived stem cells (hASCs) for myocardial therapy. For this, an efficient gene delivery system using recombinant baculovirus complexed with cell penetrating transactivating transcriptional activator TAT peptide/deoxyribonucleic acid nanoparticles (Bac-NP), through ionic interactions, was used. It was hypothesized that the hybrid Bac- NP(Ang1) system can efficiently transduce hASCs and induces favorable therapeutic effects when transplanted in vivo. To evaluate this hypothesis, a rat model with acute myocardial infarction and intramyocardially transplanted Ang1-expressing hASCs (hASC-Ang1), genetically modified by Bac-NP(Ang1), was used. Ang1 is a crucial pro-angiogenic factor for vascular maturation and neovasculogenesis. The released hAng1 from hASC-Ang1 demonstrated profound mitotic and anti-apoptotic activities on endothelial cells and cardiomyocytes. The transplanted hASC-Ang1 group showed higher cell retention compared to hASC and control groups. A significant increase in capillary density and reduction in infarct sizes were noted in the infarcted hearts with hASC-Ang1 treatment compared to infarcted hearts treated with hASC or the untreated group. Furthermore, the hASC-Ang1 group showed significantly higher cardiac performance in echocardiography (ejection fraction 46.28% ± 6.3%, P < 0.001 versus control, n = 8) than the hASC group (36.35% ± 5.7%, P < 0.01, n = 8), 28 days post-infarction. The study identified Bac-NP complex as an advanced gene delivery vehicle for stem cells and demonstrated its potential to treat ischemic heart disease with high therapeutic index for combined stem cell-gene therapy strategy.

Development of a baculovirus vector carrying a small hairpin RNA for suppression of sf-caspase-1 expression and improvement of recombinant protein production.

PubMed

Zhang, Xiaoyue; Xu, Keyan; Ou, Yanmei; Xu, Xiaodong; Chen, Hongying

2018-05-02

The Baculovirus expression vector system (BEVS) is a transient expression platform for recombinant protein production in insect cells. Baculovirus infection of insect cells will shutoff host translation and induce apoptosis and lead to the termination of protein expression. Previous reports have demonstrated the enhancement of protein yield in BEVS using stable insect cell lines expressing interference RNA to suppress the expression of caspase-1. In this study, short-hairpin RNA (shRNA) expression cassettes targeting Spodoptera frugiperda caspase-1 (Sf-caspase-1) were constructed and inserted into an Autographa californica multiple nucleopolyhedrovirus (AcMNPV) vector. Using the recombinant baculovirus vectors, we detected the suppression of Sf-caspase-1 expression and cell apoptosis. Green fluorescent protein (GFP), Discosoma sp. Red (DsRed) and firefly luciferase were then expressed as reporter proteins. The results showed that suppression of apoptosis enhanced the accumulation of exogenous proteins at 2 and 3 days post infection. After 4 days post infection, the activity of the reporter proteins remained higher in BEVS using the baculovirus carrying shRNA in comparison with the control without shRNA, but the accumulated protein levels showed no obvious difference between them, suggesting that apoptosis suppression resulted in improved protein folding rather than translation efficiency at the very late stage of baculovirus infection. The baculovirus vector developed in this study would be a useful tool for the production of active proteins suitable for structural and functional studies or pharmaceutical applications in Sf9 cells, and it also has the potential to be adapted for the improvement of protein expression in different insect cell lines that can be infected by AcMNPV.

Characterization of a heavy metal translocating P-type ATPase gene from an environmental heavy metal resistance Enterobacter sp. isolate.

PubMed

Chien, Chih-Ching; Huang, Chia-Hsuan; Lin, Yi-Wei

2013-03-01

Heavy metals are common contaminants found in polluted areas. We have identified a heavy metal translocating P-type ATPase gene (hmtp) via fosmid library and in vitro transposon mutagenesis from an Enterobacter sp. isolate. This gene is believed to participate in the bacterium's heavy metal resistance traits. The complete gene was identified, cloned, and expressed in a suitable Escherichia coli host cell. E. coli W3110, RW3110 (zntA::Km), GG48 (ΔzitB::Cm zntA::Km), and GG51 (ΔzitB::Cm) were used to study the possible effects of this gene for heavy metal (cadmium and zinc in particular) resistance. Among the E. coli strains tested, RW3110 and GG48 showed more sensitivity to cadmium and zinc compared to the wild-type E. coli W3110 and strain GG51. Therefore, strains RW3110 and GG48 were chosen for the reference hosts for further evaluation of the gene's effect. The results showed that expression of this heavy metal translocating P-type ATPase gene could increase the ability for zinc and cadmium resistance in the tested microorganisms.

The baculovirus core gene ac83 is required for nucleocapsid assembly and per os infectivity of Autographa californica nucleopolyhedrovirus.

PubMed

Zhu, Shimao; Wang, Wei; Wang, Yan; Yuan, Meijin; Yang, Kai

2013-10-01

Autographa californica multiple nucleopolyhedrovirus (AcMNPV) ac83 is a baculovirus core gene whose function in the AcMNPV life cycle is unknown. In the present study, an ac83-knockout AcMNPV (vAc83KO) was constructed to investigate the function of ac83 through homologous recombination in Escherichia coli. No budded virions were produced in vAc83KO-transfected Sf9 cells, although viral DNA replication was unaffected. Electron microscopy revealed that nucleocapsid assembly was aborted due to the ac83 deletion. Domain-mapping studies revealed that the expression of Ac83 amino acid residues 451 to 600 partially rescued the ability of AcMNPV to produce infectious budded virions. Bioassays indicated that deletion of the chitin-binding domain of Ac83 resulted in the failure of oral infection of Trichoplusia ni larvae by AcMNPV, but AcMNPV remained infectious following intrahemocoelic injection, suggesting that the domain is involved in the binding of occlusion-derived virions to the peritrophic membrane and/or to other chitin-containing insect tissues. It has been demonstrated that Ac83 is the only component with a chitin-binding domain in the per os infectivity factor complex on the occlusion-derived virion envelope. Interestingly, a functional inner nuclear membrane sorting motif, which may facilitate the localization of Ac83 to the envelopes of occlusion-derived virions, was identified by immunofluorescence analysis. Taken together, these results demonstrate that Ac83 plays an important role in nucleocapsid assembly and the establishment of oral infection.

In vivo production of recombinant proteins using occluded recombinant AcMNPV-derived baculovirus vectors.

PubMed

Guijarro-Pardo, Eva; Gómez-Sebastián, Silvia; Escribano, José M

2017-12-01

Trichoplusia ni insect larvae infected with vectors derived from the Autographa californica multiple nucleopolyhedrovirus (AcMNPV), are an excellent alternative to insect cells cultured in conventional bioreactors to produce recombinant proteins because productivity and cost-efficiency reasons. However, there is still a lot of work to do to reduce the manual procedures commonly required in this production platform that limit its scalability. To increase the scalability of this platform technology, a current bottleneck to be circumvented in the future is the need of injection for the inoculation of larvae with polyhedrin negative baculovirus vectors (Polh-) because of the lack of oral infectivity of these viruses, which are commonly used for production in insect cell cultures. In this work we have developed a straightforward alternative to obtain orally infective vectors derived from AcMNPV and expressing recombinant proteins that can be administered to the insect larvae (Trichoplusia ni) by feeding, formulated in the insect diet. The approach developed was based on the use of a recombinant polyhedrin protein expressed by a recombinant vector (Polh+), able to co-occlude any recombinant Polh- baculovirus vector expressing a recombinant protein. A second alternative was developed by the generation of a dual vector co-expressing the recombinant polyhedrin protein and the foreign gene of interest to obtain the occluded viruses. Additionally, by the incorporation of a reporter gene into the helper Polh+ vector, it was possible the follow-up visualization of the co-occluded viruses infection in insect larvae and will help to homogenize infection conditions. By using these methodologies, the production of recombinant proteins in per os infected larvae, without manual infection procedures, was very similar in yield to that obtained by manual injection of recombinant Polh- AcMNPV-based vectors expressing the same proteins. However, further analyses will be required for a

Heliothis zea nudivirus 1 gene hhi1 induces apoptosis which is blocked by the Hz-iap2 gene and a noncoding gene, pag1.

PubMed

Wu, Yueh-Lung; Wu, Carol P; Liu, Catherine Y Y; Lee, Song-Tay; Lee, Hsiao-Ping; Chao, Yu-Chan

2011-07-01

Heliothis zea nudivirus 1 (HzNV-1 or Hz-1 virus), previously regarded as a nonoccluded baculovirus, recently has been placed in the Nudivirus genus. This virus generates HzNV-1 HindIII-I 1 (hhi1) and many other transcripts during productive viral infection; during latent viral infection, however, persistency-associated gene 1 (pag1) is the only gene expressed. In this report, we used transient expression assays to show that hhi1 can trigger strong apoptosis in transfected cells, which can be blocked, at least partially, by the inhibitor of apoptosis genes Autographa californica iap2 (Ac-iap2) and H. zea iap2 (Hz-iap2). In addition to these two genes, unexpectedly, pag1, which encodes a noncoding RNA with no detectable protein product, was found to efficiently suppress hhi1-induced apoptosis. The assay of pro-Sf-caspase-1 processing by hhi1 transfection did not detect the small P12 subunit at any of the time intervals tested, suggesting that hhi1 of HzNV-1 induces apoptosis through alternative caspase pathways.

Expression and Self-Assembly in Baculovirus of Porcine Enteric Calicivirus Capsids into Virus-Like Particles and Their Use in an Enzyme-Linked Immunosorbent Assay for Antibody Detection in Swine

PubMed Central

Guo, Mingzhang; Qian, Yuan; Chang, Kyeong-Ok; Saif, Linda J.

2001-01-01

Porcine enteric calicivirus (PEC) causes diarrhea and intestinal lesions in pigs. PEC strain Cowden grows to low to moderate titers in cell culture but only with the addition of intestinal contents from uninfected gnotobiotic pigs (W. T. Flynn and L. J. Saif, J. Clin. Microbiol. 26:206–212, 1988; A. V. Parwani, W. T. Flynn, K. L. Gadfield, and L. J. Saif, Arch. Virol. 120:115–122, 1991). Cloning and sequence analysis of the PEC Cowden full-length genome revealed that it is most closely related genetically to the human Sapporo-like viruses. In this study, the complete PEC capsid gene was subcloned into the plasmid pBlueBac4.5 and the recombinant baculoviruses were identified by plaque assay and PCR. The PEC capsid protein was expressed in insect (Sf9) cells inoculated with the recombinant baculoviruses, and the recombinant capsid proteins self- assembled into virus-like particles (VLPs) that were released into the cell supernatant and purified by CsCl gradient centrifugation. The PEC VLPs had the same molecular mass (58 kDa) as the native virus capsid and reacted with pig hyperimmune and convalescent-phase sera to PEC Cowden in enzyme-linked immunosorbent assay (ELISA) and Western blotting. The PEC capsid VLPs were morphologically and antigenically similar to the native virus by immune electron microscopy. High titers (1:102,400 to 204,800) of PEC-specific antibodies were induced in guinea pigs inoculated with PEC VLPs, suggesting that the VLPs could be useful for future candidate PEC vaccines. A fixed-cell ELISA and VLP ELISA were developed to detect PEC serum antibodies in pigs. For the fixed-cell ELISA, Sf9 cells were infected with recombinant baculoviruses expressing PEC capsids, followed by cell fixation with formalin. For the VLP ELISA, the VLPs were used for the coating antigen. Our data indicate that both tests were rapid, specific, and reproducible and might be used for large-scale serological investigations of PEC antibodies in swine. PMID:11283075

P97/CDC-48: proteostasis control in tumor cell biology.

PubMed

Fessart, Delphine; Marza, Esther; Taouji, Saïd; Delom, Frédéric; Chevet, Eric

2013-08-28

P97/CDC-48 is a prominent member of a highly evolutionary conserved Walker cassette - containing AAA+ATPases. It has been involved in numerous cellular processes ranging from the control of protein homeostasis to membrane trafficking through the intervention of specific accessory proteins. Expression of p97/CDC-48 in cancers has been correlated with tumor aggressiveness and prognosis, however the precise underlying molecular mechanisms remain to be characterized. Moreover p97/CDC-48 inhibitors were developed and are currently under intense investigation as anticancer drugs. Herein, we discuss the role of p97/CDC-48 in cancer development and its therapeutic potential in tumor cell biology. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

p48 Activates a UV-Damaged-DNA Binding Factor and Is Defective in Xeroderma Pigmentosum Group E Cells That Lack Binding Activity

PubMed Central

Hwang, Byung Joon; Toering, Stephanie; Francke, Uta; Chu, Gilbert

1998-01-01

A subset of xeroderma pigmentosum (XP) group E cells lack a factor that binds to DNA damaged by UV radiation. This factor can be purified to homogeneity as p125, a 125-kDa polypeptide. However, when cDNA encoding p125 is translated in vitro, only a small fraction binds to UV-damaged DNA, suggesting that a second factor is required for the activation of p125. We discovered that most hamster cell lines expressed inactive p125, which was activated in somatic cell hybrids containing human chromosome region 11p11.2-11cen. This region excluded p125 but included p48, which encodes a 48-kDa polypeptide known to copurify with p125 under some conditions. Expression of human p48 activated p125 binding in hamster cells and increased p125 binding in human cells. No such effects were observed from expression of p48 containing single amino acid substitutions from XP group E cells that lacked binding activity, demonstrating that the p48 gene is defective in those cells. Activation of p125 occurred by a “hit-and-run” mechanism, since the presence of p48 was not required for subsequent binding. Nevertheless, p48 was capable of forming a complex with p125 either bound to UV-damaged DNA or in free solution. It is notable that hamster cells fail to efficiently repair cyclobutane pyrimidine dimers in nontranscribed DNA and fail to express p48, which contains a WD motif with homology to proteins that reorganize chromatin. We propose that p48 plays a role in repairing lesions that would otherwise remain inaccessible in nontranscribed chromatin. PMID:9632823

Effect of different baculovirus inactivation procedures on the integrity and immunogenicity of porcine parvovirus-like particles.

PubMed

Rueda, P; Fominaya, J; Langeveld, J P; Bruschke, C; Vela, C; Casal, J I

2000-11-22

We have demonstrated earlier the usefulness of recombinant porcine parvovirus (PPV) virus-like particles (VLPs) as an efficient recombinant vaccine for PPV. Here, we have demonstrated that preparations of PPV VLPs could be contaminated by recombinant baculoviruses. Since these baculoviruses can be a problem for the registration and safety requirements of the recombinant vaccine, we have tested different baculovirus inactivation strategies, studying simultaneously the integrity and immunogenicity of the VLPs. These methods were pasteurization, treatment with detergents and alkylation with binary ethylenimine (BEI). The structural and functional integrity of the PPV VLPs after the inactivation treatments were analyzed by electron microscopy, hemagglutination, double antibody sandwich (DAS)-ELISA and immunogenicity studies. Binary ethylenimine and Triton X-100 inactivated particles maintained all the original structural and antigenic properties. In addition, PPV VLPs were subjected to size-exclusion chromatography to analyze the presence of VP2 monomers or any other contaminant. The resulting highly purified material was used as the standard of reference to quantify PPV VLPs in order to determine the dose of vaccine by DAS-ELISA. After immunization experiments in guinea pigs, the antibody titers obtained with all the inactivation procedures were very similar. Triton X-100 treatment was selected for further testing in animals because of the speed, simplicity and safety of the overall procedure.

Reduction of the infectivity of baculovirus stocks frozen at ultra-low temperature in serum-free media: The role of lipid emulsions.

PubMed

Eberhardt, Ignacio; Gioria, Verónica Viviana; Micheloud, Gabriela Analía; Claus, Juan Daniel

2016-11-01

The infectivity of stocks of baculoviruses produced in serum-free media is sensitive to freezing at ultra-low temperatures. The objective of this work was to elucidate the causes of such sensitivity, using as a model the freezing of stocks of Anticarsia gemmatalis multiple nucleopolyhedrovirus (AgMNPV), a baculovirus widely employed as biological insecticide. Titers of supernatants of cell cultures infected with AgMNPV in four different serum-free media supplemented with lipid emulsions were reduced by 50 to 90% after six months freezing. By using a full factorial experiment, freezing and lipid emulsion, as well as the interaction between them, were identified as the main factors reducing the viral titer. The virucidal effect of the lipid emulsion was reproduced by one of their components, the surfactant Polysorbate 80. Damaged viral envelopes were observed by transmission electron microscopy in most particles frozen in a medium supplemented with lipid emulsion or Polysorbate 80. Additionally, Polysorbate 80 also affected the infectivity of AgMNPV stocks that were incubated at 27°C. The identification of the roles played by the lipid emulsion and Polysorbate 80 is not only a contribution to the understanding of the mechanisms underlying the inactivation of baculovirus stocks produced in serum-free media during storage at ultra-low temperature, but is also an input for the rational development of new procedures aimed at improving both the preservation of baculovirus stocks and the composition of culture media for the production of baculovirus-based bioproducts in insect cells. © 2016 American Institute of Chemical Engineers Biotechnol. Prog., 32:1559-1569, 2016. © 2016 American Institute of Chemical Engineers.

Analysis of codon usage bias of envelope glycoprotein genes in nuclear polyhedrosis virus (NPV) and its relation to evolution.

PubMed

Zhao, Yongchao; Zheng, Hao; Xu, Anying; Yan, Donghua; Jiang, Zijian; Qi, Qi; Sun, Jingchen

2016-08-24

Analysis of codon usage bias is an extremely versatile method using in furthering understanding of the genetic and evolutionary paths of species. Codon usage bias of envelope glycoprotein genes in nuclear polyhedrosis virus (NPV) has remained largely unexplored at present. Hence, the codon usage bias of NPV envelope glycoprotein was analyzed here to reveal the genetic and evolutionary relationships between different viral species in baculovirus genus. A total of 9236 codons from 18 different species of NPV of the baculovirus genera were used to perform this analysis. Glycoprotein of NPV exhibits weaker codon usage bias. Neutrality plot analysis and correlation analysis of effective number of codons (ENC) values indicate that natural selection is the main factor influencing codon usage bias, and that the impact of mutation pressure is relatively smaller. Another cluster analysis shows that the kinship or evolutionary relationships of these viral species can be divided into two broad categories despite all of these 18 species are from the same baculovirus genus. There are many elements that can affect codon bias, such as the composition of amino acids, mutation pressure, natural selection, gene expression level, and etc. In the meantime, cluster analysis also illustrates that codon usage bias of virus envelope glycoprotein can serve as an effective means of evolutionary classification in baculovirus genus.

Analysis of the promoters involved in enterocin AS-48 expression.

PubMed

Cebrián, Rubén; Rodríguez-Ruano, Sonia; Martínez-Bueno, Manuel; Valdivia, Eva; Maqueda, Mercedes; Montalbán-López, Manuel

2014-01-01

The enterocin AS-48 is the best characterized antibacterial circular protein in prokaryotes. It is a hydrophobic and cationic bacteriocin, which is ribosomally synthesized by enterococcal cells and post-translationally cyclized by a head-to-tail peptide bond. The production of and immunity towards AS-48 depend upon the coordinated expression of ten genes organized in two operons, as-48ABC (where genes encoding enzymes with processing, secretion, and immunity functions are adjacent to the structural as-48A gene) and as-48C1DD1EFGH. The current study describes the identification of the promoters involved in AS-48 expression. Seven putative promoters have been here amplified, and separately inserted into the promoter-probe vector pTLR1, to create transcriptional fusions with the mCherry gene used as a reporter. The activity of these promoter regions was assessed measuring the expression of the fluorescent mCherry protein using the constitutive pneumococcal promoter PX as a reference. Our results revealed that only three promoters PA, P2(2) and PD1 were recognized in Enterococcus faecalis, Lactococcus lactis and Escherichia coli, in the conditions tested. The maximal fluorescence was obtained with PX in all the strains, followed by the P2(2) promoter, which level of fluorescence was 2-fold compared to PA and 4-fold compared to PD1. Analysis of putative factors influencing the promoter activity in single and double transformants in E. faecalis JH2-2 demonstrated that, in general, a better expression was achieved in presence of pAM401-81. In addition, the P2(2) promoter could be regulated in a negative fashion by genes existing in the native pMB-2 plasmid other than those of the as-48 cluster, while the pH seems to affect differently the as-48 promoter expression.

Prognostic value of the expression of tumor suppressor genes p53, p21, p16 and prb, and Ki-67 labelling in high grade astrocytomas treated with radiotherapy.

PubMed

Kirla, R; Salminen, E; Huhtala, S; Nuutinen, J; Talve, L; Haapasalo, H; Kalimo, H

2000-01-01

Cumulative inactivation of tumor suppressor genes and/or amplification of oncogenes lead to progressively more malignant astrocytic tumors. We have analyzed the significance of tumor suppressor genes p53, p21, p16 and retinoblastoma protein (pRb) and proliferative activity for survival in 77 high grade astrocytic tumors. After operation, the patients--25 anaplastic astrocytomas (AA) and 52 glioblastomas (GBs)--were treated with similar radiotherapy. The expression of the suppressor genes and the proliferative activity were analyzed immunohistochemically. p53 immunopositivity was found in 44% of AAs and 46% of GBs. Tumors with aberrant p53 expression had lower proliferation indices than p53 immunonegative tumors. Neither p53 expression nor p21 immunonegativity (52% of AAs and 48% of GBs) correlated with survival. p16 immunostaining was negative in 16% of AAs and in 44% of GBs, and it correlated inversely with survival in both uni- and multivariate analyses. pRb immunostaining was negative only in 8% of both AAs and GBs and the absence of p16 and pRb were mutually exclusive. Ki-67 labelling index (LI) was significantly higher in GBs (26.8%) than in AAs (20.3%), and in multivariate analysis it was an independent prognostic factor for survival. In 48% of AAs Ki-67 LI exceeded 20% and this subset of AAs had similar prognosis as GB. In high grade astrocytic tumors p16 immunonegativity was an independent indicator of poor prognosis in addition to the previously established patient's age, histopathology and Ki-67 LI. Furthermore, there was a subset of AAs with a high proliferation rate (> 20%) in which the histopathological hallmarks of GB were lacking, but which had similarly dismal prognosis as GB.

Gamow-Teller Strength Distributions in {sup 48}Sc by the {sup 48}Ca(p,n) and {sup 48}Ti(n,p) Reactions and Two-Neutrino Double-beta Decay Nuclear Matrix Elements

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yako, K.; Sasano, M.; Miki, K.

2009-07-03

The double-differential cross sections for the {sup 48}Ca(p,n) and {sup 48}Ti(n,p) reactions were measured at 300 MeV. A multipole decomposition technique was applied to the spectra to extract the Gamow-Teller (GT) components. The integrated GT strengths up to an excitation energy of 30 MeV in {sup 48}Sc are 15.3+-2.2 and 2.8+-0.3 in the (p,n) and (n,p) spectra, respectively. In the (n,p) spectra additional GT strengths were found above 8 MeV where shell models within the fp shell-model space predict almost no GT strengths, suggesting that the present shell-model description of the nuclear matrix element of the two-neutrino double-beta decay ismore » incomplete.« less

Soluble forms of the cell adhesion molecule L1 produced by insect and baculovirus-transduced mammalian cells enhance Schwann cell motility.

PubMed

Lavdas, Alexandros A; Efrose, Rodica; Douris, Vassilis; Gaitanou, Maria; Papastefanaki, Florentia; Swevers, Luc; Thomaidou, Dimitra; Iatrou, Kostas; Matsas, Rebecca

2010-12-01

For biotechnological applications, insect cell lines are primarily known as hosts for the baculovirus expression system that is capable to direct synthesis of high levels of recombinant proteins through use of powerful viral promoters. Here, we demonstrate the implementation of two alternative approaches based on the baculovirus system for production of a mammalian recombinant glycoprotein, comprising the extracellular part of the cell adhesion molecule L1, with potential important therapeutic applications in nervous system repair. In the first approach, the extracellular part of L1 bearing a myc tag is produced in permanently transformed insect cell lines and purified by affinity chromatography. In the second approach, recombinant baculoviruses that express L1-Fc chimeric protein, derived from fusion of the extracellular part of L1 with the Fc part of human IgG1, under the control of a mammalian promoter are used to infect mammalian HEK293 and primary Schwann cells. Both the extracellular part of L1 bearing a myc tag accumulating in the supernatants of insect cultures as well as L1-Fc secreted by transduced HEK293 or Schwann cells are capable of increasing the motility of Schwann cells with similar efficiency in a gap bridging bioassay. In addition, baculovirus-transduced Schwann cells show enhanced motility when grafted on organotypic cultures of neonatal brain slices while they retain their ability to myelinate CNS axons. This proof-of-concept that the migratory properties of myelin-forming cells can be modulated by recombinant protein produced in insect culture as well as by means of baculovirus-mediated adhesion molecule expression in mammalian cells may have beneficial applications in the field of CNS therapies. ©2010 The Authors. Journal of Neurochemistry © 2010 International Society for Neurochemistry.

A Gene for an Extended Phenotype

Treesearch

K. Hoover; M. Grove; M. Gardner; D. P. Hughes; J. McNeil; J. Slavicek

2011-01-01

Manipulation of host behavior by parasites and pathogens has been widely observed, but the basis for these behaviors has remained elusive. Gypsy moths infected by a baculovirus climb to the top of trees to die, liquefy, and "rain" virus on the foliage below to infect new hosts. The viral gene that manipulates climbing behavior of the host was identified,...

Purification of proteins from baculovirus-infected insect cells.

PubMed

O'Shaughnessy, Luke; Doyle, Sean

2011-01-01

Expression of recombinant proteins in the baculovirus/insect cell expression system is employed because it enables post-translational protein modification and high yields of recombinant protein. The system is capable of facilitating the functional expression of many proteins - either secreted or intracellularly located within infected insect cells. Strategies for the isolation and extraction of soluble proteins are presented in this chapter and involve selective cell lysis, precipitation and chromatography. Protein insolubility, following recombinant expression in insect cells, can occur. However, using the methods described herein, it is possible to extract and purify insoluble protein using affinity, ion-exchange and gel filtration chromatography. Indeed, protein insolubility often aids protein purification.

Physical mapping of the genomic DNA of the Oryctes rhinoceros baculovirus, KI.

PubMed

Mohan, K S; Gopinathan, K P

1991-11-15

A non-occluded baculovirus, OBV-KI has been isolated from the insect pest, Oryctes rhinoceros. The viral genome is estimated to be 123 kb, with a G + C content of 43 mol% and no detectible methylated bases. A restriction map of the OBV-KI genome for BamHI, EcoRI, HindIII, PstI, SalI and XbaI has been constructed.

Contributions of immune responses to developmental resistance in Lymantria dispar challenged with baculovirus

Treesearch

James McNeil; Diana Cox-Foster; James Slavicek; Kelli Hoover

2010-01-01

How the innate immune system functions to defend insects from viruses is an emerging field of study. We examined the impact of melanized encapsulation, a component of innate immunity that integrates both cellular and humoral immune responses, on the success of the baculovirus Lymantria dispar multiple nucleocapsid nucleopolyhedrovirus (LdMNPV) in its...

Molecular analysis of an enhancin gene in the Lymantria dispar nuclear polyhedrosis virus

Treesearch

David S. Bischoff; James M. Slavicek

1997-01-01

A Lymantria dispar nuclear polyhedrosis virus (LdMNPV) gene has been identified that encodes a homolog to the granulovirus (GV) enhancin proteins that are capable of enhancing the infection of other baculoviruses. Enhancin genes have been identified and sequenced for three species of GVs but have not been found in any other nuclear...

Integrated analysis of gene expression and methylation profiles of 48 candidate genes in breast cancer patients.

PubMed

Li, Zibo; Heng, Jianfu; Yan, Jinhua; Guo, Xinwu; Tang, Lili; Chen, Ming; Peng, Limin; Wu, Yepeng; Wang, Shouman; Xiao, Zhi; Deng, Zhongping; Dai, Lizhong; Wang, Jun

2016-11-01

Gene-specific methylation and expression have shown biological and clinical importance for breast cancer diagnosis and prognosis. Integrated analysis of gene methylation and gene expression may identify genes associated with biology mechanism and clinical outcome of breast cancer and aid in clinical management. Using high-throughput microfluidic quantitative PCR, we analyzed the expression profiles of 48 candidate genes in 96 Chinese breast cancer patients and investigated their correlation with gene methylation and associations with breast cancer clinical parameters. Breast cancer-specific gene expression alternation was found in 25 genes with significant expression difference between paired tumor and normal tissues. A total of 9 genes (CCND2, EGFR, GSTP1, PGR, PTGS2, RECK, SOX17, TNFRSF10D, and WIF1) showed significant negative correlation between methylation and gene expression, which were validated in the TCGA database. Total 23 genes (ACADL, APC, BRCA2, CADM1, CAV1, CCND2, CST6, EGFR, ESR2, GSTP1, ICAM5, NPY, PGR, PTGS2, RECK, RUNX3, SFRP1, SOX17, SYK, TGFBR2, TNFRSF10D, WIF1, and WRN) annotated with potential TFBSs in the promoter regions showed negative correlation between methylation and expression. In logistics regression analysis, 31 of the 48 genes showed improved performance in disease prediction with combination of methylation and expression coefficient. Our results demonstrated the complex correlation and the possible regulatory mechanisms between DNA methylation and gene expression. Integration analysis of methylation and expression of candidate genes could improve performance in breast cancer prediction. These findings would contribute to molecular characterization and identification of biomarkers for potential clinical applications.

A Novel Microdeletion in 1(p34.2p34.3), Involving the "SLC2A1" ("GLUT1") Gene, and Severe Delayed Development

ERIC Educational Resources Information Center

Vermeer, Sascha; Koolen, David A; Visser, Gepke; Brackel, Hein J. L.; van der Burgt, Ineke; de Leeuw, Nicole; Willemsen, Michel A. A. P.; Sistermans, Erik A.; Pfundt, Rolph; de Vries, Bert B. A.

2007-01-01

A "de novo" 4.1-megabase microdeletion of chromosome 1p34.2p34.3 has been identified by array-based comparative genomic hybridization in a young male with severely delayed development, microcephaly, pronounced hypotonia, and facial dysmorphism. The deleted region encompasses 48 genes, among them the glucose transporter 1 ("SLC2A1" or "GLUT1")…

Protein Expression Profiles of Permissive, Semi-Permissive and Non-Permissive Cells Infected by Baculovirus

USDA-ARS?s Scientific Manuscript database

Amassing information on the in vitro protein expression of an insect host challenged by an entomopathogenic agent, such as a baculovirus, is paramount to an enhanced understanding of how host-pathogen interactions determine the success or failure of a pathogen. In this study, 2D-gel electrophoresis...

Plant nitrogen regulatory P-PII genes

DOEpatents

Coruzzi, Gloria M.; Lam, Hon-Ming; Hsieh, Ming-Hsiun

2001-01-01

The present invention generally relates to plant nitrogen regulatory PII gene (hereinafter P-PII gene), a gene involved in regulating plant nitrogen metabolism. The invention provides P-PII nucleotide sequences, expression constructs comprising said nucleotide sequences, and host cells and plants having said constructs and, optionally expressing the P-PII gene from said constructs. The invention also provides substantially pure P-PII proteins. The P-PII nucleotide sequences and constructs of the

[Use of the recombinant baculovirus BacVP6C for the construction of an internal positive control of rotavirus C].

PubMed

Abid-Ayadi, I; Guix, S; Pintó, R M; Bosch, A

2011-06-01

Unlike group A, a few studies have interested other groups of the rotavirus, especially in Tunisia. The role of rotavirus C (RVC) infection is underestimated because of its sporadic nature. The aim of our study was to develop rapid diagnostic procedures of RVC by using an internal positive control of reverse transcription PCR (RT-PCR). The internal positive control (386pb) was designed from the recombinant baculovirus BacVP6C containing the full length cDNA of the Cowden strain gene 5 (1353pb). A fragment of 596pb was amplified by PCR using the BacVP6C DNA ds as template. Then, a central part of 210pb was deleted and the remaining fragment (386pb) was cloned into pGEM-3Zf(+) plasmid between SP6 and T7 RNA polymerase promoters. The obtained recombinant plasmid "pIAM1" was then used for the generation of the internal positive control by in vitro transcription. The sensibility of the RT-PCR was about 3.66×10(5) molecules of RNA/μl. The use of a shorter positive control, as compared to the wild type, allows increased specificity of the RT-PCR reaction, and could be used for efficient diagnostic and surveillance of RVC-caused diseases. Copyright © 2009 Elsevier Masson SAS. All rights reserved.

Diversity of bacteria and glycosyl hydrolase family 48 genes in cellulolytic consortia enriched from thermophilic biocompost.

PubMed

Izquierdo, Javier A; Sizova, Maria V; Lynd, Lee R

2010-06-01

The enrichment from nature of novel microbial communities with high cellulolytic activity is useful in the identification of novel organisms and novel functions that enhance the fundamental understanding of microbial cellulose degradation. In this work we identify predominant organisms in three cellulolytic enrichment cultures with thermophilic compost as an inoculum. Community structure based on 16S rRNA gene clone libraries featured extensive representation of clostridia from cluster III, with minor representation of clostridial clusters I and XIV and a novel Lutispora species cluster. Our studies reveal different levels of 16S rRNA gene diversity, ranging from 3 to 18 operational taxonomic units (OTUs), as well as variability in community membership across the three enrichment cultures. By comparison, glycosyl hydrolase family 48 (GHF48) diversity analyses revealed a narrower breadth of novel clostridial genes associated with cultured and uncultured cellulose degraders. The novel GHF48 genes identified in this study were related to the novel clostridia Clostridium straminisolvens and Clostridium clariflavum, with one cluster sharing as little as 73% sequence similarity with the closest known relative. In all, 14 new GHF48 gene sequences were added to the known diversity of 35 genes from cultured species.

Genomic structure and chromosomal localization of GML (GPI-anchored molecule-like protein), a gene induced by p53

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kimura, Yasutoshi; Furuhata, Tomohisa; Nakamura, Yusuke

1997-05-01

Among its known functions, tumor suppressor gene p53 serves as a transcriptional regulator and mediates various signals through activation of downstream genes. We recently identified a novel gene, GML (glycosylphosphatidylinositol (GPI)-anchored molecule-like protein), whose expression is specifically induced by wildtype p53. To characterize the GML gene further, we determined 35.8 kb of DNA sequence that included a consensus binding sequence for p53 and the entire GML gene. The GML gene consists of four exons, and the p53-binding sequence is present in the 5{prime}-flanking region. In genomic organization this gene resembles genes encoding murine Ly-6 glycoproteins, a human homologue of themore » Ly-6 family called RIG-E, and CD59; products of these genes, known as GPI-anchored proteins, are variously involved in signal transduction, cell-cell adhesion, and cell-matrix attachment. FISH analysis revealed that the GML gene is located on human chromosome 8q24.3. Genes encoding at least two other GPI-anchored molecules, E48 and RIG-E, are also located in this region. 20 refs., 2 figs., 1 tab.« less

Laboratory and field evaluations for efficacy of a fast-killing baculovirus isolate from Spodoptera frugiperda

USDA-ARS?s Scientific Manuscript database

Three biopesticide parameters were evaluated for a fast-killing isolate (3AP2) Spodoptera frugiperda multiple nucleopolyhedrovirus (SfMNPV) and a wild-type isolate (Sf3) of the same baculovirus. Both isolates were evaluated for virus production using in vivo methods, for speed of kill based on bioas...

A Herpes Simplex Virus Type 1 Mutant Expressing a Baculovirus Inhibitor of Apoptosis Gene in Place of Latency-Associated Transcript Has a Wild-Type Reactivation Phenotype in the Mouse

PubMed Central

Jin, Ling; Perng, Guey-Chuen; Mott, Kevin R.; Osorio, Nelson; Naito, Julia; Brick, David J.; Carpenter, Dale; Jones, Clinton; Wechsler, Steven L.

2005-01-01

The latency-associated transcript (LAT) is essential for the wild-type herpes simplex virus type 1 (HSV-1) high-reactivation phenotype since LAT− mutants have a low-reactivation phenotype. We previously reported that LAT can decrease apoptosis and proposed that this activity is involved in LAT's ability to enhance the HSV-1 reactivation phenotype. The first 20% of the primary 8.3-kb LAT transcript is sufficient for enhancing the reactivation phenotype and for decreasing apoptosis, supporting this proposal. For this study, we constructed an HSV-1 LAT− mutant that expresses the baculovirus antiapoptosis gene product cpIAP under control of the LAT promoter and in place of the LAT region mentioned above. Mice were ocularly infected with this mutant, designated dLAT-cpIAP, and the reactivation phenotype was determined using the trigeminal ganglion explant model. dLAT-cpIAP had a reactivation phenotype similar to that of wild-type virus and significantly higher than that of (i) the LAT− mutant dLAT2903; (ii) dLAT1.5, a control virus containing the same LAT deletion as dLAT-cpIAP, but with no insertion of foreign DNA, thereby controlling for potential readthrough transcription past the cpIAP insert; and (iii) dLAT-EGFP, a control virus identical to dLAT-cpIAP except that it contained the enhanced green fluorescent protein open reading frame (ORF) in place of the cpIAP ORF, thereby controlling for expression of a random foreign gene instead of the cpIAP gene. These results show that an antiapoptosis gene with no sequence similarity to LAT can efficiently substitute for the LAT function involved in enhancing the in vitro-induced HSV-1 reactivation phenotype in the mouse. PMID:16160155

Expression and purification of the matrix protein of Nipah virus in baculovirus insect cell system.

PubMed

Masoomi Dezfooli, Seyedehsara; Tan, Wen Siang; Tey, Beng Ti; Ooi, Chien Wei; Hussain, Siti Aslina

2016-01-01

Nipah virus (NiV) causes fatal respiratory illness and encephalitis in humans and animals. The matrix (M) protein of NiV plays an important role in the viral assembly and budding process. Thus, an access to the NiV M protein is vital to the design of viral antigens as diagnostic reagents. In this study, recombinant DNA technology was successfully adopted in the cloning and expression of NiV M protein. A recombinant expression cassette (baculovirus expression vector) was used to encode an N-terminally His-tagged NiV M protein in insect cells. A time-course study demonstrated that the highest yield of recombinant M protein (400-500 μg) was expressed from 107 infected cells 3 days after infection. A single-step purification method based on metal ion affinity chromatography was established to purify the NiV M protein, which successfully yielded a purity level of 95.67% and a purification factor of 3.39. The Western blotting and enzyme-linked immunosorbent assay (ELISA) showed that the purified recombinant M protein (48 kDa) was antigenic and reacted strongly with the serum of a NiV infected pig. © 2015 American Institute of Chemical Engineers.

Baculovirus AC102 Is a Nucleocapsid Protein That Is Crucial for Nuclear Actin Polymerization and Nucleocapsid Morphogenesis.

PubMed

Hepp, Susan E; Borgo, Gina M; Ticau, Simina; Ohkawa, Taro; Welch, Matthew D

2018-06-01

The baculovirus Autographa californica multiple nucleopolyhedrovirus (AcMNPV), the type species of alphabaculoviruses, is an enveloped DNA virus that infects lepidopteran insects and is commonly known as a vector for protein expression and cell transduction. AcMNPV belongs to a diverse group of viral and bacterial pathogens that target the host cell actin cytoskeleton during infection. AcMNPV is unusual, however, in that it absolutely requires actin translocation into the nucleus early in infection and actin polymerization within the nucleus late in infection coincident with viral replication. Of the six viral factors that are sufficient, when coexpressed, to induce the nuclear localization of actin, only AC102 is essential for viral replication and the nuclear accumulation of actin. We therefore sought to better understand the role of AC102 in actin mobilization in the nucleus early and late in infection. Although AC102 was proposed to function early in infection, we found that AC102 is predominantly expressed as a late protein. In addition, we observed that AC102 is required for F-actin assembly in the nucleus during late infection, as well as for proper formation of viral replication structures and nucleocapsid morphogenesis. Finally, we found that AC102 is a nucleocapsid protein and a newly recognized member of a complex consisting of the viral proteins EC27, C42, and the actin polymerization protein P78/83. Taken together, our findings suggest that AC102 is necessary for nucleocapsid morphogenesis and actin assembly during late infection through its role as a component of the P78/83-C42-EC27-AC102 protein complex. IMPORTANCE The baculovirus Autographa californica multiple nucleopolyhedrovirus (AcMNPV) is an important biotechnological tool for protein expression and cell transduction, and related nucleopolyhedroviruses are also used as environmentally benign insecticides. One impact of our work is to better understand the fundamental mechanisms through which Ac

Electron Tomography and Simulation of Baculovirus Actin Comet Tails Support a Tethered Filament Model of Pathogen Propulsion

PubMed Central

Mueller, Jan; Pfanzelter, Julia; Winkler, Christoph; Narita, Akihiro; Le Clainche, Christophe; Nemethova, Maria; Carlier, Marie-France; Maeda, Yuichiro; Welch, Matthew D.; Ohkawa, Taro; Schmeiser, Christian; Resch, Guenter P.; Small, J. Victor

2014-01-01

Several pathogens induce propulsive actin comet tails in cells they invade to disseminate their infection. They achieve this by recruiting factors for actin nucleation, the Arp2/3 complex, and polymerization regulators from the host cytoplasm. Owing to limited information on the structural organization of actin comets and in particular the spatial arrangement of filaments engaged in propulsion, the underlying mechanism of pathogen movement is currently speculative and controversial. Using electron tomography we have resolved the three-dimensional architecture of actin comet tails propelling baculovirus, the smallest pathogen yet known to hijack the actin motile machinery. Comet tail geometry was also mimicked in mixtures of virus capsids with purified actin and a minimal inventory of actin regulators. We demonstrate that propulsion is based on the assembly of a fishbone-like array of actin filaments organized in subsets linked by branch junctions, with an average of four filaments pushing the virus at any one time. Using an energy-minimizing function we have simulated the structure of actin comet tails as well as the tracks adopted by baculovirus in infected cells in vivo. The results from the simulations rule out gel squeezing models of propulsion and support those in which actin filaments are continuously tethered during branch nucleation and polymerization. Since Listeria monocytogenes, Shigella flexneri, and Vaccinia virus among other pathogens use the same common toolbox of components as baculovirus to move, we suggest they share the same principles of actin organization and mode of propulsion. PMID:24453943

Electron tomography and simulation of baculovirus actin comet tails support a tethered filament model of pathogen propulsion.

PubMed

Mueller, Jan; Pfanzelter, Julia; Winkler, Christoph; Narita, Akihiro; Le Clainche, Christophe; Nemethova, Maria; Carlier, Marie-France; Maeda, Yuichiro; Welch, Matthew D; Ohkawa, Taro; Schmeiser, Christian; Resch, Guenter P; Small, J Victor

2014-01-01

Several pathogens induce propulsive actin comet tails in cells they invade to disseminate their infection. They achieve this by recruiting factors for actin nucleation, the Arp2/3 complex, and polymerization regulators from the host cytoplasm. Owing to limited information on the structural organization of actin comets and in particular the spatial arrangement of filaments engaged in propulsion, the underlying mechanism of pathogen movement is currently speculative and controversial. Using electron tomography we have resolved the three-dimensional architecture of actin comet tails propelling baculovirus, the smallest pathogen yet known to hijack the actin motile machinery. Comet tail geometry was also mimicked in mixtures of virus capsids with purified actin and a minimal inventory of actin regulators. We demonstrate that propulsion is based on the assembly of a fishbone-like array of actin filaments organized in subsets linked by branch junctions, with an average of four filaments pushing the virus at any one time. Using an energy-minimizing function we have simulated the structure of actin comet tails as well as the tracks adopted by baculovirus in infected cells in vivo. The results from the simulations rule out gel squeezing models of propulsion and support those in which actin filaments are continuously tethered during branch nucleation and polymerization. Since Listeria monocytogenes, Shigella flexneri, and Vaccinia virus among other pathogens use the same common toolbox of components as baculovirus to move, we suggest they share the same principles of actin organization and mode of propulsion.

Zika Virus Baculovirus-Expressed Virus-Like Particles Induce Neutralizing Antibodies in Mice.

PubMed

Dai, Shiyu; Zhang, Tao; Zhang, Yanfang; Wang, Hualin; Deng, Fei

2018-06-01

The newly emerged mosquito-borne Zika virus (ZIKV) strains pose a global challenge owing to its ability to cause microcephaly and neurological disorders. Several ZIKV vaccine candidates have been proposed, including inactivated and live attenuated virus vaccines, vector-based vaccines, DNA and RNA vaccines. These have been shown to be efficacious in preclinical studies in mice and nonhuman primates, but their use will potentially be a threat to immunocompromised individuals and pregnant women. Virus-like particles (VLPs) are empty particles composed merely of viral proteins, which can serve as a safe and valuable tool for clinical prevention and treatment strategies. In this study, we used a new strategy to produce ZIKV VLPs based on the baculovirus expression system and demonstrated the feasibility of their use as a vaccine candidate. The pre-membrane (prM) and envelope (E) proteins were co-expressed in insect cells and self-assembled into particles similar to ZIKV. We found that the ZIKV VLPs could be quickly and easily prepared in large quantities using this system. The VLPs were shown to have good immunogenicity in immunized mice, as they stimulated high levels of virus neutralizing antibody titers, ZIKV-specific IgG titers and potent memory T cell responses. Thus, the baculovirus-based ZIKV VLP vaccine is a safe, effective and economical vaccine candidate for use against ZIKV.

Incorporation of adenylate cyclase into membranes of giant liposomes using membrane fusion with recombinant baculovirus-budded virus particles.

PubMed

Mori, Takaaki; Kamiya, Koki; Tomita, Masahiro; Yoshimura, Tetsuro; Tsumoto, Kanta

2014-06-01

Recombinant transmembrane adenylate cyclase (AC) was incorporated into membranes of giant liposomes using membrane fusion between liposomes and baculovirus-budded virus (BV). AC genes were constructed into transfer vectors in a form fused with fluorescent protein or polyhistidine at the C-terminus. The recombinant BVs were collected by ultracentrifugation and AC expression was verified using western blotting. The BVs and giant liposomes generated using gentle hydration were fused under acidic conditions; the incorporation of AC into giant liposomes was demonstrated by confocal laser scanning microscopy through the emission of fluorescence from their membranes. The AC-expressing BVs were also fused with liposomes containing the substrate (ATP) with/without a specific inhibitor (SQ 22536). An enzyme immunoassay on extracts of the sample demonstrated that cAMP was produced inside the liposomes. This procedure facilitates direct introduction of large transmembrane proteins into artificial membranes without solubilization.

CHARACTERIZATION OF THE GLYCOSYLATED ECDYSTEROIDS IN THE HEMOLYMPH OF BACULOVIRUS-INFECTED GYPSY MOTH LARVAE AND CELLS IN CULTURE

EPA Science Inventory

Fourth-instar gypsy moth (Lymantria dispar; Lepidoptera: Lymantriidae) larvae, infected with the gypsy moth baculovirus (LdNPV), show an elevated and prolonged extension of the hemolymph ecdysteroid titer peak associated with molting. The ecdysteroid immunoreactivity associated w...

Baculovirus vectors expressing F proteins in combination with virus-induced signaling adaptor (VISA) molecules confer protection against respiratory syncytial virus infection.

PubMed

Zhang, Yuan; Qiao, Lei; Hu, Xiao; Zhao, Kang; Zhang, Yanwen; Chai, Feng; Pan, Zishu

2016-01-04

Baculovirus has been exploited for use as a novel vaccine vector. To investigate the feasibility and efficacy of recombinant baculoviruses (rBVs) expressing respiratory syncytial virus (RSV) fusion (F) proteins, four constructs (Bac-tF/64, Bac-CF, Bac-CF/tF64 and Bac-CF/tF64-VISA) were generated. Bac-tF64 displays the F ectodomain (tF) on the envelope of rBVs, whereas Bac-CF expresses full-length F protein in transduced mammalian cells. Bac-CF/tF64 not only displays tF on the envelope but also expresses F in cells. Bac-CF/tF64-VISA comprises Bac-CF/tF64 harboring the virus-induced signaling adaptor (VISA) gene. After administration to BALB/c mice, all four vectors elicited RSV neutralizing antibody (Ab), systemic Ab (IgG, IgG1, and IgG2a), and cytokine responses. Compared with Bac-tF64, mice inoculated with Bac-CF and Bac-CF/tF64 exhibited an increased mixed Th1/Th2 cytokine response, increased ratios of IgG2a/IgG1 antibody responses, and reduced immunopathology upon RSV challenge. Intriguingly, co-expression of VISA reduced Th2 cytokine (IL-4, IL-5, and IL-10) production induced by Bac-CF/tF64, thus relieving lung pathology upon a subsequent RSV challenge. Our results indicated that the Bac-CF/tF64 vector incorporated with the VISA molecule may provide an effective vaccine strategy for protection against RSV. Copyright © 2015 Elsevier Ltd. All rights reserved.

Adenovirus-Mediated p202 Gene Transfer in Breast Cancer Gene Therapy

DTIC Science & Technology

2005-05-01

transcriptional regulation of genes important for cell cycle control, differentiation, and apoptosis (1, 3, 4). Our previous studies have shown that p202...leads to induction of p53 and activation of p53 target gene (e.g., p21 CIP 1). 10. The positive regulation of p53 by IFIXcd can be observed only in...cancers. Together, our data suggest that both Ad-p202 and IFIX may be further developed into efficient therapeutic agents for human cancer gene

Characterization of an Sf-rhabdovirus-negative Spodoptera frugiperda cell line as an alternative host for recombinant protein production in the baculovirus-insect cell system.

PubMed

Maghodia, Ajay B; Geisler, Christoph; Jarvis, Donald L

2016-06-01

Cell lines derived from the fall armyworm, Spodoptera frugiperda (Sf), are widely used as hosts for recombinant protein production in the baculovirus-insect cell system (BICS). However, it was recently discovered that these cell lines are contaminated with a virus, now known as Sf-rhabdovirus [1]. The detection of this adventitious agent raised a potential safety issue that could adversely impact the BICS as a commercial recombinant protein production platform. Thus, we examined the properties of Sf-RVN, an Sf-rhabdovirus-negative Sf cell line, as a potential alternative host. Nested RT-PCR assays showed Sf-RVN cells had no detectable Sf-rhabdovirus over the course of 60 passages in continuous culture. The general properties of Sf-RVN cells, including their average growth rates, diameters, morphologies, and viabilities after baculovirus infection, were virtually identical to those of Sf9 cells. Baculovirus-infected Sf-RVN and Sf9 cells produced equivalent levels of three recombinant proteins, including an intracellular prokaryotic protein and two secreted eukaryotic glycoproteins, and provided similar N-glycosylation patterns. In fact, except for the absence of Sf-rhabdovirus, the only difference between Sf-RVN and Sf9 cells was SF-RVN produced higher levels of infectious baculovirus progeny. These results show Sf-RVN cells can be used as improved, alternative hosts to circumvent the potential safety hazard associated with the use of Sf-rhabdovirus-contaminated Sf cells for recombinant protein manufacturing with the BICS. Copyright © 2016 Elsevier Inc. All rights reserved.

Evolution in Oryctes baculovirus: rate and types of genomic change.

PubMed

Crawford, A M; Zelazny, B

1990-01-01

Three cloned strains of Oryctes baculovirus were released into a previously unexposed population of the host insect, the coconut palm rhinoceros beetle, Oryctes rhinoceros. The experiment was conducted on Meemu Atoll in the Maldive Islands. Viruses were isolated from the beetle population at 1 year, 1.75 years, and 4 years after release. No changes in genotype were observed in viruses isolated after 1 and 1.75 years. After 4 years, however, three types of genomic change had occurred. A recombinant derived from two of the released strains, an isolate containing a 100-bp insert, and one example of a point mutation were found in the 22 isolates examined.

Bacteriophage P2 ogr and P4 delta genes act independently and are essential for P4 multiplication.

PubMed Central

Halling, C; Calendar, R

1990-01-01

Satellite bacteriophage P4 requires the products of the late genes of a helper phage such as P2 for lytic growth. Expression of the P2 late genes is positively regulated by the P2 ogr gene in a process requiring P2 DNA replication. Transactivation of P2 late gene expression by P4 requires the P4 delta gene product and works even in the absence of P2 DNA replication. We have made null mutants of the P2 ogr and P4 delta genes. In the absence of the P4 delta gene product, P4 multiplication required both the P2 ogr protein and P2 DNA replication. In the absence of the P2 ogr gene product, P4 multiplication required the P4 delta protein. In complementation experiments, we found that the P2 ogr protein was made in the absence of P2 DNA replication but could not function unless P2 DNA replicated. We produced P4 delta protein from a plasmid and found that it complemented the null P4 delta and P2 ogr mutants. Images PMID:2193911

Armored DNA in recombinant Baculoviruses as controls in molecular genetic assays.

PubMed

Freystetter, Andrea; Paar, Christian; Stekel, Herbert; Berg, Jörg

2017-10-01

The widespread use of molecular PCR-based assays in analytical and clinical laboratories brings about the need for test-specific, stable, and reliable external controls (EC) as well as standards and internal amplification controls (IC), in order to arrive at consistent test results. In addition, there is also a growing need to produce and provide stable, well-characterized molecular controls for quality assurance programs. In this study, we describe a novel approach to generate armored double-stranded DNA controls, which are encapsulated in baculovirus (BV) particles of the species Autographa californica multiple nucleopolyhedrovirus. We used the well-known BacPAK™ Baculovirus Expression System (Takara-Clontech), removed the polyhedrin promoter used for protein expression, and generated recombinant BV-armored DNAs. The obtained BV-armored DNAs were readily extracted by standard clinical DNA extraction methods, showed favorable linearity and performance in our clinical PCR assays, were resistant to DNase I digestion, and exhibited marked stability in human plasma and serum. BV-armored DNA ought to be used as ECs, quantification standards, and ICs in molecular assays, with the latter application allowing for the entire monitoring of clinical molecular assays for sample adequacy. BV-armored DNA may also be used to produce double-stranded DNA reference materials for, e.g., quality assurance programs. The ease to produce BV-armored DNA should make this approach feasible for a broad spectrum of molecular applications. Finally, as BV-armored DNAs are non-infectious to mammals, they may be even more conveniently shipped than clinical specimen.

The Complete Genome of a New Betabaculovirus from Clostera anastomosis

PubMed Central

Yin, Feifei; Zhu, Zheng; Liu, Xiaoping; Hou, Dianhai; Wang, Jun; Zhang, Lei; Wang, Manli; Kou, Zheng; Wang, Hualin; Deng, Fei; Hu, Zhihong

2015-01-01

Clostera anastomosis (Lepidoptera: Notodontidae) is a defoliating forest insect pest. Clostera anastomosis granulovirus-B (ClasGV-B) belonging to the genus Betabaculovirus of family Baculoviridae has been used for biological control of the pest. Here we reported the full genome sequence of ClasGV-B and compared it to other previously sequenced baculoviruses. The circular double-stranded DNA genome is 107,439 bp in length, with a G+C content of 37.8% and contains 123 open reading frames (ORFs) representing 93% of the genome. ClasGV-B contains 37 baculovirus core genes, 25 lepidopteran baculovirus specific genes, 19 betabaculovirus specific genes, 39 other genes with homologues to baculoviruses and 3 ORFs unique to ClasGV-B. Hrs appear to be absent from the ClasGV-B genome, however, two non-hr repeats were found. Phylogenetic tree based on 37 core genes from 73 baculovirus genomes placed ClasGV-B in the clade b of betabaculoviruses and was most closely related to Erinnyis ello GV (ErelGV). The gene arrangement of ClasGV-B also shared the strongest collinearity with ErelGV but differed from Clostera anachoreta GV (ClanGV), Clostera anastomosis GV-A (ClasGV-A, previously also called CaLGV) and Epinotia aporema GV (EpapGV) with a 20 kb inversion. ClasGV-B genome contains three copies of polyhedron envelope protein gene (pep) and phylogenetic tree divides the PEPs of betabaculoviruses into three major clades: PEP-1, PEP-2 and PEP/P10. ClasGV-B also contains three homologues of P10 which all harbor an N-terminal coiled-coil domain and a C-terminal basic sequence. ClasGV-B encodes three fibroblast growth factor (FGF) homologues which are conserved in all sequenced betabaculoviruses. Phylogenetic analysis placed these three FGFs into different groups and suggested that the FGFs were evolved at the early stage of the betabaculovirus expansion. ClasGV-B is different from previously reported ClasGV-A and ClanGV isolated from Notodontidae in sequence and gene arrangement

[Demonstration, stabilization and purification of an intracapsid nucleoprotein structure of Baculovirus of Oryctes rhinoceros L].

PubMed

Monsarrat, P; Revet, B; Gourevitch, I

1975-11-10

The presence of a structurally organized nucleoproteic structure in the capsid of the Baculovirus of Oryctes rhinoceros L. is shown. This structure is stabilized under definite conditions described in detail in the paper. It possesses a rope-like structure of about 280 nm in length on 15 nm in diameter containing the DNA molecule. A basic protein is found in the virus.

Structure and functions of the chaperone-like p97/CDC48 in plants.

PubMed

Bègue, Hervé; Jeandroz, Sylvain; Blanchard, Cécile; Wendehenne, David; Rosnoblet, Claire

2017-01-01

The chaperone-like p97 is a member of the AAA+ ATPase enzyme family that contributes to numerous cellular activities. P97 has been broadly studied in mammals (VCP/p97) and yeasts (CDC48: Cell Division Cycle 48/p97) and numerous investigations highlighted that this protein is post-translationally regulated, is structured in homohexamer and interacts with partners and cofactors that direct it to distinct cellular signalization pathway including protein quality control and degradation, cell cycle regulation, genome stability, vesicular trafficking, autophagy and immunity. p97 is also conserved in plants (CDC48) but its functions are less understood. In the present review we intended to present the state of the art of the structure, regulation and functions of CDC48 in plants. Evidence accumulated underline that CDC48 plays a crucial role in development, cell cycle regulation and protein turnover in plants. Furthermore, its involvement in plant immunity has recently emerged and first interacting partners have been identified, shedding light on its putative cellular activities. Identification of emerging functions of CDC48 in plants opens new roads of research in immunity and provides new insights into the mechanisms of protein quality control. Copyright © 2016 Elsevier B.V. All rights reserved.

Heterogeneous distribution of P53 immunoreactivity in human lung adenocarcinoma correlates with MDM2 protein expression, rather than with P53 gene mutation.

PubMed

Koga, T; Hashimoto, S; Sugio, K; Yoshino, I; Nakagawa, K; Yonemitsu, Y; Sugimachi, K; Sueishi, K

2001-07-20

Although the tumor suppressor p53 protein (P53) immunoreactivity and its gene (p53) mutation were reported to be significant prognostic indicators for human lung adenocarcinomas, little is known regarding the relationship between the heterogeneous distribution of P53 and its genetic status in each tumor focus and the clinicopathological significance. To determine how P53 is heterogeneously stabilized in patients, we compared P53 expression to both the p53 allelic mutation in exon 2 approximately 9 by polymerase chain reaction-single strand conformation polymorphism using microdissected DNA fractions, and the immunohistochemical MDM2 expression. Of the 48 positive to P53 in 118 lung adenocarcinomas examined, 10 with heterogeneous P53 expression were closely examined. The higher P53 expression foci in 7 of 10 cases were less differentiated, histologically in respective cases, and were frequently associated with fibrous stroma. Two had genetic mutations in exon 7 of the p53 gene in both the high and low P53 expression foci of cancer tissue indicating no apparent correlation between heterogeneous P53 expression and the occurrence of gene mutation. Immunohistochemical expression of MDM2 was significantly lower in high P53 expression areas (p < 0.05, the mean labeling indices of high and low P53 expression areas being 4.2 +/- 5.4% and 13.6 +/- 12.2%, respectively). In addition, among all the 118 cases examined, MDM2 expression was significantly suppressed in cases of p53 gene mutation, simultaneously with P53 overexpression, as compared with cases without both the p53 mutation and expression (p < 0.001). These findings suggest that the heterogeneous stabilization of P53 in human lung adenocarcinomas could be partly due to suppressed MDM2 expression. The overexpression of non-mutated P53 may afford a protective mechanism in human lung adenocarcinomas. Copyright 2001 Wiley-Liss, Inc.

Characterization of 5-HT₁A receptors and their complexes with G-proteins in budded baculovirus particles using fluorescence anisotropy of Bodipy-FL-NAN-190.

PubMed

Tõntson, Lauri; Kopanchuk, Sergei; Rinken, Ago

2014-02-01

Bodipy-FL-NAN-190 was found to be well suited for characterization of ligand binding to 5-HT1A receptors expressed in budded baculovirus particles, as binding is accompanied by large increases in fluorescence intensity and anisotropy. This ligand appears to bind rapidly (t1/2,ass<1 min), reversibly (t1/2,diss∼6 min) and has high affinity (Kd=0.30 ± 0.13 nM). This fluorescence anisotropy assay based on Bodipy-FL-NAN-190 binding to baculovirus particles was also a suitable assay system for the pharmacological characterization of non-labelled serotonergic ligands, as well as being sensitive to the presence of G-proteins and guanine nucleotides. Coexpression of αi subunits of human G-proteins in baculovirus particles resulted in the appearance of significantly greater proportion of nucleotide sensitive high affinity agonist binding sites. There were no significant differences between αi1 and αi3 subtypes, while ligand binding in the presence of αi2 had higher sensitivity to GDP and Mn(2+). Copyright © 2014 Elsevier Ltd. All rights reserved.

Goose parvovirus structural proteins expressed by recombinant baculoviruses self-assemble into virus-like particles with strong immunogenicity in goose

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ju, Huanyu; Wei, Na; Wang, Qian

Highlights: {yields} All three capsid proteins can be expressed in insect cells in baculovirus expression system. {yields} All three recombinant proteins were spontaneously self-assemble into virus-like particles whose size and appearance were similar to those of native purified GPV virions. {yields} The immunogenicity of GPV-VLPs was better than commercial inactivated vaccine and attenuated vaccine. -- Abstract: Goose parvovirus (GPV), a small non-enveloped ssDNA virus, can cause Derzsy's disease, and three capsid proteins of VP1, VP2, and VP3 are encoded by an overlapping nucleotide sequence. However, little is known on whether recombinant viral proteins (VPs) could spontaneously assemble into virus-like particlesmore » (VLPs) in insect cells and whether these VLPs could retain their immunoreactivity and immunogenicity in susceptible geese. To address these issues, genes for these GPV VPs were amplified by PCR, and the recombinant VPs proteins were expressed in insect cells using a baculovirus expression system for the characterization of their structures, immunoreactivity, and immunogenicity. The rVP1, rVP2, and rVP3 expressed in Sf9 cells were detected by anti-GPV sera, anti-VP3 sera, and anti-His antibodies, respectively. Electron microscopy revealed that these rVPs spontaneously assembled into VLPs in insect cells, similar to that of the purified wild-type GPV virions. In addition, vaccination with individual types of VLPs, particularly with the rVP2-VLPs, induced higher titers of antibodies and neutralized different strains of GPVs in primary goose and duck embryo fibroblast cells in vitro. These data indicated that these VLPs retained immunoreactivity and had strong immunogenicity in susceptible geese. Therefore, our findings may provide a framework for development of new vaccines for the prevention of Derzsy's disease and vehicles for the delivery of drugs.« less

Isolation of a baculovirus variant that exhibits enhanced polyhedra production stability during serial passage in cell culture

Treesearch

James M. Slavicek; Melissa J. Mercer; Mary Ellen Kelly; Nancy Hayes-Plazolles

1996-01-01

The formation of few polyhedra mutants during serial propagation of baculoviruses in cell culture encumbers commercial scale production in this system. A Lymantria dispar nuclear polyhedrosis virus (LdMNPV) variant (isolate A21-MPV) has been isolated and the traits of budded virus (BV) production, synthesis of polyhedra, the...

48 CFR 301.607-76 - FAC-P/PM application process.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 48 Federal Acquisition Regulations System 4 2010-10-01 2010-10-01 false FAC-P/PM application... 301.607-76 FAC-P/PM application process. The P/PM Handbook contains application procedures and forms...; recertification; and certification waiver. Applicants for HHS FAC-P/PM certification actions shall comply with the...

48 CFR 301.607-76 - FAC-P/PM application process.

Code of Federal Regulations, 2011 CFR

2011-10-01

... 48 Federal Acquisition Regulations System 4 2011-10-01 2011-10-01 false FAC-P/PM application... 301.607-76 FAC-P/PM application process. The P/PM Handbook contains application procedures and forms...; recertification; and certification waiver. Applicants for HHS FAC-P/PM certification actions shall comply with the...

48 CFR 301.607-76 - FAC-P/PM application process.

Code of Federal Regulations, 2014 CFR

2014-10-01

... 48 Federal Acquisition Regulations System 4 2014-10-01 2014-10-01 false FAC-P/PM application... 301.607-76 FAC-P/PM application process. The P/PM Handbook contains application procedures and forms...; recertification; and certification waiver. Applicants for HHS FAC-P/PM certification actions shall comply with the...

48 CFR 301.607-76 - FAC-P/PM application process.

Code of Federal Regulations, 2012 CFR

2012-10-01

... 48 Federal Acquisition Regulations System 4 2012-10-01 2012-10-01 false FAC-P/PM application... 301.607-76 FAC-P/PM application process. The P/PM Handbook contains application procedures and forms...; recertification; and certification waiver. Applicants for HHS FAC-P/PM certification actions shall comply with the...

48 CFR 301.607-76 - FAC-P/PM application process.

Code of Federal Regulations, 2013 CFR

2013-10-01

... 48 Federal Acquisition Regulations System 4 2013-10-01 2013-10-01 false FAC-P/PM application... 301.607-76 FAC-P/PM application process. The P/PM Handbook contains application procedures and forms...; recertification; and certification waiver. Applicants for HHS FAC-P/PM certification actions shall comply with the...

Prevalence, diversity and co-occurrence of the white spot syndrome virus, monodon baculovirus and Penaeus stylirostris densovirus in wild populations of Penaeus monodon in the Philippines.

PubMed

Orosco, Fredmoore L; Lluisma, Arturo O

2017-08-09

The farming of the black tiger shrimp Penaeus monodon in the Philippines relies on wild broodstock. PCR was thus used to determine the prevalence of white spot syndrome virus (WSSV), monodon baculovirus (MBV) and Penaeus stylirostris densovirus (PstDV) in a total of 178 shrimp from 6 geographically disparate locations where broodstock are captured for use in hatcheries. PCR amplicons were also sequenced to identify phylogenetic relationships of the virus haplotypes detected. Shrimp from southeastern Luzon (Camarines Norte) had the highest prevalence of each of the 3 viruses and were frequently co-infected with 2 or more viruses. No viruses were detected in shrimp from northwestern Luzon (Pangasinan). MBV was most prevalent and PstDV strains displayed the most genetic diversity. WSSV was detected at 3 sites, and a VP28 gene sequence examined was invariant and consistent with strains found in many countries, including Thailand, China, Japan, Korea, Indonesia, Iran, Brazil and Mexico. WSSV open reading frame 94 gene sequence analysis identified location-specific repeat types. MBV sequences were dissimilar to haplotypes detected in India. PstDV sequences were diverse and included 2 lineages detected either in Australia or in the United States, Ecuador, Taiwan, China and Vietnam. The PCR data confirmed that WSSV, MBV and PstDV are endemic in P. monodon in the Philippines but that populations at some locations might remain free of infection.

Induction of an IAP antagonist in Culex quinquefasciatus larvae in response to infection by the baculovirus CuniNPV

USDA-ARS?s Scientific Manuscript database

CuniNPV is a member of the Dipteran–specific baculoviruses in the genus Deltabaculovirus that specifically infects mosquito larvae within the genus Culex while species of Aedes and Anopheles are refractory. Infections are restricted to the nuclei of larval midgut epithelial cells with transmission...

The 38K-Mediated Specific Dephosphorylation of the Viral Core Protein P6.9 Plays an Important Role in the Nucleocapsid Assembly of Autographa californica Multiple Nucleopolyhedrovirus.

PubMed

Lai, Qingying; Wu, Wenbi; Li, Ao; Wang, Wei; Yuan, Meijin; Yang, Kai

2018-05-01

Encapsidation of the viral genomes, leading to the assembly of the nucleocapsids to form infectious progeny virions, is a key step in many virus life cycles. Baculovirus nucleocapsid assembly is a complex process that involves many proteins. Our previous studies showed that the deletion of the core gene 38K ( ac98 ) interrupted the nucleocapsid assembly by producing capsid sheaths devoid of viral genomes by an unknown mechanism. All homologs of 38K contain conserved motifs of the haloacid dehalogenase superfamily, which are involved in phosphoryl transfer. The requirements of these motifs for nucleocapsid assembly, confirmed in the present study, suggest that 38K may be a functioning haloacid dehalogenase. P6.9 is also encoded by a core gene ( ac100 ) and is required for viral genome encapsidation. It has been reported that multiple phosphorylated species of P6.9 are present in virus-infected cells, while only an unphosphorylated species is detected in the budded virus. Therefore, whether 38K mediates the dephosphorylation of P6.9 was investigated. An additional phosphorylated species of P6.9 in 38K -deleted or -mutated virus-transfected cells was detected, and the dephosphorylated sites mediated by 38K were determined by mass spectrometry. To assess the effects of dephosphorylation of P6.9 mediated by 38K on virus replication, these sites were mutated to glutamic acids (phosphorylation-mimic mutant) or to alanines (phosphorylation-deficient mutant). Studies showed that the nucleocapsid assembly was interrupted in phosphorylation-mimic mutant virus-transfected cells. Taken together, our findings demonstrate that 38K mediates the dephosphorylation of specific sites at the C terminus of P6.9, which is essential for viral genome encapsidation. IMPORTANCE Genome packaging is a fundamental process in the virus life cycle, and viruses have different strategies to perform this step. For several double-stranded DNA (dsDNA) viruses, the procapsid is formed before genome

The 38K-Mediated Specific Dephosphorylation of the Viral Core Protein P6.9 Plays an Important Role in the Nucleocapsid Assembly of Autographa californica Multiple Nucleopolyhedrovirus

PubMed Central

Lai, Qingying; Li, Ao; Wang, Wei; Yuan, Meijin

2018-01-01

ABSTRACT Encapsidation of the viral genomes, leading to the assembly of the nucleocapsids to form infectious progeny virions, is a key step in many virus life cycles. Baculovirus nucleocapsid assembly is a complex process that involves many proteins. Our previous studies showed that the deletion of the core gene 38K (ac98) interrupted the nucleocapsid assembly by producing capsid sheaths devoid of viral genomes by an unknown mechanism. All homologs of 38K contain conserved motifs of the haloacid dehalogenase superfamily, which are involved in phosphoryl transfer. The requirements of these motifs for nucleocapsid assembly, confirmed in the present study, suggest that 38K may be a functioning haloacid dehalogenase. P6.9 is also encoded by a core gene (ac100) and is required for viral genome encapsidation. It has been reported that multiple phosphorylated species of P6.9 are present in virus-infected cells, while only an unphosphorylated species is detected in the budded virus. Therefore, whether 38K mediates the dephosphorylation of P6.9 was investigated. An additional phosphorylated species of P6.9 in 38K-deleted or -mutated virus-transfected cells was detected, and the dephosphorylated sites mediated by 38K were determined by mass spectrometry. To assess the effects of dephosphorylation of P6.9 mediated by 38K on virus replication, these sites were mutated to glutamic acids (phosphorylation-mimic mutant) or to alanines (phosphorylation-deficient mutant). Studies showed that the nucleocapsid assembly was interrupted in phosphorylation-mimic mutant virus-transfected cells. Taken together, our findings demonstrate that 38K mediates the dephosphorylation of specific sites at the C terminus of P6.9, which is essential for viral genome encapsidation. IMPORTANCE Genome packaging is a fundamental process in the virus life cycle, and viruses have different strategies to perform this step. For several double-stranded DNA (dsDNA) viruses, the procapsid is formed before genome

Control of bacteriophage P2 gene expression: analysis of transcription of the ogr gene.

PubMed Central

Birkeland, N K; Lindqvist, B H; Christie, G E

1991-01-01

The bacteriophage P2 ogr gene encodes an 8.3-kDa protein that is a positive effector of P2 late gene transcription. The ogr gene is preceded by a promoter sequence (Pogr) resembling a normal Escherichia coli promoter and is located just downstream of a late transcription unit. We analyzed the kinetics and regulation of ogr gene transcription by using an ogr-specific antisense RNA probe in an S1 mapping assay. During a normal P2 infection, ogr gene transcription starts from Pogr at an intermediate time between the onset of early and late transcription. At late times after infection the ogr gene is cotranscribed with the late FETUD operon; the ogr gene product thus positively regulates its own synthesis from the P2 late promoter PF. Expression of the P2 late genes also requires P2 DNA replication. Complementation experiments and transcriptional analysis show that a nonreplicating P2 phage expresses the ogr gene from Pogr but is unable to transcribe the late genes. A P2 ogr-defective phage makes an increased level of ogr mRNA, consistent with autogenous control from Pogr. Transcription of the ogr gene in the prophage of a P2 heteroimmune lysogen is stimulated after infection with P2, suggesting that Pogr is under indirect immunity control and is activated by a yet-unidentified P2 early gene product during infection. Images FIG. 4 FIG. 5 FIG. 6 FIG. 7 FIG. 8 PMID:1938896

Expression of p24 gag protein of bovine leukemia virus in insect cells and its use in immunodetection of the disease.

PubMed

Larsen, Alejandra; Gonzalez, Ester Teresa; Serena, María Soledad; Echeverría, María Gabriela; Mortola, Eduardo

2013-06-01

Bovine leukemia is a common retroviral infection of cattle. The disease is characterized by a strong immunological response to several viral proteins, but the antibodies against p24 and gp51 are predominant. In this study, a recombinant baculovirus containing the gag gene p24 was constructed and the protein, used as antigen, analyzed by western blot and an indirect in-house rp24-ELISA test. This allowed detecting the presence of antibodies for bovine leukemia virus in a panel of cattle sera. The authentication of the protein expands its potential use for different medical applications, from improved diagnosis of the disease to source of antigens to be included in a subunit vaccine.

Evidence of recent interspecies horizontal gene transfer regarding nucleopolyhedrovirus infection of Spodoptera frugiperda.

PubMed

Barrera, Gloria Patricia; Belaich, Mariano Nicolás; Patarroyo, Manuel Alfonso; Villamizar, Laura Fernanda; Ghiringhelli, Pablo Daniel

2015-11-25

Baculoviruses are insect-associated viruses carrying large, circular double-stranded-DNA genomes with significant biotechnological applications such as biological pest control, recombinant protein production, gene delivery in mammals and as a model of DNA genome evolution. These pathogens infect insects from the orders Lepidoptera, Hymenoptera and Diptera, and have high species diversity which is expressed in their diverse biological properties including morphology, virulence or pathogenicity. Spodoptera frugiperda (Lepidoptera: Noctuidae), the fall armyworm, represents a significant pest for agriculture in America; it is a host for baculoviruses such as the Spodoptera frugiperda multiple nucleopolyhedrovirus (SfMNPV) (Colombia strain, genotype A) having been classified as a Group II alphabaculovirus making it a very attractive target for bioinsecticidal use. Genome analysis by pyrosequencing revealed that SfMNPV ColA has 145 ORFs, 2 of which were not present in the other sequenced genotypes of the virus (SfMNPV-NicB, SfMNPV-NicG, SfMNPV-19 and SfMNPV-3AP2). An in-depth bioinformatics study showed that ORF023 and ORF024 were acquired by a recent homologous recombination process between Spodoptera frugiperda and Spodoptera litura (the Oriental leafworm moth) nucleopolyhedroviruses. Auxiliary genes are numerous in the affected locus which has a homologous region (hr3), a repetitive sequence associated with genome replication which became lost in SfColA along with 1 ORF. Besides, the mRNAs associated with two acquired genes appeared in the virus' life-cycle during the larval stage. Predictive studies concerning the theoretical proteins identified that ORF023 protein would be a phosphatase involved in DNA repair and that the ORF024 protein would be a membrane polypeptide associated with cell transport. The SfColA genome was thus revealed to be a natural recombinant virus showing evidence of recent horizontal gene transfer between different baculovirus species occurring

Polymorphism of the cytochrome P450 CYP2D6 gene in a European population: characterization of 48 mutations and 53 alleles, their frequencies and evolution.

PubMed

Marez, D; Legrand, M; Sabbagh, N; Lo Guidice, J M; Spire, C; Lafitte, J J; Meyer, U A; Broly, F

1997-06-01

The polymorphic cytochrome P450 CYP2D6 is involved in the metabolism of various drugs of wide therapeutic use and is a presumed susceptibility factor for certain environmentally-induced diseases. Our aim was to define the mutations and alleles of the CYP2D6 gene and to evaluate their frequencies in the European population. Using polymerase chain reaction-single strand conformation polymorphism analysis, 672 unrelated subjects were screened for mutations in the 9 exons of the gene and their exon-intron boundaries. A total of 48 point mutations were identified, of which 29 were novel. Mutations 1749 G-->C, 2938 C-->T and 4268 G-->C represented 52.6%, 34.3% and 52.9% of the mutations in the total population, respectively. Of the eight detrimental mutations detected, the 1934 G-->A, the 1795 Tdel and the 2637 Adel accounted for 65.8%, 6.2% and 4.8% respectively, within the poor metabolizer subgroup. Fifty-three different alleles were characterized from the mutation pattern and by allele-specific sequencing. They are derived from three major alleles, namely the wild-type CYP2D6*1A, the functional CYP2D6*2 and the null CYP2D6*4A. Five allelic variants (CYP2D6*1A, *2, *2B, *4A and *5) account for about 87% of all alleles, while the remaining alleles occur with a frequency of 0.1%-2.7%. These data provide a solid basis for future epidemiological, clinical as well as interethnic studies of the CYP2D6 polymorphism and highlight that the described single strand conformation polymorphism method can be successfully used in designing such studies.

Baculovirus-mediated expression of GPCRs in insect cells.

PubMed

Saarenpää, Tuulia; Jaakola, Veli-Pekka; Goldman, Adrian

2015-01-01

G-protein-coupled receptors (GPCRs) are a large family of seven transmembrane proteins that influence a considerable number of cellular events. For this reason, they are one of the most studied receptor types for their pharmacological and structural properties. Solving the structure of several GPCR receptor types has been possible using almost all expression systems, including Escherichia coli, yeast, mammalian, and insect cells. So far, however, most of the GPCR structures solved have been done using the baculovirus insect cell expression system. The reason for this is mainly due to cost-effectiveness, posttranslational modification efficiency, and overall effortless maintenance. The system has evolved so much that variables starting from vector type, purification tags, cell line, and growth conditions can be varied and optimized countless ways to suit the needs of new constructs. Here, we present the array of techniques that enable the rapid and efficient optimization of expression steps for maximal protein quality and quantity, including our emendations. © 2015 Elsevier Inc. All rights reserved.

Gasmin (BV2-5), a polydnaviral-acquired gene in Spodoptera exigua. Trade-off in the defense against bacterial and viral infections.

PubMed

Gasmi, Laila; Jakubowska, Agata K; Herrero, Salvador

2016-03-01

Thousands of Hymenopteran endoparasitoids have developed a unique symbiotic relationship with viruses named polydnavirus (PDVs). These viruses immunocompromise the lepidopteran host allowing the survival of the wasp eggs. In a previous work, we have shown the horizontal transfer of some polydnaviral genes into the genome of the Lepidoptera, Spodoptera exigua. One of these genes, BV2-5 (named gasmin) interferes with actin polymerization, negatively affecting the multiplication of baculovirus in cell culture. In this work, we have focused in the study of the effect of Gasmin expression on different aspects of the baculovirus production. In addition, and since actin polymerization is crucial for phagocytosis, we have studied the effect of Gasmin expression on the larval interaction with bacterial pathogens. Over-expression of Gasmin on hemocytes significantly reduces their capacity to phagocytize the pathogenic bacteria Bacillus thuringiensis. According to these results, gasmin domestication negatively affects baculovirus replication, but increases larvae susceptibility to bacterial infections as pay off. Although the effect of Gasmin on the insect interaction with other pathogens or parasitoids remain unknown, the opposite effects described here could shape the biological history of this species based on the abundance of certain type of pathogens as suggested by the presence of truncated forms of this protein in several regions of the world. Copyright © 2015 Elsevier Ltd. All rights reserved.

Identification of human cytochrome P450 2D6 as major enzyme involved in the O-demethylation of the designer drug p-methoxymethamphetamine.

PubMed

Staack, Roland F; Theobald, Denis S; Paul, Liane D; Springer, Dietmar; Kraemer, Thomas; Maurer, Hans H

2004-04-01

p-Methoxymethamphetamine (PMMA) is a new designer drug, listed in many countries as a controlled substance. Several fatalities have been attributed to the abuse of this designer drug. Previous in vivo studies using Wistar rats had shown that PMMA was metabolized mainly by O-demethylation. The aim of the study presented here was to identify the human hepatic cytochrome P450 (P450) enzymes involved in the biotransformation of PMMA to p-hydroxymethamphetamine. Baculovirus-infected insect cell microsomes, pooled human liver microsomes (pHLMs), and CYP2D6 poor-metabolizer genotype human liver microsomes (PM HLMs) were used for this purpose. Only CYP2D6 catalyzed O-demethylation. The apparent K(m) and V(max) values in baculovirus-infected insect cell microsomes were 4.6 +/- 1.0 microM and 92.0 +/- 3.7 pmol/min/pmol P450, respectively, and 42.0 +/- 4.0 microM and 412.5 +/- 10.8 pmol/min/mg protein in pHLMs. Inhibition studies with 1 microM quinidine showed significant inhibition of the metabolite formation (67.2 +/- 0.6%; p < 0.0001), and comparison of the metabolite formation between pHLMs and PM HLMs revealed significantly lower metabolite formation in the incubations with PM HLMs (87.3 +/- 1.1%; p < 0.0001). According to these studies, CYP2D6 is the major P450 involved in O-demethylation of PMMA.

The Autographa californica Multiple Nucleopolyhedrovirus ac83 Gene Contains a cis-Acting Element That Is Essential for Nucleocapsid Assembly.

PubMed

Huang, Zhihong; Pan, Mengjia; Zhu, Silei; Zhang, Hao; Wu, Wenbi; Yuan, Meijin; Yang, Kai

2017-03-01

Baculoviridae is a family of insect-specific viruses that have a circular double-stranded DNA genome packaged within a rod-shaped capsid. The mechanism of baculovirus nucleocapsid assembly remains unclear. Previous studies have shown that deletion of the ac83 gene of Autographa californica multiple nucleopolyhedrovirus (AcMNPV) blocks viral nucleocapsid assembly. Interestingly, the ac83 -encoded protein Ac83 is not a component of the nucleocapsid, implying a particular role for ac83 in nucleocapsid assembly that may be independent of its protein product. To examine this possibility, Ac83 synthesis was disrupted by insertion of a chloramphenicol resistance gene into its coding sequence or by deleting its promoter and translation start codon. Both mutants produced progeny viruses normally, indicating that the Ac83 protein is not required for nucleocapsid assembly. Subsequently, complementation assays showed that the production of progeny viruses required the presence of ac83 in the AcMNPV genome instead of its presence in trans Therefore, we reasoned that ac83 is involved in nucleocapsid assembly via an internal cis -acting element, which we named the nucleocapsid assembly-essential element (NAE). The NAE was identified to lie within nucleotides 1651 to 1850 of ac83 and had 8 conserved A/T-rich regions. Sequences homologous to the NAE were found only in alphabaculoviruses and have a conserved positional relationship with another essential cis -acting element that was recently identified. The identification of the NAE may help to connect the data of viral cis -acting elements and related proteins in the baculovirus nucleocapsid assembly, which is important for elucidating DNA-protein interaction events during this process. IMPORTANCE Virus nucleocapsid assembly usually requires specific cis -acting elements in the viral genome for various processes, such as the selection of the viral genome from the cellular nucleic acids, the cleavage of concatemeric viral genome

Retinoic acid induces signal transducer and activator of transcription (STAT) 1, STAT2, and p48 expression in myeloid leukemia cells and enhances their responsiveness to interferons.

PubMed

Matikainen, S; Ronni, T; Lehtonen, A; Sareneva, T; Melén, K; Nordling, S; Levy, D E; Julkunen, I

1997-06-01

IFNs are antiproliferative cytokines that have growth-inhibitory effects on various normal and malignant cells. Therefore, they have been used in the treatment of certain forms of cancer, such as chronic myelogenous leukemia and hairy cell leukemia. However, there is little evidence that IFNs would be effective in the treatment of acute myelogenous leukemia, and molecular mechanisms underlying IFN unresponsiveness have not been clarified. Here we have studied the activation and induction of IFN-specific transcription factors signal transducer and activator of transcription (STAT) 1, STAT2, and p48 in all-trans-retinoic acid (ATRA)-differentiated myeloid leukemia cells using promyelocytic NB4, myeloblastic HL-60, and monoblastic U937 cells as model systems. These cells respond to ATRA by growth inhibition and differentiation. We show that in undifferentiated NB4 cells, 2',5'-oligoadenylate synthetase and MxB gene expression is not activated by IFN-alpha, possibly due to a relative lack of signaling molecules, especially p48 protein. However, during ATRA-induced differentiation, steady-state STAT1, STAT2, and especially p48 mRNA and corresponding protein levels were elevated both in NB4 and U937 cells, apparently correlating to an enhanced responsiveness of these cells to IFNs. ATRA treatment of NB4 cells sensitized them to IFN action as seen by increased IFN-gamma activation site DNA-binding activity or by efficient formation of IFN-alpha-specific ISGF3 complex and subsequent oligoadenylate synthetase and MxB gene expression. Lack of p48 expression could be one of the mechanisms of promyelocytic leukemia cell escape from growth-inhibitory effects of IFN-alpha.

Protective Efficacy of a Single Dose of Baculovirus Hemagglutinin-Based Vaccine in Chickens and Ducks Against Homologous and Heterologous H5N1 Virus Infections

PubMed Central

Park, Eun Hye; Song, Byung Min; Yum, Jung; Kim, Ji An; Oh, Seung Kyoo; Kim, Hyun Soo; Cho, Gil Jae

2014-01-01

Abstract Outbreaks of the highly pathogenic H5N1 virus in poultry and humans are ongoing. Vaccination is an efficient method for prevention of H5N1 infection. Using chickens and ducks, we assessed the efficacy of a vaccine comprising H5N1 hemagglutinin (HA) protein produced in a baculovirus expression system. The immunized chickens and ducks were protected against lethal infection by H5N1 in an antigen dose-dependent manner. Complete protection against homologous challenge and partial protection against heterologous challenge were achieved in chickens immunized with 5 μg HA protein and in ducks immunized with 10 μg HA protein. The IgG antibody subtype was mainly detected in the sera and tissues, including the lungs. The neuraminidase (NA) inhibition assay was negative in immunized chickens and ducks. Our results indicated that the expressed HA protein by baculovirus was immunogenic to both chickens and ducks, and the immunized chickens and ducks were protected from the lethal infections of highly pathogenic H5N1 influenza virus, though ducks required more HA protein than chickens to be protected. Also, baculovirus HA-vaccinated poultry can be differentiated from infected poultry by NA inhibition assay. PMID:25211640

Comprehensive analysis of single molecule sequencing-derived complete genome and whole transcriptome of Hyposidra talaca nuclear polyhedrosis virus.

PubMed

Nguyen, Thong T; Suryamohan, Kushal; Kuriakose, Boney; Janakiraman, Vasantharajan; Reichelt, Mike; Chaudhuri, Subhra; Guillory, Joseph; Divakaran, Neethu; Rabins, P E; Goel, Ridhi; Deka, Bhabesh; Sarkar, Suman; Ekka, Preety; Tsai, Yu-Chih; Vargas, Derek; Santhosh, Sam; Mohan, Sangeetha; Chin, Chen-Shan; Korlach, Jonas; Thomas, George; Babu, Azariah; Seshagiri, Somasekar

2018-06-12

We sequenced the Hyposidra talaca NPV (HytaNPV) double stranded circular DNA genome using PacBio single molecule sequencing technology. We found that the HytaNPV genome is 139,089 bp long with a GC content of 39.6%. It encodes 141 open reading frames (ORFs) including the 37 baculovirus core genes, 25 genes conserved among lepidopteran baculoviruses, 72 genes known in baculovirus, and 7 genes unique to the HytaNPV genome. It is a group II alphabaculovirus that codes for the F protein and lacks the gp64 gene found in group I alphabaculovirus viruses. Using RNA-seq, we confirmed the expression of the ORFs identified in the HytaNPV genome. Phylogenetic analysis showed HytaNPV to be closest to BusuNPV, SujuNPV and EcobNPV that infect other tea pests, Buzura suppressaria, Sucra jujuba, and Ectropis oblique, respectively. We identified repeat elements and a conserved non-coding baculovirus element in the genome. Analysis of the putative promoter sequences identified motif consistent with the temporal expression of the genes observed in the RNA-seq data.

MBL, P2X7, and SLC11A1 gene polymorphisms in patients with oropharyngeal tularemia.

PubMed

Somuk, Battal Tahsin; Koc, Sema; Ates, Omer; Göktas, Göksel; Soyalic, Harun; Uysal, Ismail Onder; Gurbuzler, Levent; Sapmaz, Emrah; Sezer, Saime; Eyibilen, Ahmet

2016-11-01

A significant association was found of oropharyngeal tularemia with SLC11A1 allele polymorphism (INT4 G/C) and MBL2 C + 4T (P/Q). These results indicate C allele and Q allele might be a risk factor for the development of oropharyngeal tularemia. This study aimed to investigate the relationship of SLC11A1, MBL, and P2X 7 gene polymorphism with oropharyngeal tularemia. The study included totally 120 patients who were diagnosed with oropharyngeal tularemia. Frequencies of polymorphisms in the following genes were analyzed both in the patient and control groups in the study: SLC11A1 (5'(GT) n Allele 2/3, Int4 G/C, 3' UTR, D543N G/A), MBL (MBL2 C + 4T (P/Q), and P2X 7 (-762 C/T and 1513 A/C). Among all polymorphisms that were investigated in this study, SLC11A1 gene showed a significance in the distriburtion of polymorphism allelle frequency at the INT4 region. Frequency of C allele was 54 (28%) in patients with oropharyngeal tularemia, and 31 (13%) in the control group (p = 0.006 and OR = 1.96 (1.21-3.20)). An association was detected between MBL2 C + 4T (P/Q) gene polymorphism and oropharyngeal tularemia (p < 0.005 and OR = 0.30 (0.19-0.48)). No significant relation was found between P2X 7 (-762 C/T and 1513 A/C) gene polymorphism and oropharyngeal tularemia in this study (p > 0.05).

Functional characterization of Bombyx mori nucleopolyhedrovirus late gene transcription and genome replication factors in the non-permissive insect cell line SF-21

DOE Office of Scientific and Technical Information (OSTI.GOV)

Berretta, Marcelo F.; Deshpande, Mandar; Crouch, Erin A.

2006-04-25

We compared the abilities of late gene transcription and DNA replication machineries of the baculoviruses Autographa californica nucleopolyhedrovirus (AcMNPV) and Bombyx mori NPV (BmNPV) in SF-21 cells, an insect-derived cell line permissive for AcMNPV infection. It has been well established that 19 AcMNPV late expression factors (lefs) stimulate substantial levels of late gene promoter activity in SF-21 cells. Thus, we constructed a set of clones containing the BmNPV homologs of the AcMNPV lefs under control of the constitutive Drosophila heat shock 70 protein promoter and tested their ability to activate an AcMNPV late promoter-reporter gene cassette in SF-21 cells. Wemore » tested the potential of individual or predicted functional groups of BmNPV lefs to successfully replace the corresponding AcMNPV gene(s) in transient late gene expression assays. We found that most, but not all, BmNPV lefs were able to either fully or partially substitute for the corresponding AcMNPV homolog in the context of the remaining AcMNPV lefs with the exception of BmNPV p143, ie-2, and p35. BmNPV p143 was unable to support late gene expression or be imported into the nucleus of cells in the presence of the AcMNPV or the BmNPV LEF-3, a P143 nuclear shuttling factor. Our results suggest that host-specific factors may affect the function of homologous proteins.« less

Generation of PCV2 in PK15 cells transfected with recombinant baculovirus containing a 1.1 copy of the PCV2 genome.

PubMed

Cai, Jie; Xie, Xiaohong; Hu, Yi; Zhan, Yang; Yu, Wanting; Wang, Aibing; Wang, Naidong

2017-06-01

Porcine circovirus associated diseases (PCVAD) caused by PCV2 are responsible for severe economic losses in the swine industry. The mechanism of PCV2 replication has not been fully elucidated yet. PCV2 may be successfully rescued by means of either an infectious DNA clone containing the full length of the viral genomic DNA, or from PCV2-infected clinical tissues in PK15 cell culture. However, viruses harvested by both methods have low titres. In this study, PCV2 was prepared with a higher titre from PK15 cells infected by recombinant baculoviruses containing 1PCV2 (one stem-loop structure) or 1.1PCV2 (two stem-loop structure) genomic DNA copy. In addition, infectious DNA clones containing two stem-loop structures in either plasmid or baculovirus backbones are capable of generating a higher virus titre than the DNA clones with only one copy of stem-loop structure.

The production of multiprotein complexes in insect cells using the baculovirus expression system.

PubMed

Abdulrahman, Wassim; Radu, Laura; Garzoni, Frederic; Kolesnikova, Olga; Gupta, Kapil; Osz-Papai, Judit; Berger, Imre; Poterszman, Arnaud

2015-01-01

The production of a homogeneous protein sample in sufficient quantities is an essential prerequisite not only for structural investigations but represents also a rate-limiting step for many functional studies. In the cell, a large fraction of eukaryotic proteins exists as large multicomponent assemblies with many subunits, which act in concert to catalyze specific activities. Many of these complexes cannot be obtained from endogenous source material, so recombinant expression and reconstitution are then required to overcome this bottleneck. This chapter describes current strategies and protocols for the efficient production of multiprotein complexes in large quantities and of high quality, using the baculovirus/insect cell expression system.

Characterizations of 9p21 candidate genes in familial melanoma

DOE Office of Scientific and Technical Information (OSTI.GOV)

Walker, G.J.; Flores, J.F.; Glendening, J.M.

We have previously collected and characterized 16 melanoma families for the inheritance of a familial melanoma predisposition gene on 9p21. Clear evidence for genetic linkage has been detected in 8 of these families with the 9p21 markers D9S126 and 1FNA, while linkage of the remaining families to this region is less certain. A candidate for the 9p21 familial melanoma gene, the cyclin kinase inhibitor gene p16 (also known as the multiple tumor suppressor 1 (MTS1) gene), has been recently indentified. Notably, a nonsense mutation within the p16 gene has been detected in the lymphoblastoid cell line DNA from a dysplasticmore » nevus syndrome (DNS), or familial melanoma, patient. The p16 gene is also known to be frequently deleted or mutated in a variety of tumor cell lines (including melanoma) and resides within a region that has been defined as harboring the 9p21 melanoma predisposition locus. This region is delineated on the distal side by the marker D9S736 (which resides just distal to the p16 gene) and extends in a proximal direction to the marker D9S171. Overall, the entire distance between these two loci is estimated at 3-5Mb. Preliminary analysis of our two largest 9p21-linked melanoma kindreds (by direct sequencing of PCR products) has not yet revealed mutations within the coding region of the p16 gene. Others have reported that 8/11 unrelated 9p21-linked melanoma families do not appear to carry p16 mutations; thus the possibility exists that p16 is not a melanoma susceptibility gene per se, although it appears to play some role in melanoma tumor progression. Our melanoma kindred DNAs are currently being analyzed by SSCP using primers that amplify exons of other candidate genes from the 9p21 region implicated in familial melanoma. These novel genes reside within a distinct critical region of homozygous loss in melanoma which is located >2 Mb from the p16 gene on 9p21.« less

Three cobalt(II)-linked {P8W48} network assemblies: syntheses, structures, and magnetic and photocatalysis properties.

PubMed

Jiao, Yan-Qing; Qin, Chao; Wang, Xin-Long; Wang, Chun-Gang; Sun, Chun-Yi; Wang, Hai-Ning; Shao, Kui-Zhan; Su, Zhong-Min

2014-02-01

Three cobalt(II)-containing tungstophosphate compounds, Na8Li8Co5[Co5.5(H2O)19P8W48.5O184]⋅60 H2O (1), K2Na4Li11Co5[Co7(H2O)28P8W48O184]Cl⋅ 59 H2O (2), and K2Na4LiCo11[Co8(H2O)32P8W48O184](CH3COO)4Cl⋅47 H2O (3), have been synthesized and characterized by IR spectroscopy, thermogravimetric analysis, elemental analyses, and magnetic measurements. The pH value impacts the formation of distinct cobalt-linked frameworks. The cyclic cavity of the polyanion accommodates 5.5, 7, and 8 cobalt ions in 1, 2, and 3, respectively. In compounds 1 and 2, each {Co5.5P8W48} and {Co7P8W48} fragment links to four others through multiple {Co-O-W} coordination bonds to generate a two-dimensional network. Compound 3 can be considered as a 3D network based on the {Co-O-W} coordination bonds and the {Co3(CH3COO)2(H2O)10} linkers between the {P8W48} fragments. Interestingly, acetate ligands have been employed to form the {Co3(CH3COO)2(H2O)10} unit, thereby inducing the construction of a 12-connected framework. To the best of our knowledge, compound 3 contains the largest-ever number of cobalt ions in a {P8W48}-based polyoxometalate when counterions are taken into account and the {P8W48} unit shows the highest number of connections thanks to the carboxyl bridges. The UV/Vis diffuse reflectance spectra of these powder samples indicate that the corresponding well-defined optical absorption associated with Eg can be assessed at 2.58, 2.48, and 2.73 eV and reveal the presence of an optical band gap. The photocatalytic H2 evolution activities of these {P8W48}-based compounds are evaluated. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Recombinant expression of extracellular domain of mutant Epidermal Growth Factor Receptor in prokaryotic and baculovirus expression systems.

PubMed

Vettath, Sunitha Kodengil; Shivashankar, Gaganashree; Menon, Krishnakumar N; Vijayachandran, Lakshmi S

2018-04-15

Epidermal Growth Factor Receptor variant III (EGFRvIII) is a tumor specific antigen detected in various tumors including gliomas, breast cancer, lung cancer, head and neck squamous cell carcinoma (HNSCC). Screening of EGFRvIII targeting drug molecules can be accelerated by developing drug screening platforms using recombinantly expressed protein. Choice of expression system is one of the major factors deciding the success of recombinant expression of a protein. In our study, we have tried to express and purify the extracellular domain (ECD) of this highly unstable protein using bacterial and baculovirus expression systems to select the expression system suited for our purpose. Even though the protein was successfully expressed in prokaryotic system, purification could be done only under denaturing conditions. But in the baculovirus expression system, the protein was expressed in soluble form and could be purified under native conditions, with single step of purification. Based on our results, we conclude that insect cells are better choice over E. coli cells for expressing EGFRvIII ECD in soluble form. This study provides insights for other researchers involved in expression of similar unstable membrane proteins, on selecting the best expression system and challenges involved. Copyright © 2018 Elsevier B.V. All rights reserved.

Expression of the MDR-1 gene-encoded P-glycoprotein in cardiomyocytes of conscious sheep undergoing acute myocardial ischemia followed by reperfusion.

PubMed

Laguens, Rubén P; Lazarowski, Alberto J; Cuniberti, Luis A; Vera Janavel, Gustavo L; Cabeza Meckert, Patricia M; Yannarelli, Gustavo G; del Valle, Héctor F; Lascano, Elena C; Negroni, Jorge A; Crottogini, Alberto J

2007-02-01

We have recently reported that in chronic myocardial ischemia, adult mammalian cardiomyocytes express P-glycoprotein (P-gp). We now investigate if P-gp is also expressed in acute regional ischemia followed by reperfusion. Adult conscious sheep underwent 12-min occlusion of the mid-left anterior descending artery (inflatable cuff). Successful ischemia-reperfusion was confirmed by monitoring percent systolic left ventricular anterior wall thickening (sonomicrometry) during the whole ischemic period and every 10 min over 2 hr following cuff deflation. At 3, 24, and 48 hr after reperfusion, P-gp expression was investigated by immunohistochemistry and Western blot and MDR-1 mRNA by RT-PCR. Cardiomyocytes in the occluded artery territory (but not those in remote areas) consistently expressed P-gp at their sarcolemma. Whereas at 3 and 24 hr P-gp was mainly observed in the T tubules, at 48 hr it predominated in intercalated discs and gap junctions. RT-PCR and Western blot revealed higher expression in ischemic than in control myocardium. We conclude that in adult sheep with acute myocardial ischemia, the MDR-1 gene-encoded P-gp is expressed at the sarcolemma of the cardiomyocytes from 3 hr up to at least 48 hr after reperfusion.

Immune responses to baculovirus-displayed enterovirus 71 VP1 antigen.

PubMed

Kiener, Tanja K; Premanand, Balraj; Kwang, Jimmy

2013-04-01

The increased distribution and neurovirulence of enterovirus 71 is an important health threat for young children in Asia Pacific. Vaccine design has concentrated on inactivated virus with the most advanced undergoing Phase III clinical trials. By using a subunit vaccine approach, production costs could be reduced by lowering the need for biocontainment. In addition, novel mutations could be rapidly incorporated to reflect the emergence of new enterovirus 71 subgenogroups. To circumvent the problems associated with conventional subunit vaccines, the antigen can be displayed on a viral vector that conveys stability and facilitates purification. Additional advantages of viral-vectored subunit vaccines are their ability to stimulate the innate immune system by transducing cells and the possibility of oral or nasal delivery, which dispenses with the need for syringes and medical personnel. Baculovirus-displayed VP1 combines all these benefits with protection that is as efficient as inactivated virus.

Proteolytic Processing and Assembly of gag and gag-pol Proteins of TED, a Baculovirus-Associated Retrotransposon of the Gypsy Family

PubMed Central

Hajek, Kathryn L.; Friesen, Paul D.

1998-01-01

TED (transposable element D) is an env-containing member of the gypsy family of retrotransposons that represents a possible retrovirus of invertebrates. This lepidopteran (moth) retroelement contains gag and pol genes that encode proteins capable of forming viruslike particles (VLP) with reverse transcriptase. Since VLP are likely intermediates in TED transposition, we investigated the roles of gag and pol in TED capsid assembly and maturation. By using constructed baculovirus vectors and TED Gag-specific antiserum, we show that the principal translation product of gag (Pr55gag) is cleaved to produce a single VLP structural protein, p37gag. Replacement of Asp436 within the retrovirus-like active site of the pol-encoded protease (PR) abolished Pr55gag cleavage and demonstrated the requirement for PR in capsid processing. As shown by expression of an in-frame fusion of TED gag and pol, PR is derived from the Gag-Pol polyprotein Pr195gag-pol. The PR cleavage site within Pr55gag was mapped to a position near the junction of a basic, nucleocapsid-like domain and a C-terminal acidic domain. Once released by cleavage, the C-terminal fragment was not detected. This acidic fragment was dispensable for VLP assembly, as demonstrated by the formation of VLP by C-terminal Pr55gag truncation proteins and replacement of the acidic domain with a heterologous protein. In contrast, C-terminal deletions that extended into the adjacent nucleocapsid-like domain of Pr55gag abolished VLP recovery and demonstrated that this central region contributes to VLP assembly or stability, or both. Collectively, these data suggest that the single TED protein p37gag provides both capsid and nucleocapsid functions. TED may therefore use a simple processing strategy for VLP assembly and genome packaging. PMID:9765414

Proteolytic processing and assembly of gag and gag-pol proteins of TED, a baculovirus-associated retrotransposon of the gypsy family.

PubMed

Hajek, K L; Friesen, P D

1998-11-01

TED (transposable element D) is an env-containing member of the gypsy family of retrotransposons that represents a possible retrovirus of invertebrates. This lepidopteran (moth) retroelement contains gag and pol genes that encode proteins capable of forming viruslike particles (VLP) with reverse transcriptase. Since VLP are likely intermediates in TED transposition, we investigated the roles of gag and pol in TED capsid assembly and maturation. By using constructed baculovirus vectors and TED Gag-specific antiserum, we show that the principal translation product of gag (Pr55(gag)) is cleaved to produce a single VLP structural protein, p37(gag). Replacement of Asp436 within the retrovirus-like active site of the pol-encoded protease (PR) abolished Pr55(gag) cleavage and demonstrated the requirement for PR in capsid processing. As shown by expression of an in-frame fusion of TED gag and pol, PR is derived from the Gag-Pol polyprotein Pr195(gag-pol). The PR cleavage site within Pr55(gag) was mapped to a position near the junction of a basic, nucleocapsid-like domain and a C-terminal acidic domain. Once released by cleavage, the C-terminal fragment was not detected. This acidic fragment was dispensable for VLP assembly, as demonstrated by the formation of VLP by C-terminal Pr55(gag) truncation proteins and replacement of the acidic domain with a heterologous protein. In contrast, C-terminal deletions that extended into the adjacent nucleocapsid-like domain of Pr55(gag) abolished VLP recovery and demonstrated that this central region contributes to VLP assembly or stability, or both. Collectively, these data suggest that the single TED protein p37(gag) provides both capsid and nucleocapsid functions. TED may therefore use a simple processing strategy for VLP assembly and genome packaging.

P gene as an inherited biomarker of human eye color.

PubMed

Rebbeck, Timothy R; Kanetsky, Peter A; Walker, Amy H; Holmes, Robin; Halpern, Allan C; Schuchter, Lynn M; Elder, David E; Guerry, DuPont

2002-08-01

Human pigmentation, including eye color, has been associated with skin cancer risk. The P gene is the human homologue to the mouse pink-eye dilution locus and is responsible for oculocutaneous albinism type 2 and other phenotypes that confer eye hypopigmentation. The P gene is located on chromosome 15q11.2-q12, which is also the location of a putative eye pigmentation gene (EYCL3) inferred to exist by linkage analysis. Therefore, the P gene is a strong candidate for determination of human eye color. Using a sample of 629 normally pigmented individuals, we found that individuals were less likely to have blue or gray eyes if they had P gene variants Arg305Trp (P = 0.002), Arg419Gln (P = 0.001), or the combination of both variants (P = 0.003). These results suggest that P gene, in part, determines normal phenotypic variation in human eye color and may therefore represent an inherited biomarker of cutaneous cancer risk.

Real-time PCR assays for the detection and quantification of carbapenemase genes (bla KPC, bla NDM, and bla OXA-48) in environmental samples.

PubMed

Subirats, Jèssica; Royo, Elena; Balcázar, José Luis; Borrego, Carles M

2017-03-01

In this study, we have developed real-time PCR assays using SYBR Green chemistry to detect all known alleles of bla KPC , bla NDM , and bla OXA-48 -like carbapenemase genes in water, sediment, and biofilm samples collected from hospital and wastewater treatment plant (WWTP) effluents and rivers receiving chronic WWTP discharges. The amplification of bla KPC , bla NDM , and bla OXA-48 DNA was linear over 7 log dilutions (R 2 between 0.995 and 0.997) and showing efficiencies ranging from 92.6% to 100.3%. The analytical sensitivity indicated that the reaction for bla KPC , bla NDM , and bla OXA-48 -like genes was able to detect 35, 16, and 19 copy numbers per assay, respectively. The three carbapenemase genes were detected in hospital effluents, whereas only the bla KPC and bla NDM genes were detected in biofilm and sediment samples collected from wastewater-impacted rivers. The detection of bla KPC , bla NDM , and bla OXA-48 -like genes in different matrices suggests that carbapenem-resistant bacteria occur in both planktonic and benthic habitats thus expanding the range of resistance reservoirs for last-resort antibiotics. We believe that these real-time PCR assays would be a powerful tool for the rapid detection and quantification of bla KPC , bla NDM , and bla OXA-48 -like genes in complex environmental samples.

Mutation analysis of the p53, APC, and p16 genes in the Barrett's oesophagus, dysplasia, and adenocarcinoma.

PubMed Central

González, M V; Artímez, M L; Rodrigo, L; López-Larrea, C; Menéndez, M J; Alvarez, V; Pérez, R; Fresno, M F; Pérez, M J; Sampedro, A; Coto, E

1997-01-01

AIMS: To study the loss of heterozygosity and the presence of mutations at the p53, p16/CDKN2, and APC genes in Barrett's oesophagus, low grade dysplastic oesophageal epithelium, and adenocarcinoma of the oesophagus; to relate the presence of alterations at these genes with the progression from Barrett's oesophagus to adenocarcinoma. METHODS: DNA was extracted from paraffin blocks containing tissue from Barrett's oesophagus (12 samples), low grade dysplasia (15 cases), and adenocarcinoma (14 cases). Loss of heterozygosity (LOH) at the p53, p16, and APC genes was determined by comparing the autoradiographic patterns of several microsatellite markers between the normal tissue and the malignant tissue counterpart. SSCP was used to determine the presence of mutations at p53 (exons 5 to 8), p16 (exon 2), and APC. Homozygous deletion of the p16 gene was defined through polymerase chain reaction followed by Southern blot. RESULTS: LOH at the p53, p16, and APC genes was not observed in Barrett's oesophagus without dysplasia, and increased to 90% (p53), 89% (p16), and 60% (APC) in the adenocarcinomas. The p53 gene was mutated in only two adenocarcinomas (codons 175 and 245). In one case a mutation at the APC gene (codon 1297) was found. No patient had mutation at the second exon of p16. However, this gene was homozygously deleted in three of the 12 adenocarcinomas. CONCLUSIONS: The tumour suppressor genes p53, p16, and APC are often deleted in adenocarcinomas derived from Barrett's oesophagus. Mutations at these genes are also found in the adenocarcinomas, including the homozygous deletion of the p16 gene. However, the absence of genetic alterations in the Barrett's oesophagus and the low grade dysplastic epithelia suggest that mutations at these genes develop later in the progression from Barrett's oesophagus to adenocarcinoma. Images PMID:9155671

Overexpression of OsERF48 causes regulation of OsCML16, a calmodulin-like protein gene that enhances root growth and drought tolerance.

PubMed

Jung, Harin; Chung, Pil Joong; Park, Su-Hyun; Redillas, Mark Christian Felipe Reveche; Kim, Youn Shic; Suh, Joo-Won; Kim, Ju-Kon

2017-10-01

The AP2/ERF family is a plant-specific transcription factor family whose members have been associated with various developmental processes and stress tolerance. Here, we functionally characterized the drought-inducible OsERF48, a group Ib member of the rice ERF family with four conserved motifs, CMI-1, -2, -3 and -4. A transactivation assay in yeast revealed that the C-terminal CMI-1 motif was essential for OsERF48 transcriptional activity. When OsERF48 was overexpressed in an either a root-specific (ROX O s ERF 48 ) or whole-body (OX O s ERF 48 ) manner, transgenic plants showed a longer and denser root phenotype compared to the nontransgenic (NT) controls. When plants were grown on a 40% polyethylene glycol-infused medium under in vitro drought conditions, ROX O s ERF 48 plants showed a more vigorous root growth than OX O s ERF 48 and NT plants. In addition, the ROX O s ERF 48 plants exhibited higher grain yield than OX O s ERF 48 and NT plants under field-drought conditions. We constructed a putative OsERF48 regulatory network by cross-referencing ROX O s ERF 48 root-specific RNA-seq data with a co-expression network database, from which we inferred the involvement of 20 drought-related genes in OsERF48-mediated responses. These included genes annotated as being involved in stress signalling, carbohydrate metabolism, cell-wall proteins and drought responses. They included, OsCML16, a key gene in calcium signalling during abiotic stress, which was shown to be a direct target of OsERF48 by chromatin immunoprecipitation-qPCR analysis and a transient protoplast expression assay. Our results demonstrated that OsERF48 regulates OsCML16, a calmodulin-like protein gene that enhances root growth and drought tolerance. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Vertical transmission of sublethal granulovirus infection in the Indian meal moth, Plodia interpunctella.

PubMed

Burden, J P; Griffiths, C M; Cory, J S; Smith, P; Sait, S M

2002-03-01

Knowledge of the mechanisms of pathogen persistence in relation to fluctuations in host density is crucial to our understanding of disease dynamics. In the case of insect baculoviruses, which are typically transmitted horizontally via a lifestage that can persist outside the host, a key issue that remains to be elucidated is whether the virus can also be transmitted vertically as a sublethal infection. We show that RNA transcripts for the Plodia interpunctella GV granulin gene are present in a high proportion of P. interpunctella insects that survive virus challenge. Granulin is a late-expressed gene that is only transcribed after viral genome replication, its presence thus strongly indicates that viral genome replication has occurred. Almost all insects surviving the virus challenge tested positive for viral RNA in the larval and pupal stage. However, this proportion declined in the emerging adults. Granulin mRNA was also detected in both the ovaries and testes, which may represent a putative mechanism by which reduced fecundity in sublethally affected hosts might be manifested. RNA transcripts were also detected in 60-80% of second-generation larvae that were derived from mating surviving adults, but there was no difference between the sexes, with both males and females capable of transmitting a sublethal infection to their offspring. The data indicate that low-level persistent infection, with at least limited gene expression, can occur in P. interpunctella following survival of a granulovirus challenge. We believe that this is the first demonstration of a persistent, sublethal infection by a baculovirus to be initiated by a sublethal virus dose. We hypothesize that the 'latent' baculovirus infections frequently referred to in the literature may also be low level persistent, sublethal infections resulting from survival from initial baculovirus exposure.

The Origins and Evolution of the p53 Family of Genes

PubMed Central

Belyi, Vladimir A.; Ak, Prashanth; Markert, Elke; Wang, Haijian; Hu, Wenwei; Puzio-Kuter, Anna; Levine, Arnold J.

2010-01-01

A common ancestor to the three p53 family members of human genes p53, p63, and p73 is first detected in the evolution of modern‐day sea anemones, in which both structurally and functionally it acts to protect the germ line from genomic instabilities in response to stresses. This p63/p73 common ancestor gene is found in almost all invertebrates and first duplicates to produce a p53 gene and a p63/p73 ancestor in cartilaginous fish. Bony fish contain all three genes, p53, p63, and p73, and the functions of these three transcription factors diversify in the higher vertebrates. Thus, this gene family has preserved its structural features and functional activities for over one billion years of evolution. PMID:20516129

Baculovirus-vectored multistage Plasmodium vivax vaccine induces both protective and transmission-blocking immunities against transgenic rodent malaria parasites.

PubMed

Mizutani, Masanori; Iyori, Mitsuhiro; Blagborough, Andrew M; Fukumoto, Shinya; Funatsu, Tomohiro; Sinden, Robert E; Yoshida, Shigeto

2014-10-01

A multistage malaria vaccine targeting the pre-erythrocytic and sexual stages of Plasmodium could effectively protect individuals against infection from mosquito bites and provide transmission-blocking (TB) activity against the sexual stages of the parasite, respectively. This strategy could help prevent malaria infections in individuals and, on a larger scale, prevent malaria transmission in communities of endemicity. Here, we describe the development of a multistage Plasmodium vivax vaccine which simultaneously expresses P. vivax circumsporozoite protein (PvCSP) and P25 (Pvs25) protein of this species as a fusion protein, thereby acting as a pre-erythrocytic vaccine and a TB vaccine, respectively. A new-concept vaccine platform based on the baculovirus dual-expression system (BDES) was evaluated. The BDES-Pvs25-PvCSP vaccine displayed correct folding of the Pvs25-PvCSP fusion protein on the viral envelope and was highly expressed upon transduction of mammalian cells in vitro. This vaccine induced high levels of antibodies to Pvs25 and PvCSP and elicited protective (43%) and TB (82%) efficacies against transgenic P. berghei parasites expressing the corresponding P. vivax antigens in mice. Our data indicate that our BDES, which functions as both a subunit and DNA vaccine, can offer a promising multistage vaccine capable of delivering a potent antimalarial pre-erythrocytic and TB response via a single immunization regimen. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

Triglyceride-rich lipoprotein regulates APOB48 receptor gene expression in human THP-1 monocytes and macrophages.

PubMed

Bermudez, Beatriz; Lopez, Sergio; Varela, Lourdes M; Ortega, Almudena; Pacheco, Yolanda M; Moreda, Wenceslao; Moreno-Luna, Rafael; Abia, Rocio; Muriana, Francisco J G

2012-02-01

The postprandial metabolism of dietary fats implies that the production of TG-rich lipoproteins (TRL) contributes to the progression of plaque development. TRL and their remnants cause rapid receptor-mediated monocyte/macrophage lipid engorgement via the cell surface apoB48 receptor (apoB48R). However, the mechanistic basis for apoB48 receptor (APOB48R) regulation by postprandial TRL in monocytes and macrophages is not well established. In this study, we investigated the effects of postprandial TRL from healthy volunteers on the expression of APOB48R mRNA and lipid uptake in human THP-1 monocytes and THP-1-derived macrophages. The expression of APOB48R mRNA was upregulated in THP-1 monocytes, but downregulated in THP-1-derived macrophages when treated with postprandial TRL (P < 0.05), in a dose- and time-dependent manner. TG and free cholesterol were dramatically increased in THP-1-derived macrophages (140 and 50%, respectively; P < 0.05) and in THP-1 monocytes (160 and 95%, respectively; P < 0.05). This lipid accumulation was severely decreased (~50%; P < 0.05) in THP-1-derived macrophages by small interfering RNA (siRNA) targeting of APOB48R. Using PPAR and retinoid X receptor (RXR) agonists, antagonists, and siRNA, our data indicate that PPARα, PPARγ, and RXRα are involved in postprandial TRL-induced APOB48R transcriptional regulation. Co-incubation with acyl-CoA synthetase or acyl-CoA:cholesterol acyltransferase inhibitors potentiated the effects of postprandial TRL on the expression of APOB48R mRNA in THP-1 monocytes and THP-1-derived macrophages. Our findings collectively suggest that APOB48R represents a molecular target of postprandial TRL via PPAR-dependent pathways in human THP-1 monocytes and macrophages and advance a potentially important link between postprandial metabolism of dietary fats and atherogenesis.

Protein Expression in Insect and Mammalian Cells Using Baculoviruses in Wave Bioreactors.

PubMed

Kadwell, Sue H; Overton, Laurie K

2016-01-01

Many types of disposable bioreactors for protein expression in insect and mammalian cells are now available. They differ in design, capacity, and sensor options, with many selections available for either rocking platform, orbitally shaken, pneumatically mixed, or stirred-tank bioreactors lined with an integral disposable bag (Shukla and Gottschalk, Trends Biotechnol 31(3):147-154, 2013). WAVE Bioreactors™ were among the first disposable systems to be developed (Singh, Cytotechnology 30:149-158, 1999). Since their commercialization in 1999, Wave Bioreactors have become routinely used in many laboratories due to their ease of operation, limited utility requirements, and protein expression levels comparability to traditional stirred-tank bioreactors. Wave Bioreactors are designed to use a presterilized Cellbag™, which is attached to a rocking platform and inflated with filtered air provided by the bioreactor unit. The Cellbag can be filled with medium and cells and maintained at a set temperature. The rocking motion, which is adjusted through angle and rock speed settings, provides mixing of oxygen (and CO2, which is used to control pH in mammalian cell cultures) from the headspace created in the inflated Cellbag with the cell culture medium and cells. This rocking motion can be adjusted to prevent cell shear damage. Dissolved oxygen and pH can be monitored during scale-up, and samples can be easily removed to monitor other parameters. Insect and mammalian cells grow very well in Wave Bioreactors (Shukla and Gottschalk, Trends Biotechnol 31(3):147-154, 2013). Combining Wave Bioreactor cell growth capabilities with recombinant baculoviruses engineered for insect or mammalian cell expression has proven to be a powerful tool for rapid production of a wide range of proteins.

Biology and genomics of viruses within the genus Gammabaculovirus.

PubMed

Arif, Basil; Escasa, Shannon; Pavlik, Lillian

2011-11-01

Hymenoptera is a very large and ancient insect order encompassing bees, wasps, ants and sawflies. Fossil records indicate that they existed over 200 million years ago and about 100 million years before the appearance of Lepidoptera. Sawflies have been major pests in many parts of the world and some have caused serious forest defoliation in North America. All baculoviruses isolated from sawflies are of the single nucleocapsids phenotype and appear to replicate in midgut cells only. This group of viruses has been shown to be excellent pest control agents and three have been registered in Canada and Britain for this purpose. Sawfly baculoviruses contain the smallest genome of all baculoviruses sequenced so far. Gene orders among sequenced sawfly baculoviruses are co-linear but this is not shared with the genomes of lepidopteran baculoviruses. One distinguishing feature among all sequenced sawfly viruses is the lack of a gene encoding a membrane fusion protein, which brought into question the role of the budded virus phenotype in Gammabaculovirus biology.

48-hour wireless oesophageal pH-monitoring in children: are two days better than one?

PubMed

Gunnarsdóttir, A; Stenström, P; Arnbjörnsson, E

2007-12-01

Use of a catheter-free, radio telemetric, oesophageal pH-monitoring system in paediatric clinical practice allows patients to follow a more normal physiological pattern of activities and causes less discomfort. At our institution, placement of the capsule is done under general anaesthesia, which restricts the child's activity during the first day. The aim of this study was to determine whether oesophageal pH-measurements should be performed over 48 hours or whether 24-hour measurement provides sufficient and reliable results. The study included 24 consecutive children with symptomatic gastro-oesophageal reflux problems who had undergone upper gastrointestinal endoscopies under general anaesthesia. The radio-transmitting Bravo capsule was introduced transorally and placed above the diaphragm at a width of two vertebral bodies. Oesophageal acid exposure was monitored via a portable receiver for 48 hours. The children's symptoms during measurements were registered. Wilcoxon signed rank test for paired samples was used after power analysis. The capsule was successfully attached to the oesophageal mucosa in all cases with minor technical problems in only one patient. The 48-hour pH-monitoring was completed in 23 patients. The median percentage time with an oesophageal pH of less than 4 was 5.4 +/- 6.8 for the first 24 hours and 5.8 +/- 7.4 for the 48-hour measurement. The DeMeester score was 20.5 +/- 23.7 and 22.2 +/- 25.7, respectively. Ambulatory pH-monitoring using the wireless system is feasible and safe. It was well-tolerated by the children. There was no statistical difference between the pH-measurements or DeMeester scores during the first 24 hours compared with the 48-hour measurements. Individual variations were noted but had no clinical significance except in two patients. Our results support the use of pH-measurement for a period of 24 hours only.

p53 genes function to restrain mobile elements

PubMed Central

Wylie, Annika; Jones, Amanda E.; D'Brot, Alejandro; Lu, Wan-Jin; Kurtz, Paula; Moran, John V.; Rakheja, Dinesh; Chen, Kenneth S.; Hammer, Robert E.; Comerford, Sarah A.; Amatruda, James F.; Abrams, John M.

2016-01-01

Throughout the animal kingdom, p53 genes govern stress response networks by specifying adaptive transcriptional responses. The human member of this gene family is mutated in most cancers, but precisely how p53 functions to mediate tumor suppression is not well understood. Using Drosophila and zebrafish models, we show that p53 restricts retrotransposon activity and genetically interacts with components of the piRNA (piwi-interacting RNA) pathway. Furthermore, transposon eruptions occurring in the p53− germline were incited by meiotic recombination, and transcripts produced from these mobile elements accumulated in the germ plasm. In gene complementation studies, normal human p53 alleles suppressed transposons, but mutant p53 alleles from cancer patients could not. Consistent with these observations, we also found patterns of unrestrained retrotransposons in p53-driven mouse and human cancers. Furthermore, p53 status correlated with repressive chromatin marks in the 5′ sequence of a synthetic LINE-1 element. Together, these observations indicate that ancestral functions of p53 operate through conserved mechanisms to contain retrotransposons. Since human p53 mutants are disabled for this activity, our findings raise the possibility that p53 mitigates oncogenic disease in part by restricting transposon mobility. PMID:26701264

Whole genome co-expression analysis of soybean cytochrome P450 genes identifies nodulation-specific P450 monooxygenases

PubMed Central

2010-01-01

Background Cytochrome P450 monooxygenases (P450s) catalyze oxidation of various substrates using oxygen and NAD(P)H. Plant P450s are involved in the biosynthesis of primary and secondary metabolites performing diverse biological functions. The recent availability of the soybean genome sequence allows us to identify and analyze soybean putative P450s at a genome scale. Co-expression analysis using an available soybean microarray and Illumina sequencing data provides clues for functional annotation of these enzymes. This approach is based on the assumption that genes that have similar expression patterns across a set of conditions may have a functional relationship. Results We have identified a total number of 332 full-length P450 genes and 378 pseudogenes from the soybean genome. From the full-length sequences, 195 genes belong to A-type, which could be further divided into 20 families. The remaining 137 genes belong to non-A type P450s and are classified into 28 families. A total of 178 probe sets were found to correspond to P450 genes on the Affymetrix soybean array. Out of these probe sets, 108 represented single genes. Using the 28 publicly available microarray libraries that contain organ-specific information, some tissue-specific P450s were identified. Similarly, stress responsive soybean P450s were retrieved from 99 microarray soybean libraries. We also utilized Illumina transcriptome sequencing technology to analyze the expressions of all 332 soybean P450 genes. This dataset contains total RNAs isolated from nodules, roots, root tips, leaves, flowers, green pods, apical meristem, mock-inoculated and Bradyrhizobium japonicum-infected root hair cells. The tissue-specific expression patterns of these P450 genes were analyzed and the expression of a representative set of genes were confirmed by qRT-PCR. We performed the co-expression analysis on many of the 108 P450 genes on the Affymetrix arrays. First we confirmed that CYP93C5 (an isoflavone synthase gene) is

K11- and K48-Linked Ubiquitin Chains Interact with p97 during Endoplasmic Reticulum-Associated Degradation

PubMed Central

Locke, Matthew; Toth, Julia I.; Petroski, Matthew D.

2014-01-01

The AAA+ ATPase p97 has a critical function in the cytoplasmic degradation of proteins misfolded in the endoplasmic reticulum through a mechanism known as ER-associated degradation (ERAD). During this process, p97 binds polyubiquitinated ERAD substrates and couples ATP hydrolysis to their dislocation from the ER as a prerequisite to destruction by the proteasome. The ubiquitin signals important for this process are not fully understood. Here we report that p97 interacts with lysine 11 (K11) and K48-linked ubiquitin polymers, but not those containing K63 linkages. Disruption of p97 through siRNA-mediated depletion, dominant negative over-expression, or chemical inhibition results in the accumulation of K11 and K48 ubiquitin chains predominantly at the ER membrane, and is associated with ER stress induction. We show that a catalytically inactive deubiquitinating enzyme and p97 cofactor YOD1 enhances the accumulation of K11- and K48-linked polyubiquitin in the cytoplasm, at the ER membrane, and bound to p97. In addition to general effects on p97-associated ubiquitin polymers, the ERAD substrate CD3δ is modified with both K11- and K48-ubiquitin chains prior to p97-dependent dislocation. Collectively, our data are consistent with a major role for p97 in the recognition of K11 and K48 polyubiquitinated proteins prior to their degradation by the proteasome. PMID:24417208

The human CLN2 protein/tripeptidyl-peptidase I is a serine protease that autoactivates at acidic pH.

PubMed

Lin, L; Sohar, I; Lackland, H; Lobel, P

2001-01-19

The CLN2 gene mutated in the fatal hereditary neurodegenerative disease late infantile neuronal ceroid lipofuscinosis encodes a lysosomal protease with tripeptidyl-peptidase I activity. To understand the enzymological properties of the protein, we purified and characterized C-terminal hexahistidine-tagged human CLN2p/tripeptidyl-peptidase I produced from insect cells transfected with a baculovirus vector. The N terminus of the secreted 66-kDa protein corresponds to residue 20 of the primary CLN2 gene translation product, indicating removal of a 19-residue signal peptide. The purified protein is enzymatically inactive; however, upon acidification, it is proteolytically processed and concomitantly acquires enzymatic activity. The N terminus of the final 46-kDa processed form (Leu196) corresponds to that of mature CLN2p/tripeptidyl-peptidase I purified from human brain. The activity of the mature enzyme is irreversibly inhibited by the serine esterase inhibitor diisopropyl fluorophosphate, which specifically and stoichiometrically reacts with CLN2p/tripeptidyl-peptidase I at Ser475, demonstrating that this residue represents the active site nucleophile. Expression of wild type and mutant proteins in CHO cells indicate that Ser475, Asp360, Asp517, but not His236 are essential for activity. These data indicate that the CLN2 gene product is synthesized as an inactive proenzyme that is autocatalytically converted to an active serine protease.

Epigenetic profiling of cutaneous T-cell lymphoma: promoter hypermethylation of multiple tumor suppressor genes including BCL7a, PTPRG, and p73.

PubMed

van Doorn, Remco; Zoutman, Willem H; Dijkman, Remco; de Menezes, Renee X; Commandeur, Suzan; Mulder, Aat A; van der Velden, Pieter A; Vermeer, Maarten H; Willemze, Rein; Yan, Pearlly S; Huang, Tim H; Tensen, Cornelis P

2005-06-10

To analyze the occurrence of promoter hypermethylation in primary cutaneous T-cell lymphoma (CTCL) on a genome-wide scale, focusing on epigenetic alterations with pathogenetic significance. DNA isolated from biopsy specimens of 28 patients with CTCL, including aggressive CTCL entities (transformed mycosis fungoides and CD30-negative large T-cell lymphoma) and an indolent entity (CD30-positive large T-cell lymphoma), were investigated. For genome-wide DNA methylation screening, differential methylation hybridization using CpG island microarrays was applied, which allows simultaneous detection of the methylation status of 8640 CpG islands. Bisulfite sequence analysis was applied for confirmation and detection of hypermethylation of eight selected tumor suppressor genes. The DNA methylation patterns of CTCLs emerging from differential methylation hybridization analysis included 35 CpG islands hypermethylated in at least four of the 28 studied CTCL samples when compared with benign T-cell samples. Hypermethylation of the putative tumor suppressor genes BCL7a (in 48% of CTCL samples), PTPRG (27%), and thrombospondin 4 (52%) was confirmed and demonstrated to be associated with transcriptional downregulation. BCL7a was hypermethylated at a higher frequency in aggressive (64%) than in indolent (14%) CTCL entities. In addition, the promoters of the selected tumor suppressor genes p73 (48%), p16 (33%), CHFR (19%), p15 (10%), and TMS1 (10%) were hypermethylated in CTCL. Malignant T cells of patients with CTCL display widespread promoter hypermethylation associated with inactivation of several tumor suppressor genes involved in DNA repair, cell cycle, and apoptosis signaling pathways. In view of this, CTCL may be amenable to treatment with demethylating agents.

Oxothiomolybdenum derivatives of the superlacunary crown heteropolyanion {P8W48}: structure of [K4{Mo4O4S4(H2O)3(OH)2}2(WO2)(P8W48O184)]30– and studies in solution.

PubMed

Korenev, Vladimir S; Floquet, Sébastien; Marrot, Jérôme; Haouas, Mohamed; Mbomekallé, Israël-Martyr; Taulelle, Francis; Sokolov, Maxim N; Fedin, Vladimir P; Cadot, Emmanuel

2012-02-20

Reaction of the cyclic lacunary [H(7)P(8)W(48)O(184)](33-) anion (noted P(8)W(48)) with the [Mo(2)S(2)O(2)(H(2)O)(6)](2+) oxothiocation led to two compounds, namely, [K(4){Mo(4)O(4)S(4)(H(2)O)(3)(OH)(2)}(2)(WO(2))(P(8)W(48)O(184))](30-) (denoted 1) and [{Mo(4)O(4)S(4)(H(2)O)(3)(OH)(2)}(2)(P(8)W(48)O(184))](36-) (denoted 2), which were characterized in the solid state and solution. In the solid state, the structure of [K(4){Mo(4)O(4)S(4)(H(2)O)(3)(OH)(2)}(2)(WO(2))(P(8)W(48)O(184))](30-) reveals the presence of two disordered {Mo(4)O(4)S(4)(H(2)O)(3)(OH)(2)}(2+) "handles" connected on both sides of the P(8)W(48) ring. Such a disorder is consistent with the presence of two geometrical isomers where the relative disposition of the two {Mo(4)O(4)S(4)(H(2)O)(3)(OH)(2)}(2+) handles are arranged in a perpendicular or parallel mode. Such an interpretation is fully supported by (31)P and (183)W NMR solution studies. The relative stability of both geometrical isomers appears to be dependent upon the nature of the internal alkali cations, i.e., Na(+) vs K(+), and increased lability of the two {Mo(4)O(4)S(4)(H(2)O)(3)(OH)(2)}(2+) handles, compared to the oxo analogous, was clearly identified by significant broadening of the (31)P and (183)W NMR lines. Solution studies carried out by UV-vis spectroscopy showed that formation of the adduct [{Mo(4)O(4)S(4)(H(2)O)(3)(OH)(2)}(2)(P(8)W(48)O(184))](36-) occurs in the 1.5-4.7 pH range and corresponds to a fast and quantitative condensation process. Furthermore, (31)P NMR titrations in solution reveal formation of the "monohandle" derivative [{Mo(4)O(4)S(4)(H(2)O)(3)(OH)(2)}(P(8)W(48)O(184))](38-) as an intermediate prior to formation of the "bishandle" derivatives. Furthermore, the electrochemical behavior of [{Mo(4)O(4)S(4)(H(2)O)(3)(OH)(2)}(2)(P(8)W(48)O(184))](36-) was studied in aqueous medium and compared with the parent anion P(8)W(48).

P19-dependent and P19-independent reversion of F1-V gene silencing in tomato.

PubMed

Alvarez, M Lucrecia; Pinyerd, Heidi L; Topal, Emel; Cardineau, Guy A

2008-09-01

As a part of a project to develop a plant-made plague vaccine, we expressed the Yersinia pestis F1-V antigen fusion protein in tomato. We discovered that in some of these plants the expression of the f1-v gene was undetectable in leaves and fruit by ELISA, even though they had multiple copies of f1-v according to Southern-blot analysis. A likely explanation of these results is the phenomenon of RNA silencing, a group of RNA-based processes that produces sequence-specific inhibition of gene expression and may result in transgene silencing in plants. Here we report the reversion of the f1-v gene silencing in transgenic tomato plants through two different mechanisms. In the P19-dependent Reversion or Type I, the viral suppressor of gene silencing, P19, induces the reversion of gene silencing. In the P19-independent Reversion or Type II, the f1-v gene expression is restored after the substantial loss of gene copies as a consequence of transgene segregation in the progeny. The transient and stable expression of the p19 gene driven by a constitutive promoter as well as an ethanol inducible promoter induced a P19-dependent reversion of f1-v gene silencing. In particular, the second generation plant 3D1.6 had the highest P19 protein levels and correlated with the highest F1-V protein accumulation, almost a three-fold increase of F1-V protein levels in fruit than that previously reported for the non-silenced F1-V elite tomato lines. These results confirm the potential exploitation of P19 to substantially increase the expression of value-added proteins in plants.

A soluble form of P74 can act as a per os infectivity factor to the autographa californica multiple nucleopolyhedrovirus

USDA-ARS?s Scientific Manuscript database

The baculovirus occlusion-derived virion (ODV) is required to spread virus infection among insect hosts via the per os route. The Autographa californica Multicapsid Nucleopolyhedrovirus (AcMNPV) P74 protein is an ODV envelope protein that is essential for ODVs to be infectious. P74 is anchored in ...

Diversity in Expression of Phosphorus (P) Responsive Genes in Cucumis melo L

PubMed Central

Fita, Ana; Bowen, Helen C.; Hayden, Rory M.; Nuez, Fernando; Picó, Belén; Hammond, John P.

2012-01-01

Background Phosphorus (P) is a major limiting nutrient for plant growth in many soils. Studies in model species have identified genes involved in plant adaptations to low soil P availability. However, little information is available on the genetic bases of these adaptations in vegetable crops. In this respect, sequence data for melon now makes it possible to identify melon orthologues of candidate P responsive genes, and the expression of these genes can be used to explain the diversity in the root system adaptation to low P availability, recently observed in this species. Methodology and Findings Transcriptional responses to P starvation were studied in nine diverse melon accessions by comparing the expression of eight candidate genes (Cm-PAP10.1, Cm-PAP10.2, Cm-RNS1, Cm-PPCK1, Cm-transferase, Cm-SQD1, Cm-DGD1 and Cm-SPX2) under P replete and P starved conditions. Differences among melon accessions were observed in response to P starvation, including differences in plant morphology, P uptake, P use efficiency (PUE) and gene expression. All studied genes were up regulated under P starvation conditions. Differences in the expression of genes involved in P mobilization and remobilization (Cm-PAP10.1, Cm-PAP10.2 and Cm-RNS1) under P starvation conditions explained part of the differences in P uptake and PUE among melon accessions. The levels of expression of the other studied genes were diverse among melon accessions, but contributed less to the phenotypical response of the accessions. Conclusions This is the first time that these genes have been described in the context of P starvation responses in melon. There exists significant diversity in gene expression levels and P use efficiency among melon accessions as well as significant correlations between gene expression levels and phenotypical measurements. PMID:22536378

pGenN, a gene normalization tool for plant genes and proteins in scientific literature.

PubMed

Ding, Ruoyao; Arighi, Cecilia N; Lee, Jung-Youn; Wu, Cathy H; Vijay-Shanker, K

2015-01-01

Automatically detecting gene/protein names in the literature and connecting them to databases records, also known as gene normalization, provides a means to structure the information buried in free-text literature. Gene normalization is critical for improving the coverage of annotation in the databases, and is an essential component of many text mining systems and database curation pipelines. In this manuscript, we describe a gene normalization system specifically tailored for plant species, called pGenN (pivot-based Gene Normalization). The system consists of three steps: dictionary-based gene mention detection, species assignment, and intra species normalization. We have developed new heuristics to improve each of these phases. We evaluated the performance of pGenN on an in-house expertly annotated corpus consisting of 104 plant relevant abstracts. Our system achieved an F-value of 88.9% (Precision 90.9% and Recall 87.2%) on this corpus, outperforming state-of-art systems presented in BioCreative III. We have processed over 440,000 plant-related Medline abstracts using pGenN. The gene normalization results are stored in a local database for direct query from the pGenN web interface (proteininformationresource.org/pgenn/). The annotated literature corpus is also publicly available through the PIR text mining portal (proteininformationresource.org/iprolink/).

The activity of phenoloxidase in haemolymph plasma is not a predictor of Lymantria dispar resistance to its baculovirus

PubMed Central

Kasianov, Nikita S.; Belousova, Irina A.; Pavlushin, Sergey V.; Dubovskiy, Ivan M.; Podgwaite, John D.; Bakhvalov, Stanislav A.

2017-01-01

Host innate immunity is one of the factors that determines the resistance of insects to their entomopathogens. In the research reported here we studied whether or not phenoloxidase (PO), a key enzyme in the melanogenesis component of humoral immunity of insects, plays a role in the protection of Lymantria dispar larvae from infection by L. dispar multiple nucleopolyhedrovirus. We studied two types of viral infection: overt and covert. The following lines of investigation were tested: i) the intravital individual estimation of baseline PO activity in haemolymph plasma followed by virus challenging; ii) the specific inhibition of PO activity in vivo by peroral treatment of infected larvae with phenylthiourea (PTU), a competitive inhibitor of PO; iii) the evaluation of PO activity in the haemolymph plasma after larval starvation. Starvation is a stress that activates the covert infection to an overt form. All of these experiments did not show a relationship between PO activity in haemolymph plasma of L. dispar larvae and larval susceptibility to baculovirus. Moreover, starvation-induced activation of covert viral infection to an overt form occurred in 70 percent of virus-carrying larvae against the background of a dramatic increase of PO activity in haemolymph plasma in the insects studied. Our conclusion is that in L. dispar larvae PO activity is not a predictor of host resistance to baculovirus. PMID:28854240

Baculovirus directly activates murine NK cells via TLR9.

PubMed

Moriyama, T; Suzuki, T; Chang, M O; Kitajima, M; Takaku, H

2017-04-01

The importance of natural killer (NK) cells in innate immune responses against tumors or viral infections enhances the appeal of NK cell-based immunotherapeutic approaches. We have recently reported that baculovirus (BV)-infected dendritic cells (DCs; BV-DCs) induce antitumor immunity against established tumors in mice. These antitumor effects were CD8 + T-cell and NK cell dependent; however, they were found to be CD4 + T-cell independent. In this study, we investigated the involvement of Toll-like receptor 9 (TLR9) in the process of BV recognition by NK cells. We found that BV directly stimulated NK cells, induced the expression of the activation marker CD69 and promoted interferon-gamma (IFN-γ) production and cytotoxicity. Moreover, TLR9 knockout in mice (tlr9-/- NK cells) inhibited NK cell responses to BV, indicating that TLR9 may have a relevant role in the BV-induced upregulation of NK cell functions. Our data demonstrated for the first time that NK cells directly recognize BV via TLR9, which provides opportunities for the use of this technique as an effective tool for BV-based immunotherapies against malignancies.

Repression of the interleukin 6 gene promoter by p53 and the retinoblastoma susceptibility gene product

DOE Office of Scientific and Technical Information (OSTI.GOV)

Santhanam, U.; Ray, A.; Sehgal, P.B.

1991-09-01

The aberrant overexpression of interleukin 6 (IL-6) is implicated as an autocrine mechanism in the enhanced proliferation of the neoplastic cell elements in various B- and T-cell malignancies and in some carcinomas and sarcomas; many of these neoplasms have been shown to be associated with a mutated p53 gene. The possibility that wild-type (wt) p53, a nuclear tumor-suppressor protein, but not its transforming mutants might serve to repress IL-6 gene expression was investigated in HeLa cells. The authors transiently cotransfected these cells with constitutive cytomegalovirus (CMV) enhancer/promoter expression plasmids overproducing wt or mutant human or murine p53 and with appropriatemore » chloramphenicol acetyltransferase (CAT) reporter plasmids containing the promoter elements of human IL-6, c-fos, or {beta}-actin genes or of porcine major histocompatibility complex (MHC) class I gene in pN-38 to evaluate the effect of the various p53 species on these promoters. These observations identify transcriptional repression as a property of p53 and suggest that p53 and RB may be involved as transcriptional repressors in modulating IL-6 gene expression during cellular differentiation and oncogenesis.« less

pGenN, a Gene Normalization Tool for Plant Genes and Proteins in Scientific Literature

PubMed Central

Ding, Ruoyao; Arighi, Cecilia N.; Lee, Jung-Youn; Wu, Cathy H.; Vijay-Shanker, K.

2015-01-01

Background Automatically detecting gene/protein names in the literature and connecting them to databases records, also known as gene normalization, provides a means to structure the information buried in free-text literature. Gene normalization is critical for improving the coverage of annotation in the databases, and is an essential component of many text mining systems and database curation pipelines. Methods In this manuscript, we describe a gene normalization system specifically tailored for plant species, called pGenN (pivot-based Gene Normalization). The system consists of three steps: dictionary-based gene mention detection, species assignment, and intra species normalization. We have developed new heuristics to improve each of these phases. Results We evaluated the performance of pGenN on an in-house expertly annotated corpus consisting of 104 plant relevant abstracts. Our system achieved an F-value of 88.9% (Precision 90.9% and Recall 87.2%) on this corpus, outperforming state-of-art systems presented in BioCreative III. We have processed over 440,000 plant-related Medline abstracts using pGenN. The gene normalization results are stored in a local database for direct query from the pGenN web interface (proteininformationresource.org/pgenn/). The annotated literature corpus is also publicly available through the PIR text mining portal (proteininformationresource.org/iprolink/). PMID:26258475

Clinical therapeutic effect and biological monitoring of p53 gene in advanced hepatocellular carcinoma.

PubMed

Chen, Shixi; Chen, Jun; Xi, Wei; Xu, Weidong; Yin, Guowen

2014-02-01

To investigate the therapeutic effect and biological changes of hepatic arterial infusion of p53 gene by the percutaneous port catheter system on advanced hepatocellular carcinoma (HCC) through a prospective randomized trial. A total of 48 patients with advanced HCC between May 2005 and January 2009 were divided into the treatment group (30) and the control group (18). The port catheter system was implanted through the right external iliac artery approach in all the cases; the target artery was determined according to the manifestation of the angiograph. The patients in the treatment group were given arterial infusion of p53 gene (Gendicine, Shenzhen Sibiono GeneTech Co, Ltd) with Gendicine (10vp) combined with hydroxycamptothecin (20 mg), once a week, for a course continuously for 3 weeks. The arterial infusion with hydroxycamptothecin (20 mg) was given to the patients in the control group. Pretreatment/posttreatment a fetus protein and Karnofsky Performance Status values, change of tumor according to Response Evaluation Criteria in Solid Tumors (RECIST), and the survival time were analyzed. Pretreatment/posttreatment expression of mutant p53 gene and spontaneous micronucleus formation in the peripheral blood were evaluated by flow cytometry and micronucleus test in vivo. The patients in the treatment group received 1 to 8 courses of treatment, in which the differences between pretreatment/posttreatment AFP and KPS values were significant (P < 0.05), whereas there was no significant difference (P > 0.05) between pretreatment/posttreatment AFP and KPS values within the control group. After 1 month, the survival rates of the treatment and control groups (96.6% and 94.4%, respectively) and changes in the tumor evaluated according to RECIST were significantly different (P < 0.05) between the 2 groups. After 3 months, the survival rates of the treatment and control groups (83.3% and 55.6%, respectively) and changes in the tumor were also significantly different between

Systematic Search for Gene-Gene Interaction Effect on Prostate Cancer Risk

DTIC Science & Technology

2013-07-01

Systematic Search for Gene-Gene Interaction 5a. CONTRACT NUMBER Effect on Prostate Cancer Risk 5b. GRANT NUMBER W81XWH-09-1-0488 5c. PROGRAM...Supported by this grant ) 1. Tao S, Wang Z, Feng J, Hsu FC, Jin G, Kin ST, Zhang Z, Gronberg H, Zheng, SL, Isaacs WB, XU J, Sun J. A Genome-Wide Search for...order interactions among estrogen- metabolism genes in sporadic breast cancer. Am J Hum Genet, 69, 138-47. 48. Marchini, J., Donnelly, P. and Cardon

Recovery of an HMWP/hmwBP (pUL48/pUL47) complex from virions of human cytomegalovirus: subunit interactions, oligomer composition, and deubiquitylase activity.

PubMed

Tullman, Jennifer A; Harmon, Mary-Elizabeth; Delannoy, Michael; Gibson, Wade

2014-08-01

We report that the human cytomegalovirus (HCMV) high-molecular-weight tegument protein (HMWP, pUL48; 253 kDa) and the HMWP-binding protein (hmwBP, pUL47; 110 kDa) can be recovered as a complex from virions disrupted by treatment with 50 mM Tris (pH 7.5), 0.5 M NaCl, 0.5% NP-40, and 10 mM dithiothreitol [DTT]. The subunit ratio of the complex approximates 1:1, with a shape and structure consistent with an elongated heterodimer. The HMWP/hmwBP complex was corroborated by reciprocal coimmunoprecipitation experiments using antipeptide antibodies and lysates from both infected cells and disrupted virus particles. An interaction of the amino end of pUL48 (amino acids [aa] 322 to 754) with the carboxyl end of pUL47 (aa 693 to 982) was identified by fragment coimmunoprecipitation experiments, and a head-to-tail self-interaction of hmwBP was also observed. The deubiquitylating activity of pUL48 is retained in the isolated complex, which cleaves K11, K48, and K63 ubiquitin isopeptide linkages. Human cytomegalovirus (HCMV, or human herpesvirus 5 [HHV-5]) is a large DNA-containing virus that belongs to the betaherpesvirus subfamily and is a clinically important pathogen. Defining the constituent elements of its mature form, their organization within the particle, and the assembly process by which it is produced are fundamental to understanding the mechanisms of herpesvirus infection and developing drugs and vaccines against them. In this study, we report isolating a complex of two large proteins encoded by HCMV open reading frames (ORFs) UL47 and UL48 and identifying the binding domains responsible for their interaction with each other and of pUL47 with itself. Our calculations indicate that the complex is a rod-shaped heterodimer. Additionally, we determined that the ubiquitin-specific protease activity of the ORF UL48 protein was functional in the complex, cleaving K11-, K48-, and K63-linked ubiquitin dimers. This information builds on and extends our understanding of the

Fullerene-like organization of HIV gag-protein shell in virus-like particles produced by recombinant baculovirus.

PubMed

Nermut, M V; Hockley, D J; Jowett, J B; Jones, I M; Garreau, M; Thomas, D

1994-01-01

Virus-like particles produced by a recombinant baculovirus containing the HIV gag gene were examined by negative staining after delipidization. This technique demonstrated that the gag-protein shell consisted of radially arranged short rods which formed a network of ring-like structures. Similar structures were observed at the plasma membrane of infected cells which had been opened by wet-cleaving. Occasionally five or six subunits were observed forming a ring. These findings suggest that the gag-encoded precursor (pr55) is a rod-like molecule about 34 A in diameter and 85 A in length. A protein cylinder of such dimensions would have a molecular weight of 56K. The center-to-center distance of two neighboring rings formed by the rods was 66 +/- 8 A (N = 200) by direct measurements and 65 A as obtained from averaged images. This morphology and these dimensions indicate that the virus-like particles contain the gag precursor in the form of a near-spherical "fullerene-like" icosahedral shell. Our data indicate that the triangulation number of the rings equals 63. However, since one rod of pr55 is shared by two rings, the number of copies of the precursor will be 1890 as opposed to 2522 if the molecules were closely packed. The particle diameter of 102 nm deduced from the proposed model was close to the diameter obtained from thin sections of low-temperature-embedded specimens (103-108 nm).

Isolation of the alkane inducible cytochrome P450 (P450alk) gene from the yeast Candida tropicalis

EPA Science Inventory

The gene for the alkane-inducible cytochrome P450, P450alk, has been isolated from the yeast Candida tropicalis by immunoscreening a λgt11 library. Isolation of the gene has been identified on the basis of its inducibility and partial DNA sequence. Transcripts of this gene were i...

GSTM1 and GSTT1 Genes are Associated With DNA Damage of p53 Gene in Coke-oven Workers.

PubMed

He, Yuefeng; Qi, Jun; He, Fang; Zhang, Yongchang; Wang, Youlian; Zhang, Ruobing; Li, Gang

2017-06-01

This study investigated whether variations in GSTT1 and GSTM1 gene are associated with the DNA damage level of p53 gene. We quantified urinary 1-hydroxypyrene using high-performance liquid chromatography, and examined the DNA damage level of p53 gene by real-time quantitative PCR in 756 coke-oven workers. Multiplex PCR was used to detect the presence or absence of genes. DNA damage levels of p53 gene in the high exposure group and intermediate exposure group were significantly higher than that of p53 gene in the low exposure group (P < 0.01). In coke-oven workers, the DNA damage levels of subjects with non-null genotype in GSTT1 or GSTM1 gene were significantly higher than that of those with the null genotype (P < 0.01). GSTT1 and GSTM1 may modulate DNA damage levels of p53 gene when exposed to polycyclic aromatic hydrocarbons.

Microbubble-assisted p53, RB, and p130 gene transfer in combination with radiation therapy in prostate cancer.

PubMed

Nande, Rounak; Greco, Adelaide; Gossman, Michael S; Lopez, Jeffrey P; Claudio, Luigi; Salvatore, Marco; Brunetti, Arturo; Denvir, James; Howard, Candace M; Claudio, Pier Paolo

2013-06-01

Combining radiation therapy and direct intratumoral (IT) injection of adenoviral vectors has been explored as a means to enhance the therapeutic potential of gene transfer. A major challenge for gene transfer is systemic delivery of nucleic acids directly into an affected tissue. Ultrasound (US) contrast agents (microbubbles) are viable candidates to enhance targeted delivery of systemically administered genes. Here we show that p53, pRB, and p130 gene transfer mediated by US cavitation of microbubbles at the tumor site resulted in targeted gene transduction and increased reduction in tumor growth compared to DU-145 prostate cancer cell xenografts treated intratumorally with adenovirus (Ad) or radiation alone. Microbubble-assisted/US-mediated Ad.p53 and Ad.RB treated tumors showed significant reduction in tumor volume compared to Ad.p130 treated tumors (p<0.05). Additionally, US mediated microbubble delivery of p53 and RB combined with external beam radiation resulted in the most profound tumor reduction in DU-145 xenografted nude mice (p<0.05) compared to radiation alone. These findings highlight the potential therapeutic applications of this novel image-guided gene transfer technology in combination with external beam radiation for prostate cancer patients with therapy resistant disease.

Establishment of a new human pre-B acute lymphoblastic leukemia cell line (KMO-90) with 1;19 translocation carrying p53 gene alterations.

PubMed

Sotomatsu, M; Hayashi, Y; Kawamura, M; Yugami, S; Shitara, T

1993-10-01

A new human pre-B acute lymphoblastic leukemia cell line (KMO-90) was established from the bone marrow sample of a 12-year-old girl with acute lymphoblastic leukemia (ALL) carrying 1;19 chromosome translocation. KMO-90 cells expressed HLA-DR, CD10, CD19, and CD22 antigens. These cells had also cytoplasmic immunoglobulin lacking surface immunoglobulin, indicating that these had a pre-B phenotype. Chromosome analysis of this cell line showed 48, XX, +8, +19, t(1;19)(q23;p13). Southern blot analysis showed the same sized rearrangements of the E2A gene in KMO-90 cells as those in the original leukemic cells. By means of reverse transcriptase-polymerase chain reaction analysis, we detected E2A/PBX1 fusion transcripts in KMO-90 cells. KMO-90 is useful when studying the role of the 1;19 translocation in the etiology of pre-B ALL. Furthermore, we studied alterations of the p53 gene in this cell line by polymerase chain reaction, single-strand conformation polymorphism analysis. KMO-90 cells were identified to have a point mutation at codon 177 (CCC-->TCC) of the p53 gene, suggesting that alterations of the p53 gene may have an important role in the establishment of this cell line.

Development of a sensitive and specific indirect enzyme-linked immunosorbent assay based on a baculovirus recombinant antigen for detection of specific antibodies against Ehrlichia canis.

PubMed

López, Lissett; Venteo, Angel; Aguirre, Enara; García, Marga; Rodríguez, Majosé; Amusátegui, Inmaculada; Tesouro, Miguel A; Vela, Carmen; Sainz, Angel; Rueda, Paloma

2007-11-01

An indirect enzyme-linked immunosorbent assay (ELISA) based on baculovirus recombinant P30 protein of Ehrlichia canis and the 1BH4 anticanine IgG monoclonal antibody was developed and evaluated by examining a panel of 98 positive and 157 negative sera using the indirect fluorescent antibody (IFA) test as the reference technique. The P30-based ELISA appeared to be sensitive and specific (77.55% and 95.54%, respectively) when qualitative results (positive/negative) were compared with those of the IFA test; the coefficient of correlation (R) between the 2 tests was 0.833. Furthermore, it was possible to establish a mathematical formula for use in comparing the results of both techniques. These results indicate that recombinant P30 antigen-based ELISA is a suitable alternative of the IFA test for simple, consistent, and rapid serodiagnosis of canine ehrlichiosis. Moreover, the use of this recombinant protein as antigen offers a great advantage for antigen preparation in comparison with other techniques in which the whole E. canis organism is used as antigen.

Gamow-Teller strength observed in the 48Ti(n, p) 48Sc reaction: Implications for the double beta decay of 48Ca

NASA Astrophysics Data System (ADS)

Alford, W. P.; Helmer, R. L.; Abegg, R.; Celler, A.; Frekers, D.; Green, P.; Häusser, O.; Henderson, R.; Hicks, K.; Jackson, K. P.; Jeppesen, R.; Miller, C. A.; Trudel, A.; Vetterli, M.; Yen, S.; Pourang, R.; Watson, J.; Brown, B. A.; Engel, J.

1990-07-01

Cross sections for the 48Ti(n, p) reaction have been measured at angles of 0°, 6°, and 12° at an energy of 200 MeV. The measurements are compared with results of DWIA calculations to obtain estimates of transition strengths for L = 0, 1, and ⩾2 up to an excitation energy of 25 MeV. Gamow-Teller strength ( L = 0) is peaked between 3 and 4 MeV excitation energy, with a significant distribution extending to about 12 MeV. The L = 1 strength is found mainly between 6 and 20 MeV while the cross section for transitions with L ⩾2 increases from 10 MeV to the upper limit of the measurements. The distribution of Gamow-Teller strength is in poor agreement with theoretical distributions used to calculate the lifetime for double beta decay of 48Ca.

A novel dual vector coexpressing PhiX174 lysis E gene and staphylococcal nuclease A gene on the basis of lambda promoter pR and pL, respectively.

PubMed

Fu, Lixia; Lu, Chengping

2013-06-01

Bacterial ghost is a novel vaccine platform, and its safe and efficient production depends largely upon a suitable and functional vector. In this study, a series of temperature-inducible plasmids, carrying Phix174 lysis gene E and/or staphylococcal nuclease A (SNA) gene, were constructed and evaluated in Escherichia coli. The results showed that the direct product of SNA (pBV220-SNA) could degrade the plasmid and genomic DNA of E. coli while the fusion product of gene E and partial Cro gene (pKF396M-2) lost the ability to lyse the host strain. The insertion of enhancer T7g10 elements and Shine-Dalgarno box (ESD) between them (pKF396M-3) could resume the function of gene E. Using plasmid pKF396M-4 with gene E and SNA, respectively, under the immediate control of promoter pR and pL, the remnant plasmids and genomic DNA of E. coli were eliminated, and the rates of inactivation increased by two orders of magnitude over that obtained with the exclusive use of E-mediated lysis plasmid. By substituting these two genes with customized multiple cloning sites sequences, the plasmid could be modified to a dual expression vector (pKF396M-5).

Overexpression of p53 mRNA in colorectal cancer and its relationship to p53 gene mutation.

PubMed Central

el-Mahdani, N.; Vaillant, J. C.; Guiguet, M.; Prévot, S.; Bertrand, V.; Bernard, C.; Parc, R.; Béréziat, G.; Hermelin, B.

1997-01-01

We analysed the frequency of p53 mRNA overexpression in a series of 109 primary colorectal carcinomas and its association with p53 gene mutation, which has been correlated with short survival. Sixty-nine of the 109 cases (63%) demonstrated p53 mRNA overexpression, without any correlation with stage or site of disease. Comparison with p53 gene mutation indicated that, besides cases in which p53 gene mutation and p53 mRNA overexpression were either both present (40 cases) or both absent (36 cases), there were also cases in which p53 mRNA was overexpressed in the absence of any mutation (29 cases) and those with a mutant gene in which the mRNA was not overexpressed (four cases). Moreover, the mutant p53 tumours exhibited an increase of p53 mRNA expression, which was significantly higher in tumours expressing the mutated allele alone than in tumours expressing both wild- and mutated-type alleles. These data (1) show that p53 mRNA overexpression is a frequent event in colorectal tumours and is not predictive of the status of the gene, i.e. whether or not a mutation is present; (2) provide further evidence that p53 protein overexpression does not only result from an increase in the half-life of mutated p53 and suggest that inactivation of the p53 function in colorectal cancers involves at least two distinct mechanisms, including p53 overexpression and/or mutation; and (3) suggest that p53 mRNA overexpression is an early event, since it is not correlated with Dukes stage. PMID:9052405

An auxin responsive CLE gene regulates shoot apical meristem development in Arabidopsis

PubMed Central

Guo, Hongyan; Zhang, Wei; Tian, Hainan; Zheng, Kaijie; Dai, Xuemei; Liu, Shanda; Hu, Qingnan; Wang, Xianling; Liu, Bao; Wang, Shucai

2015-01-01

Plant hormone auxin regulates most, if not all aspects of plant growth and development, including lateral root formation, organ pattering, apical dominance, and tropisms. Peptide hormones are peptides with hormone activities. Some of the functions of peptide hormones in regulating plant growth and development are similar to that of auxin, however, the relationship between auxin and peptide hormones remains largely unknown. Here we report the identification of OsCLE48, a rice (Oryza sativa) CLE (CLAVATA3/ENDOSPERM SURROUNDING REGION) gene, as an auxin response gene, and the functional characterization of OsCLE48 in Arabidopsis and rice. OsCLE48 encodes a CLE peptide hormone that is similar to Arabidopsis CLEs. RT-PCR analysis showed that OsCLE48 was induced by exogenously application of IAA (indole-3-acetic acid), a naturally occurred auxin. Expression of integrated OsCLE48p:GUS reporter gene in transgenic Arabidopsis plants was also induced by exogenously IAA treatment. These results indicate that OsCLE48 is an auxin responsive gene. Histochemical staining showed that GUS activity was detected in all the tissue and organs of the OsCLE48p:GUS transgenic Arabidopsis plants. Expression of OsCLE48 under the control of the 35S promoter in Arabidopsis inhibited shoot apical meristem development. Expression of OsCLE48 under the control of the CLV3 native regulatory elements almost completely complemented clv3-2 mutant phenotypes, suggesting that OsCLE48 is functionally similar to CLV3. On the other hand, expression of OsCLE48 under the control of the 35S promoter in Arabidopsis has little, if any effects on root apical meristem development, and transgenic rice plants overexpressing OsCLE48 are morphologically indistinguishable from wild type plants, suggesting that the functions of some CLE peptides may not be fully conserved in Arabidopsis and rice. Taken together, our results showed that OsCLE48 is an auxin responsive peptide hormone gene, and it regulates shoot apical

Functional Regulation of an Autographa californica Nucleopolyhedrovirus-Encoded MicroRNA, AcMNPV-miR-1, in Baculovirus Replication

PubMed Central

Zhu, Mengxiao; Deng, Riqiang

2016-01-01

ABSTRACT An Autographa californica nucleopolyhedrovirus-encoded microRNA (miRNA), AcMNPV-miR-1, downregulates the ac94 gene, reducing the production of infectious budded virions and accelerating the formation of occlusion-derived virions. In the current study, four viruses that constitutively overexpress AcMNPV-miR-1 were constructed to further explore the function of the miRNA. In addition to the ac94 gene, two new viral gene targets (ac18 and ac95) of AcMNPV-miR-1 were identified, and the possible interacting proteins were verified and tested. In the context of AcMNPV-miR-1 overexpression, ac18 was slightly upregulated, and ac95 was downregulated. Several interacting proteins were identified, and a functional pathway for AcMNPV-miR-1 was deduced. AcMNPV-miR-1 overexpression decreased budded virus infectivity, reduced viral DNA replication, accelerated polyhedron formation, and promoted viral infection efficiency in Trichoplusia ni larvae, suggesting that AcMNPV-miR-1 restrains virus infection of cells but facilitates virus infection of larvae. IMPORTANCE Recently, microRNAs (miRNAs) have been widely reported as moderators or regulators of mammalian cellular processes, especially disease-related pathways in humans. However, the roles played by miRNAs encoded by baculoviruses, which infect numerous beneficial insects and agricultural pests, have rarely been described. To explore the actions of virus-encoded miRNAs, we investigated an miRNA encoded by Autographa californica nucleopolyhedrovirus (AcMNPV-miR-1). We previously identified this miRNA through the exogenous addition of AcMNPV-miR-1 mimics. In the current study, we constitutively overexpressed AcMNPV-miR-1 and analyzed the resultant effects to more comprehensively assess what is indeed the function of this miRNA during viral infection. In addition, we widely explored the target genes for the miRNA in the viral and host genomes and proposed a possible functional network for AcMNPV-miR-1, which provides a

Continuous Influx of Genetic Material from Host to Virus Populations

PubMed Central

Gilbert, Clément; Peccoud, Jean; Chateigner, Aurélien; Moumen, Bouziane

2016-01-01

Many genes of large double-stranded DNA viruses have a cellular origin, suggesting that host-to-virus horizontal transfer (HT) of DNA is recurrent. Yet, the frequency of these transfers has never been assessed in viral populations. Here we used ultra-deep DNA sequencing of 21 baculovirus populations extracted from two moth species to show that a large diversity of moth DNA sequences (n = 86) can integrate into viral genomes during the course of a viral infection. The majority of the 86 different moth DNA sequences are transposable elements (TEs, n = 69) belonging to 10 superfamilies of DNA transposons and three superfamilies of retrotransposons. The remaining 17 sequences are moth sequences of unknown nature. In addition to bona fide DNA transposition, we uncover microhomology-mediated recombination as a mechanism explaining integration of moth sequences into viral genomes. Many sequences integrated multiple times at multiple positions along the viral genome. We detected a total of 27,504 insertions of moth sequences in the 21 viral populations and we calculate that on average, 4.8% of viruses harbor at least one moth sequence in these populations. Despite this substantial proportion, no insertion of moth DNA was maintained in any viral population after 10 successive infection cycles. Hence, there is a constant turnover of host DNA inserted into viral genomes each time the virus infects a moth. Finally, we found that at least 21 of the moth TEs integrated into viral genomes underwent repeated horizontal transfers between various insect species, including some lepidopterans susceptible to baculoviruses. Our results identify host DNA influx as a potent source of genetic diversity in viral populations. They also support a role for baculoviruses as vectors of DNA HT between insects, and call for an evaluation of possible gene or TE spread when using viruses as biopesticides or gene delivery vectors. PMID:26829124

Continuous Influx of Genetic Material from Host to Virus Populations.

PubMed

Gilbert, Clément; Peccoud, Jean; Chateigner, Aurélien; Moumen, Bouziane; Cordaux, Richard; Herniou, Elisabeth A

2016-02-01

Many genes of large double-stranded DNA viruses have a cellular origin, suggesting that host-to-virus horizontal transfer (HT) of DNA is recurrent. Yet, the frequency of these transfers has never been assessed in viral populations. Here we used ultra-deep DNA sequencing of 21 baculovirus populations extracted from two moth species to show that a large diversity of moth DNA sequences (n = 86) can integrate into viral genomes during the course of a viral infection. The majority of the 86 different moth DNA sequences are transposable elements (TEs, n = 69) belonging to 10 superfamilies of DNA transposons and three superfamilies of retrotransposons. The remaining 17 sequences are moth sequences of unknown nature. In addition to bona fide DNA transposition, we uncover microhomology-mediated recombination as a mechanism explaining integration of moth sequences into viral genomes. Many sequences integrated multiple times at multiple positions along the viral genome. We detected a total of 27,504 insertions of moth sequences in the 21 viral populations and we calculate that on average, 4.8% of viruses harbor at least one moth sequence in these populations. Despite this substantial proportion, no insertion of moth DNA was maintained in any viral population after 10 successive infection cycles. Hence, there is a constant turnover of host DNA inserted into viral genomes each time the virus infects a moth. Finally, we found that at least 21 of the moth TEs integrated into viral genomes underwent repeated horizontal transfers between various insect species, including some lepidopterans susceptible to baculoviruses. Our results identify host DNA influx as a potent source of genetic diversity in viral populations. They also support a role for baculoviruses as vectors of DNA HT between insects, and call for an evaluation of possible gene or TE spread when using viruses as biopesticides or gene delivery vectors.

Molecular and immunohistochemical analysis of P53 in phaeochromocytoma.

PubMed Central

Dahia, P. L.; Aguiar, R. C.; Tsanaclis, A. M.; Bendit, I.; Bydlowski, S. P.; Abelin, N. M.; Toledo, S. P.

1995-01-01

We searched for mutations of the p53 gene in 25 phaeochromocytomas using polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) analysis of the entire conserved region of the gene, encompassing exons 4-8; expression of the p53 protein was assessed by immunohistochemistry. No mutations were found, while a polymorphism in codon 72 was observed. Immunohistochemistry revealed nuclear p53 overexpression in one tumour sample. We conclude that mutations of the 'hotspot' region of the p53 gene do not seem to play a role in the pathogenesis of phaeochromocytoma. Images Figure 1 Figure 2 Figure 3 PMID:7577469

Seroprevalence of sapovirus in dogs using baculovirus-expressed virus-like particles.

PubMed

Melegari, Irene; Marsilio, Fulvio; Di Profio, Federica; Sarchese, Vittorio; Massirio, Ivano; Palombieri, Andrea; D'Angelo, Anna Rita; Lanave, Gianvito; Diakoudi, Georgia; Cavalli, Alessandra; Martella, Vito; Di Martino, Barbara

2018-06-02

Caliciviruses of the Sapovirus genus have been recently detected in dogs. Canine sapoviruses (SaVs) have been identified in the stools of young or juvenile animals with gastro-enteric disease at low prevalence (2.0-2.2%), but whether they may have a role as enteric pathogens and to which extent dogs are exposed to SaVs remains unclear. Here, we report the expression in a baculovirus system of virus like-particles (VLPs) of a canine SaV strain, the prototype virus Bari/4076/2007/ITA. The recombinant antigen was used to develop an enzyme-linked immunosorbent assay (ELISA). By screening an age-stratified collection of serum samples from 516 dogs in Italy, IgG antibodies specific for the canine SaV VLPs were detected in 40.3% (208/516) of the sera. Also, as observed for SaV infection in humans, we observed a positive association between seropositivity and age, with the highest prevalence rates in dogs older than 4 years of age. Copyright © 2018 Elsevier B.V. All rights reserved.

Heterologous expression of proteins from Plasmodium falciparum: results from 1000 genes.

PubMed

Mehlin, Christopher; Boni, Erica; Buckner, Frederick S; Engel, Linnea; Feist, Tiffany; Gelb, Michael H; Haji, Lutfiyah; Kim, David; Liu, Colleen; Mueller, Natascha; Myler, Peter J; Reddy, J T; Sampson, Joshua N; Subramanian, E; Van Voorhis, Wesley C; Worthey, Elizabeth; Zucker, Frank; Hol, Wim G J

2006-08-01

As part of a structural genomics initiative, 1000 open reading frames from Plasmodium falciparum, the causative agent of the most deadly form of malaria, were tested in an E. coli protein expression system. Three hundred and thirty-seven of these targets were observed to express, although typically the protein was insoluble. Sixty-three of the targets provided soluble protein in yields ranging from 0.9 to 406.6 mg from one liter of rich media. Higher molecular weight, greater protein disorder (segmental analysis, SEG), more basic isoelectric point (pI), and a lack of homology to E. coli proteins were all highly and independently correlated with difficulties in expression. Surprisingly, codon usage and the percentage of adenosines and thymidines (%AT) did not appear to play a significant role. Of those proteins which expressed, high pI and a hypothetical annotation were both strongly and independently correlated with insolubility. The overwhelmingly important role of pI in both expression and solubility appears to be a surprising and fundamental issue in the heterologous expression of P. falciparum proteins in E. coli. Twelve targets which did not express in E. coli from the native gene sequence were codon-optimized through whole gene synthesis, resulting in the (insoluble) expression of three of these proteins. Seventeen targets which were expressed insolubly in E. coli were moved into a baculovirus/Sf-21 system, resulting in the soluble expression of one protein at a high level and six others at a low level. A variety of factors conspire to make the heterologous expression of P. falciparum proteins challenging, and these observations lay the groundwork for a rational approach to prioritizing and, ultimately, eliminating these impediments.

Intermediate Nuclear Structure for 2v 2{beta} Decay of {sup 48}Ca Studied by (p, n) and (n, p) Reactions at 300 MeV

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sakai, H.; Yako, K.

2009-08-26

Angular distributions of the double differential cross sections for the {sup 48}Ca(p,n) and the {sup 48}Ti(n,p) reactions were measured at 300 MeV. A multipole decomposition technique was applied to the spectra to extract the Gamow-Teller (GT) transition strengths. In the (n, p) spectrum beyond 8 MeV excitation energy extra B(GT{sup +}) strengths which are not predicted by the shell model calculation. This extra B(GT{sup +}) strengths significantly contribute to the nuclear matrix element of the 2v2{beta}-decay.

Genetic diversity of transmission-blocking vaccine candidate Pvs48/45 in Plasmodium vivax populations in China.

PubMed

Feng, Hui; Gupta, Bhavna; Wang, Meilian; Zheng, Wenqi; Zheng, Li; Zhu, Xiaotong; Yang, Yimei; Fang, Qiang; Luo, Enjie; Fan, Qi; Tsuboi, Takafumi; Cao, Yaming; Cui, Liwang

2015-12-01

The male gamete fertilization factor P48/45 in malaria parasites is a prime transmission-blocking vaccine (TBV) candidate. Efforts to develop antimalarial vaccines are often thwarted by genetic diversity of the target antigens. Here we evaluated the genetic diversity of Pvs48/45 gene in global Plasmodium vivax populations. We determined 200 Pvs48/45 sequences collected from temperate and subtropical parasite populations in China. Population genetic and evolutionary analyses were performed to determine the levels of genetic diversity, potential signature of selection, and population differentiation. Analysis of the Pvs48/45 sequences from 200 P. vivax parasites collected in a temperate and a tropical region revealed a low level of genetic diversity (π = 0.0012) with 14 single nucleotide polymorphisms, of which 11 were nonsynonymous. Analysis of 344 Pvs48/45 sequences from nine worldwide P. vivax populations detected a total of 38 haplotypes, of which 13 haplotypes were present only once. Multiple tests for selection confirmed a signature of positive selection on Pvs48/45 with selection skewed to the second cysteine domain. Haplotype network analysis and Wright's fixation index showed large geographical differentiation with the presence of continent-or region-specific mutations in this gene. Pvs48/45 displays low levels of genetic diversity with the presence of region-specific mutations. Some of the mutations may be potential epitope targets based on their positions in the predicted structure, highlighting the need for future evaluation of these mutations in designing Pvs48/45-based TBV.

p21 as a Transcriptional Co-Repressor of S-Phase and Mitotic Control Genes

PubMed Central

Ferrándiz, Nuria; Caraballo, Juan M.; García-Gutierrez, Lucía; Devgan, Vikram; Rodriguez-Paredes, Manuel; Lafita, M. Carmen; Bretones, Gabriel; Quintanilla, Andrea; Muñoz-Alonso, M. Jose; Blanco, Rosa; Reyes, Jose C.; Agell, Neus; Delgado, M. Dolores; Dotto, G. Paolo; León, Javier

2012-01-01

It has been previously described that p21 functions not only as a CDK inhibitor but also as a transcriptional co-repressor in some systems. To investigate the roles of p21 in transcriptional control, we studied the gene expression changes in two human cell systems. Using a human leukemia cell line (K562) with inducible p21 expression and human primary keratinocytes with adenoviral-mediated p21 expression, we carried out microarray-based gene expression profiling. We found that p21 rapidly and strongly repressed the mRNA levels of a number of genes involved in cell cycle and mitosis. One of the most strongly down-regulated genes was CCNE2 (cyclin E2 gene). Mutational analysis in K562 cells showed that the N-terminal region of p21 is required for repression of gene expression of CCNE2 and other genes. Chromatin immunoprecipitation assays indicated that p21 was bound to human CCNE2 and other p21-repressed genes gene in the vicinity of the transcription start site. Moreover, p21 repressed human CCNE2 promoter-luciferase constructs in K562 cells. Bioinformatic analysis revealed that the CDE motif is present in most of the promoters of the p21-regulated genes. Altogether, the results suggest that p21 exerts a repressive effect on a relevant number of genes controlling S phase and mitosis. Thus, p21 activity as inhibitor of cell cycle progression would be mediated not only by the inhibition of CDKs but also by the transcriptional down-regulation of key genes. PMID:22662213

Localization of a new autosomal dominant retinitis pigmentosa gene on chromosome 17p screeningof candidate genes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Greenberg, J.; Goliath, R.; Shugart, Y.Y.

1994-09-01

A new gene locus for autosomal dominant retinitis pigmentosa (ADRP) on 17p has been identified in a large South African (SA) family consisting of 28 living affected individuals in 4 successive generations. This is the first ADRP gene to be reported from SA. The human recoverin (RCVN) gene, which codes for a retinal-specific protein important in recovery to the dark state after visual excitation, has been mapped to 17p13.1 and was considered as a prime candidate gene for the disorder in this family. Mutation screening (using 8 different electrophoretic conditions to resolve heteroduplexes and SSCPs) did not produce any evidencemore » of RCVN being involved in the pathogenesis of ADRP in this SA family. In addition, a mobility shift detected within exon 1 of the RCVN gene did not track with the ADRP phenotype. RP patients from 77 SA families and 30 normal individuals are being examined to establish the frequency of this polymorphism in the SA population. Highly polymorphic markers from 17p13 are now being sought in order to establish the minimum region containing this novel ADRP-SA gene. Two additional recently described retinal-expressed cDNAs, guanylyl cyclase and pigment epithelium-derived factor, which map to 17p13.1, will be tested for tight linkage to ADRP-SA.« less

Cannibalism and virus production in Spodoptera frugiperda (J.E. Smith) (Lepidoptera: Noctuidae) larvae fed with two leaf substrates inoculated with Baculovirus spodoptera.

PubMed

Valicente, F H; Tuelher, E S; Pena, R C; Andreazza, R; Guimarães, M R F

2013-04-01

Cannibalism in the fall armyworm, Spodoptera frugiperda (J.E. Smith) (Lepidoptera: Noctuidae) (FAW), is a limiting factor in a baculovirus production system. To detect the impact of cannibalism, a two-step bioassay was conducted with different larval ages of FAW fed on two food sources (corn and castor bean leaves) contaminated with the S. frugiperda multiple-embedded nucleopolyhedrovirus. In a first bioassay, the food source affected the cannibalism, being higher for all larval ages tested (5-, 6- and 7-day-old larvae) in larvae fed on corn than on those fed on castor bean leaves. Larval mortality, weight equivalent and larval equivalents (LEs) per hectare decreased as the larval age increased. Larval weight, occlusion bodies (OBs)/larva and total OBs increased when the larval age increased. In a second bioassay, in which only 6- and 7-day-old larvae were used because of the performance in the first bioassay, the cannibalism rates were affected by the interaction between food sources and time of feeding (48 and 72 h), reaching the highest values for 6- and 7-day-old larvae fed on corn leaves for 72 h. Mortality of the FAW was affected by the interaction between food sources, larval age and time of feeding. The lowest mortalities were on 7-day-old larvae when they were fed on castor bean leaves for 48 and 72 h. Larval weight, OBs/larva, total OBs and LEs were affected by the interaction between food sources and larval age. A significant correlation was observed between larval weight and OBs/larva that fed on both food sources, suggesting that larval weight can be used to achieve a concentration to be sprayed in 1 ha.

CHARACTERIZATION OF THE ALKANE-INDUCIBLE CYTOCHROME P450 (P450ALK) GENE FROM THE YEAST CANDIDA TROPICALIS: IDENTIFICATION OF A NEW P450 FAMILY

EPA Science Inventory

The P450alk gene, which is inducible by the assimilation of alkane in Candida tropicalis, was sequenced and characterized. Structural features described in promoter and terminator regions of Saccharomyces yeast genes are present in the P450alk gene and some particular structures ...

Escherichia coli K-12 and B contain functional bacteriophage P2 ogr genes.

PubMed Central

Slettan, A; Gebhardt, K; Kristiansen, E; Birkeland, N K; Lindqvist, B H

1992-01-01

The bacteriophage P2 ogr gene encodes an essential 72-amino-acid protein which acts as a positive regulator of P2 late transcription. A P2 ogr deletion phage, which depends on the supply of Ogr protein in trans for lytic growth on Escherichia coli C, has previously been constructed. E. coli B and K-12 were found to support the growth of the ogr-defective P2 phage because of the presence of functional ogr genes located in cryptic P2-like prophages in these strains. The cryptic ogr genes were cloned and sequenced. Compared with the P2 wild-type ogr gene, the ogr genes in the B and K-12 strains are conserved, containing mostly silent base substitutions. One of the base substitutions in the K-12 ogr gene results in replacement of an alanine with valine at position 57 in the Ogr protein but does not seem to affect the function of Ogr as a transcriptional activator. The cryptic ogr genes are constitutively transcribed, apparently at a higher level than the wild-type ogr gene in a P2 lysogen. Images PMID:1597424

48. Neg. No. P3120, ca. 1930, Photographer A. C. Gates, ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

48. Neg. No. P-3120, ca. 1930, Photographer- A. C. Gates, Los Angeles, AERIAL VIEW OF THE FORD MOTOR COMPANY ASSEMBLY PLANT, PRIOR TO CONSTRUCTION OF THE PRESSED STEEL BUILDING, NOTE THE CLIPPER SHIPS IN THE BACKGROUND, AND THE OIL WELLS IN THE UPPER LEFT CORNER - Ford Motor Company Long Beach Assembly Plant, Assembly Building, 700 Henry Ford Avenue, Long Beach, Los Angeles County, CA

Hsf1p and Msn2/4p cooperate in the expression of Saccharomyces cerevisiae genes HSP26 and HSP104 in a gene- and stress type-dependent manner.

PubMed

Amorós, M; Estruch, F

2001-03-01

Saccharomyces cerevisiae possesses several transcription factors involved in the transcriptional activation of stress-induced genes. Among them, the heat shock factor (Hsf1p) and the zinc finger proteins of the general stress response (Msn2p and Msn4p) have been shown to play a major role in stress protection. Some heat shock protein (HSP) genes contain both heat shock elements (HSEs) and stress response elements (STREs), suggesting the involvement of both transcription factors in their regulation. Analysis of the stress-induced expression of two of these genes, HSP26 and HSP104, reveals that the contribution of Hsf1p and Msn2/4p is different depending on the gene and the stress condition.

The Baculovirus-Expressed Binding Region of Plasmodium falciparum EBA-140 Ligand and Its Glycophorin C Binding Specificity

PubMed Central

Rydzak, Joanna; Kaczmarek, Radoslaw; Czerwinski, Marcin; Lukasiewicz, Jolanta; Tyborowska, Jolanta; Szewczyk, Boguslaw; Jaskiewicz, Ewa

2015-01-01

The erythrocyte binding ligand 140 (EBA-140) is a member of the Plasmodium falciparum DBL family of erythrocyte binding proteins, which are considered as prospective candidates for malaria vaccine development. The EBA-140 ligand is a paralogue of the well-characterized P. falciparum EBA-175 protein. They share homology of domain structure, including Region II, which consists of two homologous F1 and F2 domains and is responsible for ligand-erythrocyte receptor interaction during invasion. In this report we describe, for the first time, the glycophorin C specificity of the recombinant, baculovirus-expressed binding region (Region II) of P. falciparum EBA-140 ligand. It was found that the recombinant EBA-140 Region II binds to the endogenous and recombinant glycophorin C, but does not bind to Gerbich-type glycophorin C, neither normal nor recombinant, which lacks amino acid residues 36–63 of its polypeptide chain. Our results emphasize the crucial role of this glycophorin C region in EBA-140 ligand binding. Moreover, the EBA-140 Region II did not bind either to glycophorin D, the truncated form of glycophorin C lacking the N-glycan or to desialylated GPC. These results draw attention to the role of glycophorin C glycans in EBA-140 binding. The full identification of the EBA-140 binding site on glycophorin C molecule, consisting most likely of its glycans and peptide backbone, may help to design therapeutics or vaccines that target the erythrocyte binding merozoite ligands. PMID:25588042

CDC-48/p97 coordinates CDT-1 degradation with GINS chromatin dissociation to ensure faithful DNA replication.

PubMed

Franz, André; Orth, Michael; Pirson, Paul A; Sonneville, Remi; Blow, J Julian; Gartner, Anton; Stemmann, Olaf; Hoppe, Thorsten

2011-10-07

Faithful transmission of genomic information requires tight spatiotemporal regulation of DNA replication factors. In the licensing step of DNA replication, CDT-1 is loaded onto chromatin to subsequently promote the recruitment of additional replication factors, including CDC-45 and GINS. During the elongation step, the CDC-45/GINS complex moves with the replication fork; however, it is largely unknown how its chromatin association is regulated. Here, we show that the chaperone-like ATPase CDC-48/p97 coordinates degradation of CDT-1 with release of the CDC-45/GINS complex. C. elegans embryos lacking CDC-48 or its cofactors UFD-1/NPL-4 accumulate CDT-1 on mitotic chromatin, indicating a critical role of CDC-48 in CDT-1 turnover. Strikingly, CDC-48(UFD-1/NPL-4)-deficient embryos show persistent chromatin association of CDC-45/GINS, which is a consequence of CDT-1 stabilization. Moreover, our data confirmed a similar regulation in Xenopus egg extracts, emphasizing a conserved coordination of licensing and elongation events during eukaryotic DNA replication by CDC-48/p97. Copyright © 2011 Elsevier Inc. All rights reserved.

Development of a subunit vaccine for infectious pancreatic necrosis virus using a baculovirus insect/larvae system

USGS Publications Warehouse

Shivappa, R.B.; McAllister, P.E.; Edwards, G.H.; Santi, N.; Evensen, O.; Vakharia, V.N.; ,

2005-01-01

Various attempts to develop a vaccine against infectious pancreatic necrosis virus (IPNV) have not yielded consistent results. Thus, at present, no commercial vaccine is available that can be used with confidence to immunize fry of salmon and trout. We generated a cDNA clone of the large genome segment A of an IPNV Sp strain and expressed all structural protein genes in insect cells and larvae using a baculovirus expression system. Green fluorescent protein was also co-expressed as a reporter molecule. High yields of IPNV proteins were obtained and the structural proteins self assembled to form virus-like particles (VLPs). We tested the immunogenicity of the putative VLP antigen in immersion vaccine experiments (two concentrations) in rainbow trout (Oncorhynchus mykiss) fry, and by intraperitoneal immunisation of Atlantic salmon (Salmo salar) pre-smolts using an oil adjuvant formulation. Rainbow trout were challenged by immersion using either the Sp or the VR-299 strain of IPNV two or three weeks post-vaccination, while Atlantic salmon were bath challenged with Sp strain after two months, after parr-smolt transformation. In the rainbow trout fry challenged two weeks post-immunization, cumulative mortality rates three weeks post challenge were 14 % in the fry that had received the highest dose versus 8 % in the control groups. No indication of protection was seen in repeated trials using a lower dose of antigen and challenge three weeks post-immunisation. The cumulative mortality rate of intraperitoneally immunised Atlantic salmon post-smolts four weeks post challenge was lower (56 %) than in the control fish (77 %), showing a dose-response pattern.

A P-Norm Robust Feature Extraction Method for Identifying Differentially Expressed Genes

PubMed Central

Liu, Jian; Liu, Jin-Xing; Gao, Ying-Lian; Kong, Xiang-Zhen; Wang, Xue-Song; Wang, Dong

2015-01-01

In current molecular biology, it becomes more and more important to identify differentially expressed genes closely correlated with a key biological process from gene expression data. In this paper, based on the Schatten p-norm and Lp-norm, a novel p-norm robust feature extraction method is proposed to identify the differentially expressed genes. In our method, the Schatten p-norm is used as the regularization function to obtain a low-rank matrix and the Lp-norm is taken as the error function to improve the robustness to outliers in the gene expression data. The results on simulation data show that our method can obtain higher identification accuracies than the competitive methods. Numerous experiments on real gene expression data sets demonstrate that our method can identify more differentially expressed genes than the others. Moreover, we confirmed that the identified genes are closely correlated with the corresponding gene expression data. PMID:26201006

A P-Norm Robust Feature Extraction Method for Identifying Differentially Expressed Genes.

PubMed

Liu, Jian; Liu, Jin-Xing; Gao, Ying-Lian; Kong, Xiang-Zhen; Wang, Xue-Song; Wang, Dong

2015-01-01

In current molecular biology, it becomes more and more important to identify differentially expressed genes closely correlated with a key biological process from gene expression data. In this paper, based on the Schatten p-norm and Lp-norm, a novel p-norm robust feature extraction method is proposed to identify the differentially expressed genes. In our method, the Schatten p-norm is used as the regularization function to obtain a low-rank matrix and the Lp-norm is taken as the error function to improve the robustness to outliers in the gene expression data. The results on simulation data show that our method can obtain higher identification accuracies than the competitive methods. Numerous experiments on real gene expression data sets demonstrate that our method can identify more differentially expressed genes than the others. Moreover, we confirmed that the identified genes are closely correlated with the corresponding gene expression data.

Protection of chickens from Newcastle disease with a recombinant baculovirus subunit vaccine expressing the fusion and hemagglutinin-neuraminidase proteins

PubMed Central

Lee, Youn-Jeong; Sung, Haan-Woo; Choi, Jun-Gu; Lee, Eun-Kyoung; Yoon, Hachung; Kim, Jae-Hong

2008-01-01

Recombinant baculoviruses containing the fusion (F) and hemagglutinin-neuraminidase (HN) glycoprotein gene of the viscerotropic velogenic (vv) Newcastle disease virus (NDV) isolate, Kr-005/00, and a lentogenic La Sota strain of the NDV were constructed in an attempt to develop an effective subunit vaccine to the recent epizootic vvNDV. The level of protection was determined by evaluating the clinical signs, mortality, and virus shedding from the oropharynx and cloaca of chickens after a challenge with vvNDV Kr-005/00. The recombinant ND F (rND F) and recombinant HN (rND HN) glycoproteins derived from the velogenic strain provided good protection against the clinical signs and mortality, showing a 0.00 PI value and 100% protection after a booster immunization. On the other hand, the combined rND F + HN glycoprotein derived from the velogenic strain induced complete protection (0.00 PI value and 100% protection) and significantly reduced the amount of virus shedding even after a single immunization. The rND F and rND HN glycoproteins derived from the velogenic strain had a slightly, but not significantly, greater protective effect than the lentogenic strain. These results suggest that the combined rND F + HN glycoprotein derived from vvNDV can be an ideal subunit marker vaccine candidate in chickens in a future ND eradication program. PMID:18716451

Identification and expression profile of multiple genes in response to magnesium exposure in Culex quinquefasciatus larvae.

USDA-ARS?s Scientific Manuscript database

Magnesium is crucial for baculovirus transmission in Culex nigripalpus (Theobald) and Cx. quinquefasciatus (Say) larvae, both in the field and in the laboratory. However, the mechanistic role of magnesium in baculovirus transmission is unknown. To investigate the possible role of a host response fac...

The p16INK4alpha/p19ARF gene mutations are infrequent and are mutually exclusive to p53 mutations in Indian oral squamous cell carcinomas.

PubMed

Kannan, K; Munirajan, A K; Krishnamurthy, J; Bhuvarahamurthy, V; Mohanprasad, B K; Panishankar, K H; Tsuchida, N; Shanmugam, G

2000-03-01

Eighty-seven untreated primary oral squamous cell carcinomas (SCCs) associated with betel quid and tobacco chewing from Indian patients were analysed for the presence of mutations in the commonly shared exon 2 of p16INK4alpha/p19ARF genes. Polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) and sequencing analysis were used to detect mutations. SSCP analysis indicated that only 9% (8/87) of the tumours had mutation in p16INK4alpha/p19ARF genes. Seventy-two tumours studied here were previously analysed for p53 mutations and 21% (15/72) of them were found to have mutations in p53 gene. Only one tumour was found to have mutation at both p53 and p16INK4alpha/p19ARF genes. Thus, the mutation rates observed were 21% for p53, 9% for p16INK4alpha/p19ARF, and 1% for both. Sequencing analysis revealed two types of mutations; i) G to C (GCAG to CCAG) transversion type mutation at intron 1-exon 2 splice junction and ii) another C to T transition type mutation resulting in CGA to TGA changing arginine to a termination codon at p16INK4alpha gene codon 80 and the same mutation will alter codon 94 of p19ARF gene from CCG to CTG (proline to leucine). These results suggest that p16INK4alpha/p19ARF mutations are less frequent than p53 mutations in Indian oral SCCs. The p53 and p16INK4alpha/p19ARF mutational events are independent and are mutually exclusive suggesting that mutational inactivation of either p53 or p16INK4alpha/p19ARF may alleviate the need for the inactivation of the other gene.

Identifying candidate genes for 2p15p16.1 microdeletion syndrome using clinical, genomic, and functional analysis

PubMed Central

Bagheri, Hani; Badduke, Chansonette; Qiao, Ying; Colnaghi, Rita; Abramowicz, Iga; Alcantara, Diana; Dunham, Christopher; Wen, Jiadi; Wildin, Robert S.; Nowaczyk, Malgorzata J.M.; Eichmeyer, Jennifer; Lehman, Anna; Maranda, Bruno; Martell, Sally; Shan, Xianghong; Lewis, Suzanne M.E.; O’Driscoll, Mark; Gregory-Evans, Cheryl Y.

2016-01-01

The 2p15p16.1 microdeletion syndrome has a core phenotype consisting of intellectual disability, microcephaly, hypotonia, delayed growth, common craniofacial features, and digital anomalies. So far, more than 20 cases of 2p15p16.1 microdeletion syndrome have been reported in the literature; however, the size of the deletions and their breakpoints vary, making it difficult to identify the candidate genes. Recent reports pointed to 4 genes (XPO1, USP34, BCL11A, and REL) that were included, alone or in combination, in the smallest deletions causing the syndrome. Here, we describe 8 new patients with the 2p15p16.1 deletion and review all published cases to date. We demonstrate functional deficits for the above 4 candidate genes using patients’ lymphoblast cell lines (LCLs) and knockdown of their orthologs in zebrafish. All genes were dosage sensitive on the basis of reduced protein expression in LCLs. In addition, deletion of XPO1, a nuclear exporter, cosegregated with nuclear accumulation of one of its cargo molecules (rpS5) in patients’ LCLs. Other pathways associated with these genes (e.g., NF-κB and Wnt signaling as well as the DNA damage response) were not impaired in patients’ LCLs. Knockdown of xpo1a, rel, bcl11aa, and bcl11ab resulted in abnormal zebrafish embryonic development including microcephaly, dysmorphic body, hindered growth, and small fins as well as structural brain abnormalities. Our multifaceted analysis strongly implicates XPO1, REL, and BCL11A as candidate genes for 2p15p16.1 microdeletion syndrome. PMID:27699255

A method to facilitate and monitor expression of exogenous genes in the rat kidney using plasmid and viral vectors

PubMed Central

Corridon, Peter R.; Rhodes, George J.; Leonard, Ellen C.; Basile, David P.; Gattone, Vincent H.; Bacallao, Robert L.

2013-01-01

Gene therapy has been proposed as a novel alternative to treat kidney disease. This goal has been hindered by the inability to reliably deliver transgenes to target cells throughout the kidney, while minimizing injury. Since hydrodynamic forces have previously shown promising results, we optimized this approach and designed a method that utilizes retrograde renal vein injections to facilitate transgene expression in rat kidneys. We show, using intravital fluorescence two-photon microscopy, that fluorescent albumin and dextrans injected into the renal vein under defined conditions of hydrodynamic pressure distribute broadly throughout the kidney in live animals. We found injection parameters that result in no kidney injury as determined by intravital microscopy, histology, and serum creatinine measurements. Plasmids, baculovirus, and adenovirus vectors, designed to express EGFP, EGFP-actin, EGFP-occludin, EGFP-tubulin, tdTomato-H2B, or RFP-actin fusion proteins, were introduced into live kidneys in a similar fashion. Gene expression was then observed in live and ex vivo kidneys using two-photon imaging and confocal laser scanning microscopy. We recorded widespread fluorescent protein expression lasting more than 1 mo after introduction of transgenes. Plasmid and adenovirus vectors provided gene transfer efficiencies ranging from 50 to 90%, compared with 10–50% using baculovirus. Using plasmids and adenovirus, fluorescent protein expression was observed 1) in proximal and distal tubule epithelial cells; 2) within glomeruli; and 3) within the peritubular interstitium. In isolated kidneys, fluorescent protein expression was observed from the cortex to the papilla. These results provide a robust approach for gene delivery and the study of protein function in live mammal kidneys. PMID:23467422

Genetic diversity of three surface protein genes in Plasmodium malariae from three Asian countries.

PubMed

Srisutham, Suttipat; Saralamba, Naowarat; Sriprawat, Kanlaya; Mayxay, Mayfong; Smithuis, Frank; Nosten, Francois; Pukrittayakamee, Sasithon; Day, Nicholas P J; Dondorp, Arjen M; Imwong, Mallika

2018-01-11

Genetic diversity of the three important antigenic proteins, namely thrombospondin-related anonymous protein (TRAP), apical membrane antigen 1 (AMA1), and 6-cysteine protein (P48/45), all of which are found in various developmental stages of Plasmodium parasites is crucial for targeted vaccine development. While studies related to the genetic diversity of these proteins are available for Plasmodium falciparum and Plasmodium vivax, barely enough information exists regarding Plasmodium malariae. The present study aims to demonstrate the genetic variations existing among these three genes in P. malariae by analysing their diversity at nucleotide and protein levels. Three surface protein genes were isolated from 45 samples collected in Thailand (N = 33), Myanmar (N = 8), and Lao PDR (N = 4), using conventional polymerase chain reaction (PCR) assay. Then, the PCR products were sequenced and analysed using BioEdit, MEGA6, and DnaSP programs. The average pairwise nucleotide diversities (π) of P. malariae trap, ama1, and p48/45 were 0.00169, 0.00413, and 0.00029, respectively. The haplotype diversities (Hd) of P. malariae trap, ama1, and p48/45 were 0.919, 0.946, and 0.130, respectively. Most of the nucleotide substitutions were non-synonymous, which indicated that the genetic variations of these genes were maintained by positive diversifying selection, thus, suggesting their role as a potential target of protective immune response. Amino acid substitutions of P. malariae TRAP, AMA1, and P48/45 could be categorized to 17, 20, and 2 unique amino-acid variants, respectively. For further vaccine development, carboxyl terminal of P48/45 would be a good candidate according to conserved amino acid at low genetic diversity (π = 0.2-0.3). High mutational diversity was observed in P. malariae trap and ama1 as compared to p48/45 in P. malariae samples isolated from Thailand, Myanmar, and Lao PDR. Taken together, these results suggest that P48/45 might be a good vaccine

The maternal genes Ci-p53/p73-a and Ci-p53/p73-b regulate zygotic ZicL expression and notochord differentiation in Ciona intestinalis embryos.

PubMed

Noda, Takeshi

2011-12-01

I isolated a Ciona intestinalis homolog of p53, Ci-p53/p73-a, in a microarray screen of rapidly degraded maternal mRNA by comparing the transcriptomes of unfertilized eggs and 32-cell stage embryos. Higher expression of the gene in eggs and lower expression in later embryonic stages were confirmed by whole-mount in situ hybridization (WISH) and quantitative reverse transcription-PCR (qRT-PCR); expression was ubiquitous in eggs and early embryos. Knockdown of Ci-p53/p73-a by injection of antisense morpholino oligonucleotides (MOs) severely perturbed gastrulation cell movements and expression of notochord marker genes. A key regulator of notochord differentiation in Ciona embryos is Brachyury (Ci-Bra), which is directly activated by a zic-like gene (Ci-ZicL). The expression of Ci-ZicL and Ci-Bra in A-line notochord precursors was downregulated in Ci-p53/p73-a knockdown embryos. Maternal expression of Ci-p53/p73-b, a homolog of Ci-p53/p73-a, was also detected. In Ci-p53/p73-b knockdown embryos, gastrulation cell movements, expression of Ci-ZicL and Ci-Bra in A-line notochord precursors, and expression of notochord marker gene at later stages were perturbed. The upstream region of Ci-ZicL contains putative p53-binding sites. Cis-regulatory analysis of Ci-ZicL showed that these sites are involved in expression of Ci-ZicL in A-line notochord precursors at the 32-cell and early gastrula stages. These results suggest that p53 genes are maternal factors that play a crucial role in A-line notochord differentiation in C. intestinalis embryos by regulating Ci-ZicL expression. Copyright © 2011 Elsevier Inc. All rights reserved.

A mutation of the p63 gene in non‐syndromic cleft lip

PubMed Central

Leoyklang, P; Siriwan, P; Shotelersuk, V

2006-01-01

Mutations in the p63 gene (TP63) underlie several monogenic malformation syndromes manifesting cleft lip with or without cleft palate (CL/P). We investigated whether p63 mutations also result in non‐syndromic CL/P. Specifically, we performed mutation analysis of the 16 exons of the p63 gene for 100 Thai patients with non‐syndromic CL/P. In total, 21 variant sites were identified. All were single nucleotide changes, with six in coding regions, including three novel non‐synonymous changes: S90L, R313G, and D564H. The R313G was concluded to be pathogenic on the basis of its amino acid change, evolutionary conservation, its occurrence in a functionally important domain, its predicted damaging function, its de novo occurrence, and its absence in 500 control individuals. Our data strongly suggest, for the first time, a causative role of a heterozygous mutation in the p63 gene in non‐syndromic CL/P, highlighting the wide phenotypic spectrum of p63 gene mutations. PMID:16740912

Tissue-specific expression of silkmoth chorion genes in vivo using Bombyx mori nuclear polyhedrosis virus as a transducing vector.

PubMed Central

Iatrou, K; Meidinger, R G

1990-01-01

A pair of silkmoth chorion chromosomal genes, HcA.12-HcB.12, was inserted into a baculovirus transfer vector, pBmp2, derived from the nuclear polyhedrosis virus of Bombyx mori. This vector, which permits the insertion of foreign genetic material in the vicinity of a mutationally inactivated polyhedrin gene, was used to acquire the corresponding recombinant virus. Injection of mutant silkmoth pupae that lack all Hc chorion genes with the recombinant virus resulted in the infection of all internal organs including follicular tissue. Analysis of RNA from infected tissues has demonstrated that the two chorion genes present in the viral genome are correctly transcribed under the control of their own promoter in follicular cells, the tissue in which chorion genes are normally expressed. The chorion primary transcripts are also correctly processed in the infected follicular cells and yield mature mRNAs indistinguishable from authentic chorion mRNAs present in wild-type follicles. These results demonstrate that recombinant nuclear polyhedrosis viruses can be used as transducing vectors for introducing genetic material of host origin into the cells of the organism and that the transduced genes are transiently expressed in a tissue-specific manner under the control of their resident regulatory sequences. Thus we show the in vivo expression of cloned genes under cellular promoter control in an insect other than Drosophila melanogaster. The approach should be applicable to all insect systems that are subject to nuclear polyhedrosis virus infection. Images PMID:2187186

Convergent Loss of ABC Transporter Genes From Clostridioides difficile Genomes Is Associated With Impaired Tyrosine Uptake and p-Cresol Production.

PubMed

Steglich, Matthias; Hofmann, Julia D; Helmecke, Julia; Sikorski, Johannes; Spröer, Cathrin; Riedel, Thomas; Bunk, Boyke; Overmann, Jörg; Neumann-Schaal, Meina; Nübel, Ulrich

2018-01-01

We report the frequent, convergent loss of two genes encoding the substrate-binding protein and the ATP-binding protein of an ATP-binding cassette (ABC) transporter from the genomes of unrelated Clostridioides difficile strains. This specific genomic deletion was strongly associated with the reduced uptake of tyrosine and phenylalanine and production of derived Stickland fermentation products, including p -cresol, suggesting that the affected ABC transporter had been responsible for the import of aromatic amino acids. In contrast, the transporter gene loss did not measurably affect bacterial growth or production of enterotoxins. Phylogenomic analysis of publically available genome sequences indicated that this transporter gene deletion had occurred multiple times in diverse clonal lineages of C. difficile , with a particularly high prevalence in ribotype 027 isolates, where 48 of 195 genomes (25%) were affected. The transporter gene deletion likely was facilitated by the repetitive structure of its genomic location. While at least some of the observed transporter gene deletions are likely to have occurred during the natural life cycle of C. difficile , we also provide evidence for the emergence of this mutation during long-term laboratory cultivation of reference strain R20291.

Convergent Loss of ABC Transporter Genes From Clostridioides difficile Genomes Is Associated With Impaired Tyrosine Uptake and p-Cresol Production

PubMed Central

Steglich, Matthias; Hofmann, Julia D.; Helmecke, Julia; Sikorski, Johannes; Spröer, Cathrin; Riedel, Thomas; Bunk, Boyke; Overmann, Jörg; Neumann-Schaal, Meina; Nübel, Ulrich

2018-01-01

We report the frequent, convergent loss of two genes encoding the substrate-binding protein and the ATP-binding protein of an ATP-binding cassette (ABC) transporter from the genomes of unrelated Clostridioides difficile strains. This specific genomic deletion was strongly associated with the reduced uptake of tyrosine and phenylalanine and production of derived Stickland fermentation products, including p-cresol, suggesting that the affected ABC transporter had been responsible for the import of aromatic amino acids. In contrast, the transporter gene loss did not measurably affect bacterial growth or production of enterotoxins. Phylogenomic analysis of publically available genome sequences indicated that this transporter gene deletion had occurred multiple times in diverse clonal lineages of C. difficile, with a particularly high prevalence in ribotype 027 isolates, where 48 of 195 genomes (25%) were affected. The transporter gene deletion likely was facilitated by the repetitive structure of its genomic location. While at least some of the observed transporter gene deletions are likely to have occurred during the natural life cycle of C. difficile, we also provide evidence for the emergence of this mutation during long-term laboratory cultivation of reference strain R20291. PMID:29867812

p53 as the focus of gene therapy: past, present and future.

PubMed

Valente, Joana Fa; Queiroz, Joao A; Sousa, Fani

2018-01-15

Several gene deviations can be responsible for triggering oncogenic processes. However, mutations in tumour suppressor genes are usually more associated to malignant diseases, being p53 one of the most affected and studied element. p53 is implicated in a number of known cellular functions, including DNA damage repair, cell cycle arrest in G1/S and G2/M and apoptosis, being an interesting target for cancer treatment. Considering these facts, the development of gene therapy approaches focused on p53 expression and regulation seems to be a promising strategy for cancer therapy. Several studies have shown that transfection of cancer cells with wild-type p53 expressing plasmids could directly drive cells into apoptosis and/or growth arrest, suggesting that a gene therapy approach for cancer treatment can be based on the re-establishment of the normal p53 expression levels and function. Up until now, several clinical research studies using viral and non-viral vectors delivering p53 genes, isolated or combined with other therapeutic agents, have been accomplished and there are already in the market therapies based on the use of this gene. This review summarizes the different methods used to deliver and/or target the p53 as well as the main results of therapeutic effect obtained with the different strategies applied. Finally, the ongoing approaches are described, also focusing the combinatorial therapeutics to show the increased therapeutic potential of combining gene therapy vectors with chemo or radiotherapy. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

An inversion inv(4)(p12-p15.3) in autistic siblings implicates the 4p GABA receptor gene cluster.

PubMed

Vincent, J B; Horike, S I; Choufani, S; Paterson, A D; Roberts, W; Szatmari, P; Weksberg, R; Fernandez, B; Scherer, S W

2006-05-01

We describe the case of two brothers diagnosed with autism who both carry a paracentic inversion of the short arm of chromosome 4 (46,XY, inv(4)(p12-p15.3)). We have determined that this inversion is inherited from an apparently unaffected mother and unaffected maternal grandfather. Methods/ Using fluorescence in situ hybridisation analysis and Southern blot hybridisation we identified the breakpoints. The proximal breakpoint (4p12) maps to a region containing a cluster of gamma-aminobutyric acid A (GABA(A)) receptor genes, and directly interrupts the GABRG1 gene, the distal-most gene of the cluster. We also identified an insertion/deletion polymorphism for a approximately 2 kb LINE1 (L1) element that occurs within intron 7 of GABRG1. Our genotype analysis amongst autism families indicated that the L1 deletion allele did not show increased transmission to affected individuals. No linkage disequilibrium was evident between the L1 and single nucleotide polymorphisms in adjacent GABA(A) receptor genes on 4p, where a recent study has identified significant association with autism. Despite this, the identification of an inversion breakpoint disrupting GABRG1 provides solid support for the genetic involvement of the short arm of chromosome 4 in the genetic aetiology of autism, and for the hypothesis of disrupted GABA neurotransmission in autism.

Phenotypic Variation in Overwinter Environmental Transmission of a Baculovirus and the Cost of Virulence.

PubMed

Fleming-Davies, Arietta E; Dwyer, Greg

2015-12-01

A pathogen's ability to persist in the environment is an ecologically important trait, and variation in this trait may promote coexistence of different pathogen strains. We asked whether naturally occurring isolates of the baculovirus that infects gypsy moth larvae varied in their overwinter environmental transmission and whether this variation was consistent with a trade-off or an upper limit to virulence that might promote pathogen diversity. We used experimental manipulations to replicate the natural overwinter infection process, using 16 field-collected isolates. Virus isolates varied substantially in the fraction of larvae infected, leading to differences in overwinter transmission rates. Furthermore, isolates that killed more larvae also had higher rates of early larval death in which no infectious particles were produced, consistent with a cost of high virulence. Our results thus support the existence of a cost that could impose an upper limit to virulence even in a highly virulent pathogen.

Methylation of CpG island of p14(ARK), p15(INK4b) and p16(INK4a) genes in coke oven workers.

PubMed

Zhang, H; Li, X; Ge, L; Yang, J; Sun, J; Niu, Q

2015-02-01

To detect the blood genomic DNA methylation in coke oven workers and find a possible early screening index for occupational lung cancer, 74 coke oven workers as the exposed group and 47 water pump workers as the controls were surveyed, and urine samples and peripheral blood mononuclear cells (PBMCs) were collected. Airborne benzo[a]pyrene (B[a]P) levels in workplace and urinary 1-hydroxypyrene (1-OH-Py) levels were determined by high-performance liquid chromatography. DNA damage of PBMCs and the p14(ARK), p15(INK4b) and p16(INK4a) gene CpG island methylation in the promoter region were detected by comet assay and methylation-specific polymerase chain reaction techniques, respectively. Results show that compared with the controls, concentration of airborne B[a]Ps was elevated in the coke plant, and urinary 1-OH-Py's level and DNA olive tail moment in comet assay were significantly increased in the coke oven workers, and p14(ARK), p15(INK4b) and p16(INK4a) gene methylation rates were also significantly increased. With the working years and urinary 1-OH-Py's level, the rates of p14(ARK) and p16(INK4a) gene methylation were significantly increased while that of p15(INK4b) gene methylation displayed no statistical change. We conclude that PBMCs' p14(ARK) and p16(INK4a) gene methylation may be used for screening and warning lung cancer in coke oven workers. © The Author(s) 2015.

Heterologous expression of the Pleurotus ostreatus MnP3 gene by the laccase gene promoter in Lentinula edodes.

PubMed

Sato, Toshitsugu; Irie, Toshikazu; Yoshino, Fumihiko

2017-08-01

Lentinula edodes (shiitake), which have a powerful ligninolytic system, is one of the most important edible mushrooms in Asia. In this study, we introduced the manganese peroxidase (MnP, EC 1.11.1.13) gene from Pleurotus ostreatus driven by L. edodes laccase 1 gene promoter into L. edodes for expression. The resulting transformant expressed the recombinant gene and showed a higher level of MnP activity than that of the wild-type strain.

Ultraviolet B radiation induces impaired lifecycle traits and modulates expression of cytochrome P450 (CYP) genes in the copepod Tigriopus japonicus.

PubMed

Puthumana, Jayesh; Lee, Min-Chul; Park, Jun Chul; Kim, Hui-Su; Hwang, Dae-Sik; Han, Jeonghoon; Lee, Jae-Seong

2017-03-01

To evaluate the effects of ultraviolet B (UV-B) radiation at the developmental, reproductive, and molecular levels in aquatic invertebrates, we measured UV-B-induced acute toxicity, impairments in developmental and reproductive traits, and UV-B interaction with the entire family of cytochrome P450 (CYP) genes in the intertidal benthic copepod Tigriopus japonicus. We found a significant, dose-dependent reduction (P<0.05) in the survival of T. japonicus that began as a developmental delay and decreased fecundity. The 48h LD10 and LD50 were 1.35 and 1.84kJ/m 2 , and the CYP inhibitor (PBO) elevated mortality, confirming the involvement of CYP genes in UV-B induced toxicity. Low-dose UV-B (1.5kJ/m 2 ) induced developmental delays, and higher doses (6-18kJ/m 2 ) caused reproductive impairments in ovigerous females. The significant up-regulation of CYP genes belonging to clans 2/3/MT/4/20 in T. japonicus exposed to UV-B (12kJ/m 2 ) confirmed molecular interaction between UV-B and CYP genes. Moreover, orphan CYPs, such as CYP20A1, provide good insight on the deorphanization of invertebrate CYPs. Overall, these results demonstrate the involvement of UV-B radiation in the expression of all the CYP genes in T. japonicus and their susceptibility to UV-B radiation. This will provide a better understanding of the mechanistic effects of UV-B in copepods through the predicted AhR-mediated up-regulation of CYP genes. Copyright © 2017 Elsevier B.V. All rights reserved.

[p16 and MGMT gene methylation in sputum cells of uranium workers].

PubMed

Su, Shi-biao; Yang, Lu-jing; Zhang, Wei; Jin, Ya-li; Nie, Ji-hua; Tong, Jian

2006-02-01

To study the methylation of O-6-methylguanine-DNA methyltransferase (MGMT) and p16 gene in the sputum cells of radon-exposed population. To provide the experimental base for finding the molecular biomarker of the high risk population of the radon-induced lung cancer. 91 radon-exposed workers were divided into 4 groups, high dosage group (> 120 WLM), middle dosage group (between 60 and 120 WLM), low dosage group (between 30 and 60 WLB) and lower dosage group (between 2 and 30 WLM) according to the accumulated exposure dosage of the radon daughters. The abnormal methylation of p16 and MGMT gene in the sputum cells of the population in the four groups was detected with the methylation specific PCR (MSP). There was significantly upward trend for the p16 gene methylation rate (0.00%-20.00%), the MGMT gene methylation rate (0.00%-28.00%) and the total methylation rate (0.00%-40.00%) with the increase of the accumulated exposure dosage of the radon daughters (P < 0.01). The methylation of p16 and MGMT gene is related to the accumulate exposure dosage of the radon daughters.

Stimulation of autophagy by the p53 target gene Sestrin2.

PubMed

Maiuri, Maria Chiara; Malik, Shoaib Ahmad; Morselli, Eugenia; Kepp, Oliver; Criollo, Alfredo; Mouchel, Pierre-Luc; Carnuccio, Rosa; Kroemer, Guido

2009-05-15

The oncosuppressor protein p53 regulates autophagy in a dual fashion. The pool of cytoplasmic p53 protein represses autophagy in a transcription-independent fashion, while the pool of nuclear p53 stimulates autophagy through the transactivation of specific genes. Here we report the discovery that Sestrin2, a novel p53 target gene, is involved in the induction of autophagy. Depletion of Sestrin2 by RNA interference reduced the level of autophagy in a panel of p53-sufficient human cancer cell lines responding to distinct autophagy inducers. In quantitative terms, Sestrin2 depletion was as efficient in preventing autophagy induction as was the depletion of Dram, another p53 target gene. Knockout of either Sestrin2 or Dram reduced autophagy elicited by nutrient depletion, rapamycin, lithium or thapsigargin. Moreover, autophagy induction by nutrient depletion or pharmacological stimuli led to an increase in Sestrin2 expression levels in p53-proficient cells. In strict contrast, the depletion of Sestrin2 or Dram failed to affect autophagy in p53-deficient cells and did not modulate the inhibition of baseline autophagy by a cytoplasmic p53 mutant that was reintroduced into p53-deficient cells. We conclude that Sestrin2 acts as a positive regulator of autophagy in p53-proficient cells.

Mitochondrial-related gene expression changes are sensitive to agonal-pH state: implications for brain disorders

PubMed Central

Vawter, MP; Tomita, H; Meng, F; Bolstad, B; Li, J; Evans, S; Choudary, P; Atz, M; Shao, L; Neal, C; Walsh, DM; Burmeister, M; Speed, T; Myers, R; Jones, EG; Watson, SJ; Akil, H; Bunney, WE

2010-01-01

Mitochondrial defects in gene expression have been implicated in the pathophysiology of bipolar disorder and schizophrenia. We have now contrasted control brains with low pH versus high pH and showed that 28% of genes in mitochondrial-related pathways meet criteria for differential expression. A majority of genes in the mitochondrial, chaperone and proteasome pathways of nuclear DNA-encoded gene expression were decreased with decreased brain pH, whereas a majority of genes in the apoptotic and reactive oxygen stress pathways showed an increased gene expression with a decreased brain pH. There was a significant increase in mitochondrial DNA copy number and mitochondrial DNA gene expression with increased agonal duration. To minimize effects of agonal-pH state on mood disorder comparisons, two classic approaches were used, removing all subjects with low pH and agonal factors from analysis, or grouping low and high pH as a separate variable. Three groups of potential candidate genes emerged that may be mood disorder related: (a) genes that showed no sensitivity to pH but were differentially expressed in bipolar disorder or major depressive disorder; (b) genes that were altered by agonal-pH in one direction but altered in mood disorder in the opposite direction to agonal-pH and (c) genes with agonal-pH sensitivity that displayed the same direction of changes in mood disorder. Genes from these categories such as NR4A1 and HSPA2 were confirmed with Q-PCR. The interpretation of postmortem brain studies involving broad mitochondrial gene expression and related pathway alterations must be monitored against the strong effect of agonal-pH state. Genes with the least sensitivity to agonal-pH could present a starting point for candidate gene search in neuropsychiatric disorders. PMID:16636682

A Novel Vaccine Approach for Chagas Disease Using Rare Adenovirus Serotype 48 Vectors

PubMed Central

Farrow, Anitra L.; Peng, Binghao J.; Gu, Linlin; Krendelchtchikov, Alexandre; Matthews, Qiana L.

2016-01-01

Due to the increasing amount of people afflicted worldwide with Chagas disease and an increasing prevalence in the United States, there is a greater need to develop a safe and effective vaccine for this neglected disease. Adenovirus serotype 5 (Ad5) is the most common adenovirus vector used for gene therapy and vaccine approaches, but its efficacy is limited by preexisting vector immunity in humans resulting from natural infections. Therefore, we have employed rare serotype adenovirus 48 (Ad48) as an alternative choice for adenovirus/Chagas vaccine therapy. In this study, we modified Ad5 and Ad48 vectors to contain T. cruzi’s amastigote surface protein 2 (ASP-2) in the adenoviral early gene. We also modified Ad5 and Ad48 vectors to utilize the “Antigen Capsid-Incorporation” strategy by adding T. cruzi epitopes to protein IX (pIX). Mice that were immunized with the modified vectors were able to elicit T. cruzi-specific humoral and cellular responses. This study indicates that Ad48-modified vectors function comparable to or even premium to Ad5-modified vectors. This study provides novel data demonstrating that Ad48 can be used as a potential adenovirus vaccine vector against Chagas disease. PMID:26978385

P53 Gene Mutagenesis in Breast Cancer

DTIC Science & Technology

2005-03-01

the wild type T peak. 12 Table 1. Sonic ntations dected by SINtA Individual Cell Sequence Amino Acid Species Conservation 3 ID’ ID Change2 Change... differences in the content of toxic substances in the diet (Biggs et al., 1993; Blaszyk et al., 1996). The development of this p53 mutation load...Changes in the P53 Gene in Single Cells Individual Sequence Amino acid Species conservation ’ ID’ Cell ID change’ change Monkey Mouse Rat Chicken

Analysis of the Genome of the Sexually Transmitted Insect Virus Helicoverpa zea Nudivirus 2

PubMed Central

Burand, John P.; Kim, Woojin; Afonso, Claudio L.; Tulman, Edan R.; Kutish, Gerald F.; Lu, Zhiqiang; Rock, Daniel L.

2012-01-01

The sexually transmitted insect virus Helicoverpa zea nudivirus 2 (HzNV-2) was determined to have a circular double-stranded DNA genome of 231,621 bp coding for an estimated 113 open reading frames (ORFs). HzNV-2 is most closely related to the nudiviruses, a sister group of the insect baculoviruses. Several putative ORFs that share homology with the baculovirus core genes were identified in the viral genome. However, HzNV-2 lacks several key genetic features of baculoviruses including the late transcriptional regulation factor, LEF-1 and the palindromic hrs, which serve as origins of replication. The HzNV-2 genome was found to code for three ORFs that had significant sequence homology to cellular genes which are not generally found in viral genomes. These included a presumed juvenile hormone esterase gene, a gene coding for a putative zinc-dependent matrix metalloprotease, and a major facilitator superfamily protein gene; all of which are believed to play a role in the cellular proliferation and the tissue hypertrophy observed in the malformation of reproductive organs observed in HzNV-2 infected corn earworm moths, Helicoverpa zea. PMID:22355451

Analysis of the genome of the sexually transmitted insect virus Helicoverpa zea nudivirus 2.

PubMed

Burand, John P; Kim, Woojin; Afonso, Claudio L; Tulman, Edan R; Kutish, Gerald F; Lu, Zhiqiang; Rock, Daniel L

2012-01-01

The sexually transmitted insect virus Helicoverpa zea nudivirus 2 (HzNV-2) was determined to have a circular double-stranded DNA genome of 231,621 bp coding for an estimated 113 open reading frames (ORFs). HzNV-2 is most closely related to the nudiviruses, a sister group of the insect baculoviruses. Several putative ORFs that share homology with the baculovirus core genes were identified in the viral genome. However, HzNV-2 lacks several key genetic features of baculoviruses including the late transcriptional regulation factor, LEF-1 and the palindromic hrs, which serve as origins of replication. The HzNV-2 genome was found to code for three ORFs that had significant sequence homology to cellular genes which are not generally found in viral genomes. These included a presumed juvenile hormone esterase gene, a gene coding for a putative zinc-dependent matrix metalloprotease, and a major facilitator superfamily protein gene; all of which are believed to play a role in the cellular proliferation and the tissue hypertrophy observed in the malformation of reproductive organs observed in HzNV-2 infected corn earworm moths, Helicoverpa zea.

Novel Detection of Insecticide Resistance Related P450 Genes and Transcriptome Analysis of the Hemimetabolous Pest Erthesina fullo (Thunberg) (Hemiptera: Heteroptera).

PubMed

Liu, Yang; Wu, Haoyang; Xie, Qiang; Bu, Wenjun

2015-01-01

Erthesina fullo (Thunberg, 1783) is an economically important heteropteran species in China. Since only three nucleotide sequences of this species (COI, 16S rRNA, and 18S rRNA) appear in the GenBank database so far, no analysis of the molecular mechanisms underlying E. fullo's resistance to insecticide and environmental stress has been accomplished. We reported a de novo assembled and annotated transcriptome for adult E. fullo using the Illumina sequence system. A total of 53,359,458 clean reads of 4.8 billion nucleotides (nt) were assembled into 27,488 unigenes with an average length of 750 bp, of which 17,743 (64.55%) were annotated. In the present study, we identified 88 putative cytochrome P450 sequences and analyzed the evolution of cytochrome P450 superfamilies, genes of the CYP3 clan related to metabolizing xenobiotics and plant natural compounds, in E. fullo, increasing the candidate genes for the molecular mechanisms of insecticide resistance in P450. The sequenced transcriptome greatly expands the available genomic information and could allow a better understanding of the mechanisms of insecticide resistance at the systems biology level.

The 987P fimbrial gene cluster of enterotoxigenic Escherichia coli is plasmid encoded.

PubMed Central

Schifferli, D M; Beachey, E H; Taylor, R K

1990-01-01

A clone containing the 987P fimbrial gene cluster was selected from a cosmid library of total DNA of the prototype Escherichia coli strain 987 by using 987P-specific antiserum. A subclone of 12 kilobases containing all of the genes required for fimbrial expression on a nonfimbriated K-12 strain of E. coli and a DNA fragment internal to the fimbrial subunit gene were used to probe the prototype strain and various isolates of 987P-fimbriated enterotoxigenic E. coli. All strains had several plasmids, as shown by agarose gel electrophoresis, and each of five strains which expressed 987P fimbriae showed a plasmid of 35 to 40 megadaltons (MDa) hybridizing to both 987P-specific probes. Hybridization to restricted DNA of strain 987 supported a plasmid origin for the cloned 987P gene cluster. Moreover, an isogenic strain which had lost its 35-MDa plasmid was no longer capable of synthesizing fimbrial subunits, but regained fimbrial expression after reintroduction of the TnphoA (Tn5 IS50L::phoA)-tagged 35-MDa plasmid. Absence of fimbrial subunit synthesis in K-12 strains transformed with the 35-MDa plasmid alone suggested the requirement of regulatory elements existing in strain 987 but missing in K-12 strains. A probe for the heat-stable enterotoxin STIa hybridized in each of the 987P-fimbriated strains to the plasmid containing the 987P genes and in most of these strains to an additional plasmid which contained the gene for the heat-stable enterotoxin STII. Occurrence of the 987P and STIa genes on the same replicon correlates with epidemiological observations, STIa being the most prevalent toxin produced by 987P-fimbriated E. coli. Images PMID:1967167

Transcriptional analysis of the bglP gene from Streptococcus mutans.

PubMed

Cote, Christopher K; Honeyman, Allen L

2006-04-21

An open reading frame encoding a putative antiterminator protein, LicT, was identified in the genomic sequence of Streptococcus mutans. A potential ribonucleic antitermination (RAT) site to which the LicT protein would potentially bind has been identified immediately adjacent to this open reading frame. The licT gene and RAT site are both located 5' to a beta-glucoside PTS regulon previously described in S. mutans that is responsible for esculin utilization in the presence of glucose. It was hypothesized that antitermination is the regulatory mechanism that is responsible for the control of the bglP gene expression, which encodes an esculin-specific PTS enzyme II. To localize the promoter activity associated with the bglP locus, a series of transcriptional lacZ gene fusions was formed on a reporter shuttle vector using various DNA fragments from the bglP promoter region. Subsequent beta-galactosidase assays in S. mutans localized the bglP promoter region and identified putative -35 and -10 promoter elements. Primer extension analysis identified the bglP transcriptional start site. In addition, a terminated bglP transcript formed by transcriptional termination was identified via transcript mapping experiments. The physical location of these genetic elements, the RAT site and the promoter regions, and the identification of a short terminated mRNA support the hypothesis that antitermination regulates the bglP transcript.

Transcriptional analysis of the bglP gene from Streptococcus mutans

PubMed Central

Cote, Christopher K; Honeyman, Allen L

2006-01-01

Background An open reading frame encoding a putative antiterminator protein, LicT, was identified in the genomic sequence of Streptococcus mutans. A potential ribonucleic antitermination (RAT) site to which the LicT protein would potentially bind has been identified immediately adjacent to this open reading frame. The licT gene and RAT site are both located 5' to a beta-glucoside PTS regulon previously described in S. mutans that is responsible for esculin utilization in the presence of glucose. It was hypothesized that antitermination is the regulatory mechanism that is responsible for the control of the bglP gene expression, which encodes an esculin-specific PTS enzyme II. Results To localize the promoter activity associated with the bglP locus, a series of transcriptional lacZ gene fusions was formed on a reporter shuttle vector using various DNA fragments from the bglP promoter region. Subsequent beta-galactosidase assays in S. mutans localized the bglP promoter region and identified putative -35 and -10 promoter elements. Primer extension analysis identified the bglP transcriptional start site. In addition, a terminated bglP transcript formed by transcriptional termination was identified via transcript mapping experiments. Conclusion The physical location of these genetic elements, the RAT site and the promoter regions, and the identification of a short terminated mRNA support the hypothesis that antitermination regulates the bglP transcript. PMID:16630357

Nine co-localized cytochrome P450 genes of the CYP2N, CYP2AD, and CYP2P gene families in the mangrove killifish Kryptolebias marmoratus genome: Identification and expression in response to B[α]P, BPA, OP, and NP.

PubMed

Puthumana, Jayesh; Kim, Bo-Mi; Jeong, Chang-Bum; Kim, Duck-Hyun; Kang, Hye-Min; Jung, Jee-Hyun; Kim, Il-Chan; Hwang, Un-Ki; Lee, Jae-Seong

2017-06-01

The CYP2 genes are the largest and most diverse cytochrome P450 (CYP) subfamily in vertebrates. We have identified nine co-localized CYP2 genes (∼55kb) in a new cluster in the genome of the highly resilient ecotoxicological fish model Kryptolebias marmoratus. Molecular characterization, temporal and tissue-specific expression pattern, and response to xenobiotics of these genes were examined. The CYP2 gene clusters were characterized and designated CYP2N22-23, CYP2AD12, and CYP2P16-20. Gene synteny analysis confirmed that the cluster in K. marmoratus is similar to that found in other teleost fishes, including zebrafish. A gene duplication event with diverged catalytic function was observed in CYP2AD12. Moreover, a high level of divergence in expression was observed among the co-localized genes. Phylogeny of the cluster suggested an orthologous relationship with similar genes in zebrafish and Japanese medaka. Gene expression analysis showed that CYP2P19 and CYP2N20 were consecutively expressed throughout embryonic development, whereas CYP2P18 was expressed in all adult tissues, suggesting that members of each CYP2 gene family have different physiological roles even though they are located in the same cluster. Among endocrine-disrupting chemicals (EDCs), benzo[α]pyrene (B[α]P) induced expression of CYP2N23, bisphenol A (BPA) induced CYP2P18 and CYP2P19, and 4-octylphenol (OP) induced CYP2AD12, but there was no significant response to 4-nonylphenol (NP), implying differential catalytic roles of the enzyme. In this paper, we identify and characterize a CYP2 gene cluster in the mangrove killifish K. marmoratus with differing catalytic roles toward EDCs. Our findings provide insights on the roles of nine co-localized CYP2 genes and their catalytic functions for better understanding of chemical-biological interactions in fish. Copyright © 2017 Elsevier B.V. All rights reserved.

Antibacterial protection by enterocin AS-48 in sport and energy drinks with less acidic pH values.

PubMed

Viedma, Pilar Martinez; Abriouel, Hikmate; Ben Omar, Nabil; López, Rosario Lucas; Valdivia, Eva; Gálvez, Antonio

2009-04-01

The low pH and acid content found in sports and energy drinks are a matter of concern in dental health. Raising the pH may solve this problem, but at the same time increase the risks of spoilage or presence of pathogenic bacteria. In the present study, commercial energy drinks were adjusted to pH 5.0 and challenged with Listeria monocytogenes (drinks A to F), Staphylococcus aureus, Bacillus cereus, and Bacillus licheniformis (drink A) during storage at 37 degrees C. L. monocytogenes was able to grow in drink A and survived in drinks D and F for at least 2 days. Addition of enterocin AS-48 (1 microg/ml final concentration) rapidly inactivated L. monocytogenes in all drinks tested. S. aureus and B. cereus also survived quite well in drink A, and were completely inactivated by 12.5 microg/ml enterocin AS-48 after 2 days of storage or by 25 microg/ml bacteriocin after 1 day. B. licheniformis was able to multiply in drink A, but it was completely inactivated by 5 microg/ml enterocin AS-48 after 2 days of storage or by 12.5 microg/ml bacteriocin after 1 day. Results from the present study suggest that enterocin AS-48 could be used as a natural preservative against these target bacteria in less acidic sport and energy drinks.

Goose parvovirus structural proteins expressed by recombinant baculoviruses self-assemble into virus-like particles with strong immunogenicity in goose.

PubMed

Ju, Huanyu; Wei, Na; Wang, Qian; Wang, Chunyuan; Jing, Zhiqiang; Guo, Lu; Liu, Dapeng; Gao, Mingchun; Ma, Bo; Wang, Junwei

2011-05-27

Goose parvovirus (GPV), a small non-enveloped ssDNA virus, can cause Derzsy's disease, and three capsid proteins of VP1, VP2, and VP3 are encoded by an overlapping nucleotide sequence. However, little is known on whether recombinant viral proteins (VPs) could spontaneously assemble into virus-like particles (VLPs) in insect cells and whether these VLPs could retain their immunoreactivity and immunogenicity in susceptible geese. To address these issues, genes for these GPV VPs were amplified by PCR, and the recombinant VPs proteins were expressed in insect cells using a baculovirus expression system for the characterization of their structures, immunoreactivity, and immunogenicity. The rVP1, rVP2, and rVP3 expressed in Sf9 cells were detected by anti-GPV sera, anti-VP3 sera, and anti-His antibodies, respectively. Electron microscopy revealed that these rVPs spontaneously assembled into VLPs in insect cells, similar to that of the purified wild-type GPV virions. In addition, vaccination with individual types of VLPs, particularly with the rVP2-VLPs, induced higher titers of antibodies and neutralized different strains of GPVs in primary goose and duck embryo fibroblast cells in vitro. These data indicated that these VLPs retained immunoreactivity and had strong immunogenicity in susceptible geese. Therefore, our findings may provide a framework for development of new vaccines for the prevention of Derzsy's disease and vehicles for the delivery of drugs. Copyright © 2011 Elsevier Inc. All rights reserved.

A gene (ETM) for essential tremor maps to chromosome 2p22-p25.

PubMed

Higgins, J J; Pho, L T; Nee, L E

1997-11-01

We report the results of linkage analysis in a large American family of Czech descent with dominantly inherited "pure" essential tremor (ET) and genetic anticipation. Genetic loci on chromosome 2p22-p25 establish linkage to this region with a maximum LOD score (Zmax) = 5.92 for the locus, D2S272. Obligate recombinant events place the ETM gene in a 15-cM candidate interval between the genetic loci D2S168 and D2S224. Repeat expansion detection analysis suggests that expanded CAG trinucleotide sequences are associated with ET. These findings will facilitate the search for an ETM gene and may further our understanding of the human motor system.

Generation and gene expression profiling of 48 transcription-factor-inducible mouse embryonic stem cell lines.

PubMed

Yamamizu, Kohei; Sharov, Alexei A; Piao, Yulan; Amano, Misa; Yu, Hong; Nishiyama, Akira; Dudekula, Dawood B; Schlessinger, David; Ko, Minoru S H

2016-05-06

Mouse embryonic stem cells (ESCs) can differentiate into a wide range - and possibly all cell types in vitro, and thus provide an ideal platform to study systematically the action of transcription factors (TFs) in cell differentiation. Previously, we have generated and analyzed 137 TF-inducible mouse ESC lines. As an extension of this "NIA Mouse ESC Bank," we generated and characterized 48 additional mouse ESC lines, in which single TFs in each line could be induced in a doxycycline-controllable manner. Together, with the previous ESC lines, the bank now comprises 185 TF-manipulable ESC lines (>10% of all mouse TFs). Global gene expression (transcriptome) profiling revealed that the induction of individual TFs in mouse ESCs for 48 hours shifts their transcriptomes toward specific differentiation fates (e.g., neural lineages by Myt1 Isl1, and St18; mesodermal lineages by Pitx1, Pitx2, Barhl2, and Lmx1a; white blood cells by Myb, Etv2, and Tbx6, and ovary by Pitx1, Pitx2, and Dmrtc2). These data also provide and lists of inferred target genes of each TF and possible functions of these TFs. The results demonstrate the utility of mouse ESC lines and their transcriptome data for understanding the mechanism of cell differentiation and the function of TFs.

Variation in GABA-A subunit gene copy number in an autistic patient with mosaic 4 p duplication (p12p16).

PubMed

Kakinuma, Hiroaki; Ozaki, Mamoru; Sato, Hitoshi; Takahashi, Hiroaki

2008-09-05

Autism has been associated with chromosomal aberrations, including duplications at chromosome 4, and the identification of genetic factors contributing to the etiology of this disease is the focus of much research. Here we report a Japanese girl with mosaic of chromosome 4p duplication, mos 46,XX,dup(4)(p12p16)[54]/46,XX[6], who was diagnosed with autism at 3 years of age. Fluorescence in situ hybridization (FISH) with probes covering the region spanning a cluster of the gamma aminobutyric acid A (GABA-A) receptor subunit genes in the proximal short arm of chromosome 4 demonstrated total three signals for the GABRG1, GABRA4, and GABRA2 genes, but only two signals for GABRB1. This suggests that aberrant copy number of the GABA-A receptor subunit genes may contribute to the etiology of autism in this patient. 2007 Wiley-Liss, Inc.

p16 gene silencing along with p53 single-nucleotide polymorphism and risk of esophageal cancer in Northeast India.

PubMed

Das, Mandakini; Sharma, Santanu Kumar; Sekhon, Gaganpreet Singh; Mahanta, Jagadish; Phukan, Rup Kumar; Jalan, Bimal Kumar

2017-05-01

The high incidence of esophageal cancer in Northeast India and the unique ethnic background and dietary habits provide a great opportunity to study the molecular genetics behind esophageal squamous cell carcinoma in this part of the region. We hypothesized that in addition to currently known environmental risk factors for esophageal cancer, genetic and epigenetic factors are also involved in esophageal carcinogenesis in Northeast India. Therefore, in this study, we explored the possible association between the two important G1 cell cycle regulatory genes p16 and p53 and environmental risk factors and risk of esophageal carcinogenesis. A total of 100 newly diagnosed esophageal cancer cases along with equal number of age-, sex-, and ethnicity-matched controls were included in this study. Methylation-specific polymerase chain reaction was used to determine the p16 promoter methylation status. Single-nucleotide polymorphism at codon 72 of p53 gene was assessed by the polymerase chain reaction-restriction fragment length polymorphism method. Aberrant methylation of p16 gene was seen in 81% of esophageal cancer cases. Hypermethylation of p16 gene was not found in healthy controls. p53 Pro/Pro genotype was found to be a risk genotype in Northeast India compared with Arg/Pro and Arg/Arg. p53 variant/polymorphism was significantly associated with esophageal cancer risk in the study population under all three genetic models, namely, dominant model (Arg/Pro + Pro/Pro vs Arg/Arg odds ratio = 2.25, confidence interval = 1.19-4.26; p = 0.012), recessive model (Arg/Arg + Arg/Pro vs Pro/Pro odds ratio = 2.35, confidence interval = 1.24-4.44; p = 0.008), and homozygous model (Pro/Pro vs Arg/Arg odds ratio = 3.33, confidence interval = 1.54-7.20; p = 0.002). However, p53 variant/polymorphism was not statistically associated with esophageal cancer risk under the heterozygous model (Pro/Pro vs Arg/Pro). In the case-only analysis based on p16

Digital PCR (dPCR) analysis reveals that the homozygous c.315-48T>C variant in the FECH gene might cause erythropoietic protoporphyria (EPP).

PubMed

Brancaleoni, Valentina; Granata, Francesca; Missineo, Pasquale; Fustinoni, Silvia; Graziadei, Giovanna; Di Pierro, Elena

2018-06-13

Alterations in the ferrochelatase gene (FECH) are the basis of the phenotypic expressions in erythropoietic protoporphyria. The phenotype is due to the presence of a mutation in the FECH gene associated in trans to the c.315-48 T > C variant in the intron 3. The latter is able to increase the physiological quota of alternative splicing events in the intron 3. Other two variants in the FECH gene (c.1-252A > G and c.68-23C > T) have been found to be associated to the intron 3 variant in some populations and together, they constitute a haplotype (ACT/GTC), but eventually, their role in the alternative splicing event has never been elucidated. The absolute number of the aberrantly spliced FECH mRNA molecules and the absolute expression of the FECH gene were evaluated by digital PCR technique in a comprehensive cohort. The number of splicing events that rose in the presence of the c.315-48 T > C variant, both in the heterozygous and homozygous condition was reported for the first time. Also, the percentage of the inserted FECH mRNA increased, even doubled in the T/C cases, compared to T/T cases. The constant presence of variants in the promoter and intron 2 did not influence or modulate the aberrant splicing. The results of FECH gene expression suggested that the homozygosity for the c.315-48 T > C variant could be considered pathological. Thus, this study identified the homozygotes for the c.315-48 T > C variant as pathological. By extension, when the samples were categorised according to the haplotypes, the GTC haplotype in homozygosis was pathological. Copyright © 2018 Elsevier Inc. All rights reserved.

Regulation of p53 Target Gene Expression by Peptidylarginine Deiminase 4 ▿ †

PubMed Central

Li, Pingxin; Yao, Hongjie; Zhang, Zhiqiang; Li, Ming; Luo, Yuan; Thompson, Paul R.; Gilmour, David S.; Wang, Yanming

2008-01-01

Histone Arg methylation has been correlated with transcriptional activation of p53 target genes. However, whether this modification is reversed to repress the expression of p53 target genes is unclear. Here, we report that peptidylarginine deiminase 4, a histone citrullination enzyme, is involved in the repression of p53 target genes. Inhibition or depletion of PAD4 elevated the expression of a subset of p53 target genes, including p21/CIP1/WAF1, leading to cell cycle arrest and apoptosis. Moreover, the induction of p21, cell cycle arrest, and apoptosis by PAD4 depletion is p53 dependent. Protein-protein interaction studies showed an interaction between p53 and PAD4. Chromatin immunoprecipitation assays showed that PAD4 is recruited to the p21 promoter in a p53-dependent manner. RNA polymerase II (Pol II) activities and the association of PAD4 are dynamically regulated at the p21 promoter during UV irradiation. Paused RNA Pol II and high levels of PAD4 were detected before UV treatment. At early time points after UV treatment, an increase of histone Arg methylation and a decrease of citrullination were correlated with a transient activation of p21. At later times after UV irradiation, a loss of RNA Pol II and an increase of PAD4 were detected at the p21 promoter. The dynamics of RNA Pol II activities after UV treatment were further corroborated by permanganate footprinting. Together, these results suggest a role of PAD4 in the regulation of p53 target gene expression. PMID:18505818

Induction of P450 genes in Nilaparvata lugens and Sogatella furcifera by two neonicotinoid insecticides.

PubMed

Yang, Yuan-Xue; Yu, Na; Zhang, Jian-Hua; Zhang, Yi-Xi; Liu, Ze-Wen

2018-06-01

Nilaparvata lugens and Sogatella furcifera are two primary planthoppers on rice throughout Asian countries and areas. Neonicotinoid insecticides, such as imidacloprid (IMI), have been extensively used to control rice planthoppers and IMI resistance consequently occurred with an important mechanism from the over-expression of P450 genes. The induction of P450 genes by IMI may increase the ability to metabolize this insecticide in planthoppers and increase the resistance risk. In this study, the induction of P450 genes was compared in S. furcifera treated with IMI and nitromethyleneimidazole (NMI), in two planthopper species by IMI lethal dose that kills 85% of the population (LD 85 ), and in N. lugens among three IMI doses (LD 15 , LD 50 and LD 85 ). When IMI and NMI at the LD 85 dose were applied to S. furcifera, the expression changes in most P450 genes were similar, including the up-regulation of nine genes and down-regulation of three genes. In terms of the expression changes in 12 homologous P450 genes between N. lugens and S. furcifera treated with IMI at the LD 85 dose, 10 genes had very similar patterns, such as up-regulation in seven genes, down-regulation in one gene and no significant changes in two genes. When three different IMI doses were applied to N. lugens, the changes in P450 gene expression were much different, such as up-regulation in four genes at all doses and dose-dependent regulation of the other nine genes. For example, CYP6AY1 could be induced by all IMI doses, while CYP6ER1 was only up-regulated by the LD 50 dose, although both genes were reported important in IMI resistance. In conclusion, P450 genes in two planthopper species showed similar regulation patterns in responding to IMI, and the two neonicotinoid insecticides had similar effects on P450 gene expression, although the regulation was often dose-dependent. © 2017 Institute of Zoology, Chinese Academy of Sciences.

Introduction of OXA-48-producing Enterobacteriaceae to Israeli hospitals by medical tourism.

PubMed

Adler, Amos; Shklyar, Maya; Schwaber, Mitchell J; Navon-Venezia, Shiri; Dhaher, Yacoub; Edgar, Rotem; Solter, Ester; Benenson, Shmuel; Masarwa, Samira; Carmeli, Yehuda

2011-12-01

The carbapenemase OXA-48 has been reported from different Mediterranean countries. It is mostly encoded on a single plasmid in various Enterobacteriaceae species. We characterized the epidemiological and molecular features of OXA-48-producing Enterobacteriaceae (OPE) in Israel. Epidemiological investigation was conducted by the National Center for Infection Control. Genotyping was performed using multilocus sequence typing. The bla(OXA-48)-carrying plasmids were investigated using S1 endonuclease and restriction fragment length polymorphism (RFLP). Conjugation efficiency of the bla(OXA-48)-carrying plasmids was studied in a filter mating experiment. Since 2007, four OPE-infected patients were identified, all non-Israeli (two Palestinian, one Jordanian and one Georgian). Three had prior hospitalization; two in Jordan and one in Georgia. The bla(OXA-48) gene was detected in three Escherichia coli strains belonging to different clonal complexes, one Klebsiella oxytoca and one Klebsiella pneumoniae sequence type 101, as previously reported from Tunisia and Spain. In all isolates, the bla(OXA-48) gene was located inside Tn1999.2 and was carried on a 60 kb plasmid with an identical RFLP pattern. The plasmid was able to conjugate from Klebsiella spp. to E. coli, and had a conjugation efficiency up to ~10000 times higher than that of pKpQIL. OPE, introduced mainly by medical tourism, are an emerging threat to patients from affected Mediterranean countries. The bla(OXA-48)-carrying plasmid demonstrated remarkable conjugation efficiency, which is probably important in the success of its dissemination.

Antisense imaging of epidermal growth factor-induced p21(WAF-1/CIP-1) gene expression in MDA-MB-468 human breast cancer xenografts.

PubMed

Wang, Judy; Chen, Paul; Mrkobrada, Marko; Hu, Meiduo; Vallis, Katherine A; Reilly, Raymond M

2003-09-01

Molecular imaging of the expression of key genes which determine the response to DNA damage following cancer treatment may predict the effectiveness of a particular treatment strategy. A prominent early response gene for DNA damage is the gene encoding p21(WAF-1/CIP-1), a cyclin-dependent kinase inhibitor that regulates progression through the cell cycle. In this study, we explored the feasibility of imaging p21(WAF-1/CIP-1) gene expression at the mRNA level using an 18-mer phosphorothioated antisense oligodeoxynucleotide (ODN) labeled with (111)In. The known induction of the p21(WAF-1/CIP-1) gene in MDA-MB-468 human breast cancer cells following exposure to epidermal growth factor (EGF) was used as an experimental tool. Treatment of MDA-MB-468 cells in vitro with EGF (20 n M) increased the ratio of p21(WAF-1/CIP-1) mRNA/beta-actin mRNA threefold within 2 h as measured by the reverse transcription polymerase chain reaction (RT-PCR). A concentration-dependent inhibition of EGF-induced p21(WAF-1/CIP-1) protein expression was achieved in MDA-MB-468 cells by treatment with antisense ODNs with up to a tenfold decrease observed at 1 microM. There was a fourfold lower inhibition of p21(WAF-1/CIP-1) protein expression by control sense or random sequence ODNs. Intratumoral injections of EGF (15 microg/dayx3 days) were employed to induce p21(WAF-1/CIP-1) gene expression in MDA-MB-468 xenografts implanted subcutaneously into athymic mice. RT-PCR of explanted tumors showed a threefold increased level of p21(WAF-1/CIP-1) mRNA compared with normal saline-treated tumors. Successful imaging of EGF-induced p21(WAF-1/CIP-1) gene expression in MDA-MB-468 xenografts was achieved at 48 h post injection of (111)In-labeled antisense ODNs (3.7 MBq; 2 microg). Tumors displaying basal levels of p21(WAF-1/CIP-1) gene expression in the absence of EGF treatment could not be visualized. Biodistribution studies showed a significantly higher tumor accumulation of (111)In-labeled antisense ODNs in

Permethrin induction of multiple cytochrome P450 genes in insecticide resistant mosquitoes, Culex quinquefasciatus.

PubMed

Gong, Youhui; Li, Ting; Zhang, Lee; Gao, Xiwu; Liu, Nannan

2013-01-01

The expression of some insect P450 genes can be induced by both exogenous and endogenous compounds and there is evidence to suggest that multiple constitutively overexpressed P450 genes are co-responsible for the development of resistance to permethrin in resistant mosquitoes. This study characterized the permethrin induction profiles of P450 genes known to be constitutively overexpressed in resistant mosquitoes, Culex quinquefasciatus. The gene expression in 7 of the 19 P450 genes CYP325K3v1, CYP4D42v2, CYP9J45, (CYP) CPIJ000926, CYP325G4, CYP4C38, CYP4H40 in the HAmCqG8 strain, increased more than 2-fold after exposure to permethrin at an LC50 concentration (10 ppm) compared to their acetone treated counterpart; no significant differences in the expression of these P450 genes in susceptible S-Lab mosquitoes were observed after permethrin treatment. Eleven of the fourteen P450 genes overexpressed in the MAmCqG6 strain, CYP9M10, CYP6Z12, CYP9J33, CYP9J43, CYP9J34, CYP306A1, CYP6Z15, CYP9J45, CYPPAL1, CYP4C52v1, CYP9J39, were also induced more than doubled after exposure to an LC50 (0.7 ppm) dose of permethrin. No significant induction in P450 gene expression was observed in the susceptible S-Lab mosquitoes after permethrin treatment except for CYP6Z15 and CYP9J39, suggesting that permethrin induction of these two P450 genes are common to both susceptible and resistant mosquitoes while the induction of the others are specific to insecticide resistant mosquitoes. These results demonstrate that multiple P450 genes are co-up-regulated in insecticide resistant mosquitoes through both constitutive overexpression and induction mechanisms, providing additional support for their involvement in the detoxification of insecticides and the development of insecticide resistance.

Expression induction of P450 genes by imidacloprid in Nilaparvata lugens: A genome-scale analysis.

PubMed

Zhang, Jianhua; Zhang, Yixi; Wang, Yunchao; Yang, Yuanxue; Cang, Xinzhu; Liu, Zewen

2016-09-01

The overexpression of P450 monooxygenase genes is a main mechanism for the resistance to imidacloprid, a representative neonicotinoid insecticide, in Nilaparvata lugens (brown planthopper, BPH). However, only two P450 genes (CYP6AY1 and CYP6ER1), among fifty-four P450 genes identified from BPH genome database, have been reported to play important roles in imidacloprid resistance until now. In this study, after the confirmation of important roles of P450s in imidacloprid resistance by the synergism analysis, the expression induction by imidacloprid was determined for all P450 genes. In the susceptible (Sus) strain, eight P450 genes in Clade4, eight in Clade3 and two in Clade2 were up-regulated by imidacloprid, among which three genes (CYP6CS1, CYP6CW1 and CYP6ER1, all in Clade3) were increased to above 4.0-fold and eight genes to above 2.0-fold. In contrast, no P450 genes were induced in Mito clade. Eight genes induced to above 2.0-fold were selected to determine their expression and induced levels in Huzhou population, in which piperonyl butoxide showed the biggest effects on imidacloprid toxicity among eight field populations. The expression levels of seven P450 genes were higher in Huzhou population than that in Sus strain, with the biggest differences for CYP6CS1 (9.8-fold), CYP6ER1 (7.7-fold) and CYP6AY1 (5.1-fold). The induction levels for all tested genes were bigger in Sus strain than that in Huzhou population except CYP425B1. Screening the induction of P450 genes by imidacloprid in the genome-scale will provide an overall view on the possible metabolic factors in the resistance to neonicotinoid insecticides. The further work, such as the functional study of recombinant proteins, will be performed to validate the roles of these P450s in imidacloprid resistance. Copyright © 2015 Elsevier B.V. All rights reserved.

Pathogenic mutation in the ALS/FTD gene, CCNF, causes elevated Lys48-linked ubiquitylation and defective autophagy.

PubMed

Lee, Albert; Rayner, Stephanie L; Gwee, Serene S L; De Luca, Alana; Shahheydari, Hamideh; Sundaramoorthy, Vinod; Ragagnin, Audrey; Morsch, Marco; Radford, Rowan; Galper, Jasmin; Freckleton, Sarah; Shi, Bingyang; Walker, Adam K; Don, Emily K; Cole, Nicholas J; Yang, Shu; Williams, Kelly L; Yerbury, Justin J; Blair, Ian P; Atkin, Julie D; Molloy, Mark P; Chung, Roger S

2018-01-01

Amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD) are fatal neurodegenerative disorders that have common molecular and pathogenic characteristics, such as aberrant accumulation and ubiquitylation of TDP-43; however, the mechanisms that drive this process remain poorly understood. We have recently identified CCNF mutations in familial and sporadic ALS and FTD patients. CCNF encodes cyclin F, a component of an E3 ubiquitin-protein ligase (SCF cyclin F ) complex that is responsible for ubiquitylating proteins for degradation by the ubiquitin-proteasome system. In this study, we examined the ALS/FTD-causing p.Ser621Gly (p.S621G) mutation in cyclin F and its effect upon downstream Lys48-specific ubiquitylation in transfected Neuro-2A and SH-SY5Y cells. Expression of mutant cyclin F S621G caused increased Lys48-specific ubiquitylation of proteins in neuronal cells compared to cyclin F WT . Proteomic analysis of immunoprecipitated Lys48-ubiquitylated proteins from mutant cyclin F S621G -expressing cells identified proteins that clustered within the autophagy pathway, including sequestosome-1 (p62/SQSTM1), heat shock proteins, and chaperonin complex components. Examination of autophagy markers p62, LC3, and lysosome-associated membrane protein 2 (Lamp2) in cells expressing mutant cyclin F S621G revealed defects in the autophagy pathway specifically resulting in impairment in autophagosomal-lysosome fusion. This finding highlights a potential mechanism by which cyclin F interacts with p62, the receptor responsible for transporting ubiquitylated substrates for autophagic degradation. These findings demonstrate that ALS/FTD-causing mutant cyclin F S621G disrupts Lys48-specific ubiquitylation, leading to accumulation of substrates and defects in the autophagic machinery. This study also demonstrates that a single missense mutation in cyclin F causes hyper-ubiquitylation of proteins that can indirectly impair the autophagy degradation pathway, which is

Reverse strand-displacement amplification strategy for rapid detection of p53 gene.

PubMed

Wang, Lisha; Han, Ying; Xiao, Shuai; Lv, Sha; Wang, Cong; Zhang, Nan; Wang, Zhengyong; Tang, Yongqiong; Li, Hongbo; Lyu, Jianxin; Xu, Huo; Shen, Zhifa

2018-09-01

The development of rapid approaches to detect prognostic markers is significant in reducing the morbidity and mortality of cancer. In this paper, we describe a rapid and specific biosensing platform for target DNA (p53 gene as a model) detection based on reverse strand displacement amplification (R-SDA). When the p53 gene is added, multifuctional molecular beacon (MMB) is unfolded via the hybridization with p53 gene. With the assist of Klenow fragment (KF) and Nt.BbvCI (the nicking endonuclease), p53 gene recycling could be initiated and considerable amount of complementary sequences for the MMBs (Nicked fragments, NFs) could be formed, generating enhanced fluorescence signal. Using this amplification strategy, the proposed biosensor displays the detection limit of 1 nM and a wide linear range from 1 to 100 nM, even if only one type of probe is involved. Notably, remarkable detection specificity for single-base mismatched target p53 gene is achieved. Moreover, the described biosensor also exhibited the stability in real biological samples (human serum). The rapid detection strategy can be performed less than 30 min without harsh reaction conditions or expensive nanoparticles. This biosensor shows great potential for application in clinic assay, especially, for early cancer diagnosis. Copyright © 2018 Elsevier B.V. All rights reserved.

Whole-Gene Positive Selection, Elevated Synonymous Substitution Rates, Duplication, and Indel Evolution of the Chloroplast clpP1 Gene

PubMed Central

Erixon, Per; Oxelman, Bengt

2008-01-01

Background Synonymous DNA substitution rates in the plant chloroplast genome are generally relatively slow and lineage dependent. Non-synonymous rates are usually even slower due to purifying selection acting on the genes. Positive selection is expected to speed up non-synonymous substitution rates, whereas synonymous rates are expected to be unaffected. Until recently, positive selection has seldom been observed in chloroplast genes, and large-scale structural rearrangements leading to gene duplications are hitherto supposed to be rare. Methodology/Principle Findings We found high substitution rates in the exons of the plastid clpP1 gene in Oenothera (the Evening Primrose family) and three separate lineages in the tribe Sileneae (Caryophyllaceae, the Carnation family). Introns have been lost in some of the lineages, but where present, the intron sequences have substitution rates similar to those found in other introns of their genomes. The elevated substitution rates of clpP1 are associated with statistically significant whole-gene positive selection in three branches of the phylogeny. In two of the lineages we found multiple copies of the gene. Neighboring genes present in the duplicated fragments do not show signs of elevated substitution rates or positive selection. Although non-synonymous substitutions account for most of the increase in substitution rates, synonymous rates are also markedly elevated in some lineages. Whereas plant clpP1 genes experiencing negative (purifying) selection are characterized by having very conserved lengths, genes under positive selection often have large insertions of more or less repetitive amino acid sequence motifs. Conclusions/Significance We found positive selection of the clpP1 gene in various plant lineages to correlated with repeated duplication of the clpP1 gene and surrounding regions, repetitive amino acid sequences, and increase in synonymous substitution rates. The present study sheds light on the controversial issue

Metadata Analysis of Phanerochaete chrysosporium Gene Expression Data Identified Common CAZymes Encoding Gene Expression Profiles Involved in Cellulose and Hemicellulose Degradation.

PubMed

Kameshwar, Ayyappa Kumar Sista; Qin, Wensheng

2017-01-01

In literature, extensive studies have been conducted on popular wood degrading white rot fungus, Phanerochaete chrysosporium about its lignin degrading mechanisms compared to the cellulose and hemicellulose degrading abilities. This study delineates cellulose and hemicellulose degrading mechanisms through large scale metadata analysis of P. chrysosporium gene expression data (retrieved from NCBI GEO) to understand the common expression patterns of differentially expressed genes when cultured on different growth substrates. Genes encoding glycoside hydrolase classes commonly expressed during breakdown of cellulose such as GH-5,6,7,9,44,45,48 and hemicellulose are GH-2,8,10,11,26,30,43,47 were found to be highly expressed among varied growth conditions including simple customized and complex natural plant biomass growth mediums. Genes encoding carbohydrate esterase class enzymes CE (1,4,8,9,15,16) polysaccharide lyase class enzymes PL-8 and PL-14, and glycosyl transferases classes GT (1,2,4,8,15,20,35,39,48) were differentially expressed in natural plant biomass growth mediums. Based on these results, P. chrysosporium, on natural plant biomass substrates was found to express lignin and hemicellulose degrading enzymes more than cellulolytic enzymes except GH-61 (LPMO) class enzymes, in early stages. It was observed that the fate of P. chrysosporium transcriptome is significantly affected by the wood substrate provided. We believe, the gene expression findings in this study plays crucial role in developing genetically efficient microbe with effective cellulose and hemicellulose degradation abilities.

INGN 201: Ad-p53, Ad5CMV-p53, adenoviral p53, p53 gene therapy--introgen, RPR/INGN 201.

PubMed

2007-01-01

Introgen and its wholly owned European subsidiary Gendux AB are developing an adenoviral p53 gene therapy as a treatment for cancer in the US and Europe, respectively. Phase III trials in patients with head and neck cancer are ongoing, and a number of clinical trials in other cancer indications have been completed. INGN 201 is being reviewed by the EMEA for approval in Li-Fraumeni syndrome (LFS) under the provisions of exceptional circumstance; the therapy is available on a compassionate use basis to eligible LFS cancer patients under a protocol authorised by the US FDA. The p53 tumour suppressor gene is deleted or mutated in many tumour cells and is one of the most frequently mutated genes in human tumours. The p53 protein is one of the most intricate elements in the apoptotic signalling cascade, and a mutation in the gene encoding it is believed to result in a decreased ability of a cell to apoptose. Thus replacing this gene via adenovirally-mediated p53 gene therapy is hoped to result in increased apoptosis where it is administered.INGN 201 is available for licensing, although Introgen favours retaining partial or full rights to the therapy in the US. Introgen entered into a license agreement with The University of Texas System and MD Anderson Cancer Center in 1994. The technologies licenced include p53 and fus1 (INGN 401). The collaboration has yielded exclusive patent and licensing rights to numerous technologies. Introgen entered into a collaboration with Rhône-Poulenc Rorer Pharmaceuticals (now sanofi-aventis) to develop therapeutics based on p53 inhibition in October 1994. However, in June 2001 this relationship was restructured and Introgen assumed responsibility for the worldwide development of all p53 products including INGN 201, and acquired all marketing and commercialisation rights with respect to those products. Introgen initiated two phase III trials in head and neck cancer (in June 2000 and May 2001) at about 80 sites in the US, Canada and Europe

Comparative analysis of Homo sapiens and Mus musculus cyclin-dependent kinase (CDK) inhibitor genes p16 (MTS1) and p15 (MTS2).

PubMed

Jiang, P; Stone, S; Wagner, R; Wang, S; Dayananth, P; Kozak, C A; Wold, B; Kamb, A

1995-12-01

Cyclin-dependent kinase inhibitors are a growing family of molecules that regulate important transitions in the cell cycle. At least one of these molecules, p16, has been implicated in human tumorigenesis while its close homolog, p15, is induced by cell contact and transforming growth factor-beta (TGF-beta). To investigate the evolutionary and functional features of p15 and p16, we have isolated mouse (Mus musculus) homologs of each gene. Comparative analysis of these sequences provides evidence that the genes have similar functions in mouse and human. In addition, the comparison suggests that a gene conversion event is part of the evolution of the human p15 and p16 genes.

GeneFisher-P: variations of GeneFisher as processes in Bio-jETI

PubMed Central

Lamprecht, Anna-Lena; Margaria, Tiziana; Steffen, Bernhard; Sczyrba, Alexander; Hartmeier, Sven; Giegerich, Robert

2008-01-01

Background PCR primer design is an everyday, but not trivial task requiring state-of-the-art software. We describe the popular tool GeneFisher and explain its recent restructuring using workflow techniques. We apply a service-oriented approach to model and implement GeneFisher-P, a process-based version of the GeneFisher web application, as a part of the Bio-jETI platform for service modeling and execution. We show how to introduce a flexible process layer to meet the growing demand for improved user-friendliness and flexibility. Results Within Bio-jETI, we model the process using the jABC framework, a mature model-driven, service-oriented process definition platform. We encapsulate remote legacy tools and integrate web services using jETI, an extension of the jABC for seamless integration of remote resources as basic services, ready to be used in the process. Some of the basic services used by GeneFisher are in fact already provided as individual web services at BiBiServ and can be directly accessed. Others are legacy programs, and are made available to Bio-jETI via the jETI technology. The full power of service-based process orientation is required when more bioinformatics tools, available as web services or via jETI, lead to easy extensions or variations of the basic process. This concerns for instance variations of data retrieval or alignment tools as provided by the European Bioinformatics Institute (EBI). Conclusions The resulting service- and process-oriented GeneFisher-P demonstrates how basic services from heterogeneous sources can be easily orchestrated in the Bio-jETI platform and lead to a flexible family of specialized processes tailored to specific tasks. PMID:18460174

Identification of a p53-response element in the promoter of the proline oxidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-05-02

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

Space experiment "Rad Gene"-report 1; p53-Dependent gene expression in human cultured cells exposed to space environment

NASA Astrophysics Data System (ADS)

Takahashi, Akihisa; Ohnishi, Takeo; Suzuki, Hiromi; Omori, Katsunori; Seki, Masaya; Hashizume, Toko; Shimazu, Toru; Ishioka, Noriaki

The space environment contains two major biologically significant influences: space radiations and microgravity. A p53 tumor suppressor protein plays a role as a guardian of the genome through the activity of p53-centered signal transduction pathways. The aim of this study was to clarify the biological effects of space radiations, microgravity and a space environment on the gene and protein expression of p53-dependent regulated genes. Space experiments were performed with two human cultured lymphoblastoid cell lines: one cells line (TSCE5) bears a wild-type p53 gene status, and another cells line (WTK1) bears a mutated p53 gene status. Un-der one gravity or microgravity condition, the cells were grown in the cell biology experimental facility (CBEF) of the International Space Station (ISS) for 8 days without experiencing the stress during launching and landing because the cells were frozen during these periods. Ground control samples also were cultured for 8 days in the CBEF on the ground during the same periods as space flight. Gene and protein expression was analyzed by using DNA chip (a 44k whole human genome microarray, Agilent Technologies Inc.) and protein chip (PanoramaTM Ab MicroArray, Sigma-Aldrich Co.), respectively. In addition, we analyzed the gene expression in cultured cells after space flight during 133 days with frozen condition. We report the results and discussion from the viewpoint of the functions of the up-regulated and down-regulated genes after an exposure to space radiations and/or microgravity. The initial goal of this space experiment was completely achieved. It is expected that data from this type of work will be helpful in designing physical protection from the deleterious effects of space radiations during long term stays in space.

The gene for PAX7, a member of the paired-box-containing genes, is localized on human chromosome arm 1p36.

PubMed

Shapiro, D N; Sublett, J E; Li, B; Valentine, M B; Morris, S W; Noll, M

1993-09-01

The murine Pax-7 gene and the cognate human gene, formerly designated HuP1, are members of the multigene paired-box-containing class of developmental regulatory genes first identified in Drosophila. By analysis of somatic cell hybrids segregating human chromosomes, the gene encoding PAX7 was localized to human chromosome 1. Fluorescence in situ hybridization confirmed this assignment and allowed mapping of the gene to the terminal region of the short arm (1p36) of the chromosome. Additionally, these results confirm the extensive homology between human chromosome 1p and the distal segment of mouse chromosome 4, extending from bands C5 through E2.

The presence of p53 influences the expression of multiple human cytomegalovirus genes at early times postinfection.

PubMed

Hannemann, Holger; Rosenke, Kyle; O'Dowd, John M; Fortunato, Elizabeth A

2009-05-01

Human cytomegalovirus (HCMV) is a common cause of morbidity and mortality in immunocompromised and immunosuppressed individuals. During infection, HCMV is known to employ host transcription factors to facilitate viral gene expression. To further understand the previously observed delay in viral replication and protein expression in p53 knockout cells, we conducted microarray analyses of p53(+/+) and p53(-/-) immortalized fibroblast cell lines. At a multiplicity of infection (MOI) of 1 at 24 h postinfection (p.i.), the expression of 22 viral genes was affected by the absence of p53. Eleven of these 22 genes (group 1) were examined by real-time reverse transcriptase, or quantitative, PCR (q-PCR). Additionally, five genes previously determined to have p53 bound to their nearest p53-responsive elements (group 2) and three control genes without p53 binding sites in their upstream sequences (group 3) were also examined. At an MOI of 1, >3-fold regulation was found for five group 1 genes. The expression of group 2 and 3 genes was not changed. At an MOI of 5, all genes from group 1 and four of five genes from group 2 were found to be regulated. The expression of control genes from group 3 remained unchanged. A q-PCR time course of four genes revealed that p53 influences viral gene expression most at immediate-early and early times p.i., suggesting a mechanism for the reduced and delayed production of virions in p53(-/-) cells.

LincRNA-p21 activates p21 in cis to promote Polycomb target gene expression and to enforce the G1/S checkpoint

PubMed Central

Dimitrova, Nadya; Zamudio, Jesse R.; Jong, Robyn M.; Soukup, Dylan; Resnick, Rebecca; Sarma, Kavitha; Ward, Amanda J.; Raj, Arjun; Lee, Jeannie; Sharp, Phillip A.; Jacks, Tyler

2014-01-01

SUMMARY The p53-regulated long non-coding RNA lincRNA-p21 has been proposed to act in trans via several mechanisms ranging from repressing genes in the p53 transcriptional network to regulating mRNA translation and protein stability. To further examine lincRNA-p21 function we generated a conditional knockout mouse model. We find that lincRNA-p21 predominantly functions in cis to activate expression of its neighboring gene, p21. Mechanistically, we show that lincRNA-p21 acts in concert with hnRNP-K as a co-activator for p53-dependent p21 transcription. Additional phenotypes of lincRNA-p21 deficiency could be attributed to diminished p21 levels, including deregulated expression and altered chromatin state of some Polycomb target genes, defective G1/S checkpoint, increased proliferation rates, and enhanced reprogramming efficiency. These findings indicate that lincRNA-p21 affects global gene expression and influences the p53 tumor suppressor pathway by acting in cis as a locus-restricted co-activator for p53-mediated p21 expression. PMID:24857549

DRAGO (KIAA0247), a New DNA Damage–Responsive, p53-Inducible Gene That Cooperates With p53 as Oncosupprossor

PubMed Central

Polato, Federica; Rusconi, Paolo

2014-01-01

Background p53 influences genomic stability, apoptosis, autophagy, response to stress, and DNA damage. New p53-target genes could elucidate mechanisms through which p53 controls cell integrity and response to damage. Methods DRAGO (drug-activated gene overexpressed, KIAA0247) was characterized by bioinformatics methods as well as by real-time polymerase chain reaction, chromatin immunoprecipitation and luciferase assays, time-lapse microscopy, and cell viability assays. Transgenic mice (94 p53−/− and 107 p53+/− mice on a C57BL/6J background) were used to assess DRAGO activity in vivo. Survival analyses were performed using Kaplan–Meier curves and the Mantel–Haenszel test. All statistical tests were two-sided. Results We identified DRAGO as a new p53-responsive gene induced upon treatment with DNA-damaging agents. DRAGO is highly conserved, and its ectopic overexpression resulted in growth suppression and cell death. DRAGO−/− mice are viable without macroscopic alterations. However, in p53−/− or p53+/− mice, the deletion of both DRAGO alleles statistically significantly accelerated tumor development and shortened lifespan compared with p53−/− or p53+/− mice bearing wild-type DRAGO alleles (p53−/−, DRAGO−/− mice: hazard ratio [HR] = 3.25, 95% confidence interval [CI] = 1.7 to 6.1, P < .001; p53+/−, DRAGO−/− mice: HR = 2.35, 95% CI = 1.3 to 4.0, P < .001; both groups compared with DRAGO+/+ counterparts). DRAGO mRNA levels were statistically significantly reduced in advanced-stage, compared with early-stage, ovarian tumors, but no mutations were found in several human tumors. We show that DRAGO expression is regulated both at transcriptional—through p53 (and p73) and methylation-dependent control—and post-transcriptional levels by miRNAs. Conclusions DRAGO represents a new p53-dependent gene highly regulated in human cells and whose expression cooperates with p53 in tumor suppressor functions. PMID:24652652

Suppression of p53-inducible gene 3 is significant for glioblastoma progression and predicts poor patient prognosis.

PubMed

Quan, Jishu; Li, Yong; Jin, Meihua; Chen, Dunfu; Yin, Xuezhe; Jin, Ming

2017-03-01

Glioblastoma is the most malignant and invasive brain tumor with extremely poor prognosis. p53-inducible gene 3, a downstream molecule of the tumor suppressor p53, has been found involved in apoptosis and oxidative stress response. However, the functions of p53-inducible gene 3(PIG3) in cancer are far from clear including glioblastoma. In this study, we found that p53-inducible gene 3 expression was suppressed in glioblastoma tissues compared with normal tissues. And the expression of p53-inducible gene 3 was significantly associated with the World Health Organization grade. Patients with high p53-inducible gene 3 expression have a significantly longer median survival time (15 months) than those with low p53-inducible gene 3 expression (8 months). According to Cox regression analysis, p53-inducible gene 3 was an independent prognostic factor with multivariate hazard ratio of 0.578 (95% confidence interval, 0.352-0.947; p = 0.030) for overall survival. Additionally, gain and loss of function experiments showed that knockdown of p53-inducible gene 3 significantly increased the proliferation and invasion ability of glioblastoma cells while overexpression of p53-inducible gene 3 inhibited the proliferation and invasion ability. The results of in vivo glioblastoma models further confirmed that p53-inducible gene 3 suppression promoted glioblastoma progression. Altogether, our data suggest that high expression of p53-inducible gene 3 is significant for glioblastoma inhibition and p53-inducible gene 3 independently indicates good prognosis in patients, which might be a novel prognostic biomarker or potential therapeutic target in glioblastoma.

Characterization and expression of the cytochrome P450 gene family in diamondback moth, Plutella xylostella (L.).

PubMed

Yu, Liying; Tang, Weiqi; He, Weiyi; Ma, Xiaoli; Vasseur, Liette; Baxter, Simon W; Yang, Guang; Huang, Shiguo; Song, Fengqin; You, Minsheng

2015-03-10

Cytochrome P450 monooxygenases are present in almost all organisms and can play vital roles in hormone regulation, metabolism of xenobiotics and in biosynthesis or inactivation of endogenous compounds. In the present study, a genome-wide approach was used to identify and analyze the P450 gene family of diamondback moth, Plutella xylostella, a destructive worldwide pest of cruciferous crops. We identified 85 putative cytochrome P450 genes from the P. xylostella genome, including 84 functional genes and 1 pseudogene. These genes were classified into 26 families and 52 subfamilies. A phylogenetic tree constructed with three additional insect species shows extensive gene expansions of P. xylostella P450 genes from clans 3 and 4. Gene expression of cytochrome P450s was quantified across multiple developmental stages (egg, larva, pupa and adult) and tissues (head and midgut) using P. xylostella strains susceptible or resistant to insecticides chlorpyrifos and fiprinol. Expression of the lepidopteran specific CYP367s predominantly occurred in head tissue suggesting a role in either olfaction or detoxification. CYP340s with abundant transposable elements and relatively high expression in the midgut probably contribute to the detoxification of insecticides or plant toxins in P. xylostella. This study will facilitate future functional studies of the P. xylostella P450s in detoxification.

Characterization and expression of the cytochrome P450 gene family in diamondback moth, Plutella xylostella (L.)

PubMed Central

Yu, Liying; Tang, Weiqi; He, Weiyi; Ma, Xiaoli; Vasseur, Liette; Baxter, Simon W.; Yang, Guang; Huang, Shiguo; Song, Fengqin; You, Minsheng

2015-01-01

Cytochrome P450 monooxygenases are present in almost all organisms and can play vital roles in hormone regulation, metabolism of xenobiotics and in biosynthesis or inactivation of endogenous compounds. In the present study, a genome-wide approach was used to identify and analyze the P450 gene family of diamondback moth, Plutella xylostella, a destructive worldwide pest of cruciferous crops. We identified 85 putative cytochrome P450 genes from the P. xylostella genome, including 84 functional genes and 1 pseudogene. These genes were classified into 26 families and 52 subfamilies. A phylogenetic tree constructed with three additional insect species shows extensive gene expansions of P. xylostella P450 genes from clans 3 and 4. Gene expression of cytochrome P450s was quantified across multiple developmental stages (egg, larva, pupa and adult) and tissues (head and midgut) using P. xylostella strains susceptible or resistant to insecticides chlorpyrifos and fiprinol. Expression of the lepidopteran specific CYP367s predominantly occurred in head tissue suggesting a role in either olfaction or detoxification. CYP340s with abundant transposable elements and relatively high expression in the midgut probably contribute to the detoxification of insecticides or plant toxins in P. xylostella. This study will facilitate future functional studies of the P. xylostella P450s in detoxification. PMID:25752830

Versatile types of polysaccharide-based supramolecular polycation/pDNA nanoplexes for gene delivery

NASA Astrophysics Data System (ADS)

Hu, Yang; Zhao, Nana; Yu, Bingran; Liu, Fusheng; Xu, Fu-Jian

2014-06-01

Different polysaccharide-based supramolecular polycations were readily synthesized by assembling multiple β-cyclodextrin-cored star polycations with an adamantane-functionalized dextran via host-guest interaction in the absence or presence of bioreducible linkages. Compared with nanoplexes of the starting star polycation and pDNA, the supramolecular polycation/pDNA nanoplexes exhibited similarly low cytotoxicity, improved cellular internalization and significantly higher gene transfection efficiencies. The incorporation of disulfide linkages imparted the supramolecular polycation/pDNA nanoplexes with the advantage of intracellular bioreducibility, resulting in better gene delivery properties. In addition, the antitumor properties of supramolecular polycation/pDNA nanoplexes were also investigated using a suicide gene therapy system. The present study demonstrates that the proper assembly of cyclodextrin-cored polycations with adamantane-functionalized polysaccharides is an effective strategy for the production of new nanoplex delivery systems.Different polysaccharide-based supramolecular polycations were readily synthesized by assembling multiple β-cyclodextrin-cored star polycations with an adamantane-functionalized dextran via host-guest interaction in the absence or presence of bioreducible linkages. Compared with nanoplexes of the starting star polycation and pDNA, the supramolecular polycation/pDNA nanoplexes exhibited similarly low cytotoxicity, improved cellular internalization and significantly higher gene transfection efficiencies. The incorporation of disulfide linkages imparted the supramolecular polycation/pDNA nanoplexes with the advantage of intracellular bioreducibility, resulting in better gene delivery properties. In addition, the antitumor properties of supramolecular polycation/pDNA nanoplexes were also investigated using a suicide gene therapy system. The present study demonstrates that the proper assembly of cyclodextrin-cored polycations

DRAGO (KIAA0247), a new DNA damage-responsive, p53-inducible gene that cooperates with p53 as oncosuppressor. [Corrected].

PubMed

Polato, Federica; Rusconi, Paolo; Zangrossi, Stefano; Morelli, Federica; Boeri, Mattia; Musi, Alberto; Marchini, Sergio; Castiglioni, Vittoria; Scanziani, Eugenio; Torri, Valter; Broggini, Massimo

2014-04-01

p53 influences genomic stability, apoptosis, autophagy, response to stress, and DNA damage. New p53-target genes could elucidate mechanisms through which p53 controls cell integrity and response to damage. DRAGO (drug-activated gene overexpressed, KIAA0247) was characterized by bioinformatics methods as well as by real-time polymerase chain reaction, chromatin immunoprecipitation and luciferase assays, time-lapse microscopy, and cell viability assays. Transgenic mice (94 p53(-/-) and 107 p53(+/-) mice on a C57BL/6J background) were used to assess DRAGO activity in vivo. Survival analyses were performed using Kaplan-Meier curves and the Mantel-Haenszel test. All statistical tests were two-sided. We identified DRAGO as a new p53-responsive gene induced upon treatment with DNA-damaging agents. DRAGO is highly conserved, and its ectopic overexpression resulted in growth suppression and cell death. DRAGO(-/-) mice are viable without macroscopic alterations. However, in p53(-/-) or p53(+/-) mice, the deletion of both DRAGO alleles statistically significantly accelerated tumor development and shortened lifespan compared with p53(-/-) or p53(+/-) mice bearing wild-type DRAGO alleles (p53(-/-), DRAGO(-/-) mice: hazard ratio [HR] = 3.25, 95% confidence interval [CI] = 1.7 to 6.1, P < .001; p53(+/-), DRAGO(-/-) mice: HR = 2.35, 95% CI = 1.3 to 4.0, P < .001; both groups compared with DRAGO(+/+) counterparts). DRAGO mRNA levels were statistically significantly reduced in advanced-stage, compared with early-stage, ovarian tumors, but no mutations were found in several human tumors. We show that DRAGO expression is regulated both at transcriptional-through p53 (and p73) and methylation-dependent control-and post-transcriptional levels by miRNAs. DRAGO represents a new p53-dependent gene highly regulated in human cells and whose expression cooperates with p53 in tumor suppressor functions.

Pax1, a member of the paired box-containing class of developmental control genes, is mapped to human chromosome 20p11.2 by in situ hybridization (ISH and FISH).

PubMed

Schnittger, S; Rao, V V; Deutsch, U; Gruss, P; Balling, R; Hansmann, I

1992-11-01

Pax-1, a member of a murine multigene family, belongs to the paired box-containing class of developmental control genes first identified in Drosophila. The Pax-1 gene encodes a sequence-specific DNA-binding protein with transcriptional activating properties and has been found to be mutated in the autosomal recessive mutation undulated (un) on mouse chromosome 2 with vertebral anomalies along the entire rostrocaudal axis. By radioactive in situ hybridization (ISH) using a fragment from the murine Pax-1 paired box that is almost identical to the respective sequences from the cognate human gene HuP48 and fluorescence in situ hybridization (FISH) using a complete mouse Pax-1 cDNA, we have assigned the human homologue of murine Pax-1, the PAX1 locus, to chromosome 20p. The map position of PAX1 after FISH (FL-pter value of 0.34 +/- 0.04) corresponds to band p11.2. These results confirm the exceptional homology between human chromosome 20 and the distal segment of mouse chromosome 2, extending from bands F to G, and add PAX1 to the group of genes on 20p like PTPA, PRNP, SCG1, BMP2A, which are located in proximity on both chromosomes.

Function analysis of Ac-PCNA and Sf-PCNA during the Autographa californica multiple nucleopolyhedrovirus infection process.

PubMed

Fu, Yuejun; Wang, Ruisheng; Liang, Aihua

2018-06-01

The baculovirus Autographa californica multiple nucleopolyhedrovirus (AcMNPV) possesses a gene, ac-pcna or ac49, which encodes a protein with similarity to proliferating cell nuclear antigen (PCNA). Homologs of this gene code for DNA polymerase processivity factors and are essential in the DNA replication systems. But the function of ac-pcna still remains unclear. To define the function of Ac-pcna in AcMNPV and Sf-pcna in host Sf9 cells, Bac-to-Bac baculovirus expression system was used to generate two recombinant baculoviruses: AcMNPV-Ac-pcna-EGFP and AcMNPV-Sf-pcna-EGFP. Results indicated that AcMNPV-mediated overexpression of Ac-PCNA and Sf-PCNA could stimulate replication of AcMNPV genome in the host Sf9 cells. Meanwhile, either AcMNPV-Ac-pcna-EGFP or AcMNPV-Sf-pcna-EGFP had a significant stimulating effect on Sf9 genome replication during infection. We also found that Ac-PCNA and Sf-PCNA could promote the production of budded virus. Ac-PCNA could improve the transcription level of ie2 gene dramatically and further improved the transcription of late gene, for example 38 K and vp39, at 12 h p.i.. Moreover, insecticidal potency test showed that the larvae of Beet armyworm in the AcMNPV-Ac-pcna-EGFP and AcMNPV-Sf-pcna-EGFP groups had a higher mortality rate (83.33 and 91.67%), a lower pupation rate (16.67 and 8.33%), and a lower emergence rate (6.67 and 3.33%), compared with those in AcMNPV-EGFP group. The function of Ac-PCNA and Sf-PCNA was confirmed in this study, which provided the theoretical foundation for using and modifying AcMNPV.

A gene for Waardenburg syndrome type 2 maps close to the human homologue of the microphthalmia gene at chromosome 3p12-p14.1.

PubMed

Hughes, A E; Newton, V E; Liu, X Z; Read, A P

1994-08-01

Waardenburg syndrome (WS), an autosomal dominant syndrome of hearing loss and pigmentary disturbances, comprises at least two separate conditions. WS type 1 is normally caused by mutations in PAX3 located at chromosome 2q35 and is distinguished clinically by minor facial malformations. We have now located a gene for WS type 2. Two families show linkage to a group of microsatellite markers located on chromosome 3p12-p14.1. D3S1261 gave a maximum lod score of 6.5 at zero recombination in one large Type 2 family. In a second, smaller family the adjacent marker D3S1210 gave a lod of 2.05 at zero recombination. Interestingly, the human homologue (MITF) of the mouse microphthalmia gene, a good candidate at the phenotypic level, has recently been mapped to 3p12.3-p14.4.

Reconstitutional Mutagenesis of the Maize P Gene by Short-Range Ac Transpositions

PubMed Central

Moreno, M. A.; Chen, J.; Greenblatt, I.; Dellaporta, S. L.

1992-01-01

The tendency for Ac to transpose over short intervals has been utilized to develop insertional mutagenesis and fine structure genetic mapping strategies in maize. We recovered excisions of Ac from the P gene and insertions into nearby chromosomal sites. These closely linked Ac elements reinserted into the P gene, reconstituting over 250 unstable variegated alleles. Reconstituted alleles condition a variety of variegation patterns that reflect the position and orientation of Ac within the P gene. Molecular mapping and DNA sequence analyses have shown that reinsertion sites are dispersed throughout a 12.3-kb chromosomal region in the promoter, exons and introns of the P gene, but in some regions insertions sites were clustered in a nonrandom fashion. Transposition profiles and target site sequence data obtained from these studies have revealed several features of Ac transposition including its preference for certain target sites. These results clearly demonstrate the tendency of Ac to transpose to nearby sites in both proximal and distal directions from the donor site. With minor modifications, reconstitutional mutagenesis should be applicable to many Ac-induced mutations in maize and in other plant species and can possibly be extended to other eukaryotic transposon systems as well. PMID:1325389

Comparative analysis of Klebsiella pneumoniae strains isolated in 2012-2016 that differ by antibiotic resistance genes and virulence genes profiles.

PubMed

Lev, Anastasia I; Astashkin, Eugeny I; Kislichkina, Angelina A; Solovieva, Ekaterina V; Kombarova, Tatiana I; Korobova, Olga V; Ershova, Olga N; Alexandrova, Irina A; Malikov, Vladimir E; Bogun, Alexander G; Borzilov, Alexander I; Volozhantsev, Nikolay V; Svetoch, Edward A; Fursova, Nadezhda K

2018-04-30

The antibacterial resistance and virulence genotypes and phenotypes of 148 non-duplicate Klebsiella pneumoniae strains collected from 112 patients in Moscow hospitals in 2012-2016 including isolates from the respiratory system (57%), urine (30%), wounds (5%), cerebrospinal fluid (4%), blood (3%), and rectal swab (1%) were determined. The majority (98%) were multidrug resistant (MDR) strains carrying bla SHV (91%), bla CTX-M (74%), bla TEM (51%), bla OXA (38%), and bla NDM (1%) beta-lactamase genes, class 1 integrons (38%), and the porin protein gene ompK36 (96%). The beta-lactamase genes bla TEM-1 , bla SHV-1 , bla SHV-11 , bla SHV-110 , bla SHV-190 , bla CTX-M-15 , bla CTX-M-3 , bla CTX-M-55 , bla OXA-48 , bla OXA-244 , and bla NDM-1 were detected; class 1 integron gene cassette arrays (aadA1), (dfrA7), (dfrA1-orfC), (aadB-aadA1), (dfrA17-aadA5), and (dfrA12-orfF-aadA2) were identified. Twenty-two (15%) of clinical K. pneumoniae strains had hypermucoviscous (HV) phenotype defined as string test positive. The rmpA gene associated with HV phenotype was detected in 24% of strains. The intrapersonal mutation of rmpA gene (deletion of one nucleotide at the polyG tract) was a reason for negative hypermucoviscosity phenotype and low virulence of rmpA-positive K. pneumoniae strain KPB584. Eighteen virulent for mice strains with LD 50  ≤ 10 4  CFU were attributed to sequence types ST23, ST86, ST218, ST65, ST2174, and ST2280 and to capsular types K1, K2, and K57. This study is the first report about hypervirulent K. pneumoniae strain KPB2580-14 of ST23 K1 harboring extended-spectrum beta-lactamase CTX-M-15 and carbapenemase OXA-48 genes located on pCTX-M-15-like and pOXA-48-like plasmids correspondingly.

Association Between P2RX7 Gene and Hepatocellular Carcinoma Susceptibility: A Case-Control Study in a Chinese Han Population

PubMed Central

Duan, Shaobo; Yu, Jie; Han, Zhiyu; Cheng, Zhigang; Liang, Ping

2016-01-01

Background Hepatocellular carcinoma (HCC) is one of the most common types of liver cancer. It is hypothesized that P2RX7 genetic polymorphisms have strong association with HCC susceptibility. Therefore, a case-control study was designed and performed to verify the association between P2RX7 gene polymorphisms and HCC susceptibility. Material/Methods A total of 646 subjects were recruited in our study, including 323 HCC patients and 323 healthy controls. Five gene polymorphisms, −762C>T (rs2393799), 946G>A (rs28360457), 1513A>C (rs3751143), 1068G>A (rs1718119), and 1096C>G (rs2230911), were selected. Odds ratio (ORs) and 95% confidence interval (CI) were used to quantify the association between P2RX7 gene polymorphisms and the susceptibility to HCC. All tests were performed using SPSS 20 and a 2-sided P value of less than 0.05 was considered to be statistically significant. Results Our results suggest that allelic frequencies of these 5 SNPs all conformed to Hardy-Weinberg equilibrium (HWE). There was no significant difference in genotype and allele distributions of −762C>T and 1096C>G between the case group and the control group. However, an increased risk of HCC was associated with 946G>A (A vs. G: OR=1.48, 95%CI=1.09–2.01, P=0.013; GA+AA vs. GG: OR=1.46, 95%CI=1.03–2.07, P=0.033). A similar increased risk was associated with 1513A>C polymorphism (C vs. A: OR=1.37, 95%CI=1.05–1.79, P=0.021; AC+CC vs. AA: OR=1.40, 95%CI=1.01–1.93, P=0.041). On the other hand, a decreased risk of HCC was associated with gene polymorphism of 1068G>A (A vs. G: OR=0.68, 95%CI=0.51–0.91, P=0.010; GA+AA vs. GG: OR=0.68, 95%CI=0.49–0.96, P=0.027; AA vs. GG: OR=0.42, 95%CI=0.18–0.99, P=0.048). Conclusions Our results suggest that 3 of the 5 polymorphisms of P2RX7 described above (1513A>C, 946G>A, and 1068G>A) are significantly associated with HCC susceptibility in a Chinese Han population. Studies with larger sample sizes are recommended to confirm whether our results will

Population genetic evidence for speciation pattern and gene flow between Picea wilsonii, P. morrisonicola and P. neoveitchii

PubMed Central

Zou, Jiabin; Sun, Yongshuai; Li, Long; Wang, Gaini; Yue, Wei; Lu, Zhiqiang; Wang, Qian; Liu, Jianquan

2013-01-01

Background and Aims Genetic drift due to geographical isolation, gene flow and mutation rates together make it difficult to determine the evolutionary relationships of present-day species. In this study, population genetic data were used to model and decipher interspecific relationships, speciation patterns and gene flow between three species of spruce with similar morphology, Picea wilsonii, P. neoveitchii and P. morrisonicola. Picea wilsonii and P. neoveitchii occur from central to north-west China, where they have overlapping distributions. Picea morrisonicola, however, is restricted solely to the island of Taiwan and is isolated from the other two species by a long distance. Methods Sequence variations were examined in 18 DNA fragments for 22 populations, including three fragments from the chloroplast (cp) genome, two from the mitochondrial (mt) genome and 13 from the nuclear genome. Key Results In both the cpDNA and the mtDNA, P. morrisonicola accumulated more species-specific mutations than the other two species. However, most nuclear haplotypes of P. morrisonicola were shared by P. wilsonii, or derived from the dominant haplotypes found in that species. Modelling of population genetic data supported the hypothesis that P. morrisonicola derived from P. wilsonii within the more recent past, most probably indicating progenitor–derivative speciation with a distinct bottleneck, although further gene flow from the progenitor to the derivative continued. In addition, the occurrence was detected of an obvious mtDNA introgression from P. neoveitchii to P. wilsonii despite their early divergence. Conclusions The extent of mutation, introgression and lineage sorting taking place during interspecific divergence and demographic changes in the three species had varied greatly between the three genomes. The findings highlight the complex evolutionary histories of these three Asian spruce species. PMID:24220103

In planta functions of cytochrome P450 monooxygenase genes in the phytocassane biosynthetic gene cluster on rice chromosome 2.

PubMed

Ye, Zhongfeng; Yamazaki, Kohei; Minoda, Hiromi; Miyamoto, Koji; Miyazaki, Sho; Kawaide, Hiroshi; Yajima, Arata; Nojiri, Hideaki; Yamane, Hisakazu; Okada, Kazunori

2018-06-01

In response to environmental stressors such as blast fungal infections, rice produces phytoalexins, an antimicrobial diterpenoid compound. Together with momilactones, phytocassanes are among the major diterpenoid phytoalexins. The biosynthetic genes of diterpenoid phytoalexin are organized on the chromosome in functional gene clusters, comprising diterpene cyclase, dehydrogenase, and cytochrome P450 monooxygenase genes. Their functions have been studied extensively using in vitro enzyme assay systems. Specifically, P450 genes (CYP71Z6, Z7; CYP76M5, M6, M7, M8) on rice chromosome 2 have multifunctional activities associated with ent-copalyl diphosphate-related diterpene hydrocarbons, but the in planta contribution of these genes to diterpenoid phytoalexin production remains unknown. Here, we characterized cyp71z7 T-DNA mutant and CYP76M7/M8 RNAi lines to find that potential phytoalexin intermediates accumulated in these P450-suppressed rice plants. The results suggested that in planta, CYP71Z7 is responsible for C2-hydroxylation of phytocassanes and that CYP76M7/M8 is involved in C11α-hydroxylation of 3-hydroxy-cassadiene. Based on these results, we proposed potential routes of phytocassane biosynthesis in planta.

A Baculovirus Immediate-Early Gene, ie1, Promoter Drives Efficient Expression of a Transgene in Both Drosophila melanogaster and Bombyx mori

PubMed Central

Masumoto, Mika; Ohde, Takahiro; Shiomi, Kunihiro; Yaginuma, Toshinobu; Niimi, Teruyuki

2012-01-01

Many promoters have been used to drive expression of heterologous transgenes in insects. One major obstacle in the study of non-model insects is the dearth of useful promoters for analysis of gene function. Here, we investigated whether the promoter of the immediate-early gene, ie1, from the Bombyx mori nucleopolyhedrovirus (BmNPV) could be used to drive efficient transgene expression in a wide variety of insects. We used a piggyBac-based vector with a 3xP3-DsRed transformation marker to generate a reporter construct; this construct was used to determine the expression patterns driven by the BmNPV ie1 promoter; we performed a detailed investigation of the promoter in transgene expression pattern in Drosophila melanogaster and in B. mori. Drosophila and Bombyx belong to different insect orders (Diptera and Lepidoptera, respectively); however, and to our surprise, ie1 promoter-driven expression was evident in several tissues (e.g., prothoracic gland, midgut, and tracheole) in both insects. Furthermore, in both species, the ie1 promoter drove expression of the reporter gene from a relatively early embryonic stage, and strong ubiquitous ie1 promoter-driven expression continued throughout the larval, pupal, and adult stages by surface observation. Therefore, we suggest that the ie1 promoter can be used as an efficient expression driver in a diverse range of insect species. PMID:23152896

Stress induction of Bm1 RNA in silkworm larvae: SINEs, an unusual class of stress genes

PubMed Central

Kimura, Richard H.; Choudary, Prabhakara V.; Stone, Koni K.; Schmid, Carl W.

2001-01-01

This study surveys the induction of RNA polymerase III (Pol III)–directed expression of short interspersed element (SINE) transcripts by various stresses in an animal model, silkworm larvae. Sublethal heat shock and exposure to several toxic compounds increase the level of Bm1 RNA, the silkworm SINE transcript, while also transiently increasing expression of a well-characterized stress-induced transcript, Hsp70 messenger RNA (mRNA). In certain cases, the Bm1 RNA response coincides with that of Hsp70 mRNA, but more often Bm1 RNA responds later in recovery. Baculovirus infection and exposure to certain toxic compounds increase Bm1 RNA but not Hsp70 mRNA, showing that SINE induction is not necessarily coupled to transcription of this particular heat shock gene. SINEs behave as an additional class of stress-inducible genes in living animals but are unusual as stress genes because of their high copy number, genomic dispersion, and Pol III–directed transcription. PMID:11599568

Epitope mapping of the nucleocapsid protein of European and North American isolates of porcine reproductive and respiratory syndrome virus.

PubMed

Rodriguez, M J; Sarraseca, J; Garcia, J; Sanz, A; Plana-Durán, J; Ignacio Casal, J

1997-09-01

Two major genotypes of porcine reproductive and respiratory syndrome virus (PRRSV) have been described, which correspond to the European and North American isolates. PRRSV nucleocapsid (N) protein has been identified as the most immunodominant viral protein. The N genes from two PRRSV isolates, Olot/91 (European) and Québec 807/94 (North American), were cloned and expressed in: (i) baculovirus under the control of the polyhedrin promoter and (ii) Escherichia coli using the pET3x system. The N protein from both isolates was expressed much more efficiently in E. coli as a fusion protein than in baculovirus. The antigenicity of the protein was similar in both systems and it was recognized by a collection of 48 PRRSV-positive pig sera. The antigenic structure of the PRRSV N protein was investigated using seven monoclonal antibodies (MAbs) and overlapping fragments of the protein expressed in E. coli. Four MAbs recognized two discontinuous epitopes that were present in the partially folded protein, or at least a large fragment comprising the first 78 residues. The other three MAbs revealed the presence of a common antigenic site localized in the central region of the protein (amino acids 50-66). This region is well conserved among different isolates of European and North American origin and is the most hydrophilic region of the protein. However, this epitope, although recognized by the MAbs and many pig sera, is not useful for diagnostic purposes. Moreover, none of the N protein fragments were able to mimic the antigenicity of the entire protein.

Genetic and Biochemical characterization of OXA-519, a novel OXA-48-like β-lactamase.

PubMed

Dabos, Laura; Bogaerts, Pierre; Bonnin, Remy A; Zavala, Agustin; Sacré, Pierre; Iorga, Bogdan I; Huang, Daniel T; Glupczynski, Youri; Naas, Thierry

2018-06-04

A multidrug-resistant K. pneumoniae 1210 isolate with reduced carbapenem susceptibility revealed the presence of a novel plasmid-encoded bla OXA-48-like gene, named bla OXA-519. The 60.7-kb plasmid (pOXA-519) was similar to the IncL-OXA-48 prototypical plasmid except for a ca. 2-kb deletion due to an IS 1R insertion. OXA-519 differed from OXA-48 by a Val120Leu substitution, which resulted in an overall reduced ß-lactam-hydrolysis profile, except for ertapenem and meropenem that was increased. Thus, detection of OXA-519-producers using biochemical tests monitoring imipenem-hydrolysis will be difficult. Copyright © 2018 American Society for Microbiology.

Response of marine bacterioplankton pH homeostasis gene expression to elevated CO2

NASA Astrophysics Data System (ADS)

Bunse, Carina; Lundin, Daniel; Karlsson, Christofer M. G.; Akram, Neelam; Vila-Costa, Maria; Palovaara, Joakim; Svensson, Lovisa; Holmfeldt, Karin; González, José M.; Calvo, Eva; Pelejero, Carles; Marrasé, Cèlia; Dopson, Mark; Gasol, Josep M.; Pinhassi, Jarone

2016-05-01

Human-induced ocean acidification impacts marine life. Marine bacteria are major drivers of biogeochemical nutrient cycles and energy fluxes; hence, understanding their performance under projected climate change scenarios is crucial for assessing ecosystem functioning. Whereas genetic and physiological responses of phytoplankton to ocean acidification are being disentangled, corresponding functional responses of bacterioplankton to pH reduction from elevated CO2 are essentially unknown. Here we show, from metatranscriptome analyses of a phytoplankton bloom mesocosm experiment, that marine bacteria responded to lowered pH by enhancing the expression of genes encoding proton pumps, such as respiration complexes, proteorhodopsin and membrane transporters. Moreover, taxonomic transcript analysis showed that distinct bacterial groups expressed different pH homeostasis genes in response to elevated CO2. These responses were substantial for numerous pH homeostasis genes under low-chlorophyll conditions (chlorophyll a <2.5 μg l-1) however, the changes in gene expression under high-chlorophyll conditions (chlorophyll a >20 μg l-1) were low. Given that proton expulsion through pH homeostasis mechanisms is energetically costly, these findings suggest that bacterioplankton adaptation to ocean acidification could have long-term effects on the economy of ocean ecosystems.

Infectivity and pathogenicity of a novel baculovirus, CuniNPV from Culex nigripalpus (Diptera: Culicidae) for thirteen species and four genera of mosquitoes.

PubMed

Andreadis, Theodore G; Becnel, James J; White, Susan E

2003-07-01

The infectivity and pathogenicity of newly discovered baculovirus, CuniNPV (family Baculoviridae, genus Nucleopolyhedrovirus) originally isolated from the mosquito Culex nigripalpus Theobald, was evaluated in laboratory bioassys against thirteen species and four genera of mosquitoes native to the northeastern U.S. Purified virus at a dosage rate of 1.6 x 10(7) occlusion bodies/ml with 10 mM Mg2+ added was used in exposures with second through fourth instars at temperatures ranging from 17 to 27 degrees C. High infection rates and accompanying mortality were achieved in Cx. pipiens L. (83.0-14.4%), Cx. pipiens f. molestus (80.4% infection), and Cx. salinarius Coquillett (48.0-43.1%). Cx. restuans Theobald was also susceptible but infection rates were lower (21.3-12.5%). The gross pathology associated with infection was identical to that reported in Cx. nigripalpus. Infected larvae were lethargic and were often suspended at the water surface. Development of CuniNPV was observed in the nuclei of the midgut epitheial cells in the gastric caeca and posterior region of the stomach of host larvae. One hundred percent mortality was observed in all larvae that exhibited gross symptoms of infection within 4-d p.i. Cx. territans Walker (subgenus Neoculex Dyar) was the only Culex mosquito that was not susceptible. No infections were obtained with any species of Aedes [Ae. vexans (Meigen)], Culiseta [Culiseta morsitans (Theobald)] or Ochlerotatus [Ochlerotatus canadensis (Theobald), Oc. cantator (Coquillett), Oc. communis (De Geer), Oc. excrucians (Walker), Oc. japonicus (Theobald), Ochlerotatus stimulans (Walker), and Ochlerotatus triseriatus (Coquillett)]. The host range of CuniNPV appears to be restricted to Culex mosquitoes within the subgenus Culex. An inhibitory effect on transmission of CuniNPV was observed when a liver powder/Brewer's yeast mixture was used as a source of food reinforcing the critical role of Mg2+ and sensitivity of the infection process to the presence

Identification of the interleukin 4 receptor alpha gene as a direct target for p73.

PubMed

Sasaki, Yasushi; Mita, Hiroaki; Toyota, Minoru; Ishida, Setsuko; Morimoto, Ichiro; Yamashita, Toshiharu; Tanaka, Toshihiro; Imai, Kohzoh; Nakamura, Yusuke; Tokino, Takashi

2003-12-01

p73 has a high degree of structural homology to p53 and can activate transcription of p53-responsive genes. However, analysis of p73-deficient mice revealed a marked divergence in the physiological activities of p53 family genes and distinguishes p73 from p53. Mice deficient for p73 exhibit profound defects, including hippocampal dysgenesis, chronic infection, and inflammation, as well as abnormalities in pheromone sensory pathways. p73 plays important roles in neurogenesis, sensory pathways, and homeostatic regulation. Here, we found that the interleukin 4 receptor alpha (IL-4Ralpha) gene is up-regulated by p73 but not significantly by p53 in several human cancer cell lines. IL-4Ralphatranscription is also activated in response to cisplatin, a DNA-damaging agent known to induce p73. By using small interference RNA designed to target p73, we demonstrated that silencing endogenous p73 abrogates the induction of the IL-4Ralpha gene after cisplatin treatment. Furthermore, we identified a p73-binding site in the first intron of the IL-4Ralpha gene that can directly interact with the p73 protein in vivo. This p73-binding site consists of eight copies of a 10-bp consensus p53-binding motif and is a functional response element that is relatively specific for p73 among the p53 family. p73beta promoted localized nucleosomal acetylation through recruitment of coactivator p300, indicating that p73 regulates transcription of IL-4Ralpha through the unique p73-binding site. We also found that p73beta-transfected tumor cells are sensitive to IL-4-mediated apoptosis. Our data suggest that IL-4Ralpha could mediate, in part, certain immune responses and p73-dependent cell death.

Strategies to re-express epigenetically silenced p15(INK4b) and p21(WAF1) genes in acute myeloid leukemia.

PubMed

Geyer, C Ronald

2010-01-01

p15(INK4B) and p21(WAF1) are TGF-β targets that are silenced in leukemia by epigenetic mechanisms involving DNA methylation and/or histone modifications. Mechanisms for establishing and maintaining epigenetic silencing of p15(INK4B) and p21(WAF1) are not well established. The reversible nature of epigenetic modifications has lead to the development of drugs that target DNA methyltransferases, histone deacetylases, and histone methyltransferases, which have been used to re-express aberrantly silenced genes in leukemia. Recently, non-coding RNA, referred to as natural antisense transcripts (NATs), have been implicated in the regulation of epigenetic modifications. Here, we review epigenetic mechanisms for silencing p15(INK4B) and p21(WAF1) and the role of NATs in this process. We also review epigenetic drugs and drug combinations used to re-express p15(INK4B) and p21(WAF1). Lastly, we discuss the potential use of NATs to target the activity of epigenetic drugs to specific genes and to permanently re-express epigenetically silenced genes.

Genome-wide identification of 52 cytochrome P450 (CYP) genes in the copepod Tigriopus japonicus and their B[α]P-induced expression patterns.

PubMed

Han, Jeonghoon; Kim, Duck-Hyun; Kim, Hui-Su; Nelson, David R; Lee, Jae-Seong

2017-09-01

Cytochrome P450s (CYPs) are enzymes with a heme-binding domain that are found in all living organisms. CYP enzymes have important roles associated with detoxification of xenobiotics and endogenous compounds (e.g. steroids, fatty acids, and hormones). Although CYP enzymes have been reported in several invertebrates, including insects, little is known about copepod CYPs. Here, we identified the entire repertoire of CYP genes (n=52) from whole genome and transcriptome sequences of the benthic copepod Tigriopus japonicus, including a tandem duplication (CYP3026A3, CYP3026A4, CYP3026A5), and examined patterns of gene expression over various developmental stages and in response to benzo[α]pyrene (B[α]P) exposure. Through phylogenetic analysis, the 52 T. japonicus CYP genes were assigned to five distinct clans: CYP2 (22 genes), CYP3 (19 genes), CYP4 (two genes), CYP20 (one gene), and mitochondrial (eight genes). Developmental stage and gender-specific expression patterns of the 52 T. japonicus CYPs were analyzed. CYP3022A1 was constitutively expressed during all developmental stages. CYP genes in clans 2 and 3 were induced in response to B[α]P, suggesting that these differentially modulated CYP transcripts are likely involved in defense against exposure to B[α]P and other pollutants. This study enhances our understanding of the repertoire of CYP genes in copepods and of their potential role in development and detoxification in copepods. Copyright © 2017 Elsevier Inc. All rights reserved.

Gravity persistent signal 1 reveals a novel cytochrome P450 involved in gravitropic signal transduction

NASA Astrophysics Data System (ADS)

Wyatt, Sarah

Understanding gene expression that occurs during gravitopism is important for studying the processes that link the perception of gravity to the growth response. Arabidopsis plants with a mutation in the GRAVITY PERSISTENT SIGNAL (GPS)1 locus show a "no response" phenotype during gravistimulation experiments. Basepital auxin transport in gps1 mutant was unaffected by the mutation, but auxin was not laterally redistributed after gravistimulation. GPS1 encodes CYP705A22, a cytochrome P450 protein (P450) of unknown function. The wild type CYP705A22 gene was transformed into the gps1 mutant background and successfully rescued the mutant phenotype. Data mining of microarray data collected from gravistimulated root tips of Arabidopsis indicated that although CYP705A22 was not expressed in roots, a family member CYP705A5 was up-regulated within 3 minutes after gravistimulation. Expression profiling of CYP705A5, using real-time quantitative PCR, showed that CYP705A5 was up-regulated nearly five fold within minutes of gravity stimulation. And reporter gene fusions that link the CYP705A5 gene to the green fluorescent protein showed that CYP705A5 was expressed in the root zones of elongation and maturation. Computer modeling of the catalytic domain of CYP705A22 and CYP705A5 and in silico substrate docking simulations generated a list of 130 compounds that are potential substrates of the P450s. Many of the compounds are phenylpropanoid derivatives. Heterologous expression of CYP705A5 in baculovirus and Type 1 binding studies indicate the substrate of the P450 may be quercitin or myricetin. A mutation affecting CYP705A5 expression resulted in a delayed gravity response in roots. The mutant phenotype could be chemically complemented, and DPBA staining in the CYP705A5 mutant indicated a 1.5 fold accumulation of quercetin in mutant roots as compared to WT. These data, taken together, may indicate that we have identified a flavonoid pathway that regulates auxin distribution and thus

Positive relationship between p42.3 gene and inflammation in chronic non-atrophic gastritis.

PubMed

Chen, Ping; Cui, Yun; Fu, Qing Yan; Lu, You Yong; Fang, Jing Yuan; Chen, Xiao Yu

2015-10-01

Gastric cancer (GC) is a typical type of inflammation-related tumor. The p42.3 gene is shown to be highly expressed in GC, but its association with gastritis remains unknown. We aimed to explore the relationship between gastric inflammation and p42.3 gene in vitro and in vivo. Normal gastric epithelial cells (GES-1) were treated with Helicobacter pylori (H. pylori) and tumor necrosis factor (TNF)-α. Total cell mRNA and protein were extracted and collected, and polymerase chain reaction and Western blot were performed to determine the relative expression of p42.3 gene. In total, 291 biopsy samples from patients with chronic non-atrophic gastritis were collected and immunohistochemistry was used to measure the p42.3 protein expression. The association between p42.3 protein expression and the clinicopathological characteristics of these patients were analyzed. Both H. pylori and TNF-α significantly enhanced the p42.3 protein expression in GES-1 cells in a time and dose-dependent manner. In addition, p42.3 gene expression was positively associated with the severity of gastric mucosal inflammation and H. pylori infection (P = 0.000). Its expression was significantly more common in severe gastric inflammation and in H. pylori-infected cases. p42.3 gene expression is associated with gastric mucosal inflammation that can be upregulated by TNF-α and H. pylori infection. © 2015 Chinese Medical Association Shanghai Branch, Chinese Society of Gastroenterology, Renji Hospital Affiliated to Shanghai Jiaotong University School of Medicine and Wiley Publishing Asia Pty Ltd.

Long-term wireless pH monitoring of the distal esophagus: prolonging the test beyond 48 hours is unnecessary and may be misleading.

PubMed

Capovilla, G; Salvador, R; Spadotto, L; Voltarel, G; Pesenti, E; Perazzolo, A; Nicoletti, L; Merigliano, S; Costantini, M

2017-10-01

Wireless pH monitoring of the esophagus has been widely used to detect GERD for more than a decade. It is generally well tolerated and accepted by patients, but it is still unclear whether prolonging a recording beyond the usual 48 hours can improve the test's diagnostic value. The aim of this study is to examine the diagnostic yield of 96-hour pH monitoring vis-à-vis 24- and 48-hour tests, and to ascertain whether any gain in diagnostic terms was of genuine clinical utility. Patients with suspected GERD underwent 4-day PPI-off wireless pH monitoring of the distal esophagus. The capsule was inserted under endoscopic control, 6 cm above the squamocolumnar junction. Average acid exposure time was calculated after 24, 48, and 96 hours of recording. Ninety-nine patients completed the 96 hour test, and formed the study sample. The wireless test method was used in 42 patients (42.4%) unable to tolerate the traditional pH-monitoring catheter, and in 57 (57.6%) with a previous negative pH study despite symptoms suggestive of GERD. On complete analysis, 47 patients (47.5%) had a pathological test result: 19 patients within the first 24 hours (19.2%, 24 hour group); another 16 after 48 hours (+16.2%, 48 hour group), and a further 12 (+12.1%, 96 hour group) only after 96 hours of monitoring. All 47 patients with an abnormal acid exposure were offered and accepted surgery (10 patients) or medical therapy (37 patients). Clinical follow-up was obtained in all patients with a positive Bravo test result after a median 67 months (IQR: 38-98) using a validated symptom questionnaire. A good outcome after fundoplication or medical therapy was achieved in 73.7% of patients in the 24 hour group, in 62.5% of those in the 48 hour group, and in only 25% of those in the 96 hour group, P = 0.02. Long-term wireless pH monitoring enables an increase in the diagnostic yield over traditional 24- and 48-hour pH studies, but prolonging the test may constitute an unwanted bias and prompt the

Establishment of lysozyme gene RNA interference systemand its involvement in salinity tolerance in sea cucumber (Apostichopus japonicus).

PubMed

Tian, Yi; Jiang, Yanan; Shang, Yanpeng; Zhang, Yu-Peng; Geng, Chen-Fan; Wang, Li-Qiang; Chang, Ya-Qing

2017-06-01

The lysozyme gene was silenced using RNA interference (RNAi) to analyze the function of lysozyme in sea cucumber under salt stress. The interfering efficiency of four lysozyme RNAi oligos ranged from 0.55 to 0.70. From the four oligos, p-miR-L245 was used for further interfering experiments because it had the best silencing efficiency. Peristomial film injection of p-miR-L245 (10 μg) was used for further interfering experiments. The lowest gene expression, determined by RT-PCR assay, in muscle, coelomic fluid, and parapodium occurred 48 h after p-miR-L245 injection, while that of body wall and tube foot was 96 h and 24 h, respectively. Lysozyme activity in muscle and body wall was significantly lower than the controls. The lowest lysozyme activity in muscle, body wall and parapodium, was found at 48, 72, and 48 h, respectively, which was consistent with the transcription expression of lysozyme. The lowest point of lysozyme activity was at 96 h in coelomic fluid and tube foot, which was laid behind lysozyme expression in transcription level. The expression profile of the lysozyme transcription level and lysozyme activity in the body wall and tube foot increased at 12 h after p-miR-L245 injection before the interference effect appeared. NKA gene expression was expressed at a high level in the positive control (PC) and negative control (NC) groups at 12, 24, and 48 h, while NKA was expressed at low levels in the lysozyme RNAi injection group at 12 and 24 h. The level of NKA gene expression recovered to the level of the PC and NC group at 48, 72, and 96 h after the lysozyme RNAi injection. NKCC1 gene expression was high in the PC and NC groups at 96 h, while the NKCC1 was expressed at a low level 96 h after lysozyme RNAi injection. The results suggest that lysozyme decay involves NKA and NKCC1 gene expression under salinity 18 psμ. The K + and Cl - concentration after lysozyme RNAi injection was lower than in the PC and NC group. Copyright © 2017

Intracellular Trafficking of Baculovirus Particles: A Quantitative Study of the HearNPV/HzAM1 Cell and AcMNPV/Sf9 Cell Systems.

PubMed

Matindoost, Leila; Nielsen, Lars K; Reid, Steve

2015-05-05

To replace the in vivo production of baculovirus-based biopesticides with a more convenient in vitro produced product, the limitations imposed by in vitro production have to be solved. One of the main problems is the low titer of HearNPV budded virions (BV) in vitro as the use of low BV titer stocks can result in non-homogenous infections resulting in multiple virus replication cycles during scale up that leads to low Occlusion Body yields. Here we investigate the baculovirus traffic in subcellular fractions of host cells throughout infection with an emphasis on AcMNPV/Sf9 and HearNPV/HzAM1 systems distinguished as "good" and "bad" BV producers, respectively. qPCR quantification of viral DNA in the nucleus, cytoplasm and extracellular fractions demonstrated that although the HearNPV/HzAM1 system produces twice the amount of vDNA as the AcMNPV/Sf9 system, its percentage of BV to total progeny vDNA was lower. vDNA egress from the nucleus to the cytoplasm is sufficient in both systems, however, a higher percentage of vDNA in the HearNPV/HzAM1 system remain in the cytoplasm and do not bud out of the cells compared to the AcMNPV/Sf9 system. In both systems more than 75% of the vDNA produced in the nuclear fraction go unused, without budding or being encapsulated in OBs showing the capacity for improvements that could result from the engineering of the virus/cell line systems to achieve better productivities for both BV and OB yields.

Cytochrome P460 Genes from the Methanotroph Methylococcus capsulatus Bath†

PubMed Central

Bergmann, David J.; Zahn, James A.; Hooper, Alan B.; DiSpirito, Alan A.

1998-01-01

P460 cytochromes catalyze the oxidation of hydroxylamine to nitrite. They have been isolated from the ammonia-oxidizing bacterium Nitrosomonas europaea (R. H. Erickson and A. B. Hooper, Biochim. Biophys. Acta 275:231–244, 1972) and the methane-oxidizing bacterium Methylococcus capsulatus Bath (J. A. Zahn et al., J. Bacteriol. 176:5879–5887, 1994). A degenerate oligonucleotide probe was synthesized based on the N-terminal amino acid sequence of cytochrome P460 and used to identify a DNA fragment from M. capsulatus Bath that contains cyp, the gene encoding cytochrome P460. cyp is part of a gene cluster that contains three open reading frames (ORFs), the first predicted to encode a 59,000-Da membrane-bound polypeptide, the second predicted to encode a 12,000-Da periplasmic protein, and the third (cyp) encoding cytochrome P460. The products of the first two ORFs have no apparent similarity to any proteins in the GenBank database. The overall sequence similarity of the P460 cytochromes from M. capsulatus Bath and N. europaea was low (24.3% of residues identical), although short regions of conserved residues are present in the two proteins. Both cytochromes have a C-terminal, c-heme binding motif (CXXCH) and a conserved lysine residue (K61) that may provide an additional covalent cross-link to the heme (D. M. Arciero and A. B. Hooper, FEBS Lett. 410:457–460, 1997). Gene probing using cyp indicated that a cytochrome P460 similar to that from M. capsulatus Bath may be present in the type II methanotrophs Methylosinus trichosporium OB3b and Methylocystis parvus OBBP but not in the type I methanotrophs Methylobacter marinus A45, Methylomicrobium albus BG8, and Methylomonas sp. strains MN and MM2. Immunoblot analysis with antibodies against cytochrome P460 from M. capsulatus Bath indicated that the expression level of cytochrome P460 was not affected either by expression of the two different methane monooxygenases or by addition of ammonia to the culture medium. PMID

pH-Dependent DNA Distortion and Repression of Gene Expression by Pectobacterium atrosepticum PecS.

PubMed

Deochand, Dinesh K; Meariman, Jacob K; Grove, Anne

2016-07-15

Transcriptional activity is exquisitely sensitive to changes in promoter DNA topology. Transcription factors may therefore control gene activity by modulating the relative positioning of -10 and -35 promoter elements. The plant pathogen Pectobacterium atrosepticum, which causes soft rot in potatoes, must alter gene expression patterns to ensure growth in planta. In the related soft-rot enterobacterium Dickeya dadantii, PecS functions as a master regulator of virulence gene expression. Here, we report that P. atrosepticum PecS controls gene activity by altering promoter DNA topology in response to pH. While PecS binds the pecS promoter with high affinity regardless of pH, it induces significant DNA distortion only at neutral pH, the pH at which the pecS promoter is repressed in vivo. At pH ∼8, DNA distortions are attenuated, and PecS no longer represses the pecS promoter. A specific histidine (H142) located in a crevice between the dimerization- and DNA-binding regions is required for pH-dependent changes in DNA distortion and repression of gene activity, and mutation of this histidine renders the mutant protein incapable of repressing the pecS promoter. We propose that protonated PecS induces a DNA conformation at neutral pH in which -10 and -35 promoter elements are suboptimally positioned for RNA polymerase binding; on deprotonation of PecS, binding is no longer associated with significant changes in DNA conformation, allowing gene expression. We suggest that this mode of gene regulation leads to differential expression of the PecS regulon in response to alkalinization of the plant apoplast.

Naturally acquired antibody responses to recombinant Pfs230 and Pfs48/45 transmission blocking vaccine candidates.

PubMed

Jones, Sophie; Grignard, Lynn; Nebie, Issa; Chilongola, Jaffu; Dodoo, Daniel; Sauerwein, Robert; Theisen, Michael; Roeffen, Will; Singh, Shrawan Kumar; Singh, Rajesh Kumar; Singh, Sanjay; Kyei-Baafour, Eric; Tetteh, Kevin; Drakeley, Chris; Bousema, Teun

2015-07-01

Pfs48/45 and Pfs230 are Plasmodium falciparum sexual stage proteins and promising malaria transmission-blocking vaccine candidates. Antibody responses against these proteins may be naturally acquired and target antigens may be under selective pressure. This has consequences for the future evaluation of vaccine immunogenicity and efficacy in populations naturally exposed to malaria. We determined naturally acquired antibody responses to the recombinant proteins Pfs48/45-10C and Pfs230-230CMB in children from three malaria endemic settings in Ghana, Tanzania and Burkina Faso. We also examined genetic polymorphisms in the P. falciparum gene pfs48/45. Antibody prevalence was 1.1-18.2% for 10C and 6.7-18.9% for 230CMB. In Burkina Faso we observed evidence of an age-dependent acquisition pattern for both 10C (p < 0.001) and 230CMB (p = 0.031). Membrane feeding assays on a separate dataset demonstrated an association between functional transmission reducing activity and antibody prevalence for both 10C (p = 0.017) and 230CMB (p = 0.049). 17 single nucleotide polymorphisms were found in pfs48/45 (from 126 samples), with 5 non-synonymous SNPs in the Pfs48/45 10C region. We conclude there are naturally acquired antibody responses to both vaccine candidates which have functional relevance by reducing the transmissibility of infected individuals. We identified genetic polymorphisms, in pfs48/45 which exhibited geographical specificity. Copyright © 2015 The British Infection Association. Published by Elsevier Ltd. All rights reserved.

Identification of eight candidate target genes of the recurrent 3p12-p14 loss in cervical cancer by integrative genomic profiling.

PubMed