Towards smart environments using smart objects.

PubMed

Sedlmayr, Martin; Prokosch, Hans-Ulrich; Münch, Ulli

2011-01-01

Barcodes, RFID, WLAN, Bluetooth and many more technologies are used in hospitals. They are the technological bases for different applications such as patient monitoring, asset management and facility management. However, most of these applications exist side by side with hardly any integration and even interoperability is not guaranteed. Introducing the concept of smart objects inspired by the Internet of Things can improve the situation by separating the capabilities and functions of an object from the implementing technology such as RFID or WLAN. By aligning technological and business developments smart objects have the power to transform a hospital from an agglomeration of technologies into a smart environment.

Photocleavable DNA barcode-antibody conjugates allow sensitive and multiplexed protein analysis in single cells.

PubMed

Agasti, Sarit S; Liong, Monty; Peterson, Vanessa M; Lee, Hakho; Weissleder, Ralph

2012-11-14

DNA barcoding is an attractive technology, as it allows sensitive and multiplexed target analysis. However, DNA barcoding of cellular proteins remains challenging, primarily because barcode amplification and readout techniques are often incompatible with the cellular microenvironment. Here we describe the development and validation of a photocleavable DNA barcode-antibody conjugate method for rapid, quantitative, and multiplexed detection of proteins in single live cells. Following target binding, this method allows DNA barcodes to be photoreleased in solution, enabling easy isolation, amplification, and readout. As a proof of principle, we demonstrate sensitive and multiplexed detection of protein biomarkers in a variety of cancer cells.

Thank you for asking: Exploring patient perceptions of barcode medication administration identification practices in inpatient mental health settings.

PubMed

Strudwick, Gillian; Clark, Carrie; McBride, Brittany; Sakal, Moshe; Kalia, Kamini

2017-09-01

Barcode medication administration systems have been implemented in a number of healthcare settings in an effort to decrease medication errors. To use the technology, nurses are required to login to an electronic health record, scan a medication and a form of patient identification to ensure that these correspond correctly with the ordered medications prior to medication administration. In acute care settings, patient wristbands have been traditionally used as a form of identification; however, past research has suggested that this method of identification may not be preferred in inpatient mental health settings. If barcode medication administration technology is to be effectively used in this context, healthcare organizations need to understand patient preferences with regards to identification methods. The purpose of this study was to elicit patient perceptions of barcode medication administration identification practices in inpatient mental health settings. Insights gathered can be used to determine patient-centered preferences of identifying patients using barcode medication administration technology. Using a qualitative descriptive approach, fifty-two (n=52) inpatient interviews were completed by a Peer Support Worker using a semi-structured interview guide over a period of two months. Interviews were conducted in a number of inpatient mental health areas including forensic, youth, geriatric, acute, and rehabilitation services. An interprofessional team, inclusive of a Peer Support Worker, completed a thematic analysis of the interview data. Six themes emerged as a result of the inductive data analysis. These included: management of information, privacy and security, stigma, relationships, safety and comfort, and negative associations with the technology. Patients also indicated that they would like a choice in the type of identification method used during barcode medication administration. As well, suggestions were made for how barcode medication administration practices could be modified to become more patient-centered. The results of this study have a number of implications for healthcare organizations. As patients indicated that they would like a choice in the type of identification method used during barcode medication administration, healthcare organizations will need to determine how they can facilitate this process. Furthermore, many of the concerns that patients had with barcode medication administration technology could be addressed through patient education. Copyright © 2017 Elsevier B.V. All rights reserved.

Closed-Tube Barcoding.

PubMed

Sirianni, Nicky M; Yuan, Huijun; Rice, John E; Kaufman, Ronit S; Deng, John; Fulton, Chandler; Wangh, Lawrence J

2016-11-01

Here, we present a new approach for increasing the rate and lowering the cost of identifying, cataloging, and monitoring global biodiversity. These advances, which we call Closed-Tube Barcoding, are one application of a suite of proven PCR-based technologies invented in our laboratory. Closed-Tube Barcoding builds on and aims to enhance the profoundly important efforts of the International Barcode of Life initiative. Closed-Tube Barcoding promises to be particularly useful when large numbers of small or rare specimens need to be screened and characterized at an affordable price. This approach is also well suited for automation and for use in portable devices.

Effect of bar-code technology on the safety of medication administration.

PubMed

Poon, Eric G; Keohane, Carol A; Yoon, Catherine S; Ditmore, Matthew; Bane, Anne; Levtzion-Korach, Osnat; Moniz, Thomas; Rothschild, Jeffrey M; Kachalia, Allen B; Hayes, Judy; Churchill, William W; Lipsitz, Stuart; Whittemore, Anthony D; Bates, David W; Gandhi, Tejal K

2010-05-06

Serious medication errors are common in hospitals and often occur during order transcription or administration of medication. To help prevent such errors, technology has been developed to verify medications by incorporating bar-code verification technology within an electronic medication-administration system (bar-code eMAR). We conducted a before-and-after, quasi-experimental study in an academic medical center that was implementing the bar-code eMAR. We assessed rates of errors in order transcription and medication administration on units before and after implementation of the bar-code eMAR. Errors that involved early or late administration of medications were classified as timing errors and all others as nontiming errors. Two clinicians reviewed the errors to determine their potential to harm patients and classified those that could be harmful as potential adverse drug events. We observed 14,041 medication administrations and reviewed 3082 order transcriptions. Observers noted 776 nontiming errors in medication administration on units that did not use the bar-code eMAR (an 11.5% error rate) versus 495 such errors on units that did use it (a 6.8% error rate)--a 41.4% relative reduction in errors (P<0.001). The rate of potential adverse drug events (other than those associated with timing errors) fell from 3.1% without the use of the bar-code eMAR to 1.6% with its use, representing a 50.8% relative reduction (P<0.001). The rate of timing errors in medication administration fell by 27.3% (P<0.001), but the rate of potential adverse drug events associated with timing errors did not change significantly. Transcription errors occurred at a rate of 6.1% on units that did not use the bar-code eMAR but were completely eliminated on units that did use it. Use of the bar-code eMAR substantially reduced the rate of errors in order transcription and in medication administration as well as potential adverse drug events, although it did not eliminate such errors. Our data show that the bar-code eMAR is an important intervention to improve medication safety. (ClinicalTrials.gov number, NCT00243373.) 2010 Massachusetts Medical Society

Barcode uses and abuses

DOE Office of Scientific and Technical Information (OSTI.GOV)

KEENEN,MARTHA JANE; NUSBAUM,ANNA W.

2000-05-18

Barcodes are something that everybody sees every day; so common as to be taken for granted and normally unnoticed. Readable, no one reads them. They are used to allow machines to identify a wide variety of non-electronic, real life objects. Barcode is one of the earliest types of what is now called ``Automatic Identification and Data Capture'' (AIDC), meaning ``data was transmitted into whatever system by something other than typing or hand-writing.'' There are 18 technologies, broken down into six categories--biometrics, electromagnetic, magnetic, optical, Smart Cards, Touch--included in the AIDC concept. Many are used jointly with or as adjuncts tomore » a basic barcode system of some type. All are based on assignment of a unique identifier to the object, usually a number. The uniqueness presumption makes barcode systems very applicable and appropriate to the nuclear information management venue as they inherently comply with the Nuclear Quality Assurance (NQA-1) requirements. Barcode systems belong to the optical category of AIDC. It is very old in usage as these technologies go, having first been patented in 1949. It astonished me, in researching this paper, to find that there are over 250 types of barcode (symbologies), each with its own specialized attributes, though only a few dozen are in active use. The initial uses were in the early 1950s and diversity of use is ever increasing as people find new ways to make this versatile old technology work. To what else could it be applied, in the future? This paper attempts to answer this.« less

Effect of Bar-code Technology on the Incidence of Medication Dispensing Errors and Potential Adverse Drug Events in a Hospital Pharmacy

PubMed Central

Poon, Eric G; Cina, Jennifer L; Churchill, William W; Mitton, Patricia; McCrea, Michelle L; Featherstone, Erica; Keohane, Carol A; Rothschild, Jeffrey M; Bates, David W; Gandhi, Tejal K

2005-01-01

We performed a direct observation pre-post study to evaluate the impact of barcode technology on medication dispensing errors and potential adverse drug events in the pharmacy of a tertiary-academic medical center. We found that barcode technology significantly reduced the rate of target dispensing errors leaving the pharmacy by 85%, from 0.37% to 0.06%. The rate of potential adverse drug events (ADEs) due to dispensing errors was also significantly reduced by 63%, from 0.19% to 0.069%. In a 735-bed hospital where 6 million doses of medications are dispensed per year, this technology is expected to prevent about 13,000 dispensing errors and 6,000 potential ADEs per year. PMID:16779372

An Analytic Hierarchy Process-based Method to Rank the Critical Success Factors of Implementing a Pharmacy Barcode System.

PubMed

Alharthi, Hana; Sultana, Nahid; Al-Amoudi, Amjaad; Basudan, Afrah

2015-01-01

Pharmacy barcode scanning is used to reduce errors during the medication dispensing process. However, this technology has rarely been used in hospital pharmacies in Saudi Arabia. This article describes the barriers to successful implementation of a barcode scanning system in Saudi Arabia. A literature review was conducted to identify the relevant critical success factors (CSFs) for a successful dispensing barcode system implementation. Twenty-eight pharmacists from a local hospital in Saudi Arabia were interviewed to obtain their perception of these CSFs. In this study, planning (process flow issues and training requirements), resistance (fear of change, communication issues, and negative perceptions about technology), and technology (software, hardware, and vendor support) were identified as the main barriers. The analytic hierarchy process (AHP), one of the most widely used tools for decision making in the presence of multiple criteria, was used to compare and rank these identified CSFs. The results of this study suggest that resistance barriers have a greater impact than planning and technology barriers. In particular, fear of change is the most critical factor, and training is the least critical factor.

Data Flow Infrastructure Initiative (DFII): Coupling Inventory Practices and Data collection Technology to Enhance Research Productivity and Information Access

NASA Astrophysics Data System (ADS)

Meyer, K.; Malin, R.; Rich, R. L.; Pierce, S. A.

2011-12-01

Shortening the cycle from data collection to research publications is a competitive advantage for researchers. Existing technologies for inventory systems such as UPC barcoding systems can be coupled with flexible mobile or handheld devices to advance efficiency, productivity, automation, and integrity in data flows, from data collection to sample processing to database management and analysis, and finally publication. At the University of Texas, the Data Flow Infrastructure Initiative (DFII) has introduced handheld devices with integrated barcode scanners as a mechanism to enhance research productivity and information access. These devices are established technology and provide a flexible but consistent platform for research data collection and data management. They are not in widespread use yet in the research community. Additional application benefits will accrue by using handheld devices to deliver data on demand in teaching applications. Introducing research scientists, graduate students, and the UT community to the merits and flexibility of these data collection technologies will provide avenues for innovation as well as improving efficiency. The objective of this project is to bring the technology and expertise with handheld systems to a diverse set of pilot projects and establish proficiency at The University of Texas at Austin necessary for widespread application. We have implemented a pilot project in three research labs covering the fields of microbial ecology, water resources decision support, and biogeochemistry to introduce these technologies. We used NautizX5 handheld devices that feature: barcode scanning, bluetooth, stylus, and keypad data inputs coupled with Pendragon Forms Software, a program that allows users to create custom data collection forms structured into an SQL or Access platform thus allowing concurrent data management, data collection and analysis in field and lab settings. Results include the elimination of most manual data entry, reducing data entry error, tracking effectiveness at data collection, and increased sampling efficiency and consistency over multi-year experiments.

Evaluating ethanol-based sample preservation to facilitate use of DNA barcoding in routine freshwater biomonitoring programs using benthic macroinvertebrates.

PubMed

Stein, Eric D; White, Bryan P; Mazor, Raphael D; Miller, Peter E; Pilgrim, Erik M

2013-01-01

Molecular methods, such as DNA barcoding, have the potential to enhance biomonitoring programs worldwide. Altering routinely used sample preservation methods to protect DNA from degradation may pose a potential impediment to application of DNA barcoding and metagenomics for biomonitoring using benthic macroinvertebrates. Using higher volumes or concentrations of ethanol, requirements for shorter holding times, or the need to include additional filtering may increase cost and logistical constraints to existing biomonitoring programs. To address this issue we evaluated the efficacy of various ethanol-based sample preservation methods at maintaining DNA integrity. We evaluated a series of methods that were minimally modified from typical field protocols in order to identify an approach that can be readily incorporated into existing monitoring programs. Benthic macroinvertebrates were collected from a minimally disturbed stream in southern California, USA and subjected to one of six preservation treatments. Ten individuals from five taxa were selected from each treatment and processed to produce DNA barcodes from the mitochondrial gene cytochrome c oxidase I (COI). On average, we obtained successful COI sequences (i.e. either full or partial barcodes) for between 93-99% of all specimens across all six treatments. As long as samples were initially preserved in 95% ethanol, successful sequencing of COI barcodes was not affected by a low dilution ratio of 2∶1, transfer to 70% ethanol, presence of abundant organic matter, or holding times of up to six months. Barcoding success varied by taxa, with Leptohyphidae (Ephemeroptera) producing the lowest barcode success rate, most likely due to poor PCR primer efficiency. Differential barcoding success rates have the potential to introduce spurious results. However, routine preservation methods can largely be used without adverse effects on DNA integrity.

Evaluating Ethanol-based Sample Preservation to Facilitate Use of DNA Barcoding in Routine Freshwater Biomonitoring Programs Using Benthic Macroinvertebrates

PubMed Central

Stein, Eric D.; White, Bryan P.; Mazor, Raphael D.; Miller, Peter E.; Pilgrim, Erik M.

2013-01-01

Molecular methods, such as DNA barcoding, have the potential to enhance biomonitoring programs worldwide. Altering routinely used sample preservation methods to protect DNA from degradation may pose a potential impediment to application of DNA barcoding and metagenomics for biomonitoring using benthic macroinvertebrates. Using higher volumes or concentrations of ethanol, requirements for shorter holding times, or the need to include additional filtering may increase cost and logistical constraints to existing biomonitoring programs. To address this issue we evaluated the efficacy of various ethanol-based sample preservation methods at maintaining DNA integrity. We evaluated a series of methods that were minimally modified from typical field protocols in order to identify an approach that can be readily incorporated into existing monitoring programs. Benthic macroinvertebrates were collected from a minimally disturbed stream in southern California, USA and subjected to one of six preservation treatments. Ten individuals from five taxa were selected from each treatment and processed to produce DNA barcodes from the mitochondrial gene cytochrome c oxidase I (COI). On average, we obtained successful COI sequences (i.e. either full or partial barcodes) for between 93–99% of all specimens across all six treatments. As long as samples were initially preserved in 95% ethanol, successful sequencing of COI barcodes was not affected by a low dilution ratio of 2∶1, transfer to 70% ethanol, presence of abundant organic matter, or holding times of up to six months. Barcoding success varied by taxa, with Leptohyphidae (Ephemeroptera) producing the lowest barcode success rate, most likely due to poor PCR primer efficiency. Differential barcoding success rates have the potential to introduce spurious results. However, routine preservation methods can largely be used without adverse effects on DNA integrity. PMID:23308097

[Integrated DNA barcoding database for identifying Chinese animal medicine].

PubMed

Shi, Lin-Chun; Yao, Hui; Xie, Li-Fang; Zhu, Ying-Jie; Song, Jing-Yuan; Zhang, Hui; Chen, Shi-Lin

2014-06-01

In order to construct an integrated DNA barcoding database for identifying Chinese animal medicine, the authors and their cooperators have completed a lot of researches for identifying Chinese animal medicines using DNA barcoding technology. Sequences from GenBank have been analyzed simultaneously. Three different methods, BLAST, barcoding gap and Tree building, have been used to confirm the reliabilities of barcode records in the database. The integrated DNA barcoding database for identifying Chinese animal medicine has been constructed using three different parts: specimen, sequence and literature information. This database contained about 800 animal medicines and the adulterants and closely related species. Unknown specimens can be identified by pasting their sequence record into the window on the ID page of species identification system for traditional Chinese medicine (www. tcmbarcode. cn). The integrated DNA barcoding database for identifying Chinese animal medicine is significantly important for animal species identification, rare and endangered species conservation and sustainable utilization of animal resources.

The Relationship between Barcode Medication Administration Satisfaction and the Use of Workarounds among Registered Nurses

ERIC Educational Resources Information Center

Bennett, Sally F.

2012-01-01

Adverse drug events, resulting in preventable patient harm or death, are of great concern. To keep patients safe, hospitals have implemented barcode medication administration (BCMA) technology for RNs who have accepted this technology with varying levels of satisfaction. When nurses are dissatisfied with a BCMA system, they may find alternative…

DNA fingerprinting, DNA barcoding, and next generation sequencing technology in plants.

PubMed

Sucher, Nikolaus J; Hennell, James R; Carles, Maria C

2012-01-01

DNA fingerprinting of plants has become an invaluable tool in forensic, scientific, and industrial laboratories all over the world. PCR has become part of virtually every variation of the plethora of approaches used for DNA fingerprinting today. DNA sequencing is increasingly used either in combination with or as a replacement for traditional DNA fingerprinting techniques. A prime example is the use of short, standardized regions of the genome as taxon barcodes for biological identification of plants. Rapid advances in "next generation sequencing" (NGS) technology are driving down the cost of sequencing and bringing large-scale sequencing projects into the reach of individual investigators. We present an overview of recent publications that demonstrate the use of "NGS" technology for DNA fingerprinting and DNA barcoding applications.

A systematic review of patient tracking systems for use in the pediatric emergency department.

PubMed

Dobson, Ian; Doan, Quynh; Hung, Geoffrey

2013-01-01

Patient safety is of great importance in the pediatric emergency department (PED). The combination of acutely and critically ill patients and high patient volumes creates a need for systems to support physicians in making accurate and timely diagnoses. Electronic patient tracking systems can potentially improve PED safety by reducing overcrowding and enhancing security. To enhance our understanding of current electronic tracking technologies, how they are implemented in a clinical setting, and resulting effect on patient care outcomes including patient safety. Nine databases were searched. Two independent reviewers identified articles that contained reference to patient tracking technologies in pediatrics or emergency medicine. Quantitative studies were assessed independently for methodological strength by two reviewers using an external assessment tool. Of 2292 initial articles, 22 were deemed relevant. Seventeen were qualitative, and the remaining five quantitative articles were assessed as being methodologically weak. Existing patient tracking systems in the ED included: infant monitoring/abduction prevention; barcode identification; radiofrequency identification (RFID)- or infrared (IR)-based patient tracking. Twenty articles supported the use of tracking technology to enhance patient safety or improve efficiency. One article failed to support the use of IR patient sensors due to study design flaws. Support exists for the use of barcode-, IR-, and RFID-based patient tracking systems to improve ED patient safety and efficiency. A lack of methodologically strong studies indicates a need for further evidence-based support for the implementation of patient tracking technology in a clinical or research setting. Copyright © 2013 Elsevier Inc. All rights reserved.

Photocleavable DNA Barcoding Antibodies for Multiplexed Protein Analysis in Single Cells.

PubMed

Ullal, Adeeti V; Weissleder, Ralph

2015-01-01

We describe a DNA-barcoded antibody sensing technique for single cell protein analysis in which the barcodes are photocleaved and digitally detected without amplification steps (Ullal et al., Sci Transl Med 6:219, 2014). After photocleaving the unique ~70 mer DNA barcodes we use a fluorescent hybridization technology for detection, similar to what is commonly done for nucleic acid readouts. This protocol offers a simple method for multiplexed protein detection using 100+ antibodies and can be performed on clinical samples as well as single cells.

Invisible two-dimensional barcode fabrication inside a synthetic fused silica by femtosecond laser processing using a computer-generated hologram

NASA Astrophysics Data System (ADS)

Kawashima, Hayato; Yamaji, Masahiro; Suzuki, Jun'ichi; Tanaka, Shuhei

2011-03-01

We report an invisible two-dimensional (2D) barcode embedded into a synthetic fused silica by femtosecond laser processing using a computer-generated hologram (CGH) that generates a spatially extended femtosecond pulse beam in the depth direction. When we illuminate the irradiated 2D barcode pattern with a 254 nm ultraviolet (UV) light, a strong red photoluminescence (PL) is observed, and we can read it by using a complementary metal oxide semiconductor (CMOS) camera and image processing technology. This work provides a novel barcode fabrication method by femtosecond laser processing using a CGH and a barcode reading method by a red PL.

Pair-barcode high-throughput sequencing for large-scale multiplexed sample analysis

PubMed Central

2012-01-01

Background The multiplexing becomes the major limitation of the next-generation sequencing (NGS) in application to low complexity samples. Physical space segregation allows limited multiplexing, while the existing barcode approach only permits simultaneously analysis of up to several dozen samples. Results Here we introduce pair-barcode sequencing (PBS), an economic and flexible barcoding technique that permits parallel analysis of large-scale multiplexed samples. In two pilot runs using SOLiD sequencer (Applied Biosystems Inc.), 32 independent pair-barcoded miRNA libraries were simultaneously discovered by the combination of 4 unique forward barcodes and 8 unique reverse barcodes. Over 174,000,000 reads were generated and about 64% of them are assigned to both of the barcodes. After mapping all reads to pre-miRNAs in miRBase, different miRNA expression patterns are captured from the two clinical groups. The strong correlation using different barcode pairs and the high consistency of miRNA expression in two independent runs demonstrates that PBS approach is valid. Conclusions By employing PBS approach in NGS, large-scale multiplexed pooled samples could be practically analyzed in parallel so that high-throughput sequencing economically meets the requirements of samples which are low sequencing throughput demand. PMID:22276739

Pair-barcode high-throughput sequencing for large-scale multiplexed sample analysis.

PubMed

Tu, Jing; Ge, Qinyu; Wang, Shengqin; Wang, Lei; Sun, Beili; Yang, Qi; Bai, Yunfei; Lu, Zuhong

2012-01-25

The multiplexing becomes the major limitation of the next-generation sequencing (NGS) in application to low complexity samples. Physical space segregation allows limited multiplexing, while the existing barcode approach only permits simultaneously analysis of up to several dozen samples. Here we introduce pair-barcode sequencing (PBS), an economic and flexible barcoding technique that permits parallel analysis of large-scale multiplexed samples. In two pilot runs using SOLiD sequencer (Applied Biosystems Inc.), 32 independent pair-barcoded miRNA libraries were simultaneously discovered by the combination of 4 unique forward barcodes and 8 unique reverse barcodes. Over 174,000,000 reads were generated and about 64% of them are assigned to both of the barcodes. After mapping all reads to pre-miRNAs in miRBase, different miRNA expression patterns are captured from the two clinical groups. The strong correlation using different barcode pairs and the high consistency of miRNA expression in two independent runs demonstrates that PBS approach is valid. By employing PBS approach in NGS, large-scale multiplexed pooled samples could be practically analyzed in parallel so that high-throughput sequencing economically meets the requirements of samples which are low sequencing throughput demand.

DNA Barcodes for Forensically Important Fly Species in Brazil.

PubMed

Koroiva, Ricardo; de Souza, Mirian S; Roque, Fabio de Oliveira; Pepinelli, Mateus

2018-04-07

Here, we analyze 248 DNA barcode sequences of 35 fly species of forensic importance in Brazil. DNA barcoding can be effectively used for specimen identification of these species, allowing the unambiguous identification of 31 species, an overall success rate of 88%. Our results show a high rate of success for molecular identification using DNA barcoding sequences and open new perspectives for immature species identification, a subject on which limited forensic investigations exist in Tropical regions. We also address the implications of building a robust forensic DNA barcode database. A geographic bias is recognized for the COI dataset available for forensically important fly species in Brazil, with concentration of sequences from specimens collected mainly in sites located in the Cerrado, Mata Atlântica, and Pampa biomes.

The Barcode of Life Data Portal: Bridging the Biodiversity Informatics Divide for DNA Barcoding

PubMed Central

Sarkar, Indra Neil; Trizna, Michael

2011-01-01

With the volume of molecular sequence data that is systematically being generated globally, there is a need for centralized resources for data exploration and analytics. DNA Barcode initiatives are on track to generate a compendium of molecular sequence–based signatures for identifying animals and plants. To date, the range of available data exploration and analytic tools to explore these data have only been available in a boutique form—often representing a frustrating hurdle for many researchers that may not necessarily have resources to install or implement algorithms described by the analytic community. The Barcode of Life Data Portal (BDP) is a first step towards integrating the latest biodiversity informatics innovations with molecular sequence data from DNA barcoding. Through establishment of community driven standards, based on discussion with the Data Analysis Working Group (DAWG) of the Consortium for the Barcode of Life (CBOL), the BDP provides an infrastructure for incorporation of existing and next-generation DNA barcode analytic applications in an open forum. PMID:21818249

High-Throughput Functional Validation of Progression Drivers in Lung Adenocarcinoma

DTIC Science & Technology

2013-09-01

2) a novel molecular barcoding approach that facilitates cost- effective detection of driver events following in vitro and in vivo functional screens...aberration construction pipeline, which we named High-Throughput 3 Mutagenesis and Molecular Barcoding (HiTMMoB; Fig.1). We have therefore been able...lentiviral vector specially constructed for this project. This vector is compatible with our flexible molecular barcoding technology (Fig. 1), thus each

Potential of DNA barcoding for detecting quarantine fungi.

PubMed

Gao, Ruifang; Zhang, Guiming

2013-11-01

The detection of live quarantine pathogenic fungi plays an important role in guaranteeing regional biological safety. DNA barcoding, an emerging species identification technology, holds promise for the reliable, quick, and accurate detection of quarantine fungi. International standards for phytosanitary guidelines are urgently needed. The varieties of quarantine fungi listed for seven countries/regions, the currently applied detection methods, and the status of DNA barcoding for detecting quarantine fungi are summarized in this study. Two approaches have been proposed to apply DNA barcoding to fungal quarantine procedures: (i) to verify the reliability of known internal transcribed spacer (ITS)/cytochrome c oxidase subunit I (COI) data for use as barcodes, and (ii) to determine other barcodes for species that cannot be identified by ITS/COI. As a unique, standardizable, and universal species identification tool, DNA barcoding offers great potential for integrating detection methods used in various countries/regions and establishing international detection standards based on accepted DNA barcodes. Through international collaboration, interstate disputes can be eased and many problems related to routine quarantine detection methods can be solved for global trade.

BioBarcode: a general DNA barcoding database and server platform for Asian biodiversity resources.

PubMed

Lim, Jeongheui; Kim, Sang-Yoon; Kim, Sungmin; Eo, Hae-Seok; Kim, Chang-Bae; Paek, Woon Kee; Kim, Won; Bhak, Jong

2009-12-03

DNA barcoding provides a rapid, accurate, and standardized method for species-level identification using short DNA sequences. Such a standardized identification method is useful for mapping all the species on Earth, particularly when DNA sequencing technology is cheaply available. There are many nations in Asia with many biodiversity resources that need to be mapped and registered in databases. We have built a general DNA barcode data processing system, BioBarcode, with open source software - which is a general purpose database and server. It uses mySQL RDBMS 5.0, BLAST2, and Apache httpd server. An exemplary database of BioBarcode has around 11,300 specimen entries (including GenBank data) and registers the biological species to map their genetic relationships. The BioBarcode database contains a chromatogram viewer which improves the performance in DNA sequence analyses. Asia has a very high degree of biodiversity and the BioBarcode database server system aims to provide an efficient bioinformatics protocol that can be freely used by Asian researchers and research organizations interested in DNA barcoding. The BioBarcode promotes the rapid acquisition of biological species DNA sequence data that meet global standards by providing specialized services, and provides useful tools that will make barcoding cheaper and faster in the biodiversity community such as standardization, depository, management, and analysis of DNA barcode data. The system can be downloaded upon request, and an exemplary server has been constructed with which to build an Asian biodiversity system http://www.asianbarcode.org.

Submicrometre geometrically encoded fluorescent barcodes self-assembled from DNA

NASA Astrophysics Data System (ADS)

Lin, Chenxiang; Jungmann, Ralf; Leifer, Andrew M.; Li, Chao; Levner, Daniel; Church, George M.; Shih, William M.; Yin, Peng

2012-10-01

The identification and differentiation of a large number of distinct molecular species with high temporal and spatial resolution is a major challenge in biomedical science. Fluorescence microscopy is a powerful tool, but its multiplexing ability is limited by the number of spectrally distinguishable fluorophores. Here, we used (deoxy)ribonucleic acid (DNA)-origami technology to construct submicrometre nanorods that act as fluorescent barcodes. We demonstrate that spatial control over the positioning of fluorophores on the surface of a stiff DNA nanorod can produce 216 distinct barcodes that can be decoded unambiguously using epifluorescence or total internal reflection fluorescence microscopy. Barcodes with higher spatial information density were demonstrated via the construction of super-resolution barcodes with features spaced by ˜40 nm. One species of the barcodes was used to tag yeast surface receptors, which suggests their potential applications as in situ imaging probes for diverse biomolecular and cellular entities in their native environments.

Sub-micrometer Geometrically Encoded Fluorescent Barcodes Self-Assembled from DNA

PubMed Central

Lin, Chenxiang; Jungmann, Ralf; Leifer, Andrew M.; Li, Chao; Levner, Daniel; Church, George M.; Shih, William M.; Yin, Peng

2012-01-01

The identification and differentiation of a large number of distinct molecular species with high temporal and spatial resolution is a major challenge in biomedical science. Fluorescence microscopy is a powerful tool, but its multiplexing ability is limited by the number of spectrally distinguishable fluorophores. Here we use DNA-origami technology to construct sub-micrometer nanorods that act as fluorescent barcodes. We demonstrate that spatial control over the positioning of fluorophores on the surface of a stiff DNA nanorod can produce 216 distinct barcodes that can be unambiguously decoded using epifluorescence or total internal reflection fluorescence (TIRF) microscopy. Barcodes with higher spatial information density were demonstrated via the construction of super-resolution barcodes with features spaced by ~40 nm. One species of the barcodes was used to tag yeast surface receptors, suggesting their potential applications as in situ imaging probes for diverse biomolecular and cellular entities in their native environments. PMID:23000997

Errors detected in pediatric oral liquid medication doses prepared in an automated workflow management system.

PubMed

Bledsoe, Sarah; Van Buskirk, Alex; Falconer, R James; Hollon, Andrew; Hoebing, Wendy; Jokic, Sladan

2018-02-01

The effectiveness of barcode-assisted medication preparation (BCMP) technology on detecting oral liquid dose preparation errors. From June 1, 2013, through May 31, 2014, a total of 178,344 oral doses were processed at Children's Mercy, a 301-bed pediatric hospital, through an automated workflow management system. Doses containing errors detected by the system's barcode scanning system or classified as rejected by the pharmacist were further reviewed. Errors intercepted by the barcode-scanning system were classified as (1) expired product, (2) incorrect drug, (3) incorrect concentration, and (4) technological error. Pharmacist-rejected doses were categorized into 6 categories based on the root cause of the preparation error: (1) expired product, (2) incorrect concentration, (3) incorrect drug, (4) incorrect volume, (5) preparation error, and (6) other. Of the 178,344 doses examined, 3,812 (2.1%) errors were detected by either the barcode-assisted scanning system (1.8%, n = 3,291) or a pharmacist (0.3%, n = 521). The 3,291 errors prevented by the barcode-assisted system were classified most commonly as technological error and incorrect drug, followed by incorrect concentration and expired product. Errors detected by pharmacists were also analyzed. These 521 errors were most often classified as incorrect volume, preparation error, expired product, other, incorrect drug, and incorrect concentration. BCMP technology detected errors in 1.8% of pediatric oral liquid medication doses prepared in an automated workflow management system, with errors being most commonly attributed to technological problems or incorrect drugs. Pharmacists rejected an additional 0.3% of studied doses. Copyright © 2018 by the American Society of Health-System Pharmacists, Inc. All rights reserved.

Telling plant species apart with DNA: from barcodes to genomes

PubMed Central

Li, De-Zhu; van der Bank, Michelle

2016-01-01

Land plants underpin a multitude of ecosystem functions, support human livelihoods and represent a critically important component of terrestrial biodiversity—yet many tens of thousands of species await discovery, and plant identification remains a substantial challenge, especially where material is juvenile, fragmented or processed. In this opinion article, we tackle two main topics. Firstly, we provide a short summary of the strengths and limitations of plant DNA barcoding for addressing these issues. Secondly, we discuss options for enhancing current plant barcodes, focusing on increasing discriminatory power via either gene capture of nuclear markers or genome skimming. The former has the advantage of establishing a defined set of target loci maximizing efficiency of sequencing effort, data storage and analysis. The challenge is developing a probe set for large numbers of nuclear markers that works over sufficient phylogenetic breadth. Genome skimming has the advantage of using existing protocols and being backward compatible with existing barcodes; and the depth of sequence coverage can be increased as sequencing costs fall. Its non-targeted nature does, however, present a major informatics challenge for upscaling to large sample sets. This article is part of the themed issue ‘From DNA barcodes to biomes’. PMID:27481790

DNA barcode goes two-dimensions: DNA QR code web server.

PubMed

Liu, Chang; Shi, Linchun; Xu, Xiaolan; Li, Huan; Xing, Hang; Liang, Dong; Jiang, Kun; Pang, Xiaohui; Song, Jingyuan; Chen, Shilin

2012-01-01

The DNA barcoding technology uses a standard region of DNA sequence for species identification and discovery. At present, "DNA barcode" actually refers to DNA sequences, which are not amenable to information storage, recognition, and retrieval. Our aim is to identify the best symbology that can represent DNA barcode sequences in practical applications. A comprehensive set of sequences for five DNA barcode markers ITS2, rbcL, matK, psbA-trnH, and CO1 was used as the test data. Fifty-three different types of one-dimensional and ten two-dimensional barcode symbologies were compared based on different criteria, such as coding capacity, compression efficiency, and error detection ability. The quick response (QR) code was found to have the largest coding capacity and relatively high compression ratio. To facilitate the further usage of QR code-based DNA barcodes, a web server was developed and is accessible at http://qrfordna.dnsalias.org. The web server allows users to retrieve the QR code for a species of interests, convert a DNA sequence to and from a QR code, and perform species identification based on local and global sequence similarities. In summary, the first comprehensive evaluation of various barcode symbologies has been carried out. The QR code has been found to be the most appropriate symbology for DNA barcode sequences. A web server has also been constructed to allow biologists to utilize QR codes in practical DNA barcoding applications.

Multiplexing clonality: combining RGB marking and genetic barcoding

PubMed Central

Cornils, Kerstin; Thielecke, Lars; Hüser, Svenja; Forgber, Michael; Thomaschewski, Michael; Kleist, Nadja; Hussein, Kais; Riecken, Kristoffer; Volz, Tassilo; Gerdes, Sebastian; Glauche, Ingmar; Dahl, Andreas; Dandri, Maura; Roeder, Ingo; Fehse, Boris

2014-01-01

RGB marking and DNA barcoding are two cutting-edge technologies in the field of clonal cell marking. To combine the virtues of both approaches, we equipped LeGO vectors encoding red, green or blue fluorescent proteins with complex DNA barcodes carrying color-specific signatures. For these vectors, we generated highly complex plasmid libraries that were used for the production of barcoded lentiviral vector particles. In proof-of-principle experiments, we used barcoded vectors for RGB marking of cell lines and primary murine hepatocytes. We applied single-cell polymerase chain reaction to decipher barcode signatures of individual RGB-marked cells expressing defined color hues. This enabled us to prove clonal identity of cells with one and the same RGB color. Also, we made use of barcoded vectors to investigate clonal development of leukemia induced by ectopic oncogene expression in murine hematopoietic cells. In conclusion, by combining RGB marking and DNA barcoding, we have established a novel technique for the unambiguous genetic marking of individual cells in the context of normal regeneration as well as malignant outgrowth. Moreover, the introduction of color-specific signatures in barcodes will facilitate studies on the impact of different variables (e.g. vector type, transgenes, culture conditions) in the context of competitive repopulation studies. PMID:24476916

Review and future prospects for DNA barcoding methods in forensic palynology.

PubMed

Bell, Karen L; Burgess, Kevin S; Okamoto, Kazufusa C; Aranda, Roman; Brosi, Berry J

2016-03-01

Pollen can be a critical forensic marker in cases where determining geographic origin is important, including investigative leads, missing persons cases, and intelligence applications. However, its use has previously been limited by the need for a high level of specialization by expert palynologists, slow speeds of identification, and relatively poor taxonomic resolution (typically to the plant family or genus level). By contrast, identification of pollen through DNA barcoding has the potential to overcome all three of these limitations, and it may seem surprising that the method has not been widely implemented. Despite what might seem a straightforward application of DNA barcoding to pollen, there are technical issues that have delayed progress. However, recent developments of standard methods for DNA barcoding of pollen, along with improvements in high-throughput sequencing technology, have overcome most of these technical issues. Based on these recent methodological developments in pollen DNA barcoding, we believe that now is the time to start applying these techniques in forensic palynology. In this article, we discuss the potential for these methods, and outline directions for future research to further improve on the technology and increase its applicability to a broader range of situations. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

BioBarcode: a general DNA barcoding database and server platform for Asian biodiversity resources

PubMed Central

2009-01-01

Background DNA barcoding provides a rapid, accurate, and standardized method for species-level identification using short DNA sequences. Such a standardized identification method is useful for mapping all the species on Earth, particularly when DNA sequencing technology is cheaply available. There are many nations in Asia with many biodiversity resources that need to be mapped and registered in databases. Results We have built a general DNA barcode data processing system, BioBarcode, with open source software - which is a general purpose database and server. It uses mySQL RDBMS 5.0, BLAST2, and Apache httpd server. An exemplary database of BioBarcode has around 11,300 specimen entries (including GenBank data) and registers the biological species to map their genetic relationships. The BioBarcode database contains a chromatogram viewer which improves the performance in DNA sequence analyses. Conclusion Asia has a very high degree of biodiversity and the BioBarcode database server system aims to provide an efficient bioinformatics protocol that can be freely used by Asian researchers and research organizations interested in DNA barcoding. The BioBarcode promotes the rapid acquisition of biological species DNA sequence data that meet global standards by providing specialized services, and provides useful tools that will make barcoding cheaper and faster in the biodiversity community such as standardization, depository, management, and analysis of DNA barcode data. The system can be downloaded upon request, and an exemplary server has been constructed with which to build an Asian biodiversity system http://www.asianbarcode.org. PMID:19958506

Impact of Barcode Medication Administration Technology on How Nurses Spend Their Time On Clinical Care

PubMed Central

Poon, Eric G; Keohane, Carol; Featherstone, Erica; Hays, Brandon; Dervan, Andrew; Woolf, Seth; Hayes, Judy; Bane, Anne; Newmark, Lisa; Gandhi, Tejal K

2006-01-01

In a time-motion study conducted in a hospital that recently implemented barcode medication administration (BCMA) technology, we found that the BCMA system did not increase the amount of time nurses spend on medication administration activities, and did not compromise the amount of time nurses spent on direct care of patients. Our results should allay concerns regarding the impact of BCMA on nursing workflow. PMID:17238684

Using DNA barcoding to differentiate invasive Dreissena species (Mollusca, Bivalvia)

PubMed Central

Marescaux, Jonathan; Van Doninck, Karine

2013-01-01

Abstract The zebra mussel (Dreissena polymorpha) and the quagga mussel (Dreissena rostriformis bugensis) are considered as the most competitive invaders in freshwaters of Europe and North America. Although shell characteristics exist to differentiate both species, phenotypic plasticity in the genus Dreissena does not always allow a clear identification. Therefore, the need to find an accurate identification method is essential. DNA barcoding has been proven to be an adequate procedure to discriminate species. The cytochrome c oxidase subunit I mitochondrial gene (COI) is considered as the standard barcode for animals. We tested the use of this gene as an efficient DNA barcode and found that it allow rapid and accurate identification of adult Dreissena individuals. PMID:24453560

From barcoding single individuals to metabarcoding biological communities: towards an integrative approach to the study of global biodiversity.

PubMed

Cristescu, Melania E

2014-10-01

DNA-based species identification, known as barcoding, transformed the traditional approach to the study of biodiversity science. The field is transitioning from barcoding individuals to metabarcoding communities. This revolution involves new sequencing technologies, bioinformatics pipelines, computational infrastructure, and experimental designs. In this dynamic genomics landscape, metabarcoding studies remain insular and biodiversity estimates depend on the particular methods used. In this opinion article, I discuss the need for a coordinated advancement of DNA-based species identification that integrates taxonomic and barcoding information. Such an approach would facilitate access to almost 3 centuries of taxonomic knowledge and 1 decade of building repository barcodes. Conservation projects are time sensitive, research funding is becoming restricted, and informed decisions depend on our ability to embrace integrative approaches to biodiversity science. Copyright © 2014 Elsevier Ltd. All rights reserved.

Time trend of injection drug errors before and after implementation of bar-code verification system.

PubMed

Sakushima, Ken; Umeki, Reona; Endoh, Akira; Ito, Yoichi M; Nasuhara, Yasuyuki

2015-01-01

Bar-code technology, used for verification of patients and their medication, could prevent medication errors in clinical practice. Retrospective analysis of electronically stored medical error reports was conducted in a university hospital. The number of reported medication errors of injected drugs, including wrong drug administration and administration to the wrong patient, was compared before and after implementation of the bar-code verification system for inpatient care. A total of 2867 error reports associated with injection drugs were extracted. Wrong patient errors decreased significantly after implementation of the bar-code verification system (17.4/year vs. 4.5/year, p< 0.05), although wrong drug errors did not decrease sufficiently (24.2/year vs. 20.3/year). The source of medication errors due to wrong drugs was drug preparation in hospital wards. Bar-code medication administration is effective for prevention of wrong patient errors. However, ordinary bar-code verification systems are limited in their ability to prevent incorrect drug preparation in hospital wards.

Future collaborations between NEON and the U.S. EPA: linking molecular genomics for bioassessment with national ecological data sets

EPA Science Inventory

Molecular taxonomic techniques such as DNA barcoding offer interesting new capabilities for studying community biodiversity for applications like biological monitoring. Beyond DNA barcoding, new DNA sequencing technologies (i.e. Next-Generation Sequencing) present even greater po...

Multiplexed profiling of GPCR activities by combining split TEV assays and EXT-based barcoded readouts.

PubMed

Galinski, Sabrina; Wichert, Sven P; Rossner, Moritz J; Wehr, Michael C

2018-05-25

G protein-coupled receptors (GPCRs) are the largest class of cell surface receptors and are implicated in the physiological regulation of many biological processes. The high diversity of GPCRs and their physiological functions make them primary targets for therapeutic drugs. For the generation of novel compounds, however, selectivity towards a given target is a critical issue in drug development as structural similarities between members of GPCR subfamilies exist. Therefore, the activities of multiple GPCRs that are both closely and distantly related to assess compound selectivity need to be tested simultaneously. Here, we present a cell-based multiplexed GPCR activity assay, termed GPCRprofiler, which uses a β-arrestin recruitment strategy and combines split TEV protein-protein interaction and EXT-based barcode technologies. This approach enables simultaneous measurements of receptor activities of multiple GPCR-ligand combinations by applying massively parallelized reporter assays. In proof-of-principle experiments covering 19 different GPCRs, both the specificity of endogenous agonists and the polypharmacological effects of two known antipsychotics on GPCR activities were demonstrated. Technically, normalization of barcode reporters across individual assays allows quantitative pharmacological assays in a parallelized manner. In summary, the GPCRprofiler technique constitutes a flexible and scalable approach, which enables simultaneous profiling of compound actions on multiple receptor activities in living cells.

Derivative Technology of DNA Barcoding (Nucleotide Signature and SNP Double Peak Methods) Detects Adulterants and Substitution in Chinese Patent Medicines.

PubMed

Gao, Zitong; Liu, Yang; Wang, Xiaoyue; Song, Jingyuan; Chen, Shilin; Ragupathy, Subramanyam; Han, Jianping; Newmaster, Steven G

2017-07-19

Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it's not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5' CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3') was developed derived from ITS2 region of Eucommiae Folium based on unique motifs. Mixtures of powdered Lonicerae japonicae Flos and Lonicerae Flos resulted in double peaks at the expected SNP (Single Nucleotide Polymorphisms) positions, of which the height of the peaks were roughly indicative of the species' ratio in the mixed powder. Subsequently we tested 20 extracts and 47 CPMs labelled as containing some species of Lonicera. The results revealed only 17% of the extracts and 22% of the CPMs were authentic, others exist substitution or adulterant; 7% were shown to contain both of two adulterants Eucommiae Folium and Lonicerae Flos. The methods developed in this study will widely broaden the application of DNA barcode in quality assurance of natural health products.

An economic analysis of private incentives to adopt DNA barcoding technology for fish species authentication in Canada.

PubMed

Ugochukwu, Albert I; Hobbs, Jill E; Phillips, Peter W B; Gray, Richard

2015-12-01

The increasing spate of species substitution and mislabelling in fish markets has become a concern to the public and a challenge to both the food industry and regulators. Species substitution and mislabelling within fish supply chains occurs because of price incentives to misrepresent products for economic gain. Emerging authenticity technologies, such as the DNA barcoding technology that has been used to identify plants and animal (particularly fish) species through DNA sequencing, offer a potential technological solution to this information problem. However, the adoption of these authenticity technologies depends also on economic factors. The present study uses economic welfare analysis to examine the effects of species substitution and mislabelling in fish markets, and examines the feasibility of the technology for a typical retail store in Canada. It is assumed that increased accuracy of the technology in detecting fraud and enforcement of legal penalties and other associated costs would be likely to discourage cheating. Empirical results suggest that DNA barcoding technology would be feasible presently for a typical retail store only if authentication is done in a third party laboratory, as it may not be feasible on an individual retail store level once fixed and other associated costs of the technology are considered.

DNA barcodes for ecology, evolution, and conservation.

PubMed

Kress, W John; García-Robledo, Carlos; Uriarte, Maria; Erickson, David L

2015-01-01

The use of DNA barcodes, which are short gene sequences taken from a standardized portion of the genome and used to identify species, is entering a new phase of application as more and more investigations employ these genetic markers to address questions relating to the ecology and evolution of natural systems. The suite of DNA barcode markers now applied to specific taxonomic groups of organisms are proving invaluable for understanding species boundaries, community ecology, functional trait evolution, trophic interactions, and the conservation of biodiversity. The application of next-generation sequencing (NGS) technology will greatly expand the versatility of DNA barcodes across the Tree of Life, habitats, and geographies as new methodologies are explored and developed. Published by Elsevier Ltd.

76 FR 59504 - Intelligent Mail Package Barcode (IMpb) Implementation for Commercial Parcels

Federal Register 2010, 2011, 2012, 2013, 2014

2011-09-27

... formats when printing an IMpb. Current standards require a different human-readable service banner text... packages must also ensure sufficient label space exists to print a longer barcode that meets specifications... service) will be used for pre-printed MRS labels (since unique serial numbers cannot be used). Response...

The seven deadly sins of DNA barcoding.

PubMed

Collins, R A; Cruickshank, R H

2013-11-01

Despite the broad benefits that DNA barcoding can bring to a diverse range of biological disciplines, a number of shortcomings still exist in terms of the experimental design of studies incorporating this approach. One underlying reason for this lies in the confusion that often exists between species discovery and specimen identification, and this is reflected in the way that hypotheses are generated and tested. Although these aims can be associated, they are quite distinct and require different methodological approaches, but their conflation has led to the frequently inappropriate use of commonly used analytical methods such as neighbour-joining trees, bootstrap resampling and fixed distance thresholds. Furthermore, the misidentification of voucher specimens can also have serious implications for end users of reference libraries such as the Barcode of Life Data Systems, and in this regard we advocate increased diligence in the a priori identification of specimens to be used for this purpose. This commentary provides an assessment of seven deficiencies that we identify as common in the DNA barcoding literature, and outline some potential improvements for its adaptation and adoption towards more reliable and accurate outcomes. © 2012 John Wiley & Sons Ltd.

Quantitative phenotyping via deep barcode sequencing.

PubMed

Smith, Andrew M; Heisler, Lawrence E; Mellor, Joseph; Kaper, Fiona; Thompson, Michael J; Chee, Mark; Roth, Frederick P; Giaever, Guri; Nislow, Corey

2009-10-01

Next-generation DNA sequencing technologies have revolutionized diverse genomics applications, including de novo genome sequencing, SNP detection, chromatin immunoprecipitation, and transcriptome analysis. Here we apply deep sequencing to genome-scale fitness profiling to evaluate yeast strain collections in parallel. This method, Barcode analysis by Sequencing, or "Bar-seq," outperforms the current benchmark barcode microarray assay in terms of both dynamic range and throughput. When applied to a complex chemogenomic assay, Bar-seq quantitatively identifies drug targets, with performance superior to the benchmark microarray assay. We also show that Bar-seq is well-suited for a multiplex format. We completely re-sequenced and re-annotated the yeast deletion collection using deep sequencing, found that approximately 20% of the barcodes and common priming sequences varied from expectation, and used this revised list of barcode sequences to improve data quality. Together, this new assay and analysis routine provide a deep-sequencing-based toolkit for identifying gene-environment interactions on a genome-wide scale.

Biodiversity inventories in high gear: DNA barcoding facilitates a rapid biotic survey of a temperate nature reserve.

PubMed

Telfer, Angela C; Young, Monica R; Quinn, Jenna; Perez, Kate; Sobel, Crystal N; Sones, Jayme E; Levesque-Beaudin, Valerie; Derbyshire, Rachael; Fernandez-Triana, Jose; Rougerie, Rodolphe; Thevanayagam, Abinah; Boskovic, Adrian; Borisenko, Alex V; Cadel, Alex; Brown, Allison; Pages, Anais; Castillo, Anibal H; Nicolai, Annegret; Glenn Mockford, Barb Mockford; Bukowski, Belén; Wilson, Bill; Trojahn, Brock; Lacroix, Carole Ann; Brimblecombe, Chris; Hay, Christoper; Ho, Christmas; Steinke, Claudia; Warne, Connor P; Garrido Cortes, Cristina; Engelking, Daniel; Wright, Danielle; Lijtmaer, Dario A; Gascoigne, David; Hernandez Martich, David; Morningstar, Derek; Neumann, Dirk; Steinke, Dirk; Marco DeBruin, Donna DeBruin; Dobias, Dylan; Sears, Elizabeth; Richard, Ellen; Damstra, Emily; Zakharov, Evgeny V; Laberge, Frederic; Collins, Gemma E; Blagoev, Gergin A; Grainge, Gerrie; Ansell, Graham; Meredith, Greg; Hogg, Ian; McKeown, Jaclyn; Topan, Janet; Bracey, Jason; Guenther, Jerry; Sills-Gilligan, Jesse; Addesi, Joseph; Persi, Joshua; Layton, Kara K S; D'Souza, Kareina; Dorji, Kencho; Grundy, Kevin; Nghidinwa, Kirsti; Ronnenberg, Kylee; Lee, Kyung Min; Xie, Linxi; Lu, Liuqiong; Penev, Lyubomir; Gonzalez, Mailyn; Rosati, Margaret E; Kekkonen, Mari; Kuzmina, Maria; Iskandar, Marianne; Mutanen, Marko; Fatahi, Maryam; Pentinsaari, Mikko; Bauman, Miriam; Nikolova, Nadya; Ivanova, Natalia V; Jones, Nathaniel; Weerasuriya, Nimalka; Monkhouse, Norman; Lavinia, Pablo D; Jannetta, Paul; Hanisch, Priscila E; McMullin, R Troy; Ojeda Flores, Rafael; Mouttet, Raphaëlle; Vender, Reid; Labbee, Renee N; Forsyth, Robert; Lauder, Rob; Dickson, Ross; Kroft, Ruth; Miller, Scott E; MacDonald, Shannon; Panthi, Sishir; Pedersen, Stephanie; Sobek-Swant, Stephanie; Naik, Suresh; Lipinskaya, Tatsiana; Eagalle, Thanushi; Decaëns, Thibaud; Kosuth, Thibault; Braukmann, Thomas; Woodcock, Tom; Roslin, Tomas; Zammit, Tony; Campbell, Victoria; Dinca, Vlad; Peneva, Vlada; Hebert, Paul D N; deWaard, Jeremy R

2015-01-01

Comprehensive biotic surveys, or 'all taxon biodiversity inventories' (ATBI), have traditionally been limited in scale or scope due to the complications surrounding specimen sorting and species identification. To circumvent these issues, several ATBI projects have successfully integrated DNA barcoding into their identification procedures and witnessed acceleration in their surveys and subsequent increase in project scope and scale. The Biodiversity Institute of Ontario partnered with the rare Charitable Research Reserve and delegates of the 6th International Barcode of Life Conference to complete its own rapid, barcode-assisted ATBI of an established land trust in Cambridge, Ontario, Canada. The existing species inventory for the rare Charitable Research Reserve was rapidly expanded by integrating a DNA barcoding workflow with two surveying strategies - a comprehensive sampling scheme over four months, followed by a one-day bioblitz involving international taxonomic experts. The two surveys resulted in 25,287 and 3,502 specimens barcoded, respectively, as well as 127 human observations. This barcoded material, all vouchered at the Biodiversity Institute of Ontario collection, covers 14 phyla, 29 classes, 117 orders, and 531 families of animals, plants, fungi, and lichens. Overall, the ATBI documented 1,102 new species records for the nature reserve, expanding the existing long-term inventory by 49%. In addition, 2,793 distinct Barcode Index Numbers (BINs) were assigned to genus or higher level taxonomy, and represent additional species that will be added once their taxonomy is resolved. For the 3,502 specimens, the collection, sequence analysis, taxonomic assignment, data release and manuscript submission by 100+ co-authors all occurred in less than one week. This demonstrates the speed at which barcode-assisted inventories can be completed and the utility that barcoding provides in minimizing and guiding valuable taxonomic specialist time. The final product is more than a comprehensive biotic inventory - it is also a rich dataset of fine-scale occurrence and sequence data, all archived and cross-linked in the major biodiversity data repositories. This model of rapid generation and dissemination of essential biodiversity data could be followed to conduct regional assessments of biodiversity status and change, and potentially be employed for evaluating progress towards the Aichi Targets of the Strategic Plan for Biodiversity 2011-2020.

Biodiversity inventories in high gear: DNA barcoding facilitates a rapid biotic survey of a temperate nature reserve

PubMed Central

Young, Monica R; Quinn, Jenna; Perez, Kate; Sobel, Crystal N; Sones, Jayme E; Levesque-Beaudin, Valerie; Derbyshire, Rachael; Fernandez-Triana, Jose; Rougerie, Rodolphe; Thevanayagam, Abinah; Boskovic, Adrian; Borisenko, Alex V; Cadel, Alex; Brown, Allison; Pages, Anais; Castillo, Anibal H; Nicolai, Annegret; Glenn Mockford, Barb Mockford; Bukowski, Belén; Wilson, Bill; Trojahn, Brock; Lacroix, Carole Ann; Brimblecombe, Chris; Hay, Christoper; Ho, Christmas; Steinke, Claudia; Warne, Connor P; Garrido Cortes, Cristina; Engelking, Daniel; Wright, Danielle; Lijtmaer, Dario A; Gascoigne, David; Hernandez Martich, David; Morningstar, Derek; Neumann, Dirk; Steinke, Dirk; Marco DeBruin, Donna DeBruin; Dobias, Dylan; Sears, Elizabeth; Richard, Ellen; Damstra, Emily; Zakharov, Evgeny V; Laberge, Frederic; Collins, Gemma E; Blagoev, Gergin A; Grainge, Gerrie; Ansell, Graham; Meredith, Greg; Hogg, Ian; McKeown, Jaclyn; Topan, Janet; Bracey, Jason; Guenther, Jerry; Sills-Gilligan, Jesse; Addesi, Joseph; Persi, Joshua; Layton, Kara K S; D'Souza, Kareina; Dorji, Kencho; Grundy, Kevin; Nghidinwa, Kirsti; Ronnenberg, Kylee; Lee, Kyung Min; Xie, Linxi; Lu, Liuqiong; Penev, Lyubomir; Gonzalez, Mailyn; Rosati, Margaret E; Kekkonen, Mari; Kuzmina, Maria; Iskandar, Marianne; Mutanen, Marko; Fatahi, Maryam; Pentinsaari, Mikko; Bauman, Miriam; Nikolova, Nadya; Ivanova, Natalia V; Jones, Nathaniel; Weerasuriya, Nimalka; Monkhouse, Norman; Lavinia, Pablo D; Jannetta, Paul; Hanisch, Priscila E; McMullin, R. Troy; Ojeda Flores, Rafael; Mouttet, Raphaëlle; Vender, Reid; Labbee, Renee N; Forsyth, Robert; Lauder, Rob; Dickson, Ross; Kroft, Ruth; Miller, Scott E; MacDonald, Shannon; Panthi, Sishir; Pedersen, Stephanie; Sobek-Swant, Stephanie; Naik, Suresh; Lipinskaya, Tatsiana; Eagalle, Thanushi; Decaëns, Thibaud; Kosuth, Thibault; Braukmann, Thomas; Woodcock, Tom; Roslin, Tomas; Zammit, Tony; Campbell, Victoria; Dinca, Vlad; Peneva, Vlada; Hebert, Paul D N

2015-01-01

Abstract Background Comprehensive biotic surveys, or ‘all taxon biodiversity inventories’ (ATBI), have traditionally been limited in scale or scope due to the complications surrounding specimen sorting and species identification. To circumvent these issues, several ATBI projects have successfully integrated DNA barcoding into their identification procedures and witnessed acceleration in their surveys and subsequent increase in project scope and scale. The Biodiversity Institute of Ontario partnered with the rare Charitable Research Reserve and delegates of the 6th International Barcode of Life Conference to complete its own rapid, barcode-assisted ATBI of an established land trust in Cambridge, Ontario, Canada. New information The existing species inventory for the rare Charitable Research Reserve was rapidly expanded by integrating a DNA barcoding workflow with two surveying strategies – a comprehensive sampling scheme over four months, followed by a one-day bioblitz involving international taxonomic experts. The two surveys resulted in 25,287 and 3,502 specimens barcoded, respectively, as well as 127 human observations. This barcoded material, all vouchered at the Biodiversity Institute of Ontario collection, covers 14 phyla, 29 classes, 117 orders, and 531 families of animals, plants, fungi, and lichens. Overall, the ATBI documented 1,102 new species records for the nature reserve, expanding the existing long-term inventory by 49%. In addition, 2,793 distinct Barcode Index Numbers (BINs) were assigned to genus or higher level taxonomy, and represent additional species that will be added once their taxonomy is resolved. For the 3,502 specimens, the collection, sequence analysis, taxonomic assignment, data release and manuscript submission by 100+ co-authors all occurred in less than one week. This demonstrates the speed at which barcode-assisted inventories can be completed and the utility that barcoding provides in minimizing and guiding valuable taxonomic specialist time. The final product is more than a comprehensive biotic inventory – it is also a rich dataset of fine-scale occurrence and sequence data, all archived and cross-linked in the major biodiversity data repositories. This model of rapid generation and dissemination of essential biodiversity data could be followed to conduct regional assessments of biodiversity status and change, and potentially be employed for evaluating progress towards the Aichi Targets of the Strategic Plan for Biodiversity 2011–2020. PMID:26379469

Comprehensive DNA barcoding of the herpetofauna of Germany.

PubMed

Hawlitschek, O; Morinière, J; Dunz, A; Franzen, M; Rödder, D; Glaw, F; Haszprunar, G

2016-01-01

We present the first comprehensive DNA barcoding study of German reptiles and amphibians representing likewise the first on the European herpetofauna. A total of 248 barcodes for all native species and subspecies in the country and a few additional taxa were obtained in the framework of the projects 'Barcoding Fauna Bavarica' (BFB) and 'German Barcode of Life' (GBOL). In contrast to many invertebrate groups, the success rate of the identification of mitochondrial lineages representing species via DNA barcode was almost 100% because no cases of Barcode Index Number (BIN) sharing were detected within German native reptiles and amphibians. However, as expected, a reliable identification of the hybridogenetic species complex in the frog genus Pelophylax was not possible. Deep conspecific lineages resulting in the identification of more than one BIN were found in Lissotriton vulgaris, Natrix natrix and the hybridogenetic Pelophylax complex. A high variety of lineages with different BINs was also found in the barcodes of wall lizards (Podarcis muralis), confirming the existence of many introduced lineages and the frequent occurrence of multiple introductions. Besides the reliable species identification of all life stages and even of tissue remains, our study highlights other potential applications of DNA barcoding concerning German amphibians and reptiles, such as the detection of allochthonous lineages, monitoring of gene flow and also noninvasive sampling via environmental DNA. DNA barcoding based on COI has now proven to be a reliable and efficient tool for studying most amphibians and reptiles as it is already for many other organism groups in zoology. © 2015 John Wiley & Sons Ltd.

DNA barcoding commercially important fish species of Turkey.

PubMed

Keskın, Emre; Atar, Hasan H

2013-09-01

DNA barcoding was used in the identification of 89 commercially important freshwater and marine fish species found in Turkish ichthyofauna. A total of 1765 DNA barcodes using a 654-bp-long fragment of the mitochondrial cytochrome c oxidase subunit I gene were generated for 89 commercially important freshwater and marine fish species found in Turkish ichthyofauna. These species belong to 70 genera, 40 families and 19 orders from class Actinopterygii, and all were associated with a distinct DNA barcode. Nine and 12 of the COI barcode clusters represent the first species records submitted to the BOLD and GenBank databases, respectively. All COI barcodes (except sequences of first species records) were matched with reference sequences of expected species, according to morphological identification. Average nucleotide frequencies of the data set were calculated as T = 29.7%, C = 28.2%, A = 23.6% and G = 18.6%. Average pairwise genetic distance among individuals were estimated as 0.32%, 9.62%, 17,90% and 22.40% for conspecific, congeneric, confamilial and within order, respectively. Kimura 2-parameter genetic distance values were found to increase with taxonomic level. For most of the species analysed in our data set, there is a barcoding gap, and an overlap in the barcoding gap exists for only two genera. Neighbour-joining trees were drawn based on DNA barcodes and all the specimens clustered in agreement with their taxonomic classification at species level. Results of this study supported DNA barcoding as an efficient molecular tool for a better monitoring, conservation and management of fisheries. © 2013 John Wiley & Sons Ltd.

Scanning-time evaluation of Digimarc Barcode

NASA Astrophysics Data System (ADS)

Gerlach, Rebecca; Pinard, Dan; Weaver, Matt; Alattar, Adnan

2015-03-01

This paper presents a speed comparison between the use of Digimarc® Barcodes and the Universal Product Code (UPC) for customer checkout at point of sale (POS). The recently introduced Digimarc Barcode promises to increase the speed of scanning packaged goods at POS. When this increase is exploited by workforce optimization systems, the retail industry could potentially save billions of dollars. The Digimarc Barcode is based on Digimarc's watermarking technology, and it is imperceptible, very robust, and does not require any special ink, material, or printing processes. Using an image-based scanner, a checker can quickly scan consumer packaged goods (CPG) embedded with the Digimarc Barcode without the need to reorient the packages with respect to the scanner. Faster scanning of packages saves money and enhances customer satisfaction. It reduces the length of the queues at checkout, reduces the cost of cashier labor, and makes self-checkout more convenient. This paper quantifies the increase in POS scanning rates resulting from the use of the Digimarc Barcode versus the traditional UPC. It explains the testing methodology, describes the experimental setup, and analyzes the obtained results. It concludes that the Digimarc Barcode increases number of items per minute (IPM) scanned at least 50% over traditional UPC.

DNA barcoding detected improper labelling and supersession of crab food served by restaurants in India.

PubMed

Vartak, Vivek Rohidas; Narasimmalu, Rajendran; Annam, Pavan Kumar; Singh, Dhirendra P; Lakra, Wazir S

2015-01-01

Detection of improper labelling of raw and processed seafood is of global importance for reducing commercial fraud and enhancing food safety. Crabs are crustaceans with intricate morphological as well as genetic divergence among species and are popular as seafood in restaurants. Owing to the high number of crab species available, it can be difficult to identify those included in particular food dishes, thus increasing the chance of supersession. DNA barcoding is an advanced technology for detecting improper food labelling and has been used successfully to authenticate seafood. This study identified 11 edible crab species from India by classical taxonomy and developed molecular barcodes with the cytochrome c oxidase I (COI) gene. These barcodes were used as reference barcodes for detecting any improper labelling of 50 restaurant crab samples. Neighbour-joining tree analysis with COI barcodes showed distinct clusters of restaurant samples with respective reference species. The study demonstrated 100% improper labelling of restaurant samples to cover up acts of inferior crab supersession. DNA barcoding successfully identified 11 edible crabs in accordance with classical taxonomy and discerned improper crab food labelling in restaurants of India. © 2014 Society of Chemical Industry.

A System for Anesthesia Drug Administration Using Barcode Technology: The Codonics Safe Label System and Smart Anesthesia Manager.

PubMed

Jelacic, Srdjan; Bowdle, Andrew; Nair, Bala G; Kusulos, Dolly; Bower, Lynnette; Togashi, Kei

2015-08-01

Many anesthetic drug errors result from vial or syringe swaps. Scanning the barcodes on vials before drug preparation, creating syringe labels that include barcodes, and scanning the syringe label barcodes before drug administration may help to prevent errors. In contrast, making syringe labels by hand that comply with the recommendations of regulatory agencies and standards-setting bodies is tedious and time consuming. A computerized system that uses vial barcodes and generates barcoded syringe labels could address both safety issues and labeling recommendations. We measured compliance of syringe labels in multiple operating rooms (ORs) with the recommendations of regulatory agencies and standards-setting bodies before and after the introduction of the Codonics Safe Label System (SLS). The Codonics SLS was then combined with Smart Anesthesia Manager software to create an anesthesia barcode drug administration system, which allowed us to measure the rate of scanning syringe label barcodes at the time of drug administration in 2 cardiothoracic ORs before and after introducing a coffee card incentive. Twelve attending cardiothoracic anesthesiologists and the OR satellite pharmacy participated. The use of the Codonics SLS drug labeling system resulted in >75% compliant syringe labels (95% confidence interval, 75%-98%). All syringe labels made using the Codonics SLS system were compliant. The average rate of scanning barcodes on syringe labels using Smart Anesthesia Manager was 25% (730 of 2976) over 13 weeks but increased to 58% (956 of 1645) over 8 weeks after introduction of a simple (coffee card) incentive (P < 0.001). An anesthesia barcode drug administration system resulted in a moderate rate of scanning syringe label barcodes at the time of drug administration. Further, adaptation of the system will be required to achieve a higher utilization rate.

Feasibility of 3D Reconstruction of Neural Morphology Using Expansion Microscopy and Barcode-Guided Agglomeration.

PubMed

Yoon, Young-Gyu; Dai, Peilun; Wohlwend, Jeremy; Chang, Jae-Byum; Marblestone, Adam H; Boyden, Edward S

2017-01-01

We here introduce and study the properties, via computer simulation, of a candidate automated approach to algorithmic reconstruction of dense neural morphology, based on simulated data of the kind that would be obtained via two emerging molecular technologies-expansion microscopy (ExM) and in-situ molecular barcoding. We utilize a convolutional neural network to detect neuronal boundaries from protein-tagged plasma membrane images obtained via ExM, as well as a subsequent supervoxel-merging pipeline guided by optical readout of information-rich, cell-specific nucleic acid barcodes. We attempt to use conservative imaging and labeling parameters, with the goal of establishing a baseline case that points to the potential feasibility of optical circuit reconstruction, leaving open the possibility of higher-performance labeling technologies and algorithms. We find that, even with these conservative assumptions, an all-optical approach to dense neural morphology reconstruction may be possible via the proposed algorithmic framework. Future work should explore both the design-space of chemical labels and barcodes, as well as algorithms, to ultimately enable routine, high-performance optical circuit reconstruction.

DNA Barcode Goes Two-Dimensions: DNA QR Code Web Server

PubMed Central

Li, Huan; Xing, Hang; Liang, Dong; Jiang, Kun; Pang, Xiaohui; Song, Jingyuan; Chen, Shilin

2012-01-01

The DNA barcoding technology uses a standard region of DNA sequence for species identification and discovery. At present, “DNA barcode” actually refers to DNA sequences, which are not amenable to information storage, recognition, and retrieval. Our aim is to identify the best symbology that can represent DNA barcode sequences in practical applications. A comprehensive set of sequences for five DNA barcode markers ITS2, rbcL, matK, psbA-trnH, and CO1 was used as the test data. Fifty-three different types of one-dimensional and ten two-dimensional barcode symbologies were compared based on different criteria, such as coding capacity, compression efficiency, and error detection ability. The quick response (QR) code was found to have the largest coding capacity and relatively high compression ratio. To facilitate the further usage of QR code-based DNA barcodes, a web server was developed and is accessible at http://qrfordna.dnsalias.org. The web server allows users to retrieve the QR code for a species of interests, convert a DNA sequence to and from a QR code, and perform species identification based on local and global sequence similarities. In summary, the first comprehensive evaluation of various barcode symbologies has been carried out. The QR code has been found to be the most appropriate symbology for DNA barcode sequences. A web server has also been constructed to allow biologists to utilize QR codes in practical DNA barcoding applications. PMID:22574113

Suspension arrays based on nanoparticle-encoded microspheres for high-throughput multiplexed detection

PubMed Central

Leng, Yuankui

2017-01-01

Spectrometrically or optically encoded microsphere based suspension array technology (SAT) is applicable to the high-throughput, simultaneous detection of multiple analytes within a small, single sample volume. Thanks to the rapid development of nanotechnology, tremendous progress has been made in the multiplexed detecting capability, sensitivity, and photostability of suspension arrays. In this review, we first focus on the current stock of nanoparticle-based barcodes as well as the manufacturing technologies required for their production. We then move on to discuss all existing barcode-based bioanalysis patterns, including the various labels used in suspension arrays, label-free platforms, signal amplification methods, and fluorescence resonance energy transfer (FRET)-based platforms. We then introduce automatic platforms for suspension arrays that use superparamagnetic nanoparticle-based microspheres. Finally, we summarize the current challenges and their proposed solutions, which are centered on improving encoding capacities, alternative probe possibilities, nonspecificity suppression, directional immobilization, and “point of care” platforms. Throughout this review, we aim to provide a comprehensive guide for the design of suspension arrays, with the goal of improving their performance in areas such as multiplexing capacity, throughput, sensitivity, and cost effectiveness. We hope that our summary on the state-of-the-art development of these arrays, our commentary on future challenges, and some proposed avenues for further advances will help drive the development of suspension array technology and its related fields. PMID:26021602

The practical evaluation of DNA barcode efficacy.

PubMed

Spouge, John L; Mariño-Ramírez, Leonardo

2012-01-01

This chapter describes a workflow for measuring the efficacy of a barcode in identifying species. First, assemble individual sequence databases corresponding to each barcode marker. A controlled collection of taxonomic data is preferable to GenBank data, because GenBank data can be problematic, particularly when comparing barcodes based on more than one marker. To ensure proper controls when evaluating species identification, specimens not having a sequence in every marker database should be discarded. Second, select a computer algorithm for assigning species to barcode sequences. No algorithm has yet improved notably on assigning a specimen to the species of its nearest neighbor within a barcode database. Because global sequence alignments (e.g., with the Needleman-Wunsch algorithm, or some related algorithm) examine entire barcode sequences, they generally produce better species assignments than local sequence alignments (e.g., with BLAST). No neighboring method (e.g., global sequence similarity, global sequence distance, or evolutionary distance based on a global alignment) has yet shown a notable superiority in identifying species. Finally, "the probability of correct identification" (PCI) provides an appropriate measurement of barcode efficacy. The overall PCI for a data set is the average of the species PCIs, taken over all species in the data set. This chapter states explicitly how to calculate PCI, how to estimate its statistical sampling error, and how to use data on PCR failure to set limits on how much improvements in PCR technology can improve species identification.

A regional approach to plant DNA barcoding provides high species resolution of sedges (Carex and Kobresia, Cyperaceae) in the Canadian Arctic Archipelago.

PubMed

Clerc-Blain, Jessica L E; Starr, Julian R; Bull, Roger D; Saarela, Jeffery M

2010-01-01

Previous research on barcoding sedges (Carex) suggested that basic searches within a global barcoding database would probably not resolve more than 60% of the world's some 2000 species. In this study, we take an alternative approach and explore the performance of plant DNA barcoding in the Carex lineage from an explicitly regional perspective. We characterize the utility of a subset of the proposed protein-coding and noncoding plastid barcoding regions (matK, rpoB, rpoC1, rbcL, atpF-atpH, psbK-psbI) for distinguishing species of Carex and Kobresia in the Canadian Arctic Archipelago, a clearly defined eco-geographical region representing 1% of the Earth's landmass. Our results show that matK resolves the greatest number of species of any single-locus (95%), and when combined in a two-locus barcode, it provides 100% species resolution in all but one combination (matK + atpFH) during unweighted pair-group method with arithmetic mean averages (UPGMA) analyses. Noncoding regions were equally or more variable than matK, but as single markers they resolve substantially fewer taxa than matK alone. When difficulties with sequencing and alignment due to microstructural variation in noncoding regions are also considered, our results support other studies in suggesting that protein-coding regions are more practical as barcoding markers. Plastid DNA barcodes are an effective identification tool for species of Carex and Kobresia in the Canadian Arctic Archipelago, a region where the number of co-existing closely related species is limited. We suggest that if a regional approach to plant DNA barcoding was applied on a global scale, it could provide a solution to the generally poor species resolution seen in previous barcoding studies. © 2009 Blackwell Publishing Ltd.

Identification of species based on DNA barcode using k-mer feature vector and Random forest classifier.

PubMed

Meher, Prabina Kumar; Sahu, Tanmaya Kumar; Rao, A R

2016-11-05

DNA barcoding is a molecular diagnostic method that allows automated and accurate identification of species based on a short and standardized fragment of DNA. To this end, an attempt has been made in this study to develop a computational approach for identifying the species by comparing its barcode with the barcode sequence of known species present in the reference library. Each barcode sequence was first mapped onto a numeric feature vector based on k-mer frequencies and then Random forest methodology was employed on the transformed dataset for species identification. The proposed approach outperformed similarity-based, tree-based, diagnostic-based approaches and found comparable with existing supervised learning based approaches in terms of species identification success rate, while compared using real and simulated datasets. Based on the proposed approach, an online web interface SPIDBAR has also been developed and made freely available at http://cabgrid.res.in:8080/spidbar/ for species identification by the taxonomists. Copyright © 2016 Elsevier B.V. All rights reserved.

DNA Barcoding through Quaternary LDPC Codes

PubMed Central

Tapia, Elizabeth; Spetale, Flavio; Krsticevic, Flavia; Angelone, Laura; Bulacio, Pilar

2015-01-01

For many parallel applications of Next-Generation Sequencing (NGS) technologies short barcodes able to accurately multiplex a large number of samples are demanded. To address these competitive requirements, the use of error-correcting codes is advised. Current barcoding systems are mostly built from short random error-correcting codes, a feature that strongly limits their multiplexing accuracy and experimental scalability. To overcome these problems on sequencing systems impaired by mismatch errors, the alternative use of binary BCH and pseudo-quaternary Hamming codes has been proposed. However, these codes either fail to provide a fine-scale with regard to size of barcodes (BCH) or have intrinsic poor error correcting abilities (Hamming). Here, the design of barcodes from shortened binary BCH codes and quaternary Low Density Parity Check (LDPC) codes is introduced. Simulation results show that although accurate barcoding systems of high multiplexing capacity can be obtained with any of these codes, using quaternary LDPC codes may be particularly advantageous due to the lower rates of read losses and undetected sample misidentification errors. Even at mismatch error rates of 10−2 per base, 24-nt LDPC barcodes can be used to multiplex roughly 2000 samples with a sample misidentification error rate in the order of 10−9 at the expense of a rate of read losses just in the order of 10−6. PMID:26492348

DNA Barcoding through Quaternary LDPC Codes.

PubMed

Tapia, Elizabeth; Spetale, Flavio; Krsticevic, Flavia; Angelone, Laura; Bulacio, Pilar

2015-01-01

For many parallel applications of Next-Generation Sequencing (NGS) technologies short barcodes able to accurately multiplex a large number of samples are demanded. To address these competitive requirements, the use of error-correcting codes is advised. Current barcoding systems are mostly built from short random error-correcting codes, a feature that strongly limits their multiplexing accuracy and experimental scalability. To overcome these problems on sequencing systems impaired by mismatch errors, the alternative use of binary BCH and pseudo-quaternary Hamming codes has been proposed. However, these codes either fail to provide a fine-scale with regard to size of barcodes (BCH) or have intrinsic poor error correcting abilities (Hamming). Here, the design of barcodes from shortened binary BCH codes and quaternary Low Density Parity Check (LDPC) codes is introduced. Simulation results show that although accurate barcoding systems of high multiplexing capacity can be obtained with any of these codes, using quaternary LDPC codes may be particularly advantageous due to the lower rates of read losses and undetected sample misidentification errors. Even at mismatch error rates of 10(-2) per base, 24-nt LDPC barcodes can be used to multiplex roughly 2000 samples with a sample misidentification error rate in the order of 10(-9) at the expense of a rate of read losses just in the order of 10(-6).

Application of DNA barcoding in biodiversity studies of shallow-water octocorals: molecular proxies agree with morphological estimates of species richness in Palau

NASA Astrophysics Data System (ADS)

McFadden, C. S.; Brown, A. S.; Brayton, C.; Hunt, C. B.; van Ofwegen, L. P.

2014-06-01

The application of DNA barcoding to anthozoan cnidarians has been hindered by their slow rates of mitochondrial gene evolution and the failure to identify alternative molecular markers that distinguish species reliably. Among octocorals, however, multilocus barcodes can distinguish up to 70 % of morphospecies, thereby facilitating the identification of species that are ecologically important but still very poorly known taxonomically. We tested the ability of these imperfect DNA barcodes to estimate species richness in a biodiversity survey of the shallow-water octocoral fauna of Palau using multilocus ( COI, mtMutS, 28S rDNA) sequences obtained from 305 specimens representing 38 genera of octocorals. Numbers and identities of species were estimated independently (1) by a taxonomic expert using morphological criteria and (2) by assigning sequences to molecular operational taxonomic units (MOTUs) using predefined genetic distance thresholds. Estimated numbers of MOTUs ranged from 73 to 128 depending on the barcode and distance threshold applied, bracketing the estimated number of 118 morphospecies. Concordance between morphospecies identifications and MOTUs ranged from 71 to 75 % and differed little among barcodes. For the speciose and ecologically dominant genus Sinularia, however, we were able to identify 95 % of specimens correctly simply by comparing mtMutS sequences and in situ photographs of colonies to an existing vouchered database. Because we lack a clear understanding of species boundaries in most of these taxa, numbers of morphospecies and MOTUs are both estimates of the true species diversity, and we cannot currently determine which is more accurate. Our results suggest, however, that the two methods provide comparable estimates of species richness for shallow-water Indo-Pacific octocorals. Use of molecular barcodes in biodiversity surveys will facilitate comparisons of species richness and composition among localities and over time, data that do not currently exist for any octocoral community.

Synthesis of a multi-functional DNA nanosphere barcode system for direct cell detection.

PubMed

Han, Sangwoo; Lee, Jae Sung; Lee, Jong Bum

2017-09-28

Nucleic acid-based technologies have been applied to numerous biomedical applications. As a novel material for target detection, DNA has been used to construct a barcode system with a range of structures. This paper reports multi-functionalized DNA nanospheres (DNANSs) by rolling circle amplification (RCA) with several functionalized nucleotides. DNANSs with a barcode system were designed to exhibit fluorescence for coding enhanced signals and contain biotin for more functionalities, including targeting through the biotin-streptavidin (biotin-STA) interaction. Functionalized deoxynucleotide triphosphates (dNTPs) were mixed in the RCA process and functional moieties can be expressed on the DNANSs. The anti-epidermal growth factor receptor antibodies (anti-EGFR Abs) can be conjugated on DNANSs for targeting cancer cells specifically. As a proof of concept, the potential of the multi-functional DNANS barcode was demonstrated by direct cell detection as a simple detection method. The DNANS barcode provides a new route for the simple and rapid selective recognition of cancer cells.

Quantitative phenotyping via deep barcode sequencing

PubMed Central

Smith, Andrew M.; Heisler, Lawrence E.; Mellor, Joseph; Kaper, Fiona; Thompson, Michael J.; Chee, Mark; Roth, Frederick P.; Giaever, Guri; Nislow, Corey

2009-01-01

Next-generation DNA sequencing technologies have revolutionized diverse genomics applications, including de novo genome sequencing, SNP detection, chromatin immunoprecipitation, and transcriptome analysis. Here we apply deep sequencing to genome-scale fitness profiling to evaluate yeast strain collections in parallel. This method, Barcode analysis by Sequencing, or “Bar-seq,” outperforms the current benchmark barcode microarray assay in terms of both dynamic range and throughput. When applied to a complex chemogenomic assay, Bar-seq quantitatively identifies drug targets, with performance superior to the benchmark microarray assay. We also show that Bar-seq is well-suited for a multiplex format. We completely re-sequenced and re-annotated the yeast deletion collection using deep sequencing, found that ∼20% of the barcodes and common priming sequences varied from expectation, and used this revised list of barcode sequences to improve data quality. Together, this new assay and analysis routine provide a deep-sequencing-based toolkit for identifying gene–environment interactions on a genome-wide scale. PMID:19622793

Towards writing the encyclopaedia of life: an introduction to DNA barcoding

PubMed Central

Savolainen, Vincent; Cowan, Robyn S; Vogler, Alfried P; Roderick, George K; Lane, Richard

2005-01-01

An international consortium of major natural history museums, herbaria and other organizations has launched an ambitious project, the ‘Barcode of Life Initiative’, to promote a process enabling the rapid and inexpensive identification of the estimated 10 million species on Earth. DNA barcoding is a diagnostic technique in which short DNA sequence(s) can be used for species identification. The first international scientific conference on Barcoding of Life was held at the Natural History Museum in London in February 2005, and here we review the scientific challenges discussed during this conference and in previous publications. Although still controversial, the scientific benefits of DNA barcoding include: (i) enabling species identification, including any life stage or fragment, (ii) facilitating species discoveries based on cluster analyses of gene sequences (e.g. cox1=CO1, in animals), (iii) promoting development of handheld DNA sequencing technology that can be applied in the field for biodiversity inventories and (iv) providing insight into the diversity of life. PMID:16214739

CRISPR-Barcoding for Intratumor Genetic Heterogeneity Modeling and Functional Analysis of Oncogenic Driver Mutations.

PubMed

Guernet, Alexis; Mungamuri, Sathish Kumar; Cartier, Dorthe; Sachidanandam, Ravi; Jayaprakash, Anitha; Adriouch, Sahil; Vezain, Myriam; Charbonnier, Françoise; Rohkin, Guy; Coutant, Sophie; Yao, Shen; Ainani, Hassan; Alexandre, David; Tournier, Isabelle; Boyer, Olivier; Aaronson, Stuart A; Anouar, Youssef; Grumolato, Luca

2016-08-04

Intratumor genetic heterogeneity underlies the ability of tumors to evolve and adapt to different environmental conditions. Using CRISPR/Cas9 technology and specific DNA barcodes, we devised a strategy to recapitulate and trace the emergence of subpopulations of cancer cells containing a mutation of interest. We used this approach to model different mechanisms of lung cancer cell resistance to EGFR inhibitors and to assess effects of combined drug therapies. By overcoming intrinsic limitations of current approaches, CRISPR-barcoding also enables investigation of most types of genetic modifications, including repair of oncogenic driver mutations. Finally, we used highly complex barcodes inserted at a specific genome location as a means of simultaneously tracing the fates of many thousands of genetically labeled cancer cells. CRISPR-barcoding is a straightforward and highly flexible method that should greatly facilitate the functional investigation of specific mutations, in a context that closely mimics the complexity of cancer. Copyright © 2016 Elsevier Inc. All rights reserved.

Existence of species complex largely reduced barcoding success for invasive species of Tephritidae: a case study in Bactrocera spp.

PubMed

Jiang, F; Jin, Q; Liang, L; Zhang, A B; Li, Z H

2014-11-01

Fruit flies in the family Tephritidae are the economically important pests that have many species complexes. DNA barcoding has gradually been verified as an effective tool for identifying species in a wide range of taxonomic groups, and there are several publications on rapid and accurate identification of fruit flies based on this technique; however, comprehensive analyses of large and new taxa for the effectiveness of DNA barcoding for fruit flies identification have been rare. In this study, we evaluated the COI barcode sequences for the diagnosis of fruit flies using 1426 sequences for 73 species of Bactrocera distributed worldwide. Tree-based [neighbour-joining (NJ)]; distance-based, such as Best Match (BM), Best Close Match (BCM) and Minimum Distance (MD); and character-based methods were used to evaluate the barcoding success rates obtained with maintaining the species complex in the data set, treating a species complex as a single taxon unit, and removing the species complex. Our results indicate that the average divergence between species was 14.04% (0.00-25.16%), whereas within a species this was 0.81% (0.00-9.71%); the existence of species complexes largely reduced the barcoding success for Tephritidae, for example relatively low success rates (74.4% based on BM and BCM and 84.8% based on MD) were obtained when the sequences from species complexes were included in the analysis, whereas significantly higher success rates were achieved if the species complexes were treated as a single taxon or removed from the data set - BM (98.9%), BCM (98.5%) and MD (97.5%), or BM (98.1%), BCM (97.4%) and MD (98.2%). © 2014 John Wiley & Sons Ltd.

Je, a versatile suite to handle multiplexed NGS libraries with unique molecular identifiers.

PubMed

Girardot, Charles; Scholtalbers, Jelle; Sauer, Sajoscha; Su, Shu-Yi; Furlong, Eileen E M

2016-10-08

The yield obtained from next generation sequencers has increased almost exponentially in recent years, making sample multiplexing common practice. While barcodes (known sequences of fixed length) primarily encode the sample identity of sequenced DNA fragments, barcodes made of random sequences (Unique Molecular Identifier or UMIs) are often used to distinguish between PCR duplicates and transcript abundance in, for example, single-cell RNA sequencing (scRNA-seq). In paired-end sequencing, different barcodes can be inserted at each fragment end to either increase the number of multiplexed samples in the library or to use one of the barcodes as UMI. Alternatively, UMIs can be combined with the sample barcodes into composite barcodes, or with standard Illumina® indexing. Subsequent analysis must take read duplicates and sample identity into account, by identifying UMIs. Existing tools do not support these complex barcoding configurations and custom code development is frequently required. Here, we present Je, a suite of tools that accommodates complex barcoding strategies, extracts UMIs and filters read duplicates taking UMIs into account. Using Je on publicly available scRNA-seq and iCLIP data containing UMIs, the number of unique reads increased by up to 36 %, compared to when UMIs are ignored. Je is implemented in JAVA and uses the Picard API. Code, executables and documentation are freely available at http://gbcs.embl.de/Je . Je can also be easily installed in Galaxy through the Galaxy toolshed.

Analysis of high-order SNP barcodes in mitochondrial D-loop for chronic dialysis susceptibility.

PubMed

Yang, Cheng-Hong; Lin, Yu-Da; Chuang, Li-Yeh; Chang, Hsueh-Wei

2016-10-01

Positively identifying disease-associated single nucleotide polymorphism (SNP) markers in genome-wide studies entails the complex association analysis of a huge number of SNPs. Such large numbers of SNP barcode (SNP/genotype combinations) continue to pose serious computational challenges, especially for high-dimensional data. We propose a novel exploiting SNP barcode method based on differential evolution, termed IDE (improved differential evolution). IDE uses a "top combination strategy" to improve the ability of differential evolution to explore high-order SNP barcodes in high-dimensional data. We simulate disease data and use real chronic dialysis data to test four global optimization algorithms. In 48 simulated disease models, we show that IDE outperforms existing global optimization algorithms in terms of exploring ability and power to detect the specific SNP/genotype combinations with a maximum difference between cases and controls. In real data, we show that IDE can be used to evaluate the relative effects of each individual SNP on disease susceptibility. IDE generated significant SNP barcode with less computational complexity than the other algorithms, making IDE ideally suited for analysis of high-order SNP barcodes. Copyright © 2016 Elsevier Inc. All rights reserved.

The HTS barcode checker pipeline, a tool for automated detection of illegally traded species from high-throughput sequencing data.

PubMed

Lammers, Youri; Peelen, Tamara; Vos, Rutger A; Gravendeel, Barbara

2014-02-06

Mixtures of internationally traded organic substances can contain parts of species protected by the Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES). These mixtures often raise the suspicion of border control and customs offices, which can lead to confiscation, for example in the case of Traditional Chinese medicines (TCMs). High-throughput sequencing of DNA barcoding markers obtained from such samples provides insight into species constituents of mixtures, but manual cross-referencing of results against the CITES appendices is labor intensive. Matching DNA barcodes against NCBI GenBank using BLAST may yield misleading results both as false positives, due to incorrectly annotated sequences, and false negatives, due to spurious taxonomic re-assignment. Incongruence between the taxonomies of CITES and NCBI GenBank can result in erroneous estimates of illegal trade. The HTS barcode checker pipeline is an application for automated processing of sets of 'next generation' barcode sequences to determine whether these contain DNA barcodes obtained from species listed on the CITES appendices. This analytical pipeline builds upon and extends existing open-source applications for BLAST matching against the NCBI GenBank reference database and for taxonomic name reconciliation. In a single operation, reads are converted into taxonomic identifications matched with names on the CITES appendices. By inclusion of a blacklist and additional names databases, the HTS barcode checker pipeline prevents false positives and resolves taxonomic heterogeneity. The HTS barcode checker pipeline can detect and correctly identify DNA barcodes of CITES-protected species from reads obtained from TCM samples in just a few minutes. The pipeline facilitates and improves molecular monitoring of trade in endangered species, and can aid in safeguarding these species from extinction in the wild. The HTS barcode checker pipeline is available at https://github.com/naturalis/HTS-barcode-checker.

The HTS barcode checker pipeline, a tool for automated detection of illegally traded species from high-throughput sequencing data

PubMed Central

2014-01-01

Background Mixtures of internationally traded organic substances can contain parts of species protected by the Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES). These mixtures often raise the suspicion of border control and customs offices, which can lead to confiscation, for example in the case of Traditional Chinese medicines (TCMs). High-throughput sequencing of DNA barcoding markers obtained from such samples provides insight into species constituents of mixtures, but manual cross-referencing of results against the CITES appendices is labor intensive. Matching DNA barcodes against NCBI GenBank using BLAST may yield misleading results both as false positives, due to incorrectly annotated sequences, and false negatives, due to spurious taxonomic re-assignment. Incongruence between the taxonomies of CITES and NCBI GenBank can result in erroneous estimates of illegal trade. Results The HTS barcode checker pipeline is an application for automated processing of sets of 'next generation’ barcode sequences to determine whether these contain DNA barcodes obtained from species listed on the CITES appendices. This analytical pipeline builds upon and extends existing open-source applications for BLAST matching against the NCBI GenBank reference database and for taxonomic name reconciliation. In a single operation, reads are converted into taxonomic identifications matched with names on the CITES appendices. By inclusion of a blacklist and additional names databases, the HTS barcode checker pipeline prevents false positives and resolves taxonomic heterogeneity. Conclusions The HTS barcode checker pipeline can detect and correctly identify DNA barcodes of CITES-protected species from reads obtained from TCM samples in just a few minutes. The pipeline facilitates and improves molecular monitoring of trade in endangered species, and can aid in safeguarding these species from extinction in the wild. The HTS barcode checker pipeline is available at https://github.com/naturalis/HTS-barcode-checker. PMID:24502833

Patient safety with blood products administration using wireless and bar-code technology.

PubMed

Porcella, Aleta; Walker, Kristy

2005-01-01

Supported by a grant from the Agency for Healthcare Research and Quality, a University of Iowa Hospitals and Clinics interdisciplinary research team created an online data-capture-response tool utilizing wireless mobile devices and bar code technology to track and improve blood products administration process. The tool captures 1) sample collection, 2) sample arrival in the blood bank, 3) blood product dispense from blood bank, and 4) administration. At each step, the scanned patient wristband ID bar code is automatically compared to scanned identification barcode on requisition, sample, and/or product, and the system presents either a confirmation or an error message to the user. Following an eight-month, 5 unit, staged pilot, a 'big bang,' hospital-wide implementation occurred on February 7, 2005. Preliminary results from pilot data indicate that the new barcode process captures errors 3 to 10 times better than the old manual process.

An integrated approach to fast and informative morphological vouchering of nematodes for applications in molecular barcoding

PubMed Central

De Ley, Paul; De Ley, Irma Tandingan; Morris, Krystalynne; Abebe, Eyualem; Mundo-Ocampo, Manuel; Yoder, Melissa; Heras, Joseph; Waumann, Dora; Rocha-Olivares, Axayácatl; Jay Burr, A.H; Baldwin, James G; Thomas, W. Kelley

2005-01-01

Molecular surveys of meiofaunal diversity face some interesting methodological challenges when it comes to interstitial nematodes from soils and sediments. Morphology-based surveys are greatly limited in processing speed, while barcoding approaches for nematodes are hampered by difficulties of matching sequence data with traditional taxonomy. Intermediate technology is needed to bridge the gap between both approaches. An example of such technology is video capture and editing microscopy, which consists of the recording of taxonomically informative multifocal series of microscopy images as digital video clips. The integration of multifocal imaging with sequence analysis of the D2D3 region of large subunit (LSU) rDNA is illustrated here in the context of a combined morphological and barcode sequencing survey of marine nematodes from Baja California and California. The resulting video clips and sequence data are made available online in the database NemATOL (http://nematol.unh.edu/). Analyses of 37 barcoded nematodes suggest that these represent at least 32 species, none of which matches available D2D3 sequences in public databases. The recorded multifocal vouchers allowed us to identify most specimens to genus, and will be used to match specimens with subsequent species identifications and descriptions of preserved specimens. Like molecular barcodes, multifocal voucher archives are part of a wider effort at structuring and changing the process of biodiversity discovery. We argue that data-rich surveys and phylogenetic tools for analysis of barcode sequences are an essential component of the exploration of phyla with a high fraction of undiscovered species. Our methods are also directly applicable to other meiofauna such as for example gastrotrichs and tardigrades. PMID:16214752

[Identification and analysis of Corydalis boweri, Meconopsis horridula and their close related species of the same genus by using ITS2 DNA barcode].

PubMed

Dou, Rong-kun; Bi, Zhen-fei; Bai, Rui-xue; Ren, Yao-yao; Tan, Rui; Song, Liang-ke; Li, Di-qiang; Mao, Can-quan

2015-04-01

The study is aimed to ensure the quality and safety of medicinal plants by using ITS2 DNA barcode technology to identify Corydalis boweri, Meconopsis horridula and their close related species. The DNA of 13 herb samples including C. boweri and M. horridula from Lhasa of Tibet was extracted, ITS PCR were amplified and sequenced. Both assembled and web downloaded 71 ITS2 sequences were removed of 5. 8S and 28S. Multiple sequence alignment was completed and the intraspecific and interspecific genetic distances were calculated by MEGA 5.0, while the neighbor-joining phylogenetic trees were constructed. We also predicted the ITS2 secondary structure of C. boweri, M. horridula and their close related species. The results showed that ITS2 as DNA barcode was able to identify C. boweri, M. horridula as well as well as their close related species effectively. The established based on ITS2 barcode method provides the regular and safe detection technology for identification of C. boweri, M. horridula and their close related species, adulterants and counterfeits, in order to ensure their quality control, safe medication, reasonable development and utilization.

Quality Traceability System of Traditional Chinese Medicine Based on Two Dimensional Barcode Using Mobile Intelligent Technology.

PubMed

Cai, Yong; Li, Xiwen; Wang, Runmiao; Yang, Qing; Li, Peng; Hu, Hao

2016-01-01

Currently, the chemical fingerprint comparison and analysis is mainly based on professional equipment and software, it's expensive and inconvenient. This study aims to integrate QR (Quick Response) code with quality data and mobile intelligent technology to develop a convenient query terminal for tracing quality in the whole industrial chain of TCM (traditional Chinese medicine). Three herbal medicines were randomly selected and their chemical two-dimensional barcode (2D) barcodes fingerprints were constructed. Smartphone application (APP) based on Android system was developed to read initial data of 2D chemical barcodes, and compared multiple fingerprints from different batches of same species or different species. It was demonstrated that there were no significant differences between original and scanned TCM chemical fingerprints. Meanwhile, different TCM chemical fingerprint QR codes could be rendered in the same coordinate and showed the differences very intuitively. To be able to distinguish the variations of chemical fingerprint more directly, linear interpolation angle cosine similarity algorithm (LIACSA) was proposed to get similarity ratio. This study showed that QR codes can be used as an effective information carrier to transfer quality data. Smartphone application can rapidly read quality information in QR codes and convert data into TCM chemical fingerprints.

Enhancing the detection of barcoded reads in high throughput DNA sequencing data by controlling the false discovery rate.

PubMed

Buschmann, Tilo; Zhang, Rong; Brash, Douglas E; Bystrykh, Leonid V

2014-08-07

DNA barcodes are short unique sequences used to label DNA or RNA-derived samples in multiplexed deep sequencing experiments. During the demultiplexing step, barcodes must be detected and their position identified. In some cases (e.g., with PacBio SMRT), the position of the barcode and DNA context is not well defined. Many reads start inside the genomic insert so that adjacent primers might be missed. The matter is further complicated by coincidental similarities between barcode sequences and reference DNA. Therefore, a robust strategy is required in order to detect barcoded reads and avoid a large number of false positives or negatives.For mass inference problems such as this one, false discovery rate (FDR) methods are powerful and balanced solutions. Since existing FDR methods cannot be applied to this particular problem, we present an adapted FDR method that is suitable for the detection of barcoded reads as well as suggest possible improvements. In our analysis, barcode sequences showed high rates of coincidental similarities with the Mus musculus reference DNA. This problem became more acute when the length of the barcode sequence decreased and the number of barcodes in the set increased. The method presented in this paper controls the tail area-based false discovery rate to distinguish between barcoded and unbarcoded reads. This method helps to establish the highest acceptable minimal distance between reads and barcode sequences. In a proof of concept experiment we correctly detected barcodes in 83% of the reads with a precision of 89%. Sensitivity improved to 99% at 99% precision when the adjacent primer sequence was incorporated in the analysis. The analysis was further improved using a paired end strategy. Following an analysis of the data for sequence variants induced in the Atp1a1 gene of C57BL/6 murine melanocytes by ultraviolet light and conferring resistance to ouabain, we found no evidence of cross-contamination of DNA material between samples. Our method offers a proper quantitative treatment of the problem of detecting barcoded reads in a noisy sequencing environment. It is based on the false discovery rate statistics that allows a proper trade-off between sensitivity and precision to be chosen.

Direct embryo tagging and identification system by attachment of biofunctionalized polysilicon barcodes to the zona pellucida of mouse embryos.

PubMed

Novo, Sergi; Penon, Oriol; Barrios, Leonardo; Nogués, Carme; Santaló, Josep; Durán, Sara; Gómez-Matínez, Rodrigo; Samitier, Josep; Plaza, José Antonio; Pérez-García, Luisa; Ibáñez, Elena

2013-06-01

Is the attachment of biofunctionalized polysilicon barcodes to the outer surface of the zona pellucida an effective approach for the direct tagging and identification of cultured embryos? The results achieved provide a proof of concept for a direct embryo tagging system using biofunctionalized polysilicon barcodes, which could help to minimize the risk of mismatching errors (mix-ups) in human assisted reproduction technologies. Even though the occurrence of mix-ups is rare, several cases have been reported in fertility clinics around the world. Measures to prevent the risk of mix-ups in human assisted reproduction technologies are therefore required. Mouse embryos were tagged with 10 barcodes and the effectiveness of the tagging system was tested during fresh in vitro culture (n=140) and after embryo cryopreservation (n = 84). Finally, the full-term development of tagged embryos was evaluated (n =105). Mouse pronuclear embryos were individually rolled over wheat germ agglutinin-biofunctionalized polysilicon barcodes to distribute them uniformly around the ZONA PELLUCIDA surface. Embryo viability and retention of barcodes were determined during 96 h of culture. The identification of tagged embryos was performed every 24 h in an inverted microscope and without embryo manipulation to simulate an automatic reading procedure. Full-term development of the tagged embryos was assessed after their transfer to pseudo-pregnant females. To test the validity of the embryo tagging system after a cryopreservation process, tagged embryos were frozen at the 2-cell stage using a slow freezing protocol, and followed in culture for 72 h after thawing. Neither the in vitro or in vivo development of tagged embryos was adversely affected. The tagging system also proved effective during an embryo cryopreservation process. Global identification rates higher than 96 and 92% in fresh and frozen-thawed tagged embryos, respectively, were obtained when simulating an automatic barcode reading system, although these rates could be increased to 100% by simply rotating the embryos during the reading process. The direct embryo tagging developed here has exclusively been tested in mouse embryos. Its effectiveness in other species, such as the human, is currently being tested. The direct embryo tagging system developed here, once tested in human embryos, could provide fertility clinics with a novel tool to reduce the risk of mix-ups in human assisted reproduction technologies.

Improving soil bacterial taxa–area relationships assessment using DNA meta-barcoding

PubMed Central

Terrat, S; Dequiedt, S; Horrigue, W; Lelievre, M; Cruaud, C; Saby, N P A; Jolivet, C; Arrouays, D; Maron, P-A; Ranjard, L; Chemidlin Prévost-Bouré, N

2015-01-01

The evaluation of the taxa–area relationship (TAR) with molecular fingerprinting data demonstrated the spatial structuration of soil microorganisms and provided insights into the processes shaping their diversity. The increasing use of massive sequencing technologies in biodiversity investigations has now raised the question of the advantages of such technologies over the fingerprinting approach for elucidation of the determinism of soil microbial community assembly in broad-scale biogeographic studies. Our objectives in this study were to compare DNA fingerprinting and meta-barcoding approaches for evaluating soil bacterial TAR and the determinism of soil bacterial community assembly on a broad scale. This comparison was performed on 392 soil samples from four French geographic regions with different levels of environmental heterogeneity. Both molecular approaches demonstrated a TAR with a significant slope but, because of its more sensitive description of soil bacterial community richness, meta-barcoding provided significantly higher and more accurate estimates of turnover rates. Both approaches were useful in evidencing the processes shaping bacterial diversity variations on a broad scale. When different taxonomic resolutions were considered for meta-barcoding data, they significantly influenced the estimation of turnover rates but not the relative importance of each component process. Altogether, DNA meta-barcoding provides a more accurate evaluation of the TAR and may lead to re-examination of the processes shaping soil bacterial community assembly. This should provide new insights into soil microbial ecology in the context of sustainable use of soil resources. PMID:25293875

The Application of DNA Barcodes for the Identification of Marine Crustaceans from the North Sea and Adjacent Regions.

PubMed

Raupach, Michael J; Barco, Andrea; Steinke, Dirk; Beermann, Jan; Laakmann, Silke; Mohrbeck, Inga; Neumann, Hermann; Kihara, Terue C; Pointner, Karin; Radulovici, Adriana; Segelken-Voigt, Alexandra; Wesse, Christina; Knebelsberger, Thomas

2015-01-01

During the last years DNA barcoding has become a popular method of choice for molecular specimen identification. Here we present a comprehensive DNA barcode library of various crustacean taxa found in the North Sea, one of the most extensively studied marine regions of the world. Our data set includes 1,332 barcodes covering 205 species, including taxa of the Amphipoda, Copepoda, Decapoda, Isopoda, Thecostraca, and others. This dataset represents the most extensive DNA barcode library of the Crustacea in terms of species number to date. By using the Barcode of Life Data Systems (BOLD), unique BINs were identified for 198 (96.6%) of the analyzed species. Six species were characterized by two BINs (2.9%), and three BINs were found for the amphipod species Gammarus salinus Spooner, 1947 (0.4%). Intraspecific distances with values higher than 2.2% were revealed for 13 species (6.3%). Exceptionally high distances of up to 14.87% between two distinct but monophyletic clusters were found for the parasitic copepod Caligus elongatus Nordmann, 1832, supporting the results of previous studies that indicated the existence of an overlooked sea louse species. In contrast to these high distances, haplotype-sharing was observed for two decapod spider crab species, Macropodia parva Van Noort & Adema, 1985 and Macropodia rostrata (Linnaeus, 1761), underlining the need for a taxonomic revision of both species. Summarizing the results, our study confirms the application of DNA barcodes as highly effective identification system for the analyzed marine crustaceans of the North Sea and represents an important milestone for modern biodiversity assessment studies using barcode sequences.

Spatial heterogeneity in the Mediterranean Biodiversity Hotspot affects barcoding accuracy of its freshwater fishes.

PubMed

Geiger, M F; Herder, F; Monaghan, M T; Almada, V; Barbieri, R; Bariche, M; Berrebi, P; Bohlen, J; Casal-Lopez, M; Delmastro, G B; Denys, G P J; Dettai, A; Doadrio, I; Kalogianni, E; Kärst, H; Kottelat, M; Kovačić, M; Laporte, M; Lorenzoni, M; Marčić, Z; Özuluğ, M; Perdices, A; Perea, S; Persat, H; Porcelotti, S; Puzzi, C; Robalo, J; Šanda, R; Schneider, M; Šlechtová, V; Stoumboudi, M; Walter, S; Freyhof, J

2014-11-01

Incomplete knowledge of biodiversity remains a stumbling block for conservation planning and even occurs within globally important Biodiversity Hotspots (BH). Although technical advances have boosted the power of molecular biodiversity assessments, the link between DNA sequences and species and the analytics to discriminate entities remain crucial. Here, we present an analysis of the first DNA barcode library for the freshwater fish fauna of the Mediterranean BH (526 spp.), with virtually complete species coverage (498 spp., 98% extant species). In order to build an identification system supporting conservation, we compared species determination by taxonomists to multiple clustering analyses of DNA barcodes for 3165 specimens. The congruence of barcode clusters with morphological determination was strongly dependent on the method of cluster delineation, but was highest with the general mixed Yule-coalescent (GMYC) model-based approach (83% of all species recovered as GMYC entity). Overall, genetic morphological discontinuities suggest the existence of up to 64 previously unrecognized candidate species. We found reduced identification accuracy when using the entire DNA-barcode database, compared with analyses on databases for individual river catchments. This scale effect has important implications for barcoding assessments and suggests that fairly simple identification pipelines provide sufficient resolution in local applications. We calculated Evolutionarily Distinct and Globally Endangered scores in order to identify candidate species for conservation priority and argue that the evolutionary content of barcode data can be used to detect priority species for future IUCN assessments. We show that large-scale barcoding inventories of complex biotas are feasible and contribute directly to the evaluation of conservation priorities. © 2014 John Wiley & Sons Ltd.

Identifying the true oysters (Bivalvia: Ostreidae) with mitochondrial phylogeny and distance-based DNA barcoding.

PubMed

Liu, Jun; Li, Qi; Kong, Lingfeng; Yu, Hong; Zheng, Xiaodong

2011-09-01

Oysters (family Ostreidae), with high levels of phenotypic plasticity and wide geographic distribution, are a challenging group for taxonomists and phylogenetics. As a useful tool for molecular species identification, DNA barcoding might offer significant potential for oyster identification and taxonomy. This study used two mitochondrial fragments, cytochrome c oxidase I (COI) and the large ribosomal subunit (16S rDNA), to assess whether oyster species could be identified by phylogeny and distance-based DNA barcoding techniques. Relationships among species were estimated by the phylogenetic analyses of both genes, and then pairwise inter- and intraspecific genetic divergences were assessed. Species forming well-differentiated clades in the molecular phylogenies were identical for both genes even when the closely related species were included. Intraspecific variability of 16S rDNA overlapped with interspecific divergence. However, average intra- and interspecific genetic divergences for COI were 0-1.4% (maximum 2.2%) and 2.6-32.2% (minimum 2.2%), respectively, indicating the existence of a barcoding gap. These results confirm the efficacy of species identification in oysters via DNA barcodes and phylogenetic analysis. © 2011 Blackwell Publishing Ltd.

A new method for species identification via protein-coding and non-coding DNA barcodes by combining machine learning with bioinformatic methods.

PubMed

Zhang, Ai-bing; Feng, Jie; Ward, Robert D; Wan, Ping; Gao, Qiang; Wu, Jun; Zhao, Wei-zhong

2012-01-01

Species identification via DNA barcodes is contributing greatly to current bioinventory efforts. The initial, and widely accepted, proposal was to use the protein-coding cytochrome c oxidase subunit I (COI) region as the standard barcode for animals, but recently non-coding internal transcribed spacer (ITS) genes have been proposed as candidate barcodes for both animals and plants. However, achieving a robust alignment for non-coding regions can be problematic. Here we propose two new methods (DV-RBF and FJ-RBF) to address this issue for species assignment by both coding and non-coding sequences that take advantage of the power of machine learning and bioinformatics. We demonstrate the value of the new methods with four empirical datasets, two representing typical protein-coding COI barcode datasets (neotropical bats and marine fish) and two representing non-coding ITS barcodes (rust fungi and brown algae). Using two random sub-sampling approaches, we demonstrate that the new methods significantly outperformed existing Neighbor-joining (NJ) and Maximum likelihood (ML) methods for both coding and non-coding barcodes when there was complete species coverage in the reference dataset. The new methods also out-performed NJ and ML methods for non-coding sequences in circumstances of potentially incomplete species coverage, although then the NJ and ML methods performed slightly better than the new methods for protein-coding barcodes. A 100% success rate of species identification was achieved with the two new methods for 4,122 bat queries and 5,134 fish queries using COI barcodes, with 95% confidence intervals (CI) of 99.75-100%. The new methods also obtained a 96.29% success rate (95%CI: 91.62-98.40%) for 484 rust fungi queries and a 98.50% success rate (95%CI: 96.60-99.37%) for 1094 brown algae queries, both using ITS barcodes.

Evaluation of scanning 2D barcoded vaccines to improve data accuracy of vaccines administered.

PubMed

Daily, Ashley; Kennedy, Erin D; Fierro, Leslie A; Reed, Jenica Huddleston; Greene, Michael; Williams, Warren W; Evanson, Heather V; Cox, Regina; Koeppl, Patrick; Gerlach, Ken

2016-11-11

Accurately recording vaccine lot number, expiration date, and product identifiers, in patient records is an important step in improving supply chain management and patient safety in the event of a recall. These data are being encoded on two-dimensional (2D) barcodes on most vaccine vials and syringes. Using electronic vaccine administration records, we evaluated the accuracy of lot number and expiration date entered using 2D barcode scanning compared to traditional manual or drop-down list entry methods. We analyzed 128,573 electronic records of vaccines administered at 32 facilities. We compared the accuracy of records entered using 2D barcode scanning with those entered using traditional methods using chi-square tests and multilevel logistic regression. When 2D barcodes were scanned, lot number data accuracy was 1.8 percentage points higher (94.3-96.1%, P<0.001) and expiration date data accuracy was 11 percentage points higher (84.8-95.8%, P<0.001) compared with traditional methods. In multivariate analysis, lot number was more likely to be accurate (aOR=1.75; 99% CI, 1.57-1.96) as was expiration date (aOR=2.39; 99% CI, 2.12-2.68). When controlling for scanning and other factors, manufacturer, month vaccine was administered, and vaccine type were associated with variation in accuracy for both lot number and expiration date. Two-dimensional barcode scanning shows promise for improving data accuracy of vaccine lot number and expiration date records. Adapting systems to further integrate with 2D barcoding could help increase adoption of 2D barcode scanning technology. Published by Elsevier Ltd.

Competitive Genomic Screens of Barcoded Yeast Libraries

PubMed Central

Urbanus, Malene; Proctor, Michael; Heisler, Lawrence E.; Giaever, Guri; Nislow, Corey

2011-01-01

By virtue of advances in next generation sequencing technologies, we have access to new genome sequences almost daily. The tempo of these advances is accelerating, promising greater depth and breadth. In light of these extraordinary advances, the need for fast, parallel methods to define gene function becomes ever more important. Collections of genome-wide deletion mutants in yeasts and E. coli have served as workhorses for functional characterization of gene function, but this approach is not scalable, current gene-deletion approaches require each of the thousands of genes that comprise a genome to be deleted and verified. Only after this work is complete can we pursue high-throughput phenotyping. Over the past decade, our laboratory has refined a portfolio of competitive, miniaturized, high-throughput genome-wide assays that can be performed in parallel. This parallelization is possible because of the inclusion of DNA 'tags', or 'barcodes,' into each mutant, with the barcode serving as a proxy for the mutation and one can measure the barcode abundance to assess mutant fitness. In this study, we seek to fill the gap between DNA sequence and barcoded mutant collections. To accomplish this we introduce a combined transposon disruption-barcoding approach that opens up parallel barcode assays to newly sequenced, but poorly characterized microbes. To illustrate this approach we present a new Candida albicans barcoded disruption collection and describe how both microarray-based and next generation sequencing-based platforms can be used to collect 10,000 - 1,000,000 gene-gene and drug-gene interactions in a single experiment. PMID:21860376

Noise reduction in single time frame optical DNA maps

PubMed Central

Müller, Vilhelm; Westerlund, Fredrik

2017-01-01

In optical DNA mapping technologies sequence-specific intensity variations (DNA barcodes) along stretched and stained DNA molecules are produced. These “fingerprints” of the underlying DNA sequence have a resolution of the order one kilobasepairs and the stretching of the DNA molecules are performed by surface adsorption or nano-channel setups. A post-processing challenge for nano-channel based methods, due to local and global random movement of the DNA molecule during imaging, is how to align different time frames in order to produce reproducible time-averaged DNA barcodes. The current solutions to this challenge are computationally rather slow. With high-throughput applications in mind, we here introduce a parameter-free method for filtering a single time frame noisy barcode (snap-shot optical map), measured in a fraction of a second. By using only a single time frame barcode we circumvent the need for post-processing alignment. We demonstrate that our method is successful at providing filtered barcodes which are less noisy and more similar to time averaged barcodes. The method is based on the application of a low-pass filter on a single noisy barcode using the width of the Point Spread Function of the system as a unique, and known, filtering parameter. We find that after applying our method, the Pearson correlation coefficient (a real number in the range from -1 to 1) between the single time-frame barcode and the time average of the aligned kymograph increases significantly, roughly by 0.2 on average. By comparing to a database of more than 3000 theoretical plasmid barcodes we show that the capabilities to identify plasmids is improved by filtering single time-frame barcodes compared to the unfiltered analogues. Since snap-shot experiments and computational time using our method both are less than a second, this study opens up for high throughput optical DNA mapping with improved reproducibility. PMID:28640821

From water striders to water bugs: the molecular diversity of aquatic Heteroptera (Gerromorpha, Nepomorpha) of Germany based on DNA barcodes

PubMed Central

Havemann, Nadine; Gossner, Martin M.; Hendrich, Lars; Morinière, Jèrôme; Niedringhaus, Rolf; Schäfer, Peter

2018-01-01

With about 5,000 species worldwide, the Heteroptera or true bugs are the most diverse taxon among the hemimetabolous insects in aquatic and semi-aquatic ecosystems. Species may be found in almost every freshwater environment and have very specific habitat requirements, making them excellent bioindicator organisms for water quality. However, a correct determination by morphology is challenging in many species groups due to high morphological variability and polymorphisms within, but low variability between species. Furthermore, it is very difficult or even impossible to identify the immature life stages or females of some species, e.g., of the corixid genus Sigara. In this study we tested the effectiveness of a DNA barcode library to discriminate species of the Gerromorpha and Nepomorpha of Germany. We analyzed about 700 specimens of 67 species, with 63 species sampled in Germany, covering more than 90% of all recorded species. Our library included various morphological similar taxa, e.g., species within the genera Sigara and Notonecta as well as water striders of the genus Gerris. Fifty-five species (82%) were unambiguously assigned to a single Barcode Index Number (BIN) by their barcode sequences, whereas BIN sharing was observed for 10 species. Furthermore, we found monophyletic lineages for 52 analyzed species. Our data revealed interspecific K2P distances with below 2.2% for 18 species. Intraspecific distances above 2.2% were shown for 11 species. We found evidence for hybridization between various corixid species (Sigara, Callicorixa), but our molecular data also revealed exceptionally high intraspecific distances as a consequence of distinct mitochondrial lineages for Cymatia coleoptrata and the pygmy backswimmer Plea minutissima. Our study clearly demonstrates the usefulness of DNA barcodes for the identification of the aquatic Heteroptera of Germany and adjacent regions. In this context, our data set represents an essential baseline for a reference library for bioassessment studies of freshwater habitats using modern high-throughput technologies in the near future. The existing data also opens new questions regarding the causes of observed low inter- and high intraspecific genetic variation and furthermore highlight the necessity of taxonomic revisions for various taxa, combining both molecular and morphological data. PMID:29736329

High-Throughput Mapping of Single-Neuron Projections by Sequencing of Barcoded RNA.

PubMed

Kebschull, Justus M; Garcia da Silva, Pedro; Reid, Ashlan P; Peikon, Ian D; Albeanu, Dinu F; Zador, Anthony M

2016-09-07

Neurons transmit information to distant brain regions via long-range axonal projections. In the mouse, area-to-area connections have only been systematically mapped using bulk labeling techniques, which obscure the diverse projections of intermingled single neurons. Here we describe MAPseq (Multiplexed Analysis of Projections by Sequencing), a technique that can map the projections of thousands or even millions of single neurons by labeling large sets of neurons with random RNA sequences ("barcodes"). Axons are filled with barcode mRNA, each putative projection area is dissected, and the barcode mRNA is extracted and sequenced. Applying MAPseq to the locus coeruleus (LC), we find that individual LC neurons have preferred cortical targets. By recasting neuroanatomy, which is traditionally viewed as a problem of microscopy, as a problem of sequencing, MAPseq harnesses advances in sequencing technology to permit high-throughput interrogation of brain circuits. Copyright © 2016 Elsevier Inc. All rights reserved.

Ultra-deep sequencing enables high-fidelity recovery of biodiversity for bulk arthropod samples without PCR amplification

PubMed Central

2013-01-01

Background Next-generation-sequencing (NGS) technologies combined with a classic DNA barcoding approach have enabled fast and credible measurement for biodiversity of mixed environmental samples. However, the PCR amplification involved in nearly all existing NGS protocols inevitably introduces taxonomic biases. In the present study, we developed new Illumina pipelines without PCR amplifications to analyze terrestrial arthropod communities. Results Mitochondrial enrichment directly followed by Illumina shotgun sequencing, at an ultra-high sequence volume, enabled the recovery of Cytochrome c Oxidase subunit 1 (COI) barcode sequences, which allowed for the estimation of species composition at high fidelity for a terrestrial insect community. With 15.5 Gbp Illumina data, approximately 97% and 92% were detected out of the 37 input Operational Taxonomic Units (OTUs), whether the reference barcode library was used or not, respectively, while only 1 novel OTU was found for the latter. Additionally, relatively strong correlation between the sequencing volume and the total biomass was observed for species from the bulk sample, suggesting a potential solution to reveal relative abundance. Conclusions The ability of the new Illumina PCR-free pipeline for DNA metabarcoding to detect small arthropod specimens and its tendency to avoid most, if not all, false positives suggests its great potential in biodiversity-related surveillance, such as in biomonitoring programs. However, further improvement for mitochondrial enrichment is likely needed for the application of the new pipeline in analyzing arthropod communities at higher diversity. PMID:23587339

A survey on barcode RFID and NFC

NASA Astrophysics Data System (ADS)

Thanapal, P.; Prabhu, J.; Jakhar, Mridula

2017-11-01

Over the recent years, many industries have started implementing new technologies for tracing and tracking their products. These technologies are a kind of blessing to their management system. The technology and management system has to work in parallel to avoid loopholes in the system. We can see so many technologies around us and the most difficult and important part is to choose best out of all these new technologies. The important point which we need to take care while choosing a technology for the system is to make sure the technology can integrate properly with the other parameters in the management system. The industry management system consists of many levels such as initial level, intermediate level, final level and tracking. Nowadays tracking a product from its initial stage is becoming a trend. To cope up with this upcoming trend and also with the company demand, integrating the product with Barcode, RFID tags, NFC tag or any other traceable technology. Many supply chain Management system are also adopting this techniques.

[Identification of antler powder components based on DNA barcoding technology].

PubMed

Jia, Jing; Shi, Lin-chun; Xu, Zhi-chao; Xin, Tian-yi; Song, Jing-yuan; Chen Shi, Lin

2015-10-01

In order to authenticate the components of antler powder in the market, DNA barcoding technology coupled with cloning method were used. Cytochrome c oxidase subunit I (COI) sequences were obtained according to the DNA barcoding standard operation procedure (SOP). For antler powder with possible mixed components, the cloning method was used to get each COI sequence. 65 COI sequences were successfully obtained from commercial antler powders via sequencing PCR products. The results indicates that only 38% of these samples were derived from Cervus nippon Temminck or Cervus elaphus Linnaeus which is recorded in the 2010 edition of "Chinese Pharmacopoeia", while 62% of them were derived from other species. Rangifer tarandus Linnaeus was the most frequent species among the adulterants. Further analysis showed that some samples collected from different regions, companies and prices, contained adulterants. Analysis of 36 COI sequences obtained by the cloning method showed that C. elaphus and C. nippon were main components. In addition, some samples were marked clearly as antler powder on the label, however, C. elaphus or R. tarandus were their main components. In summary, DNA barcoding can accurately and efficiently distinguish the exact content in the commercial antler powder, which provides a new technique to ensure clinical safety and improve quality control of Chinese traditional medicine

Quality Traceability System of Traditional Chinese Medicine Based on Two Dimensional Barcode Using Mobile Intelligent Technology

PubMed Central

Cai, Yong; Li, Xiwen; Wang, Runmiao; Yang, Qing; Li, Peng; Hu, Hao

2016-01-01

Currently, the chemical fingerprint comparison and analysis is mainly based on professional equipment and software, it’s expensive and inconvenient. This study aims to integrate QR (Quick Response) code with quality data and mobile intelligent technology to develop a convenient query terminal for tracing quality in the whole industrial chain of TCM (traditional Chinese medicine). Three herbal medicines were randomly selected and their chemical two-dimensional barcode (2D) barcodes fingerprints were constructed. Smartphone application (APP) based on Android system was developed to read initial data of 2D chemical barcodes, and compared multiple fingerprints from different batches of same species or different species. It was demonstrated that there were no significant differences between original and scanned TCM chemical fingerprints. Meanwhile, different TCM chemical fingerprint QR codes could be rendered in the same coordinate and showed the differences very intuitively. To be able to distinguish the variations of chemical fingerprint more directly, linear interpolation angle cosine similarity algorithm (LIACSA) was proposed to get similarity ratio. This study showed that QR codes can be used as an effective information carrier to transfer quality data. Smartphone application can rapidly read quality information in QR codes and convert data into TCM chemical fingerprints. PMID:27780256

Googling DNA sequences on the World Wide Web.

PubMed

Hajibabaei, Mehrdad; Singer, Gregory A C

2009-11-10

New web-based technologies provide an excellent opportunity for sharing and accessing information and using web as a platform for interaction and collaboration. Although several specialized tools are available for analyzing DNA sequence information, conventional web-based tools have not been utilized for bioinformatics applications. We have developed a novel algorithm and implemented it for searching species-specific genomic sequences, DNA barcodes, by using popular web-based methods such as Google. We developed an alignment independent character based algorithm based on dividing a sequence library (DNA barcodes) and query sequence to words. The actual search is conducted by conventional search tools such as freely available Google Desktop Search. We implemented our algorithm in two exemplar packages. We developed pre and post-processing software to provide customized input and output services, respectively. Our analysis of all publicly available DNA barcode sequences shows a high accuracy as well as rapid results. Our method makes use of conventional web-based technologies for specialized genetic data. It provides a robust and efficient solution for sequence search on the web. The integration of our search method for large-scale sequence libraries such as DNA barcodes provides an excellent web-based tool for accessing this information and linking it to other available categories of information on the web.

Fluorescent genetic barcoding in mammalian cells for enhanced multiplexing capabilities in flow cytometry.

PubMed

Smurthwaite, Cameron A; Hilton, Brett J; O'Hanlon, Ryan; Stolp, Zachary D; Hancock, Bryan M; Abbadessa, Darin; Stotland, Aleksandr; Sklar, Larry A; Wolkowicz, Roland

2014-01-01

The discovery of the green fluorescent protein from Aequorea victoria has revolutionized the field of cell and molecular biology. Since its discovery a growing panel of fluorescent proteins, fluorophores and fluorescent-coupled staining methodologies, have expanded the analytical capabilities of flow cytometry. Here, we exploit the power of genetic engineering to barcode individual cells with genes encoding fluorescent proteins. For genetic engineering, we utilize retroviral technology, which allows for the expression of ectopic genetic information in a stable manner in mammalian cells. We have genetically barcoded both adherent and nonadherent cells with different fluorescent proteins. Multiplexing power was increased by combining both the number of distinct fluorescent proteins, and the fluorescence intensity in each channel. Moreover, retroviral expression has proven to be stable for at least a 6-month period, which is critical for applications such as biological screens. We have shown the applicability of fluorescent barcoded multiplexing to cell-based assays that rely themselves on genetic barcoding, or on classical staining protocols. Fluorescent genetic barcoding gives the cell an inherited characteristic that distinguishes it from its counterpart. Once cell lines are developed, no further manipulation or staining is required, decreasing time, nonspecific background associated with staining protocols, and cost. The increasing number of discovered and/or engineered fluorescent proteins with unique absorbance/emission spectra, combined with the growing number of detection devices and lasers, increases multiplexing versatility, making fluorescent genetic barcoding a powerful tool for flow cytometry-based analysis. © 2013 International Society for Advancement of Cytometry.

A DNA 'barcode blitz': rapid digitization and sequencing of a natural history collection.

PubMed

Hebert, Paul D N; Dewaard, Jeremy R; Zakharov, Evgeny V; Prosser, Sean W J; Sones, Jayme E; McKeown, Jaclyn T A; Mantle, Beth; La Salle, John

2013-01-01

DNA barcoding protocols require the linkage of each sequence record to a voucher specimen that has, whenever possible, been authoritatively identified. Natural history collections would seem an ideal resource for barcode library construction, but they have never seen large-scale analysis because of concerns linked to DNA degradation. The present study examines the strength of this barrier, carrying out a comprehensive analysis of moth and butterfly (Lepidoptera) species in the Australian National Insect Collection. Protocols were developed that enabled tissue samples, specimen data, and images to be assembled rapidly. Using these methods, a five-person team processed 41,650 specimens representing 12,699 species in 14 weeks. Subsequent molecular analysis took about six months, reflecting the need for multiple rounds of PCR as sequence recovery was impacted by age, body size, and collection protocols. Despite these variables and the fact that specimens averaged 30.4 years old, barcode records were obtained from 86% of the species. In fact, one or more barcode compliant sequences (>487 bp) were recovered from virtually all species represented by five or more individuals, even when the youngest was 50 years old. By assembling specimen images, distributional data, and DNA barcode sequences on a web-accessible informatics platform, this study has greatly advanced accessibility to information on thousands of species. Moreover, much of the specimen data became publically accessible within days of its acquisition, while most sequence results saw release within three months. As such, this study reveals the speed with which DNA barcode workflows can mobilize biodiversity data, often providing the first web-accessible information for a species. These results further suggest that existing collections can enable the rapid development of a comprehensive DNA barcode library for the most diverse compartment of terrestrial biodiversity - insects.

The Application of DNA Barcodes for the Identification of Marine Crustaceans from the North Sea and Adjacent Regions

PubMed Central

Raupach, Michael J.; Barco, Andrea; Steinke, Dirk; Beermann, Jan; Laakmann, Silke; Mohrbeck, Inga; Neumann, Hermann; Kihara, Terue C.; Pointner, Karin; Radulovici, Adriana; Segelken-Voigt, Alexandra; Wesse, Christina; Knebelsberger, Thomas

2015-01-01

During the last years DNA barcoding has become a popular method of choice for molecular specimen identification. Here we present a comprehensive DNA barcode library of various crustacean taxa found in the North Sea, one of the most extensively studied marine regions of the world. Our data set includes 1,332 barcodes covering 205 species, including taxa of the Amphipoda, Copepoda, Decapoda, Isopoda, Thecostraca, and others. This dataset represents the most extensive DNA barcode library of the Crustacea in terms of species number to date. By using the Barcode of Life Data Systems (BOLD), unique BINs were identified for 198 (96.6%) of the analyzed species. Six species were characterized by two BINs (2.9%), and three BINs were found for the amphipod species Gammarus salinus Spooner, 1947 (0.4%). Intraspecific distances with values higher than 2.2% were revealed for 13 species (6.3%). Exceptionally high distances of up to 14.87% between two distinct but monophyletic clusters were found for the parasitic copepod Caligus elongatus Nordmann, 1832, supporting the results of previous studies that indicated the existence of an overlooked sea louse species. In contrast to these high distances, haplotype-sharing was observed for two decapod spider crab species, Macropodia parva Van Noort & Adema, 1985 and Macropodia rostrata (Linnaeus, 1761), underlining the need for a taxonomic revision of both species. Summarizing the results, our study confirms the application of DNA barcodes as highly effective identification system for the analyzed marine crustaceans of the North Sea and represents an important milestone for modern biodiversity assessment studies using barcode sequences. PMID:26417993

Exploring Genetic Divergence in a Species-Rich Insect Genus Using 2790 DNA Barcodes

PubMed Central

Lin, Xiaolong; Stur, Elisabeth; Ekrem, Torbjørn

2015-01-01

DNA barcoding using a fragment of the mitochondrial cytochrome c oxidase subunit 1 gene (COI) has proven to be successful for species-level identification in many animal groups. However, most studies have been focused on relatively small datasets or on large datasets of taxonomically high-ranked groups. We explore the quality of DNA barcodes to delimit species in the diverse chironomid genus Tanytarsus (Diptera: Chironomidae) by using different analytical tools. The genus Tanytarsus is the most species-rich taxon of tribe Tanytarsini (Diptera: Chironomidae) with more than 400 species worldwide, some of which can be notoriously difficult to identify to species-level using morphology. Our dataset, based on sequences generated from own material and publicly available data in BOLD, consist of 2790 DNA barcodes with a fragment length of at least 500 base pairs. A neighbor joining tree of this dataset comprises 131 well separated clusters representing 121 morphological species of Tanytarsus: 77 named, 16 unnamed and 28 unidentified theoretical species. For our geographically widespread dataset, DNA barcodes unambiguously discriminate 94.6% of the Tanytarsus species recognized through prior morphological study. Deep intraspecific divergences exist in some species complexes, and need further taxonomic studies using appropriate nuclear markers as well as morphological and ecological data to be resolved. The DNA barcodes cluster into 120–242 molecular operational taxonomic units (OTUs) depending on whether Objective Clustering, Automatic Barcode Gap Discovery (ABGD), Generalized Mixed Yule Coalescent model (GMYC), Poisson Tree Process (PTP), subjective evaluation of the neighbor joining tree or Barcode Index Numbers (BINs) are used. We suggest that a 4–5% threshold is appropriate to delineate species of Tanytarsus non-biting midges. PMID:26406595

Patterns of DNA barcode variation in Canadian marine molluscs.

PubMed

Layton, Kara K S; Martel, André L; Hebert, Paul D N

2014-01-01

Molluscs are the most diverse marine phylum and this high diversity has resulted in considerable taxonomic problems. Because the number of species in Canadian oceans remains uncertain, there is a need to incorporate molecular methods into species identifications. A 648 base pair segment of the cytochrome c oxidase subunit I gene has proven useful for the identification and discovery of species in many animal lineages. While the utility of DNA barcoding in molluscs has been demonstrated in other studies, this is the first effort to construct a DNA barcode registry for marine molluscs across such a large geographic area. This study examines patterns of DNA barcode variation in 227 species of Canadian marine molluscs. Intraspecific sequence divergences ranged from 0-26.4% and a barcode gap existed for most taxa. Eleven cases of relatively deep (>2%) intraspecific divergence were detected, suggesting the possible presence of overlooked species. Structural variation was detected in COI with indels found in 37 species, mostly bivalves. Some indels were present in divergent lineages, primarily in the region of the first external loop, suggesting certain areas are hotspots for change. Lastly, mean GC content varied substantially among orders (24.5%-46.5%), and showed a significant positive correlation with nearest neighbour distances. DNA barcoding is an effective tool for the identification of Canadian marine molluscs and for revealing possible cases of overlooked species. Some species with deep intraspecific divergence showed a biogeographic partition between lineages on the Atlantic, Arctic and Pacific coasts, suggesting the role of Pleistocene glaciations in the subdivision of their populations. Indels were prevalent in the barcode region of the COI gene in bivalves and gastropods. This study highlights the efficacy of DNA barcoding for providing insights into sequence variation across a broad taxonomic group on a large geographic scale.

Multiplex Identification of Microbes ▿ †

PubMed Central

Hyman, Richard W.; St.Onge, Robert P.; Allen, Edward A.; Miranda, Molly; Aparicio, Ana Maria; Fukushima, Marilyn; Davis, Ronald W.

2010-01-01

We have adapted molecular inversion probe technology to identify microbes in a highly multiplexed procedure. This procedure does not require growth of the microbes. Rather, the technology employs DNA homology twice: once for the molecular probe to hybridize to its homologous DNA and again for the 20-mer oligonucleotide barcode on the molecular probe to hybridize to a commercially available molecular barcode array. As proof of concept, we have designed, tested, and employed 192 molecular probes for 40 microbes. While these particular molecular probes are aimed at our interest in the microbes in the human vagina, this molecular probe method could be employed to identify the microbes in any ecological niche. PMID:20418427

DNA barcoding as an aid for species identification in austral black flies (Insecta: Diptera: Simuliidae).

PubMed

Hernández-Triana, Luis M; Montes De Oca, Fernanda; Prosser, Sean W J; Hebert, Paul D N; Gregory, T Ryan; McMurtrie, Shelley

2017-04-01

In this paper, the utility of a partial sequence of the COI gene, the DNA barcoding region, for the identification of species of black flies in the austral region was assessed. Twenty-eight morphospecies were analyzed: eight of the genus Austrosimulium (four species in the subgenus Austrosimulium s. str., three species in the subgenus Novaustrosimulium, and one species unassigned to subgenus), two of the genus Cnesia, eight of Gigantodax, three of Paracnephia, one of Paraustrosimulium, and six of Simulium (subgenera Morops, Nevermannia, and Pternaspatha). The neighbour-joining tree derived from the DNA barcode sequences grouped most specimens according to species or species groups recognized by morphotaxonomic studies. Intraspecific sequence divergences within morphologically distinct species ranged from 0% to 1.8%, while higher divergences (2%-4.2%) in certain species suggested the presence of cryptic diversity. The existence of well-defined groups within S. simile revealed the likely inclusion of cryptic diversity. DNA barcodes also showed that specimens identified as C. dissimilis, C. nr. pussilla, and C. ornata might be conspecific, suggesting possible synonymy. DNA barcoding combined with a sound morphotaxonomic framework would provide an effective approach for the identification of black flies in the region.

Nonlinear projection methods for visualizing Barcode data and application on two data sets.

PubMed

Olteanu, Madalina; Nicolas, Violaine; Schaeffer, Brigitte; Denys, Christiane; Missoup, Alain-Didier; Kennis, Jan; Larédo, Catherine

2013-11-01

Developing tools for visualizing DNA sequences is an important issue in the Barcoding context. Visualizing Barcode data can be put in a purely statistical context, unsupervised learning. Clustering methods combined with projection methods have two closely linked objectives, visualizing and finding structure in the data. Multidimensional scaling (MDS) and Self-organizing maps (SOM) are unsupervised statistical tools for data visualization. Both algorithms map data onto a lower dimensional manifold: MDS looks for a projection that best preserves pairwise distances while SOM preserves the topology of the data. Both algorithms were initially developed for Euclidean data and the conditions necessary to their good implementation were not satisfied for Barcode data. We developed a workflow consisting in four steps: collapse data into distinct sequences; compute a dissimilarity matrix; run a modified version of SOM for dissimilarity matrices to structure the data and reduce dimensionality; project the results using MDS. This methodology was applied to Astraptes fulgerator and Hylomyscus, an African rodent with debated taxonomy. We obtained very good results for both data sets. The results were robust against unbalanced species. All the species in Astraptes were well displayed in very distinct groups in the various visualizations, except for LOHAMP and FABOV that were mixed up. For Hylomyscus, our findings were consistent with known species, confirmed the existence of four unnamed taxa and suggested the existence of potentially new species. © 2013 John Wiley & Sons Ltd.

Multiplex single-molecule interaction profiling of DNA-barcoded proteins.

PubMed

Gu, Liangcai; Li, Chao; Aach, John; Hill, David E; Vidal, Marc; Church, George M

2014-11-27

In contrast with advances in massively parallel DNA sequencing, high-throughput protein analyses are often limited by ensemble measurements, individual analyte purification and hence compromised quality and cost-effectiveness. Single-molecule protein detection using optical methods is limited by the number of spectrally non-overlapping chromophores. Here we introduce a single-molecular-interaction sequencing (SMI-seq) technology for parallel protein interaction profiling leveraging single-molecule advantages. DNA barcodes are attached to proteins collectively via ribosome display or individually via enzymatic conjugation. Barcoded proteins are assayed en masse in aqueous solution and subsequently immobilized in a polyacrylamide thin film to construct a random single-molecule array, where barcoding DNAs are amplified into in situ polymerase colonies (polonies) and analysed by DNA sequencing. This method allows precise quantification of various proteins with a theoretical maximum array density of over one million polonies per square millimetre. Furthermore, protein interactions can be measured on the basis of the statistics of colocalized polonies arising from barcoding DNAs of interacting proteins. Two demanding applications, G-protein coupled receptor and antibody-binding profiling, are demonstrated. SMI-seq enables 'library versus library' screening in a one-pot assay, simultaneously interrogating molecular binding affinity and specificity.

Multiplex single-molecule interaction profiling of DNA barcoded proteins

PubMed Central

Gu, Liangcai; Li, Chao; Aach, John; Hill, David E.; Vidal, Marc; Church, George M.

2014-01-01

In contrast with advances in massively parallel DNA sequencing1, high-throughput protein analyses2-4 are often limited by ensemble measurements, individual analyte purification and hence compromised quality and cost-effectiveness. Single-molecule (SM) protein detection achieved using optical methods5 is limited by the number of spectrally nonoverlapping chromophores. Here, we introduce a single molecular interaction-sequencing (SMI-Seq) technology for parallel protein interaction profiling leveraging SM advantages. DNA barcodes are attached to proteins collectively via ribosome display6 or individually via enzymatic conjugation. Barcoded proteins are assayed en masse in aqueous solution and subsequently immobilized in a polyacrylamide (PAA) thin film to construct a random SM array, where barcoding DNAs are amplified into in situ polymerase colonies (polonies)7 and analyzed by DNA sequencing. This method allows precise quantification of various proteins with a theoretical maximum array density of over one million polonies per square millimeter. Furthermore, protein interactions can be measured based on the statistics of colocalized polonies arising from barcoding DNAs of interacting proteins. Two demanding applications, G-protein coupled receptor (GPCR) and antibody binding profiling, were demonstrated. SMI-Seq enables “library vs. library” screening in a one-pot assay, simultaneously interrogating molecular binding affinity and specificity. PMID:25252978

Integrative taxonomy of Leptonetela spiders (Araneae, Leptonetidae), with descriptions of 46 new species

PubMed Central

Wang, Chun-Xia; Xu, Xin; Li, Shu-Qiang

2017-01-01

Extreme environments, such as subterranean habitats, are suspected to be responsible for morphologically inseparable cryptic or sibling species and can bias biodiversity assessment. A DNA barcode is a short, standardized DNA sequence used for taxonomic purposes and has the potential to lessen the challenges presented by a biotic inventory. Here, we investigate the diversity of the genus Leptonetela Kratochvíl, 1978 that is endemic to karst systems in Eurasia using DNA barcoding. We analyzed 624 specimens using one mitochondrial gene fragment (COI). The results show that DNA barcoding is an efficient and rapid species identification method in this genus. DNA barcoding gap and automatic barcode gap discovery (ABGD) analyses indicated the existence of 90 species, a result consistent with previous taxonomic hypotheses, and supported the existence of extreme male pedipalpal tibial spine and median apophysis polymorphism in Leptonetela species, with direct implications for the taxonomy of the group and its diversity. Based on the molecular and morphological evidence, we delimit and diagnose 90 Leptonetela species, including the type species Leptonetela kanellisi(Deeleman-Reinhold, 1971). Forty-six of them are previously undescribed. The female of Leptonetela zhai Wang & Li, 2011 is reported for the first time. Leptonetela tianxinensis (Tong & Li, 2008) comb. nov. is transferred from the genus Leptoneta Simon, 1872;the genus Guineta Lin & Li, 2010 syn. nov. is a junior synonym of Leptonetela; Leptonetela gigachela(Lin & Li, 2010) comb. nov. is transferred from Guineta. The genus Sinoneta Lin & Li, 2010 syn. nov. is a junior synonym of Leptonetela; Leptonetela notabilis(Lin & Li, 2010) comb. nov. and Leptonetela sexdigiti(Lin & Li, 2010) comb. nov. are transferred from Sinoneta; Leptonetela sanchahe Wang & Li nom. nov. is proposed as a replacement name for Sinoneta palmata(Chen et al, 2010) because Leptonetela palmata is preoccupied. PMID:29280363

Integrative taxonomy of Leptonetela spiders (Araneae, Leptonetidae), with descriptions of 46 new species.

PubMed

Wang, Chun-Xia; Xu, Xin; Li, Shu-Qiang

2017-11-18

Extreme environments, such as subterranean habitats, are suspected to be responsible for morphologically inseparable cryptic or sibling species and can bias biodiversity assessment. A DNA barcode is a short, standardized DNA sequence used for taxonomic purposes and has the potential to lessen the challenges presented by a biotic inventory. Here, we investigate the diversity of the genus Leptonetela Kratochvíl, 1978 that is endemic to karst systems in Eurasia using DNA barcoding. We analyzed 624 specimens using one mitochondrial gene fragment ( COI ). The results show that DNA barcoding is an efficient and rapid species identification method in this genus. DNA barcoding gap and automatic barcode gap discovery (ABGD) analyses indicated the existence of 90 species, a result consistent with previous taxonomic hypotheses, and supported the existence of extreme male pedipalpal tibial spine and median apophysis polymorphism in Leptonetela species, with direct implications for the taxonomy of the group and its diversity. Based on the molecular and morphological evidence, we delimit and diagnose 90 Leptonetela species, including the type species Leptonetela kanellisi (Deeleman-Reinhold, 1971). Forty-six of them are previously undescribed. The female of Leptonetela zhai Wang & Li, 2011 is reported for the first time. Leptonetela tianxinensis (Tong & Li, 2008) comb. nov. is transferred from the genus Leptoneta Simon, 1872; the genus Guineta Lin & Li, 2010 syn. nov. is a junior synonym of Leptonetela; Leptonetela gigachela (Lin & Li, 2010) comb. nov. is transferred from Guineta . The genus Sinoneta Lin & Li, 2010 syn. nov. is a junior synonym of Leptonetela ; Leptonetela notabilis (Lin & Li, 2010) comb. nov. and Leptonetela sexdigiti (Lin & Li, 2010) comb. nov. are transferred from Sinoneta ; Leptonetela sanchahe Wang & Li nom. nov. is proposed as a replacement name for Sinoneta palmata (Chen et al., 2010) because Leptonetela palmata is preoccupied.

Aptamer-based hydrogel barcodes for the capture and detection of multiple types of pathogenic bacteria.

PubMed

Xu, Yueshuang; Wang, Huan; Luan, Chengxin; Liu, Yuxiao; Chen, Baoan; Zhao, Yuanjin

2018-02-15

Rapid and sensitive diagnosing hematological infections based on the separation and detection of pathogenic bacteria in the patient's blood is a significant challenge. To address this, we herein present a new barcodes technology that can simultaneously capture and detect multiple types of pathogenic bacteria from a complex sample. The barcodes are poly (ethylene glycol) (PEG) hydrogel inverse opal particles with characteristic reflection peak codes that remain stable during bacteria capture on their surfaces. As the spherical surface of the particles has ordered porous nanostructure, the barcodes can provide not only more surface area for probe immobilization and reaction, but also a nanopatterned platform for highly efficient bioreactions. In addition, the PEG hydrogel scaffold could decrease the non-specificity adsorption by its anti-adhesive effect, and the decorated aptamer probes in the scaffolds could increase the sensitivity, reliability, and specificity of the bacteria capture and detection. Moreover, the tagged magnetic nanoparticles in the PEG scaffold could impart the barcodes with controllable movement under magnetic fields, which can be used to significantly increase the reaction speed and simplify the processing of the bioassays. Based on the describe barcodes, it was demonstrated that the bacteria could be captured and identified even at low bacterial concentrations (100 CFU mL -1 ) within 2.5h, which is effectively shortened in comparison with the "gold standard" in clinic. These features make the barcodes ideal for capturing and detecting multiple bacteria from clinical samples for hematological infection diagnostics. Copyright © 2017 Elsevier B.V. All rights reserved.

Barcoded materials based on photoluminescent hybrid system of lanthanide ions-doped metal organic framework and silica via ion exchange.

PubMed

Shen, Xiang; Yan, Bing

2016-04-15

A multicolored photoluminescent hybrid system based on lanthanide ions-doped metal organic frameworks/silica composite host has potential in display and barcode applications. By controlling the stoichiometry of the lanthanides via cation exchange, proportional various lanthanide ions are successfully introduced into metal organic frameworks, whose emission intensity is correspondingly proportional to its amount. The resulting luminescent barcodes depend on the lanthanide ions ratios and compositions. Subsequently, the lanthanide ions located in the channels of metal organic frameworks are protected from any interaction with the environment after the modification of silica on the surface. The optical and thermal stability of the hybrid materials are improved for technological application. Copyright © 2016 Elsevier Inc. All rights reserved.

Direct Identification of On-Bead Peptides Using Surface-Enhanced Raman Spectroscopic Barcoding System for High-Throughput Bioanalysis

PubMed Central

Kang, Homan; Jeong, Sinyoung; Koh, Yul; Geun Cha, Myeong; Yang, Jin-Kyoung; Kyeong, San; Kim, Jaehi; Kwak, Seon-Yeong; Chang, Hye-Jin; Lee, Hyunmi; Jeong, Cheolhwan; Kim, Jong-Ho; Jun, Bong-Hyun; Kim, Yong-Kweon; Hong Jeong, Dae; Lee, Yoon-Sik

2015-01-01

Recently, preparation and screening of compound libraries remain one of the most challenging tasks in drug discovery, biomarker detection, and biomolecular profiling processes. So far, several distinct encoding/decoding methods such as chemical encoding, graphical encoding, and optical encoding have been reported to identify those libraries. In this paper, a simple and efficient surface-enhanced Raman spectroscopic (SERS) barcoding method using highly sensitive SERS nanoparticles (SERS ID) is presented. The 44 kinds of SERS IDs were able to generate simple codes and could possibly generate more than one million kinds of codes by incorporating combinations of different SERS IDs. The barcoding method exhibited high stability and reliability under bioassay conditions. The SERS ID encoding based screening platform can identify the peptide ligand on the bead and also quantify its binding affinity for specific protein. We believe that our SERS barcoding technology is a promising method in the screening of one-bead-one-compound (OBOC) libraries for drug discovery. PMID:26017924

Direct identification of on-bead peptides using surface-enhanced Raman spectroscopic barcoding system for high-throughput bioanalysis.

PubMed

Kang, Homan; Jeong, Sinyoung; Koh, Yul; Geun Cha, Myeong; Yang, Jin-Kyoung; Kyeong, San; Kim, Jaehi; Kwak, Seon-Yeong; Chang, Hye-Jin; Lee, Hyunmi; Jeong, Cheolhwan; Kim, Jong-Ho; Jun, Bong-Hyun; Kim, Yong-Kweon; Hong Jeong, Dae; Lee, Yoon-Sik

2015-05-28

Recently, preparation and screening of compound libraries remain one of the most challenging tasks in drug discovery, biomarker detection, and biomolecular profiling processes. So far, several distinct encoding/decoding methods such as chemical encoding, graphical encoding, and optical encoding have been reported to identify those libraries. In this paper, a simple and efficient surface-enhanced Raman spectroscopic (SERS) barcoding method using highly sensitive SERS nanoparticles (SERS ID) is presented. The 44 kinds of SERS IDs were able to generate simple codes and could possibly generate more than one million kinds of codes by incorporating combinations of different SERS IDs. The barcoding method exhibited high stability and reliability under bioassay conditions. The SERS ID encoding based screening platform can identify the peptide ligand on the bead and also quantify its binding affinity for specific protein. We believe that our SERS barcoding technology is a promising method in the screening of one-bead-one-compound (OBOC) libraries for drug discovery.

Genetic barcoding with fluorescent proteins for multiplexed applications.

PubMed

Smurthwaite, Cameron A; Williams, Wesley; Fetsko, Alexandra; Abbadessa, Darin; Stolp, Zachary D; Reed, Connor W; Dharmawan, Andre; Wolkowicz, Roland

2015-04-14

Fluorescent proteins, fluorescent dyes and fluorophores in general have revolutionized the field of molecular cell biology. In particular, the discovery of fluorescent proteins and their genes have enabled the engineering of protein fusions for localization, the analysis of transcriptional activation and translation of proteins of interest, or the general tracking of individual cells and cell populations. The use of fluorescent protein genes in combination with retroviral technology has further allowed the expression of these proteins in mammalian cells in a stable and reliable manner. Shown here is how one can utilize these genes to give cells within a population of cells their own biosignature. As the biosignature is achieved with retroviral technology, cells are barcoded 'indefinitely'. As such, they can be individually tracked within a mixture of barcoded cells and utilized in more complex biological applications. The tracking of distinct populations in a mixture of cells is ideal for multiplexed applications such as discovery of drugs against a multitude of targets or the activation profile of different promoters. The protocol describes how to elegantly develop and amplify barcoded mammalian cells with distinct genetic fluorescent markers, and how to use several markers at once or one marker at different intensities. Finally, the protocol describes how the cells can be further utilized in combination with cell-based assays to increase the power of analysis through multiplexing.

Building-up of a DNA barcode library for true bugs (insecta: hemiptera: heteroptera) of Germany reveals taxonomic uncertainties and surprises.

PubMed

Raupach, Michael J; Hendrich, Lars; Küchler, Stefan M; Deister, Fabian; Morinière, Jérome; Gossner, Martin M

2014-01-01

During the last few years, DNA barcoding has become an efficient method for the identification of species. In the case of insects, most published DNA barcoding studies focus on species of the Ephemeroptera, Trichoptera, Hymenoptera and especially Lepidoptera. In this study we test the efficiency of DNA barcoding for true bugs (Hemiptera: Heteroptera), an ecological and economical highly important as well as morphologically diverse insect taxon. As part of our study we analyzed DNA barcodes for 1742 specimens of 457 species, comprising 39 families of the Heteroptera. We found low nucleotide distances with a minimum pairwise K2P distance <2.2% within 21 species pairs (39 species). For ten of these species pairs (18 species), minimum pairwise distances were zero. In contrast to this, deep intraspecific sequence divergences with maximum pairwise distances >2.2% were detected for 16 traditionally recognized and valid species. With a successful identification rate of 91.5% (418 species) our study emphasizes the use of DNA barcodes for the identification of true bugs and represents an important step in building-up a comprehensive barcode library for true bugs in Germany and Central Europe as well. Our study also highlights the urgent necessity of taxonomic revisions for various taxa of the Heteroptera, with a special focus on various species of the Miridae. In this context we found evidence for on-going hybridization events within various taxonomically challenging genera (e.g. Nabis Latreille, 1802 (Nabidae), Lygus Hahn, 1833 (Miridae), Phytocoris Fallén, 1814 (Miridae)) as well as the putative existence of cryptic species (e.g. Aneurus avenius (Duffour, 1833) (Aradidae) or Orius niger (Wolff, 1811) (Anthocoridae)).

Building-Up of a DNA Barcode Library for True Bugs (Insecta: Hemiptera: Heteroptera) of Germany Reveals Taxonomic Uncertainties and Surprises

PubMed Central

Raupach, Michael J.; Hendrich, Lars; Küchler, Stefan M.; Deister, Fabian; Morinière, Jérome; Gossner, Martin M.

2014-01-01

During the last few years, DNA barcoding has become an efficient method for the identification of species. In the case of insects, most published DNA barcoding studies focus on species of the Ephemeroptera, Trichoptera, Hymenoptera and especially Lepidoptera. In this study we test the efficiency of DNA barcoding for true bugs (Hemiptera: Heteroptera), an ecological and economical highly important as well as morphologically diverse insect taxon. As part of our study we analyzed DNA barcodes for 1742 specimens of 457 species, comprising 39 families of the Heteroptera. We found low nucleotide distances with a minimum pairwise K2P distance <2.2% within 21 species pairs (39 species). For ten of these species pairs (18 species), minimum pairwise distances were zero. In contrast to this, deep intraspecific sequence divergences with maximum pairwise distances >2.2% were detected for 16 traditionally recognized and valid species. With a successful identification rate of 91.5% (418 species) our study emphasizes the use of DNA barcodes for the identification of true bugs and represents an important step in building-up a comprehensive barcode library for true bugs in Germany and Central Europe as well. Our study also highlights the urgent necessity of taxonomic revisions for various taxa of the Heteroptera, with a special focus on various species of the Miridae. In this context we found evidence for on-going hybridization events within various taxonomically challenging genera (e.g. Nabis Latreille, 1802 (Nabidae), Lygus Hahn, 1833 (Miridae), Phytocoris Fallén, 1814 (Miridae)) as well as the putative existence of cryptic species (e.g. Aneurus avenius (Duffour, 1833) (Aradidae) or Orius niger (Wolff, 1811) (Anthocoridae)). PMID:25203616

Development of internal COI primers to improve and extend barcoding of fruit flies (Diptera: Tephritidae: Dacini).

PubMed

Krosch, Matt N; Strutt, Francesca; Blacket, Mark J; Batovska, Jana; Starkie, Melissa; Clarke, Anthony R; Cameron, Stephen L; Schutze, Mark K

2018-06-06

Accurate species-level identifications underpin many aspects of basic and applied biology; however, identifications can be hampered by a lack of discriminating morphological characters, taxonomic expertise or time. Molecular approaches, such as DNA 'barcoding' of the cytochrome c oxidase (COI) gene, are argued to overcome these issues. However, nuclear encoding of mitochondrial genes (numts) and poor amplification success of suboptimally preserved specimens can lead to erroneous identifications. One insect group for which these molecular and morphological problems are significant are the dacine fruit flies (Diptera: Tephritidae: Dacini). We addressed these issues associated with COI barcoding in the dacines by first assessing several 'universal' COI primers against public mitochondrial genome and numt sequences for dacine taxa. We then modified a set of four primers that more closely matched true dacine COI sequence and amplified two overlapping portions of the COI barcode region. Our new primers were tested alongside universal primers on a selection of dacine species, including both fresh preserved and decades-old dry specimens. Additionally, Bactrocera tryoni mitochondrial and nuclear genomes were compared to identify putative numts. Four numt clades were identified, three of which were amplified using existing universal primers. In contrast, our new primers preferentially amplified the 'true' mitochondrial COI barcode in all dacine species tested. The new primers also successfully amplified partial barcodes from dry specimens for which full length barcodes were unobtainable. Thus we recommend these new primers be incorporated into the suites of primers used by diagnosticians and quarantine labs for the accurate identification of dacine species. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

Applying DNA Barcodes to Identify Closely Related Species of Ferns: A Case Study of the Chinese Adiantum (Pteridaceae)

PubMed Central

Wen, Jun; Ebihara, Atsushi; Li, De-Zhu

2016-01-01

DNA barcoding is a fast-developing technique to identify species by using short and standard DNA sequences. Universal selection of DNA barcodes in ferns remains unresolved. In this study, five plastid regions (rbcL, matK, trnH-psbA, trnL-F and rps4-trnS) and eight nuclear regions (ITS, pgiC, gapC, LEAFY, ITS2, IBR3_2, DET1, and SQD1_1) were screened and evaluated in the fern genus Adiantum from China and neighboring areas. Due to low primer universality (matK) and/or the existence of multiple copies (ITS), the commonly used barcodes matK and ITS were not appropriate for Adiantum. The PCR amplification rate was extremely low in all nuclear genes except for IBR3_2. rbcL had the highest PCR amplification rate (94.33%) and sequencing success rate (90.78%), while trnH-psbA had the highest species identification rate (75%). With the consideration of discriminatory power, cost-efficiency and effort, the two-barcode combination of rbcL+ trnH-psbA seems to be the best choice for barcoding Adiantum, and perhaps basal polypod ferns in general. The nuclear IBR3_2 showed 100% PCR amplification success rate in Adiantum, however, it seemed that only diploid species could acquire clean sequences without cloning. With cloning, IBR3_2 can successfully distinguish cryptic species and hybrid species from their related species. Because hybridization and allopolyploidy are common in ferns, we argue for including a selected group of nuclear loci as barcodes, especially via the next-generation sequencing, as it is much more efficient to obtain single-copy nuclear loci without the cloning procedure. PMID:27603700

Barcoding Fauna Bavarica: Myriapoda – a contribution to DNA sequence-based identifications of centipedes and millipedes (Chilopoda, Diplopoda)

PubMed Central

Spelda, Jörg; Reip, Hans S.; Oliveira–Biener, Ulla; Melzer, Roland R.

2011-01-01

Abstract We give a first account of our ongoing barcoding activities on Bavarian myriapods in the framework of the Barcoding Fauna Bavarica project and IBOL, the International Barcode of Life. Having analyzed 126 taxa (including 122 species) belonging to all major German chilopod and diplopod lineages, often using four or more specimens each, at the moment our species stock includes 82% of the diplopods and 65% of the chilopods found in Bavaria, southern Germany. The partial COI sequences allow correct identification of more than 95% of the current set of Bavarian species. Moreover, most of the myriapod orders and families appear as distinct clades in neighbour-joining trees, although the phylogenetic relationships between them are not always depicted correctly. We give examples of (1) high interspecific sequence variability among closely related species; (2) low interspecific variability in some chordeumatidan genera, indicating that recent speciations cannot be resolved with certainty using COI DNA barcodes; (3) high intraspecific variation in some genera, suggesting the existence of cryptic lineages; and (4) the possible polyphyly of some taxa, i.e. the chordeumatidan genus Ochogona. This shows that, in addition to species identification, our data may be useful in various ways in the context of species delimitations, taxonomic revisions and analyses of ongoing speciation processes. PMID:22303099

DNA Barcoding of Freshwater Fishes of Indo-Myanmar Biodiversity Hotspot.

PubMed

Barman, Anindya Sundar; Singh, Mamta; Singh, Soibam Khogen; Saha, Himadri; Singh, Yumlembam Jackie; Laishram, Martina; Pandey, Pramod Kumar

2018-06-05

To develop an effective conservation and management strategy, it is required to assess the biodiversity status of an ecosystem, especially when we deal with Indo-Myanmar biodiversity hotspot. Importance of this reaches to an entirely different level as the hotspot represents the area of high endemism which is under continuous threat. Therefore, the need of the present study was conceptualized, dealing with molecular assessment of the fish fauna of Indo-Myanmar region, which covers the Indian states namely, Manipur, Meghalaya, Mizoram, and Nagaland. A total of 363 specimens, representing 109 species were collected and barcoded from the different rivers and their tributaries of the region. The analyses performed in the present study, i.e. Kimura 2-Parameter genetic divergence, Neighbor-Joining, Automated Barcode Gap Discovery and Bayesian Poisson Tree Processes suggest that DNA barcoding is an efficient and reliable tool for species identification. Most of the species were clearly delineated. However, presence of intra-specific and inter-specific genetic distance overlap in few species, revealed the existence of putative cryptic species. A reliable DNA barcode reference library, established in our study provides an adequate knowledge base to the groups of non-taxonomists, researchers, biodiversity managers and policy makers in sketching effective conservation measures for this ecosystem.

Delineating species boundaries using an iterative taxonomic approach: the case of soldierless termites (Isoptera, Termitidae, Apicotermitinae).

PubMed

Bourguignon, Thomas; Šobotník, Jan; Hanus, Robert; Krasulová, Jana; Vrkoslav, Vladimír; Cvačka, Josef; Roisin, Yves

2013-12-01

Species boundaries are traditionally inferred using morphological characters, although morphology sometimes fails to correctly delineate species. To overcome this limitation, researchers have widely taken advantage of alternative methods such as DNA barcoding or analysis of cuticular hydrocarbons (CHs) profiles, but rarely use them simultaneously in an iterative taxonomic approach. Here, we follow such an approach using morphology, DNA barcoding and CHs profiles to precisely discriminate species of soldierless termites, a diversified clade constituting about one-third of the Neotropical termite species richness, but poorly resolved taxonomically due to the paucity of useful characters. We sampled soldierless termites in various forest types of the Nouragues Nature Reserve, French Guiana. Our results show that morphological species determination generally matches DNA barcoding, which only suggests the existence of three cryptic species in the 31 morphological species. Among them, Longustitermes manni is the only species whose splitting is corroborated by ecological data, other widely distributed species being supported by DNA barcoding. On the contrary, although CHs profiles provide a certain taxonomic signal, they often suggest inconsistent groupings which are not supported by other methods. Overall, our data support DNA barcoding and morphology as two efficient methods to distinguish soldierless termite species. Copyright © 2013 Elsevier Inc. All rights reserved.

DNA barcoding reveals high levels of genetic diversity in the fishes of the Itapecuru Basin in Maranhão, Brazil.

PubMed

Nascimento, M H S; Almeida, M S; Veira, M N S; Limeira Filho, D; Lima, R C; Barros, M C; Fraga, E C

2016-08-29

DNA barcoding is a useful complementary tool for use in traditional taxonomic studies due to its ability to detect cryptic species, and may be particularly efficient in the identification of fish species. The fish fauna of the Itapecuru River represents an important fishery resource in the Brazilian State of Maranhão, although it is currently suffering increasing degradation as a result of anthropogenic impacts. Therefore, DNA barcoding was used in the present study to identify fish species and establish a database of the rich freshwater fish fauna of Maranhão. A total of 440 specimens were analyzed, corresponding to 64 species belonging to 59 genera, 31 families, and 10 orders. Overall, 92.19% of these species could be identified by DNA barcoding, and were characterized by low levels (average 0.80%) of intra-specific divergence. However, five species (Anableps anableps, Gymnotus carapo, Sciades couma, Pseudauchenipterus nodosus, and Leporinus piau) presented values of mean genetic divergence above 3%, indicating the existence of cryptic diversity in these fishes. The DNA barcoding approach permitted the analysis of a large number of specimens and facilitated the discrimination and identification of closely related fish species in the Itapecuru Basin.

Quantitative Tracking of Salmonella Enteritidis Transmission Routes Using Barcode-Tagged Isogenic Strains in Chickens: Proof-of-Concept Study

PubMed Central

Yang, Yichao; Ricke, Steven C.; Tellez, Guillermo; Kwon, Young Min

2017-01-01

Salmonella is an important foodborne bacterial pathogen, however, a fundamental understanding on Salmonella transmission routes within a poultry flock remains unclear. In this study, a series of barcode-tagged strains were constructed by inserting six random nucleotides into a functionally neutral region on the chromosome of S. Enteritidis as a tool for quantitative tracking of Salmonella transmission in chickens. Six distinct barcode-tagged strains were used for infection or contamination at either low dose (103 CFUs; three strains) or high dose (105 CFUs; three strains) in three independent experiments (Experiment 1 oral gavage; Experiment 2 contaminated feed; Experiment 3 contaminated water). For all chick experiments, cecal and foot-wash samples were collected from a subset of the chickens at days 7 or/and 14, from which genomic DNA was extracted and used to amplify the barcode regions. After the resulting PCR amplicons were pooled and analyzed by MiSeq sequencing, a total of approximately 1.5 million reads containing the barcode sequences were analyzed to determine the relative frequency of every barcode-tagged strain in each sample. In Experiment 1, the high dose of oral infection was correlated with greater dominance of the strains in the ceca of the respective seeder chickens and also in the contact chickens yet at lesser degrees. When chicks were exposed to contaminated feed (Experiment 2) or water (Experiment 3), there were no clear patterns of the barcode-tagged strains in relation to the dosage, except that the strains introduced at low dose required a longer time to colonize the ceca with contaminated feed. Most foot-wash samples contained only one to three strains for the majority of the samples, suggesting potential existence of an unknown mechanism(s) for strain exclusion. These results demonstrated the proof of concept of using barcode tagged to investigate transmission dynamics of Salmonella in chickens in a quantitative manner. PMID:28261587

A new specimen management system using RFID technology.

PubMed

Shim, Hun; Uh, Young; Lee, Seung Hwan; Yoon, Young Ro

2011-12-01

The specimen management system with barcode needs to be improved in order to solve inherent problems in work performance. This study describes the application of Radio Frequency Identification (RFID) which is the solution for the problems associated with specimen labeling and management. A new specimen management system and architecture with RFID technology for clinical laboratory was designed. The suggested system was tested in various conditions such as durability to temperature and aspect of effective utilization of new work flow under a virtual hospital clinical laboratory environment. This system demonstrates its potential application in clinical laboratories for improving work flow and specimen management. The suggested specimen management system with RFID technology has advantages in comparison to the traditional specimen management system with barcode in the aspect of mass specimen processing, robust durability of temperature, humidity changes, and effective specimen tracking.

Two new computational methods for universal DNA barcoding: a benchmark using barcode sequences of bacteria, archaea, animals, fungi, and land plants.

PubMed

Tanabe, Akifumi S; Toju, Hirokazu

2013-01-01

Taxonomic identification of biological specimens based on DNA sequence information (a.k.a. DNA barcoding) is becoming increasingly common in biodiversity science. Although several methods have been proposed, many of them are not universally applicable due to the need for prerequisite phylogenetic/machine-learning analyses, the need for huge computational resources, or the lack of a firm theoretical background. Here, we propose two new computational methods of DNA barcoding and show a benchmark for bacterial/archeal 16S, animal COX1, fungal internal transcribed spacer, and three plant chloroplast (rbcL, matK, and trnH-psbA) barcode loci that can be used to compare the performance of existing and new methods. The benchmark was performed under two alternative situations: query sequences were available in the corresponding reference sequence databases in one, but were not available in the other. In the former situation, the commonly used "1-nearest-neighbor" (1-NN) method, which assigns the taxonomic information of the most similar sequences in a reference database (i.e., BLAST-top-hit reference sequence) to a query, displays the highest rate and highest precision of successful taxonomic identification. However, in the latter situation, the 1-NN method produced extremely high rates of misidentification for all the barcode loci examined. In contrast, one of our new methods, the query-centric auto-k-nearest-neighbor (QCauto) method, consistently produced low rates of misidentification for all the loci examined in both situations. These results indicate that the 1-NN method is most suitable if the reference sequences of all potentially observable species are available in databases; otherwise, the QCauto method returns the most reliable identification results. The benchmark results also indicated that the taxon coverage of reference sequences is far from complete for genus or species level identification in all the barcode loci examined. Therefore, we need to accelerate the registration of reference barcode sequences to apply high-throughput DNA barcoding to genus or species level identification in biodiversity research.

Two New Computational Methods for Universal DNA Barcoding: A Benchmark Using Barcode Sequences of Bacteria, Archaea, Animals, Fungi, and Land Plants

PubMed Central

Tanabe, Akifumi S.; Toju, Hirokazu

2013-01-01

Taxonomic identification of biological specimens based on DNA sequence information (a.k.a. DNA barcoding) is becoming increasingly common in biodiversity science. Although several methods have been proposed, many of them are not universally applicable due to the need for prerequisite phylogenetic/machine-learning analyses, the need for huge computational resources, or the lack of a firm theoretical background. Here, we propose two new computational methods of DNA barcoding and show a benchmark for bacterial/archeal 16S, animal COX1, fungal internal transcribed spacer, and three plant chloroplast (rbcL, matK, and trnH-psbA) barcode loci that can be used to compare the performance of existing and new methods. The benchmark was performed under two alternative situations: query sequences were available in the corresponding reference sequence databases in one, but were not available in the other. In the former situation, the commonly used “1-nearest-neighbor” (1-NN) method, which assigns the taxonomic information of the most similar sequences in a reference database (i.e., BLAST-top-hit reference sequence) to a query, displays the highest rate and highest precision of successful taxonomic identification. However, in the latter situation, the 1-NN method produced extremely high rates of misidentification for all the barcode loci examined. In contrast, one of our new methods, the query-centric auto-k-nearest-neighbor (QCauto) method, consistently produced low rates of misidentification for all the loci examined in both situations. These results indicate that the 1-NN method is most suitable if the reference sequences of all potentially observable species are available in databases; otherwise, the QCauto method returns the most reliable identification results. The benchmark results also indicated that the taxon coverage of reference sequences is far from complete for genus or species level identification in all the barcode loci examined. Therefore, we need to accelerate the registration of reference barcode sequences to apply high-throughput DNA barcoding to genus or species level identification in biodiversity research. PMID:24204702

Identification of Dendrobium species by a candidate DNA barcode sequence: the chloroplast psbA-trnH intergenic region.

PubMed

Yao, Hui; Song, Jing-Yuan; Ma, Xin-Ye; Liu, Chang; Li, Ying; Xu, Hong-Xi; Han, Jian-Ping; Duan, Li-Sheng; Chen, Shi-Lin

2009-05-01

DNA barcoding is a novel technology that uses a standard DNA sequence to facilitate species identification. Although a consensus has not been reached regarding which DNA sequences can be used as the best plant barcodes, the psbA-trnH spacer region has been tested extensively in recent years. In this study, we hypothesize that the psbA-trnH spacer regions are also effective barcodes for Dendrobium species. We have sequenced the chloroplast psbA-trnH intergenic spacers of 17 Dendrobium species to test this hypothesis. The sequences were found to be significantly different from those of other species, with percentages of variation ranging from 0.3 % to 2.3 % and an average of 1.2 %. In contrast, the intraspecific variation among the Dendrobium species studied ranged from 0 % to 0.1 %. The sequence difference between the psbA-trnH sequences of 17 Dendrobium species and one Bulbophyllum odoratissimum ranged from 2.0 % to 3.1 %, with an average of 2.5 %. Our results support the notion that the psbA-trnH intergenic spacer region could be used as a barcode to distinguish various Dendrobium species and to differentiate Dendrobium species from other adulterating species. Copyright Georg Thieme Verlag KG Stuttgart. New York.

Scaling up discovery of hidden diversity in fungi: impacts of barcoding approaches.

PubMed

Yahr, Rebecca; Schoch, Conrad L; Dentinger, Bryn T M

2016-09-05

The fungal kingdom is a hyperdiverse group of multicellular eukaryotes with profound impacts on human society and ecosystem function. The challenge of documenting and describing fungal diversity is exacerbated by their typically cryptic nature, their ability to produce seemingly unrelated morphologies from a single individual and their similarity in appearance to distantly related taxa. This multiplicity of hurdles resulted in the early adoption of DNA-based comparisons to study fungal diversity, including linking curated DNA sequence data to expertly identified voucher specimens. DNA-barcoding approaches in fungi were first applied in specimen-based studies for identification and discovery of taxonomic diversity, but are now widely deployed for community characterization based on sequencing of environmental samples. Collectively, fungal barcoding approaches have yielded important advances across biological scales and research applications, from taxonomic, ecological, industrial and health perspectives. A major outstanding issue is the growing problem of 'sequences without names' that are somewhat uncoupled from the traditional framework of fungal classification based on morphology and preserved specimens. This review summarizes some of the most significant impacts of fungal barcoding, its limitations, and progress towards the challenge of effective utilization of the exponentially growing volume of data gathered from high-throughput sequencing technologies.This article is part of the themed issue 'From DNA barcodes to biomes'. © 2016 The Authors.

The Impact of Bar Code Medication Administration Technology on Reported Medication Errors

ERIC Educational Resources Information Center

Holecek, Andrea

2011-01-01

The use of bar-code medication administration technology is on the rise in acute care facilities in the United States. The technology is purported to decrease medication errors that occur at the point of administration. How significantly this technology affects actual rate and severity of error is unknown. This descriptive, longitudinal research…

Barcode tagging of human oocytes and embryos to prevent mix-ups in assisted reproduction technologies.

PubMed

Novo, Sergi; Nogués, Carme; Penon, Oriol; Barrios, Leonardo; Santaló, Josep; Gómez-Martínez, Rodrigo; Esteve, Jaume; Errachid, Abdelhamid; Plaza, José Antonio; Pérez-García, Lluïsa; Ibáñez, Elena

2014-01-01

Is the attachment of biofunctionalized polysilicon barcodes to the outer surface of the zona pellucida an effective approach for the direct tagging and identification of human oocytes and embryos during assisted reproduction technologies (ARTs)? The direct tagging system based on lectin-biofunctionalized polysilicon barcodes of micrometric dimensions is simple, safe and highly efficient, allowing the identification of human oocytes and embryos during the various procedures typically conducted during an assisted reproduction cycle. Measures to prevent mismatching errors (mix-ups) of the reproductive samples are currently in place in fertility clinics, but none of them are totally effective and several mix-up cases have been reported worldwide. Using a mouse model, our group has previously developed an effective direct embryo tagging system which does not interfere with the in vitro and in vivo development of the tagged embryos. This system has now been tested in human oocytes and embryos. Fresh immature and mature fertilization-failed oocytes (n = 21) and cryopreserved day 1 embryos produced by in vitro fertilization (IVF) or intracytoplasmic sperm injection (ICSI) (n = 205) were donated by patients (n = 76) undergoing ARTs. In vitro development rates, embryo quality and post-vitrification survival were compared between tagged (n = 106) and non-tagged (control) embryos (n = 99). Barcode retention and identification rates were also calculated, both for embryos and for oocytes subjected to a simulated ICSI and parthenogenetic activation. Experiments were conducted from January 2012 to January 2013. Barcodes were fabricated in polysilicon and biofunctionalizated with wheat germ agglutinin lectin. Embryos were tagged with 10 barcodes and cultured in vitro until the blastocyst stage, when they were either differentially stained with propidium iodide and Hoechst or vitrified using the Cryotop method. Embryo quality was also analyzed by embryo grading and time-lapse monitoring. Injected oocytes were parthenogenetically activated using ionomycin and 6-dimethylaminopurine. Blastocyst development rates of tagged (27/58) and non-tagged embryos (24/51) were equivalent, and no significant differences in the timing of key morphokinetic parameters and the number of inner cell mass cells were detected between the two groups (tagged: 24.7 ± 2.5; non-tagged: 22.3 ± 1.9), indicating that preimplantation embryo potential and quality are not affected by the barcodes. Similarly, re-expansion rates of vitrified-warmed tagged (19/21) and non-tagged (16/19) blastocysts were similar. Global identification rates of 96.9 and 89.5% were obtained in fresh (mean barcode retention: 9.22 ± 0.13) and vitrified-warmed (mean barcode retention: 7.79 ± 0.35) tagged embryos, respectively, when simulating an automatic barcode reading process, though these rates were increased to 100% just by rotating the embryos during barcode reading. Only one of the oocytes lost one barcode during intracytoplasmic injection (100% identification rate) and all oocytes retained all the barcodes after parthenogenetic activation. Although the direct embryo tagging system developed is effective, it only allows the identification and traceability of oocytes destined for ICSI and embryos. Thus, the traceability of all reproductive samples (oocytes destined for IVF and sperm) is not yet ensured. The direct embryo tagging system developed here provides fertility clinics with a novel tool to reduce the risk of mix-ups in human ARTs. The system can also be useful in research studies that require the individual identification of oocytes or embryos and their individual tracking. This study was supported by the Sociedad Española de Fertilidad, the Spanish Ministry of Education and Science (TEC2011-29140-C03) and the Generalitat de Catalunya (2009SGR-00282 and 2009SGR-00158). The authors do not have any competing interests.

Preparation of next-generation sequencing libraries using Nextera™ technology: simultaneous DNA fragmentation and adaptor tagging by in vitro transposition.

PubMed

Caruccio, Nicholas

2011-01-01

DNA library preparation is a common entry point and bottleneck for next-generation sequencing. Current methods generally consist of distinct steps that often involve significant sample loss and hands-on time: DNA fragmentation, end-polishing, and adaptor-ligation. In vitro transposition with Nextera™ Transposomes simultaneously fragments and covalently tags the target DNA, thereby combining these three distinct steps into a single reaction. Platform-specific sequencing adaptors can be added, and the sample can be enriched and bar-coded using limited-cycle PCR to prepare di-tagged DNA fragment libraries. Nextera technology offers a streamlined, efficient, and high-throughput method for generating bar-coded libraries compatible with multiple next-generation sequencing platforms.

Tagmentation on Microbeads: Restore Long-Range DNA Sequence Information Using Next Generation Sequencing with Library Prepared by Surface-Immobilized Transposomes.

PubMed

Chen, He; Yao, Jiacheng; Fu, Yusi; Pang, Yuhong; Wang, Jianbin; Huang, Yanyi

2018-04-11

The next generation sequencing (NGS) technologies have been rapidly evolved and applied to various research fields, but they often suffer from losing long-range information due to short library size and read length. Here, we develop a simple, cost-efficient, and versatile NGS library preparation method, called tagmentation on microbeads (TOM). This method is capable of recovering long-range information through tagmentation mediated by microbead-immobilized transposomes. Using transposomes with DNA barcodes to identically label adjacent sequences during tagmentation, we can restore inter-read connection of each fragment from original DNA molecule by fragment-barcode linkage after sequencing. In our proof-of-principle experiment, more than 4.5% of the reads are linked with their adjacent reads, and the longest linkage is over 1112 bp. We demonstrate TOM with eight barcodes, but the number of barcodes can be scaled up by an ultrahigh complexity construction. We also show this method has low amplification bias and effectively fits the applications to identify copy number variations.

Feasibility of 3D Reconstruction of Neural Morphology Using Expansion Microscopy and Barcode-Guided Agglomeration

PubMed Central

Yoon, Young-Gyu; Dai, Peilun; Wohlwend, Jeremy; Chang, Jae-Byum; Marblestone, Adam H.; Boyden, Edward S.

2017-01-01

We here introduce and study the properties, via computer simulation, of a candidate automated approach to algorithmic reconstruction of dense neural morphology, based on simulated data of the kind that would be obtained via two emerging molecular technologies—expansion microscopy (ExM) and in-situ molecular barcoding. We utilize a convolutional neural network to detect neuronal boundaries from protein-tagged plasma membrane images obtained via ExM, as well as a subsequent supervoxel-merging pipeline guided by optical readout of information-rich, cell-specific nucleic acid barcodes. We attempt to use conservative imaging and labeling parameters, with the goal of establishing a baseline case that points to the potential feasibility of optical circuit reconstruction, leaving open the possibility of higher-performance labeling technologies and algorithms. We find that, even with these conservative assumptions, an all-optical approach to dense neural morphology reconstruction may be possible via the proposed algorithmic framework. Future work should explore both the design-space of chemical labels and barcodes, as well as algorithms, to ultimately enable routine, high-performance optical circuit reconstruction. PMID:29114215

Cytochrome c oxidase subunit 1 barcode data of fish of the Nayband National Park in the Persian Gulf and analysis using meta-data flag several cryptic species.

PubMed

Asgharian, Hosseinali; Sahafi, Homayoun Hosseinzadeh; Ardalan, Aria Ashja; Shekarriz, Shahrokh; Elahi, Elahe

2011-05-01

We provide cytochrome c oxidase subunit 1 (COI) barcode sequences of fishes of the Nayband National Park, Persian Gulf, Iran. Industrial activities, ecological considerations and goals of The Fish Barcode of Life campaign make it crucial that fish species residing in the park be identified. To the best of our knowledge, this is the first report of barcoding data on fishes of the Persian Gulf. We examined 187 individuals representing 76 species, 56 genera and 32 families. The data flagged potentially cryptic species of Gerres filamentosus and Plectorhinchus schotaf. 16S rDNA data on these species are provided. Exclusion of these two potential cryptic species resulted in a mean COI intraspecific distance of 0.18%, and a mean inter- to intraspecific divergence ratio of 66.7. There was no overlap between maximum Kimura 2-parameter distances among conspecifics (1.66%) and minimum distance among congeneric species (6.19%). Barcodes shared among species were not observed. Neighbour-joining analysis showed that most species formed cohesive sequence units with little variation. Finally, the comparison of 16 selected species from this study with meta-data of conspecifics from Australia, India, China and South Africa revealed high interregion divergences and potential existence of six cryptic species. Pairwise interregional comparisons were more informative than global divergence assessments with regard to detection of cryptic variation. Our analysis exemplifies optimal use of the expanding barcode data now becoming available. © 2011 Blackwell Publishing Ltd.

Clone tag detection in distributed RFID systems.

PubMed

Kamaludin, Hazalila; Mahdin, Hairulnizam; Abawajy, Jemal H

2018-01-01

Although Radio Frequency Identification (RFID) is poised to displace barcodes, security vulnerabilities pose serious challenges for global adoption of the RFID technology. Specifically, RFID tags are prone to basic cloning and counterfeiting security attacks. A successful cloning of the RFID tags in many commercial applications can lead to many serious problems such as financial losses, brand damage, safety and health of the public. With many industries such as pharmaceutical and businesses deploying RFID technology with a variety of products, it is important to tackle RFID tag cloning problem and improve the resistance of the RFID systems. To this end, we propose an approach for detecting cloned RFID tags in RFID systems with high detection accuracy and minimal overhead thus overcoming practical challenges in existing approaches. The proposed approach is based on consistency of dual hash collisions and modified count-min sketch vector. We evaluated the proposed approach through extensive experiments and compared it with existing baseline approaches in terms of execution time and detection accuracy under varying RFID tag cloning ratio. The results of the experiments show that the proposed approach outperforms the baseline approaches in cloned RFID tag detection accuracy.

TaxI: a software tool for DNA barcoding using distance methods

PubMed Central

Steinke, Dirk; Vences, Miguel; Salzburger, Walter; Meyer, Axel

2005-01-01

DNA barcoding is a promising approach to the diagnosis of biological diversity in which DNA sequences serve as the primary key for information retrieval. Most existing software for evolutionary analysis of DNA sequences was designed for phylogenetic analyses and, hence, those algorithms do not offer appropriate solutions for the rapid, but precise analyses needed for DNA barcoding, and are also unable to process the often large comparative datasets. We developed a flexible software tool for DNA taxonomy, named TaxI. This program calculates sequence divergences between a query sequence (taxon to be barcoded) and each sequence of a dataset of reference sequences defined by the user. Because the analysis is based on separate pairwise alignments this software is also able to work with sequences characterized by multiple insertions and deletions that are difficult to align in large sequence sets (i.e. thousands of sequences) by multiple alignment algorithms because of computational restrictions. Here, we demonstrate the utility of this approach with two datasets of fish larvae and juveniles from Lake Constance and juvenile land snails under different models of sequence evolution. Sets of ribosomal 16S rRNA sequences, characterized by multiple indels, performed as good as or better than cox1 sequence sets in assigning sequences to species, demonstrating the suitability of rRNA genes for DNA barcoding. PMID:16214755

Barcode identification for transfusion safety.

PubMed

Murphy, M F; Kay, J D S

2004-09-01

Errors related to blood transfusion in hospitals may produce catastrophic consequences. This review addresses potential solutions to prevent patient misidentification including the use of new technology, such as barcoding. A small number of studies using new technology for the transfusion process in hospitals have shown promising results in preventing errors. The studies demonstrated improved transfusion safety and staff preference for new technology such as bedside handheld scanners to carry out pretransfusion bedside checking. They also highlighted the need for considerable efforts in the training of staff in the new procedures before their successful implementation. Improvements in hospital transfusion safety are a top priority for transfusion medicine, and will depend on a combined approach including a better understanding of the causes of errors, a reduction in the complexity of routine procedures taking advantage of new technology, improved staff training, and regular monitoring of practice. The use of new technology to improve the safety of transfusion is very promising. Further development of the systems is needed to enable staff to carry out bedside transfusion procedures quickly and accurately, and to increase their functionality to justify the cost of their wider implementation.

A Transcontinental Challenge — A Test of DNA Barcode Performance for 1,541 Species of Canadian Noctuoidea (Lepidoptera)

PubMed Central

Zahiri, Reza; Lafontaine, J. Donald; Schmidt, B. Christian; deWaard, Jeremy R.; Zakharov, Evgeny V.; Hebert, Paul D. N.

2014-01-01

This study provides a first, comprehensive, diagnostic use of DNA barcodes for the Canadian fauna of noctuoids or “owlet” moths (Lepidoptera: Noctuoidea) based on vouchered records for 1,541 species (99.1% species coverage), and more than 30,000 sequences. When viewed from a Canada-wide perspective, DNA barcodes unambiguously discriminate 90% of the noctuoid species recognized through prior taxonomic study, and resolution reaches 95.6% when considered at a provincial scale. Barcode sharing is concentrated in certain lineages with 54% of the cases involving 1.8% of the genera. Deep intraspecific divergence exists in 7.7% of the species, but further studies are required to clarify whether these cases reflect an overlooked species complex or phylogeographic variation in a single species. Non-native species possess higher Nearest-Neighbour (NN) distances than native taxa, whereas generalist feeders have lower NN distances than those with more specialized feeding habits. We found high concordance between taxonomic names and sequence clusters delineated by the Barcode Index Number (BIN) system with 1,082 species (70%) assigned to a unique BIN. The cases of discordance involve both BIN mergers and BIN splits with 38 species falling into both categories, most likely reflecting bidirectional introgression. One fifth of the species are involved in a BIN merger reflecting the presence of 158 species sharing their barcode sequence with at least one other taxon, and 189 species with low, but diagnostic COI divergence. A very few cases (13) involved species whose members fell into both categories. Most of the remaining 140 species show a split into two or three BINs per species, while Virbia ferruginosa was divided into 16. The overall results confirm that DNA barcodes are effective for the identification of Canadian noctuoids. This study also affirms that BINs are a strong proxy for species, providing a pathway for a rapid, accurate estimation of animal diversity. PMID:24667847

How Many Loci Does it Take to DNA Barcode a Crocus?

PubMed Central

Seberg, Ole; Petersen, Gitte

2009-01-01

Background DNA barcoding promises to revolutionize the way taxonomists work, facilitating species identification by using small, standardized portions of the genome as substitutes for morphology. The concept has gained considerable momentum in many animal groups, but the higher plant world has been largely recalcitrant to the effort. In plants, efforts are concentrated on various regions of the plastid genome, but no agreement exists as to what kinds of regions are ideal, though most researchers agree that more than one region is necessary. One reason for this discrepancy is differences in the tests that are used to evaluate the performance of the proposed regions. Most tests have been made in a floristic setting, where the genetic distance and therefore the level of variation of the regions between taxa is large, or in a limited set of congeneric species. Methodology and Principal Findings Here we present the first in-depth coverage of a large taxonomic group, all 86 known species (except two doubtful ones) of crocus. Even six average-sized barcode regions do not identify all crocus species. This is currently an unrealistic burden in a barcode context. Whereas most proposed regions work well in a floristic context, the majority will – as is the case in crocus – undoubtedly be less efficient in a taxonomic setting. However, a reasonable but less than perfect level of identification may be reached – even in a taxonomic context. Conclusions/Significance The time is ripe for selecting barcode regions in plants, and for prudent examination of their utility. Thus, there is no reason for the plant community to hold back the barcoding effort by continued search for the Holy Grail. We must acknowledge that an emerging system will be far from perfect, fraught with problems and work best in a floristic setting. PMID:19240801

How many loci does it take to DNA barcode a crocus?

PubMed

Seberg, Ole; Petersen, Gitte

2009-01-01

DNA barcoding promises to revolutionize the way taxonomists work, facilitating species identification by using small, standardized portions of the genome as substitutes for morphology. The concept has gained considerable momentum in many animal groups, but the higher plant world has been largely recalcitrant to the effort. In plants, efforts are concentrated on various regions of the plastid genome, but no agreement exists as to what kinds of regions are ideal, though most researchers agree that more than one region is necessary. One reason for this discrepancy is differences in the tests that are used to evaluate the performance of the proposed regions. Most tests have been made in a floristic setting, where the genetic distance and therefore the level of variation of the regions between taxa is large, or in a limited set of congeneric species. Here we present the first in-depth coverage of a large taxonomic group, all 86 known species (except two doubtful ones) of crocus. Even six average-sized barcode regions do not identify all crocus species. This is currently an unrealistic burden in a barcode context. Whereas most proposed regions work well in a floristic context, the majority will--as is the case in crocus--undoubtedly be less efficient in a taxonomic setting. However, a reasonable but less than perfect level of identification may be reached--even in a taxonomic context. The time is ripe for selecting barcode regions in plants, and for prudent examination of their utility. Thus, there is no reason for the plant community to hold back the barcoding effort by continued search for the Holy Grail. We must acknowledge that an emerging system will be far from perfect, fraught with problems and work best in a floristic setting.

A comprehensive DNA barcode database for Central European beetles with a focus on Germany: adding more than 3500 identified species to BOLD.

PubMed

Hendrich, Lars; Morinière, Jérôme; Haszprunar, Gerhard; Hebert, Paul D N; Hausmann, Axel; Köhler, Frank; Balke, Michael

2015-07-01

Beetles are the most diverse group of animals and are crucial for ecosystem functioning. In many countries, they are well established for environmental impact assessment, but even in the well-studied Central European fauna, species identification can be very difficult. A comprehensive and taxonomically well-curated DNA barcode library could remedy this deficit and could also link hundreds of years of traditional knowledge with next generation sequencing technology. However, such a beetle library is missing to date. This study provides the globally largest DNA barcode reference library for Coleoptera for 15 948 individuals belonging to 3514 well-identified species (53% of the German fauna) with representatives from 97 of 103 families (94%). This study is the first comprehensive regional test of the efficiency of DNA barcoding for beetles with a focus on Germany. Sequences ≥500 bp were recovered from 63% of the specimens analysed (15 948 of 25 294) with short sequences from another 997 specimens. Whereas most specimens (92.2%) could be unambiguously assigned to a single known species by sequence diversity at CO1, 1089 specimens (6.8%) were assigned to more than one Barcode Index Number (BIN), creating 395 BINs which need further study to ascertain if they represent cryptic species, mitochondrial introgression, or simply regional variation in widespread species. We found 409 specimens (2.6%) that shared a BIN assignment with another species, most involving a pair of closely allied species as 43 BINs were involved. Most of these taxa were separated by barcodes although sequence divergences were low. Only 155 specimens (0.97%) show identical or overlapping clusters. © 2014 John Wiley & Sons Ltd.

Assessment, validation and deployment strategy of a two-barcode protocol for facile genotyping of duckweed species.

PubMed

Borisjuk, N; Chu, P; Gutierrez, R; Zhang, H; Acosta, K; Friesen, N; Sree, K S; Garcia, C; Appenroth, K J; Lam, E

2015-01-01

Lemnaceae, commonly called duckweeds, comprise a diverse group of floating aquatic plants that have previously been classified into 37 species based on morphological and physiological criteria. In addition to their unique evolutionary position among angiosperms and their applications in biomonitoring, the potential of duckweeds as a novel sustainable crop for fuel and feed has recently increased interest in the study of their biodiversity and systematics. However, due to their small size and abbreviated structure, accurate typing of duckweeds based on morphology can be challenging. In the past decade, attempts to employ molecular barcoding techniques for species assignment have produced promising results; however, they have yet to be codified into a simple and quantitative protocol. A study that compiles and compares the barcode sequences within all known species of this family would help to establish the fidelity and limits of this DNA-based approach. In this work, we compared the level of conservation between over 100 strains of duckweed for two intergenic barcode sequences derived from the plastid genome. By using over 300 sequences publicly available in the NCBI database, we determined the utility of each of these two barcodes for duckweed species identification. Through sequencing of these barcodes from additional accessions, 30 of the 37 known species of duckweed could be identified with varying levels of confidence using this approach. From our analyses using this reference dataset, we also confirmed two instances where mis-assignment of species has likely occurred. Potential strategies for further improving the scope of this technology are discussed. © 2014 German Botanical Society and The Royal Botanical Society of the Netherlands.

The changing epitome of species identification – DNA barcoding

PubMed Central

Ajmal Ali, M.; Gyulai, Gábor; Hidvégi, Norbert; Kerti, Balázs; Al Hemaid, Fahad M.A.; Pandey, Arun K.; Lee, Joongku

2014-01-01

The discipline taxonomy (the science of naming and classifying organisms, the original bioinformatics and a basis for all biology) is fundamentally important in ensuring the quality of life of future human generation on the earth; yet over the past few decades, the teaching and research funding in taxonomy have declined because of its classical way of practice which lead the discipline many a times to a subject of opinion, and this ultimately gave birth to several problems and challenges, and therefore the taxonomist became an endangered race in the era of genomics. Now taxonomy suddenly became fashionable again due to revolutionary approaches in taxonomy called DNA barcoding (a novel technology to provide rapid, accurate, and automated species identifications using short orthologous DNA sequences). In DNA barcoding, complete data set can be obtained from a single specimen irrespective to morphological or life stage characters. The core idea of DNA barcoding is based on the fact that the highly conserved stretches of DNA, either coding or non coding regions, vary at very minor degree during the evolution within the species. Sequences suggested to be useful in DNA barcoding include cytoplasmic mitochondrial DNA (e.g. cox1) and chloroplast DNA (e.g. rbcL, trnL-F, matK, ndhF, and atpB rbcL), and nuclear DNA (ITS, and house keeping genes e.g. gapdh). The plant DNA barcoding is now transitioning the epitome of species identification; and thus, ultimately helping in the molecularization of taxonomy, a need of the hour. The ‘DNA barcodes’ show promise in providing a practical, standardized, species-level identification tool that can be used for biodiversity assessment, life history and ecological studies, forensic analysis, and many more. PMID:24955007

Geographically widespread swordfish barcode stock identification: a case study of its application.

PubMed

Pappalardo, Anna Maria; Guarino, Francesca; Reina, Simona; Messina, Angela; De Pinto, Vito

2011-01-01

The swordfish (Xiphias gladius) is a cosmopolitan large pelagic fish inhabiting tempered and tropical waters and it is a target species for fisheries all around the world. The present study investigated the ability of COI barcoding to reliably identify swordfish and particularly specific stocks of this commercially important species. We applied the classical DNA barcoding technology, upon a 682 bp segment of COI, and compared swordfish sequences from different geographical sources (Atlantic, Indian Oceans and Mediterranean Sea). The sequences of the 5' hyper-variable fragment of the control region (5'dloop), were also used to validate the efficacy of COI as a stock-specific marker. This information was successfully applied to the discrimination of unknown samples from the market, detecting in some cases mislabeled seafood products. The NJ distance-based phenogram (K2P model) obtained with COI sequences allowed us to correlate the swordfish haplotypes to the different geographical stocks. Similar results were obtained with 5'dloop. Our preliminary data in swordfish Xiphias gladius confirm that Cytochrome Oxidase I can be proposed as an efficient species-specific marker that has also the potential to assign geographical provenance. This information might speed the samples analysis in commercial application of barcoding.

A CD45-based barcoding approach to multiplex mass-cytometry (CyTOF).

PubMed

Lai, Liyun; Ong, Raymond; Li, Juntao; Albani, Salvatore

2015-04-01

CyTOF enables the study of the immune system with a complexity, depth, and multidimensionality never achieved before. However, the full potential of using CyTOF can be limited by scarce cell samples. Barcoding strategies developed based on direct labeling of cells using maleimido-monoamide-DOTA (m-DOTA) provide a very useful tool. However, using m-DOTA has some inherent problems, mainly associated with signal intensity. This may be a source of uncertainty when samples are multiplexed. As an alternative or complementary approach to m-DOTA, conjugating an antibody, specific for a membrane protein present on most immune cells, with different isotopes could address the issues of stability and signal intensity needed for effective barcoding. We chose for this purpose CD45, and designed experiments to address different types of cultures and the ability to detect extra- and intra-cellular targets. We show here that our approach provides an useful alternative to m-DOTA in terms of sensitivity, specificity, flexibility, and user-friendliness. Our manuscript provides details to effectively barcode immune cells, overcoming limitations in current technology and enabling the use of CyTOF with scarce samples (for instance precious clinical samples). © 2015 The Authors. Published by Wiley Periodicals, Inc.

Recycling Expensive Medication: Why Not?

PubMed Central

Pomerantz, Jay M

2004-01-01

New (and proposed) advances in packaging, preserving, labeling, and verifying product integrity of individual tablets and capsules may allow for the recycling of certain expensive medicines. Previously sold, but unused, medication, if brought back to special pharmacies for resale or donation, may provide a low-cost source of patent-protected medicines. Benefits of such a program go beyond simply providing affordable medication to the poor. This article suggests that medicine recycling may be a possibility (especially if manufacturers are mandated to blister-package and bar-code individual tablets and capsules). This early discussion of medication recycling identifies relevant issues, such as: need, rationale, existing programs, available supplies, expiration dates, new technology for ensuring safety and potency, environmental impact, public health benefits, program focus, program structure, and liability. PMID:15266231

A network collaboration implementing technology to improve medication dispensing and administration in critical access hospitals.

PubMed

Wakefield, Douglas S; Ward, Marcia M; Loes, Jean L; O'Brien, John

2010-01-01

We report how seven independent critical access hospitals collaborated with a rural referral hospital to standardize workflow policies and procedures while jointly implementing the same health information technologies (HITs) to enhance medication care processes. The study hospitals implemented the same electronic health record, computerized provider order entry, pharmacy information systems, automated dispensing cabinets (ADC), and barcode medication administration systems. We conducted interviews and examined project documents to explore factors underlying the successful implementation of ADC and barcode medication administration across the network hospitals. These included a shared culture of collaboration; strategic sequencing of HIT component implementation; interface among HIT components; strategic placement of ADCs; disciplined use and sharing of workflow analyses linked with HIT applications; planning for workflow efficiencies; acquisition of adequate supply of HIT-related devices; and establishing metrics to monitor HIT use and outcomes.

Flow-pattern Guided Fabrication of High-density Barcode Antibody Microarray

PubMed Central

Ramirez, Lisa S.; Wang, Jun

2016-01-01

Antibody microarray as a well-developed technology is currently challenged by a few other established or emerging high-throughput technologies. In this report, we renovate the antibody microarray technology by using a novel approach for manufacturing and by introducing new features. The fabrication of our high-density antibody microarray is accomplished through perpendicularly oriented flow-patterning of single stranded DNAs and subsequent conversion mediated by DNA-antibody conjugates. This protocol outlines the critical steps in flow-patterning DNA, producing and purifying DNA-antibody conjugates, and assessing the quality of the fabricated microarray. The uniformity and sensitivity are comparable with conventional microarrays, while our microarray fabrication does not require the assistance of an array printer and can be performed in most research laboratories. The other major advantage is that the size of our microarray units is 10 times smaller than that of printed arrays, offering the unique capability of analyzing functional proteins from single cells when interfacing with generic microchip designs. This barcode technology can be widely employed in biomarker detection, cell signaling studies, tissue engineering, and a variety of clinical applications. PMID:26780370

Clone tag detection in distributed RFID systems

PubMed Central

Kamaludin, Hazalila; Mahdin, Hairulnizam

2018-01-01

Although Radio Frequency Identification (RFID) is poised to displace barcodes, security vulnerabilities pose serious challenges for global adoption of the RFID technology. Specifically, RFID tags are prone to basic cloning and counterfeiting security attacks. A successful cloning of the RFID tags in many commercial applications can lead to many serious problems such as financial losses, brand damage, safety and health of the public. With many industries such as pharmaceutical and businesses deploying RFID technology with a variety of products, it is important to tackle RFID tag cloning problem and improve the resistance of the RFID systems. To this end, we propose an approach for detecting cloned RFID tags in RFID systems with high detection accuracy and minimal overhead thus overcoming practical challenges in existing approaches. The proposed approach is based on consistency of dual hash collisions and modified count-min sketch vector. We evaluated the proposed approach through extensive experiments and compared it with existing baseline approaches in terms of execution time and detection accuracy under varying RFID tag cloning ratio. The results of the experiments show that the proposed approach outperforms the baseline approaches in cloned RFID tag detection accuracy. PMID:29565982

DNA barcoding in diverse educational settings: five case studies

PubMed Central

Imondi, Ralph; James, Karen; Spencer, Diana; Steinke, Dirk

2016-01-01

Despite 250 years of modern taxonomy, there remains a large biodiversity knowledge gap. Most species remain unknown to science. DNA barcoding can help address this gap and has been used in a variety of educational contexts to incorporate original research into school curricula and informal education programmes. A growing body of evidence suggests that actively conducting research increases student engagement and retention in science. We describe case studies in five different educational settings in Canada and the USA: a programme for primary and secondary school students (ages 5–18), a year-long professional development programme for secondary school teachers, projects embedding this research into courses in a post-secondary 2-year institution and a degree-granting university, and a citizen science project. We argue that these projects are successful because the scientific content is authentic and compelling, DNA barcoding is conceptually and technically straightforward, the workflow is adaptable to a variety of situations, and online tools exist that allow participants to contribute high-quality data to the international research effort. Evidence of success includes the broad adoption of these programmes and assessment results demonstrating that participants are gaining both knowledge and confidence. There are exciting opportunities for coordination among educational projects in the future. This article is part of the themed issue ‘From DNA barcodes to biomes’. PMID:27481792

DNA Barcoding for the Identification and Authentication of Animal Species in Traditional Medicine.

PubMed

Yang, Fan; Ding, Fei; Chen, Hong; He, Mingqi; Zhu, Shixin; Ma, Xin; Jiang, Li; Li, Haifeng

2018-01-01

Animal-based traditional medicine not only plays a significant role in therapeutic practices worldwide but also provides a potential compound library for drug discovery. However, persistent hunting and illegal trade markedly threaten numerous medicinal animal species, and increasing demand further provokes the emergence of various adulterants. As the conventional methods are difficult and time-consuming to detect processed products or identify animal species with similar morphology, developing novel authentication methods for animal-based traditional medicine represents an urgent need. During the last decade, DNA barcoding offers an accurate and efficient strategy that can identify existing species and discover unknown species via analysis of sequence variation in a standardized region of DNA. Recent studies have shown that DNA barcoding as well as minibarcoding and metabarcoding is capable of identifying animal species and discriminating the authentics from the adulterants in various types of traditional medicines, including raw materials, processed products, and complex preparations. These techniques can also be used to detect the unlabelled and threatened animal species in traditional medicine. Here, we review the recent progress of DNA barcoding for the identification and authentication of animal species used in traditional medicine, which provides a reference for quality control and trade supervision of animal-based traditional medicine.

Highlighting Astyanax Species Diversity through DNA Barcoding

PubMed Central

Oliveira, Carlos Alexandre Miranda; de Melo, Filipe Augusto Gonçalves; Bertaco, Vinicius de Araújo; de Astarloa, Juan M. Díaz; Rosso, Juan J.; Foresti, Fausto; Oliveira, Claudio

2016-01-01

DNA barcoding has been used extensively to solve taxonomic questions and identify new species. Neotropical fishes are found in a wide variety of shapes and sizes, with a large number of species yet to be described, many of which are very difficult to identify. Characidae is the most species-rich family of the Characiformes, and many of its genera are affected by taxonomic uncertainties, including the widely-distributed, species-rich genus Astyanax. In this study, we present an extensive analysis of Astyanax covering almost its entire area of occurrence, based on DNA barcoding. The use of different approaches (ABGD, GMYC and BIN) to the clustering of the sequences revealed ample consistency in the results obtained by the initial cutoff value of 2% divergence for putative species in the Neighbor-Joining analysis using the Kimura-2-parameter model. The results indicate the existence of five Astyanax lineages. Some groups, such as that composed by the trans-Andean forms, are mostly composed of well-defined species, and in others a number of nominal species are clustered together, hampering the delimitation of species, which in many cases proved impossible. The results confirm the extreme complexity of the systematics of the genus Astyanax and show that DNA barcoding can be an useful tool to address these complexes questions. PMID:27992537

DNA barcoding in diverse educational settings: five case studies.

PubMed

Henter, Heather J; Imondi, Ralph; James, Karen; Spencer, Diana; Steinke, Dirk

2016-09-05

Despite 250 years of modern taxonomy, there remains a large biodiversity knowledge gap. Most species remain unknown to science. DNA barcoding can help address this gap and has been used in a variety of educational contexts to incorporate original research into school curricula and informal education programmes. A growing body of evidence suggests that actively conducting research increases student engagement and retention in science. We describe case studies in five different educational settings in Canada and the USA: a programme for primary and secondary school students (ages 5-18), a year-long professional development programme for secondary school teachers, projects embedding this research into courses in a post-secondary 2-year institution and a degree-granting university, and a citizen science project. We argue that these projects are successful because the scientific content is authentic and compelling, DNA barcoding is conceptually and technically straightforward, the workflow is adaptable to a variety of situations, and online tools exist that allow participants to contribute high-quality data to the international research effort. Evidence of success includes the broad adoption of these programmes and assessment results demonstrating that participants are gaining both knowledge and confidence. There are exciting opportunities for coordination among educational projects in the future.This article is part of the themed issue 'From DNA barcodes to biomes'. © 2016 The Authors.

DNA Barcoding for the Identification and Authentication of Animal Species in Traditional Medicine

PubMed Central

Yang, Fan; Ding, Fei; Chen, Hong; He, Mingqi; Zhu, Shixin; Ma, Xin; Jiang, Li

2018-01-01

Animal-based traditional medicine not only plays a significant role in therapeutic practices worldwide but also provides a potential compound library for drug discovery. However, persistent hunting and illegal trade markedly threaten numerous medicinal animal species, and increasing demand further provokes the emergence of various adulterants. As the conventional methods are difficult and time-consuming to detect processed products or identify animal species with similar morphology, developing novel authentication methods for animal-based traditional medicine represents an urgent need. During the last decade, DNA barcoding offers an accurate and efficient strategy that can identify existing species and discover unknown species via analysis of sequence variation in a standardized region of DNA. Recent studies have shown that DNA barcoding as well as minibarcoding and metabarcoding is capable of identifying animal species and discriminating the authentics from the adulterants in various types of traditional medicines, including raw materials, processed products, and complex preparations. These techniques can also be used to detect the unlabelled and threatened animal species in traditional medicine. Here, we review the recent progress of DNA barcoding for the identification and authentication of animal species used in traditional medicine, which provides a reference for quality control and trade supervision of animal-based traditional medicine. PMID:29849709

Barcoding a quantified food web: crypsis, concepts, ecology and hypotheses.

PubMed

Smith, M Alex; Eveleigh, Eldon S; McCann, Kevin S; Merilo, Mark T; McCarthy, Peter C; Van Rooyen, Kathleen I

2011-01-01

The efficient and effective monitoring of individuals and populations is critically dependent on correct species identification. While this point may seem obvious, identifying the majority of the more than 100 natural enemies involved in the spruce budworm (Choristoneura fumiferana--SBW) food web remains a non-trivial endeavor. Insect parasitoids play a major role in the processes governing the population dynamics of SBW throughout eastern North America. However, these species are at the leading edge of the taxonomic impediment and integrating standardized identification capacity into existing field programs would provide clear benefits. We asked to what extent DNA barcoding the SBW food web would alter our understanding of the diversity and connectence of the food web and the frequency of generalists vs. specialists in different forest habitats. We DNA barcoded over 10% of the insects collected from the SBW food web in three New Brunswick forest plots from 1983 to 1993. For 30% of these specimens, we amplified at least one additional nuclear region. When the nodes of the food web were estimated based on barcode divergences (using molecular operational taxonomic units (MOTU) or phylogenetic diversity (PD)--the food web became much more diverse and connectence was reduced. We tested one measure of food web structure (the "bird feeder effect") and found no difference compared to the morphologically based predictions. Many, but not all, of the presumably polyphagous parasitoids now appear to be morphologically-cryptic host-specialists. To our knowledge, this project is the first to barcode a food web in which interactions have already been well-documented and described in space, time and abundance. It is poised to be a system in which field-based methods permit the identification capacity required by forestry scientists. Food web barcoding provided an effective tool for the accurate identification of all species involved in the cascading effects of future budworm outbreaks. Integrating standardized barcodes within food webs may ultimately change the face of community ecology. This will be most poignantly felt in food webs that have not yet been quantified. Here, more accurate and precise connections will be within the grasp of any researcher for the first time.

Barcoding a Quantified Food Web: Crypsis, Concepts, Ecology and Hypotheses

PubMed Central

Smith, M. Alex; Eveleigh, Eldon S.; McCann, Kevin S.; Merilo, Mark T.; McCarthy, Peter C.; Van Rooyen, Kathleen I.

2011-01-01

The efficient and effective monitoring of individuals and populations is critically dependent on correct species identification. While this point may seem obvious, identifying the majority of the more than 100 natural enemies involved in the spruce budworm (Choristoneura fumiferana – SBW) food web remains a non-trivial endeavor. Insect parasitoids play a major role in the processes governing the population dynamics of SBW throughout eastern North America. However, these species are at the leading edge of the taxonomic impediment and integrating standardized identification capacity into existing field programs would provide clear benefits. We asked to what extent DNA barcoding the SBW food web would alter our understanding of the diversity and connectence of the food web and the frequency of generalists vs. specialists in different forest habitats. We DNA barcoded over 10% of the insects collected from the SBW food web in three New Brunswick forest plots from 1983 to 1993. For 30% of these specimens, we amplified at least one additional nuclear region. When the nodes of the food web were estimated based on barcode divergences (using molecular operational taxonomic units (MOTU) or phylogenetic diversity (PD) – the food web became much more diverse and connectence was reduced. We tested one measure of food web structure (the “bird feeder effect”) and found no difference compared to the morphologically based predictions. Many, but not all, of the presumably polyphagous parasitoids now appear to be morphologically-cryptic host-specialists. To our knowledge, this project is the first to barcode a food web in which interactions have already been well-documented and described in space, time and abundance. It is poised to be a system in which field-based methods permit the identification capacity required by forestry scientists. Food web barcoding provided an effective tool for the accurate identification of all species involved in the cascading effects of future budworm outbreaks. Integrating standardized barcodes within food webs may ultimately change the face of community ecology. This will be most poignantly felt in food webs that have not yet been quantified. Here, more accurate and precise connections will be within the grasp of any researcher for the first time. PMID:21754977

Two barcodes encoded by the type-1 PDZ and by phospho-Ser312 regulate retromer/WASH-mediated sorting of the ß1-adrenergic receptor from endosomes to the plasma membrane.

PubMed

Nooh, Mohammed M; Bahouth, Suleiman W

2017-01-01

Recycling of the majority of agonist-internalized GPCR is dependent on a type I-PDZ "barcode" in their C-tail. The recycling of wild-type (WT) ß 1 -AR is also dependent on its default "type-1 PDZ barcode", but trafficking of the ß 1 -AR is inhibited when PKA or its substrate serine at position 312 (Ser 312 ) are inactivated. We tested the hypothesis that phospho-Ser 312 provided a second barcode for ß 1 -AR sorting from endosomes to the plasma membrane by determining the role of retromer/WASH complexes in ß 1 -AR trafficking. Recycling of WT ß 1 -AR or WT ß 2 -AR was dependent on targeting the retromer to endosomal membranes via SNX3 and rab7a, and on complexing the retromer to the WASH pentamer via the C-tail of FAM21 (FAM21 C ). These maneuvers however, did not inhibit the recycling of a phospho-Ser 312 ß 1 -AR mimic ((S312D) ß 1 -AR). Knockdown of the trans-acting PDZ protein sorting nexin27 (SNX27) inhibited the recycling of WT ß 1 -AR and WT ß 2 -AR, but had no effect on (S312D) ß 1 -AR∆PDZ or on phosphorylation of WT ß 1 -AR by PKA at Ser 312 . However, depletion of FKBP15, a FAM21 C -binding endosomal protein, selectively inhibited WT ß 1 -AR but not ß 2 -AR recycling, suggesting divergence might exist in GPCR trafficking roadmaps. These results indicate that two barcodes are involved in sorting WT ß 1 -AR out of early endosomes. The first and antecedent "barcode" was the "type-1 PDZ", followed by a second reversible "phospho-Ser 312 " verification "barcode". This organization allows tight regulation of ß 1 -AR density to signaling intensity in conditions associated with aberrant ß 1 -AR signaling such as in hypertension and heart failure. Copyright © 2016 Elsevier Inc. All rights reserved.

DNA barcoding for species identification in deep-sea clams (Mollusca: Bivalvia: Vesicomyidae).

PubMed

Liu, Jun; Zhang, Haibin

2018-01-15

Deep-sea clams (Bivalvia: Vesicomyidae) have been found in reduced environments over the world oceans, but taxonomy of this group remains confusing at species and supraspecific levels due to their high-morphological similarity and plasticity. In the present study, we collected mitochondrial COI sequences to evaluate the utility of DNA barcoding on identifying vesicomyid species. COI dataset identified 56 well-supported putative species/operational taxonomic units (OTUs), approximately covering half of the extant vesicomyid species. One species (OTU2) was first detected, and may represent a new species. Average distances between species ranged from 1.65 to 29.64%, generally higher than average intraspecific distances (0-1.41%) when excluding Pliocardia sp.10 cf. venusta (average intraspecific distance 1.91%). Local barcoding gap existed in 33 of the 35 species when comparing distances of maximum interspecific and minimum interspecific distances with two exceptions (Abyssogena southwardae and Calyptogena rectimargo-starobogatovi). The barcode index number (BIN) system determined 41 of the 56 species/OTUs, each with a unique BIN, indicating their validity. Three species were found to have two BINs, together with their high level of intraspecific variation, implying cryptic diversity within them. Although fewer 16 S sequences were collected, similar results were obtained. Nineteen putative species were determined and no overlap observed between intra- and inter-specific variation. Implications of DNA barcoding for the Vesicomyidae taxonomy were then discussed. Findings of this study will provide important evidence for taxonomic revision in this problematic clam group, and accelerate the discovery of new vesicomyid species in the future.

Evaluation of DNA barcode candidates for the discrimination of Artemisia L.

PubMed

Liu, Geyu; Ning, Huixia; Ayidaerhan, Nurbolati; Aisa, Haji Akber

2017-11-01

Because of the very similar morphologies and wide diversity of Artemisia L. varieties, they are difficult to identify, and there have been many arguments about the systematic classification Artemisia L., especially concerning the division of species. DNA barcode technology is used to rapidly identify species based on standard short DNA sequences. To evaluate seven candidate DNA barcodes (ITS, ITS2, psbA-trnH, rbcL, matK, rpoB, and rpoC1) regarding their ability to identify closely related species of the Artemisia genus in Xinjiang. The corresponding PCR amplification efficiency, detectable genetic divergence, identification efficiency and phylogenetic tree were assessed. We found that the internal transcribed spacer (ITS) region exhibited the highest interspecific divergence, which was significantly higher than the observed intraspecific variation and showed the highest identification efficiency, followed by ITS2, psbA-trnH and, finally, rpoB. matK, rbcL, and rpoC1 performed poorly in this evaluation. ITS, ITS2, and psbA-trnH were able to perfectly identify the tested species Artemisia annua, A. absinthium, A. rupestris, A. tonurnefortiana, A. austriaca, A. dracunculus, A. vulgaris, and A. macrocephala. Therefore, we propose the ITS, ITS2, and psbA-trnH regions as promising DNA barcodes for the closely related species of Artemisia L. in Xinjiang.

Advances in DNA metabarcoding for food and wildlife forensic species identification.

PubMed

Staats, Martijn; Arulandhu, Alfred J; Gravendeel, Barbara; Holst-Jensen, Arne; Scholtens, Ingrid; Peelen, Tamara; Prins, Theo W; Kok, Esther

2016-07-01

Species identification using DNA barcodes has been widely adopted by forensic scientists as an effective molecular tool for tracking adulterations in food and for analysing samples from alleged wildlife crime incidents. DNA barcoding is an approach that involves sequencing of short DNA sequences from standardized regions and comparison to a reference database as a molecular diagnostic tool in species identification. In recent years, remarkable progress has been made towards developing DNA metabarcoding strategies, which involves next-generation sequencing of DNA barcodes for the simultaneous detection of multiple species in complex samples. Metabarcoding strategies can be used in processed materials containing highly degraded DNA e.g. for the identification of endangered and hazardous species in traditional medicine. This review aims to provide insight into advances of plant and animal DNA barcoding and highlights current practices and recent developments for DNA metabarcoding of food and wildlife forensic samples from a practical point of view. Special emphasis is placed on new developments for identifying species listed in the Convention on International Trade of Endangered Species (CITES) appendices for which reliable methods for species identification may signal and/or prevent illegal trade. Current technological developments and challenges of DNA metabarcoding for forensic scientists will be assessed in the light of stakeholders' needs.

A novel process of viral vector barcoding and library preparation enables high-diversity library generation and recombination-free paired-end sequencing

PubMed Central

Davidsson, Marcus; Diaz-Fernandez, Paula; Schwich, Oliver D.; Torroba, Marcos; Wang, Gang; Björklund, Tomas

2016-01-01

Detailed characterization and mapping of oligonucleotide function in vivo is generally a very time consuming effort that only allows for hypothesis driven subsampling of the full sequence to be analysed. Recent advances in deep sequencing together with highly efficient parallel oligonucleotide synthesis and cloning techniques have, however, opened up for entirely new ways to map genetic function in vivo. Here we present a novel, optimized protocol for the generation of universally applicable, barcode labelled, plasmid libraries. The libraries are designed to enable the production of viral vector preparations assessing coding or non-coding RNA function in vivo. When generating high diversity libraries, it is a challenge to achieve efficient cloning, unambiguous barcoding and detailed characterization using low-cost sequencing technologies. With the presented protocol, diversity of above 3 million uniquely barcoded adeno-associated viral (AAV) plasmids can be achieved in a single reaction through a process achievable in any molecular biology laboratory. This approach opens up for a multitude of in vivo assessments from the evaluation of enhancer and promoter regions to the optimization of genome editing. The generated plasmid libraries are also useful for validation of sequencing clustering algorithms and we here validate the newly presented message passing clustering process named Starcode. PMID:27874090

On site DNA barcoding by nanopore sequencing

PubMed Central

Menegon, Michele; Cantaloni, Chiara; Rodriguez-Prieto, Ana; Centomo, Cesare; Abdelfattah, Ahmed; Rossato, Marzia; Bernardi, Massimo; Xumerle, Luciano; Loader, Simon; Delledonne, Massimo

2017-01-01

Biodiversity research is becoming increasingly dependent on genomics, which allows the unprecedented digitization and understanding of the planet’s biological heritage. The use of genetic markers i.e. DNA barcoding, has proved to be a powerful tool in species identification. However, full exploitation of this approach is hampered by the high sequencing costs and the absence of equipped facilities in biodiversity-rich countries. In the present work, we developed a portable sequencing laboratory based on the portable DNA sequencer from Oxford Nanopore Technologies, the MinION. Complementary laboratory equipment and reagents were selected to be used in remote and tough environmental conditions. The performance of the MinION sequencer and the portable laboratory was tested for DNA barcoding in a mimicking tropical environment, as well as in a remote rainforest of Tanzania lacking electricity. Despite the relatively high sequencing error-rate of the MinION, the development of a suitable pipeline for data analysis allowed the accurate identification of different species of vertebrates including amphibians, reptiles and mammals. In situ sequencing of a wild frog allowed us to rapidly identify the species captured, thus confirming that effective DNA barcoding in the field is possible. These results open new perspectives for real-time-on-site DNA sequencing thus potentially increasing opportunities for the understanding of biodiversity in areas lacking conventional laboratory facilities. PMID:28977016

Methodologies for sustaining barcode medication administration compliance. A multi-disciplinary approach.

PubMed

McNulty, Judy; Donnelly, Eileen; Iorio, Kris

2009-01-01

Numerous recent studies have looked at how nursing workarounds and technology failures can undermine the patient safety benefits of barcode medication administration (BCMA) systems. This article will discuss how Solaris Health System in Edison, NJ, methodically addressed these challenges to achieve and sustain 95 percent compliance with BCMA, one of two major initiatives of the non-profit Solaris Patient Safety Institute, which was established to research best practices that could be shared with other organizations. Through meetings and interviews with frontline nurses and their managers, a multidisciplinary team (pharmacy, IT, nursing) identified 12 educational, technological and process-oriented issues, then developed concrete action plans to address each one (e.g., one-on-one software and device training, additional wireless access points, a "hard stop" to require scanning the patient's wristband). Key success factors included demonstrating executive dedication, creating a culture of ownership by engaging frontline nurses in solution design and providing a strong support system.

Chemical and genetic discrimination of Cistanches Herba based on UPLC-QTOF/MS and DNA barcoding.

PubMed

Zheng, Sihao; Jiang, Xue; Wu, Labin; Wang, Zenghui; Huang, Linfang

2014-01-01

Cistanches Herba (Rou Cong Rong), known as "Ginseng of the desert", has a striking curative effect on strength and nourishment, especially in kidney reinforcement to strengthen yang. However, the two plant origins of Cistanches Herba, Cistanche deserticola and Cistanche tubulosa, vary in terms of pharmacological action and chemical components. To discriminate the plant origin of Cistanches Herba, a combined method system of chemical and genetic--UPLC-QTOF/MS technology and DNA barcoding--were firstly employed in this study. The results indicated that three potential marker compounds (isomer of campneoside II, cistanoside C, and cistanoside A) were obtained to discriminate the two origins by PCA and OPLS-DA analyses. DNA barcoding enabled to differentiate two origins accurately. NJ tree showed that two origins clustered into two clades. Our findings demonstrate that the two origins of Cistanches Herba possess different chemical compositions and genetic variation. This is the first reported evaluation of two origins of Cistanches Herba, and the finding will facilitate quality control and its clinical application.

Cancer cell profiling by barcoding allows multiplexed protein analysis in fine-needle aspirates.

PubMed

Ullal, Adeeti V; Peterson, Vanessa; Agasti, Sarit S; Tuang, Suan; Juric, Dejan; Castro, Cesar M; Weissleder, Ralph

2014-01-15

Immunohistochemistry-based clinical diagnoses require invasive core biopsies and use a limited number of protein stains to identify and classify cancers. We introduce a technology that allows analysis of hundreds of proteins from minimally invasive fine-needle aspirates (FNAs), which contain much smaller numbers of cells than core biopsies. The method capitalizes on DNA-barcoded antibody sensing, where barcodes can be photocleaved and digitally detected without any amplification steps. After extensive benchmarking in cell lines, this method showed high reproducibility and achieved single-cell sensitivity. We used this approach to profile ~90 proteins in cells from FNAs and subsequently map patient heterogeneity at the protein level. Additionally, we demonstrate how the method could be used as a clinical tool to identify pathway responses to molecularly targeted drugs and to predict drug response in patient samples. This technique combines specificity with ease of use to offer a new tool for understanding human cancers and designing future clinical trials.

Cancer cell profiling by barcoding allows multiplexed protein analysis in fine needle aspirates

PubMed Central

Ullal, Adeeti V.; Peterson, Vanessa; Agasti, Sarit S.; Tuang, Suan; Juric, Dejan; Castro, Cesar M.; Weissleder, Ralph

2014-01-01

Immunohistochemistry-based clinical diagnoses require invasive core biopsies and use a limited number of protein stains to identify and classify cancers. Here, we introduce a technology that allows analysis of hundreds of proteins from minimally invasive fine needle aspirates (FNA), which contain much smaller numbers of cells than core biopsies. The method capitalizes on DNA-barcoded antibody sensing where barcodes can be photo-cleaved and digitally detected without any amplification steps. Following extensive benchmarking in cell lines, this method showed high reproducibility and achieved single cell sensitivity. We used this approach to profile ~90 proteins in cells from FNAs and subsequently map patient heterogeneity at the protein level. Additionally, we demonstrate how the method could be used as a clinical tool to identify pathway responses to molecularly targeted drugs and to predict drug response in patient samples. This technique combines specificity with ease of use to offer a new tool for understanding human cancers and designing future clinical trials. PMID:24431113

The taxonomic status of Japanese threadfin bream Nemipterus japonicus (Bloch, 1791) (Perciformes: Nemipteridae) with a redescription of this species from the south china sea based on morphology and DNA barcodes

NASA Astrophysics Data System (ADS)

Ning, Ping; Sha, Zhongli; Hebert, Paul D. N.; Russell, Barry

2015-02-01

Because of its importance as a food source, Nemipterus japonicus (Bloch, 1791) (Nemipteridae) or Japanese threadfin bream is the best studied of these taxa, and numerous investigations have examined its fisheries, its biology and biochemistry. Despite such intensive work, the taxonomic status of N. japonicus has never been seriously questioned and it is regarded as a common species, widely distributed throughout the Indo-Western Pacific Ocean. In fact, Bloch's description of the type specimen of N. japonicus has ambiguous collection data and lacks a designation for the type locality, though it is probably Java. In this paper, DNA barcode results based on COI gene support the existence of two geographically separated lineages of the Japanese threadfin bream, both being an Indian Ocean and western Pacific lineage, with 2.7% sequence divergence, and the results indicate a possible existing of some cryptic species. The two lineages also possess a diagnostic difference in their belly color, with specimens in the South China Sea having a silver belly, while those from the Indian Ocean isolate specimen have a yellow coloration. Based upon new collections from the South China Sea, this species from the western Pacific is morphologically redescribed and its details of DNA barcode diversity are shown for the future investigations.

Filling reference gaps via assembling DNA barcodes using high-throughput sequencing—moving toward barcoding the world

PubMed Central

Zhou, Chengran

2017-01-01

Abstract Over the past decade, biodiversity researchers have dedicated tremendous efforts to constructing DNA reference barcodes for rapid species registration and identification. Although analytical cost for standard DNA barcoding has been significantly reduced since early 2000, further dramatic reduction in barcoding costs is unlikely because Sanger sequencing is approaching its limits in throughput and chemistry cost. Constraints in barcoding cost not only led to unbalanced barcoding efforts around the globe, but also prevented high-throughput sequencing (HTS)–based taxonomic identification from applying binomial species names, which provide crucial linkages to biological knowledge. We developed an Illumina-based pipeline, HIFI-Barcode, to produce full-length Cytochrome c oxidase subunit I (COI) barcodes from pooled polymerase chain reaction amplicons generated by individual specimens. The new pipeline generated accurate barcode sequences that were comparable to Sanger standards, even for different haplotypes of the same species that were only a few nucleotides different from each other. Additionally, the new pipeline was much more sensitive in recovering amplicons at low quantity. The HIFI-Barcode pipeline successfully recovered barcodes from more than 78% of the polymerase chain reactions that didn’t show clear bands on the electrophoresis gel. Moreover, sequencing results based on the single molecular sequencing platform Pacbio confirmed the accuracy of the HIFI-Barcode results. Altogether, the new pipeline can provide an improved solution to produce full-length reference barcodes at about one-tenth of the current cost, enabling construction of comprehensive barcode libraries for local fauna, leading to a feasible direction for DNA barcoding global biomes. PMID:29077841

Filling reference gaps via assembling DNA barcodes using high-throughput sequencing-moving toward barcoding the world.

PubMed

Liu, Shanlin; Yang, Chentao; Zhou, Chengran; Zhou, Xin

2017-12-01

Over the past decade, biodiversity researchers have dedicated tremendous efforts to constructing DNA reference barcodes for rapid species registration and identification. Although analytical cost for standard DNA barcoding has been significantly reduced since early 2000, further dramatic reduction in barcoding costs is unlikely because Sanger sequencing is approaching its limits in throughput and chemistry cost. Constraints in barcoding cost not only led to unbalanced barcoding efforts around the globe, but also prevented high-throughput sequencing (HTS)-based taxonomic identification from applying binomial species names, which provide crucial linkages to biological knowledge. We developed an Illumina-based pipeline, HIFI-Barcode, to produce full-length Cytochrome c oxidase subunit I (COI) barcodes from pooled polymerase chain reaction amplicons generated by individual specimens. The new pipeline generated accurate barcode sequences that were comparable to Sanger standards, even for different haplotypes of the same species that were only a few nucleotides different from each other. Additionally, the new pipeline was much more sensitive in recovering amplicons at low quantity. The HIFI-Barcode pipeline successfully recovered barcodes from more than 78% of the polymerase chain reactions that didn't show clear bands on the electrophoresis gel. Moreover, sequencing results based on the single molecular sequencing platform Pacbio confirmed the accuracy of the HIFI-Barcode results. Altogether, the new pipeline can provide an improved solution to produce full-length reference barcodes at about one-tenth of the current cost, enabling construction of comprehensive barcode libraries for local fauna, leading to a feasible direction for DNA barcoding global biomes. © The Authors 2017. Published by Oxford University Press.

Self-registering spread-spectrum barcode method

DOEpatents

Cummings, Eric B.; Even Jr., William R.

2004-11-09

A novel spread spectrum barcode methodology is disclosed that allows a barcode to be read in its entirety even when a significant fraction or majority of the barcode is obscured. The barcode methodology makes use of registration or clocking information that is distributed along with the encoded user data across the barcode image. This registration information allows for the barcode image to be corrected for imaging distortion such as zoom, rotation, tilt, curvature, and perspective.

The neotype barcode of the cotton aphid (Hemiptera: Aphididae: Aphis gossypii Glover, 1877) and a proposal for type barcodes

USDA-ARS?s Scientific Manuscript database

A type barcode is a DNA barcode unequivocally tied to an authoritatively identified specimen, preferably the primary type specimen. Type barcodes are analogous, albeit subordinate, to type specimens, providing a stable reference to which other barcodes can be compared. We here designate and describe...

High-throughput screening of hybridoma supernatants using multiplexed fluorescent cell barcoding on live cells.

PubMed

Lu, Mei; Chan, Brian M; Schow, Peter W; Chang, Wesley S; King, Chadwick T

2017-12-01

With current available assay formats using either immobilized protein (ELISA, enzyme-linked immunosorbent assay) or immunostaining of fixed cells for primary monoclonal antibody (mAb) screening, researchers often fail to identify and characterize antibodies that recognize the native conformation of cell-surface antigens. Therefore, screening using live cells has become an integral and important step contributing to the successful identification of therapeutic antibody candidates. Thus the need for developing high-throughput screening (HTS) technologies using live cells has become a major priority for therapeutic mAb discovery and development. We have developed a novel technique called Multiplexed Fluorescent Cell Barcoding (MFCB), a flow cytometry-based method based upon the Fluorescent Cell Barcoding (FCB) technique and the Luminex fluorescent bead array system, but is applicable to high-through mAb screens on live cells. Using this technique in our system, we can simultaneously identify or characterize the antibody-antigen binding of up to nine unique fluorescent labeled cell populations in the time that it would normally take to process a single population. This has significantly reduced the amount of time needed for the identification of potential lead candidates. This new technology enables investigators to conduct large-scale primary hybridoma screens using flow cytometry. This in turn has allowed us to screen antibodies more efficiently than before and streamline identification and characterization of lead molecules. Copyright © 2017 Elsevier B.V. All rights reserved.

A Single-Molecule Barcoding System using Nanoslits for DNA Analysis

NASA Astrophysics Data System (ADS)

Jo, Kyubong; Schramm, Timothy M.; Schwartz, David C.

Single DNA molecule approaches are playing an increasingly central role in the analytical genomic sciences because single molecule techniques intrinsically provide individualized measurements of selected molecules, free from the constraints of bulk techniques, which blindly average noise and mask the presence of minor analyte components. Accordingly, a principal challenge that must be addressed by all single molecule approaches aimed at genome analysis is how to immobilize and manipulate DNA molecules for measurements that foster construction of large, biologically relevant data sets. For meeting this challenge, this chapter discusses an integrated approach for microfabricated and nanofabricated devices for the manipulation of elongated DNA molecules within nanoscale geometries. Ideally, large DNA coils stretch via nanoconfinement when channel dimensions are within tens of nanometers. Importantly, stretched, often immobilized, DNA molecules spanning hundreds of kilobase pairs are required by all analytical platforms working with large genomic substrates because imaging techniques acquire sequence information from molecules that normally exist in free solution as unrevealing random coils resembling floppy balls of yarn. However, nanoscale devices fabricated with sufficiently small dimensions fostering molecular stretching make these devices impractical because of the requirement of exotic fabrication technologies, costly materials, and poor operational efficiencies. In this chapter, such problems are addressed by discussion of a new approach to DNA presentation and analysis that establishes scaleable nanoconfinement conditions through reduction of ionic strength; stiffening DNA molecules thus enabling their arraying for analysis using easily fabricated devices that can also be mass produced. This new approach to DNA nanoconfinement is complemented by the development of a novel labeling scheme for reliable marking of individual molecules with fluorochrome labels, creating molecular barcodes, which are efficiently read using fluorescence resonance energy transfer techniques for minimizing noise from unincorporated labels. As such, our integrative approach for the realization of genomic analysis through nanoconfinement, named nanocoding, was demonstrated through the barcoding and mapping of bacterial artificial chromosomal molecules, thereby providing the basis for a high-throughput platform competent for whole genome investigations.

DNA barcoding and morphological studies confirm the occurrence of three Atarbolana (Crustacea: Isopoda: Cirolanidae) species along the coastal zone of the Persian Gulf and Gulf of Oman.

PubMed

Khalaji-Pirbalouty, Valiallah; Raupach, Michael J

2016-11-27

Two species of Atarbolana (Cirolanidae: Isopoda) from the intertidal zone of the Gulf of Oman and the Persian Gulf were studied and redescribed. The known distribution of this small genus is limited to the northern areas of the Indian Ocean, from the Pakistan coasts to the Persian Gulf. The analyses of DNA barcodes as well as detailed morphological studies clearly support the existence of three distinct Atarbolana species along the coastal zone of the Persian Gulf and northern Arabian Sea. Furthermore, A. dasycolus Yasmeen, 2004 is synonymized with A. setosa Javed and Yasmeen, 1989.

Ten years of barcoding at the African Centre for DNA Barcoding.

PubMed

Bezeng, B S; Davies, T J; Daru, B H; Kabongo, R M; Maurin, O; Yessoufou, K; van der Bank, H; van der Bank, M

2017-07-01

The African Centre for DNA Barcoding (ACDB) was established in 2005 as part of a global initiative to accurately and rapidly survey biodiversity using short DNA sequences. The mitochondrial cytochrome c oxidase 1 gene (CO1) was rapidly adopted as the de facto barcode for animals. Following the evaluation of several candidate loci for plants, the Plant Working Group of the Consortium for the Barcoding of Life in 2009 recommended that two plastid genes, rbcLa and matK, be adopted as core DNA barcodes for terrestrial plants. To date, numerous studies continue to test the discriminatory power of these markers across various plant lineages. Over the past decade, we at the ACDB have used these core DNA barcodes to generate a barcode library for southern Africa. To date, the ACDB has contributed more than 21 000 plant barcodes and over 3000 CO1 barcodes for animals to the Barcode of Life Database (BOLD). Building upon this effort, we at the ACDB have addressed questions related to community assembly, biogeography, phylogenetic diversification, and invasion biology. Collectively, our work demonstrates the diverse applications of DNA barcoding in ecology, systematics, evolutionary biology, and conservation.

New Products.

ERIC Educational Resources Information Center

TechTrends, 1992

1992-01-01

Reviews new educational technology products, including a microcomputer-based tutoring system, laser barcode reader, video/data projectors, CD-ROM for notebook computers, a system to increase a printer's power, data cartridge storage shell, knowledge-based decision tool, video illustrator, interactive videodiscs, surge protectors, scanner system,…

Phylogenetic analysis, genetic diversity and relationships between the recently segregated species of Corynandra and Cleoserrata from the genus Cleome using DNA barcoding and molecular markers.

PubMed

Tamboli, Asif Shabodin; Patil, Swapnil Mahadeo; Gholave, Avinash Ramchandra; Kadam, Suhas Kishor; Kotibhaskar, Shreya Vijaykumar; Yadav, Shrirang Ramchandra; Govindwar, Sanjay Prabhu

2016-01-01

Cleome is the largest genus in the family Cleomaceae and it is known for its various medicinal properties. Recently, some species from the Cleome genus (Cleome viscosa, Cleome chelidonii, Cleome felina and Cleome speciosa) are split into genera Corynandra (Corynandra viscosa, Corynandra chelidonii, Corynandra felina), and Cleoserrata (Cleoserrata speciosa). The objective of this study was to obtain DNA barcodes for these species for their accurate identification and determining phylogenetic relationships. Out of 10 screened barcoding regions, rbcL, matK and ITS1 regions showed higher PCR efficiency and sequencing success. This study added matK, rbcL and ITS1 barcodes for the identification of Corynandra chelidonii, Corynandra felina, Cleome simplicifolia and Cleome aspera species in existing barcode data. Corynandra chelidonii and Corynandra felina species belong to the Corynandra genus, but they are not grouped with the Corynandra viscosa species, however clustered with the Cleome species. Molecular marker analysis showed 100% polymorphism among the studied plant samples. Diversity indices for molecular markers were ranged from He=0.1115-0.1714 and I=0.2268-0.2700, which indicates a significant amount of genetic diversity among studied species. Discrimination of the Cleome and Corynandra species from Cleoserrata speciosa was obtained by two RAPD primers (OPA-4 and RAPD-17) and two ISSR primers (ISSR-1 and ISSR-2). RAPD and ISSR markers are useful for the genetic characterization of these studied species. The present investigation will be helpful to understand the relationships of Cleome lineages with Corynandra and Cleoserrata species. Copyright © 2016 Académie des sciences. Published by Elsevier SAS. All rights reserved.

Complex species status for extinct moa (Aves: Dinornithiformes) from the genus Euryapteryx.

PubMed

Huynen, Leon; Lambert, David M

2014-01-01

The exact species status of New Zealand's extinct moa remains unknown. In particular, moa belonging to the genus Euryapteryx have been difficult to classify. We use the DNA barcoding sequence on a range of Euryapteryx samples in an attempt to resolve the species status for this genus. We obtained mitochondrial control region and the barcoding region from Cytochrome Oxidase Subunit I (COI) from a number of new moa samples and use available sequences from previous moa phylogenies and eggshell data to try and clarify the species status of Euryapteryx. Using the COI barcoding region we show that species status in Euryapteryx is complex with no clear separation between various individuals. Eggshell, soil, and bone data suggests that a Euryapteryx subspecies likely exists on New Zealand's North Island and can be characterized by a single mitochondrial control region SNP. COI divergences between Euryapteryx individuals from the south of New Zealand's South Island and those from the Far North of the North Island exceed 1.6% and are likely to represent separate species. Individuals from other areas of New Zealand were unable to be clearly separated based on COI differences possibly as a result of repeated hybridisation events. Despite the accuracy of the COI barcoding region to determine species status in birds, including that for the other moa genera, for moa from the genus Euryapteryx, COI barcoding fails to provide a clear result, possibly as a consequence of repeated hybridisation events between these moa. A single control region SNP was identified however that segregates with the two general morphological variants determined for Euryapteryx; a smaller subspecies restricted to the North Island of New Zealand, and a larger subspecies, found on both New Zealand's North and South Island.

Efficient alignment-free DNA barcode analytics.

PubMed

Kuksa, Pavel; Pavlovic, Vladimir

2009-11-10

In this work we consider barcode DNA analysis problems and address them using alternative, alignment-free methods and representations which model sequences as collections of short sequence fragments (features). The methods use fixed-length representations (spectrum) for barcode sequences to measure similarities or dissimilarities between sequences coming from the same or different species. The spectrum-based representation not only allows for accurate and computationally efficient species classification, but also opens possibility for accurate clustering analysis of putative species barcodes and identification of critical within-barcode loci distinguishing barcodes of different sample groups. New alignment-free methods provide highly accurate and fast DNA barcode-based identification and classification of species with substantial improvements in accuracy and speed over state-of-the-art barcode analysis methods. We evaluate our methods on problems of species classification and identification using barcodes, important and relevant analytical tasks in many practical applications (adverse species movement monitoring, sampling surveys for unknown or pathogenic species identification, biodiversity assessment, etc.) On several benchmark barcode datasets, including ACG, Astraptes, Hesperiidae, Fish larvae, and Birds of North America, proposed alignment-free methods considerably improve prediction accuracy compared to prior results. We also observe significant running time improvements over the state-of-the-art methods. Our results show that newly developed alignment-free methods for DNA barcoding can efficiently and with high accuracy identify specimens by examining only few barcode features, resulting in increased scalability and interpretability of current computational approaches to barcoding.

Transient partial permeabilization with saponin enables cellular barcoding prior to surface marker staining1

PubMed Central

Behbehani, Gregory K.; Thom, Colin; Zunder, Eli R.; Finck, Rachel; Gaudilliere, Brice; Fragiadakis, Gabriela K.; Fantl, Wendy J.; Nolan, Garry P.

2015-01-01

Fluorescent cellular barcoding and mass-tag cellular barcoding are cytometric methods that enable high sample throughput, minimize inter-sample variation, and reduce reagent consumption. Previously employed barcoding protocols require that barcoding be performed after surface marker staining, complicating combining the technique with measurement of alcohol-sensitive surface epitopes. This report describes a method of barcoding fixed cells after a transient partial permeabilization with 0.02% saponin that results in efficient and consistent barcode staining with fluorescent or mass-tagged reagents while preserving surface marker staining. This approach simplifies barcoding protocols and allows direct comparison of surface marker staining of multiple samples without concern for variations in the antibody cocktail volume, antigen-antibody ratio, or machine sensitivity. Using this protocol, cellular barcoding can be used to reliably detect subtle differences in surface marker expression. PMID:25274027

Building a DNA barcode reference library for the true butterflies (Lepidoptera) of Peninsula Malaysia: what about the subspecies?

PubMed

Wilson, John-James; Sing, Kong-Wah; Sofian-Azirun, Mohd

2013-01-01

The objective of this study was to build a DNA barcode reference library for the true butterflies of Peninsula Malaysia and assess the value of attaching subspecies names to DNA barcode records. A new DNA barcode library was constructed with butterflies from the Museum of Zoology, University of Malaya collection. The library was analysed in conjunction with publicly available DNA barcodes from other Asia-Pacific localities to test the ability of the DNA barcodes to discriminate species and subspecies. Analyses confirmed the capacity of the new DNA barcode reference library to distinguish the vast majority of species (92%) and revealed that most subspecies possessed unique DNA barcodes (84%). In some cases conspecific subspecies exhibited genetic distances between their DNA barcodes that are typically seen between species, and these were often taxa that have previously been regarded as full species. Subspecies designations as shorthand for geographically and morphologically differentiated groups provide a useful heuristic for assessing how such groups correlate with clustering patterns of DNA barcodes, especially as the number of DNA barcodes per species in reference libraries increases. Our study demonstrates the value in attaching subspecies names to DNA barcode records as they can reveal a history of taxonomic concepts and expose important units of biodiversity.

Building a DNA Barcode Reference Library for the True Butterflies (Lepidoptera) of Peninsula Malaysia: What about the Subspecies?

PubMed Central

Wilson, John-James; Sing, Kong-Wah; Sofian-Azirun, Mohd

2013-01-01

The objective of this study was to build a DNA barcode reference library for the true butterflies of Peninsula Malaysia and assess the value of attaching subspecies names to DNA barcode records. A new DNA barcode library was constructed with butterflies from the Museum of Zoology, University of Malaya collection. The library was analysed in conjunction with publicly available DNA barcodes from other Asia-Pacific localities to test the ability of the DNA barcodes to discriminate species and subspecies. Analyses confirmed the capacity of the new DNA barcode reference library to distinguish the vast majority of species (92%) and revealed that most subspecies possessed unique DNA barcodes (84%). In some cases conspecific subspecies exhibited genetic distances between their DNA barcodes that are typically seen between species, and these were often taxa that have previously been regarded as full species. Subspecies designations as shorthand for geographically and morphologically differentiated groups provide a useful heuristic for assessing how such groups correlate with clustering patterns of DNA barcodes, especially as the number of DNA barcodes per species in reference libraries increases. Our study demonstrates the value in attaching subspecies names to DNA barcode records as they can reveal a history of taxonomic concepts and expose important units of biodiversity. PMID:24282514

Unique DNA-barcoded aerosol test particles for studying aerosol transport

DOE Office of Scientific and Technical Information (OSTI.GOV)

Harding, Ruth N.; Hara, Christine A.; Hall, Sara B.

Data are presented for the first use of novel DNA-barcoded aerosol test particles that have been developed to track the fate of airborne contaminants in populated environments. Until DNATrax (DNA Tagged Reagents for Aerosol eXperiments) particles were developed, there was no way to rapidly validate air transport models with realistic particles in the respirable range of 1–10 μm in diameter. The DNATrax particles, developed at Lawrence Livermore National Laboratory (LLNL) and tested with the assistance of the Pentagon Force Protection Agency, are the first safe and effective materials for aerosol transport studies that are identified by DNA molecules. The usemore » of unique synthetic DNA barcodes overcomes the challenges of discerning the test material from pre-existing environmental or background contaminants (either naturally occurring or previously released). The DNATrax particle properties are demonstrated to have appropriate size range (approximately 1–4.5 μm in diameter) to accurately simulate bacterial spore transport. As a result, we describe details of the first field test of the DNATrax aerosol test particles in a large indoor facility.« less

Unique DNA-barcoded aerosol test particles for studying aerosol transport

DOE PAGES

Harding, Ruth N.; Hara, Christine A.; Hall, Sara B.; ...

2016-03-22

Data are presented for the first use of novel DNA-barcoded aerosol test particles that have been developed to track the fate of airborne contaminants in populated environments. Until DNATrax (DNA Tagged Reagents for Aerosol eXperiments) particles were developed, there was no way to rapidly validate air transport models with realistic particles in the respirable range of 1–10 μm in diameter. The DNATrax particles, developed at Lawrence Livermore National Laboratory (LLNL) and tested with the assistance of the Pentagon Force Protection Agency, are the first safe and effective materials for aerosol transport studies that are identified by DNA molecules. The usemore » of unique synthetic DNA barcodes overcomes the challenges of discerning the test material from pre-existing environmental or background contaminants (either naturally occurring or previously released). The DNATrax particle properties are demonstrated to have appropriate size range (approximately 1–4.5 μm in diameter) to accurately simulate bacterial spore transport. As a result, we describe details of the first field test of the DNATrax aerosol test particles in a large indoor facility.« less

Aspergillus and Penicillium identification using DNA sequences: Barcode or MLST?

USDA-ARS?s Scientific Manuscript database

Current methods in DNA technology can detect single nucleotide polymorphisms with measurable accuracy using several different approaches appropriate for different uses. If there are even single nucleotide differences that are invariant markers of the species, we can accomplish identification through...

Constructing DNA Barcode Sets Based on Particle Swarm Optimization.

PubMed

Wang, Bin; Zheng, Xuedong; Zhou, Shihua; Zhou, Changjun; Wei, Xiaopeng; Zhang, Qiang; Wei, Ziqi

2018-01-01

Following the completion of the human genome project, a large amount of high-throughput bio-data was generated. To analyze these data, massively parallel sequencing, namely next-generation sequencing, was rapidly developed. DNA barcodes are used to identify the ownership between sequences and samples when they are attached at the beginning or end of sequencing reads. Constructing DNA barcode sets provides the candidate DNA barcodes for this application. To increase the accuracy of DNA barcode sets, a particle swarm optimization (PSO) algorithm has been modified and used to construct the DNA barcode sets in this paper. Compared with the extant results, some lower bounds of DNA barcode sets are improved. The results show that the proposed algorithm is effective in constructing DNA barcode sets.

Large-scale DNA Barcode Library Generation for Biomolecule Identification in High-throughput Screens.

PubMed

Lyons, Eli; Sheridan, Paul; Tremmel, Georg; Miyano, Satoru; Sugano, Sumio

2017-10-24

High-throughput screens allow for the identification of specific biomolecules with characteristics of interest. In barcoded screens, DNA barcodes are linked to target biomolecules in a manner allowing for the target molecules making up a library to be identified by sequencing the DNA barcodes using Next Generation Sequencing. To be useful in experimental settings, the DNA barcodes in a library must satisfy certain constraints related to GC content, homopolymer length, Hamming distance, and blacklisted subsequences. Here we report a novel framework to quickly generate large-scale libraries of DNA barcodes for use in high-throughput screens. We show that our framework dramatically reduces the computation time required to generate large-scale DNA barcode libraries, compared with a naїve approach to DNA barcode library generation. As a proof of concept, we demonstrate that our framework is able to generate a library consisting of one million DNA barcodes for use in a fragment antibody phage display screening experiment. We also report generating a general purpose one billion DNA barcode library, the largest such library yet reported in literature. Our results demonstrate the value of our novel large-scale DNA barcode library generation framework for use in high-throughput screening applications.

Efficient alignment-free DNA barcode analytics

PubMed Central

Kuksa, Pavel; Pavlovic, Vladimir

2009-01-01

Background In this work we consider barcode DNA analysis problems and address them using alternative, alignment-free methods and representations which model sequences as collections of short sequence fragments (features). The methods use fixed-length representations (spectrum) for barcode sequences to measure similarities or dissimilarities between sequences coming from the same or different species. The spectrum-based representation not only allows for accurate and computationally efficient species classification, but also opens possibility for accurate clustering analysis of putative species barcodes and identification of critical within-barcode loci distinguishing barcodes of different sample groups. Results New alignment-free methods provide highly accurate and fast DNA barcode-based identification and classification of species with substantial improvements in accuracy and speed over state-of-the-art barcode analysis methods. We evaluate our methods on problems of species classification and identification using barcodes, important and relevant analytical tasks in many practical applications (adverse species movement monitoring, sampling surveys for unknown or pathogenic species identification, biodiversity assessment, etc.) On several benchmark barcode datasets, including ACG, Astraptes, Hesperiidae, Fish larvae, and Birds of North America, proposed alignment-free methods considerably improve prediction accuracy compared to prior results. We also observe significant running time improvements over the state-of-the-art methods. Conclusion Our results show that newly developed alignment-free methods for DNA barcoding can efficiently and with high accuracy identify specimens by examining only few barcode features, resulting in increased scalability and interpretability of current computational approaches to barcoding. PMID:19900305

Filling the BINs of life: Report of an amphibian and reptile survey of the Tanintharyi (Tenasserim) Region of Myanmar, with DNA barcode data.

PubMed

Mulcahy, Daniel G; Lee, Justin L; Miller, Aryeh H; Chand, Mia; Thura, Myint Kyaw; Zug, George R

2018-01-01

Despite threats of species extinctions, taxonomic crises, and technological advances in genomics and natural history database informatics, we are still distant from cataloguing all of the species of life on earth. Amphibians and reptiles are no exceptions; in fact new species are described nearly every day and many species face possible extinction. The number of described species continues to climb as new areas of the world are explored and as species complexes are examined more thoroughly. The use of DNA barcoding provides a mechanism for rapidly estimating the number of species at a given site and has the potential to record all of the species of life on Earth. Though DNA barcoding has its caveats, it can be useful to estimate the number of species in a more systematic and efficient manner, to be followed in combination with more traditional, morphology-based identifications and species descriptions. Herein, we report the results of a voucher-based herpetological expedition to the Tanintharyi (Tenasserim) Region of Myanmar, enhanced with DNA barcode data. Our main surveys took place in the currently proposed Tanintharyi National Park. We combine our results with photographs and observational data from the Chaung-nauk-pyan forest reserve. Additionally, we provide the first checklist of amphibians and reptiles of the region, with species based on the literature and museum. Amphibians, anurans in particular, are one of the most poorly known groups of vertebrates in terms of taxonomy and the number of known species, particularly in Southeast Asia. Our rapid-assessment program combined with DNA barcoding and use of Barcode Index Numbers (BINs) of voucher specimens reveals the depth of taxonomic diversity in the southern Tanintharyi herpetofauna even though only a third of the potential amphibians and reptiles were seen. A total of 51 putative species (one caecilian, 25 frogs, 13 lizards, 10 snakes, and two turtles) were detected, several of which represent potentially undescribed species. Several of these species were detected by DNA barcode data alone. Furthermore, five species were recorded for the first time in Myanmar, two amphibians (Ichthyophis cf. kohtaoensis and Chalcorana eschatia ) and three snakes ( Ahaetulla mycterizans , Boiga dendrophila , and Boiga drapiezii ).

Filling the BINs of life: Report of an amphibian and reptile survey of the Tanintharyi (Tenasserim) Region of Myanmar, with DNA barcode data

PubMed Central

Mulcahy, Daniel G.; Lee, Justin L.; Miller, Aryeh H.; Chand, Mia; Thura, Myint Kyaw; Zug, George R.

2018-01-01

Abstract Despite threats of species extinctions, taxonomic crises, and technological advances in genomics and natural history database informatics, we are still distant from cataloguing all of the species of life on earth. Amphibians and reptiles are no exceptions; in fact new species are described nearly every day and many species face possible extinction. The number of described species continues to climb as new areas of the world are explored and as species complexes are examined more thoroughly. The use of DNA barcoding provides a mechanism for rapidly estimating the number of species at a given site and has the potential to record all of the species of life on Earth. Though DNA barcoding has its caveats, it can be useful to estimate the number of species in a more systematic and efficient manner, to be followed in combination with more traditional, morphology-based identifications and species descriptions. Herein, we report the results of a voucher-based herpetological expedition to the Tanintharyi (Tenasserim) Region of Myanmar, enhanced with DNA barcode data. Our main surveys took place in the currently proposed Tanintharyi National Park. We combine our results with photographs and observational data from the Chaung-nauk-pyan forest reserve. Additionally, we provide the first checklist of amphibians and reptiles of the region, with species based on the literature and museum. Amphibians, anurans in particular, are one of the most poorly known groups of vertebrates in terms of taxonomy and the number of known species, particularly in Southeast Asia. Our rapid-assessment program combined with DNA barcoding and use of Barcode Index Numbers (BINs) of voucher specimens reveals the depth of taxonomic diversity in the southern Tanintharyi herpetofauna even though only a third of the potential amphibians and reptiles were seen. A total of 51 putative species (one caecilian, 25 frogs, 13 lizards, 10 snakes, and two turtles) were detected, several of which represent potentially undescribed species. Several of these species were detected by DNA barcode data alone. Furthermore, five species were recorded for the first time in Myanmar, two amphibians (Ichthyophis cf. kohtaoensis and Chalcorana eschatia) and three snakes (Ahaetulla mycterizans, Boiga dendrophila, and Boiga drapiezii). PMID:29780268

Critical factors for assembling a high volume of DNA barcodes

PubMed Central

Hajibabaei, Mehrdad; deWaard, Jeremy R; Ivanova, Natalia V; Ratnasingham, Sujeevan; Dooh, Robert T; Kirk, Stephanie L; Mackie, Paula M; Hebert, Paul D.N

2005-01-01

Large-scale DNA barcoding projects are now moving toward activation while the creation of a comprehensive barcode library for eukaryotes will ultimately require the acquisition of some 100 million barcodes. To satisfy this need, analytical facilities must adopt protocols that can support the rapid, cost-effective assembly of barcodes. In this paper we discuss the prospects for establishing high volume DNA barcoding facilities by evaluating key steps in the analytical chain from specimens to barcodes. Alliances with members of the taxonomic community represent the most effective strategy for provisioning the analytical chain with specimens. The optimal protocols for DNA extraction and subsequent PCR amplification of the barcode region depend strongly on their condition, but production targets of 100K barcode records per year are now feasible for facilities working with compliant specimens. The analysis of museum collections is currently challenging, but PCR cocktails that combine polymerases with repair enzyme(s) promise future success. Barcode analysis is already a cost-effective option for species identification in some situations and this will increasingly be the case as reference libraries are assembled and analytical protocols are simplified. PMID:16214753

Feasibility and Limitations of Vaccine Two-Dimensional Barcoding Using Mobile Devices.

PubMed

Bell, Cameron; Guerinet, Julien; Atkinson, Katherine M; Wilson, Kumanan

2016-06-23

Two-dimensional (2D) barcoding has the potential to enhance documentation of vaccine encounters at the point of care. However, this is currently limited to environments equipped with dedicated barcode scanners and compatible record systems. Mobile devices may present a cost-effective alternative to leverage 2D vaccine vial barcodes and improve vaccine product-specific information residing in digital health records. Mobile devices have the potential to capture product-specific information from 2D vaccine vial barcodes. We sought to examine the feasibility, performance, and potential limitations of scanning 2D barcodes on vaccine vials using 4 different mobile phones. A unique barcode scanning app was developed for Android and iOS operating systems. The impact of 4 variables on the scan success rate, data accuracy, and time to scan were examined: barcode size, curvature, fading, and ambient lighting conditions. Two experimenters performed 4 trials 10 times each, amounting to a total of 2160 barcode scan attempts. Of the 1832 successful scans performed in this evaluation, zero produced incorrect data. Five-millimeter barcodes were the slowest to scan, although only by 0.5 seconds on average. Barcodes with up to 50% fading had a 100% success rate, but success rate deteriorated beyond 60% fading. Curved barcodes took longer to scan compared with flat, but success rate deterioration was only observed at a vial diameter of 10 mm. Light conditions did not affect success rate or scan time between 500 lux and 20 lux. Conditions below 20 lux impeded the device's ability to scan successfully. Variability in scan time was observed across devices in all trials performed. 2D vaccine barcoding is possible using mobile devices and is successful under the majority of conditions examined. Manufacturers utilizing 2D barcodes should take into consideration the impact of factors that limit scan success rates. Future studies should evaluate the effect of mobile barcoding on workflow and vaccine administrator acceptance.

A DNA mini-barcode for land plants.

PubMed

Little, Damon P

2014-05-01

Small portions of the barcode region - mini-barcodes - may be used in place of full-length barcodes to overcome DNA degradation for samples with poor DNA preservation. 591,491,286 rbcL mini-barcode primer combinations were electronically evaluated for PCR universality, and two novel highly universal sets of priming sites were identified. Novel and published rbcL mini-barcode primers were evaluated for PCR amplification [determined with a validated electronic simulation (n = 2765) and empirically (n = 188)], Sanger sequence quality [determined empirically (n = 188)], and taxonomic discrimination [determined empirically (n = 30,472)]. PCR amplification for all mini-barcodes, as estimated by validated electronic simulation, was successful for 90.2-99.8% of species. Overall Sanger sequence quality for mini-barcodes was very low - the best mini-barcode tested produced sequences of adequate quality (B20 ≥ 0.5) for 74.5% of samples. The majority of mini-barcodes provide correct identifications of families in excess of 70.1% of the time. Discriminatory power noticeably decreased at lower taxonomic levels. At the species level, the discriminatory power of the best mini-barcode was less than 38.2%. For samples believed to contain DNA from only one species, an investigator should attempt to sequence, in decreasing order of utility and probability of success, mini-barcodes F (rbcL1/rbcLB), D (F52/R193) and K (F517/R604). For samples believed to contain DNA from more than one species, an investigator should amplify and sequence mini-barcode D (F52/R193). © 2013 John Wiley & Sons Ltd.

Management information system of medical equipment using mobile devices

NASA Astrophysics Data System (ADS)

Núñez, C.; Castro, D.

2011-09-01

The large numbers of technologies currently incorporated into mobile devices transform them into excellent tools for capture and to manage the information, because of the increasing computing power and storage that allow to add many miscellaneous applications. In order to obtain benefits of these technologies, in the biomedical engineering field, it was developed a mobile information system for medical equipment management. The central platform for the system it's a mobile phone, which by a connection with a web server, it's capable to send and receive information relative to any medical equipment. Decoding a type of barcodes, known as QR-Codes, the management process is simplified and improved. These barcodes identified the medical equipments in a database, when these codes are photographed and decoded with the mobile device, you can access to relevant information about the medical equipment in question. This Project in it's actual state is a basic support tool for the maintenance of medical equipment. It is also a modern alternative, competitive and economic in the actual market.

The campaign to DNA barcode all fishes, FISH-BOL.

PubMed

Ward, R D; Hanner, R; Hebert, P D N

2009-02-01

FISH-BOL, the Fish Barcode of Life campaign, is an international research collaboration that is assembling a standardized reference DNA sequence library for all fishes. Analysis is targeting a 648 base pair region of the mitochondrial cytochrome c oxidase I (COI) gene. More than 5000 species have already been DNA barcoded, with an average of five specimens per species, typically vouchers with authoritative identifications. The barcode sequence from any fish, fillet, fin, egg or larva can be matched against these reference sequences using BOLD; the Barcode of Life Data System (http://www.barcodinglife.org). The benefits of barcoding fishes include facilitating species identification, highlighting cases of range expansion for known species, flagging previously overlooked species and enabling identifications where traditional methods cannot be applied. Results thus far indicate that barcodes separate c. 98 and 93% of already described marine and freshwater fish species, respectively. Several specimens with divergent barcode sequences have been confirmed by integrative taxonomic analysis as new species. Past concerns in relation to the use of fish barcoding for species discrimination are discussed. These include hybridization, recent radiations, regional differentiation in barcode sequences and nuclear copies of the barcode region. However, current results indicate these issues are of little concern for the great majority of specimens.

A DNA Mini-Barcoding System for Authentication of Processed Fish Products.

PubMed

Shokralla, Shadi; Hellberg, Rosalee S; Handy, Sara M; King, Ian; Hajibabaei, Mehrdad

2015-10-30

Species substitution is a form of seafood fraud for the purpose of economic gain. DNA barcoding utilizes species-specific DNA sequence information for specimen identification. Previous work has established the usability of short DNA sequences-mini-barcodes-for identification of specimens harboring degraded DNA. This study aims at establishing a DNA mini-barcoding system for all fish species commonly used in processed fish products in North America. Six mini-barcode primer pairs targeting short (127-314 bp) fragments of the cytochrome c oxidase I (CO1) DNA barcode region were developed by examining over 8,000 DNA barcodes from species in the U.S. Food and Drug Administration (FDA) Seafood List. The mini-barcode primer pairs were then tested against 44 processed fish products representing a range of species and product types. Of the 44 products, 41 (93.2%) could be identified at the species or genus level. The greatest mini-barcoding success rate found with an individual primer pair was 88.6% compared to 20.5% success rate achieved by the full-length DNA barcode primers. Overall, this study presents a mini-barcoding system that can be used to identify a wide range of fish species in commercial products and may be utilized in high throughput DNA sequencing for authentication of heavily processed fish products.

Four years of DNA barcoding: current advances and prospects.

PubMed

Frézal, Lise; Leblois, Raphael

2008-09-01

Research using cytochrome c oxidase barcoding techniques on zoological specimens was initiated by Hebert et al. [Hebert, P.D.N., Ratnasingham, S., deWaard, J.R., 2003. Barcoding animal life: cytochrome c oxidase subunit 1 divergences among closely related species. Proc. R. Soc. Lond. B 270, S96-S99]. By March 2004, the Consortium for the Barcode of Life started to promote the use of a standardized DNA barcoding approach, consisting of identifying a specimen as belonging to a certain animal species based on a single universal marker: the DNA barcode sequence. Over the last 4 years, this approach has become increasingly popular and advances as well as limitations have clearly emerged as increasing amounts of organisms have been studied. Our purpose is to briefly expose DNA Barcode of Life principles, pros and cons, relevance and universality. The initially proposed Barcode of life framework has greatly evolved, giving rise to a flexible description of DNA barcoding and a larger range of applications.

Exploring the utility of DNA barcoding in species delimitation of Polypedilum (Tripodura) non-biting midges (Diptera: Chironomidae).

PubMed

Song, Chao; Wang, Qian; Zhang, Ruilei; Sun, Bingjiao; Wang, Xinhua

2016-02-16

In this study, we tested the utility of the mitochondrial gene cytochrome c oxidase subunit 1 (CO1) as the barcode region to deal with taxonomical problems of Polypedilum (Tripodura) non-biting midges (Diptera: Chironomidae). The 114 DNA barcodes representing 27 morphospecies are divided into 33 well separated clusters based on both Neighbor Joining and Maximum Likelihood methods. DNA barcodes revealed an 82% success rate in matching with morphospecies. The selected DNA barcode data support 37-64 operational taxonomic units (OTUs) based on the methods of Automatic Barcode Gap Discovery (ABGD) and Poisson Tree Process (PTP). Furthermore, a priori species based on consistent phenotypic variations were attested by molecular analysis, and a taxonomical misidentification of barcode sequences from GenBank was found. We could not observe a distinct barcode gap but an overlap ranged from 9-12%. Our results supported DNA barcoding as an ideal method to detect cryptic species, delimit sibling species, and associate different life stages in non-biting midges.

DNA barcoding in the media: does coverage of cool science reflect its social context?

PubMed

Geary, Janis; Camicioli, Emma; Bubela, Tania

2016-09-01

Paul Hebert and colleagues first described DNA barcoding in 2003, which led to international efforts to promote and coordinate its use. Since its inception, DNA barcoding has generated considerable media coverage. We analysed whether this coverage reflected both the scientific and social mandates of international barcoding organizations. We searched newspaper databases to identify 900 English-language articles from 2003 to 2013. Coverage of the science of DNA barcoding was highly positive but lacked context for key topics. Coverage omissions pose challenges for public understanding of the science and applications of DNA barcoding; these included coverage of governance structures and issues related to the sharing of genetic resources across national borders. Our analysis provided insight into how barcoding communication efforts have translated into media coverage; more targeted communication efforts may focus media attention on previously omitted, but important topics. Our analysis is timely as the DNA barcoding community works to establish the International Society for the Barcode of Life.

75 FR 56922 - Implementation of the Intelligent Mail Package Barcode

Federal Register 2010, 2011, 2012, 2013, 2014

2010-09-17

... the USPS Intelligent Mail strategy. Packages that currently bear barcodes designed to provide delivery... symbology of the barcode; however the elements within the barcode and layout will change. There are several...

Reliable DNA Barcoding Performance Proved for Species and Island Populations of Comoran Squamate Reptiles

PubMed Central

Hawlitschek, Oliver; Nagy, Zoltán T.; Berger, Johannes; Glaw, Frank

2013-01-01

In the past decade, DNA barcoding became increasingly common as a method for species identification in biodiversity inventories and related studies. However, mainly due to technical obstacles, squamate reptiles have been the target of few barcoding studies. In this article, we present the results of a DNA barcoding study of squamates of the Comoros archipelago, a poorly studied group of oceanic islands close to and mostly colonized from Madagascar. The barcoding dataset presented here includes 27 of the 29 currently recognized squamate species of the Comoros, including 17 of the 18 endemic species. Some species considered endemic to the Comoros according to current taxonomy were found to cluster with non-Comoran lineages, probably due to poorly resolved taxonomy. All other species for which more than one barcode was obtained corresponded to distinct clusters useful for species identification by barcoding. In most species, even island populations could be distinguished using barcoding. Two cryptic species were identified using the DNA barcoding approach. The obtained barcoding topology, a Bayesian tree based on COI sequences of 5 genera, was compared with available multigene topologies, and in 3 cases, major incongruences between the two topologies became evident. Three of the multigene studies were initiated after initial screening of a preliminary version of the barcoding dataset presented here. We conclude that in the case of the squamates of the Comoros Islands, DNA barcoding has proven a very useful and efficient way of detecting isolated populations and promising starting points for subsequent research. PMID:24069192

Product self-management: evolution in recycling and reuse.

PubMed

Thomas, Valerie M

2003-12-01

This paper explores the potential to make product recycling and reuse easier by shifting responsibility for product management toward the product itself. Examples range from barcode-enabled Internet sales of used products to RFID-enabled garbage trucks that identify recyclable items and provide rebates. Initial steps toward product self-management have made opportunistic use of product bar codes and Internet markets. In the United States, Internet markets are driving increased reuse of products. In the European Union, recycling and waste management policy is driving the use of radio electronics in waste management. Prospects for product self-management are assessed from both a technological and an economic perspective. The technological analysis indicates that radio-frequency tags offer some advantages over bar codes, but their application to product self-management requires considerable investment in the waste management infrastructure. This suggests that early applications of advanced product tags are most suitable for Germany and other countries where the waste management industry has already integrated information technology into its operations. The economic analysis indicates that increased reuse of products can reduce consumption of new products and materials, although on a less than one-to-one basis, simultaneously reducing costs for consumers and deriving more value from existing products.

Single-Molecule Denaturation Mapping of Genomic DNA in Nanofluidic Channels

NASA Astrophysics Data System (ADS)

Reisner, Walter; Larsen, Niels; Kristensen, Anders; Tegenfeldt, Jonas O.; Flyvbjerg, Henrik

2009-03-01

We have developed a new DNA barcoding technique based on the partial denaturation of extended fluorescently labeled DNA molecules. We partially melt DNA extended in nanofluidic channels via a combination of local heating and added chemical denaturants. The melted molecules, imaged via a standard fluorescence videomicroscopy setup, exhibit a nonuniform fluorescence profile corresponding to a series of local dips and peaks in the intensity trace along the stretched molecule. We show that this barcode is consistent with the presence of locally melted regions and can be explained by calculations of sequence-dependent melting probability. We believe this melting mapping technology is the first optically based single molecule technique sensitive to genome wide sequence variation that does not require an additional enzymatic labeling or restriction scheme.

Watermarking spot colors in packaging

NASA Astrophysics Data System (ADS)

Reed, Alastair; Filler, TomáÅ.¡; Falkenstern, Kristyn; Bai, Yang

2015-03-01

In January 2014, Digimarc announced Digimarc® Barcode for the packaging industry to improve the check-out efficiency and customer experience for retailers. Digimarc Barcode is a machine readable code that carries the same information as a traditional Universal Product Code (UPC) and is introduced by adding a robust digital watermark to the package design. It is imperceptible to the human eye but can be read by a modern barcode scanner at the Point of Sale (POS) station. Compared to a traditional linear barcode, Digimarc Barcode covers the whole package with minimal impact on the graphic design. This significantly improves the Items per Minute (IPM) metric, which retailers use to track the checkout efficiency since it closely relates to their profitability. Increasing IPM by a few percent could lead to potential savings of millions of dollars for retailers, giving them a strong incentive to add the Digimarc Barcode to their packages. Testing performed by Digimarc showed increases in IPM of at least 33% using the Digimarc Barcode, compared to using a traditional barcode. A method of watermarking print ready image data used in the commercial packaging industry is described. A significant proportion of packages are printed using spot colors, therefore spot colors needs to be supported by an embedder for Digimarc Barcode. Digimarc Barcode supports the PANTONE spot color system, which is commonly used in the packaging industry. The Digimarc Barcode embedder allows a user to insert the UPC code in an image while minimizing perceptibility to the Human Visual System (HVS). The Digimarc Barcode is inserted in the printing ink domain, using an Adobe Photoshop plug-in as the last step before printing. Since Photoshop is an industry standard widely used by pre-press shops in the packaging industry, a Digimarc Barcode can be easily inserted and proofed.

All You Need to Know about Videodiscs: One Easy Lesson.

ERIC Educational Resources Information Center

Padgett, Helen L.

1993-01-01

Explains videodisc technology and its uses in education. Topics addressed include formats of videodiscs, including CAV discs (constant angular velocity) and CLV discs (constant linear velocity); the three industry-standard levels of interactivity; bar codes; bar-code readers; and finding information on a videodisc. (LRW)

Great Lakes DNA barcode reference library: Mollusca, annelida, and minor phyla

EPA Science Inventory

In recent years, the research and development of DNA-based tools has improved both their sensitivity and costs. This technology has the potential to be useful in the early detection of aquatic invasive species, and can increase the scope of surveillance compared with traditional ...

[Trial of eye drops recognizer for visually disabled persons].

PubMed

Okamoto, Norio; Suzuki, Katsuhiko; Mimura, Osamu

2009-01-01

The development of a device to enable the visually disabled to differentiate eye drops and their dose. The new instrument is composed of a voice generator and a two-dimensional bar-code reader (LS9208). We designed voice outputs for the visually disabled to state when (number of times) and where (right, left, or both) to administer eye drops. We then determined the minimum bar-code size that can be recognized. After attaching bar-codes of the appropriate size to the lateral or bottom surface of the eye drops container, the readability of the bar-codes was compared. The minimum discrimination bar-code size was 6 mm high x 8.5 mm long. Bar-codes on the bottom surface could be more easily recognized than bar-codes on the side. Our newly-developed device using bar-codes enables visually disabled persons to differentiate eye drops and their doses.

Detection of dopamine in dopaminergic cell using nanoparticles-based barcode DNA analysis.

PubMed

An, Jeung Hee; Kim, Tae-Hyung; Oh, Byung-Keun; Choi, Jeong Woo

2012-01-01

Nanotechnology-based bio-barcode-amplification analysis may be an innovative approach to dopamine detection. In this study, we evaluated the efficacy of this bio-barcode DNA method in detecting dopamine from dopaminergic cells. Herein, a combination DNA barcode and bead-based immunoassay for neurotransmitter detection with PCR-like sensitivity is described. This method relies on magnetic nanoparticles with antibodies and nanoparticles that are encoded with DNA, and antibodies that can sandwich the target protein captured by the nanoparticle-bound antibodies. The aggregate sandwich structures are magnetically separated from solution, and treated in order to remove the conjugated barcode DNA. The DNA barcodes were then identified via PCR analysis. The dopamine concentration in dopaminergic cells can be readily and rapidly detected via the bio-barcode assay method. The bio-barcode assay method is, therefore, a rapid and high-throughput screening tool for the detection of neurotransmitters such as dopamine.

RFID in Space: Exploring the Feasibility and Performance of Gen 2 Tags as a Means of Tracking Equipment, Supplies, and Consumable Products in Cargo Transport Bags onboard a Space Vehicle or Habitat

NASA Technical Reports Server (NTRS)

Jones, Erick C.; Richards, Casey; Herstein, Kelli; Franca, Rodrigo; Yagoda, Evan L.; Vasquez, Reuben

2008-01-01

Current inventory management techniques for consumables and supplies aboard space vehicles are burdensome and time consuming. Inventory of food, clothing, and supplies are taken periodically by manually scanning the barcodes on each item. The inaccuracy of reading barcodes and the excessive amount of time it takes for the astronauts to perform this function would be better spent doing scientific experiments. Therefore, there is a need for an alternative method of inventory control by NASA astronauts. Radio Frequency Identification (RFID) is an automatic data capture technology that has potential to create a more effective and user-friendly inventory management system (IMS). In this paper we introduce a Design for Six Sigma Research (DFSS-R) methodology that allows for reliability testing of RFID systems. The research methodology uses a modified sequential design of experiments process to test and evaluate the quality of commercially available RFID technology. The results from the experimentation are compared to the requirements provided by NASA to evaluate the feasibility of using passive Generation 2 RFID technology to improve inventory control aboard crew exploration vehicles.

Evaluation of candidate barcoding markers in Orinus (Poaceae).

PubMed

Su, X; Liu, Y P; Chen, Z; Chen, K L

2016-04-26

Orinus is an alpine endemic genus of Poaceae. Because of the imperfect specimens, high level of intraspecific morphological variability, and homoplasies of morphological characters, it is relatively difficult to delimitate species of Orinus by using morphology alone. To this end, the DNA barcoding has shown great potential in identifying species. The present study is the first attempt to test the feasibility of four proposed DNA barcoding markers (matK, rbcL, trnH-psbA, and ITS) in identifying four currently revised species of Orinus from the Qinghai-Tibetan Plateau (QTP). Among all the single-barcode candidates, the differentiation power was the highest for the nuclear internal transcribed spacer (ITS), while the chloroplast barcodes matK (M), rbcL (R), and trnH-psbA (H) could not identify the species. Meanwhile, the differentiation efficiency of the nuclear ITS (I) was also higher than any two- or three-locus combination of chloroplast barcodes, or even a combination of ITS and any chloroplast barcode except H + I and R + I. All the combinations of chloroplast barcodes plus the nuclear ITS, H + I, and R + I differentiated the highest portion of species. The highest differentiation rate for the barcodes or barcode combinations examined here was 100% (H + I and R + I). In summary, this case study showed that the nuclear ITS region represents a more promising barcode than any maternally inherited chloroplast region or combination of chloroplast regions in differentiating Orinus species from the QTP. Moreover, combining the ITS region with chloroplast regions may improve the barcoding success rate.

Data Release: DNA barcodes of plant species collected for the Global Genome Initiative for Gardens Program, National Museum of Natural History, Smithsonian Institution

PubMed Central

Zúñiga, Jose D.; Gostel, Morgan R.; Mulcahy, Daniel G.; Barker, Katharine; Asia Hill; Sedaghatpour, Maryam; Vo, Samantha Q.; Funk, Vicki A.; Coddington, Jonathan A.

2017-01-01

Abstract The Global Genome Initiative has sequenced and released 1961 DNA barcodes for genetic samples obtained as part of the Global Genome Initiative for Gardens Program. The dataset includes barcodes for 29 plant families and 309 genera that did not have sequences flagged as barcodes in GenBank and sequences from officially recognized barcoding genetic markers meet the data standard of the Consortium for the Barcode of Life. The genetic samples were deposited in the Smithsonian Institution’s National Museum of Natural History Biorepository and their records were made public through the Global Genome Biodiversity Network’s portal. The DNA barcodes are now available on GenBank. PMID:29118648

DNA barcoding the floras of biodiversity hotspots.

PubMed

Lahaye, Renaud; van der Bank, Michelle; Bogarin, Diego; Warner, Jorge; Pupulin, Franco; Gigot, Guillaume; Maurin, Olivier; Duthoit, Sylvie; Barraclough, Timothy G; Savolainen, Vincent

2008-02-26

DNA barcoding is a technique in which species identification is performed by using DNA sequences from a small fragment of the genome, with the aim of contributing to a wide range of ecological and conservation studies in which traditional taxonomic identification is not practical. DNA barcoding is well established in animals, but there is not yet any universally accepted barcode for plants. Here, we undertook intensive field collections in two biodiversity hotspots (Mesoamerica and southern Africa). Using >1,600 samples, we compared eight potential barcodes. Going beyond previous plant studies, we assessed to what extent a "DNA barcoding gap" is present between intra- and interspecific variations, using multiple accessions per species. Given its adequate rate of variation, easy amplification, and alignment, we identified a portion of the plastid matK gene as a universal DNA barcode for flowering plants. Critically, we further demonstrate the applicability of DNA barcoding for biodiversity inventories. In addition, analyzing >1,000 species of Mesoamerican orchids, DNA barcoding with matK alone reveals cryptic species and proves useful in identifying species listed in Convention on International Trade of Endangered Species (CITES) appendixes.

DNA barcoding the floras of biodiversity hotspots

PubMed Central

Lahaye, Renaud; van der Bank, Michelle; Bogarin, Diego; Warner, Jorge; Pupulin, Franco; Gigot, Guillaume; Maurin, Olivier; Duthoit, Sylvie; Barraclough, Timothy G.; Savolainen, Vincent

2008-01-01

DNA barcoding is a technique in which species identification is performed by using DNA sequences from a small fragment of the genome, with the aim of contributing to a wide range of ecological and conservation studies in which traditional taxonomic identification is not practical. DNA barcoding is well established in animals, but there is not yet any universally accepted barcode for plants. Here, we undertook intensive field collections in two biodiversity hotspots (Mesoamerica and southern Africa). Using >1,600 samples, we compared eight potential barcodes. Going beyond previous plant studies, we assessed to what extent a “DNA barcoding gap” is present between intra- and interspecific variations, using multiple accessions per species. Given its adequate rate of variation, easy amplification, and alignment, we identified a portion of the plastid matK gene as a universal DNA barcode for flowering plants. Critically, we further demonstrate the applicability of DNA barcoding for biodiversity inventories. In addition, analyzing >1,000 species of Mesoamerican orchids, DNA barcoding with matK alone reveals cryptic species and proves useful in identifying species listed in Convention on International Trade of Endangered Species (CITES) appendixes. PMID:18258745

Tamper-indicating barcode and method

DOEpatents

Cummings, Eric B.; Even, Jr., William R.; Simmons, Blake A.; Dentinger, Paul Michael

2005-03-22

A novel tamper-indicating barcode methodology is disclosed that allows for detection of alteration to the barcode. The tamper-indicating methodology makes use of a tamper-indicating means that may be comprised of a particulate indicator, an optical indicator, a deformable substrate, and/or may be an integrated aspect of the barcode itself. This tamper-indicating information provides greater security for the contents of containers sealed with the tamper-indicating barcodes.

DNA barcoding reveals a cryptic nemertean invasion in Atlantic and Mediterranean waters

NASA Astrophysics Data System (ADS)

Fernández-Álvarez, Fernando Ángel; Machordom, Annie

2013-09-01

For several groups, like nemerteans, morphology-based identification is a hard discipline, but DNA barcoding may help non-experts in the identification process. In this study, DNA barcoding is used to reveal the cryptic invasion of Pacific Cephalothrix cf. simula into Atlantic and Mediterranean coasts. Although DNA barcoding is a promising method for the identification of Nemertea, only 6 % of the known number of nemertean species is currently associated with a correct DNA barcode. Therefore, additional morphological and molecular studies are necessary to advance the utility of DNA barcoding in the characterisation of possible nemertean alien invasions.

Evaluation of the DNA barcodes in Dendrobium (Orchidaceae) from mainland Asia.

PubMed

Xu, Songzhi; Li, Dezhu; Li, Jianwu; Xiang, Xiaoguo; Jin, Weitao; Huang, Weichang; Jin, Xiaohua; Huang, Luqi

2015-01-01

DNA barcoding has been proposed to be one of the most promising tools for accurate and rapid identification of taxa. However, few publications have evaluated the efficiency of DNA barcoding for the large genera of flowering plants. Dendrobium, one of the largest genera of flowering plants, contains many species that are important in horticulture, medicine and biodiversity conservation. Besides, Dendrobium is a notoriously difficult group to identify. DNA barcoding was expected to be a supplementary means for species identification, conservation and future studies in Dendrobium. We assessed the power of 11 candidate barcodes on the basis of 1,698 accessions of 184 Dendrobium species obtained primarily from mainland Asia. Our results indicated that five single barcodes, i.e., ITS, ITS2, matK, rbcL and trnH-psbA, can be easily amplified and sequenced with the currently established primers. Four barcodes, ITS, ITS2, ITS+matK, and ITS2+matK, have distinct barcoding gaps. ITS+matK was the optimal barcode based on all evaluation methods. Furthermore, the efficiency of ITS+matK was verified in four other large genera including Ficus, Lysimachia, Paphiopedilum, and Pedicularis in this study. Therefore, we tentatively recommend the combination of ITS+matK as a core DNA barcode for large flowering plant genera.

Evaluation of the DNA Barcodes in Dendrobium (Orchidaceae) from Mainland Asia

PubMed Central

Xu, Songzhi; Li, Dezhu; Li, Jianwu; Xiang, Xiaoguo; Jin, Weitao; Huang, Weichang; Jin, Xiaohua; Huang, Luqi

2015-01-01

DNA barcoding has been proposed to be one of the most promising tools for accurate and rapid identification of taxa. However, few publications have evaluated the efficiency of DNA barcoding for the large genera of flowering plants. Dendrobium, one of the largest genera of flowering plants, contains many species that are important in horticulture, medicine and biodiversity conservation. Besides, Dendrobium is a notoriously difficult group to identify. DNA barcoding was expected to be a supplementary means for species identification, conservation and future studies in Dendrobium. We assessed the power of 11 candidate barcodes on the basis of 1,698 accessions of 184 Dendrobium species obtained primarily from mainland Asia. Our results indicated that five single barcodes, i.e., ITS, ITS2, matK, rbcL and trnH-psbA, can be easily amplified and sequenced with the currently established primers. Four barcodes, ITS, ITS2, ITS+matK, and ITS2+matK, have distinct barcoding gaps. ITS+matK was the optimal barcode based on all evaluation methods. Furthermore, the efficiency of ITS+matK was verified in four other large genera including Ficus, Lysimachia, Paphiopedilum, and Pedicularis in this study. Therefore, we tentatively recommend the combination of ITS+matK as a core DNA barcode for large flowering plant genera. PMID:25602282

Automated Interactive Storeroom Inventory System.

ERIC Educational Resources Information Center

Sapp, Albert L.; Hess, Larry G.

1989-01-01

The inventory system designed for six storerooms in three buildings at the University of Illinois at Urbana-Champaign's School of Chemical Sciences replaced an issue-slip and transactions record system with barcode technology. Data collection error reductions have been significant, making it easier to determine stock levels and plan purchases.…

Things the Teacher of Your Media Utilization Course May Not Have Told You.

ERIC Educational Resources Information Center

Ekhaml, Leticia

1995-01-01

Discusses maintenance and safety information that may not be covered in a technology training program. Topics include computers, printers, televisions, video and audio equipment, electric roll laminators, overhead and slide projectors, equipment carts, power cords and outlets, batteries, darkrooms, barcode readers, Liquid Crystal Display units,…

Building a DNA barcode library of Alaska's non-marine arthropods.

PubMed

Sikes, Derek S; Bowser, Matthew; Morton, John M; Bickford, Casey; Meierotto, Sarah; Hildebrandt, Kyndall

2017-03-01

Climate change may result in ecological futures with novel species assemblages, trophic mismatch, and mass extinction. Alaska has a limited taxonomic workforce to address these changes. We are building a DNA barcode library to facilitate a metabarcoding approach to monitoring non-marine arthropods. Working with the Canadian Centre for DNA Barcoding, we obtained DNA barcodes from recently collected and authoritatively identified specimens in the University of Alaska Museum (UAM) Insect Collection and the Kenai National Wildlife Refuge collection. We submitted tissues from 4776 specimens, of which 81% yielded DNA barcodes representing 1662 species and 1788 Barcode Index Numbers (BINs), of primarily terrestrial, large-bodied arthropods. This represents 84% of the species available for DNA barcoding in the UAM Insect Collection. There are now 4020 Alaskan arthropod species represented by DNA barcodes, after including all records in Barcode of Life Data Systems (BOLD) of species that occur in Alaska - i.e., 48.5% of the 8277 Alaskan, non-marine-arthropod, named species have associated DNA barcodes. An assessment of the identification power of the library in its current state yielded fewer species-level identifications than expected, but the results were not discouraging. We believe we are the first to deliberately begin development of a DNA barcode library of the entire arthropod fauna for a North American state or province. Although far from complete, this library will become increasingly valuable as more species are added and costs to obtain DNA sequences fall.

Species-specific identification from incomplete sampling: applying DNA barcodes to monitoring invasive solanum plants.

PubMed

Zhang, Wei; Fan, Xiaohong; Zhu, Shuifang; Zhao, Hong; Fu, Lianzhong

2013-01-01

Comprehensive sampling is crucial to DNA barcoding, but it is rarely performed because materials are usually unavailable. In practice, only a few rather than all species of a genus are required to be identified. Thus identification of a given species using a limited sample is of great importance in current application of DNA barcodes. Here, we selected 70 individuals representing 48 species from each major lineage of Solanum, one of the most species-rich genera of seed plants, to explore whether DNA barcodes can provide reliable specific-species discrimination in the context of incomplete sampling. Chloroplast genes ndhF and trnS-trnG and the nuclear gene waxy, the commonly used markers in Solanum phylogeny, were selected as the supplementary barcodes. The tree-building and modified barcode gap methods were employed to assess species resolution. The results showed that four Solanum species of quarantine concern could be successfully identified through the two-step barcoding sampling strategy. In addition, discrepancies between nuclear and cpDNA barcodes in some samples demonstrated the ability to discriminate hybrid species, and highlights the necessity of using barcode regions with different modes of inheritance. We conclude that efficient phylogenetic markers are good candidates as the supplementary barcodes in a given taxonomic group. Critically, we hypothesized that a specific-species could be identified from a phylogenetic framework using incomplete sampling-through this, DNA barcoding will greatly benefit the current fields of its application.

A lateral electrophoretic flow diagnostic assay

PubMed Central

Lin, Robert; Skandarajah, Arunan; Gerver, Rachel E.; Neira, Hector D.; Fletcher, Daniel A.

2015-01-01

Immunochromatographic assays are a cornerstone tool in disease screening. To complement existing lateral flow assays (based on wicking flow) we introduce a lateral flow format that employs directed electrophoretic transport. The format is termed a “lateral e-flow assay” and is designed to support multiplexed detection using immobilized reaction volumes of capture antigen. To fabricate the lateral e-flow device, we employ mask-based UV photopatterning to selectively immobilize unmodified capture antigen along the microchannel in a barcode-like pattern. The channel-filling polyacrylamide hydrogel incorporates a photoactive moiety (benzophenone) to immobilize capture antigen to the hydrogel without a priori antigen modification. We report a heterogeneous sandwich assay using low-power electrophoresis to drive biospecimen through the capture antigen barcode. Fluorescence barcode readout is collected via a low-resource appropriate imaging system (CellScope). We characterize lateral e-flow assay performance and demonstrate a serum assay for antibodies to the hepatitis C virus (HCV). In a pilot study, the lateral e-flow assay positively identifies HCV+ human sera in 60 min. The lateral e-flow assay provides a flexible format for conducting multiplexed immunoassays relevant to confirmatory diagnosis in near-patient settings. PMID:25608872

Generation and analysis of a barcode-tagged insertion mutant library in the fission yeast Schizosaccharomyces pombe.

PubMed

Chen, Bo-Ruei; Hale, Devin C; Ciolek, Peter J; Runge, Kurt W

2012-05-03

Barcodes are unique DNA sequence tags that can be used to specifically label individual mutants. The barcode-tagged open reading frame (ORF) haploid deletion mutant collections in the budding yeast Saccharomyces cerevisiae and the fission yeast Schizosaccharomyces pombe allow for high-throughput mutant phenotyping because the relative growth of mutants in a population can be determined by monitoring the proportions of their associated barcodes. While these mutant collections have greatly facilitated genome-wide studies, mutations in essential genes are not present, and the roles of these genes are not as easily studied. To further support genome-scale research in S. pombe, we generated a barcode-tagged fission yeast insertion mutant library that has the potential of generating viable mutations in both essential and non-essential genes and can be easily analyzed using standard molecular biological techniques. An insertion vector containing a selectable ura4+ marker and a random barcode was used to generate a collection of 10,000 fission yeast insertion mutants stored individually in 384-well plates and as six pools of mixed mutants. Individual barcodes are flanked by Sfi I recognition sites and can be oligomerized in a unique orientation to facilitate barcode sequencing. Independent genetic screens on a subset of mutants suggest that this library contains a diverse collection of single insertion mutations. We present several approaches to determine insertion sites. This collection of S. pombe barcode-tagged insertion mutants is well-suited for genome-wide studies. Because insertion mutations may eliminate, reduce or alter the function of essential and non-essential genes, this library will contain strains with a wide range of phenotypes that can be assayed by their associated barcodes. The design of the barcodes in this library allows for barcode sequencing using next generation or standard benchtop cloning approaches.

The chaperonin-60 universal target is a barcode for bacteria that enables de novo assembly of metagenomic sequence data.

PubMed

Links, Matthew G; Dumonceaux, Tim J; Hemmingsen, Sean M; Hill, Janet E

2012-01-01

Barcoding with molecular sequences is widely used to catalogue eukaryotic biodiversity. Studies investigating the community dynamics of microbes have relied heavily on gene-centric metagenomic profiling using two genes (16S rRNA and cpn60) to identify and track Bacteria. While there have been criteria formalized for barcoding of eukaryotes, these criteria have not been used to evaluate gene targets for other domains of life. Using the framework of the International Barcode of Life we evaluated DNA barcodes for Bacteria. Candidates from the 16S rRNA gene and the protein coding cpn60 gene were evaluated. Within complete bacterial genomes in the public domain representing 983 species from 21 phyla, the largest difference between median pairwise inter- and intra-specific distances ("barcode gap") was found from cpn60. Distribution of sequence diversity along the ∼555 bp cpn60 target region was remarkably uniform. The barcode gap of the cpn60 universal target facilitated the faithful de novo assembly of full-length operational taxonomic units from pyrosequencing data from a synthetic microbial community. Analysis supported the recognition of both 16S rRNA and cpn60 as DNA barcodes for Bacteria. The cpn60 universal target was found to have a much larger barcode gap than 16S rRNA suggesting cpn60 as a preferred barcode for Bacteria. A large barcode gap for cpn60 provided a robust target for species-level characterization of data. The assembly of consensus sequences for barcodes was shown to be a reliable method for the identification and tracking of novel microbes in metagenomic studies.

Accelerated construction of a regional DNA-barcode reference library: Caddisflies (Trichoptera) in the Great Smoky Mountains National Park

USGS Publications Warehouse

Zhou, X.; Robinson, J.L.; Geraci, C.J.; Parker, C.R.; Flint, O.S.; Etnier, D.A.; Ruiter, D.; DeWalt, R.E.; Jacobus, L.M.; Hebert, P.D.N.

2011-01-01

Deoxyribonucleic acid (DNA) barcoding is an effective tool for species identification and lifestage association in a wide range of animal taxa. We developed a strategy for rapid construction of a regional DNA-barcode reference library and used the caddisflies (Trichoptera) of the Great Smoky Mountains National Park (GSMNP) as a model. Nearly 1000 cytochrome c oxidase subunit I (COI) sequences, representing 209 caddisfly species previously recorded from GSMNP, were obtained from the global Trichoptera Barcode of Life campaign. Most of these sequences were collected from outside the GSMNP area. Another 645 COI sequences, representing 80 species, were obtained from specimens collected in a 3-d bioblitz (short-term, intense sampling program) in GSMNP. The joint collections provided barcode coverage for 212 species, 91% of the GSMNP fauna. Inclusion of samples from other localities greatly expedited construction of the regional DNA-barcode reference library. This strategy increased intraspecific divergence and decreased average distances to nearest neighboring species, but the DNA-barcode library was able to differentiate 93% of the GSMNP Trichoptera species examined. Global barcoding projects will aid construction of regional DNA-barcode libraries, but local surveys make crucial contributions to progress by contributing rare or endemic species and full-length barcodes generated from high-quality DNA. DNA taxonomy is not a goal of our present work, but the investigation of COI divergence patterns in caddisflies is providing new insights into broader biodiversity patterns in this group and has directed attention to various issues, ranging from the need to re-evaluate species taxonomy with integrated morphological and molecular evidence to the necessity of an appropriate interpretation of barcode analyses and its implications in understanding species diversity (in contrast to a simple claim for barcoding failure).

Combining and Comparing Coalescent, Distance and Character-Based Approaches for Barcoding Microalgaes: A Test with Chlorella-Like Species (Chlorophyta).

PubMed

Zou, Shanmei; Fei, Cong; Song, Jiameng; Bao, Yachao; He, Meilin; Wang, Changhai

2016-01-01

Several different barcoding methods of distinguishing species have been advanced, but which method is the best is still controversial. Chlorella is becoming particularly promising in the development of second-generation biofuels. However, the taxonomy of Chlorella-like organisms is easily confused. Here we report a comprehensive barcoding analysis of Chlorella-like species from Chlorella, Chloroidium, Dictyosphaerium and Actinastrum based on rbcL, ITS, tufA and 16S sequences to test the efficiency of traditional barcoding, GMYC, ABGD, PTP, P ID and character-based barcoding methods. First of all, the barcoding results gave new insights into the taxonomic assessment of Chlorella-like organisms studied, including the clear species discrimination and resolution of potentially cryptic species complexes in C. sorokiniana, D. ehrenbergianum and C. Vulgaris. The tufA proved to be the most efficient barcoding locus, which thus could be as potential "specific barcode" for Chlorella-like species. The 16S failed in discriminating most closely related species. The resolution of GMYC, PTP, P ID, ABGD and character-based barcoding methods were variable among rbcL, ITS and tufA genes. The best resolution for species differentiation appeared in tufA analysis where GMYC, PTP, ABGD and character-based approaches produced consistent groups while the PTP method over-split the taxa. The character analysis of rbcL, ITS and tufA sequences could clearly distinguish all taxonomic groups respectively, including the potentially cryptic lineages, with many character attributes. Thus, the character-based barcoding provides an attractive complement to coalescent and distance-based barcoding. Our study represents the test that proves the efficiency of multiple DNA barcoding in species discrimination of microalgaes.

DNA Barcoding of genus Hexacentrus in China reveals cryptic diversity within Hexacentrus japonicus (Orthoptera, Tettigoniidae).

PubMed

Guo, Hui-Fang; Guan, Bei; Shi, Fu-Ming; Zhou, Zhi-Jun

2016-01-01

DNA barcoding has been proved successful to provide resolution beyond the boundaries of morphological information. Hence, a study was undertaken to establish DNA barcodes for all morphologically determined Hexacentrus species in China collections. In total, 83 specimens of five Hexacentrus species were barcoded using standard mitochondrial cytochrome c oxidase subunit I (COI) gene. Except for Hexacentrus japonicus, barcode gaps were present in the remaining Hexacentrus species. Taxon ID tree generated seven BOLD's barcode index numbers (BINs), four of which were in agreement with the morphological species. For Hexacentrus japonicus, the maximum intraspecific divergence (4.43%) produced a minimal overlap (0.64%), and 19 specimens were divided into three different BINs. There may be cryptic species within the current Hexacentrus japonicus. This study adds to a growing body of DNA barcodes that have become available for katydids, and shows that a DNA barcoding approach enables the identification of known Hexacentrus species with a very high resolution.

DNA Barcoding of genus Hexacentrus in China reveals cryptic diversity within Hexacentrus japonicus (Orthoptera, Tettigoniidae)

PubMed Central

Guo, Hui-Fang; Guan, Bei; Shi, Fu-Ming; Zhou, Zhi-Jun

2016-01-01

Abstract DNA barcoding has been proved successful to provide resolution beyond the boundaries of morphological information. Hence, a study was undertaken to establish DNA barcodes for all morphologically determined Hexacentrus species in China collections. In total, 83 specimens of five Hexacentrus species were barcoded using standard mitochondrial cytochrome c oxidase subunit I (COI) gene. Except for Hexacentrus japonicus, barcode gaps were present in the remaining Hexacentrus species. Taxon ID tree generated seven BOLD’s barcode index numbers (BINs), four of which were in agreement with the morphological species. For Hexacentrus japonicus, the maximum intraspecific divergence (4.43%) produced a minimal overlap (0.64%), and 19 specimens were divided into three different BINs. There may be cryptic species within the current Hexacentrus japonicus. This study adds to a growing body of DNA barcodes that have become available for katydids, and shows that a DNA barcoding approach enables the identification of known Hexacentrus species with a very high resolution. PMID:27408576

Systematic and Evolutionary Insights Derived from mtDNA COI Barcode Diversity in the Decapoda (Crustacea: Malacostraca)

PubMed Central

Matzen da Silva, Joana; Creer, Simon; dos Santos, Antonina; Costa, Ana C.; Cunha, Marina R.; Costa, Filipe O.; Carvalho, Gary R.

2011-01-01

Background Decapods are the most recognizable of all crustaceans and comprise a dominant group of benthic invertebrates of the continental shelf and slope, including many species of economic importance. Of the 17635 morphologically described Decapoda species, only 5.4% are represented by COI barcode region sequences. It therefore remains a challenge to compile regional databases that identify and analyse the extent and patterns of decapod diversity throughout the world. Methodology/Principal Findings We contributed 101 decapod species from the North East Atlantic, the Gulf of Cadiz and the Mediterranean Sea, of which 81 species represent novel COI records. Within the newly-generated dataset, 3.6% of the species barcodes conflicted with the assigned morphological taxonomic identification, highlighting both the apparent taxonomic ambiguity among certain groups, and the need for an accelerated and independent taxonomic approach. Using the combined COI barcode projects from the Barcode of Life Database, we provide the most comprehensive COI data set so far examined for the Order (1572 sequences of 528 species, 213 genera, and 67 families). Patterns within families show a general predicted molecular hierarchy, but the scale of divergence at each taxonomic level appears to vary extensively between families. The range values of mean K2P distance observed were: within species 0.285% to 1.375%, within genus 6.376% to 20.924% and within family 11.392% to 25.617%. Nucleotide composition varied greatly across decapods, ranging from 30.8 % to 49.4 % GC content. Conclusions/Significance Decapod biological diversity was quantified by identifying putative cryptic species allowing a rapid assessment of taxon diversity in groups that have until now received limited morphological and systematic examination. We highlight taxonomic groups or species with unusual nucleotide composition or evolutionary rates. Such data are relevant to strategies for conservation of existing decapod biodiversity, as well as elucidating the mechanisms and constraints shaping the patterns observed. PMID:21589909

Choosing and Using a Plant DNA Barcode

PubMed Central

Hollingsworth, Peter M.; Graham, Sean W.; Little, Damon P.

2011-01-01

The main aim of DNA barcoding is to establish a shared community resource of DNA sequences that can be used for organismal identification and taxonomic clarification. This approach was successfully pioneered in animals using a portion of the cytochrome oxidase 1 (CO1) mitochondrial gene. In plants, establishing a standardized DNA barcoding system has been more challenging. In this paper, we review the process of selecting and refining a plant barcode; evaluate the factors which influence the discriminatory power of the approach; describe some early applications of plant barcoding and summarise major emerging projects; and outline tool development that will be necessary for plant DNA barcoding to advance. PMID:21637336

Barcodes for genomes and applications

PubMed Central

Zhou, Fengfeng; Olman, Victor; Xu, Ying

2008-01-01

Background Each genome has a stable distribution of the combined frequency for each k-mer and its reverse complement measured in sequence fragments as short as 1000 bps across the whole genome, for 1

Single molecule counting and assessment of random molecular tagging errors with transposable giga-scale error-correcting barcodes.

PubMed

Lau, Billy T; Ji, Hanlee P

2017-09-21

RNA-Seq measures gene expression by counting sequence reads belonging to unique cDNA fragments. Molecular barcodes commonly in the form of random nucleotides were recently introduced to improve gene expression measures by detecting amplification duplicates, but are susceptible to errors generated during PCR and sequencing. This results in false positive counts, leading to inaccurate transcriptome quantification especially at low input and single-cell RNA amounts where the total number of molecules present is minuscule. To address this issue, we demonstrated the systematic identification of molecular species using transposable error-correcting barcodes that are exponentially expanded to tens of billions of unique labels. We experimentally showed random-mer molecular barcodes suffer from substantial and persistent errors that are difficult to resolve. To assess our method's performance, we applied it to the analysis of known reference RNA standards. By including an inline random-mer molecular barcode, we systematically characterized the presence of sequence errors in random-mer molecular barcodes. We observed that such errors are extensive and become more dominant at low input amounts. We described the first study to use transposable molecular barcodes and its use for studying random-mer molecular barcode errors. Extensive errors found in random-mer molecular barcodes may warrant the use of error correcting barcodes for transcriptome analysis as input amounts decrease.

Barcoded microchips for biomolecular assays.

PubMed

Zhang, Yi; Sun, Jiashu; Zou, Yu; Chen, Wenwen; Zhang, Wei; Xi, Jianzhong Jeff; Jiang, Xingyu

2015-01-20

Multiplexed assay of analytes is of great importance for clinical diagnostics and other analytical applications. Barcode-based bioassays with the ability to encode and decode may realize this goal in a straightforward and consistent manner. We present here a microfluidic barcoded chip containing several sets of microchannels with different widths, imitating the commonly used barcode. A single barcoded microchip can carry out tens of individual protein/nucleic acid assays (encode) and immediately yield all assay results by a portable barcode reader or a smartphone (decode). The applicability of a barcoded microchip is demonstrated by human immunodeficiency virus (HIV) immunoassays for simultaneous detection of three targets (anti-gp41 antibody, anti-gp120 antibody, and anti-gp36 antibody) from six human serum samples. We can also determine seven pathogen-specific oligonucleotides by a single chip containing both positive and negative controls.

Barcoding Sponges: An Overview Based on Comprehensive Sampling

PubMed Central

Vargas, Sergio; Schuster, Astrid; Sacher, Katharina; Büttner, Gabrielle; Schätzle, Simone; Läuchli, Benjamin; Hall, Kathryn; Hooper, John N. A.; Erpenbeck, Dirk; Wörheide, Gert

2012-01-01

Background Phylum Porifera includes ∼8,500 valid species distributed world-wide in aquatic ecosystems ranging from ephemeral fresh-water bodies to coastal environments and the deep-sea. The taxonomy and systematics of sponges is complicated, and morphological identification can be both time consuming and erroneous due to phenotypic convergence and secondary losses, etc. DNA barcoding can provide sponge biologists with a simple and rapid method for the identification of samples of unknown taxonomic membership. The Sponge Barcoding Project (www.spongebarcoding.org), the first initiative to barcode a non-bilaterian metazoan phylum, aims to provide a comprehensive DNA barcode database for Phylum Porifera. Methodology/Principal Findings ∼7,400 sponge specimens have been extracted, and amplification of the standard COI barcoding fragment has been attempted for approximately 3,300 museum samples with ∼25% mean amplification success. Based on this comprehensive sampling, we present the first report on the workflow and progress of the sponge barcoding project, and discuss some common pitfalls inherent to the barcoding of sponges. Conclusion A DNA-barcoding workflow capable of processing potentially large sponge collections has been developed and is routinely used for the Sponge Barcoding Project with success. Sponge specific problems such as the frequent co-amplification of non-target organisms have been detected and potential solutions are currently under development. The initial success of this innovative project have already demonstrated considerable refinement of sponge systematics, evaluating morphometric character importance, geographic phenotypic variability, and the utility of the standard barcoding fragment for Porifera (despite its conserved evolution within this basal metazoan phylum). PMID:22802937

Behavioral barcoding in the cloud: embracing data-intensive digital phenotyping in neuropharmacology.

PubMed

Kokel, David; Rennekamp, Andrew J; Shah, Asmi H; Liebel, Urban; Peterson, Randall T

2012-08-01

For decades, studying the behavioral effects of individual drugs and genetic mutations has been at the heart of efforts to understand and treat nervous system disorders. High-throughput technologies adapted from other disciplines (e.g., high-throughput chemical screening, genomics) are changing the scale of data acquisition in behavioral neuroscience. Massive behavioral datasets are beginning to emerge, particularly from zebrafish labs, where behavioral assays can be performed rapidly and reproducibly in 96-well, high-throughput format. Mining these datasets and making comparisons across different assays are major challenges for the field. Here, we review behavioral barcoding, a process by which complex behavioral assays are reduced to a string of numeric features, facilitating analysis and comparison within and across datasets. Copyright © 2012 Elsevier Ltd. All rights reserved.

Fluorescence bio-barcode DNA assay based on gold and magnetic nanoparticles for detection of Exotoxin A gene sequence.

PubMed

Amini, Bahram; Kamali, Mehdi; Salouti, Mojtaba; Yaghmaei, Parichehreh

2017-06-15

Bio-barcode DNA based on gold nanoparticle (bDNA-GNPs) as a new generation of biosensor based detection tools, holds promise for biological science studies. They are of enormous importance in the emergence of rapid and sensitive procedures for detecting toxins of microorganisms. Exotoxin A (ETA) is the most toxic virulence factor of Pseudomonas aeruginosa. ETA has ADP-ribosylation activity and decisively affects the protein synthesis of the host cells. In the present study, we developed a fluorescence bio-barcode technology to trace P. aeruginosa ETA. The GNPs were coated with the first target-specific DNA probe 1 (1pDNA) and bio-barcode DNA, which acted as a signal reporter. The magnetic nanoparticles (MNPs) were coated with the second target-specific DNA probe 2 (2pDNA) that was able to recognize the other end of the target DNA. After binding the nanoparticles with the target DNA, the following sandwich structure was formed: MNP 2pDNA/tDNA/1pDNA-GNP-bDNA. After isolating the sandwiches by a magnetic field, the DNAs of the probes which have been hybridized to their complementary DNA, GNPs and MNPs, via the hydrogen, electrostatic and covalently bonds, were released from the sandwiches after dissolving in dithiothreitol solution (DTT 0.8M). This bio-barcode DNA with known DNA sequence was then detected by fluorescence spectrophotometry. The findings showed that the new method has the advantages of fast, high sensitivity (the detection limit was 1.2ng/ml), good selectivity, and wide linear range of 5-200ng/ml. The regression analysis also showed that there was a good linear relationship (∆F=0.57 [target DNA]+21.31, R 2 =0.9984) between the fluorescent intensity and the target DNA concentration in the samples. Copyright © 2016. Published by Elsevier B.V.

BioMaS: a modular pipeline for Bioinformatic analysis of Metagenomic AmpliconS.

PubMed

Fosso, Bruno; Santamaria, Monica; Marzano, Marinella; Alonso-Alemany, Daniel; Valiente, Gabriel; Donvito, Giacinto; Monaco, Alfonso; Notarangelo, Pasquale; Pesole, Graziano

2015-07-01

Substantial advances in microbiology, molecular evolution and biodiversity have been carried out in recent years thanks to Metagenomics, which allows to unveil the composition and functions of mixed microbial communities in any environmental niche. If the investigation is aimed only at the microbiome taxonomic structure, a target-based metagenomic approach, here also referred as Meta-barcoding, is generally applied. This approach commonly involves the selective amplification of a species-specific genetic marker (DNA meta-barcode) in the whole taxonomic range of interest and the exploration of its taxon-related variants through High-Throughput Sequencing (HTS) technologies. The accessibility to proper computational systems for the large-scale bioinformatic analysis of HTS data represents, currently, one of the major challenges in advanced Meta-barcoding projects. BioMaS (Bioinformatic analysis of Metagenomic AmpliconS) is a new bioinformatic pipeline designed to support biomolecular researchers involved in taxonomic studies of environmental microbial communities by a completely automated workflow, comprehensive of all the fundamental steps, from raw sequence data upload and cleaning to final taxonomic identification, that are absolutely required in an appropriately designed Meta-barcoding HTS-based experiment. In its current version, BioMaS allows the analysis of both bacterial and fungal environments starting directly from the raw sequencing data from either Roche 454 or Illumina HTS platforms, following two alternative paths, respectively. BioMaS is implemented into a public web service available at https://recasgateway.ba.infn.it/ and is also available in Galaxy at http://galaxy.cloud.ba.infn.it:8080 (only for Illumina data). BioMaS is a friendly pipeline for Meta-barcoding HTS data analysis specifically designed for users without particular computing skills. A comparative benchmark, carried out by using a simulated dataset suitably designed to broadly represent the currently known bacterial and fungal world, showed that BioMaS outperforms QIIME and MOTHUR in terms of extent and accuracy of deep taxonomic sequence assignments.

Managing Archival Collections in an Automated Environment: The Joys of Barcoding

ERIC Educational Resources Information Center

Hamburger, Susan; Charles, Jane Veronica

2006-01-01

In a desire for automated collection control, archival repositories are adopting barcoding from their library and records center colleagues. This article discusses the planning, design, and implementation phases of barcoding. The authors focus on reasons for barcoding, security benefits, in-room circulation tracking, potential for gathering…

An example of how barcodes can clarify cryptic species: the case of the calanoid copepod Mastigodiaptomus albuquerquensis (Herrick).

PubMed

Gutiérrez-Aguirre, Martha Angélica; Cervantes-Martínez, Adrián; Elías-Gutiérrez, Manuel

2014-01-01

The freshwater calanoid Mastigodiaptomus is a genus with high richness in the Americas and is composed of nine species, seven recorded in Mexico and four that are apparently endemic to small areas. Mastigodiaptomus albuquerquensis is a common, widely distributed species ranging from the southern USA to Central America. This species can be easily identified by a notable butterfly-like sclerotization on the basis of the right fifth leg of males. Nevertheless, morphological differences observed among populations throughout this species distributional range have led to the description of several related species or subspecies, such as M. albuquerquensis patzcuarensis from Lake Pátzcuaro in the Central Plateau of Mexico. Genetic results based on barcodes, morphology based on scanning electron and light microscopy images, and morphometric analyses were used to describe cryptic species within the M. albuquerquensis complex. The morphological analyses coincided partially with the genetic markers, suggesting the existence of at least two sibling species: M. albuquerquensis s. str. and M. patzcuarensis. A third species was genetically separated but was morphologically indistinguishable from the M. patzcuarensis group. Hidden diversity has been a major problem in establishing real patterns of species distribution and genetic acquisition from megadiverse hotspots such as Mexico, where the Nearctic and the Neotropical regions of the Americas meet. Barcodes can help taxonomists to reveal and formally name these new species. Here, we describe two of three potential species highlighted by the use of barcodes: M. albuquerquensis s. str. in the northern semi-desert and M. patzcuarensis on the Central Plateau at more than 2000 m above sea level.

Identification of Scleractinian Coral Recruits Using Fluorescent Censusing and DNA Barcoding Techniques

PubMed Central

Hsu, Chia-Min; de Palmas, Stéphane; Kuo, Chao-Yang; Denis, Vianney; Chen, Chaolun Allen

2014-01-01

The identification of coral recruits has been problematic due to a lack of definitive morphological characters being available for higher taxonomic resolution. In this study, we tested whether fluorescent detection of coral recruits used in combinations of different DNA-barcoding markers (cytochrome oxidase I gene [COI], open reading frame [ORF], and nuclear Pax-C intron [PaxC]) could be useful for increasing the resolution of coral spat identification in ecological studies. One hundred and fifty settlement plates were emplaced at nine sites on the fringing reefs of Kenting National Park in southern Taiwan between April 2011 and September 2012. A total of 248 living coral spats and juveniles (with basal areas ranging from 0.21 to 134.57 mm2) were detected on the plates with the aid of fluorescent light and collected for molecular analyses. Using the COI DNA barcoding technique, 90.3% (224/248) of coral spats were successfully identified into six genera, including Acropora, Isopora, Montipora, Pocillopora, Porites, and Pavona. PaxC further separated I. cuneata and I. palifera of Isopora from Acropora, and ORF successfully identified the species of Pocillopora (except P. meandrina and P. eydouxi). Moreover, other cnidarian species such as actinarians, zoanthids, and Millepora species were visually found using fluorescence and identified by COI DNA barcoding. This combination of existing approaches greatly improved the taxonomic resolution of early coral life stages, which to date has been mainly limited to the family level based on skeletal identification. Overall, this study suggests important improvements for the identification of coral recruits in ecological studies. PMID:25211345

Suitable DNA Barcoding for Identification and Supervision of Piper kadsura in Chinese Medicine Markets.

PubMed

Yu, Ning; Gu, Hong; Wei, Yulong; Zhu, Ning; Wang, Yanli; Zhang, Haiping; Zhu, Yue; Zhang, Xin; Ma, Chao; Sun, Aidong

2016-09-12

Piper kadsura is a vine-like medicinal plant which is widely used in clinical treatment. However, P. kadsura is often substituted by other materials in the markets, thereby causing health risks. In this study, 38 P. kadsura samples and eight sequences from GenBank, including a closely-related species and common adulterants were collected. This study aimed to identify an effective DNA barcode from four popular DNA loci for P. kadsura authentication. The success rates of PCR amplification, sequencing, and sequence acquisition of matK were 10.5%, 75%, and 7.9%, respectively; for rbcL they were 89.5%, 8.8%, and 7.9%, respectively; ITS2 rates were 86.8%, 3.0%, and 2.6%, respectively, while for psbA-trnH they were all 100%, which is much higher than for the other three loci. The sequences were aligned using Muscle, genetic distances were computed using MEGA 5.2.2, and barcoding gap was performed using TAXON DNA. Phylogenetic analysis showed that psbA-trnH could clearly distinguish P. kadsura from its closely related species and the common adulterant. psbA-trnH was then used to evaluate the fake proportions of P. kadsura. Results showed that 18.4% of P. kadsura samples were fake, indicating that adulterant species exist in the Chinese markets. Two-dimensional DNA barcoding imaging of P. kadsura was conducted, which was beneficial to the management of P. kadsura. We conclude that the psbA-trnH region is a powerful tool for P. kadsura identification and supervision in the current medicine markets.

Identification of scleractinian coral recruits using fluorescent censusing and DNA barcoding techniques.

PubMed

Hsu, Chia-Min; de Palmas, Stéphane; Kuo, Chao-Yang; Denis, Vianney; Chen, Chaolun Allen

2014-01-01

The identification of coral recruits has been problematic due to a lack of definitive morphological characters being available for higher taxonomic resolution. In this study, we tested whether fluorescent detection of coral recruits used in combinations of different DNA-barcoding markers (cytochrome oxidase I gene [COI], open reading frame [ORF], and nuclear Pax-C intron [PaxC]) could be useful for increasing the resolution of coral spat identification in ecological studies. One hundred and fifty settlement plates were emplaced at nine sites on the fringing reefs of Kenting National Park in southern Taiwan between April 2011 and September 2012. A total of 248 living coral spats and juveniles (with basal areas ranging from 0.21 to 134.57 mm(2)) were detected on the plates with the aid of fluorescent light and collected for molecular analyses. Using the COI DNA barcoding technique, 90.3% (224/248) of coral spats were successfully identified into six genera, including Acropora, Isopora, Montipora, Pocillopora, Porites, and Pavona. PaxC further separated I. cuneata and I. palifera of Isopora from Acropora, and ORF successfully identified the species of Pocillopora (except P. meandrina and P. eydouxi). Moreover, other cnidarian species such as actinarians, zoanthids, and Millepora species were visually found using fluorescence and identified by COI DNA barcoding. This combination of existing approaches greatly improved the taxonomic resolution of early coral life stages, which to date has been mainly limited to the family level based on skeletal identification. Overall, this study suggests important improvements for the identification of coral recruits in ecological studies.

DNA barcode data accurately assign higher spider taxa

PubMed Central

Coddington, Jonathan A.; Agnarsson, Ingi; Cheng, Ren-Chung; Čandek, Klemen; Driskell, Amy; Frick, Holger; Gregorič, Matjaž; Kostanjšek, Rok; Kropf, Christian; Kweskin, Matthew; Lokovšek, Tjaša; Pipan, Miha; Vidergar, Nina

2016-01-01

The use of unique DNA sequences as a method for taxonomic identification is no longer fundamentally controversial, even though debate continues on the best markers, methods, and technology to use. Although both existing databanks such as GenBank and BOLD, as well as reference taxonomies, are imperfect, in best case scenarios “barcodes” (whether single or multiple, organelle or nuclear, loci) clearly are an increasingly fast and inexpensive method of identification, especially as compared to manual identification of unknowns by increasingly rare expert taxonomists. Because most species on Earth are undescribed, a complete reference database at the species level is impractical in the near term. The question therefore arises whether unidentified species can, using DNA barcodes, be accurately assigned to more inclusive groups such as genera and families—taxonomic ranks of putatively monophyletic groups for which the global inventory is more complete and stable. We used a carefully chosen test library of CO1 sequences from 49 families, 313 genera, and 816 species of spiders to assess the accuracy of genus and family-level assignment. We used BLAST queries of each sequence against the entire library and got the top ten hits. The percent sequence identity was reported from these hits (PIdent, range 75–100%). Accurate assignment of higher taxa (PIdent above which errors totaled less than 5%) occurred for genera at PIdent values >95 and families at PIdent values ≥ 91, suggesting these as heuristic thresholds for accurate generic and familial identifications in spiders. Accuracy of identification increases with numbers of species/genus and genera/family in the library; above five genera per family and fifteen species per genus all higher taxon assignments were correct. We propose that using percent sequence identity between conventional barcode sequences may be a feasible and reasonably accurate method to identify animals to family/genus. However, the quality of the underlying database impacts accuracy of results; many outliers in our dataset could be attributed to taxonomic and/or sequencing errors in BOLD and GenBank. It seems that an accurate and complete reference library of families and genera of life could provide accurate higher level taxonomic identifications cheaply and accessibly, within years rather than decades. PMID:27547527

Design of 240,000 orthogonal 25mer DNA barcode probes.

PubMed

Xu, Qikai; Schlabach, Michael R; Hannon, Gregory J; Elledge, Stephen J

2009-02-17

DNA barcodes linked to genetic features greatly facilitate screening these features in pooled formats using microarray hybridization, and new tools are needed to design large sets of barcodes to allow construction of large barcoded mammalian libraries such as shRNA libraries. Here we report a framework for designing large sets of orthogonal barcode probes. We demonstrate the utility of this framework by designing 240,000 barcode probes and testing their performance by hybridization. From the test hybridizations, we also discovered new probe design rules that significantly reduce cross-hybridization after their introduction into the framework of the algorithm. These rules should improve the performance of DNA microarray probe designs for many applications.

Design of 240,000 orthogonal 25mer DNA barcode probes

PubMed Central

Xu, Qikai; Schlabach, Michael R.; Hannon, Gregory J.; Elledge, Stephen J.

2009-01-01

DNA barcodes linked to genetic features greatly facilitate screening these features in pooled formats using microarray hybridization, and new tools are needed to design large sets of barcodes to allow construction of large barcoded mammalian libraries such as shRNA libraries. Here we report a framework for designing large sets of orthogonal barcode probes. We demonstrate the utility of this framework by designing 240,000 barcode probes and testing their performance by hybridization. From the test hybridizations, we also discovered new probe design rules that significantly reduce cross-hybridization after their introduction into the framework of the algorithm. These rules should improve the performance of DNA microarray probe designs for many applications. PMID:19171886

A Concealed Barcode Identification System Using Terahertz Time-domain Spectroscopy

NASA Astrophysics Data System (ADS)

Guan, Yu; Yamamoto, Manabu; Kitazawa, Toshiyuki; Tripathi, Saroj R.; Takeya, Kei; Kawase, Kodo

2015-03-01

We present a concealed terahertz barcode/chipless tag to achieve remote identification through an obstructing material using terahertz radiation. We show scanned terahertz reflection spectral images of barcodes concealed by a thick obstacle. A concealed and double- side printed terahertz barcode structure is proposed, and we demonstrate that our design has better performance in definition than a single-side printed barcode using terahertz time-domain spectroscopy. This technique combines the benefits of a chipless tag to read encoded information covered by an optically opaque material with low cost and a simple fabrication process. Simulations are also described, along with an explanation of the principle of the terahertz barcode identification system.

Rapidly evolving homing CRISPR barcodes

PubMed Central

Kalhor, Reza; Mali, Prashant; Church, George M.

2017-01-01

We present here an approach for engineering evolving DNA barcodes in living cells. The methodology entails using a homing guide RNA (hgRNA) scaffold that directs the Cas9-hgRNA complex to target the DNA locus of the hgRNA itself. We show that this homing CRISPR-Cas9 system acts as an expressed genetic barcode that diversifies its sequence and that the rate of diversification can be controlled in cultured cells. We further evaluate these barcodes in cell populations and show the barcode RNAs can be assayed as single molecules in situ . This integrated approach will have wide ranging applications, such as in deep lineage tracing, cellular barcoding, molecular recording, dissecting cancer biology, and connectome mapping. PMID:27918539

BOLDMirror: a global mirror system of DNA barcode data.

PubMed

Liu, D; Liu, L; Guo, G; Wang, W; Sun, Q; Parani, M; Ma, J

2013-11-01

DNA barcoding is a novel concept for taxonomic identification using short, specific genetic markers and has been applied to study a large number of eukaryotes. The huge amount of data output generated by DNA barcoding requires well-organized information systems. Besides the Barcode of Life Data system (BOLD) established in Canada, the mirror system is also important for the international barcode of life project (iBOL). For this purpose, we developed the BOLDMirror, a global mirror system of DNA barcode data. It is open-sourced and can run on the LAMP (Linux + Apache + MySQL + PHP) environment. BOLDMirror has data synchronization, data representation and statistics modules, and also provides spaces to store user operation history. BOLDMirror can be accessed at http://www.boldmirror.net and several countries have used it to setup their site of DNA barcoding. © 2012 John Wiley & Sons Ltd.

Insect barcode information system.

PubMed

Pratheepa, Maria; Jalali, Sushil Kumar; Arokiaraj, Robinson Silvester; Venkatesan, Thiruvengadam; Nagesh, Mandadi; Panda, Madhusmita; Pattar, Sharath

2014-01-01

Insect Barcode Information System called as Insect Barcode Informática (IBIn) is an online database resource developed by the National Bureau of Agriculturally Important Insects, Bangalore. This database provides acquisition, storage, analysis and publication of DNA barcode records of agriculturally important insects, for researchers specifically in India and other countries. It bridges a gap in bioinformatics by integrating molecular, morphological and distribution details of agriculturally important insects. IBIn was developed using PHP/My SQL by using relational database management concept. This database is based on the client- server architecture, where many clients can access data simultaneously. IBIn is freely available on-line and is user-friendly. IBIn allows the registered users to input new information, search and view information related to DNA barcode of agriculturally important insects.This paper provides a current status of insect barcode in India and brief introduction about the database IBIn. http://www.nabg-nbaii.res.in/barcode.

Barcoding Tetrahymena: discriminating species and identifying unknowns using the cytochrome c oxidase subunit I (cox-1) barcode.

PubMed

Kher, Chandni P; Doerder, F Paul; Cooper, Jason; Ikonomi, Pranvera; Achilles-Day, Undine; Küpper, Frithjof C; Lynn, Denis H

2011-01-01

DNA barcoding using the mitochondrial cytochromecoxidase subunit I (cox-1) gene has recently gained popularity as a tool for species identification of a variety of taxa. The primary objective of our research was to explore the efficacy of using cox-1 barcoding for species identification within the genusTetrahymena. We first increased intraspecific sampling forTetrahymena canadensis, Tetrahymena hegewischi, Tetrahymena pyriformis, Tetrahymena rostrata, Tetrahymena thermophila, and Tetrahymena tropicalis. Increased sampling efforts show that intraspecific sequence divergence is typically less than 1%, though it may be more in some species. The barcoding also showed that some strains might be misidentified or mislabeled. We also used cox-1 barcodes to provide species identifications for 51 unidentified environmental isolates, with a success rate of 98%. Thus, cox-1 barcoding is an invaluable tool for protistologists, especially when used in conjunction with morphological studies. 2010 Elsevier GmbH. All rights reserved.

78 FR 13006 - New Intelligent Mail Package Barcode Standards To Enhance Package Visibility; Opportunity for...

Federal Register 2010, 2011, 2012, 2013, 2014

2013-02-26

...The Postal Service is exploring the advisability of requiring the use of Intelligent Mail[supreg] package barcodes (IMpb) or unique tracking Intelligent Mail barcodes (IMbTM) on all commercial parcels, and providing support to mailers to assure their ability to apply unique tracking barcodes to all commercial parcels.

DNA Barcoding of Marine Metazoa

NASA Astrophysics Data System (ADS)

Bucklin, Ann; Steinke, Dirk; Blanco-Bercial, Leocadio

2011-01-01

More than 230,000 known species representing 31 metazoan phyla populate the world's oceans. Perhaps another 1,000,000 or more species remain to be discovered. There is reason for concern that species extinctions may outpace discovery, especially in diverse and endangered marine habitats such as coral reefs. DNA barcodes (i.e., short DNA sequences for species recognition and discrimination) are useful tools to accelerate species-level analysis of marine biodiversity and to facilitate conservation efforts. This review focuses on the usual barcode region for metazoans: a ˜648 base-pair region of the mitochondrial cytochrome c oxidase subunit I (COI) gene. Barcodes have also been used for population genetic and phylogeographic analysis, identification of prey in gut contents, detection of invasive species, forensics, and seafood safety. More controversially, barcodes have been used to delimit species boundaries, reveal cryptic species, and discover new species. Emerging frontiers are the use of barcodes for rapid and increasingly automated biodiversity assessment by high-throughput sequencing, including environmental barcoding and the use of barcodes to detect species for which formal identification or scientific naming may never be possible.

Patent and product piracy

NASA Astrophysics Data System (ADS)

Ignat, V.

2016-08-01

Advanced industrial countries are affected by technology theft. German industry annually loses more than 50 billion euros. The main causes are industrial espionage and fraudulent copying patents and industrial products. Many Asian countries are profiteering saving up to 65% of production costs. Most affected are small medium enterprises, who do not have sufficient economic power to assert themselves against some powerful countries. International organizations, such as Interpol and World Customs Organization - WCO - work together to combat international economic crime. Several methods of protection can be achieved by registering patents or specific technical methods for recognition of product originality. They have developed more suitable protection, like Hologram, magnetic stripe, barcode, CE marking, digital watermarks, DNA or Nano-technologies, security labels, radio frequency identification, micro color codes, matrix code, cryptographic encodings. The automotive industry has developed the method “Manufactures against Product Piracy”. A sticker on the package features original products and it uses a Data Matrix verifiable barcode. The code can be recorded with a smartphone camera. The smartphone is connected via Internet to a database, where the identification numbers of the original parts are stored.

Enhancing Chemical Inventory Management in Laboratory through a Mobile-Based QR Code Tag

NASA Astrophysics Data System (ADS)

Shukran, M. A. M.; Ishak, M. S.; Abdullah, M. N.

2017-08-01

The demand for a greater inventory management system which can provide a lot of useful information from a single scan has made laboratory inventory management using barcode technology more difficult. Since the barcode technology lacks the ability to overcome the problem and is not capable of providing information needed to manage the chemicals in the laboratory, thus employing a QR code technology is the best solution. In this research, the main idea is to develop a standalone application running with its own database that is periodically synchronized with the inventory software hosted by the computer and connected to a specialized network as well. The first process required to establish this centralized system is to determine all inventory available in the chemical laboratory by referring to the documented data in order to develop the database. Several customization and enhancement were made to the open source QR code technology to ensure the developed application is dedicated for its main purposes. As the end of the research, it was proven that the system is able to track the position of all inventory and showing real time information about the scanned chemical labels. This paper intends to give an overview about the QR tag inventory system that was developed and its implementation at the National Defence University of Malaysia’s (NDUM) chemical laboratory.

Designing robust watermark barcodes for multiplex long-read sequencing.

PubMed

Ezpeleta, Joaquín; Krsticevic, Flavia J; Bulacio, Pilar; Tapia, Elizabeth

2017-03-15

To attain acceptable sample misassignment rates, current approaches to multiplex single-molecule real-time sequencing require upstream quality improvement, which is obtained from multiple passes over the sequenced insert and significantly reduces the effective read length. In order to fully exploit the raw read length on multiplex applications, robust barcodes capable of dealing with the full single-pass error rates are needed. We present a method for designing sequencing barcodes that can withstand a large number of insertion, deletion and substitution errors and are suitable for use in multiplex single-molecule real-time sequencing. The manuscript focuses on the design of barcodes for full-length single-pass reads, impaired by challenging error rates in the order of 11%. The proposed barcodes can multiplex hundreds or thousands of samples while achieving sample misassignment probabilities as low as 10-7 under the above conditions, and are designed to be compatible with chemical constraints imposed by the sequencing process. Software tools for constructing watermark barcode sets and demultiplexing barcoded reads, together with example sets of barcodes and synthetic barcoded reads, are freely available at www.cifasis-conicet.gov.ar/ezpeleta/NS-watermark . ezpeleta@cifasis-conicet.gov.ar. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

An Algorithm Enabling Blind Users to Find and Read Barcodes

PubMed Central

Tekin, Ender; Coughlan, James M.

2010-01-01

Most camera-based systems for finding and reading barcodes are designed to be used by sighted users (e.g. the Red Laser iPhone app), and assume the user carefully centers the barcode in the image before the barcode is read. Blind individuals could benefit greatly from such systems to identify packaged goods (such as canned goods in a supermarket), but unfortunately in their current form these systems are completely inaccessible because of their reliance on visual feedback from the user. To remedy this problem, we propose a computer vision algorithm that processes several frames of video per second to detect barcodes from a distance of several inches; the algorithm issues directional information with audio feedback (e.g. “left,” “right”) and thereby guides a blind user holding a webcam or other portable camera to locate and home in on a barcode. Once the barcode is detected at sufficiently close range, a barcode reading algorithm previously developed by the authors scans and reads aloud the barcode and the corresponding product information. We demonstrate encouraging experimental results of our proposed system implemented on a desktop computer with a webcam held by a blindfolded user; ultimately the system will be ported to a camera phone for use by visually impaired users. PMID:20617114

DNA barcodes and citizen science provoke a diversity reappraisal for the "ring" butterflies of Peninsular Malaysia (Ypthima: Satyrinae: Nymphalidae: Lepidoptera).

PubMed

Jisming-See, Shi-Wei; Sing, Kong-Wah; Wilson, John-James

2016-10-01

The "rings" belonging to the genus Ypthima are amongst the most common butterflies in Peninsular Malaysia. However, the species can be difficult to tell apart, with keys relying on minor and often non-discrete ring characters found on the hindwing. Seven species have been reported from Peninsular Malaysia, but this is thought to be an underestimate of diversity. DNA barcodes of 165 individuals, and wing and genital morphology, were examined to reappraise species diversity of this genus in Peninsular Malaysia. DNA barcodes collected during citizen science projects-School Butterfly Project and Peninsular Malaysia Butterfly Count-recently conducted in Peninsular Malaysia were included. The new DNA barcodes formed six groups with different Barcode Index Numbers (BINs) representing four species reported in Peninsular Malaysia. When combined with public DNA barcodes from the Barcode Of Life Datasystems, several taxonomic issues arose. We consider the taxon Y. newboldi, formerly treated as a subspecies of Y. baldus, as a distinct species. DNA barcodes also supported an earlier suggestion that Y. nebulosa is a synonym under Y. horsfieldii humei. Two BINs of the genus Ypthima comprising DNA barcodes collected during citizen science projects did not correspond to any species previously reported in Peninsular Malaysia.

DNA barcode analysis of butterfly species from Pakistan points towards regional endemism

PubMed Central

Ashfaq, Muhammad; Akhtar, Saleem; Khan, Arif M; Adamowicz, Sarah J; Hebert, Paul D N

2013-01-01

DNA barcodes were obtained for 81 butterfly species belonging to 52 genera from sites in north-central Pakistan to test the utility of barcoding for their identification and to gain a better understanding of regional barcode variation. These species represent 25% of the butterfly fauna of Pakistan and belong to five families, although the Nymphalidae were dominant, comprising 38% of the total specimens. Barcode analysis showed that maximum conspecific divergence was 1.6%, while there was 1.7–14.3% divergence from the nearest neighbour species. Barcode records for 55 species showed <2% sequence divergence to records in the Barcode of Life Data Systems (BOLD), but only 26 of these cases involved specimens from neighbouring India and Central Asia. Analysis revealed that most species showed little incremental sequence variation when specimens from other regions were considered, but a threefold increase was noted in a few cases. There was a clear gap between maximum intraspecific and minimum nearest neighbour distance for all 81 species. Neighbour-joining cluster analysis showed that members of each species formed a monophyletic cluster with strong bootstrap support. The barcode results revealed two provisional species that could not be clearly linked to known taxa, while 24 other species gained their first coverage. Future work should extend the barcode reference library to include all butterfly species from Pakistan as well as neighbouring countries to gain a better understanding of regional variation in barcode sequences in this topographically and climatically complex region. PMID:23789612

DNA barcoding gap: reliable species identification over morphological and geographical scales.

PubMed

Čandek, Klemen; Kuntner, Matjaž

2015-03-01

The philosophical basis and utility of DNA barcoding have been a subject of numerous debates. While most literature embraces it, some studies continue to question its use in dipterans, butterflies and marine gastropods. Here, we explore the utility of DNA barcoding in identifying spider species that vary in taxonomic affiliation, morphological diagnosibility and geographic distribution. Our first test searched for a 'barcoding gap' by comparing intra- and interspecific means, medians and overlap in more than 75,000 computed Kimura 2-parameter (K2P) genetic distances in three families. Our second test compared K2P distances of congeneric species with high vs. low morphological distinctness in 20 genera of 11 families. Our third test explored the effect of enlarging geographical sampling area at a continental scale on genetic variability in DNA barcodes within 20 species of nine families. Our results generally point towards a high utility of DNA barcodes in identifying spider species. However, the size of the barcoding gap strongly depends on taxonomic groups and practices. It is becoming critical to define the barcoding gap statistically more consistently and to document its variation over taxonomic scales. Our results support models of independent patterns of morphological and molecular evolution by showing that DNA barcodes are effective in species identification regardless of their morphological diagnosibility. We also show that DNA barcodes represent an effective tool for identifying spider species over geographic scales, yet their variation contains useful biogeographic information. © 2014 John Wiley & Sons Ltd.

VIP Barcoding: composition vector-based software for rapid species identification based on DNA barcoding.

PubMed

Fan, Long; Hui, Jerome H L; Yu, Zu Guo; Chu, Ka Hou

2014-07-01

Species identification based on short sequences of DNA markers, that is, DNA barcoding, has emerged as an integral part of modern taxonomy. However, software for the analysis of large and multilocus barcoding data sets is scarce. The Basic Local Alignment Search Tool (BLAST) is currently the fastest tool capable of handling large databases (e.g. >5000 sequences), but its accuracy is a concern and has been criticized for its local optimization. However, current more accurate software requires sequence alignment or complex calculations, which are time-consuming when dealing with large data sets during data preprocessing or during the search stage. Therefore, it is imperative to develop a practical program for both accurate and scalable species identification for DNA barcoding. In this context, we present VIP Barcoding: a user-friendly software in graphical user interface for rapid DNA barcoding. It adopts a hybrid, two-stage algorithm. First, an alignment-free composition vector (CV) method is utilized to reduce searching space by screening a reference database. The alignment-based K2P distance nearest-neighbour method is then employed to analyse the smaller data set generated in the first stage. In comparison with other software, we demonstrate that VIP Barcoding has (i) higher accuracy than Blastn and several alignment-free methods and (ii) higher scalability than alignment-based distance methods and character-based methods. These results suggest that this platform is able to deal with both large-scale and multilocus barcoding data with accuracy and can contribute to DNA barcoding for modern taxonomy. VIP Barcoding is free and available at http://msl.sls.cuhk.edu.hk/vipbarcoding/. © 2014 John Wiley & Sons Ltd.

Potential efficacy of mitochondrial genes for animal DNA barcoding: a case study using eutherian mammals.

PubMed

Luo, Arong; Zhang, Aibing; Ho, Simon Yw; Xu, Weijun; Zhang, Yanzhou; Shi, Weifeng; Cameron, Stephen L; Zhu, Chaodong

2011-01-28

A well-informed choice of genetic locus is central to the efficacy of DNA barcoding. Current DNA barcoding in animals involves the use of the 5' half of the mitochondrial cytochrome oxidase 1 gene (CO1) to diagnose and delimit species. However, there is no compelling a priori reason for the exclusive focus on this region, and it has been shown that it performs poorly for certain animal groups. To explore alternative mitochondrial barcoding regions, we compared the efficacy of the universal CO1 barcoding region with the other mitochondrial protein-coding genes in eutherian mammals. Four criteria were used for this comparison: the number of recovered species, sequence variability within and between species, resolution to taxonomic levels above that of species, and the degree of mutational saturation. Based on 1,179 mitochondrial genomes of eutherians, we found that the universal CO1 barcoding region is a good representative of mitochondrial genes as a whole because the high species-recovery rate (> 90%) was similar to that of other mitochondrial genes, and there were no significant differences in intra- or interspecific variability among genes. However, an overlap between intra- and interspecific variability was still problematic for all mitochondrial genes. Our results also demonstrated that any choice of mitochondrial gene for DNA barcoding failed to offer significant resolution at higher taxonomic levels. We suggest that the CO1 barcoding region, the universal DNA barcode, is preferred among the mitochondrial protein-coding genes as a molecular diagnostic at least for eutherian species identification. Nevertheless, DNA barcoding with this marker may still be problematic for certain eutherian taxa and our approach can be used to test potential barcoding loci for such groups.

Potential efficacy of mitochondrial genes for animal DNA barcoding: a case study using eutherian mammals

PubMed Central

2011-01-01

Background A well-informed choice of genetic locus is central to the efficacy of DNA barcoding. Current DNA barcoding in animals involves the use of the 5' half of the mitochondrial cytochrome oxidase 1 gene (CO1) to diagnose and delimit species. However, there is no compelling a priori reason for the exclusive focus on this region, and it has been shown that it performs poorly for certain animal groups. To explore alternative mitochondrial barcoding regions, we compared the efficacy of the universal CO1 barcoding region with the other mitochondrial protein-coding genes in eutherian mammals. Four criteria were used for this comparison: the number of recovered species, sequence variability within and between species, resolution to taxonomic levels above that of species, and the degree of mutational saturation. Results Based on 1,179 mitochondrial genomes of eutherians, we found that the universal CO1 barcoding region is a good representative of mitochondrial genes as a whole because the high species-recovery rate (> 90%) was similar to that of other mitochondrial genes, and there were no significant differences in intra- or interspecific variability among genes. However, an overlap between intra- and interspecific variability was still problematic for all mitochondrial genes. Our results also demonstrated that any choice of mitochondrial gene for DNA barcoding failed to offer significant resolution at higher taxonomic levels. Conclusions We suggest that the CO1 barcoding region, the universal DNA barcode, is preferred among the mitochondrial protein-coding genes as a molecular diagnostic at least for eutherian species identification. Nevertheless, DNA barcoding with this marker may still be problematic for certain eutherian taxa and our approach can be used to test potential barcoding loci for such groups. PMID:21276253

Assessment of Four Molecular Markers as Potential DNA Barcodes for Red Algae Kappaphycus Doty and Eucheuma J. Agardh (Solieriaceae, Rhodophyta)

PubMed Central

Tan, Ji; Lim, Phaik-Eem; Phang, Siew-Moi; Hong, Dang Diem; Sunarpi, H.; Hurtado, Anicia Q.

2012-01-01

DNA barcoding has been a major advancement in the field of taxonomy, seeing much effort put into the barcoding of wide taxa of organisms, macro and microalgae included. The mitochondrial-encoded cox1 and plastid-encoded rbcL has been proposed as potential DNA barcodes for rhodophytes, but are yet to be tested on the commercially important carrageenophytes Kappaphycus and Eucheuma. This study gauges the effectiveness of four markers, namely the mitochondrial cox1, cox2, cox2-3 spacer and the plastid rbcL in DNA barcoding on selected Kappaphycus and Eucheuma from Southeast Asia. Marker assessments were performed using established distance and tree-based identification criteria from earlier studies. Barcoding patterns on a larger scale were simulated by empirically testing on the commonly used cox2-3 spacer. The phylogeny of these rhodophytes was also briefly described. In this study, the cox2 marker which satisfies the prerequisites of DNA barcodes was found to exhibit moderately high interspecific divergences with no intraspecific variations, thus a promising marker for the DNA barcoding of Kappaphycus and Eucheuma. However, the already extensively used cox2-3 spacer was deemed to be in overall more appropriate as a DNA barcode for these two genera. On a wider scale, cox1 and rbcL were still better DNA barcodes across the rhodophyte taxa when practicality and cost-efficiency were taken into account. The phylogeny of Kappaphycus and Eucheuma were generally similar to those earlier reported. Still, the application of DNA barcoding has demonstrated our relatively poor taxonomic comprehension of these seaweeds, thus suggesting more in-depth efforts in taxonomic restructuring as well as establishment. PMID:23285223

Combining and Comparing Coalescent, Distance and Character-Based Approaches for Barcoding Microalgaes: A Test with Chlorella-Like Species (Chlorophyta)

PubMed Central

Zou, Shanmei; Fei, Cong; Song, Jiameng; Bao, Yachao; He, Meilin; Wang, Changhai

2016-01-01

Several different barcoding methods of distinguishing species have been advanced, but which method is the best is still controversial. Chlorella is becoming particularly promising in the development of second-generation biofuels. However, the taxonomy of Chlorella–like organisms is easily confused. Here we report a comprehensive barcoding analysis of Chlorella-like species from Chlorella, Chloroidium, Dictyosphaerium and Actinastrum based on rbcL, ITS, tufA and 16S sequences to test the efficiency of traditional barcoding, GMYC, ABGD, PTP, P ID and character-based barcoding methods. First of all, the barcoding results gave new insights into the taxonomic assessment of Chlorella-like organisms studied, including the clear species discrimination and resolution of potentially cryptic species complexes in C. sorokiniana, D. ehrenbergianum and C. Vulgaris. The tufA proved to be the most efficient barcoding locus, which thus could be as potential “specific barcode” for Chlorella-like species. The 16S failed in discriminating most closely related species. The resolution of GMYC, PTP, P ID, ABGD and character-based barcoding methods were variable among rbcL, ITS and tufA genes. The best resolution for species differentiation appeared in tufA analysis where GMYC, PTP, ABGD and character-based approaches produced consistent groups while the PTP method over-split the taxa. The character analysis of rbcL, ITS and tufA sequences could clearly distinguish all taxonomic groups respectively, including the potentially cryptic lineages, with many character attributes. Thus, the character-based barcoding provides an attractive complement to coalescent and distance-based barcoding. Our study represents the test that proves the efficiency of multiple DNA barcoding in species discrimination of microalgaes. PMID:27092945

Generation and analysis of a barcode-tagged insertion mutant library in the fission yeast Schizosaccharomyces pombe

PubMed Central

2012-01-01

Background Barcodes are unique DNA sequence tags that can be used to specifically label individual mutants. The barcode-tagged open reading frame (ORF) haploid deletion mutant collections in the budding yeast Saccharomyces cerevisiae and the fission yeast Schizosaccharomyces pombe allow for high-throughput mutant phenotyping because the relative growth of mutants in a population can be determined by monitoring the proportions of their associated barcodes. While these mutant collections have greatly facilitated genome-wide studies, mutations in essential genes are not present, and the roles of these genes are not as easily studied. To further support genome-scale research in S. pombe, we generated a barcode-tagged fission yeast insertion mutant library that has the potential of generating viable mutations in both essential and non-essential genes and can be easily analyzed using standard molecular biological techniques. Results An insertion vector containing a selectable ura4+ marker and a random barcode was used to generate a collection of 10,000 fission yeast insertion mutants stored individually in 384-well plates and as six pools of mixed mutants. Individual barcodes are flanked by Sfi I recognition sites and can be oligomerized in a unique orientation to facilitate barcode sequencing. Independent genetic screens on a subset of mutants suggest that this library contains a diverse collection of single insertion mutations. We present several approaches to determine insertion sites. Conclusions This collection of S. pombe barcode-tagged insertion mutants is well-suited for genome-wide studies. Because insertion mutations may eliminate, reduce or alter the function of essential and non-essential genes, this library will contain strains with a wide range of phenotypes that can be assayed by their associated barcodes. The design of the barcodes in this library allows for barcode sequencing using next generation or standard benchtop cloning approaches. PMID:22554201

DNA barcoding of vouchered xylarium wood specimens of nine endangered Dalbergia species.

PubMed

Yu, Min; Jiao, Lichao; Guo, Juan; Wiedenhoeft, Alex C; He, Tuo; Jiang, Xiaomei; Yin, Yafang

2017-12-01

ITS2+ trnH - psbA was the best combination of DNA barcode to resolve the Dalbergia wood species studied. We demonstrate the feasibility of building a DNA barcode reference database using xylarium wood specimens. The increase in illegal logging and timber trade of CITES-listed tropical species necessitates the development of unambiguous identification methods at the species level. For these methods to be fully functional and deployable for law enforcement, they must work using wood or wood products. DNA barcoding of wood has been promoted as a promising tool for species identification; however, the main barrier to extensive application of DNA barcoding to wood is the lack of a comprehensive and reliable DNA reference library of barcodes from wood. In this study, xylarium wood specimens of nine Dalbergia species were selected from the Wood Collection of the Chinese Academy of Forestry and DNA was then extracted from them for further PCR amplification of eight potential DNA barcode sequences (ITS2, matK, trnL, trnH-psbA, trnV-trnM1, trnV-trnM2, trnC-petN, and trnS-trnG). The barcodes were tested singly and in combination for species-level discrimination ability by tree-based [neighbor-joining (NJ)] and distance-based (TaxonDNA) methods. We found that the discrimination ability of DNA barcodes in combination was higher than any single DNA marker among the Dalbergia species studied, with the best two-marker combination of ITS2+trnH-psbA analyzed with NJ trees performing the best (100% accuracy). These barcodes are relatively short regions (<350 bp) and amplification reactions were performed with high success (≥90%) using wood as the source material, a necessary factor to apply DNA barcoding to timber trade. The present results demonstrate the feasibility of using vouchered xylarium specimens to build DNA barcoding reference databases.

Comprehensive phylogeny, biogeography and new classification of the diverse bee tribe Megachilini: Can we use DNA barcodes in phylogenies of large genera?

PubMed

Trunz, V; Packer, L; Vieu, J; Arrigo, N; Praz, C J

2016-10-01

Classification and evolutionary studies of particularly speciose clades pose important challenges, as phylogenetic analyses typically sample a small proportion of the existing diversity. We examine here one of the largest bee genera, the genus Megachile - the dauber and leafcutting bees. Besides presenting a phylogeny based on five nuclear genes (5480 aligned nucleotide positions), we attempt to use the phylogenetic signal of mitochondrial DNA barcodes, which are rapidly accumulating and already include a substantial proportion of the known species diversity in the genus. We used barcodes in two ways: first, to identify particularly divergent lineages and thus to guide taxon sampling in our nuclear phylogeny; second, to augment taxon sampling by combining nuclear markers (as backbone for ancient divergences) with DNA barcodes. Our results indicate that DNA barcodes bear phylogenetic signal limited to very recent divergences (3-4 my before present). Sampling within clades of very closely related species may be augmented using this technique, but our results also suggest statistically supported, but incongruent placements of some taxa. However, the addition of one single nuclear gene (LW-rhodopsin) to the DNA barcode data was enough to recover meaningful placement with high clade support values for nodes up to 15 million years old. We discuss different proposals for the generic classification of the tribe Megachilini. Finding a classification that is both in agreement with our phylogenetic hypotheses and practical in terms of diagnosability is particularly challenging as our analyses recover several well-supported clades that include morphologically heterogeneous lineages. We favour a classification that recognizes seven morphologically well-delimited genera in Megachilini: Coelioxys, Gronoceras, Heriadopsis, Matangapis, Megachile, Noteriades and Radoszkowskiana. Our results also lead to the following classification changes: the groups known as Dinavis, Neglectella, Eurymella and Phaenosarus are reestablished as valid subgenera of the genus Megachile, while the subgenus Alocanthedon is placed in synonymy with M. (Callomegachile), the subgenera Parachalicodoma and Largella with M. (Pseudomegachile), Anodonteutricharaea with M. (Paracella), Platysta with M. (Eurymella), and Grosapis and Eumegachile with M. (Megachile) (new synonymies). In addition, we use maximum likelihood reconstructions of ancestral geographic ranges to infer the origin of the tribe and reconstruct the main dispersal routes explaining the current, cosmopolitan distribution of this genus. Copyright © 2016 Elsevier Inc. All rights reserved.

[Principles for molecular identification of traditional Chinese materia medica using DNA barcoding].

PubMed

Chen, Shi-Lin; Yao, Hui; Han, Jian-Ping; Xin, Tian-Yi; Pang, Xiao-Hui; Shi, Lin-Chun; Luo, Kun; Song, Jing-Yuan; Hou, Dian-Yun; Shi, Shang-Mei; Qian, Zhong-Zhi

2013-01-01

Since the research of molecular identification of Chinese Materia Medica (CMM) using DNA barcode is rapidly developing and popularizing, the principle of this method is approved to be listed in the Supplement of the Pharmacopoeia of the People's Republic of China. Based on the study on comprehensive samples, the DNA barcoding systems have been established to identify CMM, i.e. ITS2 as a core barcode and psbA-trnH as a complementary locus for identification of planta medica, and COI as a core barcode and ITS2 as a complementary locus for identification of animal medica. This article introduced the principle of molecular identification of CMM using DNA barcoding and its drafting instructions. Furthermore, its application perspective was discussed.

[Hydrophidae identification through analysis on Cyt b gene barcode].

PubMed

Liao, Li-xi; Zeng, Ke-wu; Tu, Peng-fei

2015-08-01

Hydrophidae, one of the precious traditional Chinese medicines, is generally drily preserved to prevent corruption, but it is hard to identify the species of Hydrophidae through the appearance because of the change due to the drying process. The identification through analysis on gene barcode, a new technique in species identification, can avoid the problem. The gene barcodes of the 6 species of Hydrophidae like Lapemis hardwickii were aquired through DNA extraction and gene sequencing. These barcodes were then in sequence alignment and test the identification efficency by BLAST. Our results revealed that the barcode sequences performed high identification efficiency, and had obvious difference between intra- and inter-species. These all indicated that Cyt b DNA barcoding can confirm the Hydrophidae identification.

DNA barcode analysis of butterfly species from Pakistan points towards regional endemism.

PubMed

Ashfaq, Muhammad; Akhtar, Saleem; Khan, Arif M; Adamowicz, Sarah J; Hebert, Paul D N

2013-09-01

DNA barcodes were obtained for 81 butterfly species belonging to 52 genera from sites in north-central Pakistan to test the utility of barcoding for their identification and to gain a better understanding of regional barcode variation. These species represent 25% of the butterfly fauna of Pakistan and belong to five families, although the Nymphalidae were dominant, comprising 38% of the total specimens. Barcode analysis showed that maximum conspecific divergence was 1.6%, while there was 1.7-14.3% divergence from the nearest neighbour species. Barcode records for 55 species showed <2% sequence divergence to records in the Barcode of Life Data Systems (BOLD), but only 26 of these cases involved specimens from neighbouring India and Central Asia. Analysis revealed that most species showed little incremental sequence variation when specimens from other regions were considered, but a threefold increase was noted in a few cases. There was a clear gap between maximum intraspecific and minimum nearest neighbour distance for all 81 species. Neighbour-joining cluster analysis showed that members of each species formed a monophyletic cluster with strong bootstrap support. The barcode results revealed two provisional species that could not be clearly linked to known taxa, while 24 other species gained their first coverage. Future work should extend the barcode reference library to include all butterfly species from Pakistan as well as neighbouring countries to gain a better understanding of regional variation in barcode sequences in this topographically and climatically complex region. © 2013 The Authors. Molecular Ecology Resources published by John Wiley & Sons Ltd.

Limitations of mitochondrial gene barcoding in Octocorallia.

PubMed

McFadden, Catherine S; Benayahu, Yehuda; Pante, Eric; Thoma, Jana N; Nevarez, P Andrew; France, Scott C

2011-01-01

The widespread assumption that COI and other mitochondrial genes will be ineffective DNA barcodes for anthozoan cnidarians has not been well tested for most anthozoans other than scleractinian corals. Here we examine the limitations of mitochondrial gene barcoding in the sub-class Octocorallia, a large, diverse, and ecologically important group of anthozoans. Pairwise genetic distance values (uncorrected p) were compared for three candidate barcoding regions: the Folmer region of COI; a fragment of the octocoral-specific mitochondrial protein-coding gene, msh1; and an extended barcode of msh1 plus COI with a short, adjacent intergenic region (igr1). Intraspecific variation was <0.5%, with most species exhibiting no variation in any of the three gene regions. Interspecific divergence was also low: 18.5% of congeneric morphospecies shared identical COI barcodes, and there was no discernible barcoding gap between intra- and interspecific p values. In a case study to assess regional octocoral biodiversity, COI and msh1 barcodes each identified 70% of morphospecies. In a second case study, a nucleotide character-based analysis correctly identified 70% of species in the temperate genus Alcyonium. Although interspecific genetic distances were 2× greater for msh1 than COI, each marker identified similar numbers of species in the two case studies, and the extended COI + igr1 + msh1 barcode more effectively discriminated sister taxa in Alcyonium. Although far from perfect for species identification, a COI + igr1 + msh1 barcode nonetheless represents a valuable addition to the depauperate set of characters available for octocoral taxonomy. © 2010 Blackwell Publishing Ltd.

Validation of the ITS2 region as a novel DNA barcode for identifying medicinal plant species.

PubMed

Chen, Shilin; Yao, Hui; Han, Jianping; Liu, Chang; Song, Jingyuan; Shi, Linchun; Zhu, Yingjie; Ma, Xinye; Gao, Ting; Pang, Xiaohui; Luo, Kun; Li, Ying; Li, Xiwen; Jia, Xiaocheng; Lin, Yulin; Leon, Christine

2010-01-07

The plant working group of the Consortium for the Barcode of Life recommended the two-locus combination of rbcL+matK as the plant barcode, yet the combination was shown to successfully discriminate among 907 samples from 550 species at the species level with a probability of 72%. The group admits that the two-locus barcode is far from perfect due to the low identification rate, and the search is not over. Here, we compared seven candidate DNA barcodes (psbA-trnH, matK, rbcL, rpoC1, ycf5, ITS2, and ITS) from medicinal plant species. Our ranking criteria included PCR amplification efficiency, differential intra- and inter-specific divergences, and the DNA barcoding gap. Our data suggest that the second internal transcribed spacer (ITS2) of nuclear ribosomal DNA represents the most suitable region for DNA barcoding applications. Furthermore, we tested the discrimination ability of ITS2 in more than 6600 plant samples belonging to 4800 species from 753 distinct genera and found that the rate of successful identification with the ITS2 was 92.7% at the species level. The ITS2 region can be potentially used as a standard DNA barcode to identify medicinal plants and their closely related species. We also propose that ITS2 can serve as a novel universal barcode for the identification of a broader range of plant taxa.

Classification of Sharks in the Egyptian Mediterranean Waters Using Morphological and DNA Barcoding Approaches

PubMed Central

Moftah, Marie; Abdel Aziz, Sayeda H.; Elramah, Sara; Favereaux, Alexandre

2011-01-01

The identification of species constitutes the first basic step in phylogenetic studies, biodiversity monitoring and conservation. DNA barcoding, i.e. the sequencing of a short standardized region of DNA, has been proposed as a new tool for animal species identification. The present study provides an update on the composition of shark in the Egyptian Mediterranean waters off Alexandria, since the latest study to date was performed 30 years ago, DNA barcoding was used in addition to classical taxonomical methodologies. Thus, 51 specimen were DNA barcoded for a 667 bp region of the mitochondrial COI gene. Although DNA barcoding aims at developing species identification systems, some phylogenetic signals were apparent in the data. In the neighbor-joining tree, 8 major clusters were apparent, each of them containing individuals belonging to the same species, and most with 100% bootstrap value. This study is the first to our knowledge to use DNA barcoding of the mitochondrial COI gene in order to confirm the presence of species Squalus acanthias, Oxynotus centrina, Squatina squatina, Scyliorhinus canicula, Scyliorhinus stellaris, Mustelus mustelus, Mustelus punctulatus and Carcharhinus altimus in the Egyptian Mediterranean waters. Finally, our study is the starting point of a new barcoding database concerning shark composition in the Egyptian Mediterranean waters (Barcoding of Egyptian Mediterranean Sharks [BEMS], http://www.boldsystems.org/views/projectlist.php?&#Barcoding%20Fish%20%28FishBOL%29). PMID:22087242

Cytochrome c oxidase I primers for corbiculate bees: DNA barcode and mini-barcode.

PubMed

Françoso, E; Arias, M C

2013-09-01

Bees (Apidae), of which there are more than 19 900 species, are extremely important for ecosystem services and economic purposes, so taxon identity is a major concern. The goal of this study was to optimize the DNA barcode technique based on the Cytochrome c oxidase (COI) mitochondrial gene region. This approach has previously been shown to be useful in resolving taxonomic inconsistencies and for species identification when morphological data are poor. Specifically, we designed and tested new primers and standardized PCR conditions to amplify the barcode region for bees, focusing on the corbiculate Apids. In addition, primers were designed to amplify small COI amplicons and tested with pinned specimens. Short barcode sequences were easily obtained for some Bombus century-old museum specimens and shown to be useful as mini-barcodes. The new primers and PCR conditions established in this study proved to be successful for the amplification of the barcode region for all species tested, regardless of the conditions of tissue preservation. We saw no evidence of Wolbachia or numts amplification by these primers, and so we suggest that these new primers are of broad value for corbiculate bee identification through DNA barcode. © 2013 John Wiley & Sons Ltd.

TagDigger: user-friendly extraction of read counts from GBS and RAD-seq data.

PubMed

Clark, Lindsay V; Sacks, Erik J

2016-01-01

In genotyping-by-sequencing (GBS) and restriction site-associated DNA sequencing (RAD-seq), read depth is important for assessing the quality of genotype calls and estimating allele dosage in polyploids. However, existing pipelines for GBS and RAD-seq do not provide read counts in formats that are both accurate and easy to access. Additionally, although existing pipelines allow previously-mined SNPs to be genotyped on new samples, they do not allow the user to manually specify a subset of loci to examine. Pipelines that do not use a reference genome assign arbitrary names to SNPs, making meta-analysis across projects difficult. We created the software TagDigger, which includes three programs for analyzing GBS and RAD-seq data. The first script, tagdigger_interactive.py, rapidly extracts read counts and genotypes from FASTQ files using user-supplied sets of barcodes and tags. Input and output is in CSV format so that it can be opened by spreadsheet software. Tag sequences can also be imported from the Stacks, TASSEL-GBSv2, TASSEL-UNEAK, or pyRAD pipelines, and a separate file can be imported listing the names of markers to retain. A second script, tag_manager.py, consolidates marker names and sequences across multiple projects. A third script, barcode_splitter.py, assists with preparing FASTQ data for deposit in a public archive by splitting FASTQ files by barcode and generating MD5 checksums for the resulting files. TagDigger is open-source and freely available software written in Python 3. It uses a scalable, rapid search algorithm that can process over 100 million FASTQ reads per hour. TagDigger will run on a laptop with any operating system, does not consume hard drive space with intermediate files, and does not require programming skill to use.

DNA barcoding Indian freshwater fishes.

PubMed

Lakra, Wazir Singh; Singh, M; Goswami, Mukunda; Gopalakrishnan, A; Lal, K K; Mohindra, V; Sarkar, U K; Punia, P P; Singh, K V; Bhatt, J P; Ayyappan, S

2016-11-01

DNA barcoding is a promising technique for species identification using a short mitochondrial DNA sequence of cytochrome c oxidase I (COI) gene. In the present study, DNA barcodes were generated from 72 species of freshwater fish covering the Orders Cypriniformes, Siluriformes, Perciformes, Synbranchiformes, and Osteoglossiformes representing 50 genera and 19 families. All the samples were collected from diverse sites except the species endemic to a particular location. Species were represented by multiple specimens in the great majority of the barcoded species. A total of 284 COI sequences were generated. After amplification and sequencing of 700 base pair fragment of COI, primers were trimmed which invariably generated a 655 base pair barcode sequence. The average Kimura two-parameter (K2P) distances within-species, genera, families, and orders were 0.40%, 9.60%, 13.10%, and 17.16%, respectively. DNA barcode discriminated congeneric species without any confusion. The study strongly validated the efficiency of COI as an ideal marker for DNA barcoding of Indian freshwater fishes.

Using barcoded Zika virus to assess virus population structure in vitro and in Aedes aegypti mosquitoes.

PubMed

Weger-Lucarelli, James; Garcia, Selene M; Rückert, Claudia; Byas, Alex; O'Connor, Shelby L; Aliota, Matthew T; Friedrich, Thomas C; O'Connor, David H; Ebel, Gregory D

2018-06-20

Arboviruses such as Zika virus (ZIKV, Flaviviridae; Flavivirus) must replicate in both mammalian and insect hosts possessing strong immune defenses. Accordingly, transmission between and replication within hosts involves genetic bottlenecks, during which viral population size and genetic diversity may be significantly reduced. To help quantify these bottlenecks and their effects, we constructed 4 "barcoded" ZIKV populations that theoretically contain thousands of barcodes each. After identifying the most diverse barcoded virus, we passaged this virus 3 times in 2 mammalian and mosquito cell lines and characterized the population using deep sequencing of the barcoded region of the genome. C6/36 maintain higher barcode diversity, even after 3 passages, than Vero. Additionally, field-caught mosquitoes exposed to the virus to assess bottlenecks in a natural host. A progressive reduction in barcode diversity occurred throughout systemic infection of these mosquitoes. Differences in bottlenecks during systemic spread were observed between different populations of Aedes aegypti. Copyright © 2018. Published by Elsevier Inc.

Defining operational taxonomic units using DNA barcode data.

PubMed

Blaxter, Mark; Mann, Jenna; Chapman, Tom; Thomas, Fran; Whitton, Claire; Floyd, Robin; Abebe, Eyualem

2005-10-29

The scale of diversity of life on this planet is a significant challenge for any scientific programme hoping to produce a complete catalogue, whatever means is used. For DNA barcoding studies, this difficulty is compounded by the realization that any chosen barcode sequence is not the gene 'for' speciation and that taxa have evolutionary histories. How are we to disentangle the confounding effects of reticulate population genetic processes? Using the DNA barcode data from meiofaunal surveys, here we discuss the benefits of treating the taxa defined by barcodes without reference to their correspondence to 'species', and suggest that using this non-idealist approach facilitates access to taxon groups that are not accessible to other methods of enumeration and classification. Major issues remain, in particular the methodologies for taxon discrimination in DNA barcode data.

DNA Barcoding of Neotropical Sand Flies (Diptera, Psychodidae, Phlebotominae): Species Identification and Discovery within Brazil

PubMed Central

Pinto, Israel de Souza; Chagas, Bruna Dias das; Rodrigues, Andressa Alencastre Fuzari; Ferreira, Adelson Luiz; Rezende, Helder Ricas; Bruno, Rafaela Vieira; Falqueto, Aloisio; Andrade-Filho, José Dilermando; Galati, Eunice Aparecida Bianchi; Shimabukuro, Paloma Helena Fernandes; Brazil, Reginaldo Peçanha

2015-01-01

DNA barcoding has been an effective tool for species identification in several animal groups. Here, we used DNA barcoding to discriminate between 47 morphologically distinct species of Brazilian sand flies. DNA barcodes correctly identified approximately 90% of the sampled taxa (42 morphologically distinct species) using clustering based on neighbor-joining distance, of which four species showed comparatively higher maximum values of divergence (range 4.23–19.04%), indicating cryptic diversity. The DNA barcodes also corroborated the resurrection of two species within the shannoni complex and provided an efficient tool to differentiate between morphologically indistinguishable females of closely related species. Taken together, our results validate the effectiveness of DNA barcoding for species identification and the discovery of cryptic diversity in sand flies from Brazil. PMID:26506007

DNA Barcoding of Neotropical Sand Flies (Diptera, Psychodidae, Phlebotominae): Species Identification and Discovery within Brazil.

PubMed

Pinto, Israel de Souza; Chagas, Bruna Dias das; Rodrigues, Andressa Alencastre Fuzari; Ferreira, Adelson Luiz; Rezende, Helder Ricas; Bruno, Rafaela Vieira; Falqueto, Aloisio; Andrade-Filho, José Dilermando; Galati, Eunice Aparecida Bianchi; Shimabukuro, Paloma Helena Fernandes; Brazil, Reginaldo Peçanha; Peixoto, Alexandre Afranio

2015-01-01

DNA barcoding has been an effective tool for species identification in several animal groups. Here, we used DNA barcoding to discriminate between 47 morphologically distinct species of Brazilian sand flies. DNA barcodes correctly identified approximately 90% of the sampled taxa (42 morphologically distinct species) using clustering based on neighbor-joining distance, of which four species showed comparatively higher maximum values of divergence (range 4.23-19.04%), indicating cryptic diversity. The DNA barcodes also corroborated the resurrection of two species within the shannoni complex and provided an efficient tool to differentiate between morphologically indistinguishable females of closely related species. Taken together, our results validate the effectiveness of DNA barcoding for species identification and the discovery of cryptic diversity in sand flies from Brazil.

High-throughput tetrad analysis.

PubMed

Ludlow, Catherine L; Scott, Adrian C; Cromie, Gareth A; Jeffery, Eric W; Sirr, Amy; May, Patrick; Lin, Jake; Gilbert, Teresa L; Hays, Michelle; Dudley, Aimée M

2013-07-01

Tetrad analysis has been a gold-standard genetic technique for several decades. Unfortunately, the need to manually isolate, disrupt and space tetrads has relegated its application to small-scale studies and limited its integration with high-throughput DNA sequencing technologies. We have developed a rapid, high-throughput method, called barcode-enabled sequencing of tetrads (BEST), that uses (i) a meiosis-specific GFP fusion protein to isolate tetrads by FACS and (ii) molecular barcodes that are read during genotyping to identify spores derived from the same tetrad. Maintaining tetrad information allows accurate inference of missing genetic markers and full genotypes of missing (and presumably nonviable) individuals. An individual researcher was able to isolate over 3,000 yeast tetrads in 3 h, an output equivalent to that of almost 1 month of manual dissection. BEST is transferable to other microorganisms for which meiotic mapping is significantly more laborious.

Tropical montane nymphalids in Mexico: DNA barcodes reveal greater diversity.

PubMed

Escalante, Patricia; Ibarra-Vazquez, Adolfo; Rosas-Escobar, Patricia

2010-12-01

DNA sequences obtained for the Barcode of Life library in the All Lepidoptera Campaign project Nymphalidae of Central Mexico were analyzed as a test of species limits and to explore possible phylogenetic groupings in the Preponini tribe. Using specimens in the National Insect Collection of the Instituto de Biología of the Universidad Nacional Autónoma de México, 78 specimens were assayed for cytochrome oxidase c subunit 1. Disregarding the missing data, there were 458 conserved sites, 200 variable sites and 187 parsimony-informative sites. The neighbor-joining and maximum likelihood analyses indicate that none of the three genera of Preponini as currently circumscribed are reciprocally monophyletic. As per species limits, high levels of barcode variation in the Prepona deiphile complex suggest the existence of at least two new endemic species to Mexico. The divergent taxa were escalantiana from the Tuxtlas region in Veracruz, and ibarra from Sierra Madre del Sur in the Pacific states of southern Mexico. The genetic distance in the CO1 fragment between them and the other deiphile populations ranged from 2.7 to 8.0%. We recommend that morphological data need to be re-examined and that additional molecular data for species ought to be gathered before a particular biogeographic model can be proposed for the group in Mesoamerica.

Why barcode? High-throughput multiplex sequencing of mitochondrial genomes for molecular systematics.

PubMed

Timmermans, M J T N; Dodsworth, S; Culverwell, C L; Bocak, L; Ahrens, D; Littlewood, D T J; Pons, J; Vogler, A P

2010-11-01

Mitochondrial genome sequences are important markers for phylogenetics but taxon sampling remains sporadic because of the great effort and cost required to acquire full-length sequences. Here, we demonstrate a simple, cost-effective way to sequence the full complement of protein coding mitochondrial genes from pooled samples using the 454/Roche platform. Multiplexing was achieved without the need for expensive indexing tags ('barcodes'). The method was trialled with a set of long-range polymerase chain reaction (PCR) fragments from 30 species of Coleoptera (beetles) sequenced in a 1/16th sector of a sequencing plate. Long contigs were produced from the pooled sequences with sequencing depths ranging from ∼10 to 100× per contig. Species identity of individual contigs was established via three 'bait' sequences matching disparate parts of the mitochondrial genome obtained by conventional PCR and Sanger sequencing. This proved that assembly of contigs from the sequencing pool was correct. Our study produced sequences for 21 nearly complete and seven partial sets of protein coding mitochondrial genes. Combined with existing sequences for 25 taxa, an improved estimate of basal relationships in Coleoptera was obtained. The procedure could be employed routinely for mitochondrial genome sequencing at the species level, to provide improved species 'barcodes' that currently use the cox1 gene only.

Implications of Hybridization, NUMTs, and Overlooked Diversity for DNA Barcoding of Eurasian Ground Squirrels

PubMed Central

Ermakov, Oleg A.; Simonov, Evgeniy; Surin, Vadim L.; Titov, Sergey V.; Brandler, Oleg V.; Ivanova, Natalia V.; Borisenko, Alex V.

2015-01-01

The utility of DNA Barcoding for species identification and discovery has catalyzed a concerted effort to build the global reference library; however, many animal groups of economical or conservational importance remain poorly represented. This study aims to contribute DNA barcode records for all ground squirrel species (Xerinae, Sciuridae, Rodentia) inhabiting Eurasia and to test efficiency of this approach for species discrimination. Cytochrome c oxidase subunit 1 (COI) gene sequences were obtained for 97 individuals representing 16 ground squirrel species of which 12 were correctly identified. Taxonomic allocation of some specimens within four species was complicated by geographically restricted mtDNA introgression. Exclusion of individuals with introgressed mtDNA allowed reaching a 91.6% identification success rate. Significant COI divergence (3.5–4.4%) was observed within the most widespread ground squirrel species (Spermophilus erythrogenys, S. pygmaeus, S. suslicus, Urocitellus undulatus), suggesting the presence of cryptic species. A single putative NUMT (nuclear mitochondrial pseudogene) sequence was recovered during molecular analysis; mitochondrial COI from this sample was amplified following re-extraction of DNA. Our data show high discrimination ability of 100 bp COI fragments for Eurasian ground squirrels (84.3%) with no incorrect assessments, underscoring the potential utility of the existing reference librariy for the development of diagnostic ‘mini-barcodes’. PMID:25617768

Ecological niche modelling and nDNA sequencing support a new, morphologically cryptic beetle species unveiled by DNA barcoding.

PubMed

Hawlitschek, Oliver; Porch, Nick; Hendrich, Lars; Balke, Michael

2011-02-09

DNA sequencing techniques used to estimate biodiversity, such as DNA barcoding, may reveal cryptic species. However, disagreements between barcoding and morphological data have already led to controversy. Species delimitation should therefore not be based on mtDNA alone. Here, we explore the use of nDNA and bioclimatic modelling in a new species of aquatic beetle revealed by mtDNA sequence data. The aquatic beetle fauna of Australia is characterised by high degrees of endemism, including local radiations such as the genus Antiporus. Antiporus femoralis was previously considered to exist in two disjunct, but morphologically indistinguishable populations in south-western and south-eastern Australia. We constructed a phylogeny of Antiporus and detected a deep split between these populations. Diagnostic characters from the highly variable nuclear protein encoding arginine kinase gene confirmed the presence of two isolated populations. We then used ecological niche modelling to examine the climatic niche characteristics of the two populations. All results support the status of the two populations as distinct species. We describe the south-western species as Antiporus occidentalis sp.n. In addition to nDNA sequence data and extended use of mitochondrial sequences, ecological niche modelling has great potential for delineating morphologically cryptic species.

Ecological Niche Modelling and nDNA Sequencing Support a New, Morphologically Cryptic Beetle Species Unveiled by DNA Barcoding

PubMed Central

Hawlitschek, Oliver; Porch, Nick; Hendrich, Lars; Balke, Michael

2011-01-01

Background DNA sequencing techniques used to estimate biodiversity, such as DNA barcoding, may reveal cryptic species. However, disagreements between barcoding and morphological data have already led to controversy. Species delimitation should therefore not be based on mtDNA alone. Here, we explore the use of nDNA and bioclimatic modelling in a new species of aquatic beetle revealed by mtDNA sequence data. Methodology/Principal Findings The aquatic beetle fauna of Australia is characterised by high degrees of endemism, including local radiations such as the genus Antiporus. Antiporus femoralis was previously considered to exist in two disjunct, but morphologically indistinguishable populations in south-western and south-eastern Australia. We constructed a phylogeny of Antiporus and detected a deep split between these populations. Diagnostic characters from the highly variable nuclear protein encoding arginine kinase gene confirmed the presence of two isolated populations. We then used ecological niche modelling to examine the climatic niche characteristics of the two populations. All results support the status of the two populations as distinct species. We describe the south-western species as Antiporus occidentalis sp.n. Conclusion/Significance In addition to nDNA sequence data and extended use of mitochondrial sequences, ecological niche modelling has great potential for delineating morphologically cryptic species. PMID:21347370

Optimization education after project implementation: sharing "lessons learned" with staff.

PubMed

Vaughn, Susan

2011-01-01

Implementations involving healthcare technology solutions focus on providing end-user education prior to the application going "live" in the organization. Benefits to postimplementation education for staff should be included when planning these projects. This author describes the traditional training provided during the implementation of a bar-coding medication project and then the optimization training 8 weeks later.

Location Based Service in Indoor Environment Using Quick Response Code Technology

NASA Astrophysics Data System (ADS)

Hakimpour, F.; Zare Zardiny, A.

2014-10-01

Today by extensive use of intelligent mobile phones, increased size of screens and enriching the mobile phones by Global Positioning System (GPS) technology use of location based services have been considered by public users more than ever.. Based on the position of users, they can receive the desired information from different LBS providers. Any LBS system generally includes five main parts: mobile devices, communication network, positioning system, service provider and data provider. By now many advances have been gained in relation to any of these parts; however the users positioning especially in indoor environments is propounded as an essential and critical issue in LBS. It is well known that GPS performs too poorly inside buildings to provide usable indoor positioning. On the other hand, current indoor positioning technologies such as using RFID or WiFi network need different hardware and software infrastructures. In this paper, we propose a new method to overcome these challenges. This method is using the Quick Response (QR) Code Technology. QR Code is a 2D encrypted barcode with a matrix structure which consists of black modules arranged in a square grid. Scanning and data retrieving process from QR Code is possible by use of different camera-enabled mobile phones only by installing the barcode reader software. This paper reviews the capabilities of QR Code technology and then discusses the advantages of using QR Code in Indoor LBS (ILBS) system in comparison to other technologies. Finally, some prospects of using QR Code are illustrated through implementation of a scenario. The most important advantages of using this new technology in ILBS are easy implementation, spending less expenses, quick data retrieval, possibility of printing the QR Code on different products and no need for complicated hardware and software infrastructures.

R-Syst::diatom: an open-access and curated barcode database for diatoms and freshwater monitoring.

PubMed

Rimet, Frédéric; Chaumeil, Philippe; Keck, François; Kermarrec, Lenaïg; Vasselon, Valentin; Kahlert, Maria; Franc, Alain; Bouchez, Agnès

2016-01-01

Diatoms are micro-algal indicators of freshwater pollution. Current standardized methodologies are based on microscopic determinations, which is time consuming and prone to identification uncertainties. The use of DNA-barcoding has been proposed as a way to avoid these flaws. Combining barcoding with next-generation sequencing enables collection of a large quantity of barcodes from natural samples. These barcodes are identified as certain diatom taxa by comparing the sequences to a reference barcoding library using algorithms. Proof of concept was recently demonstrated for synthetic and natural communities and underlined the importance of the quality of this reference library. We present an open-access and curated reference barcoding database for diatoms, called R-Syst::diatom, developed in the framework of R-Syst, the network of systematic supported by INRA (French National Institute for Agricultural Research), see http://www.rsyst.inra.fr/en. R-Syst::diatom links DNA-barcodes to their taxonomical identifications, and is dedicated to identify barcodes from natural samples. The data come from two sources, a culture collection of freshwater algae maintained in INRA in which new strains are regularly deposited and barcoded and from the NCBI (National Center for Biotechnology Information) nucleotide database. Two kinds of barcodes were chosen to support the database: 18S (18S ribosomal RNA) and rbcL (Ribulose-1,5-bisphosphate carboxylase/oxygenase), because of their efficiency. Data are curated using innovative (Declic) and classical bioinformatic tools (Blast, classical phylogenies) and up-to-date taxonomy (Catalogues and peer reviewed papers). Every 6 months R-Syst::diatom is updated. The database is available through the R-Syst microalgae website (http://www.rsyst.inra.fr/) and a platform dedicated to next-generation sequencing data analysis, virtual_BiodiversityL@b (https://galaxy-pgtp.pierroton.inra.fr/). We present here the content of the library regarding the number of barcodes and diatom taxa. In addition to these information, morphological features (e.g. biovolumes, chloroplasts…), life-forms (mobility, colony-type) or ecological features (taxa preferenda to pollution) are indicated in R-Syst::diatom. Database URL: http://www.rsyst.inra.fr/. © The Author(s) 2016. Published by Oxford University Press.

R-Syst::diatom: an open-access and curated barcode database for diatoms and freshwater monitoring

PubMed Central

Rimet, Frédéric; Chaumeil, Philippe; Keck, François; Kermarrec, Lenaïg; Vasselon, Valentin; Kahlert, Maria; Franc, Alain; Bouchez, Agnès

2016-01-01

Diatoms are micro-algal indicators of freshwater pollution. Current standardized methodologies are based on microscopic determinations, which is time consuming and prone to identification uncertainties. The use of DNA-barcoding has been proposed as a way to avoid these flaws. Combining barcoding with next-generation sequencing enables collection of a large quantity of barcodes from natural samples. These barcodes are identified as certain diatom taxa by comparing the sequences to a reference barcoding library using algorithms. Proof of concept was recently demonstrated for synthetic and natural communities and underlined the importance of the quality of this reference library. We present an open-access and curated reference barcoding database for diatoms, called R-Syst::diatom, developed in the framework of R-Syst, the network of systematic supported by INRA (French National Institute for Agricultural Research), see http://www.rsyst.inra.fr/en. R-Syst::diatom links DNA-barcodes to their taxonomical identifications, and is dedicated to identify barcodes from natural samples. The data come from two sources, a culture collection of freshwater algae maintained in INRA in which new strains are regularly deposited and barcoded and from the NCBI (National Center for Biotechnology Information) nucleotide database. Two kinds of barcodes were chosen to support the database: 18S (18S ribosomal RNA) and rbcL (Ribulose-1,5-bisphosphate carboxylase/oxygenase), because of their efficiency. Data are curated using innovative (Declic) and classical bioinformatic tools (Blast, classical phylogenies) and up-to-date taxonomy (Catalogues and peer reviewed papers). Every 6 months R-Syst::diatom is updated. The database is available through the R-Syst microalgae website (http://www.rsyst.inra.fr/) and a platform dedicated to next-generation sequencing data analysis, virtual_BiodiversityL@b (https://galaxy-pgtp.pierroton.inra.fr/). We present here the content of the library regarding the number of barcodes and diatom taxa. In addition to these information, morphological features (e.g. biovolumes, chloroplasts…), life-forms (mobility, colony-type) or ecological features (taxa preferenda to pollution) are indicated in R-Syst::diatom. Database URL: http://www.rsyst.inra.fr/ PMID:26989149

Supervised DNA Barcodes species classification: analysis, comparisons and results

PubMed Central

2014-01-01

Background Specific fragments, coming from short portions of DNA (e.g., mitochondrial, nuclear, and plastid sequences), have been defined as DNA Barcode and can be used as markers for organisms of the main life kingdoms. Species classification with DNA Barcode sequences has been proven effective on different organisms. Indeed, specific gene regions have been identified as Barcode: COI in animals, rbcL and matK in plants, and ITS in fungi. The classification problem assigns an unknown specimen to a known species by analyzing its Barcode. This task has to be supported with reliable methods and algorithms. Methods In this work the efficacy of supervised machine learning methods to classify species with DNA Barcode sequences is shown. The Weka software suite, which includes a collection of supervised classification methods, is adopted to address the task of DNA Barcode analysis. Classifier families are tested on synthetic and empirical datasets belonging to the animal, fungus, and plant kingdoms. In particular, the function-based method Support Vector Machines (SVM), the rule-based RIPPER, the decision tree C4.5, and the Naïve Bayes method are considered. Additionally, the classification results are compared with respect to ad-hoc and well-established DNA Barcode classification methods. Results A software that converts the DNA Barcode FASTA sequences to the Weka format is released, to adapt different input formats and to allow the execution of the classification procedure. The analysis of results on synthetic and real datasets shows that SVM and Naïve Bayes outperform on average the other considered classifiers, although they do not provide a human interpretable classification model. Rule-based methods have slightly inferior classification performances, but deliver the species specific positions and nucleotide assignments. On synthetic data the supervised machine learning methods obtain superior classification performances with respect to the traditional DNA Barcode classification methods. On empirical data their classification performances are at a comparable level to the other methods. Conclusions The classification analysis shows that supervised machine learning methods are promising candidates for handling with success the DNA Barcoding species classification problem, obtaining excellent performances. To conclude, a powerful tool to perform species identification is now available to the DNA Barcoding community. PMID:24721333

An Example of How Barcodes Can Clarify Cryptic Species: The Case of the Calanoid Copepod Mastigodiaptomus albuquerquensis (Herrick)

PubMed Central

Gutiérrez-Aguirre, Martha Angélica; Cervantes-Martínez, Adrián; Elías-Gutiérrez, Manuel

2014-01-01

Background The freshwater calanoid Mastigodiaptomus is a genus with high richness in the Americas and is composed of nine species, seven recorded in Mexico and four that are apparently endemic to small areas. Mastigodiaptomus albuquerquensis is a common, widely distributed species ranging from the southern USA to Central America. This species can be easily identified by a notable butterfly-like sclerotization on the basis of the right fifth leg of males. Nevertheless, morphological differences observed among populations throughout this species distributional range have led to the description of several related species or subspecies, such as M. albuquerquensis patzcuarensis from Lake Pátzcuaro in the Central Plateau of Mexico. Methods Genetic results based on barcodes, morphology based on scanning electron and light microscopy images, and morphometric analyses were used to describe cryptic species within the M. albuquerquensis complex. Results The morphological analyses coincided partially with the genetic markers, suggesting the existence of at least two sibling species: M. albuquerquensis s. str. and M. patzcuarensis. A third species was genetically separated but was morphologically indistinguishable from the M. patzcuarensis group. Conclusions Hidden diversity has been a major problem in establishing real patterns of species distribution and genetic acquisition from megadiverse hotspots such as Mexico, where the Nearctic and the Neotropical regions of the Americas meet. Barcodes can help taxonomists to reveal and formally name these new species. Here, we describe two of three potential species highlighted by the use of barcodes: M. albuquerquensis s. str. in the northern semi-desert and M. patzcuarensis on the Central Plateau at more than 2000 m above sea level. PMID:24465470

DNA Barcoding of the Endangered Aquilaria (Thymelaeaceae) and Its Application in Species Authentication of Agarwood Products Traded in the Market

PubMed Central

Lee, Shiou Yih; Ng, Wei Lun; Mahat, Mohd Noor; Nazre, Mohd; Mohamed, Rozi

2016-01-01

The identification of Aquilaria species from their resinous non-wood product, the agarwood, is challenging as conventional techniques alone are unable to ascertain the species origin. Aquilaria is a highly protected species due to the excessive exploitation of its precious agarwood. Here, we applied the DNA barcoding technique to generate barcode sequences for Aquilaria species and later applied the barcodes to identify the source species of agarwood found in the market. We developed a reference DNA barcode library using eight candidate barcode loci (matK, rbcL, rpoB, rpoC1, psbA-trnH, trnL-trnF, ITS, and ITS2) amplified from 24 leaf accessions of seven Aquilaria species obtained from living trees. Our results indicated that all single barcodes can be easily amplified and sequenced with the selected primers. The combination of trnL-trnF+ITS and trnL-trnF+ITS2 yielded the greatest species resolution using the least number of loci combination, while matK+trnL-trnF+ITS showed potential in detecting the geographical origins of Aquilaria species. We propose trnL-trnF+ITS2 as the best candidate barcode for Aquilaria as ITS2 has a shorter sequence length compared to ITS, which eases PCR amplification especially when using degraded DNA samples such as those extracted from processed agarwood products. A blind test conducted on eight agarwood samples in different forms using the proposed barcode combination proved successful in their identification up to the species level. Such potential of DNA barcoding in identifying the source species of agarwood will contribute to the international timber trade control, by providing an effective method for species identification and product authentication. PMID:27128309

Reading the Complex Skipper Butterfly Fauna of One Tropical Place

PubMed Central

Janzen, Daniel H.; Hallwachs, Winnie; Burns, John M.; Hajibabaei, Mehrdad; Bertrand, Claudia; Hebert, Paul D. N.

2011-01-01

Background An intense, 30-year, ongoing biodiversity inventory of Lepidoptera, together with their food plants and parasitoids, is centered on the rearing of wild-caught caterpillars in the 120,000 terrestrial hectares of dry, rain, and cloud forest of Area de Conservacion Guanacaste (ACG) in northwestern Costa Rica. Since 2003, DNA barcoding of all species has aided their identification and discovery. We summarize the process and results for a large set of the species of two speciose subfamilies of ACG skipper butterflies (Hesperiidae) and emphasize the effectiveness of barcoding these species (which are often difficult and time-consuming to identify). Methodology/Principal Findings Adults are DNA barcoded by the Biodiversity Institute of Ontario, Guelph, Canada; and they are identified by correlating the resulting COI barcode information with more traditional information such as food plant, facies, genitalia, microlocation within ACG, caterpillar traits, etc. This process has found about 303 morphologically defined species of eudamine and pyrgine Hesperiidae breeding in ACG (about 25% of the ACG butterfly fauna) and another 44 units indicated by distinct barcodes (n = 9,094), which may be additional species and therefore may represent as much as a 13% increase. All but the members of one complex can be identified by their DNA barcodes. Conclusions/Significance Addition of DNA barcoding to the methodology greatly improved the inventory, both through faster (hence cheaper) accurate identification of the species that are distinguishable without barcoding, as well as those that require it, and through the revelation of species “hidden” within what have long been viewed as single species. Barcoding increased the recognition of species-level specialization. It would be no more appropriate to ignore barcode data in a species inventory than it would be to ignore adult genitalia variation or caterpillar ecology. PMID:21857895

DNA barcoding simplifies environmental risk assessment of genetically modified crops in biodiverse regions.

PubMed

Nzeduru, Chinyere V; Ronca, Sandra; Wilkinson, Mike J

2012-01-01

Transgenes encoding for insecticidal crystal (Cry) proteins from the soil-dwelling bacterium Bacillus Thuringiensis have been widely introduced into Genetically Modified (GM) crops to confer protection against insect pests. Concern that these transgenes may also harm beneficial or otherwise valued insects (so-called Non Target Organisms, NTOs) represents a major element of the Environmental Risk Assessments (ERAs) used by all countries prior to commercial release. Compiling a comprehensive list of potentially susceptible NTOs is therefore a necessary part of an ERA for any Cry toxin-containing GM crop. In partly-characterised and biodiverse countries, NTO identification is slowed by the need for taxonomic expertise and time to enable morphological identifications. This limitation represents a potentially serious barrier to timely adoption of GM technology in some developing countries. We consider Bt Cry1A cowpea (Vigna unguiculata) in Nigeria as an exemplar to demonstrate how COI barcoding can provide a simple and cost-effective means of addressing this problem. Over a period of eight weeks, we collected 163 insects from cowpea flowers across the agroecological and geographic range of the crop in Nigeria. These individuals included 32 Operational Taxonomic Units (OTUs) spanning four Orders and that could mostly be assigned to genus or species level. They included 12 Lepidopterans and two Coleopterans (both potentially sensitive to different groups of Cry proteins). Thus, barcode-assisted diagnoses were highly harmonised across groups (typically to genus or species level) and so were insensitive to expertise or knowledge gaps. Decisively, the entire study was completed within four months at a cost of less than 10,000 US$. The broader implications of the findings for food security and the capacity for safe adoption of GM technology are briefly explored.

A DNA barcode for land plants.

PubMed

2009-08-04

DNA barcoding involves sequencing a standard region of DNA as a tool for species identification. However, there has been no agreement on which region(s) should be used for barcoding land plants. To provide a community recommendation on a standard plant barcode, we have compared the performance of 7 leading candidate plastid DNA regions (atpF-atpH spacer, matK gene, rbcL gene, rpoB gene, rpoC1 gene, psbK-psbI spacer, and trnH-psbA spacer). Based on assessments of recoverability, sequence quality, and levels of species discrimination, we recommend the 2-locus combination of rbcL+matK as the plant barcode. This core 2-locus barcode will provide a universal framework for the routine use of DNA sequence data to identify specimens and contribute toward the discovery of overlooked species of land plants.

A DNA barcode for land plants

PubMed Central

Hollingsworth, Peter M.; Forrest, Laura L.; Spouge, John L.; Hajibabaei, Mehrdad; Ratnasingham, Sujeevan; van der Bank, Michelle; Chase, Mark W.; Cowan, Robyn S.; Erickson, David L.; Fazekas, Aron J.; Graham, Sean W.; James, Karen E.; Kim, Ki-Joong; Kress, W. John; Schneider, Harald; van AlphenStahl, Jonathan; Barrett, Spencer C.H.; van den Berg, Cassio; Bogarin, Diego; Burgess, Kevin S.; Cameron, Kenneth M.; Carine, Mark; Chacón, Juliana; Clark, Alexandra; Clarkson, James J.; Conrad, Ferozah; Devey, Dion S.; Ford, Caroline S.; Hedderson, Terry A.J.; Hollingsworth, Michelle L.; Husband, Brian C.; Kelly, Laura J.; Kesanakurti, Prasad R.; Kim, Jung Sung; Kim, Young-Dong; Lahaye, Renaud; Lee, Hae-Lim; Long, David G.; Madriñán, Santiago; Maurin, Olivier; Meusnier, Isabelle; Newmaster, Steven G.; Park, Chong-Wook; Percy, Diana M.; Petersen, Gitte; Richardson, James E.; Salazar, Gerardo A.; Savolainen, Vincent; Seberg, Ole; Wilkinson, Michael J.; Yi, Dong-Keun; Little, Damon P.

2009-01-01

DNA barcoding involves sequencing a standard region of DNA as a tool for species identification. However, there has been no agreement on which region(s) should be used for barcoding land plants. To provide a community recommendation on a standard plant barcode, we have compared the performance of 7 leading candidate plastid DNA regions (atpF–atpH spacer, matK gene, rbcL gene, rpoB gene, rpoC1 gene, psbK–psbI spacer, and trnH–psbA spacer). Based on assessments of recoverability, sequence quality, and levels of species discrimination, we recommend the 2-locus combination of rbcL+matK as the plant barcode. This core 2-locus barcode will provide a universal framework for the routine use of DNA sequence data to identify specimens and contribute toward the discovery of overlooked species of land plants. PMID:19666622

Defining operational taxonomic units using DNA barcode data

PubMed Central

Blaxter, Mark; Mann, Jenna; Chapman, Tom; Thomas, Fran; Whitton, Claire; Floyd, Robin; Abebe, Eyualem

2005-01-01

Abstract The scale of diversity of life on this planet is a significant challenge for any scientific programme hoping to produce a complete catalogue, whatever means is used. For DNA barcoding studies, this difficulty is compounded by the realization that any chosen barcode sequence is not the gene ‘for’ speciation and that taxa have evolutionary histories. How are we to disentangle the confounding effects of reticulate population genetic processes? Using the DNA barcode data from meiofaunal surveys, here we discuss the benefits of treating the taxa defined by barcodes without reference to their correspondence to ‘species’, and suggest that using this non-idealist approach facilitates access to taxon groups that are not accessible to other methods of enumeration and classification. Major issues remain, in particular the methodologies for taxon discrimination in DNA barcode data. PMID:16214751

Validation of the ITS2 Region as a Novel DNA Barcode for Identifying Medicinal Plant Species

PubMed Central

Chen, Shilin; Yao, Hui; Han, Jianping; Liu, Chang; Song, Jingyuan; Shi, Linchun; Zhu, Yingjie; Ma, Xinye; Gao, Ting; Pang, Xiaohui; Luo, Kun; Li, Ying; Li, Xiwen; Jia, Xiaocheng; Lin, Yulin; Leon, Christine

2010-01-01

Background The plant working group of the Consortium for the Barcode of Life recommended the two-locus combination of rbcL + matK as the plant barcode, yet the combination was shown to successfully discriminate among 907 samples from 550 species at the species level with a probability of 72%. The group admits that the two-locus barcode is far from perfect due to the low identification rate, and the search is not over. Methodology/Principal Findings Here, we compared seven candidate DNA barcodes (psbA-trnH, matK, rbcL, rpoC1, ycf5, ITS2, and ITS) from medicinal plant species. Our ranking criteria included PCR amplification efficiency, differential intra- and inter-specific divergences, and the DNA barcoding gap. Our data suggest that the second internal transcribed spacer (ITS2) of nuclear ribosomal DNA represents the most suitable region for DNA barcoding applications. Furthermore, we tested the discrimination ability of ITS2 in more than 6600 plant samples belonging to 4800 species from 753 distinct genera and found that the rate of successful identification with the ITS2 was 92.7% at the species level. Conclusions The ITS2 region can be potentially used as a standard DNA barcode to identify medicinal plants and their closely related species. We also propose that ITS2 can serve as a novel universal barcode for the identification of a broader range of plant taxa. PMID:20062805

Multilocus inference of species trees and DNA barcoding.

PubMed

Mallo, Diego; Posada, David

2016-09-05

The unprecedented amount of data resulting from next-generation sequencing has opened a new era in phylogenetic estimation. Although large datasets should, in theory, increase phylogenetic resolution, massive, multilocus datasets have uncovered a great deal of phylogenetic incongruence among different genomic regions, due both to stochastic error and to the action of different evolutionary process such as incomplete lineage sorting, gene duplication and loss and horizontal gene transfer. This incongruence violates one of the fundamental assumptions of the DNA barcoding approach, which assumes that gene history and species history are identical. In this review, we explain some of the most important challenges we will have to face to reconstruct the history of species, and the advantages and disadvantages of different strategies for the phylogenetic analysis of multilocus data. In particular, we describe the evolutionary events that can generate species tree-gene tree discordance, compare the most popular methods for species tree reconstruction, highlight the challenges we need to face when using them and discuss their potential utility in barcoding. Current barcoding methods sacrifice a great amount of statistical power by only considering one locus, and a transition to multilocus barcodes would not only improve current barcoding methods, but also facilitate an eventual transition to species-tree-based barcoding strategies, which could better accommodate scenarios where the barcode gap is too small or inexistent.This article is part of the themed issue 'From DNA barcodes to biomes'. © 2016 The Authors.

Opening the treasure chest: A DNA-barcoding primer set for most higher taxa of Central European birds and mammals from museum collections

PubMed Central

Schäffer, Sylvia; Zachos, Frank E.

2017-01-01

DNA-barcoding is a rapidly developing method for efficiently identifying samples to species level by means of short standard DNA sequences. However, reliable species assignment requires the availability of a comprehensive DNA barcode reference library, and hence numerous initiatives aim at generating such barcode databases for particular taxa or geographic regions. Historical museum collections represent a potentially invaluable source for the DNA-barcoding of many taxa. This is particularly true for birds and mammals, for which collecting fresh (voucher) material is often very difficult to (nearly) impossible due to the special animal welfare and conservation regulations that apply to vertebrates in general, and birds and mammals in particular. Moreover, even great efforts might not guarantee sufficiently complete sampling of fresh material in a short period of time. DNA extracted from historical samples is usually degraded, such that only short fragments can be amplified, rendering the recovery of the barcoding region as a single fragment impossible. Here, we present a new set of primers that allows the efficient amplification and sequencing of the entire barcoding region in most higher taxa of Central European birds and mammals in six overlapping fragments, thus greatly increasing the value of historical museum collections for generating DNA barcode reference libraries. Applying our new primer set in recently established NGS protocols promises to further increase the efficiency of barcoding old bird and mammal specimens. PMID:28358863

Decision Tree Algorithm-Generated Single-Nucleotide Polymorphism Barcodes of rbcL Genes for 38 Brassicaceae Species Tagging.

PubMed

Yang, Cheng-Hong; Wu, Kuo-Chuan; Chuang, Li-Yeh; Chang, Hsueh-Wei

2018-01-01

DNA barcode sequences are accumulating in large data sets. A barcode is generally a sequence larger than 1000 base pairs and generates a computational burden. Although the DNA barcode was originally envisioned as straightforward species tags, the identification usage of barcode sequences is rarely emphasized currently. Single-nucleotide polymorphism (SNP) association studies provide us an idea that the SNPs may be the ideal target of feature selection to discriminate between different species. We hypothesize that SNP-based barcodes may be more effective than the full length of DNA barcode sequences for species discrimination. To address this issue, we tested a r ibulose diphosphate carboxylase ( rbcL ) S NP b arcoding (RSB) strategy using a decision tree algorithm. After alignment and trimming, 31 SNPs were discovered in the rbcL sequences from 38 Brassicaceae plant species. In the decision tree construction, these SNPs were computed to set up the decision rule to assign the sequences into 2 groups level by level. After algorithm processing, 37 nodes and 31 loci were required for discriminating 38 species. Finally, the sequence tags consisting of 31 rbcL SNP barcodes were identified for discriminating 38 Brassicaceae species based on the decision tree-selected SNP pattern using RSB method. Taken together, this study provides the rational that the SNP aspect of DNA barcode for rbcL gene is a useful and effective sequence for tagging 38 Brassicaceae species.

Opening the treasure chest: A DNA-barcoding primer set for most higher taxa of Central European birds and mammals from museum collections.

PubMed

Schäffer, Sylvia; Zachos, Frank E; Koblmüller, Stephan

2017-01-01

DNA-barcoding is a rapidly developing method for efficiently identifying samples to species level by means of short standard DNA sequences. However, reliable species assignment requires the availability of a comprehensive DNA barcode reference library, and hence numerous initiatives aim at generating such barcode databases for particular taxa or geographic regions. Historical museum collections represent a potentially invaluable source for the DNA-barcoding of many taxa. This is particularly true for birds and mammals, for which collecting fresh (voucher) material is often very difficult to (nearly) impossible due to the special animal welfare and conservation regulations that apply to vertebrates in general, and birds and mammals in particular. Moreover, even great efforts might not guarantee sufficiently complete sampling of fresh material in a short period of time. DNA extracted from historical samples is usually degraded, such that only short fragments can be amplified, rendering the recovery of the barcoding region as a single fragment impossible. Here, we present a new set of primers that allows the efficient amplification and sequencing of the entire barcoding region in most higher taxa of Central European birds and mammals in six overlapping fragments, thus greatly increasing the value of historical museum collections for generating DNA barcode reference libraries. Applying our new primer set in recently established NGS protocols promises to further increase the efficiency of barcoding old bird and mammal specimens.

DNA barcodes of the native ray-finned fishes in Taiwan.

PubMed

Chang, Chia-Hao; Shao, Kwang-Tsao; Lin, Han-Yang; Chiu, Yung-Chieh; Lee, Mao-Ying; Liu, Shih-Hui; Lin, Pai-Lei

2017-07-01

Species identification based on the DNA sequence of a fragment of the cytochrome c oxidase subunit I gene in the mitochondrial genome, DNA barcoding, is widely applied to assist in sustainable exploitation of fish resources and the protection of fish biodiversity. The aim of this study was to establish a reliable barcoding reference database of the native ray-finned fishes in Taiwan. A total of 2993 individuals, belonging to 1245 species within 637 genera, 184 families and 29 orders of ray-finned fishes and representing approximately 40% of the recorded ray-finned fishes in Taiwan, were PCR amplified at the barcode region and bidirectionally sequenced. The mean length of the 2993 barcodes is 549 bp. Mean congeneric K2P distance (15.24%) is approximately 10-fold higher than the mean conspecific one (1.51%), but approximately 1.4-fold less than the mean genetic distance between families (20.80%). The Barcode Index Number (BIN) discordance report shows that 2993 specimens represent 1275 BINs and, among them, 86 BINs are singletons, 570 BINs are taxonomically concordant, and the other 619 BINs are taxonomically discordant. Barcode gap analysis also revealed that more than 90% of the collected fishes in this study can be discriminated by DNA barcoding. Overall, the barcoding reference database established by this study reveals the need for taxonomic revisions and voucher specimen rechecks, in addition to assisting in the management of Taiwan's fish resources and diversity. © 2016 John Wiley & Sons Ltd.

ERASE-Seq: Leveraging replicate measurements to enhance ultralow frequency variant detection in NGS data

PubMed Central

Kamps-Hughes, Nick; McUsic, Andrew; Kurihara, Laurie; Harkins, Timothy T.; Pal, Prithwish; Ray, Claire

2018-01-01

The accurate detection of ultralow allele frequency variants in DNA samples is of interest in both research and medical settings, particularly in liquid biopsies where cancer mutational status is monitored from circulating DNA. Next-generation sequencing (NGS) technologies employing molecular barcoding have shown promise but significant sensitivity and specificity improvements are still needed to detect mutations in a majority of patients before the metastatic stage. To address this we present analytical validation data for ERASE-Seq (Elimination of Recurrent Artifacts and Stochastic Errors), a method for accurate and sensitive detection of ultralow frequency DNA variants in NGS data. ERASE-Seq differs from previous methods by creating a robust statistical framework to utilize technical replicates in conjunction with background error modeling, providing a 10 to 100-fold reduction in false positive rates compared to published molecular barcoding methods. ERASE-Seq was tested using spiked human DNA mixtures with clinically realistic DNA input quantities to detect SNVs and indels between 0.05% and 1% allele frequency, the range commonly found in liquid biopsy samples. Variants were detected with greater than 90% sensitivity and a false positive rate below 0.1 calls per 10,000 possible variants. The approach represents a significant performance improvement compared to molecular barcoding methods and does not require changing molecular reagents. PMID:29630678

Developing Mobile BIM/2D Barcode-Based Automated Facility Management System

PubMed Central

Chen, Yen-Pei

2014-01-01

Facility management (FM) has become an important topic in research on the operation and maintenance phase. Managing the work of FM effectively is extremely difficult owing to the variety of environments. One of the difficulties is the performance of two-dimensional (2D) graphics when depicting facilities. Building information modeling (BIM) uses precise geometry and relevant data to support the facilities depicted in three-dimensional (3D) object-oriented computer-aided design (CAD). This paper proposes a new and practical methodology with application to FM that uses an integrated 2D barcode and the BIM approach. Using 2D barcode and BIM technologies, this study proposes a mobile automated BIM-based facility management (BIMFM) system for FM staff in the operation and maintenance phase. The mobile automated BIMFM system is then applied in a selected case study of a commercial building project in Taiwan to verify the proposed methodology and demonstrate its effectiveness in FM practice. The combined results demonstrate that a BIMFM-like system can be an effective mobile automated FM tool. The advantage of the mobile automated BIMFM system lies not only in improving FM work efficiency for the FM staff but also in facilitating FM updates and transfers in the BIM environment. PMID:25250373

Developing mobile BIM/2D barcode-based automated facility management system.

PubMed

Lin, Yu-Cheng; Su, Yu-Chih; Chen, Yen-Pei

2014-01-01

Facility management (FM) has become an important topic in research on the operation and maintenance phase. Managing the work of FM effectively is extremely difficult owing to the variety of environments. One of the difficulties is the performance of two-dimensional (2D) graphics when depicting facilities. Building information modeling (BIM) uses precise geometry and relevant data to support the facilities depicted in three-dimensional (3D) object-oriented computer-aided design (CAD). This paper proposes a new and practical methodology with application to FM that uses an integrated 2D barcode and the BIM approach. Using 2D barcode and BIM technologies, this study proposes a mobile automated BIM-based facility management (BIMFM) system for FM staff in the operation and maintenance phase. The mobile automated BIMFM system is then applied in a selected case study of a commercial building project in Taiwan to verify the proposed methodology and demonstrate its effectiveness in FM practice. The combined results demonstrate that a BIMFM-like system can be an effective mobile automated FM tool. The advantage of the mobile automated BIMFM system lies not only in improving FM work efficiency for the FM staff but also in facilitating FM updates and transfers in the BIM environment.

Genetic barcodes

DOEpatents

Weier, Heinz -Ulrich G

2015-08-04

Herein are described multicolor FISH probe sets termed "genetic barcodes" targeting several cancer or disease-related loci to assess gene rearrangements and copy number changes in tumor cells. Two, three or more different fluorophores are used to detect the genetic barcode sections thus permitting unique labeling and multilocus analysis in individual cell nuclei. Gene specific barcodes can be generated and combined to provide both numerical and structural genetic information for these and other pertinent disease associated genes.

Potential for DNA-based identification of Great Lakes fauna: match and mismatch between taxa inventories and DNA barcode libraries.

PubMed

Trebitz, Anett S; Hoffman, Joel C; Grant, George W; Billehus, Tyler M; Pilgrim, Erik M

2015-07-22

DNA-based identification of mixed-organism samples offers the potential to greatly reduce the need for resource-intensive morphological identification, which would be of value both to bioassessment and non-native species monitoring. The ability to assign species identities to DNA sequences found depends on the availability of comprehensive DNA reference libraries. Here, we compile inventories for aquatic metazoans extant in or threatening to invade the Laurentian Great Lakes and examine the availability of reference mitochondrial COI DNA sequences (barcodes) in the Barcode of Life Data System for them. We found barcode libraries largely complete for extant and threatening-to-invade vertebrates (100% of reptile, 99% of fish, and 92% of amphibian species had barcodes). In contrast, barcode libraries remain poorly developed for precisely those organisms where morphological identification is most challenging; 46% of extant invertebrates lacked reference barcodes with rates especially high among rotifers, oligochaetes, and mites. Lack of species-level identification for many aquatic invertebrates also is a barrier to matching DNA sequences with physical specimens. Attaining the potential for DNA-based identification of mixed-organism samples covering the breadth of aquatic fauna requires a concerted effort to build supporting barcode libraries and voucher collections.

Potential for DNA-based identification of Great Lakes fauna: match and mismatch between taxa inventories and DNA barcode libraries

NASA Astrophysics Data System (ADS)

Trebitz, Anett S.; Hoffman, Joel C.; Grant, George W.; Billehus, Tyler M.; Pilgrim, Erik M.

2015-07-01

DNA-based identification of mixed-organism samples offers the potential to greatly reduce the need for resource-intensive morphological identification, which would be of value both to bioassessment and non-native species monitoring. The ability to assign species identities to DNA sequences found depends on the availability of comprehensive DNA reference libraries. Here, we compile inventories for aquatic metazoans extant in or threatening to invade the Laurentian Great Lakes and examine the availability of reference mitochondrial COI DNA sequences (barcodes) in the Barcode of Life Data System for them. We found barcode libraries largely complete for extant and threatening-to-invade vertebrates (100% of reptile, 99% of fish, and 92% of amphibian species had barcodes). In contrast, barcode libraries remain poorly developed for precisely those organisms where morphological identification is most challenging; 46% of extant invertebrates lacked reference barcodes with rates especially high among rotifers, oligochaetes, and mites. Lack of species-level identification for many aquatic invertebrates also is a barrier to matching DNA sequences with physical specimens. Attaining the potential for DNA-based identification of mixed-organism samples covering the breadth of aquatic fauna requires a concerted effort to build supporting barcode libraries and voucher collections.

Complete DNA barcode reference library for a country's butterfly fauna reveals high performance for temperate Europe

PubMed Central

Dincă, Vlad; Zakharov, Evgeny V.; Hebert, Paul D. N.; Vila, Roger

2011-01-01

DNA barcoding aims to accelerate species identification and discovery, but performance tests have shown marked differences in identification success. As a consequence, there remains a great need for comprehensive studies which objectively test the method in groups with a solid taxonomic framework. This study focuses on the 180 species of butterflies in Romania, accounting for about one third of the European butterfly fauna. This country includes five eco-regions, the highest of any in the European Union, and is a good representative for temperate areas. Morphology and DNA barcodes of more than 1300 specimens were carefully studied and compared. Our results indicate that 90 per cent of the species form barcode clusters allowing their reliable identification. The remaining cases involve nine closely related species pairs, some whose taxonomic status is controversial or that hybridize regularly. Interestingly, DNA barcoding was found to be the most effective identification tool, outperforming external morphology, and being slightly better than male genitalia. Romania is now the first country to have a comprehensive DNA barcode reference database for butterflies. Similar barcoding efforts based on comprehensive sampling of specific geographical regions can act as functional modules that will foster the early application of DNA barcoding while a global system is under development. PMID:20702462

The Trichoptera barcode initiative: a strategy for generating a species-level Tree of Life.

PubMed

Zhou, Xin; Frandsen, Paul B; Holzenthal, Ralph W; Beet, Clare R; Bennett, Kristi R; Blahnik, Roger J; Bonada, Núria; Cartwright, David; Chuluunbat, Suvdtsetseg; Cocks, Graeme V; Collins, Gemma E; deWaard, Jeremy; Dean, John; Flint, Oliver S; Hausmann, Axel; Hendrich, Lars; Hess, Monika; Hogg, Ian D; Kondratieff, Boris C; Malicky, Hans; Milton, Megan A; Morinière, Jérôme; Morse, John C; Mwangi, François Ngera; Pauls, Steffen U; Gonzalez, María Razo; Rinne, Aki; Robinson, Jason L; Salokannel, Juha; Shackleton, Michael; Smith, Brian; Stamatakis, Alexandros; StClair, Ros; Thomas, Jessica A; Zamora-Muñoz, Carmen; Ziesmann, Tanja; Kjer, Karl M

2016-09-05

DNA barcoding was intended as a means to provide species-level identifications through associating DNA sequences from unknown specimens to those from curated reference specimens. Although barcodes were not designed for phylogenetics, they can be beneficial to the completion of the Tree of Life. The barcode database for Trichoptera is relatively comprehensive, with data from every family, approximately two-thirds of the genera, and one-third of the described species. Most Trichoptera, as with most of life's species, have never been subjected to any formal phylogenetic analysis. Here, we present a phylogeny with over 16 000 unique haplotypes as a working hypothesis that can be updated as our estimates improve. We suggest a strategy of implementing constrained tree searches, which allow larger datasets to dictate the backbone phylogeny, while the barcode data fill out the tips of the tree. We also discuss how this phylogeny could be used to focus taxonomic attention on ambiguous species boundaries and hidden biodiversity. We suggest that systematists continue to differentiate between 'Barcode Index Numbers' (BINs) and 'species' that have been formally described. Each has utility, but they are not synonyms. We highlight examples of integrative taxonomy, using both barcodes and morphology for species description.This article is part of the themed issue 'From DNA barcodes to biomes'. © 2016 The Authors.

Accuracy and time requirements of a bar-code inventory system for medical supplies.

PubMed

Hanson, L B; Weinswig, M H; De Muth, J E

1988-02-01

The effects of implementing a bar-code system for issuing medical supplies to nursing units at a university teaching hospital were evaluated. Data on the time required to issue medical supplies to three nursing units at a 480-bed, tertiary-care teaching hospital were collected (1) before the bar-code system was implemented (i.e., when the manual system was in use), (2) one month after implementation, and (3) four months after implementation. At the same times, the accuracy of the central supply perpetual inventory was monitored using 15 selected items. One-way analysis of variance tests were done to determine any significant differences between the bar-code and manual systems. Using the bar-code system took longer than using the manual system because of a significant difference in the time required for order entry into the computer. Multiple-use requirements of the central supply computer system made entering bar-code data a much slower process. There was, however, a significant improvement in the accuracy of the perpetual inventory. Using the bar-code system for issuing medical supplies to the nursing units takes longer than using the manual system. However, the accuracy of the perpetual inventory was significantly improved with the implementation of the bar-code system.

A smartphone-readable barcode assay for the detection and quantitation of pesticide residues.

PubMed

Guo, Juan; Wong, Jessica X H; Cui, Caie; Li, Xiaochun; Yu, Hua-Zhong

2015-08-21

In this paper, we present a smartphone-readable barcode assay for the qualitative detection of methyl parathion residues, a toxic organophosphorus pesticide that is popularly used in agriculture worldwide. The detection principle is based on the irreversible inhibition of the enzymatic activity of acetylcholinesterase (AchE) by methyl parathion; AchE catalytically hydrolyzes acetylthiocholine iodine to thiocholine that in turn dissociates dithiobis-nitrobenzoate to produce a yellow product (deprotonated thio-nitrobenzoate). The yellow intensity of the product was confirmed to be inversely dependent on the concentration of the pesticide. We have designed a barcode-formatted assay chip by using a PDMS (polydimethylsiloxane) channel plate (as the reaction reservoir), situated under a printed partial barcode, to complete the whole barcode such that it can be directly read by a barcode scanning app installed on a smartphone. The app is able to qualitatively present the result of the pesticide test; the absence or a low concentration of methyl parathion results in the barcode reading as "-", identifying the test as negative for pesticides. Upon obtaining a positive result (the app reads a "+" character), the captured image can be further analyzed to quantitate the methyl parathion concentration in the sample. Besides the portability and simplicity, this mobile-app based colorimetric barcode assay compares favorably with the standard spectrophotometric method.

Taxonomic challenges in freshwater fishes: a mismatch between morphology and DNA barcoding in fish of the north-eastern part of the Congo basin.

PubMed

Decru, Eva; Moelants, Tuur; De Gelas, Koen; Vreven, Emmanuel; Verheyen, Erik; Snoeks, Jos

2016-01-01

This study evaluates the utility of DNA barcoding to traditional morphology-based species identifications for the fish fauna of the north-eastern Congo basin. We compared DNA sequences (COI) of 821 samples from 206 morphologically identified species. Best match, best close match and all species barcoding analyses resulted in a rather low identification success of 87.5%, 84.5% and 64.1%, respectively. The ratio 'nearest-neighbour distance/maximum intraspecific divergence' was lower than 1 for 26.1% of the samples, indicating possible taxonomic problems. In ten genera, belonging to six families, the number of species inferred from mtDNA data exceeded the number of species identified using morphological features; and in four cases indications of possible synonymy were detected. Finally, the DNA barcodes confirmed previously known identification problems within certain genera of the Clariidae, Cyprinidae and Mormyridae. Our results underscore the large number of taxonomic problems lingering in the taxonomy of the fish fauna of the Congo basin and illustrate why DNA barcodes will contribute to future efforts to compile a reliable taxonomic inventory of the Congo basin fish fauna. Therefore, the obtained barcodes were deposited in the reference barcode library of the Barcode of Life Initiative. © 2015 John Wiley & Sons Ltd.

Preventing the forgotten ureteral stent: implementation of a web-based stent registry with automatic recall application.

PubMed

Lynch, Mark F; Ghani, Khurshid R; Frost, Ian; Anson, Ken M

2007-09-01

To describe and analyze a unique computerized system that tracks ureteral stents and automatically sends a notice by e-mail to clinical staff if a stent becomes overdue for removal. We have developed an electronic stent register (ESR) and stent extraction reminder facility (SERF) located within our hospital computer network. After stent insertion, a stent "episode" is created in the ESR with a mandatory maximal stent life (MSL). The SERF interrogates the ESR on a daily basis and identifies stents that have breached its MSL, generating daily e-mail notices to personnel until the stent is removed and the ESR updated. The episode data capture initially employing manual entry was changed to barcode technology acquisition. We analyzed the success of patient recall and conducted a prospective, blinded review to determine the success of the data acquisition. A total of 293 episodes were created within 2.4 years. Of the 241 (86%) episodes that were closed, 123 (51%) went beyond the MSL. The mean delay from designated MSL to stent removal was 20.89 days (SD 19.71). In the 7 months before barcode data acquisition, 43 of 71 stents were entered into the ESR (data capture rate 61%). In the 7 months after barcode data acquisition, 52 of 60 stents were entered (data capture rate 87%; P = 0.0009). The results of our study have shown the ESR and SERF to be robust and valuable tools for the treatment of patients with ureteral stents. Barcode acquisition significantly improved the stent insertion capture rate. This system ensures improved patient safety with an element of protection from potential litigation.

Filling Gaps in Biodiversity Knowledge for Macrofungi: Contributions and Assessment of an Herbarium Collection DNA Barcode Sequencing Project

PubMed Central

Osmundson, Todd W.; Robert, Vincent A.; Schoch, Conrad L.; Baker, Lydia J.; Smith, Amy; Robich, Giovanni; Mizzan, Luca; Garbelotto, Matteo M.

2013-01-01

Despite recent advances spearheaded by molecular approaches and novel technologies, species description and DNA sequence information are significantly lagging for fungi compared to many other groups of organisms. Large scale sequencing of vouchered herbarium material can aid in closing this gap. Here, we describe an effort to obtain broad ITS sequence coverage of the approximately 6000 macrofungal-species-rich herbarium of the Museum of Natural History in Venice, Italy. Our goals were to investigate issues related to large sequencing projects, develop heuristic methods for assessing the overall performance of such a project, and evaluate the prospects of such efforts to reduce the current gap in fungal biodiversity knowledge. The effort generated 1107 sequences submitted to GenBank, including 416 previously unrepresented taxa and 398 sequences exhibiting a best BLAST match to an unidentified environmental sequence. Specimen age and taxon affected sequencing success, and subsequent work on failed specimens showed that an ITS1 mini-barcode greatly increased sequencing success without greatly reducing the discriminating power of the barcode. Similarity comparisons and nonmetric multidimensional scaling ordinations based on pairwise distance matrices proved to be useful heuristic tools for validating the overall accuracy of specimen identifications, flagging potential misidentifications, and identifying taxa in need of additional species-level revision. Comparison of within- and among-species nucleotide variation showed a strong increase in species discriminating power at 1–2% dissimilarity, and identified potential barcoding issues (same sequence for different species and vice-versa). All sequences are linked to a vouchered specimen, and results from this study have already prompted revisions of species-sequence assignments in several taxa. PMID:23638077

Real-time DNA barcoding in a rainforest using nanopore sequencing: opportunities for rapid biodiversity assessments and local capacity building.

PubMed

Pomerantz, Aaron; Peñafiel, Nicolás; Arteaga, Alejandro; Bustamante, Lucas; Pichardo, Frank; Coloma, Luis A; Barrio-Amorós, César L; Salazar-Valenzuela, David; Prost, Stefan

2018-04-01

Advancements in portable scientific instruments provide promising avenues to expedite field work in order to understand the diverse array of organisms that inhabit our planet. Here, we tested the feasibility for in situ molecular analyses of endemic fauna using a portable laboratory fitting within a single backpack in one of the world's most imperiled biodiversity hotspots, the Ecuadorian Chocó rainforest. We used portable equipment, including the MinION nanopore sequencer (Oxford Nanopore Technologies) and the miniPCR (miniPCR), to perform DNA extraction, polymerase chain reaction amplification, and real-time DNA barcoding of reptile specimens in the field. We demonstrate that nanopore sequencing can be implemented in a remote tropical forest to quickly and accurately identify species using DNA barcoding, as we generated consensus sequences for species resolution with an accuracy of >99% in less than 24 hours after collecting specimens. The flexibility of our mobile laboratory further allowed us to generate sequence information at the Universidad Tecnológica Indoamérica in Quito for rare, endangered, and undescribed species. This includes the recently rediscovered Jambato toad, which was thought to be extinct for 28 years. Sequences generated on the MinION required as few as 30 reads to achieve high accuracy relative to Sanger sequencing, and with further multiplexing of samples, nanopore sequencing can become a cost-effective approach for rapid and portable DNA barcoding. Overall, we establish how mobile laboratories and nanopore sequencing can help to accelerate species identification in remote areas to aid in conservation efforts and be applied to research facilities in developing countries. This opens up possibilities for biodiversity studies by promoting local research capacity building, teaching nonspecialists and students about the environment, tackling wildlife crime, and promoting conservation via research-focused ecotourism.

Filling gaps in biodiversity knowledge for macrofungi: contributions and assessment of an herbarium collection DNA barcode sequencing project.

PubMed

Osmundson, Todd W; Robert, Vincent A; Schoch, Conrad L; Baker, Lydia J; Smith, Amy; Robich, Giovanni; Mizzan, Luca; Garbelotto, Matteo M

2013-01-01

Despite recent advances spearheaded by molecular approaches and novel technologies, species description and DNA sequence information are significantly lagging for fungi compared to many other groups of organisms. Large scale sequencing of vouchered herbarium material can aid in closing this gap. Here, we describe an effort to obtain broad ITS sequence coverage of the approximately 6000 macrofungal-species-rich herbarium of the Museum of Natural History in Venice, Italy. Our goals were to investigate issues related to large sequencing projects, develop heuristic methods for assessing the overall performance of such a project, and evaluate the prospects of such efforts to reduce the current gap in fungal biodiversity knowledge. The effort generated 1107 sequences submitted to GenBank, including 416 previously unrepresented taxa and 398 sequences exhibiting a best BLAST match to an unidentified environmental sequence. Specimen age and taxon affected sequencing success, and subsequent work on failed specimens showed that an ITS1 mini-barcode greatly increased sequencing success without greatly reducing the discriminating power of the barcode. Similarity comparisons and nonmetric multidimensional scaling ordinations based on pairwise distance matrices proved to be useful heuristic tools for validating the overall accuracy of specimen identifications, flagging potential misidentifications, and identifying taxa in need of additional species-level revision. Comparison of within- and among-species nucleotide variation showed a strong increase in species discriminating power at 1-2% dissimilarity, and identified potential barcoding issues (same sequence for different species and vice-versa). All sequences are linked to a vouchered specimen, and results from this study have already prompted revisions of species-sequence assignments in several taxa.

A DNA Barcode Library for Korean Chironomidae (Insecta: Diptera) and Indexes for Defining Barcode Gap

PubMed Central

Kim, Sungmin; Song, Kyo-Hong; Ree, Han-Il; Kim, Won

2012-01-01

Non-biting midges (Diptera: Chironomidae) are a diverse population that commonly causes respiratory allergies in humans. Chironomid larvae can be used to indicate freshwater pollution, but accurate identification on the basis of morphological characteristics is difficult. In this study, we constructed a mitochondrial cytochrome c oxidase subunit I (COI)-based DNA barcode library for Korean chironomids. This library consists of 211 specimens from 49 species, including adults and unidentified larvae. The interspecies and intraspecies COI sequence variations were analyzed. Sophisticated indexes were developed in order to properly evaluate indistinct barcode gaps that are created by insufficient sampling on both the interspecies and intraspecies levels and by variable mutation rates across taxa. In a variety of insect datasets, these indexes were useful for re-evaluating large barcode datasets and for defining COI barcode gaps. The COI-based DNA barcode library will provide a rapid and reliable tool for the molecular identification of Korean chironomid species. Furthermore, this reverse-taxonomic approach will be improved by the continuous addition of other speceis’ sequences to the library. PMID:22138764

Barcode extension for analysis and reconstruction of structures

NASA Astrophysics Data System (ADS)

Myhrvold, Cameron; Baym, Michael; Hanikel, Nikita; Ong, Luvena L.; Gootenberg, Jonathan S.; Yin, Peng

2017-03-01

Collections of DNA sequences can be rationally designed to self-assemble into predictable three-dimensional structures. The geometric and functional diversity of DNA nanostructures created to date has been enhanced by improvements in DNA synthesis and computational design. However, existing methods for structure characterization typically image the final product or laboriously determine the presence of individual, labelled strands using gel electrophoresis. Here we introduce a new method of structure characterization that uses barcode extension and next-generation DNA sequencing to quantitatively measure the incorporation of every strand into a DNA nanostructure. By quantifying the relative abundances of distinct DNA species in product and monomer bands, we can study the influence of geometry and sequence on assembly. We have tested our method using 2D and 3D DNA brick and DNA origami structures. Our method is general and should be extensible to a wide variety of DNA nanostructures.

Barcode extension for analysis and reconstruction of structures.

PubMed

Myhrvold, Cameron; Baym, Michael; Hanikel, Nikita; Ong, Luvena L; Gootenberg, Jonathan S; Yin, Peng

2017-03-13

Collections of DNA sequences can be rationally designed to self-assemble into predictable three-dimensional structures. The geometric and functional diversity of DNA nanostructures created to date has been enhanced by improvements in DNA synthesis and computational design. However, existing methods for structure characterization typically image the final product or laboriously determine the presence of individual, labelled strands using gel electrophoresis. Here we introduce a new method of structure characterization that uses barcode extension and next-generation DNA sequencing to quantitatively measure the incorporation of every strand into a DNA nanostructure. By quantifying the relative abundances of distinct DNA species in product and monomer bands, we can study the influence of geometry and sequence on assembly. We have tested our method using 2D and 3D DNA brick and DNA origami structures. Our method is general and should be extensible to a wide variety of DNA nanostructures.

Barcode extension for analysis and reconstruction of structures

PubMed Central

Myhrvold, Cameron; Baym, Michael; Hanikel, Nikita; Ong, Luvena L; Gootenberg, Jonathan S; Yin, Peng

2017-01-01

Collections of DNA sequences can be rationally designed to self-assemble into predictable three-dimensional structures. The geometric and functional diversity of DNA nanostructures created to date has been enhanced by improvements in DNA synthesis and computational design. However, existing methods for structure characterization typically image the final product or laboriously determine the presence of individual, labelled strands using gel electrophoresis. Here we introduce a new method of structure characterization that uses barcode extension and next-generation DNA sequencing to quantitatively measure the incorporation of every strand into a DNA nanostructure. By quantifying the relative abundances of distinct DNA species in product and monomer bands, we can study the influence of geometry and sequence on assembly. We have tested our method using 2D and 3D DNA brick and DNA origami structures. Our method is general and should be extensible to a wide variety of DNA nanostructures. PMID:28287117

Pharmacy workers' perceptions and acceptance of bar-coded medication technology in a pediatric hospital.

PubMed

Holden, Richard J; Brown, Roger L; Scanlon, Matthew C; Karsh, Ben-Tzion

2012-01-01

The safety benefits of bar-coded medication-dispensing and administration (BCMA) technology depend on its intended users favorably perceiving, accepting, and ultimately using the technology. (1) To describe pharmacy workers' perceptions and acceptance of a recently implemented BCMA system and (2) to model the relationship between perceptions and acceptance of BCMA. Pharmacists and pharmacy technicians at a Midwest U.S. pediatric hospital were surveyed following the hospital's implementation of a BCMA system. Twenty-nine pharmacists' and 10 technicians' self-reported perceptions and acceptance of the BCMA system were analyzed, supplemented by qualitative observational and free-response survey data. Perception-acceptance associations were analyzed using structural models. The BCMA system's perceived ease of use was rated low by pharmacists and moderate by pharmacy technicians. Both pharmacists and technicians perceived that the BCMA system was not useful for improving either personal job performance or patient care. Pharmacy workers perceived that individuals important to them encouraged BMCA use. Pharmacy workers generally intended to use BCMA but reported low satisfaction with the system. Perceptions explained 72% of the variance in intention to use BCMA and 79% of variance in satisfaction with BCMA. To promote their acceptance and use, BCMA and other technologies must be better designed and integrated into the clinical work system. Key steps to achieving better design and integration include measuring clinicians' acceptance and elucidating perceptions and other factors that shape acceptance. Copyright © 2012 Elsevier Inc. All rights reserved.

DNA barcoding of odonates from the Upper Plata basin: Database creation and genetic diversity estimation.

PubMed

Koroiva, Ricardo; Pepinelli, Mateus; Rodrigues, Marciel Elio; Roque, Fabio de Oliveira; Lorenz-Lemke, Aline Pedroso; Kvist, Sebastian

2017-01-01

We present a DNA barcoding study of Neotropical odonates from the Upper Plata basin, Brazil. A total of 38 species were collected in a transition region of "Cerrado" and Atlantic Forest, both regarded as biological hotspots, and 130 cytochrome c oxidase subunit I (COI) barcodes were generated for the collected specimens. The distinct gap between intraspecific (0-2%) and interspecific variation (15% and above) in COI, and resulting separation of Barcode Index Numbers (BIN), allowed for successful identification of specimens in 94% of cases. The 6% fail rate was due to a shared BIN between two separate nominal species. DNA barcoding, based on COI, thus seems to be a reliable and efficient tool for identifying Neotropical odonate specimens down to the species level. These results underscore the utility of DNA barcoding to aid specimen identification in diverse biological hotspots, areas that require urgent action regarding taxonomic surveys and biodiversity conservation.

Gold Nanoparticles-Based Barcode Analysis for Detection of Norepinephrine.

PubMed

An, Jeung Hee; Lee, Kwon-Jai; Choi, Jeong-Woo

2016-02-01

Nanotechnology-based bio-barcode amplification analysis offers an innovative approach for detecting neurotransmitters. We evaluated the efficacy of this method for detecting norepinephrine in normal and oxidative-stress damaged dopaminergic cells. Our approach use a combination of DNA barcodes and bead-based immunoassays for detecting neurotransmitters with surface-enhanced Raman spectroscopy (SERS), and provides polymerase chain reaction (PCR)-like sensitivity. This method relies on magnetic Dynabeads containing antibodies and nanoparticles that are loaded both with DNA barcords and with antibodies that can sandwich the target protein captured by the Dynabead-bound antibodies. The aggregate sandwich structures are magnetically separated from the solution and treated to remove the conjugated barcode DNA. The DNA barcodes are then identified by SERS and PCR analysis. The concentration of norepinephrine in dopaminergic cells can be readily detected using the bio-barcode assay, which is a rapid, high-throughput screening tool for detecting neurotransmitters.

Diversity in a Cold Hot-Spot: DNA-Barcoding Reveals Patterns of Evolution among Antarctic Demosponges (Class Demospongiae, Phylum Porifera).

PubMed

Vargas, Sergio; Kelly, Michelle; Schnabel, Kareen; Mills, Sadie; Bowden, David; Wörheide, Gert

2015-01-01

The approximately 350 demosponge species that have been described from Antarctica represent a faunistic component distinct from that of neighboring regions. Sponges provide structure to the Antarctic benthos and refuge to other invertebrates, and can be dominant in some communities. Despite the importance of sponges in the Antarctic subtidal environment, sponge DNA barcodes are scarce but can provide insight into the evolutionary relationships of this unique biogeographic province. We sequenced the standard barcoding COI region for a comprehensive selection of sponges collected during expeditions to the Ross Sea region in 2004 and 2008, and produced DNA-barcodes for 53 demosponge species covering about 60% of the species collected. The Antarctic sponge communities are phylogenetically diverse, matching the diversity of well-sampled sponge communities in the Lusitanic and Mediterranean marine provinces in the Temperate Northern Atlantic for which molecular data are readily available. Additionally, DNA-barcoding revealed levels of in situ molecular evolution comparable to those present among Caribbean sponges. DNA-barcoding using the Segregating Sites Algorithm correctly assigned approximately 54% of the barcoded species to the morphologically determined species. A barcode library for Antarctic sponges was assembled and used to advance the systematic and evolutionary research of Antarctic sponges. We provide insights on the evolutionary forces shaping Antarctica's diverse sponge communities, and a barcode library against which future sequence data from other regions or depth strata of Antarctica can be compared. The opportunity for rapid taxonomic identification of sponge collections for ecological research is now at the horizon.

DNA barcoding of vouchered xylarium wood specimens of nine endangered Dalbergia species

Treesearch

Min Yu; Lichao Jiao; Juan Guo; Alex C. Wiedenhoeft; Tuo He; Xiaomei Jiang; Yafang Yin

2017-01-01

ITS2+trnH-psbA was the best combination of DNA barcode to resolve the Dalbergia wood species studied. We demonstrate the feasibility of building a DNA barcode reference database using xylarium wood specimens.

Creation of reference DNA barcode library and authentication of medicinal plant raw drugs used in Ayurvedic medicine.

PubMed

Vassou, Sophie Lorraine; Nithaniyal, Stalin; Raju, Balaji; Parani, Madasamy

2016-07-18

Ayurveda is a system of traditional medicine that originated in ancient India, and it is still in practice. Medicinal plants are the backbone of Ayurveda, which heavily relies on the plant-derived therapeutics. While Ayurveda is becoming more popular in several countries throughout the World, lack of authenticated medicinal plant raw drugs is a growing concern. Our aim was to DNA barcode the medicinal plants that are listed in the Ayurvedic Pharmacopoeia of India (API) to create a reference DNA barcode library, and to use the same to authenticate the raw drugs that are sold in markets. We have DNA barcoded 347 medicinal plants using rbcL marker, and curated rbcL DNA barcodes for 27 medicinal plants from public databases. These sequences were used to create Ayurvedic Pharmacopoeia of India - Reference DNA Barcode Library (API-RDBL). This library was used to authenticate 100 medicinal plant raw drugs, which were in the form of powders (82) and seeds (18). Ayurvedic Pharmacopoeia of India - Reference DNA Barcode Library (API-RDBL) was created with high quality and authentic rbcL barcodes for 374 out of the 395 medicinal plants that are included in the API. The rbcL DNA barcode differentiated 319 species (85 %) with the pairwise divergence ranging between 0.2 and 29.9 %. PCR amplification and DNA sequencing success rate of rbcL marker was 100 % even for the poorly preserved medicinal plant raw drugs that were collected from local markets. DNA barcoding revealed that only 79 % raw drugs were authentic, and the remaining 21 % samples were adulterated. Further, adulteration was found to be much higher with powders (ca. 25 %) when compared to seeds (ca. 5 %). The present study demonstrated the utility of DNA barcoding in authenticating medicinal plant raw drugs, and found that approximately one fifth of the market samples were adulterated. Powdered raw drugs, which are very difficult to be identified by taxonomists as well as common people, seem to be the easy target for adulteration. Developing a quality control protocol for medicinal plant raw drugs by incorporating DNA barcoding as a component is essential to ensure safety to the consumers.

Organic Phase Change Nanoparticles for in-Product Labeling of Agrochemicals.

PubMed

Wang, Miao; Duong, Binh; Su, Ming

2015-10-28

There is an urgent need to develop in-product covert barcodes for anti-counterfeiting of agrochemicals. This paper reports a new organic nanoparticle-based in-product barcode system, in which a panel of organic phase change nanoparticles is added as a barcode into in a variety of chemicals (herein agrochemicals). The barcode is readout by detecting melting peaks of organic nanoparticles using differential scanning calorimetry. This method has high labeling capacity due to small sizes of nanoparticles, sharp melting peaks, and large scan range of thermal analysis. The in-product barcode can be effectively used to protect agrochemical products from being counterfeited due to its large coding capacity, technical readiness, covertness, and robustness.

DNA Barcoding Meets Nanotechnology: Development of a Universal Colorimetric Test for Food Authentication.

PubMed

Valentini, Paola; Galimberti, Andrea; Mezzasalma, Valerio; De Mattia, Fabrizio; Casiraghi, Maurizio; Labra, Massimo; Pompa, Pier Paolo

2017-07-03

Food trade globalization and the growing demand for selected food varieties have led to the intensification of adulteration cases, especially in the form of species substitution and mixing with cheaper taxa. This phenomenon has huge economic impact and sometimes even public health implications. DNA barcoding represents a well-proven molecular approach to assess the authenticity of food items, although its use is hampered by analytical constraints and timeframes that are often prohibitive for the food market. To address such issues, we have introduced a new technology, named NanoTracer, that allows for rapid and naked-eye molecular traceability of any food and requires limited instrumentation and cost-effective reagents. Moreover, unlike sequencing, this method can be used to identify not only the substitution of a fine ingredient, but also its dilution with cheaper ones. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

The Mystery Behind the Code: Differentiated Instruction with Quick Response Codes in Secondary Physical Education

ERIC Educational Resources Information Center

Adkins, Megan; Wajciechowski, Misti R.; Scantling, Ed

2013-01-01

Quick response codes, better known as QR codes, are small barcodes scanned to receive information about a specific topic. This article explains QR code technology and the utility of QR codes in the delivery of physical education instruction. Consideration is given to how QR codes can be used to accommodate learners of varying ability levels as…

Applying radio-frequency identification (RFID) technology in transfusion medicine.

PubMed

Hohberger, Clive; Davis, Rodeina; Briggs, Lynne; Gutierrez, Alfonso; Veeramani, Dhamaraj

2012-05-01

ISO/IEC 18000-3 mode 1 standard 13.56 MHz RFID tags have been accepted by the International Society for Blood Transfusion (ISBT) and the United States Food and Drug Administration (FDA) as data carriers to integrate with and augment ISBT 128 barcode data carried on blood products. The use of 13.56 MHz RFID carrying ISBT 128 data structures allows the global deployment and use of RFID, supporting both international transfer of blood and international disaster relief. The deployment in process at the BloodCenter of Wisconsin and testing at the University of Iowa Health Center is the first FDA-permitted implementation of RFID throughout in all phases of blood banking, donation through transfusion. RFID technology and equipment selection will be discussed along with FDA-required RF safety testing; integration with the blood enterprise computing system and required RFID tag performance. Tag design and survivability is an issue due to blood bag centrifugation and irradiation. Deployment issues will be discussed. Use of RFID results in significant return on investment over the use of barcodes in the blood center operations through labor savings and error reduction. Copyright © 2011 The International Alliance for Biological Standardization. Published by Elsevier Ltd. All rights reserved.

Systematic validation and atomic force microscopy of non-covalent short oligonucleotide barcode microarrays.

PubMed

Cook, Michael A; Chan, Chi-Kin; Jorgensen, Paul; Ketela, Troy; So, Daniel; Tyers, Mike; Ho, Chi-Yip

2008-02-06

Molecular barcode arrays provide a powerful means to analyze cellular phenotypes in parallel through detection of short (20-60 base) unique sequence tags, or "barcodes", associated with each strain or clone in a collection. However, costs of current methods for microarray construction, whether by in situ oligonucleotide synthesis or ex situ coupling of modified oligonucleotides to the slide surface are often prohibitive to large-scale analyses. Here we demonstrate that unmodified 20mer oligonucleotide probes printed on conventional surfaces show comparable hybridization signals to covalently linked 5'-amino-modified probes. As a test case, we undertook systematic cell size analysis of the budding yeast Saccharomyces cerevisiae genome-wide deletion collection by size separation of the deletion pool followed by determination of strain abundance in size fractions by barcode arrays. We demonstrate that the properties of a 13K unique feature spotted 20 mer oligonucleotide barcode microarray compare favorably with an analogous covalently-linked oligonucleotide array. Further, cell size profiles obtained with the size selection/barcode array approach recapitulate previous cell size measurements of individual deletion strains. Finally, through atomic force microscopy (AFM), we characterize the mechanism of hybridization to unmodified barcode probes on the slide surface. These studies push the lower limit of probe size in genome-scale unmodified oligonucleotide microarray construction and demonstrate a versatile, cost-effective and reliable method for molecular barcode analysis.

The Trichoptera barcode initiative: a strategy for generating a species-level Tree of Life

PubMed Central

Frandsen, Paul B.; Holzenthal, Ralph W.; Beet, Clare R.; Bennett, Kristi R.; Blahnik, Roger J.; Bonada, Núria; Cartwright, David; Chuluunbat, Suvdtsetseg; Cocks, Graeme V.; Collins, Gemma E.; deWaard, Jeremy; Dean, John; Flint, Oliver S.; Hausmann, Axel; Hendrich, Lars; Hess, Monika; Hogg, Ian D.; Kondratieff, Boris C.; Malicky, Hans; Milton, Megan A.; Morinière, Jérôme; Morse, John C.; Mwangi, François Ngera; Pauls, Steffen U.; Gonzalez, María Razo; Rinne, Aki; Robinson, Jason L.; Salokannel, Juha; Shackleton, Michael; Smith, Brian; Stamatakis, Alexandros; StClair, Ros; Thomas, Jessica A.; Zamora-Muñoz, Carmen; Ziesmann, Tanja

2016-01-01

DNA barcoding was intended as a means to provide species-level identifications through associating DNA sequences from unknown specimens to those from curated reference specimens. Although barcodes were not designed for phylogenetics, they can be beneficial to the completion of the Tree of Life. The barcode database for Trichoptera is relatively comprehensive, with data from every family, approximately two-thirds of the genera, and one-third of the described species. Most Trichoptera, as with most of life's species, have never been subjected to any formal phylogenetic analysis. Here, we present a phylogeny with over 16 000 unique haplotypes as a working hypothesis that can be updated as our estimates improve. We suggest a strategy of implementing constrained tree searches, which allow larger datasets to dictate the backbone phylogeny, while the barcode data fill out the tips of the tree. We also discuss how this phylogeny could be used to focus taxonomic attention on ambiguous species boundaries and hidden biodiversity. We suggest that systematists continue to differentiate between ‘Barcode Index Numbers’ (BINs) and ‘species’ that have been formally described. Each has utility, but they are not synonyms. We highlight examples of integrative taxonomy, using both barcodes and morphology for species description. This article is part of the themed issue ‘From DNA barcodes to biomes’. PMID:27481793

DNA Barcode Authentication and Library Development for the Wood of Six Commercial Pterocarpus Species: the Critical Role of Xylarium Specimens.

PubMed

Jiao, Lichao; Yu, Min; Wiedenhoeft, Alex C; He, Tuo; Li, Jianing; Liu, Bo; Jiang, Xiaomei; Yin, Yafang

2018-01-31

DNA barcoding has been proposed as a useful tool for forensic wood identification and development of a reliable DNA reference library is an essential first step. Xylaria (wood collections) are potentially enormous data repositories if DNA information could be extracted from wood specimens. In this study, 31 xylarium wood specimens and 8 leaf specimens of six important commercial species of Pterocarpus were selected to investigate the reliability of DNA barcodes for authentication at the species level and to determine the feasibility of building wood DNA barcode reference libraries from xylarium specimens. Four DNA barcodes (ITS2, matK, ndhF-rpl32 and rbcL) and their combination were tested to evaluate their discrimination ability for Pterocarpus species with both TaxonDNA and tree-based analytical methods. The results indicated that the combination barcode of matK + ndhF-rpl32 + ITS2 yielded the best discrimination for the Pterocarpus species studied. The mini-barcode ndhF-rpl32 (167-173 bps) performed well distinguishing P. santalinus from its wood anatomically inseparable species P. tinctorius. Results from this study verified not only the feasibility of building DNA barcode libraries using xylarium wood specimens, but the importance of using wood rather than leaves as the source tissue, when wood is the botanical material to be identified.

Bridging two scholarly islands enriches both: COI DNA barcodes for species identification versus human mitochondrial variation for the study of migrations and pathologies.

PubMed

Thaler, David S; Stoeckle, Mark Y

2016-10-01

DNA barcodes for species identification and the analysis of human mitochondrial variation have developed as independent fields even though both are based on sequences from animal mitochondria. This study finds questions within each field that can be addressed by reference to the other. DNA barcodes are based on a 648-bp segment of the mitochondrially encoded cytochrome oxidase I. From most species, this segment is the only sequence available. It is impossible to know whether it fairly represents overall mitochondrial variation. For modern humans, the entire mitochondrial genome is available from thousands of healthy individuals. SNPs in the human mitochondrial genome are evenly distributed across all protein-encoding regions arguing that COI DNA barcode is representative. Barcode variation among related species is largely based on synonymous codons. Data on human mitochondrial variation support the interpretation that most - possibly all - synonymous substitutions in mitochondria are selectively neutral. DNA barcodes confirm reports of a low variance in modern humans compared to nonhuman primates. In addition, DNA barcodes allow the comparison of modern human variance to many other extant animal species. Birds are a well-curated group in which DNA barcodes are coupled with census and geographic data. Putting modern human variation in the context of intraspecies variation among birds shows humans to be a single breeding population of average variance.

Prospects and Problems for Identification of Poisonous Plants in China using DNA Barcodes.

PubMed

Xie, Lei; Wang, Ying Wei; Guan, Shan Yue; Xie, Li Jing; Long, Xin; Sun, Cheng Ye

2014-10-01

Poisonous plants are a deadly threat to public health in China. The traditional clinical diagnosis of the toxic plants is inefficient, fallible, and dependent upon experts. In this study, we tested the performance of DNA barcodes for identification of the most threatening poisonous plants in China. Seventy-four accessions of 27 toxic plant species in 22 genera and 17 families were sampled and three DNA barcodes (matK, rbcL, and ITS) were amplified, sequenced and tested. Three methods, Blast, pairwise global alignment (PWG) distance, and Tree-Building were tested for discrimination power. The primer universality of all the three markers was high. Except in the case of ITS for Hemerocallis minor, the three barcodes were successfully generated from all the selected species. Among the three methods applied, Blast showed the lowest discrimination rate, whereas PWG Distance and Tree-Building methods were equally effective. The ITS barcode showed highest discrimination rates using the PWG Distance and Tree-Building methods. When the barcodes were combined, discrimination rates were increased for the Blast method. DNA barcoding technique provides us a fast tool for clinical identification of poisonous plants in China. We suggest matK, rbcL, ITS used in combination as DNA barcodes for authentication of poisonous plants. Copyright © 2014 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.

A DNA Barcode Library for North American Ephemeroptera: Progress and Prospects

PubMed Central

Webb, Jeffrey M.; Jacobus, Luke M.; Funk, David H.; Zhou, Xin; Kondratieff, Boris; Geraci, Christy J.; DeWalt, R. Edward; Baird, Donald J.; Richard, Barton; Phillips, Iain; Hebert, Paul D. N.

2012-01-01

DNA barcoding of aquatic macroinvertebrates holds much promise as a tool for taxonomic research and for providing the reliable identifications needed for water quality assessment programs. A prerequisite for identification using barcodes is a reliable reference library. We gathered 4165 sequences from the barcode region of the mitochondrial cytochrome c oxidase subunit I gene representing 264 nominal and 90 provisional species of mayflies (Insecta: Ephemeroptera) from Canada, Mexico, and the United States. No species shared barcode sequences and all can be identified with barcodes with the possible exception of some Caenis. Minimum interspecific distances ranged from 0.3–24.7% (mean: 12.5%), while the average intraspecific divergence was 1.97%. The latter value was inflated by the presence of very high divergences in some taxa. In fact, nearly 20% of the species included two or three haplotype clusters showing greater than 5.0% sequence divergence and some values are as high as 26.7%. Many of the species with high divergences are polyphyletic and likely represent species complexes. Indeed, many of these polyphyletic species have numerous synonyms and individuals in some barcode clusters show morphological attributes characteristic of the synonymized species. In light of our findings, it is imperative that type or topotype specimens be sequenced to correctly associate barcode clusters with morphological species concepts and to determine the status of currently synonymized species. PMID:22666447

Application of DNA Barcodes in Asian Tropical Trees--A Case Study from Xishuangbanna Nature Reserve, Southwest China.

PubMed

Huang, Xiao-cui; Ci, Xiu-qin; Conran, John G; Li, Jie

2015-01-01

Within a regional floristic context, DNA barcoding is more useful to manage plant diversity inventories on a large scale and develop valuable conservation strategies. However, there are no DNA barcode studies from tropical areas of China, which represents one of the biodiversity hotspots around the world. A DNA barcoding database of an Asian tropical trees with high diversity was established at Xishuangbanna Nature Reserve, Yunnan, southwest China using rbcL and matK as standard barcodes, as well as trnH-psbA and ITS as supplementary barcodes. The performance of tree species identification success was assessed using 2,052 accessions from four plots belonging to two vegetation types in the region by three methods: Neighbor-Joining, Maximum-Likelihood and BLAST. We corrected morphological field identification errors (9.6%) for the three plots using rbcL and matK based on Neighbor-Joining tree. The best barcode region for PCR and sequencing was rbcL (97.6%, 90.8%), followed by trnH-psbA (93.6%, 85.6%), while matK and ITS obtained relative low PCR and sequencing success rates. However, ITS performed best for both species (44.6-58.1%) and genus (72.8-76.2%) identification. With trnH-psbA slightly less effective for species identification. The two standard barcode rbcL and matK gave poor results for species identification (24.7-28.5% and 31.6-35.3%). Compared with other studies from comparable tropical forests (e.g. Cameroon, the Amazon and India), the overall performance of the four barcodes for species identification was lower for the Xishuangbanna Nature Reserve, possibly because of species/genus ratios and species composition between these tropical areas. Although the core barcodes rbcL and matK were not suitable for species identification of tropical trees from Xishuangbanna Nature Reserve, they could still help with identification at the family and genus level. Considering the relative sequence recovery and the species identification performance, we recommend the use of trnH-psbA and ITS in combination as the preferred barcodes for tropical tree species identification in China.

77 FR 33314 - POSTNET Barcode Discontinuation

Federal Register 2010, 2011, 2012, 2013, 2014

2012-06-06

.... This revision adds DMM revisions (regarding Periodicals automation letters and flats) that were... eligibility for the use of POSTNET barcodes and allow only Intelligent Mail barcodes (IMbs) for automation... for all automation letters, including Business Reply Mail[supreg] letters that qualify for Qualified...

Long-range barcode labeling-sequencing

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, Feng; Zhang, Tao; Singh, Kanwar K.

Methods for sequencing single large DNA molecules by clonal multiple displacement amplification using barcoded primers. Sequences are binned based on barcode sequences and sequenced using a microdroplet-based method for sequencing large polynucleotide templates to enable assembly of haplotype-resolved complex genomes and metagenomes.

DNA Barcoding for Identification of ‘Candidatus Phytoplasmas’ Using a Fragment of the Elongation Factor Tu Gene

PubMed Central

Makarova, Olga; Contaldo, Nicoletta; Paltrinieri, Samanta; Kawube, Geofrey; Bertaccini, Assunta; Nicolaisen, Mogens

2012-01-01

Background Phytoplasmas are bacterial phytopathogens responsible for significant losses in agricultural production worldwide. Several molecular markers are available for identification of groups or strains of phytoplasmas. However, they often cannot be used for identification of phytoplasmas from different groups simultaneously or are too long for routine diagnostics. DNA barcoding recently emerged as a convenient tool for species identification. Here, the development of a universal DNA barcode based on the elongation factor Tu (tuf) gene for phytoplasma identification is reported. Methodology/Principal Findings We designed a new set of primers and amplified a 420–444 bp fragment of tuf from all 91 phytoplasmas strains tested (16S rRNA groups -I through -VII, -IX through -XII, -XV, and -XX). Comparison of NJ trees constructed from the tuf barcode and a 1.2 kbp fragment of the 16S ribosomal gene revealed that the tuf tree is highly congruent with the 16S rRNA tree and had higher inter- and intra- group sequence divergence. Mean K2P inter−/intra- group divergences of the tuf barcode did not overlap and had approximately one order of magnitude difference for most groups, suggesting the presence of a DNA barcoding gap. The use of the tuf barcode allowed separation of main ribosomal groups and most of their subgroups. Phytoplasma tuf barcodes were deposited in the NCBI GenBank and Q-bank databases. Conclusions/Significance This study demonstrates that DNA barcoding principles can be applied for identification of phytoplasmas. Our findings suggest that the tuf barcode performs as well or better than a 1.2 kbp fragment of the 16S rRNA gene and thus provides an easy procedure for phytoplasma identification. The obtained sequences were used to create a publicly available reference database that can be used by plant health services and researchers for online phytoplasma identification. PMID:23272216

Grating-dot two-dimensional barcode patterns with extra binary data for encoding secret information

NASA Astrophysics Data System (ADS)

Lih Yeh, Sheng; Lin, Shyh Tsong

2013-02-01

The usual two-dimensional (2D) barcode patterns do not encrypt secret information. However, secret information is sometimes needed to increase the security features of barcode patterns. Therefore, this paper proposes 2D barcode patterns created by two-beam writers to encrypt extra binary data for encoding secret information. The proposed 2D barcode patterns are composed of many grating dots and the fringes of the grating dots are classified into four types. The first type of fringe possesses a pitch of 1.1 μm and an orientation of -45°, the second type of fringe possesses a pitch of 1.2 μm and an orientation of -45°, the third type of fringe possesses a pitch of 1.1 μm and an orientation of 45°and the fourth type of fringe possesses a pitch of 1.2 μm and an orientation of 45°. All the fringes with a 1.1 μm pitch can show a color and all the fringes with a 1.2 μm pitch can show another color when a microscope is used to inspect them. Therefore, extra binary data for encoding secret information can be formed with the two pitches. On the other hand, all the fringes with a -45° orientation can become bright for a viewing direction and all the fringes with a 45° orientation can become bright for another viewing direction when one looks at them. Therefore, the grating dots with the -45° fringe orientation and the grating dots with the 45° fringe orientation can be used to show a positive barcode image and a negative barcode image, respectively. Both the positive and negative barcode images can be used to derive the barcode data. The experiment shows that the proposed barcode patterns can be used conveniently and correctly.

DNA Barcoding Identifies Argentine Fishes from Marine and Brackish Waters

PubMed Central

Mabragaña, Ezequiel; Díaz de Astarloa, Juan Martín; Hanner, Robert; Zhang, Junbin; González Castro, Mariano

2011-01-01

Background DNA barcoding has been advanced as a promising tool to aid species identification and discovery through the use of short, standardized gene targets. Despite extensive taxonomic studies, for a variety of reasons the identification of fishes can be problematic, even for experts. DNA barcoding is proving to be a useful tool in this context. However, its broad application is impeded by the need to construct a comprehensive reference sequence library for all fish species. Here, we make a regional contribution to this grand challenge by calibrating the species discrimination efficiency of barcoding among 125 Argentine fish species, representing nearly one third of the known fauna, and examine the utility of these data to address several key taxonomic uncertainties pertaining to species in this region. Methodology/Principal Findings Specimens were collected and morphologically identified during crusies conducted between 2005 and 2008. The standard BARCODE fragment of COI was amplified and bi-directionally sequenced from 577 specimens (mean of 5 specimens/species), and all specimens and sequence data were archived and interrogated using analytical tools available on the Barcode of Life Data System (BOLD; www.barcodinglife.org). Nearly all species exhibited discrete clusters of closely related haplogroups which permitted the discrimination of 95% of the species (i.e. 119/125) examined while cases of shared haplotypes were detected among just three species-pairs. Notably, barcoding aided the identification of a new species of skate, Dipturus argentinensis, permitted the recognition of Genypterus brasiliensis as a valid species and questions the generic assignment of Paralichthys isosceles. Conclusions/Significance This study constitutes a significant contribution to the global barcode reference sequence library for fishes and demonstrates the utility of barcoding for regional species identification. As an independent assessment of alpha taxonomy, barcodes provide robust support for most morphologically based taxon concepts and also highlight key areas of taxonomic uncertainty worthy of reappraisal. PMID:22174860

Fungi in Thailand: a case study of the efficacy of an ITS barcode for automatically identifying species within the Annulohypoxylon and Hypoxylon genera.

PubMed

Suwannasai, Nuttika; Martín, María P; Phosri, Cherdchai; Sihanonth, Prakitsin; Whalley, Anthony J S; Spouge, John L

2013-01-01

Thailand, a part of the Indo-Burma biodiversity hotspot, has many endemic animals and plants. Some of its fungal species are difficult to recognize and separate, complicating assessments of biodiversity. We assessed species diversity within the fungal genera Annulohypoxylon and Hypoxylon, which produce biologically active and potentially therapeutic compounds, by applying classical taxonomic methods to 552 teleomorphs collected from across Thailand. Using probability of correct identification (PCI), we also assessed the efficacy of automated species identification with a fungal barcode marker, ITS, in the model system of Annulohypoxylon and Hypoxylon. The 552 teleomorphs yielded 137 ITS sequences; in addition, we examined 128 GenBank ITS sequences, to assess biases in evaluating a DNA barcode with GenBank data. The use of multiple sequence alignment in a barcode database like BOLD raises some concerns about non-protein barcode markers like ITS, so we also compared species identification using different alignment methods. Our results suggest the following. (1) Multiple sequence alignment of ITS sequences is competitive with pairwise alignment when identifying species, so BOLD should be able to preserve its present bioinformatics workflow for species identification for ITS, and possibly therefore with at least some other non-protein barcode markers. (2) Automated species identification is insensitive to a specific choice of evolutionary distance, contributing to resolution of a current debate in DNA barcoding. (3) Statistical methods are available to address, at least partially, the possibility of expert misidentification of species. Phylogenetic trees discovered a cryptic species and strongly supported monophyletic clades for many Annulohypoxylon and Hypoxylon species, suggesting that ITS can contribute usefully to a barcode for these fungi. The PCIs here, derived solely from ITS, suggest that a fungal barcode will require secondary markers in Annulohypoxylon and Hypoxylon, however. The URL http://tinyurl.com/spouge-barcode contains computer programs and other supplementary material relevant to this article.

The effectiveness of three regions in mitochondrial genome for aphid DNA barcoding: a case in Lachininae.

PubMed

Chen, Rui; Jiang, Li-Yun; Qiao, Ge-Xia

2012-01-01

The mitochondrial gene COI has been widely used by taxonomists as a standard DNA barcode sequence for the identification of many animal species. However, the COI region is of limited use for identifying certain species and is not efficiently amplified by PCR in all animal taxa. To evaluate the utility of COI as a DNA barcode and to identify other barcode genes, we chose the aphid subfamily Lachninae (Hemiptera: Aphididae) as the focus of our study. We compared the results obtained using COI with two other mitochondrial genes, COII and Cytb. In addition, we propose a new method to improve the efficiency of species identification using DNA barcoding. Three mitochondrial genes (COI, COII and Cytb) were sequenced and were used in the identification of over 80 species of Lachninae. The COI and COII genes demonstrated a greater PCR amplification efficiency than Cytb. Species identification using COII sequences had a higher frequency of success (96.9% in "best match" and 90.8% in "best close match") and yielded lower intra- and higher interspecific genetic divergence values than the other two markers. The use of "tag barcodes" is a new approach that involves attaching a species-specific tag to the standard DNA barcode. With this method, the "barcoding overlap" can be nearly eliminated. As a result, we were able to increase the identification success rate from 83.9% to 95.2% by using COI and the "best close match" technique. A COII-based identification system should be more effective in identifying lachnine species than COI or Cytb. However, the Cytb gene is an effective marker for the study of aphid population genetics due to its high sequence diversity. Furthermore, the use of "tag barcodes" can improve the accuracy of DNA barcoding identification by reducing or removing the overlap between intra- and inter-specific genetic divergence values.

Use of mitochondrial COI gene for the identification of family Salticidae and Lycosidae of spiders.

PubMed

Naseem, Sajida; Tahir, Hafiz Muhammad

2018-01-01

In recent years, DNA barcoding has become quite popular for molecular identification of species because it is simple, quick and an affordable method. Present study was conducted to identify spiders of most abundant families, i.e. Salticidae and Lycosidae from citrus orchards in Sargodha district using DNA barcoding. A total of 160 specimens were subjected to DNA barcoding but, sequences up to 600 bp were recovered for 156 specimens. This molecular approach proved helpful to assign the exact taxon to those specimens which were misidentified through morphological characters in the study. We were succeeded to discriminate six species of Lycosidae and nine species of Salticidae through DNA barcoding. Results revealed the presence of clear barcode gap (discontinuity in intra- and inter-specific divergences) for members of both families. Furthermore, the maximum intra-specific divergence was less than NN (nearest neighbour) distance for all species. This suggested the reliability of DNA barcoding for spider's identification up to species level. We got 98% success in our study. It is concluded from present study that DNA barcoding is more reliable tool especially for immature spiders, when morphological characters are ambiguous.

DNA barcoding commercially important aquatic invertebrates of Turkey.

PubMed

Keskin, Emre; Atar, Hasan Hüseyin

2013-08-01

DNA barcoding was used in order to identify aquatic invertebrates sampled from fisheries bycatch and discards. A total of 440 unique cytochrome c oxidase sub unit I (COI) barcodes were generated for 22 species from three important phyla (Arthropoda, Cnidaria, and Mollusca). All the species were sequenced and submitted to GenBank and Barcode of Life Database (BOLD) databases using 654 bp-long fragment of mitochondrial COI gene. Two of them (Pontastacus leptodactylus and Rapana bezoar) were first records of the species for the BOLD database and six of them (Carcinus aestuarii, Loligo vulgaris, Melicertus kerathurus, Nephrops norvegicus, Scyllarides latus, and Scyllarus arctus) were first standard (>648 bp) COI barcode records for the GenBank database. COI barcodes were analyzed for nucleotide composition, nucleotide pair frequencies, and Kimura's two-parameter genetic distance. Mean genetic distance among species was found increasing at higher taxonomic levels. Neighbor-joining trees generated were congruent with morphometric-based taxonomic classification. Findings of this study clearly demonstrate that DNA barcodes could be used as an efficient molecular tool in identification of not only target species from fisheries but also bycatch and discard species, and so it could provide us leverage for a better understanding in monitoring and management of fisheries and biodiversity.

Intragenomic variation in the ITS rDNA region obscures phylogenetic relationships and inflates estimates of operational taxonomic units in genus Laetiporus

Treesearch

Daniel L. Lindner; Mark T. Banik

2011-01-01

Regions of rDNA are commonly used to infer phylogenetic relationships among fungal species and as DNA barcodes for identification. These regions occur in large tandem arrays, and concerted evolution is believed to reduce intragenomic variation among copies within these arrays, although some variation still might exist. Phylogenetic studies typically use consensus...

Closing the loop of the medication use process using electronic medication administration registration.

PubMed

Lenderink, Bertil W; Egberts, Toine C G

2004-08-01

Recent reports and studies of errors in the medication process have raised the awareness of the threat to public health. An essential step in this multi-stage process is the actual administration of a medicine to the patient. The closed loop system is thought to be a way of preventing medication errors. Current information technology can facilitate this process. This article describes the way barcode technology is being used to facilitate medication administration registration on several wards in our hospital and nursing home.

Design of character-based DNA barcode motif for species identification: A computational approach and its validation in fishes.

PubMed

Chakraborty, Mohua; Dhar, Bishal; Ghosh, Sankar Kumar

2017-11-01

The DNA barcodes are generally interpreted using distance-based and character-based methods. The former uses clustering of comparable groups, based on the relative genetic distance, while the latter is based on the presence or absence of discrete nucleotide substitutions. The distance-based approach has a limitation in defining a universal species boundary across the taxa as the rate of mtDNA evolution is not constant throughout the taxa. However, character-based approach more accurately defines this using a unique set of nucleotide characters. The character-based analysis of full-length barcode has some inherent limitations, like sequencing of the full-length barcode, use of a sparse-data matrix and lack of a uniform diagnostic position for each group. A short continuous stretch of a fragment can be used to resolve the limitations. Here, we observe that a 154-bp fragment, from the transversion-rich domain of 1367 COI barcode sequences can successfully delimit species in the three most diverse orders of freshwater fishes. This fragment is used to design species-specific barcode motifs for 109 species by the character-based method, which successfully identifies the correct species using a pattern-matching program. The motifs also correctly identify geographically isolated population of the Cypriniformes species. Further, this region is validated as a species-specific mini-barcode for freshwater fishes by successful PCR amplification and sequencing of the motif (154 bp) using the designed primers. We anticipate that use of such motifs will enhance the diagnostic power of DNA barcode, and the mini-barcode approach will greatly benefit the field-based system of rapid species identification. © 2017 John Wiley & Sons Ltd.

Multiplexed Detection of Cytokines Based on Dual Bar-Code Strategy and Single-Molecule Counting.

PubMed

Li, Wei; Jiang, Wei; Dai, Shuang; Wang, Lei

2016-02-02

Cytokines play important roles in the immune system and have been regarded as biomarkers. While single cytokine is not specific and accurate enough to meet the strict diagnosis in practice, in this work, we constructed a multiplexed detection method for cytokines based on dual bar-code strategy and single-molecule counting. Taking interferon-γ (IFN-γ) and tumor necrosis factor-α (TNF-α) as model analytes, first, the magnetic nanobead was functionalized with the second antibody and primary bar-code strands, forming a magnetic nanoprobe. Then, through the specific reaction of the second antibody and the antigen that fixed by the primary antibody, sandwich-type immunocomplex was formed on the substrate. Next, the primary bar-code strands as amplification units triggered multibranched hybridization chain reaction (mHCR), producing nicked double-stranded polymers with multiple branched arms, which were served as secondary bar-code strands. Finally, the secondary bar-code strands hybridized with the multimolecule labeled fluorescence probes, generating enhanced fluorescence signals. The numbers of fluorescence dots were counted one by one for quantification with epi-fluorescence microscope. By integrating the primary and secondary bar-code-based amplification strategy and the multimolecule labeled fluorescence probes, this method displayed an excellent sensitivity with the detection limits were both 5 fM. Unlike the typical bar-code assay that the bar-code strands should be released and identified on a microarray, this method is more direct. Moreover, because of the selective immune reaction and the dual bar-code mechanism, the resulting method could detect the two targets simultaneously. Multiple analysis in human serum was also performed, suggesting that our strategy was reliable and had a great potential application in early clinical diagnosis.

DNA barcoding: an efficient tool to overcome authentication challenges in the herbal market.

PubMed

Mishra, Priyanka; Kumar, Amit; Nagireddy, Akshitha; Mani, Daya N; Shukla, Ashutosh K; Tiwari, Rakesh; Sundaresan, Velusamy

2016-01-01

The past couple of decades have witnessed global resurgence of herbal-based health care. As a result, the trade of raw drugs has surged globally. Accurate and fast scientific identification of the plant(s) is the key to success for the herbal drug industry. The conventional approach is to engage an expert taxonomist, who uses a mix of traditional and modern techniques for precise plant identification. However, for bulk identification at industrial scale, the process is protracted and time-consuming. DNA barcoding, on the other hand, offers an alternative and feasible taxonomic tool box for rapid and robust species identification. For the success of DNA barcode, the barcode loci must have sufficient information to differentiate unambiguously between closely related plant species and discover new cryptic species. For herbal plant identification, matK, rbcL, trnH-psbA, ITS, trnL-F, 5S-rRNA and 18S-rRNA have been used as successful DNA barcodes. Emerging advances in DNA barcoding coupled with next-generation sequencing and high-resolution melting curve analysis have paved the way for successful species-level resolution recovered from finished herbal products. Further, development of multilocus strategy and its application has provided new vistas to the DNA barcode-based plant identification for herbal drug industry. For successful and acceptable identification of herbal ingredients and a holistic quality control of the drug, DNA barcoding needs to work harmoniously with other components of the systems biology approach. We suggest that for effectively resolving authentication challenges associated with the herbal market, DNA barcoding must be used in conjunction with metabolomics along with need-based transcriptomics and proteomics. © 2015 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

Identification of processed Chinese medicinal materials using DNA mini-barcoding.

PubMed

Song, Ming; Dong, Gang-Qiang; Zhang, Ya-Qin; Liu, Xia; Sun, Wei

2017-07-01

Most of Chinese medicinal herbs are subjected to traditional processing procedures, including stir-frying, charring, steaming, boiling, and calcining before they are released into dispensaries. The marketing and identification of processed medicinal materials is a growing issue in the marketplace. However, conventional methods of identification have limitations, while DNA mini-barcoding, based on the sequencing of a short-standardized region, has received considerable attention as a new potential means to identify processed medicinal materials. In the present study, six DNA barcode loci including ITS2, psbA-trnH, rbcL, matK, trnL (UAA) intron and its P6 loop, were employed for the authentication of 45 processed samples belonging to 15 species. We evaluated the amplification efficiency of each locus. We also examined the identification accuracy of the potential mini-barcode locus, of trnL (UAA) intron P6 loop. Our results showed that the five primary barcode loci were successfully amplified in only 8.89%-20% of the processed samples, while the amplification rates of the trnL (UAA) intron P6 loop were higher, at 75.56% successful amplification. We compared the mini-barcode sequences with Genbank using the Blast program. The analysis showed that 45.23% samples could be identified to genus level, while only one sample could be identified to the species level. We conclude that trnL (UAA) p6 loop is a candidate mini-barcode that has shown its potential and may become a universal mini-barcode as complementary barcode for authenticity testing and will play an important role in medicinal materials control. Copyright © 2017 China Pharmaceutical University. Published by Elsevier B.V. All rights reserved.

Assessing DNA Barcodes for Species Identification in North American Reptiles and Amphibians in Natural History Collections.

PubMed

Chambers, E Anne; Hebert, Paul D N

2016-01-01

High rates of species discovery and loss have led to the urgent need for more rapid assessment of species diversity in the herpetofauna. DNA barcoding allows for the preliminary identification of species based on sequence divergence. Prior DNA barcoding work on reptiles and amphibians has revealed higher biodiversity counts than previously estimated due to cases of cryptic and undiscovered species. Past studies have provided DNA barcodes for just 14% of the North American herpetofauna, revealing the need for expanded coverage. This study extends the DNA barcode reference library for North American herpetofauna, assesses the utility of this approach in aiding species delimitation, and examines the correspondence between current species boundaries and sequence clusters designated by the BIN system. Sequences were obtained from 730 specimens, representing 274 species (43%) from the North American herpetofauna. Mean intraspecific divergences were 1% and 3%, while average congeneric sequence divergences were 16% and 14% in amphibians and reptiles, respectively. BIN assignments corresponded with current species boundaries in 79% of amphibians, 100% of turtles, and 60% of squamates. Deep divergences (>2%) were noted in 35% of squamate and 16% of amphibian species, and low divergences (<2%) occurred in 12% of reptiles and 23% of amphibians, patterns reflected in BIN assignments. Sequence recovery declined with specimen age, and variation in recovery success was noted among collections. Within collections, barcodes effectively flagged seven mislabeled tissues, and barcode fragments were recovered from five formalin-fixed specimens. This study demonstrates that DNA barcodes can effectively flag errors in museum collections, while BIN splits and merges reveal taxa belonging to deeply diverged or hybridizing lineages. This study is the first effort to compile a reference library of DNA barcodes for herpetofauna on a continental scale.

Assessing DNA Barcodes for Species Identification in North American Reptiles and Amphibians in Natural History Collections

PubMed Central

Chambers, E. Anne; Hebert, Paul D. N.

2016-01-01

Background High rates of species discovery and loss have led to the urgent need for more rapid assessment of species diversity in the herpetofauna. DNA barcoding allows for the preliminary identification of species based on sequence divergence. Prior DNA barcoding work on reptiles and amphibians has revealed higher biodiversity counts than previously estimated due to cases of cryptic and undiscovered species. Past studies have provided DNA barcodes for just 14% of the North American herpetofauna, revealing the need for expanded coverage. Methodology/Principal Findings This study extends the DNA barcode reference library for North American herpetofauna, assesses the utility of this approach in aiding species delimitation, and examines the correspondence between current species boundaries and sequence clusters designated by the BIN system. Sequences were obtained from 730 specimens, representing 274 species (43%) from the North American herpetofauna. Mean intraspecific divergences were 1% and 3%, while average congeneric sequence divergences were 16% and 14% in amphibians and reptiles, respectively. BIN assignments corresponded with current species boundaries in 79% of amphibians, 100% of turtles, and 60% of squamates. Deep divergences (>2%) were noted in 35% of squamate and 16% of amphibian species, and low divergences (<2%) occurred in 12% of reptiles and 23% of amphibians, patterns reflected in BIN assignments. Sequence recovery declined with specimen age, and variation in recovery success was noted among collections. Within collections, barcodes effectively flagged seven mislabeled tissues, and barcode fragments were recovered from five formalin-fixed specimens. Conclusions/Significance This study demonstrates that DNA barcodes can effectively flag errors in museum collections, while BIN splits and merges reveal taxa belonging to deeply diverged or hybridizing lineages. This study is the first effort to compile a reference library of DNA barcodes for herpetofauna on a continental scale. PMID:27116180

rbcL and matK earn two thumbs up as the core DNA barcode for ferns.

PubMed

Li, Fay-Wei; Kuo, Li-Yaung; Rothfels, Carl J; Ebihara, Atsushi; Chiou, Wen-Liang; Windham, Michael D; Pryer, Kathleen M

2011-01-01

DNA barcoding will revolutionize our understanding of fern ecology, most especially because the accurate identification of the independent but cryptic gametophyte phase of the fern's life history--an endeavor previously impossible--will finally be feasible. In this study, we assess the discriminatory power of the core plant DNA barcode (rbcL and matK), as well as alternatively proposed fern barcodes (trnH-psbA and trnL-F), across all major fern lineages. We also present plastid barcode data for two genera in the hyperdiverse polypod clade--Deparia (Woodsiaceae) and the Cheilanthes marginata group (currently being segregated as a new genus of Pteridaceae)--to further evaluate the resolving power of these loci. Our results clearly demonstrate the value of matK data, previously unavailable in ferns because of difficulties in amplification due to a major rearrangement of the plastid genome. With its high sequence variation, matK complements rbcL to provide a two-locus barcode with strong resolving power. With sequence variation comparable to matK, trnL-F appears to be a suitable alternative barcode region in ferns, and perhaps should be added to the core barcode region if universal primer development for matK fails. In contrast, trnH-psbA shows dramatically reduced sequence variation for the majority of ferns. This is likely due to the translocation of this segment of the plastid genome into the inverted repeat regions, which are known to have a highly constrained substitution rate. Our study provides the first endorsement of the two-locus barcode (rbcL+matK) in ferns, and favors trnL-F over trnH-psbA as a potential back-up locus. Future work should focus on gathering more fern matK sequence data to facilitate universal primer development.

DNA barcoding the native flowering plants and conifers of Wales.

PubMed

de Vere, Natasha; Rich, Tim C G; Ford, Col R; Trinder, Sarah A; Long, Charlotte; Moore, Chris W; Satterthwaite, Danielle; Davies, Helena; Allainguillaume, Joel; Ronca, Sandra; Tatarinova, Tatiana; Garbett, Hannah; Walker, Kevin; Wilkinson, Mike J

2012-01-01

We present the first national DNA barcode resource that covers the native flowering plants and conifers for the nation of Wales (1143 species). Using the plant DNA barcode markers rbcL and matK, we have assembled 97.7% coverage for rbcL, 90.2% for matK, and a dual-locus barcode for 89.7% of the native Welsh flora. We have sampled multiple individuals for each species, resulting in 3304 rbcL and 2419 matK sequences. The majority of our samples (85%) are from DNA extracted from herbarium specimens. Recoverability of DNA barcodes is lower using herbarium specimens, compared to freshly collected material, mostly due to lower amplification success, but this is balanced by the increased efficiency of sampling species that have already been collected, identified, and verified by taxonomic experts. The effectiveness of the DNA barcodes for identification (level of discrimination) is assessed using four approaches: the presence of a barcode gap (using pairwise and multiple alignments), formation of monophyletic groups using Neighbour-Joining trees, and sequence similarity in BLASTn searches. These approaches yield similar results, providing relative discrimination levels of 69.4 to 74.9% of all species and 98.6 to 99.8% of genera using both markers. Species discrimination can be further improved using spatially explicit sampling. Mean species discrimination using barcode gap analysis (with a multiple alignment) is 81.6% within 10×10 km squares and 93.3% for 2×2 km squares. Our database of DNA barcodes for Welsh native flowering plants and conifers represents the most complete coverage of any national flora, and offers a valuable platform for a wide range of applications that require accurate species identification.

DNA Barcoding the Native Flowering Plants and Conifers of Wales

PubMed Central

de Vere, Natasha; Rich, Tim C. G.; Ford, Col R.; Trinder, Sarah A.; Long, Charlotte; Moore, Chris W.; Satterthwaite, Danielle; Davies, Helena; Allainguillaume, Joel; Ronca, Sandra; Tatarinova, Tatiana; Garbett, Hannah; Walker, Kevin; Wilkinson, Mike J.

2012-01-01

We present the first national DNA barcode resource that covers the native flowering plants and conifers for the nation of Wales (1143 species). Using the plant DNA barcode markers rbcL and matK, we have assembled 97.7% coverage for rbcL, 90.2% for matK, and a dual-locus barcode for 89.7% of the native Welsh flora. We have sampled multiple individuals for each species, resulting in 3304 rbcL and 2419 matK sequences. The majority of our samples (85%) are from DNA extracted from herbarium specimens. Recoverability of DNA barcodes is lower using herbarium specimens, compared to freshly collected material, mostly due to lower amplification success, but this is balanced by the increased efficiency of sampling species that have already been collected, identified, and verified by taxonomic experts. The effectiveness of the DNA barcodes for identification (level of discrimination) is assessed using four approaches: the presence of a barcode gap (using pairwise and multiple alignments), formation of monophyletic groups using Neighbour-Joining trees, and sequence similarity in BLASTn searches. These approaches yield similar results, providing relative discrimination levels of 69.4 to 74.9% of all species and 98.6 to 99.8% of genera using both markers. Species discrimination can be further improved using spatially explicit sampling. Mean species discrimination using barcode gap analysis (with a multiple alignment) is 81.6% within 10×10 km squares and 93.3% for 2×2 km squares. Our database of DNA barcodes for Welsh native flowering plants and conifers represents the most complete coverage of any national flora, and offers a valuable platform for a wide range of applications that require accurate species identification. PMID:22701588

bold: The Barcode of Life Data System (http://www.barcodinglife.org)

PubMed Central

RATNASINGHAM, SUJEEVAN; HEBERT, PAUL D N

2007-01-01

The Barcode of Life Data System (bold) is an informatics workbench aiding the acquisition, storage, analysis and publication of DNA barcode records. By assembling molecular, morphological and distributional data, it bridges a traditional bioinformatics chasm. bold is freely available to any researcher with interests in DNA barcoding. By providing specialized services, it aids the assembly of records that meet the standards needed to gain BARCODE designation in the global sequence databases. Because of its web-based delivery and flexible data security model, it is also well positioned to support projects that involve broad research alliances. This paper provides a brief introduction to the key elements of bold, discusses their functional capabilities, and concludes by examining computational resources and future prospects. PMID:18784790

Limited efficiency of universal mini-barcode primers for DNA amplification from desert reptiles, birds and mammals.

PubMed

Arif, I A; Khan, H A; Al Sadoon, M; Shobrak, M

2011-10-31

In recent years, DNA barcoding has emerged as a powerful tool for species identification. We report an extended validation of a universal DNA mini-barcode for amplification of 130-bp COI segments from 23 specimens collected from a desert environment, including 11 reptiles, five mammals and seven birds. Besides the standard double-annealing protocol, we also tested a more stringent single-annealing protocol. The PCR success rate for the amplification of the mini-barcode region was: mammals (4/5), reptiles (5/11) and birds (4/7). These findings demonstrate the limited utility of universal primers for mini-barcoding, at least for these vertebrate taxa that we collected from the Saudi Arabian desert.

DNA barcoding of the vegetable leafminer Liriomyza sativae Blanchard (Diptera: Agromyzidae) in Bangladesh

USDA-ARS?s Scientific Manuscript database

DNA barcoding revealed the presence of the polyphagous leafminer pest Liriomyza sativae Blanchard in Bangladesh. DNA barcode sequences for mitochondrial COI were generated for Agromyzidae larvae, pupae and adults collected from field populations across Bangladesh. BLAST sequence similarity searches ...

Bar-Code System for a Microbiological Laboratory

NASA Technical Reports Server (NTRS)

Law, Jennifer; Kirschner, Larry

2007-01-01

A bar-code system has been assembled for a microbiological laboratory that must examine a large number of samples. The system includes a commercial bar-code reader, computer hardware and software components, plus custom-designed database software. The software generates a user-friendly, menu-driven interface.

PCR-free quantitative detection of genetically modified organism from raw materials – A novel electrochemiluminescence-based bio-barcode method

PubMed Central

Zhu, Debin; Tang, Yabing; Xing, Da; Chen, Wei R.

2018-01-01

Bio-barcode assay based on oligonucleotide-modified gold nanoparticles (Au-NPs) provides a PCR-free method for quantitative detection of nucleic acid targets. However, the current bio-barcode assay requires lengthy experimental procedures including the preparation and release of barcode DNA probes from the target-nanoparticle complex, and immobilization and hybridization of the probes for quantification. Herein, we report a novel PCR-free electrochemiluminescence (ECL)-based bio-barcode assay for the quantitative detection of genetically modified organism (GMO) from raw materials. It consists of tris-(2’2’-bipyridyl) ruthenium (TBR)-labele barcode DNA, nucleic acid hybridization using Au-NPs and biotin-labeled probes, and selective capture of the hybridization complex by streptavidin-coated paramagnetic beads. The detection of target DNA is realized by direct measurement of ECL emission of TBR. It can quantitatively detect target nucleic acids with high speed and sensitivity. This method can be used to quantitatively detect GMO fragments from real GMO products. PMID:18386909

Highlights of DNA Barcoding in identification of salient microorganisms like fungi.

PubMed

Dulla, E L; Kathera, C; Gurijala, H K; Mallakuntla, T R; Srinivasan, P; Prasad, V; Mopati, R D; Jasti, P K

2016-12-01

Fungi, the second largest kingdom of eukaryotic life, are diverse and widespread. Fungi play a distinctive role in the production of different products on industrial scale, like fungal enzymes, antibiotics, fermented foods, etc., to give storage stability and improved health to meet major global challenges. To utilize algae perfectly for human needs, and to pave the way for getting a healthy relationship with fungi, it is important to identify them in a quick and robust manner with molecular-based identification system. So, there is a technique that aims to provide a well-organized method for species level identifications and to contribute powerfully to taxonomic and biodiversity research is DNA Barcoding. DNA Barcoding is generally achieved by the retrieval of a short DNA sequence - the 'barcode' - from a standard part of the genome and that barcode is then compared with a library of reference barcode sequences derived from individuals of known identity for identification. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

DNA barcodes for bio-surveillance: regulated and economically important arthropod plant pests.

PubMed

Ashfaq, Muhammad; Hebert, Paul D N

2016-11-01

Many of the arthropod species that are important pests of agriculture and forestry are impossible to discriminate morphologically throughout all of their life stages. Some cannot be differentiated at any life stage. Over the past decade, DNA barcoding has gained increasing adoption as a tool to both identify known species and to reveal cryptic taxa. Although there has not been a focused effort to develop a barcode library for them, reference sequences are now available for 77% of the 409 species of arthropods documented on major pest databases. Aside from developing the reference library needed to guide specimen identifications, past barcode studies have revealed that a significant fraction of arthropod pests are a complex of allied taxa. Because of their importance as pests and disease vectors impacting global agriculture and forestry, DNA barcode results on these arthropods have significant implications for quarantine detection, regulation, and management. The current review discusses these implications in light of the presence of cryptic species in plant pests exposed by DNA barcoding.

Efficacy of DNA barcoding for the species identification of spiders from Western Ghats of India.

PubMed

Gaikwad, Swapnil; Warudkar, Ashwin; Shouche, Yogesh

2017-09-01

DNA barcoding has emerged as an additional tool for taxonomy and as an aid to taxonomic impediments. Due to their extensive morphological variation, spiders are taxonomically challenging. Therefore, all over the world, attempts are being made to DNA barcode species of spiders. Till now no attempts were made to DNA barcode Indian spiders despite their rich diversity. We have generated DNA barcodes for 60 species (n = 112) of spiders for the first time from India. Although only 17 species were correctly identified at the species level, DNA barcoding correctly discriminated 99% of the species studied here. We have also found high intraspecies nucleotide divergence in Plexippus paykulli suggesting cryptic diversity that needs to be studied in detail. Our study also showed non-specific amplification of the Cytochrome Oxidase I (COI) gene of endosymbiont bacteria Wolbachia. However, these cases are very rare and could be resolved by the use of modified or group specific primers.

Detection of tyrosine hydroxylase in dopaminergic neuron cell using gold nanoparticles-based barcode DNA.

PubMed

An, Jeung Hee; Oh, Byung-Keun; Choi, Jeong Woo

2013-04-01

Tyrosine hydroxylase, the rate-limiting enzyme of catecholamine biosysthesis, is predominantly expressed in several cell groups within the brain, including the dopaminergic neurons of the substantia nigra and ventral tegmental area. We evaluated the efficacy of this protein-detection method in detecting tyrosine hydroxylase in normal and oxidative stress damaged dopaminergic cells. In this study, a coupling of DNA barcode and bead-based immnunoassay for detecting tyrosine hydroxylaser with PCR-like sensitivity is reported. The method relies on magnetic nanoparticles with antibodies and nanoparticles that are encoded with DNA and antibodies that can sandwich the target protein captured by the nanoparticle-bound antibodies. The aggregate sandwich structures are magnetically separated from solution, and treated to remove the conjugated barcode DNA. The DNA barcodes were identified by PCR analysis. The concentration of tyrosine hydroxylase in dopaminergic cell can be easily and rapidly detected using bio-barcode assay. The bio-barcode assay is a rapid and high-throughput screening tool to detect of neurotransmitter such as dopamine.

Detection of proteins using a colorimetric bio-barcode assay.

PubMed

Nam, Jwa-Min; Jang, Kyung-Jin; Groves, Jay T

2007-01-01

The colorimetric bio-barcode assay is a red-to-blue color change-based protein detection method with ultrahigh sensitivity. This assay is based on both the bio-barcode amplification method that allows for detecting miniscule amount of targets with attomolar sensitivity and gold nanoparticle-based colorimetric DNA detection method that allows for a simple and straightforward detection of biomolecules of interest (here we detect interleukin-2, an important biomarker (cytokine) for many immunodeficiency-related diseases and cancers). The protocol is composed of the following steps: (i) conjugation of target capture molecules and barcode DNA strands onto silica microparticles, (ii) target capture with probes, (iii) separation and release of barcode DNA strands from the separated probes, (iv) detection of released barcode DNA using DNA-modified gold nanoparticle probes and (v) red-to-blue color change analysis with a graphic software. Actual target detection and quantification steps with premade probes take approximately 3 h (whole protocol including probe preparations takes approximately 3 days).

DNA barcoding of odonates from the Upper Plata basin: Database creation and genetic diversity estimation

PubMed Central

Pepinelli, Mateus; Rodrigues, Marciel Elio; Roque, Fabio de Oliveira; Lorenz-Lemke, Aline Pedroso; Kvist, Sebastian

2017-01-01

We present a DNA barcoding study of Neotropical odonates from the Upper Plata basin, Brazil. A total of 38 species were collected in a transition region of “Cerrado” and Atlantic Forest, both regarded as biological hotspots, and 130 cytochrome c oxidase subunit I (COI) barcodes were generated for the collected specimens. The distinct gap between intraspecific (0–2%) and interspecific variation (15% and above) in COI, and resulting separation of Barcode Index Numbers (BIN), allowed for successful identification of specimens in 94% of cases. The 6% fail rate was due to a shared BIN between two separate nominal species. DNA barcoding, based on COI, thus seems to be a reliable and efficient tool for identifying Neotropical odonate specimens down to the species level. These results underscore the utility of DNA barcoding to aid specimen identification in diverse biological hotspots, areas that require urgent action regarding taxonomic surveys and biodiversity conservation. PMID:28763495

Application of DNA Machineries for the Barcode Patterned Detection of Genes or Proteins.

PubMed

Zhou, Zhixin; Luo, Guofeng; Wulf, Verena; Willner, Itamar

2018-06-05

The study introduces an analytical platform for the detection of genes or aptamer-ligand complexes by nucleic acid barcode patterns generated by DNA machineries. The DNA machineries consist of nucleic acid scaffolds that include specific recognition sites for the different genes or aptamer-ligand analytes. The binding of the analytes to the scaffolds initiate, in the presence of the nucleotide mixture, a cyclic polymerization/nicking machinery that yields displaced strands of variable lengths. The electrophoretic separation of the resulting strands provides barcode patterns for the specific detection of the different analytes. Mixtures of DNA machineries that yield, upon sensing of different genes (or aptamer ligands), one-, two-, or three-band barcode patterns are described. The combination of nucleic acid scaffolds acting, in the presence of polymerase/nicking enzyme and nucleotide mixture, as DNA machineries, that generate multiband barcode patterns provide an analytical platform for the detection of an individual gene out of many possible genes. The diversity of genes (or other analytes) that can be analyzed by the DNA machineries and the barcode patterned imaging is given by the Pascal's triangle. As a proof-of-concept, the detection of one of six genes, that is, TP53, Werner syndrome, Tay-Sachs normal gene, BRCA1, Tay-Sachs mutant gene, and cystic fibrosis disorder gene by six two-band barcode patterns is demonstrated. The advantages and limitations of the detection of analytes by polymerase/nicking DNA machineries that yield barcode patterns as imaging readout signals are discussed.

The Hemiptera (Insecta) of Canada: Constructing a Reference Library of DNA Barcodes

PubMed Central

Gwiazdowski, Rodger A.; Foottit, Robert G.; Maw, H. Eric L.; Hebert, Paul D. N.

2015-01-01

DNA barcode reference libraries linked to voucher specimens create new opportunities for high-throughput identification and taxonomic re-evaluations. This study provides a DNA barcode library for about 45% of the recognized species of Canadian Hemiptera, and the publically available R workflow used for its generation. The current library is based on the analysis of 20,851 specimens including 1849 species belonging to 628 genera and 64 families. These individuals were assigned to 1867 Barcode Index Numbers (BINs), sequence clusters that often coincide with species recognized through prior taxonomy. Museum collections were a key source for identified specimens, but we also employed high-throughput collection methods that generated large numbers of unidentified specimens. Many of these specimens represented novel BINs that were subsequently identified by taxonomists, adding barcode coverage for additional species. Our analyses based on both approaches includes 94 species not listed in the most recent Canadian checklist, representing a potential 3% increase in the fauna. We discuss the development of our workflow in the context of prior DNA barcode library construction projects, emphasizing the importance of delineating a set of reference specimens to aid investigations in cases of nomenclatural and DNA barcode discordance. The identification for each specimen in the reference set can be annotated on the Barcode of Life Data System (BOLD), allowing experts to highlight questionable identifications; annotations can be added by any registered user of BOLD, and instructions for this are provided. PMID:25923328

76 FR 34871 - Mobile Barcode Promotion

Federal Register 2010, 2011, 2012, 2013, 2014

2011-06-15

... POSTAL SERVICE 39 CFR Part 111 Mobile Barcode Promotion AGENCY: Postal Service TM . ACTION: Final rule. SUMMARY: The Postal Service is revising the Mailing Standards of the United States Postal Service... mailpieces with mobile barcodes must be one of the following: 1. Presorted or automation First-Class Mail...

Reducing the Spatial Distance between Printed and Online Information Sources by Means of Mobile Technology Enhances Learning: Using 2D Barcodes

ERIC Educational Resources Information Center

Ozcelik, Erol; Acarturk, Cengiz

2011-01-01

Online information sources, such as pictures and animations on web pages are frequently used for complementing printed course material in educational contexts. The concurrent use of online and printed information sources by students, however, requires going back and forth between physically separated course material, such as a course book and a…

Evaluating Ethanol-based Sample Preservation to Facilitate Use of DNA Barcoding in Routine Freshwater Biomonitoring Programs Using Benthic Macroinvertebrates

EPA Science Inventory

Molecular methods, such as DNA barcoding, have the potential in enhance biomonitoring programs worldwide. Altering routinely used sample preservation methods to protect DNA from degradation may pose a potential impediment to application of DNA barcoding and metagenomics for biom...

Barcode haplotype variation in North American agroecosystem ladybird beetles (Coleoptera: Coccinellidae

USDA-ARS?s Scientific Manuscript database

DNA barcodes have proven invaluable in identifying and distinguishing insect pests, for example for determining the provenance of exotic invasives, but relatively few insect natural enemies have been barcoded. We used Folmer et al.’s universal invertebrate primers (1994), and those designed by Heber...

Effect of field deposition and pore size on Co/Cu barcode nanowires by electrodeposition

NASA Astrophysics Data System (ADS)

Cho, Ji Ung; Wu, Jun-Hua; Min, Ji Hyun; Lee, Ju Hun; Liu, Hong-Ling; Kim, Young Keun

2007-03-01

We have studied the effect of an external magnetic field applied during electrodeposition of Co/Cu barcode nanowires in anodic aluminum oxide nanotemplates. The magnetic properties of the barcode nanowires were greatly enhanced for 50 nm pore diameter regardless of segment aspect ratio, but field deposition has little effect on the 200 nm nanowires. The magnetic improvement is correlated with a structural change, attributed to field modification of the growth habit of the barcode nanowires. A mechanism of growth subject to geometric confinement is proposed.

A dual amplification strategy for DNA detection combining bio-barcode assay and metal-enhanced fluorescence modality.

PubMed

Zhou, Zhenpeng; Li, Tian; Huang, Hongduan; Chen, Yang; Liu, Feng; Huang, Chengzhi; Li, Na

2014-11-11

Silver-enhanced fluorescence was coupled with a bio-barcode assay to facilitate a dual amplification assay to demonstrate a non-enzymatic approach for simple and sensitive detection of DNA. In the assay design, magnetic nanoparticles seeded with silver nanoparticles were modified with the capture DNA, and silver nanoparticles were modified with the binding of ssDNA and the fluorescently labeled barcode dsDNA. Upon introduction of the target DNA, a sandwich structure was formed because of the hybridization reaction. By simple magnetic separation, silver-enhanced fluorescence of barcode DNAs could be readily measured without the need of a further step to liberate barcode DNAs from silver nanoparticles, endowing the method with simplicity and high sensitivity with a detection limit of 1 pM.

High-accuracy biodistribution analysis of adeno-associated virus variants by double barcode sequencing.

PubMed

Marsic, Damien; Méndez-Gómez, Héctor R; Zolotukhin, Sergei

2015-01-01

Biodistribution analysis is a key step in the evaluation of adeno-associated virus (AAV) capsid variants, whether natural isolates or produced by rational design or directed evolution. Indeed, when screening candidate vectors, accurate knowledge about which tissues are infected and how efficiently is essential. We describe the design, validation, and application of a new vector, pTR-UF50-BC, encoding a bioluminescent protein, a fluorescent protein and a DNA barcode, which can be used to visualize localization of transduction at the organism, organ, tissue, or cellular levels. In addition, by linking capsid variants to different barcoded versions of the vector and amplifying the barcode region from various tissue samples using barcoded primers, biodistribution of viral genomes can be analyzed with high accuracy and efficiency.

Status and prospects of DNA barcoding in medically important parasites and vectors.

PubMed

Ondrejicka, Danielle A; Locke, Sean A; Morey, Kevin; Borisenko, Alex V; Hanner, Robert H

2014-12-01

For over 10 years, DNA barcoding has been used to identify specimens and discern species. Its potential benefits in parasitology were recognized early, but its utility and uptake remain unclear. Here we review studies using DNA barcoding in parasites and vectors affecting humans and find that the technique is accurate (accords with author identifications based on morphology or other markers) in 94-95% of cases, although aspects of DNA barcoding (vouchering, marker implicated) have often been misunderstood. In a newly compiled checklist of parasites, vectors, and hazards, barcodes are available for 43% of all 1403 species and for more than half of 429 species of greater medical importance. This is encouraging coverage that would improve with an active campaign targeting parasites and vectors. Copyright © 2014 Elsevier Ltd. All rights reserved.

DNA barcodes for Nearctic Auchenorrhyncha (Insecta: Hemiptera).

PubMed

Foottit, Robert G; Maw, Eric; Hebert, P D N

2014-01-01

Many studies have shown the suitability of sequence variation in the 5' region of the mitochondrial cytochrome c oxidase I (COI) gene as a DNA barcode for the identification of species in a wide range of animal groups. We examined 471 species in 147 genera of Hemiptera: Auchenorrhyncha drawn from specimens in the Canadian National Collection of Insects to assess the effectiveness of DNA barcoding in this group. Analysis of the COI gene revealed less than 2% intra-specific divergence in 93% of the taxa examined, while minimum interspecific distances exceeded 2% in 70% of congeneric species pairs. Although most species are characterized by a distinct sequence cluster, sequences for members of many groups of closely related species either shared sequences or showed close similarity, with 25% of species separated from their nearest neighbor by less than 1%. This study, although preliminary, provides DNA barcodes for about 8% of the species of this hemipteran suborder found in North America north of Mexico. Barcodes can enable the identification of many species of Auchenorrhyncha, but members of some species groups cannot be discriminated. Future use of DNA barcodes in regulatory, pest management, and environmental applications will be possible as the barcode library for Auchenorrhyncha expands to include more species and broader geographic coverage.

With a little help from DNA barcoding: investigating the diversity of Gastropoda from the Portuguese coast

PubMed Central

Borges, Luísa M. S.; Hollatz, Claudia; Lobo, Jorge; Cunha, Ana M.; Vilela, Ana P.; Calado, Gonçalo; Coelho, Rita; Costa, Ana C.; Ferreira, Maria S. G.; Costa, Maria H.; Costa, Filipe O.

2016-01-01

The Gastropoda is one of the best studied classes of marine invertebrates. Yet, most species have been delimited based on morphology only. The application of DNA barcodes has shown to be greatly useful to help delimiting species. Therefore, sequences of the cytochrome c oxidase I gene from 108 specimens of 34 morpho-species were used to investigate the molecular diversity within the gastropods from the Portuguese coast. To the above dataset, we added available COI-5P sequences of taxonomically close species, in a total of 58 morpho-species examined. There was a good match between ours and sequences from independent studies, in public repositories. We found 32 concordant (91.4%) out of the 35 Barcode Index Numbers (BINs) generated from our sequences. The application of a ranking system to the barcodes yield over 70% with top taxonomic congruence, while 14.2% of the species barcodes had insufficient data. In the majority of the cases, there was a good concordance between morphological identification and DNA barcodes. Nonetheless, the discordance between morphological and molecular data is a reminder that even the comparatively well-known European marine gastropods can benefit from being probed using the DNA barcode approach. Discordant cases should be reviewed with more integrative studies. PMID:26876495

With a little help from DNA barcoding: investigating the diversity of Gastropoda from the Portuguese coast.

PubMed

Borges, Luísa M S; Hollatz, Claudia; Lobo, Jorge; Cunha, Ana M; Vilela, Ana P; Calado, Gonçalo; Coelho, Rita; Costa, Ana C; Ferreira, Maria S G; Costa, Maria H; Costa, Filipe O

2016-02-15

The Gastropoda is one of the best studied classes of marine invertebrates. Yet, most species have been delimited based on morphology only. The application of DNA barcodes has shown to be greatly useful to help delimiting species. Therefore, sequences of the cytochrome c oxidase I gene from 108 specimens of 34 morpho-species were used to investigate the molecular diversity within the gastropods from the Portuguese coast. To the above dataset, we added available COI-5P sequences of taxonomically close species, in a total of 58 morpho-species examined. There was a good match between ours and sequences from independent studies, in public repositories. We found 32 concordant (91.4%) out of the 35 Barcode Index Numbers (BINs) generated from our sequences. The application of a ranking system to the barcodes yield over 70% with top taxonomic congruence, while 14.2% of the species barcodes had insufficient data. In the majority of the cases, there was a good concordance between morphological identification and DNA barcodes. Nonetheless, the discordance between morphological and molecular data is a reminder that even the comparatively well-known European marine gastropods can benefit from being probed using the DNA barcode approach. Discordant cases should be reviewed with more integrative studies.

A DNA barcode library for ground beetles (Insecta, Coleoptera, Carabidae) of Germany: The genus Bembidion Latreille, 1802 and allied taxa

PubMed Central

Raupach, Michael J.; Hannig, Karsten; Morinière, Jérome; Hendrich, Lars

2016-01-01

Abstract As molecular identification method, DNA barcoding based on partial cytochrome c oxidase subunit 1 (COI) sequences has been proven to be a useful tool for species determination in many insect taxa including ground beetles. In this study we tested the effectiveness of DNA barcodes to discriminate species of the ground beetle genus Bembidion and some closely related taxa of Germany. DNA barcodes were obtained from 819 individuals and 78 species, including sequences from previous studies as well as more than 300 new generated DNA barcodes. We found a 1:1 correspondence between BIN and traditionally recognized species for 69 species (89%). Low interspecific distances with maximum pairwise K2P values below 2.2% were found for three species pairs, including two species pairs with haplotype sharing (Bembidion atrocaeruleum/Bembidion varicolor and Bembidion guttula/Bembidion mannerheimii). In contrast to this, deep intraspecific sequence divergences with distinct lineages were revealed for two species (Bembidion geniculatum/Ocys harpaloides). Our study emphasizes the use of DNA barcodes for the identification of the analyzed ground beetles species and represents an important step in building-up a comprehensive barcode library for the Carabidae in Germany and Central Europe as well. PMID:27408547

DNA Barcodes for Nearctic Auchenorrhyncha (Insecta: Hemiptera)

PubMed Central

Foottit, Robert G.; Maw, Eric; Hebert, P. D. N.

2014-01-01

Background Many studies have shown the suitability of sequence variation in the 5′ region of the mitochondrial cytochrome c oxidase I (COI) gene as a DNA barcode for the identification of species in a wide range of animal groups. We examined 471 species in 147 genera of Hemiptera: Auchenorrhyncha drawn from specimens in the Canadian National Collection of Insects to assess the effectiveness of DNA barcoding in this group. Methodology/Principal Findings Analysis of the COI gene revealed less than 2% intra-specific divergence in 93% of the taxa examined, while minimum interspecific distances exceeded 2% in 70% of congeneric species pairs. Although most species are characterized by a distinct sequence cluster, sequences for members of many groups of closely related species either shared sequences or showed close similarity, with 25% of species separated from their nearest neighbor by less than 1%. Conclusions/Significance This study, although preliminary, provides DNA barcodes for about 8% of the species of this hemipteran suborder found in North America north of Mexico. Barcodes can enable the identification of many species of Auchenorrhyncha, but members of some species groups cannot be discriminated. Future use of DNA barcodes in regulatory, pest management, and environmental applications will be possible as the barcode library for Auchenorrhyncha expands to include more species and broader geographic coverage. PMID:25004106

Barcode ITS2: a useful tool for identifying Trachelospermum jasminoides and a good monitor for medicine market.

PubMed

Yu, Ning; Wei, Yu-Long; Zhang, Xin; Zhu, Ning; Wang, Yan-Li; Zhu, Yue; Zhang, Hai-Ping; Li, Fen-Mei; Yang, Lan; Sun, Jia-Qi; Sun, Ai-Dong

2017-07-11

Trachelospermum jasminoides is commonly used in traditional Chinese medicine. However, the use of the plant's local alternatives is frequent, causing potential clinical problems. The T. jasminoides sold in the medicine market is commonly dried and sliced, making traditional identification methods difficult. In this study, the ITS2 region was evaluated on 127 sequences representing T. jasminoides and its local alternatives according to PCR and sequencing rates, intra- and inter-specific divergences, secondary structure, and discrimination capacity. Results indicated the 100% success rates of PCR and sequencing and the obvious presence of a barcoding gap. Results of BLAST 1, nearest distance and neighbor-joining tree methods showed that barcode ITS2 could successfully identify all the texted samples. The secondary structures of the ITS2 region provided another dimensionality for species identification. Two-dimensional images were obtained for better and easier identification. Previous studies on DNA barcoding concentrated more on the same family, genus, or species. However, an ideal barcode should be variable enough to identify closely related species. Meanwhile, the barcodes should also be conservative in identifying distantly related species. This study highlights the application of barcode ITS2 in solving practical problems in the distantly related local alternatives of medical plants.

The fish diversity in the upper reaches of the Salween River, Nujiang River, revealed by DNA barcoding.

PubMed

Chen, Weitao; Ma, Xiuhui; Shen, Yanjun; Mao, Yuntao; He, Shunping

2015-11-30

Nujiang River (NR), an essential component of the biodiversity hotspot of the Mountains of Southwest China, possesses a characteristic fish fauna and contains endemic species. Although previous studies on fish diversity in the NR have primarily consisted of listings of the fish species observed during field collections, in our study, we DNA-barcoded 1139 specimens belonging to 46 morphologically distinct fish species distributed throughout the NR basin by employing multiple analytical approaches. According to our analyses, DNA barcoding is an efficient method for the identification of fish by the presence of barcode gaps. However, three invasive species are characterized by deep conspecific divergences, generating multiple lineages and Operational Taxonomic Units (OTUs), implying the possibility of cryptic species. At the other end of the spectrum, ten species (from three genera) that are characterized by an overlap between their intra- and interspecific genetic distances form a single genetic cluster and share haplotypes. The neighbor-joining phenogram, Barcode Index Numbers (BINs) and Automatic Barcode Gap Discovery (ABGD) identified 43 putative species, while the General Mixed Yule-coalescence (GMYC) identified five more OTUs. Thus, our study established a reliable DNA barcode reference library for the fish in the NR and sheds new light on the local fish diversity.

DNA Barcoding for Species Identification of Insect Skins: A Test on Chironomidae (Diptera) Pupal Exuviae

PubMed Central

Ekrem, Torbjørn; Stur, Elisabeth

2017-01-01

Abstract Chironomidae (Diptera) pupal exuviae samples are commonly used for biological monitoring of aquatic habitats. DNA barcoding has proved useful for species identification of chironomid life stages containing cellular tissue, but the barcoding success of chironomid pupal exuviae is unknown. We assessed whether standard DNA barcoding could be efficiently used for species identification of chironomid pupal exuviae when compared with morphological techniques and if there were differences in performance between temperate and tropical ecosystems, subfamilies, and tribes. PCR, sequence, and identification success differed significantly between geographic regions and taxonomic groups. For Norway, 27 out of 190 (14.2%) of pupal exuviae resulted in high-quality chironomid sequences that match species. For Costa Rica, 69 out of 190 (36.3%) Costa Rican pupal exuviae resulted in high-quality sequences, but none matched known species. Standard DNA barcoding of chironomid pupal exuviae had limited success in species identification of unknown specimens due to contaminations and lack of matching references in available barcode libraries, especially from Costa Rica. Therefore, we recommend future biodiversity studies that focus their efforts on understudied regions, to simultaneously use morphological and molecular identification techniques to identify all life stages of chironomids and populate the barcode reference library with identified sequences.

Efficacy of the core DNA barcodes in identifying processed and poorly conserved plant materials commonly used in South African traditional medicine

PubMed Central

Mankga, Ledile T.; Yessoufou, Kowiyou; Moteetee, Annah M.; Daru, Barnabas H.; van der Bank, Michelle

2013-01-01

Abstract Medicinal plants cover a broad range of taxa, which may be phylogenetically less related but morphologically very similar. Such morphological similarity between species may lead to misidentification and inappropriate use. Also the substitution of a medicinal plant by a cheaper alternative (e.g. other non-medicinal plant species), either due to misidentification, or deliberately to cheat consumers, is an issue of growing concern. In this study, we used DNA barcoding to identify commonly used medicinal plants in South Africa. Using the core plant barcodes, matK and rbcLa, obtained from processed and poorly conserved materials sold at the muthi traditional medicine market, we tested efficacy of the barcodes in species discrimination. Based on genetic divergence, PCR amplification efficiency and BLAST algorithm, we revealed varied discriminatory potentials for the DNA barcodes. In general, the barcodes exhibited high discriminatory power, indicating their effectiveness in verifying the identity of the most common plant species traded in South African medicinal markets. BLAST algorithm successfully matched 61% of the queries against a reference database, suggesting that most of the information supplied by sellers at traditional medicinal markets in South Africa is correct. Our findings reinforce the utility of DNA barcoding technique in limiting false identification that can harm public health. PMID:24453559

The fish diversity in the upper reaches of the Salween River, Nujiang River, revealed by DNA barcoding

PubMed Central

Chen, Weitao; Ma, Xiuhui; Shen, Yanjun; Mao, Yuntao; He, Shunping

2015-01-01

Nujiang River (NR), an essential component of the biodiversity hotspot of the Mountains of Southwest China, possesses a characteristic fish fauna and contains endemic species. Although previous studies on fish diversity in the NR have primarily consisted of listings of the fish species observed during field collections, in our study, we DNA-barcoded 1139 specimens belonging to 46 morphologically distinct fish species distributed throughout the NR basin by employing multiple analytical approaches. According to our analyses, DNA barcoding is an efficient method for the identification of fish by the presence of barcode gaps. However, three invasive species are characterized by deep conspecific divergences, generating multiple lineages and Operational Taxonomic Units (OTUs), implying the possibility of cryptic species. At the other end of the spectrum, ten species (from three genera) that are characterized by an overlap between their intra- and interspecific genetic distances form a single genetic cluster and share haplotypes. The neighbor-joining phenogram, Barcode Index Numbers (BINs) and Automatic Barcode Gap Discovery (ABGD) identified 43 putative species, while the General Mixed Yule-coalescence (GMYC) identified five more OTUs. Thus, our study established a reliable DNA barcode reference library for the fish in the NR and sheds new light on the local fish diversity. PMID:26616046

Laser identification system based on acousto-optical barcode scanner principles

NASA Astrophysics Data System (ADS)

Khansuvarov, Ruslan A.; Korol, Georgy I.; Preslenev, Leonid N.; Bestugin, Aleksandr R.; Paraskun, Arthur S.

2016-09-01

The main purpose of the bar code in the modern world is the unique identification of the product, service, or any of their features, so personal and stationary barcode scanners so widely used. One of the important parameters of bar code scanners is their reliability, accuracy of the barcode recognition, response time and performance. Nowadays, the most popular personal barcode scanners contain a mechanical part, which extremely impairs the reliability indices. Group of SUAI engineers has proposed bar code scanner based on laser beam acoustic deflection effect in crystals [RU patent No 156009 issued 4/16/2015] Through the use of an acousto-optic deflector element in barcode scanner described by a group of engineers SUAI, it can be implemented in the manual form factor, and the stationary form factor of a barcode scanner. Being a wave electronic device, an acousto-optic element in the composition of the acousto-optic barcode scanner allows you to clearly establish a mathematical link between the encoded function of the bar code with the accepted input photodetector intensities function that allows you to speak about the great probability of a bar code clear definition. This paper provides a description of the issued patent, the description of the principles of operation based on the mathematical analysis, a description of the layout of the implemented scanner.

Application of DNA Barcodes in Asian Tropical Trees – A Case Study from Xishuangbanna Nature Reserve, Southwest China

PubMed Central

Conran, John G.; Li, Jie

2015-01-01

Background Within a regional floristic context, DNA barcoding is more useful to manage plant diversity inventories on a large scale and develop valuable conservation strategies. However, there are no DNA barcode studies from tropical areas of China, which represents one of the biodiversity hotspots around the world. Methodology and Principal Findings A DNA barcoding database of an Asian tropical trees with high diversity was established at Xishuangbanna Nature Reserve, Yunnan, southwest China using rbcL and matK as standard barcodes, as well as trnH–psbA and ITS as supplementary barcodes. The performance of tree species identification success was assessed using 2,052 accessions from four plots belonging to two vegetation types in the region by three methods: Neighbor-Joining, Maximum-Likelihood and BLAST. We corrected morphological field identification errors (9.6%) for the three plots using rbcL and matK based on Neighbor-Joining tree. The best barcode region for PCR and sequencing was rbcL (97.6%, 90.8%), followed by trnH–psbA (93.6%, 85.6%), while matK and ITS obtained relative low PCR and sequencing success rates. However, ITS performed best for both species (44.6–58.1%) and genus (72.8–76.2%) identification. With trnH–psbA slightly less effective for species identification. The two standard barcode rbcL and matK gave poor results for species identification (24.7–28.5% and 31.6–35.3%). Compared with other studies from comparable tropical forests (e.g. Cameroon, the Amazon and India), the overall performance of the four barcodes for species identification was lower for the Xishuangbanna Nature Reserve, possibly because of species/genus ratios and species composition between these tropical areas. Conclusions/Significance Although the core barcodes rbcL and matK were not suitable for species identification of tropical trees from Xishuangbanna Nature Reserve, they could still help with identification at the family and genus level. Considering the relative sequence recovery and the species identification performance, we recommend the use of trnH–psbA and ITS in combination as the preferred barcodes for tropical tree species identification in China. PMID:26121045

DNA barcode identification of Podocarpaceae--the second largest conifer family.

PubMed

Little, Damon P; Knopf, Patrick; Schulz, Christian

2013-01-01

We have generated matK, rbcL, and nrITS2 DNA barcodes for 320 specimens representing all 18 extant genera of the conifer family Podocarpaceae. The sample includes 145 of the 198 recognized species. Comparative analyses of sequence quality and species discrimination were conducted on the 159 individuals from which all three markers were recovered (representing 15 genera and 97 species). The vast majority of sequences were of high quality (B 30 = 0.596-0.989). Even the lowest quality sequences exceeded the minimum requirements of the BARCODE data standard. In the few instances that low quality sequences were generated, the responsible mechanism could not be discerned. There were no statistically significant differences in the discriminatory power of markers or marker combinations (p = 0.05). The discriminatory power of the barcode markers individually and in combination is low (56.7% of species at maximum). In some instances, species discrimination failed in spite of ostensibly useful variation being present (genotypes were shared among species), but in many cases there was simply an absence of sequence variation. Barcode gaps (maximum intraspecific p-distance > minimum interspecific p-distance) were observed in 50.5% of species when all three markers were considered simultaneously. The presence of a barcode gap was not predictive of discrimination success (p = 0.02) and there was no statistically significant difference in the frequency of barcode gaps among markers (p = 0.05). In addition, there was no correlation between number of individuals sampled per species and the presence of a barcode gap (p = 0.27).

Vehicle autonomous localization in local area of coal mine tunnel based on vision sensors and ultrasonic sensors

PubMed Central

Yang, Wei; You, Kaiming; Li, Wei; Kim, Young-il

2017-01-01

This paper presents a vehicle autonomous localization method in local area of coal mine tunnel based on vision sensors and ultrasonic sensors. Barcode tags are deployed in pairs on both sides of the tunnel walls at certain intervals as artificial landmarks. The barcode coding is designed based on UPC-A code. The global coordinates of the upper left inner corner point of the feature frame of each barcode tag deployed in the tunnel are uniquely represented by the barcode. Two on-board vision sensors are used to recognize each pair of barcode tags on both sides of the tunnel walls. The distance between the upper left inner corner point of the feature frame of each barcode tag and the vehicle center point can be determined by using a visual distance projection model. The on-board ultrasonic sensors are used to measure the distance from the vehicle center point to the left side of the tunnel walls. Once the spatial geometric relationship between the barcode tags and the vehicle center point is established, the 3D coordinates of the vehicle center point in the tunnel’s global coordinate system can be calculated. Experiments on a straight corridor and an underground tunnel have shown that the proposed vehicle autonomous localization method is not only able to quickly recognize the barcode tags affixed to the tunnel walls, but also has relatively small average localization errors in the vehicle center point’s plane and vertical coordinates to meet autonomous unmanned vehicle positioning requirements in local area of coal mine tunnel. PMID:28141829

Molecular-based rapid inventories of sympatric diversity: a comparison of DNA barcode clustering methods applied to geography-based vs clade-based sampling of amphibians.

PubMed

Paz, Andrea; Crawford, Andrew J

2012-11-01

Molecular markers offer a universal source of data for quantifying biodiversity. DNA barcoding uses a standardized genetic marker and a curated reference database to identify known species and to reveal cryptic diversity within wellsampled clades. Rapid biological inventories, e.g. rapid assessment programs (RAPs), unlike most barcoding campaigns, are focused on particular geographic localities rather than on clades. Because of the potentially sparse phylogenetic sampling, the addition of DNA barcoding to RAPs may present a greater challenge for the identification of named species or for revealing cryptic diversity. In this article we evaluate the use of DNA barcoding for quantifying lineage diversity within a single sampling site as compared to clade-based sampling, and present examples from amphibians. We compared algorithms for identifying DNA barcode clusters (e.g. species, cryptic species or Evolutionary Significant Units) using previously published DNA barcode data obtained from geography-based sampling at a site in Central Panama, and from clade-based sampling in Madagascar. We found that clustering algorithms based on genetic distance performed similarly on sympatric as well as clade-based barcode data, while a promising coalescent-based method performed poorly on sympatric data. The various clustering algorithms were also compared in terms of speed and software implementation. Although each method has its shortcomings in certain contexts, we recommend the use of the ABGD method, which not only performs fairly well under either sampling method, but does so in a few seconds and with a user-friendly Web interface.

Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi

PubMed Central

Schoch, Conrad L.; Seifert, Keith A.; Huhndorf, Sabine; Robert, Vincent; Spouge, John L.; Levesque, C. André; Chen, Wen; Bolchacova, Elena; Voigt, Kerstin; Crous, Pedro W.; Miller, Andrew N.; Wingfield, Michael J.; Aime, M. Catherine; An, Kwang-Deuk; Bai, Feng-Yan; Barreto, Robert W.; Begerow, Dominik; Bergeron, Marie-Josée; Blackwell, Meredith; Boekhout, Teun; Bogale, Mesfin; Boonyuen, Nattawut; Burgaz, Ana R.; Buyck, Bart; Cai, Lei; Cai, Qing; Cardinali, G.; Chaverri, Priscila; Coppins, Brian J.; Crespo, Ana; Cubas, Paloma; Cummings, Craig; Damm, Ulrike; de Beer, Z. Wilhelm; de Hoog, G. Sybren; Del-Prado, Ruth; Dentinger, Bryn; Diéguez-Uribeondo, Javier; Divakar, Pradeep K.; Douglas, Brian; Dueñas, Margarita; Duong, Tuan A.; Eberhardt, Ursula; Edwards, Joan E.; Elshahed, Mostafa S.; Fliegerova, Katerina; Furtado, Manohar; García, Miguel A.; Ge, Zai-Wei; Griffith, Gareth W.; Griffiths, K.; Groenewald, Johannes Z.; Groenewald, Marizeth; Grube, Martin; Gryzenhout, Marieka; Guo, Liang-Dong; Hagen, Ferry; Hambleton, Sarah; Hamelin, Richard C.; Hansen, Karen; Harrold, Paul; Heller, Gregory; Herrera, Cesar; Hirayama, Kazuyuki; Hirooka, Yuuri; Ho, Hsiao-Man; Hoffmann, Kerstin; Hofstetter, Valérie; Högnabba, Filip; Hollingsworth, Peter M.; Hong, Seung-Beom; Hosaka, Kentaro; Houbraken, Jos; Hughes, Karen; Huhtinen, Seppo; Hyde, Kevin D.; James, Timothy; Johnson, Eric M.; Johnson, Joan E.; Johnston, Peter R.; Jones, E.B. Gareth; Kelly, Laura J.; Kirk, Paul M.; Knapp, Dániel G.; Kõljalg, Urmas; Kovács, Gábor M.; Kurtzman, Cletus P.; Landvik, Sara; Leavitt, Steven D.; Liggenstoffer, Audra S.; Liimatainen, Kare; Lombard, Lorenzo; Luangsa-ard, J. Jennifer; Lumbsch, H. Thorsten; Maganti, Harinad; Maharachchikumbura, Sajeewa S. N.; Martin, María P.; May, Tom W.; McTaggart, Alistair R.; Methven, Andrew S.; Meyer, Wieland; Moncalvo, Jean-Marc; Mongkolsamrit, Suchada; Nagy, László G.; Nilsson, R. Henrik; Niskanen, Tuula; Nyilasi, Ildikó; Okada, Gen; Okane, Izumi; Olariaga, Ibai; Otte, Jürgen; Papp, Tamás; Park, Duckchul; Petkovits, Tamás; Pino-Bodas, Raquel; Quaedvlieg, William; Raja, Huzefa A.; Redecker, Dirk; Rintoul, Tara L.; Ruibal, Constantino; Sarmiento-Ramírez, Jullie M.; Schmitt, Imke; Schüßler, Arthur; Shearer, Carol; Sotome, Kozue; Stefani, Franck O.P.; Stenroos, Soili; Stielow, Benjamin; Stockinger, Herbert; Suetrong, Satinee; Suh, Sung-Oui; Sung, Gi-Ho; Suzuki, Motofumi; Tanaka, Kazuaki; Tedersoo, Leho; Telleria, M. Teresa; Tretter, Eric; Untereiner, Wendy A.; Urbina, Hector; Vágvölgyi, Csaba; Vialle, Agathe; Vu, Thuy Duong; Walther, Grit; Wang, Qi-Ming; Wang, Yan; Weir, Bevan S.; Weiß, Michael; White, Merlin M.; Xu, Jianping; Yahr, Rebecca; Yang, Zhu L.; Yurkov, Andrey; Zamora, Juan-Carlos; Zhang, Ning; Zhuang, Wen-Ying; Schindel, David

2012-01-01

Six DNA regions were evaluated as potential DNA barcodes for Fungi, the second largest kingdom of eukaryotic life, by a multinational, multilaboratory consortium. The region of the mitochondrial cytochrome c oxidase subunit 1 used as the animal barcode was excluded as a potential marker, because it is difficult to amplify in fungi, often includes large introns, and can be insufficiently variable. Three subunits from the nuclear ribosomal RNA cistron were compared together with regions of three representative protein-coding genes (largest subunit of RNA polymerase II, second largest subunit of RNA polymerase II, and minichromosome maintenance protein). Although the protein-coding gene regions often had a higher percent of correct identification compared with ribosomal markers, low PCR amplification and sequencing success eliminated them as candidates for a universal fungal barcode. Among the regions of the ribosomal cistron, the internal transcribed spacer (ITS) region has the highest probability of successful identification for the broadest range of fungi, with the most clearly defined barcode gap between inter- and intraspecific variation. The nuclear ribosomal large subunit, a popular phylogenetic marker in certain groups, had superior species resolution in some taxonomic groups, such as the early diverging lineages and the ascomycete yeasts, but was otherwise slightly inferior to the ITS. The nuclear ribosomal small subunit has poor species-level resolution in fungi. ITS will be formally proposed for adoption as the primary fungal barcode marker to the Consortium for the Barcode of Life, with the possibility that supplementary barcodes may be developed for particular narrowly circumscribed taxonomic groups. PMID:22454494

Vehicle autonomous localization in local area of coal mine tunnel based on vision sensors and ultrasonic sensors.

PubMed

Xu, Zirui; Yang, Wei; You, Kaiming; Li, Wei; Kim, Young-Il

2017-01-01

This paper presents a vehicle autonomous localization method in local area of coal mine tunnel based on vision sensors and ultrasonic sensors. Barcode tags are deployed in pairs on both sides of the tunnel walls at certain intervals as artificial landmarks. The barcode coding is designed based on UPC-A code. The global coordinates of the upper left inner corner point of the feature frame of each barcode tag deployed in the tunnel are uniquely represented by the barcode. Two on-board vision sensors are used to recognize each pair of barcode tags on both sides of the tunnel walls. The distance between the upper left inner corner point of the feature frame of each barcode tag and the vehicle center point can be determined by using a visual distance projection model. The on-board ultrasonic sensors are used to measure the distance from the vehicle center point to the left side of the tunnel walls. Once the spatial geometric relationship between the barcode tags and the vehicle center point is established, the 3D coordinates of the vehicle center point in the tunnel's global coordinate system can be calculated. Experiments on a straight corridor and an underground tunnel have shown that the proposed vehicle autonomous localization method is not only able to quickly recognize the barcode tags affixed to the tunnel walls, but also has relatively small average localization errors in the vehicle center point's plane and vertical coordinates to meet autonomous unmanned vehicle positioning requirements in local area of coal mine tunnel.

DNA Barcoding in the Cycadales: Testing the Potential of Proposed Barcoding Markers for Species Identification of Cycads

PubMed Central

Sass, Chodon; Little, Damon P.; Stevenson, Dennis Wm.; Specht, Chelsea D.

2007-01-01

Barcodes are short segments of DNA that can be used to uniquely identify an unknown specimen to species, particularly when diagnostic morphological features are absent. These sequences could offer a new forensic tool in plant and animal conservation—especially for endangered species such as members of the Cycadales. Ideally, barcodes could be used to positively identify illegally obtained material even in cases where diagnostic features have been purposefully removed or to release confiscated organisms into the proper breeding population. In order to be useful, a DNA barcode sequence must not only easily PCR amplify with universal or near-universal reaction conditions and primers, but also contain enough variation to generate unique identifiers at either the species or population levels. Chloroplast regions suggested by the Plant Working Group of the Consortium for the Barcode of Life (CBoL), and two alternatives, the chloroplast psbA-trnH intergenic spacer and the nuclear ribosomal internal transcribed spacer (nrITS), were tested for their utility in generating unique identifiers for members of the Cycadales. Ease of amplification and sequence generation with universal primers and reaction conditions was determined for each of the seven proposed markers. While none of the proposed markers provided unique identifiers for all species tested, nrITS showed the most promise in terms of variability, although sequencing difficulties remain a drawback. We suggest a workflow for DNA barcoding, including database generation and management, which will ultimately be necessary if we are to succeed in establishing a universal DNA barcode for plants. PMID:17987130

Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi.

PubMed

Schoch, Conrad L; Seifert, Keith A; Huhndorf, Sabine; Robert, Vincent; Spouge, John L; Levesque, C André; Chen, Wen

2012-04-17

Six DNA regions were evaluated as potential DNA barcodes for Fungi, the second largest kingdom of eukaryotic life, by a multinational, multilaboratory consortium. The region of the mitochondrial cytochrome c oxidase subunit 1 used as the animal barcode was excluded as a potential marker, because it is difficult to amplify in fungi, often includes large introns, and can be insufficiently variable. Three subunits from the nuclear ribosomal RNA cistron were compared together with regions of three representative protein-coding genes (largest subunit of RNA polymerase II, second largest subunit of RNA polymerase II, and minichromosome maintenance protein). Although the protein-coding gene regions often had a higher percent of correct identification compared with ribosomal markers, low PCR amplification and sequencing success eliminated them as candidates for a universal fungal barcode. Among the regions of the ribosomal cistron, the internal transcribed spacer (ITS) region has the highest probability of successful identification for the broadest range of fungi, with the most clearly defined barcode gap between inter- and intraspecific variation. The nuclear ribosomal large subunit, a popular phylogenetic marker in certain groups, had superior species resolution in some taxonomic groups, such as the early diverging lineages and the ascomycete yeasts, but was otherwise slightly inferior to the ITS. The nuclear ribosomal small subunit has poor species-level resolution in fungi. ITS will be formally proposed for adoption as the primary fungal barcode marker to the Consortium for the Barcode of Life, with the possibility that supplementary barcodes may be developed for particular narrowly circumscribed taxonomic groups.

DNA Barcode Identification of Podocarpaceae—The Second Largest Conifer Family

PubMed Central

Little, Damon P.; Knopf, Patrick; Schulz, Christian

2013-01-01

We have generated matK, rbcL, and nrITS2 DNA barcodes for 320 specimens representing all 18 extant genera of the conifer family Podocarpaceae. The sample includes 145 of the 198 recognized species. Comparative analyses of sequence quality and species discrimination were conducted on the 159 individuals from which all three markers were recovered (representing 15 genera and 97 species). The vast majority of sequences were of high quality (B 30 = 0.596–0.989). Even the lowest quality sequences exceeded the minimum requirements of the BARCODE data standard. In the few instances that low quality sequences were generated, the responsible mechanism could not be discerned. There were no statistically significant differences in the discriminatory power of markers or marker combinations (p = 0.05). The discriminatory power of the barcode markers individually and in combination is low (56.7% of species at maximum). In some instances, species discrimination failed in spite of ostensibly useful variation being present (genotypes were shared among species), but in many cases there was simply an absence of sequence variation. Barcode gaps (maximum intraspecific p–distance > minimum interspecific p–distance) were observed in 50.5% of species when all three markers were considered simultaneously. The presence of a barcode gap was not predictive of discrimination success (p = 0.02) and there was no statistically significant difference in the frequency of barcode gaps among markers (p = 0.05). In addition, there was no correlation between number of individuals sampled per species and the presence of a barcode gap (p = 0.27). PMID:24312258

DNA Barcoding Investigations Bring Biology to Life

ERIC Educational Resources Information Center

Musante, Susan

2010-01-01

This article describes how DNA barcoding investigations bring biology to life. Biologists recognize the power of DNA barcoding not just to teach biology through connections to the real world but also to immerse students in the exciting process of science. As an investigator in the Program for the Human Environment at Rockefeller University in New…

DNA Barcoding and PBL in an Australian Postsecondary College

ERIC Educational Resources Information Center

Cross, Joseph; Garard, Helen; Currie, Tina

2018-01-01

DNA barcoding is increasingly being introduced into biological science educational curricula worldwide. The technique has a number of features that make it ideal for science curricula and particularly for Project-Based Learning (PBL). This report outlines the development of a DNA barcoding project in an Australian TAFE college, which also combined…

Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi

USDA-ARS?s Scientific Manuscript database

Six DNA regions were evaluated in a multi-national, multi-laboratory consortium as potential DNA barcodes for Fungi, the second largest kingdom of eukaryotic life. The region of the mitochondrial cytochrome c oxidase subunit 1 used as the animal barcode was excluded as a potential marker, because it...

INTERNAL TRANSCRIBED SPACER (ITS), AN IDEAL DNA BARCODE FOR SPECIES DISCRIMINATION IN CRAWFURDIA WALL. (GENTIANACEAE).

PubMed

Zhang, Dequan; Jiang, Bei; Duan, Lizhen; Zhou, Nong

2016-01-01

DNA barcoding is a technique used to identify species based on species-specific differences in short regions of their DNA. It is widely used in species discrimination of medicinal plants and traditional medicines. In the present study, four potential DNA barcodes, namely rbcL , matK , trnH-psbA and ITS (nuclear ribosomal internal transcribed spacer) were adopted for species discrimination in Crawfurdia Wall (Genetiaceae). Identification ability of these DNA barcodes and combinations were evaluated using three classic methods (Distance, Blast and Tree-Building). As a result, ITS, trnH-psbA and rbcL regions showed great universality for a success rate of 100%; whereas matK was disappointing for which only 65% samples gained useful DNA sequences. ITS region, which could clearly and effectively identify the five species in Crawfurdia , performed very well in this study. On the contrary, trnH-psbA and rbcL performed poorly in discrimination among these species. ITS marker was an ideal DNA barcode in Crawfurdia and it should be incorporated into one of the core barcodes for seed plants.

Application of DNA barcodes in wildlife conservation in Tropical East Asia.

PubMed

Wilson, John-James; Sing, Kong-Wah; Lee, Ping-Shin; Wee, Alison K S

2016-10-01

Over the past 50 years, Tropical East Asia has lost more biodiversity than any tropical region. Tropical East Asia is a megadiverse region with an acute taxonomic impediment. DNA barcodes are short standardized DNA sequences used for taxonomic purposes and have the potential to lessen the challenges of biodiversity inventory and assessments in regions where they are most needed. We reviewed DNA barcoding efforts in Tropical East Asia relative to other tropical regions. We suggest DNA barcodes (or metabarcodes from next-generation sequencers) may be especially useful for characterizing and connecting species-level biodiversity units in inventories encompassing taxa lacking formal description (particularly arthropods) and in large-scale, minimal-impact approaches to vertebrate monitoring and population assessments through secondary sources of DNA (invertebrate derived DNA and environmental DNA). We suggest interest and capacity for DNA barcoding are slowly growing in Tropical East Asia, particularly among the younger generation of researchers who can connect with the barcoding analogy and understand the need for new approaches to the conservation challenges being faced. © 2016 Society for Conservation Biology.

Vision robot with rotational camera for searching ID tags

NASA Astrophysics Data System (ADS)

Kimura, Nobutaka; Moriya, Toshio

2008-02-01

We propose a new concept, called "real world crawling", in which intelligent mobile sensors completely recognize environments by actively gathering information in those environments and integrating that information on the basis of location. First we locate objects by widely and roughly scanning the entire environment with these mobile sensors, and we check the objects in detail by moving the sensors to find out exactly what and where they are. We focused on the automation of inventory counting with barcodes as an application of our concept. We developed "a barcode reading robot" which autonomously moved in a warehouse. It located and read barcode ID tags using a camera and a barcode reader while moving. However, motion blurs caused by the robot's translational motion made it difficult to recognize the barcodes. Because of the high computational cost of image deblurring software, we used the pan rotation of the camera to reduce these blurs. We derived the appropriate pan rotation velocity from the robot's translational velocity and from the distance to the surfaces of barcoded boxes. We verified the effectiveness of our method in an experimental test.

Services of DNA barcoding in different fields.

PubMed

Muhammad Tahir, Hafiz; Akhtar, Samreen

2016-11-01

DNA barcoding is a new master key for species identification and has greatly accelerated the pace of species discovery. In this novel and cost-effective technique, a short DNA sequence from a standard region of mitochondrial "CO1" gene called "barcode" is used. At present, researchers all over the world are utilizing this powerful tool for investigating biodiversity, differentiating cryptic species, testing food authenticity, identifying parasites, vectors, insect pests, and predators, monitoring of illegal trade of animals and their products, and identifying forensically important insects. In addition, this technique can potentially be used to monitor quality of drinking water, quickly identify the indicator species of lakes, rivers, and streams, identify species with harmful attributes or medicinal properties, monitor smuggling of endangered plants and animals and their products, and disease investigations. Despite non-favorable criticism from a few researchers, DNA barcoding has achieved immense popularity in the scientific community, especially among biologists. The present review provides an overview of DNA barcoding and its practical applications. The limitation, future prospective and main informative platforms for DNA barcoding have also been discussed.

Digital RNA sequencing minimizes sequence-dependent bias and amplification noise with optimized single-molecule barcodes

PubMed Central

Shiroguchi, Katsuyuki; Jia, Tony Z.; Sims, Peter A.; Xie, X. Sunney

2012-01-01

RNA sequencing (RNA-Seq) is a powerful tool for transcriptome profiling, but is hampered by sequence-dependent bias and inaccuracy at low copy numbers intrinsic to exponential PCR amplification. We developed a simple strategy for mitigating these complications, allowing truly digital RNA-Seq. Following reverse transcription, a large set of barcode sequences is added in excess, and nearly every cDNA molecule is uniquely labeled by random attachment of barcode sequences to both ends. After PCR, we applied paired-end deep sequencing to read the two barcodes and cDNA sequences. Rather than counting the number of reads, RNA abundance is measured based on the number of unique barcode sequences observed for a given cDNA sequence. We optimized the barcodes to be unambiguously identifiable, even in the presence of multiple sequencing errors. This method allows counting with single-copy resolution despite sequence-dependent bias and PCR-amplification noise, and is analogous to digital PCR but amendable to quantifying a whole transcriptome. We demonstrated transcriptome profiling of Escherichia coli with more accurate and reproducible quantification than conventional RNA-Seq. PMID:22232676

Increasing global participation in genetics research through DNA barcoding.

PubMed

Adamowicz, Sarah J; Steinke, Dirk

2015-12-01

DNA barcoding--the sequencing of short, standardized DNA regions for specimen identification and species discovery--has promised to facilitate rapid access to biodiversity knowledge by diverse users. Here, we advance our opinion that increased global participation in genetics research is beneficial, both to scientists and for science, and explore the premise that DNA barcoding can help to democratize participation in genetics research. We examine publication patterns (2003-2014) in the DNA barcoding literature and compare trends with those in the broader, related domain of genomics. While genomics is the older and much larger field, the number of nations contributing to the published literature is similar between disciplines. Meanwhile, DNA barcoding exhibits a higher pace of growth in the number of publications as well as greater evenness among nations in their proportional contribution to total authorships. This exploration revealed DNA barcoding to be a highly international discipline, with growing participation by researchers in especially biodiverse nations. We briefly consider several of the challenges that may hinder further participation in genetics research, including access to training and molecular facilities as well as policy relating to the movement of genetic resources.

Utility of GenBank and the Barcode of Life Data Systems (BOLD) for the identification of forensically important Diptera from Belgium and France

PubMed Central

Sonet, Gontran; Jordaens, Kurt; Braet, Yves; Bourguignon, Luc; Dupont, Eréna; Backeljau, Thierry; De Meyer, Marc; Desmyter, Stijn

2013-01-01

Abstract Fly larvae living on dead corpses can be used to estimate post-mortem intervals. The identification of these flies is decisive in forensic casework and can be facilitated by using DNA barcodes provided that a representative and comprehensive reference library of DNA barcodes is available. We constructed a local (Belgium and France) reference library of 85 sequences of the COI DNA barcode fragment (mitochondrial cytochrome c oxidase subunit I gene), from 16 fly species of forensic interest (Calliphoridae, Muscidae, Fanniidae). This library was then used to evaluate the ability of two public libraries (GenBank and the Barcode of Life Data Systems – BOLD) to identify specimens from Belgian and French forensic cases. The public libraries indeed allow a correct identification of most specimens. Yet, some of the identifications remain ambiguous and some forensically important fly species are not, or insufficiently, represented in the reference libraries. Several search options offered by GenBank and BOLD can be used to further improve the identifications obtained from both libraries using DNA barcodes. PMID:24453564

FISH-BOL and seafood identification: geographically dispersed case studies reveal systemic market substitution across Canada.

PubMed

Hanner, Robert; Becker, Sven; Ivanova, Natalia V; Steinke, Dirk

2011-10-01

The Fish Barcode of Life campaign involves a broad international collaboration among scientists working to advance the identification of fishes using DNA barcodes. With over 25% of the world's known ichthyofauna currently profiled, forensic identification of seafood products is now feasible and is becoming routine. Driven by growing consumer interest in the food supply, investigative reporters from five different media establishments procured seafood samples (n = 254) from numerous retail establishments located among five Canadian metropolitan areas between 2008 and 2010. The specimens were sent to the Canadian Centre for DNA Barcoding for analysis. By integrating the results from these individual case studies in a summary analysis, we provide a broad perspective on seafood substitution across Canada. Barcodes were recovered from 93% of the samples (n = 236), and identified using the Barcode of Life Data Systems "species identification" engine ( www.barcodinglife.org ). A 99% sequence similarity threshold was employed as a conservative matching criterion for specimen identification to the species level. Comparing these results against the Canadian Food Inspection Agency's "Fish List" a guideline to interpreting "false, misleading or deceptive" names (as per s 27 of the Fish Inspection regulations) demonstrated that 41% of the samples were mislabeled. Most samples were readily identified; however, this was not true in all cases because some samples had no close match. Others were ambiguous due to limited barcode resolution (or imperfect taxonomy) observed within a few closely related species complexes. The latter cases did not significantly impact the results because even the partial resolution achieved was sufficient to demonstrate mislabeling. This work highlights the functional utility of barcoding for the identification of diverse market samples. It also demonstrates how barcoding serves as a bridge linking scientific nomenclature with approved market names, potentially empowering regulatory bodies to enforce labeling standards. By synchronizing taxonomic effort with sequencing effort and database curation, barcoding provides a molecular identification resource of service to applied forensics.

First large-scale DNA barcoding assessment of reptiles in the biodiversity hotspot of Madagascar, based on newly designed COI primers.

PubMed

Nagy, Zoltán T; Sonet, Gontran; Glaw, Frank; Vences, Miguel

2012-01-01

DNA barcoding of non-avian reptiles based on the cytochrome oxidase subunit I (COI) gene is still in a very early stage, mainly due to technical problems. Using a newly developed set of reptile-specific primers for COI we present the first comprehensive study targeting the entire reptile fauna of the fourth-largest island in the world, the biodiversity hotspot of Madagascar. Representatives of the majority of Madagascan non-avian reptile species (including Squamata and Testudines) were sampled and successfully DNA barcoded. The new primer pair achieved a constantly high success rate (72.7-100%) for most squamates. More than 250 species of reptiles (out of the 393 described ones; representing around 64% of the known diversity of species) were barcoded. The average interspecific genetic distance within families ranged from a low of 13.4% in the Boidae to a high of 29.8% in the Gekkonidae. Using the average genetic divergence between sister species as a threshold, 41-48 new candidate (undescribed) species were identified. Simulations were used to evaluate the performance of DNA barcoding as a function of completeness of taxon sampling and fragment length. Compared with available multi-gene phylogenies, DNA barcoding correctly assigned most samples to species, genus and family with high confidence and the analysis of fewer taxa resulted in an increased number of well supported lineages. Shorter marker-lengths generally decreased the number of well supported nodes, but even mini-barcodes of 100 bp correctly assigned many samples to genus and family. The new protocols might help to promote DNA barcoding of reptiles and the established library of reference DNA barcodes will facilitate the molecular identification of Madagascan reptiles. Our results might be useful to easily recognize undescribed diversity (i.e. novel taxa), to resolve taxonomic problems, and to monitor the international pet trade without specialized expert knowledge.

First Large-Scale DNA Barcoding Assessment of Reptiles in the Biodiversity Hotspot of Madagascar, Based on Newly Designed COI Primers

PubMed Central

Nagy, Zoltán T.; Sonet, Gontran; Glaw, Frank; Vences, Miguel

2012-01-01

Background DNA barcoding of non-avian reptiles based on the cytochrome oxidase subunit I (COI) gene is still in a very early stage, mainly due to technical problems. Using a newly developed set of reptile-specific primers for COI we present the first comprehensive study targeting the entire reptile fauna of the fourth-largest island in the world, the biodiversity hotspot of Madagascar. Methodology/Principal Findings Representatives of the majority of Madagascan non-avian reptile species (including Squamata and Testudines) were sampled and successfully DNA barcoded. The new primer pair achieved a constantly high success rate (72.7–100%) for most squamates. More than 250 species of reptiles (out of the 393 described ones; representing around 64% of the known diversity of species) were barcoded. The average interspecific genetic distance within families ranged from a low of 13.4% in the Boidae to a high of 29.8% in the Gekkonidae. Using the average genetic divergence between sister species as a threshold, 41–48 new candidate (undescribed) species were identified. Simulations were used to evaluate the performance of DNA barcoding as a function of completeness of taxon sampling and fragment length. Compared with available multi-gene phylogenies, DNA barcoding correctly assigned most samples to species, genus and family with high confidence and the analysis of fewer taxa resulted in an increased number of well supported lineages. Shorter marker-lengths generally decreased the number of well supported nodes, but even mini-barcodes of 100 bp correctly assigned many samples to genus and family. Conclusions/Significance The new protocols might help to promote DNA barcoding of reptiles and the established library of reference DNA barcodes will facilitate the molecular identification of Madagascan reptiles. Our results might be useful to easily recognize undescribed diversity (i.e. novel taxa), to resolve taxonomic problems, and to monitor the international pet trade without specialized expert knowledge. PMID:22479636

Molecular Authentication of the Traditional Medicinal Plant "Lakshman Booti" (Smithia conferta Sm.) and Its Adulterants through DNA Barcoding.

PubMed

Umdale, Suraj D; Kshirsagar, Parthraj R; Lekhak, Manoj M; Gaikwad, Nikhil B

2017-07-01

Smithia conferta Sm. is an annual herb widely used in Indian traditional medical practice and commonly known as "Lakshman booti" in Sanskrit. Morphological resemblance among the species of genus Smithia Aiton . leads to inaccurate identification and adulteration. This causes inconsistent therapeutic effects and also affects the quality of herbal medicine. This study aimed to generate potential barcode for authentication of S. conferta and its adulterants through DNA barcoding technique. Genomic DNA extracted from S. conferta and its adulterants was used as templates for polymerase chain reaction amplification of the barcoding regions. The amplicons were directed for sequencing, and species identification was conducted using BLASTn and unweighted pair-group method with arithmetic mean trees. In addition, the secondary structures of internal transcribed spacer (ITS) 2 region were predicted. The nucleotide sequence of ITS provides species-specific single nucleotide polymorphisms and sequence divergence (22%) than psb A- trn H (10.9%) and rbc L (3.1%) sequences. The ITS barcode indicates that S. conferta and Smithia sensitiva are closely related compared to other species. ITS is the most applicable barcode for molecular authentication of S. conferta , and further chloroplast barcodes should be tested for phylogenetic analysis of genus Smithia. The present investigation is the first effort of utilization of DNA barcode for molecular authentication of S. conferta and its adulterants. Also, this study expanded the application of the ITS2 sequence data in the authentication. The ITS has been proved as a potential and reliable candidate barcode for the authentication of S. conferta . Abbreviations used: BLASTn: Basic Local Alignment Search Tool for Nucleotide; MEGA: Molecular Evolutionary Genetic Analysis; EMBL: European Molecular Biology Laboratory; psb A- trn H: Photosystem II protein D1- stuctural RNA: His tRNA gene; rbcL: Ribulose 1,5 bi-phosphate carboxylase/oxygenase large subunit gene.

Barcoding and Border Biosecurity: Identifying Cyprinid Fishes in the Aquarium Trade

PubMed Central

Collins, Rupert A.; Armstrong, Karen F.; Meier, Rudolf; Yi, Youguang; Brown, Samuel D. J.; Cruickshank, Robert H.; Keeling, Suzanne; Johnston, Colin

2012-01-01

Background Poorly regulated international trade in ornamental fishes poses risks to both biodiversity and economic activity via invasive alien species and exotic pathogens. Border security officials need robust tools to confirm identifications, often requiring hard-to-obtain taxonomic literature and expertise. DNA barcoding offers a potentially attractive tool for quarantine inspection, but has yet to be scrutinised for aquarium fishes. Here, we present a barcoding approach for ornamental cyprinid fishes by: (1) expanding current barcode reference libraries; (2) assessing barcode congruence with morphological identifications under numerous scenarios (e.g. inclusion of GenBank data, presence of singleton species, choice of analytical method); and (3) providing supplementary information to identify difficult species. Methodology/Principal Findings We sampled 172 ornamental cyprinid fish species from the international trade, and provide data for 91 species currently unrepresented in reference libraries (GenBank/Bold). DNA barcodes were found to be highly congruent with our morphological assignments, achieving success rates of 90–99%, depending on the method used (neighbour-joining monophyly, bootstrap, nearest neighbour, GMYC, percent threshold). Inclusion of data from GenBank (additional 157 spp.) resulted in a more comprehensive library, but at a cost to success rate due to the increased number of singleton species. In addition to DNA barcodes, our study also provides supporting data in the form of specimen images, morphological characters, taxonomic bibliography, preserved vouchers, and nuclear rhodopsin sequences. Using this nuclear rhodopsin data we also uncovered evidence of interspecific hybridisation, and highlighted unrecognised diversity within popular aquarium species, including the endangered Indian barb Puntius denisonii. Conclusions/Significance We demonstrate that DNA barcoding provides a highly effective biosecurity tool for rapidly identifying ornamental fishes. In cases where DNA barcodes are unable to offer an identification, we improve on previous studies by consolidating supplementary information from multiple data sources, and empower biosecurity agencies to confidently identify high-risk fishes in the aquarium trade. PMID:22276096

rbcL and matK Earn Two Thumbs Up as the Core DNA Barcode for Ferns

PubMed Central

Li, Fay-Wei; Kuo, Li-Yaung; Rothfels, Carl J.; Ebihara, Atsushi; Chiou, Wen-Liang; Windham, Michael D.; Pryer, Kathleen M.

2011-01-01

Background DNA barcoding will revolutionize our understanding of fern ecology, most especially because the accurate identification of the independent but cryptic gametophyte phase of the fern's life history—an endeavor previously impossible—will finally be feasible. In this study, we assess the discriminatory power of the core plant DNA barcode (rbcL and matK), as well as alternatively proposed fern barcodes (trnH-psbA and trnL-F), across all major fern lineages. We also present plastid barcode data for two genera in the hyperdiverse polypod clade—Deparia (Woodsiaceae) and the Cheilanthes marginata group (currently being segregated as a new genus of Pteridaceae)—to further evaluate the resolving power of these loci. Principal Findings Our results clearly demonstrate the value of matK data, previously unavailable in ferns because of difficulties in amplification due to a major rearrangement of the plastid genome. With its high sequence variation, matK complements rbcL to provide a two-locus barcode with strong resolving power. With sequence variation comparable to matK, trnL-F appears to be a suitable alternative barcode region in ferns, and perhaps should be added to the core barcode region if universal primer development for matK fails. In contrast, trnH-psbA shows dramatically reduced sequence variation for the majority of ferns. This is likely due to the translocation of this segment of the plastid genome into the inverted repeat regions, which are known to have a highly constrained substitution rate. Conclusions Our study provides the first endorsement of the two-locus barcode (rbcL+matK) in ferns, and favors trnL-F over trnH-psbA as a potential back-up locus. Future work should focus on gathering more fern matK sequence data to facilitate universal primer development. PMID:22028918

Identification of Fabaceae plants using the DNA barcode matK.

PubMed

Gao, Ting; Sun, Zhiying; Yao, Hui; Song, Jingyuan; Zhu, Yingjie; Ma, Xinye; Chen, Shilin

2011-01-01

In this study, we tested the applicability of the core DNA barcode MATK for identifying species within the Fabaceae family. Based on an evaluation of genetic variation, DNA barcoding gaps, and species discrimination power, MATK is a useful barcode for Fabaceae species. Of 1355 plant samples collected from 1079 species belonging to 409 diverse genera, MATK precisely identified approximately 80 % and 96 % of them at the species and genus levels, respectively. Therefore, our research indicates that the MATK region is a valuable marker for plant species within Fabaceae. © Georg Thieme Verlag KG Stuttgart · New York.

DNA Barcoding Reveals Cryptic Diversity within Commercially Exploited Indo-Malay Carangidae (Teleosteii: Perciformes)

PubMed Central

Mat Jaafar, Tun Nurul Aimi; Taylor, Martin I.; Mohd Nor, Siti Azizah; de Bruyn, Mark; Carvalho, Gary R.

2012-01-01

Background DNA barcodes, typically focusing on the cytochrome oxidase I gene (COI) in many animals, have been used widely as a species-identification tool. The ability of DNA barcoding to distinguish species from a range of taxa and to reveal cryptic species has been well documented. Despite the wealth of DNA barcode data for fish from many temperate regions, there are relatively few available from the Southeast Asian region. Here, we target the marine fish Family Carangidae, one of the most commercially-important families from the Indo-Malay Archipelago (IMA), to produce an initial reference DNA barcode library. Methodology/Principal Findings Here, a 652 bp region of COI was sequenced for 723 individuals from 36 putative species of Family Carangidae distributed within IMA waters. Within the newly-generated dataset, three described species exhibited conspecific divergences up to ten times greater (4.32–4.82%) than mean estimates (0.24–0.39%), indicating a discrepancy with assigned morphological taxonomic identification, and the existence of cryptic species. Variability of the mitochondrial DNA COI region was compared within and among species to evaluate the COI region's suitability for species identification. The trend in range of mean K2P distances observed was generally in accordance with expectations based on taxonomic hierarchy: 0% to 4.82% between individuals within species, 0% to 16.4% between species within genera, and 8.64% to 25.39% between genera within families. The average Kimura 2-parameter (K2P) distance between individuals, between species within genera, and between genera within family were 0.37%, 10.53% and 16.56%, respectively. All described species formed monophyletic clusters in the Neighbour-joining phylogenetic tree, although three species representing complexes of six potential cryptic species were detected in Indo-Malay Carangidae; Atule mate, Selar crumenophthalmus and Seriolina nigrofasciata. Conclusion/Significance This study confirms that COI is an effective tool for species identification of Carangidae from the IMA. There were moderate levels of cryptic diversity among putative species within the central IMA. However, to explain the hypothesis of species richness in the IMA, it is necessary to sample the whole family across their broad geographic range. Such insights are helpful not only to document mechanisms driving diversification and recruitment in Carangidae, but also to provide a scientific framework for management strategies and conservation of commercially-important fisheries resources. PMID:23209586

DNA Barcoding the Geometrid Fauna of Bavaria (Lepidoptera): Successes, Surprises, and Questions

PubMed Central

Hausmann, Axel; Haszprunar, Gerhard; Hebert, Paul D. N.

2011-01-01

Background The State of Bavaria is involved in a research program that will lead to the construction of a DNA barcode library for all animal species within its territorial boundaries. The present study provides a comprehensive DNA barcode library for the Geometridae, one of the most diverse of insect families. Methodology/Principal Findings This study reports DNA barcodes for 400 Bavarian geometrid species, 98 per cent of the known fauna, and approximately one per cent of all Bavarian animal species. Although 98.5% of these species possess diagnostic barcode sequences in Bavaria, records from neighbouring countries suggest that species-level resolution may be compromised in up to 3.5% of cases. All taxa which apparently share barcodes are discussed in detail. One case of modest divergence (1.4%) revealed a species overlooked by the current taxonomic system: Eupithecia goossensiata Mabille, 1869 stat.n. is raised from synonymy with Eupithecia absinthiata (Clerck, 1759) to species rank. Deep intraspecific sequence divergences (>2%) were detected in 20 traditionally recognized species. Conclusions/Significance The study emphasizes the effectiveness of DNA barcoding as a tool for monitoring biodiversity. Open access is provided to a data set that includes records for 1,395 geometrid specimens (331 species) from Bavaria, with 69 additional species from neighbouring regions. Taxa with deep intraspecific sequence divergences are undergoing more detailed analysis to ascertain if they represent cases of cryptic diversity. PMID:21423340

An integrated passive micromixer-magnetic separation-capillary electrophoresis microdevice for rapid and multiplex pathogen detection at the single-cell level.

PubMed

Jung, Jae Hwan; Kim, Gha-Young; Seo, Tae Seok

2011-10-21

Here we report an integrated microdevice consisting of an efficient passive mixer, a magnetic separation chamber, and a capillary electrophoretic microchannel in which DNA barcode assay, target pathogen separation, and barcode DNA capillary electrophoretic analysis were performed sequentially within 30 min for multiplex pathogen detection at the single-cell level. The intestine-shaped serpentine 3D micromixer provides a high mixing rate to generate magnetic particle-pathogenic bacteria-DNA barcode labelled AuNP complexes quantitatively. After magnetic separation and purification of those complexes, the barcode DNA strands were released and analyzed by the microfluidic capillary electrophoresis within 5 min. The size of the barcode DNA strand was controlled depending on the target bacteria (Staphylococcus aureus, Escherichia coli O157:H7, and Salmonella typhimurium), and the different elution time of the barcode DNA peak in the electropherogram allows us to recognize the target pathogen with ease in the monoplex as well as in the multiplex analysis. In addition, the quantity of the DNA barcode strand (∼10(4)) per AuNP is enough to be observed in the laser-induced confocal fluorescence detector, thereby making single-cell analysis possible. This novel integrated microdevice enables us to perform rapid, sensitive, and multiplex pathogen detection with sample-in-answer-out capability to be applied for biosafety testing, environmental screening, and clinical trials.

Barcoding Fauna Bavarica: 78% of the Neuropterida Fauna Barcoded!

PubMed Central

Morinière, Jérome; Hendrich, Lars; Hausmann, Axel; Hebert, Paul; Haszprunar, Gerhard; Gruppe, Axel

2014-01-01

This publication provides the first comprehensive DNA barcode data set for the Neuropterida of Central Europe, including 80 of the 102 species (78%) recorded from Bavaria (Germany) and three other species from nearby regions (Austria, France and the UK). Although the 286 specimens analyzed had a heterogeneous conservation history (60% dried; 30% in 80% EtOH; 10% fresh specimens in 95% EtOH), 237 (83%) generated a DNA barcode. Eleven species (13%) shared a BIN, but three of these taxa could be discriminated through barcodes. Four pairs of closely allied species shared barcodes including Chrysoperla pallida Henry et al., 2002 and C. lucasina Lacroix, 1912; Wesmaelius concinnus (Stephens, 1836) and W. quadrifasciatus (Reuter, 1894); Hemerobius handschini Tjeder, 1957 and H. nitidulus Fabricius, 1777; and H. atrifrons McLachlan, 1868 and H. contumax Tjeder, 1932. Further studies are needed to test the possible synonymy of these species pairs or to determine if other genetic markers permit their discrimination. Our data highlight five cases of potential cryptic diversity within Bavarian Neuropterida: Nineta flava (Scopoli, 1763), Sympherobius pygmaeus (Rambur, 1842), Sisyra nigra (Retzius, 1783), Semidalis aleyrodiformis (Stephens, 1836) and Coniopteryx pygmaea Enderlein, 1906 are each split into two or three BINs. The present DNA barcode library not only allows the identification of adult and larval stages, but also provides valuable information for alpha-taxonomy, and for ecological and evolutionary research. PMID:25286434

DNA barcoding for conservation, seed banking and ecological restoration of Acacia in the Midwest of Western Australia.

PubMed

Nevill, Paul G; Wallace, Mark J; Miller, Joseph T; Krauss, Siegfried L

2013-11-01

We used DNA barcoding to address an important conservation issue in the Midwest of Western Australia, working on Australia's largest genus of flowering plant. We tested whether or not currently recommended plant DNA barcoding regions (matK and rbcL) were able to discriminate Acacia taxa of varying phylogenetic distances, and ultimately identify an ambiguously labelled seed collection from a mine-site restoration project. Although matK successfully identified the unknown seed as the rare and conservation priority listed A. karina, and was able to resolve six of the eleven study species, this region was difficult to amplify and sequence. In contrast, rbcL was straightforward to recover and align, but could not determine the origin of the seed and only resolved 3 of the 11 species. Other chloroplast regions (rpl32-trnL, psbA-trnH, trnL-F and trnK) had mixed success resolving the studied taxa. In general, species were better resolved in multilocus data sets compared to single-locus data sets. We recommend using the formal barcoding regions supplemented with data from other plastid regions, particularly rpl32-trnL, for barcoding in Acacia. Our study demonstrates the novel use of DNA barcoding for seed identification and illustrates the practical potential of DNA barcoding for the growing discipline of restoration ecology. © 2013 John Wiley & Sons Ltd.

Applications of three DNA barcodes in assorting intertidal red macroalgal flora in Qingdao, China

NASA Astrophysics Data System (ADS)

Zhao, Xiaobo; Pang, Shaojun; Shan, Tifeng; Liu, Feng

2013-03-01

This study is part of the endeavor to construct a comprehensive DNA barcoding database for common seaweeds in China. Identifications of red seaweeds, which have simple morphology and anatomy, are sometimes difficult solely depending on morphological characteristics. In recent years, DNA barcode technique has become a more and more effective tool to help solve some of the taxonomic difficulties. Some DNA markers such as COI (cytochrome oxidase subunit I) are proposed as standardized DNA barcodes for all seaweed species. In this study, COI, UPA (universal plastid amplicon, domain V of 23S rRNA), and ITS (nuclear internal transcribed spacer) were employed to analyze common species of intertidal red seaweeds in Qingdao (119.3°-121°E, 35.35°-37.09°N). The applicability of using one or a few combined barcodes to identify red seaweed species was tested. The results indicated that COI is a sensitive marker at species level. However, not all the tested species gave PCR amplification products due to lack of the universal primers. The second barcode UPA had effective universal primers but needed to be tested for the effectiveness of resolving closely related species. More than one ITS sequence types were found in some species in this investigation, which might lead to confusion in further analysis. Therefore ITS sequence is not recommended as a universal barcode for seaweeds identification.

Improving Warehouse Inventory Management Through Rfid, Barcoding and Robotics Technologies

DTIC Science & Technology

2014-12-01

as a spider merge. This was designed and installed to speed up the conveyors . In their original design , conveyors traveled throughout the warehouse...lifts LCL lower confidence level xiv MRO material release order NPV net present value PMT positive material transfer POM Program Objective...depots. Active Radio Frequency Identification (aRFID ) Migration A program designed to move the active RFID enterprise from a proprietarily air interface

Functional annotation of rare gene aberration drivers of pancreatic cancer | Office of Cancer Genomics

Cancer.gov

As we enter the era of precision medicine, characterization of cancer genomes will directly influence therapeutic decisions in the clinic. Here we describe a platform enabling functionalization of rare gene mutations through their high-throughput construction, molecular barcoding and delivery to cancer models for in vivo tumour driver screens. We apply these technologies to identify oncogenic drivers of pancreatic ductal adenocarcinoma (PDAC).

Integrated Microfluidic Lectin Barcode Platform for High-Performance Focused Glycomic Profiling

NASA Astrophysics Data System (ADS)

Shang, Yuqin; Zeng, Yun; Zeng, Yong

2016-02-01

Protein glycosylation is one of the key processes that play essential roles in biological functions and dysfunctions. However, progress in glycomics has considerably lagged behind genomics and proteomics, due in part to the enormous challenges in analysis of glycans. Here we present a new integrated and automated microfluidic lectin barcode platform to substantially improve the performance of lectin array for focused glycomic profiling. The chip design and flow control were optimized to promote the lectin-glycan binding kinetics and speed of lectin microarray. Moreover, we established an on-chip lectin assay which employs a very simple blocking method to effectively suppress the undesired background due to lectin binding of antibodies. Using this technology, we demonstrated focused differential profiling of tissue-specific glycosylation changes of a biomarker, CA125 protein purified from ovarian cancer cell line and different tissues from ovarian cancer patients in a fast, reproducible, and high-throughput fashion. Highly sensitive CA125 detection was also demonstrated with a detection limit much lower than the clinical cutoff value for cancer diagnosis. This microfluidic platform holds the potential to integrate with sample preparation functions to construct a fully integrated “sample-to-answer” microsystem for focused differential glycomic analysis. Thus, our technology should present a powerful tool in support of rapid advance in glycobiology and glyco-biomarker development.

Integrated Microfluidic Lectin Barcode Platform for High-Performance Focused Glycomic Profiling

PubMed Central

Shang, Yuqin; Zeng, Yun; Zeng, Yong

2016-01-01

Protein glycosylation is one of the key processes that play essential roles in biological functions and dysfunctions. However, progress in glycomics has considerably lagged behind genomics and proteomics, due in part to the enormous challenges in analysis of glycans. Here we present a new integrated and automated microfluidic lectin barcode platform to substantially improve the performance of lectin array for focused glycomic profiling. The chip design and flow control were optimized to promote the lectin-glycan binding kinetics and speed of lectin microarray. Moreover, we established an on-chip lectin assay which employs a very simple blocking method to effectively suppress the undesired background due to lectin binding of antibodies. Using this technology, we demonstrated focused differential profiling of tissue-specific glycosylation changes of a biomarker, CA125 protein purified from ovarian cancer cell line and different tissues from ovarian cancer patients in a fast, reproducible, and high-throughput fashion. Highly sensitive CA125 detection was also demonstrated with a detection limit much lower than the clinical cutoff value for cancer diagnosis. This microfluidic platform holds the potential to integrate with sample preparation functions to construct a fully integrated “sample-to-answer” microsystem for focused differential glycomic analysis. Thus, our technology should present a powerful tool in support of rapid advance in glycobiology and glyco-biomarker development. PMID:26831207

Innovative IT system for material management in warehouses

NASA Astrophysics Data System (ADS)

Papoutsidakis, Michael; Sigala, Maria; Simeonaki, Eleni; Tseles, Dimitrios

2017-09-01

Nowadays through the rapid development of technology in all areas there is a constant effort to introduce technological solutions in everyday life with emphasis on materials management information systems (Enterprise Resource Planning). During the last few years the variety of these systems has been increased for small business or for SMEs as well as for larger companies and industries. In the field of material management and main management operations with automated processes, ERP applications have only recently begun to make their appearance. In this paper will be presented the development of a system for automated material storage process in a system built through specific roles that will manage materials using an integrated barcode scanner. In addition we will analyse and describe the operation and modules of other systems that have been created for the same usage. The aim of this project is to create a prototype application that will be innovative with a flexible nature that will give solutions, with low cost and it will be user friendly. This application will allow quick and proper materials management for storage. The expected result is that the application can be used by smart devices in android environment and computers without an external barcode scanner, making the application accessible to the buyer at low cost.

An Integrated Quantum Dot Barcode Smartphone Optical Device for Wireless Multiplexed Diagnosis of Infected Patients

NASA Astrophysics Data System (ADS)

Ming, Kevin

Integrating mobile-cellular devices with multiplex molecular diagnostics can potentially provide the most powerful platform for tracking, managing and preventing the transmission of infectious diseases. With over 6.9 billion subscriptions globally, handheld mobile-cellular devices can be programmed to spatially map, temporally track, and transmit information on infections over wide geographical space and boundaries. Current cell phone diagnostic technologies have poor limit of detection, dynamic range, and cannot detect multiple pathogen targets simultaneously, limiting their utility to single infections with high load. Here we combined recent advances in quantum dot barcode technology for molecular detection with smartphones to engineer a simple and low-cost chip-based wireless multiplex diagnostic device. We validated our device using a variety of synthetic genomic targets for the respiratory virus and blood-borne pathogens, and demonstrated that it could detect clinical samples after simple amplification. More importantly, we confirmed that the device is capable of detecting patients infected with a single or multiple infectious pathogens (e.g., HIV and hepatitis B) in a single test. This device advances the capacity for global surveillance of infectious diseases and has the potential to accelerate knowledge exchange-transfer of emerging or exigent disease threats with healthcare and military organizations in real-time.

Integrating Mobile Multimedia into Textbooks: 2D Barcodes

ERIC Educational Resources Information Center

Uluyol, Celebi; Agca, R. Kagan

2012-01-01

The major goal of this study was to empirically compare text-plus-mobile phone learning using an integrated 2D barcode tag in a printed text with three other conditions described in multimedia learning theory. The method examined in the study involved modifications of the instructional material such that: a 2D barcode was used near the text, the…

Development of a single nucleotide polymorphism barcode to genotype Plasmodium vivax infections.

PubMed

Baniecki, Mary Lynn; Faust, Aubrey L; Schaffner, Stephen F; Park, Daniel J; Galinsky, Kevin; Daniels, Rachel F; Hamilton, Elizabeth; Ferreira, Marcelo U; Karunaweera, Nadira D; Serre, David; Zimmerman, Peter A; Sá, Juliana M; Wellems, Thomas E; Musset, Lise; Legrand, Eric; Melnikov, Alexandre; Neafsey, Daniel E; Volkman, Sarah K; Wirth, Dyann F; Sabeti, Pardis C

2015-03-01

Plasmodium vivax, one of the five species of Plasmodium parasites that cause human malaria, is responsible for 25-40% of malaria cases worldwide. Malaria global elimination efforts will benefit from accurate and effective genotyping tools that will provide insight into the population genetics and diversity of this parasite. The recent sequencing of P. vivax isolates from South America, Africa, and Asia presents a new opportunity by uncovering thousands of novel single nucleotide polymorphisms (SNPs). Genotyping a selection of these SNPs provides a robust, low-cost method of identifying parasite infections through their unique genetic signature or barcode. Based on our experience in generating a SNP barcode for P. falciparum using High Resolution Melting (HRM), we have developed a similar tool for P. vivax. We selected globally polymorphic SNPs from available P. vivax genome sequence data that were located in putatively selectively neutral sites (i.e., intergenic, intronic, or 4-fold degenerate coding). From these candidate SNPs we defined a barcode consisting of 42 SNPs. We analyzed the performance of the 42-SNP barcode on 87 P. vivax clinical samples from parasite populations in South America (Brazil, French Guiana), Africa (Ethiopia) and Asia (Sri Lanka). We found that the P. vivax barcode is robust, as it requires only a small quantity of DNA (limit of detection 0.3 ng/μl) to yield reproducible genotype calls, and detects polymorphic genotypes with high sensitivity. The markers are informative across all clinical samples evaluated (average minor allele frequency > 0.1). Population genetic and statistical analyses show the barcode captures high degrees of population diversity and differentiates geographically distinct populations. Our 42-SNP barcode provides a robust, informative, and standardized genetic marker set that accurately identifies a genomic signature for P. vivax infections.

Development of a Single Nucleotide Polymorphism Barcode to Genotype Plasmodium vivax Infections

PubMed Central

Baniecki, Mary Lynn; Faust, Aubrey L.; Schaffner, Stephen F.; Park, Daniel J.; Galinsky, Kevin; Daniels, Rachel F.; Hamilton, Elizabeth; Ferreira, Marcelo U.; Karunaweera, Nadira D.; Serre, David; Zimmerman, Peter A.; Sá, Juliana M.; Wellems, Thomas E.; Musset, Lise; Legrand, Eric; Melnikov, Alexandre; Neafsey, Daniel E.; Volkman, Sarah K.; Wirth, Dyann F.; Sabeti, Pardis C.

2015-01-01

Plasmodium vivax, one of the five species of Plasmodium parasites that cause human malaria, is responsible for 25–40% of malaria cases worldwide. Malaria global elimination efforts will benefit from accurate and effective genotyping tools that will provide insight into the population genetics and diversity of this parasite. The recent sequencing of P. vivax isolates from South America, Africa, and Asia presents a new opportunity by uncovering thousands of novel single nucleotide polymorphisms (SNPs). Genotyping a selection of these SNPs provides a robust, low-cost method of identifying parasite infections through their unique genetic signature or barcode. Based on our experience in generating a SNP barcode for P. falciparum using High Resolution Melting (HRM), we have developed a similar tool for P. vivax. We selected globally polymorphic SNPs from available P. vivax genome sequence data that were located in putatively selectively neutral sites (i.e., intergenic, intronic, or 4-fold degenerate coding). From these candidate SNPs we defined a barcode consisting of 42 SNPs. We analyzed the performance of the 42-SNP barcode on 87 P. vivax clinical samples from parasite populations in South America (Brazil, French Guiana), Africa (Ethiopia) and Asia (Sri Lanka). We found that the P. vivax barcode is robust, as it requires only a small quantity of DNA (limit of detection 0.3 ng/μl) to yield reproducible genotype calls, and detects polymorphic genotypes with high sensitivity. The markers are informative across all clinical samples evaluated (average minor allele frequency > 0.1). Population genetic and statistical analyses show the barcode captures high degrees of population diversity and differentiates geographically distinct populations. Our 42-SNP barcode provides a robust, informative, and standardized genetic marker set that accurately identifies a genomic signature for P. vivax infections. PMID:25781890

Environmental Barcoding: A Next-Generation Sequencing Approach for Biomonitoring Applications Using River Benthos

PubMed Central

Hajibabaei, Mehrdad; Shokralla, Shadi; Zhou, Xin; Singer, Gregory A. C.; Baird, Donald J.

2011-01-01

Timely and accurate biodiversity analysis poses an ongoing challenge for the success of biomonitoring programs. Morphology-based identification of bioindicator taxa is time consuming, and rarely supports species-level resolution especially for immature life stages. Much work has been done in the past decade to develop alternative approaches for biodiversity analysis using DNA sequence-based approaches such as molecular phylogenetics and DNA barcoding. On-going assembly of DNA barcode reference libraries will provide the basis for a DNA-based identification system. The use of recently introduced next-generation sequencing (NGS) approaches in biodiversity science has the potential to further extend the application of DNA information for routine biomonitoring applications to an unprecedented scale. Here we demonstrate the feasibility of using 454 massively parallel pyrosequencing for species-level analysis of freshwater benthic macroinvertebrate taxa commonly used for biomonitoring. We designed our experiments in order to directly compare morphology-based, Sanger sequencing DNA barcoding, and next-generation environmental barcoding approaches. Our results show the ability of 454 pyrosequencing of mini-barcodes to accurately identify all species with more than 1% abundance in the pooled mixture. Although the approach failed to identify 6 rare species in the mixture, the presence of sequences from 9 species that were not represented by individuals in the mixture provides evidence that DNA based analysis may yet provide a valuable approach in finding rare species in bulk environmental samples. We further demonstrate the application of the environmental barcoding approach by comparing benthic macroinvertebrates from an urban region to those obtained from a conservation area. Although considerable effort will be required to robustly optimize NGS tools to identify species from bulk environmental samples, our results indicate the potential of an environmental barcoding approach for biomonitoring programs. PMID:21533287

Beyond the Colours: Discovering Hidden Diversity in the Nymphalidae of the Yucatan Peninsula in Mexico through DNA Barcoding

PubMed Central

Prado, Blanca R.; Pozo, Carmen; Valdez-Moreno, Martha; Hebert, Paul D. N.

2011-01-01

Background Recent studies have demonstrated the utility of DNA barcoding in the discovery of overlooked species and in the connection of immature and adult stages. In this study, we use DNA barcoding to examine diversity patterns in 121 species of Nymphalidae from the Yucatan Peninsula in Mexico. Our results suggest the presence of cryptic species in 8 of these 121 taxa. As well, the reference database derived from the analysis of adult specimens allowed the identification of nymphalid caterpillars providing new details on host plant use. Methodology/Principal Findings We gathered DNA barcode sequences from 857 adult Nymphalidae representing 121 different species. This total includes four species (Adelpha iphiclus, Adelpha malea, Hamadryas iphtime and Taygetis laches) that were initially overlooked because of their close morphological similarity to other species. The barcode results showed that each of the 121 species possessed a diagnostic array of barcode sequences. In addition, there was evidence of cryptic taxa; seven species included two barcode clusters showing more than 2% sequence divergence while one species included three clusters. All 71 nymphalid caterpillars were identified to a species level by their sequence congruence to adult sequences. These caterpillars represented 16 species, and included Hamadryas julitta, an endemic species from the Yucatan Peninsula whose larval stages and host plant (Dalechampia schottii, also endemic to the Yucatan Peninsula) were previously unknown. Conclusions/Significance This investigation has revealed overlooked species in a well-studied museum collection of nymphalid butterflies and suggests that there is a substantial incidence of cryptic species that await full characterization. The utility of barcoding in the rapid identification of caterpillars also promises to accelerate the assembly of information on life histories, a particularly important advance for hyperdiverse tropical insect assemblages. PMID:22132140

Evaluation of single and multilocus DNA barcodes towards species delineation in complex tree genus Terminalia

PubMed Central

Mishra, Priyanka; Kumar, Amit; Nagireddy, Akshitha; Shukla, Ashutosh K.

2017-01-01

DNA barcoding is used as a universal tool for delimiting species boundaries in taxonomically challenging groups, with different plastid and nuclear regions (rbcL, matK, ITS and psbA-trnH) being recommended as primary DNA barcodes for plants. We evaluated the feasibility of using these regions in the species-rich genus Terminalia, which exhibits various overlapping morphotypes with pantropical distribution, owing to its complex taxonomy. Terminalia bellerica and T. chebula are ingredients of the famous Ayurvedic Rasayana formulation Triphala, used for detoxification and rejuvenation. High demand for extracted phytochemicals as well as the high trade value of several species renders mandatory the need for the correct identification of traded plant material. Three different analytical methods with single and multilocus barcoding regions were tested to develop a DNA barcode reference library from 222 individuals representing 41 Terminalia species. All the single barcodes tested had a lower discriminatory power than the multilocus regions, and the combination of matK+ITS had the highest resolution rate (94.44%). The average intra-specific variations (0.0188±0.0019) were less than the distance to the nearest neighbour (0.106±0.009) with matK and ITS. Distance-based Neighbour Joining analysis outperformed the character-based Maximum Parsimony method in the identification of traded species such as T. arjuna, T. chebula and T. tomentosa, which are prone to adulteration. rbcL was shown to be a highly conservative region with only 3.45% variability between all of the sequences. The recommended barcode combination, rbcL+matK, failed to perform in the genus Terminalia. Considering the complexity of resolution observed with single regions, the present study proposes the combination of matK+ITS as the most successful barcode in Terminalia. PMID:28829803

Applying plant DNA barcodes to identify species of Parnassia (Parnassiaceae).

PubMed

Yang, Jun-Bo; Wang, Yi-Ping; Möller, Michael; Gao, Lian-Ming; Wu, Ding

2012-03-01

DNA barcoding is a technique to identify species by using standardized DNA sequences. In this study, a total of 105 samples, representing 30 Parnassia species, were collected to test the effectiveness of four proposed DNA barcodes (rbcL, matK, trnH-psbA and ITS) for species identification. Our results demonstrated that all four candidate DNA markers have a maximum level of primer universality and sequencing success. As a single DNA marker, the ITS region provided the highest species resolution with 86.7%, followed by trnH-psbA with 73.3%. The combination of the core barcode regions, matK+rbcL, gave the lowest species identification success (63.3%) among any combination of multiple markers and was found unsuitable as DNA barcode for Parnassia. The combination of ITS+trnH-psbA achieved the highest species discrimination with 90.0% resolution (27 of 30 sampled species), equal to the four-marker combination and higher than any two or three marker combination including rbcL or matK. Therefore, matK and rbcL should not be used as DNA barcodes for the species identification of Parnassia. Based on the overall performance, the combination of ITS+trnH-psbA is proposed as the most suitable DNA barcode for identifying Parnassia species. DNA barcoding is a useful technique and provides a reliable and effective mean for the discrimination of Parnassia species, and in combination with morphology-based taxonomy, will be a robust approach for tackling taxonomically complex groups. In the light of our findings, we found among the three species not identified a possible cryptic speciation event in Parnassia. © 2011 Blackwell Publishing Ltd.

DNA barcoding for identification of consumer-relevant mushrooms: A partial solution for product certification?

PubMed

Raja, Huzefa A; Baker, Timothy R; Little, Jason G; Oberlies, Nicholas H

2017-01-01

One challenge in the dietary supplement industry is confirmation of species identity for processed raw materials, i.e. those modified by milling, drying, or extraction, which move through a multilevel supply chain before reaching the finished product. This is particularly difficult for samples containing fungal mycelia, where processing removes morphological characteristics, such that they do not present sufficient variation to differentiate species by traditional techniques. To address this issue, we have demonstrated the utility of DNA barcoding to verify the taxonomic identity of fungi found commonly in the food and dietary supplement industry; such data are critical for protecting consumer health, by assuring both safety and quality. By using DNA barcoding of nuclear ribosomal internal transcribed spacer (ITS) of the rRNA gene with fungal specific ITS primers, ITS barcodes were generated for 33 representative fungal samples, all of which could be used by consumers for food and/or dietary supplement purposes. In the majority of cases, we were able to sequence the ITS region from powdered mycelium samples, grocery store mushrooms, and capsules from commercial dietary supplements. After generating ITS barcodes utilizing standard procedures accepted by the Consortium for the Barcode of Life, we tested their utility by performing a BLAST search against authenticate published ITS sequences in GenBank. In some cases, we also downloaded published, homologous sequences of the ITS region of fungi inspected in this study and examined the phylogenetic relationships of barcoded fungal species in light of modern taxonomic and phylogenetic studies. We anticipate that these data will motivate discussions on DNA barcoding based species identification as applied to the verification/certification of mushroom-containing dietary supplements. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

Assessment of snake DNA barcodes based on mitochondrial COI and Cytb genes revealed multiple putative cryptic species in Thailand.

PubMed

Laopichienpong, Nararat; Muangmai, Narongrit; Supikamolseni, Arrjaree; Twilprawat, Panupon; Chanhome, Lawan; Suntrarachun, Sunutcha; Peyachoknagul, Surin; Srikulnath, Kornsorn

2016-12-15

DNA barcodes of mitochondrial cytochrome c oxidase I (COI), cytochrome b (Cytb) genes, and their combined data sets were constructed from 35 snake species in Thailand. No barcoding gap was detected in either of the two genes from the observed intra- and interspecific sequence divergences. Intra- and interspecific sequence divergences of the COI gene differed 14 times, with barcode cut-off scores ranging over 2%-4% for threshold values differentiated among most of the different species; the Cytb gene differed 6 times with cut-off scores ranging over 2%-6%. Thirty-five specific nucleotide mutations were also found at interspecific level in the COI gene, identifying 18 snake species, but no specific nucleotide mutation was observed for Cytb in any single species. This suggests that COI barcoding was a better marker than Cytb. Phylogenetic clustering analysis indicated that most species were represented by monophyletic clusters, suggesting that these snake species could be clearly differentiated using COI barcodes. However, the two-marker combination of both COI and Cytb was more effective, differentiating snake species by over 2%-4%, and reducing species numbers in the overlap value between intra- and interspecific divergences. Three species delimitation algorithms (general mixed Yule-coalescent, automatic barcoding gap detection, and statistical parsimony network analysis) were extensively applied to a wide range of snakes based on both barcodes. This revealed cryptic diversity for eleven snake species in Thailand. In addition, eleven accessions from the database previously grouped under the same species were represented at different species level, suggesting either high genetic diversity, or the misidentification of these sequences in the database as a consequence of cryptic species. Copyright © 2016 Elsevier B.V. All rights reserved.

DNA barcoding of Rhododendron (Ericaceae), the largest Chinese plant genus in biodiversity hotspots of the Himalaya-Hengduan Mountains.

PubMed

Yan, Li-Jun; Liu, Jie; Möller, Michael; Zhang, Lin; Zhang, Xue-Mei; Li, De-Zhu; Gao, Lian-Ming

2015-07-01

The Himalaya-Hengduan Mountains encompass two global biodiversity hotspots with high levels of biodiversity and endemism. This area is one of the diversification centres of the genus Rhododendron, which is recognized as one of the most taxonomically challenging plant taxa due to recent adaptive radiations and rampant hybridization. In this study, four DNA barcodes were evaluated on 531 samples representing 173 species of seven sections of four subgenera in Rhododendron, with a high sampling density from the Himalaya-Hengduan Mountains employing three analytical methods. The varied approaches (nj, pwg and blast) had different species identification powers with blast performing best. With the pwg analysis, the discrimination rates for single barcodes varied from 12.21% to 25.19% with ITS < rbcL < matK < psbA-trnH. Combinations of ITS + psbA-trnH + matK and the four barcodes showed the highest discrimination ability (both 41.98%) among all possible combinations. As a single barcode, psbA-trnH performed best with a relatively high performance (25.19%). Overall, the three-marker combination of ITS + psbA-trnH + matK was found to be the best DNA barcode for identifying Rhododendron species. The relatively low discriminative efficiency of DNA barcoding in this genus (~42%) may possibly be attributable to too low sequence divergences as a result of a long generation time of Rhododendron and complex speciation patterns involving recent radiations and hybridizations. Taking the morphology, distribution range and habitat of the species into account, DNA barcoding provided additional information for species identification and delivered a preliminary assessment of biodiversity for the large genus Rhododendron in the biodiversity hotspots of the Himalaya-Hengduan Mountains. © 2014 John Wiley & Sons Ltd.

Mini-DNA barcode in identification of the ornamental fish: A case study from Northeast India.

PubMed

Dhar, Bishal; Ghosh, Sankar Kumar

2017-09-05

The ornamental fishes were exported under the trade names or generic names, thus creating problems in species identification. In this regard, DNA barcoding could effectively elucidate the actual species status. However, the problem arises if the specimen is having taxonomic disputes, falsified by trade/generic names, etc., On the other hand, barcoding the archival museum specimens would be of greater benefit to address such issues as it would create firm, error-free reference database for rapid identification of any species. This can be achieved only by generating short sequences as DNA from chemically preserved are mostly degraded. Here we aimed to identify a short stretch of informative sites within the full-length barcode segment, capable of delineating diverse group of ornamental fish species, commonly traded from NE India. We analyzed 287 full-length barcode sequences from the major fish orders and compared the interspecific K2P distance with nucleotide substitutions patterns and found a strong correlation of interspecies distance with transversions (0.95, p<0.001). We, therefore, proposed a short stretch of 171bp (transversion rich) segment as mini-barcode. The proposed segment was compared with the full-length barcodes and found to delineate the species effectively. Successful PCR amplification and sequencing of the 171bp segment using designed primers for different orders validated it as mini-barcodes for ornamental fishes. Thus, our findings would be helpful in strengthening the global database with the sequence of archived fish species as well as an effective identification tool of the traded ornamental fish species, as a less time consuming, cost effective field-based application. Copyright © 2017 Elsevier B.V. All rights reserved.

Wolbachia and DNA barcoding insects: patterns, potential, and problems.

PubMed

Smith, M Alex; Bertrand, Claudia; Crosby, Kate; Eveleigh, Eldon S; Fernandez-Triana, Jose; Fisher, Brian L; Gibbs, Jason; Hajibabaei, Mehrdad; Hallwachs, Winnie; Hind, Katharine; Hrcek, Jan; Huang, Da-Wei; Janda, Milan; Janzen, Daniel H; Li, Yanwei; Miller, Scott E; Packer, Laurence; Quicke, Donald; Ratnasingham, Sujeevan; Rodriguez, Josephine; Rougerie, Rodolphe; Shaw, Mark R; Sheffield, Cory; Stahlhut, Julie K; Steinke, Dirk; Whitfield, James; Wood, Monty; Zhou, Xin

2012-01-01

Wolbachia is a genus of bacterial endosymbionts that impacts the breeding systems of their hosts. Wolbachia can confuse the patterns of mitochondrial variation, including DNA barcodes, because it influences the pathways through which mitochondria are inherited. We examined the extent to which these endosymbionts are detected in routine DNA barcoding, assessed their impact upon the insect sequence divergence and identification accuracy, and considered the variation present in Wolbachia COI. Using both standard PCR assays (Wolbachia surface coding protein--wsp), and bacterial COI fragments we found evidence of Wolbachia in insect total genomic extracts created for DNA barcoding library construction. When >2 million insect COI trace files were examined on the Barcode of Life Datasystem (BOLD) Wolbachia COI was present in 0.16% of the cases. It is possible to generate Wolbachia COI using standard insect primers; however, that amplicon was never confused with the COI of the host. Wolbachia alleles recovered were predominantly Supergroup A and were broadly distributed geographically and phylogenetically. We conclude that the presence of the Wolbachia DNA in total genomic extracts made from insects is unlikely to compromise the accuracy of the DNA barcode library; in fact, the ability to query this DNA library (the database and the extracts) for endosymbionts is one of the ancillary benefits of such a large scale endeavor--which we provide several examples. It is our conclusion that regular assays for Wolbachia presence and type can, and should, be adopted by large scale insect barcoding initiatives. While COI is one of the five multi-locus sequence typing (MLST) genes used for categorizing Wolbachia, there is limited overlap with the eukaryotic DNA barcode region.

Nurses' attitudes toward the use of the bar-coding medication administration system.

PubMed

Marini, Sana Daya; Hasman, Arie; Huijer, Huda Abu-Saad; Dimassi, Hani

2010-01-01

This study determines nurses' attitudes toward bar-coding medication administration system use. Some of the factors underlying the successful use of bar-coding medication administration systems that are viewed as a connotative indicator of users' attitudes were used to gather data that describe the attitudinal basis for system adoption and use decisions in terms of subjective satisfaction. Only 67 nurses in the United States had the chance to respond to the e-questionnaire posted on the CARING list server for the months of June and July 2007. Participants rated their satisfaction with bar-coding medication administration system use based on system functionality, usability, and its positive/negative impact on the nursing practice. Results showed, to some extent, positive attitude, but the image profile draws attention to nurses' concerns for improving certain system characteristics. The high bar-coding medication administration system skills revealed a more negative perception of the system by the nursing staff. The reasons underlying dissatisfaction with bar-coding medication administration use by skillful users are an important source of knowledge that can be helpful for system development as well as system deployment. As a result, strengthening bar-coding medication administration system usability by magnifying its ability to eliminate medication errors and the contributing factors, maximizing system functionality by ascertaining its power as an extra eye in the medication administration process, and impacting the clinical nursing practice positively by being helpful to nurses, speeding up the medication administration process, and being user-friendly can offer a congenial settings for establishing positive attitude toward system use, which in turn leads to successful bar-coding medication administration system use.

Identifying Fishes through DNA Barcodes and Microarrays.

PubMed

Kochzius, Marc; Seidel, Christian; Antoniou, Aglaia; Botla, Sandeep Kumar; Campo, Daniel; Cariani, Alessia; Vazquez, Eva Garcia; Hauschild, Janet; Hervet, Caroline; Hjörleifsdottir, Sigridur; Hreggvidsson, Gudmundur; Kappel, Kristina; Landi, Monica; Magoulas, Antonios; Marteinsson, Viggo; Nölte, Manfred; Planes, Serge; Tinti, Fausto; Turan, Cemal; Venugopal, Moleyur N; Weber, Hannes; Blohm, Dietmar

2010-09-07

International fish trade reached an import value of 62.8 billion Euro in 2006, of which 44.6% are covered by the European Union. Species identification is a key problem throughout the life cycle of fishes: from eggs and larvae to adults in fisheries research and control, as well as processed fish products in consumer protection. This study aims to evaluate the applicability of the three mitochondrial genes 16S rRNA (16S), cytochrome b (cyt b), and cytochrome oxidase subunit I (COI) for the identification of 50 European marine fish species by combining techniques of "DNA barcoding" and microarrays. In a DNA barcoding approach, neighbour Joining (NJ) phylogenetic trees of 369 16S, 212 cyt b, and 447 COI sequences indicated that cyt b and COI are suitable for unambiguous identification, whereas 16S failed to discriminate closely related flatfish and gurnard species. In course of probe design for DNA microarray development, each of the markers yielded a high number of potentially species-specific probes in silico, although many of them were rejected based on microarray hybridisation experiments. None of the markers provided probes to discriminate the sibling flatfish and gurnard species. However, since 16S-probes were less negatively influenced by the "position of label" effect and showed the lowest rejection rate and the highest mean signal intensity, 16S is more suitable for DNA microarray probe design than cty b and COI. The large portion of rejected COI-probes after hybridisation experiments (>90%) renders the DNA barcoding marker as rather unsuitable for this high-throughput technology. Based on these data, a DNA microarray containing 64 functional oligonucleotide probes for the identification of 30 out of the 50 fish species investigated was developed. It represents the next step towards an automated and easy-to-handle method to identify fish, ichthyoplankton, and fish products.

Real-time DNA barcoding in a rainforest using nanopore sequencing: opportunities for rapid biodiversity assessments and local capacity building

PubMed Central

Peñafiel, Nicolás; Arteaga, Alejandro; Bustamante, Lucas; Pichardo, Frank; Coloma, Luis A; Barrio-Amorós, César L; Salazar-Valenzuela, David; Prost, Stefan

2018-01-01

Abstract Background Advancements in portable scientific instruments provide promising avenues to expedite field work in order to understand the diverse array of organisms that inhabit our planet. Here, we tested the feasibility for in situ molecular analyses of endemic fauna using a portable laboratory fitting within a single backpack in one of the world's most imperiled biodiversity hotspots, the Ecuadorian Chocó rainforest. We used portable equipment, including the MinION nanopore sequencer (Oxford Nanopore Technologies) and the miniPCR (miniPCR), to perform DNA extraction, polymerase chain reaction amplification, and real-time DNA barcoding of reptile specimens in the field. Findings We demonstrate that nanopore sequencing can be implemented in a remote tropical forest to quickly and accurately identify species using DNA barcoding, as we generated consensus sequences for species resolution with an accuracy of >99% in less than 24 hours after collecting specimens. The flexibility of our mobile laboratory further allowed us to generate sequence information at the Universidad Tecnológica Indoamérica in Quito for rare, endangered, and undescribed species. This includes the recently rediscovered Jambato toad, which was thought to be extinct for 28 years. Sequences generated on the MinION required as few as 30 reads to achieve high accuracy relative to Sanger sequencing, and with further multiplexing of samples, nanopore sequencing can become a cost-effective approach for rapid and portable DNA barcoding. Conclusions Overall, we establish how mobile laboratories and nanopore sequencing can help to accelerate species identification in remote areas to aid in conservation efforts and be applied to research facilities in developing countries. This opens up possibilities for biodiversity studies by promoting local research capacity building, teaching nonspecialists and students about the environment, tackling wildlife crime, and promoting conservation via research-focused ecotourism. PMID:29617771

Non-Enzymatic Detection of Bacterial Genomic DNA Using the Bio-Barcode Assay

PubMed Central

Hill, Haley D.; Vega, Rafael A.; Mirkin, Chad A.

2011-01-01

The detection of bacterial genomic DNA through a non-enzymatic nanomaterials based amplification method, the bio-barcode assay, is reported. The assay utilizes oligonucleotide functionalized magnetic microparticles to capture the target of interest from the sample. A critical step in the new assay involves the use of blocking oligonucleotides during heat denaturation of the double stranded DNA. These blockers bind to specific regions of the target DNA upon cooling, and prevent the duplex DNA from re-hybridizing, which allows the particle probes to bind. Following target isolation using the magnetic particles, oligonucleotide functionalized gold nanoparticles act as target recognition agents. The oligonucleotides on the nanoparticle (barcodes) act as amplification surrogates. The barcodes are then detected using the Scanometric method. The limit of detection for this assay was determined to be 2.5 femtomolar, and this is the first demonstration of a barcode type assay for the detection of double stranded, genomic DNA. PMID:17927207

DNA Barcode Authentication of Saw Palmetto Herbal Dietary Supplements

PubMed Central

Little, Damon P.; Jeanson, Marc L.

2013-01-01

Herbal dietary supplements made from saw palmetto (Serenoa repens; Arecaceae) fruit are commonly consumed to ameliorate benign prostate hyperplasia. A novel DNA mini–barcode assay to accurately identify [specificity = 1.00 (95% confidence interval = 0.74–1.00); sensitivity = 1.00 (95% confidence interval = 0.66–1.00); n = 31] saw palmetto dietary supplements was designed from a DNA barcode reference library created for this purpose. The mini–barcodes were used to estimate the frequency of mislabeled saw palmetto herbal dietary supplements on the market in the United States of America. Of the 37 supplements examined, amplifiable DNA could be extracted from 34 (92%). Mini–barcode analysis of these supplements demonstrated that 29 (85%) contain saw palmetto and that 2 (6%) supplements contain related species that cannot be legally sold as herbal dietary supplements in the United States of America. The identity of 3 (9%) supplements could not be conclusively determined. PMID:24343362

DNA barcoding and the identification of tree frogs (Amphibia: Anura: Rhacophoridae).

PubMed

Dang, Ning-Xin; Sun, Feng-Hui; Lv, Yun-Yun; Zhao, Bo-Han; Wang, Ji-Chao; Murphy, Robert W; Wang, Wen-Zhi; Li, Jia-Tang

2016-07-01

The DNA barcoding gene COI (cytochrome c oxidase subunit I) effectively identifies many species. Herein, we barcoded 172 individuals from 37 species belonging to nine genera in Rhacophoridae to test if the gene serves equally well to identify species of tree frogs. Phenetic neighbor joining and phylogenetic Bayesian inference were used to construct phylogenetic trees, which resolved all nine genera as monophyletic taxa except for Rhacophorus, two new matrilines for Liuixalus, and Polypedates leucomystax species complex. Intraspecific genetic distances ranged from 0.000 to 0.119 and interspecific genetic distances ranged from 0.015 to 0.334. Within Rhacophorus and Kurixalus, the intra- and interspecific genetic distances did not reveal an obvious barcode gap. Notwithstanding, we found that COI sequences unambiguously identified rhacophorid species and helped to discover likely new cryptic species via the synthesis of genealogical relationships and divergence patterns. Our results supported that COI is an effective DNA barcoding marker for Rhacophoridae.

DNA barcodes for dragonflies and damselflies (Odonata) of Mindanao, Philippines.

PubMed

Casas, Princess Angelie S; Sing, Kong-Wah; Lee, Ping-Shin; Nuñeza, Olga M; Villanueva, Reagan Joseph T; Wilson, John-James

2018-03-01

Reliable species identification provides a sounder basis for use of species in the order Odonata as biological indicators and for their conservation, an urgent concern as many species are threatened with imminent extinction. We generated 134 COI barcodes from 36 morphologically identified species of Odonata collected from Mindanao Island, representing 10 families and 19 genera. Intraspecific sequence divergences ranged from 0 to 6.7% with four species showing more than 2%, while interspecific sequence divergences ranged from 0.5 to 23.3% with seven species showing less than 2%. Consequently, no distinct gap was observed between intraspecific and interspecific DNA barcode divergences. The numerous islands of the Philippine archipelago may have facilitated rapid speciation in the Odonata and resulted in low interspecific sequence divergences among closely related groups of species. This study contributes DNA barcodes for 36 morphologically identified species of Odonata reported from Mindanao including 31 species with no previous DNA barcode records.

Revealing the Hyperdiverse Mite Fauna of Subarctic Canada through DNA Barcoding

PubMed Central

Young, Monica R.; Behan-Pelletier, Valerie M.; Hebert, Paul D. N.

2012-01-01

Although mites are one of the most abundant and diverse groups of arthropods, they are rarely targeted for detailed biodiversity surveys due to taxonomic constraints. We address this gap through DNA barcoding, evaluating acarine diversity at Churchill, Manitoba, a site on the tundra-taiga transition. Barcode analysis of 6279 specimens revealed nearly 900 presumptive species of mites with high species turnover between substrates and between forested and non-forested sites. Accumulation curves have not reached an asymptote for any of the three mite orders investigated, and estimates suggest that more than 1200 species of Acari occur at this locality. The coupling of DNA barcode results with taxonomic assignments revealed that Trombidiformes compose 49% of the fauna, a larger fraction than expected based on prior studies. This investigation demonstrates the efficacy of DNA barcoding in facilitating biodiversity assessments of hyperdiverse taxa. PMID:23133656

Structure-based barcoding of proteins.

PubMed

Metri, Rahul; Jerath, Gaurav; Kailas, Govind; Gacche, Nitin; Pal, Adityabarna; Ramakrishnan, Vibin

2014-01-01

A reduced representation in the format of a barcode has been developed to provide an overview of the topological nature of a given protein structure from 3D coordinate file. The molecular structure of a protein coordinate file from Protein Data Bank is first expressed in terms of an alpha-numero code and further converted to a barcode image. The barcode representation can be used to compare and contrast different proteins based on their structure. The utility of this method has been exemplified by comparing structural barcodes of proteins that belong to same fold family, and across different folds. In addition to this, we have attempted to provide an illustration to (i) the structural changes often seen in a given protein molecule upon interaction with ligands and (ii) Modifications in overall topology of a given protein during evolution. The program is fully downloadable from the website http://www.iitg.ac.in/probar/. © 2013 The Protein Society.

DNA barcode authentication of saw palmetto herbal dietary supplements.

PubMed

Little, Damon P; Jeanson, Marc L

2013-12-17

Herbal dietary supplements made from saw palmetto (Serenoa repens; Arecaceae) fruit are commonly consumed to ameliorate benign prostate hyperplasia. A novel DNA mini-barcode assay to accurately identify [specificity = 1.00 (95% confidence interval = 0.74-1.00); sensitivity = 1.00 (95% confidence interval = 0.66-1.00); n = 31] saw palmetto dietary supplements was designed from a DNA barcode reference library created for this purpose. The mini-barcodes were used to estimate the frequency of mislabeled saw palmetto herbal dietary supplements on the market in the United States of America. Of the 37 supplements examined, amplifiable DNA could be extracted from 34 (92%). Mini-barcode analysis of these supplements demonstrated that 29 (85%) contain saw palmetto and that 2 (6%) supplements contain related species that cannot be legally sold as herbal dietary supplements in the United States of America. The identity of 3 (9%) supplements could not be conclusively determined.

DNA Barcoding Reveals Limited Accuracy of Identifications Based on Folk Taxonomy

PubMed Central

Martin, Gary; Abbad, Abdelaziz; Kool, Anneleen

2014-01-01

Background The trade of plant roots as traditional medicine is an important source of income for many people around the world. Destructive harvesting practices threaten the existence of some plant species. Harvesters of medicinal roots identify the collected species according to their own folk taxonomies, but once the dried or powdered roots enter the chain of commercialization, accurate identification becomes more challenging. Methodology A survey of morphological diversity among four root products traded in the medina of Marrakech was conducted. Fifty-one root samples were selected for molecular identification using DNA barcoding using three markers, trnH-psbA, rpoC1, and ITS. Sequences were searched using BLAST against a tailored reference database of Moroccan medicinal plants and their closest relatives submitted to NCBI GenBank. Principal Findings Combining psbA-trnH, rpoC1, and ITS allowed the majority of the market samples to be identified to species level. Few of the species level barcoding identifications matched the scientific names given in the literature, including the most authoritative and widely cited pharmacopeia. Conclusions/Significance The four root complexes selected from the medicinal plant products traded in Marrakech all comprise more than one species, but not those previously asserted. The findings have major implications for the monitoring of trade in endangered plant species as morphology-based species identifications alone may not be accurate. As a result, trade in certain species may be overestimated, whereas the commercialization of other species may not be recorded at all. PMID:24416210

Colletotrichum – current status and future directions

PubMed Central

Cannon, P.F.; Damm, U.; Johnston, P.R.; Weir, B.S.

2012-01-01

A review is provided of the current state of understanding of Colletotrichum systematics, focusing on species-level data and the major clades. The taxonomic placement of the genus is discussed, and the evolution of our approach to species concepts and anamorph-teleomorph relationships is described. The application of multilocus technologies to phylogenetic analysis of Colletotrichum is reviewed, and selection of potential genes/loci for barcoding purposes is discussed. Host specificity and its relation to speciation and taxonomy is briefly addressed. A short review is presented of the current status of classification of the species clusters that are currently without comprehensive multilocus analyses, emphasising the orbiculare and destructivum aggregates. The future for Colletotrichum biology will be reliant on consensus classification and robust identification tools. In support of these goals, a Subcommission on Colletotrichum has been formed under the auspices of the International Commission on Taxonomy of Fungi, which will administer a carefully curated barcode database for sequence-based identification of species within the BioloMICS web environment. PMID:23136460

Quantitative Tracking of Combinatorially Engineered Populations with Multiplexed Binary Assemblies.

PubMed

Zeitoun, Ramsey I; Pines, Gur; Grau, Willliam C; Gill, Ryan T

2017-04-21

Advances in synthetic biology and genomics have enabled full-scale genome engineering efforts on laboratory time scales. However, the absence of sufficient approaches for mapping engineered genomes at system-wide scales onto performance has limited the adoption of more sophisticated algorithms for engineering complex biological systems. Here we report on the development and application of a robust approach to quantitatively map combinatorially engineered populations at scales up to several dozen target sites. This approach works by assembling genome engineered sites with cell-specific barcodes into a format compatible with high-throughput sequencing technologies. This approach, called barcoded-TRACE (bTRACE) was applied to assess E. coli populations engineered by recursive multiplex recombineering across both 6-target sites and 31-target sites. The 31-target library was then tracked throughout growth selections in the presence and absence of isopentenol (a potential next-generation biofuel). We also use the resolution of bTRACE to compare the influence of technical and biological noise on genome engineering efforts.

A scalable double-barcode sequencing platform for characterization of dynamic protein-protein interactions.

PubMed

Schlecht, Ulrich; Liu, Zhimin; Blundell, Jamie R; St Onge, Robert P; Levy, Sasha F

2017-05-25

Several large-scale efforts have systematically catalogued protein-protein interactions (PPIs) of a cell in a single environment. However, little is known about how the protein interactome changes across environmental perturbations. Current technologies, which assay one PPI at a time, are too low throughput to make it practical to study protein interactome dynamics. Here, we develop a highly parallel protein-protein interaction sequencing (PPiSeq) platform that uses a novel double barcoding system in conjunction with the dihydrofolate reductase protein-fragment complementation assay in Saccharomyces cerevisiae. PPiSeq detects PPIs at a rate that is on par with current assays and, in contrast with current methods, quantitatively scores PPIs with enough accuracy and sensitivity to detect changes across environments. Both PPI scoring and the bulk of strain construction can be performed with cell pools, making the assay scalable and easily reproduced across environments. PPiSeq is therefore a powerful new tool for large-scale investigations of dynamic PPIs.

De novo assembly and next-generation sequencing to analyse full-length gene variants from codon-barcoded libraries.

PubMed

Cho, Namjin; Hwang, Byungjin; Yoon, Jung-ki; Park, Sangun; Lee, Joongoo; Seo, Han Na; Lee, Jeewon; Huh, Sunghoon; Chung, Jinsoo; Bang, Duhee

2015-09-21

Interpreting epistatic interactions is crucial for understanding evolutionary dynamics of complex genetic systems and unveiling structure and function of genetic pathways. Although high resolution mapping of en masse variant libraries renders molecular biologists to address genotype-phenotype relationships, long-read sequencing technology remains indispensable to assess functional relationship between mutations that lie far apart. Here, we introduce JigsawSeq for multiplexed sequence identification of pooled gene variant libraries by combining a codon-based molecular barcoding strategy and de novo assembly of short-read data. We first validate JigsawSeq on small sub-pools and observed high precision and recall at various experimental settings. With extensive simulations, we then apply JigsawSeq to large-scale gene variant libraries to show that our method can be reliably scaled using next-generation sequencing. JigsawSeq may serve as a rapid screening tool for functional genomics and offer the opportunity to explore evolutionary trajectories of protein variants.

Integrated Blood Barcode Chips

PubMed Central

Fan, Rong; Vermesh, Ophir; Srivastava, Alok; Yen, Brian K.H.; Qin, Lidong; Ahmad, Habib; Kwong, Gabriel A.; Liu, Chao-Chao; Gould, Juliane; Hood, Leroy; Heath, James R.

2008-01-01

Blood comprises the largest version of the human proteome1. Changes of plasma protein profiles can reflect physiological or pathological conditions associated with many human diseases, making blood the most important fluid for clinical diagnostics2-4. Nevertheless, only a handful of plasma proteins are utilized in routine clinical tests. This is due to a host of reasons, including the intrinsic complexity of the plasma proteome1, the heterogeneity of human diseases and the fast kinetics associated with protein degradation in sampled blood5. Simple technologies that can sensitively sample large numbers of proteins over broad concentration ranges, from small amounts of blood, and within minutes of sample collection, would assist in solving these problems. Herein, we report on an integrated microfluidic system, called the Integrated Blood Barcode Chip (IBBC). It enables on-chip blood separation and the rapid measurement of a panel of plasma proteins from small quantities of blood samples including a fingerprick of whole blood. This platform holds potential for inexpensive, non-invasive, and informative clinical diagnoses, particularly, for point-of-care. PMID:19029914

The School Malaise Trap Program: Coupling educational outreach with scientific discovery

PubMed Central

Breton, Vanessa; Berzitis, Emily; Hebert, Paul D. N.

2017-01-01

The School Malaise Trap Program (SMTP) provides a technologically sophisticated and scientifically relevant educational experience that exposes students to the diversity of life, enhancing their understanding of biodiversity while promoting environmental stewardship. Since 2013, the SMTP has allowed 15,000 students at 350 primary and secondary schools to explore insect diversity in Canadian schoolyards. Students at each school collected hundreds of insects for an analysis of DNA sequence variation that enabled their rapid identification to a species. Through this hands-on approach, they participated in a learning exercise that conveys a real sense of scientific discovery. As well, the students contributed valuable data to the largest biodiversity genomics initiative ever undertaken: the International Barcode of Life project. To date, the SMTP has sequenced over 80,000 insect specimens, which includes representatives of 7,990 different species, nearly a tenth of the Canadian fauna. Both surprisingly and importantly, the collections generated the first DNA barcode records for 1,288 Canadian species. PMID:28437475

Thin family: a new barcode concept

NASA Astrophysics Data System (ADS)

Allais, David C.

1991-02-01

This paper describes a new space-efficient family of thin bar code symbologies which are appropriate for representing small amounts of information. The proposed structure is 30 to 50 percent more compact than the narrowest existing bar code when 12 or fewer bits of information are to be encoded in each symbol. Potential applications for these symbologies include menus catalogs automated test and survey scoring and biological research such as the tracking of honey bees.

Graded core/shell semiconductor nanorods and nanorod barcodes

DOEpatents

Alivisatos, A. Paul; Scher, Erik C.; Manna, Liberato

2010-12-14

Graded core/shell semiconductor nanorods and shaped nanorods are disclosed comprising Group II-VI, Group III-V and Group IV semiconductors and methods of making the same. Also disclosed are nanorod barcodes using core/shell nanorods where the core is a semiconductor or metal material, and with or without a shell. Methods of labeling analytes using the nanorod barcodes are also disclosed.

Graded core/shell semiconductor nanorods and nanorod barcodes

DOEpatents

Alivisatos, A. Paul; Scher, Erik C.; Manna, Liberato

2013-03-26

Graded core/shell semiconductor nanorods and shapped nanorods are disclosed comprising Group II-VI, Group III-V and Group IV semiconductors and methods of making the same. Also disclosed are nanorod barcodes using core/shell nanorods where the core is a semiconductor or metal material, and with or without a shell. Methods of labeling analytes using the nanorod barcodes are also disclosed.

DNA barcoding and morphological identification of neotropical ichthyoplankton from the Upper Paraná and São Francisco.

PubMed

Becker, R A; Sales, N G; Santos, G M; Santos, G B; Carvalho, D C

2015-07-01

The identification of fish larvae from two neotropical hydrographic basins using traditional morphological taxonomy and DNA barcoding revealed no conflicting results between the morphological and barcode identification of larvae. A lower rate (25%) of correct morphological identification of eggs as belonging to migratory or non-migratory species was achieved. Accurate identification of ichthyoplankton by DNA barcoding is an important tool for fish reproductive behaviour studies, correct estimation of biodiversity by detecting eggs from rare species, as well as defining environmental and management strategies for fish conservation in the neotropics. © 2015 The Fisheries Society of the British Isles.

Computer vision barrel inspection

NASA Astrophysics Data System (ADS)

Wolfe, William J.; Gunderson, James; Walworth, Matthew E.

1994-02-01

One of the Department of Energy's (DOE) ongoing tasks is the storage and inspection of a large number of waste barrels containing a variety of hazardous substances. Martin Marietta is currently contracted to develop a robotic system -- the Intelligent Mobile Sensor System (IMSS) -- for the automatic monitoring and inspection of these barrels. The IMSS is a mobile robot with multiple sensors: video cameras, illuminators, laser ranging and barcode reader. We assisted Martin Marietta in this task, specifically in the development of image processing algorithms that recognize and classify the barrel labels. Our subsystem uses video images to detect and locate the barcode, so that the barcode reader can be pointed at the barcode.

DNA Barcode Analysis of Thrips (Thysanoptera) Diversity in Pakistan Reveals Cryptic Species Complexes.

PubMed

Iftikhar, Romana; Ashfaq, Muhammad; Rasool, Akhtar; Hebert, Paul D N

2016-01-01

Although thrips are globally important crop pests and vectors of viral disease, species identifications are difficult because of their small size and inconspicuous morphological differences. Sequence variation in the mitochondrial COI-5' (DNA barcode) region has proven effective for the identification of species in many groups of insect pests. We analyzed barcode sequence variation among 471 thrips from various plant hosts in north-central Pakistan. The Barcode Index Number (BIN) system assigned these sequences to 55 BINs, while the Automatic Barcode Gap Discovery detected 56 partitions, a count that coincided with the number of monophyletic lineages recognized by Neighbor-Joining analysis and Bayesian inference. Congeneric species showed an average of 19% sequence divergence (range = 5.6% - 27%) at COI, while intraspecific distances averaged 0.6% (range = 0.0% - 7.6%). BIN analysis suggested that all intraspecific divergence >3.0% actually involved a species complex. In fact, sequences for three major pest species (Haplothrips reuteri, Thrips palmi, Thrips tabaci), and one predatory thrips (Aeolothrips intermedius) showed deep intraspecific divergences, providing evidence that each is a cryptic species complex. The study compiles the first barcode reference library for the thrips of Pakistan, and examines global haplotype diversity in four important pest thrips.

Comparing COI and ITS as DNA barcode markers for mushrooms and allies (Agaricomycotina).

PubMed

Dentinger, Bryn T M; Didukh, Maryna Y; Moncalvo, Jean-Marc

2011-01-01

DNA barcoding is an approach to rapidly identify species using short, standard genetic markers. The mitochondrial cytochrome oxidase I gene (COI) has been proposed as the universal barcode locus, but its utility for barcoding in mushrooms (ca. 20,000 species) has not been established. We succeeded in generating 167 partial COI sequences (~450 bp) representing ~100 morphospecies from ~650 collections of Agaricomycotina using several sets of new primers. Large introns (~1500 bp) at variable locations were detected in ~5% of the sequences we obtained. We suspect that widespread presence of large introns is responsible for our low PCR success (~30%) with this locus. We also sequenced the nuclear internal transcribed spacer rDNA regions (ITS) to compare with COI. Among the small proportion of taxa for which COI could be sequenced, COI and ITS perform similarly as a barcode. However, in a densely sampled set of closely related taxa, COI was less divergent than ITS and failed to distinguish all terminal clades. Given our results and the wealth of ITS data already available in public databases, we recommend that COI be abandoned in favor of ITS as the primary DNA barcode locus in mushrooms.

Integrating a DNA barcoding project with an ecological survey: a case study on temperate intertidal polychaete communities in Qingdao, China

NASA Astrophysics Data System (ADS)

Zhou, Hong; Zhang, Zhinan; Chen, Haiyan; Sun, Renhua; Wang, Hui; Guo, Lei; Pan, Haijian

2010-07-01

In this study, we integrated a DNA barcoding project with an ecological survey on intertidal polychaete communities and investigated the utility of CO1 gene sequence as a DNA barcode for the classification of the intertidal polychaetes. Using 16S rDNA as a complementary marker and combining morphological and ecological characterization, some of dominant and common polychaete species from Chinese coasts were assessed for their taxonomic status. We obtained 22 haplotype gene sequences of 13 taxa, including 10 CO1 sequences and 12 16S rDNA sequences. Based on intra- and inter-specific distances, we built phylogenetic trees using the neighbor-joining method. Our study suggested that the mitochondrial CO1 gene was a valid DNA barcoding marker for species identification in polychaetes, but other genes, such as 16S rDNA, could be used as a complementary genetic marker. For more accurate species identification and effective testing of species hypothesis, DNA barcoding should be incorporated with morphological, ecological, biogeographical, and phylogenetic information. The application of DNA barcoding and molecular identification in the ecological survey on the intertidal polychaete communities demonstrated the feasibility of integrating DNA taxonomy and ecology.

Identification of Neoceratitis asiatica (Becker) (Diptera: Tephritidae) based on morphological characteristics and DNA barcode.

PubMed

Guo, Shaokun; He, Jia; Zhao, Zihua; Liu, Lijun; Gao, Liyuan; Wei, Shuhua; Guo, Xiaoyu; Zhang, Rong; Li, Zhihong

2017-12-12

Neoceratitis asiatica (Becker), which especially infests wolfberry (Lycium barbarum L.), could cause serious economic losses every year in China, especially to organic wolfberry production. In some important wolfberry plantings, it is difficult and time-consuming to rear the larvae or pupae to adults for morphological identification. Molecular identification based on DNA barcode is a solution to the problem. In this study, 15 samples were collected from Ningxia, China. Among them, five adults were identified according to their morphological characteristics. The utility of mitochondrial DNA (mtDNA) cytochrome c oxidase I (COI) gene sequence as DNA barcode in distinguishing N. asiatica was evaluated by analysing Kimura 2-parameter distances and phylogenetic trees. There were significant differences between intra-specific and inter-specific genetic distances according to the barcoding gap analysis. The uncertain larval and pupal samples were within the same cluster as N. asiatica adults and formed sister cluster to N. cyanescens. A combination of morphological and molecular methods enabled accurate identification of N. asiatica. This is the first study using DNA barcode to identify N. asiatica and the obtained DNA sequences will be added to the DNA barcode database.

Comparing COI and ITS as DNA Barcode Markers for Mushrooms and Allies (Agaricomycotina)

PubMed Central

Dentinger, Bryn T. M.; Didukh, Maryna Y.; Moncalvo, Jean-Marc

2011-01-01

DNA barcoding is an approach to rapidly identify species using short, standard genetic markers. The mitochondrial cytochrome oxidase I gene (COI) has been proposed as the universal barcode locus, but its utility for barcoding in mushrooms (ca. 20,000 species) has not been established. We succeeded in generating 167 partial COI sequences (∼450 bp) representing ∼100 morphospecies from ∼650 collections of Agaricomycotina using several sets of new primers. Large introns (∼1500 bp) at variable locations were detected in ∼5% of the sequences we obtained. We suspect that widespread presence of large introns is responsible for our low PCR success (∼30%) with this locus. We also sequenced the nuclear internal transcribed spacer rDNA regions (ITS) to compare with COI. Among the small proportion of taxa for which COI could be sequenced, COI and ITS perform similarly as a barcode. However, in a densely sampled set of closely related taxa, COI was less divergent than ITS and failed to distinguish all terminal clades. Given our results and the wealth of ITS data already available in public databases, we recommend that COI be abandoned in favor of ITS as the primary DNA barcode locus in mushrooms. PMID:21966418

FBIS: A regional DNA barcode archival & analysis system for Indian fishes.

PubMed

Nagpure, Naresh Sahebrao; Rashid, Iliyas; Pathak, Ajey Kumar; Singh, Mahender; Singh, Shri Prakash; Sarkar, Uttam Kumar

2012-01-01

DNA barcode is a new tool for taxon recognition and classification of biological organisms based on sequence of a fragment of mitochondrial gene, cytochrome c oxidase I (COI). In view of the growing importance of the fish DNA barcoding for species identification, molecular taxonomy and fish diversity conservation, we developed a Fish Barcode Information System (FBIS) for Indian fishes, which will serve as a regional DNA barcode archival and analysis system. The database presently contains 2334 sequence records of COI gene for 472 aquatic species belonging to 39 orders and 136 families, collected from available published data sources. Additionally, it contains information on phenotype, distribution and IUCN Red List status of fishes. The web version of FBIS was designed using MySQL, Perl and PHP under Linux operating platform to (a) store and manage the acquisition (b) analyze and explore DNA barcode records (c) identify species and estimate genetic divergence. FBIS has also been integrated with appropriate tools for retrieving and viewing information about the database statistics and taxonomy. It is expected that FBIS would be useful as a potent information system in fish molecular taxonomy, phylogeny and genomics. The database is available for free at http://mail.nbfgr.res.in/fbis/

The Nuclear Barcode: a New Taggant for Identifying Explosives

NASA Astrophysics Data System (ADS)

Seman, James; Johnson, Catherine; Castaño, Carlos

2017-06-01

Creating an effective taggant system for explosives is a challenging problem since the taggant used must be designed to endure the detonation process. A new taggant for use in explosives has been recently developed and named the `nuclear barcode'. The nuclear barcode tags explosives by adding low concentrations of eight different elements to the explosive, and then reads the tag from the post-blast residue using neutron activation analysis (NAA) to identify the elements and their concentrations. The nuclear barcode can be used to identify explosives after detonation by sampling the post-blast residue that is deposited due to incomplete reaction of the explosives. This method of tagging explosives creates an identifying taggant that survives detonation as NAA detects atomic nuclei as opposed to using any chemical or physical properties of the taggant that don't always survive the detonation process. Additional advantages this taggant method offers is ease of recovery of the taggant after detonation, and a total of 25.6 billion possible taggants as currently conceived, which enables the nuclear barcode to be used to tag individual batches of explosives. This paper describes the development of the nuclear barcode taggant system and its potential use in the explosives industry.

Utility of DNA barcoding for rapid and accurate assessment of bat diversity in Malaysia in the absence of formally described species.

PubMed

Wilson, J-J; Sing, K-W; Halim, M R A; Ramli, R; Hashim, R; Sofian-Azirun, M

2014-02-19

Bats are important flagship species for biodiversity research; however, diversity in Southeast Asia is considerably underestimated in the current checklists and field guides. Incorporation of DNA barcoding into surveys has revealed numerous species-level taxa overlooked by conventional methods. Inclusion of these taxa in inventories provides a more informative record of diversity, but is problematic as these species lack formal description. We investigated how frequently documented, but undescribed, bat taxa are encountered in Peninsular Malaysia. We discuss whether a barcode library provides a means of recognizing and recording these taxa across biodiversity inventories. Tissue was sampled from bats trapped at Pasir Raja, Dungun Terengganu, Peninsular Malaysia. The DNA was extracted and the COI barcode region amplified and sequenced. We identified 9 species-level taxa within our samples, based on analysis of the DNA barcodes. Six specimens matched to four previously documented taxa considered candidate species but currently lacking formal taxonomic status. This study confirms the high diversity of bats within Peninsular Malaysia (9 species in 13 samples) and demonstrates how DNA barcoding allows for inventory and documentation of known taxa lacking formal taxonomic status.

Towards a comprehensive barcode library for arctic life - Ephemeroptera, Plecoptera, and Trichoptera of Churchill, Manitoba, Canada

PubMed Central

2009-01-01

Background This study reports progress in assembling a DNA barcode reference library for Ephemeroptera, Plecoptera, and Trichoptera ("EPTs") from a Canadian subarctic site, which is the focus of a comprehensive biodiversity inventory using DNA barcoding. These three groups of aquatic insects exhibit a moderate level of species diversity, making them ideal for testing the feasibility of DNA barcoding for routine biotic surveys. We explore the correlation between the morphological species delineations, DNA barcode-based haplotype clusters delimited by a sequence threshold (2%), and a threshold-free approach to biodiversity quantification--phylogenetic diversity. Results A DNA barcode reference library is built for 112 EPT species for the focal region, consisting of 2277 COI sequences. Close correspondence was found between EPT morphospecies and haplotype clusters as designated using a standard threshold value. Similarly, the shapes of taxon accumulation curves based upon haplotype clusters were very similar to those generated using phylogenetic diversity accumulation curves, but were much more computationally efficient. Conclusion The results of this study will facilitate other lines of research on northern EPTs and also bode well for rapidly conducting initial biodiversity assessments in unknown EPT faunas. PMID:20003245

DNA barcodes for 1/1000 of the animal kingdom.

PubMed

Hebert, Paul D N; Dewaard, Jeremy R; Landry, Jean-François

2010-06-23

This study reports DNA barcodes for more than 1300 Lepidoptera species from the eastern half of North America, establishing that 99.3 per cent of these species possess diagnostic barcode sequences. Intraspecific divergences averaged just 0.43 per cent among this assemblage, but most values were lower. The mean was elevated by deep barcode divergences (greater than 2%) in 5.1 per cent of the species, often involving the sympatric occurrence of two barcode clusters. A few of these cases have been analysed in detail, revealing species overlooked by the current taxonomic system. This study also provided a large-scale test of the extent of regional divergence in barcode sequences, indicating that geographical differentiation in the Lepidoptera of eastern North America is small, even when comparisons involve populations as much as 2800 km apart. The present results affirm that a highly effective system for the identification of Lepidoptera in this region can be built with few records per species because of the limited intra-specific variation. As most terrestrial and marine taxa are likely to possess a similar pattern of population structure, an effective DNA-based identification system can be developed with modest effort.

EvoluCode: Evolutionary Barcodes as a Unifying Framework for Multilevel Evolutionary Data.

PubMed

Linard, Benjamin; Nguyen, Ngoc Hoan; Prosdocimi, Francisco; Poch, Olivier; Thompson, Julie D

2012-01-01

Evolutionary systems biology aims to uncover the general trends and principles governing the evolution of biological networks. An essential part of this process is the reconstruction and analysis of the evolutionary histories of these complex, dynamic networks. Unfortunately, the methodologies for representing and exploiting such complex evolutionary histories in large scale studies are currently limited. Here, we propose a new formalism, called EvoluCode (Evolutionary barCode), which allows the integration of different evolutionary parameters (eg, sequence conservation, orthology, synteny …) in a unifying format and facilitates the multilevel analysis and visualization of complex evolutionary histories at the genome scale. The advantages of the approach are demonstrated by constructing barcodes representing the evolution of the complete human proteome. Two large-scale studies are then described: (i) the mapping and visualization of the barcodes on the human chromosomes and (ii) automatic clustering of the barcodes to highlight protein subsets sharing similar evolutionary histories and their functional analysis. The methodologies developed here open the way to the efficient application of other data mining and knowledge extraction techniques in evolutionary systems biology studies. A database containing all EvoluCode data is available at: http://lbgi.igbmc.fr/barcodes.

A photonic crystal hydrogel suspension array for the capture of blood cells from whole blood

NASA Astrophysics Data System (ADS)

Zhang, Bin; Cai, Yunlang; Shang, Luoran; Wang, Huan; Cheng, Yao; Rong, Fei; Gu, Zhongze; Zhao, Yuanjin

2016-02-01

Diagnosing hematological disorders based on the separation and detection of cells in the patient's blood is a significant challenge. We have developed a novel barcode particle-based suspension array that can simultaneously capture and detect multiple types of blood cells. The barcode particles are polyacrylamide (PAAm) hydrogel inverse opal microcarriers with characteristic reflection peak codes that remain stable during cell capture on their surfaces. The hydrophilic PAAm hydrogel scaffolds of the barcode particles can entrap various plasma proteins to capture different cells in the blood, with little damage to captured cells.Diagnosing hematological disorders based on the separation and detection of cells in the patient's blood is a significant challenge. We have developed a novel barcode particle-based suspension array that can simultaneously capture and detect multiple types of blood cells. The barcode particles are polyacrylamide (PAAm) hydrogel inverse opal microcarriers with characteristic reflection peak codes that remain stable during cell capture on their surfaces. The hydrophilic PAAm hydrogel scaffolds of the barcode particles can entrap various plasma proteins to capture different cells in the blood, with little damage to captured cells. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr06368j

Barcoding and species recognition of opportunistic pathogens in Ochroconis and Verruconis.

PubMed

Samerpitak, Kittipan; Gerrits van den Ende, Bert H G; Stielow, J Benjamin; Menken, Steph B J; de Hoog, G Sybren

2016-02-01

The genera Ochroconis and Verruconis (Sympoventuriaceae, Venturiales) have remarkably high molecular diversity despite relatively high degrees of phenotypic similarity. Tree topologies, inter-specific and intra-specific heterogeneities, barcoding gaps and reciprocal monophyly of all currently known species were analyzed. It was concluded that all currently used genes viz. SSU, ITS, LSU, ACT1, BT2, and TEF1 were unable to reach all 'gold standard' criteria of barcoding markers. They could nevertheless be used for reasonably reliable identification of species, because the markers, although variable, were associated with large inter-specific heterogeneity. Of the coding protein-genes, ACT1 revealed highest potentiality as barcoding marker in mostly all parts of the investigated sequence. SSU, LSU, ITS, and ACT1 yielded consistent monophyly in all investigated species, but only SSU and LSU generated clear barcoding gaps. For phylogeny, LSU was an informative marker, suitable to reconstruct gene-trees showing correct phylogenetic relationships. Cryptic species were revealed especially in complexes with very high intra-specific variability. When all these complexes will be taxonomically resolved, ACT1 will probably appear to be the most reliable barcoding gene for Ochroconis and Verruconis. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

Detection of HIV-1 p24 Gag in plasma by a nanoparticle-based bio-barcode-amplification method.

PubMed

Kim, Eun-Young; Stanton, Jennifer; Korber, Bette T M; Krebs, Kendall; Bogdan, Derek; Kunstman, Kevin; Wu, Samuel; Phair, John P; Mirkin, Chad A; Wolinsky, Steven M

2008-06-01

Detection of HIV-1 in patients is limited by the sensitivity and selectivity of available tests. The nanotechnology-based bio-barcode-amplification method offers an innovative approach to detect specific HIV-1 antigens from diverse HIV-1 subtypes. We evaluated the efficacy of this protein-detection method in detecting HIV-1 in men enrolled in the Chicago component of the Multicenter AIDS Cohort Study (MACS). The method relies on magnetic microparticles with antibodies that specifically bind the HIV-1 p24 Gag protein and nanoparticles that are encoded with DNA and antibodies that can sandwich the target protein captured by the microparticle-bound antibodies. The aggregate sandwich structures are magnetically separated from solution, and treated to remove the conjugated barcode DNA. The DNA barcodes (hundreds per target) were identified by a nanoparticle-based detection method that does not rely on PCR. Of 112 plasma samples from HIV-1-infected subjects, 111 were positive for HIV-1 p24 Gag protein (range: 0.11-71.5 ng/ml of plasma) by the bio-barcode-amplification method. HIV-1 p24 Gag protein was detected in only 23 out of 112 men by the conventional ELISA. A total of 34 uninfected subjects were negative by both tests. Thus, the specificity of the bio-barcode-amplification method was 100% and the sensitivity 99%. The bio-barcode-amplification method detected HIV-1 p24 Gag protein in plasma from all study subjects with less than 200 CD4(+) T cells/microl of plasma (100%) and 19 out of 20 (95%) HIV-1-infected men who had less than 50 copies/ml of plasma of HIV-1 RNA. In a separate group of 60 diverse international isolates, representative of clades A, B, C and D and circulating recombinant forms CRF01_AE and CRF02_AG, the bio-barcode-amplification method identified the presence of virus correctly. The bio-barcode-amplification method was superior to the conventional ELISA assay for the detection of HIV-1 p24 Gag protein in plasma with a breadth of coverage for diverse HIV-1 subtypes. Because the bio-barcode-amplification method does not require enzymatic amplification, this method could be translated into a robust point-of-care test.

A report on identification of sequence polymorphism in barcode region of six commercially important Cymbopogon species.

PubMed

Bishoyi, Ashok Kumar; Kavane, Aarti; Sharma, Anjali; Geetha, K A

2017-02-01

CYMBOPOGON: is an important member of grass family Poaceae, cultivated for essential oils which have greater medicinal and industrial value. Taxonomic identification of Cymbopogon species is determined mainly by morphological markers, odour of essential oils and concentration of bioactive compounds present in the oil matrices which are highly influenced by environment. Authenticated molecular marker based taxonomical identification is also lacking in the genus; hence effort was made to evaluate potential DNA barcode loci in six commercially important Cymbopogon species for their individual discrimination and authentication at the species level. Four widely used DNA barcoding regions viz., ITS 1 & ITS 2 spacers, matK, psbA-trnH and rbcL were taken for the study. Gene sequences of the same or related genera of the concerned loci were mined from NCBI domain and primers were designed and validated for barcode loci amplification. Out of the four loci studied, sequences from matK and ITS spacer loci revealed 0.46% and 5.64% nucleotide sequence diversity, respectively whereas the other two loci i.e., psbA-trnH and rbcL showed 100% sequence homology. The newly developed primers can be used for barcode loci amplification in the genus Cymbopogon. The identified Single Nucleotide Polymorphisms from the studied sequences may be used as barcodes for the six Cymbopogon species. The information generated can also be utilized for barcode development of the genus by including more number of Cymbopgon species in future.

Developing a DNA barcode library for perciform fishes in the South China Sea: Species identification, accuracy and cryptic diversity.

PubMed

Hou, Gang; Chen, Wei-Tao; Lu, Huo-Sheng; Cheng, Fei; Xie, Song-Guang

2018-01-01

DNA barcodes were studied for 1,353 specimens representing 272 morphological species belonging to 149 genera and 55 families of Perciformes from the South China Sea (SCS). The average Kimura 2-parameter (K2P) distances within species, genera and families were 0.31%, 8.71% and 14.52%, respectively. A neighbour-joining (NJ) tree, Bayesian inference (BI) and maximum-likelihood (ML) trees and Automatic Barcode Gap Discovery (ABGD) revealed 260, 253 and 259 single-species-representing clusters, respectively. Barcoding gap analysis (BGA) demonstrated that barcode gaps were present for 178 of 187 species analysed with multiple specimens (95.2%), with the minimum interspecific distance to the nearest neighbour larger than the maximum intraspecific distance. A group of three Thunnus species (T. albacares, T. obesus and T. tonggol), a pair of Gerres species (G. oyena and G. japonicus), a pair of Istiblennius species (I. edentulous and I. lineatus) and a pair of Uranoscopus species (U. oligolepis and U. kaianus) were observed with low interspecific distances and overlaps between intra- and interspecific genetic distances. Three species (Apogon ellioti, Naucrates ductor and Psenopsis anomala) showed deep intraspecific divergences and generated two lineages each, suggesting the possibility of cryptic species. Our results demonstrated that DNA barcodes are highly reliable for delineating species of Perciformes in the SCS. The DNA barcode library established in this study will shed light on further research on the diversity of Perciformes in the SCS. © 2017 John Wiley & Sons Ltd.

Systematic Validation and Atomic Force Microscopy of Non-Covalent Short Oligonucleotide Barcode Microarrays

PubMed Central

Cook, Michael A.; Chan, Chi-Kin; Jorgensen, Paul; Ketela, Troy; So, Daniel; Tyers, Mike; Ho, Chi-Yip

2008-01-01

Background Molecular barcode arrays provide a powerful means to analyze cellular phenotypes in parallel through detection of short (20–60 base) unique sequence tags, or “barcodes”, associated with each strain or clone in a collection. However, costs of current methods for microarray construction, whether by in situ oligonucleotide synthesis or ex situ coupling of modified oligonucleotides to the slide surface are often prohibitive to large-scale analyses. Methodology/Principal Findings Here we demonstrate that unmodified 20mer oligonucleotide probes printed on conventional surfaces show comparable hybridization signals to covalently linked 5′-amino-modified probes. As a test case, we undertook systematic cell size analysis of the budding yeast Saccharomyces cerevisiae genome-wide deletion collection by size separation of the deletion pool followed by determination of strain abundance in size fractions by barcode arrays. We demonstrate that the properties of a 13K unique feature spotted 20 mer oligonucleotide barcode microarray compare favorably with an analogous covalently-linked oligonucleotide array. Further, cell size profiles obtained with the size selection/barcode array approach recapitulate previous cell size measurements of individual deletion strains. Finally, through atomic force microscopy (AFM), we characterize the mechanism of hybridization to unmodified barcode probes on the slide surface. Conclusions/Significance These studies push the lower limit of probe size in genome-scale unmodified oligonucleotide microarray construction and demonstrate a versatile, cost-effective and reliable method for molecular barcode analysis. PMID:18253494

Improving the Conservation of Mediterranean Chondrichthyans: The ELASMOMED DNA Barcode Reference Library

PubMed Central

Arculeo, Marco; Bonello, Juan J.; Bonnici, Leanne; Cannas, Rita; Carbonara, Pierluigi; Cau, Alessandro; Charilaou, Charis; El Ouamari, Najib; Fiorentino, Fabio; Follesa, Maria Cristina; Garofalo, Germana; Golani, Daniel; Guarniero, Ilaria; Hanner, Robert; Hemida, Farid; Kada, Omar; Lo Brutto, Sabrina; Mancusi, Cecilia; Morey, Gabriel; Schembri, Patrick J.; Serena, Fabrizio; Sion, Letizia; Stagioni, Marco; Tursi, Angelo; Vrgoc, Nedo; Steinke, Dirk; Tinti, Fausto

2017-01-01

Cartilaginous fish are particularly vulnerable to anthropogenic stressors and environmental change because of their K-selected reproductive strategy. Accurate data from scientific surveys and landings are essential to assess conservation status and to develop robust protection and management plans. Currently available data are often incomplete or incorrect as a result of inaccurate species identifications, due to a high level of morphological stasis, especially among closely related taxa. Moreover, several diagnostic characters clearly visible in adult specimens are less evident in juveniles. Here we present results generated by the ELASMOMED Consortium, a regional network aiming to sample and DNA-barcode the Mediterranean Chondrichthyans with the ultimate goal to provide a comprehensive DNA barcode reference library. This library will support and improve the molecular taxonomy of this group and the effectiveness of management and conservation measures. We successfully barcoded 882 individuals belonging to 42 species (17 sharks, 24 batoids and one chimaera), including four endemic and several threatened ones. Morphological misidentifications were found across most orders, further confirming the need for a comprehensive DNA barcoding library as a valuable tool for the reliable identification of specimens in support of taxonomist who are reviewing current identification keys. Despite low intraspecific variation among their barcode sequences and reduced samples size, five species showed preliminary evidence of phylogeographic structure. Overall, the ELASMOMED initiative further emphasizes the key role accurate DNA barcoding libraries play in establishing reliable diagnostic species specific features in otherwise taxonomically problematic groups for biodiversity management and conservation actions. PMID:28107413

The unholy trinity: taxonomy, species delimitation and DNA barcoding

PubMed Central

DeSalle, Rob; Egan, Mary G; Siddall, Mark

2005-01-01

Recent excitement over the development of an initiative to generate DNA sequences for all named species on the planet has in our opinion generated two major areas of contention as to how this ‘DNA barcoding’ initiative should proceed. It is critical that these two issues are clarified and resolved, before the use of DNA as a tool for taxonomy and species delimitation can be universalized. The first issue concerns how DNA data are to be used in the context of this initiative; this is the DNA barcode reader problem (or barcoder problem). Currently, many of the published studies under this initiative have used tree building methods and more precisely distance approaches to the construction of the trees that are used to place certain DNA sequences into a taxonomic context. The second problem involves the reaction of the taxonomic community to the directives of the ‘DNA barcoding’ initiative. This issue is extremely important in that the classical taxonomic approach and the DNA approach will need to be reconciled in order for the ‘DNA barcoding’ initiative to proceed with any kind of community acceptance. In fact, we feel that DNA barcoding is a misnomer. Our preference is for the title of the London meetings—Barcoding Life. In this paper we discuss these two concerns generated around the DNA barcoding initiative and attempt to present a phylogenetic systematic framework for an improved barcoder as well as a taxonomic framework for interweaving classical taxonomy with the goals of ‘DNA barcoding’. PMID:16214748

Molecular Approach to the Identification of Fish in the South China Sea

PubMed Central

Zhang, Junbin; Hanner, Robert

2012-01-01

Background DNA barcoding is one means of establishing a rapid, accurate, and cost-effective system for the identification of species. It involves the use of short, standard gene targets to create sequence profiles of known species against sequences of unknowns that can be matched and subsequently identified. The Fish Barcode of Life (FISH-BOL) campaign has the primary goal of gathering DNA barcode records for all the world's fish species. As a contribution to FISH-BOL, we examined the degree to which DNA barcoding can discriminate marine fishes from the South China Sea. Methodology/Principal Findings DNA barcodes of cytochrome oxidase subunit I (COI) were characterized using 1336 specimens that belong to 242 species fishes from the South China Sea. All specimen provenance data (including digital specimen images and geospatial coordinates of collection localities) and collateral sequence information were assembled using Barcode of Life Data System (BOLD; www.barcodinglife.org). Small intraspecific and large interspecific differences create distinct genetic boundaries among most species. In addition, the efficiency of two mitochondrial genes, 16S rRNA (16S) and cytochrome b (cytb), and one nuclear ribosomal gene, 18S rRNA (18S), was also evaluated for a few select groups of species. Conclusions/Significance The present study provides evidence for the effectiveness of DNA barcoding as a tool for monitoring marine biodiversity. Open access data of fishes from the South China Sea can benefit relative applications in ecology and taxonomy. PMID:22363454

DNA barcoding of Rhodiola (crassulaceae): a case study on a group of recently diversified medicinal plants from the Qinghai-Tibetan Plateau.

PubMed

Zhang, Jian-Qiang; Meng, Shi-Yong; Wen, Jun; Rao, Guang-Yuan

2015-01-01

DNA barcoding, the identification of species using one or a few short standardized DNA sequences, is an important complement to traditional taxonomy. However, there are particular challenges for barcoding plants, especially for species with complex evolutionary histories. We herein evaluated the utility of five candidate sequences - rbcL, matK, trnH-psbA, trnL-F and the internal transcribed spacer (ITS) - for barcoding Rhodiola species, a group of high-altitude plants frequently used as adaptogens, hemostatics and tonics in traditional Tibetan medicine. Rhodiola was suggested to have diversified rapidly recently. The genus is thus a good model for testing DNA barcoding strategies for recently diversified medicinal plants. This study analyzed 189 accessions, representing 47 of the 55 recognized Rhodiola species in the Flora of China treatment. Based on intraspecific and interspecific divergence and degree of monophyly statistics, ITS was the best single-locus barcode, resolving 66% of the Rhodiola species. The core combination rbcL+matK resolved only 40.4% of them. Unsurprisingly, the combined use of all five loci provided the highest discrimination power, resolving 80.9% of the species. However, this is weaker than the discrimination power generally reported in barcoding studies of other plant taxa. The observed complications may be due to the recent diversification, incomplete lineage sorting and reticulate evolution of the genus. These processes are common features of numerous plant groups in the high-altitude regions of the Qinghai-Tibetan Plateau.

Plasmodium falciparum parasite population structure and gene flow associated to anti-malarial drugs resistance in Cambodia.

PubMed

Dwivedi, Ankit; Khim, Nimol; Reynes, Christelle; Ravel, Patrice; Ma, Laurence; Tichit, Magali; Bourchier, Christiane; Kim, Saorin; Dourng, Dany; Khean, Chanra; Chim, Pheaktra; Siv, Sovannaroth; Frutos, Roger; Lek, Dysoley; Mercereau-Puijalon, Odile; Ariey, Frédéric; Menard, Didier; Cornillot, Emmanuel

2016-06-14

Western Cambodia is recognized as the epicentre of emergence of Plasmodium falciparum multi-drug resistance. The emergence of artemisinin resistance has been observed in this area since 2008-2009 and molecular signatures associated to artemisinin resistance have been characterized in k13 gene. At present, one of the major threats faced, is the possible spread of Asian artemisinin resistant parasites over the world threatening millions of people and jeopardizing malaria elimination programme efforts. To anticipate the diffusion of artemisinin resistance, the identification of the P. falciparum population structure and the gene flow among the parasite population in Cambodia are essential. To this end, a mid-throughput PCR-LDR-FMA approach based on LUMINEX technology was developed to screen for genetic barcode in 533 blood samples collected in 2010-2011 from 16 health centres in malaria endemics areas in Cambodia. Based on successful typing of 282 samples, subpopulations were characterized along the borders of the country. Each 11-loci barcode provides evidence supporting allele distribution gradient related to subpopulations and gene flow. The 11-loci barcode successfully identifies recently emerging parasite subpopulations in western Cambodia that are associated with the C580Y dominant allele for artemisinin resistance in k13 gene. A subpopulation was identified in northern Cambodia that was associated to artemisinin (R539T resistant allele of k13 gene) and mefloquine resistance. The gene flow between these subpopulations might have driven the spread of artemisinin resistance over Cambodia.

Overview of RFID technology and its applications in the food industry.

PubMed

Kumar, P; Reinitz, H W; Simunovic, J; Sandeep, K P; Franzon, P D

2009-10-01

Radio frequency identification (RFID) is an alternative technology with a potential to replace traditional universal product code (UPC) barcodes. RFID enables identification of an object from a distance without requiring a line of sight. RFID tags can also incorporate additional data such as details of product and manufacturer and can transmit measured environmental factors such as temperature and relative humidity. This article presents key concepts and terminology related to RFID technology and its applications in the food industry. Components and working principles of an RFID system are described. Numerous applications of RFID technology in the food industry (supply chain management, temperature monitoring of foods, and ensuring food safety) are discussed. Challenges in implementation of RFID technology are also discussed in terms of read range, read accuracy, nonuniform standards, cost, recycling issues, privacy, and security concerns.