Construction and characterization of a bacterial artificial chromosome library for hexaploid wheat line 92R137

USDA-ARS?s Scientific Manuscript database

For map-based cloning of genes conferring important traits in the hexaploid wheat line 92R137, a bacterial artificial chromosome (BAC) library, including two sub libraries, was constructed using the genomic DNA of 92R137 digested with restriction enzymes HindIII and BamHI. The BAC library was compos...

Morphogenesis of the Bacillus anthracis Spore

DTIC Science & Technology

2007-02-01

product and plasmid pEO-3 (53) with BamHI and HindIII and ligated the resulting DNA fragments to build pRG23. We passaged pRG23 through E. coli GM1684...to remove debris. The removal of the exosporium was confirmed by elec- tron microscopy (data not shown). Antibody production . To produce a...O. Henriques, and S. M. Cutting (ed.), Bacterial spore formers: probiotics and emerging applications. Horizon Bioscience, Norfolk, United Kingdom

Characterization of class II alpha genes and DLA-D region allelic associations in the dog.

PubMed

Sarmiento, U M; Storb, R F

1988-10-01

Human major histocompatibility complex (HLA) cDNA probes were used to analyze the restriction fragment length polymorphism (RFLP) of the alpha genes of the DLA-D region in dogs. Genomic DNA from peripheral blood leucocytes of 23 unrelated DLA-D homozygous dogs representing nine DLA-D types (defined by mixed leucocyte reaction) was digested with restriction enzymes (BamHI, EcoRI, Hind III, Pvu II, Taq I, Rsa I, Msp I, Pst I and Bgl II), separated by agarose gel electrophoresis and transferred onto Biotrace membrane. The Southern blots were successively hybridized with radiolabelled HLA cDNA probes corresponding to DQ, DP, DZ and DR alpha genes. Clear evidence was obtained for the canine homologues of DQ and DR alpha genes with simple bi- or tri-allelic polymorphism respectively. Evidence for a single, nonpolymorphic DP alpha gene was also obtained. However, the presence of a DZ alpha gene could not be clearly demonstrated in canine genomic DNA. This report extends our previous RFLP analysis documenting polymorphism of DLA class II beta genes in the same panel of homozygous typing cell dogs, and provides the basis for DLA-D genotyping at a population level. This study also characterizes the RFLP-defined preferential allelic associations across the DLA-D region in nine different homozygous typing cell specificities.

[Construction of plant expression plasmid of chimera SBR-CT delta A1].

PubMed

Mai, Sui; Ling, Junqi

2003-08-01

The purpose of this study is to construct plant expression plasmid containing the gene encoding chimera SBR-CT delta A1. The target gene fragment P2, including the gene-encoded chimera SBR-CT delta A1 (3,498-5,378 bp), was obtained by standard PCR amplification. The PCR products were ligated with pGEM-easy vector through TA clone to form plasmid pTSC. The plasmid pTSC and plasmid pPOKII were digested by restricted endonuclease BamHI and KpnI, and the digested products were extracted and purified for recombination. Then the purified P2 and plasmid pPOKII were recombined by T4 DNA ligase to form recombinant plasmid pROSC; inserting bar gene into the plasmid and form pROSB plasmid. The recombined plasmids were isolated and identified by restricted endonuclease cutting and Sanger dideoxy DNA sequencing. P2 gene was linked to pPOKII plasmid and formed recombinant plasmid pROSC. The DNA sequence and orientation were corrected. And bar gene was inserted into pPOSC and form recombinant plasmid pROSB. Plant expression vector pROSC and pROSB containing the gene encoding chimera SBR-CT delta A1, which may provide useful experiment foundation for further study on edible vaccine against caries have been successfully constructed.

Physical mapping of the genomic DNA of the Oryctes rhinoceros baculovirus, KI.

PubMed

Mohan, K S; Gopinathan, K P

1991-11-15

A non-occluded baculovirus, OBV-KI has been isolated from the insect pest, Oryctes rhinoceros. The viral genome is estimated to be 123 kb, with a G + C content of 43 mol% and no detectible methylated bases. A restriction map of the OBV-KI genome for BamHI, EcoRI, HindIII, PstI, SalI and XbaI has been constructed.

[Construction of large fragment metagenome library of natural mangrove soil].

PubMed

Jiang, Yun-Xia; Zheng, Tian-Ling

2007-11-01

Applying our optimized direct extraction method, the percentage of large fragment DNA in the total extracted mangrove soil DNA was significant increased. The large fragment metagenome library derived from natural mangrove soil over four seasons was successfully constructed by the optimized DNA extraction and electro elution purification method. All of the clones had recombinant Cosmids and each differed in their fragment profiles when Cosmid DNA was extracted from 12 randomly picked colonies and digested with BamHI. The average insert size for this library was larger than 35 kbp. This culturing-independent library at least encompassed 335 Mbp valuable genetic information of mangrove soil microbes. It allowed mining of valuable intertidal microbial resource to become a reality. It is a recommended method for those researchers who have still not circumvented the large insert environmental libraries or for those beginning research in this field, so as to avoid them attempting repetitive, fussy work.

Application of DNA probes for rRNA and vanA genes to investigation of a nosocomial cluster of vancomycin-resistant enterococci.

PubMed Central

Woodford, N; Morrison, D; Johnson, A P; Briant, V; George, R C; Cookson, B

1993-01-01

DNA probes specific for genes encoding rRNA and the glycopeptide resistance gene vanA were used to investigate a cluster of vancomycin-resistant (MICs, > 512 mg/liter) Enterococcus faecalis and Enterococcus faecium isolated from separate patients in a renal unit in a London hospital. When digested with BamHI, 12 of 13 vancomycin-resistant E. faecalis isolates exhibited a common restriction fragment length polymorphism pattern of rRNA genes (ribotype). A vanA probe hybridized with chromosomal DNA in these 12 isolates. The other isolate of vancomycin-resistant E. faecalis had a different ribotype and the vanA gene was located on plasmid DNA. These data suggest that cross-infection with a single strain of vancomycin-resistant E. faecalis occurred in most instances. In contrast, 23 vancomycin-resistant E. faecium isolates showed greater heterogeneity, comprising 8 ribotypes, suggesting that multiple strains were present in the unit. Twenty-one of these 23 isolates harbored a 24-MDa plasmid which hybridized with the vanA probe, implying that interstrain dissemination of a vancomycin resistance plasmid may have occurred among E. faecium isolates in the renal unit. Images PMID:8096216

Function of the SpoVAEa and SpoVAF Proteins of Bacillus subtilis Spores

DTIC Science & Technology

2014-06-01

outer surface of the spore’s inner membrane, as SpoVAEa was accessible to an external biotinylation agent in spores and SpoVAEa disappeared in parallel...codon was PCR amplified from PS832 chromosomal DNA with primers that inserted BamHI and PstI restriction sites upstream and downstream, respectively... chromosomal structure, and this strain was termed PS4348 (spoVAEa mutant). A B. subtilis strain with a deletion of the spoVF gene was constructed by a two

Novel Immune Modulating Cellular Vaccine for Prostate Cancer

DTIC Science & Technology

2014-10-01

restriction sites. Murine PSMA : The cDNA encoding mPSMA was purchased from Sino Biologicals and was cloned into the HindIII and BamHI sites of pSP73-Sph/A64...sequence) and reverse primer 5’-TATATAGAGCTCTCAGATGTTCCGATACACATCTC-3’ Murine PSMA no signal sequence (mPSMA-SS): Murine PSMA minus the signal sequence...contains a HindIII site for cloning and utilizes an ATG that lies downstream of the signal sequence as the start codon in PSMA -SS ( PSMA without signal

Translations on USSR Science and Technology, Biomedical and Behavioral Sciences, Number 33

DTIC Science & Technology

1978-07-05

7.6, 6.6 mM MgCl2, 6.6 mM 2-ß- mercaptoethanol, 2 y£ BamHI. Restriction was performed at 37°C for 15 min. We used, as marker DNA, EcoRI restrictor...linear DNA as function of molecular weight, plotted according to marker DNA to determine the molecular weights of DNA restrictors. Electron...according to the amp marker ; 3) reaction to agents that eliminate plasmids (acridine orange, ethidium bromide, sodium dodecylsulfate). The obtained

Deletion of the steroid-binding domain of the human androgen receptor gene in one family with complete androgen insensitivity syndrome: Evidence for further genetic heterogeneity in this syndrome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Brown, T.R.; Lubahn, D.B.; Wilson, E.M.

1988-11-01

The cloning of a cDNA for the human androgen receptor gene has resulted in the availability for cDNA probes that span various parts of the gene, including the entire steroid-binding domain and part of the DNA-binding domain, as well as part of the 5' region of the gene. The radiolabeled probes were used to screen for androgen receptor mutations on Southern blots prepared by restriction endonuclease digestion of genomic DNA from human subjects with complete androgen insensitivity syndrome (AIS). In this investigation, the authors considered only patients presenting complete AIS and with the androgen receptor (-) form as the mostmore » probably subjects to show a gene deletion. One subject from each of six unrelated families with the receptor (-) form of complete AIS and 10 normal subjects were studied. In the 10 normal subjects and in 5 of the 6 patients, identical DNA restriction fragment patterns were observed with EcoRI and BamHI. Analysis of other members of this family confirmed the apparent gene deletion. The data provide direct proof that complete AIS in some families can result from a deletion of the androgen receptor structural gene. However, other families do not demonstrate such a deletion, suggesting that point mutations may also result in the receptor (-) form of complete AIS, adding further to the genetic heterogeneity of this syndrome.« less

Tannerella forsythia and the HLA-DQB1 allele are associated with susceptibility to periodontal disease in Japanese adolescents.

PubMed

Shimomura-Kuroki, Junko; Yamashita, Kie; Shimooka, Shohachi

2009-01-01

Periodontal disease is a multiple factor disease caused by genetic factors, environmental factors, and periodontal bacteria (periodontal pathogens). The present study aimed to elucidate the risk factors for periodontal disease in Japanese adolescents. Subjects (11-16 years old) were classified into three groups: localized aggressive periodontitis (LAP), periodontal attachment loss (PAL), and periodontally healthy (PH) groups. Genomic DNA isolated from the buccal mucosa was used for single-nucleotide polymorphism analyses of the candidate genes (interleukin-1alpha-889; interleukin-1alpha +4845; interleukin-1beta +3954; an immunoglobulin G Fc gamma receptor, FcgammaRIIa-R/H131; and a human leukocyte antigen class II allele, HLA-DQB1) of aggressive periodontitis. Subgingival plaque samples obtained from the same subjects were used for 16S rRNAbased polymerase chain reaction analysis of five important periodontal pathogens (Aggregatibacter actinomycetemcomitans, Porphyromonas gingivalis, Prevotella intermedia, Treponema denticola, and Tannerella forsythia). Tannerella forsythia was detected in the deepest periodontal pockets in all subjects in the LAP and PAL groups. The prevalence of an atypical BamHI restriction site in HLA-DQB1 of the LAP group was significantly higher than that in the PH and PAL groups. Furthermore, all subjects who had the atypical BamHI restriction site in HLA-DQB1 had T. forsythia infection. These results suggested that T. forsythia is associated with periodontal disease in Japanese adolescents and also suggested that HLA-DQB1 is related to LAP and is associated with T. forsythia infection.

Porphyromonas endodontalis reactivates latent Epstein-Barr virus.

PubMed

Makino, K; Takeichi, O; Imai, K; Inoue, H; Hatori, K; Himi, K; Saito, I; Ochiai, K; Ogiso, B

2018-06-01

To determine whether Porphyromonas endodontalis can reactivate latent Epstein-Barr virus (EBV). The concentrations of short-chain fatty acids (SCFAs) in P. endodontalis culture supernatants were determined using high-performance liquid chromatography. A promoter region of BamHI fragment Z leftward open reading frame 1 (BZLF-1), which is a transcription factor that controls the EBV lytic cycle, was cloned into luciferase expression vectors. Then, the luciferase assay was performed using P. endodontalis culture supernatants. Histone acetylation using Daudi cells treated with P. endodontalis culture supernatants was examined using Western blotting. BZLF-1 mRNA and BamHI fragment Z EB replication activator (ZEBRA) protein were also detected quantitatively using real-time polymerase chain reaction (PCR) and Western blotting. Surgically removed periapical granulomas were examined to detect P. endodontalis, EBV DNA, and BZLF-1 mRNA expression using quantitative real-time PCR. Statistical analysis using Steel tests was performed. The concentrations of n-butyric acid in P. endodontalis culture supernatants were significantly higher than those of other SCFAs (P=0.0173). Using B-95-8-221 Luc cells treated with P. endodontalis culture supernatants, the luciferase assay demonstrated that P. endodontalis induced BZLF-1 expression. Hyperacetylation of histones was also observed with the culture supernatants. BZLF-1 mRNA and ZEBRA protein were expressed by Daudi cells in a dose-dependent manner after the treatment with P. endodontalis culture supernatants. P. endodontalis and BZLF-1 in periapical granulomas were also detected. The expression levels of BZLF-1 mRNA were similar to the numbers of P. endodontalis cells in each specimen. n-butyric acid produced by P. endodontalis reactivated latent EBV. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

Comparison of 17 genome types of adenovirus type 3 identified among strains recovered from six continents.

PubMed Central

Li, Q G; Wadell, G

1988-01-01

Restriction endonucleases BamHI, BclI, BglI, BglII, BstEII, EcoRI, HindIII, HpaI, SalI, SmalI, XbalI, and XholI were used to analyze 61 selected strains of adenovirus type 3 (Ad3) isolated from Africa, Asia, Australia, Europe, North America, and South America. It was noted that the use of BamHI, BclI, BglII, HpaI, SalI, and SmaI was sufficient to distinguish 17 genome types; 13 of them were newly identified. All 17 Ad3 genome types could be divided into three genomic clusters. Genome types of Ad3 cluster 1 occurred in Africa, Europe, South America, and North America. Genomic cluster 2 was identified in Africa; genomic cluster 3 was identified in Africa, Asia, Australia, Europe (a few), and North America. This was of interest because 15 identified genome types of Ad7 could also be divided into three genomic clusters. The degree of genetic relatedness between the 17 Ad3 and the 15 Ad7 genome types was analyzed and was expressed in a three-dimensional model. Images PMID:2838500

Complete nucleotide sequence of the gene for human heparin cofactor II and mapping to chromosomal band 22q11

DOE Office of Scientific and Technical Information (OSTI.GOV)

Herzog, R.; Lutz, S.; Blin, N.

1991-02-05

Heparin cofactor II (HCII) is a 66-kDa plasma glycoprotein that inhibits thrombin rapidly in the presence of dermatan sulfate or heparin. Clones comprising the entire HCII gene were isolated from a human leukocyte genomic library in EMBL-3 {lambda} phage. The sequence of the gene was determined on both strands of DNA (15,849 bp) and included 1,749 bp of 5{prime}-flanking sequence, five exons, four introns, and 476 bp of DNA 3{prime} to the polyadenylation site. Ten complete and one partial Alu repeats were identified in the introns and 5{prime}-flanking region. The HCII gene was regionally mapped on chromosome 22 using rodent-humanmore » somatic cell hybrids, carrying only parts of human chromosome 22, and the chronic myelogenous leukemia cell line K562. With the cDNA probe HCII7.2, containing the entire coding region of the gene, the HCII gene was shown to be amplified 10-20-fold in K562 cells by Southern analysis and in situ hybridization. From these data, the authors concluded that the HCII gene is localized on the chromosomal band 22q11 proximal to the breakpoint cluster region (BCR). Analysis by pulsed-field gel electrophoresis indicated that the amplified HCII gene in K562 cells maps at least 2 Mbp proximal to BCR-1. Furthermore, the HCII7.2 cDNA probe detected two frequent restriction fragment length polymorphisms with the restriction enzymes BamHI and Hind III.« less

Cloning, Expression, and Purification of Histidine-Tagged Escherichia coli Dihydrodipicolinate Reductase.

PubMed

Trigoso, Yvonne D; Evans, Russell C; Karsten, William E; Chooback, Lilian

2016-01-01

The enzyme dihydrodipicolinate reductase (DHDPR) is a component of the lysine biosynthetic pathway in bacteria and higher plants. DHDPR catalyzes the NAD(P)H dependent reduction of 2,3-dihydrodipicolinate to the cyclic imine L-2,3,4,5,-tetrahydropicolinic acid. The dapB gene that encodes dihydrodipicolinate reductase has previously been cloned, but the expression of the enzyme is low and the purification is time consuming. Therefore the E. coli dapB gene was cloned into the pET16b vector to improve the protein expression and simplify the purification. The dapB gene sequence was utilized to design forward and reverse oligonucleotide primers that were used to PCR the gene from Escherichia coli genomic DNA. The primers were designed with NdeI or BamHI restriction sites on the 5'and 3' terminus respectively. The PCR product was sequenced to confirm the identity of dapB. The gene was cloned into the expression vector pET16b through NdeI and BamHI restriction endonuclease sites. The resulting plasmid containing dapB was transformed into the bacterial strain BL21 (DE3). The transformed cells were utilized to grow and express the histidine-tagged reductase and the protein was purified using Ni-NTA affinity chromatography. SDS/PAGE gel analysis has shown that the protein was 95% pure and has approximate subunit molecular weight of 28 kDa. The protein purification is completed in one day and 3 liters of culture produced approximately 40-50 mgs of protein, an improvement on the previous protein expression and multistep purification.

Cloning, Expression, and Purification of Histidine-Tagged Escherichia coli Dihydrodipicolinate Reductase

PubMed Central

Trigoso, Yvonne D.; Evans, Russell C.; Karsten, William E.; Chooback, Lilian

2016-01-01

The enzyme dihydrodipicolinate reductase (DHDPR) is a component of the lysine biosynthetic pathway in bacteria and higher plants. DHDPR catalyzes the NAD(P)H dependent reduction of 2,3-dihydrodipicolinate to the cyclic imine L-2,3,4,5,-tetrahydropicolinic acid. The dapB gene that encodes dihydrodipicolinate reductase has previously been cloned, but the expression of the enzyme is low and the purification is time consuming. Therefore the E. coli dapB gene was cloned into the pET16b vector to improve the protein expression and simplify the purification. The dapB gene sequence was utilized to design forward and reverse oligonucleotide primers that were used to PCR the gene from Escherichia coli genomic DNA. The primers were designed with NdeI or BamHI restriction sites on the 5’and 3’ terminus respectively. The PCR product was sequenced to confirm the identity of dapB. The gene was cloned into the expression vector pET16b through NdeI and BamHI restriction endonuclease sites. The resulting plasmid containing dapB was transformed into the bacterial strain BL21 (DE3). The transformed cells were utilized to grow and express the histidine-tagged reductase and the protein was purified using Ni-NTA affinity chromatography. SDS/PAGE gel analysis has shown that the protein was 95% pure and has approximate subunit molecular weight of 28 kDa. The protein purification is completed in one day and 3 liters of culture produced approximately 40–50 mgs of protein, an improvement on the previous protein expression and multistep purification. PMID:26815040

Genetic organization and regulation of a meta cleavage pathway for catechols produced from catabolism of toluene, benzene, phenol, and cresols by Pseudomonas pickettii PKO1.

PubMed Central

Kukor, J J; Olsen, R H

1991-01-01

Plasmid pRO1957 contains a 26.5-kb BamHI restriction endonuclease-cleaved DNA fragment cloned from the chromosome of Pseudomonas pickettii PKO1 that allows P. aeruginosa PAO1c to grow on toluene, benzene, phenol, or m-cresol as the sole carbon source. The genes encoding enzymes for meta cleavage of catechol or 3-methylcatechol, derived from catabolism of these substrates, were subcloned from pRO1957 and were shown to be organized into a single operon with the promoter proximal to tbuE. Deletion and analysis of subclones demonstrated that the order of genes in the meta cleavage operon was tbuEFGKIHJ, which encoded catechol 2,3-dioxygenase, 2-hydroxymuconate semialdehyde hydrolase, 2-hydroxymuconate semialdehyde dehydrogenase, 4-hydroxy-2-oxovalerate aldolase, 4-oxalocrotonate decarboxylase, 4-oxalocrotonate isomerase, and 2-hydroxypent-2,4-dienoate hydratase, respectively. The regulatory gene for the tbuEFGKIHJ operon, designated tbuS, was subcloned into vector plasmid pRO2317 from pRO1957 as a 1.3-kb PstI fragment, designated pRO2345. When tbuS was not present, meta pathway enzyme expression was partially derepressed, but these activity levels could not be fully induced. However, when tbuS was present in trans with tbuEFGKIHJ, meta pathway enzymes were repressed in the absence of an effector and were fully induced when an effector was present. This behavior suggests that the gene product of tbuS acts as both a repressor and an activator. Phenol and m-cresol were inducers of meta pathway enzymatic activity. Catechol, 3-methylcatechol, 4-methylcatechol, o-cresol, and p-cresol were not inducers but could be metabolized by cells previously induced by phenol or m-cresol. PMID:1856161

The Epstein-Barr virus (EBV) nuclear antigen 1 BamHI F promoter is activated on entry of EBV-transformed B cells into the lytic cycle.

PubMed Central

Lear, A L; Rowe, M; Kurilla, M G; Lee, S; Henderson, S; Kieff, E; Rickinson, A B

1992-01-01

In Epstein-Barr virus (EBV)-positive Burkitt's lymphoma cell lines exhibiting the latency I form of infection (i.e., EBV nuclear antigen 1 [EBNA1] positive in the absence of other latent proteins), the EBNA1 mRNA has a unique BamHI Q/U/K splice structure and is expressed from a novel promoter, Fp, located near the BamHI FQ boundary. This contrasts with the situation in EBV-transformed lymphoblastoid cell lines (LCLs) exhibiting the latency III form of infection (i.e., positive for all latent proteins), in which transcription from the upstream Cp or Wp promoters is the principal source of EBNA mRNAs. We carried out cDNA amplifications with oligonucleotide primer-probe combinations to determine whether Fp is ever active in an LCL environment. The results clearly showed that some LCLs express a Q/U/K-spliced EBNA1 mRNA in addition to the expected Cp/Wp-initiated transcripts; this seemed inconsistent with the concept of Cp/Wp and Fp as mutually exclusive promoters. Here we show that Fp is indeed silent in latency III cells but is activated at an early stage following the switch from latency III into the virus lytic cycle. Four pieces of evidence support this conclusion: (i) examples of coincident Cp/Wp and Fp usage in LCLs are restricted to those lines in which a small subpopulation of cells have spontaneously entered the lytic cycle; (ii) transcripts initiating from Fp can readily be demonstrated in spontaneously productive lines by S1 nuclease protection; (iii) the presence of Fp-initiated transcripts is not affected by acyclovir blockade of the late lytic cycle; and (iv) infection of latently infected LCLs with a recombinant vaccinia virus encoding the EBV immediate-early protein BZLF1, a transcriptional transactivator which normally initiates the lytic cycle, results in the appearance of the diagnostic Q/U/K-spliced transcripts. Images PMID:1331531

Restriction enzyme analysis of Indian isolates of egg drop syndrome 1976 virus recovered from chicken, duck and quail.

PubMed

Senthilkumar, N; Kataria, J M; Koti, M; Dhama, K; Dash, B B

2004-07-01

Egg drop syndrome 1976 (EDS-76) is caused by a haemagglutinating adenovirus belonging to group III of the genus Aviadenovirus in the family Adenoviridae. All isolates are serologically identical, but have been divided into three groups based on restriction endonuclease (RE) analysis. In this study the viral DNA of various Indian EDS-76 viral isolates (CEDS-A, CEDS-B, EDS-M, EDS-ML, EDS-1/AD/86, EDS-KC and QEDS) obtained from different avian species and different geographical regions were digested with restriction endonucleases viz., EcoRI, BamHI, HindIII and PstI. The results showed that one Indian isolate obtained from duck (DEDS-KC) was different from all other chicken and quail counterparts. All other isolates were identical to the reference viral strain BC-14, which belong to group I of EDS-76 viruses. The duck isolate EDS-KC could not be placed in any of the three groups reported earlier.

Construction of a novel gene bank of Bacillus subtilis using a low copy number vector in Escherichia coli.

PubMed

Hasnain, S; Thomas, C M

1986-07-01

Low copy number vector plasmid pCT571 was constructed to clone Bacillus subtilis genomic fragments in Escherichia coli. pCT571 confers KmR, TcR and CmR in E. coli and CmR in B. subtilis. It has unique restriction sites within the KmR and TcR markers to allow screening for recombinant plasmids by insertional inactivation of these genes. It contains the pSC101 replicon and replicates normally at six to eight copies per chromosome equivalent in E. coli. It also contains oriVRK2, which when supplied with the product of the trfA gene of RK2 in trans, allows pCT571 to replicate at 35-40 copies per chromosome equivalent. A B. subtilis gene bank was created by cloning partially Sau3A-digested and size-fractionated fragments of B. subtilis chromosomal DNA into the BamHI site of pCT571. DNA from 1097 KmR TcS transformants was extracted and analysed electrophoretically as supercoiled DNA and after digesting with EcoRI or EcoRI and SalI. Approximately 1000 hybrid plasmids were found with reasonably sized B. subtilis fragments. The mean size of the inserts in pCT571 is 8 kb, ranging from 4 to 20 kb in different plasmids. The gene bank covers most of the B. subtilis chromosome, as demonstrated by the results of screening the gene bank for selectable nutritional markers in E. coli and B. subtilis. Hybrid plasmids which complement E. coli mutants for arg, his, lys, met, pdx, pyr and thr markers were identified from the gene bank. In B. subtilis the presence of argC, cysA, dal, hisA, ilvA, leuA, lys, metB, metC, phe, purA, purB, thr and trpC was established by transformation experiments. The effects of copy number on cloning and long-term maintenance in the bacterial strains were also investigated. At high copy number some hybrid plasmids cannot be maintained at all, while others show an increased rate of structural deletions and rearrangements.

Cloning and expression of Bartonella henselae sucB gene encoding an immunogenic dihydrolipoamide succinyltransferase homologous protein.

PubMed

Kabeya, Hidenori; Maruyama, Soichi; Hirano, Kouji; Mikami, Takeshi

2003-01-01

Immunoscreening of a ZAP genomic library of Bartonella henselae strain Houston-1 expressed in Escherichia coli resulted in the isolation of a clone containing 3.5 kb BamHI genomic DNA fragment. This 3.5 kb DNA fragment was found to contain a sequence of a gene encoding a protein with significant homology to the dihydrolipoamide succinyltransferase of Brucella melitensis (sucB). Subsequent cloning and DNA sequence analysis revealed that the deduced amino acid sequence from the cloned gene showed 66.5% identity to SucB protein of B. melitensis, and 43.4 and 47.2% identities to those of Coxiella burnetii and E. coli, respectively. The gene was expressed as a His-Nus A-tagged fusion protein. The recombinant SucB protein (rSucB) was shown to be an immunoreactive protein of about 115 kDa by Western blot analysis with sera from B. henselae-immunized mice. Therefore the rSucB may be a candidate antigen for a specific serological diagnosis of B. henselae infection.

Ti plasmid-encoded genes responsible for catabolism of the crown gall opine mannopine by Agrobacterium tumefaciens are homologs of the T-region genes responsible for synthesis of this opine by the plant tumor.

PubMed

Kim, K S; Farrand, S K

1996-06-01

Agrobacterium tumefaciens NT1 harboring pSaB4, which contains the 14-kb BamHI fragment 4 from the octopine/mannityl opine-type Ti plasmid pTi15955, grew well with agropine (AGR) but slowly with mannopine (MOP) as the sole carbon source. When a second plasmid encoding a dedicated transport system for MOP was introduced, these cells grew well with both AGR and MOP. Transposon insertion mutagenesis and subcloning identified a 5.7-kb region of BamHI fragment 4 that encodes functions required for the degradation of MOP. DNA sequence analysis revealed seven putative genes in this region: mocD (moc for mannityl opine catabolism) and mocE, oriented from right to left, and mocRCBAS, oriented from left to right. Significant identities exist at the nucleotide and derived amino acid sequence levels between these moc genes and the mas genes that are responsible for opine biosynthesis in crown gall tumors. MocD is a homolog of Mas2, the anabolic conjugase encoded by mas2'. MocE and MocC are related to the amino half and the carboxyl half, respectively, of Mas1 (MOP reductase), the second enzyme for MOP biosynthesis. These results indicate that the moc and mas genes evolved from a common origin. MocR and MocS are related to each other and to a putative repressor for the AGR degradation system encoded by the rhizogenic plasmid pRiA4. MocB and MocA are homologs of 6-phosphogluconate dehydratase and glucose-6-phosphate dehydrogenase, respectively. Mutations in mocD and mocE, but not mocC, are suppressed by functions encoded by the chromosome or the 450-kb megaplasmid present in many Agrobacterium isolates. We propose that moc genes derived from genes located elsewhere in the bacterial genome and that the tumor-expressed mas genes evolved from the bacterial moc genes.

Ti plasmid-encoded genes responsible for catabolism of the crown gall opine mannopine by Agrobacterium tumefaciens are homologs of the T-region genes responsible for synthesis of this opine by the plant tumor.

PubMed Central

Kim, K S; Farrand, S K

1996-01-01

Agrobacterium tumefaciens NT1 harboring pSaB4, which contains the 14-kb BamHI fragment 4 from the octopine/mannityl opine-type Ti plasmid pTi15955, grew well with agropine (AGR) but slowly with mannopine (MOP) as the sole carbon source. When a second plasmid encoding a dedicated transport system for MOP was introduced, these cells grew well with both AGR and MOP. Transposon insertion mutagenesis and subcloning identified a 5.7-kb region of BamHI fragment 4 that encodes functions required for the degradation of MOP. DNA sequence analysis revealed seven putative genes in this region: mocD (moc for mannityl opine catabolism) and mocE, oriented from right to left, and mocRCBAS, oriented from left to right. Significant identities exist at the nucleotide and derived amino acid sequence levels between these moc genes and the mas genes that are responsible for opine biosynthesis in crown gall tumors. MocD is a homolog of Mas2, the anabolic conjugase encoded by mas2'. MocE and MocC are related to the amino half and the carboxyl half, respectively, of Mas1 (MOP reductase), the second enzyme for MOP biosynthesis. These results indicate that the moc and mas genes evolved from a common origin. MocR and MocS are related to each other and to a putative repressor for the AGR degradation system encoded by the rhizogenic plasmid pRiA4. MocB and MocA are homologs of 6-phosphogluconate dehydratase and glucose-6-phosphate dehydrogenase, respectively. Mutations in mocD and mocE, but not mocC, are suppressed by functions encoded by the chromosome or the 450-kb megaplasmid present in many Agrobacterium isolates. We propose that moc genes derived from genes located elsewhere in the bacterial genome and that the tumor-expressed mas genes evolved from the bacterial moc genes. PMID:8655509

Rv1458c: a new diagnostic marker for identification of Mycobacterium tuberculosis complex in a novel duplex PCR assay.

PubMed

Shrivastava, Kamal; Garima, Kushal; Narang, Anshika; Bhattacharyya, Kausik; Vishnoi, Ekta; Singh, Roshan Kumar; Chaudhry, Anil; Prasad, Rajendra; Bose, Mridula; Varma-Basil, Mandira

2017-03-01

We explored the efficiency of Rv1458c, the gene encoding a putative ABC drug transporter specific for the Mycobacterium tuberculosis complex (MTBC), as a diagnostic marker. A 190 bp region of Rv1458c and a 300 bp region of hsp65 were targeted in a novel duplex PCR assay and the results were compared with those for PCR restriction analysis(PRA) using the restriction enzymes NruI and BamHI. Species identification of a subset of the isolates (n=50) was confirmed by sequencing. Clinical isolates of M. tuberculosis (n=426) obtained from clinically suspected patients of pulmonary tuberculosis and mycobacterial (n=13) and non-mycobacterial (n=8) reference strains were included in the study. The duplex PCR assay correctly identified 320/426 isolates as MTBC and 106/426 isolates as non-tuberculous mycobacteria(NTM). The test was 100 % specific and sensitive when compared with NruI/BamHI PCR restriction analysis and highlighted the use of Rv1458c as a diagnostic marker for MTBC. The duplex PCR assay could be developed for use as a screening test to identify MTBC in clinical specimens in peripheral laboratories with limited resources.

Temperature sensing in Yersinia pestis: regulation of yopE transcription by lcrF.

PubMed Central

Hoe, N P; Minion, F C; Goguen, J D

1992-01-01

In Escherichia coli, a yopE::lacZ fusion was found to be regulated by temperature in the presence of the cloned BamHI G fragment of Yersinia pestis plasmid pCD1, which contains the lcrF locus. Increasing the copy number of lcrF relative to that of the yopE reporter had a negligible effect on the induction ratio (26 versus 37 degrees C) but caused large reductions in the absolute levels of yopE transcription. We localized the lcrF gene by monitoring the induction phenotype of BamHI G deletion derivatives. Sequencing revealed an open reading frame capable of encoding a protein of 30.8 kDa. A protein product of this size was detected in a T7 expression system, and LcrF-dependent yopE-specific DNA binding activity was observed. As expected, LcrF exhibited 98% homology to VirF of Yersinia enterocolitica and significant homology to the carboxy termini of other members of the AraC family of transcriptional regulatory proteins. These proteins could be divided into two classes according to function: those regulating operons involved in catabolism of carbon and energy sources and those involved in regulating virulence genes. lcrF::lacZ transcriptional fusions were constructed and analyzed in Y. pestis and E. coli. The activity of the fusions was not affected by the native pCD1 virulence plasmid, an intact lcrF gene, or temperature. Thus, induction of lcrF transcription is not essential for temperature-dependent activation of yopE transcription. A portion of LcrF was found associated with the membrane fraction in E. coli; however, pulse-chase experiments indicated that this result is an artifact of fractionation. Images PMID:1624422

Nucleic acid indexing

DOEpatents

Guilfoyle, Richard A.; Guo, Zhen

2001-01-01

A restriction site indexing method for selectively amplifying any fragment generated by a Class II restriction enzyme includes adaptors specific to fragment ends containing adaptor indexing sequences complementary to fragment indexing sequences near the termini of fragments generated by Class II enzyme cleavage. A method for combinatorial indexing facilitates amplification of restriction fragments whose sequence is not known.

Nucleic acid indexing

DOEpatents

Guilfoyle, Richard A.; Guo, Zhen

1999-01-01

A restriction site indexing method for selectively amplifying any fragment generated by a Class II restriction enzyme includes adaptors specific to fragment ends containing adaptor indexing sequences complementary to fragment indexing sequences near the termini of fragments generated by Class II enzyme cleavage. A method for combinatorial indexing facilitates amplification of restriction fragments whose sequence is not known.

Assignment of the gene encoding the 5-HT{sub 1E} serotonin receptor (S31) (locus HTR1E) to human chromosome 6q14-q15

DOE Office of Scientific and Technical Information (OSTI.GOV)

Levy, F.O.; Tasken, K.; Solberg, R.

1994-08-01

The human gene for the 5-HT{sub 1E} serotonin receptor was recently cloned, but no chromosomal assignment has yet been given to this gene (locus HTR1E). In this work, we demonstrate by two independent polymerase chain reactions on a panel of human-hamster somatic cell hybrid genomic DNA that the 5-HT{sub 1E} serotonin receptor gene is localized on human chromosome 6. Furthermore, by means of in situ hybridization to human metaphase chromosomes, using the cloned 5-HT{sub 1E} receptor gene (phage clone {lambda}-S31) as a probe, we demonstrate that this gene is localized to the q14-q15 region on chromosome 6. Screening of genomicmore » DNA from 15 unrelated Caucasian individuals, using as a probe the open reading frame of the cloned 5-HT{sub 1E} receptor gene, did not reveal any restriction fragment length polymorphisms with the enzymes BamHI, BanII, BglII, EcoRI, HincII, HindIII, HinfI, MspI, PstI, and PvuII. Since the 5-HT{sub 1E} receptor is found mainly in the cerebral cortex and abnormal function of the serotonergic system has been implicated in a variety of neurologic and psychiatric diseases, the precise chromosomal assignment of the 5-HT{sub 1E} receptor gene is the crucial first step toward the evaluation of this locus as a candidate for mutations in such syndromes. 28 refs., 2 figs., 2 tabs.« less

Cloning, sequence analysis, and expression in Escherichia coli of a gene coding for a. beta. -mannanase from the extremely thermophilic bacterium Caldocellum saccharolyticum

DOE Office of Scientific and Technical Information (OSTI.GOV)

Luethi, E.; Jasmat, N.B.; Grayling, R.A.

1991-03-01

A {lambda} recombinant phage expressing {beta}-mannanase activity in Escherichia coli has been isolated from a genomic library of the extremely thermophilic anaerobe Caldocellum saccharolyticum. The gene was cloned into pBR322 on a 5-kb BamHI fragment, and its location was obtained by deletion analysis. The sequence of a 2.1-kb fragment containing the mannanase gene has been determined. One open reading frame was found which could code for a protein of M{sub r} 38,904. The mannanase gene (manA) was overexpressed in E. coli by cloning the gene downstream from the lacZ promoter of pUC18. The enzyme was most active at pH 6more » and 80 C and degraded locust bean gum, guar gum, Pinus radiata glucomannan, and konjak glucomannan. The noncoding region downstream from the mannanase gene showed strong homology to celB, a gene coding for a cellulase from the same organism, suggesting that the manA gene might have been inserted into its present position on the C. saccharolyticum genome by homologous recombination.« less

Spheroplastic phase of mycobacteria isolated from patients with Crohn's disease.

PubMed Central

Chiodini, R J; Van Kruiningen, H J; Thayer, W R; Coutu, J A

1986-01-01

Two strains of an unclassified Mycobacterium species were isolated after 18 and 30 months of incubation of media inoculated with resected intestinal tissues from patients with Crohn's disease. These strains represented the third and fourth isolates of this organism from Crohn's disease patients. Ultrastructural examination of this strain and two previously isolated strains revealed the presence of spheroplasts which eventually transformed into the bacillary form of a previously unrecognized Mycobacterium species. These cell wall-deficient forms did not stain with conventional dyes and failed to grow on hypertonic media. Restriction polymorphism of the ribosomal DNA genes was used to determine the relationship between the cell wall-deficient and bacillary forms. Identical restriction patterns of the ribosomal DNA genes were found between the spheroplasts and Mycobacterium sp. isolates with EcoRI, BamHI, and XhoI restriction endonucleases, thus providing definitive evidence of their origin. Unidentified spheroplasts were isolated from an additional 12 patients with Crohn's disease, of which 7 of 10 seroagglutinated with antiserum prepared against the Mycobacterium sp. Spheroplasts were isolated from 16 of 26 (61%) patients with Crohn's disease but not from tissues of 13 patients with ulcerative colitis or 13 patients with other diseases of the bowel. These findings support the role of mycobacteria as etiologic agents in some cases of Crohn's disease. Images PMID:3760132

Novel variants of the 5S rRNA genes in Eruca sativa.

PubMed

Singh, K; Bhatia, S; Lakshmikumaran, M

1994-02-01

The 5S ribosomal RNA (rRNA) genes of Eruca sativa were cloned and characterized. They are organized into clusters of tandemly repeated units. Each repeat unit consists of a 119-bp coding region followed by a noncoding spacer region that separates it from the coding region of the next repeat unit. Our study reports novel gene variants of the 5S rRNA genes in plants. Two families of the 5S rDNA, the 0.5-kb size family and the 1-kb size family, coexist in the E. sativa genome. The 0.5-kb size family consists of the 5S rRNA genes (S4) that have coding regions similar to those of other reported plant 5S rDNA sequences, whereas the 1-kb size family consists of the 5S rRNA gene variants (S1) that exist as 1-kb BamHI tandem repeats. S1 is made up of two variant units (V1 and V2) of 5S rDNA where the BamHI site between the two units is mutated. Sequence heterogeneity among S4, V1, and V2 units exists throughout the sequence and is not limited to the noncoding spacer region only. The coding regions of V1 and V2 show approximately 20% dissimilarity to the coding regions of S4 and other reported plant 5S rDNA sequences. Such a large variation in the coding regions of the 5S rDNA units within the same plant species has been observed for the first time. Restriction site variation is observed between the two size classes of 5S rDNA in E. sativa.(ABSTRACT TRUNCATED AT 250 WORDS)

Phenoxyacetic acid degradation by the 2,4-dichlorophenoxyacetic acid (TFD) pathway of plasmid pJP4: mapping and characterization of the TFD regulatory gene, tfdR.

PubMed Central

Harker, A R; Olsen, R H; Seidler, R J

1989-01-01

Plasmid pJP4 enables Alcaligenes eutrophus JMP134 to degrade 3-chlorobenzoate and 2,4-dichlorophenoxyacetic acid (TFD). Plasmid pRO101 is a derivative of pJP4 obtained by insertion of Tn1721 into a nonessential region of pJP4. Plasmid pRO101 was transferred by conjugation to several Pseudomonas strains and to A. eutrophus AEO106, a cured isolate of JMP134. AEO106(pRO101) and some Pseudomonas transconjugants grew on TFD. Transconjugants with a chromosomally encoded phenol hydroxylase also degraded phenoxyacetic acid (PAA) in the presence of an inducer of the TFD pathway, namely, TFD or 3-chlorobenzoate. A mutant of one such phenol-degrading strain, Pseudomonas putida PPO300(pRO101), grew on PAA as the sole carbon source in the absence of inducer. This isolate carried a mutant plasmid, designated pRO103, derived from pRO101 through the deletion of a 3.9-kilobase DNA fragment. Plasmid pRO103 constitutively expressed the TFD pathway, and this allowed the metabolism of PAA in the absence of the inducer, TFD. Complementation of pRO103 in trans by a DNA fragment corresponding to the fragment deleted in pRO101 indicates that a negative control-regulatory gene (tfdR) is located on the BamHI E fragment of pRO101. Other subcloning experiments resulted in the cloning of the tfdA monooxygenase gene on a 3.5-kilobase fragment derived from pRO101. This subclone, in the absence of other pRO101 DNA, constitutively expressed the tfdA gene and allowed PPO300 to grow on PAA. Preliminary evidence suggests that the monooxygenase activity encoded by this DNA fragment is feedback-inhibited by phenols. Images PMID:2914848

Parental cigarette smoking, transforming growth factor-alpha gene variant and the risk of orofacial cleft in Iranian infants

PubMed Central

Ebadifar, Asghar; Hamedi, Roya; KhorramKhorshid, Hamid Reza; Kamali, Koorosh; Moghadam, Fatemeh Aghakhani

2016-01-01

Objective(s): We investigated the influence of genetic variation of the transforming growth-factor alpha (TGFA) locus on the relationship between smoking and oral clefts. Materials and Methods: In this study 105 Iranian infants with non-syndromic cleft lip/palate and 218 controls with non-cleft birth defects were examined to test for associations among maternal exposures, genetic markers, and oral clefts. Maternal and parental smoking histories during pregnancy were obtained through questionnaire. DNA was extracted from newborn screening blood samples, and genotyping of the BamHI polymorphism in the TGFA gene was performed by polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) methods. A number of factors including gender of the newborns, type of oral cleft, consanguinity of the parents, as well as the mother’s age and education were evaluated as potential confounders and effect modifiers. Results: Maternal smoking, in the absence of paternal smoking, was associated with an increased risk for CL/P (OR = 19.2, 95% CI = [(6.2-59.5)]) and cleft palate only (OR =48.7, 95% CI = [(8-29.3)]). If both parents smoked, risks were generally greater (OR = 55.6, 95% CI = [12-20.25]). Analyses for the risk of clefting from maternal smoking, stratified by the presence or absence of the TGFA/BamH1variant, revealed that the risk of clefting among the infants with the TGFA/BamH1 variant when their mothers smoked cigarettes was much greater than the infants who had non-smoker mothers (P=0.001, OR=10.4,95% CI=[3.2,33.6]). Conclusion: The results of this study indicate that first-trimester maternal smoking and infant TGFA locus mutations are both associated with nonsyndromic cleft lip and/or palate (CL/P). PMID:27279979

A clone-free, single molecule map of the domestic cow (Bos taurus) genome.

PubMed

Zhou, Shiguo; Goldstein, Steve; Place, Michael; Bechner, Michael; Patino, Diego; Potamousis, Konstantinos; Ravindran, Prabu; Pape, Louise; Rincon, Gonzalo; Hernandez-Ortiz, Juan; Medrano, Juan F; Schwartz, David C

2015-08-28

The cattle (Bos taurus) genome was originally selected for sequencing due to its economic importance and unique biology as a model organism for understanding other ruminants, or mammals. Currently, there are two cattle genome sequence assemblies (UMD3.1 and Btau4.6) from groups using dissimilar assembly algorithms, which were complemented by genetic and physical map resources. However, past comparisons between these assemblies revealed substantial differences. Consequently, such discordances have engendered ambiguities when using reference sequence data, impacting genomic studies in cattle and motivating construction of a new optical map resource--BtOM1.0--to guide comparisons and improvements to the current sequence builds. Accordingly, our comprehensive comparisons of BtOM1.0 against the UMD3.1 and Btau4.6 sequence builds tabulate large-to-immediate scale discordances requiring mediation. The optical map, BtOM1.0, spanning the B. taurus genome (Hereford breed, L1 Dominette 01449) was assembled from an optical map dataset consisting of 2,973,315 (439 X; raw dataset size before assembly) single molecule optical maps (Rmaps; 1 Rmap = 1 restriction mapped DNA molecule) generated by the Optical Mapping System. The BamHI map spans 2,575.30 Mb and comprises 78 optical contigs assembled by a combination of iterative (using the reference sequence: UMD3.1) and de novo assembly techniques. BtOM1.0 is a high-resolution physical map featuring an average restriction fragment size of 8.91 Kb. Comparisons of BtOM1.0 vs. UMD3.1, or Btau4.6, revealed that Btau4.6 presented far more discordances (7,463) vs. UMD3.1 (4,754). Overall, we found that Btau4.6 presented almost double the number of discordances than UMD3.1 across most of the 6 categories of sequence vs. map discrepancies, which are: COMPLEX (misassembly), DELs (extraneous sequences), INSs (missing sequences), ITs (Inverted/Translocated sequences), ECs (extra restriction cuts) and MCs (missing restriction cuts). Alignments of UMD3.1 and Btau4.6 to BtOM1.0 reveal discordances commensurate with previous reports, and affirm the NCBI's current designation of UMD3.1 sequence assembly as the "reference assembly" and the Btau4.6 as the "alternate assembly." The cattle genome optical map, BtOM1.0, when used as a comprehensive and largely independent guide, will greatly assist improvements to existing sequence builds, and later serve as an accurate physical scaffold for studies concerning the comparative genomics of cattle breeds.

Evaluation of Microbial Diversity in Wetland through Polymerase Chain Reaction (PCR) and Restriction Fragment Length Polymorphism (RFLP)

DTIC Science & Technology

2006-06-01

51 Appendix C. Promega Restriction Digest Protocol ....................................................53...Rsa1 Restriction Digest Results............................................................................180 9. DNA Base Pair Comparison...particular restriction endonuclease, the length of the fragments produced will differ when the DNA is digested with a restriction enzyme (Edwards

Unique variations of Epstein-Barr virus-encoded BARF1 gene in nasopharyngeal carcinoma biopsies.

PubMed

Wang, Yun; Wang, Xiao-Feng; Sun, Zhi-Fu; Luo, Bing

2012-06-01

The Epstein-Barr virus (EBV) BamHI-A rightward frame 1 (BARF1) gene is frequently expressed in EBV-associated epithelial malignancies and involves in oncogenicity and immunomodulation. To characterize the variations of BARF1 gene in different populations, the sequences of BARF1 gene in Northern Chinese nasopharyngeal carcinoma (NPC), EBV-associated gastric carcinoma (EBVaGC) and healthy donors were analyzed. The correlation of BARF1 variation with polymorphisms of BamHI F fragment (type F and f variants) and EBV-coded viral interleukin-10 (vIL-10) gene (B95-8 and SPM patterns) was also explored. Two major subtypes of BARF1 gene, designated as B95-8 and V29A, were identified. B95-8 subtype had identical amino acid sequence to B95-8 and was the dominant subtype among the EBV isolates from Northern China. V29A subtype, with one consistent amino acid change at residue 29 (V→A) and several nucleotide changes, showed higher frequency in NPC cases (25.3%, 20/79) than in EBVaGC cases (0/45) or healthy donors (4.3%, 2/46) (NPC vs. EBVaGC: P=0.0001; NPC vs. healthy donor: P=0.004). A preferential linkage between BamHI F and BARF1/vIL-10 polymorphisms was found. Type f isolates was specially correlated with the V29A/SPM genotype in NPC isolates and type f/V29A/SPM was preferentially found in NPC. BARF1/c-fms homology domain, transforming domain and cytotoxic T lymphocyte (CTL) epitopes of BARF1 were highly conserved in most isolates, suggesting the important role of BARF1 in virus infection and the potential usefulness in EBV-targeting immunotherapy of EBV-associated tumors. The relatively higher prevalence of type f/V29A/SPM strains in NPC may also suggest the association between these variations in multiple viral genes and NPC. Copyright © 2012 Elsevier B.V. All rights reserved.

[Construction and functional identification of eukaryotic expression vector carrying Sprague-Dawley rat MSX-2 gene].

PubMed

Yang, Xian-Xian; Zhang, Mei; Yan, Zhao-Wen; Zhang, Ru-Hong; Mu, Xiong-Zheng

2008-01-01

To construct a high effective eukaryotic expressing plasmid PcDNA 3.1-MSX-2 encoding Sprague-Dawley rat MSX-2 gene for the further study of MSX-2 gene function. The full length SD rat MSX-2 gene was amplified by PCR, and the full length DNA was inserted in the PMD1 8-T vector. It was isolated by restriction enzyme digest with BamHI and Xhol, then ligated into the cloning site of the PcDNA3.1 expression plasmid. The positive recombinant was identified by PCR analysis, restriction endonudease analysis and sequence analysis. Expression of RNA and protein was detected by RT-PCR and Western blot analysis in PcDNA3.1-MSX-2 transfected HEK293 cells. Sequence analysis and restriction endonudease analysis of PcDNA3.1-MSX-2 demonstrated that the position and size of MSX-2 cDNA insertion were consistent with the design. RT-PCR and Western blot analysis showed specific expression of mRNA and protein of MSX-2 in the transfected HEK293 cells. The high effective eukaryotic expression plasmid PcDNA3.1-MSX-2 encoding Sprague-Dawley Rat MSX-2 gene which is related to craniofacial development can be successfully reconstructed. It may serve as the basis for the further study of MSX-2 gene function.

Digital Biological Converter

DTIC Science & Technology

2013-06-28

of cuts that each fragment should be cut into so the fragments are no greater than a specific length threshold. Additionally, vector sequences and...restriction sites are attached to each fragment while ensuring the restriction sites are unique to each sequence. The vector sequences serve as hooks...for assembly into vector for cloning purposes, and also as primer binding domains for PCR ampl ification. The restriction sites are added to

Restriction fragment length polymorphism among Israeli Holstein-Friesian dairy bulls.

PubMed

Beckmann, J S; Kashi, Y; Hallerman, E M; Nave, A; Soller, M

1986-01-01

Israeli Holstein-Friesian dairy bulls were screened for restriction fragment length polymorphisms by hybridizing cloned DNA probes for bovine growth hormone, for chymosin, and for rat muscle beta-actin to restriction endonuclease-digested DNA immobilized on nitrocellulose filters. The population proved to be polymorphic at the growth hormone locus, with evidence consistent with the phenotypes being inherited in allelic fashion. A low level of polymorphism was also observed at one of the beta-actin gene family loci. The chymosin locus was monomorphic with the restriction enzymes utilized. The results illustrate the power of restriction fragment length polymorphism methodology in visualizing genetic variability in dairy cattle populations.

An Epstein-Barr virus immediate-early gene product trans-activates gene expression from the human immunodeficiency virus long terminal repeat.

PubMed

Kenney, S; Kamine, J; Markovitz, D; Fenrick, R; Pagano, J

1988-03-01

Acquired immunodeficiency syndrome patients are frequently coinfected with Epstein-Barr virus (EBV). In this report, we demonstrate that an EBV immediate-early gene product, BamHI MLF1, stimulates expression of the bacterial chloramphenicol acetyltransferase (CAT) gene linked to the human immunodeficiency virus (HIV) promoter. The HIV promoter sequences necessary for trans-activation by EBV do not include the tat-responsive sequences. In addition, in contrast to the other herpesvirus trans-activators previously studied, the EBV BamHI MLF1 gene product appears to function in part by a posttranscriptional mechanism, since it increases pHIV-CAT protein activity more than it increases HIV-CAT mRNA. This ability of an EBV gene product to activate HIV gene expression may have biologic consequences in persons coinfected with both viruses.

Detection of restriction fragment length polymorphisms in clinical isolates and serially passaged Pseudomonas aeruginosa strains.

PubMed Central

Hjelm, L N; Branstrom, A A; Warren, R L

1990-01-01

An 800-base-pair HindIII-PstI fragment that flanks a hot spot for Tn7 insertion was isolated from the chromosome of Pseudomonas aeruginosa and cloned into pUC12. The fragment was used to probe XhoI digests of genomic DNA from 18 P. aeruginosa isolates collected from sputum samples of seven cystic fibrosis patients. Only two XhoI restriction fragment length polymorphisms (RFLPs), of 3.7 and 7.7 kilobases (kb), were detected. Isolate WSU3531-1 (3.7-kb XhoI fragment) and WSU3860 (7.7-kb XhoI fragment), while isolated from the same patient, showed different RFLPs. Serial passages of isolate WSU3531-1 demonstrated that this strain was phenotypically stable. In contrast, colony and pigment variants were readily isolated at a frequency of 1% from serial passages of isolate WSU3860. When XhoI-digested genomic DNA from phenotypic variants of serially passaged WSU3860 were probed with the 800-base-pair HindIII-PstI fragment, the probe hybridized to a 10.4-kb XhoI fragment from three isolates. Restriction analysis of the genomic DNA digested with a variety of restriction enzymes showed that a 2.7-kb insertion occurred in the same region for all three isolates. There appeared to be no correlation between changes in the RFLP and changes in colony morphology. Images PMID:1977762

Physical map of the Brucella melitensis 16 M chromosome.

PubMed Central

Allardet-Servent, A; Carles-Nurit, M J; Bourg, G; Michaux, S; Ramuz, M

1991-01-01

We present the first restriction map of the Brucella melitensis 16 M chromosome obtained by Southern blot hybridization of SpeI, XhoI, and XbaI fragments separated by pulsed-field gel electrophoresis. All restriction fragments (a total of 113) were mapped into an open circle. The main difficulty in mapping involved the exceedingly high number of restriction fragments, as was expected considering the 59% G + C content of the Brucella genome. Several cloned genes were placed on this map, especially rRNA operons which are repeated three times. The size of the B. melitensis chromosome, estimated as 2,600 kb long in a previous study, appeared longer (3,130 kb) by restriction mapping. This restriction map is an initial approach to achieve a genetic map of the Brucella chromosome. Images PMID:2007548

An Epstein-Barr virus immediate-early gene product trans-activates gene expression from the human immunodeficiency virus long terminal repeat.

PubMed Central

Kenney, S; Kamine, J; Markovitz, D; Fenrick, R; Pagano, J

1988-01-01

Acquired immunodeficiency syndrome patients are frequently coinfected with Epstein-Barr virus (EBV). In this report, we demonstrate that an EBV immediate-early gene product, BamHI MLF1, stimulates expression of the bacterial chloramphenicol acetyltransferase (CAT) gene linked to the human immunodeficiency virus (HIV) promoter. The HIV promoter sequences necessary for trans-activation by EBV do not include the tat-responsive sequences. In addition, in contrast to the other herpesvirus trans-activators previously studied, the EBV BamHI MLF1 gene product appears to function in part by a posttranscriptional mechanism, since it increases pHIV-CAT protein activity more than it increases HIV-CAT mRNA. This ability of an EBV gene product to activate HIV gene expression may have biologic consequences in persons coinfected with both viruses. Images PMID:2830625

Epstein-Barr virus immediate-early gene product trans-activates gene expression from the human immunodeficiency virus long terminal repeat

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kenney, S.; Kamine, J.; Markovitz, D.

Acquired immunodeficiency syndrome patients are frequently coinfected with Epstein-Barr virus (EBV). In this report, the authors demonstrate that an EBV immediate-early gene product, BamHI MLF1, stimulates expression of the bacterial chloramphenicol acetyltransferase (CAT) gene linked to the human immunodeficiency virus (HIV) promoter. The HIV promoter sequences necessary for trans-activation by EBV do not include the tat-responsive sequences. In addition, in contrast to the other herpesvirus trans-activators previously studied, the EBV BamHI MLF1 gene product appears to function in part by a posttranscriptional mechanism, since it increases pHIV-CAT protein activity more than it increases HIV-CAT mRNA. This ability of an EBVmore » gene product to activate HIV gene expression may have biologic consequences in persons coinfected with both viruses.« less

Restriction enzyme cutting site distribution regularity for DNA looping technology.

PubMed

Shang, Ying; Zhang, Nan; Zhu, Pengyu; Luo, Yunbo; Huang, Kunlun; Tian, Wenying; Xu, Wentao

2014-01-25

The restriction enzyme cutting site distribution regularity and looping conditions were studied systematically. We obtained the restriction enzyme cutting site distributions of 13 commonly used restriction enzymes in 5 model organism genomes through two novel self-compiled software programs. All of the average distances between two adjacent restriction sites fell sharply with increasing statistic intervals, and most fragments were 0-499 bp. A shorter DNA fragment resulted in a lower looping rate, which was also directly proportional to the DNA concentration. When the length was more than 500 bp, the concentration did not affect the looping rate. Therefore, the best known fragment length was longer than 500 bp, and did not contain the restriction enzyme cutting sites which would be used for digestion. In order to make the looping efficiencies reach nearly 100%, 4-5 single cohesive end systems were recommended to digest the genome separately. Copyright © 2013 Elsevier B.V. All rights reserved.

Streptococcus mutans genes that code for extracellular proteins in Escherichia coli K-12.

PubMed

Holt, R G; Abiko, Y; Saito, S; Smorawinska, M; Hansen, J B; Curtiss, R

1982-10-01

Chromosomal DNA from Streptococcus mutans 6715 (serotype g) was cloned into Escherichia coli K-12 by using the cosmid pJC74 cloning vector and a bacteriophage lambda in vitro packaging system. Rabbit antiserum against S. mutans extracellular proteins was used for immunological screening of the clone bank. Twenty-one clones produced weak to strong precipitin bands around the colonies, but only after the lambda c1857 prophage was induced by being heated to lyse the E. coli cells. None of the clones expressed enzyme activity for several known S. mutans extracellular enzymes. One of these clones contained a 45-kilobase recombinant plasmid designated pYA721. An 8.5-kilobase fragment of S. mutans DNA from pYA721 was isolated and recloned into the BamHI restriction site of the plasmid vector pACYC184 to construct pYA726. pYA726 contained all, or nearly all, of the gene for a surface protein antigen (the spaA protein) of S. mutans 6715. This was deduced from immunological studies in which extracts of cells harboring pYA726 reacted with antisera against both purified 6715 spaA protein (about 210,000 daltons) and the immunologically similar antigen I/II of serotype c strains of S. mutans. In addition, the S. mutans spaA protein was found to possess at least one antigenic determinant not present on the protein specified by pYA726. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis of E. coli clone extracts revealed that pYA726 produced a polypeptide with a molecular mass of about 180,000 daltons which was predominantly found in the periplasmic space of E. coli cells. Antisera to the spaA protein of S. mutans reacted with extracellular protein from representative strains of S. mutans serotypes a, c, d, e, f, and g, but not b.

Signal-on electrochemical assay for label-free detection of TdT and BamHI activity based on grown DNA nanowire-templated copper nanoclusters.

PubMed

Hu, Yufang; Zhang, Qingqing; Xu, Lihua; Wang, Jiao; Rao, Jiajia; Guo, Zhiyong; Wang, Sui

2017-11-01

Electrochemical methods allow fast and inexpensive analysis of enzymatic activity. Here, a simple and yet efficient "signal-on" electrochemical assay for sensitive, label-free detection of DNA-related enzyme activity was established on the basis of terminal deoxynucleotidyl transferase (TdT)-mediated extension strategy. TdT, which is a template-independent DNA polymerase, can catalyze the sequential addition of deoxythymidine triphosphate (dTTP) at the 3'-OH terminus of single-stranded DNA (ssDNA); then, the TdT-yield T-rich DNA nanowires can be employed as the synthetic template of copper nanoclusters (CuNCs). Grown DNA nanowires-templated CuNCs (noted as DNA-CuNCs) were attached onto graphene oxide (GO) surface and exhibited unique electrocatalytic activity to H 2 O 2 reduction. Under optimal conditions, the proposed biosensor was utilized for quantitatively monitoring TdT activity, with the observed LOD of 0.1 U/mL. It also displayed high selectivity to TdT with excellent stability, and offered a facile, convenient electrochemical method for TdT-relevant inhibitors screening. Moreover, the proposed sensor was successfully used for BamHI activity detection, in which a new 3'-OH terminal was exposed by the digestion of a phosphate group. Ultimately, it has good prospects in DNA-related enzyme-based biochemical studies, disease diagnosis, and drug discovery. Graphical Abstract Extraordinary TdT-generated DNA-CuNCs are synthesized and act as a novel electrochemical sensing platform for sensitive detection of TdT and BamHI activity in biological environments.

Insecticidal properties of a crystal protein gene product isolated from Bacillus thuringiensis subsp. kenyae.

PubMed

Masson, L; Moar, W J; van Frankenhuyzen, K; Bossé, M; Brousseau, R

1992-02-01

A protoxin gene, localized to a high-molecular-weight plasmid from Bacillus thuringiensis subsp. kenyae, was cloned on a 19-kb BamHI DNA fragment into Escherichia coli. Characterization of the gene revealed it to be a member of the CryIE toxin subclass which has been reported to be as toxic as the CryIC subclass to larvae from Spodoptera exigua in assays with crude E. coli extracts. To directly test the purified recombinant gene product, the gene was subcloned as a 4.8-kb fragment into an expression vector resulting in the overexpression of a 134-kDa protein in the form of phase-bright inclusions in E. coli. Treatment of solubilized inclusion bodies with either trypsin or gut juice from the silkworm Bombyx mori resulted in the appearance of a protease-resistant 65-kDa protein. In force-feeding bioassays, the purified activated protein was highly toxic to larvae of B. mori but not to larvae of Choristoneura fumiferana. In diet bioassays with larvae from S. exigua, the purified protoxin was nontoxic. However, prior activation of the protoxin by tryptic digestion resulted in the appearance of some toxic activity. These results demonstrate that this new subclass of protein toxin may not be useful for the control of Spodoptera species as previously reported. Hierarchical clustering of the nine known lepidopteran-specific CryI toxin subclasses through multiple sequence alignment suggests that the toxins fall into four possible subgroups or clusters.

Characterization of a major late herpes simplex virus type 1 mRNA.

PubMed

Costa, R H; Devi, B G; Anderson, K P; Gaylord, B H; Wagner, E K

1981-05-01

A major, late 6-kilobase (6-kb) mRNa mapping in the large unique region of herpes simplex virus type 1 (HSV-1) was characterized by using two recombinant DNA clones, one containing EcoRI fragment G (0.190 to 0.30 map units) in lambda. WES.B (L. Enquist, M. Madden, P. Schiop-Stansly, and G. Vandl Woude, Science 203:541-544, 1979) and one containing HindIII fragment J (0.181 to 0.259 map units) in pBR322. This 6-kb mRNA had its 3' end to the left of 0.231 on the prototypical arrangement of the HSV-1 genome and was transcribed from right to left. It was bounded on both sides by regions containing a large number of distinct mRNA species, and its 3' end was partially colinear with a 1.5-kb mRNA which encoded a 35,000-dalton polypeptide. The 6-kb mRNA encoded a 155,000-dalton polypeptide which was shown to be the only one of this size detectable by hybrid-arrested translation encoded by late polyadenylated polyribosomal RNA. The S1 nuclease mapping experiments indicated that there were no introns in the coding sequence for this mRNA and that its 3' end mapped approximately 800 nucleotides to the left of the BglII site at 0.231, whereas its 5' end extended very close to the BamHI site at 0.266.

Terminal Restriction Fragment Length Polymorphism Analysis Program, a Web-Based Research Tool for Microbial Community Analysis

PubMed Central

Marsh, Terence L.; Saxman, Paul; Cole, James; Tiedje, James

2000-01-01

Rapid analysis of microbial communities has proven to be a difficult task. This is due, in part, to both the tremendous diversity of the microbial world and the high complexity of many microbial communities. Several techniques for community analysis have emerged over the past decade, and most take advantage of the molecular phylogeny derived from 16S rRNA comparative sequence analysis. We describe a web-based research tool located at the Ribosomal Database Project web site (http://www.cme.msu.edu/RDP/html/analyses.html) that facilitates microbial community analysis using terminal restriction fragment length polymorphism of 16S ribosomal DNA. The analysis function (designated TAP T-RFLP) permits the user to perform in silico restriction digestions of the entire 16S sequence database and derive terminal restriction fragment sizes, measured in base pairs, from the 5′ terminus of the user-specified primer to the 3′ terminus of the restriction endonuclease target site. The output can be sorted and viewed either phylogenetically or by size. It is anticipated that the site will guide experimental design as well as provide insight into interpreting results of community analysis with terminal restriction fragment length polymorphisms. PMID:10919828

Screening of Israeli Holstein-Friesian cattle for restriction fragment length polymorphisms using homologous and heterologous deoxyribonucleic acid probes.

PubMed

Hallerman, E M; Nave, A; Soller, M; Beckmann, J S

1988-12-01

Genomic DNA of Israeli Holstein-Friesian dairy cattle were screened with a battery of 17 cloned or subcloned DNA probes in an attempt to document restriction fragment length polymorphisms at a number of genetic loci. Restriction fragment length polymorphisms were observed at the chymosin, oxytocin-neurophysin I, lutropin beta, keratin III, keratin VI, keratin VII, prolactin, and dihydrofolate reductase loci. Use of certain genomic DNA fragments as probes produced hybridization patterns indicative of satellite DNA at the respective loci. Means for distinguishing hybridizations to coding sequences for unique genes from those to satellite DNA were developed. Results of this study are discussed in terms of strategy for the systematic development of large numbers of bovine genomic polymorphisms.

Identification of blood meal sources of Lutzomyia longipalpis using polymerase chain reaction-restriction fragment length polymorphism analysis of the cytochrome B gene

PubMed Central

Soares, Vítor Yamashiro Rocha; da Silva, Jailthon Carlos; da Silva, Kleverton Ribeiro; Cruz, Maria do Socorro Pires e; Santos, Marcos Pérsio Dantas; Ribolla, Paulo Eduardo Martins; Alonso, Diego Peres; Coelho, Luiz Felipe Leomil; Costa, Dorcas Lamounier; Costa, Carlos Henrique Nery

2014-01-01

An analysis of the dietary content of haematophagous insects can provide important information about the transmission networks of certain zoonoses. The present study evaluated the potential of polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis of the mitochondrial cytochrome B (cytb) gene to differentiate between vertebrate species that were identified as possible sources of sandfly meals. The complete cytb gene sequences of 11 vertebrate species available in the National Center for Biotechnology Information database were digested with Aci I, Alu I, Hae III and Rsa I restriction enzymes in silico using Restriction Mapper software. The cytb gene fragment (358 bp) was amplified from tissue samples of vertebrate species and the dietary contents of sandflies and digested with restriction enzymes. Vertebrate species presented a restriction fragment profile that differed from that of other species, with the exception of Canis familiaris and Cerdocyon thous. The 358 bp fragment was identified in 76 sandflies. Of these, 10 were evaluated using the restriction enzymes and the food sources were predicted for four: Homo sapiens (1), Bos taurus (1) and Equus caballus (2). Thus, the PCR-RFLP technique could be a potential method for identifying the food sources of arthropods. However, some points must be clarified regarding the applicability of the method, such as the extent of DNA degradation through intestinal digestion, the potential for multiple sources of blood meals and the need for greater knowledge regarding intraspecific variations in mtDNA. PMID:24821056

Chromosome map of the thermophilic archaebacterium Thermococcus celer

NASA Technical Reports Server (NTRS)

Noll, K. M.; Woese, C. R. (Principal Investigator)

1989-01-01

A physical map for the chromosome of the thermophilic archaebacterium Thermococcus celer Vu13 has been constructed. Thirty-four restriction endonucleases were tested for their ability to generate large restriction fragments from the chromosome of T. celer. Of these, the enzymes NheI, SpeI, and XbaI yielded the fewest fragments when analyzed by pulsed-field electrophoresis. NheI and SpeI each gave 5 fragments, while XbaI gave 12. The size of the T. celer chromosome was determined from the sum of the apparent sizes of restriction fragments derived from single and double digests by using these enzymes and was found to be 1,890 +/- 27 kilobase pairs. Partial and complete digests allowed the order of all but three small (less than 15 kilobase pairs) fragments to be deduced. These three fragments were assigned positions by using hybridization probes derived from these restriction fragments. The positions of the other fragments were confirmed by using hybridization probes derived in the same manner. The positions of the 5S, 16S, and 23S rRNA genes as well as the 7S RNA gene were located on this map by using cloned portions of these genes as hybridization probes. The 5S rRNA gene was localized 48 to 196 kilobases from the 5' end of the 16S gene. The 7S RNA gene was localized 190 to 504 kilobases from the 3' end of the 23S gene. These analyses demonstrated that the chromosome of T. celer is a single, circular DNA molecule. This is the first such demonstration of the structure of an archaebacterial chromosome.

Molecular epidemiology of Escherichia coli O157:H7 strains by bacteriophage lambda restriction fragment length polymorphism analysis: application to a multistate foodborne outbreak and a day-care center cluster.

PubMed

Samadpour, M; Grimm, L M; Desai, B; Alfi, D; Ongerth, J E; Tarr, P I

1993-12-01

Genomic DNAs prepared from 168 isolates of Escherichia coli O157:H7 were analyzed for restriction fragment length polymorphisms on Southern blots probed with bacteriophage lambda DNA. The isolates analyzed included strains from a recent large multistate outbreak of E. coli O157:H7 infection associated with consumption of poorly cooked beef in restaurants, a day-care center cluster, and temporally and geographically unrelated isolates. E. coli O157:H7 isolates recovered from the incriminated meat and from 61 (96.8%) of 63 patients from Washington and Nevada possessed identical lambda restriction fragment length patterns. The lambda restriction fragment length polymorphisms observed in 11 (91.7%) of 12 day-care center patients were identical, but they differed from that of the strain associated with the multistate outbreak. E. coli O157:H7 from 42 patients temporally or geographically unrelated to either cluster of infection possessed unique and different lambda restriction fragment length patterns, except for paired isolates from three separate clusters of infection. These data demonstrate that the hybridization of DNA digests of E. coli O157:H7 with radiolabelled bacteriophage lambda DNA can be a useful, stable, and discriminatory epidemiologic tool for analyzing the linkage between strains of E. coli O157:H7.

Repair of x-ray-induced DNA double-strand breaks in specific Not I restriction fragments in human fibroblasts: joining of correct and incorrect ends

NASA Technical Reports Server (NTRS)

Lobrich, M.; Rydberg, B.; Cooper, P. K.; Chatterjee, A. (Principal Investigator)

1995-01-01

An assay that allows measurement of absolute induction frequencies for DNA double-strand breaks (dsbs) in defined regions of the genome and that quantitates rejoining of correct DNA ends has been used to study repair of dsbs in normal human fibroblasts after x-irradiation. The approach involves hybridization of single-copy DNA probes to Not I restriction fragments separated according to size by pulsed-field gel electrophoresis. Induction of dsbs is quantitated from the decrease in the intensity of the hybridizing restriction fragment and an accumulation of a smear below the band. Rejoining of dsbs results in reconstitution of the intact restriction fragment only if correct DNA ends are joined. By comparing results from this technique with results from a conventional electrophoresis assay that detects all rejoining events, it is possible to quantitate the misrejoining frequency. Three Not I fragments on the long arm of chromosome 21 were investigated with regard to dsb induction, yielding an identical induction rate of 5.8 X 10(-3) break per megabase pair per Gy. Correct dsb rejoining was measured for two of these Not I fragments after initial doses of 80 and 160 Gy. The misrejoining frequency was about 25% for both fragments and was independent of dose. This result appears to be representative for the whole genome as shown by analysis of the entire Not I fragment distribution. The correct rejoining events primarily occurred within the first 2 h, while the misrejoining kinetics included a much slower component, with about half of the events occurring between 2 and 24 h. These misrejoining kinetics are similar to those previously reported for production of exchange aberrations in interphase chromosomes.

Magnetic bead/capture DNA/glucose-loaded nanoliposomes for amplifying the glucometer signal in the rapid screening of hepatitis C virus RNA.

PubMed

Tu, Haijian; Lin, Kun; Lun, Yongzhi; Yu, Liuming

2018-06-01

A digital detection strategy based on a portable personal glucometer (PGM) was developed for the simple, rapid, and sensitive detection of hepatitis C virus (HCV) RNA, involving the release of glucose-loaded nanoliposomes due to coupling-site-specific cleavage by the endonuclease BamHI. The glucose-loaded nanoliposomes were synthesized using a reversed-phase evaporation method and provided an amplified signal at the PGM in the presence of HCV RNA. Initially, a 21-mer oligonucleotide complementary to HCV RNA was covalently conjugated to a magnetic bead through the amino group at the 5' end of the oligonucleotide, and then bound to a glucose-loaded liposome by typical carbodiimide coupling at its 3' end. In the presence of the target HCV RNA, the target hybridized with the oligonucleotide to form double-stranded DNA. The symmetrical duplex sequence 5'-GGATCC-3' between guanines was then catalytically cleaved by BamHI, which detached the glucose-loaded liposome from the magnetic bead. Following magnetic separation of the bead, the detached glucose-loaded liposome was lysed using Triton X-100 to release the glucose molecules within it, which were then detected as an amplified signal at the digital PGM. Under optimal conditions, the PGM signal increased with increasing HCV RNA, and displayed a strongly linear dependence on the level of HCV RNA for concentrations ranging from 10 pM to 1.0 μM. The detection limit (LOD) of the system was 1.9 pM. Good reproducibility and favorable specificity were achieved in the analysis of the target HCV RNA. Human serum samples containing HCV RNA were analyzed using this strategy, and the developed sensing platform was observed to yield satisfactory results based on a comparison with the corresponding results from a Cobas ® Amplicor HCV Test Analyzer. Graphical abstract A digital detection strategy utilizing a personal glucometer was developed for the detection of hepatitis C virus RNA. The strategy involved the use of the endonuclease BamHI along with a 21-mer oligonucleotide conjugated to both a magnetic bead and a glucose-loaded nanoliposome. Hybridization of the nucleotide with the target RNA triggered the coupling-site-specific cleavage of the duplex by BamHI, leading to the release of the glucose-loaded nanoliposome. Following separation of the magnetic bead, the free nanoliposome was dissolved, liberating the glucose molecules within it, which in turn were detected as an amplified signal by the glucometer.

Molecular Determination of Fasciola Spp. Isolates from Domestic Ruminants Fecal Samples in the Northwest of Iran

PubMed Central

IMANI BARAN, Abbas; CHERAGHI SARAY, Habib; KATIRAEE, Farzad

2017-01-01

Background: Fasciola species are the main causes for fascioliasis with great financial losses and are among the most important food/water-borne parasites worldwide. The basic proceedings such as epidemiology and effective control of fascioliasis rely mainly on precise identification of Fasciola species. The present study was conducted to determine the Fasciola species in ruminant fecal samples from East Azerbaijan Province in Iran. Methods: Overall, 2012 fecal samples were collected and processed initially for microscopic examination of Fasciola eggs in 2014–15. Then, recovered eggs were subjected to molecular identification. A fragment of 618 bp of the 28S rRNA gene pertaining to Fasciola genus was amplified under PCR. The amplified fragment was restricted by fast digest Ava II enzyme in order to a Restriction Fragment Length Polymorphism. Results: Based on microscopic examination, 72 samples were infected, from which, 10 and 62 cases pertained to cattle and sheep samples respectively. Based on RFLP, the PCR products restricted by the Ava II restriction enzyme produced 529 bp fragments only. According to the positive controls, all restriction patterns were related to Fasciola hepatica, while no restriction patterns were linked to F. gigantica. Conclusion: Based on PCR-RFLP, F. hepatica was dominant species in animals of the studied areas and no evidence of F. gigantica was observed. Therefore, further field studies to verify these results are suggested. PMID:28761485

MULTIPLE ENZYME RESTRICTION FRAGMENT LENGTH POLYMORPHISM ANALYSIS FOR HIGH RESOLUTION DISTINCTION OF PSEUDOMONAS (SENSU STRICTO) 16S RRNA GENES

EPA Science Inventory

Pseudomonas specific 16S rDNA PCR amplification and multiple enzyme restriction fragment length polymorphism (MERFLP) analysis using a single digestion mixture of Alu I, Hinf I, Rsa I, and Tru 9I distinguished 150 published sequences and reference strains of authentic Pseudomonas...

Statistical Assessment of Variability of Terminal Restriction Fragment Length Polymorphism Analysis Applied to Complex Microbial Communities ▿ †

PubMed Central

Rossi, Pierre; Gillet, François; Rohrbach, Emmanuelle; Diaby, Nouhou; Holliger, Christof

2009-01-01

The variability of terminal restriction fragment polymorphism analysis applied to complex microbial communities was assessed statistically. Recent technological improvements were implemented in the successive steps of the procedure, resulting in a standardized procedure which provided a high level of reproducibility. PMID:19749066

Characterization of the Origin of DNA Replication of the Coxiella burnetii Chromosome

DTIC Science & Technology

1990-01-26

chromosomal DNAs (FIG. IB): the 19.4-kb EcoR I fragment of Salmonella typhimurium DNA (lane 4),9 the 17.5-kb Sal I fragment of Enterobacter aerogenes ...IacZYA-argF) U 1694680d IacZAM15 Salmonella typhimurium Wild type WVUd Kiebsiella pneumoniae Wild type WVUd Enterobacter aero genes Wild type WVUd... aerogenes and K. pneumoniae were digested with appropriate restriction enzymes. The restriction fragments were separated on a 0.9% agarose gel, transferred to

Cloning and study of the pectate lyase gene of Erwinia carotovora

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bukanov, N.O.; Fonshtein, M.Yu.; Evtushenkov, A.N.

1986-04-01

The cloning of the gene of a secretable protein of Erwinia carotovora, pectate lyase, in Escherichia coli was described. Primary cloning was conducted using the phage vector lambda 47.1. In the gene library of E. carotovora obtained, eight phages carrying the gene sought were identified according to the appearance of enzymatic activity of the gene product, pectate lyase, in situ. The BamHI fragment of DNA, common to all these phages, was recloned on the plasmid pUC19. It was shown that the cloned pectate lyase gene is represented on the E. carotovora chromosome in one copy. Methods of production of representativemore » gene libraries on phage vectors from no less than 1 ..mu..g of cloned DNA even for the genomes of eukaryotes have now been developed. Vectors have been created, for example, lambda 47.1, permitting the selection only of hybrid molecules. A number of methods have been developed for the search for a required gene in the library, depending on whether the cloned gene can be expressed or not, and if it can, what properties it will impart to the hybrid clone containing it.« less

Construction of a novel shuttle vector for use in Gluconobacter oxydans.

PubMed

Zhang, Lin; Lin, Jinping; Ma, Yushu; Wei, Dongzhi; Sun, Ming

2010-11-01

A shuttle vector pZL1 which can replicate both in Gluconobacter oxydans and Escherichia coli was constructed based on G. oxydans DSM2003 cryptic plasmid pGOX3, a homology of G. oxydans 621H pGOX3, and E. coli cloning vector pUC18. It was found to be stably maintained in G. oxydans during the serial subcultures in the absence of antibiotic pressure for 144 h. With pGOX3 as the reference sample, the relative copy number of pZL1 in G. oxydans is 13 determined by real-time fluorescence quantitative PCR (qPCR). The copy number of pZL1 is much higher than pBBR1MCS5 in E. coli. The vector pZL1 contains six commonly used restriction endonuclease sites, HindIII, SalI, XbaI, BamHI, SmaI, KpnI, and SacI, and is easy to manipulate in molecular biology experiments. The shuttle vector was used to express a reporter protein wasabi successfully in G. oxydans DSM2003 under the control of the tufB promoter.

A new assay based on terminal restriction fragment length polymorphism of homocitrate synthase gene fragments for Candida species identification.

PubMed

Szemiako, Kasjan; Śledzińska, Anna; Krawczyk, Beata

2017-08-01

Candida sp. have been responsible for an increasing number of infections, especially in patients with immunodeficiency. Species-specific differentiation of Candida sp. is difficult in routine diagnosis. This identification can have a highly significant association in therapy and prophylaxis. This work has shown a new application of the terminal restriction fragment length polymorphism (t-RFLP) method in the molecular identification of six species of Candida, which are the most common causes of fungal infections. Specific for fungi homocitrate synthase gene was chosen as a molecular target for amplification. The use of three restriction enzymes, DraI, RsaI, and BglII, for amplicon digestion can generate species-specific fluorescence labeled DNA fragment profiles, which can be used to determine the diagnostic algorithm. The designed method can be a cost-efficient high-throughput molecular technique for the identification of six clinically important Candida species.

Methods for producing partially digested restriction DNA fragments and for producing a partially modified PCR product

DOEpatents

Wong, Kwong-Kwok

2000-01-01

The present invention is an improved method of making a partially modified PCR product from a DNA fragment with a polymerase chain reaction (PCR). In a standard PCR process, the DNA fragment is combined with starting deoxynucleoside triphosphates, a primer, a buffer and a DNA polymerase in a PCR mixture. The PCR mixture is then reacted in the PCR producing copies of the DNA fragment. The improvement of the present invention is adding an amount of a modifier at any step prior to completion of the PCR process thereby randomly and partially modifying the copies of the DNA fragment as a partially modified PCR product. The partially modified PCR product may then be digested with an enzyme that cuts the partially modified PCR product at unmodified sites thereby producing an array of DNA restriction fragments.

Rapid estimation of microbial populations in fish samples by using terminal restriction fragment length polymorphism analysis of 16S rDNA.

PubMed

Tanaka, Yuichiro; Takahashi, Hajime; Kitazawa, Nao; Kimura, Bon

2010-01-01

A rapid system using terminal restriction fragment length polymorphism (T-RFLP) analysis targeting 16S rDNA is described for microbial population analysis in edible fish samples. The defined terminal restriction fragment database was constructed by collecting 102 strains of bacteria representing 53 genera that are associated with fish. Digestion of these 102 strains with two restriction enzymes, HhaI and MspI, formed 54 pattern groups with discrimination to the genus level. This T-RFLP system produced results comparable to those from a culture-based method in six natural fish samples with a qualitative correspondence of 71.4 to 92.3%. Using the T-RFLP system allowed an estimation of the microbial population within 7 h. Rapid assay of the microbial population is advantageous for food manufacturers and testing laboratories; moreover, the strategy presented here allows adaptation to specific testing applications.

Identification of Pork Contamination in Meatballs of Indonesia Local Market Using Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP) Analysis

PubMed Central

Erwanto, Yuny; Abidin, Mohammad Zainal; Sugiyono, Eko Yasin Prasetyo Muslim; Rohman, Abdul

2014-01-01

This research applied and evaluated a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) using cytochrome b gene to detect pork contamination in meatballs from local markets in Surabaya and Yogyakarta regions, Indonesia. To confirm the effectiveness and specificity of this fragment, thirty nine DNA samples from different meatball shops were isolated and amplified, and then the PCR amplicon was digested by BseDI restriction enzyme to detect the presence of pork in meatballs. BseDI restriction enzyme was able to cleave porcine cytochrome b gene into two fragments (131 bp and 228 bp). Testing the meatballs from the local market showed that nine of twenty meatball shops in Yogyakarta region were detected to have pork contamination, but there was no pork contamination in meatball shops in Surabaya region. In conclusion, specific PCR amplification of cytochrome b gen and cleaved by BseDI restriction enzymes seems to be a powerful technique for the identification of pork presence in meatball because of its simplicity, specificity and sensitivity. Furthermore, pork contamination intended for commercial products of sausage, nugget, steak and meat burger can be checked. The procedure is also much cheaper than other methods based on PCR, immunodiffusion and other techniques that need expensive equipment. PMID:25178301

Identification of Pork Contamination in Meatballs of Indonesia Local Market Using Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP) Analysis.

PubMed

Erwanto, Yuny; Abidin, Mohammad Zainal; Sugiyono, Eko Yasin Prasetyo Muslim; Rohman, Abdul

2014-10-01

This research applied and evaluated a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) using cytochrome b gene to detect pork contamination in meatballs from local markets in Surabaya and Yogyakarta regions, Indonesia. To confirm the effectiveness and specificity of this fragment, thirty nine DNA samples from different meatball shops were isolated and amplified, and then the PCR amplicon was digested by BseDI restriction enzyme to detect the presence of pork in meatballs. BseDI restriction enzyme was able to cleave porcine cytochrome b gene into two fragments (131 bp and 228 bp). Testing the meatballs from the local market showed that nine of twenty meatball shops in Yogyakarta region were detected to have pork contamination, but there was no pork contamination in meatball shops in Surabaya region. In conclusion, specific PCR amplification of cytochrome b gen and cleaved by BseDI restriction enzymes seems to be a powerful technique for the identification of pork presence in meatball because of its simplicity, specificity and sensitivity. Furthermore, pork contamination intended for commercial products of sausage, nugget, steak and meat burger can be checked. The procedure is also much cheaper than other methods based on PCR, immunodiffusion and other techniques that need expensive equipment.

Inheritance of restriction fragment length polymorphisms, random amplified polymorphic DNAs and isozymes in coastal Douglas-fir

Treesearch

K.D. Jermstad; A.M. Reem; J.R. Henifin; N.C. Wheeler; D.B Neale

1994-01-01

A total of 225 new genetic loci [151 restriction fragment length polymorphisms (RFLP) and 74 random amplified polymorphic DNAs (RAPD)] in coastal Douglas- fir [Pseudotsuga menziesii (Mirb.) Franco var. menziesii] have been identified using a three-generation outbred pedigree. The Mendelian inheritance of 16 RFLP loci and 29...

Telomere Restriction Fragment (TRF) Analysis.

PubMed

Mender, Ilgen; Shay, Jerry W

2015-11-20

While telomerase is expressed in ~90% of primary human tumors, most somatic tissue cells except transiently proliferating stem-like cells do not have detectable telomerase activity (Shay and Wright, 1996; Shay and Wright, 2001). Telomeres progressively shorten with each cell division in normal cells, including proliferating stem-like cells, due to the end replication (lagging strand synthesis) problem and other causes such as oxidative damage, therefore all somatic cells have limited cell proliferation capacity (Hayflick limit) (Hayflick and Moorhead, 1961; Olovnikov, 1973). The progressive telomere shortening eventually leads to growth arrest in normal cells, which is known as replicative senescence (Shay et al. , 1991). Once telomerase is activated in cancer cells, telomere length is stabilized by the addition of TTAGGG repeats to the end of chromosomes, thus enabling the limitless continuation of cell division (Shay and Wright, 1996; Shay and Wright, 2001). Therefore, the link between aging and cancer can be partially explained by telomere biology. There are many rapid and convenient methods to study telomere biology such as Telomere Restriction Fragment (TRF), Telomere Repeat Amplification Protocol (TRAP) (Mender and Shay, 2015b) and Telomere dysfunction Induced Foci (TIF) analysis (Mender and Shay, 2015a). In this protocol paper we describe Telomere Restriction Fragment (TRF) analysis to determine average telomeric length of cells. Telomeric length can be indirectly measured by a technique called Telomere Restriction Fragment analysis (TRF). This technique is a modified Southern blot, which measures the heterogeneous range of telomere lengths in a cell population using the length distribution of the terminal restriction fragments (Harley et al. , 1990; Ouellette et al. , 2000). This method can be used in eukaryotic cells. The description below focuses on the measurement of human cancer cells telomere length. The principle of this method relies on the lack of restriction enzyme recognition sites within TTAGGG tandem telomeric repeats, therefore digestion of genomic DNA, not telomeric DNA, with a combination of 6 base restriction endonucleases reduces genomic DNA size to less than 800 bp.

Linkage map of the fragments of herpesvirus papio DNA.

PubMed Central

Lee, Y S; Tanaka, A; Lau, R Y; Nonoyama, M; Rabin, H

1981-01-01

Herpesvirus papio (HVP), an Epstein-Barr-like virus, causes lymphoblastoid disease in baboons. The physical map of HVP DNA was constructed for the fragments produced by cleavage of HVP DNA with restriction endonucleases EcoRI, HindIII, SalI, and PvuI, which produced 12, 12, 10, and 4 fragments, respectively. The total molecular size of HVP DNA was calculated as close to 110 megadaltons. The following methods were used for construction of the map; (i) fragments near the ends of HVP DNA were identified by treating viral DNA with lambda exonuclease before restriction enzyme digestion; (ii) fragments containing nucleotide sequences in common with fragments from the second enzyme digest of HVP DNA were examined by Southern blot hybridization; and (iii) the location of some fragments was determined by isolating individual fragments from agarose gels and redigesting the isolated fragments with a second restriction enzyme. Terminal heterogeneity and internal repeats were found to be unique features of HVP DNA molecule. One to five repeats of 0.8 megadaltons were found at both terminal ends. Although the repeats of both ends shared a certain degree of homology, it was not determined whether they were identical repeats. The internal repeat sequence of HVP DNA was found in the EcoRI-C region, which extended from 8.4 to 23 megadaltons from the left end of the molecule. The average number of the repeats was calculated to be seven, and the molecular size was determined to be 1.8 megadaltons. Similar unique features have been reported in EBV DNA (D. Given and E. Kieff, J. Virol. 28:524-542, 1978). Images PMID:6261015

Mapped DNA probes from Ioblolly pine can be used for restriction fragment length polymorphism mapping in other conifers

Treesearch

M.R. Ahuja; M.E. Devey; A.T. Groover; K.D. Jermstad; D.B Neale

1994-01-01

A high-density genetic map based on restriction fragment length polymorphisms (RFLPs) is being constructed for loblolly pine (Pinus taeda L.). Consequently, a large number of DNA probes from loblolly pine are potentially available for use in other species. We have used some of these DNA probes to detect RFLPs in 12 conifers and an angiosperm....

Physical and genetic map of Streptococcus thermophilus A054.

PubMed Central

Roussel, Y; Pebay, M; Guedon, G; Simonet, J M; Decaris, B

1994-01-01

The three restriction endonucleases SfiI, BssHII, and SmaI were found to generate fragments with suitable size distributions for mapping the genome of Streptococcus thermophilus A054. A total of 5, 8, and 24 fragments were produced with SfiI, BssHII, and SmaI, respectively. An average genome size of 1,824 kb was determined by summing the total fragment sizes obtained by digestions with these three enzymes. Partial and multiple digestions of genomic DNA in conjunction with Southern hybridization were used to map SfiI, BssHII, and SmaI fragments. All restriction fragments were arranged in a unique circular chromosome. Southern hybridization analysis with specific probes allowed 23 genetic markers to be located on the restriction map. Among them, six rrn loci were precisely located. The area of the chromosome containing the ribosomal operons was further detailed by mapping some of the ApaI and SgrAI sites. Comparison of macrorestriction patterns from three clones derived from strain A054 revealed two variable regions in the chromosome. One was associated with the tandem rrnD and rrnE loci, and the other was mapped in the region of the lactose operon. Images PMID:8002562

Restriction/modification polypeptides, polynucleotides, and methods

DOEpatents

Westpheling, Janet; Chung, DaeHwan; Huddleston, Jennifer; Farkas, Joel A

2015-02-24

The present invention relates to the discovery of a novel restriction/modification system in Caldicellulosiruptor bescii. The discovered restriction enzyme is a HaeIII-like restriction enzyme that possesses a thermophilic activity profile. The restriction/modification system also includes a methyltransferase, M.CbeI, that methylates at least one cytosine residue in the CbeI recognition sequence to m.sup.4C. Thus, the invention provides, in various aspects, isolated CbeI or M.CbeI polypeptides, or biologically active fragments thereof; isolated polynucleotides that encode the CbeI or M.CbeI polypeptides or biologically active fragments thereof, including expression vectors that include such polynucleotide sequences; methods of digesting DNA using a CbeI polypeptide; methods of treating a DNA molecule using a M.CbeI polypeptide; and methods of transforming a Caldicellulosiruptor cell.

Novel strategies to construct complex synthetic vectors to produce DNA molecular weight standards.

PubMed

Chen, Zhe; Wu, Jianbing; Li, Xiaojuan; Ye, Chunjiang; Wenxing, He

2009-05-01

DNA molecular weight standards (DNA markers, nucleic acid ladders) are commonly used in molecular biology laboratories as references to estimate the size of various DNA samples in electrophoresis process. One method of DNA marker production is digestion of synthetic vectors harboring multiple DNA fragments of known sizes by restriction enzymes. In this article, we described three novel strategies-sequential DNA fragment ligation, screening of ligation products by polymerase chain reaction (PCR) with end primers, and "small fragment accumulation"-for constructing complex synthetic vectors and minimizing the mass differences between DNA fragments produced from restrictive digestion of synthetic vectors. The strategy could be applied to construct various complex synthetic vectors to produce any type of low-range DNA markers, usually available commercially. In addition, the strategy is useful for single-step ligation of multiple DNA fragments for construction of complex synthetic vectors and other applications in molecular biology field.

Rapid identification of Campylobacter, Arcobacter, and Helicobacter isolates by PCR-restriction fragment length polymorphism analysis of the 16S rRNA gene.

PubMed

Marshall, S M; Melito, P L; Woodward, D L; Johnson, W M; Rodgers, F G; Mulvey, M R

1999-12-01

A rapid two-step identification scheme based on PCR-restriction fragment length polymorphism (PCR-RFLP) analysis of the 16S rRNA gene was developed in order to differentiate isolates belonging to the Campylobacter, Arcobacter, and Helicobacter genera. For 158 isolates (26 reference cultures and 132 clinical isolates), specific RFLP patterns were obtained and species were successfully identified by this assay.

Pathological and Molecular Characterization of Xanthomonas campestris Strains Causing Diseases of Cassava (Manihot esculenta)

PubMed Central

Verdier, Valérie; Boher, Bernard; Maraite, Henri; Geiger, Jean-Paul

1994-01-01

Fifty-one strains representing Xanthomonas campestris pv. manihotis and cassavae and different pathovars occurring on plants of the family Euphorbiaceae were characterized by ribotyping with a 16S+23S rRNA probe of Escherichia coli and by restriction fragment length polymorphism analysis with a plasmid probe from X. campestris pv. manihotis. Pathogenicity tests were performed on cassava (Manihot esculenta). Histological comparative studies were conducted on strains of two pathovars of X. campestris (vascular and mesophyllic) that attack cassava. Our results indicated that X. campestris pv. manihotis and cassavae have different modes of action in the host and supplemented the taxonomic data on restriction fragment length polymorphism that clearly separate the two pathovars. The plasmid probe could detect multiple restriction fragment length polymorphisms among strains of the pathovar studied. Ribotyping provides a useful tool for rapid identification of X. campestris pathovars on cassava. Images PMID:16349463

Improved coverage of cDNA-AFLP by sequential digestion of immobilized cDNA.

PubMed

Weiberg, Arne; Pöhler, Dirk; Morgenstern, Burkhard; Karlovsky, Petr

2008-10-13

cDNA-AFLP is a transcriptomics technique which does not require prior sequence information and can therefore be used as a gene discovery tool. The method is based on selective amplification of cDNA fragments generated by restriction endonucleases, electrophoretic separation of the products and comparison of the band patterns between treated samples and controls. Unequal distribution of restriction sites used to generate cDNA fragments negatively affects the performance of cDNA-AFLP. Some transcripts are represented by more than one fragment while other escape detection, causing redundancy and reducing the coverage of the analysis, respectively. With the goal of improving the coverage of cDNA-AFLP without increasing its redundancy, we designed a modified cDNA-AFLP protocol. Immobilized cDNA is sequentially digested with several restriction endonucleases and the released DNA fragments are collected in mutually exclusive pools. To investigate the performance of the protocol, software tool MECS (Multiple Enzyme cDNA-AFLP Simulation) was written in Perl. cDNA-AFLP protocols described in the literature and the new sequential digestion protocol were simulated on sets of cDNA sequences from mouse, human and Arabidopsis thaliana. The redundancy and coverage, the total number of PCR reactions, and the average fragment length were calculated for each protocol and cDNA set. Simulation revealed that sequential digestion of immobilized cDNA followed by the partitioning of released fragments into mutually exclusive pools outperformed other cDNA-AFLP protocols in terms of coverage, redundancy, fragment length, and the total number of PCRs. Primers generating 30 to 70 amplicons per PCR provided the highest fraction of electrophoretically distinguishable fragments suitable for normalization. For A. thaliana, human and mice transcriptome, the use of two marking enzymes and three sequentially applied releasing enzymes for each of the marking enzymes is recommended.

Electrochemical detection of the MT-ND6 gene and its enzymatic digestion: application in human genomic sample.

PubMed

Mazloum-Ardakani, Mohammad; Ahmadi, Roya; Heidari, Mohammad Mehdi; Sheikh-Mohseni, Mohammad Ali

2014-06-15

A simple electrochemical biosensor was developed for the detection of the mitochondrial NADH dehydrogenase 6 gene (MT-ND6) and its enzymatic digestion by BamHI enzyme. This biosensor was fabricated by modification of a glassy carbon electrode with gold nanoparticles (AuNPs/GCE) and a probe oligonucleotide (ssDNA/AuNPs/GCE). The probe, which is a thiolated segment of the MT-ND6 gene, was deposited by self-assembling immobilization on AuNPs/GCE. Two indicators including methylene blue (MB) and neutral red (NR) were used as the electroactive indicators and the electrochemical response of the modified electrode was measured by differential pulse voltammetry. The proposed biosensor can detect the complementary sequences of the MT-ND6 gene. Also the modified electrode was used for the detection of an enzymatic digestion process by BamHI enzyme. The electrochemical biosensor can detect the MT-ND6 gene and its enzymatic digestion in polymerase chain reaction (PCR)-amplified DNA extracted from human blood. Also the biosensor was used directly for detection of the MT-ND6 gene in all of the human genome. Copyright © 2014 Elsevier Inc. All rights reserved.

Community analysis of preservative-treated southern pine (Pinus spp.) using terminal restriction fragment length polymorphism (T-RFLP) analysis. Part 1: Fungal field study

Treesearch

Grant T. Kirker; M. Lynn Prewitt; Tor P. Schultz; Susan V. Dieh

2012-01-01

The effects of chlorothalonil (CTN), butylated hydroxytoluene (BHT), and ammoniacal copper quat (ACQ-C) on the fungal community on southern yellow pine (SYP) were assessed using terminal restriction fragment length polymorphism (T-RFLP) analysis over 15 months. Field stakes, treated with 0.25 and 0.37 % ACQ-C, 0.1 and 0.25 % CTN, 2 % BHT alone, 0.1 and 0.25 % CTN...

Community analysis of preservative-treated southern pine (Pinus spp.) using terminal restriction fragment length polymorphism (T-RFLP) analysis

Treesearch

Grant T. Kirker; M. Lynn Prewitt; Walter J. Diehl; Susan V. Diehl

2012-01-01

The effects of wood preservatives on the bacterial community in southern yellow pine were assessed by the molecular method ‘terminal restriction fragment length polymorphism’ (T-RFLP). Stakes, treated with 0.25 % and 0.37 % ammoniacal copper quat (ACQ-C), 0.1 % and 0.25 % chlorothalonil (CTN), 0.1 % and 0.25 % CTN with 2 % butylated hydroxytoluene (BHT), and 2 % BHT...

[The transfection and expression of IL-1ra gene to the rabbit cornea in situ via cation polymer mediation].

PubMed

Yuan, Jin; Chen, Jia-qi; Zhou, Shi-you; Liu, Zu-guo; Wang, Zhi-chong; Gu, Jian-jun

2006-08-01

To investigate the efficiency and safety of transfection of PEGFP-IL-1ra plasmid via cation polymer mediation (poly-ethylenimine, PEI) by injection into the corneal stroma. Human IL-1ra cDNA fragments were cloned by RT-PCR. Plasmid PEGFP-hIL-1ra recombinants were constructed and transferred into corneal endothelial cells (CEC) via cation polymer mediation. Expression of IL-1ra mRNA and IL-1ra was detected by green fluorescent protein (GFP) and Western-blotting. In the experiment group, 20 microl preparation containing 10 microg plasmid PEGFP-hIL-1ra recombinants and PEI-in-vivo was injected into the corneal stroma of Wistar rats (n = 30). Equivalent PEI-in-vivo solution was injected into another 15 corneas as the controls. Corneas were harvested at different time points (day 1, 3, 6, 14 and 21) after injection. The changes of tissue structure and function after IL-1ra in situ transfection were studied by HE staining, transmission electron microscopy, trypan blue-alizarin red staining and immunohistochemistry. The location and intensity of IL-1ra-GFP fusion protein expression were monitored by fluorescence microscopy. The size of the RT-PCR product of hIL-1ra fragments was approximately 500 bp in agarose gel electrophoresis. Restrictive enzyme digestion analysis of PstI, BamHI and DNA sequence analysis showed that expression of plasmid PEGFP-hIL-1ra recombinants had been constructed successfully. Twelve hours after the transfection of PEGFP-hIL-1ra, GFP fluorescence was detected in 10% - 15% endothelial cells. IL-1ra protein (RMW: 44,000) was detected by Western-blotting. In PEGFP-hIL-1ra treated group, fluorescence was appeared at day 1 in cornea basal epithelial cells, peaked at day 6 in whole cornea, began to weaken at day 14, and only weak fluorescence remained in cornea epithelial cells at day 21. No fluorescence appeared in the control group. No significant pathologic changes could be found in HE stained cornea tissues in both transfected group and the controls. p63 immunocytochemical staining in cornea epithelium was positive in both groups. Trypan blue-alizarin red staining confirmed that there was no damage in cornea endothelial cells. IL-1ra-GFP granules could be found by transmission electron microscope in every layer of cornea in the transfected group, but none in the controls. There was no impairment in the ultrastructure of cells in both groups. By direct injection of PEGFP-hIL-1ra into corneal stroma and mediated by cation polymer, IL-1ra genes could be transferred and expressed in corneal tissue efficiently and safely, and might provide a novel technique of gene transfection to cornea in situ.

Antigen recognition by H-2-restricted T cells. I. Cell-free antigen processing

PubMed Central

1983-01-01

We examined the ability of a set of cloned chicken ovalbumin (cOVA)- specific, Id-restricted, T cell hybridomas to produce interleukin-2 in response to cOVA presented by the Ia+ B cell lymphoma line, A20-2J. Although viable A20-2J cells presented native, denatured, and fragmented cOVA more or less equally well, A20-2J cells that were glutaraldehyde-fixed could present only enzymatically or chemically fragmented cOVA. These results suggest that antigen fragmentation may be both necessary and sufficient to define accessory cell processing of soluble antigens so that they may be recognized in association with I- region molecules by T cells. PMID:6193218

Typing of Human Mycobacterium avium Isolates in Italy by IS1245-Based Restriction Fragment Length Polymorphism Analysis

PubMed Central

Lari, Nicoletta; Cavallini, Michela; Rindi, Laura; Iona, Elisabetta; Fattorini, Lanfranco; Garzelli, Carlo

1998-01-01

All but 2 of 63 Mycobacterium avium isolates from distinct geographic areas of Italy exhibited markedly polymorphic, multibanded IS1245 restriction fragment length polymorphism (RFLP) patterns; 2 isolates showed the low-number banding pattern typical of bird isolates. By computer analysis, 41 distinct IS1245 patterns and 10 clusters of essentially identical strains were detected; 40% of the 63 isolates showed genetic relatedness, suggesting the existence of a predominant AIDS-associated IS1245 RFLP pattern. PMID:9817900

Random-breakage mapping method applied to human DNA sequences

NASA Technical Reports Server (NTRS)

Lobrich, M.; Rydberg, B.; Cooper, P. K.; Chatterjee, A. (Principal Investigator)

1996-01-01

The random-breakage mapping method [Game et al. (1990) Nucleic Acids Res., 18, 4453-4461] was applied to DNA sequences in human fibroblasts. The methodology involves NotI restriction endonuclease digestion of DNA from irradiated calls, followed by pulsed-field gel electrophoresis, Southern blotting and hybridization with DNA probes recognizing the single copy sequences of interest. The Southern blots show a band for the unbroken restriction fragments and a smear below this band due to radiation induced random breaks. This smear pattern contains two discontinuities in intensity at positions that correspond to the distance of the hybridization site to each end of the restriction fragment. By analyzing the positions of those discontinuities we confirmed the previously mapped position of the probe DXS1327 within a NotI fragment on the X chromosome, thus demonstrating the validity of the technique. We were also able to position the probes D21S1 and D21S15 with respect to the ends of their corresponding NotI fragments on chromosome 21. A third chromosome 21 probe, D21S11, has previously been reported to be close to D21S1, although an uncertainty about a second possible location existed. Since both probes D21S1 and D21S11 hybridized to a single NotI fragment and yielded a similar smear pattern, this uncertainty is removed by the random-breakage mapping method.

Genetic Variation within a Lotic Population of Janthinobacterium lividum

PubMed Central

Saeger, Jennifer L.; Hale, Alan B.

1993-01-01

An understanding of the genetic variation within and between populations should allow scientists to address many problems, including those associated with endangered species and the release of genetically modified organisms into the environment. With respect to microorganisms, the release of genetically engineered microorganisms is likely to increase dramatically given the current growth in the bioremediation industry. In this study, genetic variation within a lotic, bacterial population of Janthinobacterium lividum was measured with restriction fragment length polymorphism analysis. Chromosomal DNA from 10 Kettle Creek (Hawk Mountain Sanctuary, Kempton, Pa.) J. lividum isolates was digested with six restriction endonucleases and probed with a 7.5-kb pKK3535 fragment containing the E. coli rrnB rRNA operon. Genetic variation, as measured in terms of nucleotide diversity, was high within the population. The 0.0781 value for genetic variation was especially high given the conservative nature of the genetic probe. The average percent similarity among isolates within the population was 67.25%. Pairwise comparisons of nucleotide diversity values (π) and similarity coefficients (F) yielded values ranging from 0.0032 to 0.1816 and 0.3363 to 0.9808, respectively. Putative clonemates were not present within the group of isolates; however, all isolates shared 14 fragments across a spectrum of six restriction enzymes. The presence of these common fragments indicates that restriction fragment length polymorphism analysis may provide population- or species-specific diagnostic markers for J. lividum. Data that suggest a plume effect with respect to the downstream movement of J. lividum are also presented. An increase in genetic variation within groups of isolates along the longitudinal gradient of Kettle Creek is also suggested. PMID:16348995

Genetic Variation within a Lotic Population of Janthinobacterium lividum.

PubMed

Saeger, J L; Hale, A B

1993-07-01

An understanding of the genetic variation within and between populations should allow scientists to address many problems, including those associated with endangered species and the release of genetically modified organisms into the environment. With respect to microorganisms, the release of genetically engineered microorganisms is likely to increase dramatically given the current growth in the bioremediation industry. In this study, genetic variation within a lotic, bacterial population of Janthinobacterium lividum was measured with restriction fragment length polymorphism analysis. Chromosomal DNA from 10 Kettle Creek (Hawk Mountain Sanctuary, Kempton, Pa.) J. lividum isolates was digested with six restriction endonucleases and probed with a 7.5-kb pKK3535 fragment containing the E. coli rrnB rRNA operon. Genetic variation, as measured in terms of nucleotide diversity, was high within the population. The 0.0781 value for genetic variation was especially high given the conservative nature of the genetic probe. The average percent similarity among isolates within the population was 67.25%. Pairwise comparisons of nucleotide diversity values (pi) and similarity coefficients (F) yielded values ranging from 0.0032 to 0.1816 and 0.3363 to 0.9808, respectively. Putative clonemates were not present within the group of isolates; however, all isolates shared 14 fragments across a spectrum of six restriction enzymes. The presence of these common fragments indicates that restriction fragment length polymorphism analysis may provide population- or species-specific diagnostic markers for J. lividum. Data that suggest a plume effect with respect to the downstream movement of J. lividum are also presented. An increase in genetic variation within groups of isolates along the longitudinal gradient of Kettle Creek is also suggested.

Identifying sites of replication initiation in yeast chromosomes: looking for origins in all the right places.

PubMed

van Brabant, A J; Hunt, S Y; Fangman, W L; Brewer, B J

1998-06-01

DNA fragments that contain an active origin of replication generate bubble-shaped replication intermediates with diverging forks. We describe two methods that use two-dimensional (2-D) agarose gel electrophoresis along with DNA sequence information to identify replication origins in natural and artificial Saccharomyces cerevisiae chromosomes. The first method uses 2-D gels of overlapping DNA fragments to locate an active chromosomal replication origin within a region known to confer autonomous replication on a plasmid. A variant form of 2-D gels can be used to determine the direction of fork movement, and the second method uses this technique to find restriction fragments that are replicated by diverging forks, indicating that a bidirectional replication origin is located between the two fragments. Either of these two methods can be applied to the analysis of any genomic region for which there is DNA sequence information or an adequate restriction map.

Species determination within Staphylococcus genus by extended PCR-restriction fragment length polymorphism of saoC gene.

PubMed

Bukowski, Michal; Polakowska, Klaudia; Ilczyszyn, Weronika M; Sitarska, Agnieszka; Nytko, Kinga; Kosecka, Maja; Miedzobrodzki, Jacek; Dubin, Adam; Wladyka, Benedykt

2015-01-01

Genetic methods based on PCR-restriction fragment length polymorphism (RFLP) are widely used for microbial species determination. In this study, we present the application of saoC gene as an effective tool for species determination and within-species diversity analysis for Staphylococcus genus. The unique sequence diversity of saoC allows us to apply four restriction enzymes to obtain RFLP patterns, which appear highly distinctive even among closely related species as well as atypical isolates of environmental origin. Such patterns were successfully obtained for 26 species belonging to Staphylococcus genus. What is more, tracing polymorphisms detected by different restriction enzymes allowed for basic phylogeny analysis for Staphylococcus aureus, which is potentially applicable for other staphylococcal species. © FEMS 2014. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Web-Based Phylogenetic Assignment Tool for Analysis of Terminal Restriction Fragment Length Polymorphism Profiles of Microbial Communities

PubMed Central

Kent, Angela D.; Smith, Dan J.; Benson, Barbara J.; Triplett, Eric W.

2003-01-01

Culture-independent DNA fingerprints are commonly used to assess the diversity of a microbial community. However, relating species composition to community profiles produced by community fingerprint methods is not straightforward. Terminal restriction fragment length polymorphism (T-RFLP) is a community fingerprint method in which phylogenetic assignments may be inferred from the terminal restriction fragment (T-RF) sizes through the use of web-based resources that predict T-RF sizes for known bacteria. The process quickly becomes computationally intensive due to the need to analyze profiles produced by multiple restriction digests and the complexity of profiles generated by natural microbial communities. A web-based tool is described here that rapidly generates phylogenetic assignments from submitted community T-RFLP profiles based on a database of fragments produced by known 16S rRNA gene sequences. Users have the option of submitting a customized database generated from unpublished sequences or from a gene other than the 16S rRNA gene. This phylogenetic assignment tool allows users to employ T-RFLP to simultaneously analyze microbial community diversity and species composition. An analysis of the variability of bacterial species composition throughout the water column in a humic lake was carried out to demonstrate the functionality of the phylogenetic assignment tool. This method was validated by comparing the results generated by this program with results from a 16S rRNA gene clone library. PMID:14602639

Detection and characterization of a dehalogenating microorganism by terminal restriction fragment length polymorphism fingerprinting of 16S rRNA in a sulfidogenic, 2-bromophenol-utilizing enrichment.

PubMed

Fennell, Donna E; Rhee, Sung-Keun; Ahn, Young-Beom; Häggblom, Max M; Kerkhof, Lee J

2004-02-01

Terminal restriction fragment length polymorphism analysis of reverse-transcribed 16S rRNA during periods of community flux was used as a tool to delineate the roles of the members of a 2-bromophenol-degrading, sulfate-reducing consortium. Starved, washed cultures were amended with 2-bromophenol plus sulfate, 2-bromophenol plus hydrogen, phenol plus sulfate, or phenol with no electron acceptor and were monitored for substrate use. In the presence of sulfate, 2-bromophenol and phenol were completely degraded. In the absence of sulfate, 2-bromophenol was dehalogenated and phenol accumulated. Direct terminal restriction fragment length polymorphism fingerprinting of the 16S rRNA in the various subcultures indicated that phylotype 2BP-48 (a Desulfovibrio-like sequence) was responsible for the dehalogenation of 2-bromophenol. A stable coculture was established which contained predominantly 2BP-48 and a second Desulfovibrio-like bacterium (designated BP212 based on terminal restriction fragment length polymorphism fingerprinting) that was capable of dehalogenating 2-bromophenol to phenol. Strain 2BP-48 in the coculture could couple reductive dehalogenation to growth with 2-bromophenol, 2,6-dibromophenol, or 2-iodophenol and lactate or formate as the electron donor. In addition to halophenols, strain 2BP-48 appears to use sulfate, sulfite, and thiosulfate as electron acceptors and is capable of simultaneous sulfidogenesis and reductive dehalogenation in the presence of sulfate.

Detection and Characterization of a Dehalogenating Microorganism by Terminal Restriction Fragment Length Polymorphism Fingerprinting of 16S rRNA in a Sulfidogenic, 2-Bromophenol-Utilizing Enrichment

PubMed Central

Fennell, Donna E.; Rhee, Sung-Keun; Ahn, Young-Beom; Häggblom, Max M.; Kerkhof, Lee J.

2004-01-01

Terminal restriction fragment length polymorphism analysis of reverse-transcribed 16S rRNA during periods of community flux was used as a tool to delineate the roles of the members of a 2-bromophenol-degrading, sulfate-reducing consortium. Starved, washed cultures were amended with 2-bromophenol plus sulfate, 2-bromophenol plus hydrogen, phenol plus sulfate, or phenol with no electron acceptor and were monitored for substrate use. In the presence of sulfate, 2-bromophenol and phenol were completely degraded. In the absence of sulfate, 2-bromophenol was dehalogenated and phenol accumulated. Direct terminal restriction fragment length polymorphism fingerprinting of the 16S rRNA in the various subcultures indicated that phylotype 2BP-48 (a Desulfovibrio-like sequence) was responsible for the dehalogenation of 2-bromophenol. A stable coculture was established which contained predominantly 2BP-48 and a second Desulfovibrio-like bacterium (designated BP212 based on terminal restriction fragment length polymorphism fingerprinting) that was capable of dehalogenating 2-bromophenol to phenol. Strain 2BP-48 in the coculture could couple reductive dehalogenation to growth with 2-bromophenol, 2,6-dibromophenol, or 2-iodophenol and lactate or formate as the electron donor. In addition to halophenols, strain 2BP-48 appears to use sulfate, sulfite, and thiosulfate as electron acceptors and is capable of simultaneous sulfidogenesis and reductive dehalogenation in the presence of sulfate. PMID:14766602

Modified Terminal Restriction Fragment Analysis for Quantifying Telomere Length Using In-gel Hybridization.

PubMed

Jenkins, Frank J; Kerr, Charles M; Fouquerel, Elise; Bovbjerg, Dana H; Opresko, Patricia L

2017-07-10

There are several different techniques for measuring telomere length, each with their own advantages and disadvantages. The traditional approach, Telomere Restriction Fragment (TRF) analysis, utilizes a DNA hybridization technique whereby genomic DNA samples are digested with restriction enzymes, leaving behind telomere DNA repeats and some sub-telomeric DNA. These are separated by agarose gel electrophoresis, transferred to a filter membrane and hybridized to oligonucleotide probes tagged with either chemiluminescence or radioactivity to visualize telomere restriction fragments. This approach, while requiring a larger quantity of DNA than other techniques such as PCR, can measure the telomere length distribution of a population of cells and allows measurement expressed in absolute kilobases. This manuscript demonstrates a modified DNA hybridization procedure for determining telomere length. Genomic DNA is first digested with restriction enzymes (that do not cut telomeres) and separated by agarose gel electrophoresis. The gel is then dried and the DNA is denatured and hybridized in situ to a radiolabeled oligonucleotide probe. This in situ hybridization avoids loss of telomere DNA and improves signal intensity. Following hybridization, the gels are imaged utilizing phosphor screens and the telomere length is quantified using a graphing program. This procedure was developed by the laboratories of Drs. Woodring Wright and Jerry Shay at the University of Texas Southwestern 1 , 2 . Here, we present a detailed description of this procedure, with some modifications.

Development of a PCR-RFLP assay for the detection and differentiation of canine parvovirus and mink enteritis virus.

PubMed

Zhang, Chuanmei; Yu, Yongle; Yang, Haiyan; Li, Guimei; Yu, Zekun; Zhang, Hongliang; Shan, Hu

2014-12-15

A polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) assay has been developed to detect and differentiate between canine parvovirus (CPV) and mink enteritis virus (MEV). Eight CPV and three MEV epidemic strains isolated from 28 pathological samples from dogs and minks suspected of being infected with parvovirus were amplified by PCR using a pair of specific primers designed based on the CPV-N strain (M19296). PCR amplified a fragment of 1016bp from the genomic DNA of both MEV and CPV. The MEV-derived fragment could be digested with the restriction enzyme BSP1407I into three fragments of 102bp, 312bp and 602bp, while the fragment amplified from the CPV genomic DNA was digested into only two fragments of 414bp and 602bp. The lowest DNA concentration of CPV and MEV that could be detected using this assay was 0.004μg/ml and 0.03μg/ml, respectively. The PCR-RFLP assay developed in the present study can, therefore, be used to detect and differentiate MEV from CPV with high specificity and sensitivity. Copyright © 2014 Elsevier B.V. All rights reserved.

Influence of backwashing on the microbial community in a biofilm developed on biological activated carbon used in a drinking water treatment plant.

PubMed

Kasuga, I; Shimazaki, D; Kunikane, S

2007-01-01

The influence of backwashing on the biofilm community developed on biological activated carbon (BAC) used in a drinking water treatment plant was investigated by means of bacterial cell enumeration and terminal-restriction fragment length polymorphism (T-RFLP) fingerprinting analysis of bacterial and eukaryotic ribosomal RNA genes (rDNA). After backwashing, the attached bacterial abundance in the top layer of the BAC bed decreased to 64% of that before backwashing. The community level changes caused by backwashing were examined through the T-RFLP profiles. In the bacterial 16S rDNA analysis, the relative abundances of some terminal-restriction fragments (T-RFs) including the Planctomycetes-derived fragment increased; however, the relative abundances of some T-RFs including the Betaproteobacteria-derived fragments decreased. In the eukaryotic 18S rDNA analysis, the relative abundances of some T-RFs including the protozoan Cercozoa-derived fragments increased; however, the relative abundances of some T-RFs including the metazoan Chaetonotus- and Paratripyla-derived fragments decreased. The T-RFLP analysis suggests that backwashing can cause changes in the relative compositions of microorganisms in a BAC biofilm in the top layer of the bed.

Cross index for improving cloning selectivity by partially filling in 5'-extensions of DNA produced by type II restriction endonucleases.

PubMed Central

Korch, C

1987-01-01

A cross index is presented for using the improved selectivity offered by the Hung and Wensink (Nucl. Acids Res. 12, 1863-1874, 1984) method of partially filling in 5'-extensions produced by type II restriction endonucleases. After this treatment, DNA fragments which normally cannot be ligated to one another, can be joined providing that complementary cohesive ends have been generated. The uses of this technique, which include the prevention of DNA fragments (both vector and insert) auto-annealing, are discussed. PMID:3033600

rRNA gene restriction patterns as an epidemiological marker in nosocomial outbreaks of Staphylococcus aureus infections.

PubMed

Meugnier, H; Fernandez, M P; Bes, M; Brun, Y; Bornstein, N; Freney, J; Fleurette, J

1993-01-01

rRNA gene restriction patterns (ribotyping) were compared with phage typing, serotyping, enterotoxins and exfoliatin production in the analysis of 26 Staphylococcus aureus strains isolated from two different nosocomial outbreaks. Total DNA was cleaved by EcoRI restriction endonuclease. After agarose gel electrophoresis and Southern transfer, the hybridization of the membranes was done with radiolabelled 16S rRNA gene from Bacillus subtilis inserted into a plasmid vector. Six to 13 fragments were visualized. A core of common fragments was discerned for all strains tested. A full correlation between ribotyping and conventional markers was observed in only one of the outbreaks studied. In both outbreaks, ribotyping proved helpful in characterizing otherwise untypable strains.

PCR and restriction fragment length polymorphism of a pel gene as a tool to identify Erwinia carotovora in relation to potato diseases.

PubMed Central

Darrasse, A; Priou, S; Kotoujansky, A; Bertheau, Y

1994-01-01

Using a sequenced pectate lyase-encoding gene (pel gene), we developed a PCR test for Erwinia carotovora. A set of primers allowed the amplification of a 434-bp fragment in E. carotovora strains. Among the 89 E. carotovora strains tested, only the Erwinia carotovora subsp. betavasculorum strains were not detected. A restriction fragment length polymorphism (RFLP) study was undertaken on the amplified fragment with seven endonucleases. The Sau3AI digestion pattern specifically identified the Erwinia carotovora subsp. atroseptica strains, and the whole set of data identified the Erwinia carotovora subsp. wasabiae strains. However, Erwinia carotovora subsp. carotovora and Erwinia carotovora subsp. odorifera could not be separated. Phenetic and phylogenic analyses of RFLP results showed E. carotovora subsp. atroseptica as a homogeneous group while E. carotovora subsp. carotovora and E. carotovora subsp. odorifera strains exhibited a genetic diversity that may result from a nonmonophyletic origin. The use of RFLP on amplified fragments in epidemiology and for diagnosis is discussed. Images PMID:7912502

Mumps Hoshino and Torii vaccine strains were distinguished from circulating wild strains.

PubMed

Sawada, Akihito; Yamaji, Yoshiaki; Nakayama, Tetsuo

2013-06-01

Aseptic meningitis and acute parotitis have been observed after mumps vaccination. Mumps outbreaks have been reported in Japan because of low vaccine coverage, and molecular differentiation is required to determine whether these cases are vaccine associated. RT-nested PCR was performed in the small hydrophobic gene region, and viruses were differentiated by restriction fragment length polymorphism assay. A total of 584 nucleotides were amplified. The PCR product of the Hoshino strain was cut into two fragments (313 and 271 nucleotides) by MfeI; that of the Torii strain was digested with EcoT22I, resulting in 332- and 252-nucleotide fragments. Both strains were genotype B and had an XbaI site, resulting in two fragments: 299 and 285 nucleotides. Current circulating wild types were cut only by XbaI or MfeI. However, the MfeI site of the wild types was different from that of the Hoshino strain, resulting in 451- and 133-nucleotide fragments. Using three restriction enzymes, two mumps vaccine strains were distinguished from wild types, and this separation was applied to the identification of vaccine-related adverse events.

Restriction Fragment Length Polymorphism Analysis Reveals High Levels of Genetic Divergence Among the Light Organ Symbionts of Flashlight Fish.

PubMed

Wolfe, C J; Haygood, M G

1991-08-01

Restriction fragment length polymorphisms within the lux and 16S ribosomal RNA gene regions were used to compare unculturable bacterial light organ symbionts of several anomalopid fish species. The method of Nei and Li (1979) was used to calculate phylogenetic distance from the patterns of restriction fragment lengths of the luxA and 16S rRNA regions. Phylogenetic trees constructed from each distance matrix (luxA and 16S rDNA data) have similar branching orders. The levels of divergence among the symbionts, relative to other culturable luminous bacteria, suggests that the symbionts differ at the level of species among host fish genera. Symbiont relatedness and host geographic location do not seem to be correlated, and the symbionts do not appear to be strains of common, free-living, luminous bacteria. In addition, the small number of hybridizing fragments within the 16S rRNA region of the symbionts, compared with that of the free-living species, suggests a decrease in copy number of rRNA operons relative to free-living species. At this level of investigation, the symbiont phylogeny is consistent with the proposed phylogeny of the host fish family and suggests that each symbiont strain coevolved with its host fish species.

Recruitment of a chromosomally encoded maleylacetate reductase for degradation of 2,4-dichlorophenoxyacetic acid by plasmid pJP4.

PubMed Central

Kukor, J J; Olsen, R H; Siak, J S

1989-01-01

When Pseudomonas aeruginosa PAO1c or P. putida PPO200 or PPO300 carry plasmid pJP4, which encodes enzymes for the degradation of 2,4-dichlorophenoxyacetic acid (TFD) to 2-chloromaleylacetate, cells do not grow on TFD and UV-absorbing material with spectral characteristics of chloromaleylacetate accumulates in the culture medium. Using plasmid pRO1727, we cloned from the chromosome of a nonfluorescent pseudomonad, Pseudomonas sp. strain PKO1, 6- and 0.5-kilobase BamHI DNA fragments which contain the gene for maleylacetate reductase. When carrying either of the recombinant plasmids, pRO1944 or pRO1945, together with pJP4, cells of P. aeruginosa or P. putida were able to utilize TFD as a sole carbon source for growth. A novel polypeptide with an estimated molecular weight of 18,000 was detected in cell extracts of P. aeruginosa carrying either plasmid pRO1944 or plasmid pRO1945. Maleylacetate reductase activity was induced in cells of P. aeruginosa or P. putida carrying plasmid pRO1945, as well as in cells of Pseudomonas strain PKO1, when grown on L-tyrosine, suggesting that the tyrosine catabolic pathway might be the source from which maleylacetate reductase is recruited for the degradation of TFD in pJP4-bearing cells of Pseudomonas sp. strain PKO1. Images PMID:2722753

A rat genetic map constructed by representational difference analysis markers with suitability for large-scale typing.

PubMed Central

Toyota, M; Canzian, F; Ushijima, T; Hosoya, Y; Kuramoto, T; Serikawa, T; Imai, K; Sugimura, T; Nagao, M

1996-01-01

Representational difference analysis (RDA) was applied to isolate chromosomal markers in the rat. Four series of RDA [restriction enzymes, BamHI and HindIII; subtraction of ACI/N (ACI) amplicon from BUF/Nac (BUF) amplicon and vice versa] yielded 131 polymorphic markers; 125 of these markers were mapped to all chromosomes except for chromosome X. This was done by using a mapping panel of 105 ACI x BUF F2 rats. To complement the relative paucity of chromosomal markers in the rat, genetically directed RDA, which allows isolation of polymorphic markers in the specific chromosomal region, was performed. By changing the F2 driver-DNA allele frequency around the region, four markers were isolated from the D1Ncc1 locus. Twenty-five of 27 RDA markers were informative regarding the dot blot analysis of amplicons, hybridizing only with tester amplicons. Dot blot analysis at a high density per unit of area made it possible to process a large number of samples. Quantitative trait loci can now be mapped in the rat genome by processing a large number of samples with RDA markers and then by isolating markers close to the loci of interest by genetically directed RDA. Images Fig. 1 Fig. 3 Fig. 4 PMID:8632989

Hybridization Capture Using RAD Probes (hyRAD), a New Tool for Performing Genomic Analyses on Collection Specimens

PubMed Central

Suchan, Tomasz; Pitteloud, Camille; Gerasimova, Nadezhda S.; Kostikova, Anna; Schmid, Sarah; Arrigo, Nils; Pajkovic, Mila; Ronikier, Michał; Alvarez, Nadir

2016-01-01

In the recent years, many protocols aimed at reproducibly sequencing reduced-genome subsets in non-model organisms have been published. Among them, RAD-sequencing is one of the most widely used. It relies on digesting DNA with specific restriction enzymes and performing size selection on the resulting fragments. Despite its acknowledged utility, this method is of limited use with degraded DNA samples, such as those isolated from museum specimens, as these samples are less likely to harbor fragments long enough to comprise two restriction sites making possible ligation of the adapter sequences (in the case of double-digest RAD) or performing size selection of the resulting fragments (in the case of single-digest RAD). Here, we address these limitations by presenting a novel method called hybridization RAD (hyRAD). In this approach, biotinylated RAD fragments, covering a random fraction of the genome, are used as baits for capturing homologous fragments from genomic shotgun sequencing libraries. This simple and cost-effective approach allows sequencing of orthologous loci even from highly degraded DNA samples, opening new avenues of research in the field of museum genomics. Not relying on the restriction site presence, it improves among-sample loci coverage. In a trial study, hyRAD allowed us to obtain a large set of orthologous loci from fresh and museum samples from a non-model butterfly species, with a high proportion of single nucleotide polymorphisms present in all eight analyzed specimens, including 58-year-old museum samples. The utility of the method was further validated using 49 museum and fresh samples of a Palearctic grasshopper species for which the spatial genetic structure was previously assessed using mtDNA amplicons. The application of the method is eventually discussed in a wider context. As it does not rely on the restriction site presence, it is therefore not sensitive to among-sample loci polymorphisms in the restriction sites that usually causes loci dropout. This should enable the application of hyRAD to analyses at broader evolutionary scales. PMID:26999359

Efficient exploration of chemical space by fragment-based screening.

PubMed

Hall, Richard J; Mortenson, Paul N; Murray, Christopher W

2014-01-01

Screening methods seek to sample a vast chemical space in order to identify starting points for further chemical optimisation. Fragment based drug discovery exploits the superior sampling of chemical space that can be achieved when the molecular weight is restricted. Here we show that commercially available fragment space is still relatively poorly sampled and argue for highly sensitive screening methods to allow the detection of smaller fragments. We analyse the properties of our fragment library versus the properties of X-ray hits derived from the library. We particularly consider properties related to the degree of planarity of the fragments. Copyright © 2014 Elsevier Ltd. All rights reserved.

Development of genetic techniques for the psychrotrophic fish pathogen Flavobacterium psychrophilum.

PubMed

Alvarez, B; Secades, P; McBride, M J; Guijarro, J A

2004-01-01

Flavobacterium psychrophilum, a member of the Cytophaga-Flavobacterium-Bacteroides group, is an important pathogen of salmonid fish. Previous attempts to develop genetic techniques for this fastidious, psychrotrophic bacterium have met with failure. Here we describe the development of techniques for the genetic manipulation of F. psychrophilum and the identification of plasmids, selectable markers, a reporter system, and a transposon that function in several isolates of this fish pathogen. The antibiotic resistance genes ermF, cfxA, and tetQ function in F. psychrophilum. Cloning vectors based on the F. psychrophilum cryptic plasmid pCP1 which carried these selectable markers were introduced by conjugation from E. coli, resulting in antibiotic-resistant colonies of F. psychrophilum. Conjugative transfer of DNA into F. psychrophilum was strain dependent. Efficient transfer was observed for two of the seven strains tested (THC02-90 and THC04-90). E. coli lacZY functioned in F. psychrophilum when expressed from a pCP1 promoter, allowing its development as a reporter for studies of gene expression. Plasmids isolated from F. psychrophilum were efficiently introduced into F. psychrophilum by electroporation, but plasmids isolated from E. coli were not suitable for transfer by this route, suggesting the presence of a restriction barrier. DNA isolated from F. psychrophilum was resistant to digestion by Sau3AI and BamHI, indicating that a Sau3AI-like restriction modification system may constitute part of this barrier. Tn4351 was introduced into F. psychrophilum from E. coli and transposed with apparent randomness, resulting in erythromycin-resistant colonies. The techniques developed in this study allow for genetic manipulation and analysis of this important fish pathogen.

Differentiation of mycoplasmalike organisms (MLOs) in European fruit trees by PCR using specific primers derived from the sequence of a chromosomal fragment of the apple proliferation MLO.

PubMed Central

Jarausch, W; Saillard, C; Dosba, F; Bové, J M

1994-01-01

A 1.8-kb chromosomal DNA fragment of the mycoplasmalike organism (MLO) associated with apple proliferation was sequenced. Three putative open reading frames were observed on this fragment. The protein encoded by open reading frame 2 shows significant homologies with bacterial nitroreductases. From the nucleotide sequence four primer pairs for PCR were chosen to specifically amplify DNA from MLOs associated with European diseases of fruit trees. Primer pairs specific for (i) Malus-affecting MLOs, (ii) Malus- and Prunus-affecting MLOs, and (iii) Malus-, Prunus-, and Pyrus-affecting MLOs were obtained. Restriction enzyme analysis of the amplification products revealed restriction fragment length polymorphisms between Malus-, Prunus, and Pyrus-affecting MLOs as well as between different isolates of the apple proliferation MLO. No amplification with either primer pair could be obtained with DNA from 12 different MLOs experimentally maintained in periwinkle. Images PMID:7916180

Rapid discrimination of sequences flanking and within T-DNA insertions in the Arabidopsis genome.

PubMed

Ponce, M R; Quesada, V; Micol, J L

1998-05-01

An improvement to previous methods for recovering Arabidopsis thaliana genomic DNA flanking T-DNA insertions is presented that allows for the avoidance of some of the cloning difficulties caused by the concatameric nature of T-DNA inserts. The principle of the procedure is to categorize by size restriction fragments of mutant DNA, produced in separate digestions with NdeI and Bst1107I. Given that the sites for these two enzymes are contiguous within the pGV3850:1003 T-DNA construct, the restriction fragments obtained fall into two categories: those showing identical size in both digestions, which correspond to sequences internal to T-DNA concatamers; and those of different sizes, that contain the junctions between plant DNA and the T-DNA insert. Such a criterion makes it possible to easily distinguish the digestion products corresponding to internal T-DNA parts, which do not deserve further attention, and those which presumably include a segment of the locus of interest. Discrimination between restriction fragments of genomic mutant DNA can be made on rescued plasmids, inverse PCR amplification products or bands in a genomic blot.

Restriction fragment length polymorphisms in dairy and beef cattle at the growth hormone and prolactin loci.

PubMed

Hallerman, E M; Nave, A; Kashi, Y; Holzer, Z; Soller, M; Beckmann, J S

1987-01-01

Two bovine populations, a Holstein-Friesian dairy stock and a synthetic (Baladi X Hereford X Simmental X Charolais) beef stock, were screened for restriction fragment length polymorphisms (RFLPs) at the growth hormone and prolactin genes. Most RFLPs at the growth hormone gene are apparently the consequence of an insertion/deletion event which was localized to a region downstream of the structural gene. The restriction map for the genomic region including the growth hormone gene was extended. Two HindIII RFLPs at the growth hormone locus, as well as several RFLPs at the prolactin gene, seemed to be the consequence of a series of point mutations. The results are discussed in terms of the possibility that minor genomic variability underlies quantitative genetic variation.

Papain cleavage of the 38,000-dalton fragment inhibits the binding of 4, 4'-diisothiocyanostilbene-2, 2'-disulfonate to lys-539 on the 60,000-dalton fragment in human band 3.

PubMed

Yamaguchi, Takeo; Kojima, Hideaki; Kawaguchi, Shiori; Shimada, Maiko; Aso, Haruka

2017-08-01

Human band 3 is a 98-kDa transmembrane (TM) protein comprising 14 TM segments. Papain cleavages band 3 into 38- and 60-kDa fragments. Under vigorous conditions, the cleavage of the loop region between the TM 7 of gate domain and the TM 8 of core domain in the 38-kDa fragment produces 7- and 31-kDa fragments. Conformational changes of the TM 5 segment containing Lys-539 by cleavage of the 38-kDa fragment remain unclear. Pressure-induced haemolysis of erythrocytes was suppressed by binding of 4, 4'-diisothiocyanostilbene-2, 2'-disulfonate (DIDS) to Lys-539. Such effect of DIDS was not observed upon cleavage of the 38-kDa fragment, because of inhibition of DIDS binding to Lys-539. Using fluorescence of DIDS labelled to Lys-539, conformational changes of band 3 were examined. Fluorescence spectra demonstrated that the molecular motion of DIDS is more restricted upon digestion of the 38-kDa fragment. Interestingly, the quenching of DIDS fluorescence showed that Hg2+ is less accessible to DIDS upon digestion of the 38-kDa fragment. Taken together, we propose that the conformational changes of the TM 5 segment characterized by the sequestration and restricted motion of Lys-539 are induced by the cleavage of the loop region between the TM 7 and the TM 8. © The Authors 2017. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.

Polymorphic sequence-characterized codominant loci in the chestnut blight fungus, Cryphonectria parasitica

Treesearch

J. E. Davis; Thomas L. Kubisiak; M. G. Milgroom

2005-01-01

Studies on the population biology of the chestnut blight fungus, Cryphonectria parasitica, have previously been carried out with dominant restriction fragment length polymorphism (RFLP) fingerprinting markers. In this study, we described the development of 11 condominant markers from randomly amplified polymorphic DNAs (RAPDs). RAPD fragments were...

In Vivo Imaging of mdrla Gene Expression

DTIC Science & Technology

2005-06-01

svImJ mouse strain, compatible with the ES cells used in our Transgenic Mouse Facility. b. Engineer PGK-neo and Renilla luciferase cassettes...inserted between the two loxP sites, upstream of the Neo cassette. A cloning strategy was then devised to fuse Renilla luciferase in-frame with the...sites: B, BamHI; E, EcoRI; S, ScaI. PGK-neo: neo under the control of the PGK promoter. Luc: Renilla luciferase fused in- frame with the translated

Factor IX gene haplotypes in Amerindians.

PubMed

Franco, R F; Araújo, A G; Zago, M A; Guerreiro, J F; Figueiredo, M S

1997-02-01

We have determined the haplotypes of the factor IX gene for 95 Indians from 5 Brazilian Amazon tribes: Wayampí, Wayana-Apalaí, Kayapó, Arára, and Yanomámi. Eight polymorphisms linked to the factor IX gene were investigated: MseI (at 5', nt -698), BamHI (at 5', nt -561), DdeI (intron 1), BamHI (intron 2), XmnI (intron 3), TaqI (intron 4), MspI (intron 4), and HhaI (at 3', approximately 8 kb). The results of the haplotype distribution and the allele frequencies for each of the factor IX gene polymorphisms in Amerindians were similar to the results reported for Asian populations but differed from results for other ethnic groups. Only five haplotypes were identified within the entire Amerindian study population, and the haplotype distribution was significantly different among the five tribes, with one (Arára) to four (Wayampí) haplotypes being found per tribe. These findings indicate a significant heterogeneity among the Indian tribes and contrast with the homogeneous distribution of the beta-globin gene cluster haplotypes but agree with our recent findings on the distribution of alpha-globin gene cluster haplotypes and the allele frequencies for six VNTRs in the same Amerindian tribes. Our data represent the first study of factor IX-associated polymorphisms in Amerindian populations and emphasizes the applicability of these genetic markers for population and human evolution studies.

Restriction fragment length polymorphism and allozyme linkage map of Cuphea lanceolata.

PubMed

Webb, D M; Knapp, S J; Tagliani, L A

1992-02-01

Cuphea lanceolata Ait. has had a significant role in the domestication of Cuphea and is a useful experimental organism for investigating how medium-chain lipids are synthesized in developing seeds. To expand the genetics of this species, a linkage map of the C. lanceolata genome was constructed using five allozyme and 32 restriction-fragment-length-polymorphism (RFLP) marker loci. These loci were assigned to six linkage groups that correspond to the six chromosomes of this species. Map length is 288 cM. Levels of polymorphism were estimated for three inbred lines of C. lanceolata and an inbred line of C. viscosissima using 84 random genomic clones and two restriction enzymes, EcoRI and HindIII. Of the probes 29% detected RFLPs between C. lanceolata and C. viscosissima lines. Crosses between these species can be exploited to expand the map.

Haloacetic acid-degrading bacterial communities in drinking water systems as determined by cultivation and by terminal restriction fragment length polymorphism of PCR-amplified haloacid dehalogenase gene fragments.

PubMed

Grigorescu, A S; Hozalski, R M; Lapara, T M

2012-04-01

To characterize the HAA-degrading bacteria in drinking water systems. Haloacetic acid (HAA)-degrading bacteria were analysed in drinking water systems by cultivation and by a novel application of terminal restriction fragment length polymorphism (tRFLP). Substantial similarities were observed among the tRFLP patterns of dehI and dehII gene fragments in drinking water samples obtained from three different cities (Minneapolis, MN; St Paul, MN; Bucharest, Romania) and from one biologically active granular activated carbon filter (Hershey, PA). The dominant fragment in the tRFLP profiles of dehI genes from the drinking water samples matched the pattern from an Afipia sp. that was previously isolated from drinking water. In contrast, the dominant fragment in the tRFLP profiles of dehII genes did not match any previously characterized dehII gene fragment. PCR cloning was used to characterize this gene fragment, which had <65% nucleotide sequence identity with any previously characterized dehII gene. Afipia spp. are an appropriate model organism for studying the biodegradation of HAAs in drinking water distribution systems as encoded by dehI genes; the organism that harbours the most prominent dehII gene in drinking water has yet to be cultivated and identified. The development of a novel application of tRFLP targeting dehI and dehII genes could be broadly useful in understanding HAA-degrading bacteria in numerous environments. © 2012 The Authors. Journal of Applied Microbiology © 2012 The Society for Applied Microbiology.

The iPhyClassifier, an interactive online tool for phytoplasma classification and taxonomic assignment

USDA-ARS?s Scientific Manuscript database

The iPhyClassifier is an Internet-based research tool for quick identification and classification of diverse phytoplasmas. The iPhyClassifier simulates laboratory restriction enzyme digestions and subsequent gel electrophoresis and generates virtual restriction fragment length polymorphism (RFLP) p...

Biochemical and genetic analyses of acetoin catabolism in Alcaligenes eutrophus.

PubMed Central

Fründ, C; Priefert, H; Steinbüchel, A; Schlegel, H G

1989-01-01

In genetic studies on the catabolism of acetoin in Alcaligenes eutrophus, we used Tn5::mob-induced mutants which were impaired in the utilization of acetoin as the sole carbon source for growth. The transposon-harboring EcoRI restriction fragments from 17 acetoin-negative and slow-growing mutants (class 2a) and from six pleiotropic mutants of A. eutorphus, which were acetoin-negative and did not grow chemolithoautotrophically (class 2b), were cloned from pHC79 gene banks. The insertions of Tn5 were mapped on four different chromosomal EcoRI restriction fragments (A, C, D, and E) in class 2a mutants. The native DNA fragments were cloned from a lambda L47 or from a cosmid gene bank. Evidence is provided that fragments A (21 kilobase pairs [kb]) and C (7.7 kb) are closely linked in the genome; the insertions of Tn5 covered a region of approximately 5 kb. Physiological experiments revealed that this region encodes for acetoin:dichlorophenol-indophenol oxidoreductase, a fast-migrating protein, and probably for one additional protein that is as yet unknown. In mutants which were not completely impaired in growth on acetoin but which grew much slower and after a prolonged lag phase, fragments D (7.2 kb) and E (8.1 kb) were inactivated by insertion of Tn5::mob. No structural gene could be assigned to the D or E fragments. In class 2b mutants, insertions of Tn5 were mapped on fragment B (11.3 kb). This fragment complemented pleiotropic hno mutants in trans; these mutants were impaired in the formation of a rpoN-like protein. The expression of the gene cluster on fragments A and C seemed to be rpoN dependent. PMID:2556366

The interaction of the Eco R1 restriction enzyme E.coli with nucleotides

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hollis, Donald F.

1979-11-01

The Eco R1 restriction enzyme can be shown to be inhibited by nucleotides which correspond to any part of its known site of phosphodiesterase activity. A series of di-, tetra-, and hexa-nucleotide fragments were synthesized and their effect on the activity of the enzyme upon superhelical Co1 E1 DNA studied. The inhibition caused by the individual mononucleotides were also studied. In general all the nucleotide fragments showed some form of interaction with the enzyme system. Tetranucleotides were stronger inhibitors than dinucleotides, which in turn were stronger inhibitors than the mononucleotides. Within each category of inhibitors, those containing the phosphodiester bondmore » which is acted upon by the enzyme were the strongest inhibitors. Only those fragments which were consistent with the enzymes site of activity showed competitive inhibition kinetics. Nucleotides which do not fit within the site of phosphodiesterase activity show non-competitive inhibition kinetics.« less

Genomic variation in parthenogenetic lizard Darevskia armeniaca: evidence from DNA fingerprinting data.

PubMed

Malysheva, D N; Tokarskaya, Olga N; Petrosyan, Varos G; Danielyan, Felix D; Darevsky, Iliya S; Ryskov, Alexei P

2007-01-01

Microsatellites, or short tandem repeats, are abundant across genomes of most organisms. It is evident that the most straightforward and conclusive way of studying mutations in microsatellite-containing loci is to use clonally transmitted genomes or DNA sequences inherited in multigeneration pedigrees. At present, little is known about the origin of genetic variation in species that lack effective genetic recombination. DNA fingerprinting in 43 families of the parthenogenetic lizard species Darevskia armeniaca (131 siblings), using (GACA)(4), (GGCA)(4), (GATA)(4), and (CAC)(5) probes, revealed mutant fingerprints in siblings that differed from their mothers in several restriction DNA fragments. In some cases, the mutant fingerprints detected in siblings were also found in population samples. The mutation rate for new restriction fragment length estimated by using multilocus probes varied from 0.8 x 10(-2) to 4.9 x 10(-2) per band/per sibling. Probably, the most variations detected as restriction fragment length polymorphism have germ-line origin, but somatic changes of (CAC)(n) fingerprints in adult lizards were also observed. These results provide new evidence of existing unstable regions in genomes of parthenogenetic vertebrate animals, which provide genetic variation in unisexual populations.

Global climate change and fragmentation of native brook trout distribution in the southern Appalachian Mountains

Treesearch

Patricia A. Flebbe

1997-01-01

Current distributions of native brook trout (Salvelinus fontinalis) in the Southern Appalachians are restricted to upper elevations by multiple factors, including habitat requirements, introduced rainbow (Oncorhynchus mykiss) and brown (Salmo trutta) trout, and other human activities. Present-day distribution of brook trout habitat is already fragmented. Increased...

Introducing Human Population Biology through an Easy Laboratory Exercise on Mitochondrial DNA

ERIC Educational Resources Information Center

Pardinas, Antonio F.; Dopico, Eduardo; Roca, Agustin; Garcia-Vazquez, Eva; Lopez, Belen

2010-01-01

This article describes an easy and cheap laboratory exercise for students to discover their own mitochondrial haplogroup. Students use buccal swabs to obtain mucosa cells as noninvasive tissue samples, extract DNA, and with a simple polymerase chain reaction-restriction fragment length polymorphism analysis they can obtain DNA fragments of…

Characterization of Erwinia chrysanthemi by pectinolytic isozyme polymorphism and restriction fragment length polymorphism analysis of PCR-amplified fragments of pel genes.

PubMed Central

Nassar, A; Darrasse, A; Lemattre, M; Kotoujansky, A; Dervin, C; Vedel, R; Bertheau, Y

1996-01-01

Conserved regions about 420 bp long of the pelADE cluster specific to Erwinia chrysanthemi were amplified by PCR and used to differentiate 78 strains of E. chrysanthemi that were obtained from different hosts and geographical areas. No PCR products were obtained from DNA samples extracted from other pectinolytic and nonpectinolytic species and genera. The pel fragments amplified from the E. chrysanthemi strains studied were compared by performing a restriction fragment length polymorphism (RFLP) analysis. On the basis of similarity coefficients derived from the RFLP analysis, the strains were separated into 16 PCR RFLP patterns grouped in six clusters, These clusters appeared to be correlated with other infraspecific levels of E. chrysanthemi classification, such as pathovar and biovar, and occasionally with geographical origin. Moreover, the clusters correlated well with the polymorphism of pectate lyase and pectin methylesterase isoenzymes. While the pectin methylesterase profiles correlated with host monocot-dicot classification, the pectate lyase polymorphism might reflect the cell wall microdomains of the plants belonging to these classes. PMID:8779560

Fast conversion of scFv to Fab antibodies using type IIs restriction enzymes.

PubMed

Sanmark, Hanna; Huovinen, Tuomas; Matikka, Tero; Pettersson, Tiina; Lahti, Maria; Lamminmäki, Urpo

2015-11-01

Single chain variable fragment (scFv) antibody libraries are widely used for developing novel bioaffinity reagents, although Fab or IgG molecules are the preferred antibody formats in many final applications. Therefore, rapid conversion methods for combining multiple DNA fragments are needed to attach constant domains to the scFv derived variable domains. In this study we describe a fast and easy cloning method for the conversion of single framework scFv fragments to Fab fragments using type IIS restriction enzymes. All cloning steps excluding plating of the Fab transformants can be done in 96 well plates and the procedure can be completed in one working day. The concept was tested by converting 69 scFv clones into Fab format on 96 well plates, which resulted in 93% success rate. The method is particularly useful as a high-throughput tool for the conversion of the chosen scFv clones into Fab molecules in order to analyze them as early as possible, as the conversion can significantly affect the binding properties of the chosen clones. Copyright © 2015 Elsevier B.V. All rights reserved.

Abstracts of papers presented at the 8th workshop of the Virology Section of the Deutsche Gesellschaft für Hygiene und Mikro-biologie, Würzburg, March 17-19, 1983.

PubMed

1983-09-01

17 adenovirus strains were found to be antigenically related to prototype Ad 15 by neutralization. No relationship to Ad 15, but to Ad 9 could be detected by hemagglutination-inhibition; we therefore named them Ad 15/H9 intermediate strains. After analysis of the genome by five different restriction enzymes, the fragment patterns obtained deviated widely from the prototype Ad 15, but only slightly from Ad 9. Differences could also be observed among the variants. After digestion by five restriction enzymes, altogether six genome types could be established among the 17 intermediate strains. To map the variations on the genome of the 15/H9 strains, two methods were employed: the double digestion of the DNA and DNA fragments together with the determination of the terminal fragments made it possible to construct a physical map. The second method depends on a particularity of adenoviruses: the DNA is covalently linked with a 55 kD protein at the 5' terminus. After digestion of the DNA, which does contain this protein, the terminal DNA fragments do not migrate into the agarose gel; after an additional digestion with pronase B, they do migrate into the gel. Thus the terminal fragments were determined by comparing the fragment patterns with and without previous pronase B treatment.

Using Restriction Mapping to Teach Basic Skills in the Molecular Biology Lab

ERIC Educational Resources Information Center

Walsh, Lauren; Shaker, Elizabeth; De Stasio, Elizabeth A.

2007-01-01

Digestion of DNA with restriction enzymes, calculation of volumes and concentrations of reagents for reactions, and the separation of DNA fragments by agarose gel electrophoresis are common molecular biology techniques that are best taught through repetition. The following open-ended, investigative laboratory exercise in plasmid restriction…

Quantification of mRNA expression by competitive PCR using non-homologous competitors containing a shifted restriction site

PubMed Central

Watzinger, Franz; Hörth, Elfriede; Lion, Thomas

2001-01-01

Despite the recent introduction of real-time PCR methods, competitive PCR techniques continue to play an important role in nucleic acid quantification because of the significantly lower cost of equipment and consumables. Here we describe a shifted restriction-site competitive PCR (SRS-cPCR) assay based on a modified type of competitor. The competitor fragments are designed to contain a recognition site for a restriction endonuclease that is also present in the target sequence to be quantified, but in a different position. Upon completion of the PCR, the amplicons are digested in the same tube with a single restriction enzyme, without the need to purify PCR products. The generated competitor- and target-specific restriction fragments display different sizes, and can be readily separated by electrophoresis and quantified by image analysis. Suboptimal digestion affects competitor- and target-derived amplicons to the same extent, thus eliminating the problem of incorrect quantification as a result of incomplete digestion of PCR products. We have established optimized conditions for a panel of 20 common restriction endonucleases permitting efficient digestion in PCR buffer. It is possible, therefore, to find a suitable restriction site for competitive PCR in virtually any sequence of interest. The assay presented is inexpensive, widely applicable, and permits reliable and accurate quantification of nucleic acid targets. PMID:11376164

High-resolution analysis of CpG methylation and in vivo protein-DNA interactions at the alternative Epstein-Barr virus latency promoters Qp and Cp in the nasopharyngeal carcinoma cell line C666-1.

PubMed

Bakos, Agnes; Banati, Ferenc; Koroknai, Anita; Takacs, Maria; Salamon, Daniel; Minarovits-Kormuta, Susanna; Schwarzmann, Fritz; Wolf, Hans; Niller, Hans Helmut; Minarovits, Janos

2007-10-01

Transcripts for the Epstein-Barr virus (EBV) encoded nuclear antigens (EBNAs) are initiated at alternative promoters (Wp, Cp, for EBNA 1-6 transcripts and Qp, for EBNA 1 transcripts only) located in the BamHI W, C or Q fragment of the viral genome. To understand the host-cell dependent expression of EBNAs in EBV-associated tumors (lymphomas and carcinomas) and in vitro transformed cell lines, it is necessary to analyse the regulatory mechanisms governing the activity of the alternative promoters of EBNA transcripts. Such studies focused mainly on lymphoid cell lines carrying latent EBV genomes, due to the lack of EBV-associated carcinoma cell lines maintaining latent EBV genomes during cultivation in tissue culture. We took advantage of the unique nasopharyngeal carcinoma cell line, C666-1, harboring EBV genomes, and undertook a detailed analysis of CpG methylation patterns and in vivo protein-DNA interactions at the latency promoters Qp and Cp. We found that the active, unmethylated Qp was marked with strong footprints of cellular transcription factors and the viral protein EBNA 1. In contrast, we could not detect binding of relevant transcription factors to the methylated, silent Cp. We concluded that the epigenetic marks at Qp and Cp in C666-1 cells of epithelial origin resemble those of group I Burkitt's lymphoma cell lines.

Mitochondrial DNA pattern of the fine shrimp Metapenaeus elegans (De Man, 1907) in the lagoon of Segara Anakan, Central Java, using Hind III

NASA Astrophysics Data System (ADS)

Nugraha, Fitra Arya Dwi; Holil, Kholifah; Kurniawan, Nia

2017-05-01

Ecological damages to the Lagoon of Segara Anakan, Central Java, as well as large-scale and continuous exploitation are threatening the sustainability of fine shrimp, Metapenaeus elegans, and resources. Information in regards to genetic resources is crucial to establish long-term conservation programs and to preserve germplasm quality. This study aims to evaluate the number and size of the fragment which is digested with restriction enzyme Hind III. Seven individuals of Metapenaeus elegans from the Lagoon of Segara Anakan were examined using Hind III. Amplification of mitochondrial DNA resulted in 950 bp, and the digestion using Hind III generated four fragments consisting of 114 bp, 200 bp, 250 bp, and 386 bp, which formed a monomorphic pattern. The restriction pattern showed the probability of homozygosity of alleles that restricted using Hind III. Homozygosity indicates no variation of DNA sequence.

Calmodulin Polymerase Chain Reaction–Restriction Fragment Length Polymorphism for Leishmania Identification and Typing

PubMed Central

Miranda, Aracelis; Samudio, Franklyn; González, Kadir; Saldaña, Azael; Brandão, Adeilton; Calzada, Jose E.

2016-01-01

A precise identification of Leishmania species involved in human infections has epidemiological and clinical importance. Herein, we describe a preliminary validation of a restriction fragment length polymorphism assay, based on the calmodulin intergenic spacer region, as a tool for detecting and typing Leishmania species. After calmodulin amplification, the enzyme HaeIII yielded a clear distinction between reference strains of Leishmania mexicana, Leishmania amazonensis, Leishmania infantum, Leishmania lainsoni, and the rest of the Viannia reference species analyzed. The closely related Viannia species: Leishmania braziliensis, Leishmania panamensis, and Leishmania guyanensis, are separated in a subsequent digestion step with different restriction enzymes. We have developed a more accessible molecular protocol for Leishmania identification/typing based on the exploitation of part of the calmodulin gene. This methodology has the potential to become an additional tool for Leishmania species characterization and taxonomy. PMID:27352873

Expression of simian virus 40 T antigen in Escherichia coli: localization of T-antigen origin DNA-binding domain to within 129 amino acids.

PubMed Central

Arthur, A K; Höss, A; Fanning, E

1988-01-01

The genomic coding sequence of the large T antigen of simian virus 40 (SV40) was cloned into an Escherichia coli expression vector by joining new restriction sites, BglII and BamHI, introduced at the intron boundaries of the gene. Full-length large T antigen, as well as deletion and amino acid substitution mutants, were inducibly expressed from the lac promoter of pUC9, albeit with different efficiencies and protein stabilities. Specific interaction with SV40 origin DNA was detected for full-length T antigen and certain mutants. Deletion mutants lacking T-antigen residues 1 to 130 and 260 to 708 retained specific origin-binding activity, demonstrating that the region between residues 131 and 259 must carry the essential binding domain for DNA-binding sites I and II. A sequence between residues 302 and 320 homologous to a metal-binding "finger" motif is therefore not required for origin-specific binding. However, substitution of serine for either of two cysteine residues in this motif caused a dramatic decrease in origin DNA-binding activity. This region, as well as other regions of the full-length protein, may thus be involved in stabilizing the DNA-binding domain and altering its preference for binding to site I or site II DNA. Images PMID:2835505

Population structure of the golden snub-nosed monkey Rhinopithecus roxellana in the Qinling Mountains, central China

Treesearch

Kang Huang; Songtao Guo; Samuel A. Cushman; Derek W. Dunn; Xiaoguang Qi; Rong Hou; Jing Zhang; Qi Li; Qiang Zhang; Zhen Shi; Kan Zhang; Baoguo Li

2016-01-01

Environmental barriers and habitat fragmentation can restrict gene flow, leading to genetic divergence among animal populations. The golden snub-nosed monkey, Rhinopithecus roxellana, is endemic to China, and ranges across 4 provinces. However, over the past 40 years its populations have become fragmented. We investigated the genetic diversity, demographic...

Plasmid mapping computer program.

PubMed Central

Nolan, G P; Maina, C V; Szalay, A A

1984-01-01

Three new computer algorithms are described which rapidly order the restriction fragments of a plasmid DNA which has been cleaved with two restriction endonucleases in single and double digestions. Two of the algorithms are contained within a single computer program (called MPCIRC). The Rule-Oriented algorithm, constructs all logical circular map solutions within sixty seconds (14 double-digestion fragments) when used in conjunction with the Permutation method. The program is written in Apple Pascal and runs on an Apple II Plus Microcomputer with 64K of memory. A third algorithm is described which rapidly maps double digests and uses the above two algorithms as adducts. Modifications of the algorithms for linear mapping are also presented. PMID:6320105

Restriction fragment length polymorphisms for growth hormone, prolactin, osteonectin, alpha crystallin, gamma crystallin, fibronectin and 21-steroid hydroxylase in cattle.

PubMed

Theilmann, J L; Skow, L C; Baker, J F; Womack, J E

1989-01-01

Genomic DNAs from animals representing six breeds of cattle (Angus, Brahman, Hereford, Holstein, Jersey and Texas Longhorn) were screened with cloned gene probes in a search for restriction fragment length polymorphisms (RFLPs). Eleven RFLPs were identified using seven different probes: growth hormone, prolactin, osteonectin, alpha A-crystallin, gamma crystallin, fibronectin and 21-steroid hydroxylase. The frequencies of the alleles identified by each probe were calculated and compared in a limited sampling of the six bovine breeds. These polymorphisms greatly enhance the pool of immunogenetic, biochemical and molecular markers available in cattle for linkage analysis, testing of parentage, and distinction of breeds.

hisT is part of a multigene operon in Escherichia coli K-12.

PubMed Central

Marvel, C C; Arps, P J; Rubin, B C; Kammen, H O; Penhoet, E E; Winkler, M E

1985-01-01

The Escherichia coli K-12 hisT gene has been cloned, and its organization and expression have been analyzed on multicopy plasmids. The hisT gene, which encodes tRNA pseudouridine synthase I (PSUI), was isolated on a Clarke-Carbon plasmid known to contain the purF gene. The presence of the hisT gene on this plasmid was suggested by its ability to restore both production of PSUI enzymatic activity and suppression of amber mutations in a hisT mutant strain. A 2.3-kilobase HindIII-ClaI restriction fragment containing the hisT gene was subcloned into plasmid pBR322, and the resulting plasmid (designated psi 300) was mapped with restriction enzymes. Complementation analysis with different kinds of hisT mutations and tRNA structural analysis confirmed that plasmid psi 300 contained the hisT structural gene. Enzyme assays showed that plasmid psi 300 overproduced PSUI activity by ca. 20-fold compared with the wild-type level. Subclones containing restriction fragments from plasmid psi 300 inserted downstream from the lac promoter established that the hisT gene is oriented from the HindIII site toward the ClaI site. Other subclones and derivatives of plasmid psi 300 containing insertion or deletion mutations were constructed and assayed for production of PSUI activity and production of proteins in minicells. These experiments showed that: (i) the proximal 1.3-kilobase HindIII-BssHII restriction fragment contains a promoter for the hisT gene and encodes a 45,000-dalton polypeptide that is not PSUI; (ii) the distal 1.0-kilobase BssHII-ClaI restriction fragment encodes the 31,000-dalton PSUI polypeptide; (iii) the 45,000-dalton polypeptide is synthesized in an approximately eightfold excess compared with PSUI; and (iv) synthesis of the two polypeptides is coupled, suggesting that the two genes are part of an operon. Insertion of mini-Mu d1 (lac Km) phage into plasmid psi 300 confirmed that the hisT gene is the downstream gene in the operon. Images PMID:2981810

Sizing of single fluorescently stained DNA fragments by scanning microscopy

PubMed Central

Laib, Stephan; Rankl, Michael; Ruckstuhl, Thomas; Seeger, Stefan

2003-01-01

We describe an approach to determine DNA fragment sizes based on the fluorescence detection of single adsorbed fragments on specifically coated glass cover slips. The brightness of single fragments stained with the DNA bisintercalation dye TOTO-1 is determined by scanning the surface with a confocal microscope. The brightness of adsorbed fragments is found to be proportional to the fragment length. The method needs only minute amount of DNA, beyond inexpensive and easily available surface coatings, like poly-l-lysine, 3-aminoproyltriethoxysilane and polyornithine, are utilizable. We performed DNA-sizing of fragment lengths between 2 and 14 kb. Further, we resolved the size distribution before and after an enzymatic restriction digest. At this a separation of buffers or enzymes was unnecessary. DNA sizes were determined within an uncertainty of 7–14%. The proposed method is straightforward and can be applied to standardized microtiter plates. PMID:14602931

Total alpha-globin gene cluster deletion has high frequency in Filipinos

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hunt, J.A.; Haruyama, A.Z.; Chu, B.M.

1994-09-01

Most {alpha}-thalassemias [Thal] are due to large deletions. In Southeast Asians, the (--{sup SEA}) double {alpha}-globin gene deletion is common, 3 (--{sup Tot}) total {alpha}-globin cluster deletions are known: Filipino (--{sup Fil}), Thai (--{sup Thai}), and Chinese (--{sup Chin}). In a Hawaii Thal project, provisional diagnosis of {alpha}-Thal-1 heterozygotes was based on microcytosis, normal isoelectric focusing, and no iron deficiency. One in 10 unselected Filipinos was an {alpha}-Thal-1 heterozygote, 2/3 of these had a (--{sup Tot}) deletion: a {var_sigma}-cDNA probe consistently showed fainter intensity of the constant 5.5 kb {var_sigma}{sub 2} BamHI band, with no heterzygosity for {var_sigma}-globin region polymorphisms;more » {alpha}-cDNA or {var_sigma}-cDNA probes showed no BamHI or BglII bands diagnostic of the (--{sup SEA}) deletion; bands for the (-{alpha}) {alpha}-Thal-2 single {alpha}-globin deletions were only seen in Hb H cases. A reliable monoclonal anti-{var_sigma}-peptide antibody test for the (--{sup SEA}) deletion was always negative in (--{sup Tot}) samples. Southern digests with the Lo probe, a gift from D. Higgs of Oxford Univ., confirmed that 49 of 50 (--{sup Tot}) chromosomes in Filipinos were (--{sup Fil}). Of 20 {alpha}-Thal-1 hydrops born to Filipinos, 11 were (--{sup Fil}/--{sup SEA}) compound heterozygotes; 9 were (--{sup SEA}/--{sup SEA}) homozygotes, but none was a (--{sup Fil}/--{sup Fil}).« less

Identification, inheritance, and linkage of B-G-like and MHC class I genes in cranes

USGS Publications Warehouse

Jarvi, S.I.; Goto, R.M.; Gee, G.F.; Briles, W.E.; Miller, M.M.

1999-01-01

We identified B-G-like genes in the whooping and Florida sandhill cranes and linked them to the major histocompatibility complex (MHC). We evaluated the inheritance of B-G-like genes in families of whooping and Florida sandhill cranes using restriction fragment patterns (RFPs). Two B-G-like genes, designated wcbgl and wcbg2, were located within 8 kb of one another. The fully sequenced wcbg2 gene encodes a B-G IgV-like domain, an additional Ig-like domain, a transmembrane domain, and a single heptad domain typical of '-helical coiled coils. Patterns of restriction fragments in DNA from the whooping crane and from a number of other species indicate that the B-G-like gene families of cranes are large with diverse sequences. Segregation of RFPs in families of Florida sandhill cranes provide evidence for genetic polymorphism in the B-G-like genes. The restriction fragments generally segregated in concert with MHC haplotypes assigned by serological typing and by single stranded conformational polymorphism (SSCP) assays based in the second exon of the crane MHC class I genes. This study supports the concept of a long-term association of polymorphic B-G-like genes with the MHC. It also establishes SSCP as a means for evaluating MHC genetic variability in cranes.

Genetic Interrelatedness among Clover Proliferation Mycoplasmalike Organisms (MLOs) and Other MLOs Investigated by Nucleic Acid Hybridization and Restriction Fragment Length Polymorphism Analyses

PubMed Central

Lee, Ing-Ming; Davis, Robert E.; Hiruki, Chuji

1991-01-01

DNA was isolated from clover proliferation (CP) mycoplasmalike organism (MLO)-diseased periwinkle plants (Catharanthus roseus (L.) G. Don.) and cloned into pSP6 plasmid vectors. CP MLO-specific recombinant DNA clones were biotin labeled and used as probes in dot hybridization and restriction fragment length polymorphism analyses to study the genetic interrelatedness among CP MLO and other MLOs, including potato witches'-broom (PWB) MLO. Results from dot hybridization analyses indicated that both a Maryland strain of aster yellows and a California strain of aster yellows are distantly related to CP MLO. Elm yellows, paulownia witches'-broom, peanut witches'-broom, loofah witches'-broom, and sweet potato witches'-broom may be very distantly related, if at all, to CP MLO. A new Jersey strain of aster yellows MLO, tomato big bud MLO, clover phyllody MLO, beet leafhopper-transmitted virescence MLO, and ash yellows MLO are related to CP MLO, but PWB MLO is the most closely related. Similarity coefficients derived from restriction fragment length polymorphism analyses revealed that PWB and CP MLOs are closely related strains and thus provided direct evidence of their relatedness in contrast to reliance solely on biological characterization. Images PMID:16348604

Identification, inheritance, and linkage of B-G-like and MHC class I genes in cranes.

PubMed

Jarvi, S I; Goto, R M; Gee, G F; Briles, W E; Miller, M M

1999-01-01

We identified B-G-like genes in the whooping and Florida sandhill cranes and linked them to the major histocompatibility complex (MHC). We evaluated the inheritance of B-G-like genes in families of whooping and Florida sandhill cranes using restriction fragment patterns (RFPs). Two B-G-like genes, designated wcbg1 and wcbg2, were located within 8 kb of one another. The fully sequenced wcbg2 gene encodes a B-G IgV-like domain, an additional Ig-like domain, a transmembrane domain, and a single heptad domain typical of alpha-helical coiled coils. Patterns of restriction fragments in DNA from the whooping crane and from a number of other species indicate that the B-G-like gene families of cranes are large with diverse sequences. Segregation of RFPs in families of Florida sandhill cranes provide evidence for genetic polymorphism in the B-G-like genes. The restriction fragments generally segregated in concert with MHC haplotypes assigned by serological typing and by single stranded conformational polymorphism (SSCP) assays based in the second exon of the crane MHC class I genes. This study supports the concept of a long-term association of polymorphic B-G-like genes with the MHC. It also establishes SSCP as a means for evaluating MHC genetic variability in cranes.

Multi-Homologous Recombination-Based Gene Manipulation in the Rice Pathogen Fusarium fujikuroi

PubMed Central

Hwang, In Sun; Ahn, Il-Pyung

2016-01-01

Gene disruption by homologous recombination is widely used to investigate and analyze the function of genes in Fusarium fujikuroi, a fungus that causes bakanae disease and root rot symptoms in rice. To generate gene deletion constructs, the use of conventional cloning methods, which rely on restriction enzymes and ligases, has had limited success due to a lack of unique restriction enzyme sites. Although strategies that avoid the use of restriction enzymes have been employed to overcome this issue, these methods require complicated PCR steps or are frequently inefficient. Here, we introduce a cloning system that utilizes multi-fragment assembly by In-Fusion to generate a gene disruption construct. This method utilizes DNA fragment fusion and requires only one PCR step and one reaction for construction. Using this strategy, a gene disruption construct for Fusarium cyclin C1 (FCC1 ), which is associated with fumonisin B1 biosynthesis, was successfully created and used for fungal transformation. In vivo and in vitro experiments using confirmed fcc1 mutants suggest that fumonisin production is closely related to disease symptoms exhibited by F. fujikuroi strain B14. Taken together, this multi-fragment assembly method represents a simpler and a more convenient process for targeted gene disruption in fungi. PMID:27298592

Molecular analysis of Leptospira spp. isolated from humans by restriction fragment length polymorphism, real-time PCR and pulsed-field gel electrophoresis.

PubMed

Turk, Nenad; Milas, Zoran; Mojcec, Vesna; Ruzic-Sabljic, Eva; Staresina, Vilim; Stritof, Zrinka; Habus, Josipa; Postic, Daniele

2009-11-01

A total of 17 Leptospira clinical strains isolated from humans in Croatia were serologically and genetically analysed. For serovar identification, the microscopic agglutination test (MAT) and pulsed-field gel electrophoresis (PFGE) were used. To identify isolates on genomic species level, PCR-based restriction fragment length polymorphism (RFLP) and real-time PCR were performed. MAT revealed the following serogroup affinities: Grippotyphosa (seven isolates), Icterohaemorrhagiae (eight isolates) and Javanica (two isolates). RFLP of PCR products from a 331-bp-long fragment of rrs (16S rRNA gene) digested with endonucleases MnlI and DdeI and real-time PCR revealed three Leptospira genomic species. Grippotyphosa isolates belonged to Leptospira kirschneri, Icterohaemorrhagiae isolates to Leptospira interrogans and Javanica isolates to Leptospira borgpetersenii. Genomic DNA from 17 leptospiral isolates was digested with NotI and SgrAI restriction enzymes and analysed by PFGE. Results showed that seven isolates have the same binding pattern to serovar Grippotyphosa, eight isolates to serovar Icterohaemorrhagiae and two isolates to serovar Poi. Results demonstrate the diversity of leptospires circulating in Croatia. We point out the usefulness of a combination of PFGE, RFLP and real-time PCR as appropriate molecular methods in molecular analysis of leptospires.

PCR-based diagnosis, molecular characterization and detection of atypical strains of avian Chlamydia psittaci in companion and wild birds.

PubMed

Madani, S A; Peighambari, S M

2013-02-01

Chlamydiosis is one of the most important infectious diseases of birds. In this study, 253 clinical samples were taken from 27 bird species belonging to seven orders. Thirty-two (12.6%) samples were positive for Chlamydia psittaci major outer membrane gene (ompA) DNA by a nested polymerase chain reaction (PCR). Twelve nested PCR-positive specimens were typed by ompA gene-based PCR-restricted fragment length polymorphism, using CTU/CTL primers and AluI restriction enzyme. Four restriction patterns were identified, including genotype A (two specimens from an African grey parrot [Psittacus erithacus] and a lorikeet [Trichoglossus haematodus]), genotype B (two specimens from a rock dove [Columbia livia] and a canary [Serinus canaria]), a third new restriction pattern (six specimens from African grey parrots), and a fourth new restriction pattern (two specimens from a ring-necked parakeet [Psittacula krameri] and an Alexandrine parakeet [Psittacula eupatria]). The third and the fourth restriction patterns are suggested to be provisional genotypes I and J, respectively. Partial sequencing of the ompA gene of seven specimens completely correlated with the results of PCR-restricted fragment length polymorphism and confirmed the presence of genotypes A and B and the two new provisional genotypes I and J. The two new genotypes have the closest identity with C. psittaci genotype F and Chlamydia abortus, respectively. From an evolutionary perspective, both new genotypes, particularly genotype J, are intermediate between the two species, C. psittaci and C. abortus.

PCR-Restriction Fragment Length Polymorphism Analysis of the Phospholipase B (PLB1) Gene for Subtyping of Cryptococcus neoformans Isolates

PubMed Central

Latouche, G. Nicolas; Huynh, Matthew; Sorrell, Tania C.; Meyer, Wieland

2003-01-01

Cryptococcus neoformans is a pathogenic yeast that is currently divided into three varieties, five serotypes, and eight molecular types. The following report describes the use of PCR-restriction fragment length polymorphism (RFLP) analysis of the phospholipase B gene (PLB1) as a simple tool to differentiate between C. neoformans subgroups. A PLB1 fragment, 1,970 bp, was amplified and digested with either AvaI or HindIII. Both sets of profiles grouped the isolates into their respective varieties, but only the AvaI profiles allowed for the identification of the eight molecular types via the corresponding RFLP profiles A1 to A8. Digestion of the same fragments with HindIII resulted in RFLP profiles H1 to H5, which distinguished only between serotype A, AD, D, and B/C. Neither enzyme distinguished serotype B from serotype C. The serotype AD profile was a composite of the serotype A and D profiles. Further investigation showed that the serotype AD isolates used in this study are heterozygous, with one allele of PLB1 originating from a serotype A parent and the other from a serotype D parent. PMID:12676686

CAPRRESI: Chimera Assembly by Plasmid Recovery and Restriction Enzyme Site Insertion.

PubMed

Santillán, Orlando; Ramírez-Romero, Miguel A; Dávila, Guillermo

2017-06-25

Here, we present chimera assembly by plasmid recovery and restriction enzyme site insertion (CAPRRESI). CAPRRESI benefits from many strengths of the original plasmid recovery method and introduces restriction enzyme digestion to ease DNA ligation reactions (required for chimera assembly). For this protocol, users clone wildtype genes into the same plasmid (pUC18 or pUC19). After the in silico selection of amino acid sequence regions where chimeras should be assembled, users obtain all the synonym DNA sequences that encode them. Ad hoc Perl scripts enable users to determine all synonym DNA sequences. After this step, another Perl script searches for restriction enzyme sites on all synonym DNA sequences. This in silico analysis is also performed using the ampicillin resistance gene (ampR) found on pUC18/19 plasmids. Users design oligonucleotides inside synonym regions to disrupt wildtype and ampR genes by PCR. After obtaining and purifying complementary DNA fragments, restriction enzyme digestion is accomplished. Chimera assembly is achieved by ligating appropriate complementary DNA fragments. pUC18/19 vectors are selected for CAPRRESI because they offer technical advantages, such as small size (2,686 base pairs), high copy number, advantageous sequencing reaction features, and commercial availability. The usage of restriction enzymes for chimera assembly eliminates the need for DNA polymerases yielding blunt-ended products. CAPRRESI is a fast and low-cost method for fusing protein-coding genes.

Creation of a type IIS restriction endonuclease with a long recognition sequence

PubMed Central

Lippow, Shaun M.; Aha, Patti M.; Parker, Matthew H.; Blake, William J.; Baynes, Brian M.; Lipovšek, Daša

2009-01-01

Type IIS restriction endonucleases cleave DNA outside their recognition sequences, and are therefore particularly useful in the assembly of DNA from smaller fragments. A limitation of type IIS restriction endonucleases in assembly of long DNA sequences is the relative abundance of their target sites. To facilitate ligation-based assembly of extremely long pieces of DNA, we have engineered a new type IIS restriction endonuclease that combines the specificity of the homing endonuclease I-SceI with the type IIS cleavage pattern of FokI. We linked a non-cleaving mutant of I-SceI, which conveys to the chimeric enzyme its specificity for an 18-bp DNA sequence, to the catalytic domain of FokI, which cuts DNA at a defined site outside the target site. Whereas previously described chimeric endonucleases do not produce type IIS-like precise DNA overhangs suitable for ligation, our chimeric endonuclease cleaves double-stranded DNA exactly 2 and 6 nt from the target site to generate homogeneous, 5′, four-base overhangs, which can be ligated with 90% fidelity. We anticipate that these enzymes will be particularly useful in manipulation of DNA fragments larger than a thousand bases, which are very likely to contain target sites for all natural type IIS restriction endonucleases. PMID:19304757

Identification and characterization of Serpulina hyodysenteriae by restriction enzyme analysis and Southern blot analysis.

PubMed Central

Sotiropoulos, C; Coloe, P J; Smith, S C

1994-01-01

Chromosomal DNA restriction enzyme analysis and Southern blot hybridization were used to characterize Serpulina hyodysenteriae strains. When chromosomal DNAs from selected strains (reference serotypes) of S. hyodysenteriae were digested with the restriction endonuclease Sau3A and hybridized with a 1.1-kb S. hyodysenteriae-specific DNA probe, a common 3-kb band was always detected in S. hyodysenteriae strains but was absent from Serpulina innocens strains. When the chromosomal DNA was digested with the restriction endonuclease Asp 700 and hybridized with two S. hyodysenteriae-specific DNA probes (0.75 and 1.1 kb of DNA), distinct hybridization patterns for each S. hyodysenteriae reference strain and the Australian isolate S. hyodysenteriae 5380 were detected. Neither the 1.1-kb nor the 0.75-kb DNA probe hybridized with Asp 700- or Sau3A-digested S. innocens chromosomal DNA. The presence of the 3-kb Sau3A DNA fragment in S. hyodysenteriae reference strains from diverse geographical locations shows that this fragment is conserved among S. hyodysenteriae strains and can be used as a species-specific marker. Restriction endonuclease analysis and Southern blot hybridization with these well-defined DNA probes are reliable and accurate methods for species-specific and strain-specific identification of S. hyodysenteriae. Images PMID:7914209

Amphibian diversity and threatened species in a severely transformed neotropical region in Mexico.

PubMed

Meza-Parral, Yocoyani; Pineda, Eduardo

2015-01-01

Many regions around the world concentrate a large number of highly endangered species that have very restricted distributions. The mountainous region of central Veracruz, Mexico, is considered a priority area for amphibian conservation because of its high level of endemism and the number of threatened species. The original tropical montane cloud forest in the region has been dramatically reduced and fragmented and is now mainly confined to ravines and hillsides. We evaluated the current situation of amphibian diversity in the cloud forest fragments of this region by analyzing species richness and abundance, comparing assemblage structure and species composition, examining the distribution and abundance of threatened species, and identifying the local and landscape variables associated with the observed amphibian diversity. From June to October 2012 we sampled ten forest fragments, investing 944 person-hours of sampling effort. A total of 895 amphibians belonging to 16 species were recorded. Notable differences in species richness, abundance, and assemblage structure between forest fragments were observed. Species composition between pairs of fragments differed by an average of 53%, with the majority (58%) resulting from species replacement and the rest (42%) explained by differences in species richness. Half of the species detected are under threat of extinction according to the International Union for Conservation of Nature, and although their distribution and abundance varied markedly, there were also ubiquitous and abundant species, along with rare species of restricted distribution. The evident heterogeneity of the ten study sites indicates that to conserve amphibians in a mountainous region such as this one it is necessary to protect groups of fragments which represent the variability of the system. Both individually and together cloud forest fragments are very important to conservation because each remnant is inhabited by several threatened species, some of them at imminent risk of extinction.

Restriction fragment length polymorphism of the major histocompatibility complex of the dog.

PubMed

Sarmiento, U M; Storb, R F

1988-01-01

Human major histocompatibility complex (HLA) cDNA probes were used to analyze the restriction fragment length polymorphism (RFLP) of the DLA-D region in dogs. Genomic DNA from peripheral blood leucocytes of 23 unrelated DLA-D-homozygous dogs representing nine DLA-D types (defined by mixed leucocyte reaction) was digested with restriction enzymes (Bam HI, Eco RI, Hind III, Pvu II, Taq I, Rsa I, Msp I, Pst I, and Bgl II), separated by agarose gel electrophoresis, and transferred onto Biotrace membrane. The Southern blots were successively hybridized with radiolabeled HLA cDNA probes corresponding to DR, DQ, DP, and DO beta genes. The autoradiograms for all nine enzyme digests displayed multiple bands with the DRb, DQb, and DPb probes while the DOb probe hybridized with one to two bands. The RFLP patterns were highly polymorphic but consistent within each DLA-D type. Standard RFLP patterns were established for nine DLA-D types which could be discriminated from each other by using two enzymes (Rsa I and Pst I) and the HLA-DPb probe. Cluster analysis of the polymorphic restriction fragments detected by the DRb probe revealed four closely related supertypic groups or DLA-DR families: Dw3 + Dw4 + D1, Dw8 + D10, D7 + D16 + D9, and Dw1. This study provides the basis for DLA-D genotyping at a population level by RFLP analysis. These results also suggest that the genetic organization of the DLA-D region may closely resemble that of the HLA complex.

Case-Study Investigation of Equine Maternity via PCR-RFLP: A Biochemistry Laboratory Experiment

PubMed Central

Millard, Julie T.; Chuang, Edward; Lucas, James S.; Nagy, Erzsebet E.; Davis, Griffin T.

2013-01-01

A simple and robust biochemistry laboratory experiment is described that uses restriction fragment length polymorphism (RFLP) of polymerase chain reaction (PCR) products to verify the identity of a potentially valuable horse. During the first laboratory period, students purify DNA from equine samples and amplify two loci of mitochondrial DNA. During the second laboratory period, students digest PCR products with restriction enzymes and analyze the fragment sizes through agarose gel electrophoresis. An optional step of validating DNA extracts through realtime PCR can expand the experiment to three weeks. This experiment, which has an engaging and versatile scenario, provides students with exposure to key principles and techniques of molecular biology, bioinformatics, and evolution in a forensic context. PMID:24363455

Molecular characterization of Coxiella burnetii isolates.

PubMed Central

Jäger, C.; Willems, H.; Thiele, D.; Baljer, G.

1998-01-01

Restriction fragment length polymorphism (RFLP) was used for the differentiation of 80 Coxiella burnetii isolates derived from animals and humans in Europe, USA, Africa and Asia. After NotI restriction of total C. burnetii DNA and pulsed field gel electrophoresis (PFGE) 20 different restriction patterns were distinguished. The index of discrimination for this typing system was 0.86. Comparison and phylogenetic analysis of the different RFLP patterns revealed evolutionary relationships among groups that corresponded to the geographical origin of the isolates. This finding was confirmed by genetic mapping. No correlation between restriction group and virulence of isolates was detected. PMID:9593485

Fragmentation modes and the evolution of life cycles.

PubMed

Pichugin, Yuriy; Peña, Jorge; Rainey, Paul B; Traulsen, Arne

2017-11-01

Reproduction is a defining feature of living systems. To reproduce, aggregates of biological units (e.g., multicellular organisms or colonial bacteria) must fragment into smaller parts. Fragmentation modes in nature range from binary fission in bacteria to collective-level fragmentation and the production of unicellular propagules in multicellular organisms. Despite this apparent ubiquity, the adaptive significance of fragmentation modes has received little attention. Here, we develop a model in which groups arise from the division of single cells that do not separate but stay together until the moment of group fragmentation. We allow for all possible fragmentation patterns and calculate the population growth rate of each associated life cycle. Fragmentation modes that maximise growth rate comprise a restrictive set of patterns that include production of unicellular propagules and division into two similar size groups. Life cycles marked by single-cell bottlenecks maximise population growth rate under a wide range of conditions. This surprising result offers a new evolutionary explanation for the widespread occurrence of this mode of reproduction. All in all, our model provides a framework for exploring the adaptive significance of fragmentation modes and their associated life cycles.

Fragmentation modes and the evolution of life cycles

PubMed Central

Rainey, Paul B.

2017-01-01

Reproduction is a defining feature of living systems. To reproduce, aggregates of biological units (e.g., multicellular organisms or colonial bacteria) must fragment into smaller parts. Fragmentation modes in nature range from binary fission in bacteria to collective-level fragmentation and the production of unicellular propagules in multicellular organisms. Despite this apparent ubiquity, the adaptive significance of fragmentation modes has received little attention. Here, we develop a model in which groups arise from the division of single cells that do not separate but stay together until the moment of group fragmentation. We allow for all possible fragmentation patterns and calculate the population growth rate of each associated life cycle. Fragmentation modes that maximise growth rate comprise a restrictive set of patterns that include production of unicellular propagules and division into two similar size groups. Life cycles marked by single-cell bottlenecks maximise population growth rate under a wide range of conditions. This surprising result offers a new evolutionary explanation for the widespread occurrence of this mode of reproduction. All in all, our model provides a framework for exploring the adaptive significance of fragmentation modes and their associated life cycles. PMID:29166656

Genetic polymorphisms and protein expression of P53 and BRCA1 in preneoplastic and neoplastic rat mammary glands.

PubMed

Al-Dhaheri, Wafa; Hassouna, Imam; Karam, Sherif M

2018-05-01

Breast cancer is the most common type of cancer and the leading cause of cancer-related deaths among women in the United Arab Emirates and worldwide. Although many factors contribute to the high incidence of breast cancer, a considerable number of cases are related to environmental factors. In the present study, breast cancer was induced in female rats using a single dose, 80 mg/kg body wt, of the environmental carcinogen 7,12-dimethylbenz[a]anthracene (DMBA). The aim of the present study, was to characterize some of the molecular changes that occur during breast cancer development in the DMBA-treated rat model. Mammary gland tissues of control and DMBA-treated rats were processed for: i) immunohistochemical probing using anti-BRCA1 antibody to characterize and correlate the localization of this cell cycle protein during progression to cancer, ii) western blotting to analyze the alteration of p53 protein expression in preneoplastic and neoplastic lesions of the mammary glands, and iii) polymerase chain reactions using primers specific for BRCA1 and P53 genes followed by single stranded conformational polymorphism (SSCP) or restriction fragment length polymorphism (RFLP) assays to detect possible mutations in these genes during development of breast cancer. Microscopic examination revealed a wide range of preneoplastic and neoplastic lesions providing a sequence representing the multistep process of breast cancer formation in DMBA-treated rats. Probing for BRCA1 protein revealed a gradual defect in its translocation from the cytoplasm to the nucleus during breast cancer progression. In control rats, BRCA1 was present in the nuclei of terminal duct epithelial cells. However, in the preneoplastic lesions, BRCA1 was localized in both the cytoplasm and nuclei of the epithelial duct cells. In all malignant lesions, BRCA1 was mostly found in the cytoplasm. Western blotting revealed initial downregulation in the expression of p53 protein during breast cancer development. However, with progression towards malignancy, upregulation of p53 was observed. These changes were associated with polymorphism in p53 gene, which was detected in exon 5 using SSCP assay. However, using RFLP and BamHI to digest the PCR products of exon 11 of BRCA1 gene revealed no detectable polymorphisms. In conclusion, molecular characterization of the early changes that occur during development of breast cancer provides some clues for better understanding of its pathogenesis.

In vitro DNA fragmentation of mitochondrial DNA caused by single-stranded breakage related to macroplasmodial senescence of the true slime mold, Physarum polycephalum.

PubMed

Abe, T; Takano, H; Sasaki, N; Mori, K; Kawano, S

2000-02-01

We found that mitochondrial DNA (mtDNA) isolated from Physarum polycephalum fragmented itself in weak ionic solutions. The mtDNA was dissolved in STE (saline Tris-EDTA: 150 mM NaCl, 10 mM Tris-HCl, 1 mM EDTA), TE (10 mM Tris-HCl, 1 mM EDTA) and DW, and then electrophoresed in an agarose gel. The intact 86-kbp mtDNA band was seen in STE, but several novel bands appeared in TE and DW. In TE, two discrete bands appeared at 6.7-kbp (alpha-band) and 5.0-kbp (beta-band), whereas at least 17 discrete bands were observed in distilled water (DW). These fragmentation patterns were not stoichiometric, as seen when using restriction endonucleases, but were clearly different from the degradation of DNA caused by a physical shearing force or a contaminating nuclease. In this paper, we characterize this in vitro fragmentation of mtDNA from P. polycephalum. We located 19 fragments, including the alpha and beta fragments, on a mtDNA restriction map, and demonstrated that these cleavage sites were S1 nuclease-sensitive regions, which are single-stranded DNA regions such as nicks and gaps in the mtDNA. The alpha and beta fragments are derived from the region encoding ribosomal RNAs (rRNAs) and the ATP synthase (atpA) gene, while the other 17 fragments are not derived from any specific region, but the cleavage sites are located throughout the mtDNA molecule. In P. polycephalum, it is well known that the growth rate of macroplasmodia decreases with aging. Equal amounts of mtDNA from juvenile and aged macroplasmodia were electrophoresed and the frequency of the beta fragment in each sample was measured. The ratio of the beta band to the total signal including background was estimated to be 3.3-4.0% in juvenile macroplasmodia, whereas it increased to 8.3-28.2% in aged macroplasmodia. This result suggests that the in vitro fragmentation of mtDNA is associated with macroplasmodial senescence. The single-stranded breakage of mtDNA of P. polycephalum may accumulate with age.

Polarity of recombination in transformation of Streptococcus pneumoniae

PubMed Central

Pasta, Franck; Sicard, Michel A.

1999-01-01

In transformation of Streptococcus pneumoniae DNA enters the cell as single-strand fragments and integrates into the chromosome by homologous recombination. Deletions and insertions of a few hundred base pairs frequently stop the recombination process of a donor strand. In this work we took advantage of such interruptions of recombination to compare the transformation efficiencies of the segments 5′- and 3′-ward from a deletion. The deletion was created in the center of a fragment of the ami locus, and sites around the deletion were labeled by a frameshift generating a restriction site. Heteroduplexes were constructed containing two restriction sites on one strand and two different ones on the complementary strand. ami+ bacteria were transformed with such heteroduplexes. ami− transformants were isolated and individually underwent amplification of the transformed ami region. We have obtained two kinds of amplification products: short when the deletion was integrated, long when recombination stops at the deletion. Each long fragment was tested by the four restriction enzymes to detect which strand and which side of the deletion had recombined. We found that 80% of the cuts were located 5′ to the deletion, showing that, in vivo, the 5′ side is strongly favored by recombination. Further results suggest that exchanges occurring from 5′ to 3′ relative to the donor strand are more efficient than in the opposite direction, thus accounting for the 5′ preference. PMID:10077616

Polarity of recombination in transformation of Streptococcus pneumoniae.

PubMed

Pasta, F; Sicard, M A

1999-03-16

In transformation of Streptococcus pneumoniae DNA enters the cell as single-strand fragments and integrates into the chromosome by homologous recombination. Deletions and insertions of a few hundred base pairs frequently stop the recombination process of a donor strand. In this work we took advantage of such interruptions of recombination to compare the transformation efficiencies of the segments 5'- and 3'-ward from a deletion. The deletion was created in the center of a fragment of the ami locus, and sites around the deletion were labeled by a frameshift generating a restriction site. Heteroduplexes were constructed containing two restriction sites on one strand and two different ones on the complementary strand. ami+ bacteria were transformed with such heteroduplexes. ami- transformants were isolated and individually underwent amplification of the transformed ami region. We have obtained two kinds of amplification products: short when the deletion was integrated, long when recombination stops at the deletion. Each long fragment was tested by the four restriction enzymes to detect which strand and which side of the deletion had recombined. We found that 80% of the cuts were located 5' to the deletion, showing that, in vivo, the 5' side is strongly favored by recombination. Further results suggest that exchanges occurring from 5' to 3' relative to the donor strand are more efficient than in the opposite direction, thus accounting for the 5' preference.

Molecular typing of Iranian mycobacteria isolates by polymerase chain reaction-restriction fragment length polymorphism analysis of 360-bp rpoB gene

PubMed Central

Hadifar, Shima; Moghim, Sharareh; Fazeli, Hossein; GhasemianSafaei, Hajieh; Havaei, Seyed Asghar; Farid, Fariba; Esfahani, Bahram Nasr

2015-01-01

Background: Diagnosis and typing of Mycobacterium genus provides basic tools for investigating the epidemiology and pathogenesis of this group of bacteria. Polymerase chain reaction (PCR)-restriction fragment length polymorphism analysis (PRA) is an accurate method providing diagnosis and typing of species of mycobacteria. The present study is conducted by the purpose of determining restriction fragment profiles of common types of mycobacteria by PRA method of rpoB gene in this geographical region. Materials and Methods: Totally 60 clinical and environmental isolates from February to October, 2013 were collected and subcultured and identified by phenotypic methods. A 360 bp fragment of the rpoB gene amplified by PCR and products were digested by MspI and HaeIII enzymes. Results: In the present study, of all mycobacteria isolates identified by PRA method, 13 isolates (21.66%) were Mycobacterium tuberculosis, 34 isolates (56.66%) were rapidly growing Nontuberculosis Mycobacteria (NTM) that including 26 clinical isolates (43.33%) and 8 environmental isolates (13.33%), 11 isolates (18.33%) were clinical slowly growing NTM. among the clinical NTM isolates, Mycobacterium fortuitum Type I with the frequency of 57.77% was the most prevalent type isolates. Furthermore, an unrecorded of the PRA pattern of Mycobacterium conceptionense (HeaIII: 120/90/80, MspI: 120/105/80) was found. This study demonstrated that the PRA method was high discriminatory power for identification and typing of mycobacteria species and was able to identify 96.6% of all isolates. Conclusion: Based on the result of this study, rpoB gene could be a potentially useful tool for identification and investigation of molecular epidemiology of mycobacterial species. PMID:26380237

Chloroplast and mitochondrial DNA are paternally inherited in Sequoia sempervirens D. Don Endl

PubMed Central

Neale, David B.; Marshall, Kimberly A.; Sederoff, Ronald R.

1989-01-01

Restriction fragment length polymorphisms in controlled crosses were used to infer the mode of inheritance of chloroplast DNA and mitochondrial DNA in coast redwood (Sequoia sempervirens D. Don Endl.). Chloroplast DNA was paternally inherited, as is true for all other conifers studied thus far. Surprisingly, a restriction fragment length polymorphism detected by a mitochondrial probe was paternally inherited as well. This polymorphism could not be detected in hybridizations with chloroplast probes covering the entire chloroplast genome, thus providing evidence that the mitochondrial probe had not hybridized to chloroplast DNA on the blot. We conclude that mitochondrial DNA is paternally inherited in coast redwood. To our knowledge, paternal inheritance of mitochondrial DNA in sexual crosses of a multicellular eukaryotic organism has not been previously reported. Images PMID:16594091

Telomere erosion varies during in vitro aging of normal human fibroblasts from young and adult donors.

PubMed

Figueroa, R; Lindenmaier, H; Hergenhahn, M; Nielsen, K V; Boukamp, P

2000-06-01

The life span of normal fibroblasts in vitro (Hayflick limit) depends on donor age, and telomere shortening has been proposed as a potential mechanism. By quantitative fluorescence in situ hybridization and Southern blot analysis, we show progressive telomere loss to about 5 kb mean telomere restriction fragment length in fibroblasts from two adult donors within 40 population doublings, whereas in fibroblasts from two infant donors, telomere erosion is reduced, leaving a mean telomere restriction fragment length of approximately 7 kb at senescence (after approximately 60 population doublings). Aging of fibroblasts from both infant and adult donors was not accompanied by chromosomal abnormalities but was correlated with increased telomere repeat-binding factor 2 expression at both the protein and transcriptional level.

Leishmania chagasi in Opossums (Didelphis albiventris) in an Urban Area Endemic for Visceral Leishmaniasis, Campo Grande, Mato Grosso do Sul, Brazil

PubMed Central

Humberg, Roberta M. P.; Oshiro, Elisa T.; Cruz, Maria do Socorro Pires e; Ribolla, Paulo E. M.; Alonso, Diego P.; Ferreira, Alda M. T.; Bonamigo, Raquel A.; Tasso, Norton; de Oliveira, Alessandra Gutierrez

2012-01-01

We investigated the occurrence of Leishmania infantum chagasi in Didelphis albiventris opossums at a wild animal rehabilitation center in the city of Campo Grande, Brazil. A total of 54 opossums were tested for L. i. chagasi infection in peripheral blood and bone marrow samples. The samples were analyzed by direct examination, culturing in a specific medium, and polymerase chain reaction–restriction fragment length polymorphism. Leishmania i. chagasi DNA was detected by polymerase chain reaction–restriction fragment length polymorphism in 11 (20.37%) animals. A total of 81.81% of positive opossums were captured in areas of known visceral leishmaniasis transmission. These results suggest a role for D. albiventris in the urban transmission of visceral leishmaniasis. PMID:22802435

C 3-symmetric opioid scaffolds are pH-responsive DNA condensation agents

PubMed Central

McStay, Natasha; Molphy, Zara; Coughlan, Alan; Cafolla, Attilio; McKee, Vickie; Gathergood, Nicholas; Kellett, Andrew

2017-01-01

Herein we report the synthesis of tripodal C3-symmetric opioid scaffolds as high-affinity condensation agents of duplex DNA. Condensation was achieved on both supercoiled and canonical B-DNA structures and identified by agarose electrophoresis, viscosity, turbidity and atomic force microscopy (AFM) measurements. Structurally, the requirement of a tris-opioid scaffold for condensation is demonstrated as both di- (C2-symmetric) and mono-substituted (C1-symmetric) mesitylene-linked opioid derivatives poorly coordinate dsDNA. Condensation, observed by toroidal and globule AFM aggregation, arises from surface-binding ionic interactions between protonated, cationic, tertiary amine groups on the opioid skeleton and the phosphate nucleic acid backbone. Indeed, by converting the 6-hydroxyl group of C3-morphine (MC3) to methoxy substituents in C3-heterocodeine (HC3) and C3-oripavine (OC3) molecules, dsDNA compaction is retained thus negating the possibility of phosphate—hydroxyl surface-binding. Tripodal opioid condensation was identified as pH dependent and strongly influenced by ionic strength with further evidence of cationic amine-phosphate backbone coordination arising from thermal melting analysis and circular dichroism spectroscopy, with compaction also witnessed on synthetic dsDNA co-polymers poly[d(A-T)2] and poly[d(G-C)2]. On-chip microfluidic analysis of DNA condensed by C3-agents provided concentration-dependent protection (inhibition) to site-selective excision by type II restriction enzymes: BamHI, HindIII, SalI and EcoRI, but not to the endonuclease DNase I. PMID:27899572

Human retinoblastoma susceptibility gene: genomic organization and analysis of heterozygous intragenic deletion mutants.

PubMed Central

Bookstein, R; Lee, E Y; To, H; Young, L J; Sery, T W; Hayes, R C; Friedmann, T; Lee, W H

1988-01-01

A gene in chromosome region 13q14 has been identified as the human retinoblastoma susceptibility (RB) gene on the basis of altered gene expression found in virtually all retinoblastomas. In order to further characterize the RB gene and its structural alterations, we examined genomic clones of the RB gene isolated from both a normal human genomic library and a library made from DNA of the retinoblastoma cell line Y79. First, a restriction and exon map of the RB gene was constructed by aligning overlapping genomic clones, yielding three contiguous regions ("contigs") of 150 kilobases total length separated by two gaps. At least 20 exons were identified in genomic clones, and these were provisionally numbered. Second, two overlapping genomic clones that demonstrated a DNA deletion of exons 2 through 6 from one RB allele were isolated from the Y79 library. To confirm and extend this result, a unique sequence probe from intron 1 was used to detect similar and possibly identical heterozygous deletions in genomic DNA from three retinoblastoma cell lines, thereby explaining the origins of their shortened RB mRNA transcripts. The same probe detected genomic rearrangements in fibroblasts from two hereditary retinoblastoma patients, indicating that intron 1 includes a frequent site for mutations conferring predisposition to retinoblastoma. Third, this probe also detected a polymorphic site for BamHI with allele frequencies near 0.5/0.5. Identification of commonly mutated regions will contribute significantly to genetic diagnosis in retinoblastoma patients and families. Images PMID:2895471

Use of restriction fragment length polymorphisms to investigate strain variation within Neisseria meningitidis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Williams, S.D.

1989-01-01

Similarity within bacterial populations is difficult to assess due to the limited number of characters available for evaluation and the heterogeneity of bacterial species. Currently, the preferred method used to evaluate the structure of bacterial populations is multilocus enzyme electrophoresis. However, this method is extremely cumbersome and only offers an indirect measure of genetic similarities. The development of a more direct and less cumbersome method for this purpose is warranted. Restriction fragment length polymorphism analysis was evaluated as a tool for use in the study of bacterial population structures and in the epidemiology and surveillance of infectious disease. A collectionmore » of Neisseria meningitidis was available for use in the investigation of this technique. Neisseria meningitidis is the causative agent of epidemic cerebrospinal meningitis and septicemia as well as a variety of other clinical manifestations. Each isolate in the collection was defined in terms of serogroup specificity, clinical history, geographic source, and date of isolation. Forty-six strains were chosen for this study. The DNA from each strain was restricted with Pst1 and EcoR1 and electrophoresed on agarose gels. The DNA was transferred to nylon filters and hybridized with P{sup 32} labeled DNA probes. Two randomly generated probes and a gene-specific probe were used to estimate the genetic similarities between and among the strains in the study population. A total of 28 different restriction fragment migration types were detected by the probes used. Data obtained from the RFLP analysis was analyzed by cluster analysis and multivariate statistical methods. A total of 7 clones groups were detected. Two of these appear to be major clones that comprise 35% of the population.« less

Short mucin 6 alleles are associated with H pylori infection

PubMed Central

Nguyen, Thai V; Janssen, Marcel JR; Gritters, Paulien; te Morsche, René HM; Drenth, Joost PH; van Asten, Henri; Laheij, Robert JF; Jansen, Jan BMJ

2006-01-01

AIM: To investigate the relationship between mucin 6 (MUC6) VNTR length and H pylori infection. METHODS: Blood samples were collected from patients visiting the Can Tho General Hospital for upper gastrointestinal endoscopy. DNA was isolated from whole blood, the repeated section was cut out using a restriction enzyme (PvuII) and the length of the allele fragments was determined by Southern blotting. H pylori infection was diagnosed by 14C urea breath test. For analysis, MUC6 allele fragment length was dichotomized as being either long (> 13.5 kbp) or short (≤ 13.5 kbp) and patients were classified according to genotype [long-long (LL), long-short (LS), short-short (SS)]. RESULTS: 160 patients were studied (mean age 43 years, 36% were males, 58% H pylori positive). MUC6 PvuII-restricted allele fragment lengths ranged from 7 to 19 kbp. Of the patients with the LL, LS, SS MUC6 genotype, 43% (24/56), 57% (25/58) and 76% (11/46) were infected with H pylori, respectively (P = 0.003). CONCLUSION: Short MUC6 alleles are associated with H pylori infection. PMID:17009402

Short mucin 6 alleles are associated with H pylori infection.

PubMed

Nguyen, Thai V; Janssen, Marcel; Gritters, Paulien; te Morsche, René H M; Drenth, Joost P H; van Asten, Henri; Laheij, Robert J F; Jansen, Jan B M J

2006-10-07

To investigate the relationship between mucin 6 (MUC6) VNTR length and H pylori infection. Blood samples were collected from patients visiting the Can Tho General Hospital for upper gastrointestinal endoscopy. DNA was isolated from whole blood, the repeated section was cut out using a restriction enzyme (Pvu II) and the length of the allele fragments was determined by Southern blotting. H pylori infection was diagnosed by (14)C urea breath test. For analysis, MUC6 allele fragment length was dichotomized as being either long (> 13.5 kbp) or short (< or = 13.5 kbp) and patients were classified according to genotype [long-long (LL), long-short (LS), short-short (SS)]. 160 patients were studied (mean age 43 years, 36% were males, 58% H pylori positive). MUC6 Pvu II-restricted allele fragment lengths ranged from 7 to 19 kbp. Of the patients with the LL, LS, SS MUC6 genotype, 43% (24/56), 57% (25/58) and 76% (11/46) were infected with H pylori, respectively (P = 0.003). Short MUC6 alleles are associated with H pylori infection.

Peculiarities of RFLP of highly repetitive DNA in crow genomes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chelomina, G.N.; Kryukov, A.P.; Ivanov, S.V.

1995-02-01

We present a study of the structural organization of highly repetitive DNA in genomes of hooded crow Corvus cornix L., carrion crow C. corone L., and jungle crow C. macrorhynchos Wagl. RFLP and blot-hybridization with {sup 32}P-labeled Msp I fragment from hooded crow nDNA suggest the interspecific structural conservatism of the most repetitive DNA. The family of repeats we studied had tandem organization and the same (210 bp) period of reiteration for a set of restriction enzymes. However, in parallel to the general similarity of restriction patterns, there are species-specific peculiarities. The repetitive family revealed (Alu I, BsuR I, andmore » Msp I fragments) has quantitative RFLP of nDNA and interspecific differences in the extent of the multimer {open_quotes}ladder{close_quotes} pattern of Msp I fragments. The latter is more pronounced in nDNA of carrion crow than in that of phylogenetically distant jungle crow and closely related hooded crow. This suggests a recent amplification event for highly organized homological repeats in crow genomes. 10 refs., 2 figs.« less

Analytic second derivative of the energy for density functional theory based on the three-body fragment molecular orbital method

NASA Astrophysics Data System (ADS)

Nakata, Hiroya; Fedorov, Dmitri G.; Zahariev, Federico; Schmidt, Michael W.; Kitaura, Kazuo; Gordon, Mark S.; Nakamura, Shinichiro

2015-03-01

Analytic second derivatives of the energy with respect to nuclear coordinates have been developed for spin restricted density functional theory (DFT) based on the fragment molecular orbital method (FMO). The derivations were carried out for the three-body expansion (FMO3), and the two-body expressions can be obtained by neglecting the three-body corrections. Also, the restricted Hartree-Fock (RHF) Hessian for FMO3 can be obtained by neglecting the density-functional related terms. In both the FMO-RHF and FMO-DFT Hessians, certain terms with small magnitudes are neglected for computational efficiency. The accuracy of the FMO-DFT Hessian in terms of the Gibbs free energy is evaluated for a set of polypeptides and water clusters and found to be within 1 kcal/mol of the corresponding full (non-fragmented) ab initio calculation. The FMO-DFT method is also applied to transition states in SN2 reactions and for the computation of the IR and Raman spectra of a small Trp-cage protein (PDB: 1L2Y). Some computational timing analysis is also presented.

Phylogenetic relationships among anuran trypanosomes as revealed by riboprinting.

PubMed

Clark, C G; Martin, D S; Diamond, L S

1995-01-01

Twenty trypanosome isolates from Anura (frogs and toads) assigned to several species were characterized by riboprinting-restriction enzyme digestion of polymerase chain reaction amplified small subunit ribosomal RNA genes. Restriction site polymorphisms allowed distinction of all the recognized species and no intraspecific variation in riboprint patterns was detected. Phylogenetic reconstruction using parsimony and distance estimates based on restriction fragment comigration showed Trypanosoma chattoni to be only distantly related to the other species, while T. ranarum and T. fallisi appear to be sister taxa despite showing non-overlapping host specificities.

A simple method for semi-random DNA amplicon fragmentation using the methylation-dependent restriction enzyme MspJI.

PubMed

Shinozuka, Hiroshi; Cogan, Noel O I; Shinozuka, Maiko; Marshall, Alexis; Kay, Pippa; Lin, Yi-Han; Spangenberg, German C; Forster, John W

2015-04-11

Fragmentation at random nucleotide locations is an essential process for preparation of DNA libraries to be used on massively parallel short-read DNA sequencing platforms. Although instruments for physical shearing, such as the Covaris S2 focused-ultrasonicator system, and products for enzymatic shearing, such as the Nextera technology and NEBNext dsDNA Fragmentase kit, are commercially available, a simple and inexpensive method is desirable for high-throughput sequencing library preparation. MspJI is a recently characterised restriction enzyme which recognises the sequence motif CNNR (where R = G or A) when the first base is modified to 5-methylcytosine or 5-hydroxymethylcytosine. A semi-random enzymatic DNA amplicon fragmentation method was developed based on the unique cleavage properties of MspJI. In this method, random incorporation of 5-methyl-2'-deoxycytidine-5'-triphosphate is achieved through DNA amplification with DNA polymerase, followed by DNA digestion with MspJI. Due to the recognition sequence of the enzyme, DNA amplicons are fragmented in a relatively sequence-independent manner. The size range of the resulting fragments was capable of control through optimisation of 5-methyl-2'-deoxycytidine-5'-triphosphate concentration in the reaction mixture. A library suitable for sequencing using the Illumina MiSeq platform was prepared and processed using the proposed method. Alignment of generated short reads to a reference sequence demonstrated a relatively high level of random fragmentation. The proposed method may be performed with standard laboratory equipment. Although the uniformity of coverage was slightly inferior to the Covaris physical shearing procedure, due to efficiencies of cost and labour, the method may be more suitable than existing approaches for implementation in large-scale sequencing activities, such as bacterial artificial chromosome (BAC)-based genome sequence assembly, pan-genomic studies and locus-targeted genotyping-by-sequencing.

pLS010 plasmid vector

DOEpatents

Lacks, Sanford A.; Balganesh, Tanjore S.

1988-01-01

Disclosed is recombinant plasmid pLS101, consisting essentially of a 2.0 Kb malM gene fragment ligated to a 4.4 Kb T.sub.c r DNA fragment, which is particularly useful for transforming Gram-positive bacteria. This plasmid contains at least four restriction sites suitable for inserting exogeneous gene sequences. Also disclosed is a method for plasmid isolation by penicillin selection, as well as processes for enrichment of recombinant plasmids in Gram-positive bacterial systems.

Identification of verotoxin type 2 variant B subunit genes in Escherichia coli by the polymerase chain reaction and restriction fragment length polymorphism analysis.

PubMed Central

Tyler, S D; Johnson, W M; Lior, H; Wang, G; Rozee, K R

1991-01-01

A set of synthetic oligonucleotide primers was designed for use in a polymerase chain reaction protocol to specifically detect the B subunit genes in vtx2ha and vtx2hb, which code for the production of the VT2 (Shiga-like toxin II) variant cytotoxins VT2v-a and VT2v-b, respectively. An additional set of primers amplified a fragment common to the B subunits of the VT2 and the VT2 variant genes. Subsequent restriction endonuclease digestion of this amplicon permitted prediction of specific VT2 and variant genotypes on the basis of predetermined restriction fragment length polymorphisms. Genotypes of 21 VT2-producing strains of Escherichia coli were determined using this polymerase chain reaction-restriction fragment length polymorphism procedure. Four strains contained B subunit target sequences only for VT2 genes, 9 strains contained sequences only for VT2v-a genes, and 3 strains contained sequences only for VT2v-b. For genes in combination, one strain contained B subunit genes for both VT2 and VT2v-a and two strains contained B subunit genes for VT2 and VT2v-b. Two strains of E. coli O91:H21 contained both VT2v-a and VT2v-b B subunit genes. The VT2 reference strain of E. coli, E32511, was found to contain the targeted sequences from both VT2 and VT2v-a genes, whereas the recombinant E. coli, pEB1, possessed only that of the VT2 gene. The specific activities of extracellular VT2 determined in HeLa cells ranged from 0.3 to 41.7 TCD50 per microgram of protein in strains carrying the VT2 gene target and from 0 to 50.0 TCD50 per microgram of protein in strains carrying only the VT2 variant target (TCD50 is the tissue culture dose by which 50% of the cells were affected), suggesting that phenotypic expression does not correlate with genotype. Images PMID:1679436

Mechanisms Underlying the Breast Cancer Susceptibility Locus Mcs5a

DTIC Science & Technology

2010-07-01

fixed using formaldehyde . The extracted fixed chromatin is digested with a restriction enzyme and religated in a strongly dilute fashion. In this...procedure the ligation of genetic elements that were glued together by formaldehyde fixation is favored over ligation of random elements. Following... digested and randomly ligated control template containing all restriction fragments of interest in equal molarity. To investigate the Mcs5a1-Mcs5a2

Two-dimensional finite-element analyses of simulated rotor-fragment impacts against rings and beams compared with experiments

NASA Technical Reports Server (NTRS)

Stagliano, T. R.; Witmer, E. A.; Rodal, J. J. A.

1979-01-01

Finite element modeling alternatives as well as the utility and limitations of the two dimensional structural response computer code CIVM-JET 4B for predicting the transient, large deflection, elastic plastic, structural responses of two dimensional beam and/or ring structures which are subjected to rigid fragment impact were investigated. The applicability of the CIVM-JET 4B analysis and code for the prediction of steel containment ring response to impact by complex deformable fragments from a trihub burst of a T58 turbine rotor was studied. Dimensional analysis considerations were used in a parametric examination of data from engine rotor burst containment experiments and data from sphere beam impact experiments. The use of the CIVM-JET 4B computer code for making parametric structural response studies on both fragment-containment structure and fragment-deflector structure was illustrated. Modifications to the analysis/computation procedure were developed to alleviate restrictions.

Hot Fusion: an efficient method to clone multiple DNA fragments as well as inverted repeats without ligase.

PubMed

Fu, Changlin; Donovan, William P; Shikapwashya-Hasser, Olga; Ye, Xudong; Cole, Robert H

2014-01-01

Molecular cloning is utilized in nearly every facet of biological and medical research. We have developed a method, termed Hot Fusion, to efficiently clone one or multiple DNA fragments into plasmid vectors without the use of ligase. The method is directional, produces seamless junctions and is not dependent on the availability of restriction sites for inserts. Fragments are assembled based on shared homology regions of 17-30 bp at the junctions, which greatly simplifies the construct design. Hot Fusion is carried out in a one-step, single tube reaction at 50 °C for one hour followed by cooling to room temperature. In addition to its utility for multi-fragment assembly Hot Fusion provides a highly efficient method for cloning DNA fragments containing inverted repeats for applications such as RNAi. The overall cloning efficiency is in the order of 90-95%.

Hot Fusion: An Efficient Method to Clone Multiple DNA Fragments as Well as Inverted Repeats without Ligase

PubMed Central

Fu, Changlin; Donovan, William P.; Shikapwashya-Hasser, Olga; Ye, Xudong; Cole, Robert H.

2014-01-01

Molecular cloning is utilized in nearly every facet of biological and medical research. We have developed a method, termed Hot Fusion, to efficiently clone one or multiple DNA fragments into plasmid vectors without the use of ligase. The method is directional, produces seamless junctions and is not dependent on the availability of restriction sites for inserts. Fragments are assembled based on shared homology regions of 17–30 bp at the junctions, which greatly simplifies the construct design. Hot Fusion is carried out in a one-step, single tube reaction at 50°C for one hour followed by cooling to room temperature. In addition to its utility for multi-fragment assembly Hot Fusion provides a highly efficient method for cloning DNA fragments containing inverted repeats for applications such as RNAi. The overall cloning efficiency is in the order of 90–95%. PMID:25551825

Bioisosteric Replacements Extracted from High-Quality Structures in the Protein Databank.

PubMed

Seddon, Matthew P; Cosgrove, David A; Gillet, Valerie J

2018-03-20

Bioisosterism is an important concept in the lead optimisation phase of drug discovery where the aim is to make modifications to parts of a molecule in order to improve some properties while maintaining others. We present an analysis of bioisosteric fragments extracted from the ligands in an established data set consisting of 121 protein targets. A pairwise analysis is carried out of all ligands for a given target. The ligands are fragmented using the BRICS fragmentation scheme and a pair of fragments is deemed to be bioisosteric if they occupy a similar volume of the protein binding site. We consider two levels of generality, one which does not consider the number of attachment points in the fragments and a more restricted case in which both fragments are required to have the same number of attachments. We investigate the extent to which the bioisosteric pairs that are found are common across different target. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Amphibian Diversity and Threatened Species in a Severely Transformed Neotropical Region in Mexico

PubMed Central

Meza-Parral, Yocoyani; Pineda, Eduardo

2015-01-01

Many regions around the world concentrate a large number of highly endangered species that have very restricted distributions. The mountainous region of central Veracruz, Mexico, is considered a priority area for amphibian conservation because of its high level of endemism and the number of threatened species. The original tropical montane cloud forest in the region has been dramatically reduced and fragmented and is now mainly confined to ravines and hillsides. We evaluated the current situation of amphibian diversity in the cloud forest fragments of this region by analyzing species richness and abundance, comparing assemblage structure and species composition, examining the distribution and abundance of threatened species, and identifying the local and landscape variables associated with the observed amphibian diversity. From June to October 2012 we sampled ten forest fragments, investing 944 person-hours of sampling effort. A total of 895 amphibians belonging to 16 species were recorded. Notable differences in species richness, abundance, and assemblage structure between forest fragments were observed. Species composition between pairs of fragments differed by an average of 53%, with the majority (58%) resulting from species replacement and the rest (42%) explained by differences in species richness. Half of the species detected are under threat of extinction according to the International Union for Conservation of Nature, and although their distribution and abundance varied markedly, there were also ubiquitous and abundant species, along with rare species of restricted distribution. The evident heterogeneity of the ten study sites indicates that to conserve amphibians in a mountainous region such as this one it is necessary to protect groups of fragments which represent the variability of the system. Both individually and together cloud forest fragments are very important to conservation because each remnant is inhabited by several threatened species, some of them at imminent risk of extinction. PMID:25799369

Detection of Penicillin Susceptibility in Streptococcus pneumoniae by pbp2b PCR-Restriction Fragment Length Polymorphism Analysis

PubMed Central

O’Neill, A. M.; Gillespie, S. H.; Whiting, G. C.

1999-01-01

A PCR-restriction fragment length polymorphism strategy directed against the pbp2b gene was evaluated for identification of penicillin susceptibility. A total of 106 United Kingdom (U.K.), 30 Danish, and 11 Papua New Guinean strains were tested. Of the U.K. strains, all the susceptible and all but one of the resistant isolates were correctly assigned. By using conventional definitions of “not resistant” and “not susceptible,” the sensitivities were 97.5 and 94.4%, the specificities were 100 and 98.9%, the positive predictive values were 100 and 94.4%, and the negative predictive values were 93.1 and 98.9%, respectively. This technique may allow susceptible (MIC, <0.1 mg/liter) and resistant (MIC, >1 mg/liter) isolates to be distinguished in a single PCR. PMID:9854082

Mapping the x-linked lymphoproliferative syndrome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Skare, J.C.; Milunsky, A.; Byron, K.S.

1987-04-01

The X-linked lymphoproliferative syndrome is triggered by Epstein-Barr virus infection and results in fatal mononucleosis, immunodeficiency, and lymphoproliferative disorders. This study shows that the mutation responsible for X-linked lymphoproliferative syndrome is genetically linked to a restriction fragment length polymorphism detected with the DXS42 probe (from Xq24-q27). The most likely recombination frequency between the loci is 4%, and the associated logarithm of the odds is 5.26. Haplotype analysis using flanking restriction fragment length polymorphism markers indicates that the locus for X-linked lymphoproliferative syndrome is distal to probe DXS42 but proximal to probe DXS99 (from Xq26-q27). It is now possible to predictmore » which members of a family with X-linked lymphoproliferative syndrome are carrier females and to diagnose the syndrome prenatally.« less

Method of preparing and applying single stranded DNA probes to double stranded target DNAs in situ

DOEpatents

Gray, Joe W.; Pinkel, Daniel

1991-01-01

A method is provided for producing single stranded non-self-complementary nucleic acid probes, and for treating target DNA for use therewith. Probe is constructed by treating DNA with a restriction enzyme and an exonuclease to form template/primers for a DNA polymerase. The digested strand is resynthesized in the presence of labeled nucleoside triphosphate precursor. Labeled single stranded fragments are separated from the resynthesized fragments to form the probe. Target DNA is treated with the same restriction enzyme used to construct the probe, and is treated with an exonuclease before application of the probe. The method significantly increases the efficiency and specificity of hybridization mixtures by increasing effective probe concentration by eliminating self-hybridization between both probe and target DNAs, and by reducing the amount of target DNA available for mismatched hybridizations.

PCR-Restriction Fragment Length Polymorphism for Rapid, Low-Cost Identification of Isoniazid-Resistant Mycobacterium tuberculosis▿

PubMed Central

Caws, Maxine; Tho, Dau Quang; Duy, Phan Minh; Lan, Nguyen Thi Ngoc; Hoa, Dai Viet; Torok, Mili Estee; Chau, Tran Thi Hong; Van Vinh Chau, Nguyen; Chinh, Nguyen Tran; Farrar, Jeremy

2007-01-01

PCR-restriction fragment length poymorphism (PCR-RFLP) is a simple, robust technique for the rapid identification of isoniazid-resistant Mycobacterium tuberculosis. One hundred consecutive isolates from a Vietnamese tuberculosis hospital were tested by MspA1I PCR-RFLP for the detection of isoniazid-resistant katG_315 mutants. The test had a sensitivity of 80% and a specificity of 100% against conventional phenotypic drug susceptibility testing. The positive and negative predictive values were 1 and 0.86, respectively. None of the discrepant isolates had mutant katG_315 codons by sequencing. The test is cheap (less than $1.50 per test), specific, and suitable for the rapid identification of isoniazid resistance in regions with a high prevalence of katG_315 mutants among isoniazid-resistant M. tuberculosis isolates. PMID:17428939

Exploitation of rolling circle amplification for the construction of large phage-display antibody libraries.

PubMed

Shahsavarian, Melody A; Le Minoux, Damien; Matti, Kalyankumar M; Kaveri, Srini; Lacroix-Desmazes, Sébastien; Boquet, Didier; Friboulet, Alain; Avalle, Bérangère; Padiolleau-Lefèvre, Séverine

2014-05-01

Phage display antibody libraries have proven to have a significant role in the discovery of therapeutic antibodies and polypeptides with desired biological and physicochemical properties. Obtaining a large and diverse phage display antibody library, however, is always a challenging task. Various steps of this technique can still undergo optimization in order to obtain an efficient library. In the construction of a single chain fragment variable (scFv) phage display library, the cloning of the scFv fragments into a phagemid vector is of crucial importance. An efficient restriction enzyme digestion of the scFv DNA leads to its proper ligation with the phagemid followed by its successful cloning and expression. Here, we are reporting a different approach to enhance the efficiency of the restriction enzyme digestion step. We have exploited rolling circle amplification (RCA) to produce a long strand of DNA with tandem repeats of scFv sequences, which is found to be highly susceptible to restriction digestion. With this important modification, we are able to construct a large phage display antibody library of naive SJL/J mice. The size of the library is estimated as ~10(8) clones. The number of clones containing a scFv fragment is estimated at 90%. Hence, the present results could considerably aid the utilization of the phage-display technique in order to get an efficiently large antibody library. Copyright © 2014 Elsevier B.V. All rights reserved.

pLS101 plasmid vector

DOEpatents

Lacks, S.A.; Balganesh, T.S.

1985-02-19

Disclosed is recombinant plasmid pLS101, consisting essentially of a 2.0 Kb ma1M gene fragment ligated to a 4.4 Kb Tcr DNA fragment, which is particularly useful for transforming Gram-positive bacteria. This plasmid contains at least four restriction sites suitable for inserting exogeneous gene sequences. Also disclosed is a method for plasmid isolation by penicillin selection, as well as processes for enrichment of recombinant plasmids in Gram-positive bacterial systems. 5 figs., 2 tabs.

The NH2-terminal and COOH-terminal fragments of dentin matrix protein 1 (DMP1) localize differently in the compartments of dentin and growth plate of bone.

PubMed

Maciejewska, Izabela; Cowan, Cameron; Svoboda, Kathy; Butler, William T; D'Souza, Rena; Qin, Chunlin

2009-02-01

Multiple studies have shown that dentin matrix protein 1 (DMP1) is essential for bone and dentin mineralization. After post-translational proteolytic cleavage, DMP1 exists within the extracellular matrix of bone and dentin as an NH2-terminal fragment, a COOH-terminal fragment, and the proteoglycan form of the NH2-terminal fragment (DMP1-PG). To begin to assess the biological function of each fragment, we evaluated the distribution of both fragments in the rat tooth and bone using antibodies specific to the NH2-terminal and COOH-terminal regions of DMP1 and confocal microscopy. In rat first molar organs, the NH2-terminal fragment localized to predentin, whereas the COOH-terminal fragment was mainly restricted to mineralized dentin. In the growth plate of bone, the NH2-terminal fragment appeared in the proliferation and hypertrophic zones, whereas the COOH-terminal fragment occupied the ossification zone. Forster resonance energy transfer analysis showed colocalization of both fragments of DMP1 in odontoblasts and predentin, as well as hypertrophic chondrocytes within the growth plates of bone. The biochemical analysis of bovine teeth showed that predentin is rich in DMP1-PG, whereas mineralized dentin primarily contains the COOH-terminal fragment. We conclude that the differential patterns of expression of NH2-terminal and COOH-terminal fragments of DMP1 reflect their potentially distinct roles in the biomineralization of dentin and bone matrices.

Two novel partial deletions of LDL-receptor gene in Italian patients with familial hypercholesterolemia (FH Siracusa and FH Reggio Emilia).

PubMed

Garuti, R; Lelli, N; Barozzini, M; Tiozzo, R; Ghisellini, M; Simone, M L; Li Volti, S; Garozzo, R; Mollica, F; Vergoni, W; Bertolini, S; Calandra, S

1996-03-01

In the present study we report two novel partial deletions of the LDL-R gene. The first (FH Siracusa), found in an FH-heterozygote, consists of a 20 kb deletion spanning from the 5' flanking region to the intron 2 of the LDL-receptor gene. The elimination of the promoter and the first two exons prevents the transcription of the deleted allele, as shown by Northern blot analysis of LDL-R mRNA isolated from the proband's fibroblasts. The second deletion (FH Reggio Emilia), which eliminates 11 nucleotides of exon 10, was also found in an FH heterozygote. The characterization of this deletion was made possible by a combination of techniques such as single strand conformation polymorphism (SSCP) analysis, direct sequence of exon 10 and cloning of the normal and deleted exon 10 from the proband's DNA. The 11 nt deletion occurs in a region of exon 10 which contains three triplets (CTG) and two four-nucleotides (CTGG) direct repeats. This structural feature might render this region more susceptible to a slipped mispairing during DNA duplication. Since this deletion causes a shift of the BamHI site at the 5' end of exon 10, a method has been devised for its rapid screening which is based on the PCR amplification of exon 10 followed by BamHI digestion. FH Reggio Emilia deletion produces a shift in the reading frame downstream from Lys458, leading to a sequence of 51 novel amino acids before the occurrence of a premature stop codon (truncated receptor). However, since RT-PCR failed to demonstrate the presence of the mutant LDL-R mRNA in proband fibroblasts, it is likely that the amount of truncated receptor produced in these cells is negligible.

Analytic second derivative of the energy for density functional theory based on the three-body fragment molecular orbital method

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nakata, Hiroya, E-mail: nakata.h.ab@m.titech.ac.jp; RIKEN, Research Cluster for Innovation, Nakamura Lab, 2-1 Hirosawa, Wako, Saitama 351-0198; Japan Society for the Promotion of Science, Kojimachi Business Center Building, 5-3-1 Kojimachi, Chiyoda-ku, Tokyo 102-0083

2015-03-28

Analytic second derivatives of the energy with respect to nuclear coordinates have been developed for spin restricted density functional theory (DFT) based on the fragment molecular orbital method (FMO). The derivations were carried out for the three-body expansion (FMO3), and the two-body expressions can be obtained by neglecting the three-body corrections. Also, the restricted Hartree-Fock (RHF) Hessian for FMO3 can be obtained by neglecting the density-functional related terms. In both the FMO-RHF and FMO-DFT Hessians, certain terms with small magnitudes are neglected for computational efficiency. The accuracy of the FMO-DFT Hessian in terms of the Gibbs free energy is evaluatedmore » for a set of polypeptides and water clusters and found to be within 1 kcal/mol of the corresponding full (non-fragmented) ab initio calculation. The FMO-DFT method is also applied to transition states in S{sub N}2 reactions and for the computation of the IR and Raman spectra of a small Trp-cage protein (PDB: 1L2Y). Some computational timing analysis is also presented.« less

Genetic Diversity in Nothofagus alessandrii (Fagaceae), an Endangered Endemic Tree Species of the Coastal Maulino Forest of Central Chile

PubMed Central

Torres-Díaz, Cristian; Ruiz, Eduardo; González, Fidelina; Fuentes, Glenda; Cavieres, Lohengrin A.

2007-01-01

Background and Aims The endemic tree Nothofagus alessandrii (Fagaceae) has been historically restricted to the coastal range of Region VII of central Chile, and its forests have been increasingly destroyed and fragmented since the end of the 19th century. In this study, the patterns of within- and among-population genetic diversity in seven fragments of this endangered narrowly endemic tree were examined. Methods Allozyme electrophoresis of seven loci of N. alessandrii was used to estimate genetic diversity, genetic structure and gene flow. Key Results High levels of genetic diversity were found as shown by mean expected heterozygosity (He = 0·182 ± 0·034), percentage of polymorphic loci (Pp = 61·2 %), mean number of alleles per locus (A = 1·8) and mean number of alleles per polymorphic locus (Ap = 2·3). Genetic differentiation was also high (GST = 0·257 and Nm = 0·7). These values are high compared with more widespread congeneric species. Conclusions Despite its endemic status and restricted geographical range N. alessandrii showed high levels of genetic diversity. The observed patterns of diversity are explained in part by historical processes and more recent human fragmentation. PMID:17513870

Computer-based image analysis of one-dimensional electrophoretic gels used for the separation of DNA restriction fragments.

PubMed Central

Gray, A J; Beecher, D E; Olson, M V

1984-01-01

A stand-alone, interactive computer system has been developed that automates the analysis of ethidium bromide-stained agarose and acrylamide gels on which DNA restriction fragments have been separated by size. High-resolution digital images of the gels are obtained using a camera that contains a one-dimensional, 2048-pixel photodiode array that is mechanically translated through 2048 discrete steps in a direction perpendicular to the gel lanes. An automatic band-detection algorithm is used to establish the positions of the gel bands. A color-video graphics system, on which both the gel image and a variety of operator-controlled overlays are displayed, allows the operator to visualize and interact with critical stages of the analysis. The principal interactive steps involve defining the regions of the image that are to be analyzed and editing the results of the band-detection process. The system produces a machine-readable output file that contains the positions, intensities, and descriptive classifications of all the bands, as well as documentary information about the experiment. This file is normally further processed on a larger computer to obtain fragment-size assignments. Images PMID:6320097

Cloning of developmentally regulated flagellin genes from Caulobacter crescentus via immunoprecipitation of polyribosomes.

PubMed Central

Milhausen, M; Gill, P R; Parker, G; Agabian, N

1982-01-01

Immunoprecipitation of Caulobacter crescentus polyribosomes with antiflagellin antibody provided RNA for the synthesis of cDNA probes that were used to identify three specific EcoRI restriction fragments (6.8, 10, and 22 kilobases) in genomic digests of Caulobacter DNA. The RNA was present only in polyribosomes isolated from a time interval in the Caulobacter cell cycle that was coincident with flagellin polypeptide synthesis. The structural gene for Mr 27,500 flagellin polypeptide was assigned to a region of the 10-kilobase EcoRI restriction fragment by DNA sequence analysis. Analysis of mutants defective in motility further established a correlation between the Mr 27,500 flagellin gene and the flaE gene locus [Johnson, R. C. & Ely, B. (1979) J. Bacteriol. 137, 627-634]. The other EcoRI fragments that hybridize with the immunoprecipitated polyribosome-derived cDNA probe are also temporally regulated and have features that suggest they encode other polypeptides associated with the flagellum. Modifications were required to adapt the procedure of immunoprecipitation of polyribosomes for use with Caulobacter and should be applicable to the production of specific structural gene probes from other prokaryotic systems. Images PMID:6294658

Arthroscopically assisted knee contracture release secondary to melorheostosis: a case report.

PubMed

Claramunt, Raúl Torres; López, Xavier Pelfort; Palou, Enric Cáceres; García, Joan C Monllau; Verdie, Lluís Puig

2011-02-01

Melorheostosis is a rare non-hereditary bone disease characterized by a radiographic pattern of flowing hyperostosis along the cortex with sclerotomal distribution. We report a case of a patient with severe knee contracture and a restricted range of motion caused by intraarticular bone fragment and hyperostotic bone lesions secondary to melorheostosis. An arthroscopically assisted approach was used successfully in order to remove free bone fragments and to release the hyperostotic lesions in the bone cortex of the distal femur.

Method for in vitro recombination

DOEpatents

Gibson, Daniel Glenn; Smith, Hamilton O

2013-05-07

The present invention relates to an in vitro method, using isolated protein reagents, for joining two double-stranded (ds) DNA molecules of interest, wherein the distal region of the first DNA molecule and the proximal region of the second DNA molecule share a region of sequence identity. The method allows the joining of a number of DNA fragments, in a predetermined order and orientation, without the use of restriction enzymes. It can be used, e.g., to join synthetically produced sub-fragments of a gene or genome of interest.

Construction of Biologically Functional Bacterial Plasmids In Vitro

PubMed Central

Cohen, Stanley N.; Chang, Annie C. Y.; Boyer, Herbert W.; Helling, Robert B.

1973-01-01

The construction of new plasmid DNA species by in vitro joining of restriction endonuclease-generated fragments of separate plasmids is described. Newly constructed plasmids that are inserted into Escherichia coli by transformation are shown to be biologically functional replicons that possess genetic properties and nucleotide base sequences from both of the parent DNA molecules. Functional plasmids can be obtained by reassociation of endonuclease-generated fragments of larger replicons, as well as by joining of plasmid DNA molecules of entirely different origins. Images PMID:4594039

Computer systems for annotation of single molecule fragments

DOEpatents

Schwartz, David Charles; Severin, Jessica

2016-07-19

There are provided computer systems for visualizing and annotating single molecule images. Annotation systems in accordance with this disclosure allow a user to mark and annotate single molecules of interest and their restriction enzyme cut sites thereby determining the restriction fragments of single nucleic acid molecules. The markings and annotations may be automatically generated by the system in certain embodiments and they may be overlaid translucently onto the single molecule images. An image caching system may be implemented in the computer annotation systems to reduce image processing time. The annotation systems include one or more connectors connecting to one or more databases capable of storing single molecule data as well as other biomedical data. Such diverse array of data can be retrieved and used to validate the markings and annotations. The annotation systems may be implemented and deployed over a computer network. They may be ergonomically optimized to facilitate user interactions.

Genotype identification of human cystic echinococcosis in Isfahan, central Iran.

PubMed

Kia, Eshrat Bigom; Rahimi, Hamidreza; Sharbatkhori, Mitra; Talebi, Ardeshir; Fasihi Harandi, Majid; Mirhendi, Hossein

2010-08-01

Echinococcosis/hydatidosis is one of the most important zoonotic diseases commonly found in different regions of Iran with a major economic and public health importance. In the current study, Echinococcus granulosus isolates were collected from hospitalized patients in Isfahan, central Iran. The genotypes of 30 samples were determined by polymerase chain reaction amplification of internal transcribed spacer-1 region of ribosomal DNA, followed by restriction fragment length polymorphism (RFLP) with two restriction enzymes namely AluI and MspI. As expected, each isolate yielded an approximately 1-kbp DNA fragment on the electrophoresis gel. According to RFLP results for both enzymes, all isolates had an equal pattern indicating the G1 genotype. Our findings confirmed that G1 is the dominant genotype of cystic echinococcosis in human in central Iran, with predilection to different organs including liver, lung, and brain, and warrants the importance of sheep dog cycle in public health.

Method of preparing and applying single stranded DNA probes to double stranded target DNAs in situ

DOEpatents

Gray, J.W.; Pinkel, D.

1991-07-02

A method is provided for producing single stranded non-self-complementary nucleic acid probes, and for treating target DNA for use therewith. The probe is constructed by treating DNA with a restriction enzyme and an exonuclease to form template/primers for a DNA polymerase. The digested strand is resynthesized in the presence of labeled nucleoside triphosphate precursor. Labeled single stranded fragments are separated from the resynthesized fragments to form the probe. Target DNA is treated with the same restriction enzyme used to construct the probe, and is treated with an exonuclease before application of the probe. The method significantly increases the efficiency and specificity of hybridization mixtures by increasing effective probe concentration by eliminating self-hybridization between both probe and target DNAs, and by reducing the amount of target DNA available for mismatched hybridizations. No Drawings

Isolation of a complementary DNA clone for the human complement protein C2 and its use in the identification of a restriction fragment length polymorphism.

PubMed Central

Woods, D E; Edge, M D; Colten, H R

1984-01-01

Complementary DNA (cDNA) clones corresponding to the major histocompatibility (MHC) class III antigen, complement protein C2, have been isolated from human liver cDNA libraries with the use of a complex mixture of synthetic oligonucleotides (17 mer) that contains 576 different oligonucleotide sequences. The C2 cDNA were used to identify a DNA restriction enzyme fragment length polymorphism that provides a genetic marker within the MHC that was not detectable at the protein level. An extensive search for genomic polymorphisms using a cDNA clone for another MHC class III gene, factor B, failed to reveal any DNA variants. The genomic variants detected with the C2 cDNA probe provide an additional genetic marker for analysis of MHC-linked diseases. Images PMID:6086718

[Effect of fluoride on gut microflora of silkworm (Bombyx mori)].

PubMed

Li, Guannan; Xia, Xuejuan; Sendegeya, Parfait; Zhao, Huanhuan; Long, Yaohang; Zhu, Yong

2015-07-04

We examined the effect of fluoride on gut microflora of silkworm. After DNA extraction and PCR amplification, clone libraries of 16S rRNA gene fragment were constructed. Amplified ribosomal DNA restriction analysis (ARDRA) was performed by digestion of the 16S rRNA gene, and each unique restriction fragment polymorphism pattern was designated as an operational taxonomic unit (OTU). A total of 14 OTUs were identified from intestinal samples of both T6 and 734. Phylogenetic trees of bacterial 16S rRNA nucleotide sequences were constructed and analyzed. Furthermore, the dominant bacteria were studied by the nested polymerase chain reaction denaturing gradient gel electrophoresis (PCR-DDGE) technology. After fluorosis, the flora of Enterococcus and Bacillus reduced. However, the flora of Staphylococcus increased. Fluoride can destroy the balance of microflora in the gut of silkworm by changing the bacteria diversity and proportion, which has bigger effect to 734 than T6.

Mycobacterium avium restriction fragment length polymorphism-IS IS1245 and the simple double repetitive element polymerase chain reaction typing method to screen genetic diversity in Brazilian strains.

PubMed

Sequeira, Patrícia Carvalho de; Fonseca, Leila de Souza; Silva, Marlei Gomes da; Saad, Maria Helena Féres

2005-11-01

Simple double repetitive element polymerase chain reaction (MaDRE-PCR) and Pvu II-IS1245 restriction fragment length polymorphism (RFLP) typing methods were used to type 41 Mycobacterium avium isolates obtained from 14 AIDS inpatients and 10 environment and animals specimens identified among 53 mycobacteria isolated from 237 food, chicken, and pig. All environmental and animals strains showed orphan patterns by both methods. By MaDRE-PCR four patients, with multiple isolates, showed different patterns, suggesting polyclonal infection that was confirmed by RFLP in two of them. This first evaluation of MaDRE-PCR on Brazilian M. avium strains demonstrated that the method seems to be useful as simple and less expensive typing method for screening genetic diversity in M. avium strains on selected epidemiological studies, although with limitation on analysis identical patterns except for one band.

Haplotypes identified by 10 DNA restriction fragment length polymorphisms at the human low density lipoprotein receptor gene locus.

PubMed Central

Kotze, M J; Langenhoven, E; Retief, A E; Seftel, H C; Henderson, H E; Weich, H F

1989-01-01

Ten useful two allele restriction fragment length polymorphisms of the low density lipoprotein receptor gene were used for haplotype analysis in 45 unrelated familial hypercholesterolaemic (FH) patients, 60 normal controls, and 32 FH homozygotes, all of whom were white Afrikaners. Pedigree analysis in 27 informative heterozygous FH and 23 normal families has shown the segregation of at least 17 haplotypes in the normal population (111 chromosomes) compared to a predominant association of two of these haplotypes with the disease in the FH subjects. This association was further confirmed in 32 FH homozygotes, indicating at least two 'founder' members for the disease in the Afrikaner population. Recombination events were not detected in any of the families studied and we thus conclude that the haplotypes associated with FH function as specific markers for the disease and will allow presymptomatic diagnosis in affected families. PMID:2565980

The Importance of Three-Body Interactions in Molecular Dynamics Simulations of Water with the Fragment Molecular Orbital Method

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pruitt, Spencer R.; Nakata, Hiroya; Nagata, Takeshi

2016-04-12

The analytic first derivative with respect to nuclear coordinates is formulated and implemented in the framework of the three-body fragment molecular orbital (FMO) method. The gradient has been derived and implemented for restricted Hartree-Fock, second-order Møller-Plesset perturbation, and density functional theories. The importance of the three-body fully analytic gradient is illustrated through the failure of the two-body FMO method during molecular dynamics simulations of a small water cluster. The parallel implementation of the fragment molecular orbital method, its parallel efficiency, and its scalability on the Blue Gene/Q architecture up to 262,144 CPU cores, are also discussed.

Profiling of EBV-Encoded microRNAs in EBV-Associated Hemophagocytic Lymphohistiocytosis.

PubMed

Zhou, Chen; Xie, Zhengde; Gao, Liwei; Liu, Chunyan; Ai, Junhong; Zhang, Li; Shen, Kunling

2015-10-01

Epstein-Barr virus-associated hemophagocytic lymphohistiocytosis (EBV-HLH) is a life-threatening complication of EBV infection. MicroRNAs (miRNAs) were small non-coding RNA, and EBV could encode miRNAs that are involved in the progression of infection. However, the profiles of EBV-miRNAs in EBV-HLH were unknown. Here, we aimed to profile the expression of EBV-miRNAs in children with EBV-HLH by analyzing 44 known EBV-miRNAs, encoded within the BamHI fragment H rightward open reading frame 1 (BHRF1) and the BamHI-A region rightward transcript (BART), in plasma and cellular targets by real-time quantitative PCR. The study included 15 children with EBV-HLH, 15 children with infectious mononucleosis (IM), and 15 healthy controls. CD8(+) T cells were found to be the cellular target of EBV infection in EBV-HLH, while CD19(+) B cells were infected with EBV in IM. We also found the greater levels of several miRNAs encoded by BART in EBV-HLH, compared to those in IM and healthy controls, whereas the levels of BHRF1 miRNAs were lower than those in IM. The profile and pattern of EBV-miRNAs in EBV-HLH indicated that EBV could display type II latency in EBV-HLH. Importantly, the level of plasma miR-BART16-1 continued decreasing during the whole chemotherapy, suggesting that plasma miR-BART16-1 could be a potential biomarker for monitoring EBV-HLH progression. The pathogenesis of EBV-HLH might be attributed to the abundance of EBV-miRNAs in EBV-HLH. These findings help elucidate the roles of EBV miRNAs in EBV-HLH, enabling the understanding of the basis of this disease and providing clues for its treatment.

Spectrophotometric, colorimetric and visually detection of Pseudomonas aeruginosa ETA gene based gold nanoparticles DNA probe and endonuclease enzyme

NASA Astrophysics Data System (ADS)

Amini, Bahram; Kamali, Mehdi; Salouti, Mojtaba; Yaghmaei, Parichehreh

2018-06-01

Colorimetric DNA detection is preferred over other methods for clinical molecular diagnosis because it does not require expensive equipment. In the present study, the colorimetric method based on gold nanoparticles (GNPs) and endonuclease enzyme was used for the detection of P. aeruginosa ETA gene. Firstly, the primers and probe for P. aeruginosa exotoxin A (ETA) gene were designed and checked for specificity by the PCR method. Then, GNPs were synthesized using the citrate reduction method and conjugated with the prepared probe to develop the new nano-biosensor. Next, the extracted target DNA of the bacteria was added to GNP-probe complex to check its efficacy for P. aeruginosa ETA gene diagnosis. A decrease in absorbance was seen when GNP-probe-target DNA cleaved into the small fragments of BamHI endonuclease due to the weakened electrostatic interaction between GNPs and the shortened DNA. The right shift of the absorbance peak from 530 to 562 nm occurred after adding the endonuclease. It was measured using a UV-VIS absorption spectroscopy that indicates the existence of the P. aeruginosa ETA gene. Sensitivity was determined in the presence of different concentrations of target DNA of P. aeruginosa. The results obtained from the optimized conditions showed that the absorbance value has linear correlation with concentration of target DNA (R: 0.9850) in the range of 10-50 ng mL-1 with the limit detection of 9.899 ng mL-1. Thus, the specificity of the new method for detection of P. aeruginosa was established in comparison with other bacteria. Additionally, the designed assay was quantitatively applied to detect the P. aeruginosa ETA gene from 103 to 108 CFU mL-1 in real samples with a detection limit of 320 CFU mL-1.

A cysteine protease encoded by the baculovirus Bombyx mori nuclear polyhedrosis virus.

PubMed Central

Ohkawa, T; Majima, K; Maeda, S

1994-01-01

Sequence analysis of the BamHI F fragment of the genome of Bombyx mori nuclear polyhedrosis virus (BmNPV) revealed an open reading frame whose deduced amino acid sequence had homology to those of cysteine proteases of the papain superfamily. The putative cysteine protease sequence (BmNPV-CP) was 323 amino acids long and showed 35% identity to a cysteine proteinase precursor from Trypanosoma brucei. Of 36 residues conserved among cathepsins B, H, L, and S and papain, 31 were identical in BmNPV-CP. In order to determine the activity and function of the putative cysteine protease, a BmNPV mutant (BmCysPD) was constructed by homologous recombination of the protease gene with a beta-galactosidase gene cassette. BmCysPD-infected BmN cell extracts were significantly reduced in acid protease activity compared with wild-type virus-infected cell extracts. The cysteine protease inhibitor E-64 [trans-epoxysuccinylleucylamido-(4-guanidino)butane] inhibited wild-type virus-expressed protease activity. Deletion of the cysteine protease gene had no significant effect on viral growth or polyhedron production in BmN cells, indicating that the cysteine protease was not essential for viral replication in vitro. However, B. mori larvae infected with BmCysPD showed symptoms different from those of wild-type BmNPV-infected larvae, e.g., less degradation of the body, including fat body cells, white body surface color due presumably to undegraded epidermal cells, and an increase in the number of polyhedra released into the hemolymph. This is the first report of (i) a virus-encoded protease with activity on general substrates and (ii) evidence that a virus-encoded protease may play a role in degradation of infected larvae to facilitate horizontal transmission of the virus. Images PMID:8083997

An ABC Transporter System of Yersinia pestis Allows Utilization of Chelated Iron by Escherichia coli SAB11

PubMed Central

Bearden, Scott W.; Staggs, Teanna M.; Perry, Robert D.

1998-01-01

The acquisition of iron is an essential component in the pathogenesis of Yersinia pestis, the agent of bubonic and pneumonic plague. A cosmid library derived from the genomic DNA of Y. pestis KIM6+ was used for transduction of an Escherichia coli mutant (SAB11) defective in the biosynthesis of the siderophore enterobactin. Recombinant plasmids which had a common 13-kb BamHI fragment were isolated from SAB11 transductants in which growth but not enterobactin synthesis was restored on media containing the iron chelator EDDA [ethylenediamine-di(o-hydroxyphenyl acetic acid)]. Subcloning and transposon mutagenesis revealed a 5.6-kb region, designated yfe, essential for SAB11 growth stimulation. In vitro transcription-translation analysis identified polypeptides of 18, 29.5, 32, and 33 kDa encoded by the yfe locus. Sequence analysis shows this locus to be comprised of five genes in two separate operons which have potential Fur-binding sequences in both promoters. A putative polycistronic operon, yfeABCD, is Fur regulated and responds to iron and manganese. A functional Fur protein is required for the observed manganese repression of this operon. This operon encodes polypeptides which have strong similarity to the ATP-binding cassette (ABC) family of transporters and include a periplasmic binding protein (YfeA), an ATP-binding protein (YfeB), and two integral membrane proteins (YfeC and -D), which likely function in the acquisition of inorganic iron and possibly other ions. The ∼21-kDa protein encoded by the separately transcribed yfeE gene may be located in the cell envelope, since a yfeE::TnphoA fusion is PhoA+. Mutations in this gene abrogate growth of SAB11 on iron-chelated media. PMID:9495751

An ABC transporter system of Yersinia pestis allows utilization of chelated iron by Escherichia coli SAB11.

PubMed

Bearden, S W; Staggs, T M; Perry, R D

1998-03-01

The acquisition of iron is an essential component in the pathogenesis of Yersinia pestis, the agent of bubonic and pneumonic plague. A cosmid library derived from the genomic DNA of Y. pestis KIM6+ was used for transduction of an Escherichia coli mutant (SAB11) defective in the biosynthesis of the siderophore enterobactin. Recombinant plasmids which had a common 13-kb BamHI fragment were isolated from SAB11 transductants in which growth but not enterobactin synthesis was restored on media containing the iron chelator EDDA [ethylenediamine-di(o-hydroxyphenyl acetic acid)]. Subcloning and transposon mutagenesis revealed a 5.6-kb region, designated yfe, essential for SAB11 growth stimulation. In vitro transcription-translation analysis identified polypeptides of 18, 29.5, 32, and 33 kDa encoded by the yfe locus. Sequence analysis shows this locus to be comprised of five genes in two separate operons which have potential Fur-binding sequences in both promoters. A putative polycistronic operon, yfeABCD, is Fur regulated and responds to iron and manganese. A functional Fur protein is required for the observed manganese repression of this operon. This operon encodes polypeptides which have strong similarity to the ATP-binding cassette (ABC) family of transporters and include a periplasmic binding protein (YfeA), an ATP-binding protein (YfeB), and two integral membrane proteins (YfeC and -D), which likely function in the acquisition of inorganic iron and possibly other ions. The approximately 21-kDa protein encoded by the separately transcribed yfeE gene may be located in the cell envelope, since a yfeE::TnphoA fusion is PhoA+. Mutations in this gene abrogate growth of SAB11 on iron-chelated media.

Increasing Chemical Space Coverage by Combining Empirical and Computational Fragment Screens

PubMed Central

2015-01-01

Most libraries for fragment-based drug discovery are restricted to 1,000–10,000 compounds, but over 500,000 fragments are commercially available and potentially accessible by virtual screening. Whether this larger set would increase chemotype coverage, and whether a computational screen can pragmatically prioritize them, is debated. To investigate this question, a 1281-fragment library was screened by nuclear magnetic resonance (NMR) against AmpC β-lactamase, and hits were confirmed by surface plasmon resonance (SPR). Nine hits with novel chemotypes were confirmed biochemically with KI values from 0.2 to low mM. We also computationally docked 290,000 purchasable fragments with chemotypes unrepresented in the empirical library, finding 10 that had KI values from 0.03 to low mM. Though less novel than those discovered by NMR, the docking-derived fragments filled chemotype holes from the empirical library. Crystal structures of nine of the fragments in complex with AmpC β-lactamase revealed new binding sites and explained the relatively high affinity of the docking-derived fragments. The existence of chemotype holes is likely a general feature of fragment libraries, as calculation suggests that to represent the fragment substructures of even known biogenic molecules would demand a library of minimally over 32,000 fragments. Combining computational and empirical fragment screens enables the discovery of unexpected chemotypes, here by the NMR screen, while capturing chemotypes missing from the empirical library and tailored to the target, with little extra cost in resources. PMID:24807704

D1/D2 domain of large-subunit ribosomal DNA for differentiation of Orpinomyces spp.

PubMed

Dagar, Sumit S; Kumar, Sanjay; Mudgil, Priti; Singh, Rameshwar; Puniya, Anil K

2011-09-01

This study presents the suitability of D1/D2 domain of large-subunit (LSU) ribosomal DNA (rDNA) for differentiation of Orpinomyces joyonii and Orpinomyces intercalaris based on PCR-restriction fragment length polymorphism (RFLP). A variation of G/T in O. intercalaris created an additional restriction site for AluI, which was used as an RFLP marker. The results demonstrate adequate heterogeneity in the LSU rDNA for species-level differentiation.

Gene Inactivation by CRISPR-Cas9 in Nicotiana tabacum BY-2 Suspension Cells.

PubMed

Mercx, Sébastien; Tollet, Jérémie; Magy, Bertrand; Navarre, Catherine; Boutry, Marc

2016-01-01

Plant suspension cells are interesting hosts for the heterologous production of pharmacological proteins such as antibodies. They have the advantage to facilitate the containment and the application of good manufacturing practices. Furthermore, antibodies can be secreted to the extracellular medium, which makes the purification steps much simpler. However, improvements are still to be made regarding the quality and the production yield. For instance, the inactivation of proteases and the humanization of glycosylation are both important targets which require either gene silencing or gene inactivation. To this purpose, CRISPR-Cas9 is a very promising technique which has been used recently in a series of plant species, but not yet in plant suspension cells. Here, we sought to use the CRISPR-Cas9 system for gene inactivation in Nicotiana tabacum BY-2 suspension cells. We transformed a transgenic line expressing a red fluorescent protein (mCherry) with a binary vector containing genes coding for Cas9 and three guide RNAs targeting mCherry restriction sites, as well as a bialaphos-resistant (bar) gene for selection. To demonstrate gene inactivation in the transgenic lines, the mCherry gene was PCR-amplified and analyzed by electrophoresis. Seven out of 20 transformants displayed a shortened fragment, indicating that a deletion occurred between two target sites. We also analyzed the transformants by restriction fragment length polymorphism and observed that the three targeted restriction sites were hit. DNA sequencing of the PCR fragments confirmed either deletion between two target sites or single nucleotide deletion. We therefore conclude that CRISPR-Cas9 can be used in N. tabacum BY2 cells.

Abundance of Enterobacteriaceae in the colon mucosa in diverticular disease.

PubMed

Linninge, Caroline; Roth, Bodil; Erlanson-Albertsson, Charlotte; Molin, Göran; Toth, Ervin; Ohlsson, Bodil

2018-02-15

To compare gut bacterial diversity and amount of Enterobacteriaceae in colonic mucosa between patients with and without diverticular disease (DD). Patients in a stable clinical condition with planned elective colonoscopy were included. Blood samples and colon mucosa biopsies were collected at the colonoscopy. Study questionnaires including questions about gastrointestinal symptoms were completed by the patients and physicians. DNA from mucosa samples was isolated and the amount of Enterobacteriaceae was estimated using PCR assay. Terminal restriction fragment length polymorphism was applied to assess microbial diversity. Diversity was estimated by calculations of richness (number of terminal restriction fragments) and Shannon-Wiener and Simpson's indices. A total of 51 patients were included, 16 patients with DD [68 (62-76) years] and 35 controls [62 (40-74) years] without any diverticula. Patients with DD had significantly higher levels of Enterobacteriaceae than those without DD ( P = 0.043), and there was an inverse relationship between the amount of Enterobacteriaceae and the Simpson's index (rs = -0.361, P = 0.033) and the Shannon-Wiener index (rs = -0.299, P = 0.081). The Simpson's index ( P = 0.383), Shannon-Wiener index ( P = 0.401) or number of restrictions fragments ( P = 0.776) did not differ between DD and controls. The majority of patients experienced gastrointestinal symptoms, and 22 patients (43.1%) fulfilled the criteria for irritable bowel syndrome, with no difference between the groups ( P = 0.212). Demography, socioeconomic status, lifestyle habits, inflammatory biomarkers, or symptoms were not related to the amount of Enterobacteriaceae or bacterial diversity. Patients with DD had higher amount of Enterobacteriaceae in the colon mucosa compared to patients without diverticula.

Kinematics of current region fragmentation in semi-inclusive deeply inelastic scattering

DOE PAGES

Boglione, M.; Collins, J.; Gamberg, L.; ...

2017-01-16

Different kinematical regions of semi-inclusive deeply inelastic scattering (SIDIS) processes correspond to different underlying partonic pictures, and it is important to understand the transition between them. We find criteria in semi-inclusive deeply inelastic scattering (SIDIS) for identifying the current fragmentation region — the kinematical region where a factorization picture with fragmentation functions is appropriate, especially for studies of transverse-momentum-dependent (TMD) functions. This region is distinguished from the central (soft) and target fragmentation regions. The basis of our argument is in the errors in approximations used in deriving factorization. As compared with previous work, we show that it is essential tomore » take account of the transverse momentum of the detected hadron, and we find a much more restricted range for genuine current fragmentation. As a result, we show that it is important to develop an extended factorization formulation to treat hadronization in the central region, as well as the current and target fragmentation regions, and to obtain a unified formalism spanning all rapidities for the detected hadron.« less

Genetic connectivity of the moth pollinated tree Glionnetia sericea in a highly fragmented habitat.

PubMed

Finger, Aline; Kaiser-Bunbury, Christopher N; Kettle, Chris J; Valentin, Terence; Ghazoul, Jaboury

2014-01-01

Long-distance gene flow is thought to be one prerequisite for the persistence of plant species in fragmented environments. Human influences have led to severe fragmentation of native habitats in the Seychelles islands, with many species surviving only in small and isolated populations. The endangered Seychelles endemic tree Glionnetia sericea is restricted to altitudes between 450 m and 900 m where the native forest vegetation has been largely lost and replaced with exotic invasives over the last 200 years. This study explores the genetic and ecological consequences of population fragmentation in this species by analysing patterns of genetic diversity in a sample of adults, juveniles and seeds, and by using controlled pollination experiments. Our results show no decrease in genetic diversity and no increase in genetic structuring from adult to juvenile cohorts. Despite significant inbreeding in some populations, there is no evidence of higher inbreeding in juvenile cohorts relative to adults. A Bayesian structure analysis and a tentative paternity analysis indicate extensive historical and contemporary gene flow among remnant populations. Pollination experiments and a paternity analysis show that Glionnetia sericea is self-compatible. Nevertheless, outcrossing is present with 7% of mating events resulting from pollen transfer between populations. Artificial pollination provided no evidence for pollen limitation in isolated populations. The highly mobile and specialized hawkmoth pollinators (Agrius convolvuli and Cenophodes tamsi; Sphingidae) appear to promote extensive gene flow, thus mitigating the potential negative ecological and genetic effects of habitat fragmentation in this species. We conclude that contemporary gene flow is sufficient to maintain genetic connectivity in this rare and restricted Seychelles endemic, in contrast to other island endemic tree species with limited contemporary gene flow.

Genetic Connectivity of the Moth Pollinated Tree Glionnetia sericea in a Highly Fragmented Habitat

PubMed Central

Finger, Aline; Valentin, Terence; Ghazoul, Jaboury

2014-01-01

Long-distance gene flow is thought to be one prerequisite for the persistence of plant species in fragmented environments. Human influences have led to severe fragmentation of native habitats in the Seychelles islands, with many species surviving only in small and isolated populations. The endangered Seychelles endemic tree Glionnetia sericea is restricted to altitudes between 450 m and 900 m where the native forest vegetation has been largely lost and replaced with exotic invasives over the last 200 years. This study explores the genetic and ecological consequences of population fragmentation in this species by analysing patterns of genetic diversity in a sample of adults, juveniles and seeds, and by using controlled pollination experiments. Our results show no decrease in genetic diversity and no increase in genetic structuring from adult to juvenile cohorts. Despite significant inbreeding in some populations, there is no evidence of higher inbreeding in juvenile cohorts relative to adults. A Bayesian structure analysis and a tentative paternity analysis indicate extensive historical and contemporary gene flow among remnant populations. Pollination experiments and a paternity analysis show that Glionnetia sericea is self-compatible. Nevertheless, outcrossing is present with 7% of mating events resulting from pollen transfer between populations. Artificial pollination provided no evidence for pollen limitation in isolated populations. The highly mobile and specialized hawkmoth pollinators (Agrius convolvuli and Cenophodes tamsi; Sphingidae) appear to promote extensive gene flow, thus mitigating the potential negative ecological and genetic effects of habitat fragmentation in this species. We conclude that contemporary gene flow is sufficient to maintain genetic connectivity in this rare and restricted Seychelles endemic, in contrast to other island endemic tree species with limited contemporary gene flow. PMID:25347541

Biogenesis and function of tRNA fragments during sperm maturation and fertilization in mammals.

PubMed

Sharma, Upasna; Conine, Colin C; Shea, Jeremy M; Boskovic, Ana; Derr, Alan G; Bing, Xin Y; Belleannee, Clemence; Kucukural, Alper; Serra, Ryan W; Sun, Fengyun; Song, Lina; Carone, Benjamin R; Ricci, Emiliano P; Li, Xin Z; Fauquier, Lucas; Moore, Melissa J; Sullivan, Robert; Mello, Craig C; Garber, Manuel; Rando, Oliver J

2016-01-22

Several recent studies link parental environments to phenotypes in subsequent generations. In this work, we investigate the mechanism by which paternal diet affects offspring metabolism. Protein restriction in mice affects small RNA (sRNA) levels in mature sperm, with decreased let-7 levels and increased amounts of 5' fragments of glycine transfer RNAs (tRNAs). In testicular sperm, tRNA fragments are scarce but increase in abundance as sperm mature in the epididymis. Epididymosomes (vesicles that fuse with sperm during epididymal transit) carry RNA payloads matching those of mature sperm and can deliver RNAs to immature sperm in vitro. Functionally, tRNA-glycine-GCC fragments repress genes associated with the endogenous retroelement MERVL, in both embryonic stem cells and embryos. Our results shed light on sRNA biogenesis and its dietary regulation during posttesticular sperm maturation, and they also link tRNA fragments to regulation of endogenous retroelements active in the preimplantation embryo. Copyright © 2016, American Association for the Advancement of Science.

Many-body expansion of the Fock matrix in the fragment molecular orbital method

NASA Astrophysics Data System (ADS)

Fedorov, Dmitri G.; Kitaura, Kazuo

2017-09-01

A many-body expansion of the Fock matrix in the fragment molecular orbital method is derived up to three-body terms for restricted Hartree-Fock and density functional theory in the atomic orbital basis and compared to the expansion in the basis of fragment molecular orbitals (MOs). The physical nature of many-body corrections is revealed in terms of charge transfer terms. An improvement of the fragment MO expansion is proposed by adding exchange to the embedding. The accuracy of all developed methods is demonstrated in comparison to unfragmented results for polyalanines, a water cluster, Trp-cage (PDB: 1L2Y) and crambin (PDB: 1CRN) proteins, a zeolite cluster, a Si nano-wire, and a boron nitride ribbon. The physical nature of metallicity is discussed, and it is shown what kinds of metallic systems can be treated by fragment-based methods. The density of states is calculated for a fully closed and a partially open nano-ring of boron nitride with a diameter of 105 nm.

Use of Restriction Fragment Length Polymorphisms to Investigate Strain Variation Within Neisseria Meningitidis.

NASA Astrophysics Data System (ADS)

Williams, Shelley Diane

Similarity within bacterial populations is difficult to assess due to the limited number of characters available for evaluation and the heterogeneity of bacterial species. Currently, the preferred method used to evaluate the structure of bacterial populations is multilocus enzyme electrophoresis. However, this method is extremely cumbersome and only offers an indirect measure of genetic similarities. The development of a more direct and less cumbersome method for this purpose is warranted. Restriction fragment length polymorphism analysis was evaluated as a tool for use in the study of bacterial population structures and in the epidemiology and surveillance of infectious disease. A collection of Neisseria meningitidis was available for use in the investigation of this technique. Neisseria meningitidis is the causative agent of epidemic cerebrospinal meningitis and septicemia as well as a variety of other clinical manifestations. Each isolate in the collection was defined in terms of serogroup specificity, clinical history, geographic source, and date of isolation. Forty -six strains were chosen for this study. The DNA from each strain was restricted with Pst1 and EcoR1 and electrophoresed on agarose gels. The DNA was transferred to nylon filters and hybridized with P ^{32} labeled DNA probes. Two randomly generated probes and a gene-specific probe were used to estimate the genetic similarities between and among the strains in the study population. A total of 28 different restriction fragment migration types were detected by the probes used. Data obtained from the RFLP analysis was analysed by cluster analysis and multivariate statistical methods. A total of 7 clones groups were detected. Two of these appear to be major clones that comprise 35% of the population. This analysis demonstrates the lack of structure within Neisseria meningitidis due primarily to a heterogenous population and the lack of geographic segregation. The potential utility of this technique as a tool in epidemiologic surveillance is addressed. Further work is needed in the evaluation of RFLP analysis in the taxonomy bacteria.

C 3-symmetric opioid scaffolds are pH-responsive DNA condensation agents.

PubMed

McStay, Natasha; Molphy, Zara; Coughlan, Alan; Cafolla, Attilio; McKee, Vickie; Gathergood, Nicholas; Kellett, Andrew

2017-01-25

Herein we report the synthesis of tripodal C 3 -symmetric opioid scaffolds as high-affinity condensation agents of duplex DNA. Condensation was achieved on both supercoiled and canonical B-DNA structures and identified by agarose electrophoresis, viscosity, turbidity and atomic force microscopy (AFM) measurements. Structurally, the requirement of a tris-opioid scaffold for condensation is demonstrated as both di- (C 2 -symmetric) and mono-substituted (C 1 -symmetric) mesitylene-linked opioid derivatives poorly coordinate dsDNA. Condensation, observed by toroidal and globule AFM aggregation, arises from surface-binding ionic interactions between protonated, cationic, tertiary amine groups on the opioid skeleton and the phosphate nucleic acid backbone. Indeed, by converting the 6-hydroxyl group of C 3 -morphine ( MC3: ) to methoxy substituents in C 3 -heterocodeine ( HC3: ) and C 3 -oripavine ( OC3: ) molecules, dsDNA compaction is retained thus negating the possibility of phosphate-hydroxyl surface-binding. Tripodal opioid condensation was identified as pH dependent and strongly influenced by ionic strength with further evidence of cationic amine-phosphate backbone coordination arising from thermal melting analysis and circular dichroism spectroscopy, with compaction also witnessed on synthetic dsDNA co-polymers poly[d(A-T) 2 ] and poly[d(G-C) 2 ]. On-chip microfluidic analysis of DNA condensed by C 3 -agents provided concentration-dependent protection (inhibition) to site-selective excision by type II restriction enzymes: BamHI, HindIII, SalI and EcoRI, but not to the endonuclease DNase I. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

An Authentic RFLP Lab for High School or College Biology Students.

ERIC Educational Resources Information Center

Guilfoile, Patrick G.; Plum, Stephen

1998-01-01

Explains how students can perform an alternative authentic DNA fingerprinting analysis. Presents restriction fragment length polymorphism (RFLP) analysis and can serve as a simulated molecular epidemiology laboratory or as a simulated forensic laboratory exercise. (DDR)

CD1d-restricted immunoglobulin G formation to GPI-anchored antigens mediated by NKT cells.

PubMed

Schofield, L; McConville, M J; Hansen, D; Campbell, A S; Fraser-Reid, B; Grusby, M J; Tachado, S D

1999-01-08

Immunoglobulin G (IgG) responses require major histocompatibility complex (MHC)-restricted recognition of peptide fragments by conventional CD4(+) helper T cells. Immunoglobulin G responses to glycosylphosphatidylinositol (GPI)- anchored protein antigens, however, were found to be regulated in part through CD1d-restricted recognition of the GPI moiety by thymus-dependent, interleukin-4-producing CD4(+), natural killer cell antigen 1.1 [(NK1.1)+] helper T cells. The CD1-NKT cell pathway regulated immunogobulin G responses to the GPI-anchored surface antigens of Plasmodium and Trypanosoma and may be a general mechanism for rapid, MHC-unrestricted antibody responses to diverse pathogens.

Genotyping of the fish rhabdovirus, viral haemorrhagic septicaemia virus, by restriction fragment length polymorphisms

USGS Publications Warehouse

Einer-Jensen, Katja; Winton, James R.; Lorenzen, Niels

2005-01-01

The aim of this study was to develop a standardized molecular assay that used limited resources and equipment for routine genotyping of isolates of the fish rhabdovirus, viral haemorrhagic septicaemia virus (VHSV). Computer generated restriction maps, based on 62 unique full-length (1524 nt) sequences of the VHSV glycoprotein (G) gene, were used to predict restriction fragment length polymorphism (RFLP) patterns that were subsequently grouped and compared with a phylogenetic analysis of the G-gene sequences of the same set of isolates. Digestion of PCR amplicons from the full-lengthG-gene by a set of three restriction enzymes was predicted to accurately enable the assignment of the VHSV isolates into the four major genotypes discovered to date. Further sub-typing of the isolates into the recently described sub-lineages of genotype I was possible by applying three additional enzymes. Experimental evaluation of the method consisted of three steps: (i) RT-PCR amplification of the G-gene of VHSV isolates using purified viral RNA as template, (ii) digestion of the PCR products with a panel of restriction endonucleases and (iii) interpretation of the resulting RFLP profiles. The RFLP analysis was shown to approximate the level of genetic discrimination obtained by other, more labour-intensive, molecular techniques such as the ribonuclease protection assay or sequence analysis. In addition, 37 previously uncharacterised isolates from diverse sources were assigned to specific genotypes. While the assay was able to distinguish between marine and continental isolates of VHSV, the differences did not correlate with the pathogenicity of the isolates.

Global patterns of fragmentation and connectivity of mammalian carnivore habitat.

PubMed

Crooks, Kevin R; Burdett, Christopher L; Theobald, David M; Rondinini, Carlo; Boitani, Luigi

2011-09-27

Although mammalian carnivores are vulnerable to habitat fragmentation and require landscape connectivity, their global patterns of fragmentation and connectivity have not been examined. We use recently developed high-resolution habitat suitability models to conduct comparative analyses and to identify global hotspots of fragmentation and connectivity for the world's terrestrial carnivores. Species with less fragmentation (i.e. more interior high-quality habitat) had larger geographical ranges, a greater proportion of habitat within their range, greater habitat connectivity and a lower risk of extinction. Species with higher connectivity (i.e. less habitat isolation) also had a greater proportion of high-quality habitat, but had smaller, not larger, ranges, probably reflecting shorter distances between habitat patches for species with restricted distributions; such species were also more threatened, as would be expected given the negative relationship between range size and extinction risk. Fragmentation and connectivity did not differ among Carnivora families, and body mass was associated with connectivity but not fragmentation. On average, only 54.3 per cent of a species' geographical range comprised high-quality habitat, and more troubling, only 5.2 per cent of the range comprised such habitat within protected areas. Identification of global hotspots of fragmentation and connectivity will help guide strategic priorities for carnivore conservation.

Global patterns of fragmentation and connectivity of mammalian carnivore habitat

PubMed Central

Crooks, Kevin R.; Burdett, Christopher L.; Theobald, David M.; Rondinini, Carlo; Boitani, Luigi

2011-01-01

Although mammalian carnivores are vulnerable to habitat fragmentation and require landscape connectivity, their global patterns of fragmentation and connectivity have not been examined. We use recently developed high-resolution habitat suitability models to conduct comparative analyses and to identify global hotspots of fragmentation and connectivity for the world's terrestrial carnivores. Species with less fragmentation (i.e. more interior high-quality habitat) had larger geographical ranges, a greater proportion of habitat within their range, greater habitat connectivity and a lower risk of extinction. Species with higher connectivity (i.e. less habitat isolation) also had a greater proportion of high-quality habitat, but had smaller, not larger, ranges, probably reflecting shorter distances between habitat patches for species with restricted distributions; such species were also more threatened, as would be expected given the negative relationship between range size and extinction risk. Fragmentation and connectivity did not differ among Carnivora families, and body mass was associated with connectivity but not fragmentation. On average, only 54.3 per cent of a species' geographical range comprised high-quality habitat, and more troubling, only 5.2 per cent of the range comprised such habitat within protected areas. Identification of global hotspots of fragmentation and connectivity will help guide strategic priorities for carnivore conservation. PMID:21844043

Fragment length polymorphisms among independent isolates of Epstein-Barr virus from immunocompromised and normal hosts.

PubMed

Katz, B Z; Niederman, J C; Olson, B A; Miller, G

1988-02-01

DNA restriction fragment length polymorphisms of Epstein-Barr virus (EBV) DNA were used as a molecular epidemiological tool to study multiple isolates of virus from the same and different individuals. We studied 35 EBV isolates: 19 from seven immunocompromised children and 16 from seven college students with mononucleosis. Analysis of the fragment length polymorphisms in this collection of isolates permitted several conclusions. Sites of polymorphism were most often encountered in regions with repetitive DNA. Epidemiologically unrelated patients harbored viruses that could be readily distinguished; by contrast, two infants and their mothers harbored similar viruses. Isolates from different sites in the same patient were similar. Variations between different clinical isolates of EBV mimic those found between different laboratory strains of the virus. Fragment length polymorphisms thus provide a useful marker for studying transmission and pathogenesis of EBV infections.

Annual Systems Engineering Conference: Focusing on Improving Performance of Defense Systems Programs (10th). Volume 3. Thursday Presentations

DTIC Science & Technology

2007-10-25

the Phit <.0001 requirement) restricts tactical delivery conditions, the probability of a fragment hit may be further qualified by considering only...Pkill – UK uses “self damage” metric • Risk Analysis: “If the above procedures ( Phit or Pkill <.0001) still result in restricting tactical delivery...10 (From NAWCWD Briefing) 4 Safe Escape Analysis Requirements Calculate Phit ,Pkill, and Pdet Is Phit <= .0001 for all launch conditions Done NO YES

D1/D2 Domain of Large-Subunit Ribosomal DNA for Differentiation of Orpinomyces spp.▿

PubMed Central

Dagar, Sumit S.; Kumar, Sanjay; Mudgil, Priti; Singh, Rameshwar; Puniya, Anil K.

2011-01-01

This study presents the suitability of D1/D2 domain of large-subunit (LSU) ribosomal DNA (rDNA) for differentiation of Orpinomyces joyonii and Orpinomyces intercalaris based on PCR-restriction fragment length polymorphism (RFLP). A variation of G/T in O. intercalaris created an additional restriction site for AluI, which was used as an RFLP marker. The results demonstrate adequate heterogeneity in the LSU rDNA for species-level differentiation. PMID:21784906

DIFFERENTIATING HUMAN FROM ANIMAL ISOLATES OF CRYPTOSPORIDIUM PARVUM

EPA Science Inventory

We analyzed 9s Cryptosporidium parvum isolates from humans and animals by a polymerase chain reaction/restriction fragment length polymorphism method based on the thrombospondin-related anonymous protein 2 gene sequence. Used as a molecular marker, this method can differentiate ...

Essentials of Conservation Biotechnology: A mini review

NASA Astrophysics Data System (ADS)

Merlyn Keziah, S.; Subathra Devi, C.

2017-11-01

Equilibrium of biodiversity is essential for the maintenance of the ecosystem as they are interdependent on each other. The decline in biodiversity is a global problem and an inevitable threat to the mankind. Major threats include unsustainable exploitation, habitat destruction, fragmentation, transformation, genetic pollution, invasive exotic species and degradation. This review covers the management strategies of biotechnology which include sin situ, ex situ conservation, computerized taxonomic analysis through construction of phylogenetic trees, calculating genetic distance, prioritizing the group for conservation, digital preservation of biodiversities within the coding and decoding keys, molecular approaches to asses biodiversity like polymerase chain reaction, real time, randomly amplified polymorphic DNA, restriction fragment length polymorphism, amplified fragment length polymorphism, single sequence repeats, DNA finger printing, single nucleotide polymorphism, cryopreservation and vitrification.

Characterization of a 3.3-kb plasmid of Escherichia coli O157:H7 and evaluation of stability of genetically engineered derivatives of this plasmid expressing green fluorescence.

PubMed

Sharma, Vijay K; Stanton, Thaddeus B

2008-12-10

Enterohemorrhagic Escherichia coli (EHEC) O157:H7 (strain 86-24) harbors a 3.3-kb plasmid (pSP70) that does not encode a selectable phenotype. A 1.1-kb fragment of DNA encoding kanamycin resistance (Kan(r)) was inserted by in vitro transposon mutagenesis at a random location on pSP70 to construct pSP70-Kan(r) that conferred Kan(r) to the host E. coli strain. Oligonucleotides complementary to 5' and 3' ends of the fragment encoding Kan(r) were used for initiating nucleotide sequencing from the plus and minus strands of pSP70, and thereafter primer walking was used to determine nucleotide sequence of pSP70. Analysis of nucleotide sequence revealed that pSP70 contained 3306 base pairs in its genome and that the genome was almost 100% identical to nucleotide sequences of small plasmids identified in EHEC O157:H7 isolates from Germany and Japan. A DNA cassette encoding a green fluorescent protein (GFP), ampicillin resistance (Amp(r)), and a double transcriptional terminator (DT) was cloned in pSP70 either at the BamHI site (created by deletion of mobA by PCR) or at the NsiI site located downstream of mobA to generate pSP70 DeltamobA-GFP/Amp(r)/DT (pSM431) and pSP70-GFP/Amp(r)/DT (pSM433), respectively. Introduction of pSM431 or pSM433 into EHEC O157:H7 yielded ampicillin-resistant colonies that glowed green under UV illumination. Consecutive subcultures of EHEC O157:H7, carrying pSM431 or pSM433 under conditions simulating the environment of bovine intestine (no selective antibiotic, incubation temperature of 39 degrees C, with or without oxygen), demonstrated that these plasmids were highly stable as greater than 95% of the isolates recovered from these subcultures were positive for green fluorescence. These findings indicate that EHEC O157:H7 carrying pSM431 or pSM433 would be useful for studying persistence and shedding of this important food-borne pathogen in cattle.

Three new sensitive and specific heat-shock protein 70 PCRs for global Leishmania species identification.

PubMed

Montalvo, A M; Fraga, J; Maes, I; Dujardin, J-C; Van der Auwera, G

2012-07-01

The heat-shock protein 70 gene (hsp70) has been exploited for Leishmania species identification in the New and Old World, using PCR followed by restriction fragment length polymorphism (RFLP) analysis. Current PCR presents limitations in terms of sensitivity, which hampers its use for analyzing clinical and biological samples, and specificity, which makes it inappropriate to discriminate between Leishmania and other trypanosomatids. The aim of the study was to improve the sensitivity and specificity of a previously reported hsp70 PCR using alternative PCR primers and RFLPs. Following in silico analysis of available sequences, three new PCR primer sets and restriction digest schemes were tested on a globally representative panel of 114 Leishmania strains, various other infectious agents, and clinical samples. The largest new PCR fragment retained the discriminatory power from RFLP, while two smaller fragments discriminated less species. The detection limit of the new PCRs was between 0.05 and 0.5 parasite genomes, they amplified clinical samples more efficiently, and were Leishmania specific. We succeeded in significantly improving the specificity and sensitivity of the PCRs for hsp70 Leishmania species typing. The improved PCR-RFLP assays can impact diagnosis, treatment, and epidemiological studies of leishmaniasis in any setting worldwide.

Chloroplast DNA haplotype variation and population differentiation in Sorbus aucuparia L. (Rosaceae: Maloideae).

PubMed

Raspé, O; Saumitou-Laprade, P; Cuguen, J; Jacquemart, A L

2000-08-01

Intra-specific chloroplast DNA (cpDNA) variation was studied in Sorbus aucuparia L., an entomophilous, mid-or early successional tree producing fleshy fruits. Eight PCR-amplified fragments of the chloroplast genome were screened for restriction fragment length polymorphisms, using one or two 4 bp-cutter restriction endonucleases. cpDNA variation was investigated on two geographical scales: (1) among four regions in France and Belgium; and (2) within the Belgian region. A total of 150 individuals from six populations were analysed. Fourteen polymorphisms were detected in six of the cpDNA fragments. All polymorphisms probably resulted from insertions or deletions, and allowed the identification of 12 haplotypes. The level of genetic differentiation computed on the basis of haplotype frequencies was similar on the two geographical scales considered (G(STc) = 0.286 among regions, G(STc) = 0.259 among populations within the Belgian region). These values are much lower than those obtained in nine previously studied temperate tree species, which are all wind-pollinated, late-successional species producing dry fruits. These results might primarily be accounted for by the contrasting life history traits of S. aucuparia. In order to obtain insights into the relative contribution of pollen and seeds to gene flow, G(STc) was also compared with previously obtained G(ST) estimates based on allozyme data.

Nested PCR and RFLP analysis based on the 16S rRNA gene

USDA-ARS?s Scientific Manuscript database

Current phytoplasma detection and identification method is primarily based on nested PCR followed by restriction fragment length polymorphism analysis and gel electrophoresis. This method can potentially detect and differentiate all phytoplasmas including those previously not described. The present ...

Healthcare Fragmentation and the Frequency of Radiology and Other Diagnostic Tests: A Cross-Sectional Study.

PubMed

Kern, Lisa M; Seirup, Joanna K; Casalino, Lawrence P; Safford, Monika M

2017-02-01

Fragmented ambulatory care has been associated with high rates of emergency department visits and hospitalizations, but effects on other types of utilization are unclear. To determine whether more fragmented care is associated with more radiology and other diagnostic tests, compared to less fragmented care. We conducted a cross-sectional study using claims from five commercial payers for 2010. The study took place in the Hudson Valley, a seven-county region in New York State. We included adult patients who were insured through the participating payers and were attributed to a primary care physician in the region. We restricted the cohort to those with ≥4 ambulatory visits, as measures of fragmentation are not reliable if based on ≤3 visits (N = 126,801). For each patient, we calculated fragmentation using a reversed Bice-Boxerman Index, which we divided into seven categories. We used negative binomial regression to determine the association between fragmentation category and rates of radiology and other diagnostic tests, stratified by number of chronic conditions and adjusting for patient age, gender, and number of visits. Patients with the most fragmented care had approximately twice as many radiology and other diagnostic tests as patients with the least fragmented care, across all groups stratified by number of chronic conditions (each adjusted p < 0.0001). For example, among patients with ≥5 chronic conditions, those with the least fragmented care had 258 tests per 100 patients, and those with the most fragmented care had 542 tests per 100 patients (+284 tests per 100 patients, or +110 %, adjusted p < 0.0001). More fragmented care was independently associated with higher rates of radiology and other diagnostic tests than less fragmented care.

Interpreting ecological diversity indices applied to terminal restriction fragment length polymorphism data: insights from simulated microbial communities.

PubMed

Blackwood, Christopher B; Hudleston, Deborah; Zak, Donald R; Buyer, Jeffrey S

2007-08-01

Ecological diversity indices are frequently applied to molecular profiling methods, such as terminal restriction fragment length polymorphism (T-RFLP), in order to compare diversity among microbial communities. We performed simulations to determine whether diversity indices calculated from T-RFLP profiles could reflect the true diversity of the underlying communities despite potential analytical artifacts. These include multiple taxa generating the same terminal restriction fragment (TRF) and rare TRFs being excluded by a relative abundance (fluorescence) threshold. True community diversity was simulated using the lognormal species abundance distribution. Simulated T-RFLP profiles were generated by assigning each species a TRF size based on an empirical or modeled TRF size distribution. With a typical threshold (1%), the only consistently useful relationship was between Smith and Wilson evenness applied to T-RFLP data (TRF-E(var)) and true Shannon diversity (H'), with correlations between 0.71 and 0.81. TRF-H' and true H' were well correlated in the simulations using the lowest number of species, but this correlation declined substantially in simulations using greater numbers of species, to the point where TRF-H' cannot be considered a useful statistic. The relationships between TRF diversity indices and true indices were sensitive to the relative abundance threshold, with greatly improved correlations observed using a 0.1% threshold, which was investigated for comparative purposes but is not possible to consistently achieve with current technology. In general, the use of diversity indices on T-RFLP data provides inaccurate estimates of true diversity in microbial communities (with the possible exception of TRF-E(var)). We suggest that, where significant differences in T-RFLP diversity indices were found in previous work, these should be reinterpreted as a reflection of differences in community composition rather than a true difference in community diversity.

Global DNA methylation analysis using methyl-sensitive amplification polymorphism (MSAP).

PubMed

Yaish, Mahmoud W; Peng, Mingsheng; Rothstein, Steven J

2014-01-01

DNA methylation is a crucial epigenetic process which helps control gene transcription activity in eukaryotes. Information regarding the methylation status of a regulatory sequence of a particular gene provides important knowledge of this transcriptional control. DNA methylation can be detected using several methods, including sodium bisulfite sequencing and restriction digestion using methylation-sensitive endonucleases. Methyl-Sensitive Amplification Polymorphism (MSAP) is a technique used to study the global DNA methylation status of an organism and hence to distinguish between two individuals based on the DNA methylation status determined by the differential digestion pattern. Therefore, this technique is a useful method for DNA methylation mapping and positional cloning of differentially methylated genes. In this technique, genomic DNA is first digested with a methylation-sensitive restriction enzyme such as HpaII, and then the DNA fragments are ligated to adaptors in order to facilitate their amplification. Digestion using a methylation-insensitive isoschizomer of HpaII, MspI is used in a parallel digestion reaction as a loading control in the experiment. Subsequently, these fragments are selectively amplified by fluorescently labeled primers. PCR products from different individuals are compared, and once an interesting polymorphic locus is recognized, the desired DNA fragment can be isolated from a denaturing polyacrylamide gel, sequenced and identified based on DNA sequence similarity to other sequences available in the database. We will use analysis of met1, ddm1, and atmbd9 mutants and wild-type plants treated with a cytidine analogue, 5-azaC, or zebularine to demonstrate how to assess the genetic modulation of DNA methylation in Arabidopsis. It should be noted that despite the fact that MSAP is a reliable technique used to fish for polymorphic methylated loci, its power is limited to the restriction recognition sites of the enzymes used in the genomic DNA digestion.

Development of a PCR-restriction fragment length polymorphism protocol for rapid detection and differentiation of four cockroach vectors (group I "Dirty 22" species) responsible for food contamination and spreading of foodborne pathogens: public health importance.

PubMed

Sulaiman, Irshad M; Anderson, Mickey; Khristova, Marina; Tang, Kevin; Sulaiman, Nikhat; Phifer, Edwin; Simpson, Steven; Kerdahi, Khalil

2011-11-01

Assessing the adulteration of food products and the presence of filth and extraneous materials is one of the measures that the U.S. Food and Drug Administration (FDA) utilizes in implementing regulatory actions of public health importance. To date, 22 common pest species (also known as the "Dirty 22" species) have been regarded by this agency as the spreaders of foodborne diseases. We have further categorized the Dirty 22 species into four groups: I has four cockroach species, II has two ant species, III has 12 fly species, and IV has four rodent species. The presence of any Dirty 22 species is also considered an indicator of unsanitary conditions in food processing and storage facilities. In this study, we describe the development of a two-step nested PCR protocol to amplify the small subunit ribosomal gene of group I Dirty 22 species that include four cockroach species: Blattella germanica, Blatta orientalis, Periplaneta americana, and Supella longipalpa, along with the development of a PCR-restriction fragment length polymorphism method for rapid detection and differentiation of these violative species. This method will be utilized when the specimen cannot be identified with conventional microscopic taxonomic methods, especially when only small body parts are separated and recovered from food samples for analysis or when these body parts are in a decomposed state. This new PCR-restriction fragment length polymorphism will provide correct identification of group I Dirty 22 species; this information can then be used in regulation and prevention of foodborne pathogens.

Abundance of Enterobacteriaceae in the colon mucosa in diverticular disease

PubMed Central

Linninge, Caroline; Roth, Bodil; Erlanson-Albertsson, Charlotte; Molin, Göran; Toth, Ervin; Ohlsson, Bodil

2018-01-01

AIM To compare gut bacterial diversity and amount of Enterobacteriaceae in colonic mucosa between patients with and without diverticular disease (DD). METHODS Patients in a stable clinical condition with planned elective colonoscopy were included. Blood samples and colon mucosa biopsies were collected at the colonoscopy. Study questionnaires including questions about gastrointestinal symptoms were completed by the patients and physicians. DNA from mucosa samples was isolated and the amount of Enterobacteriaceae was estimated using PCR assay. Terminal restriction fragment length polymorphism was applied to assess microbial diversity. Diversity was estimated by calculations of richness (number of terminal restriction fragments) and Shannon-Wiener and Simpson’s indices. RESULTS A total of 51 patients were included, 16 patients with DD [68 (62-76) years] and 35 controls [62 (40-74) years] without any diverticula. Patients with DD had significantly higher levels of Enterobacteriaceae than those without DD (P = 0.043), and there was an inverse relationship between the amount of Enterobacteriaceae and the Simpson’s index (rs = -0.361, P = 0.033) and the Shannon-Wiener index (rs = -0.299, P = 0.081). The Simpson’s index (P = 0.383), Shannon-Wiener index (P = 0.401) or number of restrictions fragments (P = 0.776) did not differ between DD and controls. The majority of patients experienced gastrointestinal symptoms, and 22 patients (43.1%) fulfilled the criteria for irritable bowel syndrome, with no difference between the groups (P = 0.212). Demography, socioeconomic status, lifestyle habits, inflammatory biomarkers, or symptoms were not related to the amount of Enterobacteriaceae or bacterial diversity. CONCLUSION Patients with DD had higher amount of Enterobacteriaceae in the colon mucosa compared to patients without diverticula. PMID:29487763

Molecular cloning and nucleotide sequence of the alpha and beta subunits of allophycocyanin from the cyanelle genome of Cyanophora paradoxa.

PubMed Central

Bryant, D A; de Lorimier, R; Lambert, D H; Dubbs, J M; Stirewalt, V L; Stevens, S E; Porter, R D; Tam, J; Jay, E

1985-01-01

The genes for the alpha- and beta-subunit apoproteins of allophycocyanin (AP) were isolated from the cyanelle genome of Cyanophora paradoxa and subjected to nucleotide sequence analysis. The AP beta-subunit apoprotein gene was localized to a 7.8-kilobase-pair Pst I restriction fragment from cyanelle DNA by hybridization with a tetradecameric oligonucleotide probe. Sequence analysis using that oligonucleotide and its complement as primers for the dideoxy chain-termination sequencing method confirmed the presence of both AP alpha- and beta-subunit genes on this restriction fragment. Additional oligonucleotide primers were synthesized as sequencing progressed and were used to determine rapidly the nucleotide sequence of a 1336-base-pair region of this cloned fragment. This strategy allowed the sequencing to be completed without a detailed restriction map and without extensive and time-consuming subcloning. The sequenced region contains two open reading frames whose deduced amino acid sequences are 81-85% homologous to cyanobacterial and red algal AP subunits whose amino acid sequences have been determined. The two open reading frames are in the same orientation and are separated by 39 base pairs. AP alpha is 5' to AP beta and both coding sequences are preceded by a polypurine, Shine-Dalgarno-type sequence. Sequences upstream from AP alpha closely resemble the Escherichia coli consensus promoter sequences and also show considerable homology to promoter sequences for several chloroplast-encoded psbA genes. A 56-base-pair palindromic sequence downstream from the AP beta gene could play a role in the termination of transcription or translation. The allophycocyanin apoprotein subunit genes are located on the large single-copy region of the cyanelle genome. PMID:2987916

Method for identifying mutagenic agents which induce large, multilocus deletions in DNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bradley, W.E.C.; Belouchi, A.; Dewyse, P.

1993-07-13

A method of identifying a mutagenic agent is described which includes a large, multilocus deletions in DNA in mammalian cells comprising: (i) exposing a class III heterozygous CHO cell line to a potential mutagenic agent under investigation, and allowing any mutation of the cell line to proceed, said cell line being characterized in that a restriction fragment length variation exists in on mutation it becomes resistant to 2,6-diaminopurine and in that the DNA sequence adjacent to the two alleles of the APRT gene such that the DNA sequence adjacent to one of the two alleles can be digested with themore » enzyme BclI but the DNA sequence variation adjacent to the other of the two alleles cannot be digested with BclI, (ii) isolating induced mutations of the cell line deficient in APRT function, (iii) isolating DNA from the induced mutants, (iv) digesting the isolated DNA with BclI enzyme to produce digested fragments including a 19 kb fragment and any 2 kb fragment, which fragments hybridize with the labeled probe derived from DNA fragment PDI, (v) separating any digested fragments, (vi) transferring the separated fragments of (v) to a solid support, (vii) hybridizing the supported separated fragments with a labeled probe derived from the clone DNA fragment PD 1, (viii) determining fragments having undergone loss of the 2 kb band identified by the probe, as an identification of parent mutants in which the loss occurred, and (ix) evaluating the mutating ability of the potential mutagenic agent.« less

[Molecular characterization of ESBL-producing Klebsiella pneumoniae isolates from intensive care patients].

PubMed

Chromá, Magdalena; Kolár, Milan; Marek, Oldrich; Koukalová, Dagmar; Sauer, Pavel

2007-10-01

The study aimed at the assessment of the prevalence of ESBL-positive isolates of Klebsiella pneumoniae in intensive care patients and their molecular biology analysis. Over a 5-month period, Klebsiella pneumoniae strains were isolated from patients hospitalized at the Department of Anaesthesiology and Resuscitation of the University Hospital in Olomouc. For each isolate, an antibiogram was performed by the standard microdilution method and the production of ESBL was determined by the modified double-disk synergy test. PCR was used to demonstrate the presence of the blaTEM and blaSHV genes. The isolates producing SHV- and TEM-types of beta-lactamases were typed using the restriction fragment length polymorphism (RFLP) method to identify the most common mutations responsible for the development of an ESBL phenotype. Similar or identical isolates were determined by pulsed-field gel electrophoresis (PFGE) of DNA fragments cleaved by the XbaI restriction endonuclease. A total of 67 isolates of Klebsiella pneumoniae were obtained. In 13 of them, the production of ESBL was detected and the presence of the blaSHV gene was confirmed by PCR. Restriction cleavage by NheI revealed mutations at position 238 in all SHV-positive PCR products. The restriction analysis did not confirm the presence of the gene encoding TEM-type extended-spectrum beta-lactamase. Molecular biology typing by PFGE detected the presence of 11 different strains. In the observed group of intensive care patients, the prevalence of ESBL-positive strains of Klebsiella pneumoniae reached 19.4 %. The analysis of SHV and TEM products of PCR by the RFLP method showed the prevalence of SHV-type ESBL. Overall, 84.6 % of the strains had unique restriction profiles. The results suggest both high levels of hygienic and epidemiological measures at the monitored department and rational antibiotic policy.

Effects of landscape matrix on population connectivity of an arboreal mammal, Petaurus breviceps.

PubMed

Malekian, Mansoureh; Cooper, Steven J B; Saint, Kathleen M; Lancaster, Melanie L; Taylor, Andrea C; Carthew, Susan M

2015-09-01

Ongoing habitat loss and fragmentation is considered a threat to biodiversity as it can create small, isolated populations that are at increased risk of extinction. Tree-dependent species are predicted to be highly sensitive to forest and woodland loss and fragmentation, but few studies have tested the influence of different types of landscape matrix on gene flow and population structure of arboreal species. Here, we examine the effects of landscape matrix on population structure of the sugar glider (Petaurus breviceps) in a fragmented landscape in southeastern South Australia. We collected 250 individuals across 12 native Eucalyptus forest remnants surrounded by cleared agricultural land or exotic Pinus radiata plantations and a large continuous eucalypt forest. Fifteen microsatellite loci were genotyped and analyzed to infer levels of population differentiation and dispersal. Genetic differentiation among most forest patches was evident. We found evidence for female philopatry and restricted dispersal distances for females relative to males, suggesting there is male-biased dispersal. Among the environmental variables, spatial variables including geographic location, minimum distance to neighboring patch, and degree of isolation were the most important in explaining genetic variation. The permeability of a cleared agricultural matrix to dispersing gliders was significantly higher than that of a pine matrix, with the gliders dispersing shorter distances across the latter. Our results added to previous findings for other species of restricted dispersal and connectivity due to habitat fragmentation in the same region, providing valuable information for the development of strategies to improve the connectivity of populations in the future.

How do protected landscapes associated with high biodiversity and population levels change?

PubMed Central

Echeverria, Cristian

2017-01-01

Most protected areas (PA) try to limit logging of forests by means of restrictions on access and use, especially in areas where local communities coexist with the forests and depend on resources derived from PAs. In such contexts, achieving full or effective protection of the forests is almost impossible. This fact has led to researching beyond PAs boundaries in order to examine large surrounding landscapes with multiple forms of properties and restriction on forests use. The present study assessed the change in forest cover and fragmentation between 1990 and 2014, in addition to the drivers that explain such changes in a landscape with the presence of PAs and high-density population belonging to the Chocó-Darien biodiversity hotspot. Results indicated differences in the extent and spatial patterns of change in forest cover of PAs and their surrounding landscapes. Two PAs exhibited a tendency to increase fragmentation and lose their forests in comparison with the stable protection of the forests in other PAs during this period. However, the greatest change in forest cover and fragmentation was observed in the surrounding landscapes, where the best connection to markets and transport networks were the dominating deforestation drivers. Our findings corroborated that the PAs were a shield against the deforestation of the tropical Andean forest, especially in landscapes with high-density population. However, the fragmentation of the forest cannot be avoided around the PAs limits. It is expected that, if this tendency continues in the future, the biodiversity in the Chocó-Darien hotspot will be seriously affected. PMID:28672002

A Polymorphism in Mitochondrial DNA Associated with IQ?

ERIC Educational Resources Information Center

Skuder, Patricia; And Others

1995-01-01

Of 100 DNA markers examined in an allelic association study, only 1 showed a replicated association with IQ in samples totaling 107 children. How the gene marked by the particular restriction fragment length polymorphism was tracked and its mitochondrial origin identified is described. (SLD)

Entomophaga maimaiga panzootic in northeastern gypsy moth populations

Treesearch

Ann E. Hajek; Joseph S. Elkinton

1991-01-01

The fungal pathogen causing extensive mortality in gypsy moth larval populations during the 1989 field season has been identified as Entomophaga maimaiga. Identification was based on morphology and in vitro culture requirements, as well as results from allozyme and restriction fragment linked polymorphism analyses. E....

UTILIZATION OF T-RFLP (TERMINAL RESTRICTION FRAGMENT LENGTH POLYMORPHISM) TO CHARACTERIZE MIXED ECTOMYCORRHIZAL FUNGAL COMMUNITIES

EPA Science Inventory

Studies of ectomycorrhizal community structure have used a variety of analytical regimens including sole or partial reliance on gross morphological characterization of colonized root tips. Depending on the rigor of the classification protocol, this technique can incorrectly assig...

Epidemiologic study of Taylorella equigenitalis strains by field inversion gel electrophoresis of genomic restriction endonuclease fragments.

PubMed Central

Bleumink-Pluym, N; ter Laak, E A; van der Zeijst, B A

1990-01-01

Contagious equine metritis (CEM), a sexually transmitted bacterial disease, was first described in thoroughbred horses. It also occurs in nonthoroughbred horses, in which it produces isolated, apparently unrelated outbreaks. Thirty-two strains of Taylorella equigenitalis, the causative agent of CEM, from all over the world were characterized by field inversion gel electrophoresis of fragments of genomic DNA obtained by digestion with low-cleavage-frequency restriction enzymes. This resulted in a division into five clearly distinct groups. Strains from thoroughbred horses from all continents belonged to one group. Strains from nonthoroughbred horses from various countries were different from strains from thoroughbred horses; four groups could be determined. Two groups contained both streptomycin-resistant and streptomycin-susceptible strains. The data indicate that CEM in nonthoroughbreds did not originate from the thoroughbred population; also, the reverse was not demonstrated. Thus, extensive international transportation directives regarding the testing of nonthoroughbred horses for CEM may need reconsideration. Images PMID:2172296

Genetic mapping of a food preference gene in the silkworm, Bombyx mori, using restriction fragment length polymorphisms (RFLPs).

PubMed

Mase, Keisuke; Iizuka, Tetsuya; Yamamoto, Toshio; Okada, Eiji; Hara, Wajirou

2007-06-01

The domesticated silkworm, Bombyx mori, has strict food preferences and grows by feeding on mulberry leaves. However, "Sawa-J", an abnormal feeding habit strain selected from the genetic stock, feeds on an artificial diet without mulberry leaf powder. In this study, the food preference gene in Sawa-J was genetically identified using restriction fragment length polymorphisms (RFLPs) of a cDNA clone on each linkage group. Taking advantage of a lack of genetic recombination in females, reciprocal backcrossed F1 (BC1) progenies were independently prepared using a non-feeding strain, C108, as a mating partner of Sawa-J. Our results of linkage analysis and mapping proved that the feeding behavior is primarily controlled by a major recessive gene mapped at 20.2 cM on RFLP linkage group 9 (RFLG9), and clone e73 at a distance of 4.2 cM was found as the first linked molecular marker.

Thermal ecology of Naegleria fowleri from a power plant cooling reservoir

DOE Office of Scientific and Technical Information (OSTI.GOV)

Huizinga, H.W.; McLaughlin, G.L.

1990-07-01

The pathogenic, free-living amoeba Naegleria fowleri is the causative agent of human primary amebic meningoencephalitis. N. fowleri has been isolated from thermally elevated aquatic environments worldwide, but temperature factors associated with occurrence of the amoeba remain undefined. In this study, a newly created cooling reservoir (Clinton Lake, Illinois) was surveyed for Naegleria spp. before and after thermal additions from a nuclear power plant. Water and sediment samples were collected from heated and unheated arms of the reservoir and analyzed for the presence of thermophilic Naegleria spp. and pathogenic N. fowleri. Amoebae were identified by morphology, in vitro cultivation, temperature tolerance,more » mouse pathogenicity assay, and DNA restriction fragment length analysis. N. fowleri was isolated from the thermally elevated arm but not from the ambient-temperature arm of the reservoir. The probability of isolating thermophilic Naegleria and pathogenic N. fowleri increased significantly with temperature. Repetitive DNA restriction fragment profiles of the N. fowleri Clinton Lake isolates and a known N. fowleri strain of human origin were homogeneous.« less

Screening of cytoplasmic DNA diversity between and within Lupinus mutabilis Sweet and Lupinus albus sensu lato by restriction fragment length polymorphism (RFLP).

PubMed

Olczak, T; Rurek, M; Jańska, H; Augustyniak, H; Sawicka-Sienkiewicz, E J

2001-01-01

Seven populations and five mutant lines of the Andean lupin and four species from the section Albus were screened for their mitochondrial and chloroplast polymorphisms. For this purpose the RFLP method with EcoRI as a restriction enzyme was used. Lupinus luteus, Lupinus albus and Phaseolus vulgaris organellar clones as well as amplified fragments were used as probes. We found that mitochondrial probes were more suitable than chloroplast probes for identification of inter- and intra-specific variations within the examined material. Most mitochondrial probes differentiate the two species investigated. A high level of mitochondrial polymorphism was observed among the populations of L. mutabilis in contrast to monomorphism among the species in the section Albus. A limited polymorphism was detected between the mutant lines of L. mutabilis. We conclude from this study that the mitochondrial RFLP analysis is a valuable tool for identification of variability among Andean lupin populations.

Rapid identification and classification of bacteria by 16S rDNA restriction fragment melting curve analyses (RFMCA).

PubMed

Rudi, Knut; Kleiberg, Gro H; Heiberg, Ragnhild; Rosnes, Jan T

2007-08-01

The aim of this work was to evaluate restriction fragment melting curve analyses (RFMCA) as a novel approach for rapid classification of bacteria during food production. RFMCA was evaluated for bacteria isolated from sous vide food products, and raw materials used for sous vide production. We identified four major bacterial groups in the material analysed (cluster I-Streptococcus, cluster II-Carnobacterium/Bacillus, cluster III-Staphylococcus and cluster IV-Actinomycetales). The accuracy of RFMCA was evaluated by comparison with 16S rDNA sequencing. The strains satisfying the RFMCA quality filtering criteria (73%, n=57), with both 16S rDNA sequence information and RFMCA data (n=45) gave identical group assignments with the two methods. RFMCA enabled rapid and accurate classification of bacteria that is database compatible. Potential application of RFMCA in the food or pharmaceutical industry will include development of classification models for the bacteria expected in a given product, and then to build an RFMCA database as a part of the product quality control.

Monitoring of antibiotic-induced alterations in the human intestinal microflora and detection of probiotic strains by use of terminal restriction fragment length polymorphism.

PubMed

Jernberg, Cecilia; Sullivan, Asa; Edlund, Charlotta; Jansson, Janet K

2005-01-01

Terminal restriction fragment length polymorphism (T-RFLP) was investigated as a tool for monitoring the human intestinal microflora during antibiotic treatment and during ingestion of a probiotic product. Fecal samples from eight healthy volunteers were taken before, during, and after administration of clindamycin. During treatment, four subjects were given a probiotic, and four subjects were given a placebo. Changes in the microbial intestinal community composition and relative abundance of specific microbial populations in each subject were monitored by using viable counts and T-RFLP fingerprints. T-RFLP was also used to monitor specific bacterial populations that were either positively or negatively affected by clindamycin. Some dominant bacterial groups, such as Eubacterium spp., were easily monitored by T-RFLP, while they were hard to recover by cultivation. Furthermore, the two probiotic Lactobacillus strains were easily tracked by T-RFLP and were shown to be the dominant Lactobacillus community members in the intestinal microflora of subjects who received the probiotic.

Monitoring of Antibiotic-Induced Alterations in the Human Intestinal Microflora and Detection of Probiotic Strains by Use of Terminal Restriction Fragment Length Polymorphism

PubMed Central

Jernberg, Cecilia; Sullivan, Åsa; Edlund, Charlotta; Jansson, Janet K.

2005-01-01

Terminal restriction fragment length polymorphism (T-RFLP) was investigated as a tool for monitoring the human intestinal microflora during antibiotic treatment and during ingestion of a probiotic product. Fecal samples from eight healthy volunteers were taken before, during, and after administration of clindamycin. During treatment, four subjects were given a probiotic, and four subjects were given a placebo. Changes in the microbial intestinal community composition and relative abundance of specific microbial populations in each subject were monitored by using viable counts and T-RFLP fingerprints. T-RFLP was also used to monitor specific bacterial populations that were either positively or negatively affected by clindamycin. Some dominant bacterial groups, such as Eubacterium spp., were easily monitored by T-RFLP, while they were hard to recover by cultivation. Furthermore, the two probiotic Lactobacillus strains were easily tracked by T-RFLP and were shown to be the dominant Lactobacillus community members in the intestinal microflora of subjects who received the probiotic. PMID:15640226

alpha-Putrescinylthymine and the sensitivity of bacteriophage phi W-14 DNA to restriction endonucleases.

PubMed Central

Miller, P B; Wakarchuk, W W; Warren, R A

1985-01-01

The modified base alpha-putrescinylthymine (putT) in phi W-14 DNA blocks cleavage of the DNA by 17 of 32 Type II restriction endonucleases. The enzymes cleaving the DNA do so to widely varying extents. The frequencies of cleavage of three altered forms of the DNA show that putT blocks recognition sites either when it occurs within the site or when it is in a sequence flanking the site. The blocking is dependent on both charge and steric factors. The charge effects can be greater than the steric effects for some of the enzymes tested. All the enzymes cleaving phi W-14 DNA release discrete fragments, showing that the distribution of putT is ordered. The cleavage frequencies for different enzymes suggest that the sequence CAputTG occurs frequently in the DNA. Only TaqI of the enzymes tested appeared not to be blocked by putT, but it was slowed down. TaqI generated fragments are joinable by T4 DNA ligase. PMID:2987859

Effects of natural forest fragmentation on a Hawaiian spider community

USGS Publications Warehouse

Vandergast, Amy; Gillespie, Rosemary G.

2004-01-01

The kipuka system, a network of forest fragments surrounded by lava flows on the island of Hawaii, offers an opportunity to study the natural, long-term fragmentation of a native ecosystem. We examined the impacts of habitat edges upon the community structure of nocturnally active native spiders, primarily in the genus Tetragnatha. We measured plant and spider species distributions across the edges of four small fragments and one large continuously forested area that were surrounded by a lava flow in 1855. Results indicated that an ???20 m edge ecotone surrounds core forest habitat. Spider community structure changed across the edge, with a decrease in total species richness and diversity at the forest/lava boundary, and a change in the dominant taxon from native Tetragnatha (Tetragnathidae) to native Cyclosa (Araneidae). Severe habitat restrictions were found for some spider species. In addition, nearly all of the spiders captured were endemic species, and the few introduced species were limited to the younger and more open lava flows. Our results suggest that species responses to edges can vary, and that core habitat specialists may decline in fragmented conditions.

Identification of a second murine interleukin-11 receptor alpha-chain gene (IL11Ra2) with a restricted pattern of expression.

PubMed

Robb, L; Hilton, D J; Brook-Carter, P T; Begley, C G

1997-03-15

The interleukin-11 receptor alpha-chain, a member of the hematopoietin receptor superfamily, forms, together with gp130, a functional high-affinity receptor complex for interleukin 11. We, and others, reported the cloning of the murine interleukin 11 receptor alpha-chain cDNA (IL11Ra) and recently described the structure of the IL11Ra locus. We also described the presence of a second IL11Ra-like locus in some mouse strains. In this study we report that the second locus, designated IL11Ra2, encodes an mRNA species. The transcript was 99% identical to the IL11Ra transcript in the coding and 3'-untranslated region, but had a different 5'-untranslated region. The complete genomic organization of the IL11Ra2 locus is presented, and the two loci are shown to be located on a 200-kb NaeI genomic fragment. Comparison of the expression pattern of the IL11Ra and IL11Ra2 genes using an RT-PCR restriction fragment length polymorphism strategy revealed that while the expression of IL11Ra was widespread, expression of IL11Ra2 was restricted to testis, lymph node, and thymus.

Vectors for co-expression of an unrestricted number of proteins

PubMed Central

Scheich, Christoph; Kümmel, Daniel; Soumailakakis, Dimitri; Heinemann, Udo; Büssow, Konrad

2007-01-01

A vector system is presented that allows generation of E. coli co-expression clones by a standardized, robust cloning procedure. The number of co-expressed proteins is not limited. Five ‘pQLink’ vectors for expression of His-tag and GST-tag fusion proteins as well as untagged proteins and for cloning by restriction enzymes or Gateway cloning were generated. The vectors allow proteins to be expressed individually; to achieve co-expression, two pQLink plasmids are combined by ligation-independent cloning. pQLink co-expression plasmids can accept an unrestricted number of genes. As an example, the co-expression of a heterotetrameric human transport protein particle (TRAPP) complex from a single plasmid, its isolation and analysis of its stoichiometry are shown. pQLink clones can be used directly for pull-down experiments if the proteins are expressed with different tags. We demonstrate pull-down experiments of human valosin-containing protein (VCP) with fragments of the autocrine motility factor receptor (AMFR). The cloning method avoids PCR or gel isolation of restriction fragments, and a single resistance marker and origin of replication are used, allowing over-expression of rare tRNAs from a second plasmid. It is expected that applications are not restricted to bacteria, but could include co-expression in other hosts such as Bacluovirus/insect cells. PMID:17311810

Distinguishing Heterodera filipjevi and H. avenae using polymerase chain reaction-restriction fragment length polymorphism and cyst morphology.

PubMed

Yan, Guiping; Smiley, Richard W

2010-03-01

The cereal cyst nematodes Heterodera filipjevi and H. avenae impede wheat production in the Pacific Northwest (PNW). Accurate identification of cyst nematode species and awareness of high population density in affected fields are essential for designing effective control measures. Morphological methods for differentiating these species are laborious. These species were differentiated using polymerase chain reaction restriction fragment length polymorphism (PCR-RFLP) of internal transcribed spacer (ITS)-ribosomal (r)DNA with up to six restriction endonucleases (TaqI, HinfI, PstI, HaeIII, RsaI, and AluI). The method was validated by inspecting underbridge structures of cyst vulval cones. Grid soil sampling of an Oregon field infested by both species revealed that H. filipjevi was present at most of the infested grid sites but mixtures of H. avenae and H. filipjevi also occurred. These procedures also detected and differentiated H. filipjevi and H. avenae in soil samples from nearby fields in Oregon and H. avenae in samples from Idaho and Washington. Intraspecific polymorphism was not observed within H. filipjevi or PNW H. avenae populations based on the ITS-rDNA. However, intraspecific variation was observed between H. avenae populations occurring in the PNW and France. Methods described here will improve detection and identification efficiencies for cereal cyst nematodes in wheat fields.

A semester-long project for teaching basic techniques in molecular biology such as restriction fragment length polymorphism analysis to undergraduate and graduate students.

PubMed

DiBartolomeis, Susan M

2011-01-01

Several reports on science education suggest that students at all levels learn better if they are immersed in a project that is long term, yielding results that require analysis and interpretation. I describe a 12-wk laboratory project suitable for upper-level undergraduates and first-year graduate students, in which the students molecularly locate and map a gene from Drosophila melanogaster called dusky and one of dusky's mutant alleles. The mapping strategy uses restriction fragment length polymorphism analysis; hence, students perform most of the basic techniques of molecular biology (DNA isolation, restriction enzyme digestion and mapping, plasmid vector subcloning, agarose and polyacrylamide gel electrophoresis, DNA labeling, and Southern hybridization) toward the single goal of characterizing dusky and the mutant allele dusky(73). Students work as individuals, pairs, or in groups of up to four students. Some exercises require multitasking and collaboration between groups. Finally, results from everyone in the class are required for the final analysis. Results of pre- and postquizzes and surveys indicate that student knowledge of appropriate topics and skills increased significantly, students felt more confident in the laboratory, and students found the laboratory project interesting and challenging. Former students report that the lab was useful in their careers.

A Semester-Long Project for Teaching Basic Techniques in Molecular Biology Such as Restriction Fragment Length Polymorphism Analysis to Undergraduate and Graduate Students

PubMed Central

DiBartolomeis, Susan M.

2011-01-01

Several reports on science education suggest that students at all levels learn better if they are immersed in a project that is long term, yielding results that require analysis and interpretation. I describe a 12-wk laboratory project suitable for upper-level undergraduates and first-year graduate students, in which the students molecularly locate and map a gene from Drosophila melanogaster called dusky and one of dusky's mutant alleles. The mapping strategy uses restriction fragment length polymorphism analysis; hence, students perform most of the basic techniques of molecular biology (DNA isolation, restriction enzyme digestion and mapping, plasmid vector subcloning, agarose and polyacrylamide gel electrophoresis, DNA labeling, and Southern hybridization) toward the single goal of characterizing dusky and the mutant allele dusky73. Students work as individuals, pairs, or in groups of up to four students. Some exercises require multitasking and collaboration between groups. Finally, results from everyone in the class are required for the final analysis. Results of pre- and postquizzes and surveys indicate that student knowledge of appropriate topics and skills increased significantly, students felt more confident in the laboratory, and students found the laboratory project interesting and challenging. Former students report that the lab was useful in their careers. PMID:21364104

Variability of chloroplast DNA and nuclear ribosomal DNA in cassava (Manihot esculenta Crantz) and its wild relatives.

PubMed

Fregene, M A; Vargas, J; Ikea, J; Angel, F; Tohme, J; Asiedu, R A; Akoroda, M O; Roca, W M

1994-11-01

Chloroplast DNA (cp) and nuclear ribosomal DNA (rDNA) variation was investigated in 45 accessions of cultivated and wild Manihot species. Ten independent mutations, 8 point mutations and 2 length mutations were identified, using eight restriction enzymes and 12 heterologous cpDNA probes from mungbean. Restriction fragment length polymorphism analysis defined nine distinct chloroplast types, three of which were found among the cultivated accessions and six among the wild species. Cladistic analysis of the cpDNA data using parsimony yielded a hypothetical phylogeny of lineages among the cpDNAs of cassava and its wild relatives that is congruent with morphological evolutionary differentiation in the genus. The results of our survey of cpDNA, together with rDNA restriction site change at the intergenic spacer region and rDNA repeat unit length variation (using rDNA cloned fragments from taro as probe), suggest that cassava might have arisen from the domestication of wild tuberous accessions of some Manihot species, followed by intensive selection. M. esculenta subspp flabellifolia is probably a wild progenitor. Introgressive hybridization with wild forms and pressures to adapt to the widely varying climates and topography in which cassava is found might have enhanced the crop's present day variability.

Using ITS2 PCR-RFLP to generate molecular markers for authentication of Sophora flavescens Ait.

PubMed

Lin, Tzu Che; Yeh, Mau Shing; Cheng, Ya Ming; Lin, Li Chang; Sung, Jih Min

2012-03-15

Dried root of Sophora flavescens Ait. is a medicinal material occasionally misused or adulterated by other species similar in appearance. In this study the internal transcribed spacer (ITS) regions of DNA samples of S. flavescens Ait. collected from different areas of Taiwan were amplified by polymerase chain reaction (PCR) and compared. The effectiveness of using ITS2 PCR restriction fragment length polymorphism (RFLP)-generated markers to differentiate S. flavescens Ait. from possible adulterants was also evaluated. The S. flavescens Ait. samples collected from different areas were extremely low in ITS sequence variability at species level. ITS2 PCR-RFLP coupled with restriction enzymes Sac I, Sac II, Xho I or Pvu I produced specific fragments for all tested variants. ITS2 PCR-RFLP coupled with Sac II was further performed to identify mixtures of DNA extracts of S. flavescens Ait. and Sophora tomentosa L. in various ratios. The developed ITS2 PCR-RFLP markers could detect mixed DNA samples of S. flavescens Ait./S. tomentosa L. up to a ratio of 10:1. The present study demonstrates the usefulness of ITS2 PCR-RFLP coupled with pre-selected restriction enzymes for practical and accurate authentication of S. flavescens Ait. The technique is also suitable for analysing S. flavescens Ait. mixed with other adulterants.

Adding Concrete Syntax to a Prolog-Based Program Synthesis System

NASA Technical Reports Server (NTRS)

Fischer, Bernd; Visser, Eelco

2003-01-01

Program generation and transformation systems manipulate large, pa- rameterized object language fragments. Support for user-definable concrete syntax makes this easier but is typically restricted to certain object and meta languages. We show how Prolog can be retrofitted with concrete syntax and describe how a seamless interaction of concrete syntax fragments with an existing legacy meta-programming system based on abstract syntax is achieved. We apply the approach to gradually migrate the schemas of the AUTOBAYES program synthesis system to concrete syntax. Fit experiences show that this can result in a considerable reduction of the code size and an improved readability of the code. In particular, abstracting out fresh-variable generation and second-order term construction allows the formulation of larger continuous fragments and improves the locality in the schemas.

Construction of a restriction map and gene map of the lettuce chloroplast small single-copy region using Southern cross-hybridization.

PubMed

Mitchelson, K R

1996-01-01

The small single-copy region (SSCR) of the chloroplast genome of many higher plants typically contain ndh genes encoding proteins that share homology with subunits of the respiratory-chain reduced nicotinamide adenine dinucleotide (NADH) dehydrogenase complex of mitochondria. A map of the lettuce chloroplast SSCR has been determined by Southern cross-hybridization, taking advantage of the high degree of homology between a tobacco small single-copy fragment and a corresponding lettuce chloroplast fragment. The gene order of the SSCR of lettuce and tobacco chloroplasts is similar. The cross-hybridization method can rapidly create a primary gene map of unknown chloroplast fragments, thus providing detailed information of the localization and arrangement of genes and conserved open reading frame regions.

Understanding the genetic effects of recent habitat fragmentation in the context of evolutionary history: Phylogeography and landscape genetics of a southern California endemic Jerusalem cricket (Orthoptera: Stenopelmatidae: Stenopelmatus)

USGS Publications Warehouse

Vandergast, A.G.; Bohonak, A.J.; Weissman, D.B.; Fisher, R.N.

2007-01-01

Habitat loss and fragmentation due to urbanization are the most pervasive threats to biodiversity in southern California. Loss of habitat and fragmentation can lower migration rates and genetic connectivity among remaining populations of native species, reducing genetic variability and increasing extinction risk. However, it may be difficult to separate the effects of recent anthropogenic fragmentation from the genetic signature of prehistoric fragmentation due to previous natural geological and climatic changes. To address these challenges, we examined the phylogenetic and population genetic structure of a flightless insect endemic to cismontane southern California, Stenopelmatus 'mahogani' (Orthoptera: Stenopelmatidae). Analyses of mitochondrial DNA sequence data suggest that diversification across southern California began during the Pleistocene, with most haplotypes currently restricted to a single population. Patterns of genetic divergence correlate with contemporary urbanization, even after correcting for (geographical information system) GIS-based reconstructions of fragmentation during the Pleistocene. Theoretical simulations confirm that contemporary patterns of genetic structure could be produced by recent urban fragmentation using biologically reasonable assumptions about model parameters. Diversity within populations was positively correlated with current fragment size, but not prehistoric fragment size, suggesting that the effects of increased drift following anthropogenic fragmentation are already being seen. Loss of genetic connectivity and diversity can hinder a population's ability to adapt to ecological perturbations commonly associated with urbanization, such as habitat degradation, climatic changes and introduced species. Consequently, our results underscore the importance of preserving and restoring landscape connectivity for long-term persistence of low vagility native species. Journal compilation ?? 2006 Blackwell Publishing Ltd.

Comparative mapping in the Pinaceae

Treesearch

Konstantin V. Krutovsky; Michela Troggio; Garth R. Brown; Kathleen D. Jermstad; David B. Neale

2004-01-01

A comparative genetic map was constructed between two important genera of the family Pinaceae. Ten homologous linkage groups in loblolly pine (Pinus taeda L.) and Douglas fir (Pseudotsuga menziesii [Mirb.] Franco) were identified using orthologous expressed sequence tag polymorphism (ESTP) and restriction fragment length polymorphism (RFLP) markers. The comparative...

A common deletion in two gamma ray induced rat pulmonary tumor cell lines.

PubMed

Van Klaveren, P; De Bruijne, J; Van der Winden, H; Kal, H B; Bentvelzen, P

1994-01-01

Subtraction hybridization was performed on normal WAG/Rij rat DNA with DNA from a syngeneic Ir-192 induced pulmonary tumor cell line L37. The residual DNA was amplified by means of sequence-independent PCR. This procedure yielded a sequence, of which multiple copies are present in normal rat DNA. In the tumor line L37 two restriction fragments hybridizing with this repeat sequence are lacking. In another Ir-192 induced pulmonary tumor line, L33, one of these fragments was also lacking. This indicates a common deletion in the two tumor lines.

Genetic and Biochemical Diversity among Isolates of Paenibacillus alvei Cultured from Australian Honeybee (Apis mellifera) Colonies

PubMed Central

Djordjevic, Steven P.; Forbes, Wendy A.; Smith, Lisa A.; Hornitzky, Michael A.

2000-01-01

Twenty-five unique CfoI-generated whole-cell DNA profiles were identified in a study of 30 Paenibacillus alvei isolates cultured from honey and diseased larvae collected from honeybee (Apis mellifera) colonies in geographically diverse areas in Australia. The fingerprint patterns were highly variable and readily discernible from one another, which highlighted the potential of this method for tracing the movement of isolates in epidemiological studies. 16S rRNA gene fragments (length, 1,416 bp) for all 30 isolates were enzymatically amplified by PCR and subjected to restriction analysis with DraI, HinfI, CfoI, AluI, FokI, and RsaI. With each enzyme the restriction profiles of the 16S rRNA genes from all 30 isolates were identical (one restriction fragment length polymorphism [RFLP] was observed in the HinfI profile of the 16S rRNA gene from isolate 17), which confirmed that the isolates belonged to the same species. The restriction profiles generated by using DraI, FokI, and HinfI differentiated P. alvei from the phylogenetically closely related species Paenibacillus macerans and Paenibacillus macquariensis. Alveolysin gene fragments (length, 1,555 bp) were enzymatically amplified from some of the P. alvei isolates (19 of 30 isolates), and RFLP were detected by using the enzymes CfoI, Sau3AI, and RsaI. Extrachromosomal DNA ranging in size from 1 to 10 kb was detected in 17 of 30 (57%) P. alvei whole-cell DNA profiles. Extensive biochemical heterogeneity was observed among the 28 P. alvei isolates examined with the API 50CHB system. All of these isolates were catalase, oxidase, and Voges-Proskauer positive and nitrate negative, and all produced acid when glycerol, esculin, and maltose were added. The isolates produced variable results for 16 of the 49 biochemical tests; negative reactions were recorded in the remaining 30 assays. The genetic and biochemical heterogeneity in P. alvei isolates may be a reflection of adaptation to the special habitats in which they originated. PMID:10698777

Genetic and biochemical diversity among isolates of Paenibacillus alvei cultured from Australian honeybee (Apis mellifera) colonies.

PubMed

Djordjevic, S P; Forbes, W A; Smith, L A; Hornitzky, M A

2000-03-01

Twenty-five unique CfoI-generated whole-cell DNA profiles were identified in a study of 30 Paenibacillus alvei isolates cultured from honey and diseased larvae collected from honeybee (Apis mellifera) colonies in geographically diverse areas in Australia. The fingerprint patterns were highly variable and readily discernible from one another, which highlighted the potential of this method for tracing the movement of isolates in epidemiological studies. 16S rRNA gene fragments (length, 1,416 bp) for all 30 isolates were enzymatically amplified by PCR and subjected to restriction analysis with DraI, HinfI, CfoI, AluI, FokI, and RsaI. With each enzyme the restriction profiles of the 16S rRNA genes from all 30 isolates were identical (one restriction fragment length polymorphism [RFLP] was observed in the HinfI profile of the 16S rRNA gene from isolate 17), which confirmed that the isolates belonged to the same species. The restriction profiles generated by using DraI, FokI, and HinfI differentiated P. alvei from the phylogenetically closely related species Paenibacillus macerans and Paenibacillus macquariensis. Alveolysin gene fragments (length, 1, 555 bp) were enzymatically amplified from some of the P. alvei isolates (19 of 30 isolates), and RFLP were detected by using the enzymes CfoI, Sau3AI, and RsaI. Extrachromosomal DNA ranging in size from 1 to 10 kb was detected in 17 of 30 (57%) P. alvei whole-cell DNA profiles. Extensive biochemical heterogeneity was observed among the 28 P. alvei isolates examined with the API 50CHB system. All of these isolates were catalase, oxidase, and Voges-Proskauer positive and nitrate negative, and all produced acid when glycerol, esculin, and maltose were added. The isolates produced variable results for 16 of the 49 biochemical tests; negative reactions were recorded in the remaining 30 assays. The genetic and biochemical heterogeneity in P. alvei isolates may be a reflection of adaptation to the special habitats in which they originated.

Flying between sky islands: the effect of naturally fragmented habitat on butterfly population structure.

PubMed

Sekar, Sandhya; Karanth, Praveen

2013-01-01

High elevation montane areas are called "sky islands" when they occur as a series of high mountains separated by lowland valleys. Different climatic conditions at high elevations makes sky islands a specialized type of habitat, rendering them naturally fragmented compared to more continuous habitat at lower elevations. Species in sky islands face unsuitable climate in the intervening valleys when moving from one montane area to another. The high elevation shola-grassland mosaic in the Western Ghats of southern India form one such sky island complex. The fragmented patches make this area ideal to study the effect of the spatial orientation of suitable habitat patches on population genetic structure of species found in these areas. Past studies have suggested that sky islands tend to have genetically structured populations, possibly due to reduced gene flow between montane areas. To test this hypothesis, we adopted the comparative approach. Using Amplified Fragment Length Polymorphisms, we compared population genetic structures of two closely related, similar sized butterfly species: Heteropsis oculus, a high elevation shola-grassland specialist restricted to the southern Western Ghats, and Mycalesis patnia, found more continuously distributed in lower elevations. In all analyses, as per expectation the sky island specialist H. oculus exhibited a greater degree of population genetic structure than M. patnia, implying a difference in geneflow. This difference in geneflow in turn appears to be due to the natural fragmentation of the sky island complexes. Detailed analysis of a subset of H. oculus samples from one sky island complex (the Anamalais) showed a surprising genetic break. A possible reason for this break could be unsuitable conditions of higher temperature and lower rainfall in the intervening valley region. Thus, sky island species are not only restricted by lack of habitat continuity between montane areas, but also by the nature of the intervening habitat.

The use of the replication region of plasmid pRS7 from Oenococcus oeni as a putative tool to generate cloning vectors for lactic acid bacteria.

PubMed

Rodríguez, M Carmen; Alegre, M Teresa; Martín, M Cruz; Mesas, Juan M

2015-01-01

A chimeric plasmid, pRS7Rep (6.1 kb), was constructed using the replication region of pRS7, a large plasmid from Oenococcus oeni, and pEM64, a plasmid derived from pIJ2925 and containing a gene for resistance to chloramphenicol. pRS7Rep is a shuttle vector that replicates in Escherichia coli using its pIJ2925 component and in lactic acid bacteria (LAB) using the replication region of pRS7. High levels of transformants per µg of DNA were obtained by electroporation of pRS7Rep into Pediococcus acidilactici (1.5 × 10(7)), Lactobacillus plantarum (5.7 × 10(5)), Lactobacillus casei (2.3 × 10(5)), Leuconostoc citreum (2.7 × 10(5)), and Enterococcus faecalis (2.4 × 10(5)). A preliminary optimisation of the technical conditions of electrotransformation showed that P. acidilactici and L. plantarum are better transformed at a later exponential phase of growth, whereas L. casei requires the early exponential phase for better electrotransformation efficiency. pRS7Rep contains single restriction sites useful for cloning purposes, BamHI, XbaI, SalI, HincII, SphI and PstI, and was maintained at an acceptable rate (>50%) over 100 generations without selective pressure in L. plantarum, but was less stable in L. casei and P. acidilactici. The ability of pRS7Rep to accept and express other genes was assessed. To the best of our knowledge, this is the first time that the replication region of a plasmid from O. oeni has been used to generate a cloning vector. Copyright © 2014 Elsevier Inc. All rights reserved.

Use of DNA markers in forest tree improvement research

Treesearch

D.B. Neale; M.E. Devey; K.D. Jermstad; M.R. Ahuja; M.C. Alosi; K.A. Marshall

1992-01-01

DNA markers are rapidly being developed for forest trees. The most important markers are restriction fragment length polymorphisms (RFLPs), polymerase chain reaction- (PCR) based markers such as random amplified polymorphic DNA (RAPD), and fingerprinting markers. DNA markers can supplement isozyme markers for monitoring tree improvement activities such as; estimating...

VIRULENCE OF Flavobacterium columnare GENOMOVARS IN RAINBOW TROUT (Oncorhynchus mykiss)

USDA-ARS?s Scientific Manuscript database

Flavobacterium columnare is the causative agent of columnaris disease and is responsible for significant economic losses in aquaculture. F. columnare is a Gram-negative bacterium, and five genetic types or genomovars have been described based on restriction fragment length polymorphism of the 16S rR...

Molecular epidemiology of Vibrio cholerae in Hong Kong.

PubMed Central

Yam, W C; Lung, M L; Ng, K Y; Ng, M H

1989-01-01

We studied restriction fragment length polymorphism of the enterotoxin genes of isolates of Vibrio cholerae El Tor, indistinguishable by bacteriophage typing, which were collected in Hong Kong since 1978. Using this approach, we could distinguish indigenous and exogenous strains obtained from different sources and epidemiological settings. Images PMID:2570082

Electronic Combat in Space: Examining the Legality of Fielding a Space-Based Disruptive Electromagnetic Jamming System

DTIC Science & Technology

2007-06-15

particles ( asteroids and meteoroids), energetic charged particles (ions, protons, electrons, etc.), and electromagnetic and ionizing radiation (x-rays...These protocols include a ban on Non-Detectable Fragments; restrictions on the use of Mines , Booby Traps, and Other Devices; prohibitions on certain...

14 CFR 431.43 - Reusable launch vehicle mission operational requirements and restrictions.

Code of Federal Regulations, 2012 CFR

2012-01-01

... debris generation will not result from conversion of energy sources into energy that fragments the vehicle or its payload. Energy sources include, but are not limited to, chemical, pneumatic, and kinetic energy; and (4) Vehicle safety operations personnel shall adhere to the following work and rest standards...

14 CFR 431.43 - Reusable launch vehicle mission operational requirements and restrictions.

Code of Federal Regulations, 2014 CFR

2014-01-01

... debris generation will not result from conversion of energy sources into energy that fragments the vehicle or its payload. Energy sources include, but are not limited to, chemical, pneumatic, and kinetic energy; and (4) Vehicle safety operations personnel shall adhere to the following work and rest standards...

14 CFR 431.43 - Reusable launch vehicle mission operational requirements and restrictions.

Code of Federal Regulations, 2011 CFR

2011-01-01

... debris generation will not result from conversion of energy sources into energy that fragments the vehicle or its payload. Energy sources include, but are not limited to, chemical, pneumatic, and kinetic energy; and (4) Vehicle safety operations personnel shall adhere to the following work and rest standards...

14 CFR 431.43 - Reusable launch vehicle mission operational requirements and restrictions.

Code of Federal Regulations, 2010 CFR

2010-01-01

... debris generation will not result from conversion of energy sources into energy that fragments the vehicle or its payload. Energy sources include, but are not limited to, chemical, pneumatic, and kinetic energy; and (4) Vehicle safety operations personnel shall adhere to the following work and rest standards...

14 CFR 431.43 - Reusable launch vehicle mission operational requirements and restrictions.

Code of Federal Regulations, 2013 CFR

2013-01-01

... debris generation will not result from conversion of energy sources into energy that fragments the vehicle or its payload. Energy sources include, but are not limited to, chemical, pneumatic, and kinetic energy; and (4) Vehicle safety operations personnel shall adhere to the following work and rest standards...

Cutting Up Text To Make Moveable, Magnetic Diagrams: A Way of Teaching and Assessing Biological Processes.

ERIC Educational Resources Information Center

Britton, Lynda A.; Wandersee, James H.

1997-01-01

Describes a method of cutting up pages in texts to make moveable, magnetic cards that can be used for instruction and assessment. Uses the diagrammatic illustrations associated with the complicated biotechnology procedures of the polymerase chain reaction and restriction fragment length polymorphism. (JRH)

Characterization of Bois noir isolates by restriction fragment length polymorphism of a Stolbur-specific putative membrane protein gene.

PubMed

Pacifico, D; Alma, A; Bagnoli, B; Foissac, X; Pasquini, G; Tessitori, M; Marzachì, C

2009-06-01

Bois noir phytoplasma (BNp), widespread in wine-producing areas of Europe and endemic in France and Italy, is classified in the 16SrXII-A subgroup, whose members are referred to as Stolbur phytoplasmas. The 16S rDNA gene of Stolbur phytoplasma shows low variability, and few non-ribosomal genes are available as markers to assess variation among isolates. We used the Stolbur-specific stol-1H10 gene, encoding a putative membrane-exposed protein, to investigate genetic diversity of French and Italian BNp isolates from plants and insects. Amplification of stol-1H10 from infected grapevines, weeds, and Hyalesthes obsoletus produced fragments of three sizes, and restriction fragment length polymorphism analysis divided these amplicons further into 12 profiles (V1 to V12). French BNp isolates were more variable than Italian ones, and different profiles were present in infected grapevines from France and Italy. Isolate V3, most abundant among Italian affected grapes but present among French ones, was found in one Urtica dioica sample and in all H. obsoletus collected on this species. Four Italian-specific profiles were represented among infected Convolvulus arvensis, the most frequent of which (V12) was also detected in H. obsoletus collected on this species. Most of the variability in the stol-1H10 sequence was associated with type II on the tuf gene.

Length Variation and Heteroplasmy Are Frequent in Mitochondrial DNA from Parthenogenetic and Bisexual Lizards (Genus Cnemidophorus)

PubMed Central

Densmore, Llewellyn D.; Wright, John W.; Brown, Wesley M.

1985-01-01

Samples of mtDNA isolated from each of 92 lizards representing all color pattern classes of Cnemidophorus tesselatus and two populations of C. tigris marmoratus were digested with the restriction endonucleases MboI, TaqI, RsaI and MspI. The mtDNA fragment sizes were compared after radioactive labeling and gel electrophoresis. Three features were notable in the comparisons: (1) there was little variation due to gain or loss of cleavage sites, (2) two fragments varied noticeably in length among the samples, one by a variable amount up to a maximum difference of ∼370 base pairs (bp) and the other by a discrete amount of 35 bp, (3) these two fragments occasionally varied within, as well as between, samples. Two regions that corresponded in size to these variants were identified by restriction endonuclease cleavage mapping. One of these is adjacent to the D-loop. Heteroplasmy, heretofore rarely observed, occurred frequently in these same two regions. Variability in the copy number of a tandemly repeated 64-bp sequence appears to be one component of the variation, but others (e.g. , base substitutions or small additions/deletions) must also be involved. The frequent occurrence of these length variations suggests either that they can be generated rapidly or that they were inherited from a highly polymorphic ancestor. The former interpretation is favored. PMID:2993100

Detection and typing of low-risk human papillomavirus genotypes HPV 6, HPV 11, HPV 42, HPV 43 and HPV 44 by polymerase chain reaction and restriction fragment length polymorphism.

PubMed

Maver, Polona J; Poljak, Mario; Seme, Katja; Kocjan, Bostjan J

2010-10-01

A novel PCR-restriction fragment length polymorphism assay (PCR-RFLP) was developed for sensitive detection and reliable differentiation of five low-risk human papillomavirus (lr-HPV) genotypes: HPV 6, HPV 11, HPV 42, HPV 43 and HPV 44, as well as differentiation of prototypic and non-prototypic HPV 6 genomic variants. The assay is based on the amplification of a 320-bp fragment of the HPV E1 gene and subsequent analysis of PCR-products with BsaJI and HinFI. Testing on plasmid standards showed that PCR-RFLP enabled simple and reliable identification and differentiation of five targeted lr-HPV genotypes and could detect reproducibly down to 10 copies of viral genome equivalents per PCR. The PCR-RFLP showed almost complete agreement with previously obtained genotyping results on 42 HPV-DNA negative samples and 223 HPV-DNA positive samples (45 HPV 6, 34 HPV 11, 35 HPV 42, 10 HPV 43, 24 HPV 44 positive samples and 75 samples containing 28 non-targeted HPV genotypes). The novel assay is simple and robust, does not require any sophisticated equipment and can be of great value for epidemiological studies, particularly in settings in which financial resources are limited. Copyright (c) 2010 Elsevier B.V. All rights reserved.

A site-directed mutagenesis method particularly useful for creating otherwise difficult-to-make mutants and alanine scanning.

PubMed

Wan, Haisu; Li, Yongwen; Fan, Yu; Meng, Fanrong; Chen, Chen; Zhou, Qinghua

2012-01-15

Site-directed mutagenesis has become routine in molecular biology. However, many mutants can still be very difficult to create. Complicated chimerical mutations, tandem repeats, inverted sequences, GC-rich regions, and/or heavy secondary structures can cause inefficient or incorrect binding of the mutagenic primer to the target sequence and affect the subsequent amplification. In theory, these problems can be avoided by introducing the mutations into the target sequence using mutagenic fragments and so removing the need for primer-template annealing. The cassette mutagenesis uses the mutagenic fragment in its protocol; however, in most cases it needs to perform two rounds of mutagenic primer-based mutagenesis to introduce suitable restriction enzyme sites into templates and is not suitable for routine mutagenesis. Here we describe a highly efficient method in which the template except the region to be mutated is amplified by polymerase chain reaction (PCR) and the type IIs restriction enzyme-digested PCR product is directly ligated with the mutagenic fragment. Our method requires no assistance of mutagenic primers. We have used this method to create various types of difficult-to-make mutants with mutagenic frequencies of nearly 100%. Our protocol has many advantages over the prevalent QuikChange method and is a valuable tool for studies on gene structure and function. Copyright © 2011 Elsevier Inc. All rights reserved.

Routine use of PCR-restriction fragment length polymorphism analysis for identification of mycobacteria growing in liquid media.

PubMed Central

Taylor, T B; Patterson, C; Hale, Y; Safranek, W W

1997-01-01

A PCR-restriction fragment length polymorphism (PCR-RFLP) procedure capable of rapidly identifying 28 species of clinically encountered mycobacteria was evaluated for use in the routine identification of acid-fast isolates growing in BACTEC 12B and 13A liquid media. PCR-RFLP identified 100 of 103 acid-fast isolates recovered from 610 patient specimens submitted for culture during the study. The three isolates unidentifiable by PCR-RFLP produced restriction patterns not included in the PCR-RFLP algorithm and could therefore not be assigned to a species. These isolates were characterized by their morphologic and biochemical characteristics. Two of the isolates were identified as M. terrae complex and M. gordonae. The third isolate could not be definitively identified and could only be characterized as a Mycobacterium sp. most closely resembling M. chelonae. PCR-RFLP identifications agreed with the conventional identifications for 96 of the 100 isolates identified by PCR-RFLP. Subsequent identification of the four discordant isolates by gas chromatography analysis supported the PCR-RFLP identification of each isolate. Amplification products were also obtained from isolates of Streptococcus albus and Rhodococcus equi recovered from patient specimens; however, the restriction patterns of these nonmycobacterial species did not resemble the patterns of any mycobacterial species included in the PCR-RFLP algorithm. PCR-RFLP seems to be a reliable procedure for the routine identification of mycobacteria and has the potential for providing identifications of mycobacterial isolates which are more accurate than conventional identification techniques based on morphologic and biochemical characteristics. PMID:8968884

Biomolecular computers with multiple restriction enzymes.

PubMed

Sakowski, Sebastian; Krasinski, Tadeusz; Waldmajer, Jacek; Sarnik, Joanna; Blasiak, Janusz; Poplawski, Tomasz

2017-01-01

The development of conventional, silicon-based computers has several limitations, including some related to the Heisenberg uncertainty principle and the von Neumann "bottleneck". Biomolecular computers based on DNA and proteins are largely free of these disadvantages and, along with quantum computers, are reasonable alternatives to their conventional counterparts in some applications. The idea of a DNA computer proposed by Ehud Shapiro's group at the Weizmann Institute of Science was developed using one restriction enzyme as hardware and DNA fragments (the transition molecules) as software and input/output signals. This computer represented a two-state two-symbol finite automaton that was subsequently extended by using two restriction enzymes. In this paper, we propose the idea of a multistate biomolecular computer with multiple commercially available restriction enzymes as hardware. Additionally, an algorithmic method for the construction of transition molecules in the DNA computer based on the use of multiple restriction enzymes is presented. We use this method to construct multistate, biomolecular, nondeterministic finite automata with four commercially available restriction enzymes as hardware. We also describe an experimental applicaton of this theoretical model to a biomolecular finite automaton made of four endonucleases.

Microorganism mediated liquid fuels

DOE Office of Scientific and Technical Information (OSTI.GOV)

Troiano, Richard

Herein disclosed is a method for producing liquid hydrocarbon product, the method comprising disintegrating a hydrocarbon source; pretreating the disintegrated hydrocarbon source; solubilizing the disintegrated hydrocarbon source to form a slurry comprising a reactant molecule of the hydrocarbon source; admixing a biochemical liquor into the slurry, wherein the biochemical liquor comprises at least one conversion enzyme configured to facilitate bond selective photo-fragmentation of said reactant molecule of the hydrocarbon source, to form liquid hydrocarbons via enzyme assisted bond selective photo-fragmentation, wherein said conversion enzyme comprises reactive sites configured to restrict said reactant molecule such that photo-fragmentation favorably targets a preselectedmore » internal bond of said reactant molecule; separating the liquid hydrocarbons from the slurry, wherein contaminants remain in the slurry; and enriching the liquid hydrocarbons to form a liquid hydrocarbon product. Various aspects of such method/process are also discussed.« less

Genetic diversity in butterflies: Interactive effects of habitat fragmentation and climate-driven range expansion.

PubMed

Hill, Jane K; Hughes, Clare L; Dytham, Calvin; Searle, Jeremy B

2006-03-22

Some species are expanding their ranges polewards during current climate warming. However, anthropogenic fragmentation of suitable habitat is affecting expansion rates and here we investigate interactions between range expansion, habitat fragmentation and genetic diversity. We examined three closely related Satyrinae butterflies, which differ in their habitat associations, from six sites along a transect in England from distribution core to expanding range margin. There was a significant decline in allozyme variation towards an expanding range margin in Pararge aegeria, which has the most restricted habitat availability, but not in Pyronia tithonus whose habitat is more widely available, or in a non-expanding 'control species' (Maniola jurtina). Moreover, data from another transect in Scotland indicated that declines in genetic diversity in P. aegeria were evident only on the transect in England, which had greater habitat fragmentation. Our results indicate that fragmentation of breeding habitats leads to more severe founder events during colonization, resulting in reduced diversity in marginal populations in more specialist species. The continued widespread loss of suitable habitats in the future may increase the likelihood of loss of genetic diversity in expanding species, which may affect whether or not species can adapt to future environmental change.

Frequency of uridine monophosphate synthase Gly(213)Ala polymorphism in Caucasian gastrointestinal cancer patients and healthy subjects, investigated by means of new, rapid genotyping assays.

PubMed

Gusella, Milena; Bertolaso, Laura; Bolzonella, Caterina; Pasini, Felice; Padrini, Roberto

2011-10-01

Uridine monophosphate synthase (UMPS) is a fundamental enzyme in pyrimidine synthesis. A single-nucleotide polymorphism, a G-C transversion at the 638th nucleotide, was demonstrated to increase UMPS activity and suggested to have clinical effects. The aims of this study were to set up simple genotyping methods and investigate the UMPS 638G>C polymorphism in the Caucasian population. Two hundred forty-one patients with gastrointestinal cancers and 189 healthy subjects were enrolled. Genomic DNA was extracted from peripheral blood. A polymerase chain reaction-restriction fragment length polymorphism (RFLP) method was implemented using a forward primer incorporating a mismatched base to produce an artificial restriction site and BsrI restriction enzyme digestion; a denaturing high performance liquid chromatography (DHPLC) method was developed to further speed up UMPS genotyping. A 153 bp UMPS gene fragment was successfully amplified and analyzed in all samples. RFLP and DHPLC results showed a 100% match and where confirmed by direct sequencing. UMPS genotype distribution was similar in patients with cancer and control subjects. Although no association was detected between UMPS variants and gastrointestinal cancer risk in Caucasians, polymerase chain reaction-RFLP with BsrI digestion and DHPLC set up at 59°C are reliable and cost-effective methods to genotype UMPS.

A Simple Restriction Fragment Length Polymorphism-Based Strategy That Can Distinguish the Internal Genes of Human H1N1, H3N2, and H5N1 Influenza A Viruses

PubMed Central

Cooper, Lynn A.; Subbarao, Kanta

2000-01-01

A simple molecular technique for rapid genotyping was developed to monitor the internal gene composition of currently circulating influenza A viruses. Sequence information from recent H1N1, H3N2, and H5N1 human virus isolates was used to identify conserved regions within each internal gene, and gene-specific PCR primers capable of amplifying all three virus subtypes were designed. Subtyping was based on subtype-specific restriction fragment length polymorphism (RFLP) patterns within the amplified regions. The strategy was tested in a blinded fashion using 10 control viruses of each subtype (total, 30) and was found to be very effective. Once standardized, the genotyping method was used to identify the origin of the internal genes of 51 influenza A viruses isolated from humans in Hong Kong during and immediately following the 1997–1998 H5N1 outbreak. No avian-human or H1-H3 reassortants were detected. Less than 2% (6 of 486) of the RFLP analyses were inconclusive; all were due to point mutations within a restriction site. The technique was also used to characterize the internal genes of two avian H9N2 viruses isolated from children in Hong Kong during 1999. PMID:10878047

Optimization methods of laws control of electric propulsion spacecraft in the restricted three-body task

NASA Astrophysics Data System (ADS)

Starinova, Olga L.

2014-12-01

This paper outlines the optimization methods of the control law of the low thrust spacecraft for the restrict problem of three-body. The conditions for fragmentation trajectory on the specific parts of trajectory are formulated. The mathematical statement and methods to solve the optimal control problem on these parts are stated. Results of the decision of applied problems for various classes of spacecrafts which are carrying out maneuvers with low thrust are presented. In particular, the non-coplanar maneuvers of the low thrust spacecraft in the Earth-Moon system are viewed.

Hydrocode predictions of collisional outcomes: Effects of target size

NASA Technical Reports Server (NTRS)

Ryan, Eileen V.; Asphaug, Erik; Melosh, H. J.

1991-01-01

Traditionally, laboratory impact experiments, designed to simulate asteroid collisions, attempted to establish a predictive capability for collisional outcomes given a particular set of initial conditions. Unfortunately, laboratory experiments are restricted to using targets considerably smaller than the modelled objects. It is therefore necessary to develop some methodology for extrapolating the extensive experimental results to the size regime of interest. Results are reported obtained through the use of two dimensional hydrocode based on 2-D SALE and modified to include strength effects and the fragmentation equations. The hydrocode was tested by comparing its predictions for post-impact fragment size distributions to those observed in laboratory impact experiments.

Design of combinatorial libraries for the exploration of virtual hits from fragment space searches with LoFT.

PubMed

Lessel, Uta; Wellenzohn, Bernd; Fischer, J Robert; Rarey, Matthias

2012-02-27

A case study is presented illustrating the design of a focused CDK2 library. The scaffold of the library was detected by a feature trees search in a fragment space based on reactions from combinatorial chemistry. For the design the software LoFT (Library optimizer using Feature Trees) was used. The special feature called FTMatch was applied to restrict the parts of the queries where the reagents are permitted to match. This way a 3D scoring function could be simulated. Results were compared with alternative designs by GOLD docking and ROCS 3D alignments.

Detection of DNA "fingerprints" of cultivated rice by hybridization with a human minisatellite DNA probe.

PubMed

Dallas, J F

1988-09-01

A human minisatellite DNA probe detects several restriction fragment length polymorphisms in cultivars of Asian and African rice. Certain fragments appear to be inherited in a Mendelian fashion and may represent unlinked loci. The hybridization patterns appear to be cultivar-specific and largely unchanged after the regeneration of plants from tissue culture. The results suggest that these regions of the rice genome may be used to generate cultivar-specific DNA fingerprints. The demonstration of similarity between a human minisatellite sequence and polymorphic regions in the rice genome suggests that such regions also occur in the genomes of many other plant species.

Using Harry Potter to Introduce Students to DNA Fingerprinting & Forensic Science

ERIC Educational Resources Information Center

Palmer, Laura K.

2010-01-01

This lesson uses characters from the Harry Potter series of novels as a "hook" to stimulate students' interest in introductory forensic science. Students are guided through RFLP (restriction fragment length polymorphism) analysis using inexpensive materials and asked to interpret data from a mock crime scene. Importantly, the lesson provides an…

A SIMPLE POLYMERASE CHAIN REACTION/RESTRICTION FRAGMENT LENGTH POLYMORPHISM ASSAY CAPABLE OF IDENTIFYING MEDICALLY RELEVANT FILAMENTOUS FUNGI

EPA Science Inventory

The accumulating evidence that suggests that numerous unhealthy conditions in the indoor environment are the result of abnormal growth of the filamentous fungi (mold) in and on buildign surfaces. In order to accurately reflect the organisms responsible for these maladies it is of...

Linguini Models of Molecular Genetic Mapping and Fingerprinting.

ERIC Educational Resources Information Center

Thompson, James N., Jr.; Gray, Stanton B.; Hellack, Jenna J.

1997-01-01

Presents an exercise using linguini noodles to demonstrate an aspect of DNA fingerprinting. DNA maps that show genetic differences can be produced by digesting a certain piece of DNA with two or more restriction enzymes both individually and in combination. By rearranging and matching linguini fragments, students can recreate the original pattern…

Fostering Knowledge and Skills to Teach for Diversity: "There Is Nothing so Practical as a Good Theory"

ERIC Educational Resources Information Center

Marchel, Carol A.; Green, Susan K

2014-01-01

Increased use of field-based teacher preparation offers important opportunities to develop skills with diverse learners. However, limited focus on theoretical content restricts understanding and generalization of well-proven theoretical approaches, resulting in fragmented field applications unlikely to result in broad application. Inspired by Kurt…

Mycobacterium marinum infections in fish and humans in Israel.

PubMed

Ucko, M; Colorni, A

2005-02-01

Israeli Mycobacterium marinum isolates from humans and fish were compared by direct sequencing of the 16S rRNA and hsp65 genes, restriction mapping, and amplified fragment length polymorphism analysis. Significant molecular differences separated all clinical isolates from the piscine isolates, ruling out the local aquaculture industry as the source of human infections.

ECTOMYCORRHIZAL FUNGI IDENTIFICATION IN SINGLE AND POOLED ROOT SAMPLES: TERMINAL RESTRICTION FRAGMENT LENGTH POLYMORPHISM (TRFLP) AND MORPHOTYPING COMPARED

EPA Science Inventory

PCR-TRFLP methodology targeting rRNA genes has effectively been used to discriminate between microbial communities but to date has not been used specifically for the analysis of ectomycorrhizal communities colonizing plant roots. We describe here results of a study conducted to a...

Inheritance of RFLP loci in a loblolly pine three-generation pedigree

Treesearch

M.D. Devey; K.D. Jermstad; C.G. Tauer; D.B. Neale

1991-01-01

A high-density restriction fragment length polymorphism (RFLP) linkage map is being constructed for loblolly pine (Pinus taeda L.). Loblolly pine cDNA and genomic DNA clones were used as probes in hybridizations to genomic DNAs prepared from grandparents, parents, and progeny of a three-generation outbred pedigree. Approximately 200 probes were...

A Rapid PCR-RFLP Method for Monitoring Genetic Variation among Commercial Mushroom Species

ERIC Educational Resources Information Center

Martin, Presley; Muruke, Masoud; Hosea, Kenneth; Kivaisi, Amelia; Zerwas, Nick; Bauerle, Cynthia

2004-01-01

We report the development of a simplified procedure for restriction fragment length polymorphism (RFLP) analysis of mushrooms. We have adapted standard molecular techniques to be amenable to an undergraduate laboratory setting in order to allow students to explore basic questions about fungal diversity and relatedness among mushroom species. The…

76 FR 74691 - Import Restrictions Imposed on Certain Archaeological and Ethnological Material From Greece

Federal Register 2010, 2011, 2012, 2013, 2014

2011-12-01

... Statuary--Subject matter is varied and includes human and animal figures, human body parts, groups of..., including fragments of statues. Subject matter includes human and animal figures and groups of figures in... marble and other stone. Subject matter includes human and animal figures and groups of figures in the...

Conservation assessment for inland cutthroat trout

Treesearch

Michael K. Young

1995-01-01

This document focuses on the state of the science for five subspecies of cutthroat trout found largely on public lands in the Rocky Mountain and Intermountain West. These subspecies are restricted to a fragment of their former range, and primarily occupy small, high-elevation streams. Little is known about the three rarest subspecies (Bonneville, Colorado River, and...

Molecular mapping of resistance to blight in an interspecific cross in the genus Castanea

Treesearch

Thomas L. Kubisiak; F.V. Hebard; C. Dana Nelson; Jiansu Zhang; R. Bernatzky; H. Huang; S.L. Anagnostakis; R.L. Doudrick

1997-01-01

A three-generation American chestnut x Chinese chestnut pedigree was used to construct a genetic linkage map for chestnut and to investigate the control of resistance to Endothia parasitica (chestnut blight fungus). DNA genotypes for 241 polymorphic markers (eight isozymes, 17 restriction fragment length polymorphisms [RFLPs], and 216 random...

Genetic fingerprinting of longleaf pine seed orchard clones following Hurricane Hugo

Treesearch

K. D. Jermstad; P.A. Guge; E.R. Carroll; S.T. Friedman; D.B. Neale

1993-01-01

Isozyme and restriction fragment length polymorphism (RFLP) markers were used to determine the genetic identities of 12 longleaf pine (Pinus palustrus Mill.) ramets whose identities came into question after Hurricane Hugo. Isozyme assays were performed for 12 enzyme systems representing 15 loci. Variation at 6 loci revealed unique identities for 6...

RESTRICTION FRAGMENT LENGTH POLYMORPHISM ANALYSIS OF PCR-AMPLIFIED NIFH SEQUENCES FROM WETLAND PLANT RHIZOSPHERE COMMUNITIES

EPA Science Inventory

We describe a method to assess the community structure of N2-fixing bacteria in the rhizosphere. Total DNA was extracted from Spartina alterniflora and Sesbania macrocarpa root zones by bead-beating and purified by CsCl-EtBr gradient centrifugation. The average DNA yield was 5.5 ...

Anaerobic microbial communities in Lake Pavin, a unique meromictic lake in France.

PubMed

Lehours, Anne-C; Bardot, Corinne; Thenot, Aurelie; Debroas, Didier; Fonty, Gerard

2005-11-01

The Bacteria and Archaea from the meromictic Lake Pavin were analyzed in samples collected along a vertical profile in the anoxic monimolimnion and were compared to those in samples from the oxic mixolimnion. Nine targeted 16S rRNA oligonucleotide probes were used to assess the distribution of Bacteria and Archaea and to investigate the in situ occurrence of sulfate-reducing bacteria and methane-producing Archaea involved in the terminal steps of the anaerobic degradation of organic material. The diversity of the complex microbial communities was assessed from the 16S rRNA polymorphisms present in terminal restriction fragment (TRF) depth patterns. The densities of the microbial community increased in the anoxic layer, and Archaea detected with probe ARCH915 represented the largest microbial group in the water column, with a mean Archaea/Eubacteria ratio of 1.5. Terminal restriction fragment length polymorphism (TRFLP) analysis revealed an elevated archaeal and bacterial phylotype richness in anoxic bottom-water samples. The structure of the Archaea community remained rather homogeneous, while TRFLP patterns for the eubacterial community revealed a heterogeneous distribution of eubacterial TRFs.

Linkage and homology analysis divides the eight genes for the small subunit of petunia ribulose 1,5-bisphosphate carboxylase into three gene families

PubMed Central

Dean, Caroline; van den Elzen, Peter; Tamaki, Stanley; Dunsmuir, Pamela; Bedbrook, John

1985-01-01

Twenty-six λ phage clones with homology to coding sequences of the small subunit (SSU) of ribulose 1,5-bisphosphate carboxylase have been isolated from an EMBL3 λ phage bank of Petunia (Mitchell) DNA. Restriction mapping of the phage inserts shows that the clones were obtained from five nonoverlapping regions of petunia DNA that carry seven SSU genes. Comparison of the HindIII genomic fragments of petunia DNA with the HindIII restriction fragments of the isolated phage indicates that petunia nuclear DNA encodes eight SSU genes, seven of which are present in the phage clones. Two incomplete genes, which contain only the 3′ end of an SSU gene, were also found in the phage clones. We demonstrate that the eight SSU genes of petunia can be divided into three gene families based on homology to three petunia cDNA clones. Two gene families contain single SSU genes and the third contains six genes, four of which are closely linked within petunia nuclear DNA. Images PMID:16593584

Molecular identification of Giardia duodenalis in Ecuador by polymerase chain reaction-restriction fragment length polymorphism

PubMed Central

Atherton, Richard; Bhavnani, Darlene; Calvopiña, Manuel; Vicuña, Yosselin; Cevallos, William; Eisenberg, Joseph

2013-01-01

The aim of this study was to determine the genetic diversity of Giardia duodenalis present in a human population living in a northern Ecuadorian rain forest. All Giardia positive samples (based on an ELISA assay) were analysed using a semi-nested polymerase chain reaction-restriction fragment length polymorphism assay that targets the glutamate dehydrogenase (gdh) gene; those amplified were subsequently genotyped using NlaIV and RsaI enzymes. The gdh gene was successfully amplified in 74 of 154 ELISA positive samples; 69 of the 74 samples were subsequently genotyped. Of these 69 samples, 42 (61%) were classified as assemblage B (26 as BIII and 16 as BIV), 22 (32%) as assemblage A (3 as AI and 19 as AII) and five (7%) as mixed AII and BIII types. In this study site we observe similar diversity in genotypes to other regions in Latin America, though in contrast to some previous studies, we found similar levels of diarrheal symptoms in those individuals infected with assemblage B compared with those infected with assemblage A. PMID:23827993

Probing the dynamics of restriction endonuclease NgoMIV-DNA interaction by single-molecule FRET.

PubMed

Tutkus, Marijonas; Sasnauskas, Giedrius; Rutkauskas, Danielis

2017-12-01

Many type II restriction endonucleases require two copies of their recognition sequence for optimal activity. Concomitant binding of two DNA sites by such an enzyme produces a DNA loop. Here we exploit single-molecule Förster resonance energy transfer (smFRET) of surface-immobilized DNA fragments to study the dynamics of DNA looping induced by tetrameric endonuclease NgoMIV. We have employed a DNA fragment with two NgoMIV recognition sites and a FRET dye pair such that upon protein-induced DNA looping the dyes are brought to close proximity resulting in a FRET signal. The dynamics of DNA-NgoMIV interactions proved to be heterogeneous, with individual smFRET trajectories exhibiting broadly different average looped state durations. Distinct types of the dynamics were attributed to different types of DNA-protein complexes, mediated either by one NgoMIV tetramer simultaneously bound to two specific sites ("slow" trajectories) or by semi-specific interactions of two DNA-bound NgoMIV tetramers ("fast" trajectories), as well as to conformational heterogeneity of individual NgoMIV molecules. © 2017 Wiley Periodicals, Inc.

Identification of Echinococcus granulosus strains using polymerase chain reaction-restriction fragment length polymorphism amongst livestock in Moroto district, Uganda.

PubMed

Chamai, Martin; Omadang, Leonard; Erume, Joseph; Ocaido, Michael; Oba, Peter; Othieno, Emmanuel; Bonaventure, Straton; Kitibwa, Annah

2016-07-29

A descriptive study was conducted to identify the different strains of Echinococcus granulosus occurring in livestock in Moroto district, Uganda. Echinococcus cysts from 104 domestic animals, including cattle, sheep, goats and camels, were taken and examined by microscopy, polymerase chain reaction with restriction fragment length polymorphism and Sanger DNA sequencing. Echinococcus granulosus genotypes or strains were identified through use of Bioinformatics tools: BioEdit, BLAST and MEGA6. The major finding of this study was the existence of a limited number of E. granulosus genotypes from cattle, goats, sheep and camels. The most predominant genotype was G1 (96.05%), corresponding to the common sheep strain. To a limited extent (3.95%), the study revealed the existence of Echinococcus canadensis G6/7 in three (n = 3) of the E. granulosus-positive samples. No other strains of E. granulosus were identified. It was concluded that the common sheep strain of Echinococcus sensu stricto and G6/7 of E. canadensis were responsible for echinococcal disease in Moroto district, Uganda.

Genetic Variation in an Inbred Plant: Variation in Tissue Cultures of Soybean [Glycine Max (L.) Merrill

PubMed Central

Roth, E. J.; Frazier, B. L.; Apuya, N. R.; Lark, K. G.

1989-01-01

Although soybean [Glycine max (L.) Merrill] grows as an inbreeding, generally homozygous, plant, the germplasm of the species contains large amounts of genetic variation. Analysis of soybean DNA has indicated that variation of RFLP (restriction fragment length polymorphism) markers within the species usually entails only two alleles at any one locus and that mixtures of such dimorphic loci account for virtually all of the restriction fragment variation seen in soybean (G. max), and in its ancestors, G. soja and G. gracilis. We report here that tissue cultures prepared from root tissue of individual soybean plants develop RFLP allelic differences at various loci. However, these newly generated alleles are almost always the same as ones previously found and characterized in other varieties of cultivated soybean (cultivars). This repeated generation of particular alleles suggests that much of the genetic variation seen in soybean could be the consequence of specific, relatively frequently employed, recombinational events. Such a mechanism would allow inbred cultivars to generate genetic variation (in the form of alternative alleles) in a controlled manner, perhaps in response to stress. PMID:2567263

Demonstration of retrotransposition of the Tf1 element in fission yeast.

PubMed

Levin, H L; Boeke, J D

1992-03-01

Tf1, a retrotransposon from fission yeast, has LTRs and coding sequences resembling the protease, reverse transcriptase and integrase domains of retroviral pol genes. A unique aspect of Tf1 is that it contains a single open reading frame whereas other retroviruses and retrotransposons usually possess two or more open reading frames. To determine whether Tf1 can transpose, we overproduced Tf1 transcripts encoded by a plasmid copy of the element marked with a neo gene. Approximately 0.1-4.0% of the cell population acquired chromosomally inherited resistance to G418. DNA blot analysis demonstrated that such strains had acquired both Tf1 and neo specific sequences within a restriction fragment of the same size; the size of this restriction fragment varied between different isolates. Structural analysis of the cloned DNA flanking the Tf1-neo element of two transposition candidates with the same regions in the parent strain showed that the ability to grow on G418 was due to transposition of Tf1-neo and not other types of recombination events.

Lyme disease with facial nerve palsy: rapid diagnosis using a nested polymerase chain reaction-restriction fragment length polymorphism analysis.

PubMed

Hashimoto, Y; Takahashi, H; Kishiyama, K; Sato, Y; Nakao, M; Miyamoto, K; Iizuka, H

1998-02-01

A 64-year-old woman with Lyme disease and manifesting facial nerve palsy had been bitten by a tick on the left frontal scalp 4 weeks previously. Erythema migrans appeared on the left forehead, accompanied by left facial paralysis. Nested polymerase chain reaction-restriction fragment length polymorphism analysis (nested PCR-RFLP) was performed on DNA extracted from a skin biopsy of the erythema on the left forehead. Borrelia flagellin gene DNA was detected and its RFLP pattern indicated that the organism was B. garinii, Five weeks later, B. garinii was isolated by conventional culture from the erythematous skin lesion, but not from the cerebrospinal fluid. After treatment with ceftriaxone intravenously for 10 days and oral administration of minocycline for 7 days, both the erythema and facial nerve palsy improved significantly. Nested PCR and culture taken after the lesion subsided, using skin samples obtained from a site adjacent to the original biopsy, were both negative. We suggest that nested PCR-RFLP analysis might be useful for the rapid diagnosis of Lyme disease and for evaluating therapy.

High-sensitivity stable-isotope probing by a quantitative terminal restriction fragment length polymorphism protocol.

PubMed

Andeer, Peter; Strand, Stuart E; Stahl, David A

2012-01-01

Stable-isotope probing (SIP) has proved a valuable cultivation-independent tool for linking specific microbial populations to selected functions in various natural and engineered systems. However, application of SIP to microbial populations with relatively minor buoyant density increases, such as populations that utilize compounds as a nitrogen source, results in reduced resolution of labeled populations. We therefore developed a tandem quantitative PCR (qPCR)-TRFLP (terminal restriction fragment length polymorphism) protocol that improves resolution of detection by quantifying specific taxonomic groups in gradient fractions. This method combines well-controlled amplification with TRFLP analysis to quantify relative taxon abundance in amplicon pools of FAM-labeled PCR products, using the intercalating dye EvaGreen to monitor amplification. Method accuracy was evaluated using mixtures of cloned 16S rRNA genes, DNA extracted from low- and high-G+C bacterial isolates (Escherichia coli, Rhodococcus, Variovorax, and Microbacterium), and DNA from soil microcosms amended with known amounts of genomic DNA from bacterial isolates. Improved resolution of minor shifts in buoyant density relative to TRFLP analysis alone was confirmed using well-controlled SIP analyses.

Genotypic characterization of psittacid herpesvirus isolates from Brazil.

PubMed

Luppi, Marcela Miranda; Luiz, Ana Paula Moreira Franco; Coelho, Fabiana Magalhães; Ecco, Roselene; da Fonseca, Flávio Guimarães; Resende, Mauricio

2016-01-01

Thirty-six isolates of psittacid herpesvirus (PsHV), obtained from 12 different species of psittacids in Brazil, were genotypically characterized by restriction fragment length polymorphism (RFLP) analysis and PCR amplification. RFLP analysis with the PstI enzyme revealed four distinct restriction patterns (A1, X, W and Y), of which only A1 (corresponding to PsHV-1) had previously been described. To study PCR amplification patterns, six pairs of primers were used. Using this method, six variants were identified, of which, variants 10, 8, and 9 (in this order) were most prevalent, followed by variants 1, 4, and 5. It was not possible to correlate the PCR and RFLP patterns. Twenty-nine of the 36 isolates were shown to contain a 419bp fragment of the UL16 gene, displaying high similarity to the PsHV-1 sequences available in GenBank. Comparison of the results with the literature data suggests that the 36 Brazilian isolates from this study belong to genotype 1 and serotype 1. Copyright © 2015 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

The pPSU Plasmids for Generating DNA Molecular Weight Markers.

PubMed

Henrici, Ryan C; Pecen, Turner J; Johnston, James L; Tan, Song

2017-05-26

Visualizing nucleic acids by gel electrophoresis is one of the most common techniques in molecular biology, and reference molecular weight markers or ladders are commonly used for size estimation. We have created the pPSU1 & pPSU2 pair of molecular weight marker plasmids which produce both 100 bp and 1 kb DNA ladders when digested with two common restriction enzymes. The 100 bp ladder fragments have been optimized to migrate appropriately on both agarose and native polyacrylamide, unlike many currently available DNA ladders. Sufficient plasmid DNA can be isolated from 100 ml E. coli cultures for the two plasmids to produce 100 bp or 1 kb ladders for 1000 gels. As such, the pPSU1 and pPSU2 plasmids provide reference fragments from 50 to 10000 bp at a fraction of the cost of commercial DNA ladders. The pPSU1 and pPSU2 plasmids are available without licensing restrictions to nonprofit academic users, affording freely available high-quality, low-cost molecular weight standards for molecular biology applications.

Human Presence Increases Parasitic Load in Endangered Lion-Tailed Macaques (Macaca silenus) in Its Fragmented Rainforest Habitats in Southern India

PubMed Central

Hussain, Shaik; Ram, Muthuvarmadam Subramanian; Kumar, Ajith; Shivaji, Sisinthy; Umapathy, Govindhaswamy

2013-01-01

Background Understanding changes in the host-parasite relationship due to habitat fragmentation is necessary for better management and conservation of endangered species in fragmented landscapes. Pathogens and parasites can pose severe threat to species in restricted environments such as forest fragments where there is increased contact of wildlife with human and livestock populations. Environmental stress and reduced nutritional level in forest fragments can influence parasite infection and intensity on the native species. In this study, we examine the impact of habitat fragmentation on the prevalence of gastrointestinal parasites in lion-tailed macaques in a fragmented rainforest in Western Ghats. Methods The prevalence of different gastrointestinal parasites was estimated from 91 fecal samples collected from 9 lion-tailed macaque groups in nine forest fragments. The parasites were identified up to genus level on the basis of the morphology and coloration of the egg, larva and cyst. The covariates included forest fragment area, group size and the presence/absence of human settlements and livestock in proximity. We used a linear regression model to identify the covariates that significantly influenced the prevalence of different parasite taxa. Results Nine gastrointestinal parasite taxa were detected in lion-tailed macaque groups. The groups near human settlements had greater prevalence and number of taxa, and these variables also had significant positive correlations with group size. We found that these parameters were also greater in groups near human settlements after controlling for group size. Livestock were present in all five fragments that had human settlements in proximity. Conclusion The present study suggests that high prevalence and species richness of gastrointestinal parasites in lion-tailed macaque groups are directly related to habitat fragmentation, high anthropogenic activities and high host density. The parasite load partially explains the reason for the decline in immature survival and birth rate in small and isolated rainforest fragments in Anamalai Hills. PMID:23717465

A global analysis of traits predicting species sensitivity to habitat fragmentation

USGS Publications Warehouse

Keinath, Douglas; Doak, Daniel F.; Hodges, Karen E.; Prugh, Laura R.; Fagan, William F.; Sekercioglu, Cagan H.; Buchart, Stuart H. M.; Kauffman, Matthew J.

2017-01-01

AimElucidating patterns in species responses to habitat fragmentation is an important focus of ecology and conservation, but studies are often geographically restricted, taxonomically narrow or use indirect measures of species vulnerability. We investigated predictors of species presence after fragmentation using data from studies around the world that included all four terrestrial vertebrate classes, thus allowing direct inter-taxonomic comparison.LocationWorld-wide.MethodsWe used generalized linear mixed-effect models in an information theoretic framework to assess the factors that explained species presence in remnant habitat patches (3342 patches; 1559 species, mostly birds; and 65,695 records of patch-specific presence–absence). We developed a novel metric of fragmentation sensitivity, defined as the maximum rate of change in probability of presence with changing patch size (‘Peak Change’), to distinguish between general rarity on the landscape and sensitivity to fragmentation per se.ResultsSize of remnant habitat patches was the most important driver of species presence. Across all classes, habitat specialists, carnivores and larger species had a lower probability of presence, and those effects were substantially modified by interactions. Sensitivity to fragmentation (measured by Peak Change) was influenced primarily by habitat type and specialization, but also by fecundity, life span and body mass. Reptiles were more sensitive than other classes. Grassland species had a lower probability of presence, though sample size was relatively small, but forest and shrubland species were more sensitive.Main conclusionsHabitat relationships were more important than life-history characteristics in predicting the effects of fragmentation. Habitat specialization increased sensitivity to fragmentation and interacted with class and habitat type; forest specialists and habitat-specific reptiles were particularly sensitive to fragmentation. Our results suggest that when conservationists are faced with disturbances that could fragment habitat they should pay particular attention to specialists, particularly reptiles. Further, our results highlight that the probability of presence in fragmented landscapes and true sensitivity to fragmentation are predicted by different factors.

Human presence increases parasitic load in endangered lion-tailed macaques (Macaca silenus) in its fragmented rainforest habitats in Southern India.

PubMed

Hussain, Shaik; Ram, Muthuvarmadam Subramanian; Kumar, Ajith; Shivaji, Sisinthy; Umapathy, Govindhaswamy

2013-01-01

Understanding changes in the host-parasite relationship due to habitat fragmentation is necessary for better management and conservation of endangered species in fragmented landscapes. Pathogens and parasites can pose severe threat to species in restricted environments such as forest fragments where there is increased contact of wildlife with human and livestock populations. Environmental stress and reduced nutritional level in forest fragments can influence parasite infection and intensity on the native species. In this study, we examine the impact of habitat fragmentation on the prevalence of gastrointestinal parasites in lion-tailed macaques in a fragmented rainforest in Western Ghats. The prevalence of different gastrointestinal parasites was estimated from 91 fecal samples collected from 9 lion-tailed macaque groups in nine forest fragments. The parasites were identified up to genus level on the basis of the morphology and coloration of the egg, larva and cyst. The covariates included forest fragment area, group size and the presence/absence of human settlements and livestock in proximity. We used a linear regression model to identify the covariates that significantly influenced the prevalence of different parasite taxa. Nine gastrointestinal parasite taxa were detected in lion-tailed macaque groups. The groups near human settlements had greater prevalence and number of taxa, and these variables also had significant positive correlations with group size. We found that these parameters were also greater in groups near human settlements after controlling for group size. Livestock were present in all five fragments that had human settlements in proximity. The present study suggests that high prevalence and species richness of gastrointestinal parasites in lion-tailed macaque groups are directly related to habitat fragmentation, high anthropogenic activities and high host density. The parasite load partially explains the reason for the decline in immature survival and birth rate in small and isolated rainforest fragments in Anamalai Hills.

Structure and Biochemestry of Laccases from the Lignin-Degrading Basidiomycete, Ganoderma lucidum

DOE Office of Scientific and Technical Information (OSTI.GOV)

C.A.Reddy, PI

2005-06-30

G. lucidum is one of the most important and widely distributed ligninolytic white rot fungi from habitats such as forest soils, agricultural soils, and tropical mangrove ecosystems and produce laccases as an important family of lignin modifying enzymes. Biochemically, laccases are blue multi copper oxidases that couple four electron reduction of molecular oxygen to water. There is a growing interest in the use of laccases for a variety of industrial applications such as bio-pulping and biobleaching as well as in their ability to detoxify a wide variety of toxic environmental pollutants. These key oxidative enzymes are found in all themore » three domains of life: Eukaryota. Prokarya, and Archaea. Ganoderma lucidum (strain no.103561) produces laccase with some of the highest activity (17,000 micro katals per mg of protein) reported for any laccases to date. Our results showed that this organism produces at least 11 different isoforms of laccase based on variation in mol. weight and/or PI. Our Studies showed that the presence of copper in the medium yields 15- to 20-fold greater levels of enzyme by G. lucidum. Dialysation of extra cellular fluid of G. lucidum against 10mM sodium tartrate (pH5.5) gave an additional 15 to 17 fold stimulation of activity with an observed specific activity of 17,000 {micro}katals/mg protein. Dialysis against acetate buffer gave five fold increase in activity while dialysis against glycine showed inhibition of activity. Purification by FPLC and preparative gel electrophoresis gave purified fractions that resolved into eleven isoforms as separated by isoelectric focusing, and the PI,s were 4.7, 4.6, 4.5, 4.3, 4.2, 4.1, 3.8, 3.7, 3.5, 3.4 and 3.3. Genomic clones of laccase were isolated using G. lucidum DNA as a template and using inverse PCR and forward/reverse primers corresponding to the sequences of the conserved copper binding region in the N-terminal domain of one of the laccases of this organism. Inverse PCR amplication of HindIII digested and ligated G.lucidum DNA was done using ABI Geneamp XL PCR kit in Ribocycler. The 5 conserved copper binding region of laccase was used for designing forward primer (5TCGACAATTCTTTCCTGTACG3) and reverse primer (5 TGGAGATGGG ACACT GGCTTATC 3). The PCR profile was 95 C for 3min, 94 C for 1min, 57 C for 30 sec and 68 C for 5min. for 30 cycles, and the final extension was at 72 C for 10min. The resulting {approx}2.7 Kb inverse PCR fragment was cloned into ZERO TOPOII blunt ligation vector (INVITROGEN) and screened on Kanamycin plates. Selected putative clones containing inserts were digested with a battery of restriction enzymes and analyzed on 1% agarose gels. Restriction digestion of these clones with BamHI, PstI, SalI, PvuII, EcoRI, and XhoI revealed 8 distinct patterns suggesting gene diversity. Two clones were sequenced using overlapping primers on ABI system. The sequences were aligned using Bioedit program. The aa sequences of the clones were deduced by Genewise2 program using Aspergillus as the reference organism. Eukaryotic gene regulatory sequences were identified using GeneWise2 Program. Laccase sequence alignments and similarity indexes were calculated using ClustalW and BioEdit programs. Blast analysis of two distinct BamHI clones, lac1 and lac4, showed that the proteins encoded by these clones are fungal laccase sequences. The coding sequence of lac1gene is interrupted by 6 introns ranging in size from 37-55 nt and encodes a mature protein consisting of 456 aa (Mr: 50,160), preceded by a putative 37-aa signal sequence. This predicted Mr is in agreement with the range of Mrs previously reported by us for the laccases of G. lucidum. The deduced aa sequence of LAC1 showed relatively high degree of homology with laccases of other basidiomycetes. It showed 96% homology to full-length LAC4 protein and 47-53% similarity to unpublished partial laccase sequences of other G. lucidum strains. Among the other basidiomycete laccases, LAC1 showed the highest similarity of 53-55% to Trametes versicolorLAC3 and LAC4. The consensus copper-binding domains found in other basidiomycete laccases are conserved in the LAC1 protein of G.lucidum. Eight putative N-glycosylation sites as well as consensus eukaryotic promoter sequence and polyadenylation signal sequences are also found. Coding sequence of lac4 is interrupted by 7 introns, encodes a mature protein of 525aa (Mr: 57,750), and has 98% nt homology to lac1, but was otherwise identical. Molecular masses of GLAC1 and GLAC4 were 49.8 kDa (462aa) and 52.5 kDa (524aa) in comparison to T. versicolr laccase which was 56.3 kDa (524aa). Predicted PI values of GLAC1, GLAC4 and T. versicolor laccase are, respectively 4.5, 4.7, and 4.2. Eight other laccase clones, distinct from lac1 and lac4 have recently been isolated from G. lucidum Our results show the existence of a laccase multi-gene family in G. lucidum in agreement with our earlier results showing multiple isoforms of laccase in this organism.« less

Lactobacillus strain diversity based on partial hsp60 gene sequences and design of PCR-restriction fragment length polymorphism assays for species identification and differentiation.

PubMed

Blaiotta, Giuseppe; Fusco, Vincenzina; Ercolini, Danilo; Aponte, Maria; Pepe, Olimpia; Villani, Francesco

2008-01-01

A phylogenetic tree showing diversities among 116 partial (499-bp) Lactobacillus hsp60 (groEL, encoding a 60-kDa heat shock protein) nucleotide sequences was obtained and compared to those previously described for 16S rRNA and tuf gene sequences. The topology of the tree produced in this study showed a Lactobacillus species distribution similar, but not identical, to those previously reported. However, according to the most recent systematic studies, a clear differentiation of 43 single-species clusters was detected/identified among the sequences analyzed. The slightly higher variability of the hsp60 nucleotide sequences than of the 16S rRNA sequences offers better opportunities to design or develop molecular assays allowing identification and differentiation of either distant or very closely related Lactobacillus species. Therefore, our results suggest that hsp60 can be considered an excellent molecular marker for inferring the taxonomy and phylogeny of members of the genus Lactobacillus and that the chosen primers can be used in a simple PCR procedure allowing the direct sequencing of the hsp60 fragments. Moreover, in this study we performed a computer-aided restriction endonuclease analysis of all 499-bp hsp60 partial sequences and we showed that the PCR-restriction fragment length polymorphism (RFLP) patterns obtainable by using both endonucleases AluI and TacI (in separate reactions) can allow identification and differentiation of all 43 Lactobacillus species considered, with the exception of the pair L. plantarum/L. pentosus. However, the latter species can be differentiated by further analysis with Sau3AI or MseI. The hsp60 PCR-RFLP approach was efficiently applied to identify and to differentiate a total of 110 wild Lactobacillus strains (including closely related species, such as L. casei and L. rhamnosus or L. plantarum and L. pentosus) isolated from cheese and dry-fermented sausages.

Lactobacillus Strain Diversity Based on Partial hsp60 Gene Sequences and Design of PCR-Restriction Fragment Length Polymorphism Assays for Species Identification and Differentiation▿ †

PubMed Central

Blaiotta, Giuseppe; Fusco, Vincenzina; Ercolini, Danilo; Aponte, Maria; Pepe, Olimpia; Villani, Francesco

2008-01-01

A phylogenetic tree showing diversities among 116 partial (499-bp) Lactobacillus hsp60 (groEL, encoding a 60-kDa heat shock protein) nucleotide sequences was obtained and compared to those previously described for 16S rRNA and tuf gene sequences. The topology of the tree produced in this study showed a Lactobacillus species distribution similar, but not identical, to those previously reported. However, according to the most recent systematic studies, a clear differentiation of 43 single-species clusters was detected/identified among the sequences analyzed. The slightly higher variability of the hsp60 nucleotide sequences than of the 16S rRNA sequences offers better opportunities to design or develop molecular assays allowing identification and differentiation of either distant or very closely related Lactobacillus species. Therefore, our results suggest that hsp60 can be considered an excellent molecular marker for inferring the taxonomy and phylogeny of members of the genus Lactobacillus and that the chosen primers can be used in a simple PCR procedure allowing the direct sequencing of the hsp60 fragments. Moreover, in this study we performed a computer-aided restriction endonuclease analysis of all 499-bp hsp60 partial sequences and we showed that the PCR-restriction fragment length polymorphism (RFLP) patterns obtainable by using both endonucleases AluI and TacI (in separate reactions) can allow identification and differentiation of all 43 Lactobacillus species considered, with the exception of the pair L. plantarum/L. pentosus. However, the latter species can be differentiated by further analysis with Sau3AI or MseI. The hsp60 PCR-RFLP approach was efficiently applied to identify and to differentiate a total of 110 wild Lactobacillus strains (including closely related species, such as L. casei and L. rhamnosus or L. plantarum and L. pentosus) isolated from cheese and dry-fermented sausages. PMID:17993558

2000 Year-old ancient equids: an ancient-DNA lesson from pompeii remains.

PubMed

Di Bernardo, Giovanni; Del Gaudio, Stefania; Galderisi, Umberto; Cipollaro, Marilena

2004-11-15

Ancient DNA extracted from 2000 year-old equine bones was examined in order to amplify mitochondrial and nuclear DNA fragments. A specific equine satellite-type sequence representing 3.7%-11% of the entire equine genome, proved to be a suitable target to address the question of the presence of aDNA in ancient bones. The PCR strategy designed to investigate this specific target also allowed us to calculate the molecular weight of amplifiable DNA fragments. Sequencing of a 370 bp DNA fragment of mitochondrial control region allowed the comparison of ancient DNA sequences with those of modern horses to assess their genetic relationship. The 16S rRNA mitochondrial gene was also examined to unravel the post-mortem base modification feature and to test the status of Pompeian equids taxon on the basis of a Mae III restriction site polymorphism. Copyright 2004 Wiley-Liss, Inc.

Useful DNA polymorphisms are identified by snapback, a midrepetitive element in Tribolium castaneum.

PubMed

Stuart, J J; De Gortari, M J; Hall, P S; Maxwell, M E; Mocelin, G; Brown, S J; Muir, W M

1996-06-01

The red flour bettle, Tribolium castaneum, is both a pest of stored grain products and an important experimental organism. To improve its facility as a genetic model, we are developing DNA fingerprinting methods for this insect. A Tribolium DNA fragment, snapback-1 (SBI), identified among sequences that reassociate before a Cot of 0.03 mol.s/L, was found to produce a banding pattern in restriction endonuclease digested genomic DNA that is characteristic of a midrepetitive element. DNA fingerprints of individual beetles demonstrated that unvarying inherited DNA polymorphism is revealed, and that polymorphism is inherited in a dominant Mendelian fashion. Linkage between bands was minimal. The sequence of SBI was determined, and hybridization experiments indicated that SBI is a fragment of a larger midrepetitive element. Fingerprinting individuals with known inbreeding coefficients indicated that SBI loci have relatively high mutation rates. The possibility that SBI is a fragment of a transposable element is discussed.

Localized extinction of an arboreal desert lizard caused by habitat fragmentation

USGS Publications Warehouse

Munguia-Vega, Adrian; Rodriguez-Estrella, Ricardo; Shaw, William W.; Culver, Melanie

2013-01-01

We adopted a species’ perspective for predicting extinction risk in a small, endemic, and strictly scansorial lizard (Urosaurus nigricaudus), in an old (∼60 year) and highly fragmented (8% habitat remaining) agricultural landscape from the Sonoran Desert, Mexico. We genotyped 10 microsatellite loci in 280 individuals from 11 populations in fragmented and continuous habitat. Individual dispersal was restricted to less than 400 m, according to analyses of spatial autocorrelation and spatially explicit Bayesian assignment methods. Within this scale, continuous areas and narrow washes with native vegetation allowed high levels of gene flow over tens of kilometers. In the absence of the native vegetation, cleared areas and highways were identified as partial barriers. In contrast, outside the scale of dispersal, cleared areas behaved as complete barriers, and surveys corroborated the species went extinct after a few decades in all small (less than 45 ha), isolated habitat fragments. No evidence for significant loss of genetic diversity was found, but results suggested fragmentation increased the spatial scale of movements, relatedness, genetic structure, and potentially affected sex-biased dispersal. A plausible threshold of individual dispersal predicted only 23% of all fragments in the landscape were linked with migration from continuous habitat, while complete barriers isolated the majority of fragments. Our study suggested limited dispersal, coupled with an inability to use a homogeneous and hostile matrix without vegetation and shade, could result in frequent time-delayed extinctions of small ectotherms in highly fragmented desert landscapes, particularly considering an increase in the risk of overheating and a decrease in dispersal potential induced by global warming.

Medium-sized tandem repeats represent an abundant component of the Drosophila virilis genome.

PubMed

Abdurashitov, Murat A; Gonchar, Danila A; Chernukhin, Valery A; Tomilov, Victor N; Tomilova, Julia E; Schostak, Natalia G; Zatsepina, Olga G; Zelentsova, Elena S; Evgen'ev, Michael B; Degtyarev, Sergey K H

2013-11-09

Previously, we developed a simple method for carrying out a restriction enzyme analysis of eukaryotic DNA in silico, based on the known DNA sequences of the genomes. This method allows the user to calculate lengths of all DNA fragments that are formed after a whole genome is digested at the theoretical recognition sites of a given restriction enzyme. A comparison of the observed peaks in distribution diagrams with the results from DNA cleavage using several restriction enzymes performed in vitro have shown good correspondence between the theoretical and experimental data in several cases. Here, we applied this approach to the annotated genome of Drosophila virilis which is extremely rich in various repeats. Here we explored the combined approach to perform the restriction analysis of D. virilis DNA. This approach enabled to reveal three abundant medium-sized tandem repeats within the D. virilis genome. While the 225 bp repeats were revealed previously in intergenic non-transcribed spacers between ribosomal genes of D. virilis, two other families comprised of 154 bp and 172 bp repeats were not described. Tandem Repeats Finder search demonstrated that 154 bp and 172 bp units are organized in multiple clusters in the genome of D. virilis. Characteristically, only 154 bp repeats derived from Helitron transposon are transcribed. Using in silico digestion in combination with conventional restriction analysis and sequencing of repeated DNA fragments enabled us to isolate and characterize three highly abundant families of medium-sized repeats present in the D. virilis genome. These repeats comprise a significant portion of the genome and may have important roles in genome function and structural integrity. Therefore, we demonstrated an approach which makes possible to investigate in detail the gross arrangement and expression of medium-sized repeats basing on sequencing data even in the case of incompletely assembled and/or annotated genomes.

Political fragmentation and widening disparities in African-American and white mortality, 1972-1988.

PubMed

Kim, Yonsu; Bruckner, Tim A

2016-12-01

During the 1970s and 1980s in the U.S., population movement, urban sprawl and urban governance reform led to a proliferation of local, autonomous jurisdictions. Prior literature examines how this creation of local governments, also referred to as political fragmentation, contributes to economic growth and social inequality. We examine the impact of political fragmentation on health equity by testing the hypothesis that the mortality disparity between whites and African-Americans varies positively with political fragmentation. We retrieved mortality data from the multiple cause-of-death file and calculated total number of local governments per 1000 residents in a county to measure the degree of political fragmentation. We focused on 226 U.S. counties with population size greater than 200,000 and restricted the analysis to four distinct periods with overlapping government and mortality data (1972-73, 1977-78, 1982-83, and 1987-88). We applied generalized estimating equation methods that permit analysis of clustered data over time. Methods also controlled for the age structure of the population, reductions in mortality over time, and confounding by county-level sociodemographic variables. Adjusted coefficients of fragmentation are positive and statistically significant for both whites (coef: 2.60, SE: 0.60, p <0.001) and African-Americans (coef: 5.31, SE: 1.56, p <0.001). The two-fold larger positive coefficient for African-Americans than for whites indicates a greater racial disparity in mortality among more politically fragmented urban counties and/or time periods. From 1972 to 1988, political fragmentation in large urban counties moves positively with the racial/ethnic gap in mortality between whites and African-Americans. We discuss intervening mechanisms through which political fragmentation may disproportionately affect mortality among African-Americans.

Tropical Forest Fragmentation Limits Movements, but Not Occurrence of a Generalist Pollinator Species

PubMed Central

Volpe, Noelia L.; Robinson, W. Douglas; Frey, Sarah J. K.; Hadley, Adam S.; Betts, Matthew G.

2016-01-01

Habitat loss and fragmentation influence species distributions and therefore ecological processes that depend upon them. Pollination may be particularly susceptible to fragmentation, as it depends on frequent pollinator movement. Unfortunately, most pollinators are too small to track efficiently which has precluded testing the hypothesis that habitat fragmentation reduces or eliminates pollen flow by disrupting pollinator movement. We used radio-telemetry to examine space use of the green hermit hummingbird (Phaethornis guy), an important ‘hub’ pollinator of understory flowering plants across substantial portions of the neotropics and the primary pollinator of a keystone plant which shows reduced pollination success in fragmented landscapes. We found that green hermits strongly avoided crossing large stretches of non-forested matrix and preferred to move along stream corridors. Forest gaps as small as 50 m diminished the odds of movement by 50%. Green hermits occurred almost exclusively inside the forest, with the odds of occurrence being 8 times higher at points with >95% canopy cover compared with points having <5% canopy cover. Nevertheless, surprisingly. the species occurred in fragmented landscapes with low amounts of forest (~30% within a 2 km radius). Our results indicate that although green hermits are present even in landscapes with low amounts of tropical forest, movement within these landscapes ends up strongly constrained by forest gaps. Restricted movement of pollinators may be an underappreciated mechanism for widespread declines in pollination and plant fitness in fragmented landscapes, even when in the presence of appropriate pollinators. PMID:27941984

Ultra-High-Speed DNA Fragment Separations Using Microfabricated Capillary Array Electrophoresis Chips

NASA Astrophysics Data System (ADS)

Woolley, Adam T.; Mathies, Richard A.

1994-11-01

Capillary electrophoresis arrays have been fabricated on planar glass substrates by photolithographic masking and chemical etching techniques. The photolithographically defined channel patterns were etched in a glass substrate, and then capillaries were formed by thermally bonding the etched substrate to a second glass slide. High-resolution electrophoretic separations of φX174 Hae III DNA restriction fragments have been performed with these chips using a hydroxyethyl cellulose sieving matrix in the channels. DNA fragments were fluorescently labeled with dye in the running buffer and detected with a laser-excited, confocal fluorescence system. The effects of variations in the electric field, procedures for injection, and sizes of separation and injection channels (ranging from 30 to 120 μm) have been explored. By use of channels with an effective length of only 3.5 cm, separations of φX174 Hae III DNA fragments from ≈70 to 1000 bp are complete in only 120 sec. We have also demonstrated high-speed sizing of PCR-amplified HLA-DQα alleles. This work establishes methods for high-speed, high-throughput DNA separations on capillary array electrophoresis chips.

Metronidazole activation and isolation of Clostridium acetobutylicum electron transport genes.

PubMed Central

Santangelo, J D; Jones, D T; Woods, D R

1991-01-01

An Escherichia coli F19 recA, nitrate reductase-deficient mutant was constructed by transposon mutagenesis and shown to be resistant to metronidazole. This mutant was a most suitable host for the isolation of Clostridium acetobutylicum genes on recombinant plasmids, which activated metronidazole and rendered the E. coli F19 strain sensitive to metronidazole. Twenty-five E. coli F19 clones containing different recombinant plasmids were isolated and classified into five groups on the basis of their sensitivity to metronidazole. The clones were tested for nitrate reductase, pyruvate-ferredoxin oxidoreductase, and hydrogenase activities. DNA hybridization and restriction endonuclease mapping revealed that four of the C. acetobutylicum insert DNA fragments on recombinant plasmids were linked in an 11.1-kb chromosomal fragment. DNA sequencing and amino acid homology studies indicated that this DNA fragment contained a flavodoxin gene which encoded a protein of 160 amino acids that activated metronidazole and made the E. coli F19 mutant very sensitive to metronidazole. The flavodoxin and hydrogenase genes which are involved in electron transfer systems were linked on the 11.1-kb DNA fragment from C. acetobutylicum. Images PMID:1991710

A mixed carbonate/clastic example in a restricted bay in a temperate carbonate shelf (Cala Fornells, northern Minorca Spain)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fornos, J.J.; Forteza, V.; Jaume, C.

1990-05-01

Cala Fornells is a restricted bay located in the northern section of the island Minorca. Cala Fornells has a surface area of 4 km{sup 2} and a maximum depth of 25 m at the mouth, which connects with the northern Minorca platform. Due to ephemeral streams with very fine textural inflow, the sedimentary facies present in the floor of the bay are primarily controlled by the bioclastic carbonate ecosystem production and the terrigenous input. The distribution of the facies is related to three major factors: (1) bathymetry, which controls the ecosystem distribution (Cymodocea nodosa-Caulerpa prolifera, Posidonia oceanica, and maeerl communities,more » from shallowest to deepest); (2) hydrodynamic conditions due to northern winds (locally called Tramuntana), which control the grain size distribution; and (3) local ephemeral streams, which control the terrigenous input. In the coarser fractions of the sediment (gravel and sand), the main component in the deepest zones are skeletal fragments of red algae. The shallowest zones contain fragments of the green alga Halimeda tuna, which may represent up to 50% of the total bioclastic fraction. The terrigenous components are mostly shales and only locally do they find a sand fragment of limestone and quartz grains. The organic matter content is very high (over 6% in the finest fractions), whereas in the more hydrodynamic and deeper facies (25 m) where the bioclastic fractions are predominant, the organic carbon content is below 0.5%.« less

A machine learning approach for viral genome classification.

PubMed

Remita, Mohamed Amine; Halioui, Ahmed; Malick Diouara, Abou Abdallah; Daigle, Bruno; Kiani, Golrokh; Diallo, Abdoulaye Baniré

2017-04-11

Advances in cloning and sequencing technology are yielding a massive number of viral genomes. The classification and annotation of these genomes constitute important assets in the discovery of genomic variability, taxonomic characteristics and disease mechanisms. Existing classification methods are often designed for specific well-studied family of viruses. Thus, the viral comparative genomic studies could benefit from more generic, fast and accurate tools for classifying and typing newly sequenced strains of diverse virus families. Here, we introduce a virus classification platform, CASTOR, based on machine learning methods. CASTOR is inspired by a well-known technique in molecular biology: restriction fragment length polymorphism (RFLP). It simulates, in silico, the restriction digestion of genomic material by different enzymes into fragments. It uses two metrics to construct feature vectors for machine learning algorithms in the classification step. We benchmark CASTOR for the classification of distinct datasets of human papillomaviruses (HPV), hepatitis B viruses (HBV) and human immunodeficiency viruses type 1 (HIV-1). Results reveal true positive rates of 99%, 99% and 98% for HPV Alpha species, HBV genotyping and HIV-1 M subtyping, respectively. Furthermore, CASTOR shows a competitive performance compared to well-known HIV-1 specific classifiers (REGA and COMET) on whole genomes and pol fragments. The performance of CASTOR, its genericity and robustness could permit to perform novel and accurate large scale virus studies. The CASTOR web platform provides an open access, collaborative and reproducible machine learning classifiers. CASTOR can be accessed at http://castor.bioinfo.uqam.ca .

Molecular characterization and evaluation of the emerging antibiotic-resistant Streptococcus pyogenes from eastern India.

PubMed

Ray, Dipanwita; Saha, Somnath; Sinha, Sukanta; Pal, Nishith Kumar; Bhattacharya, Basudev

2016-12-12

Group A Streptococcus strains causing wide variety of diseases, recently became noticeable in eastern India, are not amenable to standard treatment protocol thus enhancing the possibility of disease morbidity by becoming antibiotic resistance. The association of Lancefield group A Streptococcal variation with degree of vir architectural diversity was evaluated using emm typing and restriction fragment length polymorphism analyses. The antibiotic sensitivity patterns were examined by modified Kirby-Bauer method of disk diffusion. Percentage calculations, 95% confidence interval and one-way ANOVA were used to assess differences in proportions. Our observations revealed 20 different emm types and 13 different HaeIII vir typing patterns. A 1.2 kb fragment was found in all HaeIII typing pattern. Fragments of 1.2 kb and 550 bp were conserved in majority of the isolates. HinfI digestion was found proficient in differentiating the strains of same vir typing patterns. Strong predominance of speC (85%) and speF (80%) genes have been observed encoding exotoxins production. 4 isolates were found to be erythromycin resistant and were of genotype emm49. High degree of tetracycline resistance was shown by 53.57% isolates which belonged to 12 different emm genotypes. These findings suggested that in addition to emm typing, sequential application of HaeIII and HinfI restriction enzymes in vir typing analysis is an effective tool for group A streptococcal molecular characterization associated with antibiotic resistance.

Parasitic production of slow RI-beam from a projectile fragment separator by ion guide Laser Ion Source (PALIS)

NASA Astrophysics Data System (ADS)

Sonoda, Tetsu

2009-10-01

The projectile fragment separator BigRIPS of RIBF at RIKEN provides a wide variety of short-lived radioactive isotope (RI) ions without restrictions on their lifetime or chemical properties. A universal slow RI-beam facility (SLOWRI) to decelerate the beams from BigRIPS using an RF-carpet ion guide has been proposed as a principal facility of RIBF. However, beam time at such a modern accelerator facility is always limited and operational costs are high. We therefore propose an additional scheme as a complementary option to SLOWRI to drastically enhance the usability of such an expensive facility. In BigRIPS, a single primary beam produces thousands of isotopes but only one isotope is used for an experiment while the other >99.99% of isotopes are simply dumped in the slits or elsewhere in the fragment separator. We plan to locate a compact gas cell with 1 bar Ar at the slits. The thermalized ions in the cell will be quickly neutralized and transported to the exit by gas flow and resonantly re-ionized by lasers. Such low energy RI-beams will always be provided without any restriction to the main experiment. It will allow us to run parasitic experiments for precision atomic or decay spectroscopy, mass measurements. Furthermore, the resonance ionization in the cell itself can be used for high-sensitive laser spectroscopy, which will expand our knowledge of the ground state property of unstable nuclei.

Spectrophotometric, colorimetric and visually detection of Pseudomonas aeruginosa ETA gene based gold nanoparticles DNA probe and endonuclease enzyme.

PubMed

Amini, Bahram; Kamali, Mehdi; Salouti, Mojtaba; Yaghmaei, Parichehreh

2018-06-15

Colorimetric DNA detection is preferred over other methods for clinical molecular diagnosis because it does not require expensive equipment. In the present study, the colorimetric method based on gold nanoparticles (GNPs) and endonuclease enzyme was used for the detection of P. aeruginosa ETA gene. Firstly, the primers and probe for P. aeruginosa exotoxin A (ETA) gene were designed and checked for specificity by the PCR method. Then, GNPs were synthesized using the citrate reduction method and conjugated with the prepared probe to develop the new nano-biosensor. Next, the extracted target DNA of the bacteria was added to GNP-probe complex to check its efficacy for P. aeruginosa ETA gene diagnosis. A decrease in absorbance was seen when GNP-probe-target DNA cleaved into the small fragments of BamHI endonuclease due to the weakened electrostatic interaction between GNPs and the shortened DNA. The right shift of the absorbance peak from 530 to 562nm occurred after adding the endonuclease. It was measured using a UV-VIS absorption spectroscopy that indicates the existence of the P. aeruginosa ETA gene. Sensitivity was determined in the presence of different concentrations of target DNA of P. aeruginosa. The results obtained from the optimized conditions showed that the absorbance value has linear correlation with concentration of target DNA (R: 0.9850) in the range of 10-50ngmL -1 with the limit detection of 9.899ngmL -1 . Thus, the specificity of the new method for detection of P. aeruginosa was established in comparison with other bacteria. Additionally, the designed assay was quantitatively applied to detect the P. aeruginosa ETA gene from 10 3 to 10 8 CFUmL -1 in real samples with a detection limit of 320CFUmL -1 . Copyright © 2018 Elsevier B.V. All rights reserved.

Integration sites of Epstein-Barr virus genome on chromosomes of human lymphoblastoid cell lines

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wuu, K.D.; Chen, Y.J.; Wang-Wuu, S.

1994-09-01

Epstein-Barr virus (EBV) is the pathogen of infectious mononucleosis. The viral genome is present in more than 95% of the African cases of Burkitt lymphoma and it is usually maintained in episomal form in the tumor cells. Viral integration has been described only for Nanalwa which is a Burkitt lymphoma cell line lacking episomes. In order to examine the role of EBV in the immortalization of human Blymphocytes, we investigated whether the EBV integration into the human genome is essential. If the integration does occur, we would like to know whether the integration is randomly distributed or whether the viralmore » DNA integrates preferentially at certain sites. Fourteen in vitro immortalized human lymphoblastoid cell lines (LCLs) were examined by fluorescence in situ hybridization (FISH) with a biotinylated EBV BamHI w DNA fragment as probe. The episomal form of EBV DNA was found in all cells of these cell lines, while only about 65% of the cells have the integrated viral DNA. This might suggest that integration is not a pre-requisite for cell immortalization. Although all chromosomes, except Y, have been found with integrated viral genome, chromsomes 1 and 5 are the most frequent EBV DNA carrier (p<0.05). Nine chromosome bands, namely, 1p31, 1q31, 2q32, 3q13, 3q26, 5q14, 6q24, 7q31 and 12q21, are preferential targets for EBV integration (p<0.001). Eighty percent of the total 938 EBV hybridization signals were found to be at G-band-positive area. This suggests that the mechanism of EBV integration might be different from that of the retroviruses, which specifically integrate to G-band-negative areas. Thus, we conclude that the integration of EBV to host genome is non-random and it may have something to do with the structure of chromosome and DNA sequences.« less

Laser fragmentation of foreign bodies in the urinary tract: an in vitro study and clinical application.

PubMed

Bedke, Jens; Kruck, Stephan; Schilling, David; Matter, Anton; Horstmann, Marcus; Sievert, Karl-Dietrich; Stenzl, Arnulf; Nagele, Udo

2010-04-01

Foreign bodies of the urinary tract represent a urologic emergency. First-line treatment is endoscopic removal, but this is often impeded by restricted space, especially in the urethra. We postulated that foreign objects could be fragmented by Holmium:YAG laser and investigated its effect on objects of varying composition. In a specially designed stage flushed with physiologic saline, medical and non-medical objects of differing composition and diameter were subjected to fragmentation by Holmium:YAG at powers of 18 and 30 W. In additional thermal experiments, 5,000 J was applied to differing volumes of 0.9% sodium chloride. Experiments were repeated ten times. With one exception (16 Ch silicon catheter) all medical objects were fragmented (latex urinary catheter, ureteral stents, and guidewires). Of non-medical objects (wood, steel, copper, graphite, and nylon) only copper wire was not amenable to laser dissection. These in vitro results were applied in two patients who presented with a pencil (wood and graphite) in the urethra or bladder. After Holmium:YAG laser fragmentation, the pencil could be removed by forceps each. Foreign objects in the urinary tract can be fragmented with a Holmium:YAG laser. When foreign bodies are too big for initial endoscopic extraction, the clinician should consider this technique as a reasonable and atraumatic option to avoid open surgery.

Synthesis of a posterior indicator protein in normal embryos and double abdomens of Smittia sp. (Chironomidae, Diptera).

PubMed Central

Jäckle, H; Kalthoff, K

1980-01-01

In embryos of the chironomid midge Smittia, synthesis of a posterior indicator protein designated PI1 (Mr approximately 50,000; pI approximately 5.5) forecasts development of an abdomen as opposed to head and thorax. The protein is synthesized several hours before germ anlage formation. In normal embryos at early blastoderm stages, synthesis of PI1 is restricted to posterior embryonic fragments but not to pole cells. In "double-abdomen" embryos, a mirror-image duplication of the abdomen is formed by cells that would otherwise develop into head and thorax. Embryos were programmed for double-abdomen development by UV irradiation of the anterior pole, and half of them were reprogrammed for normal development by subsequent exposure to visible light (photoreversal). Correspondingly, PI1 was synthesized in anterior fragments of UV-irradiated embryos but not after photoreversal. In a control experiment, UV irradiation of the posterior pole caused neither double-abdomen formation nor PI1 synthesis in anterior fragments. The identity of PI1 formed in anterior fragments of prospective double abdomens with the protein found in posterior fragments was revealed by two-dimensional gel electrophoresis and limited proteolysis. Suppression of PI1 synthesis in anterior fragments of normal embryos is ascribed to the activity of cytoplasmic ribonucleoprotein particles thought to act as anterior determinants. Images PMID:6935679

Biomolecular computers with multiple restriction enzymes

PubMed Central

Sakowski, Sebastian; Krasinski, Tadeusz; Waldmajer, Jacek; Sarnik, Joanna; Blasiak, Janusz; Poplawski, Tomasz

2017-01-01

Abstract The development of conventional, silicon-based computers has several limitations, including some related to the Heisenberg uncertainty principle and the von Neumann “bottleneck”. Biomolecular computers based on DNA and proteins are largely free of these disadvantages and, along with quantum computers, are reasonable alternatives to their conventional counterparts in some applications. The idea of a DNA computer proposed by Ehud Shapiro’s group at the Weizmann Institute of Science was developed using one restriction enzyme as hardware and DNA fragments (the transition molecules) as software and input/output signals. This computer represented a two-state two-symbol finite automaton that was subsequently extended by using two restriction enzymes. In this paper, we propose the idea of a multistate biomolecular computer with multiple commercially available restriction enzymes as hardware. Additionally, an algorithmic method for the construction of transition molecules in the DNA computer based on the use of multiple restriction enzymes is presented. We use this method to construct multistate, biomolecular, nondeterministic finite automata with four commercially available restriction enzymes as hardware. We also describe an experimental applicaton of this theoretical model to a biomolecular finite automaton made of four endonucleases. PMID:29064510

Detection of the Single Nucleotide Polymorphism at Position rs2735940 in the Human Telomerase Reverse Transcriptase Gene by the Introduction of a New Restriction Enzyme Site for the PCR-RFLP Assay.

PubMed

Wang, Sihua; Ding, Mingcui; Duan, Xiaoran; Wang, Tuanwei; Feng, Xiaolei; Wang, Pengpeng; Yao, Wu; Wu, Yongjun; Yan, Zhen; Feng, Feifei; Yu, Songcheng; Wang, Wei

2017-09-01

It has been shown that the single nucleotide polymorphism (SNP) of the rs2735940 site in the human telomerase reverse transcriptase ( hTERT ) gene is associated with increased cancer risk. The traditional method to detect SNP genotypes is polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). However, there is a limitation to utilizing PCR-RFLP due to a lack of proper restriction enzyme sites at many polymorphic loci. This study used an improved PCR-RFLP method with a mismatched base for detection of the SNP rs2735940. A new restriction enzyme cutting site was created by created restriction site PCR (CRS-PCR), and in addition, the restriction enzyme Msp I for CRS-PCR was cheaper than other enzymes. We used this novel assay to determine the allele frequencies in 552 healthy Chinese Han individuals, and found the allele frequencies to be 63% for allele C and 37% for allele T In summary, the modified PCR-RFLP can be used to detect the SNP of rs2735940 with low cost and high efficiency. © 2017 by the Association of Clinical Scientists, Inc.

Porcine reproductive and respiratory disease virus: evolution and recombination yields distinct ORF5 RFLP 1-7-4 viruses with individual pathogenicity

USDA-ARS?s Scientific Manuscript database

Recent cases of porcine reproductive and respiratory syndrome virus (PRRSV) infection in United States swineherds have been associated with high mortality in piglets and severe morbidity in sows. Analysis of the ORF5 gene from such clinical cases revealed a unique restriction fragment polymorphism (...

Genetic characterization of commercial honey bee (Hymenoptera: Apidae) populations in the United States by using mitochondrial and microsatellite markers

Treesearch

D. A. Delaney; M.D. Meixner; N.M. Schiff; W.S. Sheppard

2009-01-01

Genetic diversity levels within and between the two commercial breeding areas in theUnited States were analyzed using the DraI restriction fragment length polymorphism of the COICOII mitochondrial region and 10 polymorphic microsatellite loci. The western commercial breeding population (WCBP) and the southeastern commercial...

Mycobacterium marinum Infections in Fish and Humans in Israel

PubMed Central

Ucko, M.; Colorni, A.

2005-01-01

Israeli Mycobacterium marinum isolates from humans and fish were compared by direct sequencing of the 16S rRNA and hsp65 genes, restriction mapping, and amplified fragment length polymorphism analysis. Significant molecular differences separated all clinical isolates from the piscine isolates, ruling out the local aquaculture industry as the source of human infections. PMID:15695698

Barriers, invasion, and conservation of native salmonids in coldwater streams [Box 18.2

Treesearch

Bruce Rieman; Michael Young; Kurt Fausch; Jason Dunham; Douglas Peterson

2010-01-01

Habitat loss and fragmentation are threats to persistence of many native fish populations. Invading nonnative species that may restrict or displace native species are also important. These two issues are particularly relevant for native salmonids that are often limited to remnant habitats in cold, headwater streams. On the surface, reversing threats to native fishes...

Effects of DNA Extraction Procedures on Bacteroides Profiles in Fecal Samples From Various Animals Determined by Terminal Restriction Fragment Length Polymorphism Analysis

EPA Science Inventory

A major assumption in microbial source tracking is that some fecal bacteria are specific to a host animal, and thus provide unique microbial fingerprints that can be used to differentiate hosts. However, the DNA information obtained from a particular sample may be biased dependi...

Principal Component Analysis of Microbial Community Data from an Accelerated Decay Cellar Test

Treesearch

Grant T. Kirker; Patricia K. Lebow

2014-01-01

Analysis of microbial communities is a valuable tool for characterization and identification of microbes in a myriad of environments. We are currently using the molecular method terminal restriction fragment length polymorphism (T-RFLP) analysis to characterize changes in bacterial and fungal communities on treated and untreated wood in soil. T-RFLP uses fluorescently...

Microbial community structure and abundance in the rhizosphere and bulk soil of a tomato cropping system that includes cover crops

USDA-ARS?s Scientific Manuscript database

In this report we use Terminal Restriction Fragment Length Polymorphisms (TRFLP) in a tomato production system to “finger printing” the soil microbial community structure with Phylum specific primer sets. Factors influencing the soil microbes are a cover crop of Hairy Vetch (Vicia villosa) or Rye (...

Microbial Community Analysis of Naturally Durable Wood in an Above Ground Field Test

Treesearch

G.T. Kirker; S.V. Diehl; P.K. Lebow

2014-01-01

This paper presents preliminary results of an above ground field test wherein eight naturally durable wood species were exposed concurrently at two sites in North America. Surface samples were taken at regular intervals from non-durable controls and compared to their more durable counterparts. Terminal Restriction Fragment Length Polymorphism was performed to...

Enzymatic synthesis of long double-stranded DNA labeled with haloderivatives of nucleobases in a precisely pre-determined sequence

PubMed Central

2011-01-01

Background Restriction endonucleases are widely applied in recombinant DNA technology. Among them, enzymes of class IIS, which cleave DNA beyond recognition sites, are especially useful. We use BsaI enzyme for the pinpoint introduction of halogen nucleobases into DNA. This has been done for the purpose of anticancer radio- and phototherapy that is our long-term objective. Results An enzymatic method for synthesizing long double-stranded DNA labeled with the halogen derivatives of nucleobases (Hal-NBs) with 1-bp accuracy has been put forward and successfully tested on three different DNA fragments containing the 5-bromouracil (5-BrU) residue. The protocol assumes enzymatic cleavage of two Polymerase-Chain-Reaction (PCR) fragments containing two recognition sequences for the same or different class IIS restriction endonucleases, where each PCR fragment has a partially complementary cleavage site. These sites are introduced using synthetic DNA primers or are naturally present in the sequence used. The cleavage sites are not compatible, and therefore not susceptible to ligation until they are partially filled with a Hal-NB or original nucleobase, resulting in complementary cohesive end formation. Ligation of these fragments ultimately leads to the required Hal-NB-labeled DNA duplex. With this approach, a synthetic, extremely long DNA fragment can be obtained by means of a multiple assembly reaction (n × maximum PCR product length: n × app. 50 kb). Conclusions The long, precisely labeled DNA duplexes obtained behave in very much the same manner as natural DNA and are beyond the range of chemical synthesis. Moreover, the conditions of synthesis closely resemble the natural ones, and all the artifacts accompanying the chemical synthesis of DNA are thus eliminated. The approach proposed seems to be completely general and could be used to label DNA at multiple pre-determined sites and with halogen derivatives of any nucleobase. Access to DNAs labeled with Hal-NBs at specific position is an indispensable condition for the understanding and optimization of DNA photo- and radio-degradation, which are prerequisites for clinical trials of Hal-NBs in anticancer therapy. PMID:21864341

Enzymatic synthesis of long double-stranded DNA labeled with haloderivatives of nucleobases in a precisely pre-determined sequence.

PubMed

Sobolewski, Ireneusz; Polska, Katarzyna; Zylicz-Stachula, Agnieszka; Jeżewska-Frąckowiak, Joanna; Rak, Janusz; Skowron, Piotr

2011-08-24

Restriction endonucleases are widely applied in recombinant DNA technology. Among them, enzymes of class IIS, which cleave DNA beyond recognition sites, are especially useful. We use BsaI enzyme for the pinpoint introduction of halogen nucleobases into DNA. This has been done for the purpose of anticancer radio- and phototherapy that is our long-term objective. An enzymatic method for synthesizing long double-stranded DNA labeled with the halogen derivatives of nucleobases (Hal-NBs) with 1-bp accuracy has been put forward and successfully tested on three different DNA fragments containing the 5-bromouracil (5-BrU) residue. The protocol assumes enzymatic cleavage of two Polymerase-Chain-Reaction (PCR) fragments containing two recognition sequences for the same or different class IIS restriction endonucleases, where each PCR fragment has a partially complementary cleavage site. These sites are introduced using synthetic DNA primers or are naturally present in the sequence used. The cleavage sites are not compatible, and therefore not susceptible to ligation until they are partially filled with a Hal-NB or original nucleobase, resulting in complementary cohesive end formation. Ligation of these fragments ultimately leads to the required Hal-NB-labeled DNA duplex. With this approach, a synthetic, extremely long DNA fragment can be obtained by means of a multiple assembly reaction (n × maximum PCR product length: n × app. 50 kb). The long, precisely labeled DNA duplexes obtained behave in very much the same manner as natural DNA and are beyond the range of chemical synthesis. Moreover, the conditions of synthesis closely resemble the natural ones, and all the artifacts accompanying the chemical synthesis of DNA are thus eliminated. The approach proposed seems to be completely general and could be used to label DNA at multiple pre-determined sites and with halogen derivatives of any nucleobase. Access to DNAs labeled with Hal-NBs at specific position is an indispensable condition for the understanding and optimization of DNA photo- and radio-degradation, which are prerequisites for clinical trials of Hal-NBs in anticancer therapy.

T-cell-restricted intracellular antigen 1 facilitates mitochondrial fragmentation by enhancing the expression of mitochondrial fission factor

PubMed Central

Tak, Hyosun; Eun, Jung Woo; Kim, Jihye; Park, So Jung; Kim, Chongtae; Ji, Eunbyul; Lee, Heejin; Kang, Hoin; Cho, Dong-Hyung; Lee, Kyungbun; Kim, Wook; Nam, Suk Woo; Lee, Eun Kyung

2017-01-01

Mitochondrial morphology is dynamically regulated by the formation of small fragmented units or interconnected mitochondrial networks, and this dynamic morphological change is a pivotal process in normal mitochondrial function. In the present study, we identified a novel regulator responsible for the regulation of mitochondrial dynamics. An assay using CHANG liver cells stably expressing mitochondrial-targeted yellow fluorescent protein (mtYFP) and a group of siRNAs revealed that T-cell intracellular antigen protein-1 (TIA-1) affects mitochondrial morphology by enhancing mitochondrial fission. The function of TIA-1 in mitochondrial dynamics was investigated through various biological approaches and expression analysis in human specimen. Downregulation of TIA-1-enhanced mitochondrial elongation, whereas ectopic expression of TIA-1 resulted in mitochondria fragmentation. In addition, TIA-1 increased mitochondrial activity, including the rate of ATP synthesis and oxygen consumption. Further, we identified mitochondrial fission factor (MFF) as a direct target of TIA-1, and showed that TIA-1 promotes mitochondrial fragmentation by enhancing MFF translation. TIA-1 null cells had a decreased level of MFF and less mitochondrial Drp1, a critical factor for mitochondrial fragmentation, thereby enhancing mitochondrial elongation. Taken together, our results indicate that TIA-1 is a novel factor that facilitates mitochondrial dynamics by enhancing MFF expression and contributes to mitochondrial dysfunction. PMID:27612012

Isoschizomers and amplified fragment length polymorphism for the detection of specific cytosine methylation changes.

PubMed

Ruiz-García, Leonor; Cabezas, Jose Antonio; de María, Nuria; Cervera, María-Teresa

2010-01-01

Different molecular techniques have been developed to study either the global level of methylated cytosines or methylation at specific gene sequences. One of them is a modification of the Amplified Fragment Length Polymorphism (AFLP) technique that has been used to study methylation of anonymous CCGG sequences in different fungi, plant and animal species. The main variation of this technique is based on the use of isoschizomers with different methylation sensitivity (such as HpaII and MspI) as a frequent cutter restriction enzyme. For each sample, AFLP analysis is performed using both EcoRI/HpaII and EcoRI/MspI digested samples. Comparative analysis between EcoRI/HpaII and EcoRI/MspI fragment patterns allows the identification of two types of polymorphisms: (1) "Methylation-insensitive polymorphisms" that show common EcoRI/HpaII and EcoRI/MspI patterns but are detected as polymorphic amplified fragments among samples; and (2) "Methylation-sensitive polymorphisms" that are associated with amplified fragments differing in their presence or absence or in their intensity between EcoRI/HpaII and EcoRI/MspI patterns. This chapter describes a detailed protocol of this technique and discusses modifications that can be applied to adjust the technology to different species of interest.

Consequences of extensive habitat fragmentation in landscape-level patterns of genetic diversity and structure in the Mediterranean esparto grasshopper

PubMed Central

Ortego, Joaquín; Aguirre, María P; Noguerales, Víctor; Cordero, Pedro J

2015-01-01

Anthropogenic habitat fragmentation has altered the distribution and population sizes in many organisms worldwide. For this reason, understanding the demographic and genetic consequences of this process is necessary to predict the fate of populations and establish management practices aimed to ensure their viability. In this study, we analyse whether the spatial configuration of remnant semi-natural habitat patches within a chronically fragmented landscape has shaped the patterns of genetic diversity and structure in the habitat-specialist esparto grasshopper (Ramburiella hispanica). In particular, we predict that agricultural lands constitute barriers to gene flow and hypothesize that fragmentation has restricted interpopulation dispersal and reduced local levels of genetic diversity. Our results confirmed the expectation that isolation and habitat fragmentation have reduced the genetic diversity of local populations. Landscape genetic analyses based on circuit theory showed that agricultural land offers ∽1000 times more resistance to gene flow than semi-natural habitats, indicating that patterns of dispersal are constrained by the spatial configuration of remnant patches of suitable habitat. Overall, this study shows that semi-natural habitat patches act as corridors for interpopulation gene flow and should be preserved due to the disproportionately large ecological function that they provide considering their insignificant area within these human-modified landscapes. PMID:26136826

Is Malassezia nana the main species in horses' ear canal microbiome?

PubMed

Aldrovandi, Ana Lúcia; Osugui, Lika; Acqua Coutinho, Selene Dall'

2016-01-01

The objective of this study was to characterize genotypically Malassezia spp. isolated from the external ear canal of healthy horses. Fifty-five horses, 39 (70.9%) males and 16 (29.1%) females, from different breeds and adults were studied. External ear canals were cleaned and a sterile cotton swab was introduced to collect cerumen. A total of 110 samples were cultured into Dixon medium and were incubated at 32°C for up to 15 days. Macro- and micromorphology and phenotypic identification were performed. DNA was extracted, strains were submitted to polymerase chain reaction technique, and the products obtained were submitted to Restriction Fragment Length Polymorphism using the restriction enzymes BstCI and HhaI. Strains were sent off to genetic sequencing of the regions 26S rDNA D1/D2 and ITS1-5.8S-ITS2 rDNA. Malassezia spp. were isolated from 33/55 (60%) animals and 52/110 (47%) ear canals. No growth on Sabouraud dextrose agar was observed, confirming the lipid dependence of all strains. Polymerase chain reaction-Restriction fragment length polymorphism permitted the molecular identification of Malassezia nana - 42/52 (81%) and Malassezia slooffiae - 10/52 (19%). Sequencing confirmed RFLP identification. It was surprising that M. nana represented over 80% of the strains and no Malassezia equina was isolated in this study, differing from what was expected. Copyright © 2016 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

Biodiversity and ITS-RFLP Characterisation of Aspergillus Section Nigri Isolates in Grapes from Four Traditional Grape-Producing Areas in Greece

PubMed Central

Kizis, Dimosthenis; Natskoulis, Pantelis; Nychas, George-John E.; Panagou, Efstathios Z.

2014-01-01

A study on the occurrence of Aspergillus section Nigri species on grapes from four traditional grape-producing areas in Greece during the 2011/2012 vintage, and their capability to produce OTA was conducted. One hundred and twenty-eight black aspergilli isolates were characterised at the species level initially by the use of morphological criteria in accordance with appropriate keys, followed by molecular characterisation performed with Polymerase Chain Reaction–Restriction Fragment Length Polymorphism (PCR-RFLP) of the 5.8 ribosomal RNA gene Internal Transcribed Spacer region (5.8 rRNA ITS). Restriction enzyme digestion of the ITS amplicons using the HhaI, HinfI and RsaI, endonucleases distinguished eleven different patterns of restriction fragment length polymorphism (RFLP), four for each of the HhaI and RsaI digests and three for HinfI. From a total number of 128 individual isolates, 124 were classified into four Aspergillus species corresponding to A. carbonarius, A. tubingensis, A. japonicus and A. ibericus, and the remaining 4 were classified as members of the A. niger aggregate. A. carbonarius and A. tubingensis being the main representative species were equally counted, with higher geographical representation of the former in southern and the latter in northern regions, respectively. All isolates were tested for their ochratoxigenic potential by use of High Performance Liquid Chromatography (HPLC) and Enzyme Linked Immuno Sorbent Assay (ELISA), resulting in significant interspecies differences in OTA production. PMID:24710283

Association between alleles of the transforming growth factor alpha locus and cleft lip and palate in the Chilean population

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jara, L.; Blanco, R.; Chiffelle, I.

1995-07-17

Two RFLPs at the TGFA locus were studied in 39 unrelated Chilean (Caucasoid-Mongoloid) patients with non-syndromic cleft lip/palate [CL(P)] and 51 control individuals. A highly significant association between BamHI A2 allele and CL(P) was detected ({chi}{sub 2} = 6.00; P = 0.014), while no association was found between TaqI RFLPs and clefting. No significant differences were found when comparing genotypes by type of cleft and a positive or negative family history of clefting. Our results seem to support rather definitively the association between TGFA and clefting but not support the hypothesis that TGFA is a major causal gene of CL(P).more » 29 refs., 5 tabs.« less

Spatio-temporal Genetic Structure of a Tropical Bee Species Suggests High Dispersal Over a Fragmented Landscape.

PubMed

Suni, Sevan S; Bronstein, Judith L; Brosi, Berry J

2014-03-01

Habitat destruction threatens biodiversity by reducing the amount of available resources and connectivity among geographic areas. For organisms living in fragmented habitats, population persistence may depend on dispersal, which maintains gene flow among fragments and can prevent inbreeding within them. It is centrally important to understand patterns of dispersal for bees living in fragmented areas given the importance of pollination systems and recently documented declines in bee populations. We used population and landscape genetic techniques to characterize patterns of dispersal over a large fragmented area in southern Costa Rica for the orchid bee species Euglossa championi . First, we estimated levels of genetic differentiation among forest fragments as φ pt , an analog to the traditional summary statistic F st , as well as two statistics that may more adequately represent levels of differentiation, G ' st and D est . Second, we used a Bayesian approach to determine the number and composition of genetic groups in our sample. Third we investigated how genetic differentiation changes with distance. Fourth, we determined the extent to which deforested areas restrict dispersal. Finally, we estimated the extent to which there were temporal differences in allele frequencies within the same forest fragments. Within years we found low levels of differentiation even over 80 km, and no effect of land use type on level of genetic differentiation. However, we found significant genetic differentiation between years. Taken together our results suggest that there are high levels of gene flow over this geographic area, and that individuals show low site fidelity over time.

Salt weathering on Mars

NASA Astrophysics Data System (ADS)

Jagoutz, E.

Large well rounded boulders and angular rock fragments characterizes the Martian landscape as seen on the recent excellent quality photos. Analyzing the different rock-shapes indicates a time sequence of emplacement, fragmentation and transport of different rocks on Mars, which might give interesting insight into transport and weathering processes. Larger commonly well rounded boulders were emplaced onto gravel plains. After emplacement, these rocks were fragmented and disassembled. Nests of angular rock fragments are marking the locations of preexisting larger rocks. Frequently it is possible to reconstruct larger rounded rocks from smaller angular fragments. In other cases transport after fragmentation obscured the relationship of the fragments. However, a strewn field of fragments is still reminiscent of the preexisting rock. Mechanical salt weathering could be a plausible explanation for the insitu fragmentation of larger rounded blocks into angular fragments. Impact or secondary air fall induced fragmentation produces very different patterns, as observed around impact crates on Earth. Salt weathering of rocks is a common process in terrestrial environments. Salt crystallization in capillaries causes fragmentation of rocks, irrespective of the process of salt transportation and concentration. On Earth significant salt weathering can be observed in different climatic environments: in the transition zone of alluvial aprons and salt playas in desserts and in dry valleys of Antarctica. In terrestrial semi-arid areas the salt is transported by salt solution, which is progressively concentrated by evaporation. In Antarctic dry valleys freeze-thaw cycles causes salt transportation and crystallization resulting in rock fragmentation. This salt induced process can lead to complete destruction of rocks and converts rocks to fine sand. The efficient breakdown of rocks is dominating the landscape in some dry valleys of the Earth but possibly also on Mars. (Malin, 1974). However, irrespectively of the climatic environment a liquid brine is a necessity for salt induced fragmentation of rocks. If salt weathering is responsible for the fragmented rocks on the Martian surface it implies a temporary present of liquid H_2O. However, due to the present dry atmosphere on Mars brines can only be present in restricted places without being in equilibrium with the atmosphere (Clark and van Hart 1980). M. C. Malin (1974) JGR Vol 79,26 p 3888-3894 B. C. Clark and D. C. vanHart (1980) ICARUS 45, 370-378

Mitochondrial DNA diagnosis for taeniasis and cysticercosis.

PubMed

Yamasaki, Hiroshi; Nakao, Minoru; Sako, Yasuhito; Nakaya, Kazuhiro; Sato, Marcello Otake; Ito, Akira

2006-01-01

Molecular diagnosis for taeniasis and cysticercosis in humans on the basis of mitochondrial DNA analysis was reviewed. Development and application of three different methods, including restriction fragment length polymorphism analysis, base excision sequence scanning thymine-base analysis and multiplex PCR, were described. Moreover, molecular diagnosis of cysticerci found in specimens submitted for histopathology and the molecular detection of taeniasis using copro-DNA were discussed.

North American montane red foxes: expansion, fragmentation, and the origin of the Sacramento Valley red fox

Treesearch

Benjamin N. Sacks; Mark J. Statham; John D. Perrine; Samantha M. Wisely; Keith B. Aubry

2010-01-01

Most native red foxes (Vulpes vulpes) in the western contiguous United States appear to be climatically restricted to colder regions in the major mountain ranges and, in some areas, have suffered precipitous declines in abundance that may be linked to warming trends. However, another population of unknown origin has occurred in arid habitats in the...

COMPARISON OF LARGE RESTRICTION FRAGMENTS OF MYCOBACTERIUM AVIUM ISOLATES RECOVERED FROM AIDS AND NON-AIDS PATIENTS WITH THOSE OF ISOLATES FROM POTABLE WATER

EPA Science Inventory

We examined potable water in Los Angeles, California, as a possible source of infection in AIDS and non-AIDS patients. Nontuberculous mycobacteria were recovered from 12 (92%) of 13 reservoirs, 45 (82%) of 55 homes, 31 (100%) of 31 commercial buildings, and 15 (100%) of 15 hospit...

COMPARISON OF LARGE RESTRICTION FRAGMENTS OF MYCOBACATERIUM AVIUM ISOLATES RECOVERED FROM AIDS AND NON-AIDS PATIENTS WITH THOSE OF ISOLATES FROM POTABLE WATER

EPA Science Inventory

We examined potable water in Los Angeles, California, as a possible source of infection in AIDS and non-AIDS patients. Nontuberculous mycobacteria were recovered from 12 (92%) of 13 reservoirs, 45 (82%) of 55 homes, 31 (100%) of 31 commercial buildings, and 15 (100%) of 15 hospi...

Culture, Polymerase Chain Reaction and Restriction Fragment Length Polymorphism Studies in Bartonella bacilliformis

DTIC Science & Technology

1998-09-22

within the BA lesions ofHIV-infected patients that appeared similar to the CSD bacillus. ReIman et aI. provided the first infotmation on the genus of the...1993. 31(7): 1730-1734. 21. ReIman DA. Bacillary angiomatosis and Rochalimaea species. Curro CUn. Top. Infect. Dis. pp. 205-219. MElliODS and MATERIALS

Double-Row Suture Anchor Repair of Posterolateral Corner Avulsion Fractures.

PubMed

Gilmer, Brian B

2017-08-01

Posterolateral corner avulsion fractures are a rare variant of ligamentous knee injury primarily described in the skeletally immature population. Injury is often related to a direct varus moment placed on the knee during sporting activities. Various treatment strategies have been discussed ranging from nonoperative management, to excision of the bony fragment, to primary repair with screws or suture. The described technique is a means for achieving fixation of the bony avulsion using principles familiar to double-row transosseous equivalent rotator cuff repair. Proximal anchors are placed in the epiphysis, and sutures are passed in horizontal mattress fashion. Once tied, the limbs of these same sutures are then passed to more distal anchors. Remaining eyelet sutures can be used to manage peripheral tissue. The final repair provides anatomic reduction and compression of the fragment to its bony bed with minimal extracortical hardware prominence and no violation of the physis. Risks include potential for physeal injury or chondral damage to the lateral femoral condyle through aberrant anchor placement. Postoperative care includes toe-touch weight-bearing restrictions and range of motion restrictions of 0°-90° in a hinged brace for 6 weeks followed by gradual return to activity.

Norrie disease: linkage analysis using a 4.2-kb RFLP detected by a human ornithine aminotransferase cDNA probe.

PubMed

Ngo, J T; Bateman, J B; Cortessis, V; Sparkes, R S; Mohandas, T; Inana, G; Spence, M A

1989-05-01

Previous study has shown that the usual DNA marker for Norrie disease, the L1.28 probe which identifies the DXS7 locus, can recombine with the disease locus. In this study, we used a human ornithine aminotransferase (OAT) cDNA which detects OAT-related DNA sequences mapped to the same region on the X chromosome as that of the L1.28 probe to investigate the family with Norrie disease who exhibited the recombinational event. When genomic DNA from this family was digested with the PvuII restriction endonuclease, we found a restriction fragment length polymorphism (RFLP) of 4.2 kb in size. This fragment was absent in the affected males and cosegregated with the disease locus; we calculated a lod score of 0.602, at theta = 0.00. No deletion could be detected by chromosomal analysis or on Southern blots with other enzymes. These results suggest that one of the OAT-related sequences on the X chromosome may be in close proximity to the Norrie disease locus and represent the first report which indicates that the OAT cDNA may be useful for the identification of carrier status and/or prenatal diagnosis.

[Microbial diversity of sediments from the coasts of Dalian Changshan Islands].

PubMed

Li, Jialin; Wang, Zhonghua; Qin, Song; Wang, Guangyi

2011-05-01

To understand the impacts of anthropogenic activities on structure and composition of bacterial communities and to evaluate how bacterial communities respond to environmental gradients at coastal sediments. The diversity of bacterial communities in sediments from tourist and mariculture zones at coastal area of Dalian Changshan Islands was assessed using terminal restriction fragment length polymorphism (t-RFLP) and denaturing gradient gel electrophoresis (DGGE) approaches. Meanwhile, 16S rRNA clone library was constructed to reveal the composition and structure of bacterial communities in the most seriously polluted site (D4). There were much higher values of richness, Shannon-wiener and evenness index at D4 site by the analysis of terminal restriction fragments (t-RFs). The clustering result on the t-RFs areas and DGGE patterns showed that the bacterial diversity of tourist zone were more similar, while the distinction was increased with pollution levels among the tourist and mariculture zones. The 16S rRNA clone of D4 revealed that the Proteobacteria were the dominant phylum, and gamma-proteobacteria was the main class within Proteobacteria. The study documented changes in bacterial community structure by human impacts of mariculture than geographical location.

Pros and Cons of Ion-Torrent Next Generation Sequencing versus Terminal Restriction Fragment Length Polymorphism T-RFLP for Studying the Rumen Bacterial Community

PubMed Central

de la Fuente, Gabriel; Belanche, Alejandro; Girwood, Susan E.; Pinloche, Eric; Wilkinson, Toby; Newbold, C. Jamie

2014-01-01

The development of next generation sequencing has challenged the use of other molecular fingerprinting methods used to study microbial diversity. We analysed the bacterial diversity in the rumen of defaunated sheep following the introduction of different protozoal populations, using both next generation sequencing (NGS: Ion Torrent PGM) and terminal restriction fragment length polymorphism (T-RFLP). Although absolute number differed, there was a high correlation between NGS and T-RFLP in terms of richness and diversity with R values of 0.836 and 0.781 for richness and Shannon-Wiener index, respectively. Dendrograms for both datasets were also highly correlated (Mantel test = 0.742). Eighteen OTUs and ten genera were significantly impacted by the addition of rumen protozoa, with an increase in the relative abundance of Prevotella, Bacteroides and Ruminobacter, related to an increase in free ammonia levels in the rumen. Our findings suggest that classic fingerprinting methods are still valuable tools to study microbial diversity and structure in complex environments but that NGS techniques now provide cost effect alternatives that provide a far greater level of information on the individual members of the microbial population. PMID:25051490

Genetic identification of the main opportunistic Mucorales by PCR-restriction fragment length polymorphism.

PubMed

Machouart, M; Larché, J; Burton, K; Collomb, J; Maurer, P; Cintrat, A; Biava, M F; Greciano, S; Kuijpers, A F A; Contet-Audonneau, N; de Hoog, G S; Gérard, A; Fortier, B

2006-03-01

Mucormycosis is a rare and opportunistic infection caused by fungi belonging to the order Mucorales. Recent reports have demonstrated an increasing incidence of mucormycosis, which is frequently lethal, especially in patients suffering from severe underlying conditions such as immunodeficiency. In addition, even though conventional mycology and histopathology assays allow for the identification of Mucorales, they often fail in offering a species-specific diagnosis. Due to the lack of other laboratory tests, a precise identification of these molds is thus notoriously difficult. In this study we aimed to develop a molecular biology tool to identify the main Mucorales involved in human pathology. A PCR strategy selectively amplifies genomic DNA from molds belonging to the genera Absidia, Mucor, Rhizopus, and Rhizomucor, excluding human DNA and DNA from other filamentous fungi and yeasts. A subsequent digestion step identified the Mucorales at genus and species level. This technique was validated using both fungal cultures and retrospective analyses of clinical samples. By enabling a rapid and precise identification of Mucorales strains in infected patients, this PCR-restriction fragment length polymorphism-based method should help clinicians to decide on the appropriate treatment, consequently decreasing the mortality of mucormycosis.

Genetic Identification of the Main Opportunistic Mucorales by PCR-Restriction Fragment Length Polymorphism

PubMed Central

Machouart, M.; Larché, J.; Burton, K.; Collomb, J.; Maurer, P.; Cintrat, A.; Biava, M. F.; Greciano, S.; Kuijpers, A. F. A.; Contet-Audonneau, N.; de Hoog, G. S.; Gérard, A.; Fortier, B.

2006-01-01

Mucormycosis is a rare and opportunistic infection caused by fungi belonging to the order Mucorales. Recent reports have demonstrated an increasing incidence of mucormycosis, which is frequently lethal, especially in patients suffering from severe underlying conditions such as immunodeficiency. In addition, even though conventional mycology and histopathology assays allow for the identification of Mucorales, they often fail in offering a species-specific diagnosis. Due to the lack of other laboratory tests, a precise identification of these molds is thus notoriously difficult. In this study we aimed to develop a molecular biology tool to identify the main Mucorales involved in human pathology. A PCR strategy selectively amplifies genomic DNA from molds belonging to the genera Absidia, Mucor, Rhizopus, and Rhizomucor, excluding human DNA and DNA from other filamentous fungi and yeasts. A subsequent digestion step identified the Mucorales at genus and species level. This technique was validated using both fungal cultures and retrospective analyses of clinical samples. By enabling a rapid and precise identification of Mucorales strains in infected patients, this PCR-restriction fragment length polymorphism-based method should help clinicians to decide on the appropriate treatment, consequently decreasing the mortality of mucormycosis. PMID:16517858

Development and evaluation of a species diagnostic polymerase chain reaction-restriction fragment-length polymorphism procedure for cryptic members of the Culex sitiens (Diptera: Culicidae) subgroup in Australia and the southwest Pacific.

PubMed

Beebe, N W; van den Hurk, A F; Chapman, H F; Frances, S P; Williams, C R; Cooper, R D

2002-03-01

Members of the Culex sitiens subgroup are important vectors of arboviruses, including Japanese encephalitis virus, Murray Valley encephalitis virus and Ross River virus. Of the eight described species, Cx. annulirostris Skuse, Cx. sitiens Wiedemann, and Cx. palpalis Taylor appear to be the most abundant and widespread throughout northern Australia and Papua New Guinea (PNG). Recent investigations using allozymes have shown this subgroup to contain cryptic species that possess overlapping adult morphology. We report the development of a polymerase chain reaction-restriction fragment-length polymorphism (PCR-RFLP) procedure that reliably separates these three species. This procedure utilizes the sequence variation in the ribosomal DNA ITS1 and demonstrates species-specific PCR-RFLP profiles from both colony and field collected material. Assessment of the consistency of this procedure was undertaken on mosquitoes sampled from a wide geographic area including Australia, PNG, and the Solomon Islands. Overlapping adult morphology was observed for Cx. annulirostris and Cx. palpalis in both northern Queensland and PNG and for all three species at one site in northwest Queensland.

Molecular and immunogenetic analysis of major histocompatibility haplotypes in Northern Bobwhite enable direct identification of corresponding haplotypes in an endangered subspecies, the Masked Bobwhite

USGS Publications Warehouse

Drake, B.M.; Goto, R.M.; Miller, M.M.; Gee, G.F.; Briles, W.E.

1999-01-01

The major histocompatibility complex (MHC) is a group of genetic loci coding for haplotypes that have been associated with fitness traits in mammals and birds. Such associations suggest that MHC diversity may be an indicator of overall genetic fitness of endangered or threatened species. The MHC haplotypes of a captive population of 12 families of northern bobwhites (Colinus virginianus) were identified using a combination of immunogenetic and molecular techniques. Alloantisera were produced within families of northern bobwhites and were then tested for differential agglutination of erythrocytes of all members of each family. The pattern of reactions determined from testing these alloantisera identified a single genetic system of alloantigens in the northern bobwhites, resulting in the assignment of a tentative genotype to each individual within the quail families. Restriction fragment patterns of the DNA of each bird were determined using the chicken MHC B-G cDNA probe bg11. The concordance between the restriction fragment patterns and the alloantisera reactions showed that the alloantisera had identified the MHC of the northern bobwhite and supported the tentative genotype assignments, identifying at least 12 northern bobwhite MHC haplotypes.

Bacterial community composition characterization of a lead-contaminated Microcoleus sp. consortium.

PubMed

Giloteaux, Ludovic; Solé, Antoni; Esteve, Isabel; Duran, Robert

2011-08-01

A Microcoleus sp. consortium, obtained from the Ebro delta microbial mat, was maintained under different conditions including uncontaminated, lead-contaminated, and acidic conditions. Terminal restriction fragment length polymorphism and 16S rRNA gene library analyses were performed in order to determine the effect of lead and culture conditions on the Microcoleus sp. consortium. The bacterial composition inside the consortium revealed low diversity and the presence of specific terminal-restriction fragments under lead conditions. 16S rRNA gene library analyses showed that members of the consortium were affiliated to the Alpha, Beta, and Gammaproteobacteria and Cyanobacteria. Sequences closely related to Achromobacter spp., Alcaligenes faecalis, and Thiobacillus species were exclusively found under lead conditions while sequences related to Geitlerinema sp., a cyanobacterium belonging to the Oscillatoriales, were not found in presence of lead. This result showed a strong lead selection of the bacterial members present in the Microcoleus sp. consortium. Several of the 16S rRNA sequences were affiliated to nitrogen-fixing microorganisms including members of the Rhizobiaceae and the Sphingomonadaceae. Additionally, confocal laser scanning microscopy and scanning and transmission electron microscopy showed that under lead-contaminated condition Microcoleus sp. cells were grouped and the number of electrodense intracytoplasmic inclusions was increased.

Influence of negative affect on decision making in women with restrictive and binge-purge type anorexia nervosa.

PubMed

Danner, Unna N; Sternheim, Lot; Bijsterbosch, Jojanneke M; Dingemans, Alexandra E; Evers, Catharine; van Elburg, Annemarie A

2016-05-30

The present study aims to examine the influence of negative affect on decision making in women with anorexia nervosa (AN) compared to healthy control women and, secondly, to assess differences between the restrictive (ANR) and binge-purge (ANBP) subtypes. One hundred four women (32 with ANR, 32 with ANBP, and 40 healthy controls) participated. All women were asked to watch either a negative or a control film fragment, both followed by the Bechara Gambling Task (BGT). Before and after the fragments negative affect was measured. Additionally, relevant characteristics (e.g., overall depressive symptoms) were assessed. Differences in negative affect did not influence decision making performance. Independent of affective state, decision making was found to be impaired in women with ANBP (no learning effect on the BGT), but not in women with ANR. These findings highlight the importance of considering different AN subtypes when examining decision making processes. However, the role of negative affect on decision making remains uncertain. Since other affect related factors such as affect dysregulation may also play a role, future studies on decision making in AN should take the role of affect into account. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Heterologous mitochondrial DNA recombination in human cells.

PubMed

D'Aurelio, Marilena; Gajewski, Carl D; Lin, Michael T; Mauck, William M; Shao, Leon Z; Lenaz, Giorgio; Moraes, Carlos T; Manfredi, Giovanni

2004-12-15

Inter-molecular heterologous mitochondrial DNA (mtDNA) recombination is known to occur in yeast and plants. Nevertheless, its occurrence in human cells is still controversial. To address this issue we have fused two human cytoplasmic hybrid cell lines, each containing a distinct pathogenic mtDNA mutation and specific sets of genetic markers. In this hybrid model, we found direct evidence of recombination between these two mtDNA haplotypes. Recombinant mtDNA molecules in the hybrid cells were identified using three independent experimental approaches. First, recombinant molecules containing genetic markers from both parental alleles were demonstrated with restriction fragment length polymorphism of polymerase chain reaction products, by measuring the relative frequencies of each marker. Second, fragments of recombinant mtDNA were cloned and sequenced to identify the regions involved in the recombination events. Finally, recombinant molecules were demonstrated directly by Southern blot using appropriate combinations of polymorphic restriction sites and probes. This combined approach confirmed the existence of heterogeneous species of recombinant mtDNA molecules in the hybrid cells. These findings have important implications for mtDNA-related diseases, the interpretation of human evolution and population genetics and forensic analyses based on mtDNA genotyping.

Modular structural elements in the replication origin region of Tetrahymena rDNA.

PubMed Central

Du, C; Sanzgiri, R P; Shaiu, W L; Choi, J K; Hou, Z; Benbow, R M; Dobbs, D L

1995-01-01

Computer analyses of the DNA replication origin region in the amplified rRNA genes of Tetrahymena thermophila identified a potential initiation zone in the 5'NTS [Dobbs, Shaiu and Benbow (1994), Nucleic Acids Res. 22, 2479-2489]. This region consists of a putative DNA unwinding element (DUE) aligned with predicted bent DNA segments, nuclear matrix or scaffold associated region (MAR/SAR) consensus sequences, and other common modular sequence elements previously shown to be clustered in eukaryotic chromosomal origin regions. In this study, two mung bean nuclease-hypersensitive sites in super-coiled plasmid DNA were localized within the major DUE-like element predicted by thermodynamic analyses. Three restriction fragments of the 5'NTS region predicted to contain bent DNA segments exhibited anomalous migration characteristic of bent DNA during electrophoresis on polyacrylamide gels. Restriction fragments containing the 5'NTS region bound Tetrahymena nuclear matrices in an in vitro binding assay, consistent with an association of the replication origin region with the nuclear matrix in vivo. The direct demonstration in a protozoan origin region of elements previously identified in Drosophila, chick and mammalian origin regions suggests that clusters of modular structural elements may be a conserved feature of eukaryotic chromosomal origins of replication. Images PMID:7784181

[Intestinal fungal diversity of sub-adult giant panda].

PubMed

Ai, Shengquan; Zhong, Zhijun; Peng, Guangneng; Wang, Chengdong; Luo, Yongjiu; He, Tingmei; Gu, Wuyang; Li, Caiwu; Li, Gangshi; Wu, Honglin; Liu, Xuehan; Xia, Yu; Liu, Yanhong; Zhou, Xiaoxiao

2014-11-04

The fungi diversity in the guts of five sub-adult giant pandas was analyzed. We analyzed the fungal internal transcribed spacer sequences (ITS) using restriction fragment length polymorphism (RFLP). ITS regions were amplified with fungal universal primers to construct ITS clone libraries. The fingerprints were analyzed by restriction fragment length polymorphism using the Hha I and Hae III enzymes. The cloned PCR products were analyzed by sequencing and diversities were demonstrated by phylogenetic tree. The gut fungi of 5 sub-adult giant pandas were mainly composed of Ascomycota (average of 46.24%), Basidiomycota ( average of 15.79%), unclassified (average of 29.14%), uncultured fungus (average of 8.83% ). Ascomycota was mainly composed of Saccharomycetes (average of 63.74%) and Dothideomycetes ( average of 35.91%); Basidiomycota was mainly composed of Tremellomycetes (average of 65.80%) and Microbotryomycetes (average of 33.15%). Four classes were mainly composed of Candida and Debaryomyces; Pleosporales and Myriangium; Cystofilobasidium and Trichosporon; Leucosporidium, and Leucosporidiella, whereas the proportions were different for each sample. Fungal flora existing in the intestines of sub-adult giant pandas expand our knowledge on the structure of the giant panda gut microbes and also help us to further study whether fungal flora can help giant pandas digest high-fiber foods.

Inheritance of Restriction Fragment Length Polymorphisms in Agaricus Brunnescens

PubMed Central

Summerbell, R. C.; Castle, A. J.; Horgen, P. A.; Anderson, J. B.

1989-01-01

The cultivated mushroom, Agaricus brunnescens, is secondarily homothallic; most basidia produce only two basidiospores, each of which receives two of the four post meiotic nuclei. The segregation of restriction fragment length polymorphisms (RFLPs) detected by four plasmid probes carrying single-copy nuclear DNA of Agaricus was followed in seven parental strains including commercial, wild-collected, and artificially synthesized heterokaryons. Of a total of 367 single-spore progeny examined, 351 (95.6%) were heteroallelic at all RFLP loci heteroallelic in the respective parents. Of the 16 segregant isolates, ten (2.7% of the total) were homoallelic at all segregating loci assayed, suggesting that these isolates were most probably derived from rare spores that had received only a single postmeiotic nucleus. Some of these ten isolates had recombinant genotypes. Only five isolates (1.4% of the total) showed homoallelism at one of the loci heteroallelic in the parent, while remaining heteroallelic at other loci. These five genotypes suggest that a crossover had occurred between a marker locus and its respective centromere. Taken together, the results suggest that meiosis in A. brunnescens is accompanied by low levels of recombination and that nonsister nuclei are preferentially incorporated into basidiospores after meiosis II. PMID:2573557

Wood-inhabiting fungal communities in woody debris of Norway spruce (Picea abies (L.) Karst.), as reflected by sporocarps, mycelial isolations and T-RFLP identification.

PubMed

Allmér, Johan; Vasiliauskas, Rimvis; Ihrmark, Katarina; Stenlid, Jan; Dahlberg, Anders

2006-01-01

Wood-inhabiting fungi play a key role in forest ecosystems and constitute an essential part of forest biodiversity. We therefore examined the composition and abundance of wood-inhabiting fungi by three methods: sporocarp counts, mycelial culturing and direct amplification of internal transcribed spacer terminal restriction fragment length polymorphism from wood combined with sequencing of reference rDNA. Seven-year-old slash piles left after a thinning were analyzed in a 50-year-old Norway spruce plantation. Fifty-eight fungal species were detected from the piled branches and treetops. More species were revealed by sporocarp counts and cultured mycelia than by direct amplification from wood. In principle, sporocarp monitoring may reveal all fruiting taxa, but it poorly reflects their relative abundance in the wood. In contrast, terminal restriction fragment length polymorphism will record the most frequent fungal taxa in the wood, but it may overlook uncommon taxa. Culturing mycelia from wood gives a bias towards species favoured by the cultural medium. The results demonstrate the advantage and the limitations of these methods to be considered in analyses of fungal communities in wood.

Improved Method for the Establishment of an In Vitro Blood-Brain Barrier Model Based on Porcine Brain Endothelial Cells.

PubMed

Nielsen, Simone S E; Siupka, Piotr; Georgian, Ana; Preston, Jane E; Tóth, Andrea E; Yusof, Siti R; Abbott, N Joan; Nielsen, Morten S

2017-09-24

The aim of this protocol presents an optimized procedure for the purification and cultivation of pBECs and to establish in vitro blood-brain barrier (BBB) models based on pBECs in mono-culture (MC), MC with astrocyte-conditioned medium (ACM), and non-contact co-culture (NCC) with astrocytes of porcine or rat origin. pBECs were isolated and cultured from fragments of capillaries from the brain cortices of domestic pigs 5-6 months old. These fragments were purified by careful removal of meninges, isolation and homogenization of grey matter, filtration, enzymatic digestion, and centrifugation. To further eliminate contaminating cells, the capillary fragments were cultured with puromycin-containing medium. When 60-95% confluent, pBECs growing from the capillary fragments were passaged to permeable membrane filter inserts and established in the models. To increase barrier tightness and BBB characteristic phenotype of pBECs, the cells were treated with the following differentiation factors: membrane permeant 8-CPT-cAMP (here abbreviated cAMP), hydrocortisone, and a phosphodiesterase inhibitor, RO-20-1724 (RO). The procedure was carried out over a period of 9-11 days, and when establishing the NCC model, the astrocytes were cultured 2-8 weeks in advance. Adherence to the described procedures in the protocol has allowed the establishment of endothelial layers with highly restricted paracellular permeability, with the NCC model showing an average transendothelial electrical resistance (TEER) of 1249 ± 80 Ω cm 2 , and paracellular permeability (Papp) for Lucifer Yellow of 0.90 10 -6 ± 0.13 10 -6 cm sec -1 (mean ± SEM, n=55). Further evaluation of this pBEC phenotype showed good expression of the tight junctional proteins claudin 5, ZO-1, occludin and adherens junction protein p120 catenin. The model presented can be used for a range of studies of the BBB in health and disease and, with the highly restrictive paracellular permeability, this model is suitable for studies of transport and intracellular trafficking.

Cloning of the Pseudomonas aeruginosa outer membrane porin protein P gene: evidence for a linked region of DNA homology.

PubMed Central

Siehnel, R J; Worobec, E A; Hancock, R E

1988-01-01

The gene encoding the outer membrane phosphate-selective porin protein P from Pseudomonas aeruginosa was cloned into Escherichia coli. The protein product was expressed and transported to the outer membrane of an E. coli phoE mutant and assembled into functional trimers. Expression of a product of the correct molecular weight was confirmed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and Western blot (immunoblot) analysis, using polyclonal antibodies to protein P monomer and trimer forms. Protein P trimers were partially purified from the E. coli clone and shown to form channels with the same conductance as those formed by protein P from P. aeruginosa. The location and orientation of the protein P-encoding (oprP) gene on the cloned DNA was identified by three methods: (i) mapping the insertion point of transposon Tn501 in a previously isolated P. aeruginosa protein P-deficient mutant; (ii) hybridization of restriction fragments from the cloned DNA to an oligonucleotide pool synthesized on the basis of the amino-terminal protein sequence of protein P; and (iii) fusion of a PstI fragment of the cloned DNA to the amino terminus of the beta-galactosidase gene of pUC8, producing a fusion protein that contained protein P-antigenic epitopes. Structural analysis of the cloned DNA and P. aeruginosa chromosomal DNA revealed the presence of two adjacent PstI fragments which cross-hybridized, suggesting a possible gene duplication. The P-related (PR) region hybridized to the oligonucleotide pool described above. When the PstI fragment which contained the PR region was fused to the beta-galactosidase gene of pUC8, a fusion protein was produced which reacted with a protein P-specific antiserum. However, the restriction endonuclease patterns of the PR region and the oprP gene differed significantly beyond the amino-terminal one-third of the two genes. Images PMID:2834340

[Preliminary analysis of retinal gene expression profile of diabetic rat].

PubMed

Mei, Yan; Zhou, Hong-ying; Xiang, Tao; Lu, You-guang; Li, Ai-dong; Tang, En-jie; Yang, Hui-jun

2005-10-01

Establishing the retinal gene expression profiles of non-diabetic rat and diabetic rat and comparing the profiles in order to analyze the possible genes related with diabetic retinopathy. The whole retinal transcriptional fragments of non-diabetic rat and 8-week diabetic rat were obtained by restriction fragments differential display-PCR (RFDD-PCR). Bioinformatic analysis of retinal gene expression was performed using soft wares, including Fragment Analysis. After comparison of the expression profiles, the related gene fragments of diabetic retinopathy were initially selected as the target gene of further approach. A total of 3639 significant fragments were obtained. By means of more than 3-fold contrast of fluorescent intensity as the differential expression standard, the authors got 840 differential fragments, accounting for 23.08% of the expressed numbers and including 5 visual related genes, 13 excitatory neruotransmitter genes and 3 inhibitory neurotransmitter genes. At the 8th week, the expression of Rhodopsin kinase, beta-arrestin, Phosducinìrod photoreceptor cGMP-gated channel and Rpe65 as well as iGlu R1-4 were down-regulated. mGluRs and GABA-Rs were all up-regulated, whereas the expression of GlyR was unchanged. These results prompt again that the changes in retinal nervous layer of rat have occurred at an early stage of diabetes. The genes expression pattern of visual related genes and excitatory and inhibitory neurotransmitters in rat diabetic retina have been involved in neuro-dysfunctions of diabetic retina.

Bacterio-opsin mutants of Halobacterium halobium

PubMed Central

Betlach, Mary; Pfeifer, Felicitas; Friedman, James; Boyer, Herbert W.

1983-01-01

The bacterio-opsin (bop) gene of Halobacterium halobium R1 has been cloned with about 40 kilobases of flanking genomic sequence. The 40-kilobase segment is derived from the (G+C)-rich fraction of the chromosome and is not homologous to the major (pHH1) or minor endogenous covalently closed circular DNA species of H. halobium. A 5.1-kilobase Pst I fragment containing the bop gene was subcloned in pBR322 and a partial restriction map was determined. Defined restriction fragments of this clone were used as probes to analyze the defects associated with the bop gene in 12 bacterio-opsin mutants. Eleven out of 12 of the mutants examined had inserts ranging from 350 to 3,000 base pairs either in the bop gene or up to 1,400 base pairs upstream. The positions of the inserts were localized to four regions in the 5.1-kilobase genomic fragment: within the gene (one mutant), in a region that overlaps the 5′ end of the gene (seven mutants), and in two different upstream regions (three mutants). Two revertants of the mutant with the most distal insert had an additional insert in the same region. The polar effects of these inserts are discussed in terms of inactivation of a regulatory gene or disruption of part of a coordinately expressed operon. Given the defined nature of the bop mRNA—i.e., it has a 5′ leader sequence of three ribonucleotides—these observations indicate that the bop mRNA might be processed from a large mRNA transcript. Images PMID:16593291

Comparative analysis by polymerase chain reaction amplified minicircles of kinetoplast DNA of a stable strain of Trypanosoma cruzi from São Felipe, Bahia, its clones and subclones: possibility of predominance of a principal clone in this area.

PubMed

Campos, R F; Gonçalves, M S; dos Reis, E A; dos Reis, M G; Andrade, S G

1999-01-01

Molecular characterization of one stable strain of Trypanosoma cruzi, the 21 SF, representative of the pattern of strains isolated from the endemic area of São Felipe, State of Bahia, Brazil, maintained for 15 years in laboratory by serial passages in mice and classified as biodeme Type II and zymodeme 2 has been investigated. The kinetoplast DNA (kDNA) of parental strain, 5 clones and 14 subclones were analyzed. Schizodeme was established by comparative study of the fragments obtained from digestion of the 330-bp fragments amplified by polymerase chain reaction (PCR) from the variable regions of the minicircles, and digested by restriction endonucleases Rsa I and Hinf I. Our results show a high percentual of similarity between the restriction fragment length polymorphism (RFLP) for the parental strain and its clones and among these individual clones and their subclones at a level of 80 to 100%. This homology indicates a predominance of the same "principal clone" in the 21SF strain and confirms the homogeneity previously observed at biological and isozymic analysis. These results suggest the possibility that the T. cruzi strains with similar biological and isoenzymic patterns, circulating in this endemic area, are representative of one dominant clone. The presence of "principal clones" could be responsible for a predominant tropism of the parasites for specific organs and tissues and this could contribute to the pattern of clinico-pathological manifestations of Chagas's disease in one geographical area.

Partial nucleotide sequences, and routine typing by polymerase chain reaction-restriction fragment length polymorphism, of the brown trout (Salmo trutta) lactate dehydrogenase, LDH-C1*90 and *100 alleles.

PubMed

McMeel, O M; Hoey, E M; Ferguson, A

2001-01-01

The cDNA nucleotide sequences of the lactate dehydrogenase alleles LDH-C1*90 and *100 of brown trout (Salmo trutta) were found to differ at position 308 where an A is present in the *100 allele but a G is present in the *90 allele. This base substitution results in an amino acid change from aspartic acid at position 82 in the LDH-C1 100 allozyme to a glycine in the 90 allozyme. Since aspartic acid has a net negative charge whilst glycine is uncharged, this is consistent with the electrophoretic observation that the LDH-C1 100 allozyme has a more anodal mobility relative to the LDH-C1 90 allozyme. Based on alignment of the cDNA sequence with the mouse genomic sequence, a local primer set was designed, incorporating the variable position, and was found to give very good amplification with brown trout genomic DNA. Sequencing of this fragment confirmed the difference in both homozygous and heterozygous individuals. Digestion of the polymerase chain reaction products with BslI, a restriction enzyme specific for the site difference, gave one, two and three fragments for the two homozygotes and the heterozygote, respectively, following electrophoretic separation. This provides a DNA-based means of routine screening of the highly informative LDH-C1* polymorphism in brown trout population genetic studies. Primer sets presented could be used to sequence cDNA of other LDH* genes of brown trout and other species.

Treatment of PCR products with exonuclease I and heat-labile alkaline phosphatase improves the visibility of combined bisulfite restriction analysis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Watanabe, Kousuke; Emoto, Noriko; Sunohara, Mitsuhiro

2010-08-27

Research highlights: {yields} Incubating PCR products at a high temperature causes smears in gel electrophoresis. {yields} Smears interfere with the interpretation of methylation analysis using COBRA. {yields} Treatment with exonuclease I and heat-labile alkaline phosphatase eliminates smears. {yields} The elimination of smears improves the visibility of COBRA. -- Abstract: DNA methylation plays a vital role in the regulation of gene expression. Abnormal promoter hypermethylation is an important mechanism of inactivating tumor suppressor genes in human cancers. Combined bisulfite restriction analysis (COBRA) is a widely used method for identifying the DNA methylation of specific CpG sites. Here, we report that exonucleasemore » I and heat-labile alkaline phosphatase can be used for PCR purification for COBRA, improving the visibility of gel electrophoresis after restriction digestion. This improvement is observed when restriction digestion is performed at a high temperature, such as 60 {sup o}C or 65 {sup o}C, with BstUI and TaqI, respectively. This simple method can be applied instead of DNA purification using spin columns or phenol/chloroform extraction. It can also be applied to other situations when PCR products are digested by thermophile-derived restriction enzymes, such as PCR restriction fragment length polymorphism (RFLP) analysis.« less

Differentiating the persistency and permanency of some two stages DNA splicing language via Yusof-Goode (Y-G) approach

NASA Astrophysics Data System (ADS)

Mudaber, M. H.; Yusof, Y.; Mohamad, M. S.

2017-09-01

Predicting the existence of restriction enzymes sequences on the recombinant DNA fragments, after accomplishing the manipulating reaction, via mathematical approach is considered as a convenient way in terms of DNA recombination. In terms of mathematics, for this characteristic of the recombinant DNA strands, which involve the recognition sites of restriction enzymes, is called persistent and permanent. Normally differentiating the persistency and permanency of two stages recombinant DNA strands using wet-lab experiment is expensive and time-consuming due to running the experiment at two stages as well as adding more restriction enzymes on the reaction. Therefore, in this research, by using Yusof-Goode (Y-G) model the difference between persistent and permanent splicing language of some two stages is investigated. Two theorems were provided, which show the persistency and non-permanency of two stages DNA splicing language.

Homology between Escherichia coli plasmids ColE1 and p15A.

PubMed Central

Bird, R E

1981-01-01

The location and extent of the homology between plasmids ColE1 and p15A were determined by analysis of heteroduplexes formed between them as well as with a related plasmid, pBR322, and by hybridization of radioactive deoxyribonucleic acids to restriction fragments of p15A and ColE1. The homology between the plasmids contained the entire region of ColE1 required for its replication as well as an additional 400 base pairs downstream from the origin of replication. This region on p15A, which was 980 +/- 43 base pairs, started at 0.1 of the molecular length from one end formed by cleavage with the restriction endonuclease BglI and extended to 0.54 of the molecular length from the same end. Restriction cleavage maps for the enzymes BglI, HpaI, HaeII, HaeIII, and HincII are also presented. Images PMID:6259130

Micropreparative capillary gel electrophoresis of DNA: rapid expressed sequence tag library construction.

PubMed

Shi, Liang; Khandurina, Julia; Ronai, Zsolt; Li, Bi-Yu; Kwan, Wai King; Wang, Xun; Guttman, András

2003-01-01

A capillary gel electrophoresis based automated DNA fraction collection technique was developed to support a novel DNA fragment-pooling strategy for expressed sequence tag (EST) library construction. The cDNA population is first cleaved by BsaJ I and EcoR I restriction enzymes, and then subpooled by selective ligation with specific adapters followed by polymerase chain reaction (PCR) amplification and labeling. Combination of this cDNA fingerprinting method with high-resolution capillary gel electrophoresis separation and precise fractionation of individual cDNA transcript representatives avoids redundant fragment selection and concomitant repetitive sequencing of abundant transcripts. Using a computer-controlled capillary electrophoresis device the transcript representatives were separated by their size and fractions were automatically collected in every 30 s into 96-well plates. The high resolving power of the sieving matrix ensured sequencing grade separation of the DNA fragments (i.e., single-base resolution) and successful fraction collection. Performance and precision of the fraction collection procedure was validated by PCR amplification of the collected DNA fragments followed by capillary electrophoresis analysis for size and purity verification. The collected and PCR-amplified transcript representatives, ranging up to several hundred base pairs, were then sequenced to create an EST library.

De novo design of molecular architectures by evolutionary assembly of drug-derived building blocks.

PubMed

Schneider, G; Lee, M L; Stahl, M; Schneider, P

2000-07-01

An evolutionary algorithm was developed for fragment-based de novo design of molecules (TOPAS, TOPology-Assigning System). This stochastic method aims at generating a novel molecular structure mimicking a template structure. A set of approximately 25,000 fragment structures serves as the building block supply, which were obtained by a straightforward fragmentation procedure applied to 36,000 known drugs. Eleven reaction schemes were implemented for both fragmentation and building block assembly. This combination of drug-derived building blocks and a restricted set of reaction schemes proved to be a key for the automatic development of novel, synthetically tractable structures. In a cyclic optimization process, molecular architectures were generated from a parent structure by virtual synthesis, and the best structure of a generation was selected as the parent for the subsequent TOPAS cycle. Similarity measures were used to define 'fitness', based on 2D-structural similarity or topological pharmacophore distance between the template molecule and the variants. The concept of varying library 'diversity' during a design process was consequently implemented by using adaptive variant distributions. The efficiency of the design algorithm was demonstrated for the de novo construction of potential thrombin inhibitors mimicking peptide and non-peptide template structures.

Molecular and phenotypic descriptions of Stachybotrys chlorohalonata sp. nov. and two chemotypes of Stachybotrys chartarum found in water-damaged buildings.

PubMed

Andersen, Birgitte; Nielsen, Kristian F; Thrane, Ulf; Szaro, Tim; Taylor, John W; Jarvis, Bruce B

2003-01-01

Twenty-five Stachybotrys isolates from two previous studies have been examined and compared, using morphological, chemical and phylogenetic methods. The results show that S. chartarum sensu lato can be segregated into two chemotypes and one new species. The new species, S. chlorohalonata, differs morphologically from S. chartarum by having smooth conidia, being more restricted in growth and producing a green extracellular pigment on the medium CYA. S. chlorohalonata and S. chartarum also have different tri5, chs1 and tub1 gene fragment sequences. The two chemotypes of S. chartarum, chemotype S and chemotype A, have similar morphology but differ in production of metabolites. Chemotype S produces macrocyclic trichothecenes, satratoxins and roridins, while chemotype A produces atranones and dolabellanes. There is no difference between the two chemotypes in the tub1 gene fragment, but there is a one nucleotide difference in each of the tri5 and the chs1 gene fragments.

Differential diagnosis between complete mole and hydropic abortus by deoxyribonucleic acid fingerprints.

PubMed

Nobunaga, T; Azuma, C; Kimura, T; Tokugawa, Y; Takemura, M; Kamiura, S; Saji, F; Tanizawa, O

1990-08-01

We used a new method of deoxyribonucleic acid fingerprint analysis to obtain the differential diagnosis between complete mole and hydropic abortus. This method with a deoxyribonucleic acid minisatellite probe requires only a small amount of tissue sample and peripheral blood, and presents individual specific restriction fragment length polymorphisms (deoxyribonucleic acid "fingerprints") by simultaneous detection of many hypervariable regions (minisatellite regions) widely dispersed in the human genome. Southern blot hybridization showed that in cases of complete mole, all polymorphic fragments were exclusively inherited from the father. Some of the polymorphic bands of paternal deoxyribonucleic acid were not observed in molar deoxyribonucleic acid. However, in the hydropic abortus, the polymorphic fragments could be traced back to its parent. These results indicate that deoxyribonucleic acid fingerprints could distinguish the abnormal fertilization of complete mole (androgenesis) from the normal fertilization of hydropic abortus by identifying the difference in genetic variations between complete mole and hydropic abortus at the deoxyribonucleic acid level.

[The investigation of genomes of some species of the genus Gentiana in nature and in vitro cell culture].

PubMed

Mel'nyk, V M; Spiridonova, K V; Andrieiev, I O; Strashniuk, N M; Kunakh, V A

2002-01-01

The comparative study of the genomes of intact plants-representatives of some species of the genus Gentiana L. as well as cultured cells of G. lutea and G. punctata was performed using restriction analysis. Species specificity of restriction fragment patterns for studied representatives of this genus was revealed. The differences between electrophoretic patterns of digested DNA purified from rhizome and leaves of G. lutea and G. punctata were found. The changes in genomes of G. lutea and G. punctata cells cultured in vitro compared with the genomes of intact plants were detected. The data obtained evidence that some of them may be of nonrandom character.

Zygosaccharomyces kombuchaensis, a new ascosporogenous yeast from 'Kombucha tea'.

PubMed

Kurtzman, C P; Robnett, C J; Basehoar-Powers, E

2001-07-01

A new ascosporogenous yeast, Zygosaccharomyces kombuchaensis sp. n. (type strain NRRL YB-4811, CBS 8849), is described; it was isolated from Kombucha tea, a popular fermented tea-based beverage. The four known strains of the new species have identical nucleotide sequences in domain D1/D2 of 26S rDNA. Phylogenetic analysis of D1/D2 and 18S rDNA sequences places Z. kombuchaensis near Zygosaccharomyces lentus. The two species are indistinguishable on standard physiological tests used for yeast identification, but can be recognized from differences in restriction fragment length polymorphism patterns obtained by digestion of 18S-ITS1 amplicons with the restriction enzymes DdeI and MboI.

Meat species identification and Halal authentication analysis using mitochondrial DNA.

PubMed

Murugaiah, Chandrika; Noor, Zainon Mohd; Mastakim, Maimunah; Bilung, Lesley Maurice; Selamat, Jinap; Radu, Son

2009-09-01

A method utilizing PCR-restriction fragment length polymorphism (RFLP) in the mitochondrial genes was developed for beef (Bos taurus), pork (Sus scrofa), buffalo (Bubalus bubali), quail (Coturnix coturnix), chicken (Gallus gallus), goat (Capra hircus), rabbit (Oryctolagus cuniculus) species identification and Halal authentication. PCR products of 359-bp were successfully obtained from the cyt b gene of these six meats. AluI, BsaJI, RsaI, MseI, and BstUI enzymes were identified as potential restriction endonucleases to differentiate the meats. The genetic differences within the cyt b gene among the meat were successfully confirmed by PCR-RFLP. A reliable typing scheme of species which revealed the genetic differences among the species was developed.

Fragmentation and thermal risks from climate change interact to affect persistence of native trout in the Colorado River basin.

PubMed

Roberts, James J; Fausch, Kurt D; Peterson, Douglas P; Hooten, Mevin B

2013-05-01

Impending changes in climate will interact with other stressors to threaten aquatic ecosystems and their biota. Native Colorado River cutthroat trout (CRCT; Oncorhynchus clarkii pleuriticus) are now relegated to 309 isolated high-elevation (>1700 m) headwater stream fragments in the Upper Colorado River Basin, owing to past nonnative trout invasions and habitat loss. Predicted changes in climate (i.e., temperature and precipitation) and resulting changes in stochastic physical disturbances (i.e., wildfire, debris flow, and channel drying and freezing) could further threaten the remaining CRCT populations. We developed an empirical model to predict stream temperatures at the fragment scale from downscaled climate projections along with geomorphic and landscape variables. We coupled these spatially explicit predictions of stream temperature with a Bayesian Network (BN) model that integrates stochastic risks from fragmentation to project persistence of CRCT populations across the upper Colorado River basin to 2040 and 2080. Overall, none of the populations are at risk from acute mortality resulting from high temperatures during the warmest summer period. In contrast, only 37% of populations have a ≥90% chance of persistence for 70 years (similar to the typical benchmark for conservation), primarily owing to fragmentation. Populations in short stream fragments <7 km long, and those at the lowest elevations, are at the highest risk of extirpation. Therefore, interactions of stochastic disturbances with fragmentation are projected to be greater threats than warming for CRCT populations. The reason for this paradox is that past nonnative trout invasions and habitat loss have restricted most CRCT populations to high-elevation stream fragments that are buffered from the potential consequences of warming, but at risk of extirpation from stochastic events. The greatest conservation need is for management to increase fragment lengths to forestall these risks. © 2013 Blackwell Publishing Ltd.

Fragmentation and thermal risks from climate change interact to affect persistence of native trout in the Colorado River basin

USGS Publications Warehouse

Roberts, James J.; Fausch, Kurt D.; Peterson, Douglas P.; Hooten, Mevin B.

2013-01-01

Impending changes in climate will interact with other stressors to threaten aquatic ecosystems and their biota. Native Colorado River cutthroat trout (CRCT; Oncorhynchus clarkii pleuriticus) are now relegated to 309 isolated high-elevation (>1700 m) headwater stream fragments in the Upper Colorado River Basin, owing to past nonnative trout invasions and habitat loss. Predicted changes in climate (i.e., temperature and precipitation) and resulting changes in stochastic physical disturbances (i.e., wildfire, debris flow, and channel drying and freezing) could further threaten the remaining CRCT populations. We developed an empirical model to predict stream temperatures at the fragment scale from downscaled climate projections along with geomorphic and landscape variables. We coupled these spatially explicit predictions of stream temperature with a Bayesian Network (BN) model that integrates stochastic risks from fragmentation to project persistence of CRCT populations across the upper Colorado River basin to 2040 and 2080. Overall, none of the populations are at risk from acute mortality resulting from high temperatures during the warmest summer period. In contrast, only 37% of populations have a greater than or equal to 90% chance of persistence for 70 years (similar to the typical benchmark for conservation), primarily owing to fragmentation. Populations in short stream fragments <7 km long, and those at the lowest elevations, are at the highest risk of extirpation. Therefore, interactions of stochastic disturbances with fragmentation are projected to be greater threats than warming for CRCT populations. The reason for this paradox is that past nonnative trout invasions and habitat loss have restricted most CRCT populations to high-elevation stream fragments that are buffered from the potential consequences of warming, but at risk of extirpation from stochastic events. The greatest conservation need is for management to increase fragment lengths to forestall these risks. 

DNA fingerprinting and analysis of population structure in the chestnut blight fungus, Cryphonectria parasitica.

PubMed

Milgroom, M G; Lipari, S E; Powell, W A

1992-06-01

We analyzed DNA fingerprints in the chestnut blight fungus, Cryphonectria parasitica, for stability, inheritance, linkage and variability in a natural population. DNA fingerprints resulting from hybridization with a dispersed moderately repetitive DNA sequence of C. parasitica in plasmid pMS5.1 hybridized to 6-17 restriction fragments per individual isolate. In a laboratory cross and from progeny from a single perithecium collected from a field population, the presence/absence of 11 fragments in the laboratory cross and 12 fragments in the field progeny set segregated in 1:1 ratios. Two fragments in each progeny set cosegregated; no other linkage was detected among the segregating fragments. Mutations, identified by missing bands, were detected for only one fragment in which 4 of 43 progeny lacked a band present in both parents; no novel fragments were detected in any progeny. All other fragments appeared to be stably inherited. Hybridization patterns did not change during vegetative growth or sporulation. However, fingerprint patterns of single conidial isolates of strains EP155 and EP67 were found to be heterogenous due to mutations that occurred during culturing in the laboratory since these strains were first isolated in 1976-1977. In a population sample of 39 C. parasitica isolates, we found 33 different fingerprint patterns with pMS5.1. Most isolates differed from all other isolates by the presence or absence of several fragments. Six fingerprint patterns each occurred twice. Isolates with identical fingerprints occurred in cankers on the same chestnut stems three times; isolates within the other three pairs were isolated from cankers more than 5 m apart. The null hypothesis of random mating in this population could not be rejected if the six putative clones were removed from the analysis. Thus, a rough estimate of the clonal fraction of this population is 6 in 39 isolates (15.4%).

Genotyping of Chromobacterium violaceum isolates by recA PCR-RFLP analysis.

PubMed

Scholz, Holger Christian; Witte, Angela; Tomaso, Herbert; Al Dahouk, Sascha; Neubauer, Heinrich

2005-03-15

Intraspecies variation of Chromobacterium violaceum was examined by comparative sequence - and by restriction fragment length polymorphism analysis of the recombinase A gene (recA-PCR-RFLP). Primers deduced from the known recA gene sequence of the type strain C. violaceum ATCC 12472(T) allowed the specific amplification of a 1040bp recA fragment from each of the 13 C. violaceum strains investigated, whereas other closely related organisms tested negative. HindII-PstI-recA RFLP analysis generated from 13 representative C. violaceum strains enabled us to identify at least three different genospecies. In conclusion, analysis of the recA gene provides a rapid and robust nucleotide sequence-based approach to specifically identify and classify C. violaceum on genospecies level.

Age differences in implicit memory: conceptual, perceptual, or methodological?

PubMed

Mitchell, David B; Bruss, Peter J

2003-12-01

The authors examined age differences in conceptual and perceptual implicit memory via word-fragment completion, word-stem completion, category exemplar generation, picture-fragment identification, and picture naming. Young, middle-aged, and older participants (N = 60) named pictures and words at study. Limited test exposure minimized explicit memory contamination, yielding no reliable age differences and equivalent cross-format effects. In contrast, explicit memory and neuropsychological measures produced significant age differences. In a follow-up experiment, 24 young adults were informed a priori about implicit testing. Their priming was equivalent to the main experiment, showing that test trial time restrictions limit explicit memory strategies. The authors concluded that most implicit memory processes remain stable across adulthood and suggest that explicit contamination be rigorously monitored in aging studies.

DNA Fingerprinting of Pearls to Determine Their Origins

PubMed Central

Meyer, Joana B.; Cartier, Laurent E.; Pinto-Figueroa, Eric A.; Krzemnicki, Michael S.; Hänni, Henry A.; McDonald, Bruce A.

2013-01-01

We report the first successful extraction of oyster DNA from a pearl and use it to identify the source oyster species for the three major pearl-producing oyster species Pinctada margaritifera, P. maxima and P. radiata. Both mitochondrial and nuclear gene fragments could be PCR-amplified and sequenced. A polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) assay in the internal transcribed spacer (ITS) region was developed and used to identify 18 pearls of unknown origin. A micro-drilling technique was developed to obtain small amounts of DNA while maintaining the commercial value of the pearls. This DNA fingerprinting method could be used to document the source of historic pearls and will provide more transparency for traders and consumers within the pearl industry. PMID:24130725

DNA fingerprinting of pearls to determine their origins.

PubMed

Meyer, Joana B; Cartier, Laurent E; Pinto-Figueroa, Eric A; Krzemnicki, Michael S; Hänni, Henry A; McDonald, Bruce A

2013-01-01

We report the first successful extraction of oyster DNA from a pearl and use it to identify the source oyster species for the three major pearl-producing oyster species Pinctada margaritifera, P. maxima and P. radiata. Both mitochondrial and nuclear gene fragments could be PCR-amplified and sequenced. A polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) assay in the internal transcribed spacer (ITS) region was developed and used to identify 18 pearls of unknown origin. A micro-drilling technique was developed to obtain small amounts of DNA while maintaining the commercial value of the pearls. This DNA fingerprinting method could be used to document the source of historic pearls and will provide more transparency for traders and consumers within the pearl industry.

Chromatin Constrains the Initiation and Elongation of DNA Replication.

PubMed

Devbhandari, Sujan; Jiang, Jieqing; Kumar, Charanya; Whitehouse, Iestyn; Remus, Dirk

2017-01-05

Eukaryotic chromosomal DNA is faithfully replicated in a complex series of cell-cycle-regulated events that are incompletely understood. Here we report the reconstitution of DNA replication free in solution with purified proteins from the budding yeast Saccharomyces cerevisiae. The system recapitulates regulated bidirectional origin activation; synthesis of leading and lagging strands by the three replicative DNA polymerases Pol α, Pol δ, and Pol ε; and canonical maturation of Okazaki fragments into continuous daughter strands. We uncover a dual regulatory role for chromatin during DNA replication: promoting origin dependence and determining Okazaki fragment length by restricting Pol δ progression. This system thus provides a functional platform for the detailed mechanistic analysis of eukaryotic chromosome replication. Copyright © 2017 Elsevier Inc. All rights reserved.

The effects of habitat fragmentation on the social kin structure and mating system of the agile antechinus, Antechinus agilis.

PubMed

Banks, S C; Ward, S J; Lindenmayer, D B; Finlayson, G R; Lawson, S J; Taylor, A C

2005-05-01

Habitat fragmentation is one of the major contributors to the loss of biodiversity worldwide. However, relatively little is known about its more immediate impacts on within-patch population processes such as social structure and mating systems, whose alteration may play an important role in extinction risk. We investigated the impacts of habitat fragmentation due to the establishment of an exotic softwood plantation on the social kin structure and breeding system of the Australian marsupial carnivore, Antechinus agilis. Restricted dispersal by males in fragmented habitat resulted in elevated relatedness among potential mates in populations in fragments, potentially increasing the risk of inbreeding. Antechinus agilis nests communally in tree hollows; these nests are important points for social contact between males and females in the mating season. In response to elevated relatedness among potential mates in fragmented habitat, A. agilis significantly avoided sharing nests with opposite-sex relatives in large fragment sites (but not in small ones, possibly due to limited nest locations and small population sizes). Because opposite-sex individuals shared nests randomly with respect to relatedness in unfragmented habitat, we interpreted the phenomenon in fragmented habitat as a precursor to inbreeding avoidance via mate choice. Despite evidence that female A. agilis at high inbreeding risk selected relatively unrelated mates, there was no overall increased avoidance of related mates by females in fragmented habitats compared to unfragmented habitats. Simulations indicated that only dispersal, and not nonrandom mating, contributed to inbreeding avoidance in either habitat context. However, habitat fragmentation did influence the mating system in that the degree of multiple paternity was reduced due to the reduction in population sizes and population connectivity. This, in turn, reduced the number of males available to females in the breeding season. This suggests that in addition to the obvious impacts of reduced recruitment, patch recolonization and increased genetic drift, the isolation of populations in habitat patches may cause changes in breeding behaviour that contribute to the negative impacts of habitat fragmentation.

Tests of spool models for DNA packaging in phage lambda.

PubMed

Widom, J; Baldwin, R L

1983-12-25

Experiments are reported which bear on two spool models proposed for packaging the DNA of phage lambda. Both spool models fill an assumed spherical cavity with DNA wrapped in cylindrical or quasi-cylindrical layers composed of adjacent circular turns. In the curved-spool model, a single continuous segment of DNA, about 20% of the DNA length and probably located near the left end of the DNA, is in contact with the coat protein of the phage capsid. In the straight spool model, there are several DNA segments in contact with the capsid; they are concentrated in one half (probably the left half) of lambda DNA. We have identified the loci on the DNA which are in contact with the capsid by chemical crosslinking, induced by ultraviolet-irradiation of phage containing 5-bromodeoxyuridine in place of thymine. In an electron microscope experiment, phage are first lysed with EDTA, and then spread in a cytochrome c film by the formamide method. The disrupted capsid, which has the appearance of a phage ghost, serves as a marker showing where the DNA is crosslinked to the coat. The left end of the DNA is not distinguished from the right end, and so the map of DNA-capsid contacts is folded over on itself. Contacts are found nearly randomly over the entire map. In a second experiment, DNA from lysed, crosslinked phage is cut either with EcoRI or HindIII restriction endonucleases and the cut restriction fragments are labeled at their ends with 32P. Density centrifugation in a CsCl gradient separates free DNA from restriction fragments crosslinked to protein. After digestion with proteinase k, the DNA fragments previously crosslinked to protein are identified by size after agarose gel electrophoresis. DNA fragments from all parts of the genome are found. These two experiments show that, if the DNA of each phage is packaged identically, then the curved-spool model is ruled out and the straight spool model is unlikely. Alternatively, the manner of packaging the DNA may vary from one phage to the next. These results agree with other recent experiments on lambda DNA packaging by Hall & Schellman (1982a,b), and by Haas et al. (1982). A different experiment is also reported. The psoralen derivative aminomethyltrioxalen (AMT) is allowed to intercalate into lambda phage and then the DNA strands are crosslinked by ultraviolet-irradiation after the rapid phase of AMT intercalation is complete. The DNA is subsequently denatured by glyoxal modification and spread for electron microscopy in a cytochrome c film by the formamide method.(ABSTRACT TRUNCATED AT 400 WORDS)

Achieving climate connectivity in a fragmented landscape

PubMed Central

Lawler, Joshua J.; McRae, Brad H.; Nuñez, Tristan A.; Theobald, David M.

2016-01-01

The contiguous United States contains a disconnected patchwork of natural lands. This fragmentation by human activities limits species’ ability to track suitable climates as they rapidly shift. However, most models that project species movement needs have not examined where fragmentation will limit those movements. Here, we quantify climate connectivity, the capacity of landscape configuration to allow species movement in the face of dynamically shifting climate. Using this metric, we assess to what extent habitat fragmentation will limit species movements in response to climate change. We then evaluate how creating corridors to promote climate connectivity could potentially mitigate these restrictions, and we assess where strategies to increase connectivity will be most beneficial. By analyzing fragmentation patterns across the contiguous United States, we demonstrate that only 41% of natural land area retains enough connectivity to allow plants and animals to maintain climatic parity as the climate warms. In the eastern United States, less than 2% of natural area is sufficiently connected. Introducing corridors to facilitate movement through human-dominated regions increases the percentage of climatically connected natural area to 65%, with the most impactful gains in low-elevation regions, particularly in the southeastern United States. These climate connectivity analyses allow ecologists and conservation practitioners to determine the most effective regions for increasing connectivity. More importantly, our findings demonstrate that increasing climate connectivity is critical for allowing species to track rapidly changing climates, reconfiguring habitats to promote access to suitable climates. PMID:27298349

Achieving climate connectivity in a fragmented landscape.

PubMed

McGuire, Jenny L; Lawler, Joshua J; McRae, Brad H; Nuñez, Tristan A; Theobald, David M

2016-06-28

The contiguous United States contains a disconnected patchwork of natural lands. This fragmentation by human activities limits species' ability to track suitable climates as they rapidly shift. However, most models that project species movement needs have not examined where fragmentation will limit those movements. Here, we quantify climate connectivity, the capacity of landscape configuration to allow species movement in the face of dynamically shifting climate. Using this metric, we assess to what extent habitat fragmentation will limit species movements in response to climate change. We then evaluate how creating corridors to promote climate connectivity could potentially mitigate these restrictions, and we assess where strategies to increase connectivity will be most beneficial. By analyzing fragmentation patterns across the contiguous United States, we demonstrate that only 41% of natural land area retains enough connectivity to allow plants and animals to maintain climatic parity as the climate warms. In the eastern United States, less than 2% of natural area is sufficiently connected. Introducing corridors to facilitate movement through human-dominated regions increases the percentage of climatically connected natural area to 65%, with the most impactful gains in low-elevation regions, particularly in the southeastern United States. These climate connectivity analyses allow ecologists and conservation practitioners to determine the most effective regions for increasing connectivity. More importantly, our findings demonstrate that increasing climate connectivity is critical for allowing species to track rapidly changing climates, reconfiguring habitats to promote access to suitable climates.

Genotype Diversity and Distribution of Orientia tsutsugamushi Causing Scrub Typhus in Thailand

DTIC Science & Technology

2011-07-01

typhus assay and vaccine development. Orientia tsutsugamushi, formerly known as Rickettsia tsutsug- amushi, is the causative agent of scrub typhus, a...Sunderland, MA. 13. Horinoucbi, H., et al. 1996. Genotypic identification of Rickettsia tsutsuga- mushi by restriction fragment length polymorphism... Rickettsia tsutsu· gamushi. Sequence and comparative analyses of the genes encoding TSA homologues from four antigenic variants. J. Bioi. Chern. 267:12728

Lessons Learned on Bioaugmentation of DNAPL Source Zone Areas

DTIC Science & Technology

2007-10-01

but rather have stringers, ganglia or blobs that can create an “effective pool length”. As the leading edge of these discontinuous DNAPL free-phases...terminal restriction fragment length polymorphism (T-RFLP), denaturing gradient gel electrophoresis (DGGE), and fluorescent in situ hybridization ( FISH ...question of interest (e.g. PCR, FISH , DGGE); (ii) sampling location(s); (iii) an appropriate sampling procedure; and (iv) an appropriate sample handling

Genetic diversity and seed production in Santa Lucia fir (Abies bracteata),a relict of the Miocene broadleaved evergreen forest

Treesearch

F. Thomas Ledig; Paul D. Hodgskiss; David R. Johnson

2006-01-01

Santa Lucia fir (Abies bracteata), is a unique fir, the sole member of the subgenus Pseudotorreya. It is a relict of the Miocene broadleaved evergreen sclerophyll forest, and is now restricted to a highly fragmented range in the Santa Lucia Mountains of central coastal California. Expected heterozygosity for 30 isozyme loci in 18 enzyme systems...

Genetic diversity and the mating system of a rare Mexican Piñon, Pinus pinceana, and a comparison with Pinus maximartinezii (Pinaceae)

Treesearch

F. Thomas Ledig; Miguel A. Capó-Arteaga; Paul D. Hodgskiss; Hassan Sbay; Celestino Flores-López; M. Thompson Conkle; Basilio Bermejo-Velázquez

2001-01-01

Weeping piñon (Pinus pinceana) has a restricted and fragmented range, trees are widely scattered within populations, and reproduction is limited. Nevertheless, genetic diversity was high; based on 27 isozyme loci in 18 enzyme systems, unbiased expected heterozygosity averaged 0.174. Differentiation also was high (FST = 0.152),...

A Consensus Map for Loblolly Pine (Pinus taeda L.). I. Construction and Integration of Individual Linkage Maps From TwoOutbred Three-Generation Pedigrees

Treesearch

Mitchell M. Sewell; Bradley K. Sherman; David B. Neale

1998-01-01

A consensus map for loblolly pine (Pinus taeda L.) was constructed from the integration of linkage data from two unrelated three-generation out bred pedigrees. The progeny segregation data from restriction fragment length polymorphism, random amplified polymorphic DNA, and isozyme genetic markers from each pedigree were recoded to reflect the two independent...

Improving Leishmania Species Identification in Different Types of Samples from Cutaneous Lesions

PubMed Central

Cruz-Barrera, Mónica L.; Ovalle-Bracho, Clemencia; Ortegon-Vergara, Viviana; Pérez-Franco, Jairo E.

2015-01-01

The discrimination of Leishmania species from patient samples has epidemiological and clinical relevance. In this study, different gene target PCR-restriction fragment length polymorphism (RFLP) protocols were evaluated for their robustness as Leishmania species discriminators in 61 patients with cutaneous leishmaniasis. We modified the hsp70-PCR-RFLP protocol and found it to be the most reliable protocol for species identification. PMID:25609727

Genetic diversity, genetic structure, and mating system of brewer spruce (Pinaceae), a relict of the acto-tertiary forest

Treesearch

F. Thomas Ledig; Paul D. Hodgskiss; David R. Johnson

2005-01-01

Brewer spruce (Picea breweriana), a relict of the widespread Arcto-Tertiary forests, is now restricted to a highly fragmented range in the Klamath Region of California and Oregon. Expected heterozygosity for 26 isozyme loci, averaged over 10 populations, was 0.121. More notable than the relatively high level of diversity when compared to other woody...

Chloroplast genes as genetic markers for inferring patterns of change, maternal ancestry and phylogenetic relationships among Eleusine species

PubMed Central

Agrawal, Renuka; Agrawal, Nitin; Tandon, Rajesh; Raina, Soom Nath

2013-01-01

Assessment of phylogenetic relationships is an important component of any successful crop improvement programme, as wild relatives of the crop species often carry agronomically beneficial traits. Since its domestication in East Africa, Eleusine coracana (2n = 4x = 36), a species belonging to the genus Eleusine (x = 8, 9, 10), has held a prominent place in the semi-arid regions of India, Nepal and Africa. The patterns of variation between the cultivated and wild species reported so far and the interpretations based upon them have been considered primarily in terms of nuclear events. We analysed, for the first time, the phylogenetic relationship between finger millet (E. coracana) and its wild relatives by species-specific chloroplast deoxyribonucleic acid (cpDNA) polymerase chain reaction–restriction fragment length polymorphism (PCR–RFLP) and chloroplast simple sequence repeat (cpSSR) markers/sequences. Restriction fragment length polymorphism of the seven amplified chloroplast genes/intergenic spacers (trnK, psbD, psaA, trnH–trnK, trnL–trnF, 16S and trnS–psbC), nucleotide sequencing of the chloroplast trnK gene and chloroplast microsatellite polymorphism were analysed in all nine known species of Eleusine. The RFLP of all seven amplified chloroplast genes/intergenic spacers and trnK gene sequences in the diploid (2n = 16, 18, 20) and allotetraploid (2n = 36, 38) species resulted in well-resolved phylogenetic trees with high bootstrap values. Eleusine coracana, E. africana, E. tristachya, E. indica and E. kigeziensis did not show even a single change in restriction site. Eleusine intermedia and E. floccifolia were also shown to have identical cpDNA fragment patterns. The cpDNA diversity in Eleusine multiflora was found to be more extensive than that of the other eight species. The trnK gene sequence data complemented the results obtained by PCR–RFLP. The maternal lineage of all three allotetraploid species (AABB, AADD) was the same, with E. indica being the maternal diploid progenitor species. The markers specific to certain species were also identified. PMID:24790119

Chloroplast genes as genetic markers for inferring patterns of change, maternal ancestry and phylogenetic relationships among Eleusine species.

PubMed

Agrawal, Renuka; Agrawal, Nitin; Tandon, Rajesh; Raina, Soom Nath

2014-01-01

Assessment of phylogenetic relationships is an important component of any successful crop improvement programme, as wild relatives of the crop species often carry agronomically beneficial traits. Since its domestication in East Africa, Eleusine coracana (2n = 4x = 36), a species belonging to the genus Eleusine (x = 8, 9, 10), has held a prominent place in the semi-arid regions of India, Nepal and Africa. The patterns of variation between the cultivated and wild species reported so far and the interpretations based upon them have been considered primarily in terms of nuclear events. We analysed, for the first time, the phylogenetic relationship between finger millet (E. coracana) and its wild relatives by species-specific chloroplast deoxyribonucleic acid (cpDNA) polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) and chloroplast simple sequence repeat (cpSSR) markers/sequences. Restriction fragment length polymorphism of the seven amplified chloroplast genes/intergenic spacers (trnK, psbD, psaA, trnH-trnK, trnL-trnF, 16S and trnS-psbC), nucleotide sequencing of the chloroplast trnK gene and chloroplast microsatellite polymorphism were analysed in all nine known species of Eleusine. The RFLP of all seven amplified chloroplast genes/intergenic spacers and trnK gene sequences in the diploid (2n = 16, 18, 20) and allotetraploid (2n = 36, 38) species resulted in well-resolved phylogenetic trees with high bootstrap values. Eleusine coracana, E. africana, E. tristachya, E. indica and E. kigeziensis did not show even a single change in restriction site. Eleusine intermedia and E. floccifolia were also shown to have identical cpDNA fragment patterns. The cpDNA diversity in Eleusine multiflora was found to be more extensive than that of the other eight species. The trnK gene sequence data complemented the results obtained by PCR-RFLP. The maternal lineage of all three allotetraploid species (AABB, AADD) was the same, with E. indica being the maternal diploid progenitor species. The markers specific to certain species were also identified.

Influence of fragment size and postoperative joint congruency on long-term outcome of posterior malleolar fractures.

PubMed

Drijfhout van Hooff, Cornelis Christiaan; Verhage, Samuel Marinus; Hoogendoorn, Jochem Maarten

2015-06-01

One of the factors contributing to long-term outcome of posterior malleolar fractures is the development of osteoarthritis. Based on biomechanical, cadaveric, and small population studies, fixation of posterior malleolar fracture fragments (PMFFs) is usually performed when fragment size exceeds 25-33%. However, the influence of fragment size on long-term clinical and radiological outcome size remains unclear. A retrospective cohort study of 131 patients treated for an isolated ankle fracture with involvement of the posterior malleolus was performed. Mean follow-up was 6.9 (range, 2.5-15.9) years. Patients were divided into groups depending on size of the fragment, small (<5%, n = 20), medium (5-25%, n = 86), or large (>25%, n = 25), and presence of step-off after operative treatment. We have compared functional outcome measures (AOFAS, AAOS), pain (VAS), and dorsiflexion restriction compared to the contralateral ankle and the incidence of osteoarthritis on X-ray. There were no nonunions, 56% of patients had no radiographic osteoarthritis, VAS was 10 of 100, and median clinical score was 90 of 100. More osteoarthritis occurred in ankle fractures with medium and large PMFFs compared to small fragments (small 16%, medium 48%, large 54%; P = .006). Also when comparing small with medium-sized fragments (P = .02), larger fragment size did not lead to a significantly decreased function (median AOFAS 95 vs 88, P = .16). If the PMFF size was >5%, osteoarthritis occurred more frequently when there was a postoperative step-off ≥1 mm in the tibiotalar joint surface (41% vs 61%, P = .02) (whether the posterior fragment had been fixed or not). In this group, fixing the PMFF did not influence development of osteoarthritis. However, in 42% of the cases with fixation of the fragment a postoperative step-off remained (vs 45% in the group without fixation). Osteoarthritis is 1 component of long-term outcome of malleolar fractures, and the results of this study demonstrate that there was more radiographic osteoarthritis in patients with medium and large posterior fragments than in those with small fragments. Radiographic osteoarthritis also occurred more frequently when postoperative step-off was 1 mm or more, whether the posterior fragment was fixed or not. However, clinical scores were not different for these groups. Level IV, retrospective case series. © The Author(s) 2015.

Seasonal diversity of planktonic protists in Southwestern Alberta rivers over a 1-year period as revealed by terminal restriction fragment length polymorphism and 18S rRNA gene library analyses.

PubMed

Thomas, Matthew C; Selinger, L Brent; Inglis, G Douglas

2012-08-01

The temporal dynamics of planktonic protists in river water have received limited attention despite their ecological significance and recent studies linking phagotrophic protists to the persistence of human-pathogenic bacteria. Using molecular-based techniques targeting the 18S rRNA gene, we studied the seasonal diversity of planktonic protists in Southwestern Alberta rivers (Oldman River Basin) over a 1-year period. Nonmetric multidimensional scaling analysis of terminal restriction fragment length polymorphism (T-RFLP) data revealed distinct shifts in protistan community profiles that corresponded to season rather than geographical location. Community structures were examined by using clone library analysis; HaeIII restriction profiles of 18S rRNA gene amplicons were used to remove prevalent solanaceous plant clones prior to sequencing. Sanger sequencing of the V1-to-V3 region of the 18S rRNA gene libraries from spring, summer, fall, and winter supported the T-RFLP results and showed marked seasonal differences in the protistan community structure. The spring library was dominated by Chloroplastidae (29.8%), Centrohelida (28.1%), and Alveolata (25.5%), while the summer and fall libraries contained primarily fungal clones (83.0% and 88.0%, respectively). Alveolata (35.6%), Euglenozoa (24.4%), Chloroplastida (15.6%), and Fungi (15.6%) dominated the winter library. These data demonstrate that planktonic protists, including protozoa, are abundant in river water in Southwestern Alberta and that conspicuous seasonal shifts occur in the community structure.

Seasonal Diversity of Planktonic Protists in Southwestern Alberta Rivers over a 1-Year Period as Revealed by Terminal Restriction Fragment Length Polymorphism and 18S rRNA Gene Library Analyses

PubMed Central

Thomas, Matthew C.; Selinger, L. Brent

2012-01-01

The temporal dynamics of planktonic protists in river water have received limited attention despite their ecological significance and recent studies linking phagotrophic protists to the persistence of human-pathogenic bacteria. Using molecular-based techniques targeting the 18S rRNA gene, we studied the seasonal diversity of planktonic protists in Southwestern Alberta rivers (Oldman River Basin) over a 1-year period. Nonmetric multidimensional scaling analysis of terminal restriction fragment length polymorphism (T-RFLP) data revealed distinct shifts in protistan community profiles that corresponded to season rather than geographical location. Community structures were examined by using clone library analysis; HaeIII restriction profiles of 18S rRNA gene amplicons were used to remove prevalent solanaceous plant clones prior to sequencing. Sanger sequencing of the V1-to-V3 region of the 18S rRNA gene libraries from spring, summer, fall, and winter supported the T-RFLP results and showed marked seasonal differences in the protistan community structure. The spring library was dominated by Chloroplastidae (29.8%), Centrohelida (28.1%), and Alveolata (25.5%), while the summer and fall libraries contained primarily fungal clones (83.0% and 88.0%, respectively). Alveolata (35.6%), Euglenozoa (24.4%), Chloroplastida (15.6%), and Fungi (15.6%) dominated the winter library. These data demonstrate that planktonic protists, including protozoa, are abundant in river water in Southwestern Alberta and that conspicuous seasonal shifts occur in the community structure. PMID:22685143

Response of estuarine biofilm microbial community development to changes in dissolved oxygen and nutrient concentrations.

PubMed

Nocker, Andreas; Lepo, Joe Eugene; Martin, Linda Lin; Snyder, Richard Allan

2007-10-01

The information content and responsiveness of microbial biofilm community structure, as an integrative indicator of water quality, was assessed against short-term changes in oxygen and nutrient loading in an open-water estuarine setting. Biofilms were grown for 7-day periods on artificial substrates in the Pensacola Bay estuary, Florida, in the vicinity of a wastewater treatment plant (WWTP) outfall and a nearby reference site. Substrates were deployed floating at the surface and near the benthos in 5.4 m of water. Three sampling events covered a 1-month period coincident with declining seasonal WWTP flow and increasing dissolved oxygen (DO) levels in the bottom waters. Biomass accumulation in benthic biofilms appeared to be controlled by oxygen rather than nutrients. The overriding effect of DO was also seen in DNA fingerprints of community structure by terminal restriction fragment length polymorphism (T-RFLP) of amplified 16S rRNA genes. Ribotype diversity in benthic biofilms at both sites dramatically increased during the transition from hypoxic to normoxic. Terminal restriction fragment length polymorphism patterns showed pronounced differences between benthic and surface biofilm communities from the same site in terms of signal type, strength, and diversity, but minor differences between sites. Sequencing of 16S rRNA gene clone libraries from benthic biofilms at the WWTP site suggested that low DO levels favored sulfate-reducing prokaryotes (SRP), which decreased with rising oxygen levels and increasing overall diversity. A 91-bp ribotype in the CfoI-restricted 16S rRNA gene T-RFLP profiles, indicative of SRP, tracked the decrease in relative SRP abundance over time.

Identification of two invasive Cacopsylla chinensis (Hemiptera: Psyllidae) lineages based on two mitochondrial sequences and restriction fragment length polymorphism of cytochrome oxidase I amplicon.

PubMed

Lee, Hsien-Chung; Yang, Man-Miao; Yeh, Wen-Bin

2008-08-01

The occurrence of pear decline, a disease found in some pear (Pyrus spp.) orchards of Taiwan in recent years, is accompanied by an outbreak of Cacopsylla chinensis (Yang & Li). Two major morphological forms (summer and winter forms) with a variety of intermediate body color and two phylogenetic lineages of this psyllid have been described. The work herein used sequences of mitochondrial cytochrome oxidase I (COI) and 16S rDNA regions to delineate the genetic differentiation of this color-variable insect and to elucidate their relationship. Sequence divergence and phylogenetic analysis have shown that C. chinensis individuals could be divided into two lineages with 3.3 and 2.3% divergence of COI and 16S rDNA, respectively. All specimens from China were found to belong to lineage I. Restriction fragment length polymorphism analysis of COI with restriction enzymes AcuI, AseI, BccI, and FokI on 263 specimens of six populations from Taiwan produced two digestion patterns, which are in agreement with the two lineages described above. Both patterns could be found in each population, with most individuals belonging to lineage I and 5-21% of the individuals belonging to lineage II. Because these two lineages included summer as well as winter morphological forms, the lineage differentiation is apparently not related to morphological characters of this psyllid. Because the invasive records are not in favor of a sympatric differentiation, this psyllid is more likely introduced as different populations from countries in temperate regions.

Neer Award 2017: A rapid method for detecting Propionibacterium acnes in surgical biopsy specimens from the shoulder.

PubMed

Holmes, Scott; Pena Diaz, Ana M; Athwal, George S; Faber, Kenneth J; O'Gorman, David B

2017-02-01

Propionibacterium (P) acnes infection of the shoulder after arthroplasty is a common and serious complication. Current detection methods for P acnes involve anaerobic cultures that require prolonged incubation periods (typically 7-14 days). We have developed a polymerase chain reaction (PCR)-restriction fragment length polymorphism (RFLP) approach that sensitively and specifically identifies P acnes in tissue specimens within a 24-hour period. Primers were designed to amplify a unique region of the 16S rRNA gene in P acnes that contained a unique HaeIII restriction enzyme site. PCR and RFLP analyses were optimized to detect P acnes DNA in in vitro cultures and in arthroscopic surgical biopsy specimens from patients with P acnes infections. A 564 base-pair PCR amplicon was derived from all of the known P acnes strains. HaeIII digests of the amplicon yielded a restriction fragment pattern that was unique to P acnes. P acnes-specific amplicons were detected in as few as 10 bacterial cells and in clinical biopsy specimens of infected shoulder tissues. This PCR-RFLP assay combines the sensitivity of PCR with the specificity of RFLP mapping to identify P acnes in surgical isolates. The assay is robust and rapid, and a P acnes-positive tissue specimen can be confirmed within 24 hours of sampling, facilitating treatment decision making, targeted antibiotic therapy, and monitoring to minimize implant failure and revision surgery. Copyright © 2017 Journal of Shoulder and Elbow Surgery Board of Trustees. Published by Elsevier Inc. All rights reserved.

A simple procedure for parallel sequence analysis of both strands of 5'-labeled DNA.

PubMed

Razvi, F; Gargiulo, G; Worcel, A

1983-08-01

Ligation of a 5'-labeled DNA restriction fragment results in a circular DNA molecule carrying the two 32Ps at the reformed restriction site. Double digestions of the circular DNA with the original enzyme and a second restriction enzyme cleavage near the labeled site allows direct chemical sequencing of one 5'-labeled DNA strand. Similar double digestions, using an isoschizomer that cleaves differently at the 32P-labeled site, allows direct sequencing of the now 3'-labeled complementary DNA strand. It is possible to directly sequence both strands of cloned DNA inserts by using the above protocol and a multiple cloning site vector that provides the necessary restriction sites. The simultaneous and parallel visualization of both DNA strands eliminates sequence ambiguities. In addition, the labeled circular molecules are particularly useful for single-hit DNA cleavage studies and DNA footprint analysis. As an example, we show here an analysis of the micrococcal nuclease-induced breaks on the two strands of the somatic 5S RNA gene of Xenopus borealis, which suggests that the enzyme may recognize and cleave small AT-containing palindromes along the DNA helix.

Natural (auto)antibodies in calves are affected by age and diet.

PubMed

Khobondo, Joel O; Nieuwland, Mike G B; Webb, Laura E; Bokkers, Eddie A M; Parmentier, Henk K

2015-06-01

Natural autoantibodies (N(a)ab) were found in every species tested so far, and are likely important in maintaining homeostasis. (1) To determine N(a)ab in Bos taurus calves, (2) evaluate effects of diet and age on N(a)ab binding repertoires in calves, and (3) delineate bovine liver cell lysate (BLL) antigens related with variation in rumen score and body weight. Effects of age and diet on staining of BLL fragments by IgM and IgG antibodies in serum samples collected at 20 or at 26 weeks of age from bull calves either fed a restricted or ad libitum diet were analyzed using quantitative Western blotting. Correlations between fragments stained and grouping of calves were done by Principal Component Analysis (PCA). Redundancy analysis (RDA) was done to relate rumen score and body weight variation at slaughter at 27 weeks of age with stained BLL fragments. In sera from all calves IgM and IgG antibodies binding BLL antigens were found. Corresponding fragments were stained, but quantitative differences in staining intensities were related to diet and age for both IgM and IgG. PCA revealed that age had a greater influence than diet on BLL fragment staining. RDA suggested that staining by IgM or IgG of specific BLL fragments was related with variation in rumen score and body weight. Analyses of N(a)ab in serum could be a potential tool to estimate the health status of cattle, and be used to evaluate effects of husbandry practices.

Genotyping of bacteria belonging to the former Erwinia genus by PCR-RFLP analysis of a recA gene fragment.

PubMed

Waleron, Małgorzata; Waleron, Krzysztof; Podhajska, Anna J; Lojkowska, Ewa

2002-02-01

Genotypic characterization, based on the analysis of restriction fragment length polymorphism of the recA gene fragment PCR product (recA PCR-RFLP), was performed on members of the former Erwinia genus. PCR primers deduced from published recA gene sequences of Erwinia carotovora allowed the amplification of an approximately 730 bp DNA fragment from each of the 19 Erwinia species tested. Amplified recA fragments were compared using RFLP analysis with four endonucleases (AluI, HinfI, TasI and Tru1I), allowing the detection of characteristic patterns of RFLP products for most of the Erwinia species. Between one and three specific RFLP groups were identified among most of the species tested (Erwinia amylovora, Erwinia ananas, Erwinia cacticida, Erwinia cypripedii, Erwinia herbicola, Erwinia mallotivora, Erwinia milletiae, Erwinia nigrifluens, Erwinia persicina, Erwinia psidii, Erwinia quercina, Erwinia rhapontici, Erwinia rubrifaciens, Erwinia salicis, Erwinia stewartii, Erwinia tracheiphila, Erwinia uredovora, Erwinia carotovora subsp. atroseptica, Erwinia carotovora subsp. betavasculorum, Erwinia carotovora subsp. odorifera and Erwinia carotovora subsp. wasabiae). However, in two cases, Erwinia chrysanthemi and Erwinia carotovora subsp. carotovora, 15 and 18 specific RFLP groups were detected, respectively. The variability of genetic patterns within these bacteria could be explained in terms of their geographic origin and/or wide host-range. The results indicated that PCR-RFLP analysis of the recA gene fragment is a useful tool for identification of species and subspecies belonging to the former Erwinia genus, as well as for differentiation of strains within E. carotovora subsp. carotovora and E. chrysanthemi.

Optical mapping and sequencing of the Escherichia coli KO11 genome reveal extensive chromosomal rearrangements, and multiple tandem copies of the Zymomonas mobilis pdc and adhB genes.

PubMed

Turner, Peter C; Yomano, Lorraine P; Jarboe, Laura R; York, Sean W; Baggett, Christy L; Moritz, Brélan E; Zentz, Emily B; Shanmugam, K T; Ingram, Lonnie O

2012-04-01

Escherichia coli KO11 (ATCC 55124) was engineered in 1990 to produce ethanol by chromosomal insertion of the Zymomonas mobilis pdc and adhB genes into E. coli W (ATCC 9637). KO11FL, our current laboratory version of KO11, and its parent E. coli W were sequenced, and contigs assembled into genomic sequences using optical NcoI restriction maps as templates. E. coli W contained plasmids pRK1 (102.5 kb) and pRK2 (5.4 kb), but KO11FL only contained pRK2. KO11FL optical maps made with AflII and with BamHI showed a tandem repeat region, consisting of at least 20 copies of a 10-kb unit. The repeat region was located at the insertion site for the pdc, adhB, and chloramphenicol-resistance genes. Sequence coverage of these genes was about 25-fold higher than average, consistent with amplification of the foreign genes that were inserted as circularized DNA. Selection for higher levels of chloramphenicol resistance originally produced strains with higher pdc and adhB expression, and hence improved fermentation performance, by increasing the gene copy number. Sequence data for an earlier version of KO11, ATCC 55124, indicated that multiple copies of pdc adhB were present. Comparison of the W and KO11FL genomes showed large inversions and deletions in KO11FL, mostly enabled by IS10, which is absent from W but present at 30 sites in KO11FL. The early KO11 strain ATCC 55124 had no rearrangements, contained only one IS10, and lacked most accumulated single nucleotide polymorphisms (SNPs) present in KO11FL. Despite rearrangements and SNPs in KO11FL, fermentation performance was equal to that of ATCC 55124.

Association of N2-fixing cyanobacteria and plants: towards novel symbioses of agricultural importance

DOE Office of Scientific and Technical Information (OSTI.GOV)

Elhai, Jeff

2001-06-25

Some nitrogen-fixing cyanobacteria are able to form symbioses with a wide variety of plants. Nostoc 2S9B is unusual in its ability to infect the roots of wheat, raising the prospect of a productive association with an important crop plant. The goal of the project was to lay the groundwork for the use of novel associations between Nostoc and crops of agronomic importance, thereby reducing our reliance on nitrogenous fertilizer. Nostoc 2S9B was found to enter roots through mechanical damage of roots and reside primarily in intercellular spaces. The strain could also be incorporated into wheat calli grown in tissue culture.more » In both cases, the rate of nitrogen fixation by the cyanobacterium was higher than that of the same strain grown with no plant present. Artificial nodules induced by the action of hormone 2,4D were readily infected by Nostoc 2S9B, and the cyanobacteria within such nodules fixed nitrogen under fully aerobic conditions. The nitrogen fixed was shown to be incorporated into the growing wheat seedlings. Nostoc thus differs from other bacteria in its ability to fix nitrogen in para-nodules without need for artificially microaerobic conditions. It would be useful to introduce foreign DNA into Nostoc 2S9B in order to make defined mutations to understand the genetic basis of its ability to infect wheat and to create strains that might facilitate the study of the infection process. Transfer of DNA into the cyanobacterium appears to be limited by the presence of four restriction enzymes, with recognition sequences the same as BamHI, BglI, BsaHI, and Tth111I. Genes encoding methyltransferases that protect DNA against these four enzymes have been cloned into helper plasmids to allow transfer of DNA from E. coli to Nostoc 2S9B.« less

Use of molecular markers to compare Fusarium verticillioides pathogenic strains isolated from plants and humans.

PubMed

Chang, S C; Macêdo, D P C; Souza-Motta, C M; Oliveira, N T

2013-08-12

Fusarium verticillioides is a pathogen of agriculturally important crops, especially maize. It is considered one of the most important pathogens responsible for fumonisin contamination of food products, which causes severe, chronic, and acute intoxication in humans and animals. Moreover, it is recognized as a cause of localized infections in immunocompetent patients and disseminated infections among severely immunosuppressed patients. Several molecular tools have been used to analyze the intraspecific variability of fungi. The objective of this study was to use molecular markers to compare pathogenic isolates of F. verticillioides and isolates of the same species obtained from clinical samples of patients with Fusarium mycoses. The molecular markers that we used were inter-simple sequence repeat markers (primers GTG5 and GACA4), intron splice site primer (primer EI1), random amplified polymorphic DNA marker (primer OPW-6), and restriction fragment length polymorphism-internal transcribed spacer (ITS) from rDNA. From the data obtained, clusters were generated based on the UPGMA clustering method. The amplification products obtained using primers ITS4 and ITS5 and loci ITS1-5.8-ITS2 of the rDNA yielded fragments of approximately 600 bp for all the isolates. Digestion of the ITS region fragment using restriction enzymes such as EcoRI, DraI, BshI, AluI, HaeIII, HinfI, MspI, and PstI did not permit differentiation among pathogenic and clinical isolates. The inter-simple sequence repeat, intron splice site primer, and random amplified polymorphic DNA markers presented high genetic homogeneity among clinical isolates in contrast to the high variability found among the phytopathogenic isolates of F. verticillioides.

Comparison of repair of DNA double-strand breaks in identical sequences in primary human fibroblast and immortal hamster-human hybrid cells harboring a single copy of human chromosome 11

NASA Technical Reports Server (NTRS)

Fouladi, B.; Waldren, C. A.; Rydberg, B.; Cooper, P. K.; Chatterjee, A. (Principal Investigator)

2000-01-01

We have optimized a pulsed-field gel electrophoresis assay that measures induction and repair of double-strand breaks (DSBs) in specific regions of the genome (Lobrich et al., Proc. Natl. Acad. Sci. USA 92, 12050-12054, 1995). The increased sensitivity resulting from these improvements makes it possible to analyze the size distribution of broken DNA molecules immediately after the introduction of DSBs and after repair incubation. This analysis shows that the distribution of broken DNA pieces after exposure to sparsely ionizing radiation is consistent with the distribution expected from randomly induced DSBs. It is apparent from the distribution of rejoined DNA pieces after repair incubation that DNA ends continue to rejoin between 3 and 24 h postirradiation and that some of these rejoining events are in fact misrejoining events, since novel restriction fragments both larger and smaller than the original fragment are generated after repair. This improved assay was also used to study the kinetics of DSB rejoining and the extent of misrejoining in identical DNA sequences in human GM38 cells and human-hamster hybrid A(L) cells containing a single human chromosome 11. Despite the numerous differences between these cells, which include species and tissue of origin, levels of TP53, expression of telomerase, and the presence or absence of a homologous chromosome for the restriction fragments examined, the kinetics of rejoining of radiation-induced DSBs and the extent of misrejoining were similar in the two cell lines when studied in the G(1) phase of the cell cycle. Furthermore, DSBs were removed from the single-copy human chromosome in the hamster A(L) cells with similar kinetics and misrejoining frequency as at a locus on this hybrid's CHO chromosomes.

Fast structure similarity searches among protein models: efficient clustering of protein fragments

PubMed Central

2012-01-01

Background For many predictive applications a large number of models is generated and later clustered in subsets based on structure similarity. In most clustering algorithms an all-vs-all root mean square deviation (RMSD) comparison is performed. Most of the time is typically spent on comparison of non-similar structures. For sets with more than, say, 10,000 models this procedure is very time-consuming and alternative faster algorithms, restricting comparisons only to most similar structures would be useful. Results We exploit the inverse triangle inequality on the RMSD between two structures given the RMSDs with a third structure. The lower bound on RMSD may be used, when restricting the search of similarity to a reasonably low RMSD threshold value, to speed up similarity searches significantly. Tests are performed on large sets of decoys which are widely used as test cases for predictive methods, with a speed-up of up to 100 times with respect to all-vs-all comparison depending on the set and parameters used. Sample applications are shown. Conclusions The algorithm presented here allows fast comparison of large data sets of structures with limited memory requirements. As an example of application we present clustering of more than 100000 fragments of length 5 from the top500H dataset into few hundred representative fragments. A more realistic scenario is provided by the search of similarity within the very large decoy sets used for the tests. Other applications regard filtering nearly-indentical conformation in selected CASP9 datasets and clustering molecular dynamics snapshots. Availability A linux executable and a Perl script with examples are given in the supplementary material (Additional file 1). The source code is available upon request from the authors. PMID:22642815

DNA Probes Show Genetic Variation in Cyanobacterial Symbionts of the Azolla Fern and a Closer Relationship to Free-Living Nostoc Strains than to Free-Living Anabaena Strains

PubMed Central

Plazinski, Jacek; Zheng, Qi; Taylor, Rona; Croft, Lynn; Rolfe, Barry G.; Gunning, Brian E. S.

1990-01-01

Twenty-two isolates of Anabaena azollae derived from seven Azolla species from various geographic and ecological sources were characterized by DNA-DNA hybridization. Cloned DNA fragments derived from the genomic sequences of three different A. azollae isolates were used to detect restriction fragment length polymorphism among all symbiotic anabaenas. DNA clones were radiolabeled and hybridized against southern blot transfers of genomic DNAs of different isolates of A. azollae digested with restriction endonucleases. Eight DNA probes were selected to identify the Anabaena strains tested. Two were strain specific and hybridized only to A. azollae strains isolated from Azolla microphylla or Azolla caroliniana. One DNA probe was section specific (hybridized only to anabaenas isolated from Azolla ferns representing the section Euazolla), and five other probes gave finer discrimination among anabaenas representing various ecotypes of Azolla species. These cloned genomic DNA probes identified 11 different genotypes of A. azollae isolates. These included three endosymbiotic genotypes within Azolla filiculoides species and two genotypes within both A. caroliniana and Azolla pinnata endosymbionts. Although we were not able to discriminate among anabaenas extracted from different ecotypes of Azolla nilotica, Azolla mexicina, Azolla rubra and Azolla microphylla species, each of the endosymbionts was easily identified as a unique genotype. When total DNA isolated from free-living Anabaena sp. strain PCC7120 was screened, none of the genomic DNA probes gave detectable positive hybridization. Total DNA of Nostoc cycas PCC7422 hybridized with six of eight genomic DNA fragments. These data imply that the dominant symbiotic organism in association with Azolla spp. is more closely related to Nostoc spp. than to free-living Anabaena spp. Images PMID:16348182

Genotypic lineages and restriction fragment length polymorphism of canine distemper virus isolates in Thailand.

PubMed

Radtanakatikanon, Araya; Keawcharoen, Juthatip; Charoenvisal, Na Taya; Poovorawan, Yong; Prompetchara, Eakachai; Yamaguchi, Ryoji; Techangamsuwan, Somporn

2013-09-27

Canine distemper virus (CDV) is known to cause multisystemic disease in all families of terrestrial carnivores. Attenuated live vaccines have been used to control CDV in a variety of species for many decades, yet a number of CDV infections in vaccinated dogs are still observed. The aims of this study were to investigate the genetic diversity of CDV lineages based on phosphoprotein (P), hemagglutinin (H) and fusion protein (F) genes and to develop the restriction fragment length polymorphism (RFLP) technique for effective differentiation among individual wild-type and vaccine lineages in Thailand. Four commercial vaccine products, thirteen conjunctival swabs and various tissues from 9 necropsied dogs suspected of having CDV infections were included. Virus isolation was performed using Vero cell expressing canine signaling lymphocyte activation molecules (Vero-DST cells). Reverse-transcription polymerase chain reaction (RT-PCR) on 3 gene regions from the dog derived specimens and the vaccines were carried out, then RFLP analysis upon F-gene amplified fragments was developed. Nucleotide sequence and phylogenetic analysis were compared with other CDV lineages in Genbank. Phylogenetic relationships revealed that CDV field isolates were separated from the vaccine lineage and could be divided into two clusters; one of which belonged to the Asia-1 lineage and another, not related to any previous recognized lineages was proposed as 'Asia-4'. RFLP patterns demonstrating concordance with phylogenetic trees of the distemper virus allowed for differentiation between the Asia-1, Asia-4 and vaccine lineages. Thus, RFLP technique is able to effectively distinguish individual wild-type canine distemper virus from vaccine lineages in Thailand. Copyright © 2013 Elsevier B.V. All rights reserved.

Population genetic diversity and structure of a naturally isolated plant species, Rhodiola dumulosa (Crassulaceae).

PubMed

Hou, Yan; Lou, Anru

2011-01-01

Rhodiola dumulosa (Crassulaceae) is a perennial diploid species found in high-montane areas. It is distributed in fragmented populations across northern, central and northwestern China. In this study, we aimed to (i) measure the genetic diversity of this species and that of its populations; (ii) describe the genetic structure of these populations across the entire distribution range in China; and (iii) evaluate the extent of gene flow among the naturally fragmented populations. Samples from 1089 individuals within 35 populations of R. dumulosa were collected, covering as much of the entire distribution range of this species within China as possible. Population genetic diversity and structure were analyzed using AFLP molecular markers. Gene flow among populations was estimated according to the level of population differentiation. The total genetic diversity of R. dumulosa was high but decreased with increasing altitude. Population-structure analysis indicated that the most closely related populations were geographically restricted and occurred in close proximity to each other. A significant isolation-by-distance pattern, caused by the naturally fragmented population distribution, was observed. At least two distinct gene pools were found in the 35 sampled populations, one composed of populations in northern China and the other composed of populations in central and northwestern China. The calculation of Nei's gene diversity index revealed that the genetic diversity in the northern China pool (0.1972) was lower than that in the central and northwestern China pool (0.2216). The populations were significantly isolated, and gene flow was restricted throughout the entire distribution. However, gene flow among populations on the same mountain appears to be unrestricted, as indicated by the weak genetic isolation among these populations.

Population Genetic Diversity and Structure of a Naturally Isolated Plant Species, Rhodiola dumulosa (Crassulaceae)

PubMed Central

Hou, Yan; Lou, Anru

2011-01-01

Aims Rhodiola dumulosa (Crassulaceae) is a perennial diploid species found in high-montane areas. It is distributed in fragmented populations across northern, central and northwestern China. In this study, we aimed to (i) measure the genetic diversity of this species and that of its populations; (ii) describe the genetic structure of these populations across the entire distribution range in China; and (iii) evaluate the extent of gene flow among the naturally fragmented populations. Methods Samples from 1089 individuals within 35 populations of R. dumulosa were collected, covering as much of the entire distribution range of this species within China as possible. Population genetic diversity and structure were analyzed using AFLP molecular markers. Gene flow among populations was estimated according to the level of population differentiation. Important Findings The total genetic diversity of R. dumulosa was high but decreased with increasing altitude. Population-structure analysis indicated that the most closely related populations were geographically restricted and occurred in close proximity to each other. A significant isolation-by-distance pattern, caused by the naturally fragmented population distribution, was observed. At least two distinct gene pools were found in the 35 sampled populations, one composed of populations in northern China and the other composed of populations in central and northwestern China. The calculation of Nei's gene diversity index revealed that the genetic diversity in the northern China pool (0.1972) was lower than that in the central and northwestern China pool (0.2216). The populations were significantly isolated, and gene flow was restricted throughout the entire distribution. However, gene flow among populations on the same mountain appears to be unrestricted, as indicated by the weak genetic isolation among these populations. PMID:21909437

Impact of three global change drivers on a Mediterranean shrub.

PubMed

Matesanz, Silvia; Escudero, Adrián; Valladares, Fernando

2009-09-01

Global change is not restricted to climate change, and plant species generally face multiple human-driven disturbances constraining their viability. Most importantly, interactions among these drivers frequently generate nonadditive effects that cannot be predicted based on single-factor studies. Our goal was to assess the joint effects of three global change drivers that are especially relevant in Mediterranean ecosystems, namely, fragmentation, reduced habitat quality, and climate change on Centaurea hyssopifolia, a gypsum specialist plant. We carried out a two-year study (2005-2006) in natural populations of this plant in large (>11 ha) and small (< 1.5 ha) fragments. Within each fragment, we identified areas of contrasting habitat quality as revealed by plant cover and nutrient content, and within each combination of habitat quality and fragment size we performed a rainfall manipulation experiment simulating the most likely future climate scenario for the region. Survival, growth, phenology, and reproductive success of selected plants were monitored. The three drivers profoundly affected responses of Centaurea hyssopifolia in both study years, phenology being mainly affected by changes in habitat quality and reductions in rainfall and reproductive traits being mainly affected by fragmentation. Plants in sites of poor habitat quality and plants in the dry treatment advanced most of their phenophases (flowering and dispersing earlier) and showed reduced growth rate and increased fraction of senescent leaves. Plants growing in small fragments had lower survival, lower number of viable seeds, and a reduced seed set compared to those from large fragments. We found significant synergistic interactions among drivers. For example, the interaction between fragmentation and habitat quality led to lower survival and lower relative growth in plants from small and poor-quality habitat sites. Our results highlight the importance of studies addressing simultaneously all relevant drivers of global change potentially affecting plant performance under natural conditions. In addition, the complex responses of phenology and reproductive traits of C. hyssopifolia emphasize the need for studies integrating traits from vegetative to reproductive and from the organ to the whole-plant level.

Matrix-assisted laser desorption/ionisation time-of-flight mass spectrometry. A comparison of fragmentation patterns of linear dextran obtained by in-source decay, post-source decay and collision-induced dissociation and the stability of linear and cyclic glucans studied by in-source decay.

PubMed

Bashir, Sajid; Giannakopulos, Anastassios E; Derrick, Peter J; Critchley, Peter; Bottrill, Andrew; Padley, Henry J

2004-01-01

In the first part of this study fragmentation patterns from a range of dextran oligomers (containing 4-20 anhydroglucose units) were compared in three different methods of analysis coupled with matrix-assisted laser desorption/ionisation (MALDI) mass spectrometry. Collision-induced-dissociation (CID), prompt in-source decay (ISD) and post-source decay (PSD) all caused cleavage of the glycosidic bonds. Both CID and to a lesser extent ISD caused further cleavage of pyranose rings of the individual sugar residues. There was very little cleavage of pyranose rings detected in the PSD spectrum. Derivatisation of the reducing end-groups of the oligodextrans with 1-phenyl-3-methyl-5-pyrazolone (PMP) restricted cleavage in the MALDI mass spectrometer to the non-reducing end, and further it enabled the saccharides to be separated by HPLC so that a single chain length could be examined as a standard. Maltoheptaose was also used as a standard. In the second part of the study prompt ISD-MALDI mass spectrometry was used to compare the fragmentation of three oligoglucans, dextran, maltodextrin and gamma cyclodextrin, that have different linkages and different secondary structure. The results showed that the degree of fragmentation correlated with the degree of freedom in the saccharide chains in solution determined by NMR. Dextran the most random conformation was fragmented most whereas there was little evidence of any fragments, not even glycosidic bond breakage from cyclodextrin, even when the laser power was increased considerably. The fragmentation pattern of maltodextrin was intermediate. The patterns of fragmentation produced by MALDI mass spectrometry, particularly where standards are available to calibrate the spectrum and the energy of the laser is controlled, can be used to predict the type of linkage present.

A Semester-Long Project for Teaching Basic Techniques in Molecular Biology Such as Restriction Fragment Length Polymorphism Analysis to Undergraduate and Graduate Students

ERIC Educational Resources Information Center

DiBartolomeis, Susan M.

2011-01-01

Several reports on science education suggest that students at all levels learn better if they are immersed in a project that is long term, yielding results that require analysis and interpretation. I describe a 12-wk laboratory project suitable for upper-level undergraduates and first-year graduate students, in which the students molecularly…

Sequencing of the Chlamydophila psittaci ompA Gene Reveals a New Genotype, E/B, and the Need for a Rapid Discriminatory Genotyping Method

PubMed Central

Geens, Tom; Desplanques, Ann; Van Loock, Marnix; Bönner, Brigitte M.; Kaleta, Erhard F.; Magnino, Simone; Andersen, Arthur A.; Everett, Karin D. E.; Vanrompay, Daisy

2005-01-01

Twenty-one avian Chlamydophila psittaci isolates from different European countries were characterized using ompA restriction fragment length polymorphism, ompA sequencing, and major outer membrane protein serotyping. Results reveal the presence of a new genotype, E/B, in several European countries and stress the need for a discriminatory rapid genotyping method. PMID:15872282

Varicella zoster virus DNA exists as two isomers.

PubMed Central

Ecker, J R; Hyman, R W

1982-01-01

Fragments of varicella zoster virus DNA produced by EcoRI endonuclease cleavage were cloned in vector pACYC 184 and those produced by HindIII cleavage were cloned in pBR322. Restriction enzyme cleavage maps established by double digestion and blot hybridization showed that varicella zoster virus DNA has a Mr of 80 +/- 3 x 10(6) and exists as a population of two isomers. Images PMID:6275385

Rapid and cost-effective method for the detection of the c.533G>A mutation in the HEXA gene.

PubMed

Ribeiro, Diogo; Duarte, Ana Joana; Amaral, Olga

2011-03-01

Tay-Sachs disease is a rare autosomal recessive neurodegenerative disorder that results from mutations in the HEXA gene, leading to β-hexosaminidase A (HexA) α subunit deficiency. An unusual variant of Tay-Sachs disease is known as the B1 variant. Previous studies indicated that, in northern Portugal, this is not only the most common variant but also one of the most prevalent lysosomal storage diseases. Additionally, this variant might also show a higher prevalence in populations of Portuguese and Spanish ancestry. A single mutation is invariably present in at least one of the alleles of B1 variant patients, HEXA mutation c.533G >A. To implement a method for c.533G >A testing in individuals and populations, we have optimized two distinct mutation analysis techniques, one based on restriction fragment length polymorphism analysis and the other based on allelic discrimination. We present the comparison of both methods and their advantages. Mutation screening by allelic discrimination proved to be particularly useful for the studying of large samples of individuals. It is time saving and highly reproducible, and under the conditions used, its cost is lower than the cost of polymerase chain reaction-based restriction fragment length polymorphism analysis.

Community composition of lacustrine small eukaryotes in hyper-eutrophic conditions in relation to top-down and bottom-up factors.

PubMed

Lepère, Cécile; Domaizon, Isabelle; Debroas, Didier

2007-09-01

Small eukaryotes (0.2-5 microm) in hyper-eutrophic conditions were described using terminal restriction fragment length polymorphism and cloning-sequencing, and were related to environmental variables both by an experimental approach and by a temporal field study. In situ analysis showed marked temporal variations in the dominant terminal restriction fragments (T-RFs), which were related to environmental variables such as nutrient concentrations and metazooplankton composition. To monitor the responses of the small-eukaryote community to top-down (absence or presence of planktivorous fish) and bottom-up (low or high nitrogen and phosphorus addition) effects, a cross-classified design mesocosm experiment was used. Depending on the type of treatment, we recorded changes in the diversity of T-RFs, as well as modifications in phylogenetic composition. Centroheliozoa and Cryptophyta were found in all types of treatment, whereas Chlorophyta were specific to enclosures receiving high nutrient loadings, and were associated either with LKM11 and 'environmental sequences'. Cercozoa and Fungi were not detected in enclosures receiving high nutrient loadings and fishes. Our results showed that resources and top-down factors are both clearly involved in shaping the structure of small eukaryotes, not only autotrophs but also heterotrophs, via complex interactions and trophic cascades within a microbial loop, notably in response to nutrient loading.

Isolation of a species-specific mitochondrial DNA sequence for identification of Tilletia indica, the Karnal bunt of wheat fungus.

PubMed Central

Ferreira, M A; Tooley, P W; Hatziloukas, E; Castro, C; Schaad, N W

1996-01-01

Mitochondrial DNA (mtDNA) from five isolates of Tilletia indica was isolated and digested with several restriction enzymes. A 2.3-kb EcoRI fragment was chosen, cloned, and shown to hybridize with total DNA restricted with EcoRI from T. indica and not from a morphologically similar smut fungus, Tilletia barclayana. The clone was partially sequenced, and primers were designed and tested under high-stringency conditions in PCR assays. The primer pair Ti1/Ti4 amplified a 2.3-kb fragment from total DNA of 17 T. indica isolates from India, Pakistan, and Mexico. DNA from 25 isolates of other smut fungi (T. barclayana, Tilletia foetida, Tilletia caries, Tilletia fusca, and Tilletia controversa) did not produce any bands, as detected by ethidium bromide-stained agarose gels and Southern hybridizations. The sensitivity of the assay was determined and increased by using a single nested primer in a second round of amplification, so that 1 pg of total mycelial DNA could be detected. The results indicated that the primers which originated from a cloned mtDNA sequence can be used to differentiate T. indica from other Tilletia species and have the potential to identify teliospores contaminating wheat seeds. PMID:8572716

Bacterial adhesion affinities of various implant abutment materials.

PubMed

Yamane, Koichi; Ayukawa, Yasunori; Takeshita, Toru; Furuhashi, Akihiro; Yamashita, Yoshihisa; Koyano, Kiyoshi

2013-12-01

To investigate bacterial adhesion to various abutment materials. Thirty volunteers participated in this study. Resin splints were fabricated, and five types of disks were fabricated from pure titanium, gold-platinum alloy, zirconia, alumina, and hydroxyapatite with uniform surface roughness and attached to the buccal surface of each splint. After 4 days of use by the subjects, the plaque accumulated on the disk surfaces was analyzed. The bacterial community structure was evaluated using 16S rRNA gene profiling with terminal restriction fragment length polymorphism analysis. The total bacterial count on each disk was estimated using quantitative polymerase chain reaction. Terminal restriction fragment length polymorphism profiles were more similar between tested materials than between subjects, suggesting that the bacterial community structures on the abutment material were influenced more by the individuals than by the type of material. However, the total number of bacteria attached to a disk was significantly different among five materials (P < 0.001, Brunner-Langer test for longitudinal data). Fewer bacteria were attached to the gold-platinum alloy than to the other materials. Gold-platinum alloy appears to be useful material for abutments when considering the accumulation of plaque. However, alternative properties of the abutment material, such as effects on soft tissue healing, should also be taken into consideration when choosing an abutment material. © 2012 John Wiley & Sons A/S.

The genetic map of finger millet, Eleusine coracana.

PubMed

Dida, Mathews M; Srinivasachary; Ramakrishnan, Sujatha; Bennetzen, Jeffrey L; Gale, Mike D; Devos, Katrien M

2007-01-01

Restriction fragment length polymorphism (RFLP), amplified fragment length polymorphism (AFLP), expressed-sequenced tag (EST), and simple sequence repeat (SSR) markers were used to generate a genetic map of the tetraploid finger millet (Eleusine coracana subsp. coracana) genome (2n = 4x = 36). Because levels of variation in finger millet are low, the map was generated in an inter-subspecific F(2) population from a cross between E. coracana subsp. coracana cv. Okhale-1 and its wild progenitor E. coracana subsp. africana acc. MD-20. Duplicated loci were used to identify homoeologous groups. Assignment of linkage groups to the A and B genome was done by comparing the hybridization patterns of probes in Okhale-1, MD-20, and Eleusine indica acc. MD-36. E. indica is the A genome donor to E. coracana. The maps span 721 cM on the A genome and 787 cM on the B genome and cover all 18 finger millet chromosomes, at least partially. To facilitate the use of marker-assisted selection in finger millet, a first set of 82 SSR markers was developed. The SSRs were identified in small-insert genomic libraries generated using methylation-sensitive restriction enzymes. Thirty-one of the SSRs were mapped. Application of the maps and markers in hybridization-based breeding programs will expedite the improvement of finger millet.

DNA variation of the mammalian major histocompatibility complex reflects genomic diversity and population history.

PubMed Central

Yuhki, N; O'Brien, S J

1990-01-01

The major histocompatibility complex (MHC) is a multigene complex of tightly linked homologous genes that encode cell surface antigens that play a key role in immune regulation and response to foreign antigens. In most species, MHC gene products display extreme antigenic polymorphism, and their variability has been interpreted to reflect an adaptive strategy for accommodating rapidly evolving infectious agents that periodically afflict natural populations. Determination of the extent of MHC variation has been limited to populations in which skin grafting is feasible or for which serological reagents have been developed. We present here a quantitative analysis of restriction fragment length polymorphism of MHC class I genes in several mammalian species (cats, rodents, humans) known to have very different levels of genetic diversity based on functional MHC assays and on allozyme surveys. When homologous class I probes were employed, a notable concordance was observed between the extent of MHC restriction fragment variation and functional MHC variation detected by skin grafts or genome-wide diversity estimated by allozyme screens. These results confirm the genetically depauperate character of the African cheetah, Acinonyx jubatus, and the Asiatic lion, Panthera leo persica; further, they support the use of class I MHC molecular reagents in estimating the extent and character of genetic diversity in natural populations. Images PMID:1967831

Aspergillus Section Fumigati Typing by PCR-Restriction Fragment Polymorphism▿

PubMed Central

Staab, Janet F.; Balajee, S. Arunmozhi; Marr, Kieren A.

2009-01-01

Recent studies have shown that there are multiple clinically important members of the Aspergillus section Fumigati that are difficult to distinguish on the basis of morphological features (e.g., Aspergillus fumigatus, A. lentulus, and Neosartorya udagawae). Identification of these organisms may be clinically important, as some species vary in their susceptibilities to antifungal agents. In a prior study, we utilized multilocus sequence typing to describe A. lentulus as a species distinct from A. fumigatus. The sequence data show that the gene encoding β-tubulin, benA, has high interspecies variability at intronic regions but is conserved among isolates of the same species. These data were used to develop a PCR-restriction fragment length polymorphism (PCR-RFLP) method that rapidly and accurately distinguishes A. fumigatus, A. lentulus, and N. udagawae, three major species within the section Fumigati that have previously been implicated in disease. Digestion of the benA amplicon with BccI generated unique banding patterns; the results were validated by screening a collection of clinical strains and by in silico analysis of the benA sequences of Aspergillus spp. deposited in the GenBank database. PCR-RFLP of benA is a simple method for the identification of clinically important, similar morphotypes of Aspergillus spp. within the section Fumigati. PMID:19403766

Aspergillus section Fumigati typing by PCR-restriction fragment polymorphism.

PubMed

Staab, Janet F; Balajee, S Arunmozhi; Marr, Kieren A

2009-07-01

Recent studies have shown that there are multiple clinically important members of the Aspergillus section Fumigati that are difficult to distinguish on the basis of morphological features (e.g., Aspergillus fumigatus, A. lentulus, and Neosartorya udagawae). Identification of these organisms may be clinically important, as some species vary in their susceptibilities to antifungal agents. In a prior study, we utilized multilocus sequence typing to describe A. lentulus as a species distinct from A. fumigatus. The sequence data show that the gene encoding beta-tubulin, benA, has high interspecies variability at intronic regions but is conserved among isolates of the same species. These data were used to develop a PCR-restriction fragment length polymorphism (PCR-RFLP) method that rapidly and accurately distinguishes A. fumigatus, A. lentulus, and N. udagawae, three major species within the section Fumigati that have previously been implicated in disease. Digestion of the benA amplicon with BccI generated unique banding patterns; the results were validated by screening a collection of clinical strains and by in silico analysis of the benA sequences of Aspergillus spp. deposited in the GenBank database. PCR-RFLP of benA is a simple method for the identification of clinically important, similar morphotypes of Aspergillus spp. within the section Fumigati.

Synthesis and antioxidant activity of polyhydroxylated trans-restricted 2-arylcinnamic acids.

PubMed

Miliovsky, Mitko; Svinyarov, Ivan; Prokopova, Elena; Batovska, Daniela; Stoyanov, Simeon; Bogdanov, Milen G

2015-02-02

A series of sixteen polyhydroxylated trans-restricted 2-arylcinnamic acid analogues 3a-p were synthesized through a one-pot reaction between homophthalic anhydrides and various aromatic aldehydes, followed by treatment with BBr3. The structure of the newly synthesized compounds was confirmed by spectroscopic methods and the configuration around the double bond was unequivocally estimated by means of gated decoupling 13C-NMR spectra. It was shown that the trans-cinnamic acid fragment incorporated into the target compounds' structure ensures the cis-configuration of the stilbene backbone and prevents further isomerization along the carbon-carbon double bond. The antioxidant activity of compounds 3a-p was measured against 1,1-diphenyl-2-picrylhydrazyl (DPPH●), hydroxyl (OH●) and superoxide (O2●▬) radicals. The results obtained showed that the tested compounds possess higher activities than natural antioxidants such as protocatechuic acid, caffeic acid and gallic acid. Moreover, it was shown that a combination of two different and independently acting fragments of well-known pharmacological profiles into one covalently bonded hybrid molecule evoke a synergistic effect resulting in higher than expected activity. To rationalize the apparent antioxidant activity and to establish the mechanism of action, a SAR analysis and DFT quantum chemical computations were also performed.

A comparison of restriction fragment length polymorphism, tetra primer amplification refractory mutation system PCR and unlabeled probe melting analysis for LTA+252 C>T SNP genotyping.

PubMed

Soler, Stephan; Rittore, Cécile; Touitou, Isabelle; Philibert, Laurent

2011-02-20

From the wide range of methods currently available for genotyping, we wished to identify a quick, reliable and affordable approach for routine use in our laboratory for LTA+252 C>T SNP screening. We set up and compared three genotyping methods for SNP detection: restriction fragment length polymorphism (RFLP), tetra primer amplification refractory mutation system PCR (TPAP) and unlabeled probe melting analysis (UPMA). The SNP model used was LTA+252 C>T, a cytokine gene polymorphism that has been associated with response to treatment in rheumatoid arthritis. The study was performed using 46 samples from healthy Caucasian volunteers. Allele and genotype distribution was similar to that previously described in the same population. All three genotyping methods showed good reproducibility and are suitable for a medium scale throughput molecular platform. UPMA was the most cost effective, reliable and safe method since it required the shortest technician time, could be performed in a single closed tube and involved automatic data analysis. This work is the first to compare these three genotyping techniques and provides evidence for UPMA being the method of choice for LTA+252 C>T SNP genotyping. Copyright © 2010 Elsevier B.V. All rights reserved.

Genetic Heterogeneity in Mycobacterium tuberculosis Isolates Reflected in IS6110 Restriction Fragment Length Polymorphism Patterns as Low-Intensity Bands

PubMed Central

de Boer, Annette S.; Kremer, Kristin; Borgdorff, Martien W.; de Haas, Petra E. W.; Heersma, Herre F.; van Soolingen, Dick

2000-01-01

Mycobacterium tuberculosis isolates with identical IS6110 restriction fragment length polymorphism (RFLP) patterns are considered to originate from the same ancestral strain and thus to reflect ongoing transmission. In this study, we investigated 1,277 IS6110 RFLP patterns for the presence of multiple low-intensity bands (LIBs), which may indicate infections with multiple M. tuberculosis strains. We did not find any multiple LIBs, suggesting that multiple infections are rare in the Netherlands. However, we did observe a few LIBs in 94 patterns (7.4%) and examined the nature of this phenomenon. With single-colony cultures it was found that LIBs mostly represent mixed bacterial populations with slightly different RFLP patterns. Mixtures were expressed in RFLP patterns as LIBs when 10 to 30% of the DNA analyzed originated from a bacterial population with another RFLP pattern. Presumably, a part of the LIBs did not represent mixed bacterial populations, as in some clusters all strains exhibited LIBs in their RFLP patterns. The occurrence of LIBs was associated with increased age in patients. This may reflect either a gradual change of the bacterial population in the human body over time or IS6110-mediated genetic adaptation of M. tuberculosis to changes in the environmental conditions during the dormant state or reactivation thereafter. PMID:11101583

Differences in the second internal transcribed spacer of four species of Nematodirus (Nematoda: Molineidae).

PubMed

Newton, L A; Chilton, N B; Beveridge, I; Gasser, R B

1998-02-01

Genetic differences among Nematodirus spathiger, Nematodirus filicollis, Nematodirus helvetianus and Nematodirus battus in the nucleotide sequence of the second internal transcribed spacer (ITS-2) of ribosomal DNA ranged from 3.9 to 24.7%. Pairwise comparisons of their ITS-2 sequences indicated that the most genetically similar species were N. spathiger and N. helvetianus. N. battus was the most genetically distinct species, with differences ranging from 22.8 to 24.7% with respect to the other three species. Some of the nucleotide differences among species provided different endonuclease restriction sites that could be used in restriction fragment length polymorphism studies. The ITS-2 sequence data may prove useful in studies of the systematics of molineid nematodes.

Cloning of polymorphisms (COP): enrichment of polymorphic sequences from complex genomes

PubMed Central

Li, Jingfeng; Wang, Fuli; Zabarovska, Veronika; Wahlestedt, Claes; Zabarovsky, Eugene R.

2000-01-01

Here we describe a new procedure (cloning of polymorphisms, COP) for enrichment of single nucleotide polymorphisms (SNPs) that represent restriction fragment length polymorphisms (RFLPs). COP would be applicable to the isolation of SNPs from particular regions of the genome, e.g. CpG islands, chromosomal bands, YACs or PAC contigs. A combination of digestion with restriction enzymes, treatment with uracil-DNA glycosylase and mung bean nuclease, PCR amplification and purification with streptavidin magnetic beads was used to isolate polymorphic sequences from the genomes of two human samples. After only two cycles of enrichment, 80% of the isolated clones were found to contain RFLPs. A simple method for the PCR detection of these polymorphisms was also developed. PMID:10606669

An introduction to issues of habitat fragmentation relative to transportation corridors with special reference to high-speed rail (HSR)

NASA Astrophysics Data System (ADS)

de Santo, Robert S.; Smith, Dwight G.

1993-01-01

Potential environmental impacts on wildlife result from siting and construction (short-term impacts) and habitat removal and fragmentation (long-term impacts) as a consequence of transportation corridor construction. Especially in rural districts, wildlife migration corridors and dispersal orientation are altered or destroyed and wildlife populations and their gene pools are isolated. This significantly weakens the wildlife community. Prudent selection of construction corridors reduces fragmentation impacts by maximizing preserved fragment sizes, and by running parallel to, not through, natural areas. Corridor width determines the degree to which wildlife movement is restricted except that culverts, underpasses, overpasses, and one-way gates, can aid wildlife in cross movements. Minimum underpass dimensions for large wildlife should be no smaller than 14 ft×14 ft and should include natural substratum inverts. Rail corridors have four characteristics that minimize adverse environmental impacts. The railbed is dry, ballast fillters runoff, there is little runoff beyond the toe of slope, and drainage ditches serve to control sheet flow and erosion, sediment movement, and uncontrolled channel flow. Rail corridors usually occupy smaller land areas because they are narrower and are more feasible to elevate so as to allow free movement of wildlife across the corridor.

Analysis of DNA Cytosine Methylation Patterns Using Methylation-Sensitive Amplification Polymorphism (MSAP).

PubMed

Guevara, María Ángeles; de María, Nuria; Sáez-Laguna, Enrique; Vélez, María Dolores; Cervera, María Teresa; Cabezas, José Antonio

2017-01-01

Different molecular techniques have been developed to study either the global level of methylated cytosines or methylation at specific gene sequences. One of them is the methylation-sensitive amplified polymorphism technique (MSAP) which is a modification of amplified fragment length polymorphism (AFLP). It has been used to study methylation of anonymous CCGG sequences in different fungi, plants, and animal species. The main variation of this technique resides on the use of isoschizomers with different methylation sensitivity (such as HpaII and MspI) as a frequent-cutter restriction enzyme. For each sample, MSAP analysis is performed using both EcoRI/HpaII- and EcoRI/MspI-digested samples. A comparative analysis between EcoRI/HpaII and EcoRI/MspI fragment patterns allows the identification of two types of polymorphisms: (1) methylation-insensitive polymorphisms that show common EcoRI/HpaII and EcoRI/MspI patterns but are detected as polymorphic amplified fragments among samples and (2) methylation-sensitive polymorphisms which are associated with the amplified fragments that differ in their presence or absence or in their intensity between EcoRI/HpaII and EcoRI/MspI patterns. This chapter describes a detailed protocol of this technique and discusses the modifications that can be applied to adjust the technology to different species of interest.

Fragment-based modelling of single stranded RNA bound to RNA recognition motif containing proteins

PubMed Central

de Beauchene, Isaure Chauvot; de Vries, Sjoerd J.; Zacharias, Martin

2016-01-01

Abstract Protein-RNA complexes are important for many biological processes. However, structural modeling of such complexes is hampered by the high flexibility of RNA. Particularly challenging is the docking of single-stranded RNA (ssRNA). We have developed a fragment-based approach to model the structure of ssRNA bound to a protein, based on only the protein structure, the RNA sequence and conserved contacts. The conformational diversity of each RNA fragment is sampled by an exhaustive library of trinucleotides extracted from all known experimental protein–RNA complexes. The method was applied to ssRNA with up to 12 nucleotides which bind to dimers of the RNA recognition motifs (RRMs), a highly abundant eukaryotic RNA-binding domain. The fragment based docking allows a precise de novo atomic modeling of protein-bound ssRNA chains. On a benchmark of seven experimental ssRNA–RRM complexes, near-native models (with a mean heavy-atom deviation of <3 Å from experiment) were generated for six out of seven bound RNA chains, and even more precise models (deviation < 2 Å) were obtained for five out of seven cases, a significant improvement compared to the state of the art. The method is not restricted to RRMs but was also successfully applied to Pumilio RNA binding proteins. PMID:27131381

Genetic Variability of Stolbur Phytoplasma in Hyalesthes obsoletus (Hemiptera: Cixiidae) and its Main Host Plants in Vineyard Agroecosystems.

PubMed

Landi, Lucia; Riolo, Paola; Murolo, Sergio; Romanazzi, Gianfranco; Nardi, Sandro; Isidoro, Nunzio

2015-08-01

Bois noir is an economically important grapevine yellows that is induced by 'Candidatus Phytoplasma solani' and principally vectored by the planthopper Hyalesthes obsoletus Signoret (Hemiptera: Cixiidae). This study explores the 'Ca. P. solani' genetic variability associated to the nettle-H. obsoletus and bindweed-H. obsoletus systems in vineyard agroecosystems of the central-eastern Italy. Molecular characterization of 'Ca. P. solani' isolates was carried out using polymerase chain reaction/restriction fragment length polymorphism to investigate the nonribosomal vmp1 gene. Seven phytoplasma vmp-types were detected among the host plants- and insect-associated field-collected samples. The vmp1 gene showed the highest polymorphism in the bindweed-H. obsoletus system, according to restriction fragment length polymorphism analysis, which is in agreement with nucleotide sequence analysis. Five vmp-types were associated with H. obsoletus from bindweed, of which one was solely restricted to planthoppers, with one genotype also in planthoppers from nettle. Type V12 was the most prevalent in both planthoppers and bindweed. H. obsoletus from nettle harbored three vmp-types, of which V3 was predominant. V3 was the only type detected for nettle. Our data demonstrate that planthoppers might have acquired some 'Ca. P. solani' profiles from other plant hosts before landing on nettle or bindweed. Overall, the different vmp1 gene rearrangements observed in these two plant hosts-H. obsoletus systems might represent different adaptations of the pathogen to the two host plants. Molecular information about the complex of vmp-types provides useful data for better understanding of Bois noir epidemiology in vineyard agroecosystem. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Characterization of proviruses cloned from mink cell focus-forming virus-infected cellular DNA.

PubMed Central

Khan, A S; Repaske, R; Garon, C F; Chan, H W; Rowe, W P; Martin, M A

1982-01-01

Two proviruses were cloned from EcoRI-digested DNA extracted from mink cells chronically infected with AKR mink cell focus-forming (MCF) 247 murine leukemia virus (MuLV), using a lambda phage host vector system. One cloned MuLV DNA fragment (designated MCF 1) contained sequences extending 6.8 kilobases from an EcoRI restriction site in the 5' long terminal repeat (LTR) to an EcoRI site located in the envelope (env) region and was indistinguishable by restriction endonuclease mapping for 5.1 kilobases (except for the EcoRI site in the LTR) from the 5' end of AKR ecotropic proviral DNA. The DNA segment extending from 5.1 to 6.8 kilobases contained several restriction sites that were not present in the AKR ecotropic provirus. A 0.5-kilobase DNA segment located at the 3' end of MCF 1 DNA contained sequences which hybridized to a xenotropic env-specific DNA probe but not to labeled ecotropic env-specific DNA. This dual character of MCF 1 proviral DNA was also confirmed by analyzing heteroduplex molecules by electron microscopy. The second cloned proviral DNA (designated MCF 2) was a 6.9-kilobase EcoRI DNA fragment which contained LTR sequences at each end and a 2.0-kilobase deletion encompassing most of the env region. The MCF 2 proviral DNA proved to be a useful reagent for detecting LTRs electron microscopically due to the presence of nonoverlapping, terminally located LTR sequences which effected its circularization with DNAs containing homologous LTR sequences. Nucleotide sequence analysis demonstrated the presence of a 104-base-pair direct repeat in the LTR of MCF 2 DNA. In contrast, only a single copy of the reiterated component of the direct repeat was present in MCF 1 DNA. Images PMID:6281459

Differentiation of Toxocara canis and Toxocara cati based on PCR-RFLP analyses of rDNA-ITS and mitochondrial cox1 and nad1 regions.

PubMed

Mikaeili, Fattaneh; Mathis, Alexander; Deplazes, Peter; Mirhendi, Hossein; Barazesh, Afshin; Ebrahimi, Sepideh; Kia, Eshrat Beigom

2017-09-26

The definitive genetic identification of Toxocara species is currently based on PCR/sequencing. The objectives of the present study were to design and conduct an in silico polymerase chain reaction-restriction fragment length polymorphism method for identification of Toxocara species. In silico analyses using the DNASIS and NEBcutter softwares were performed with rDNA internal transcribed spacers, and mitochondrial cox1 and nad1 sequences obtained in our previous studies along with relevant sequences deposited in GenBank. Consequently, RFLP profiles were designed and all isolates of T. canis and T. cati collected from dogs and cats in different geographical areas of Iran were investigated with the RFLP method using some of the identified suitable enzymes. The findings of in silico analyses predicted that on the cox1 gene only the MboII enzyme is appropriate for PCR-RFLP to reliably distinguish the two species. No suitable enzyme for PCR-RFLP on the nad1 gene was identified that yields the same pattern for all isolates of a species. DNASIS software showed that there are 241 suitable restriction enzymes for the differentiation of T. canis from T. cati based on ITS sequences. RsaI, MvaI and SalI enzymes were selected to evaluate the reliability of the in silico PCR-RFLP. The sizes of restriction fragments obtained by PCR-RFLP of all samples consistently matched the expected RFLP patterns. The ITS sequences are usually conserved and the PCR-RFLP approach targeting the ITS sequence is recommended for the molecular differentiation of Toxocara species and can provide a reliable tool for identification purposes particularly at the larval and egg stages.

Isolation and Characterization of Five Erwinia amylovora Bacteriophages and Assessment of Phage Resistance in Strains of Erwinia amylovora

PubMed Central

Schnabel, Elise L.; Jones, Alan L.

2001-01-01

Phages able to infect the fire blight pathogen Erwinia amylovora were isolated from apple, pear, and raspberry tissues and from soil samples collected at sites displaying fire blight symptoms. Among a collection of 50 phage isolates, 5 distinct phages, including relatives of the previously described phages φEa1 and φEa7 and 3 novel phages named φEa100, φEa125, and φEa116C, were identified based on differences in genome size and restriction fragment pattern. φEa1, the phage distributed most widely, had an approximately 46-kb genome which exhibited some restriction site variability between isolates. Phages φEa100, φEa7, and φEa125 each had genomes of approximately 35 kb and could be distinguished by their EcoRI restriction fragment patterns. φEa116C contained an approximately 75-kb genome. φEa1, φEa7, φEa100, φEa125, and φEa116C were able to infect 39, 36, 16, 20, and 40, respectively, of 40 E. amylovora strains isolated from apple orchards in Michigan and 8, 12, 10, 10, and 12, respectively, of 12 E. amylovora strains isolated from raspberry fields (Rubus spp.) in Michigan. Only 22 of 52 strains were sensitive to all five phages, and 23 strains exhibited resistance to more than one phage. φEa116C was more effective than the other phages at lysing E. amylovora strain Ea110 in liquid culture, reducing the final titer of Ea110 by >95% when added at a ratio of 1 PFU per 10 CFU and by 58 to 90% at 1 PFU per 105 CFU. PMID:11133428

Cloning and Characterization of the Lactococcal Plasmid-Encoded Type II Restriction/Modification System, LlaDII

PubMed Central

Madsen, Annette; Josephsen, Jytte

1998-01-01

The LlaDII restriction/modification (R/M) system was found on the naturally occurring 8.9-kb plasmid pHW393 in Lactococcus lactis subsp. cremoris W39. A 2.4-kb PstI-EcoRI fragment inserted into the Escherichia coli-L. lactis shuttle vector pCI3340 conferred to L. lactis LM2301 and L. lactis SMQ86 resistance against representatives of the three most common lactococcal phage species: 936, P335, and c2. The LlaDII endonuclease was partially purified and found to recognize and cleave the sequence 5′-GC↓NGC-3′, where the arrow indicates the cleavage site. It is thus an isoschizomer of the commercially available restriction endonuclease Fnu4HI. Sequencing of the 2.4-kb PstI-EcoRI fragment revealed two open reading frames arranged tandemly and separated by a 105-bp intergenic region. The endonuclease gene of 543 bp preceded the methylase gene of 954 bp. The deduced amino acid sequence of the LlaDII R/M system showed high homology to that of its only sequenced isoschizomer, Bsp6I from Bacillus sp. strain RFL6, with 41% identity between the endonucleases and 60% identity between the methylases. The genetic organizations of the LlaDII and Bsp6I R/M systems are identical. Both methylases have two recognition sites (5′-GCGGC-3′ and 5′-GCCGC-3′) forming a putative stem-loop structure spanning part of the presumed −35 sequence and part of the intervening region between the −35 and −10 sequences. Alignment of the LlaDII and Bsp6I methylases with other m5C methylases showed that the protein primary structures possessed the same organization. PMID:9647810

Matrilineage differentiation of the genus Tetragonisca using mitochondrial DNA markers and the polymerase chain reaction-restriction fragment length polymorphism technique.

PubMed

Santos, S A; Bronzato, A R; Moreira, B M T; Araujo, K F; Ronqui, L; Mangolin, C A; Toledo, V A A; Ruvolo-Takasusuki, M C C

2015-10-21

The Meliponinae are important pollinators of plant species, and one of the most managed species is Tetragonisca angustula. Initially, two subspecies were identified in T. angustula: T. angustula angustula and T. angustula fiebrigi. Subsequently, T. a. fiebrigi was considered a species, based on the coloration of its mesepisternum. The objective of the present study was to obtain genetic markers that could differentiate the two species by amplifying regions of mitochondrial DNA and conducting polymerase chain reaction-restriction fragment length polymorphism analysis. Worker bees were collected in three Brazilian states: Paraná (Maringá, Altônia, and Foz do Iguaçu), São Paulo (Dracena, São Carlos, and Santa Cruz do Rio Pardo), and Rondônia (Ariquemes). Ten pairs of insect heterologous primers were tested and four were used (primer pair 1, ND2 and COI; primer pair 2, COI; primer pair 8, 16S and 12S; and primer pair 9, COII). For the restriction analysis, 13 enzymes were tested: EcoRI, EcoRV, HindIII, HinfI, RsaI, PstI, XbaI, HaeIII, ClaI, XhoI, BglII, PvuII, and ScaI. Markers were obtained (primer pair 8 cleaved with EcoRV and XbaI and primer pair 9 cleaved with HaeIII, RsaI, and XbaI) that enabled matrilineage identification in the nests studied, which confirmed that hybridization could occur between both Tetragonisca species. The beginning of speciation was probably recent, and secondary contact has resulted in crosses between T. angustula females and T. fiebrigi males. Because of this hybridization, it would be appropriate to consider them as two subspecies of T. angustula.

Characterization of a splicing mutation in group A xeroderma pigmentosum

DOE Office of Scientific and Technical Information (OSTI.GOV)

Satokata, Ichiro; Tanaka, Kiyoji; Miura, Naoyuki

1990-12-01

The molecular basis of group A xeroderma pigmentosum (WP) was investigated by comparison of the nucleotide sequences of multiple clones of the XP group A complementing gene (XPAC) from a patient with group A XP with that of a normal gene. The clones showed a G {r arrow} C substitution at the 3{prime} splice acceptor site of intron 3, which altered the obligatory AG acceptor dinucleotide to AC. Nucleotide sequencing of cDNAs amplified by the polymerase chain reaction revealed that this single base substitution abolishes the canonical 3{prime} splice site, thus creating two abnormally spliced mRNA forms. The larger formmore » is identical with normal mRNA except for a dinucleotide deletion at the 5{prime} end of exon 4. This deletion results in a frameshift with premature translation termination in exon 4. The smaller form has a deletion of the entire exon 3 and the dinucleotide at the 5{prime} end of exon 4. The result of a transfection study provided additional evidence that this single base substitution is the disease-causing mutation. This single base substitution creates a new cleavage site for the restriction nuclease AlwNI. Analysis of AlwNI restriction fragment length polymorphism showed a high frequency of this mutation in Japanese patients with group A XP: 16 of 21 unrelated Japanese patients were homozygous and 4 were heterozygous for this mutation. However, 11 Caucasians and 2 Blacks with group A XP did not have this mutant allele. The polymorphic AlwNI restriction fragments are concluded to be useful for diagnosis of group A XP in Japanese subjects, including prenatal cases and carriers.« less

Chloroplast DNA Diversity among Trees, Populations and Species in the California Closed-Cone Pines (Pinus Radiata, Pinus Muricata and Pinus Attenuata)

PubMed Central

Hong, Y. P.; Hipkins, V. D.; Strauss, S. H.

1993-01-01

The amount, distribution and mutational nature of chloroplast DNA polymorphisms were studied via analysis of restriction fragment length polymorphisms in three closely related species of conifers, the California closed-cone pines-knobcone pine: Pinus attenuata Lemm.; bishop pine: Pinus muricata D. Don; and Monterey pine: Pinus radiata D. Don. Genomic DNA from 384 trees representing 19 populations were digested with 9-20 restriction enzymes and probed with cloned cpDNA fragments from Douglas-fir [Pseudotsuga menziesii (Mirb.) Franco] that comprise 82% of the chloroplast genome. Up to 313 restriction sites were surveyed, and 25 of these were observed to be polymorphic among or within species. Differences among species accounted for the majority of genetic (haplotypic) diversity observed [G(st) = 84(+/-13)%]; nucleotide diversity among species was estimated to be 0.3(+/-0.1)%. Knobcone pine and Monterey pine displayed almost no genetic variation within or among populations. Bishop pine also showed little variability within populations, but did display strong population differences [G(st) = 87(+/-8)%] that were a result of three distinct geographic groups. Mean nucleotide diversity within populations was 0.003(+/-0.002)%; intrapopulation polymorphisms were found in only five populations. This pattern of genetic variation contrasts strongly with findings from study of nuclear genes (allozymes) in the group, where most genetic diversity resides within populations rather than among populations or species. Regions of the genome subject to frequent length mutations were identified; estimates of subdivision based on length variant frequencies in one region differed strikingly from those based on site mutations or allozymes. Two trees were identified with a major chloroplast DNA inversion that closely resembled one documented between Pinus and Pseudotsuga. PMID:7905846

Study of the family of a patient with male-limited precocious puberty (MPP) due to T1193C transition in exon 11 of LH receptor gene.

PubMed

Ignacak, M; Starzyk, J; Dziatkowiak, H; Trzeciak, W H

2002-03-01

Molecular diagnostics of the LHR gene was conducted in a 5-year-old boy with clinical symptoms and hormonal profile typical of precocious puberty. His parents and 4 sisters were also diagnosed. Single-strand conformation polymorphism analysis under temperature gradient conditions (Multitemperature SSCP) of 3 overlapping fragments of exon 11 of LHR gene revealed a mutation in the fragment spanning nucleotides 1072 to 1804. This mutation was found in the patient, in his mother and in his 4 sisters, and was confirmed by digestion with the use of restriction enzyme Bbr Cl. Direct sequencing revealed a heterozygous T1193C transition in the DNA fragment of the patient and in one of the alleles of his mother's and sister's DNA. This mutation causes Met398Thr substitution in the second transmembrane helix and results in a constitutive activation of LH receptor. This is the second identical mutation detected in Poland and one of the 7 identified so far in the world population.

In-gel multiple displacement amplification of long DNA fragments diluted to the single molecule level.

PubMed

Michikawa, Yuichi; Sugahara, Keisuke; Suga, Tomo; Ohtsuka, Yoshimi; Ishikawa, Kenichi; Ishikawa, Atsuko; Shiomi, Naoko; Shiomi, Tadahiro; Iwakawa, Mayumi; Imai, Takashi

2008-12-15

The isolation and multiple genotyping of long individual DNA fragments are needed to obtain haplotype information for diploid organisms. Limiting dilution of sample DNA followed by multiple displacement amplification is a useful technique but is restricted to short (<5 kb) DNA fragments. In the current study, a novel modification was applied to overcome these problems. A limited amount of cellular DNA was carefully released from intact cells into a mildly heated alkaline agarose solution and mixed thoroughly. The solution was then gently aliquoted and allowed to solidify while maintaining the integrity of the diluted DNA. Exogenously provided Phi29 DNA polymerase was used to perform consistent genomic amplification with random hexameric oligonucleotides within the agarose gels. Simple heat melting of the gel allowed recovery of the amplified materials in a solution of the polymerase chain reaction (PCR)-ready form. The haplotypes of seven SNPs spanning 240 kb of the DNA surrounding the human ATM gene region on chromosome 11 were determined for 10 individuals, demonstrating the feasibility of this new method.

The chloroplast and mitochondrial DNA type are correlated with the nuclear composition of somatic hybrid calli of Solanum tuberosum and Nicotiana plumbaginifolia.

PubMed

Wolters, A M; Koornneef, M; Gilissen, L J

1993-09-01

This paper describes the analysis of chloroplast (cp) DNA and mitochondrial (mt) DNA in 21 somatic hybrid calli of Solanum tuberosum and Nicotiana plumbaginifolia by means of Southern-blot hybridization. Each of these calli contained only one type of cpDNA; 14 had the N. plumbaginifolia (Np) type and seven the S. tuberosum (St) type. N. plumbaginifolia cpDNA was present in hybrids previously shown to contain predominantly N. plumbaginifolia chromosomes whereas hybrids in which S. tuberosum chromosomes predominated possessed cpDNA from potato. We have analyzed the mtDNA of these 21 somatic hybrid calli using four restriction enzyme/probe combinations. Most fusion products had only, or mostly, mtDNA fragments from the parent that predominated in the nucleus. The hybrids containing mtDNA fragments from only one parent (and new fragments) also possessed chloroplasts from the same species. The results suggest the existence of a strong nucleo-cytoplasmic incongruity which affects the genome composition of somatic hybrids between distantly related species.

Authentication of beef, carabeef, chevon, mutton and pork by a PCR-RFLP assay of mitochondrial cytb gene.

PubMed

Kumar, Deepak; Singh, S P; Karabasanavar, Nagappa S; Singh, Rashmi; Umapathi, V

2014-11-01

Authentication of meat assumes significance in view of religious, quality assurance, food safety, public health, conservation and legal concerns. Here, we describe a PCR-RFLP (Polymerase Chain Reaction- Restriction Fragment Length Polymorphism) assay targeting mitochondrial cytochrome-b gene for the identification of meats of five most common food animals namely cattle, buffalo, goat, sheep and pig. A pair of forward and reverse primers (VPH-F & VPH-R) amplifying a conserved region (168-776 bp) of mitochondrial cytochrome-b (cytb) gene for targeted species was designed which yielded a 609 bp PCR amplicon. Further, restriction enzyme digestion of the amplicons with Alu1 and Taq1 restriction enzymes resulted in a distinctive digestion pattern that was able to discriminate each species. The repeatability of the PCR-RFLP assay was validated ten times with consistent results observed. The developed assay can be used in routine diagnostic laboratories to differentiate the meats of closely related domestic livestock species namely cattle from buffalo and sheep from goat.

Comparison of CHROMagar, polymerase chain reaction-restriction fragment length polymorphism, and polymerase chain reaction-fragment size for the identification of Candida species.

PubMed

Jafari, Zahra; Motamedi, Marjan; Jalalizand, Nilufar; Shokoohi, Gholam R; Charsizadeh, Arezu; Mirhendi, Hossein

2017-09-01

The epidemiological alteration in the distribution of Candida species, as well as the significantly increasing trend of either intrinsic or acquired resistance of some of these fungi highlights the need for a reliable method for the identification of the species. Polymerase chain reaction (PCR) is one of the methods facilitating the quick and precise identification of Candida species. The aim of this study was to compare the efficiency of CHROMagar, PCR-restriction fragment length polymorphism (PCR-RFLP), and PCR-fragment size polymorphism (PCR-FSP) assays in the identification of Candida species to determine the benefits and limitations of these methods. This study was conducted on 107 Candida strains, including 20 standard strains and 87 clinical isolates. The identification of the isolates was accomplished by using CHROMagar as a conventional method. The PCR-RFLP assay was performed on the entire internal transcribed spacer (ITS) region of ribosomal DNA (rDNA), and the consequent enzymatic digestion was compared with PCR-FSP results in which ITS1 and ITS2 regions were separately PCR amplified. In both molecular assays, yeast identification was carried out through the specific electrophoretic profiles of the PCR products. According to the results, the utilization of CHROMagar resulted in the identification of 29 (33.3%) Candida isolates, while the PCR-RFLP and PCR-FSP facilitated the identification of 83 (95.4%) and 80 (91.9%) clinical isolates, respectively. The obtained concordances between CHROMagar and PCR-RFLP, between CHROMagar and PCR-FSP, as well as between PCR-RFLP and PCR-FSP were 0.23, 0.20, and 0.77, respectively. The recognition of the benefits and limitations of PCR methods allows for the selection of the most efficient technique for a fast and correct differentiation. The PCR-RFLP and PCR-FSP assays had satisfactory concordance. The PCR-FSP provides a rapid, technically simple, and cost-effective method for the identification of Candida species. Nevertheless, to accurately differentiate among the taxonomically related species, PCR-RFLP should be implemented.

Physical and genetic mapping of the dipeptidase gene DPEP1 to 16q24. 3

DOE Office of Scientific and Technical Information (OSTI.GOV)

Austruy, E.; Jeanpierre, C.; Junien, C.

1993-03-01

The authors report the subregional physical and genetic mapping on chromosome 16q of a cDNA clone selected as a potential tumor/growth suppressor sequence. By DNA sequencing and RNA expression pattern, this clone was identified as part of the renal dipeptidase gene (DPEP1). Using somatic cell hybrids carrying either different human chromosomes or chromosome 16 segments, they confirm and refine the physical mapping of DPEP1 to the chromosome 16 subregion q24.3. Two RFLPs, a biallelic polymorphism detected by TaqI and a VNTR detected by BamHI, EcoRI, and BglII, are described. Using the VNTR polymorphism, DPEP1 was shown to be linked tomore » D16S7 with a maximum lod score of 5.8 at a recombination fraction of 0.03. 14 refs., 2 figs., 2 tabs.« less

Cloning and expression in Escherichia coli of a hygromycin B phosphotransferase gene from Streptomyces hygroscopicus.

PubMed

Zalacain, M; Malpartida, F; Pulido, D; Jiménez, A

1987-01-15

The Streptomyces hygroscopicus hyg gene encoding a hygromycin B phosphotransferase has been introduced into different sites of both the Escherichia coli plasmid pBR322 and the Escherichia coli-Saccharomyces cerevisiae shuttle vector YRp7. When this gene was inserted into the BamHI site of pBR322 and then cloned in E. coli phosphorylating activity was not detected, indicating that the hyg gene promoter was not functional in this bacterium. However, when the hyg gene was inserted into either the unique PstI site of pBR322 or into each of the two PstI sites of YRp7, phosphotransferase activity was observed. Analysis of the translation products from these constructions by coupled in vitro transcription-translation systems suggested that in all cases transcrition was regulated by a promoter not provided by the inserted hyg gene and that the synthesized polypeptide was identical to that present in S. hygroscopicus.

The Synthetic Antimicrobial Peptide 19-2.5 Interacts with Heparanase and Heparan Sulfate in Murine and Human Sepsis.

PubMed

Martin, Lukas; De Santis, Rebecca; Koczera, Patrick; Simons, Nadine; Haase, Hajo; Heinbockel, Lena; Brandenburg, Klaus; Marx, Gernot; Schuerholz, Tobias

2015-01-01

Heparanase is an endo-β-glucuronidase that cleaves heparan sulfate side chains from their proteoglycans. Thereby, heparanase liberates highly potent circulating heparan sulfate-fragments (HS-fragments) and triggers the fatal and excessive inflammatory response in sepsis. As a potential anti-inflammatory agent for sepsis therapy, peptide 19-2.5 belongs to the class of synthetic anti-lipopolysaccharide peptides; however, its activity is not restricted to Gram-negative bacterial infection. We hypothesized that peptide 19-2.5 interacts with heparanase and/or HS, thereby reducing the levels of circulating HS-fragments in murine and human sepsis. Our data indicate that the treatment of septic mice with peptide 19-2.5 compared to untreated control animals lowers levels of plasma heparanase and circulating HS-fragments and reduces heparanase activity. Additionally, mRNA levels of heparanase in heart, liver, lung, kidney and spleen are downregulated in septic mice treated with peptide 19-2.5 compared to untreated control animals. In humans, plasma heparanase level and activity are elevated in septic shock. The ex vivo addition of peptide 19-2.5 to plasma of septic shock patients decreases heparanase activity but not heparanase level. Isothermal titration calorimetry revealed a strong exothermic reaction between peptide 19-2.5 and heparanase and HS-fragments. However, a saturation character has been identified only in the peptide 19-2.5 and HS interaction. In conclusion, the findings of our current study indicate that peptide 19-2.5 interacts with heparanase, which is elevated in murine and human sepsis and consecutively attenuates the generation of circulating HS-fragments in systemic inflammation. Thus, peptide 19-2.5 seems to be a potential anti-inflammatory agent in sepsis.

No signs of inbreeding despite long-term isolation and habitat fragmentation in the critically endangered Montseny brook newt (Calotriton arnoldi)

PubMed Central

Valbuena-Ureña, E; Soler-Membrives, A; Steinfartz, S; Orozco-terWengel, P; Carranza, S

2017-01-01

Endemic species with restricted geographic ranges potentially suffer the highest risk of extinction. If these species are further fragmented into genetically isolated subpopulations, the risk of extinction is elevated. Habitat fragmentation is generally considered to have negative effects on species survival, despite some evidence for neutral or even positive effects. Typically, non-negative effects are ignored by conservation biology. The Montseny brook newt (Calotriton arnoldi) has one of the smallest distribution ranges of any European amphibian (8 km2) and is considered critically endangered by the International Union for Conservation of Nature. Here we apply molecular markers to analyze its population structure and find that habitat fragmentation owing to a natural barrier has resulted in strong genetic division of populations into two sectors, with no detectable migration between sites. Although effective population size estimates suggest low values for all populations, we found low levels of inbreeding and relatedness between individuals within populations. Moreover, C. arnoldi displays similar levels of genetic diversity to its sister species Calotriton asper, from which it separated around 1.5 million years ago and which has a much larger distribution range. Our extensive study shows that natural habitat fragmentation does not result in negative genetic effects, such as the loss of genetic diversity and inbreeding on an evolutionary timescale. We hypothesize that species in such conditions may evolve strategies (for example, special mating preferences) to mitigate the effects of small population sizes. However, it should be stressed that the influence of natural habitat fragmentation on an evolutionary timescale should not be conflated with anthropogenic habitat loss or degradation when considering conservation strategies. PMID:28074844

Structural Organization and Strain Variation in the Genome of Varicella Zoster Virus

DTIC Science & Technology

1984-10-23

Zoster 6 Growth of VZV in tissue culture 9 Structure and proteins of VZV 15 Structure of HSV DNA 20 Classification of herpesviruses based on DNA...structure 28 Strain variation in herpesvirus DNA 31 VZV DNA 33 Specific aims 36 II. MATERIALS AND METHODS 38 Cells and viruses 38 Isolation of virus...endonuclease fragments by colony hybridization 106 21. Selected methods of restriction endonuclease mapping .... 109 22. Identification of

[Research progress of molecular genetic analysis in Schistosoma variation].

PubMed

Zheng, Su-Yue; Li, Fei

2014-02-01

The development of molecular biology techniques makes important contributions to the researches of heritable variation of Schistosoma. In recent years, the molecular genetic analysis in the Schistosoma variation researches mainly includes the restriction fragment length polymorphism (RFLP), random amplified polymorphism technology (RAPD), microsatellite anchored PCR (SSR-PCR), and polymerase reaction single-strand conformation polymorphism (PCR-SSCP). This article reviews the research progress of molecular genetic analysis in Schistosoma variation in recent years.

Soil pretreatment and fast cell lysis for direct polymerase chain reaction from forest soils for terminal restriction fragment length polymorphism analysis of fungal communities

Treesearch

Fei Cheng; Lin Hou; Keith Woeste; Zhengchun Shang; Xiaobang Peng; Peng Zhao; Shuoxin Zhang

2016-01-01

Humic substances in soil DNA samples can influence the assessment of microbial diversity and community composition. Using multiple steps during or after cell lysis adds expenses, is time-consuming, and causes DNA loss. A pretreatment of soil samples and a single step DNA extraction may improve experimental results. In order to optimize a protocol for obtaining high...

Measurement of Epstein-Barr virus DNA load using a novel quantification standard containing two EBV DNA targets and SYBR Green I dye.

PubMed

Lay, Meav-Lang J; Lucas, Robyn M; Ratnamohan, Mala; Taylor, Janette; Ponsonby, Anne-Louise; Dwyer, Dominic E

2010-09-22

Reactivation of Epstein-Barr virus (EBV) infection may cause serious, life-threatening complications in immunocompromised individuals. EBV DNA is often detected in EBV-associated disease states, with viral load believed to be a reflection of virus activity. Two separate real-time quantitative polymerase chain reaction (QPCR) assays using SYBR Green I dye and a single quantification standard containing two EBV genes, Epstein-Barr nuclear antigen-1 (EBNA-1) and BamHI fragment H rightward open reading frame-1 (BHRF-1), were developed to detect and measure absolute EBV DNA load in patients with various EBV-associated diseases. EBV DNA loads and viral capsid antigen (VCA) IgG antibody titres were also quantified on a population sample. EBV DNA was measurable in ethylenediaminetetraacetic acid (EDTA) whole blood, peripheral blood mononuclear cells (PBMCs), plasma and cerebrospinal fluid (CSF) samples. EBV DNA loads were detectable from 8.0 × 10(2) to 1.3 × 10(8) copies/ml in post-transplant lymphoproliferative disease (n = 5), 1.5 × 10(3) to 2.0 × 10(5) copies/ml in infectious mononucleosis (n = 7), 7.5 × 10(4) to 1.1 × 10(5) copies/ml in EBV-associated haemophagocytic syndrome (n = 1), 2.0 × 10(2) to 5.6 × 10(3) copies/ml in HIV-infected patients (n = 12), and 2.0 × 10(2) to 9.1 × 10(4) copies/ml in the population sample (n = 218). EBNA-1 and BHRF-1 DNA were detected in 11.0% and 21.6% of the population sample respectively. There was a modest correlation between VCA IgG antibody titre and BHRF-1 DNA load (rho = 0.13, p = 0.05) but not EBNA-1 DNA load (rho = 0.11, p = 0.11). Two sensitive and specific real-time PCR assays using SYBR Green I dye and a single quantification standard containing two EBV DNA targets, were developed for the detection and measurement of EBV DNA load in a variety of clinical samples. These assays have application in the investigation of EBV-related illnesses in immunocompromised individuals.

Determining Phylogenetic Relationships Among Date Palm Cultivars Using Random Amplified Polymorphic DNA (RAPD) and Inter-Simple Sequence Repeat (ISSR) Markers.

PubMed

Haider, Nadia

2017-01-01

Investigation of genetic variation and phylogenetic relationships among date palm (Phoenix dactylifera L.) cultivars is useful for their conservation and genetic improvement. Various molecular markers such as restriction fragment length polymorphisms (RFLPs), simple sequence repeat (SSR), representational difference analysis (RDA), and amplified fragment length polymorphism (AFLP) have been developed to molecularly characterize date palm cultivars. PCR-based markers random amplified polymorphic DNA (RAPD) and inter-simple sequence repeat (ISSR) are powerful tools to determine the relatedness of date palm cultivars that are difficult to distinguish morphologically. In this chapter, the principles, materials, and methods of RAPD and ISSR techniques are presented. Analysis of data generated from these two techniques and the use of these data to reveal phylogenetic relationships among date palm cultivars are also discussed.

Application of heteroduplex analysis for detecting variation within the growth hormone 2 gene in Salmo trutta L. (brown trout).

PubMed

Gross, R; Nilsson, J

1995-03-01

A new method to detect variation at a single copy nuclear gene in brown trout, Salmo trutta L., is provided. The technique entails (i) selective gene amplification by the polymerase chain reaction (PCR), (ii) digestion of amplification products by restriction endonucleases to obtain fragments of suitable size, (iii) hybridization with heterologous DNA followed by denaturation and reannealing to obtain heteroduplex molecules, and (iv) screening for variation in polyacrylamide gels. Variation was studied within a growth hormone 2 gene 1489 bp segment and polymorphism was detected in two HinfI-digested fragments. Formation of different heteroduplex patterns in experimental mixtures of digested amplification products from brown trout and Atlantic salmon, Salmo salar L., allowed us to determine the genotype of the brown trout. Polymorphism was observed in four out of six studied populations.

Non-random distribution of DNA double-strand breaks induced by particle irradiation

NASA Technical Reports Server (NTRS)

Lobrich, M.; Cooper, P. K.; Rydberg, B.; Chatterjee, A. (Principal Investigator)

1996-01-01

Induction of DNA double-strand breaks (dsbs) in mammalian cells is dependent on the spatial distribution of energy deposition from the ionizing radiation. For high LET particle radiations the primary ionization sites occur in a correlated manner along the track of the particles, while for X-rays these sites are much more randomly distributed throughout the volume of the cell. It can therefore be expected that the distribution of dsbs linearly along the DNA molecule also varies with the type of radiation and the ionization density. Using pulsed-field gel and conventional gel techniques, we measured the size distribution of DNA molecules from irradiated human fibroblasts in the total range of 0.1 kbp-10 Mbp for X-rays and high LET particles (N ions, 97 keV/microns and Fe ions, 150 keV/microns). On a mega base pair scale we applied conventional pulsed-field gel electrophoresis techniques such as measurement of the fraction of DNA released from the well (FAR) and measurement of breakage within a specific NotI restriction fragment (hybridization assay). The induction rate for widely spaced breaks was found to decrease with LET. However, when the entire distribution of radiation-induced fragments was analysed, we detected an excess of fragments with sizes below about 200 kbp for the particles compared with X-irradiation. X-rays are thus more effective than high LET radiations in producing large DNA fragments but less effective in the production of smaller fragments. We determined the total induction rate of dsbs for the three radiations based on a quantitative analysis of all the measured radiation-induced fragments and found that the high LET particles were more efficient than X-rays at inducing dsbs, indicating an increasing total efficiency with LET. Conventional assays that are based only on the measurement of large fragments are therefore misleading when determining total dsb induction rates of high LET particles. The possible biological significance of this non-randomness for dsb induction is discussed.

Population Genetic Structure of Glycyrrhiza inflata B. (Fabaceae) Is Shaped by Habitat Fragmentation, Water Resources and Biological Characteristics.

PubMed

Yang, Lulu; Chen, Jianjun; Hu, Weiming; Yang, Tianshun; Zhang, Yanjun; Yukiyoshi, Tamura; Zhou, Yanyang; Wang, Ying

2016-01-01

Habitat fragmentation, water resources and biological characteristics are important factors that shape the genetic structure and geographical distribution of desert plants. Analysis of the relationships between these factors and population genetic variation should help to determine the evolutionary potential and conservation strategies for genetic resources for desert plant populations. As a traditional Chinese herb, Glycyrrhiza inflata B. (Fabaceae) is restricted to the fragmented desert habitat in China and has undergone a dramatic decline due to long-term over-excavation. Determining the genetic structure of the G. inflata population and identifying a core collection could help with the development of strategies to conserve this species. We investigated the genetic variation of 25 G. inflata populations based on microsatellite markers. A high level of population genetic divergence (FST = 0.257), population bottlenecks, reduced gene flow and moderate genetic variation (HE = 0.383) were detected. The genetic distances between the populations significantly correlated with the geographical distances, and this suggests that habitat fragmentation has driven a special genetic structure of G. inflata in China through isolation by distance. STRUCTURE analysis showed that G. inflata populations were structured into three clusters and that the populations belonged to multiple water systems, which suggests that water resources were related to the genetic structure of G. inflata. In addition, the biological characteristics of the perennial species G. inflata, such as its long-lived seeds, asexual reproduction, and oasis ecology, may be related to its resistance to habitat fragmentation. A core collection of G. inflata, that included 57 accessions was further identified, which captured the main allelic diversity of G. inflata. Recent habitat fragmentation has accelerated genetic divergence. The population genetic structure of G. inflata has been shaped by habitat fragmentation, water resources and biological characteristics. This genetic information and core collection will facilitate the conservation of wild germplasm and breeding of this Chinese medicinal plant.

Population Genetic Structure of Glycyrrhiza inflata B. (Fabaceae) Is Shaped by Habitat Fragmentation, Water Resources and Biological Characteristics

PubMed Central

Yang, Lulu; Chen, Jianjun; Hu, Weiming; Yang, Tianshun; Zhang, Yanjun; Yukiyoshi, Tamura; Zhou, Yanyang; Wang, Ying

2016-01-01

Background Habitat fragmentation, water resources and biological characteristics are important factors that shape the genetic structure and geographical distribution of desert plants. Analysis of the relationships between these factors and population genetic variation should help to determine the evolutionary potential and conservation strategies for genetic resources for desert plant populations. As a traditional Chinese herb, Glycyrrhiza inflata B. (Fabaceae) is restricted to the fragmented desert habitat in China and has undergone a dramatic decline due to long-term over-excavation. Determining the genetic structure of the G. inflata population and identifying a core collection could help with the development of strategies to conserve this species. Results We investigated the genetic variation of 25 G. inflata populations based on microsatellite markers. A high level of population genetic divergence (FST = 0.257), population bottlenecks, reduced gene flow and moderate genetic variation (HE = 0.383) were detected. The genetic distances between the populations significantly correlated with the geographical distances, and this suggests that habitat fragmentation has driven a special genetic structure of G. inflata in China through isolation by distance. STRUCTURE analysis showed that G. inflata populations were structured into three clusters and that the populations belonged to multiple water systems, which suggests that water resources were related to the genetic structure of G. inflata. In addition, the biological characteristics of the perennial species G. inflata, such as its long-lived seeds, asexual reproduction, and oasis ecology, may be related to its resistance to habitat fragmentation. A core collection of G. inflata, that included 57 accessions was further identified, which captured the main allelic diversity of G. inflata. Conclusions Recent habitat fragmentation has accelerated genetic divergence. The population genetic structure of G. inflata has been shaped by habitat fragmentation, water resources and biological characteristics. This genetic information and core collection will facilitate the conservation of wild germplasm and breeding of this Chinese medicinal plant. PMID:27711241

Discriminating the Drivers of Edge Effects on Nest Predation: Forest Edges Reduce Capture Rates of Ship Rats (Rattus rattus), a Globally Invasive Nest Predator, by Altering Vegetation Structure

PubMed Central

Ruffell, Jay; Didham, Raphael K.; Barrett, Paul; Gorman, Nic; Pike, Rhonda; Hickey-Elliott, Andrée; Sievwright, Karin; Armstrong, Doug P.

2014-01-01

Forest edges can strongly affect avian nest success by altering nest predation rates, but this relationship is inconsistent and context dependent. There is a need for researchers to improve the predictability of edge effects on nest predation rates by examining the mechanisms driving their occurrence and variability. In this study, we examined how the capture rates of ship rats, an invasive nest predator responsible for avian declines globally, varied with distance from the forest edge within forest fragments in a pastoral landscape in New Zealand. We hypothesised that forest edges would affect capture rates by altering vegetation structure within fragments, and that the strength of edge effects would depend on whether fragments were grazed by livestock. We measured vegetation structure and rat capture rates at 488 locations ranging from 0–212 m from the forest edge in 15 forest fragments, seven of which were grazed. Contrary to the vast majority of previous studies of edge effects on nest predation, ship rat capture rates increased with increasing distance from the forest edge. For grazed fragments, capture rates were estimated to be 78% lower at the forest edge than 118 m into the forest interior (the farthest distance for grazed fragments). This relationship was similar for ungrazed fragments, with capture rates estimated to be 51% lower at the forest edge than 118 m into the forest interior. A subsequent path analysis suggested that these ‘reverse’ edge effects were largely or entirely mediated by changes in vegetation structure, implying that edge effects on ship rats can be predicted from the response of vegetation structure to forest edges. We suggest the occurrence, strength, and direction of edge effects on nest predation rates may depend on edge-driven changes in local habitat when the dominant predator is primarily restricted to forest patches. PMID:25412340