Cytological diploidization of paleopolyploid genus Zea: Divergence between homoeologous chromosomes or activity of pairing regulator genes?

PubMed Central

2018-01-01

Cytological diploidization process is different in autopolyploid and allopolyploid species. Colchicine applied at the onset of meiosis suppresses the effect of pairing regulator genes resulting multivalents formation in bivalent-forming species. Colchicine treated maizes (4x = 2n = 20, AmAmBmBm) showed up to 5IV, suggesting pairing between chromosomes from genomes homoeologous Am and Bm. In untreated individuals of the alloautooctoploid Zea perennis (8x = 2n = 40, ApApAp´Ap´Bp1Bp1Bp2Bp2) the most frequent configuration was 5IV+10II (formed by A and B genomes, respectively). The colchicine treated Z. perennis show up to 10IV revealing higher affinity within genomes A and B, but any homology among them. These results suggest the presence of a paring regulator locus (PrZ) in maize and Z. perennis, whose expression is suppressed by colchicine. It could be postulated that in Z. perennis, PrZ would affect independently the genomes A and B, being relevant the threshold of homology, the fidelity of pairing in each genomes and the ploidy level. Cytological analysis of the treated hexaploid hybrids (6x = 2n = 30), with Z. perennis as a parental, strongly suggests that PrZ is less effective in only one doses. This conclusion was reinforced by the homoeologous pairing observed in untreated dihaploid maizes, which showed up to 5II. Meiotic behaviour of individuals treated with different doses of colchicine allowed to postulate that PrZ affect the homoeologous association by controlling entire genomes (Am or Bm) rather than individual chromosomes. Based on cytological and statistical results it is possible to propose that the cytological diploidization in Zea species occurs by restriction of pairing between homoeologous chromosomes or by genetical divergence of the homoeologous chromosomes, as was observed in untreated Z. mays ssp. parviglumis. These are independent but complementary systems and could be acting jointly in the same nucleus. PMID:29293518

Cytological diploidization of paleopolyploid genus Zea: Divergence between homoeologous chromosomes or activity of pairing regulator genes?

PubMed

Poggio, Lidia; González, Graciela Esther

2018-01-01

Cytological diploidization process is different in autopolyploid and allopolyploid species. Colchicine applied at the onset of meiosis suppresses the effect of pairing regulator genes resulting multivalents formation in bivalent-forming species. Colchicine treated maizes (4x = 2n = 20, AmAmBmBm) showed up to 5IV, suggesting pairing between chromosomes from genomes homoeologous Am and Bm. In untreated individuals of the alloautooctoploid Zea perennis (8x = 2n = 40, ApApAp´Ap´Bp1Bp1Bp2Bp2) the most frequent configuration was 5IV+10II (formed by A and B genomes, respectively). The colchicine treated Z. perennis show up to 10IV revealing higher affinity within genomes A and B, but any homology among them. These results suggest the presence of a paring regulator locus (PrZ) in maize and Z. perennis, whose expression is suppressed by colchicine. It could be postulated that in Z. perennis, PrZ would affect independently the genomes A and B, being relevant the threshold of homology, the fidelity of pairing in each genomes and the ploidy level. Cytological analysis of the treated hexaploid hybrids (6x = 2n = 30), with Z. perennis as a parental, strongly suggests that PrZ is less effective in only one doses. This conclusion was reinforced by the homoeologous pairing observed in untreated dihaploid maizes, which showed up to 5II. Meiotic behaviour of individuals treated with different doses of colchicine allowed to postulate that PrZ affect the homoeologous association by controlling entire genomes (Am or Bm) rather than individual chromosomes. Based on cytological and statistical results it is possible to propose that the cytological diploidization in Zea species occurs by restriction of pairing between homoeologous chromosomes or by genetical divergence of the homoeologous chromosomes, as was observed in untreated Z. mays ssp. parviglumis. These are independent but complementary systems and could be acting jointly in the same nucleus.

Sythesis of MCMC and Belief Propagation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ahn, Sungsoo; Chertkov, Michael; Shin, Jinwoo

Markov Chain Monte Carlo (MCMC) and Belief Propagation (BP) are the most popular algorithms for computational inference in Graphical Models (GM). In principle, MCMC is an exact probabilistic method which, however, often suffers from exponentially slow mixing. In contrast, BP is a deterministic method, which is typically fast, empirically very successful, however in general lacking control of accuracy over loopy graphs. In this paper, we introduce MCMC algorithms correcting the approximation error of BP, i.e., we provide a way to compensate for BP errors via a consecutive BP-aware MCMC. Our framework is based on the Loop Calculus (LC) approach whichmore » allows to express the BP error as a sum of weighted generalized loops. Although the full series is computationally intractable, it is known that a truncated series, summing up all 2-regular loops, is computable in polynomial-time for planar pair-wise binary GMs and it also provides a highly accurate approximation empirically. Motivated by this, we first propose a polynomial-time approximation MCMC scheme for the truncated series of general (non-planar) pair-wise binary models. Our main idea here is to use the Worm algorithm, known to provide fast mixing in other (related) problems, and then design an appropriate rejection scheme to sample 2-regular loops. Furthermore, we also design an efficient rejection-free MCMC scheme for approximating the full series. The main novelty underlying our design is in utilizing the concept of cycle basis, which provides an efficient decomposition of the generalized loops. In essence, the proposed MCMC schemes run on transformed GM built upon the non-trivial BP solution, and our experiments show that this synthesis of BP and MCMC outperforms both direct MCMC and bare BP schemes.« less

Optical Properties of Vibronically Coupled Cy3 Dimers on DNA Scaffolds.

PubMed

Cunningham, Paul D; Kim, Young C; Díaz, Sebastián A; Buckhout-White, Susan; Mathur, Divita; Medintz, Igor L; Melinger, Joseph S

2018-05-17

We examine the effect of electronic coupling on the optical properties of Cy3 dimers attached to DNA duplexes as a function of base pair (bp) separation using steady-state and time-resolved spectroscopy. For close Cy3-Cy3 separations, 0 and 1 bp between dyes, intermediate to strong electronic coupling is revealed by modulation of the absorption and fluorescence properties including spectral band shape, peak wavelength, and excited-state lifetime. Using a vibronic exciton model, we estimate coupling strengths of 150 and 266 cm -1 for the 1 and 0 bp separations, respectively, which are comparable to those found in natural light-harvesting complexes. For the strongest electronic coupling (0 bp separation), we observe that the absorption band shape is strongly affected by the base pairs that surround the dyes, where more strongly hydrogen-bonded G-C pairs produce a red-shifted absorption spectrum consistent with a J-type dimer. This effect is studied theoretically using molecular dynamics simulation, which predicts an in-line dye configuration that is consistent with the experimental J-type spectrum. When the Cy3 dimers are in a standard aqueous buffer, the presence of relatively strong electronic coupling is accompanied by decreased fluorescence lifetime, suggesting that it promotes nonradiative relaxation in cyanine dyes. However, we show that the use of a viscous solvent can suppress this nonradiative recombination and thereby restore the dimer fluorescent emission. Ultrafast transient absorption measurements of Cy3 dimers in both standard aqueous buffer and viscous glycerol buffer suggest that sufficiently strong electronic coupling increases the probability of excited-state relaxation through a dark state that is related to Cy3 torsional motion.

Characterization and classification of one new cytoplasmic male sterility (CMS) line based on morphological, cytological and molecular markers in non-heading Chinese cabbage (Brassica rapa L.).

PubMed

Heng, Shuangping; Shi, Dianyi; Hu, Zhenhua; Huang, Tao; Li, Jinping; Liu, Liyan; Xia, Chunxiu; Yuan, Zhenzhen; Xu, Yuejin; Fu, Tingdong; Wan, Zhengjie

2015-09-01

A new non-heading Chinese cabbage CMS line M119A was characterized and specific molecular markers were developed to classify different CMS types. One new non-heading Chinese cabbage (Brassica rapa L.) cytoplasmic male sterile (CMS) line M119A was obtained by interspecific crosses between the recently discovered hau CMS line of Brassica juncea and B. rapa. Furthermore, the line was characterized and compared with other five isonuclear-alloplasmic CMS lines. The M119A line produced six stamens without pollen and only two stamen fused together in fewer flowers. Tissue section indicated that anther abortion in M119A may have occurred during differentiation of the archesporial cells without pollen sac. All the six CMS lines were grouped into three types based on the presence of three PCR fragments of 825, 465 and 772 bp amplified with different mitochondrial genes specific primers. The 825-bp fragment was amplified both in 09-10A and H201A using the specific primer pair P-orf224-atp6, and showed 100 % identity with the mitochondrial gene of pol CMS. The 465-bp fragment was amplified in 30A and 105A using the primer pair P-orf138 and shared 100 % identity with the mitochondrial gene of ogu CMS. The 772-bp fragment was amplified in M119A and H203A using the primer pair P-orf288 and showed 100 % identity with the mitochondrial gene of hau CMS. Therefore, these markers could efficiently distinguish different types of isonuclear-alloplasmic CMS lines of non-heading Chinese cabbage, which were useful for improving the efficiency of cross-breeding and heterosis utilization in cruciferous vegetables.

The complete mitochondrial genome structure of snow leopard Panthera uncia.

PubMed

Wei, Lei; Wu, Xiaobing; Jiang, Zhigang

2009-05-01

The complete mitochondrial genome (mtDNA) of snow leopard Panthera uncia was obtained by using the polymerase chain reaction (PCR) technique based on the PCR fragments of 30 primers we designed. The entire mtDNA sequence was 16 773 base pairs (bp) in length, and the base composition was: A-5,357 bp (31.9%); C-4,444 bp (26.5%); G-2,428 bp (14.5%); T-4,544 bp (27.1%). The structural characteristics [0] of the P. uncia mitochondrial genome were highly similar to these of Felis catus, Acinonyx jubatus, Neofelis nebulosa and other mammals. However, we found several distinctive features of the mitochondrial genome of Panthera unica. First, the termination codon of COIII was TAA, which differed from those of F. catus, A. jubatus and N. nebulosa. Second, tRNA(Ser) ((AGY)), which lacked the ''DHU'' arm, could not be folded into the typical cloverleaf-shaped structure. Third, in the control region, a long repetitive sequence in RS-2 (32 bp) region was found with 2 repeats while one short repetitive segment (9 bp) was found with 15 repeats in the RS-3 region. We performed phylogenetic analysis based on a 3 816 bp concatenated sequence of 12S rRNA, 16S rRNA, ND2, ND4, ND5, Cyt b and ATP8 for P. uncia and other related species, the result indicated that P. uncia and P. leo were the sister species, which was different from the previous findings.

Intrafamilial aggregation and heritability of office-day blood pressure difference in a community of African ancestry: implications for genetic association studies.

PubMed

Djami-Tchatchou, Arnaud T; Norton, Gavin R; Redelinghuys, Michelle; Maseko, Muzi J; Majane, Olebogeng H I; Woodiwiss, Angela J

2014-12-01

An inability to show consistent relationships between gene variants and blood pressure (BP) may be confounded by the use of office BP measurement. Whether the difference between office BP and day BP (office-day) is genetically predetermined is unknown. We therefore aimed to determine the intrafamilial aggregation and heritability of office-day BP. Nurse-derived office BP (mean of 5 measurements according to guidelines) and 24-h ambulatory BP were determined for 592 participants from 198 families (67 spouse pairs, 361 parent-child pairs, and 169 sibling-sibling pairs), with 12 families having three generations, from an urban developing community of black Africans. Heritability estimates were determined using SAGE software. With adjustments for confounders, office systolic BP (SBP) (h=0.35±0.09, P<0.0001) showed comparable heritability estimates to 24-h SBP (h=0.33±0.09, P<0.0001). Similarly, with adjustments for confounders, office diastolic BP (DBP) (h=0.37±0.09, P<0.0001) showed comparable heritability estimates as 24-h DBP (h=0.35±0.09, P<0.0001). However, multivariate adjusted heritability estimates of day SBP (h=0.29±0.09, P<0.0001) and DBP (h=0.33±0.09, P<0.0001) were not diminished by further adjustments for office SBP (h=0.42±0.09, P<0.0001) or DBP (h=0.34±0.09, P<0.0001). Further, independent of confounders, office-day BP showed significant intrafamilial aggregation and heritability (SBP: h=0.51±0.10, P<0.0001; DBP: h=0.37±0.09, P<0.0001), effects that persisted with further adjustments for office, day, or day-night BP (P<0.0005 for SBP and DBP). Although office and ambulatory BP may show similar heritability estimates, genetic associations with carefully determined office BP measurements may be confounded by the heritability of office-day BP differences.

A nested multiplex polymerase chain reaction assay for the differential identification of three zooanthroponotic chlamydial strains in porcine swab samples.

PubMed

Li, Yingguo; Wang, Yu; Nie, Fuping; Xiao, Jinwen; Wang, Guoming; Yuan, Ling; Li, Zhengguo

2011-07-01

Porcine chlamydial infection is an enzootic infectious disease caused by multiple members of the family Chlamydiaceae (e.g. Chlamydophila abortus, Chlamydia suis, and Chlamydophila pneumoniae). Rapid and accurate differentiation of these pathogens is critical in the control and prevention of disease. The aim of the current study was to develop a nested multiplex polymerase chain reaction (nmPCR) assay to simultaneously detect the 3 chlamydial pathogens in clinical samples. In the first round of the nmPCR, 1 pair of family-specific primers were used to amplify the 1,100 base pair (bp) fragment of chlamydial ompA gene. In the second round of the nmPCR, 4 inner primers were designed for Ch. abortus, C. suis, and Ch. pneumoniae. Each pathogen produced a specific amplicon with a size of 340 bp, 526 bp, and 267 bp respectively. The assay was sensitive and specific for detecting target pathogens in both cell cultures and clinical specimens. The results, incorporated with the improved rapid DNA extraction protocol, suggest that the nmPCR could be a promising assay for differential identification of different chlamydial strains in pigs.

Interfacial properties of black phosphorus/transition metal carbide van der Waals heterostructures

NASA Astrophysics Data System (ADS)

Yuan, Hao; Li, Zhenyu

2018-06-01

Owing to its outstanding electronic properties, black phosphorus (BP) is considered as a promising material for next-generation optoelectronic devices. In this work, devices based on BP/MXene (Zr n+1C n T2, T = O, F, OH, n = 1, 2) van der Waals (vdW) heterostructures are designed via first-principles calculations. Zr n+1C n T2 compositions with appropriate work functions lead to the formation of Ohmic contact with BP in the vertical direction. Low Schottky barriers are found along the lateral direction in BP/Zr2CF2, BP/Zr2CO2H2, BP/Zr3C2F2, and BP/Zr3C2O2H2 bilayers, and BP/Zr3C2O2 even exhibits Ohmic contact behavior. BP/Zr2CO2 is a semiconducting heterostructure with type-II band alignment, which facilitates the separation of electron-hole pairs. The band structure of BP/Zr2CO2 can be effectively tuned via a perpendicular electric field, and BP is predicted to undergo a transition from donor to acceptor at a 0.4 V/Å electric field. The versatile electronic properties of the BP/MXene heterostructures examined in this work highlight their promising potential for applications in electronics.

Draft genome of tule elk Cervus canadensis nannodes.

PubMed

Mizzi, Jessica E; Lounsberry, Zachary T; Brown, C Titus; Sacks, Benjamin N

2017-01-01

This paper presents the first draft genome of the tule elk ( Cervus elaphus nannodes ), a subspecies native to California that underwent an extreme genetic bottleneck in the late 1800s.  The genome was generated from Illumina HiSeq 3000 whole genome sequencing of four individuals, resulting in the assembly of 2.395 billion base pairs (Gbp) over 602,862 contigs over 500 bp and N50 = 6,885 bp. This genome provides a resource to facilitate future genomic research on elk and other cervids.

The complete chloroplast genome of Sinopodophyllum hexandrum Ying (Berberidaceae).

PubMed

Meng, Lihua; Liu, Ruijuan; Chen, Jianbing; Ding, Chenxu

2017-05-01

The complete nucleotide sequence of the Sinopodophyllum hexandrum Ying chloroplast genome (cpDNA) was determined based on next-generation sequencing technologies in this study. The genome was 157 203 bp in length, containing a pair of inverted repeat (IRa and IRb) regions of 25 960 bp, which were separated by a large single-copy (LSC) region of 87 065 bp and a small single-copy (SSC) region of 18 218 bp, respectively. The cpDNA contained 148 genes, including 96 protein-coding genes, 8 ribosomal RNA genes, and 44 tRNA genes. In these genes, eight harbored a single intron, and two (ycf3 and clpP) contained a couple of introns. The cpDNA AT content of S. hexandrum cpDNA is 61.5%.

Assembly of human C-terminal binding protein (CtBP) into tetramers.

PubMed

Bellesis, Andrew G; Jecrois, Anne M; Hayes, Janelle A; Schiffer, Celia A; Royer, William E

2018-06-08

C-terminal binding protein 1 (CtBP1) and CtBP2 are transcriptional coregulators that repress numerous cellular processes, such as apoptosis, by binding transcription factors and recruiting chromatin-remodeling enzymes to gene promoters. The NAD(H)-linked oligomerization of human CtBP is coupled to its co-transcriptional activity, which is implicated in cancer progression. However, the biologically relevant level of CtBP assembly has not been firmly established; nor has the stereochemical arrangement of the subunits above that of a dimer. Here, multi-angle light scattering (MALS) data established the NAD + - and NADH-dependent assembly of CtBP1 and CtBP2 into tetramers. An examination of subunit interactions within CtBP1 and CtBP2 crystal lattices revealed that both share a very similar tetrameric arrangement resulting from assembly of two dimeric pairs, with specific interactions probably being sensitive to NAD(H) binding. Creating a series of mutants of both CtBP1 and CtBP2, we tested the hypothesis that the crystallographically observed interdimer pairing stabilizes the solution tetramer. MALS data confirmed that these mutants disrupt both CtBP1 and CtBP2 tetramers, with the dimer generally remaining intact, providing the first stereochemical models for tetrameric assemblies of CtBP1 and CtBP2. The crystal structure of a subtle destabilizing mutant suggested that small structural perturbations of the hinge region linking the substrate- and NAD-binding domains are sufficient to weaken the CtBP1 tetramer. These results strongly suggest that the tetramer is important in CtBP function, and the series of CtBP mutants reported here can be used to investigate the physiological role of the tetramer. © 2018 Bellesis et al.

Simultaneous compared with sequential blood pressure measurement results in smaller inter-arm blood pressure differences.

PubMed

van der Hoeven, Niels V; Lodestijn, Sophie; Nanninga, Stephanie; van Montfrans, Gert A; van den Born, Bert-Jan H

2013-11-01

There are currently few recommendations on how to assess inter-arm blood pressure (BP) differences. The authors compared simultaneous with sequential measurement on mean BP, inter-arm BP differences, and within-visit reproducibility in 240 patients stratified according to age (<50 or ≥60 years) and BP (<140/90 mm Hg or ≥140/90 mm Hg). Three simultaneous and three sequential BP measurements were taken in each patient. Starting measurement type and starting arm for sequential measurements were randomized. Mean BP and inter-arm BP differences of the first pair and reproducibility of inter-arm BP differences of the first and second pair were compared between both methods. Mean systolic BP was 1.3±7.5 mm Hg lower during sequential compared with simultaneous measurement (P<.01). However, the first sequential measurement was on average higher than the second, suggesting an order effect. Absolute systolic inter-arm BP differences were smaller on simultaneous (6.2±6.7/3.3±3.5 mm Hg) compared with sequential BP measurement (7.8±7.3/4.6±5.6 mm Hg, P<.01 for both). Within-visit reproducibility was identical (both r=0.60). Simultaneous measurement of BP at both arms reduces order effects and results in smaller inter-arm BP differences, thereby potentially reducing unnecessary referral and diagnostic procedures. ©2013 Wiley Periodicals, Inc.

Bioinformatics analysis and detection of gelatinase encoded gene in Lysinibacillussphaericus

NASA Astrophysics Data System (ADS)

Repin, Rul Aisyah Mat; Mutalib, Sahilah Abdul; Shahimi, Safiyyah; Khalid, Rozida Mohd.; Ayob, Mohd. Khan; Bakar, Mohd. Faizal Abu; Isa, Mohd Noor Mat

2016-11-01

In this study, we performed bioinformatics analysis toward genome sequence of Lysinibacillussphaericus (L. sphaericus) to determine gene encoded for gelatinase. L. sphaericus was isolated from soil and gelatinase species-specific bacterium to porcine and bovine gelatin. This bacterium offers the possibility of enzymes production which is specific to both species of meat, respectively. The main focus of this research is to identify the gelatinase encoded gene within the bacteria of L. Sphaericus using bioinformatics analysis of partially sequence genome. From the research study, three candidate gene were identified which was, gelatinase candidate gene 1 (P1), NODE_71_length_93919_cov_158.931839_21 which containing 1563 base pair (bp) in size with 520 amino acids sequence; Secondly, gelatinase candidate gene 2 (P2), NODE_23_length_52851_cov_190.061386_17 which containing 1776 bp in size with 591 amino acids sequence; and Thirdly, gelatinase candidate gene 3 (P3), NODE_106_length_32943_cov_169.147919_8 containing 1701 bp in size with 566 amino acids sequence. Three pairs of oligonucleotide primers were designed and namely as, F1, R1, F2, R2, F3 and R3 were targeted short sequences of cDNA by PCR. The amplicons were reliably results in 1563 bp in size for candidate gene P1 and 1701 bp in size for candidate gene P3. Therefore, the results of bioinformatics analysis of L. Sphaericus resulting in gene encoded gelatinase were identified.

Micrometer-Scale Ballistic Transport of Electron Pairs in LaAlO_{3}/SrTiO_{3} Nanowires.

PubMed

Tomczyk, Michelle; Cheng, Guanglei; Lee, Hyungwoo; Lu, Shicheng; Annadi, Anil; Veazey, Joshua P; Huang, Mengchen; Irvin, Patrick; Ryu, Sangwoo; Eom, Chang-Beom; Levy, Jeremy

2016-08-26

High-mobility complex-oxide heterostructures and nanostructures offer new opportunities for extending the paradigm of quantum transport beyond the realm of traditional III-V or carbon-based materials. Recent quantum transport investigations with LaAlO_{3}/SrTiO_{3}-based quantum dots reveal the existence of a strongly correlated phase in which electrons form spin-singlet pairs without becoming superconducting. Here, we report evidence for the micrometer-scale ballistic transport of electron pairs in quasi-1D LaAlO_{3}/SrTiO_{3} nanowire cavities. In the paired phase, Fabry-Perot-like quantum interference is observed, in sync with conductance oscillations observed in the superconducting regime (at a zero magnetic field). Above a critical magnetic field B_{p}, the electron pairs unbind and the conductance oscillations shift with the magnetic field. These experimental observations extend the regime of ballistic electronic transport to strongly correlated phases.

SMM-system: A mining tool to identify specific markers in Salmonella enterica.

PubMed

Yu, Shuijing; Liu, Weibing; Shi, Chunlei; Wang, Dapeng; Dan, Xianlong; Li, Xiao; Shi, Xianming

2011-03-01

This report presents SMM-system, a software package that implements various personalized pre- and post-BLASTN tasks for mining specific markers of microbial pathogens. The main functionalities of SMM-system are summarized as follows: (i) converting multi-FASTA file, (ii) cutting interesting genomic sequence, (iii) automatic high-throughput BLASTN searches, and (iv) screening target sequences. The utility of SMM-system was demonstrated by using it to identify 214 Salmonella enterica-specific protein-coding sequences (CDSs). Eighteen primer pairs were designed based on eighteen S. enterica-specific CDSs, respectively. Seven of these primer pairs were validated with PCR assay, which showed 100% inclusivity for the 101 S. enterica genomes and 100% exclusivity of 30 non-S. enterica genomes. Three specific primer pairs were chosen to develop a multiplex PCR assay, which generated specific amplicons with a size of 180bp (SC1286), 238bp (SC1598) and 405bp (SC4361), respectively. This study demonstrates that SMM-system is a high-throughput specific marker generation tool that can be used to identify genus-, species-, serogroup- and even serovar-specific DNA sequences of microbial pathogens, which has a potential to be applied in food industries, diagnostics and taxonomic studies. SMM-system is freely available and can be downloaded from http://foodsafety.sjtu.edu.cn/SMM-system.html. Copyright © 2011 Elsevier B.V. All rights reserved.

Plasmid origin of replication of herpesvirus papio: DNA sequence and enhancer function.

PubMed Central

Loeb, D D; Sung, N S; Pesano, R L; Sexton, C J; Hutchison, C; Pagano, J S

1990-01-01

Herpesvirus papio (HVP) is a lymphotropic virus of baboons which is related to Epstein-Barr virus (EBV) and produces latent infection. The nucleotide sequence of the 5,775-base-pair (bp) EcoRI K fragment of HVP, which has previously been shown to confer the ability to replicate autonomously, has been determined. Within this DNA fragment is a region which bears structural and sequence similarity to the ori-P region of EBV. The HVP ori-P region has a 10- by 26-bp tandem array which is related to the 20- by 30-bp tandem array from the EBV ori-P region. In HVP there is an intervening region of 764 bp followed by five partial copies of the 26-bp monomer. Both the EBV and HVP 3' regions have the potential to form dyad structures which, however, differ in arrangement. We also demonstrate that a transcriptional enhancer which requires transactivation by a virus-encoded factor is present in the HVP ori-P. Images PMID:2159548

Identification of Simple Sequence Repeats in Chloroplast Genomes of Magnoliids Through Bioinformatics Approach.

PubMed

Srivastava, Deepika; Shanker, Asheesh

2016-12-01

Basal angiosperms or Magnoliids is an important clade of commercially important plants which mainly include spices and edible fruits. In this study, 17 chloroplast genome sequences belonging to clade Magnoliids were screened for the identification of chloroplast simple sequence repeats (cpSSRs). Simple sequence repeats or microsatellites are short stretches of DNA up to 1-6 base pair in length. These repeats are ubiquitous and play important role in the development of molecular markers and to study the mapping of traits of economic, medical or ecological interest. A total of 479 SSRs were detected, showing average density of 1 SSR/6.91 kb. Depending on the repeat units, the length of SSRs ranged from 12 to 24 bp for mono-, 12 to 18 bp for di-, 12 to 26 bp for tri-, 12 to 24 bp for tetra-, 15 bp for penta- and 18 bp for hexanucleotide repeats. Mononucleotide repeats were the most frequent (207, 43.21 %) followed by tetranucleotide repeats (130, 27.13 %). Penta- and hexanucleotide repeats were least frequent or absent in these chloroplast genomes.

No Evidence of Causal Effects of Blood Pressure on Cognition in the Population at Large.

PubMed

Swagerman, Suzanne C; van Bergen, Elsje; Kan, Kees-Jan; Koenis, Marinka M G; Hulshoff Pol, Hilleke E; Boomsma, Dorret I; de Geus, Eco J C

2016-02-01

The large body of literature on the association between blood pressure (BP) and cognitive functioning has yielded mixed results, possibly due to the presence of non-linear effects across age, or because BP affects specific brain areas differently, impacting more on some cognitive skills than on others. If a robust association was detected among BP and specific cognitive tasks, the causal nature of reported associations between BP and cognition could be investigated in twin data, which allow a test of alternative explanations, including genetic pleiotropy. The present study first examines the association between BP and cognition in a sample of 1,140 participants with an age range between 10 and 86 years. Linear and quadratic effects of systolic BP (SBP) and diastolic BP (DBP) on cognitive functioning were examined for 17 tests across five functions. Associations were corrected for effects of sex and linear and quadratic effects of age. Second, to test a causal model, data from 123 monozygotic (MZ) twin pairs were analyzed to test whether cognitive functioning of the twins with the higher BP was different from that of the co-twins with lower BP. Associations between BP and cognitive functioning were absent for the majority of the cognitive tests, with the exception of a lower speed of emotion identification and verbal reasoning in subjects with high diastolic BP. In the MZ twin pair analyses, no effects of BP on cognition were found. We conclude that in the population at large, BP level is not associated with cognitive functioning in a clinically meaningful way.

Concordance of haemoglobin A1c, blood pressure and C-reactive protein between children and their parents in Chinese households.

PubMed

Dong, F; Howard, A G; Herring, A H; Adair, L S; Thompson, A L; Popkin, B M; Aiello, A E; Zhang, B; Gordon-Larsen, P

2017-10-01

China has the world's highest diabetes prevalence, which along with hypertension and inflammation continues to grow particularly among children. Little is known about the strength of the association of these cardiometabolic risk factors between parents and their children; thus, the potential of household-based strategies to reduce risk is unknown. The objective of the study is to examine the parent-child association for haemoglobin A1c (HbA1c), blood pressure (BP) and C-reactive protein (CRP) in a large, geographically diverse Chinese sample. In 940 parent-child pairs (children aged 7-17 years) who participated in the 2009 China Health and Nutrition Survey, we measured each individual's HbA1c and CRP using fasting blood and BP. We used sex-specific random-effects linear regression to examine the parent-child association for these risk factors, accounting for within-family clustering. Child's HbA1c was positively associated with parental HbA1c. Beta coefficients ranged from 0.06 (95% CI 0.03-0.12) for father-daughter to 0.43 (95% CI 0.28-0.58) for mother-son pairs. We also detected a positive mother-daughter association for BP and positive father-child associations for CRP. The statistically significant parent-child association for HbA1c, BP and CRP in Chinese families suggests that household-based interventions could be useful for confronting the high rates of diabetes, hypertension and inflammation in China. © 2016 The Authors. Pediatric Obesity published by John Wiley & Sons, Ltd on behalf of World Obesity Federation.

Development of a PCR protocol to detect aflatoxigenic molds in food products.

PubMed

Luque, M Isabel; Rodríguez, Alicia; Andrade, María J; Martín, Alberto; Córdoba, Juan J

2012-01-01

Aflatoxins are secondary metabolites produced mainly by Aspergillus species growing in foodstuffs. Because aflatoxins have important health effects, the detection of early contamination of foods by aflatoxigenic molds should be useful. In the present work, a reliable conventional PCR method for detecting aflatoxigenic molds of various species was developed. Fifty-six aflatoxigenic and nonaflatoxigenic strains commonly reported in foodstuffs were tested. Aflatoxin production was first confirmed by micellar electrokinetic capillary electrophoresis or/and high-pressure liquid chromatography-mass spectrometry. Based on the conserved regions of the O-methyltransferase gene (omt-1) involved in the aflatoxin biosynthetic pathway, six primer pairs were designed. With only the designed primer pair AFF1-AFR3, the expected PCR product (381 bp) was obtained in all of the tested aflatoxigenic strains of various species and genera. Amplification products were not obtained with this primer pair for any of the nonaflatoxigenic reference molds. However, an amplicon of 453 bp was obtained for all aflatoxigenic and nonaflatoxigenic mold reference strains with a PCR protocol based on the constitutive fungal β-tubulin gene, which was used as a positive fungal control. The PCR protocol based on omt-1 detected as little as 15 pg of DNA from aflatoxigenic molds and 10(2) to 10(3) CFU/g in contaminated food samples. This PCR protocol should be used as a routine technique to detect aflatoxigenic molds in foods.

Four base recognition by triplex-forming oligonucleotides at physiological pH

PubMed Central

Rusling, David A.; Powers, Vicki E. C.; Ranasinghe, Rohan T.; Wang, Yang; Osborne, Sadie D.; Brown, Tom; Fox, Keith R.

2005-01-01

We have achieved recognition of all 4 bp by triple helix formation at physiological pH, using triplex-forming oligonucleotides that contain four different synthetic nucleotides. BAU [2′-aminoethoxy-5-(3-aminoprop-1-ynyl)uridine] recognizes AT base pairs with high affinity, MeP (3-methyl-2 aminopyridine) binds to GC at higher pHs than cytosine, while APP (6-(3-aminopropyl)-7-methyl-3H-pyrrolo[2,3-d]pyrimidin-2(7H)-one) and S [N-(4-(3-acetamidophenyl)thiazol-2-yl-acetamide)] bind to CG and TA base pairs, respectively. Fluorescence melting and DNase I footprinting demonstrate successful triplex formation at a 19mer oligopurine sequence that contains two CG and two TA interruptions. The complexes are pH dependent, but are still stable at pH 7.0. BAU, MeP and APP retain considerable selectivity, and single base pair changes opposite these residues cause a large reduction in affinity. In contrast, S is less selective and tolerates CG pairs as well as TA. PMID:15911633

Nearest-neighbor thermodynamics of deoxyinosine pairs in DNA duplexes

PubMed Central

Watkins, Norman E.; SantaLucia, John

2005-01-01

Nearest-neighbor thermodynamic parameters of the ‘universal pairing base’ deoxyinosine were determined for the pairs I·C, I·A, I·T, I·G and I·I adjacent to G·C and A·T pairs. Ultraviolet absorbance melting curves were measured and non-linear regression performed on 84 oligonucleotide duplexes with 9 or 12 bp lengths. These data were combined with data for 13 inosine containing duplexes from the literature. Multiple linear regression was used to solve for the 32 nearest-neighbor unknowns. The parameters predict the Tm for all sequences within 1.2°C on average. The general trend in decreasing stability is I·C > I·A > I·T ≈ I· G > I·I. The stability trend for the base pair 5′ of the I·X pair is G·C > C·G > A·T > T·A. The stability trend for the base pair 3′ of I·X is the same. These trends indicate a complex interplay between H-bonding, nearest-neighbor stacking, and mismatch geometry. A survey of 14 tandem inosine pairs and 8 tandem self-complementary inosine pairs is also provided. These results may be used in the design of degenerate PCR primers and for degenerate microarray probes. PMID:16264087

Mitochondrial genome sequence and expression profiling for the legume pod borer Maruca vitrata (Lepidoptera: Crambidae)

USDA-ARS?s Scientific Manuscript database

We report on the assembly of the 14,146 base pairs (bp) near complete mitochondrial sequencing of the legume pod borer (LPB), Maruca vitrata (Lepidoptera: Crambidae), which was used to estimate divergence and relationships within the lepidopteran lineage. Arrangement and orientation of 13 protein c...

Sequence-specific activation of the DNA sensor cGAS by Y-form DNA structures as found in primary HIV-1 cDNA.

PubMed

Herzner, Anna-Maria; Hagmann, Cristina Amparo; Goldeck, Marion; Wolter, Steven; Kübler, Kirsten; Wittmann, Sabine; Gramberg, Thomas; Andreeva, Liudmila; Hopfner, Karl-Peter; Mertens, Christina; Zillinger, Thomas; Jin, Tengchuan; Xiao, Tsan Sam; Bartok, Eva; Coch, Christoph; Ackermann, Damian; Hornung, Veit; Ludwig, Janos; Barchet, Winfried; Hartmann, Gunther; Schlee, Martin

2015-10-01

Cytosolic DNA that emerges during infection with a retrovirus or DNA virus triggers antiviral type I interferon responses. So far, only double-stranded DNA (dsDNA) over 40 base pairs (bp) in length has been considered immunostimulatory. Here we found that unpaired DNA nucleotides flanking short base-paired DNA stretches, as in stem-loop structures of single-stranded DNA (ssDNA) derived from human immunodeficiency virus type 1 (HIV-1), activated the type I interferon-inducing DNA sensor cGAS in a sequence-dependent manner. DNA structures containing unpaired guanosines flanking short (12- to 20-bp) dsDNA (Y-form DNA) were highly stimulatory and specifically enhanced the enzymatic activity of cGAS. Furthermore, we found that primary HIV-1 reverse transcripts represented the predominant viral cytosolic DNA species during early infection of macrophages and that these ssDNAs were highly immunostimulatory. Collectively, our study identifies unpaired guanosines in Y-form DNA as a highly active, minimal cGAS recognition motif that enables detection of HIV-1 ssDNA.

Development of a PCR-RFLP assay for the detection and differentiation of canine parvovirus and mink enteritis virus.

PubMed

Zhang, Chuanmei; Yu, Yongle; Yang, Haiyan; Li, Guimei; Yu, Zekun; Zhang, Hongliang; Shan, Hu

2014-12-15

A polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) assay has been developed to detect and differentiate between canine parvovirus (CPV) and mink enteritis virus (MEV). Eight CPV and three MEV epidemic strains isolated from 28 pathological samples from dogs and minks suspected of being infected with parvovirus were amplified by PCR using a pair of specific primers designed based on the CPV-N strain (M19296). PCR amplified a fragment of 1016bp from the genomic DNA of both MEV and CPV. The MEV-derived fragment could be digested with the restriction enzyme BSP1407I into three fragments of 102bp, 312bp and 602bp, while the fragment amplified from the CPV genomic DNA was digested into only two fragments of 414bp and 602bp. The lowest DNA concentration of CPV and MEV that could be detected using this assay was 0.004μg/ml and 0.03μg/ml, respectively. The PCR-RFLP assay developed in the present study can, therefore, be used to detect and differentiate MEV from CPV with high specificity and sensitivity. Copyright © 2014 Elsevier B.V. All rights reserved.

Homoeologous cloning of omega-secalin gene family in a wheat 1BL/1RS translocation.

PubMed

Chai, Jian Fang; Liu, Xu; Jia, Ji Zeng

2005-08-01

Wheat 1BL/1RS translocations are widely planted in China as well as in most of the wheat producing area in the world for their good qualities of disease resistance and high yield. 1BL/1RS translocations are however poor in bread making, partially caused by a family of small monomeric proteins, omega-secalins, which are encoded by genes on 1RS. Based on published sequence of a rye omega-secalin gene we designed a pair of primers to cover the whole mature protein coding sequence. A major band could be amplified from 1BL/1RS translocations but not from euploid wheat. Using this primer set we conducted PCR amplification by using high fidelity Pfu polymerase on the genomic DNAs and cDNAs purified from a 1BL/1RS translocation Lankao 906. Sequencing analysis indicated that this gene family contains several members of 1150 bp, 1076 bp, 1075 bp, 1052 bp and 1004 bp genes, including two pseudogenes and three active genes. The gene transcripts were differentially expressed in developing seeds.

Detection of Strand Cleavage And Oxidation Damage Using Model DNA Molecules Captured in a Nanoscale Pore

NASA Technical Reports Server (NTRS)

Vercoutere, W.; Solbrig, A.; DeGuzman, V.; Deamer, D.; Akeson, M.

2003-01-01

We use a biological nano-scale pore to distinguish among individual DNA hairpins that differ by a single site of oxidation or a nick in the sugar-phosphate backbone. In earlier work we showed that the protein ion channel alpha-hemolysin can be used as a detector to distinguish single-stranded from double-stranded DNA, single base pair and single nucleotide differences. This resolution is in part a result of sensitivity to structural changes that influence the molecular dynamics of nucleotides within DNA. The strand cleavage products we examined here included a 5-base-pair (5-bp) hairpin with a 5-prime five-nucleotide overhang, and a complementary five-nucleotide oligomer. These produced predictable shoulder-spike and rapid near-full blockade signatures, respectively. When combined, strand annealing was monitored in real time. The residual current level dropped to a lower discrete level in the shoulder-spike blockade signatures, and the duration lengthened. However, these blockade signatures had a shorter duration than the unmodified l0bp hairpin. To test the pore sensitivity to nucleotide oxidation, we examined a 9-bp hairpin with a terminal 8-oxo-deoxyguanosine (8-oxo-dG), or a penultimate 8-oxo-dG. Each produced blockade signatures that differed from the otherwise identical control 9bp hairpins. This study showed that DNA structure is modified sufficiently by strand cleavage or oxidation damage at a single site to alter in a predictable manner the ionic current blockade signatures produced. This technique improves the ability to assess damage to DNA, and can provide a simple means to help characterize the risks of radiation exposure. It may also provide a method to test radiation protection.

The complete chloroplast genome sequence of Dodonaea viscosa: comparative and phylogenetic analyses.

PubMed

Saina, Josphat K; Gichira, Andrew W; Li, Zhi-Zhong; Hu, Guang-Wan; Wang, Qing-Feng; Liao, Kuo

2018-02-01

The plant chloroplast (cp) genome is a highly conserved structure which is beneficial for evolution and systematic research. Currently, numerous complete cp genome sequences have been reported due to high throughput sequencing technology. However, there is no complete chloroplast genome of genus Dodonaea that has been reported before. To better understand the molecular basis of Dodonaea viscosa chloroplast, we used Illumina sequencing technology to sequence its complete genome. The whole length of the cp genome is 159,375 base pairs (bp), with a pair of inverted repeats (IRs) of 27,099 bp separated by a large single copy (LSC) 87,204 bp, and small single copy (SSC) 17,972 bp. The annotation analysis revealed a total of 115 unique genes of which 81 were protein coding, 30 tRNA, and four ribosomal RNA genes. Comparative genome analysis with other closely related Sapindaceae members showed conserved gene order in the inverted and single copy regions. Phylogenetic analysis clustered D. viscosa with other species of Sapindaceae with strong bootstrap support. Finally, a total of 249 SSRs were detected. Moreover, a comparison of the synonymous (Ks) and nonsynonymous (Ka) substitution rates in D. viscosa showed very low values. The availability of cp genome reported here provides a valuable genetic resource for comprehensive further studies in genetic variation, taxonomy and phylogenetic evolution of Sapindaceae family. In addition, SSR markers detected will be used in further phylogeographic and population structure studies of the species in this genus.

Improved identification of cranial nerves using paired-agent imaging: topical staining protocol optimization through experimentation and simulation

NASA Astrophysics Data System (ADS)

Torres, Veronica C.; Wilson, Todd; Staneviciute, Austeja; Byrne, Richard W.; Tichauer, Kenneth M.

2018-03-01

Skull base tumors are particularly difficult to visualize and access for surgeons because of the crowded environment and close proximity of vital structures, such as cranial nerves. As a result, accidental nerve damage is a significant concern and the likelihood of tumor recurrence is increased because of more conservative resections that attempt to avoid injuring these structures. In this study, a paired-agent imaging method with direct administration of fluorophores is applied to enhance cranial nerve identification. Here, a control imaging agent (ICG) accounts for non-specific uptake of the nerve-targeting agent (Oxazine 4), and ratiometric data analysis is employed to approximate binding potential (BP, a surrogate of targeted biomolecule concentration). For clinical relevance, animal experiments and simulations were conducted to identify parameters for an optimized stain and rinse protocol using the developed paired-agent method. Numerical methods were used to model the diffusive and kinetic behavior of the imaging agents in tissue, and simulation results revealed that there are various combinations of stain time and rinse number that provide improved contrast of cranial nerves, as suggested by optimal measures of BP and contrast-to-noise ratio.

Genetic Variation among Major Human Geographic Groups Supports a Peculiar Evolutionary Trend in PAX9

PubMed Central

Paixão-Côrtes, Vanessa R.; Meyer, Diogo; Pereira, Tiago V.; Mazières, Stéphane; Elion, Jacques; Krishnamoorthy, Rajagopal; Zago, Marco A.; Silva, Wilson A.; Salzano, Francisco M.; Bortolini, Maria Cátira

2011-01-01

A total of 172 persons from nine South Amerindian, three African and one Eskimo populations were studied in relation to the Paired box gene 9 (PAX9) exon 3 (138 base pairs) as well as its 5′and 3′flanking intronic segments (232 bp and 220 bp, respectively) and integrated with the information available for the same genetic region from individuals of different geographical origins. Nine mutations were scored in exon 3 and six in its flanking regions; four of them are new South American tribe-specific singletons. Exon3 nucleotide diversity is several orders of magnitude higher than its intronic regions. Additionally, a set of variants in the PAX9 and 101 other genes related with dentition can define at least some dental morphological differences between Sub-Saharan Africans and non-Africans, probably associated with adaptations after the modern human exodus from Africa. Exon 3 of PAX9 could be a good molecular example of how evolvability works. PMID:21298044

Cloning of a promoter-like soybean DNA sequence responding to IAA induction in Escherichia coli K12.

PubMed

Kline, E L; Chiang, S J; Lattora, D; Chaung, W

1992-02-01

We have constructed a soybean genomic DNA library in Escherichia coli K12 strain KC13 using plasmid pPV33, which consists of a promoter-less tetracycline resistance (Tcr) gene. A recombinant clone, KC13(pAU-SB1)+, was obtained by selecting for resistance to tetracycline in the presence of indole-3-acetic acid (IAA). Restriction enzyme cleavage and Southern hybridization analysis revealed that the pAU-SB1 plasmid has a 250 bp soybean DNA insert fused with the Tcr gene. In the presence of a selected group of auxins, induction of the Tcr phenotype and mRNA synthesis of the Tcr gene are observed only in KC13(pAU-SB1)+ cultures. On the other hand, induction of the Tcr phenotype and mRNA synthesis of the Tcr gene are absent in cells harboring the cloning vector pPV33 or a recombinant plasmid containing the 250 bp insert in the reverse orientation, pAU-SB1ro. This demonstrated a need for the insertion of the 250 bp soybean DNA and the specificity of its orientation in response to IAA induction. The start point of mRNA transcription in response to IAA, IBA, IPA, 2,4,5-T, and a-NAP is at base pair -96 or -95 upstream of the translational start site of the Tcr gene and base pair -98 with 2,4-D.

Evaluating the Relationship Between Birth Weight for Gestational Age and Adult Blood Pressure Using Participants From a Cohort of Same-Sex Siblings, Discordant on Birth Weight Percentile.

PubMed

Kahn, Linda G; Buka, Stephen L; Cirillo, Piera M; Cohn, Barbara A; Factor-Litvak, Pam; Gillman, Matthew W; Susser, Ezra; Lumey, L H

2017-09-01

Many studies have described an inverse relationship between birth weight and blood pressure (BP). Debate continues, however, over the magnitude and validity of the association. This analysis draws on the Early Determinants of Adult Health study (2005-2008), a cohort of 393 US adults (mean age 43 years; 47% male), including 114 same-sex sibling pairs deliberately sampled to be discordant on sex-specific birth weight for gestational age (BW/GA) in order to minimize confounding in studies of fetal growth and midlife health outcomes. Every quintile increment in BW/GA percentile was associated with a 1.04-mm Hg decrement in adult systolic BP (95% confidence interval (CI): -2.14, 0.06) and a 0.63-mm Hg decrement in diastolic BP (95% CI: -1.35, 0.09), controlling for sex, age, site, smoking, and race/ethnicity. The relationship was strongest among those in the lowest decile of BW/GA. Adding adult body mass index to the models attenuated the estimates (e.g., to -0.90 mm Hg (95% CI: -1.94, 0.14) for systolic BP). In the sibling-pair subgroup, associations were slightly stronger but with wider confidence intervals (e.g., -1.22 mm Hg (95% CI: -5.20, 2.75) for systolic BP). In conclusion, we found a small inverse relationship between BW/GA and BP in cohort and sibling-pair analyses, but the clinical or public health significance is likely limited. © The Author(s) 2017. Published by Oxford University Press on behalf of the Johns Hopkins Bloomberg School of Public Health. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Validation of the iHealth BP5 wireless upper arm blood pressure monitor for self-measurement according to the European Society of Hypertension International Protocol revision 2010.

PubMed

Shang, Fujun; Zhu, Yizheng; Zhu, Zhenlai; Liu, Lei; Wan, Yi

2013-10-01

The aim of this study was to validate the iHealth BP5 wireless upper arm blood pressure (BP) monitor according to the European Society of Hypertension International Protocol (ESH-IP) revision 2010. The ESH-IP revision 2010 for validation of BP measuring devices in adults was followed precisely. A total of 99 pairs of test device and reference BP measurements (three pairs for each of the 33 participants) were obtained in the study. The device produced 71, 89, and 97 measurements within 5, 10, and 15 mmHg for systolic blood pressure (SBP) and 73, 90, and 99 mmHg for diastolic blood pressure (DBP), respectively. The mean ± SD device-observer difference was -1.21 ± 5.87 mmHg for SBP and -1.04 ± 5.28 mmHg for DBP. The number of participants with two or three device-observer differences within 5 mmHg was 25 for SBP and 28 for DBP. In addition, three participants had no device-observer difference within 5 mmHg for SBP and none of the participants had the same for DBP. According to the validation results on the basis of the ESH-IP revision 2010, the iHealth BP5 wireless upper arm BP monitor can be recommended for self/home measurement in an adult population.

Chloroplast genome of Aconitum barbatum var. puberulum (Ranunculaceae) derived from CCS reads using the PacBio RS platform.

PubMed

Chen, Xiaochen; Li, Qiushi; Li, Ying; Qian, Jun; Han, Jianping

2015-01-01

The chloroplast genome (cp genome) of Aconitum barbatum var. puberulum was sequenced using the third-generation sequencing platform based on the single-molecule real-time (SMRT) sequencing approach. To our knowledge, this is the first reported complete cp genome of Aconitum, and we anticipate that it will have great value for phylogenetic studies of the Ranunculaceae family. In total, 23,498 CCS reads and 20,685,462 base pairs were generated, the mean read length was 880 bp, and the longest read was 2,261 bp. Genome coverage of 100% was achieved with a mean coverage of 132× and no gaps. The accuracy of the assembled genome is 99.973%; the assembly was validated using Sanger sequencing of six selected genes from the cp genome. The complete cp genome of A. barbatum var. puberulum is 156,749 bp in length, including a large single-copy region of 87,630 bp and a small single-copy region of 16,941 bp separated by two inverted repeats of 26,089 bp. The cp genome contains 130 genes, including 84 protein-coding genes, 34 tRNA genes and eight rRNA genes. Four forward, five inverted and eight tandem repeats were identified. According to the SSR analysis, the longest poly structure is a 20-T repeat. Our results presented in this paper will facilitate the phylogenetic studies and molecular authentication on Aconitum.

Chloroplast genome of Aconitum barbatum var. puberulum (Ranunculaceae) derived from CCS reads using the PacBio RS platform

PubMed Central

Chen, Xiaochen; Li, Qiushi; Li, Ying; Qian, Jun; Han, Jianping

2015-01-01

The chloroplast genome (cp genome) of Aconitum barbatum var. puberulum was sequenced using the third-generation sequencing platform based on the single-molecule real-time (SMRT) sequencing approach. To our knowledge, this is the first reported complete cp genome of Aconitum, and we anticipate that it will have great value for phylogenetic studies of the Ranunculaceae family. In total, 23,498 CCS reads and 20,685,462 base pairs were generated, the mean read length was 880 bp, and the longest read was 2,261 bp. Genome coverage of 100% was achieved with a mean coverage of 132× and no gaps. The accuracy of the assembled genome is 99.973%; the assembly was validated using Sanger sequencing of six selected genes from the cp genome. The complete cp genome of A. barbatum var. puberulum is 156,749 bp in length, including a large single-copy region of 87,630 bp and a small single-copy region of 16,941 bp separated by two inverted repeats of 26,089 bp. The cp genome contains 130 genes, including 84 protein-coding genes, 34 tRNA genes and eight rRNA genes. Four forward, five inverted and eight tandem repeats were identified. According to the SSR analysis, the longest poly structure is a 20-T repeat. Our results presented in this paper will facilitate the phylogenetic studies and molecular authentication on Aconitum. PMID:25705213

Determining ERβ Binding Affinity to Singly Mutant ERE Using Dual Polarization Interferometry

NASA Astrophysics Data System (ADS)

Song, Hong Yan; Su, Xiaodi

In a classic mode of estrogen action, estrogen receptors (ERs) bind to estrogen responsive element (ERE) to activate gene transcription. A perfect ERE contains a 13-base pair sequence of a palindromic repeat separated by a three-base spacer, 5‧-GGTCAnnnTGACC-3‧. In addition to the consensus or wild-type ERE (wtERE), naturally occurring EREs often have one or two base pairs’ alternation. Based on the newly constructed Thermodynamic Modeling of ChIP-seq (TherMos) model, binding energy between ERβ and a series of 34-bp mutant EREs (mutERE) was simulated to predict the binding affinity between ERs and EREs with single base pair deviation at different sites of the 13-bp inverted sequence. Experimentally, dual polarization interferometry (DPI) method was developed to measure ERβ-mutEREs binding affinity. On a biotin-NeutrAvidin (NA)-biotin treated DPI chip, wtERE is immobilized. In a direct binding assay, ERβ-wtERE binding affinity is determined. In a competition assay, ERβ was preincubated with mutant EREs before being added for competitive binding to the immobilized wtERE. This competition strategy provided a successful platform to evaluate the binding affinity variation among large number of ERE with different base mutations. The experimental result correlates well with the mathematically predicted binding energy with a Spearman correlation coefficient of 0.97.

Mass spectrometry based on a coupled Cooper-pair box and nanomechanical resonator system

NASA Astrophysics Data System (ADS)

Jiang, Cheng; Chen, Bin; Li, Jin-Jin; Zhu, Ka-Di

2011-10-01

Nanomechanical resonators (NRs) with very high frequency have a great potential for mass sensing with unprecedented sensitivity. In this study, we propose a scheme for mass sensing based on the NR capacitively coupled to a Cooper-pair box (CPB) driven by two microwave currents. The accreted mass landing on the resonator can be measured conveniently by tracking the resonance frequency shifts because of mass changes in the signal absorption spectrum. We demonstrate that frequency shifts induced by adsorption of ten 1587 bp DNA molecules can be well resolved in the absorption spectrum. Integration with the CPB enables capacitive readout of the mechanical resonance directly on the chip.

The complete chloroplast genome sequence of Dendrobium officinale.

PubMed

Yang, Pei; Zhou, Hong; Qian, Jun; Xu, Haibin; Shao, Qingsong; Li, Yonghua; Yao, Hui

2016-01-01

The complete chloroplast sequence of Dendrobium officinale, an endangered and economically important traditional Chinese medicine, was reported and characterized. The genome size is 152,018 bp, with 37.5% GC content. A pair of inverted repeats (IRs) of 26,284 bp are separated by a large single-copy region (LSC, 84,944 bp) and a small single-copy region (SSC, 14,506 bp). The complete cp DNA contains 83 protein-coding genes, 39 tRNA genes and 8 rRNA genes. Fourteen genes contained one or two introns.

The comparative chloroplast genomic analysis of photosynthetic orchids and developing DNA markers to distinguish Phalaenopsis orchids.

PubMed

Jheng, Cheng-Fong; Chen, Tien-Chih; Lin, Jhong-Yi; Chen, Ting-Chieh; Wu, Wen-Luan; Chang, Ching-Chun

2012-07-01

The chloroplast genome of Phalaenopsis equestris was determined and compared to those of Phalaenopsis aphrodite and Oncidium Gower Ramsey in Orchidaceae. The chloroplast genome of P. equestris is 148,959 bp, and a pair of inverted repeats (25,846 bp) separates the genome into large single-copy (85,967 bp) and small single-copy (11,300 bp) regions. The genome encodes 109 genes, including 4 rRNA, 30 tRNA and 75 protein-coding genes, but loses four ndh genes (ndhA, E, F and H) and seven other ndh genes are pseudogenes. The rate of inter-species variation between the two moth orchids was 0.74% (1107 sites) for single nucleotide substitution and 0.24% for insertions (161 sites; 1388 bp) and deletions (189 sites; 1393 bp). The IR regions have a lower rate of nucleotide substitution (3.5-5.8-fold) and indels (4.3-7.1-fold) than single-copy regions. The intergenic spacers are the most divergent, and based on the length variation of the three intergenic spacers, 11 native Phalaenopsis orchids could be successfully distinguished. The coding genes, IR junction and RNA editing sites are relatively more conserved between the two moth orchids than between those of Phalaenopsis and Oncidium spp. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

Bioinformatic analysis of phage AB3, a phiKMV-like virus infecting Acinetobacter baumannii.

PubMed

Zhang, J; Liu, X; Li, X-J

2015-01-16

The phages of Acinetobacter baumannii has drawn increasing attention because of the multi-drug resistance of A. baumanni. The aim of this study was to sequence Acinetobacter baumannii phage AB3 and conduct bioinformatic analysis to lay a foundation for genome remodeling and phage therapy. We isolated and sequenced A. baumannii phage AB3 and attempted to annotate and analyze its genome. The results showed that the genome is a double-stranded DNA with a total length of 31,185 base pairs (bp) and 97 open reading frames greater than 100 bp. The genome includes 28 predicted genes, of which 24 are homologous to phage AB1. The entire coding sequence is located on the negative strand, representing 90.8% of the total length. The G+C mol% was 39.18%, without areas of high G+C content over 200 bp in length. No GC island, tRNA gene, or repeated sequence was identified. Gene lengths were 120-3099 bp, with an average of 1011 bp. Six genes were found to be greater than 2000 bp in length. Genomic alignment and phylogenetic analysis of the RNA polymerase gene showed that similar to phage AB1, phage AB3 is a phiKMV-like virus in the T7 phage family.

Rangewide phylogeography of the western U.S. endemic frog Rana boylii (Ranidae): Implications for the conservation of frogs and rivers

Treesearch

A.J. Lind; H.B. Shaffer; P.Q. Spinks; G.M. Fellers

2011-01-01

Genetic data are increasingly being used in conservation planning for declining species. We sampled both the ecological and distributional limits of the foothill yellow-legged frog, Rana boylii to characterize mitochondrial DNA (mtDNA) variation in this declining, riverine amphibian. We evaluated 1525 base pairs (bp) of cytochrome b...

Cloning of cardiac, kidney, and brain promoters of the feline ncx1 gene.

PubMed

Barnes, K V; Cheng, G; Dawson, M M; Menick, D R

1997-04-25

The Na+-Ca2+ exchanger (NCX1) plays a major role in calcium efflux and therefore in the control and regulation of intracellular calcium in the heart. The exchanger has been shown to be regulated at several levels including transcription. NCX1 mRNA levels are up-regulated in both cardiac hypertrophy and failure. In this work, the 5'-end of the ncx1 gene has been cloned to study the mechanisms that mediate hypertrophic stimulation and cardiac expression. The feline ncx1 gene has three exons that encode 5'-untranslated sequences that are under the control of three tissue-specific promoters. The cardiac promoter drives expression in cardiocytes, but not in mouse L cells. Although it contains at least one enhancer (-2000 to -1250 base pairs (bp)) and one or more negative elements (-1250 to -250 bp), a minimum promoter (-250 to +200 bp) is sufficient for cardiac expression and alpha-adrenergic stimulation.

The interaction between the iron-responsive element binding protein and its cognate RNA is highly dependent upon both RNA sequence and structure.

PubMed

Jaffrey, S R; Haile, D J; Klausner, R D; Harford, J B

1993-09-25

To assess the influence of RNA sequence/structure on the interaction RNAs with the iron-responsive element binding protein (IRE-BP), twenty eight altered RNAs were tested as competitors for an RNA corresponding to the ferritin H chain IRE. All changes in the loop of the predicted IRE hairpin and in the unpaired cytosine residue characteristically found in IRE stems significantly decreased the apparent affinity of the RNA for the IRE-BP. Similarly, alteration in the spacing and/or orientation of the loop and the unpaired cytosine of the stem by either increasing or decreasing the number of base pairs separating them significantly reduced efficacy as a competitor. It is inferred that the IRE-BP forms multiple contacts with its cognate RNA, and that these contacts, acting in concert, provide the basis for the high affinity of this interaction.

Development of a Multiplex PCR Method to Detect Fungal Pathogens for Quarantine on Exported Cacti

PubMed Central

Cho, Hyun ji; Hong, Seong Won; Kim, Hyun-ju; Kwak, Youn-Sig

2016-01-01

Major diseases in grafted cacti have been reported and Fusarium oxysporum, Bipolaris cactivora, Phytophthora spp. and Collectotrichum spp. are known as causal pathogens. These pathogens can lead to plant death after infection. Therefore, some European countries have quarantined imported cacti that are infected with specific fungal pathogens. Consequently, we developed PCR detection methods to identify four quarantined fungal pathogens and reduce export rejection rates of Korean grafted cacti. The pathogen specific primer sets F.oF-F.oR, B.CF-B.CR, P.nF-P.nR, and P.cF-P.CR were tested for F. oxysporum, B. cactivora, P. nicotinae, and P. cactorum, respectively. The F.oF-F.oR primer set was designed from the Fusarium ITS region; the B.CF-B.CR and P.nF-P.nR primers respectively from Bipolaris and Phytophthora ITS1; and the P.cF-P.CR primer set from the Ypt1protein gene region. The quarantine fungal pathogen primer pairs were amplified to the specific number of base pairs in each of the following fungal pathogens: 210-bp (F. oxysporum), 510-bp (B. cactivora), 313-bp (P. nicotinae), and 447-bp (P. cactorum). The detection limit for the mono- and multiplex PCR primer sets was 0.1 ng of template DNA under in vitro conditions. Therefore, each primer set successfully diagnosed contamination of quarantine pathogens in export grafted cacti. Consequently, our methodology is a viable tool to screen contamination of the fungal pathogen in exported grafted cacti. PMID:26889115

Genetic regulation of the variation of circulating insulin-like growth factors and leptin in human pedigrees.

PubMed

Pantsulaia, Ia; Pantsulaia, I; Trofimov, Svetlana; Kobyliansky, Eugene; Livshits, Gregory

2005-07-01

Recent literature has shown that circulating levels of insulin-like growth factor I (IGF-I) and/or IGF binding proteins (IGF-BPs) may be of importance in the risk assessment of several chronic diseases including cancer, cardiovascular disease, diabetes mellitus and so on. The present study examined the extent of genetic and environmental influences on the populational variation of circulating IGF-I and IGF-BP-1 in apparently healthy and ethnically homogeneous white families. The plasma levels of each of the studied biochemical indices were determined by enzyme-linked immunoassay in 563 individuals aged 18 to 80 years. Quantitative genetic analysis showed that the IGF-I variation was appreciably attributable to genetic effects (47.1% +/- 9.0%), whereas for IGF-BP-1, only 23.3% +/- 7.8% of the interindividual variation was explained by genetic determinants. Common familial environment factors contributed significantly only to IGF-BP-1 variation (23.3% +/- 7.8%). In addition, we examined the covariations between these molecules and between them and IGF-BP-3 and leptin that were previously studied in the same sample. The analysis revealed that the pleiotropic genetic effects were significant for 2 pairs of traits, namely for IGF-I and IGF-BP-3, and for IGF-BP-1 and leptin. The bivariate heritability estimates were 0.21 +/- 0.04 and 0.15 +/- 0.05. The common environmental factors were consistently a significant source of correlation between all pairs (barring IGF-I and leptin) of the studied molecules; they were the sole predictors of correlation between IGF-I and IGF-BP-1, and between IGF-BP-1 and IGF-BP-3. Our results affirm the existence of specific and common genetic pathways that in combination determine a substantial proportion of the circulating variation of these molecules.

Novel and differential accumulation of mitochondrial DNA deletions in Swedish and vietnamese patients with colorectal cancer.

PubMed

Dimberg, Jan; Hong, Thai Trinh; Skarstedt, Marita; Löfgren, Sture; Zar, Niklas; Matussek, Andreas

2014-01-01

Mitochondrial DNA (mtDNA) has been proposed to be involved in carcinogenesis and aging. The mtDNA 4977 bp deletion is one of the most frequently observed mtDNA mutations in human tissues and may play a role in colorectal cancer (CRC). In the present study, we aimed to evaluate the frequency of mtDNA 4977 bp deletion in CRC tissues and its association with clinical factors. We determined the presence of the 4977 bp common deletion in cancer and normal paired tissue samples from 105 Swedish and 88 Vietnamese patients with CRC using polymerase chain reaction (PCR) assays. The mtDNA 4977 bp deletion was shown to be significantly more frequent in normal tissues in comparison with paired cancer tissues in both Swedish and Vietnamese patients. The 4977 bp common deletion was significantly more frequent in cancer tissues of the Vietnamese patients compared to the Swedish patients, and in Vietnamese cancer tissues, the 4977 bp deletion was significantly over represented in those with localized disease compared to those with disseminated disease. Moreover, we detected nine novel mtDNA deletions and found a significantly higher rate of these in CRC tissues in Swedish in comparison to Vietnamese patients. The mtDNA 4977 bp deletion seems to have an impact on the clinical outcome of CRC in Vietnamese patients, that the Swedish patients accumulate more of the detected novel deletions in CRC tissue compared to Vietnamese patients probably indicates divergent mechanisms in colorectal carcinogenesis.

Identification of a p53-response element in the promoter of the proline oxidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-05-02

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

Adaptive control with self-tuning for non-invasive beat-by-beat blood pressure measurement.

PubMed

Nogawa, Masamichi; Ogawa, Mitsuhiro; Yamakoshi, Takehiro; Tanaka, Shinobu; Yamakoshi, Ken-ichi

2011-01-01

Up to now, we have successfully carried out the non-invasive beat-by-beat measurement of blood pressure (BP) in the root of finger, superficial temporal and radial artery based on the volume-compensation technique with reasonable accuracy. The present study concerns with improvement of control method for this beat-by-beat BP measurement. The measurement system mainly consists of a partial pressurization cuff with a pair of LED and photo-diode for the detection of arterial blood volume, and a digital self-tuning control method. Using healthy subjects, the performance and accuracy of this system were evaluated through comparison experiments with the system using a conventional empirically tuned PID controller. The significant differences of BP measured in finger artery were not showed in systolic (SBP), p=0.52, and diastolic BP (DBP), p=0.35. With the advantage of the adaptive control with self-tuning method, which can tune the control parameters without disturbing the control system, the application area of the non-invasive beat-by-beat measurement method will be broadened.

Production of DNA minicircles less than 250 base pairs through a novel concentrated DNA circularization assay enabling minicircle design with NF-κB inhibition activity

PubMed Central

Thibault, Thomas; Degrouard, Jeril; Baril, Patrick; Pichon, Chantal; Midoux, Patrick

2017-01-01

Abstract Double-stranded DNA minicircles of less than 1000 bp in length have great interest in both fundamental research and therapeutic applications. Although minicircles have shown promising activity in gene therapy thanks to their good biostability and better intracellular trafficking, minicircles down to 250 bp in size have not yet been investigated from the test tube to the cell for lack of an efficient production method. Herein, we report a novel versatile plasmid-free method for the production of DNA minicircles comprising fewer than 250 bp. We designed a linear nicked DNA double-stranded oligonucleotide blunt-ended substrate for efficient minicircle production in a ligase-mediated and bending protein-assisted circularization reaction at high DNA concentration of 2 μM. This one pot multi-step reaction based-method yields hundreds of micrograms of minicircle with sequences of any base composition and position and containing or not a variety of site-specifically chemical modifications or physiological supercoiling. Biochemical and cellular studies were then conducted to design a 95 bp minicircle capable of binding in vitro two NF-κB transcription factors per minicircle and to efficiently inhibiting NF-κB-dependent transcriptional activity in human cells. Therefore, our production method could pave the way for the design of minicircles as new decoy nucleic acids. PMID:27899652

The complete chloroplast genome sequence of Hibiscus syriacus.

PubMed

Kwon, Hae-Yun; Kim, Joon-Hyeok; Kim, Sea-Hyun; Park, Ji-Min; Lee, Hyoshin

2016-09-01

The complete chloroplast genome sequence of Hibiscus syriacus L. is presented in this study. The genome is composed of 161 019 bp in length, with a typical circular structure containing a pair of inverted repeats of 25 745 bp of length separated by a large single-copy region and a small single-copy region of 89 698 bp and 19 831 bp of length, respectively. The overall GC content is 36.8%. One hundred and fourteen genes were annotated, including 81 protein-coding genes, 4 ribosomal RNA genes and 29 transfer RNA genes.

Architecture of a Fur Binding Site: a Comparative Analysis

PubMed Central

Lavrrar, Jennifer L.; McIntosh, Mark A.

2003-01-01

Fur is an iron-binding transcriptional repressor that recognizes a 19-bp consensus site of the sequence 5′-GATAATGATAATCATTATC-3′. This site can be defined as three adjacent hexamers of the sequence 5′-GATAAT-3′, with the third being slightly imperfect (an F-F-F configuration), or as two hexamers in the forward orientation separated by one base pair from a third hexamer in the reverse orientation (an F-F-x-R configuration). Although Fur can bind synthetic DNA sequences containing the F-F-F arrangement, most natural binding sites are variations of the F-F-x-R arrangement. The studies presented here compared the ability of Fur to recognize synthetic DNA sequences containing two to four adjacent hexamers with binding to sequences containing variations of the F-F-x-R arrangement (including natural operator sequences from the entS and fepB promoter regions of Escherichia coli). Gel retardation assays showed that the F-F-x-R architecture was necessary for high-affinity Fur-DNA interactions and that contiguous hexamers were not recognized as effectively. In addition, the stoichiometry of Fur at each binding site was determined, showing that Fur interacted with its minimal 19-bp binding site as two overlapping dimers. These data confirm the proposed overlapping-dimer binding model, where the unit of interaction with a single Fur dimer is two inverted hexamers separated by a C:G base pair, with two overlapping units comprising the 19-bp consensus binding site required for the high-affinity interaction with two Fur dimers. PMID:12644489

Complete plastid genome sequence of goosegrass (Eleusine indica) and comparison with other Poaceae.

PubMed

Zhang, Hui; Hall, Nathan; McElroy, J Scott; Lowe, Elijah K; Goertzen, Leslie R

2017-02-05

Eleusine indica, also known as goosegrass, is a serious weed in at least 42 countries. In this paper we report the complete plastid genome sequence of goosegrass obtained by de novo assembly of paired-end and mate-paired reads generated by Illumina sequencing of total genomic DNA. The goosegrass plastome is a circular molecule of 135,151bp in length, consisting of two single-copy regions separated by a pair of inverted repeats (IRs) of 20,919 bases. The large (LSC) and the small (SSC) single-copy regions span 80,667 bases and 12,646 bases, respectively. The plastome of goosegrass has 38.19% GC content and includes 108 unique genes, of which 76 are protein-coding, 28 are transfer RNA, and 4 are ribosomal RNA. The goosegrass plastome sequence was compared to eight other species of Poaceae. Although generally conserved with respect to Poaceae, this genomic resource will be useful for evolutionary studies within this weed species and the genus Eleusine. Copyright © 2016. Published by Elsevier B.V.

Peripheral Opioid Analgesia

DTIC Science & Technology

1999-07-16

central nervous system by neurons called primary afferent nociceptors (PANs). These neurons have their cell bodies in the dorsal root ganglia (ORG... neurons , and in particular their role in the generation, propagation and modulation of noxious stimulation will be summarized. The final section of...and processing of each opioid peptide is discussed below. The human POMC gene is 7665 base pairs (bp) long which contains three exons and two

Development of chemiluminescent probe hybridization, RT-PCR and nucleic acid cycle sequencing assays of Sabin type 3 isolates to identify base pair 472 Sabin type 3 mutants associated with vaccine associated paralytic poliomyelitis.

PubMed

Old, M O; Logan, L H; Maldonado, Y A

1997-11-01

Sabin type 3 polio vaccine virus is the most common cause of poliovaccine associated paralytic poliomyelitis. Vaccine associated paralytic poliomyelitis cases have been associated with Sabin type 3 revertants containing a single U to C substitution at bp 472 of Sabin type 3. A rapid method of identification of Sabin type 3 bp 472 mutants is described. An enterovirus group-specific probe for use in a chemiluminescent dot blot hybridization assay was developed to identify enterovirus positive viral lysates. A reverse transcription-polymerase chain reaction (RT-PCR) assay producing a 319 bp PCR product containing the Sabin type 3 bp 472 mutation site was then employed to identify Sabin type 3 isolates. Chemiluminescent nucleic acid cycle sequencing of the purified 319 bp PCR product was then employed to identify nucleic acid sequences at bp 472. The enterovirus group probe hybridization procedure and isolation of the Sabin type 3 PCR product were highly sensitive and specific; nucleic acid cycle sequencing corresponded to the known sequence of stock Sabin type 3 isolates. These methods will be used to identify the Sabin type 3 reversion rate from sequential stool samples of infants obtained after the first and second doses of oral poliovirus vaccine.

Dynamic genetic linkage of intermediate blood pressure phenotypes during postural adaptations in a founder population

PubMed Central

Arenas, I. A.; Tremblay, J.; Deslauriers, B.; Sandoval, J.; Šeda, O.; Gaudet, D.; Merlo, E.; Kotchen, T.; Cowley, A. W.

2013-01-01

Blood pressure (BP) is a dynamic phenotype that varies rapidly to adjust to changing environmental conditions. Standing upright is a recent evolutionary trait, and genetic factors that influence postural adaptations may contribute to BP variability. We studied the effect of posture on the genetics of BP and intermediate BP phenotypes. We included 384 sib-pairs in 64 sib-ships from families ascertained by early-onset hypertension and dyslipidemia. Blood pressure, three hemodynamic and seven neuroendocrine intermediate BP phenotypes were measured with subjects lying supine and standing upright. The effect of posture on estimates of heritability and genetic covariance was investigated in full pedigrees. Linkage was conducted on 196 candidate genes by sib-pair analyses, and empirical estimates of significance were obtained. A permutation algorithm was implemented to study the postural effect on linkage. ADRA1A, APO, CAST, CORIN, CRHR1, EDNRB, FGF2, GC, GJA1, KCNB2, MMP3, NPY, NR3C2, PLN, TGFBR2, TNFRSF6, and TRHR showed evidence of linkage with any phenotype in the supine position and not upon standing, whereas AKR1B1, CD36, EDNRA, F5, MMP9, PKD2, PON1, PPARG, PPARGC1A, PRKCA, and RET were specifically linked to standing phenotypes. Genetic profiling was undertaken to show genetic interactions among intermediate BP phenotypes and genes specific to each posture. When investigators perform genetic studies exclusively on a single posture, important genetic components of BP are missed. Supine and standing BPs have distinct genetic signatures. Standardized maneuvers influence the results of genetic investigations into BP, thus reflecting its dynamic regulation. PMID:23269701

Meraculous: De Novo Genome Assembly with Short Paired-End Reads

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chapman, Jarrod A.; Ho, Isaac; Sunkara, Sirisha

2011-08-18

We describe a new algorithm, meraculous, for whole genome assembly of deep paired-end short reads, and apply it to the assembly of a dataset of paired 75-bp Illumina reads derived from the 15.4 megabase genome of the haploid yeast Pichia stipitis. More than 95% of the genome is recovered, with no errors; half the assembled sequence is in contigs longer than 101 kilobases and in scaffolds longer than 269 kilobases. Incorporating fosmid ends recovers entire chromosomes. Meraculous relies on an efficient and conservative traversal of the subgraph of the k-mer (deBruijn) graph of oligonucleotides with unique high quality extensions inmore » the dataset, avoiding an explicit error correction step as used in other short-read assemblers. A novel memory-efficient hashing scheme is introduced. The resulting contigs are ordered and oriented using paired reads separated by ~280 bp or ~3.2 kbp, and many gaps between contigs can be closed using paired-end placements. Practical issues with the dataset are described, and prospects for assembling larger genomes are discussed.« less

A unique chromatin complex occupies young α-satellite arrays of human centromeres

PubMed Central

Henikoff, Jorja G.; Thakur, Jitendra; Kasinathan, Sivakanthan; Henikoff, Steven

2015-01-01

The intractability of homogeneous α-satellite arrays has impeded understanding of human centromeres. Artificial centromeres are produced from higher-order repeats (HORs) present at centromere edges, although the exact sequences and chromatin conformations of centromere cores remain unknown. We use high-resolution chromatin immunoprecipitation (ChIP) of centromere components followed by clustering of sequence data as an unbiased approach to identify functional centromere sequences. We find that specific dimeric α-satellite units shared by multiple individuals dominate functional human centromeres. We identify two recently homogenized α-satellite dimers that are occupied by precisely positioned CENP-A (cenH3) nucleosomes with two ~100–base pair (bp) DNA wraps in tandem separated by a CENP-B/CENP-C–containing linker, whereas pericentromeric HORs show diffuse positioning. Precise positioning is largely maintained, whereas abundance decreases exponentially with divergence, which suggests that young α-satellite dimers with paired ~100-bp particles mediate evolution of functional human centromeres. Our unbiased strategy for identifying functional centromeric sequences should be generally applicable to tandem repeat arrays that dominate the centromeres of most eukaryotes. PMID:25927077

Effects of stimulation configurations on place pitch discrimination in cochlear implants.

PubMed

Kwon, Bomjun J; Perry, Trevor T; Olmstead, Vauna L

2011-06-01

The present study aimed to examine the effect of electrode configuration, specifically monopolar (MP) or bipolar (BP) stimulation, on place pitch discrimination in cochlear implants (CIs). Twelve subjects implanted with the Nucleus Freedom device were presented with various pairs of stimulation across the electrode array, with varying degrees of distance between stimulation sites, and asked to judge the higher of the two in pitch. Each pair was presented either in the same mode or in different modes of stimulation for the within-mode or across-mode condition, respectively, at least 20 times. The result of the within-mode condition revealed that subjects, on average, were able to discriminate pitches significantly better in MP than in BP, with the sensitivity index (d') for adjacent channels of 1.2 for MP and 0.8 for BP. The result of the across-mode condition revealed that while individual variability existed, there was a strong tendency for CI subjects to perceive a higher pitch in BP stimulation than in MP for a similar site of stimulation. In other words, an MP channel needed to be shifted in a basal direction by as much as two electrodes on average to elicit a pitch comparable to that of a BP channel. © 2011 Acoustical Society of America

[Study on sequence characterized amplified region (SCAR) markers of Cornus officinalis].

PubMed

Chen, Suiqing; Lu, Xiaolei; Wang, Lili

2011-05-01

To establish sequence characterized amplified region markers of Cornus officinalis and provide a scientific basis for molecular identification of C. officinalis. The random primer was screened through RAPD to obtain specific RAPD marker bands. The RAPD marker bands were separated, extracted, cloned and sequenced. Both ends of the sequence of RAPD marker bands were determined. A pair of specific primers was designed for conventional PCR reaction, and SCAR marker was acquired. Four pairs of primers were designed based on the sequence of RAPD marker bands. The DNA of the seven varieties of C. officinalis was amplified by using YST38 and YST43 primer. The results showed that seven varieties of C. officinalis were able to produce a single PCR product. It was an effective way to identify C. officinalis. The varieties with cylindrical and long-pear shape fruits amplified by YST38 showed a specific band, which could be used as the evidence of variety identification. Seven varieties of C. oficinalis were amplified by using primer YST39. But the size of band of the variety with spindly shape fruit (35,0400 bp) was about 300 bp, which was shorter than those of the variety with the other shape fruits of C. officinalis (650-700 bp). The variety with the spindly shape fruit could be identified through this difference. The primer YST92 could produce a fragment from 600-700 bp in the varieties with cylindrical and long-pear shape fruits, a fragment from 200-300 bp in the varieties with oval and short-cylindrical shape fruits and had no fragment in the varieties with long cylindrical, elliptic and short-pear shape fruits, which could be used to select the different shapes of C. officinalis. SCAR mark is established and can be used as the basis for breeding and distinguishing the verieties of C. officinalis.

Stacked-unstacked equilibrium at the nick site of DNA.

PubMed

Protozanova, Ekaterina; Yakovchuk, Peter; Frank-Kamenetskii, Maxim D

2004-09-17

Stability of duplex DNA with respect to separation of complementary strands is crucial for DNA executing its major functions in the cell and it also plays a central role in major biotechnology applications of DNA: DNA sequencing, polymerase chain reaction, and DNA microarrays. Two types of interaction are well known to contribute to DNA stability: stacking between adjacent base-pairs and pairing between complementary bases. However, their contribution into the duplex stability is yet to be determined. Now we fill this fundamental gap in our knowledge of the DNA double helix. We have prepared a series of 32, 300 bp-long DNA fragments with solitary nicks in the same position differing only in base-pairs flanking the nick. Electrophoretic mobility of these fragments in the gel has been studied. Assuming the equilibrium between stacked and unstacked conformations at the nick site, all 32 stacking free energy parameters have been obtained. Only ten of them are essential and they govern the stacking interactions between adjacent base-pairs in intact DNA double helix. A full set of DNA stacking parameters has been determined for the first time. From these data and from a well-known dependence of DNA melting temperature on G.C content, the contribution of base-pairing into duplex stability has been estimated. The obtained energy parameters of the DNA double helix are of paramount importance for understanding sequence-dependent DNA flexibility and for numerous biotechnology applications.

Regulation of COL1A1 expression in type I collagen producing tissues: identification of a 49 base pair region which is required for transgene expression in bone of transgenic mice

NASA Technical Reports Server (NTRS)

Bedalov, A.; Salvatori, R.; Dodig, M.; Kronenberg, M. S.; Kapural, B.; Bogdanovic, Z.; Kream, B. E.; Woody, C. O.; Clark, S. H.; Mack, K.;

A Hypertrophic Cardiomyopathy-associated MYBPC3 Mutation Common in Populations of South Asian Descent Causes Contractile Dysfunction*

PubMed Central

Kuster, Diederik W. D.; Govindan, Suresh; Springer, Tzvia I.; Martin, Jody L.; Finley, Natosha L.; Sadayappan, Sakthivel

2015-01-01

Hypertrophic cardiomyopathy (HCM) results from mutations in genes encoding sarcomeric proteins, most often MYBPC3, which encodes cardiac myosin binding protein-C (cMyBP-C). A recently discovered HCM-associated 25-base pair deletion in MYBPC3 is inherited in millions worldwide. Although this mutation causes changes in the C10 domain of cMyBP-C (cMyBP-CC10mut), which binds to the light meromyosin (LMM) region of the myosin heavy chain, the underlying molecular mechanism causing HCM is unknown. In this study, adenoviral expression of cMyBP-CC10mut in cultured adult rat cardiomyocytes was used to investigate protein localization and evaluate contractile function and Ca2+ transients, compared with wild-type cMyBP-C expression (cMyBP-CWT) and controls. Forty-eight hours after infection, 44% of cMyBP-CWT and 36% of cMyBP-CC10mut protein levels were determined in total lysates, confirming equal expression. Immunofluorescence experiments showed little or no localization of cMyBP-CC10mut to the C-zone, whereas cMyBP-CWT mostly showed C-zone staining, suggesting that cMyBP-CC10mut could not properly integrate in the C-zone of the sarcomere. Subcellular fractionation confirmed that most cMyBP-CC10mut resided in the soluble fraction, with reduced presence in the myofilament fraction. Also, cMyBP-CC10mut displayed significantly reduced fractional shortening, sarcomere shortening, and relaxation velocities, apparently caused by defects in sarcomere function, because Ca2+ transients were unaffected. Co-sedimentation and protein cross-linking assays confirmed that C10mut causes the loss of C10 domain interaction with myosin LMM. Protein homology modeling studies showed significant structural perturbation in cMyBP-CC10mut, providing a potential structural basis for the alteration in its mode of interaction with myosin LMM. Therefore, expression of cMyBP-CC10mut protein is sufficient to cause contractile dysfunction in vitro. PMID:25583989

The complete mitochondrial genome sequence of Malus hupehensis var. pinyiensis.

PubMed

Duan, Naibin; Sun, Honghe; Wang, Nan; Fei, Zhangjun; Chen, Xuesen

2016-07-01

The complete mitochondrial genome sequence of Malus hupehensis var. pinyiensis, a widely used apple rootstock, was determined using the Illumina high-throughput sequencing approach. The genome is 422,555 bp in length and has a GC content of 45.21%. It is separated by a pair of inverted repeats of 32,504 bp, to form a large single copy region of 213,055 bp and a small single copy region of 144,492 bp. The genome contains 38 protein-coding genes, four pseudogenes, 25 tRNA genes, and three rRNA genes. The genome is 25,608 bp longer than that of M. domestica, and several structural variations between these two mitogenomes were detected.

The complete chloroplast genome sequence of the medicinal plant Andrographis paniculata.

PubMed

Ding, Ping; Shao, Yanhua; Li, Qian; Gao, Junli; Zhang, Runjing; Lai, Xiaoping; Wang, Deqin; Zhang, Huiye

2016-07-01

The complete chloroplast genome of Andrographis paniculata, an important medicinal plant with great economic value, has been studied in this article. The genome size is 150,249 bp in length, with 38.3% GC content. A pair of inverted repeats (IRs, 25,300 bp) are separated by a large single copy region (LSC, 82,459 bp) and a small single-copy region (SSC, 17,190 bp). The chloroplast genome contains 114 unique genes, 80 protein-coding genes, 30 tRNA genes and 4 rRNA genes. In these genes, 15 genes contained 1 intron and 3 genes comprised of 2 introns.

The complete chloroplast genome sequence of Dianthus superbus var. longicalycinus.

PubMed

Gurusamy, Raman; Lee, Do-Hyung; Park, SeonJoo

2016-05-01

The complete chloroplast genome (cpDNA) sequence of Dianthus superbus var. longicalycinus is an economically important traditional Chinese medicine was reported and characterized. The cpDNA of Dianthus superbus var. longicalycinus is 149,539 bp, with 36.3% GC content. A pair of inverted repeats (IRs) of 24,803 bp is separated by a large single-copy region (LSC, 82,805 bp) and a small single-copy region (SSC, 17,128 bp). It encodes 85 protein-coding genes, 36 tRNA genes and 8 rRNA genes. Of 129 individual genes, 13 genes encoded one intron and three genes have two introns.

The complete chloroplast genome sequence of Curcuma flaviflora (Curcuma).

PubMed

Zhang, Yan; Deng, Jiabin; Li, Yangyi; Gao, Gang; Ding, Chunbang; Zhang, Li; Zhou, Yonghong; Yang, Ruiwu

2016-09-01

The complete chloroplast (cp) genome of Curcuma flaviflora, a medicinal plant in Southeast Asia, was sequenced. The genome size was 160 478 bp in length, with 36.3% GC content. A pair of inverted repeats (IRs) of 26 946 bp were separated by a large single copy (LSC) of 88 008 bp and a small single copy (SSC) of 18 578 bp, respectively. The cp genome contained 132 annotated genes, including 79 protein coding genes, 30 tRNA genes, and four rRNA genes. And 19 of these genes were duplicated in inverted repeat regions.

Pair cascades in the magnetospheres of strongly magnetized neutron stars

NASA Astrophysics Data System (ADS)

Medin, Zach; Lai, Dong

2010-08-01

We present numerical simulations of electron-positron pair cascades in the magnetospheres of magnetic neutron stars for a wide range of surface fields (Bp = 1012-1015 G), rotation periods (0.1-10 s) and field geometries. This has been motivated by the discovery in recent years of a number of radio pulsars with inferred magnetic fields comparable to those of magnetars. Evolving the cascade generated by a primary electron or positron after it has been accelerated in the inner gap of the magnetosphere, we follow the spatial development of the cascade until the secondary photons and electron-positron pairs leave the magnetosphere, and we obtain the pair multiplicity and the energy spectra of the cascade pairs and photons under various conditions. Going beyond previous works, which were restricted to weaker fields (B <~ afew × 1012 G), we have incorporated in our simulations detailed treatments of physical processes that are potentially important (especially in the high-field regime) but were either neglected or crudely treated before, including photon splitting with the correct selection rules for photon polarization modes, one-photon pair production into low Landau levels for the e+/-, and resonant inverse Compton scattering from polar cap hotspots. We find that even for B >> BQ = 4 × 1013 G, photon splitting has a small effect on the multiplicity of the cascade since a majority of the photons in the cascade cannot split. One-photon decay into e+ e- pairs at low Landau levels, however, becomes the dominant pair production channel when B >~ 3 × 1012 G; this tends to suppress synchrotron radiation so that the cascade can develop only at a larger distance from the stellar surface. Nevertheless, we find that the total number of pairs and their energy spectrum produced in the cascade depend mainly on the polar cap voltage BpP-2, and are weakly dependent on Bp (and P) alone. We discuss the implications of our results for the radio pulsar death line and for the hard X-ray emission from magnetized neutron stars.

(S)-3-hydroxy-3-methylglutaryl coenzyme A reductase, a product of the mva operon of Pseudomonas mevalonii, is regulated at the transcriptional level.

PubMed Central

Wang, Y L; Beach, M J; Rodwell, V W

1989-01-01

We have cloned and sequenced a 505-base-pair (bp) segment of DNA situated upstream of mvaA, the structural gene for (S)-3-hydroxy-3-methylglutaryl coenzyme A reductase (EC 1.1.1.88) of Pseudomonas mevalonii. The DNA segment that we characterized includes the promoter region for the mva operon. Nuclease S1 mapping and primer extension analysis showed that mvaA is the promoter-proximal gene of the mva operon. Transcription initiates at -56 bp relative to the first A (+1) of the translation start site. Transcription in vivo was induced by mevalonate. Structural features of the mva promoter region include an 80-bp A + T-rich region, and -12, -24 consensus sequences that resemble sequences of sigma 54 promoters in enteric organisms. The relative amplitudes of catalytic activity, enzyme protein, and mvaA mRNA are consistent with a model of regulation of this operon at the transcriptional level. Images PMID:2477360

Complete mitochondrial genome of the brown alga Sargassum fusiforme (Sargassaceae, Phaeophyceae): genome architecture and taxonomic consideration.

PubMed

Liu, Feng; Pang, Shaojun; Luo, Minbo

2016-01-01

Sargassum fusiforme (Harvey) Setchell (=Hizikia fusiformis (Harvey) Okamura) is one of the most important economic seaweeds for mariculture in China. In this study, we present the complete mitochondrial genome of S. fusiforme. The genome is 34,696 bp in length with circular organization, encoding the standard set of three ribosomal RNA genes (rRNA), 25 transfer RNA genes (tRNA), 35 protein-coding genes, and two conserved open reading frames (ORFs). Its total AT content is 62.47%, lower than other brown algae except Pylaiella littoralis. The mitogenome carries 1571 bp of intergenic region constituting 4.53% of the genome, and 13 pairs of overlapping genes with the overlap size from 1 to 90 bp. The phylogenetic analyses based on 35 protein-coding genes reveal that S. fusiforme has a closer evolutionary relationship with Sargassum muticum than Sargassum horneri, indicating Hizikia are not distinct evolutionary entity and should be reduced to synonymy with Sargassum.

Production of DNA minicircles less than 250 base pairs through a novel concentrated DNA circularization assay enabling minicircle design with NF-κB inhibition activity.

PubMed

Thibault, Thomas; Degrouard, Jeril; Baril, Patrick; Pichon, Chantal; Midoux, Patrick; Malinge, Jean-Marc

2017-03-17

Double-stranded DNA minicircles of less than 1000 bp in length have great interest in both fundamental research and therapeutic applications. Although minicircles have shown promising activity in gene therapy thanks to their good biostability and better intracellular trafficking, minicircles down to 250 bp in size have not yet been investigated from the test tube to the cell for lack of an efficient production method. Herein, we report a novel versatile plasmid-free method for the production of DNA minicircles comprising fewer than 250 bp. We designed a linear nicked DNA double-stranded oligonucleotide blunt-ended substrate for efficient minicircle production in a ligase-mediated and bending protein-assisted circularization reaction at high DNA concentration of 2 μM. This one pot multi-step reaction based-method yields hundreds of micrograms of minicircle with sequences of any base composition and position and containing or not a variety of site-specifically chemical modifications or physiological supercoiling. Biochemical and cellular studies were then conducted to design a 95 bp minicircle capable of binding in vitro two NF-κB transcription factors per minicircle and to efficiently inhibiting NF-κB-dependent transcriptional activity in human cells. Therefore, our production method could pave the way for the design of minicircles as new decoy nucleic acids. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Complete chloroplast genome sequence of common bermudagrass (Cynodon dactylon (L.) Pers.) and comparative analysis within the family Poaceae

PubMed Central

Huang, Ya-Yi; Cho, Shu-Ting; Haryono, Mindia; Kuo, Chih-Horng

2017-01-01

Common bermudagrass (Cynodon dactylon (L.) Pers.) belongs to the subfamily Chloridoideae of the Poaceae family, one of the most important plant families ecologically and economically. This grass has a long connection with human culture but its systematics is relatively understudied. In this study, we sequenced and investigated the chloroplast genome of common bermudagrass, which is 134,297 bp in length with two single copy regions (LSC: 79,732 bp; SSC: 12,521 bp) and a pair of inverted repeat (IR) regions (21,022 bp). The annotation contains a total of 128 predicted genes, including 82 protein-coding, 38 tRNA, and 8 rRNA genes. Additionally, our in silico analyses identified 10 sets of repeats longer than 20 bp and predicted the presence of 36 RNA editing sites. Overall, the chloroplast genome of common bermudagrass resembles those from other Poaceae lineages. Compared to most angiosperms, the accD gene and the introns of both clpP and rpoC1 genes are missing. Additionally, the ycf1, ycf2, ycf15, and ycf68 genes are pseudogenized and two genome rearrangements exist. Our phylogenetic analysis based on 47 chloroplast protein-coding genes supported the placement of common bermudagrass within Chloridoideae. Our phylogenetic character mapping based on the parsimony principle further indicated that the loss of the accD gene and clpP introns, the pseudogenization of four ycf genes, and the two rearrangements occurred only once after the most recent common ancestor of the Poaceae diverged from other monocots, which could explain the unusual long branch leading to the Poaceae when phylogeny is inferred based on chloroplast sequences. PMID:28617867

Complete chloroplast genome sequence of common bermudagrass (Cynodon dactylon (L.) Pers.) and comparative analysis within the family Poaceae.

PubMed

Huang, Ya-Yi; Cho, Shu-Ting; Haryono, Mindia; Kuo, Chih-Horng

2017-01-01

Common bermudagrass (Cynodon dactylon (L.) Pers.) belongs to the subfamily Chloridoideae of the Poaceae family, one of the most important plant families ecologically and economically. This grass has a long connection with human culture but its systematics is relatively understudied. In this study, we sequenced and investigated the chloroplast genome of common bermudagrass, which is 134,297 bp in length with two single copy regions (LSC: 79,732 bp; SSC: 12,521 bp) and a pair of inverted repeat (IR) regions (21,022 bp). The annotation contains a total of 128 predicted genes, including 82 protein-coding, 38 tRNA, and 8 rRNA genes. Additionally, our in silico analyses identified 10 sets of repeats longer than 20 bp and predicted the presence of 36 RNA editing sites. Overall, the chloroplast genome of common bermudagrass resembles those from other Poaceae lineages. Compared to most angiosperms, the accD gene and the introns of both clpP and rpoC1 genes are missing. Additionally, the ycf1, ycf2, ycf15, and ycf68 genes are pseudogenized and two genome rearrangements exist. Our phylogenetic analysis based on 47 chloroplast protein-coding genes supported the placement of common bermudagrass within Chloridoideae. Our phylogenetic character mapping based on the parsimony principle further indicated that the loss of the accD gene and clpP introns, the pseudogenization of four ycf genes, and the two rearrangements occurred only once after the most recent common ancestor of the Poaceae diverged from other monocots, which could explain the unusual long branch leading to the Poaceae when phylogeny is inferred based on chloroplast sequences.

The complete chloroplast genome sequence of Actinidia arguta using the PacBio RS II platform

PubMed Central

Lin, Miaomiao; Qi, Xiujuan; Chen, Jinyong; Sun, Leiming; Zhong, Yunpeng; Fang, Jinbao; Hu, Chungen

2018-01-01

Actinidia arguta is the most basal species in a phylogenetically and economically important genus in the family Actinidiaceae. To better understand the molecular basis of the Actinidia arguta chloroplast (cp), we sequenced the complete cp genome from A. arguta using Illumina and PacBio RS II sequencing technologies. The cp genome from A. arguta was 157,611 bp in length and composed of a pair of 24,232 bp inverted repeats (IRs) separated by a 20,463 bp small single copy region (SSC) and an 88,684 bp large single copy region (LSC). Overall, the cp genome contained 113 unique genes. The cp genomes from A. arguta and three other Actinidia species from GenBank were subjected to a comparative analysis. Indel mutation events and high frequencies of base substitution were identified, and the accD and ycf2 genes showed a high degree of variation within Actinidia. Forty-seven simple sequence repeats (SSRs) and 155 repetitive structures were identified, further demonstrating the rapid evolution in Actinidia. The cp genome analysis and the identification of variable loci provide vital information for understanding the evolution and function of the chloroplast and for characterizing Actinidia population genetics. PMID:29795601

Detecting the Length of Double-stranded DNA with Solid State Nanopores

NASA Astrophysics Data System (ADS)

Li, Jiali; Gershow, Marc; Stein, Derek; Qun, Cai; Brandin, Eric; Wang, Hui; Huang, Albert; Branton, Dan; Golovchenko, Jene

2003-03-01

We report on the use of nanometer scale diameter, solid-state nanopores as single molecule detectors of double stranded DNA molecules. These solid-state nanopores are fabricated in thin membranes of silicon nitride, by ion beam sculpting 1. They produce discrete electronic signals: current blockages, when an electrically biased nanopore is exposed to DNA molecules in aqueous salt solutions. We demonstrate examples of such electronic signals for 3k base pairs (bp) and 10k bp double stranded DNA molecules, which suggest that these molecules are individually translocating through the nanopore during the detection process. The translocating time for the 10k bp double stranded DNA is about 3 times longer than the 3k bp, demonstrating that a solid-state nanopore device can be used to detect the lengths of double stranded DNA molecules. Similarities and differences with signals obtained from single stranded DNA in a biological nanopores are discussed 2. 1. Li, J., Stein, D., McMullan, C., Branton, D. Aziz, M. J. and Golovchenko, J. Ion Beam Sculpting at nanometer length scales. Nature 412, 166-169 (2001). 2. Meller, A., L. Nivon, E. Brandin, Golovchenko, J. & Branton, D. Proc. Natl. Acad. Sci. USA 97, 1079-1084 (2000).

Association between the GABA(A) receptor alpha5 subunit gene locus (GABRA5) and bipolar affective disorder.

PubMed

Papadimitriou, G N; Dikeos, D G; Karadima, G; Avramopoulos, D; Daskalopoulou, E G; Vassilopoulos, D; Stefanis, C N

1998-02-07

Genetic factors seem to play an important role in the pathogenesis of affective disorder. The candidate gene strategies are being used, among others, to identify the genes conferring vulnerability to the disease. The genes coding for the receptors of gamma-aminobutyric acid (GABA) have been proposed as candidates for affective disorder, since the GABA neurotransmitter system has been implicated in the pathogenesis of the illness. We examined the possible genetic association between the GABA(A) receptor alpha5 subunit gene locus (GABRA5) on chromosome 15 and affective disorder, in 48 bipolar patients (BP), 40 unipolar patients (UP), and 50 healthy individuals, age- and sex-matched to the patients. All patients and controls were unrelated Greeks. Diagnoses were made after direct interviews according to the DSM-IV and ICD-10 criteria. For the genotyping, a dinucleotide (CA) repeat marker was used. The polymerase chain reaction (PCR) products found were nine alleles with lengths between 272 and 290 base pairs (bp). The distribution of allelic frequencies of the GABRA5 locus differed significantly between BP patients and controls with the 282-bp allele found to be associated with BP affective disorder, while no such difference was observed between the groups of UP patients and controls nor between the two patient groups. The presence or absence of the 282-bp allele in the genotype of BP patients was not shown to influence the age of onset and the overall clinical severity, but was found to be associated with a preponderance of manic over depressive episodes in the course of the illness.

Detection of Naegleria Species in Environmental Samples from Peninsular Malaysia

PubMed Central

Ithoi, Init; Ahmad, Arine Fadzlun; Nissapatorn, Veeranoot; Lau, Yee Ling; Mahmud, Rohela; Mak, Joon Wah

2011-01-01

Background In Malaysia, researchers and medical practitioners are unfamiliar with Naegleria infections. Thus little is known about the existence of pathogenic Naegleria fowleri, and the resultant primary amoebic meningoencephalitis (PAM) is seldom included in the differential diagnosis of central nervous system infections. This study was conducted to detect the presence of Naegleria species in various environmental samples. Methods/Findings A total of 41 Naegleria-like isolates were isolated from water and dust samples. All these isolates were subjected to PCR using two primer sets designed from the ITS1-ITS2 regions. The N. fowleri species-specific primer set failed to produce the expected amplicon. The Naegleria genus-specific primers produced amplicons of 408 bp (35), 450 bp (2), 457 bp (2) or 381 bp (2) from all 41 isolates isolated from aquatic (33) and dust (8) samples. Analysis of the sequences from 10 representative isolates revealed that amplicons with fragments 408, 450 and 457 bp showed homology with non-pathogenic Naegleria species, and 381 bp showed homology with Vahlkampfia species. These results concurred with the morphological observation that all 39 isolates which exhibited flagella were Naegleria, while 2 isolates (AC7, JN034055 and AC8, JN034056) that did not exhibit flagella were Vahlkampfia species. Conclusion To date, pathogenic species of N. fowleri have not been isolated from Malaysia. All 39 isolates that produced amplicons (408, 450 and 457 bp) from the genus-specific primers were identified as being similar to nonpathogenic Naegleria. Amplicon 408 bp from 5 representative isolates showed 100% and 99.7% identity to Naegleria philippinensis isolate RJTM (AM167890) and is thus believed to be the most common species in our environment. Amplicons 450 bp and 457 bp were respectively believed to be from 2 new species of Naegleria, since representative isolates showed lower homology and had a longer base pair length when compared to the reference species in the Genbank, Naegleria schusteri (AJ566626) and Naegleria laresi (AJ566630), respectively. PMID:21915311

Cost-effectiveness analysis of biodegradable polymer versus durable polymer drug-eluting stents incorporating real-world evidence.

PubMed

Teng, Monica; Zhao, Ying Jiao; Khoo, Ai Leng; Ananthakrishna, Rajiv; Yeo, Tiong Cheng; Lim, Boon Peng; Chan, Mark Y; Loh, Joshua P

2018-06-05

Compared with second-generation durable polymer drug-eluting stents (DP-DES), the cost-effectiveness of biodegradable polymer drug-eluting stents (BP-DES) remains unclear in the real-world setting. We assessed the cost-effectiveness of BP-DES in patients with coronary artery disease undergoing percutaneous coronary intervention (PCI). We developed a decision-analytic model to compare the cost-effectiveness of BP-DES to DP-DES over one year and five years from healthcare payer perspective. Relative treatment effects during the first year post-PCI were obtained from a real-world population analysis while clinical event risks in the subsequent four years were derived from a meta-analysis of published studies. At one year, based on the clinical data analysis of 497 propensity-score matched pairs of patients, BP-DES were associated with an incremental cost-effectiveness ratio (ICER) of USD20,503 per quality-adjusted life-year (QALY) gained. At five years, BP-DES yielded an ICER of USD4,062 per QALY gained. At the willingness-to-pay threshold of USD50,400 (one gross domestic product per capita in Singapore in 2015), BP-DES were cost-effective. Sensitivity analysis showed that the cost of stents had a significant impact on the cost-effectiveness of BP-DES. Threshold analysis demonstrated that if the cost difference between BP-DES and DP-DES exceeded USD493, BP-DES would not be cost-effective in patients with one-year of follow-up. BP-DES were cost-effective compared with DP-DES in patients with coronary artery disease at one year and five years after PCI. It is worth noting that the cost of stents had a significant impact on the findings. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

The complete chloroplast genome sequence of American bird pepper (Capsicum annuum var. glabriusculum).

PubMed

Zeng, Fan-chun; Gao, Cheng-wen; Gao, Li-zhi

2016-01-01

The complete chloroplast genome sequence of American bird pepper (Capsicum annuum var. glabriusculum) is reported and characterized in this study. The genome size is 156,612 bp, containing a pair of inverted repeats (IRs) of 25,776 bp separated by a large single-copy region of 87,213 bp and a small single-copy region of 17,851 bp. The chloroplast genome harbors 130 known genes, including 89 protein-coding genes, 8 ribosomal RNA genes, and 37 tRNA genes. A total of 18 of these genes are duplicated in the inverted repeat regions, 16 genes contain 1 intron, and 2 genes and one ycf have 2 introns.

Gustaf: Detecting and correctly classifying SVs in the NGS twilight zone.

PubMed

Trappe, Kathrin; Emde, Anne-Katrin; Ehrlich, Hans-Christian; Reinert, Knut

2014-12-15

The landscape of structural variation (SV) including complex duplication and translocation patterns is far from resolved. SV detection tools usually exhibit low agreement, are often geared toward certain types or size ranges of variation and struggle to correctly classify the type and exact size of SVs. We present Gustaf (Generic mUlti-SpliT Alignment Finder), a sound generic multi-split SV detection tool that detects and classifies deletions, inversions, dispersed duplications and translocations of ≥ 30 bp. Our approach is based on a generic multi-split alignment strategy that can identify SV breakpoints with base pair resolution. We show that Gustaf correctly identifies SVs, especially in the range from 30 to 100 bp, which we call the next-generation sequencing (NGS) twilight zone of SVs, as well as larger SVs >500 bp. Gustaf performs better than similar tools in our benchmark and is furthermore able to correctly identify size and location of dispersed duplications and translocations, which otherwise might be wrongly classified, for example, as large deletions. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Polymerase chain reaction for detection of invasive Shigella flexneri in food.

PubMed

Lampel, K A; Jagow, J A; Trucksess, M; Hill, W E

1990-06-01

The polymerase chain reaction (PCR) was used to amplify a 760-base-pair (bp) fragment with the 220-kbp invasive plasmids of enteroinvasive Escherichia coli, Shigella flexneri, Shigella dysenteriae, Shigella boydii, and Shigella sonnei as templates. This PCR product was easily detected by agarose gel electrophoresis. A 210-bp AccI-PstI fragment lying within the amplified region was used as a probe in Southern hybridization blots and showed that the PCR-generated product was derived from the invasive plasmid. The application of PCR as a rapid method to detect enteroinvasive bacteria in foods was tested by inoculating lettuce with 10(4) S. flexneri cells per g in shigella broth base. Plasmid DNA was isolated from cultures of inoculated and uninoculated lettuce in broth after 0, 4, and 24 h of incubation. With the PCR, the 760-bp fragment was generated only from lettuce inoculated with S. flexneri, as shown by gel electrophoresis and confirmed both by Southern blotting and by nucleotide sequencing of the amplified region. Because the isolation of plasmid DNA, the performance of PCR, and gel electrophoresis all can be completed in 6 to 7 h, invasive enteric bacteria can be detected in less than 1 day.

cgDNAweb: a web interface to the cgDNA sequence-dependent coarse-grain model of double-stranded DNA.

PubMed

De Bruin, Lennart; Maddocks, John H

2018-06-14

The sequence-dependent statistical mechanical properties of fragments of double-stranded DNA is believed to be pertinent to its biological function at length scales from a few base pairs (or bp) to a few hundreds of bp, e.g. indirect read-out protein binding sites, nucleosome positioning sequences, phased A-tracts, etc. In turn, the equilibrium statistical mechanics behaviour of DNA depends upon its ground state configuration, or minimum free energy shape, as well as on its fluctuations as governed by its stiffness (in an appropriate sense). We here present cgDNAweb, which provides browser-based interactive visualization of the sequence-dependent ground states of double-stranded DNA molecules, as predicted by the underlying cgDNA coarse-grain rigid-base model of fragments with arbitrary sequence. The cgDNAweb interface is specifically designed to facilitate comparison between ground state shapes of different sequences. The server is freely available at cgDNAweb.epfl.ch with no login requirement.

Using galaxy pairs to investigate the three-point correlation function in the squeezed limit

NASA Astrophysics Data System (ADS)

Yuan, Sihan; Eisenstein, Daniel J.; Garrison, Lehman H.

2017-11-01

We investigate the three-point correlation function (3PCF) in the squeezed limit by considering galaxy pairs as discrete objects and cross-correlating them with the galaxy field. We develop an efficient algorithm using fast Fourier transforms to compute such cross-correlations and their associated pair-galaxy bias bp, g and the squeezed 3PCF coefficient Qeff. We implement our method using N-body cosmological simulations and a fiducial halo occupation distribution (HOD) and present the results in both the real space and redshift space. In real space, we observe a peak in bp, g and Qeff at pair separation of ∼2 Mpc, attributed to the fact that galaxy pairs at 2 Mpc separation trace the most massive dark matter haloes. We also see strong anisotropy in the bp, g and Qeff signals that track the large-scale filamentary structure. In redshift space, both the 2 Mpc peak and the anisotropy are significantly smeared out along the line of sight due to finger-of-God effect. In both the real space and redshift space, the squeezed 3PCF shows a factor of 2 variation, contradicting the hierarchical ansatz, but offering rich information on the galaxy-halo connection. Thus, we explore the possibility of using the squeezed 3PCF to constrain the HOD. When we compare two simple HOD models that are closely matched in their projected two-point correlation function (2PCF), we do not yet see a strong variation in the 3PCF that is clearly disentangled from variations in the projected 2PCF. Nevertheless, we propose that more complicated HOD models, e.g. those incorporating assembly bias, can break degeneracies in the 2PCF and show a distinguishable squeezed 3PCF signal.

Single-molecule fluorescence reveals the unwinding stepping mechanism of replicative helicase.

PubMed

Syed, Salman; Pandey, Manjula; Patel, Smita S; Ha, Taekjip

2014-03-27

Bacteriophage T7 gp4 serves as a model protein for replicative helicases that couples deoxythymidine triphosphate (dTTP) hydrolysis to directional movement and DNA strand separation. We employed single-molecule fluorescence resonance energy transfer methods to resolve steps during DNA unwinding by T7 helicase. We confirm that the unwinding rate of T7 helicase decreases with increasing base pair stability. For duplexes containing >35% guanine-cytosine (GC) base pairs, we observed stochastic pauses every 2-3 bp during unwinding. The dwells on each pause were distributed nonexponentially, consistent with two or three rounds of dTTP hydrolysis before each unwinding step. Moreover, we observed backward movements of the enzyme on GC-rich DNAs at low dTTP concentrations. Our data suggest a coupling ratio of 1:1 between base pairs unwound and dTTP hydrolysis, and they further support the concept that nucleic acid motors can have a hierarchy of different-sized steps or can accumulate elastic energy before transitioning to a subsequent phase. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

Quetzal: a transposon of the Tc1 family in the mosquito Anopheles albimanus.

PubMed

Ke, Z; Grossman, G L; Cornel, A J; Collins, F H

1996-10-01

A member of the Tc1 family of transposable elements has been identified in the Central and South American mosquito Anopheles albimanus. The full-length Quetzal element is 1680 base pairs (bp) in length, possesses 236 bp inverted terminal repeats (ITRs), and has a single open reading frame (ORF) with the potential of encoding a 341-amino-acid (aa) protein that is similar to the transposases of other members of the Tc1 family, particularly elements described from three different Drosophila species. The approximately 10-12 copies per genome of Quetzal are found in the euchromatin of all three chromosomes of A. albimanus. One full-length clone, Que27, appears capable of encoding a complete transposase and may represent a functional copy of this element.

Molecular identification and characterization of clustered regularly interspaced short palindromic repeats (CRISPRs) in a urease-positive thermophilic Campylobacter sp. (UPTC).

PubMed

Tasaki, E; Hirayama, J; Tazumi, A; Hayashi, K; Hara, Y; Ueno, H; Moore, J E; Millar, B C; Matsuda, M

2012-02-01

Novel clustered regularly-interspaced short palindromic repeats (CRISPRs) locus [7,500 base pairs (bp) in length] occurred in the urease-positive thermophilic Campylobacter (UPTC) Japanese isolate, CF89-12. The 7,500 bp gene loci consisted of the 5'-methylaminomethyl-2-thiouridylate methyltransferase gene, putative (P) CRISPR associated (p-Cas), putative open reading frames, Cas1 and Cas2, leader sequence region (146 bp), 12 CRISPRs consensus sequence repeats (each 36 bp) separated by a non-repetitive unique spacer region of similar length (26-31 bp) and the phosphatidyl glycerophosphatase A gene. When the CRISPRs loci in the UPTC CF89-12 and five C. jejuni isolates were compared with one another, these six isolates contained p-Cas, Cas1 and Cas2 within the loci. Four to 12 CRISPRs consensus sequence repeats separated by a non-repetitive unique spacer region occurred in six isolates and the nucleotide sequences of those repeats gave approximately 92-100% similarity with each other. However, no sequence similarity occurred in the unique spacer regions among these isolates. The putative σ(70) transcriptional promoter and the hypothetical ρ-independent terminator structures for the CRISPRs and Cas were detected. No in vivo transcription of p-Cas, Cas1 and Cas2 was confirmed in the UPTC cells.

Nonlinear assessment of cerebral autoregulation from spontaneous blood pressure and cerebral blood flow fluctuations.

PubMed

Hu, Kun; Peng, C K; Czosnyka, Marek; Zhao, Peng; Novak, Vera

2008-03-01

Cerebral autoregulation (CA) is an most important mechanism responsible for the relatively constant blood flow supply to brain when cerebral perfusion pressure varies. Its assessment in nonacute cases has been relied on the quantification of the relationship between noninvasive beat-to-beat blood pressure (BP) and blood flow velocity (BFV). To overcome the nonstationary nature of physiological signals such as BP and BFV, a computational method called multimodal pressure-flow (MMPF) analysis was recently developed to study the nonlinear BP-BFV relationship during the Valsalva maneuver (VM). The present study aimed to determine (i) whether this method can estimate autoregulation from spontaneous BP and BFV fluctuations during baseline rest conditions; (ii) whether there is any difference between the MMPF measures of autoregulation based on intra-arterial BP (ABP) and based on cerebral perfusion pressure (CPP); and (iii) whether the MMPF method provides reproducible and reliable measure for noninvasive assessment of autoregulation. To achieve these aims, we analyzed data from existing databases including: (i) ABP and BFV of 12 healthy control, 10 hypertensive, and 10 stroke subjects during baseline resting conditions and during the Valsalva maneuver, and (ii) ABP, CPP, and BFV of 30 patients with traumatic brain injury (TBI) who were being paralyzed, sedated, and ventilated. We showed that autoregulation in healthy control subjects can be characterized by specific phase shifts between BP and BFV oscillations during the Valsalva maneuver, and the BP-BFV phase shifts were reduced in hypertensive and stroke subjects (P < 0.01), indicating impaired autoregulation. Similar results were found during baseline condition from spontaneous BP and BFV oscillations. The BP-BFV phase shifts obtained during baseline and during VM were highly correlated (R > 0.8, P < 0.0001), showing no statistical difference (paired-t test P > 0.47). In TBI patients there were strong correlations between phases of ABP and CPP oscillations (R = 0.99, P < 0.0001) and, thus, between ABP-BFV and CPP-BFV phase shifts (P < 0.0001, R = 0.76). By repeating the MMPF 4 times on data of TBI subjects, each time on a selected cycle of spontaneous BP and BFV oscillations, we showed that MMPF had better reproducibility than traditional autoregulation index. These results indicate that the MMPF method, based on instantaneous phase relationships between cerebral blood flow velocity and peripheral blood pressure, has better performance than the traditional standard method, and can reliably assess cerebral autoregulation dynamics from ambulatory blood pressure and cerebral blood flow during supine rest conditions.

The crystal structure of an oligo(U):pre-mRNA duplex from a trypanosome RNA editing substrate

PubMed Central

Mooers, Blaine H.M.; Singh, Amritanshu

2011-01-01

Guide RNAs bind antiparallel to their target pre-mRNAs to form editing substrates in reaction cycles that insert or delete uridylates (Us) in most mitochondrial transcripts of trypanosomes. The 5′ end of each guide RNA has an anchor sequence that binds to the pre-mRNA by base-pair complementarity. The template sequence in the middle of the guide RNA directs the editing reactions. The 3′ ends of most guide RNAs have ∼15 contiguous Us that bind to the purine-rich unedited pre-mRNA upstream of the editing site. The resulting U-helix is rich in G·U wobble base pairs. To gain insights into the structure of the U-helix, we crystallized 8 bp of the U-helix in one editing substrate for the A6 mRNA of Trypanosoma brucei. The fragment provides three samples of the 5′-AGA-3′/5′-UUU-3′ base-pair triple. The fusion of two identical U-helices head-to-head promoted crystallization. We obtained X-ray diffraction data with a resolution limit of 1.37 Å. The U-helix had low and high twist angles before and after each G·U wobble base pair; this variation was partly due to shearing of the wobble base pairs as revealed in comparisons with a crystal structure of a 16-nt RNA with all Watson–Crick base pairs. Both crystal structures had wider major grooves at the junction between the poly(U) and polypurine tracts. This junction mimics the junction between the template helix and the U-helix in RNA-editing substrates and may be a site of major groove invasion by RNA editing proteins. PMID:21878548

Reversed-phase ion-pair liquid chromatography method for purification of duplex DNA with single base pair resolution

PubMed Central

Wysoczynski, Christina L.; Roemer, Sarah C.; Dostal, Vishantie; Barkley, Robert M.; Churchill, Mair E. A.; Malarkey, Christopher S.

2013-01-01

Obtaining quantities of highly pure duplex DNA is a bottleneck in the biophysical analysis of protein–DNA complexes. In traditional DNA purification methods, the individual cognate DNA strands are purified separately before annealing to form DNA duplexes. This approach works well for palindromic sequences, in which top and bottom strands are identical and duplex formation is typically complete. However, in cases where the DNA is non-palindromic, excess of single-stranded DNA must be removed through additional purification steps to prevent it from interfering in further experiments. Here we describe and apply a novel reversed-phase ion-pair liquid chromatography purification method for double-stranded DNA ranging in lengths from 17 to 51 bp. Both palindromic and non-palindromic DNA can be readily purified. This method has the unique ability to separate blunt double-stranded DNA from pre-attenuated (n-1, n-2, etc) synthesis products, and from DNA duplexes with single base pair overhangs. Additionally, palindromic DNA sequences with only minor differences in the central spacer sequence of the DNA can be separated, and the purified DNA is suitable for co-crystallization of protein–DNA complexes. Thus, double-stranded ion-pair liquid chromatography is a useful approach for duplex DNA purification for many applications. PMID:24013567

Karyotype variability in tropical maize sister inbred lines and hybrids compared with KYS standard line

PubMed Central

Mondin, Mateus; Santos-Serejo, Janay A.; Bertäo, Mônica R.; Laborda, Prianda; Pizzaia, Daniel; Aguiar-Perecin, Margarida L. R.

2014-01-01

Maize karyotype variability has been extensively investigated. The identification of maize somatic and pachytene chromosomes has improved with the development of fluorescence in situ hybridization (FISH) using tandemly repeated DNA sequences as probes. We identified the somatic chromosomes of sister inbred lines that were derived from a tropical flint maize population (Jac Duro [JD]), and hybrids between them, using FISH probes for the 180-bp knob repeat, centromeric satellite (CentC), centromeric satellite 4 (Cent4), subtelomeric clone 4-12-1, 5S ribosomal DNA and nucleolus organizing region DNA sequences. The observations were integrated with data based on C-banded mitotic metaphases and conventional analysis of pachytene chromosomes. Heterochromatic knobs visible at pachynema were coincident with C-bands and 180-bp FISH signals on somatic chromosomes, and most of them were large. Variation in the presence of some knobs was observed among lines. Small 180-bp knob signals were invariant on the short arms of chromosomes 1, 6, and 9. The subtelomeric 4-12-1 signal was also invariant and useful for identifying some chromosomes. The centromere location of chromosomes 2 and 4 differed from previous reports on standard maize lines. Somatic chromosomes of a JD line and the commonly used KYS line were compared by FISH in a hybrid of these lines. The pairing behavior of chromosomes 2 and 4 at pachytene stage in this hybrid was investigated using FISH with chromosome-specific probes. The homologues were fully synapsed, including the 5S rDNA and CentC sites on chromosome 2, and Cent4 and subtelomeric 4-12-1 sites on chromosome 4. This suggests that homologous chromosomes could pair through differential degrees of chromatin packaging in homologous arms differing in size. The results contribute to current knowledge of maize global diversity and also raise questions concerning the meiotic pairing of homologous chromosomes possibly differing in their amounts of repetitive DNA. PMID:25352856

Kinetic Modeling of the Tau PET Tracer 18F-AV-1451 in Human Healthy Volunteers and Alzheimer Disease Subjects.

PubMed

Barret, Olivier; Alagille, David; Sanabria, Sandra; Comley, Robert A; Weimer, Robby M; Borroni, Edilio; Mintun, Mark; Seneca, Nicholas; Papin, Caroline; Morley, Thomas; Marek, Ken; Seibyl, John P; Tamagnan, Gilles D; Jennings, Danna

2017-07-01

18 F-AV-1451 is currently the most widely used of several experimental tau PET tracers. The objective of this study was to evaluate 18 F-AV-1451 binding with full kinetic analysis using a metabolite-corrected arterial input function and to compare parameters derived from kinetic analysis with SUV ratio (SUVR) calculated over different imaging time intervals. Methods: 18 F-AV-1451 PET brain imaging was completed in 16 subjects: 4 young healthy volunteers (YHV), 4 aged healthy volunteers (AHV), and 8 Alzheimer disease (AD) subjects. Subjects were imaged for 3.5 h, with arterial blood samples obtained throughout. PET data were analyzed using plasma and reference tissue-based methods to estimate the distribution volume, binding potential (BP ND ), and SUVR. BP ND and SUVR were calculated using the cerebellar cortex as a reference region and were compared across the different methods and across the 3 groups (YHV, AHV, and AD). Results: AD demonstrated increased 18 F-AV-1451 retention compared with YHV and AHV based on both invasive and noninvasive analyses in cortical regions in which paired helical filament tau accumulation is expected in AD. A correlation of R 2 > 0.93 was found between BP ND (130 min) and SUVR-1 at all time intervals. Cortical SUVR curves reached a relative plateau around 1.0-1.2 for YHV and AHV by approximately 50 min, but increased in AD by up to approximately 20% at 110-130 min and approximately 30% at 160-180 min relative to 80-100 min. Distribution volume (130 min) was lower by 30%-35% in the YHV than AHV. Conclusion: Our data suggest that although 18 F-AV-1451 SUVR curves do not reach a plateau and are still increasing in AD, an SUVR calculated over an imaging window of 80-100 min (as currently used in clinical studies) provides estimates of paired helical filament tau burden in good correlation with BP ND , whereas SUVR sensitivity to regional cerebral blood changes needs further investigation. © 2017 by the Society of Nuclear Medicine and Molecular Imaging.

Genetic analysis of 430 Chinese Cynodon dactylon accessions using sequence-related amplified polymorphism markers.

PubMed

Huang, Chunqiong; Liu, Guodao; Bai, Changjun; Wang, Wenqiang

2014-10-21

Although Cynodon dactylon (C. dactylon) is widely distributed in China, information on its genetic diversity within the germplasm pool is limited. The objective of this study was to reveal the genetic variation and relationships of 430 C. dactylon accessions collected from 22 Chinese provinces using sequence-related amplified polymorphism (SRAP) markers. Fifteen primer pairs were used to amplify specific C. dactylon genomic sequences. A total of 481 SRAP fragments were generated, with fragment sizes ranging from 260-1800 base pairs (bp). Genetic similarity coefficients (GSC) among the 430 accessions averaged 0.72 and ranged from 0.53-0.96. Cluster analysis conducted by two methods, namely the unweighted pair-group method with arithmetic averages (UPGMA) and principle coordinate analysis (PCoA), separated the accessions into eight distinct groups. Our findings verify that Chinese C. dactylon germplasms have rich genetic diversity, which is an excellent basis for C. dactylon breeding for new cultivars.

The complete mitogenome of the river blackfish, Gadopsis marmoratus (Richardson, 1848) (Teleostei: Percichthyidae).

PubMed

Gan, Han Ming; Tan, Mun Hua; Lee, Yin Peng; Austin, Christopher M

2016-05-01

The mitogenome of the Australian freshwater blackfish, Gadopsis marmoratus was recovered coverage by genome skimming using the MiSeq sequencer (GenBank Accession Number: NC_024436). The blackfish mitogenome has 16,407 base pairs made up of 13 protein-coding genes, 2 ribosomal subunit genes, 22 transfer RNAs, and a 819 bp non-coding AT-rich region. This is the 5th mitogenome sequence to be reported for the family Percichthyidae.

The whole chloroplast genome of wild rice (Oryza australiensis).

PubMed

Wu, Zhiqiang; Ge, Song

2016-01-01

The whole chloroplast genome of wild rice (Oryza australiensis) is characterized in this study. The genome size is 135,224  bp, exhibiting a typical circular structure including a pair of 25,776  bp inverted repeats (IRa,b) separated by a large single-copy region (LSC) of 82,212  bp and a small single-copy region (SSC) of 12,470  bp. The overall GC content of the genome is 38.95%. 110 unique genes were annotated, including 76 protein-coding genes, 4 ribosomal RNA genes, and 30t RNA genes. Among these, 18 are duplicated in the inverted repeat regions, 13 genes contain one intron, and 2 genes (rps12 and ycf3) have two introns.

The complete chloroplast genome of a medicinal plant Epimedium koreanum Nakai (Berberidaceae).

PubMed

Lee, Jung-Hoon; Kim, Kyunghee; Kim, Na-Rae; Lee, Sang-Choon; Yang, Tae-Jin; Kim, Young-Dong

2016-11-01

Epimedium koreanum is a perennial medicinal plant distributed in Eastern Asia. The complete chloroplast genome sequences of E. koreanum was obtained by de novo assembly using whole genome next-generation sequences. The chloroplast genome of E. koreanum was 157 218 bp in length and separated into four distinct regions such as large single copy region (89 600 bp), small single copy region (17 222 bp) and a pair of inverted repeat regions (25 198 bp). The genome contained a total of 112 genes including 78 protein-coding genes, 30 tRNA genes, and 4 rRNA genes. Phylogenetic analysis with the reported chloroplast genomes revealed that E. koreanum is most closely related to Berberis bealei, a traditional medicinal plant in the Berberidaceae family.

Molecular mechanisms of ribosomal protein gene coregulation

PubMed Central

Reja, Rohit; Vinayachandran, Vinesh; Ghosh, Sujana; Pugh, B. Franklin

2015-01-01

The 137 ribosomal protein genes (RPGs) of Saccharomyces provide a model for gene coregulation. We examined the positional and functional organization of their regulators (Rap1 [repressor activator protein 1], Fhl1, Ifh1, Sfp1, and Hmo1), the transcription machinery (TFIIB, TFIID, and RNA polymerase II), and chromatin at near-base-pair resolution using ChIP-exo, as RPGs are coordinately reprogrammed. Where Hmo1 is enriched, Fhl1, Ifh1, Sfp1, and Hmo1 cross-linked broadly to promoter DNA in an RPG-specific manner and demarcated by general minor groove widening. Importantly, Hmo1 extended 20–50 base pairs (bp) downstream from Fhl1. Upon RPG repression, Fhl1 remained in place. Hmo1 dissociated, which was coupled to an upstream shift of the +1 nucleosome, as reflected by the Hmo1 extension and core promoter region. Fhl1 and Hmo1 may create two regulatable and positionally distinct barriers, against which chromatin remodelers position the +1 nucleosome into either an activating or a repressive state. Consistent with in vitro studies, we found that specific TFIID subunits, in addition to cross-linking at the core promoter, made precise cross-links at Rap1 sites, which we interpret to reflect native Rap1–TFIID interactions. Our findings suggest how sequence-specific DNA binding regulates nucleosome positioning and transcription complex assembly >300 bp away and how coregulation coevolved with coding sequences. PMID:26385964

Structural studies on Pax-8 Prd domain/DNA complex.

PubMed

Campagnolo, M; Pesaresi, A; Zelezetsky, I; Geremia, S; Randaccio, L; Bisca, A; Tell, G

2007-04-01

Pax-8 is a member of the Pax family of transcription factors and is essential in the development of thyroid follicular cells. Pax-8 has two DNA-binding domains: the paired domain and the homeo domain. In this study, a preliminary X-ray diffraction analysis of the mammalian Pax-8 paired domain in complex with the C-site of the thyroglobulin promoter was achieved. The Pax-8 paired domain was crystallized by the hanging-drop vapor-diffusion method in complex with both a blunt-ended 26 bp DNA fragment and with a sticky-ended 24 bp DNA fragment with two additional overhanging bases. Crystallization experiments make clear that the growth of transparent crystals with large dimensions and regular shape is particularly influenced by ionic strength. The crystals of Pax-8 complex with blunt-ended and sticky-ended DNA, diffracted synchrotron radiation to 6.0 and 8.0 A resolution and belongs both to the C centered monoclinic system with cell dimensions: a = 89.88 A, b = 80.05 A, c = 67.73 A, and beta = 124.3 degrees and a = 256.56, b = 69.07, c = 99.32 A, and beta = 98.1 degrees , respectively. Fluorescence experiments suggest that the crystalline disorder, deduced by the poor diffraction, can be attributed to the low homogeneity of the protein-DNA sample. The theoretical comparative model of the Pax-8 paired domain complexed with the C-site of the thyroglobulin promoter shows the probable presence of some specific protein-DNA interactions already observed in other Pax proteins and the important role of the cysteine residues of PAI subdomain in the redox control of the DNA recognition.

Development of a suspension microarray for the genotyping of African swine fever virus targeting the SNPs in the C-terminal end of the p72 gene region of the genome.

PubMed

Leblanc, N; Cortey, M; Fernandez Pinero, J; Gallardo, C; Masembe, C; Okurut, A R; Heath, L; van Heerden, J; Sánchez-Vizcaino, J M; Ståhl, K; Belák, S

2013-08-01

African swine fever virus (ASFV) causes one of the most dreaded transboundary animal diseases (TADs) in Suidae. African swine fever (ASF) often causes high rates of morbidity and mortality, which can reach 100% in domestic swine. To date, serological diagnosis has the drawback of not being able to differentiate variants of this virus. Previous studies have identified the 22 genotypes based on sequence variation in the C-terminal region of the p72 gene, which has become the standard for categorizing ASFVs. This article describes a genotyping assay developed using a segment of PCR-amplified genomic DNA of approximately 450 bp, which encompasses the C-terminal end of the p72 gene. Complementary paired DNA probes of 15 or 17 bp in length, which are identical except for a single nucleotide polymorphism (SNP) in the central position, were designed to either individually or in combination differentiate between the 22 genotypes. The assay was developed using xMAP technology; probes were covalently linked to microspheres, hybridized to PCR product, labelled with a reporter and read in the Luminex 200 analyzer. Characterization of the sample was performed by comparing fluorescence of the paired SNP probes, that is, the probe with higher fluorescence in a complementary pair identified the SNP that a particular sample possessed. In the final assay, a total of 52 probes were employed, 24 SNP pairs and 4 for general detection. One or more samples from each of the 22 genotypes were tested. The assay was able to detect and distinguish all 22 genotypes. This novel assay provides a powerful novel tool for the simultaneous rapid diagnosis and genotypic differentiation of ASF. © 2012 Blackwell Verlag GmbH.

Abundance and Characterization of Perfect Microsatellites on the Cattle Y Chromosome.

PubMed

Ma, Zhi-Jie

2017-07-03

Microsatellites or simple sequence repeats (SSRs) are found in most organisms and play an important role in genomic organization and function. To characterize the abundance of SSRs (1-6 base-pairs [bp]) on the cattle Y chromsome, the relative frequency and density of perfect or uninterrupted SSRs based on the published Y chromosome sequence were examined. A total of 17,273 perfect SSRs were found, with total length of 324.78 kb, indicating that approximately 0.75% of the cattle Y chromosome sequence (43.30 Mb) comprises perfect SSRs, with an average length of 18.80 bp. The relative frequency and density were 398.92 loci/Mb and 7500.62 bp/Mb, respectively. The proportions of the six classes of perfect SSRs were highly variable on the cattle Y chromosome. Mononucleotide repeats had a total number of 8073 (46.74%) and an average length of 15.45 bp, and were the most abundant SSRs class, while the percentages of di-, tetra-, tri-, penta-, and hexa-nucleotide repeats were 22.86%, 11.98%, 11.58%, 6.65%, and 0.19%, respectively. Different classes of SSRs varied in their repeat number, with the highest being 42 for dinucleotides. Results reveal that repeat categories A, AC, AT, AAC, AGC, GTTT, CTTT, ATTT, and AACTG predominate on the Y chromosome. This study provides insight into the organization of cattle Y chromosome repetitive DNA, as well as information useful for developing more polymorphic cattle Y-chromosome-specific SSRs.

Two synthetic Sp1-binding sites functionally substitute for the 21-base-pair repeat region to activate simian virus 40 growth in CV-1 cells.

PubMed Central

Lednicky, J; Folk, W R

1992-01-01

The 21-bp repeat region of simian virus 40 (SV40) activates viral transcription and DNA replication and contains binding sites for many cellular proteins, including Sp1, LSF, ETF, Ap2, Ap4, GT-1B, H16, and p53, and for the SV40 large tumor antigen. We have attempted to reduce the complexity of this region while maintaining its growth-promoting capacity. Deletion of the 21-bp repeat region from the SV40 genome delays the expression of viral early proteins and DNA replication and reduces virus production in CV-1 cells. Replacement of the 21-bp repeat region with two copies of DNA sequence motifs bound with high affinities by Sp1 promotes SV40 growth in CV-1 cells to nearly wild-type levels, but substitution by motifs bound less avidly by Sp1 or bound by other activator proteins does not restore growth. This indicates that Sp1 or a protein with similar sequence specificity is primarily responsible for the function of the 21-bp repeat region. We speculate about how Sp1 activates both SV40 transcription and DNA replication. Images PMID:1328672

Topography of the ISW2–nucleosome complex: insights into nucleosome spacing and chromatin remodeling

PubMed Central

Kagalwala, Mohamedi N; Glaus, Benjamin J; Dang, Weiwei; Zofall, Martin; Bartholomew, Blaine

2004-01-01

Linker DNA was found to be critical for the specific docking of ISW2 with nucleosomes as shown by mapping the physical contacts of ISW2 with nucleosomes at base-pair resolution. Hydroxyl radical footprinting revealed that ISW2 not only extensively interacts with the linker DNA, but also approaches the nucleosome from the side perpendicular to the axis of the DNA superhelix and contacts two disparate sites on the nucleosomal DNA from opposite sides of the superhelix. The topography of the ISW2–nucleosome was further delineated by finding which of the ISW2 subunits are proximal to specific sites within the linker and nucleosomal DNA regions by site-directed DNA photoaffinity labeling. Although ISW2 was shown to contact ∼63 bp of linker DNA, a minimum of 20 bp of linker DNA was required for stable binding of ISW2 to nucleosomes. The remaining ∼43 bp of flanking linker DNA promoted more efficient binding under competitive binding conditions and was functionally important for enhanced sliding of nucleosomes when ISW2 was significantly limiting. PMID:15131696

From the γ γ →p p ¯ reaction to the production of p p ¯ pairs in ultraperipheral ultrarelativistic heavy-ion collisions at the LHC

NASA Astrophysics Data System (ADS)

Kłusek-Gawenda, Mariola; Lebiedowicz, Piotr; Nachtmann, Otto; Szczurek, Antoni

2017-11-01

In this paper we consider the production of proton-antiproton pairs in two-photon interactions in electron-positron and heavy-ion collisions. We try to understand the dependence of the total cross section on the photon-photon c.m. energy as well as corresponding angular distributions measured by the Belle Collaboration for the γ γ →p p ¯ process. To understand the Belle data we include the proton-exchange, the f2(1270 ) and f2(1950 ) s -channel exchanges, as well as the hand-bag mechanism. The helicity amplitudes for the γ γ →f2→p p ¯ process are written explicitly based on a Lagrangian approach. The parameters of vertex form factors are adjusted to the Belle data. Having described the angular distributions for the γ γ →p p ¯ process we present first predictions for the ultraperipheral, ultrarelativistic, heavy-ion reaction P208bP208b→P208bP208bp p ¯ . Both, the total cross section and several differential distributions for experimental cuts corresponding to the ALICE, ATLAS, CMS, and LHCb experiments are presented. We find the total cross section 100 μ b for the ALICE cuts, 160 μ b for the ATLAS cuts, 500 μ b for the CMS cuts, and 104 μ b taking into account the LHCb cuts. This opens a possibility to study the γ γ →p p ¯ process at the LHC.

Doping-stabilized two-dimensional black phosphorus.

PubMed

Xuan, Xiaoyu; Zhang, Zhuhua; Guo, Wanlin

2018-05-03

Two-dimensional (2D) black phosphorus (BP) has attracted broad interests but remains to be synthesized. One of the issues lies in its large number of 2D allotropes with highly degenerate energies, especially 2D blue phosphorus. Here, we show that both nitrogen and hole-carrier doping can lift the energy degeneracy and locate 2D BP in a deep global energy minimum, while arsenic doping favours the formation of 2D blue phosphorus, attributed to a delicate interplay between s-p overlapping and repulsion of lone pairs. Chemically inert substrates, e.g. graphene and hexagonal boron nitride, can be synergic with carrier doping to stabilize the BP further over other 2D allotropes, while frequently used metal substrates severely reduce the stability of 2D BP. These results not only offer new insight into the structural stability of 2D phosphorus but also suggest a promising pathway towards the chemical synthesis of 2D BP.

Rapid and simple method by combining FTA™ card DNA extraction with two set multiplex PCR for simultaneous detection of non-O157 Shiga toxin-producing Escherichia coli strains and virulence genes in food samples.

PubMed

Kim, S A; Park, S H; Lee, S I; Ricke, S C

2017-12-01

The aim of this research was to optimize two multiplex polymerase chain reaction (PCR) assays that could simultaneously detect six non-O157 Shiga toxin-producing Escherichia coli (STEC) as well as the three virulence genes. We also investigated the potential of combining the FTA™ card-based DNA extraction with the multiplex PCR assays. Two multiplex PCR assays were optimized using six primer pairs for each non-O157 STEC serogroup and three primer pairs for virulence genes respectively. Each STEC strain specific primer pair only amplified 155, 238, 321, 438, 587 and 750 bp product for O26, O45, O103, O111, O121 and O145 respectively. Three virulence genes were successfully multiplexed: 375 bp for eae, 655 bp for stx1 and 477 bp for stx2. When two multiplex PCR assays were validated with ground beef samples, distinctive bands were also successfully produced. Since the two multiplex PCR examined here can be conducted under the same PCR conditions, the six non-O157 STEC and their virulence genes could be concurrently detected with one run on the thermocycler. In addition, all bands clearly appeared to be amplified by FTA card DNA extraction in the multiplex PCR assay from the ground beef sample, suggesting that an FTA card could be a viable sampling approach for rapid and simple DNA extraction to reduce time and labour and therefore may have practical use for the food industry. Two multiplex polymerase chain reaction (PCR) assays were optimized for discrimination of six non-O157 Shiga toxin-producing Escherichia coli (STEC) and identification of their major virulence genes within a single reaction, simultaneously. This study also determined the successful ability of the FTA™ card as an alternative to commercial DNA extraction method for conducting multiplex STEC PCR assays. The FTA™ card combined with multiplex PCR holds promise for the food industry by offering a simple and rapid DNA sample method for reducing time, cost and labour for detection of STEC in food and environmental samples. © 2017 The Society for Applied Microbiology.

Ancient DNA evidence of Iberian lynx palaeoendemism

NASA Astrophysics Data System (ADS)

Rodríguez-Varela, Ricardo; Tagliacozzo, Antonio; Ureña, Irene; García, Nuria; Crégut-Bonnoure, Evelyne; Mannino, Marcello A.; Arsuaga, Juan Luis; Valdiosera, Cristina

2015-03-01

The Iberian lynx, endemic to the Iberian Peninsula, is the most threatened carnivore in Europe and the most endangered felid in the world. Widely distributed throughout Iberia during the Pleistocene and Holocene it is now confined to two small populations in southern Spain. Lynx species differentiation, based solely on morphological analysis from skeletal traits, is a difficult task and can potentially lead to misidentification. In order to verify whether Iberian lynx had a wider geographical distribution in the past, we successfully sequenced 152 base pairs (bp) of the cytochrome b gene and 183 bp of the mitochondrial control region in 20 Late Pleistocene and Holocene fossil remains of Lynx sp. from southern Europe. Our results confirm the presence of Iberian lynx outside the Iberian Peninsula demonstrating that this is a palaeoendemic species that had a wider distribution range in southern Europe during the Holocene and the Late Pleistocene. In addition, we documented the presence of both Palaearctic extant lynx species in the Arene Candide (north Italy) site during the Last Glacial Maximum.

Evidence That Intergenic Spacer Repeats of Drosophila Melanogaster Rrna Genes Function as X-Y Pairing Sites in Male Meiosis, and a General Model for Achiasmatic Pairing

PubMed Central

McKee, B. D.; Habera, L.; Vrana, J. A.

1992-01-01

In Drosophila melanogaster males, X-Y meiotic chromosome pairing is mediated by the nucleolus organizers (NOs) which are located in the X heterochromatin (Xh) and near the Y centromere. Deficiencies for Xh disrupt X-Y meiotic pairing and cause high frequencies of X-Y nondisjunction. Insertion of cloned rRNA genes on an Xh(-) chromosome partially restores normal X-Y pairing and disjunction. To map the sequences within an inserted, X-linked rRNA gene responsible for stimulating X-Y pairing, partial deletions were generated by P element-mediated destabilization of the insert. Complete deletions of the rRNA transcription unit did not interfere with the ability to stimulate X-Y pairing as long as most of the intergenic spacer (IGS) remained. Within groups of deletions that lacked the entire transcription unit and differed only in length of residual IGS material, pairing ability was proportional to the dose of 240-bp intergenic spacer repeats. Deletions of the complete rRNA transcription unit or of the 28S sequences alone blocked nucleolus formation, as determined by binding of an antinucleolar antibody, yet did not interfere with pairing ability, suggesting that X-Y pairing may not be mechanistically related to nucleolus formation. A model for achiasmatic pairing in Drosophila males based upon the combined action of topoisomerase I and a strand transferase is proposed. PMID:1330825

[Detection and application of PIS genetic deficiency gene in dairy goat].

PubMed

Yang, Bo; Jia, Li-Li; Zhao, De-Chao; Meng, Li-Yun; Liu, Xue-Feng; Zhang, Yan-Jun; Zhang, Wen-Guang; Li, Jin-Quan

2012-07-01

The purpose of this study was to develop a molecular method for detecting polled intersex syndrome (PIS) genetic deficiency gene in dairy goat. Three pairs of primers, PIS-, PIS+, and NEI were designed based on PIS gene sequence (AF404302) to identify the PIS genetic deficiency genotype. For the normal phenotype, the fragments of 141 and 300 bp were obtained for the genotype PIS-PIS-, and 141, 449, and 300 bp for the genotype PIS-PIS+. For the PIS goat with the genotype PIS+PIS+, 449 and 300 bp were obtained. Two hundred and twenty-four dairy goats in one population were tested based on this method. The results showed that there were 150 PIS-PIS+, 70 PIS -PIS-, and 4 PIS+PIS+. The genotype frequency of PIS-PIS+ was 66.9%, and the gene frequency of PIS+ was 35.3% in the population. Therefore, the frequency of PIS offspring was over 12%. This study developed a method to detect PIS genetic deficiency dairy goat. The method could identify buck genotype accurately to avoid the occurrence of PIS genetic deficiency. The ease and accuracy show a strong potential of the method for use in marker assisted selection of dairy goats and healthy development of dairy goat industry.

Development of a Diagnostic Tool to Detect DNA Methylation Biomarkers for Early-Stage Lung Cancer

DTIC Science & Technology

2015-02-01

include: 1) a DNA recognition domain that recognizes the specific DNA sequence of interest and 2) one half of the leucine zipper pair. The second...piece will include 1) the second half of the leucine zipper pair, 2) a flexible linker flanked by a FRET pair that determines the local (within 30 bp...each other to determine the resolution of our probes. All DNA fragments are methylated using bacterial methyltransferase. Since only a single CG

Photoclickable dendritic molecular glue: noncovalent-to-covalent photochemical transformation of protein hybrids.

PubMed

Uchida, Noriyuki; Okuro, Kou; Niitani, Yamato; Ling, Xiao; Ariga, Takayuki; Tomishige, Michio; Aida, Takuzo

2013-03-27

A water-soluble dendron with a fluorescein isothiocyanate (FITC) fluorescent label and bearing nine pendant guanidinium ion (Gu(+))/benzophenone (BP) pairs at its periphery (Glue(BP)-FITC) serves as a "photoclickable molecular glue". By multivalent salt-bridge formation between Gu(+) ions and oxyanions, Glue(BP)-FITC temporarily adheres to a kinesin/microtubule hybrid. Upon subsequent exposure to UV light, this noncovalent binding is made permanent via a cross-linking reaction mediated by carbon radicals derived from the photoexcited BP units. This temporal-to-permanent transformation by light occurs quickly and efficiently in this preorganized state, allowing the movements of microtubules on a kinesin-coated glass plate to be photochemically controlled. A fundamental difference between such temporal and permanent bindings was visualized by the use of "optical tweezers".

The complete chloroplast genome of Sinopodophyllum hexandrum (Berberidaceae).

PubMed

Li, Huie; Guo, Qiqiang

2016-07-01

The complete chloroplast (cp) genome of the Sinopodophyllum hexandrum (Berberidaceae) was determined in this study. The circular genome is 157,940 bp in size, and comprises a pair of inverted repeat (IR) regions of 26,077 bp each, a large single-copy (LSC) region of 86,460 bp and a small single-copy (SSC) region of 19,326 bp. The GC content of the whole cp genome was 38.5%. A total of 133 genes were identified, including 88 protein-coding genes, 37 tRNA genes and eight rRNA genes. The whole cp genome consists of 114 unique genes, and 19 genes are duplicated in the IR regions. The phylogenetic analysis revealed that S. hexandrum is closely related to Nandina domestica within the family Berberidaceae.

The complete chloroplast genome sequence of Euonymus japonicus (Celastraceae).

PubMed

Choi, Kyoung Su; Park, SeonJoo

2016-09-01

The complete chloroplast (cp) genome sequence of the Euonymus japonicus, the first sequenced of the genus Euonymus, was reported in this study. The total length was 157 637 bp, containing a pair of 26 678 bp inverted repeat region (IR), which were separated by small single copy (SSC) region and large single copy (LSC) region of 18 340 bp and 85 941 bp, respectively. This genome contains 107 unique genes, including 74 coding genes, four rRNA genes, and 29 tRNA genes. Seventeen genes contain intron of E. japonicus, of which three genes (clpP, ycf3, and rps12) include two introns. The maximum likelihood (ML) phylogenetic analysis revealed that E. japonicus was closely related to Manihot and Populus.

Structural Basis of Transcriptional Regulation of the Proline Utilization Regulon by Multifunctional PutA

PubMed Central

Zhou, Yuzhen; Larson, John D.; Bottoms, Christopher A.; Arturo, Emilia C.; Henzl, Michael T.; Jenkins, Jermaine L.; Nix, Jay C.; Becker, Donald F.; Tanner, John J.

2009-01-01

Summary The multifunctional Escherichia coli PutA flavoprotein functions as both a membrane-associated proline catabolic enzyme and transcriptional repressor of the proline utilization genes putA and putP. To better understand the mechanism of transcriptional regulation by PutA, we have mapped the put regulatory region, determined a crystal structure of the PutA ribbon-helix-helix domain (PutA52) complexed with DNA and examined the thermodynamics of DNA binding to PutA52. Five operator sites, each containing the sequence motif 5′-GTTGCA-3′, were identified using gel-shift analysis. Three of the sites are shown to be critical for repression of putA, whereas the two other sites are important for repression of putP. The 2.25 Å resolution crystal structure of PutA52 bound to one of the operators (operator 2, 21-bp) shows that the protein contacts a 9-bp fragment, corresponding to the GTTGCA consensus motif plus three flanking base pairs. Since the operator sequences differ in flanking bases, the structure implies that PutA may have different affinities for the five operators. This hypothesis was explored using isothermal titration calorimetry. The binding of PutA52 to operator 2 is exothermic with an enthalpy of −1.8 kcal/mol and a dissociation constant of 210 nM. Substitution of the flanking bases of operator 4 into operator 2 results in an unfavorable enthalpy of 0.2 kcal/mol and 15-fold lower affinity, which shows that base pairs outside of the consensus motif impact binding. The structural and thermodynamic data suggest that hydrogen bonds between Lys9 and bases adjacent to the GTTGCA motif contribute to transcriptional regulation by fine-tuning the affinity of PutA for put control operators. PMID:18586269

A simple and rapid method for detection of Trypanosoma evansi in the dromedary camel using a nested polymerase chain reaction

PubMed Central

Aradaib, Imadeldin E; Majid, Ali A

2006-01-01

A nested polymerase chain reaction (nPCR)-based assay, was developed and evaluated for rapid detection of Trypanosoma evansi in experimentally infected mice and naturally infected camels (Camelus dromedarius). Four oligonucleotide primers (TE1, TE2, TE3 and TE4), selected from nuclear repetitive gene of T. evansi, were designed and used for PCR amplifications. The first amplification, using a pair of outer primers TE1 and TE2, produced a 821-bp primary PCR product from T. evansi DNA. The second amplification, using nested (internal) pair of primers TE3 and TE4, produced a 270-bp PCR product. T. evansi DNAs extracted from blood samples of experimentally infected mice and naturally infected Sudanese breed of dromedary camels were detected by this nested PCR-based assay. The nested primers TE3 and TE4 increased the sensitivity of the PCR assay and as little as 10 fg of T. evansi DNA (equivalent to a single copy of the putative gene of the parasite) was amplified and visualized onto ethidium bromide-stained agarose gels. Amplification products were not detected when the PCR-based assay was applied to DNA from other blood parasites including Thieleria annulata, Babesia bigemina or nucleic acid free samples. Application of this nPCR-based assay to clinical samples resulted in direct detection of T. evansi from a variety of tissue samples collected from experimentally infected mice and blood from naturally infected camels. The described nPCR-based assay provides a valuable tool to study the epidemiology of T. evansi infection in camels and other susceptible animal populations. PMID:16712737

The complete chloroplast genome sequence of date palm (Phoenix dactylifera L.).

PubMed

Yang, Meng; Zhang, Xiaowei; Liu, Guiming; Yin, Yuxin; Chen, Kaifu; Yun, Quanzheng; Zhao, Duojun; Al-Mssallem, Ibrahim S; Yu, Jun

2010-09-15

Date palm (Phoenix dactylifera L.), a member of Arecaceae family, is one of the three major economically important woody palms--the two other palms being oil palm and coconut tree--and its fruit is a staple food among Middle East and North African nations, as well as many other tropical and subtropical regions. Here we report a complete sequence of the data palm chloroplast (cp) genome based on pyrosequencing. After extracting 369,022 cp sequencing reads from our whole-genome-shotgun data, we put together an assembly and validated it with intensive PCR-based verification, coupled with PCR product sequencing. The date palm cp genome is 158,462 bp in length and has a typical quadripartite structure of the large (LSC, 86,198 bp) and small single-copy (SSC, 17,712 bp) regions separated by a pair of inverted repeats (IRs, 27,276 bp). Similar to what has been found among most angiosperms, the date palm cp genome harbors 112 unique genes and 19 duplicated fragments in the IR regions. The junctions between LSC/IRs and SSC/IRs show different features of sequence expansion in evolution. We identified 78 SNPs as major intravarietal polymorphisms within the population of a specific cp genome, most of which were located in genes with vital functions. Based on RNA-sequencing data, we also found 18 polycistronic transcription units and three highly expression-biased genes--atpF, trnA-UGC, and rrn23. Unlike most monocots, date palm has a typical cp genome similar to that of tobacco--with little rearrangement and gene loss or gain. High-throughput sequencing technology facilitates the identification of intravarietal variations in cp genomes among different cultivars. Moreover, transcriptomic analysis of cp genes provides clues for uncovering regulatory mechanisms of transcription and translation in chloroplasts.

[Development of specific and degenerated primers to CesA genes encoding flax (Linum usitatissimum L.) cellulose synthase].

PubMed

Grushetskaia, Z E; Lemesh, V A; Khotyleva, L V

2010-01-01

Cellulose synthase catalytic subunit genes, CesA, have been discovered in several higher plant species, and it has been shown that the CesA gene family has multiple members. HVR2 fragment of these genes determine the class specificity of the CESA protein and its participation in the primary or secondary cell wall synthesis. The aim of this study was development of specific and degenerated primers to flax CesA gene fragments leading to obtaining the class specific HVR2 region of the gene. Two pairs of specific primers to the certain fragments of CesA-1 and CesA-6 genes and one pair of degenerated primers to HVR2 region of all flax CesA genes were developed basing on comparison of six CesA EST sequences of flax and full cDNA sequences of Arabidopsis, poplar, maize and cotton plants, obtained from GenBank. After amplification of flax cDNA, the bands of expected size were detected (201 and 300 b.p. for the CesA-1 and CesA-6, and 600 b.p. for the HVR2 region of CesA respectively). The developed markers can be used for cloning and sequencing of flax CesA genes, identifying their number in flax genome, tissue and stage specificity.

The rise and fall of an ancient Adélie penguin `supercolony' at Cape Adare, Antarctica

NASA Astrophysics Data System (ADS)

Emslie, Steven D.; McKenzie, Ashley; Patterson, William P.

2018-04-01

We report new discoveries and radiocarbon dates on active and abandoned Adélie penguin (Pygoscelis adeliae) colonies at Cape Adare, Antarctica. This colony, first established at approximately 2000 BP (calendar years before present, i.e. 1950), is currently the largest for this species with approximately 338 000 breeding pairs, most located on low-lying Ridley Beach. We hypothesize that this colony first formed after fast ice began blocking open-water access by breeding penguins to the Scott Coast in the southern Ross Sea during a cooling period also at approximately 2000 BP. Our results suggest that the new colony at Cape Adare continued to grow, expanding to a large upper terrace above Ridley Beach, until it exceeded approximately 500 000 breeding pairs (a `supercolony') by approximately 1200 BP. The high marine productivity associated with the Ross Sea polynya and continental shelf break supported this growth, but the colony collapsed to its present size for unknown reasons after approximately 1200 BP. Ridley Beach will probably be abandoned in the near future due to rising sea level in this region. We predict that penguins will retreat to higher elevations at Cape Adare and that the Scott Coast will be reoccupied by breeding penguins as fast ice continues to dissipate earlier each summer, restoring open-water access to beaches there.

The rise and fall of an ancient Adélie penguin 'supercolony' at Cape Adare, Antarctica.

PubMed

Emslie, Steven D; McKenzie, Ashley; Patterson, William P

2018-04-01

We report new discoveries and radiocarbon dates on active and abandoned Adélie penguin ( Pygoscelis adeliae ) colonies at Cape Adare, Antarctica. This colony, first established at approximately 2000 BP (calendar years before present, i.e. 1950), is currently the largest for this species with approximately 338 000 breeding pairs, most located on low-lying Ridley Beach. We hypothesize that this colony first formed after fast ice began blocking open-water access by breeding penguins to the Scott Coast in the southern Ross Sea during a cooling period also at approximately 2000 BP. Our results suggest that the new colony at Cape Adare continued to grow, expanding to a large upper terrace above Ridley Beach, until it exceeded approximately 500 000 breeding pairs (a 'supercolony') by approximately 1200 BP. The high marine productivity associated with the Ross Sea polynya and continental shelf break supported this growth, but the colony collapsed to its present size for unknown reasons after approximately 1200 BP. Ridley Beach will probably be abandoned in the near future due to rising sea level in this region. We predict that penguins will retreat to higher elevations at Cape Adare and that the Scott Coast will be reoccupied by breeding penguins as fast ice continues to dissipate earlier each summer, restoring open-water access to beaches there.

The rise and fall of an ancient Adélie penguin ‘supercolony’ at Cape Adare, Antarctica

PubMed Central

McKenzie, Ashley; Patterson, William P.

2018-01-01

We report new discoveries and radiocarbon dates on active and abandoned Adélie penguin (Pygoscelis adeliae) colonies at Cape Adare, Antarctica. This colony, first established at approximately 2000 BP (calendar years before present, i.e. 1950), is currently the largest for this species with approximately 338 000 breeding pairs, most located on low-lying Ridley Beach. We hypothesize that this colony first formed after fast ice began blocking open-water access by breeding penguins to the Scott Coast in the southern Ross Sea during a cooling period also at approximately 2000 BP. Our results suggest that the new colony at Cape Adare continued to grow, expanding to a large upper terrace above Ridley Beach, until it exceeded approximately 500 000 breeding pairs (a ‘supercolony’) by approximately 1200 BP. The high marine productivity associated with the Ross Sea polynya and continental shelf break supported this growth, but the colony collapsed to its present size for unknown reasons after approximately 1200 BP. Ridley Beach will probably be abandoned in the near future due to rising sea level in this region. We predict that penguins will retreat to higher elevations at Cape Adare and that the Scott Coast will be reoccupied by breeding penguins as fast ice continues to dissipate earlier each summer, restoring open-water access to beaches there. PMID:29765656

Thermal and chemical denaturation of the BRCT functional module of human 53BP1.

PubMed

Thanassoulas, Angelos; Nomikos, Michail; Theodoridou, Maria; Stavros, Philemon; Mastellos, Dimitris; Nounesis, George

2011-10-01

BRCTs are protein-docking modules involved in eukaryotic DNA repair. They are characterized by low sequence homology with generally well-conserved structure organization. In a considerable number of proteins, a pair of BRCT structural repeats occurs, connected with inter-BRCT linkers, variable in length, sequence and structure. Linkers may separate and control the relative position of BRCT domains as well as protect and stabilize the hydrophobic inter-BRCT interface region. Their vital role in protein function has been demonstrated by recent findings associating missense mutations in the inter-repeat linker region of the BRCT domain of BRCA1 (BRCA1-BRCT) to hereditary breast/ovarian cancer. The interaction of 53BP1 with the core domain of the p53 tumor suppressor involves the C-terminal BRCT repeat as well as the inert-BRCT linker of the tandem BRCT domain of 53BP1 (53BP1-BRCT). High-accuracy differential scanning calorimetry (DSC) and circular dichroism (CD) have been employed to characterize the heat-induced unfolding of 53BP1-BRCT domain. The calorimetric results provide evidence for unfolding to an intermediate, only partly unfolded state, which, based on the CD results, retains the secondary structural characteristics of the native protein. A direct comparison with the corresponding thermal processes for BRAC1-BRCT and BARD1-BRCT provides evidence that the observed behavior is analogous to BRCA1-BRCT even though the two domains differ substantially in the linker structure. Moreover, chemical denaturation experiments of the untagged 53BP1-BRCT and comparison with BRCA1 and BARD1 BRCTs show that no clear association can be drawn between the structural organization of the inter-BRCT linkers and the overall stability of the BRCT domains. Copyright © 2011 Elsevier B.V. All rights reserved.

Telomere Length, Current Perceived Stress, and Urinary Stress Hormones in Women

PubMed Central

Parks, Christine G.; Miller, Diane B.; McCanlies, Erin C.; Cawthon, Richard M.; Andrew, Michael E.; DeRoo, Lisa A.; Sandler, Dale P.

2009-01-01

Telomeres are repetitive DNA sequences that cap and protect the ends of chromosomes; critically short telomeres may lead to cellular senescence or carcinogenic transformation. Previous findings suggest a link between psychosocial stress, shorter telomeres, and chronic disease risk. This cross-sectional study examined relative telomere length in relation to perceived stress and urinary stress hormones in a sample of participants (n = 647) in the National Institute of Environmental Health Sciences Sister Study, a cohort of women ages 35 to 74 years who have a sister with breast cancer. Average leukocyte telomere length was determined by quantitative PCR. Current stress was assessed using the Perceived Stress Scale and creatinine-adjusted neuroendocrine hormones in first morning urines. Linear regression models estimated differences in telomere length base pairs (bp) associated with stress measures adjusted for age, race, smoking, and obesity. Women with higher perceived stress had somewhat shorter telomeres [adjusted difference of −129bp for being at or above moderate stress levels; 95% confidence interval (CI), −292 to 33], but telomere length did not decrease monotonically with higher stress levels. Shorter telomeres were independently associated with increasing age (−27bp/year), obesity, and current smoking. Significant stress-related differences in telomere length were seen in women ages 55 years and older (−289bp; 95% CI, −519 to −59), those with recent major losses (−420bp; 95% CI, −814 to −27), and those with above-average urinary catecholamines (e.g., epinephrine: −484bp; 95% CI, −709 to −259). Although current perceived stress was only modestly associated with shorter telomeres in this broad sample of women, our findings suggest the effect of stress on telomere length may vary depending on neuroendocrine responsiveness, external stressors, and age. PMID:19190150

Prolonged photo-carriers generated in a massive-and-anisotropic Dirac material.

PubMed

Nurmamat, Munisa; Ishida, Yukiaki; Yori, Ryohei; Sumida, Kazuki; Zhu, Siyuan; Nakatake, Masashi; Ueda, Yoshifumi; Taniguchi, Masaki; Shin, Shik; Akahama, Yuichi; Kimura, Akio

2018-06-13

Transient electron-hole pairs generated in semiconductors can exhibit unconventional excitonic condensation. Anisotropy in the carrier mass is considered as the key to elongate the life time of the pairs, and hence to stabilize the condensation. Here we employ time- and angle-resolved photoemission spectroscopy to explore the dynamics of photo-generated carriers in black phosphorus. The electronic structure above the Fermi level has been successfully observed, and a massive-and-anisotropic Dirac-type dispersions are confirmed; more importantly, we directly observe that the photo-carriers generated across the direct band gap have the life time exceeding 400 ps. Our finding confirms that black phosphorus is a suitable platform for excitonic condensations, and also open an avenue for future applications in broadband mid-infrared BP-based optoelectronic devices.

Molecular mechanisms of ribosomal protein gene coregulation.

PubMed

Reja, Rohit; Vinayachandran, Vinesh; Ghosh, Sujana; Pugh, B Franklin

2015-09-15

The 137 ribosomal protein genes (RPGs) of Saccharomyces provide a model for gene coregulation. We examined the positional and functional organization of their regulators (Rap1 [repressor activator protein 1], Fhl1, Ifh1, Sfp1, and Hmo1), the transcription machinery (TFIIB, TFIID, and RNA polymerase II), and chromatin at near-base-pair resolution using ChIP-exo, as RPGs are coordinately reprogrammed. Where Hmo1 is enriched, Fhl1, Ifh1, Sfp1, and Hmo1 cross-linked broadly to promoter DNA in an RPG-specific manner and demarcated by general minor groove widening. Importantly, Hmo1 extended 20-50 base pairs (bp) downstream from Fhl1. Upon RPG repression, Fhl1 remained in place. Hmo1 dissociated, which was coupled to an upstream shift of the +1 nucleosome, as reflected by the Hmo1 extension and core promoter region. Fhl1 and Hmo1 may create two regulatable and positionally distinct barriers, against which chromatin remodelers position the +1 nucleosome into either an activating or a repressive state. Consistent with in vitro studies, we found that specific TFIID subunits, in addition to cross-linking at the core promoter, made precise cross-links at Rap1 sites, which we interpret to reflect native Rap1-TFIID interactions. Our findings suggest how sequence-specific DNA binding regulates nucleosome positioning and transcription complex assembly >300 bp away and how coregulation coevolved with coding sequences. © 2015 Reja et al.; Published by Cold Spring Harbor Laboratory Press.

Deep Sequence Analysis of AgoshRNA Processing Reveals 3' A Addition and Trimming.

PubMed

Harwig, Alex; Herrera-Carrillo, Elena; Jongejan, Aldo; van Kampen, Antonius Hubertus; Berkhout, Ben

2015-07-14

The RNA interference (RNAi) pathway, in which microprocessor and Dicer collaborate to process microRNAs (miRNA), was recently expanded by the description of alternative processing routes. In one of these noncanonical pathways, Dicer action is replaced by the Argonaute2 (Ago2) slicer function. It was recently shown that the stem-length of precursor-miRNA or short hairpin RNA (shRNA) molecules is a major determinant for Dicer versus Ago2 processing. Here we present the results of a deep sequence study on the processing of shRNAs with different stem length and a top G·U wobble base pair (bp). This analysis revealed some unexpected properties of these so-called AgoshRNA molecules that are processed by Ago2 instead of Dicer. First, we confirmed the gradual shift from Dicer to Ago2 processing upon shortening of the hairpin length. Second, hairpins with a stem larger than 19 base pair are inefficiently cleaved by Ago2 and we noticed a shift in the cleavage site. Third, the introduction of a top G·U bp in a regular shRNA can promote Ago2-cleavage, which coincides with a loss of Ago2-loading of the Dicer-cleaved 3' strand. Fourth, the Ago2-processed AgoshRNAs acquire a short 3' tail of 1-3 A-nucleotides (nt) and we present evidence that this product is subsequently trimmed by the poly(A)-specific ribonuclease (PARN).

Deep Sequence Analysis of AgoshRNA Processing Reveals 3' A Addition and Trimming

PubMed Central

Harwig, Alex; Herrera-Carrillo, Elena; Jongejan, Aldo; van Kampen, Antonius Hubertus; Berkhout, Ben

2015-01-01

The RNA interference (RNAi) pathway, in which microprocessor and Dicer collaborate to process microRNAs (miRNA), was recently expanded by the description of alternative processing routes. In one of these noncanonical pathways, Dicer action is replaced by the Argonaute2 (Ago2) slicer function. It was recently shown that the stem-length of precursor-miRNA or short hairpin RNA (shRNA) molecules is a major determinant for Dicer versus Ago2 processing. Here we present the results of a deep sequence study on the processing of shRNAs with different stem length and a top G·U wobble base pair (bp). This analysis revealed some unexpected properties of these so-called AgoshRNA molecules that are processed by Ago2 instead of Dicer. First, we confirmed the gradual shift from Dicer to Ago2 processing upon shortening of the hairpin length. Second, hairpins with a stem larger than 19 base pair are inefficiently cleaved by Ago2 and we noticed a shift in the cleavage site. Third, the introduction of a top G·U bp in a regular shRNA can promote Ago2-cleavage, which coincides with a loss of Ago2-loading of the Dicer-cleaved 3' strand. Fourth, the Ago2-processed AgoshRNAs acquire a short 3' tail of 1–3 A-nucleotides (nt) and we present evidence that this product is subsequently trimmed by the poly(A)-specific ribonuclease (PARN). PMID:26172504

Salt-Dependent DNA-DNA Spacings in Intact Bacteriophage lambda Reflect Relative Importance of DNA Self-Repulsion and Bending Energies

DOE Office of Scientific and Technical Information (OSTI.GOV)

X Qiu; D Rau; V Parsegian

2011-12-31

Using solution synchrotron x-ray scattering, we measure the variation of DNA-DNA d spacings in bacteriophage {lambda} with mono-, di-, and polyvalent salt concentrations, for wild-type [48.5 x 10{sup 3} base pairs (bp)] and short-genome-mutant (37.8 kbp) strains. From the decrease in d spacings with increasing salt, we deduce the relative contributions of DNA self-repulsion and bending to the energetics of packaged phage genomes. We quantify the DNA-DNA interaction energies within the intact phage by combining the measured d spacings in the capsid with measurements of osmotic pressure in DNA assemblies under the same salt conditions in bulk solution. In themore » commonly used Tris-Mg buffer, the DNA-DNA interaction energies inside the phage capsids are shown to be about 1 kT/bp, an order of magnitude larger than the bending energies.« less

Solution structure of conserved AGNN tetraloops: insights into Rnt1p RNA processing

PubMed Central

Lebars, Isabelle; Lamontagne, Bruno; Yoshizawa, Satoko; Abou Elela, Sherif; Fourmy, Dominique

2001-01-01

Rnt1p, the yeast orthologue of RNase III, cleaves rRNAs, snRNAs and snoRNAs at a stem capped with conserved AGNN tetraloop. Here we show that 9 bp long stems ending with AGAA or AGUC tetraloops bind to Rnt1p and direct specific but sequence-independent RNA cleavage when provided with stems longer than 13 bp. The solution structures of these two tetraloops reveal a common fold for the terminal loop stabilized by non-canonical A–A or A–C pairs and extensive base stacking. The conserved nucleotides are stacked at the 5′ side of the loop, exposing their Watson–Crick and Hoogsteen faces for recognition by Rnt1p. These results indicate that yeast RNase III recognizes the fold of a conserved single-stranded tetraloop to direct specific dsRNA cleavage. PMID:11743001

DOE Office of Scientific and Technical Information (OSTI.GOV)

Larimer, Frank W; Chain, Patrick S. G.; Hauser, Loren John

Rhodopseudomonas palustris is among the most metabolically versatile bacteria known. It uses light, inorganic compounds, or organic compounds, for energy. It acquires carbon from many types of green plant-derived compounds or by carbon dioxide fixation, and it fixes nitrogen. Here we describe the genome sequence of R. palustris, which consists of a 5,459,213-base-pair (bp) circular chromosome with 4,836 predicted genes and a plasmid of 8,427 bp. The sequence reveals genes that confer a remarkably large number of options within a given type of metabolism, including three nitrogenases, five benzene ring cleavage pathways and four light harvesting 2 systems. R. palustrismore » encodes 63 signal transduction histidine kinases and 79 response regulator receiver domains. Almost 15% of the genome is devoted to transport. This genome sequence is a starting point to use R. palustris as a model to explore how organisms integrate metabolic modules in response to environmental perturbations.« less

Molecular detection and serotyping of infectious bronchitis virus from FTA filter paper.

PubMed

Moscoso, Hugo; Raybon, Erine O; Thayer, Stephan G; Hofacre, Charles L

2005-03-01

We investigated the feasibility of using Flinders Technology Associates (FTA) filter cards for the storage of allantoic fluid containing an infectious bronchitis virus (IBV), such as Arkansas-DPI, Connecticut, and Massachusetts, and for their identification by reverse transcriptase (RT)-polymerase chain reaction (PCR) and characterization by restriction fragment length polymorphism (RFLP) or nucleotide sequencing. FTA paper is a cotton-based cellulose membrane containing lyophilized chemicals that lyses many types of bacteria and viruses. IBV was inactivated upon contact with the FTA, as shown by the inability of the virus to be propagated in embryonating chicken eggs. RT-PCR of the S1 gene showed that viral RNA in allantoic fluid remained stable after storage on FTA filter cards and that the stability was time and temperature sensitive for the large (1700 base pair [bp]) but not the small (383 bp) PCR products. Analysis of the amplified products showed that molecular characterization is feasible in allantoic fluid stored on FTA under nonfavorable environmental conditions (41 C) for at least 15 days. The use of FTA cards for the collection, transport, and storage of IBV-containing samples is safe, inexpensive, and adequate for molecular diagnosis. We propose that specimens coming from overseas on FTA cards would be first analyzed by RT-PCR with primers yielding a 1700-bp product followed by RFLP of the positive cases. Negative cases would be analyzed with primers yielding a 383-bp product (to exdude detrimental effect of the storage conditions) followed by nucleotide sequencing of the positive cases.

De Novo Transcriptomic Analysis of an Oleaginous Microalga: Pathway Description and Gene Discovery for Production of Next-Generation Biofuels

PubMed Central

Wan, LingLin; Han, Juan; Sang, Min; Li, AiFen; Wu, Hong; Yin, ShunJi; Zhang, ChengWu

2012-01-01

Background Eustigmatos cf. polyphem is a yellow-green unicellular soil microalga belonging to the eustimatophyte with high biomass and considerable production of triacylglycerols (TAGs) for biofuels, which is thus referred to as an oleaginous microalga. The paucity of microalgae genome sequences, however, limits development of gene-based biofuel feedstock optimization studies. Here we describe the sequencing and de novo transcriptome assembly for a non-model microalgae species, E. cf. polyphem, and identify pathways and genes of importance related to biofuel production. Results We performed the de novo assembly of E. cf. polyphem transcriptome using Illumina paired-end sequencing technology. In a single run, we produced 29,199,432 sequencing reads corresponding to 2.33 Gb total nucleotides. These reads were assembled into 75,632 unigenes with a mean size of 503 bp and an N50 of 663 bp, ranging from 100 bp to >3,000 bp. Assembled unigenes were subjected to BLAST similarity searches and annotated with Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) orthology identifiers. These analyses identified the majority of carbohydrate, fatty acids, TAG and carotenoids biosynthesis and catabolism pathways in E. cf. polyphem. Conclusions Our data provides the construction of metabolic pathways involved in the biosynthesis and catabolism of carbohydrate, fatty acids, TAG and carotenoids in E. cf. polyphem and provides a foundation for the molecular genetics and functional genomics required to direct metabolic engineering efforts that seek to enhance the quantity and character of microalgae-based biofuel feedstock. PMID:22536352

mtDNA diversity in Azara's owl monkeys (Aotus azarai azarai) of the Argentinean Chaco.

PubMed

Babb, Paul L; Fernandez-Duque, Eduardo; Baiduc, Caitlin A; Gagneux, Pascal; Evans, Sian; Schurr, Theodore G

2011-10-01

Owl monkeys (Aotus spp.) inhabit much of South America yet represent an enigmatic evolutionary branch among primates. While morphological, cytogenetic, and immunological evidence suggest that owl monkey populations have undergone isolation and diversification since their emergence in the New World, problems with adjacent species ranges, and sample provenance have complicated efforts to characterize genetic variation within the genus. As a result, the phylogeographic history of owl monkey species and subspecies remains unclear, and the extent of genetic diversity at the population level is unknown. To explore these issues, we analyzed mitochondrial DNA (mt DNA) variation in a population of wild Azara's owl monkeys (Aotus azarai azarai) living in the Gran Chaco region of Argentina. We sequenced the complete mitochondrial genome from one individual (16,585 base pairs (bp)) and analyzed 1,099 bp of the hypervariable control region (CR) and 696 bp of the cytochrome oxidase II (COII) gene in 117 others. In addition, we sequenced the mitochondrial genome (16,472 bp) of one Nancy Ma's owl monkey (A. nancymaae). Based on the whole mtDNA and COII data, we observed an ancient phylogeographic discontinuity among Aotus species living north, south, and west of the Amazon River that began more than eight million years ago. Our population analyses identified three major CR lineages and detected a high level of haplotypic diversity within A. a. azarai. These data point to a recent expansion of Azara's owl monkeys into the Argentinean Chaco. Overall, we provide a detailed view of owl monkey mtDNA variation at genus, species, and population levels. Copyright © 2011 Wiley-Liss, Inc.

The complete chloroplast genome sequence of Chikusichloa aquatica (Poaceae: Oryzeae).

PubMed

Zhang, Jie; Zhang, Dan; Shi, Chao; Gao, Ju; Gao, Li-Zhi

2016-07-01

The complete chloroplast sequence of the Chikusichloa aquatica was determined in this study. The genome consists of 136 563 bp containing a pair of inverted repeats (IRs) of 20 837 bp, which was separated by a large single-copy region and a small single-copy region of 82 315 bp and 33 411 bp, respectively. The C. aquatica cp genome encodes 111 functional genes (71 protein-coding genes, four rRNA genes, and 36 tRNA genes): 92 are unique, while 19 are duplicated in the IR regions. The genic regions account for 58.9% of whole cp genome, and the GC content of the plastome is 39.0%. A phylogenomic analysis showed that C. aquatica is closely related to Rhynchoryza subulata that belongs to the tribe Oryzeae.

Effect of a newly developed charging chamber for the treatment of hypotension during hemodialysis.

PubMed

Ikegami, Tadayoshi; Fujii, Zenzo; Minami, Masae; Matsumoto, Machiko; Matsuzaki, Masunori

2006-01-01

We developed a new method of hemodialysis using a charging chamber for treatment of hemodialysis patients with hypotension occurring during the latter half of hemodialysis (collapse). The purpose of this method was to recover systolic blood pressure (BP) by returning a part of blood within the chamber into the body circulation when hemodialysis collapse occurred. Using this method, systolic BP recovery (DeltaBP) in ten hemodialysis patients (4 males, 6 females, mean age 66.0 years old) was compared to a control group treated with intravenous administration of 20 ml of 10% NaCl. When hemodialysis collapse occurred, 60 ml of blood within the chamber in this method and 20 ml of 10% NaCl intravenously in the control group were administered and systolic BP was measured 20 minutes later. The results showed that DeltaBP using this method was 26.0 mm Hg (ANOVA: p = 0.0072), while in the control group it was 30.2 mm Hg (ANOVA: p = 0.0003), and there was no significant difference between the systolic BP recovery of both groups (paired t test: p = 0.4196).

Men exhibit greater fatigue resistance than women in alternated bench press and leg press exercises.

PubMed

Monteiro, Estêvão R; Steele, James; Novaes, Jefferson S; Brown, Amanda F; Cavanaugh, Mark T; Vingren, Jakob L; Behm, David G

2017-11-17

The purpose of this study was to evaluate the influence of sex, exercise order, and rest interval on neuromuscular fatigue resistance for an alternated strength training sequence of bench press (BP) and leg press (LP) exercises. Twelve women and 16 men, both recreationally trained, performed four sessions in a random order: 1) BP followed by LP with three-minutes rest (BP+LP with rest), 2) LP followed by BP with three-minutes rest (LP+BP with rest), 3) BP followed by LP without rest interval (BP+LP no rest), and 4) LP followed by BP without rest interval (LP+BP no rest). Participants performed four sets with 100% of 10RM load to concentric failure with the goal of completing the maximum number of repetitions in both exercises. The fatigue index was analyzed from the first and last sets of each exercise bout. A main effect for sex showed that women exhibited 25.5% (p=0.001) and 24.5% (p=0.001) greater BP and LP fatigue than men respectively when performing 10RM. Men exhibited greater BP (p<0.0001; 34.1%) and LP (p<0.0001; 30.5%) fatigue resistance when a rest period was provided. Men did not show an exercise order effect for BP fatigue and exhibited greater (p=0.0003; 14.5%) LP fatigue resistance when BP was performed first. The present study demonstrated the greater fatigue resistance of men when performing 10RM BP and LP exercises. Since men tend to experience less fatigue with the second exercise in the exercise pairing, women's training programs should be adjusted to ensure they do not parallel men's resistance training programs.

Screening and identification of a microsatellite marker associated with sex in Wami tilapia, Oreochromis urolepis hornorum.

PubMed

Zhu, Huaping; Liu, Zhigang; Lu, Maixin; Gao, Fengying; Ke, Xiaoli; Ma, Dongmei; Huang, Zhanghan; Cao, Jianmeng; Wang, Miao

2016-06-01

In this study, primer pairs of 15 microsatellite markers associated with sex determination of tilapia were selected and amplified in Wami tilapia, Oreochromis urolepis hornorum. While one marker, UNH168, on linkage group 3 (LG3) was associated (P <0.001) with the phenotypic sex in the experimental population, nine genotypes were detected in both sexes. Only 99-bp allele was detected in the female samples, while 141, 149 and 157-bp alleles were present in both male and female samples. UNH168 was localized by fluorescence in situ hybridization (FISH) on the long arm of the largest tilapia chromosome pair (chromosome 1, equivalent to LG3). This sex-linked microsatellite marker could potentially be used for marker-assisted selection in tilapia breeding programmes to produce monosex male tilapia.

Complete Chloroplast Genome of Pinus massoniana (Pinaceae): Gene Rearrangements, Loss of ndh Genes, and Short Inverted Repeats Contraction, Expansion.

PubMed

Ni, ZhouXian; Ye, YouJu; Bai, Tiandao; Xu, Meng; Xu, Li-An

2017-09-11

The chloroplast genome (CPG) of Pinus massoniana belonging to the genus Pinus (Pinaceae), which is a primary source of turpentine, was sequenced and analyzed in terms of gene rearrangements, ndh genes loss, and the contraction and expansion of short inverted repeats (IRs). P. massoniana CPG has a typical quadripartite structure that includes large single copy (LSC) (65,563 bp), small single copy (SSC) (53,230 bp) and two IRs (IRa and IRb, 485 bp). The 108 unique genes were identified, including 73 protein-coding genes, 31 tRNAs, and 4 rRNAs. Most of the 81 simple sequence repeats (SSRs) identified in CPG were mononucleotides motifs of A/T types and located in non-coding regions. Comparisons with related species revealed an inversion (21,556 bp) in the LSC region; P. massoniana CPG lacks all 11 intact ndh genes (four ndh genes lost completely; the five remained truncated as pseudogenes; and the other two ndh genes remain as pseudogenes because of short insertions or deletions). A pair of short IRs was found instead of large IRs, and size variations among pine species were observed, which resulted from short insertions or deletions and non-synchronized variations between "IRa" and "IRb". The results of phylogenetic analyses based on whole CPG sequences of 16 conifers indicated that the whole CPG sequences could be used as a powerful tool in phylogenetic analyses.

Identification and expression analysis of two pro-inflammatory cytokines, TNF-α and IL-8, in cobia (Rachycentron canadum L.) in response to Streptococcus dysgalactiae infection.

PubMed

Nguyen, Thuy Thi Thu; Nguyen, Hai Trong; Wang, Pei-Chyi; Chen, Shih-Chu

2017-08-01

Tumor necrosis factor-alpha (TNF-α) and interleukin-8 (IL-8/CXCL8) play pivotal roles in mediating inflammatory responses to invading pathogens. In this study, we identified and analyzed expressions of cobia TNF-α and IL-8 during Streptococcus dysgalactiae infection. The cloned cDNA transcript of cobia TNF-α comprised of 1281 base pairs (bp), with a 774 bp open reading frame (ORF) encoding 257 amino acids. The deduced amino acid sequence of cobia TNF-α showed a close relationship (84% similarity) with TNF-α of yellowtail amberjack. The cloned IL-8 cDNA sequence was 828 bp long, including a 300-bp ORF encoding 99 amino acids. The deduced amino acid sequence of cobia IL-8 shared 90% identity with IL-8 of striped trumpeter. Cobia challenged with a virulent S. dysgalactiae strain displayed an early significant up-regulation of TNF-α and IL-8 in head kidney, liver, and spleen. Notably, IL-8 expression level increased dramatically in the liver at the severe stage of infection (72 h). In conclusion, a better understanding of TNF-α and IL-8 allows more detailed investigation of immune responses in cobia and furthers study on controlling the infectious disease caused by S. dysgalactiae. Copyright © 2017 Elsevier Ltd. All rights reserved.

Structure of the highly repeated, long interspersed DNA family (LINE or L1Rn) of the rat.

PubMed Central

D'Ambrosio, E; Waitzkin, S D; Witney, F R; Salemme, A; Furano, A V

1986-01-01

We present the DNA sequence of a 6.7-kilobase member of the rat long interspersed repeated DNA family (LINE or L1Rn). This member (LINE 3) is flanked by a perfect 14-base-pair (bp) direct repeat and is a full-length, or close-to-full-length, member of this family. LINE 3 contains an approximately 100-bp A-rich right end, a number of long (greater than 400-bp) open reading frames, and a ca. 200-bp G + C-rich (ca. 60%) cluster near each terminus. Comparison of the LINE 3 sequence with the sequence of about one-half of another member, which we also present, as well as restriction enzyme analysis of the genomic copies of this family, indicates that in length and overall structure LINE 3 is quite typical of the 40,000 or so other genomic members of this family which would account for as much as 10% of the rat genome. Therefore, the rat LINE family is relatively homogeneous, which contrasts with the heterogeneous LINE families in primates and mice. Transcripts corresponding to the entire LINE sequence are abundant in the nuclear RNA of rat liver. The characteristics of the rat LINE family are discussed with respect to the possible function and evolution of this family of DNA sequences. Images PMID:3023845

Electrostatic Functionalization and Passivation of Water-Exfoliated Few-Layer Black Phosphorus by Poly Dimethyldiallyl Ammonium Chloride and Its Ultrafast Laser Application.

PubMed

Feng, Qingliang; Liu, Hongyan; Zhu, Meijie; Shang, Jing; Liu, Dan; Cui, Xiaoqi; Shen, Diqin; Kou, Liangzhi; Mao, Dong; Zheng, Jianbang; Li, Chun; Zhang, Jin; Xu, Hua; Zhao, Jianlin

2018-03-21

Few-layer black phosphorus (BP) which exhibits excellent optical and electronic properties, has great potential applications in nanodevices. However, BP inevitably suffers from the rapid degradation in ambient air because of the high reactivity of P atoms with oxygen and water, which greatly hinders its wide applications. Herein, we demonstrate the electrostatic functionalization as an effective way to simultaneously enhance the stability and dispersity of aqueous phase exfoliated few-layer BP. The poly dimethyldiallyl ammonium chloride (PDDA) is selected to spontaneously and uniformly adsorb on the surface of few-layer BP via electrostatic interaction. The positive charge-center of the N atom of PDDA, which passivates the lone-pair electrons of P, plays a critical role in stabilizing the BP. Meanwhile, the PDDA could serve as hydrophilic ligands to improve the dispersity of exfoliated BP in water. The thinner PDDA-BP nanosheets can stabilize in both air and water even after 15 days of exposure. Finally, the uniform PDDA-BP-polymer film was used as a saturable absorber to realize passive mode-locking operations in a fiber laser, delivering a train of ultrafast pulses with the duration of 1.2 ps at 1557.8 nm. This work provides a new way to obtain highly stable few-layer BP, which shows great promise in ultrafast optics application.

Genetic Analysis of 430 Chinese Cynodon dactylon Accessions Using Sequence-Related Amplified Polymorphism Markers

PubMed Central

Huang, Chunqiong; Liu, Guodao; Bai, Changjun; Wang, Wenqiang

2014-01-01

Although Cynodon dactylon (C. dactylon) is widely distributed in China, information on its genetic diversity within the germplasm pool is limited. The objective of this study was to reveal the genetic variation and relationships of 430 C. dactylon accessions collected from 22 Chinese provinces using sequence-related amplified polymorphism (SRAP) markers. Fifteen primer pairs were used to amplify specific C. dactylon genomic sequences. A total of 481 SRAP fragments were generated, with fragment sizes ranging from 260–1800 base pairs (bp). Genetic similarity coefficients (GSC) among the 430 accessions averaged 0.72 and ranged from 0.53–0.96. Cluster analysis conducted by two methods, namely the unweighted pair-group method with arithmetic averages (UPGMA) and principle coordinate analysis (PCoA), separated the accessions into eight distinct groups. Our findings verify that Chinese C. dactylon germplasms have rich genetic diversity, which is an excellent basis for C. dactylon breeding for new cultivars. PMID:25338051

Rapidity and kT dependence of HBT correlations in Au+Au collisions at 200 GeV with PHOBOS

NASA Astrophysics Data System (ADS)

Holzman, Burt; PHOBOS Collaboration; Back, B. B.; Baker, M. D.; Ballintijn, M.; Barton, D. S.; Betts, R. R.; Bickley, A. A.; Bindel, R.; Budzanowski, A.; Busza, W.; Carroll, A.; Decowski, M. P.; García, E.; George, N.; Gulbrandsen, K.; Gushue, S.; Halliwell, C.; Hamblen, J.; Heintzelman, G. A.; Henderson, C.; Hofman, D. J.; Hollis, R. S.; Holynski, R.; Holzman, B.; Iordanova, A.; Johnson, E.; Kane, J. L.; Katzy, J.; Khan, N.; Kucewicz, W.; Kulinich, P.; Kuo, C. M.; Lin, W. T.; Manly, S.; McLeod, D.; Mignerey, A. C.; Nouicer, R.; Olszewski, A.; Pak, R.; Park, I. C.; Pernegger, H.; Reed, C.; Remsberg, L. P.; Reuter, M.; Roland, C.; Roland, G.; Rosenberg, L.; Sagerer, J.; Sarin, P.; Sawicki, P.; Skulski, W.; Steinberg, P.; Stephans, G. S. F.; Sukhanov, A.; Tang, J.-L.; Tonjes, M. B.; Trzupek, A.; Vale, C.; van Nieuwenhuizen, G. J.; Verdier, R.; Wolfs, F. L. H.; Wosiek, B.; Wozniak, K.; Wuosmaa, A. H.; Wyslouch, B.

2004-08-01

Two-particle correlations of identical charged pion pairs from Au+Au collisions at \\sqrt{s_{\\rm NN}} = 200 GeV were measured by the PHOBOS experiment at RHIC. Data for the most central (0 15%) events were analysed with Bertsch Pratt (BP) and Yano Koonin Podgoretskii (YKP) parametrizations using pairs with rapidities of 0.4 < y < 1.3 and transverse momenta 0.1 < kT < 1.4 GeV/c. The Bertsch Pratt radii decrease as a function of pair transverse momentum. The pair rapidity Ypgrpgr roughly scales with the source rapidity YYKP, indicating strong dynamical correlations.

Rapidity and kT dependence of HBT correlations in Au+Au collisions at 200 GeV with PHOBOS

NASA Astrophysics Data System (ADS)

Holzman, Burt; the PHOBOS Collaboration; Back, B. B.; Baker, M. D.; Ballintijn, M.; Barton, D. S.; Betts, R. R.; Bickley, A. A.; Bindel, R.; Budzanowski, A.; Busza, W.; Carroll, A.; Decowski, M. P.; García, E.; George, N.; Gulbrandsen, K.; Gushue, S.; Halliwell, C.; Hamblen, J.; Heintzelman, G. A.; Henderson, C.; Hofman, D. J.; Hollis, R. S.; Hołyński, R.; Holzman, B.; Iordanova, A.; Johnson, E.; Kane, J. L.; Katzy, J.; Khan, N.; Kucewicz, W.; Kulinich, P.; Kuo, C. M.; Lin, W. T.; Manly, S.; McLeod, D.; Mignerey, A. C.; Nouicer, R.; Olszewski, A.; Pak, R.; Park, I. C.; Pernegger, H.; Reed, C.; Remsberg, L. P.; Reuter, M.; Roland, C.; Roland, G.; Rosenberg, L.; Sagerer, J.; Sarin, P.; Sawicki, P.; Skulski, W.; Steinberg, P.; Stephans, G. S. F.; Sukhanov, A.; Tang, J.-L.; Tonjes, M. B.; Trzupek, A.; Vale, C.; van Nieuwenhuizen, G. J.; Verdier, R.; Wolfs, F. L. H.; Wosiek, B.; Wozniak, K.; Wuosmaa, A. H.; Wysłouch, B.

2004-08-01

Two-particle correlations of identical charged pion pairs from Au+Au collisions at \\sqrt{s_NN} = 200 GeV were measured by the PHOBOS experiment at RHIC. Data for the most central (0-15%) events were analysed with Bertsch-Pratt (BP) and Yano-Koonin-Podgoretskii (YKP) parametrizations using pairs with rapidities of 0.4 < y < 1.3 and transverse momenta 0.1 < kT < 1.4 GeV/c. The Bertsch-Pratt radii decrease as a function of pair transverse momentum. The pair rapidity Yππ roughly scales with the source rapidity YYKP, indicating strong dynamical correlations.

Association between HLA-G 14bp Gene Polymorphism and Serum sHLA-G Protein Concentrations in Preeclamptic Patients and Normal Pregnant Women.

PubMed

Rokhafrooz, Saber; Ghadiri, Ata; Ghandil, Pegah; Ghafourian, Mehri; Hossaini, Seyed Hojjat; Daraei, Nahid; Najafian, Mahin; Rouhizadeh, Ahmad

2018-06-28

Preeclampsia (PE) is a multisystem syndrome that is a primary source of fetal-maternal morbidity and mortality. Human leukocyte antigen-G (HLA-G) is a nonclassical Major histocompatibility complex (MHC) class-Ib molecule expressed on the extravillous trophoblast and seems to have immunomodulatory functions during pregnancy. The purpose of our study was to investigate whether HLA-G may be a vital marker in the modulation of the pregnancy. In this case-control study, a number of 150 healthy pregnant women and 150 patients with PE had been genotyped for the 14 base-pair (bp) insertion/deletion polymorphism in exon 8 of the HLA-G gene, and the serum level of soluble HLA-G (sHLA-G) protein was measured using the enzyme-linked immunosorbent assay. Data showed that the PE syndrome was not related to the HLA-G 14 bp genotype. But, the serum level of sHLA-G in PE patients was significantly lower than that in healthy pregnant women in the third trimester (11.74 and 24.48 U/ml, respectively, p < 0.001). However, no significant association was observed between the HLA-G 14 bp genotype and serum sHLA-G level. Our results demonstrate that measurement of sHLA-G protein level may be helpful as a primary diagnosis for the pathogenesis of PE. Overall, this study suggests that the association between HLA-G 14 bp polymorphism and serum sHLA-G level in different ethnic populations of PE should be taken into consideration.

Description of polymerase chain reaction and sequencing DNA Mycobacterium tuberculosis from specimen sputum of tuberculosis patients in Medan

NASA Astrophysics Data System (ADS)

Lily; Siregar, Y.; Ilyas, S.

2018-03-01

This study purposed to describe the product Polymerase Chain Reaction (PCR) and sequencing of DNA Mycobacterium (M.) tuberculosis from sputum of tuberculosis (TB) patients in Medan. Sputum was collected from patients that diagnosed with pulmonary TB by a physician. Specimen processed by PCR method of Li et al. and sequencing at Macrogen Laboratory. All of 12 product PCR were showed brightness bands at 126 base pair (bp). These results indicated similarity to the study of Li et al. Sequencing analysis showed the presence of a mutation and non-mutation groups of M. tuberculosis. The reference and outcome berange of the mutation and non-mutation of M. tuberculosis were 56-107, 59-85, 60-120 and 63-94, respectively. The percentage bp difference between the outcome and references for mutation and non-mutation were 3.448-6.569and 3.278-7.428%, respectively. In conclusion, the successful amplification of PCR products in a 1.5% agarose gel electrophoresis where all 12 sputa contained rpoB-positive M. tuberculosis and 0.644% difference was found between the outcome with reference bp of the mutation and non-mutation M. tuberculosis groups.

The genome sequence of the plant pathogen Xylella fastidiosa. The Xylella fastidiosa Consortium of the Organization for Nucleotide Sequencing and Analysis.

PubMed

Simpson, A J; Reinach, F C; Arruda, P; Abreu, F A; Acencio, M; Alvarenga, R; Alves, L M; Araya, J E; Baia, G S; Baptista, C S; Barros, M H; Bonaccorsi, E D; Bordin, S; Bové, J M; Briones, M R; Bueno, M R; Camargo, A A; Camargo, L E; Carraro, D M; Carrer, H; Colauto, N B; Colombo, C; Costa, F F; Costa, M C; Costa-Neto, C M; Coutinho, L L; Cristofani, M; Dias-Neto, E; Docena, C; El-Dorry, H; Facincani, A P; Ferreira, A J; Ferreira, V C; Ferro, J A; Fraga, J S; França, S C; Franco, M C; Frohme, M; Furlan, L R; Garnier, M; Goldman, G H; Goldman, M H; Gomes, S L; Gruber, A; Ho, P L; Hoheisel, J D; Junqueira, M L; Kemper, E L; Kitajima, J P; Krieger, J E; Kuramae, E E; Laigret, F; Lambais, M R; Leite, L C; Lemos, E G; Lemos, M V; Lopes, S A; Lopes, C R; Machado, J A; Machado, M A; Madeira, A M; Madeira, H M; Marino, C L; Marques, M V; Martins, E A; Martins, E M; Matsukuma, A Y; Menck, C F; Miracca, E C; Miyaki, C Y; Monteriro-Vitorello, C B; Moon, D H; Nagai, M A; Nascimento, A L; Netto, L E; Nhani, A; Nobrega, F G; Nunes, L R; Oliveira, M A; de Oliveira, M C; de Oliveira, R C; Palmieri, D A; Paris, A; Peixoto, B R; Pereira, G A; Pereira, H A; Pesquero, J B; Quaggio, R B; Roberto, P G; Rodrigues, V; de M Rosa, A J; de Rosa, V E; de Sá, R G; Santelli, R V; Sawasaki, H E; da Silva, A C; da Silva, A M; da Silva, F R; da Silva, W A; da Silveira, J F; Silvestri, M L; Siqueira, W J; de Souza, A A; de Souza, A P; Terenzi, M F; Truffi, D; Tsai, S M; Tsuhako, M H; Vallada, H; Van Sluys, M A; Verjovski-Almeida, S; Vettore, A L; Zago, M A; Zatz, M; Meidanis, J; Setubal, J C

2000-07-13

Xylella fastidiosa is a fastidious, xylem-limited bacterium that causes a range of economically important plant diseases. Here we report the complete genome sequence of X. fastidiosa clone 9a5c, which causes citrus variegated chlorosis--a serious disease of orange trees. The genome comprises a 52.7% GC-rich 2,679,305-base-pair (bp) circular chromosome and two plasmids of 51,158 bp and 1,285 bp. We can assign putative functions to 47% of the 2,904 predicted coding regions. Efficient metabolic functions are predicted, with sugars as the principal energy and carbon source, supporting existence in the nutrient-poor xylem sap. The mechanisms associated with pathogenicity and virulence involve toxins, antibiotics and ion sequestration systems, as well as bacterium-bacterium and bacterium-host interactions mediated by a range of proteins. Orthologues of some of these proteins have only been identified in animal and human pathogens; their presence in X. fastidiosa indicates that the molecular basis for bacterial pathogenicity is both conserved and independent of host. At least 83 genes are bacteriophage-derived and include virulence-associated genes from other bacteria, providing direct evidence of phage-mediated horizontal gene transfer.

ARL2BP, a protein linked to Retinitis Pigmentosa, is needed for normal photoreceptor cilia doublets and outer segment structure.

PubMed

Moye, Abigail R; Singh, Ratnesh; Kimler, Victoria A; Dilan, Tanya L; Munezero, Daniella; Saravanan, Thamaraiselvi; Goldberg, Andrew F X; Ramamurthy, Visvanathan

2018-05-02

The outer segment (OS) of photoreceptor cells is an elaboration of a primary cilium with organized stacks of membranous discs that contain the proteins needed for phototransduction and vision. Though cilia formation and function has been well characterized, little is known about the role of cilia in the development of photoreceptor OS. Nevertheless, progress has been made by studying mutations in ciliary proteins which often result in malformed outer segments and lead to blinding diseases. To investigate how ciliary proteins contribute to outer segment formation, we generated a knockout mouse model for ARL2BP, a ciliary protein linked to Retinitis Pigmentosa. The knockout mice display an early and progressive reduction in visual response. Prior to photoreceptor degeneration we observed disorganization of the photoreceptor OS, with vertically aligned discs and shortened axonemes. Interestingly, ciliary doublet microtubule structure was also impaired, displaying open B-tubule doublets, paired with loss of singlet microtubules. Based on results from this study, we conclude that ARL2BP is necessary for photoreceptor cilia doublet formation and axoneme elongation, which is required for outer segment morphogenesis and vision.

Unlocking Short Read Sequencing for Metagenomics

DOE PAGES

Rodrigue, Sébastien; Materna, Arne C.; Timberlake, Sonia C.; ...

2010-07-28

We describe an experimental and computational pipeline yielding millions of reads that can exceed 200 bp with quality scores approaching that of traditional Sanger sequencing. The method combines an automatable gel-less library construction step with paired-end sequencing on a short-read instrument. With appropriately sized library inserts, mate-pair sequences can overlap, and we describe the SHERA software package that joins them to form a longer composite read.

Validation of the A&D UA-1020 upper-arm blood pressure monitor for home blood pressure monitoring according to the British Hypertension Society Protocol.

PubMed

Zeng, Wei-Fang; Kang, Yuan-Yuan; Liu, Ming; Li, Yan; Wang, Ji-Guang

2013-06-01

The present study aimed to evaluate the accuracy of the automated oscillometric upper-arm blood pressure (BP) monitor A&D UA-1020 with two different-shaped cuffs for home BP monitoring according to the British Hypertension Society (BHS) Protocol. We recruited individuals for each of the two cuffs (D-ring and cylindrical) until there were 85 eligible participants (255 pairs of comparisons) and their BP could meet the BP distribution requirements specified by the BHS Protocol. For each participant, we sequentially measured the systolic and diastolic BP using a mercury sphygmomanometer (two observers) and the UA-1020 device (one supervisor). For the D-ring cuff, the device achieved grade A. The percentage of BP differences within 5, 10, and 15 mmHg was 67, 87, and 96%, respectively, for systolic BP, and 70, 90, and 99%, respectively, for diastolic BP. The average (±SD) of the device-observer differences was -0.2±7.3 mmHg (P=0.64) and 1.7±5.8 mmHg (P<0.0001) for systolic and diastolic BP, respectively. For the cylindrical cuff, the device also achieved grade A. The percentage of BP differences within 5, 10, and 15 mmHg was 67, 88, and 97%, respectively, for systolic BP and 64, 89, and 98%, respectively, for diastolic BP. The average of the device-observer differences was -0.1±7.0 mmHg (P=0.89) and 2.0±6.3 mmHg (P<0.0001) for systolic and diastolic BP, respectively. The UA-1020 device has passed the requirements of the BHS Protocol with both the D-ring and the cylindrical cuffs, and hence can be recommended for home use in adults.

Questionable accuracy of home blood pressure measurements in the obese population - Validation of the Microlife WatchBP O3® and Omron RS6® devices according to the European Society of Hypertension-International Protocol.

PubMed

Azaki, Alaa; Diab, Reem; Harb, Aya; Asmar, Roland; Chahine, Mirna N

2017-01-01

Two oscillometric devices, the Microlife WatchBP O3 ® and the Omron RS6 ® , designed for self-blood pressure measurement were evaluated according to the European Society of Hypertension (ESH)-International Protocol (IP) Revision 2010 in the obese population. The Microlife WatchBP O3 measures blood pressure (BP) at the brachial level and the Omron RS6 measures BP at the wrist level. The ESH-IP revision 2010 includes a total of 33 subjects. The difference between observers' and device BP values was calculated for each measure. A total of 99 pairs of BP differences were classified into three categories (≤5, ≤10, and ≤15 mmHg). The protocol procedures were followed precisely in each of the two studies. Microlife WatchBP O3 and Omron RS6 failed to fulfill the criteria of the ESH-IP. The mean differences between the device and the mercury readings were: 0.3±7.8 mmHg and -1.9±6.4 mmHg for systolic BP and diastolic BP, respectively, for Microlife WatchBP O3, and 2.7±9.9 mmHg for SBP and 3.5±11.1 mmHg for diastolic BP for Omron RS6. Microlife WatchBP O3 and Omron RS6 readings differing from the mercury standard by more than 5, 10, and 15 mmHg failed to fulfill the ESH-IP revision 2010 requirements in obese subjects. Therefore, the two devices cannot be recommended for use in obese subjects.

Validation of a smartphone auscultatory blood pressure kit Accutension XYZ-110 in adults according to the ANSI/AAMI/ISO 81060-2: 2013 standard.

PubMed

Chu, Guang; Zhang, Zhi; Xu, Mengdan; Huang, Daini; Dai, Qiuyan

2017-10-01

The aim of this study was to validate the accuracy of the Accutension XYZ-110 blood pressure (BP) kit according to the American National Standards Institute/Association for the Advancement of Medical Instrumentation/International Organization for Standardization (ANSI/AAMI/ISO) 81060-2:2013 standard. Systolic blood pressure (SBP) and diastolic blood pressure (DBP) were measured simultaneously on the same arm in 85 Chinese adults (female : male=48 : 37) with a mean age of 43.2 years using the mercury sphygmomanometer (two observers) and the Accutension XYZ-110 device (one supervisor). The ANSI/AAMI/ISO 81060-2:2013 standard for the validation of BP-measuring devices in adults was followed precisely. A total of 255 comparison pairs were obtained for analysis. The mean device-observer difference in the 255 separate BP data pairs was 2.45±2.24 mmHg for SBP and 0.69±2.09 mmHg for DBP. The data were in accordance with the criterion 1 of the ANSI/AAMI/ISO 81060-2:2013 standard requirements (≤5±8 mmHg). In addition, the mean device-observer difference of the 85 participants was 2.45±1.47 mmHg for SBP and 0.69±1.36 mmHg for DBP. The device accuracy also fulfilled the criterion 2 with the SD of less than or equal to 6.47 for SBP and less than or equal to 6.90 mmHg for DBP. The Accutension XYZ-110 BP kit fulfilled the requirements of the ANSI/AAMI/ISO 81060-2:2013 standard, and hence could be recommended for both clinical and self/home BP measurement in adults.

Dysregulation of RNA Interference in Breast Cancer

DTIC Science & Technology

2007-07-01

of miRNA complementary elements in 3-UTR of target mRNAs, the concentration in the seed (6–8 bp) of continuous Watson - Crick base pairing in the 5...treated the transfected cells with the anticancer drug topotecan (TPT) that is known to inhibit DNA topoisomerase I and cause DNA damage (Tanizawa et...as DNA damage caused by TPT, can increase the inhibitory effect mediated by R el at iv e C el l G ro w th R el at iv e C el l G ro w th Negative

Late Quaternary lake-level changes constrained by radiocarbon and stable isotope studies on sediment cores from Lake Titicaca, South America

NASA Astrophysics Data System (ADS)

Rowe, Harold D.; Guilderson, Thomas P.; Dunbar, Robert B.; Southon, John R.; Seltzer, Geoffrey O.; Mucciarone, David A.; Fritz, Sherilyn C.; Baker, Paul A.

2003-09-01

We present and compare AMS- 14C geochronologies for sediment cores recovered from Lake Titicaca, South America. Radiocarbon dates from three core sites constrain the timing of late Quaternary paleoenvironmental changes in the Central Andes and highlight the site-specific factors that limit the radiocarbon geochronometer. With the exception of mid-Holocene sediments, all cores are generally devoid of macrophyte fragments, thus bulk organic fractions are used to build core chronologies. Comparisons of radiocarbon results for chemically defined fractions (bulk decalcified, humate, humin) suggest that ages derived from all fractions are generally coherent in the post-13,500 yr BP time interval. In the pre-13,500 yr BP time interval, ages derived from humate extracts are significantly younger (300-7000 years) than ages from paired humin residues. Gross age incoherencies between paired humate and humin sub-fractions in pre-13,500 yr BP sediments from all core sites probably reflect the net downward migration of humates. Ages derived from bulk decalcified fractions at our shallow water (90 m) and deep water (230 m) core sites consistently fall between ages derived from humate and humin sub-fractions in the pre-13,500 yr BP interval, reflecting that the bulk decalcified fraction is predominantly a mixture of humate and humin sub-fractions. Bulk decalcified ages from the pre-13,500 yr BP interval at our intermediate depth core site (150 m) are consistently older than humate (youngest) and humin sub-fractions. This uniform, reproducible pattern can be explained by the mobilization of a relatively older organic sub-fraction during and after the re-acidification step following the alkaline treatment of the bulk sediment. The inferred existence of this 'alkali-mobile, acid-soluble' sub-fraction implies a different depositional/post-depositional history that is potentially associated with a difference in source material. While internally consistent geochronologies can be developed for the Lake Titicaca sequence using different organic fractions, mobile organic sub-fractions and fractions containing mobile sub-fractions should generally be avoided in geochronology studies. Consequently, we believe humin and/or bulk decalcified ages provide the most consistent chronologies for the post-13,500 yr BP interval, and humin ages provide the most representative ages for sedimentation prior to 13,500 yr BP interval. Using the age model derived from the deep water core site and a previously published isotope-based lake-level reconstruction, we present a qualitative record of lake level in the context of several ice-core records from the western hemisphere. We find the latest Pleistocene lake-level response to changing insolation began during or just prior to the Bølling/Allerød period. Using the isotope-based lake-level reconstruction, we also find the 85-m drop in lake level that occurred during the mid-Holocene was synchronous with an increase in the variability of ice-core δ18O from a nearby icecap, but was not reflected in any of the polar ice-core records recovered from the interior of Antarctica and Greenland.

Length Variation and Heteroplasmy Are Frequent in Mitochondrial DNA from Parthenogenetic and Bisexual Lizards (Genus Cnemidophorus)

PubMed Central

Densmore, Llewellyn D.; Wright, John W.; Brown, Wesley M.

1985-01-01

Samples of mtDNA isolated from each of 92 lizards representing all color pattern classes of Cnemidophorus tesselatus and two populations of C. tigris marmoratus were digested with the restriction endonucleases MboI, TaqI, RsaI and MspI. The mtDNA fragment sizes were compared after radioactive labeling and gel electrophoresis. Three features were notable in the comparisons: (1) there was little variation due to gain or loss of cleavage sites, (2) two fragments varied noticeably in length among the samples, one by a variable amount up to a maximum difference of ∼370 base pairs (bp) and the other by a discrete amount of 35 bp, (3) these two fragments occasionally varied within, as well as between, samples. Two regions that corresponded in size to these variants were identified by restriction endonuclease cleavage mapping. One of these is adjacent to the D-loop. Heteroplasmy, heretofore rarely observed, occurred frequently in these same two regions. Variability in the copy number of a tandemly repeated 64-bp sequence appears to be one component of the variation, but others (e.g. , base substitutions or small additions/deletions) must also be involved. The frequent occurrence of these length variations suggests either that they can be generated rapidly or that they were inherited from a highly polymorphic ancestor. The former interpretation is favored. PMID:2993100

Sanger sequencing as a first-line approach for molecular diagnosis of Andersen-Tawil syndrome.

PubMed

Totomoch-Serra, Armando; Marquez, Manlio F; Cervantes-Barragán, David E

2017-01-01

In 1977, Frederick Sanger developed a new method for DNA sequencing based on the chain termination method, now known as the Sanger sequencing method (SSM).  Recently, massive parallel sequencing, better known as next-generation sequencing (NGS),  is replacing the SSM for detecting mutations in cardiovascular diseases with a genetic background. The present opinion article wants to remark that "targeted" SSM is still effective as a first-line approach for the molecular diagnosis of some specific conditions, as is the case for Andersen-Tawil syndrome (ATS). ATS is described as a rare multisystemic autosomal dominant channelopathy syndrome caused mainly by a heterozygous mutation in the KCNJ2 gene . KCJN2 has particular characteristics that make it attractive for "directed" SSM. KCNJ2 has a sequence of 17,510 base pairs (bp), and a short coding region with two exons (exon 1=166 bp and exon 2=5220 bp), half of the mutations are located in the C-terminal cytosolic domain, a mutational hotspot has been described in residue Arg218, and this gene explains the phenotype in 60% of ATS cases that fulfill all the clinical criteria of the disease. In order to increase the diagnosis of ATS we urge cardiologists to search for facial and muscular abnormalities in subjects with frequent ventricular arrhythmias (especially bigeminy) and prominent U waves on the electrocardiogram.

Sanger sequencing as a first-line approach for molecular diagnosis of Andersen-Tawil syndrome

PubMed Central

Totomoch-Serra, Armando; Marquez, Manlio F.; Cervantes-Barragán, David E.

2017-01-01

In 1977, Frederick Sanger developed a new method for DNA sequencing based on the chain termination method, now known as the Sanger sequencing method (SSM).  Recently, massive parallel sequencing, better known as next-generation sequencing (NGS),  is replacing the SSM for detecting mutations in cardiovascular diseases with a genetic background. The present opinion article wants to remark that “targeted” SSM is still effective as a first-line approach for the molecular diagnosis of some specific conditions, as is the case for Andersen-Tawil syndrome (ATS). ATS is described as a rare multisystemic autosomal dominant channelopathy syndrome caused mainly by a heterozygous mutation in the KCNJ2 gene . KCJN2 has particular characteristics that make it attractive for “directed” SSM. KCNJ2 has a sequence of 17,510 base pairs (bp), and a short coding region with two exons (exon 1=166 bp and exon 2=5220 bp), half of the mutations are located in the C-terminal cytosolic domain, a mutational hotspot has been described in residue Arg218, and this gene explains the phenotype in 60% of ATS cases that fulfill all the clinical criteria of the disease. In order to increase the diagnosis of ATS we urge cardiologists to search for facial and muscular abnormalities in subjects with frequent ventricular arrhythmias (especially bigeminy) and prominent U waves on the electrocardiogram. PMID:29093808

PCR-based Diagnosis of Toxoplasma Parasite in Ocular Infections Having Clinical Indications of Toxoplasmosis.

PubMed

Farhadi, Atieh; Haniloo, Ali; Fazaeli, Asghar; Moradian, Siamak; Farhadi, Mehdi

2017-01-01

The diagnosis of ocular toxoplasmosis is mainly based on clinical features. However, ocular fluid testing by PCR may be very helpful for approval or rejection of this etiology. In this study, we utilized a nested-PCR technique, targeting the B1 partial sequence to analyze the aqueous and vitreous samples for evaluating the presence of the Toxoplasma DNA. Fifty aqueous or vitreous humor samples were obtained from patients with clinical features of ocular toxoplasmosis admitted to ophthalmology hospitals and clinics in Iran, within 2014. The samples were subsequently subjected to DNA extraction and purification. For nested amplification of the Toxoplasma B1 gene, two primer pairs were used. The outer and inner primers are expected to produce a 193 bp and a 96 bp fragments, respectively. The first-round PCR resulted in the detection of T. gondii in 58% of samples by amplification of the expected 193bp DNA fragment. The nested-PCR using the inner primers, detected 15 additional samples from those with negative amplicons in the first round PCR (overall positivity of 88%). In addition, vitreous samples showed relatively more positive cases than aqueous humor in detection of the infection. The nested-PCR protocol using the B1 gene, with the high detection power, could be a useful complimentary method to clinical diagnose of ocular toxoplasmosis.

Mitochondrial genome sequences of landsnails Aegista diversifamilia and Dolicheulota formosensis (Gastropoda: Pulmonata: Stylommatophora).

PubMed

Huang, Chih-Wei; Lin, Si-Min; Wu, Wen-Lung

2016-07-01

The first mitochondrial genome sequences of Aegista and Dolicheulota belonging to Bradybaenidae are described in this report. Mitogenomic sequences were generated from Illumina paired-end sequencing. The complete mitogenome of Aegista diversifamilia was 14,039 bp in length and nearly complete mitogenome of Dolicheulota formosensis was 14,237 bp. Both mitogenomes consisted of 13 protein-coding genes (PCGs), 2 ribosomal RNA genes, and 22 transfer RNA genes. Most genes were overlapped with neighboring genes that the overlapping regions ranged from 2 to 64 bp in A. diversifamilia and from 1 to 45 bp in D. formosensis. Novel gene arrangement, tRNA-Tyr-ND3-tRNA-Trp, was identified in A. diversifamilia, whereas D. formosensis showed identical gene order to other Bradybaenidae mitogenomes. Maximum likelihood phylogenetic tree suggested Aegista as a sister clade to Euhadra and Dolicheulota. Bradybaenidae is monophyly sister clade to Camaenidae.

Effect of Acupuncture on Functional Connectivity of Anterior Cingulate Cortex for Bell's Palsy Patients with Different Clinical Duration

PubMed Central

Wu, Hongli; Kan, Hongxing; Li, Chuanfu; Park, Kyungmo; Zhu, Yifang; Mohamed, Abdalla Z.; Xu, Chunsheng; Wu, Yuanyuan; Zhang, Wei

2015-01-01

Acupuncture is widely used in the treatment of Bell's palsy (BP) in many countries, but its underlying physiological mechanism remained controversial. In order to explore the potential mechanism, changes of functional connectivity (FC) of anterior cingulate gyrus (ACC) were investigated. We collected 20 healthy (control group) participants and 28 BP patients with different clinical duration accepted resting state functional MRI (rfMRI) scans before and after acupuncture, respectively. The FC of ACC before and after acupuncture was compared with paired t-test and the detailed results are presented in the paper. Our results showed that effects of the acupuncture on FC were closely related to clinical duration in patients with BP, which suggested that brain response to acupuncture was closely connected with the status of brain functional connectivity and implied that acupuncture plays a homeostatic role in the BP treatment. PMID:26161125

The complete chloroplast genome of an irreplaceable dietary and model crop, foxtail millet (Setaria italica).

PubMed

Wang, Shuo; Gao, Li-Zhi

2016-11-01

The complete chloroplast genome sequence of foxtail millet (Setaria italica), an important food and fodder crop in the family Poaceae, is first reported in this study. The genome consists of 1 35 516 bp containing a pair of inverted repeats (IRs) of 21 804 bp separated by a large single-copy (LSC) region and a small single-copy (SSC) region of 79 896 bp and 12 012 bp, respectively. Coding sequences constitute 58.8% of the genome harboring 111 unique genes, 71 of which are protein-coding genes, 4 are rRNA genes, and 36 are tRNA genes. Phylogenetic analysis indicated foxtail millet clustered with Panicum virgatum and Echinochloa crus-galli belonging to the tribe Paniceae of the subfamily Panicoideae. This newly determined chloroplast genome will provide valuable information for the future breeding programs of valuable cereal crops in the family Poaceae.

An Examination of the Behavioral and Neuropsychological Correlates of Three ADHD Candidate Gene Polymorphisms (DRD4 7+, DBH TaqI A2, and DAT1 40bp VNTR) in Hyperactive and Normal Children Followed to Adulthood

PubMed Central

Barkley, Russell A.; Smith, Karen M.; Fischer, Mariellen; Navia, Bradford

2008-01-01

Several candidate gene polymorphisms have been implicated in attention deficit hyperactivity disorder (ADHD), including DAT1 40bp VNTR, DRD4 7+, and DBH TaqI A2 alleles. We used the Milwaukee longitudinal study of hyperactive (N=122) and normal (N=67) children to compare participants with and without these respective polymorphisms on ADHD-related behavioral ratings at childhood, 8 years later in adolescence, and 13+ years later into young adulthood. Neuropsychological tests were given at the adolescent and young adulthood follow-up. No differences were found between the DRD4-7+ and 7- repeat polymorphism. The DBH TaqI A2 allele, when homozygous, was associated with being more hyperactive in childhood, having more pervasive behavior problems at adolescence, and earning less money on a Card Playing Task in adulthood. At adolescence, poorer test scores were also found only in the hyperactive group with homozygous for this allele. The DAT1 40bp VNTR heterozygous 9/10 repeat, however, differed from the 10/10 repeat pair in many respects, having greater ADHD and externalizing symptoms at all three follow-ups, more cross-situational behavioral problems at both childhood and adolescence, poorer mother-teen relations at adolescence, and lower class rankings in high school. Participants with the 9/10 pair in the control group also had lower work performance, a lower grade point average in high school, greater teacher rated externalizing symptoms at adolescence, and greater omission errors on a continuous performance test in adulthood. The DAT1 40bp VNTR 9/10 polymorphism pairing appears to be reliably associated with greater symptoms of ADHD and externalizing behavior from childhood to adulthood, and with family, educational, and occupational impairments. We also present a contrary view on the appropriate endophenotypes for use in behavioral genetic research on ADHD. PMID:16741944

Complete chloroplast DNA sequence from a Korean endemic genus, Megaleranthis saniculifolia, and its evolutionary implications.

PubMed

Kim, Young-Kyu; Park, Chong-wook; Kim, Ki-Joong

2009-03-31

The chloroplast DNA sequences of Megaleranthis saniculifolia, an endemic and monotypic endangered plant species, were completed in this study (GenBank FJ597983). The genome is 159,924 bp in length. It harbors a pair of IR regions consisting of 26,608 bp each. The lengths of the LSC and SSC regions are 88,326 bp and 18,382 bp, respectively. The structural organizations, gene and intron contents, gene orders, AT contents, codon usages, and transcription units of the Megaleranthis chloroplast genome are similar to those of typical land plant cp DNAs. However, the detailed features of Megaleranthis chloroplast genomes are substantially different from that of Ranunculus, which belongs to the same family, the Ranunculaceae. First, the Megaleranthis cp DNA was 4,797 bp longer than that of Ranunculus due to an expanded IR region into the SSC region and duplicated sequence elements in several spacer regions of the Megaleranthis cp genome. Second, the chloroplast genomes of Megaleranthis and Ranunculus evidence 5.6% sequence divergence in the coding regions, 8.9% sequence divergence in the intron regions, and 18.7% sequence divergence in the intergenic spacer regions, respectively. In both the coding and noncoding regions, average nucleotide substitution rates differed markedly, depending on the genome position. Our data strongly implicate the positional effects of the evolutionary modes of chloroplast genes. The genes evidencing higher levels of base substitutions also have higher incidences of indel mutations and low Ka/Ks ratios. A total of 54 simple sequence repeat loci were identified from the Megaleranthis cp genome. The existence of rich cp SSR loci in the Megaleranthis cp genome provides a rare opportunity to study the population genetic structures of this endangered species. Our phylogenetic trees based on the two independent markers, the nuclear ITS and chloroplast matK sequences, strongly support the inclusion of the Megaleranthis to the Trollius. Therefore, our molecular trees support Ohwi's original treatment of Megaleranthis saniculiforia to Trollius chosenensis Ohwi.

Novel TaqMan real-time polymerase chain reaction assay for verifying the authenticity of meat and commercial meat products from game birds.

PubMed

Rojas, María; González, Isabel; Pavón, Miguel Angel; Pegels, Nicolette; Lago, Adriana; Hernández, Pablo E; García, Teresa; Martín, Rosario

2010-06-01

Species-specific real-time polymerase chain reaction (PCR) assays using TaqMan probes have been developed for verifying the labeling of meat and commercial meat products from game birds, including quail, pheasant, partridge, guinea fowl, pigeon, Eurasian woodcock and song thrush. The method combines the use of species-specific primers and TaqMan probes that amplify small fragments (amplicons <150 base pairs) of the mitochondrial 12S rRNA gene, and an endogenous control primer pair that amplifies a 141-bp fragment of the nuclear 18S rRNA gene from eukaryotic DNA. Analysis of experimental raw and heat-treated binary mixtures as well as of commercial meat products from the target species demonstrated the suitability of the assay for the detection of the target DNAs.

Molecular detection of Hepatozoon canis and Babesia canis vogeli in domestic dogs from Cuiabá, Brazil.

PubMed

Spolidorio, Mariana Granziera; Torres, Mariana de Medeiros; Campos, Wilma Neres da Silva; Melo, Andréia Lima Tomé; Igarashi, Michelle; Amude, Alexandre Mendes; Labruna, Marcelo Bahia; Aguiar, Daniel Moura

2011-01-01

The objective of this study was to report for the first time infection by Hepatozoon spp. and Babesia spp. in 10 dogs from the city of Cuiabá, State of Mato Grosso, central-western Brazil. A pair of primers that amplifies a 574 bp fragment of the 18S rRNA of Hepatozoon spp., and a pair of primers that amplifies a 551 bp fragment of the gene 18S rRNA for Babesia spp. were used. Six dogs were positive for Babesia spp., and 9 were positive for Hepatozoon spp. Co‑infection of Babesia spp. and Hepatozoon spp. was seen in 5 dogs. Sequenced samples revealed 100% identity with B. canis vogeli, and H. canis. This is the first molecular detection of H. canis in domestic dogs from Cuiabá. Additionally, it is described for the first time the presence of B. canis vogeli circulating among dogs in Cuiabá.

Single and Multiple Dose Pharmacokinetics of Maraviroc in Saliva, Semen, and Rectal Tissue of Healthy HIV-negative Men

PubMed Central

Patterson, Kristine B.; Malone, Stephanie A.; Shaheen, Nicholas J.; Asher Prince, Heather M.; Dumond, Julie B.; Spacek, Melissa B.; Heidt, Paris E.; Cohen, Myron S.; Kashuba, Angela D. M.

2011-01-01

Background. Antiretroviral pharmacology in seminal plasma (SP) and rectal tissue (RT) may provide insight into antiretroviral resistance and the prevention of sexual transmission of human immunodeficiency virus (HIV). Saliva may be of utility for noninvasively measuring adherence. Methods. A pharmacokinetic study was performed in 12 HIV-negative men receiving maraviroc 300 mg twice daily for 8 days. Seven time-matched pairs of blood plasma (BP) and saliva samples were collected over 12 h on day 1 (PK1) and days 7 and 8 (PK2). One RT sample from each subject was collected during PK1 and PK2. Two SP samples were collected from each subject during PK1, and 6 SP samples were collected from each subject during PK2. Results. SP AUCs were ∼50% lower than BP. However, protein binding in SP ranged from 4% to 25%, resulting in protein-free concentrations >2-fold higher than BP. RT AUCs were 7.5- to 26-fold higher than BP. Maraviroc saliva AUCs were ∼70% lower than BP, but saliva concentrations correlated with BP (r2 = 0.58). Conclusions. More pharmacologically available maraviroc was found in SP than BP. High RT concentrations are promising for preventing rectal HIV acquisition. Saliva correlation with BP suggests that this may be useful for monitoring adherence. Clinical Trials Registration. NCT00775294. PMID:21502084

Glucocorticoids suppress tumor necrosis factor-alpha expression by human monocytic THP-1 cells by suppressing transactivation through adjacent NF-kappa B and c-Jun-activating transcription factor-2 binding sites in the promoter.

PubMed

Steer, J H; Kroeger, K M; Abraham, L J; Joyce, D A

2000-06-16

Glucocorticoid drugs suppress tumor necrosis factor-alpha (TNF-alpha) synthesis by activated monocyte/macrophages, contributing to an anti-inflammatory action in vivo. In lipopolysaccharide (LPS)-activated human monocytic THP-1 cells, glucocorticoids acted primarily on the TNF-alpha promoter to suppress a burst of transcriptional activity that occurred between 90 min and 3 h after LPS exposure. LPS increased nuclear c-Jun/ATF-2, NF-kappaB(1)/Rel-A, and Rel-A/C-Rel transcription factor complexes, which bound specifically to oligonucleotide sequences from the -106 to -88 base pair (bp) region of the promoter. The glucocorticoid, dexamethasone, suppressed nuclear binding activity of these complexes prior to and during the critical phase of TNF-alpha transcription. Site-directed mutagenesis in TNF-alpha promoter-luciferase reporter constructs showed that the adjacent c-Jun/ATF-2 (-106 to -99 bp) and NF-kappaB (-97 to -88 bp) binding sites each contributed to the LPS-stimulated expression. Mutating both sites largely prevented dexamethasone from suppressing TNF-alpha promoter-luciferase reporters. LPS exposure also increased nuclear Egr-1 and PU.1 abundance. The Egr-1/Sp1 (-172 to -161 bp) binding sites and the PU.1-binding Ets site (-116 to -110 bp) each contributed to the LPS-stimulated expression but not to glucocorticoid response. Dexamethasone suppressed the abundance of the c-Fos/c-Jun complex in THP-1 cell nuclei, but there was no direct evidence for c-Fos/c-Jun transactivation through sites in the -172 to -52 bp region. Small contributions to glucocorticoid response were attributable to promoter sequences outside the -172 to -88 bp region and to sequences in the TNF-alpha 3'-untranslated region. We conclude that glucocorticoids suppress LPS-stimulated secretion of TNF-alpha from human monocytic cells largely through antagonizing transactivation by c-Jun/ATF-2 and NF-kappaB complexes at binding sites in the -106 to -88 bp region of the TNF-alpha promoter.

Analysis of 16S-23S rRNA intergenic spacer regions of Vibrio cholerae and Vibrio mimicus.

PubMed

Chun, J; Huq, A; Colwell, R R

1999-05-01

Vibrio cholerae identification based on molecular sequence data has been hampered by a lack of sequence variation from the closely related Vibrio mimicus. The two species share many genes coding for proteins, such as ctxAB, and show almost identical 16S DNA coding for rRNA (rDNA) sequences. Primers targeting conserved sequences flanking the 3' end of the 16S and the 5' end of the 23S rDNAs were used to amplify the 16S-23S rRNA intergenic spacer regions of V. cholerae and V. mimicus. Two major (ca. 580 and 500 bp) and one minor (ca. 750 bp) amplicons were consistently generated for both species, and their sequences were determined. The largest fragment contains three tRNA genes (tDNAs) coding for tRNAGlu, tRNALys, and tRNAVal, which has not previously been found in bacteria examined to date. The 580-bp amplicon contained tDNAIle and tDNAAla, whereas the 500-bp fragment had single tDNA coding either tRNAGlu or tRNAAla. Little variation, i.e., 0 to 0.4%, was found among V. cholerae O1 classical, O1 El Tor, and O139 epidemic strains. Slightly more variation was found against the non-O1/non-O139 serotypes (ca. 1% difference) and V. mimicus (2 to 3% difference). A pair of oligonucleotide primers were designed, based on the region differentiating all of V. cholerae strains from V. mimicus. The PCR system developed was subsequently evaluated by using representatives of V. cholerae from environmental and clinical sources, and of other taxa, including V. mimicus. This study provides the first molecular tool for identifying the species V. cholerae.

Minor groove binding of a bis-quaternary ammonium compound: the crystal structure of SN 7167 bound to d(CGCGAATTCGCG)2.

PubMed Central

Squire, C J; Clark, G R; Denny, W A

1997-01-01

The X-ray crystal structure of the complex between the synthetic antitumour and antiviral DNA binding ligand SN 7167 and the DNA oligonucleotide d(CGCGAATTCGCG)2 has been determined to an R factor of 18.3% at 2.6 A resolution. The ligand is located within the minor groove and covers almost 6 bp with the 1-methylpyridinium ring extending as far as the C9-G16 base pair and the 1-methylquinolinium ring lying between the G4-C21 and A5-T20 base pairs. The ligand interacts only weakly with the DNA, as evidenced by long range contacts and shallow penetration into the groove. This structure is compared with that of the complex between the parent compound SN 6999 and the alkylated DNA sequence d(CGC[e6G]AATTCGCG)2. There are significant differences between the two structures in the extent of DNA bending, ligand conformation and groove binding. PMID:9321660

Nonlinear Assessment of Cerebral Autoregulation from Spontaneous Blood Pressure and Cerebral Blood Flow Fluctuations

PubMed Central

Peng, C. K.; Czosnyka, Marek; Zhao, Peng

2009-01-01

Cerebral autoregulation (CA) is an most important mechanism responsible for the relatively constant blood flow supply to brain when cerebral perfusion pressure varies. Its assessment in nonacute cases has been relied on the quantification of the relationship between noninvasive beat-to-beat blood pressure (BP) and blood flow velocity (BFV). To overcome the nonstationary nature of physiological signals such as BP and BFV, a computational method called multimodal pressure-flow (MMPF) analysis was recently developed to study the nonlinear BP–BFV relationship during the Valsalva maneuver (VM). The present study aimed to determine (i) whether this method can estimate autoregulation from spontaneous BP and BFV fluctuations during baseline rest conditions; (ii) whether there is any difference between the MMPF measures of autoregulation based on intra-arterial BP (ABP) and based on cerebral perfusion pressure (CPP); and (iii) whether the MMPF method provides reproducible and reliable measure for noninvasive assessment of autoregulation. To achieve these aims, we analyzed data from existing databases including: (i) ABP and BFV of 12 healthy control, 10 hypertensive, and 10 stroke subjects during baseline resting conditions and during the Valsalva maneuver, and (ii) ABP, CPP, and BFV of 30 patients with traumatic brain injury (TBI) who were being paralyzed, sedated, and ventilated. We showed that autoregulation in healthy control subjects can be characterized by specific phase shifts between BP and BFV oscillations during the Valsalva maneuver, and the BP–BFV phase shifts were reduced in hypertensive and stroke subjects (P < 0.01), indicating impaired autoregulation. Similar results were found during baseline condition from spontaneous BP and BFV oscillations. The BP–BFV phase shifts obtained during baseline and during VM were highly correlated (R > 0.8, P < 0.0001), showing no statistical difference (paired-t test P > 0.47). In TBI patients there were strong correlations between phases of ABP and CPP oscillations (R = 0.99, P < 0.0001) and, thus, between ABP–BFV and CPP–BFV phase shifts (P < 0.0001, R = 0.76). By repeating the MMPF 4 times on data of TBI subjects, each time on a selected cycle of spontaneous BP and BFV oscillations, we showed that MMPF had better reproducibility than traditional autoregulation index. These results indicate that the MMPF method, based on instantaneous phase relationships between cerebral blood flow velocity and peripheral blood pressure, has better performance than the traditional standard method, and can reliably assess cerebral autoregulation dynamics from ambulatory blood pressure and cerebral blood flow during supine rest conditions. PMID:18080758

Identification and characterization of RAPD-SCAR markers linked to glyphosate-susceptible and -resistant biotypes of Eleusine indica (L.) Gaertn.

PubMed

Cha, Thye San; Anne-Marie, Kaben; Chuah, Tse Seng

2014-02-01

Eleusine indica is one of the most common weed species found in agricultural land worldwide. Although herbicide-glyphosate provides good control of the weed, its frequent uses has led to abundant reported cases of resistance. Hence, the development of genetic markers for quick detection of glyphosate-resistance in E. indica population is imperative for the control and management of the weed. In this study, a total of 14 specific random amplified polymorphic DNA (RAPD) markers were identified and two of the markers, namely S4R727 and S26R6976 were further sequence characterized. Sequence alignment revealed that marker S4R727 showing a 12-bp nucleotides deletion in resistant biotypes, while marker S26R6976 contained a 167-bp nucleotides insertion in the resistant biotypes. Based on these sequence differences, three pairs of new sequence characterized amplified region (SCAR) primers were developed. The specificity of these primer pairs were further validated with genomic DNA extracted from ten individual plants of one glyphosate-susceptible and five glyphosate-resistant (R2, R4, R6, R8 and R11) populations. The resulting RAPD-SCAR markers provided the basis for assessing genetic diversity between glyphosate-susceptible and -resistant E. indica biotypes, as well for the identification of genetic locus link to glyphosate-resistance event in the species.

The illusion of specific capture: surface and solution studies of suboptimal oligonucleotide hybridization

PubMed Central

2013-01-01

Background Hybridization based assays and capture systems depend on the specificity of hybridization between a probe and its intended target. A common guideline in the construction of DNA microarrays, for instance, is that avoiding complementary stretches of more than 15 nucleic acids in a 50 or 60-mer probe will eliminate sequence specific cross-hybridization reactions. Here we present a study of the behavior of partially matched oligonucleotide pairs with complementary stretches starting well below this threshold complementarity length – in silico, in solution, and at the microarray surface. The modeled behavior of pairs of oligonucleotide probes and their targets suggests that even a complementary stretch of sequence 12 nt in length would give rise to specific cross-hybridization. We designed a set of binding partners to a 50-mer oligonucleotide containing complementary stretches from 6 nt to 21 nt in length. Results Solution melting experiments demonstrate that stable partial duplexes can form when only 12 bp of complementary sequence are present; surface hybridization experiments confirm that a signal close in magnitude to full-strength signal can be obtained from hybridization of a 12 bp duplex within a 50mer oligonucleotide. Conclusions Microarray and other molecular capture strategies that rely on a 15 nt lower complementarity bound for eliminating specific cross-hybridization may not be sufficiently conservative. PMID:23445545

The use of short and long PCR products for improved detection of prunus necrotic ringspot virus in woody plants.

PubMed

Rosner, A; Maslenin, L; Spiegel, S

1997-09-01

The reverse transcriptase-polymerase chain reaction (RT-PCR) was used for detection of prunus necrotic ringspot virus (PNRSV) in dormant peach and almond trees by the application of two different pairs of primers yielding a short and a long product, respectively. The relative amount of the short (200 base pair, bp) product was higher than the longer (785 bp) product. PNRSV was detected better in plant tissues with a low virus concentration (e.g. dormant trees) by amplification of the short PCR product, whereas the long product was product was produced at higher virus titers. Simultaneous amplification of both short and long products was demonstrated using a three-primer mixture in a single reaction tube. In this assay, amplification of either PCR product indicated the presence of PNRSV-specific sequences in the plant tissue examined, thus covering a wide range of virus concentrations in a single test. Dilution of the RNA extracted from infected plant material resulted in a steep decline in the amplification of both short and long PCR products. In contrast, serial dilutions of the intermediate cDNA template differentially affected the amplification patterns: the relative amount of the short product increased whereas that of the long product decreased. These results may explain the preferential amplification of the short PCR product observed in samples containing low virus concentrations.

Identification and characterization of single nucleotide polymorphisms in 6 growth-correlated genes in porcine by denaturing high performance liquid chromatography.

PubMed

Liu, Dewu; Zhang, Yushan; Du, Yinjun; Yang, Guanfu; Zhang, Xiquan

2007-06-01

The growth-correlated genes that are part of the neuroendocrine growth axis play crucial roles in the regulation of growth and development of pig. The identification of genetic polymorphisms in these genes will enable the scientist to evaluate the biological relevance of such polymorphisms and to gain a better understanding of quantitative traits like growth. In the present study, seven pairs of primers were designed to obtain unknown sequences of growth-correlated genes, and other 25 pairs of primers were designed to identify single nucleotide polymorphisms (SNP) using the denaturing high-performance liquid chromatography (DHPLC) technology in four pig breeds (Duroc, Landrace, Lantang and Wuzhishan), significantly differing in growth and development characteristics. A total of 101 polymorphisms were discovered in 10,707 base pairs (bp) from six genes of the ghrelin (GHRL), leptin (LEP), insulin-like growth factor II (IGF-II), insulin-like growth factor binding protein 2 (IGFBP-2), insulin-like growth factor binding protein 3 (IGFBP-3), and somatostatin (SS). The observed average distances between the SNP in the 5'UTR, coding regions, introns and 3'UTR were 134, 521, 81 and 92 bp, respectively. Four SNPs were found in the coding regions of IGF-II, IGFBP-2 and LEP, respectively. Two synonymous mutations were obtained in IGF-II and LEP genes respectively, and two non-synonymous were found in IGFBP-2 and LEP genes, respectively. Seven other mutations were also observed. Thirty-two PCR-RFLP markers were found among 101 polymorphisms of the six genes. The SNP discovered in this study would provide suitable markers for association studies of candidate genes with growth related traits in pig.

The complete chloroplast DNA sequence of Eleutherococcus senticosus (Araliaceae); comparative evolutionary analyses with other three asterids.

PubMed

Yi, Dong-Keun; Lee, Hae-Lim; Sun, Byung-Yun; Chung, Mi Yoon; Kim, Ki-Joong

2012-05-01

This study reports the complete chloroplast (cp) DNA sequence of Eleutherococcus senticosus (GenBank: JN 637765), an endangered endemic species. The genome is 156,768 bp in length, and contains a pair of inverted repeat (IR) regions of 25,930 bp each, a large single copy (LSC) region of 86,755 bp and a small single copy (SSC) region of 18,153 bp. The structural organization, gene and intron contents, gene order, AT content, codon usage, and transcription units of the E. senticosus chloroplast genome are similar to that of typical land plant cp DNA. We aligned and analyzed the sequences of 86 coding genes, 19 introns and 113 intergenic spacers (IGS) in three different taxonomic hierarchies; Eleutherococcus vs. Panax, Eleutherococcus vs. Daucus, and Eleutherococcus vs. Nicotiana. The distribution of indels, the number of polymorphic sites and nucleotide diversity indicate that positional constraint is more important than functional constraint for the evolution of cp genome sequences in Asterids. For example, the intron sequences in the LSC region exhibited base substitution rates 5-11-times higher than that of the IR regions, while the intron sequences in the SSC region evolved 7-14-times faster than those in the IR region. Furthermore, the Ka/Ks ratio of the gene coding sequences supports a stronger evolutionary constraint in the IR region than in the LSC or SSC regions. Therefore, our data suggest that selective sweeps by base collection mechanisms more frequently eliminate polymorphisms in the IR region than in other regions. Chloroplast genome regions that have high levels of base substitutions also show higher incidences of indels. Thirty-five simple sequence repeat (SSR) loci were identified in the Eleutherococcus chloroplast genome. Of these, 27 are homopolymers, while six are di-polymers and two are tri-polymers. In addition to the SSR loci, we also identified 18 medium size repeat units ranging from 22 to 79 bp, 11 of which are distributed in the IGS or intron regions. These medium size repeats may contribute to developing a cp genome-specific gene introduction vector because the region may use for specific recombination sites.

Pearl millet [Pennisetum glaucum (L.) R. Br.] consensus linkage map constructed using four RIL mapping populations and newly developed EST-SSRs.

PubMed

Rajaram, Vengaldas; Nepolean, Thirunavukkarasu; Senthilvel, Senapathy; Varshney, Rajeev K; Vadez, Vincent; Srivastava, Rakesh K; Shah, Trushar M; Supriya, Ambawat; Kumar, Sushil; Ramana Kumari, Basava; Bhanuprakash, Amindala; Narasu, Mangamoori Lakshmi; Riera-Lizarazu, Oscar; Hash, Charles Thomas

2013-03-09

Pearl millet [Pennisetum glaucum (L.) R. Br.] is a widely cultivated drought- and high-temperature tolerant C4 cereal grown under dryland, rainfed and irrigated conditions in drought-prone regions of the tropics and sub-tropics of Africa, South Asia and the Americas. It is considered an orphan crop with relatively few genomic and genetic resources. This study was undertaken to increase the EST-based microsatellite marker and genetic resources for this crop to facilitate marker-assisted breeding. Newly developed EST-SSR markers (99), along with previously mapped EST-SSR (17), genomic SSR (53) and STS (2) markers, were used to construct linkage maps of four F7 recombinant inbred populations (RIP) based on crosses ICMB 841-P3 × 863B-P2 (RIP A), H 77/833-2 × PRLT 2/89-33 (RIP B), 81B-P6 × ICMP 451-P8 (RIP C) and PT 732B-P2 × P1449-2-P1 (RIP D). Mapped loci numbers were greatest for RIP A (104), followed by RIP B (78), RIP C (64) and RIP D (59). Total map lengths (Haldane) were 615 cM, 690 cM, 428 cM and 276 cM, respectively. A total of 176 loci detected by 171 primer pairs were mapped among the four crosses. A consensus map of 174 loci (899 cM) detected by 169 primer pairs was constructed using MergeMap to integrate the individual linkage maps. Locus order in the consensus map was well conserved for nearly all linkage groups. Eighty-nine EST-SSR marker loci from this consensus map had significant BLAST hits (top hits with e-value ≤ 1E-10) on the genome sequences of rice, foxtail millet, sorghum, maize and Brachypodium with 35, 88, 58, 48 and 38 loci, respectively. The consensus map developed in the present study contains the largest set of mapped SSRs reported to date for pearl millet, and represents a major consolidation of existing pearl millet genetic mapping information. This study increased numbers of mapped pearl millet SSR markers by >50%, filling important gaps in previously published SSR-based linkage maps for this species and will greatly facilitate SSR-based QTL mapping and applied marker-assisted selection programs.

The complete chloroplast genome of Gentiana straminea (Gentianaceae), an endemic species to the Sino-Himalayan subregion.

PubMed

Ni, Lianghong; Zhao, Zhili; Xu, Hongxi; Chen, Shilin; Dorje, Gaawe

2016-02-15

Endemic to the Sino-Himalayan subregion, the medicinal alpine plant Gentiana straminea is a threatened species. The genetic and molecular data about it is deficient. Here we report the complete chloroplast (cp) genome sequence of G. straminea, as the first sequenced member of the family Gentianaceae. The cp genome is 148,991bp in length, including a large single copy (LSC) region of 81,240bp, a small single copy (SSC) region of 17,085bp and a pair of inverted repeats (IRs) of 25,333bp. It contains 112 unique genes, including 78 protein-coding genes, 30 tRNAs and 4 rRNAs. The rps16 gene lacks exon2 between trnK-UUU and trnQ-UUG, which is the first rps16 pseudogene found in the nonparasitic plants of Asterids clade. Sequence analysis revealed the presence of 13 forward repeats, 13 palindrome repeats and 39 simple sequence repeats (SSRs). An entire cp genome comparison study of G. straminea and four other species in Gentianales was carried out. Phylogenetic analyses using maximum likelihood (ML) and maximum parsimony (MP) were performed based on 69 protein-coding genes from 36 species of Asterids. The results strongly supported the position of Gentianaceae as one member of the order Gentianales. The complete chloroplast genome sequence will provide intragenic information for its conservation and contribute to research on the genetic and phylogenetic analyses of Gentianales and Asterids. Copyright © 2015 Elsevier B.V. All rights reserved.

Arabidopsis intragenomic conserved noncoding sequence

PubMed Central

Thomas, Brian C.; Rapaka, Lakshmi; Lyons, Eric; Pedersen, Brent; Freeling, Michael

2007-01-01

After the most recent tetraploidy in the Arabidopsis lineage, most gene pairs lost one, but not both, of their duplicates. We manually inspected the 3,179 retained gene pairs and their surrounding gene space still present in the genome using a custom-made viewer application. The display of these pairs allowed us to define intragenic conserved noncoding sequences (CNSs), identify exon annotation errors, and discover potentially new genes. Using a strict algorithm to sort high-scoring pair sequences from the bl2seq data, we created a database of 14,944 intragenomic Arabidopsis CNSs. The mean CNS length is 31 bp, ranging from 15 to 285 bp. There are ≈1.7 CNSs associated with a typical gene, and Arabidopsis CNSs are found in all areas around exons, most frequently in the 5′ upstream region. Gene ontology classifications related to transcription, regulation, or “response to …” external or endogenous stimuli, especially hormones, tend to be significantly overrepresented among genes containing a large number of CNSs, whereas protein localization, transport, and metabolism are common among genes with no CNSs. There is a 1.5% overlap between these CNSs and the 218,982 putative RNAs in the Arabidopsis Small RNA Project database, allowing for two mismatches. These CNSs provide a unique set of noncoding sequences enriched for function. CNS function is implied by evolutionary conservation and independently supported because CNS-richness predicts regulatory gene ontology categories. PMID:17301222

pH-Modulated Watson-Crick duplex-quadruplex equilibria of guanine-rich and cytosine-rich DNA sequences 140 base pairs upstream of the c-kit transcription initiation site.

PubMed

Bucek, Pavel; Jaumot, Joaquim; Aviñó, Anna; Eritja, Ramon; Gargallo, Raimundo

2009-11-23

Guanine-rich regions of DNA are sequences capable of forming G-quadruplex structures. The formation of a G-quadruplex structure in a region 140 base pairs (bp) upstream of the c-kit transcription initiation site was recently proposed (Fernando et al., Biochemistry, 2006, 45, 7854). In the present study, the acid-base equilibria and the thermally induced unfolding of the structures formed by a guanine-rich region and by its complementary cytosine-rich strand in c-kit were studied by means of circular dichroism and molecular absorption spectroscopies. In addition, competition between the Watson-Crick duplex and the isolated structures was studied as a function of pH value and temperature. Multivariate data analysis methods based on both hard and soft modeling were used to allow accurate quantification of the various acid-base species present in the mixtures. Results showed that the G-quadruplex and i-motif coexist with the Watson-Crick duplex over the pH range from 3.0 to 6.5, approximately, under the experimental conditions tested in this study. At pH 7.0, the duplex is practically the only species present.

Chloroplast genomes of Arabidopsis halleri ssp. gemmifera and Arabidopsis lyrata ssp. petraea: Structures and comparative analysis.

PubMed

Asaf, Sajjad; Khan, Abdul Latif; Khan, Muhammad Aaqil; Waqas, Muhammad; Kang, Sang-Mo; Yun, Byung-Wook; Lee, In-Jung

2017-08-08

We investigated the complete chloroplast (cp) genomes of non-model Arabidopsis halleri ssp. gemmifera and Arabidopsis lyrata ssp. petraea using Illumina paired-end sequencing to understand their genetic organization and structure. Detailed bioinformatics analysis revealed genome sizes of both subspecies ranging between 154.4~154.5 kbp, with a large single-copy region (84,197~84,158 bp), a small single-copy region (17,738~17,813 bp) and pair of inverted repeats (IRa/IRb; 26,264~26,259 bp). Both cp genomes encode 130 genes, including 85 protein-coding genes, eight ribosomal RNA genes and 37 transfer RNA genes. Whole cp genome comparison of A. halleri ssp. gemmifera and A. lyrata ssp. petraea, along with ten other Arabidopsis species, showed an overall high degree of sequence similarity, with divergence among some intergenic spacers. The location and distribution of repeat sequences were determined, and sequence divergences of shared genes were calculated among related species. Comparative phylogenetic analysis of the entire genomic data set and 70 shared genes between both cp genomes confirmed the previous phylogeny and generated phylogenetic trees with the same topologies. The sister species of A. halleri ssp. gemmifera is A. umezawana, whereas the closest relative of A. lyrata spp. petraea is A. arenicola.

Complete Chloroplast Genome Sequences of Mongolia Medicine Artemisia frigida and Phylogenetic Relationships with Other Plants

PubMed Central

Liu, Yue; Huo, Naxin; Dong, Lingli; Wang, Yi; Zhang, Shuixian; Young, Hugh A.; Feng, Xiaoxiao; Gu, Yong Qiang

2013-01-01

Background Artemisia frigida Willd. is an important Mongolian traditional medicinal plant with pharmacological functions of stanch and detumescence. However, there is little sequence and genomic information available for Artemisia frigida, which makes phylogenetic identification, evolutionary studies, and genetic improvement of its value very difficult. We report the complete chloroplast genome sequence of Artemisia frigida based on 454 pyrosequencing. Methodology/Principal Findings The complete chloroplast genome of Artemisia frigida is 151,076 bp including a large single copy (LSC) region of 82,740 bp, a small single copy (SSC) region of 18,394 bp and a pair of inverted repeats (IRs) of 24,971 bp. The genome contains 114 unique genes and 18 duplicated genes. The chloroplast genome of Artemisia frigida contains a small 3.4 kb inversion within a large 23 kb inversion in the LSC region, a unique feature in Asteraceae. The gene order in the SSC region of Artemisia frigida is inverted compared with the other 6 Asteraceae species with the chloroplast genomes sequenced. This inversion is likely caused by an intramolecular recombination event only occurred in Artemisia frigida. The existence of rich SSR loci in the Artemisia frigida chloroplast genome provides a rare opportunity to study population genetics of this Mongolian medicinal plant. Phylogenetic analysis demonstrates a sister relationship between Artemisia frigida and four other species in Asteraceae, including Ageratina adenophora, Helianthus annuus, Guizotia abyssinica and Lactuca sativa, based on 61 protein-coding sequences. Furthermore, Artemisia frigida was placed in the tribe Anthemideae in the subfamily Asteroideae (Asteraceae) based on ndhF and trnL-F sequence comparisons. Conclusion The chloroplast genome sequence of Artemisia frigida was assembled and analyzed in this study, representing the first plastid genome sequenced in the Anthemideae tribe. This complete chloroplast genome sequence will be useful for molecular ecology and molecular phylogeny studies within Artemisia species and also within the Asteraceae family. PMID:23460871

The Complete Chloroplast Genome Sequence of Date Palm (Phoenix dactylifera L.)

PubMed Central

Yang, Meng; Zhang, Xiaowei; Liu, Guiming; Yin, Yuxin; Chen, Kaifu; Yun, Quanzheng; Zhao, Duojun; Al-Mssallem, Ibrahim S.; Yu, Jun

2010-01-01

Background Date palm (Phoenix dactylifera L.), a member of Arecaceae family, is one of the three major economically important woody palms—the two other palms being oil palm and coconut tree—and its fruit is a staple food among Middle East and North African nations, as well as many other tropical and subtropical regions. Here we report a complete sequence of the data palm chloroplast (cp) genome based on pyrosequencing. Methodology/Principal Findings After extracting 369,022 cp sequencing reads from our whole-genome-shotgun data, we put together an assembly and validated it with intensive PCR-based verification, coupled with PCR product sequencing. The date palm cp genome is 158,462 bp in length and has a typical quadripartite structure of the large (LSC, 86,198 bp) and small single-copy (SSC, 17,712 bp) regions separated by a pair of inverted repeats (IRs, 27,276 bp). Similar to what has been found among most angiosperms, the date palm cp genome harbors 112 unique genes and 19 duplicated fragments in the IR regions. The junctions between LSC/IRs and SSC/IRs show different features of sequence expansion in evolution. We identified 78 SNPs as major intravarietal polymorphisms within the population of a specific cp genome, most of which were located in genes with vital functions. Based on RNA-sequencing data, we also found 18 polycistronic transcription units and three highly expression-biased genes—atpF, trnA-UGC, and rrn23. Conclusions Unlike most monocots, date palm has a typical cp genome similar to that of tobacco—with little rearrangement and gene loss or gain. High-throughput sequencing technology facilitates the identification of intravarietal variations in cp genomes among different cultivars. Moreover, transcriptomic analysis of cp genes provides clues for uncovering regulatory mechanisms of transcription and translation in chloroplasts. PMID:20856810

An improved assembly of the loblolly pine mega-genome using long-read single-molecule sequencing.

PubMed

Zimin, Aleksey V; Stevens, Kristian A; Crepeau, Marc W; Puiu, Daniela; Wegrzyn, Jill L; Yorke, James A; Langley, Charles H; Neale, David B; Salzberg, Steven L

2017-01-01

The 22-gigabase genome of loblolly pine (Pinus taeda) is one of the largest ever sequenced. The draft assembly published in 2014 was built entirely from short Illumina reads, with lengths ranging from 100 to 250 base pairs (bp). The assembly was quite fragmented, containing over 11 million contigs whose weighted average (N50) size was 8206 bp. To improve this result, we generated approximately 12-fold coverage in long reads using the Single Molecule Real Time sequencing technology developed at Pacific Biosciences. We assembled the long and short reads together using the MaSuRCA mega-reads assembly algorithm, which produced a substantially better assembly, P. taeda version 2.0. The new assembly has an N50 contig size of 25 361, more than three times as large as achieved in the original assembly, and an N50 scaffold size of 107 821, 61% larger than the previous assembly. © The Author 2017. Published by Oxford University Press.

Involvement of a Polyketide Synthetase ClPKS18 in the Regulation of Vegetative Growth, Melanin and Toxin Synthesis, and Virulence in Curvularia lunata.

PubMed

Gao, Jin-Xin; Chen, Jie

2017-12-01

The clpks18 gene was first cloned and identified in Curvularia lunata. It contains 6571 base pairs (bp) and an 6276 bp open reading frame encoding 2091 amino acids. The ClPKS18 deletion mutant displayed an albino phenotype, and almost lost the ability to product 5-(hydroxymethyl) furan-2-carboxylate (M5HF2C) toxin, implying that clpks18 gene in C. lunata is not only involved in 1,8-dihydroxynaphthalene melanin synthesis, but also relatively associated with M5HF2C toxin biosynthesis of the pathogen. The pathogenicity assays revealed that ΔClPKS18 was impaired in colonizing the maize leaves, which corresponds to the finding that ClPKS18 controls the production of melanin and M5HF2C in C. lunata . Results indicate that ClPKS18 plays a vital role in regulating pathogenicity of in C. lunata .

Ancient DNA Reveals Late Pleistocene Existence of Ostriches in Indian Sub-Continent.

PubMed

Jain, Sonal; Rai, Niraj; Kumar, Giriraj; Pruthi, Parul Aggarwal; Thangaraj, Kumarasamy; Bajpai, Sunil; Pruthi, Vikas

2017-01-01

Ancient DNA (aDNA) analysis of extinct ratite species is of considerable interest as it provides important insights into their origin, evolution, paleogeographical distribution and vicariant speciation in congruence with continental drift theory. In this study, DNA hotspots were detected in fossilized eggshell fragments of ratites (dated ≥25000 years B.P. by radiocarbon dating) using confocal laser scanning microscopy (CLSM). DNA was isolated from five eggshell fragments and a 43 base pair (bp) sequence of a 16S rRNA mitochondrial-conserved region was successfully amplified and sequenced from one of the samples. Phylogenetic analysis of the DNA sequence revealed a 92% identity of the fossil eggshells to Struthio camelus and their position basal to other palaeognaths, consistent with the vicariant speciation model. Our study provides the first molecular evidence for the presence of ostriches in India, complementing the continental drift theory of biogeographical movement of ostriches in India, and opening up a new window into the evolutionary history of ratites.

Erratum to: An improved assembly of the loblolly pine mega-genome using long-read single-molecule sequencing.

PubMed

Zimin, Aleksey V; Stevens, Kristian A; Crepeau, Marc W; Puiu, Daniela; Wegrzyn, Jill L; Yorke, James A; Langley, Charles H; Neale, David B; Salzberg, Steven L

2017-10-01

The 22-gigabase genome of loblolly pine (Pinus taeda) is one of the largest ever sequenced. The draft assembly published in 2014 was built entirely from short Illumina reads, with lengths ranging from 100 to 250 base pairs (bp). The assembly was quite fragmented, containing over 11 million contigs whose weighted average (N50) size was 8206 bp. To improve this result, we generated approximately 12-fold coverage in long reads using the Single Molecule Real Time sequencing technology developed at Pacific Biosciences. We assembled the long and short reads together using the MaSuRCA mega-reads assembly algorithm, which produced a substantially better assembly, P. taeda version 2.0. The new assembly has an N50 contig size of 25 361, more than three times as large as achieved in the original assembly, and an N50 scaffold size of 107 821, 61% larger than the previous assembly. © The Authors 2017. Published by Oxford University Press.

Structural features of diverse Pin-II proteinase inhibitor genes from Capsicum annuum.

PubMed

Mahajan, Neha S; Dewangan, Veena; Lomate, Purushottam R; Joshi, Rakesh S; Mishra, Manasi; Gupta, Vidya S; Giri, Ashok P

2015-02-01

The proteinase inhibitor (PI) genes from Capsicum annuum were characterized with respect to their UTR, introns and promoter elements. The occurrence of PIs with circularly permuted domain organization was evident. Several potato inhibitor II (Pin-II) type proteinase inhibitor (PI) genes have been analyzed from Capsicum annuum (L.) with respect to their differential expression during plant defense response. However, complete gene characterization of any of these C. annuum PIs (CanPIs) has not been carried out so far. Complete gene architectures of a previously identified CanPI-7 (Beads-on-string, Type A) and a member of newly isolated Bracelet type B, CanPI-69 are reported in this study. The 5' UTR (untranslated region), 3'UTR, and intronic sequences of both the CanPI genes were obtained. The genomic sequence of CanPI-7 exhibited, exon 1 (49 base pair, bp) and exon 2 (740 bp) interrupted by a 294-bp long type I intron. We noted the occurrence of three multi-domain PIs (CanPI-69, 70, 71) with circularly permuted domain organization. CanPI-69 was found to possess exon 1 (49 bp), exon 2 (551 bp) and a 584-bp long type I intron. The upstream sequence analysis of CanPI-7 and CanPI-69 predicted various transcription factor-binding sites including TATA and CAAT boxes, hormone-responsive elements (ABRELATERD1, DOFCOREZM, ERELEE4), and a defense-responsive element (WRKY71OS). Binding of transcription factors such as zinc finger motif MADS-box and MYB to the promoter regions was confirmed using electrophoretic mobility shift assay followed by mass spectrometric identification. The 3' UTR analysis for 25 CanPI genes revealed unique/distinct 3' UTR sequence for each gene. Structures of three domain CanPIs of type A and B were predicted and further analyzed for their attributes. This investigation of CanPI gene architecture will enable the better understanding of the genetic elements present in CanPIs.

The complete mitogenome of the whale shark parasitic copepod Pandarus rhincodonicus norman, Newbound & Knott (Crustacea; Siphonostomatoida; Pandaridae)--a new gene order for the copepoda.

PubMed

Austin, Christopher M; Tan, Mun Hua; Lee, Yin Peng; Croft, Laurence J; Meekan, Mark G; Pierce, Simon J; Gan, Han Ming

2016-01-01

The complete mitochondrial genome of the parasitic copepod Pandarus rhincodonicus was obtained from a partial genome scan using the HiSeq sequencing system. The Pandarus rhincodonicus mitogenome has 14,480 base pairs (62% A+T content) made up of 12 protein-coding genes, 2 ribosomal subunit genes, 22 transfer RNAs, and a putative 384 bp non-coding AT-rich region. This Pandarus mitogenome sequence is the first for the family Pandaridae, the second for the order Siphonostomatoida and the sixth for the Copepoda.

Data of 10 SSR markers for genomes of homo sapiens and monkeys.

PubMed

Reddy, K K V V V S; Raju, S Viswanadha; Someswara Rao, Chinta

2017-06-01

In this data, we present 10 Simple Sequence Repeat(SSR) markers TAGA, TCAT, GAAT, AGAT, AGAA, GATA, TATC, CTTT, TCTG and TCTA which are extracted from the genomes of homo sapiens and monkeys using string matching mechanism [1]. All loci showed 4 Base Pair(bp) in allele size, indicating that there are some polymorphisms between individuals correlating to the number of SSR repeats that maybe useful for the detection of similarity among the genotypes. Collectively, these data show that the SSR extraction is a valuable method to illustrate genetic variation of genomes.

Final progress report, Construction of a genome-wide highly characterized clone resource for genome sequencing

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nierman, William C.

At TIGR, the human Bacterial Artificial Chromosome (BAC) end sequencing and trimming were with an overall sequencing success rate of 65%. CalTech human BAC libraries A, B, C and D as well as Roswell Park Cancer Institute's library RPCI-11 were used. To date, we have generated >300,000 end sequences from >186,000 human BAC clones with an average read length {approx}460 bp for a total of 141 Mb covering {approx}4.7% of the genome. Over sixty percent of the clones have BAC end sequences (BESs) from both ends representing over five-fold coverage of the genome by the paired-end clones. The average phredmore » Q20 length is {approx}400 bp. This high accuracy makes our BESs match the human finished sequences with an average identity of 99% and a match length of 450 bp, and a frequency of one match per 12.8 kb contig sequence. Our sample tracking has ensured a clone tracking accuracy of >90%, which gives researchers a high confidence in (1) retrieving the right clone from the BA C libraries based on the sequence matches; and (2) building a minimum tiling path of sequence-ready clones across the genome and genome assembly scaffolds.« less

Characterisation of pks15/1 in clinical isolates of Mycobacterium tuberculosis from Mexico

PubMed Central

Zenteno-Cuevas, Roberto; Silva-Hernández, Francisco X; Mendoza-Damián, Fabiola; Ramírez-Hernández, Maria Dolores; Vázquez-Medina, Karen; Widrobo-García, Lorena; Cuellar-Sanchez, Aremy; Muñíz-Salazar, Raquel; Enciso-Moreno, Leonor; Pérez-Navarro, Lucia Monserrat; Enciso-Moreno, José Antonio

2013-01-01

Tuberculosis (TB) is an infectocontagious respiratory disease caused by members of the Mycobacterium tuberculosis complex. A 7 base pair (bp) deletion in the locus polyketide synthase (pks)15/1 is described as polymorphic among members of the M. tuberculosis complex, enabling the identification of Euro-American, Indo-Oceanic and Asian lineages. The aim of this study was to characterise this locus in TB isolates from Mexico. One hundred twenty clinical isolates were recovered from the states of Veracruz and Estado de Mexico. We determined the nucleotide sequence of a ± 400 bp fragment of the locus pks15/1, while genotypic characterisation was performed by spoligotyping. One hundred and fifty isolates contained the 7 bp deletion, while five had the wild type locus. Lineages X (22%), LAM (18%) and T (17%) were the most frequent; only three (2%) of the isolates were identified as Beijing and two (1%) EAI-Manila. The wild type pks15/1 locus was observed in all Asian lineage isolates tested. Our results confirm the utility of locus pks15/1 as a molecular marker for identifying Asian lineages of the M. tuberculosis complex. This marker could be of great value in the epidemiological surveillance of TB, especially in countries like Mexico, where the prevalence of such lineages is unknown. PMID:24037193

Molecular identification and characterization of clustered regularly interspaced short palindromic repeat (CRISPR) gene cluster in Taylorella equigenitalis.

PubMed

Hara, Yasushi; Hayashi, Kyohei; Nakajima, Takuya; Kagawa, Shizuko; Tazumi, Akihiro; Moore, John E; Matsuda, Motoo

2013-09-01

Clustered regularly interspaced short palindromic repeats (CRISPRs), of approximately 10,000 base pairs (bp) in length, were shown to occur in the Japanese Taylorella equigenitalis strain, EQ59. The locus was composed of the putative CRISPRs-associated with 5 (cas5), RAMP csd1, csd2, recB, cas1, a leader region, 13 CRISPR consensus sequence repeats (each 32 bp; 5'-TCAGCCACGTTCGCGTGGCTGTGTGTTTAAAG-3'). These were in turn separated by 12 non repetitive unique spacer regions of similar length. In addition, a leader region, a transposase/IS protein, a leader region, and cas3 were also seen. All seven putative open reading frames carry their ribosome binding sites. Promoter consensus sequences at the -35 and -10 regions and putative intrinsic ρ-independent transcription terminator regions also occurred. A possible long overlap of 170 bp in length occurred between the recB and cas1 loci. Positive reverse transcription PCR signals of cas5, RAMP csd1, csd2-recB/cas1, and cas3 were generated. A putative secondary structure of the CRISPR consensus repeats was constructed. Following this, CRISPR results of the T. equigenitalis EQ59 isolate were subsequently compared with those from the Taylorella asinigenitalis MCE3 isolate.

A PCR method for the detection and differentiation of Lentinus edodes and Trametes versicolor in defined-mixed cultures used for wastewater treatment.

PubMed

García-Mena, Jaime; Cano-Ramirez, Claudia; Garibay-Orijel, Claudio; Ramirez-Canseco, Sergio; Poggi-Varaldo, Héctor M

2005-06-01

A PCR-based method for the quantitative detection of Lentinus edodes and Trametes versicolor, two ligninolytic fungi applied for wastewater treatment and bioremediation, was developed. Genomic DNA was used to optimize a PCR method targeting the conserved copper-binding sequence of laccase genes. The method allowed the quantitative detection and differentiation of these fungi in single and defined-mixed cultures after fractionation of the PCR products by electrophoresis in agarose gels. Amplified products of about 150 bp for L. edodes, and about 200 bp for T. versicolor were purified and cloned. The PCR method showed a linear detection response in the 1.0 microg-1 ng range. The same method was tested with genomic DNA from a third fungus (Phanerochaete chrysosporium), yielding a fragment of about 400 bp. Southern-blot and DNA sequence analysis indicated that a specific PCR product was amplified from each genome, and that these corresponded to sequences of laccase genes. This PCR protocol permits the detection and differentiation of three ligninolytic fungi by amplifying DNA fragments of different sizes using a single pair of primers, without further enzymatic restriction of the PCR products. This method has potential use in the monitoring, evaluation, and improvement of fungal cultures used in wastewater treatment processes.

Phylogenetics of the phlebotomine sand fly group Verrucarum (Diptera: Psychodidae: Lutzomyia).

PubMed

Cohnstaedt, Lee W; Beati, Lorenza; Caceres, Abraham G; Ferro, Cristina; Munstermann, Leonard E

2011-06-01

Within the sand fly genus Lutzomyia, the Verrucarum species group contains several of the principal vectors of American cutaneous leishmaniasis and human bartonellosis in the Andean region of South America. The group encompasses 40 species for which the taxonomic status, phylogenetic relationships, and role of each species in disease transmission remain unresolved. Mitochondrial cytochrome c oxidase I (COI) phylogenetic analysis of a 667-bp fragment supported the morphological classification of the Verrucarum group into series. Genetic sequences from seven species were grouped in well-supported monophyletic lineages. Four species, however, clustered in two paraphyletic lineages that indicate conspecificity--the Lutzomyia longiflocosa-Lutzomyia sauroida pair and the Lutzomyia quasitownsendi-Lutzomyia torvida pair. COI sequences were also evaluated as a taxonomic tool based on interspecific genetic variability within the Verrucarum group and the intraspecific variability of one of its members, Lutzomyia verrucarum, across its known distribution.

Phylogenetics of the Phlebotomine Sand Fly Group Verrucarum (Diptera: Psychodidae: Lutzomyia)

PubMed Central

Cohnstaedt, Lee W.; Beati, Lorenza; Caceres, Abraham G.; Ferro, Cristina; Munstermann, Leonard E.

2011-01-01

Within the sand fly genus Lutzomyia, the Verrucarum species group contains several of the principal vectors of American cutaneous leishmaniasis and human bartonellosis in the Andean region of South America. The group encompasses 40 species for which the taxonomic status, phylogenetic relationships, and role of each species in disease transmission remain unresolved. Mitochondrial cytochrome c oxidase I (COI) phylogenetic analysis of a 667-bp fragment supported the morphological classification of the Verrucarum group into series. Genetic sequences from seven species were grouped in well-supported monophyletic lineages. Four species, however, clustered in two paraphyletic lineages that indicate conspecificity—the Lutzomyia longiflocosa–Lutzomyia sauroida pair and the Lutzomyia quasitownsendi–Lutzomyia torvida pair. COI sequences were also evaluated as a taxonomic tool based on interspecific genetic variability within the Verrucarum group and the intraspecific variability of one of its members, Lutzomyia verrucarum, across its known distribution. PMID:21633028

Zebrafish foxP2 Zinc Finger Nuclease Mutant Has Normal Axon Pathfinding

PubMed Central

Xing, Lingyan; Hoshijima, Kazuyuki; Grunwald, David J.; Fujimoto, Esther; Quist, Tyler S.; Sneddon, Jacob; Chien, Chi-Bin; Stevenson, Tamara J.; Bonkowsky, Joshua L.

2012-01-01

foxP2, a forkhead-domain transcription factor, is critical for speech and language development in humans, but its role in the establishment of CNS connectivity is unclear. While in vitro studies have identified axon guidance molecules as targets of foxP2 regulation, and cell culture assays suggest a role for foxP2 in neurite outgrowth, in vivo studies have been lacking regarding a role for foxP2 in axon pathfinding. We used a modified zinc finger nuclease methodology to generate mutations in the zebrafish foxP2 gene. Using PCR-based high resolution melt curve analysis (HRMA) of G0 founder animals, we screened and identified three mutants carrying nonsense mutations in the 2nd coding exon: a 17 base-pair (bp) deletion, an 8bp deletion, and a 4bp insertion. Sequence analysis of cDNA confirmed that these were frameshift mutations with predicted early protein truncations. Homozygous mutant fish were viable and fertile, with unchanged body morphology, and no apparent differences in CNS apoptosis, proliferation, or patterning at embryonic stages. There was a reduction in expression of the known foxP2 target gene cntnap2 that was rescued by injection of wild-type foxP2 transcript. When we examined axon pathfinding using a pan-axonal marker or transgenic lines, including a foxP2-neuron-specific enhancer, we did not observe any axon guidance errors. Our findings suggest that foxP2 is not necessary for axon pathfinding during development. PMID:22937139

Zebrafish foxP2 zinc finger nuclease mutant has normal axon pathfinding.

PubMed

Xing, Lingyan; Hoshijima, Kazuyuki; Grunwald, David J; Fujimoto, Esther; Quist, Tyler S; Sneddon, Jacob; Chien, Chi-Bin; Stevenson, Tamara J; Bonkowsky, Joshua L

2012-01-01

foxP2, a forkhead-domain transcription factor, is critical for speech and language development in humans, but its role in the establishment of CNS connectivity is unclear. While in vitro studies have identified axon guidance molecules as targets of foxP2 regulation, and cell culture assays suggest a role for foxP2 in neurite outgrowth, in vivo studies have been lacking regarding a role for foxP2 in axon pathfinding. We used a modified zinc finger nuclease methodology to generate mutations in the zebrafish foxP2 gene. Using PCR-based high resolution melt curve analysis (HRMA) of G0 founder animals, we screened and identified three mutants carrying nonsense mutations in the 2(nd) coding exon: a 17 base-pair (bp) deletion, an 8bp deletion, and a 4bp insertion. Sequence analysis of cDNA confirmed that these were frameshift mutations with predicted early protein truncations. Homozygous mutant fish were viable and fertile, with unchanged body morphology, and no apparent differences in CNS apoptosis, proliferation, or patterning at embryonic stages. There was a reduction in expression of the known foxP2 target gene cntnap2 that was rescued by injection of wild-type foxP2 transcript. When we examined axon pathfinding using a pan-axonal marker or transgenic lines, including a foxP2-neuron-specific enhancer, we did not observe any axon guidance errors. Our findings suggest that foxP2 is not necessary for axon pathfinding during development.

FMRFamide-related peptides in potato cyst nematodes.

PubMed

Kimber, M J; Fleming, C C; Bjourson, A J; Halton, D W; Maule, A G

2001-09-03

This study presents data demonstrating the presence of FMRFamide-related peptides (FaRPs) in potato cyst nematodes (PCN). Five transcripts of FaRP encoding genes, designated gpflp-1 to gpflp-5, were characterised using RACE. In terms of ORFs, gpflp-1 was 444 base pairs (bp) long and coded for four copies of the FaRP, PF3 (KSAYMRFamide) whilst gpflp-2 was 309 bp long and encoded one copy of the peptide, KNKFEFIRFamide. gpflp-3 (420 bp) Encoded two copies of KHEYLRFamide (AF2) and the genes gpflp-4 and gpflp-5 encoded a total of 11 FaRPs, most of which are novel to PCN. FMRFamide-related peptide (FaRP)-like immunoreactivity was observed in both PCN species, Globodera pallida and Globodera rostochiensis, using an antiserum raised against the invertebrate peptide, FMRFamide. Immunopositive neurones were found throughout the central nervous system in the ventral and dorsal nerve cords and the circumpharyngeal and perianal nerve rings. Reactive neurones were also present peripherally, innervating the highly muscular pharynx with a nerve net and ring-like structures. Positive immunostaining was also observed in neurones running toward the stylet protractor muscles and/or the anterior sensory apparatus. This study implicates a role for FaRPs in feeding, host penetration and sensory function of PCN. This is the first study to characterise FaRP encoding genes from a plant-parasitic nematode using a targeted PCR based RACE approach and further underlines the importance and diversity of this neuropeptide group in the phylum Nematoda.

Modularization and epistatic hierarchy determine homeostatic actions of multiple blood pressure quantitative trait loci.

PubMed

Chauvet, Cristina; Crespo, Kimberley; Ménard, Annie; Roy, Julie; Deng, Alan Y

2013-11-15

Hypertension, the most frequently diagnosed clinical condition world-wide, predisposes individuals to morbidity and mortality, yet its underlying pathological etiologies are poorly understood. So far, a large number of quantitative trait loci (QTLs) have been identified in both humans and animal models, but how they function together in determining overall blood pressure (BP) in physiological settings is unknown. Here, we systematically and comprehensively performed pair-wise comparisons of individual QTLs to create a global picture of their functionality in an inbred rat model. Rather than each of numerous QTLs contributing to infinitesimal BP increments, a modularized pattern arises: two epistatic 'blocks' constitute basic functional 'units' for nearly all QTLs, designated as epistatic module 1 (EM1) and EM2. This modularization dictates the magnitude and scope of BP effects. Any EM1 member can contribute to BP additively to that of EM2, but not to those of the same module. Members of each EM display epistatic hierarchy, which seems to reflect a related functional pathway. Rat homologues of 11 human BP QTLs belong to either EM1 or EM2. Unique insights emerge into the novel genetic mechanism and hierarchy determining BP in the Dahl salt-sensitive SS/Jr (DSS) rat model that implicate a portion of human QTLs. Elucidating the pathways underlying EM1 and EM2 may reveal the genetic regulation of BP.

The presence of codon-anticodon pairs in the acceptor stem of tRNAs.

PubMed Central

Rodin, S; Rodin, A; Ohno, S

1996-01-01

A total of 1268 available (excluding mitochondrial) tRNA sequences was used to reconstruct the common consensus image of their acceptor domains. Its structure appeared as a 11-bp-long double-stranded palindrome with complementary triplets in the center, each flanked by the 3'-ACCD and NGGU-5' motifs on each strand (D, base determinator). The palindrome readily extends up to the modern tRNA-like cloverleaf passing through an intermediate hairpin having in the center the single-stranded triplet, in supplement to its double-stranded precursor. The latter might represent an original anticodon-codon pair mapped at 1-2-3 positions of the present-day tRNA acceptors. This conclusion is supported by the striking correlation: in pairs of consensus tRNAs with complementary anticodons, their bases at the 2nd position of the acceptor stem were also complementary. Accordingly, inverse complementarity was also evident at the 71st position of the acceptor stem. With a single exception (tRNA(Phe)-tRNA(Glu) pair), the parallelism is especially impressive for the pairs of tRNAs recognized by aminoacyl-tRNA synthetases (aaRS) from the opposite classes. The above complementarity still doubly presented at the key central position of real single-stranded anticodons and their hypothetical double-stranded precursors is consistent with our previous data pointing to the double-strand use of ancient RNAs in the origin of the main actors in translation- tRNAs with complementary anticodons and the two classes of aaRS. Images Fig. 3 Table 2 Fig. 4 PMID:8643439

DYZ1 arrays show sequence variation between the monozygotic males

PubMed Central

2014-01-01

Background Monozygotic twins (MZT) are an important resource for genetical studies in the context of normal and diseased genomes. In the present study we used DYZ1, a satellite fraction present in the form of tandem arrays on the long arm of the human Y chromosome, as a tool to uncover sequence variations between the monozygotic males. Results We detected copy number variation, frequent insertions and deletions within the sequences of DYZ1 arrays amongst all the three sets of twins used in the present study. MZT1b showed loss of 35 bp compared to that in 1a, whereas 2a showed loss of 31 bp compared to that in 2b. Similarly, 3b showed 10 bp insertion compared to that in 3a. MZT1a germline DNA showed loss of 5 bp and 1b blood DNA showed loss of 26 bp compared to that of 1a blood and 1b germline DNA, respectively. Of the 69 restriction sites detected in DYZ1 arrays, MboII, BsrI, TspEI and TaqI enzymes showed frequent loss and or gain amongst all the 3 pairs studied. MZT1 pair showed loss/gain of VspI, BsrDI, AgsI, PleI, TspDTI, TspEI, TfiI and TaqI restriction sites in both blood and germline DNA. All the three sets of MZT showed differences in the number of DYZ1 copies. FISH signals reflected somatic mosaicism of the DYZ1 copies across the cells. Conclusions DYZ1 showed both sequence and copy number variation between the MZT males. Sequence variation was also noticed between germline and blood DNA samples of the same individual as we observed at least in one set of sample. The result suggests that DYZ1 faithfully records all the genetical changes occurring after the twining which may be ascribed to the environmental factors. PMID:24495361

Completion of the mitochondrial genome sequence of onion (Allium cepa L.) containing the CMS-S male-sterile cytoplasm and identification of an independent event of the ccmF N gene split.

PubMed

Kim, Bongju; Kim, Kyunghee; Yang, Tae-Jin; Kim, Sunggil

2016-11-01

Cytoplasmic male-sterility (CMS) conferred by the CMS-S cytoplasm has been most commonly used for onion (Allium cepa L.) F 1 hybrid seed production. We first report the complete mitochondrial genome sequence containing CMS-S cytoplasm in this study. Initially, seven contigs were de novo assembled from 150-bp paired-end raw reads produced from the total genomic DNA using the Illumina NextSeq500 platform. These contigs were connected into a single circular genome consisting of 316,363 bp (GenBank accession: KU318712) by PCR amplification. Although all 24 core protein-coding genes were present, no ribosomal protein-coding genes, except rps12, were identified in the onion mitochondrial genome. Unusual trans-splicing of the cox2 gene was verified, and the cox1 gene was identified as part of the chimeric orf725 gene, which is a candidate gene responsible for inducing CMS. In addition to orf725, two small chimeric genes were identified, but no transcripts were detected for these two open reading frames. Thirteen chloroplast-derived sequences, with sizes of 126-13,986 bp, were identified in the intergenic regions. Almost 10 % of the onion mitochondrial genome was composed of repeat sequences. The vast majority of repeats were short repeats of <100 base pairs. Interestingly, the gene encoding ccmF N was split into two genes. The ccmF N gene split is first identified outside the Brassicaceae family. The breakpoint in the onion ccmF N gene was different from that of other Brassicaceae species. This split of the ccmF N gene was also present in 30 other Allium species. The complete onion mitochondrial genome sequence reported in this study would be fundamental information for elucidation of onion CMS evolution.

Extending the spectrum of DNA sequences retrieved from ancient bones and teeth

PubMed Central

Glocke, Isabelle; Meyer, Matthias

2017-01-01

The number of DNA fragments surviving in ancient bones and teeth is known to decrease with fragment length. Recent genetic analyses of Middle Pleistocene remains have shown that the recovery of extremely short fragments can prove critical for successful retrieval of sequence information from particularly degraded ancient biological material. Current sample preparation techniques, however, are not optimized to recover DNA sequences from fragments shorter than ∼35 base pairs (bp). Here, we show that much shorter DNA fragments are present in ancient skeletal remains but lost during DNA extraction. We present a refined silica-based DNA extraction method that not only enables efficient recovery of molecules as short as 25 bp but also doubles the yield of sequences from longer fragments due to improved recovery of molecules with single-strand breaks. Furthermore, we present strategies for monitoring inefficiencies in library preparation that may result from co-extraction of inhibitory substances during DNA extraction. The combination of DNA extraction and library preparation techniques described here substantially increases the yield of DNA sequences from ancient remains and provides access to a yet unexploited source of highly degraded DNA fragments. Our work may thus open the door for genetic analyses on even older material. PMID:28408382

De novo transcriptome assembly of 'Angeleno' and 'Lamoon' Japanese plum cultivars (Prunus salicina).

PubMed

González, Máximo; Maldonado, Jonathan; Salazar, Erika; Silva, Herman; Carrasco, Basilio

2016-09-01

Japanese plum (Prunus salicina L.) is a fruit tree of the Rosaceae family, which is an economically important stone fruit around the world. Currently, Japanese plum breeding programs combine traditional breeding and plant physiology strategies with genetic and genomic analysis. In order to understand the flavonoid pathway regulation and to develop molecular markers associated to the fuit skin color (EST-SSRs), we performed a next generation sequencing based on Illumina Hiseq2000 platform. A total of 22.4 GB and 21 GB raw data were obtained from 'Lamoon' and 'Angeleno' respectively, corresponding to 85,404,726 raw reads to 'Lamoon' and 79,781,666 to 'Angeleno'. A total of 139,775,975 reads were filtered after removing low-quality reads and trimming the adapter sequences. De novo transcriptome assembly was performed using CLC Genome Workbench software and a total of 54,584 unique contigs were generated, with an N50 of 1343 base pair (bp) and a mean length of 829 bp. This work contributed with a specific Japanese plum skin transcriptome, providing two libraries of contrasting fruit skin color phenotype (yellow and red) and increasing substantially the GB of raw data available until now for this specie.

Molecular recognition of thiaclopride by Aplysia californica AChBP: new insights from a computational investigation

NASA Astrophysics Data System (ADS)

Alamiddine, Zakaria; Selvam, Balaji; Cerón-Carrasco, José P.; Mathé-Allainmat, Monique; Lebreton, Jacques; Thany, Steeve H.; Laurent, Adèle D.; Graton, Jérôme; Le Questel, Jean-Yves

2015-12-01

The binding of thiaclopride (THI), a neonicotinoid insecticide, with Aplysia californica acetylcholine binding protein ( Ac-AChBP), the surrogate of the extracellular domain of insects nicotinic acetylcholine receptors, has been studied with a QM/QM' hybrid methodology using the ONIOM approach (M06-2X/6-311G(d):PM6). The contributions of Ac-AChBP key residues for THI binding are accurately quantified from a structural and energetic point of view. The importance of water mediated hydrogen-bond (H-bond) interactions involving two water molecules and Tyr55 and Ser189 residues in the vicinity of the THI nitrile group, is specially highlighted. A larger stabilization energy is obtained with the THI- Ac-AChBP complex compared to imidacloprid (IMI), the forerunner of neonicotinoid insecticides. Pairwise interaction energy calculations rationalize this result with, in particular, a significantly more important contribution of the pivotal aromatic residues Trp147 and Tyr188 with THI through CH···π/CH···O and π-π stacking interactions, respectively. These trends are confirmed through a complementary non-covalent interaction (NCI) analysis of selected THI- Ac-AChBP amino acid pairs.

Validation of the SEJOY BP-1307 upper-arm blood pressure monitor for home blood pressure monitoring according to the European Society of Hypertension International Protocol revision 2010.

PubMed

Lei, Lei; Chen, Yi; Chen, Qi; Li, Yan; Wang, Ji-Guang

2017-12-01

The present study aimed to evaluate the accuracy of the automated oscillometric upper-arm blood pressure monitor SEJOY BP-1307 (also called JOYTECH DBP-1307) for home blood pressure monitoring according to the International Protocol of the European Society of Hypertension revision 2010. Systolic and diastolic blood pressures were sequentially measured in 33 adult Chinese individuals (13 women, 45.1 years of mean age) using a mercury sphygmomanometer (two observers) and the SEJOY BP-1307 device (one supervisor). Ninety-nine pairs of comparisons were obtained from 33 participants for judgments in two parts with three grading phases. The average±SD of the device-observer differences was 0.2±4.1 and -1.7±4.7 mmHg for systolic and diastolic blood pressure, respectively. The SEJOY BP-1307 device achieved the criteria in both part 1 and part 2 of the validation study. The SEJOY upper-arm blood pressure monitor BP-1307 has passed the requirements of the International Protocol revision 2010, and hence can be recommended for home use in adults.

Improving BP control through electronic communications: an economic evaluation.

PubMed

Fishman, Paul A; Cook, Andrea J; Anderson, Melissa L; Ralston, James D; Catz, Sheryl L; Carrell, David; Carlson, James; Green, Beverly B

2013-09-01

Web-based collaborative approaches to managing chronic illness show promise for both improving health outcomes and increasing the efficiency of the healthcare system. Analyze the cost-effectiveness of the Electronic Communications and Home Blood Pressure Monitoring to Improve Blood Pressure Control (e-BP) study, a randomized controlled trial that used a patient-shared electronic medical record, home blood pressure (BP) monitoring, and web-based pharmacist care to improve BP control (<140/90 mm Hg). Incremental cost-effectiveness analysis conducted from a health plan perspective. Cost-effectiveness of home BP monitoring and web-based pharmacist care estimated for percent change in patients with controlled BP and cost per mm Hg in diastolic and systolic BP relative to usual care and home BP monitoring alone. A 1% improvement in number of patients with controlled BP using home BP monitoring and web-based pharmacist care-the e-BP program-costs $16.65 (95% confidence interval: 15.37- 17.94) relative to home BP monitoring and web training alone. Each mm HG reduction in systolic and diastolic BP achieved through the e-BP program costs $65.29 (59.91-70.67) relativeto home BP monitoring and web tools only. Life expectancy was increased at an incremental cost of $1850 (1635-2064) and $2220 (1745-2694) per year of life saved for men and women, respectively. Web-based collaborative care can be used to achieve BP control at a relatively low cost. Future research should examine the cost impact of potential long-term clinical improvements.

Application of myostatin in sheep breeding programs: A review

PubMed Central

Miar, Younes; Salehi, Abdolreza; Kolbehdari, Davood; Aleyasin, Seyed Ahmad

2014-01-01

Plasma membrane H+-ATPase is a major integral membrane protein with a role in various physiological processes including abiotic stress response. To study the effect of NaCl on the expression pattern of a gene encoding the plasma membrane H+-ATPase, an experiment was carried out in a completely random design with three replications. A pair of specific primers was designed based on the sequence of the gene encoding plasma membrane H+-ATPase in Aeluropus littoralis to amplify a 259 bp fragment from the target gene by PCR. A gene encoding actin was used as reference gene to normalize the expression level of the target gene. A pair of specific primers was designed to amplify a 157 bp fragment from the actin gene by PCR. Plants were treated with different concentrations of NaCl, 0, 50, 100, 150, 200, 250, 500 and 1000 mM, for two days. Our results showed that the expression level of the plasma membrane H+-ATPase gene increased dramatically at 500 mM and then decreased with increasing concentrations of NaCl. The results also indicated that the leaves of plants, were treated with high concentrations of NaCl changed morphologically, but those grown under low concentrations of NaCl as well as the control plants did not show morphological changes in their leaves. Our results suggest a relation between morphological changes of treated plants and the expression level of the plasma membrane H+-ATPase gene in Aeluropus littoralis. PMID:27843975

Comparison between Mt-DNA D-Loop and Cyt B primers for porcine DNA detection in meat products

NASA Astrophysics Data System (ADS)

Hamzah, Azhana; Mutalib, Sahilah Abd.; Babji, Abdul Salam

2013-11-01

This study was conducted to detect the presence of porcine DNA in meat products in the market using conventional polymerase chain reaction (PCR) and commercial PCR-southern hybridization analysis. Porcine DNA detection in meat products was tested due to some issues associated with the adulteration of food products in Malaysia. This is an important issue especially for Halal authentication which is required for some religious practices such as in Islam and Hinduisms. Many techniques have been developed for determining the Halal status of food products. In this paper, mt-DNA D-loop primer and cytochrome (cyt) b were used to detect the presence of porcine DNA in meat products. Positive and negative controls were always present for each batch of extraction. DNA of raw pork meat was used as a positive control while nucleus free water is used as negative control. A pair of oligonucleotide primer was used namely Pork1 and Pork2 which produced amplicon of 531 base pair (bp) in size. While, PCR-southern hybridization was conducted using primers readily supplied by commercial PCR-Southern hybridization and produced amplicon with 276 bp in size. In the present study, demonstrated that none of the samples were contaminated with porcine residuals but selected samples with pork meat were positive. The species-specific PCR amplification yielded excellent results for identification of pork derivatives in food products and it is a potentially reliable and suitable technique in routine food analysis for Halal certification.

Unconventional P-35S sequence identified in genetically modified maize

PubMed Central

Al-Hmoud, Nisreen; Al-Husseini, Nawar; Ibrahim-Alobaide, Mohammed A; Kübler, Eric; Farfoura, Mahmoud; Alobydi, Hytham; Al-Rousan, Hiyam

2014-01-01

The Cauliflower Mosaic Virus 35S promoter sequence, CaMV P-35S, is one of several commonly used genetic targets to detect genetically modified maize and is found in most GMOs. In this research we report the finding of an alternative P-35S sequence and its incidence in GM maize marketed in Jordan. The primer pair normally used to amplify a 123 bp DNA fragment of the CaMV P-35S promoter in GMOs also amplified a previously undetected alternative sequence of CaMV P-35S in GM maize samples which we term V3. The amplified V3 sequence comprises 386 base pairs and was not found in the standard wild-type maize, MON810 and MON 863 GM maize. The identified GM maize samples carrying the V3 sequence were found free of CaMV when compared with CaMV infected brown mustard sample. The data of sequence alignment analysis of the V3 genetic element showed 90% similarity with the matching P-35S sequence of the cauliflower mosaic virus isolate CabbB-JI and 99% similarity with matching P-35S sequences found in several binary plant vectors, of which the binary vector locus JQ693018 is one example. The current study showed an increase of 44% in the incidence of the identified 386 bp sequence in GM maize sold in Jordan’s markets during the period 2009 and 2012. PMID:24495911

Ocular manifestations of sickle cell disease and genetic susceptibility for refractive errors

PubMed Central

Shukla, Palak; Verma, Henu; Patel, Santosh; Patra, P. K.; Bhaskar, L. V. K. S.

2017-01-01

PURPOSE: Sickle cell disease (SCD) is the most common and serious form of an inherited blood disorder that lead to higher risk of early mortality. SCD patients are at high risk for developing multiorgan acute and chronic complications linked with significant morbidity and mortality. Some of the ophthalmological complications of SCD include retinal changes, refractive errors, vitreous hemorrhage, and abnormalities of the cornea. MATERIALS AND METHODS: The present study includes 96 SCD patients. A dilated comprehensive eye examination was performed to know the status of retinopathy. Refractive errors were measured in all patients. In patients with >10 years of age, cycloplegia was not performed before autorefractometry. A subset of fifty patients’ genotyping was done for NOS3 27-base pair (bp) variable number of tandem repeat (VNTR) and IL4 intron-3 VNTR polymorphisms using polymerase chain reaction-electrophoresis. Chi-square test was performed to test the association between the polymorphisms and refractive errors. RESULTS: The results of the present study revealed that 63.5% of patients have myopia followed by 19.8% hyperopia. NOS3 27-bp VNTR genotypes significantly deviated from Hardy–Weinberg equilibrium (P < 0.0001). Although IL4 70-bp VNTR increased the risk of developing refractive errors, it is not statistically significant. However, NOS3 27-bp VNTR significantly reduced the risk of development of myopia. CONCLUSION: In summary, our study documents the prevalence of refractive errors along with some retinal changes in Indian SCD patients. Further, this study demonstrates that the NOS3 VNTR contributes to the susceptibility to development of myopia in SCD cases. PMID:29018763

Long-range correlation properties of coding and noncoding DNA sequences: GenBank analysis.

PubMed

Buldyrev, S V; Goldberger, A L; Havlin, S; Mantegna, R N; Matsa, M E; Peng, C K; Simons, M; Stanley, H E

1995-05-01

An open question in computational molecular biology is whether long-range correlations are present in both coding and noncoding DNA or only in the latter. To answer this question, we consider all 33301 coding and all 29453 noncoding eukaryotic sequences--each of length larger than 512 base pairs (bp)--in the present release of the GenBank to dtermine whether there is any statistically significant distinction in their long-range correlation properties. Standard fast Fourier transform (FFT) analysis indicates that coding sequences have practically no correlations in the range from 10 bp to 100 bp (spectral exponent beta=0.00 +/- 0.04, where the uncertainty is two standard deviations). In contrast, for noncoding sequences, the average value of the spectral exponent beta is positive (0.16 +/- 0.05) which unambiguously shows the presence of long-range correlations. We also separately analyze the 874 coding and the 1157 noncoding sequences that have more than 4096 bp and find a larger region of power-law behavior. We calculate the probability that these two data sets (coding and noncoding) were drawn from the same distribution and we find that it is less than 10(-10). We obtain independent confirmation of these findings using the method of detrended fluctuation analysis (DFA), which is designed to treat sequences with statistical heterogeneity, such as DNA's known mosaic structure ("patchiness") arising from the nonstationarity of nucleotide concentration. The near-perfect agreement between the two independent analysis methods, FFT and DFA, increases the confidence in the reliability of our conclusion.

Long-range correlation properties of coding and noncoding DNA sequences: GenBank analysis

NASA Technical Reports Server (NTRS)

Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Mantegna, R. N.; Matsa, M. E.; Peng, C. K.; Simons, M.; Stanley, H. E.

1995-01-01

An open question in computational molecular biology is whether long-range correlations are present in both coding and noncoding DNA or only in the latter. To answer this question, we consider all 33301 coding and all 29453 noncoding eukaryotic sequences--each of length larger than 512 base pairs (bp)--in the present release of the GenBank to dtermine whether there is any statistically significant distinction in their long-range correlation properties. Standard fast Fourier transform (FFT) analysis indicates that coding sequences have practically no correlations in the range from 10 bp to 100 bp (spectral exponent beta=0.00 +/- 0.04, where the uncertainty is two standard deviations). In contrast, for noncoding sequences, the average value of the spectral exponent beta is positive (0.16 +/- 0.05) which unambiguously shows the presence of long-range correlations. We also separately analyze the 874 coding and the 1157 noncoding sequences that have more than 4096 bp and find a larger region of power-law behavior. We calculate the probability that these two data sets (coding and noncoding) were drawn from the same distribution and we find that it is less than 10(-10). We obtain independent confirmation of these findings using the method of detrended fluctuation analysis (DFA), which is designed to treat sequences with statistical heterogeneity, such as DNA's known mosaic structure ("patchiness") arising from the nonstationarity of nucleotide concentration. The near-perfect agreement between the two independent analysis methods, FFT and DFA, increases the confidence in the reliability of our conclusion.

Ocular manifestations of sickle cell disease and genetic susceptibility for refractive errors.

PubMed

Shukla, Palak; Verma, Henu; Patel, Santosh; Patra, P K; Bhaskar, L V K S

2017-01-01

Sickle cell disease (SCD) is the most common and serious form of an inherited blood disorder that lead to higher risk of early mortality. SCD patients are at high risk for developing multiorgan acute and chronic complications linked with significant morbidity and mortality. Some of the ophthalmological complications of SCD include retinal changes, refractive errors, vitreous hemorrhage, and abnormalities of the cornea. The present study includes 96 SCD patients. A dilated comprehensive eye examination was performed to know the status of retinopathy. Refractive errors were measured in all patients. In patients with >10 years of age, cycloplegia was not performed before autorefractometry. A subset of fifty patients' genotyping was done for NOS3 27-base pair (bp) variable number of tandem repeat (VNTR) and IL4 intron-3 VNTR polymorphisms using polymerase chain reaction-electrophoresis. Chi-square test was performed to test the association between the polymorphisms and refractive errors. The results of the present study revealed that 63.5% of patients have myopia followed by 19.8% hyperopia. NOS3 27-bp VNTR genotypes significantly deviated from Hardy-Weinberg equilibrium ( P < 0.0001). Although IL4 70-bp VNTR increased the risk of developing refractive errors, it is not statistically significant. However, NOS3 27-bp VNTR significantly reduced the risk of development of myopia. In summary, our study documents the prevalence of refractive errors along with some retinal changes in Indian SCD patients. Further, this study demonstrates that the NOS3 VNTR contributes to the susceptibility to development of myopia in SCD cases.

Molecular and functional characterization of the promoter of ETS2, the human c-ets-2 gene.

PubMed Central

Mavrothalassitis, G J; Watson, D K; Papas, T S

1990-01-01

The 5' end of the human c-ets-2 gene, ETS2, was cloned and characterized. The major transcription initiation start sites were identified, and the pertinent sequences surrounding the ETS2 promoter were determined. The promoter region of ETS2 does not possess typical "TATA" and "CAAT" elements. However, this promoter contains several repeat regions, as well as two consensus AP2 binding sites and three putative Sp1 sites. There is also a palindromic region similar to the serum response element of the c-fos gene, located 1400 base pairs (bp) upstream from the first major transcription initiation site. A G + C-rich sequence (GC element) with dyad symmetry can be seen in the ETS2 promoter, immediately following an unusually long (approximately 250-bp) polypurine-polypyrimidine tract. A series of deletion fragments from the putative promoter region were ligated in front of the bacterial chloramphenicol acetyltransferase gene and tested for activity following transfection into HeLa cells. The 5' boundary of the region needed for maximum promoter activity was found to be 159 bp upstream of the major initiation site. This region of 159 bp contains putative binding sites for transcription factors Sp1 and AP2 (one for each), the GC element, one small forward repeat, one inverted repeat, and half of the polypurine-pyrimidine tract. The promoter of ETS2 (within the polypyrimidine tract) serves to illustrate an alternative structure that may be present in genes with "TATA-less" promoters. Images PMID:2405393

Transcriptome analysis of the couch potato (CPO) protein reveals an expression pattern associated with early development in the salmon louse Caligus rogercresseyi.

PubMed

Gallardo-Escárate, Cristian; Valenzuela-Muñoz, Valentina; Nuñez-Acuña, Gustavo; Chávez-Mardones, Jacqueline; Maldonado-Aguayo, Waleska

2014-02-15

The couch potato (CPO) protein is a key biomolecule involved in regulating diapause through the RNA-binding process of the peripheral and central nervous systems in insects and also recently discovered in a few crustacean species. As such, ectoparasitic copepods are interesting model species that have no evidence of developmental arrest. The present study is the first to report on the cloning of a putative CPO gene from the salmon louse Caligus rogercresseyi (CrCPO), as identified by high-throughput transcriptome sequencing. In addition, the transcription expression in larvae and adults was evaluated using quantitative real-time PCR. The CrCPO cDNA sequence showed 3261 base pairs (bp), consisting of 713bp of 5' UTR, 1741bp of 3' UTR, and an open reading frame of 807bp encoding for 268 amino acids. The highly conserved RNA binding regions RNP2 (LFVSGL) and RNP1 (SPVGFVTF), as well the dimerization site (LEF), were also found. Furthermore, eight single nucleotide polymorphisms located in the untranslated regions and one located in the coding region were detected. Gene transcription analysis revealed that CrCPO has ubiquitous expression across larval stages and in adult individuals, with the highest expression from nauplius to copepodid stages. The present study suggests a putative biological function of CrCPO associated with the development of the nervous system in salmon lice and contributes molecular evidence for candidate genes related to host-parasite interactions. Copyright © 2013 Elsevier B.V. All rights reserved.

Diagnosis of Xeroderma Pigmentosum Groups A and C by Detection of Two Prevalent Mutations in West Algerian Population: A Rapid Genotyping Tool for the Frequent XPC Mutation c.1643_1644delTG

PubMed Central

Bensenouci, Salima; Louhibi, Lotfi; De Verneuil, Hubert; Mahmoudi, Khadidja; Saidi-Mehtar, Nadhira

2016-01-01

Xeroderma pigmentosum (XP) is a rare autosomal recessive disorder. Considering that XP patients have a defect of the nucleotide excision repair (NER) pathway which enables them to repair DNA damage caused by UV light, they have an increased risk of developing skin and eyes cancers. In the present study, we investigated the involvement of the prevalent XPA and XPC genes mutations—nonsense mutation (c.682C>T, p.Arg228X) and a two-base-pair (2 bp) deletion (c.1643_1644delTG or p.Val548Ala fsX25), respectively—in 19 index cases from 19 unrelated families in the West of Algeria. For the genetic diagnosis of XPA gene, we proceeded to PCR-RFLP. For the XPC gene, we validated a routine analysis which includes a specific amplification of a short region surrounding the 2 bp deletion using a fluorescent primer and fragment sizing (GeneScan size) on a sequencing gel. Among the 19 index cases, there were 17 homozygous patients for the 2 bp deletion in the XPC gene and 2 homozygous patients carrying the nonsense XPA mutation. Finally, XPC appears to be the major disease-causing gene concerning xeroderma pigmentosum in North Africa. The use of fragment sizing is the simplest method to analyze this 2 bp deletion for the DNA samples coming from countries where the mutation c.1643_1644delTG of XPC gene is prevalent. PMID:27413738

Diagnosis of Xeroderma Pigmentosum Groups A and C by Detection of Two Prevalent Mutations in West Algerian Population: A Rapid Genotyping Tool for the Frequent XPC Mutation c.1643_1644delTG.

PubMed

Bensenouci, Salima; Louhibi, Lotfi; De Verneuil, Hubert; Mahmoudi, Khadidja; Saidi-Mehtar, Nadhira

2016-01-01

Xeroderma pigmentosum (XP) is a rare autosomal recessive disorder. Considering that XP patients have a defect of the nucleotide excision repair (NER) pathway which enables them to repair DNA damage caused by UV light, they have an increased risk of developing skin and eyes cancers. In the present study, we investigated the involvement of the prevalent XPA and XPC genes mutations-nonsense mutation (c.682C>T, p.Arg228X) and a two-base-pair (2 bp) deletion (c.1643_1644delTG or p.Val548Ala fsX25), respectively-in 19 index cases from 19 unrelated families in the West of Algeria. For the genetic diagnosis of XPA gene, we proceeded to PCR-RFLP. For the XPC gene, we validated a routine analysis which includes a specific amplification of a short region surrounding the 2 bp deletion using a fluorescent primer and fragment sizing (GeneScan size) on a sequencing gel. Among the 19 index cases, there were 17 homozygous patients for the 2 bp deletion in the XPC gene and 2 homozygous patients carrying the nonsense XPA mutation. Finally, XPC appears to be the major disease-causing gene concerning xeroderma pigmentosum in North Africa. The use of fragment sizing is the simplest method to analyze this 2 bp deletion for the DNA samples coming from countries where the mutation c.1643_1644delTG of XPC gene is prevalent.

Complete chloroplast genome sequence of a major invasive species, crofton weed (Ageratina adenophora).

PubMed

Nie, Xiaojun; Lv, Shuzuo; Zhang, Yingxin; Du, Xianghong; Wang, Le; Biradar, Siddanagouda S; Tan, Xiufang; Wan, Fanghao; Weining, Song

2012-01-01

Crofton weed (Ageratina adenophora) is one of the most hazardous invasive plant species, which causes serious economic losses and environmental damages worldwide. However, the sequence resource and genome information of A. adenophora are rather limited, making phylogenetic identification and evolutionary studies very difficult. Here, we report the complete sequence of the A. adenophora chloroplast (cp) genome based on Illumina sequencing. The A. adenophora cp genome is 150, 689 bp in length including a small single-copy (SSC) region of 18, 358 bp and a large single-copy (LSC) region of 84, 815 bp separated by a pair of inverted repeats (IRs) of 23, 755 bp. The genome contains 130 unique genes and 18 duplicated in the IR regions, with the gene content and organization similar to other Asteraceae cp genomes. Comparative analysis identified five DNA regions (ndhD-ccsA, psbI-trnS, ndhF-ycf1, ndhI-ndhG and atpA-trnR) containing parsimony-informative characters higher than 2%, which may be potential informative markers for barcoding and phylogenetic analysis. Repeat structure, codon usage and contraction of the IR were also investigated to reveal the pattern of evolution. Phylogenetic analysis demonstrated a sister relationship between A. adenophora and Guizotia abyssinica and supported a monophyly of the Asterales. We have assembled and analyzed the chloroplast genome of A. adenophora in this study, which was the first sequenced plastome in the Eupatorieae tribe. The complete chloroplast genome information is useful for plant phylogenetic and evolutionary studies within this invasive species and also within the Asteraceae family.

Linking clinic and home: a randomized, controlled clinical effectiveness trial of real-time, wireless blood pressure monitoring for older patients with kidney disease and hypertension.

PubMed

Rifkin, Dena E; Abdelmalek, Joseph A; Miracle, Cynthia M; Low, Chai; Barsotti, Ryan; Rios, Phil; Stepnowsky, Carl; Agha, Zia

2013-02-01

Older adults with chronic kidney disease have a high rate of uncontrolled hypertension. Home monitoring of blood pressure (BP) is an integral part of management, but requires that patients bring records to clinic visits. Telemonitoring interventions, however, have not targeted older, less technologically-skilled populations. Veterans with stage 3 or greater chronic kidney disease and uncontrolled hypertension were randomized to a novel telemonitoring device pairing a Bluetooth-enabled BP cuff with an Internet-enabled hub, which wirelessly transmitted readings (n=28), or usual care (n=15). Home recordings were reviewed weekly and telemonitoring participants were contacted if BP was above goal. The prespecified primary endpoints were improved data exchange and device acceptability. Secondary endpoint was BP change. Forty-three participants (average age 68 years, 75% white) completed the 6-month study. Average start-of-study BP was 147/78 mmHg. Those in the intervention arm had a median of 29 (IQR 22, 53) transmitted BP readings per month, with 78% continuing to use the device regularly, whereas only 20% of those in the usual care group brought readings to in-person visits. The median number of telephone contacts triggered by the wireless monitoring was 2 (IQR 1, 4) per patient. Both groups had a significant improvement in systolic BP (P<0.05, for both changes); systolic BP fell a median of 13 mmHg in monitored participants compared with 8.5 mmHg in usual care participants (P for comparison 0.31). This low-cost wireless monitoring strategy led to greater sharing of data between patients and clinic and produced a trend toward improvements in BP control over usual care at 6 months.

RanBP9 at the intersection between cofilin and Aβ pathologies: rescue of neurodegenerative changes by RanBP9 reduction.

PubMed

Woo, J A; Boggess, T; Uhlar, C; Wang, X; Khan, H; Cappos, G; Joly-Amado, A; De Narvaez, E; Majid, S; Minamide, L S; Bamburg, J R; Morgan, D; Weeber, E; Kang, D E

2015-03-05

Molecular pathways underlying the neurotoxicity and production of amyloid β protein (Aβ) represent potentially promising therapeutic targets for Alzheimer's disease (AD). We recently found that overexpression of the scaffolding protein RanBP9 increases Aβ production in cell lines and in transgenic mice while promoting cofilin activation and mitochondrial dysfunction. Translocation of cofilin to mitochondria and induction of cofilin-actin pathology require the activation/dephosphorylation of cofilin by Slingshot homolog 1 (SSH1) and cysteine oxidation of cofilin. In this study, we found that endogenous RanBP9 positively regulates SSH1 levels and mediates Aβ-induced translocation of cofilin to mitochondria and induction of cofilin-actin pathology in cultured cells, primary neurons, and in vivo. Endogenous level of RanBP9 was also required for Aβ-induced collapse of growth cones in immature neurons (days in vitro 9 (DIV9)) and depletion of synaptic proteins in mature neurons (DIV21). In vivo, amyloid precursor protein (APP)/presenilin-1 (PS1) mice exhibited 3.5-fold increased RanBP9 levels, and RanBP9 reduction protected against cofilin-actin pathology, synaptic damage, gliosis, and Aβ accumulation associated with APP/PS1 mice. Brains slices derived from APP/PS1 mice showed significantly impaired long-term potentiation (LTP), and RanBP9 reduction significantly enhanced paired pulse facilitation and LTP, as well as partially rescued contextual memory deficits associated with APP/PS1 mice. Therefore, these results underscore the critical importance of endogenous RanBP9 not only in Aβ accumulation but also in mediating the neurotoxic actions of Aβ at the level of synaptic plasticity, mitochondria, and cofilin-actin pathology via control of the SSH1-cofilin pathway in vivo.

Accuracy of the WatchBP office ABI device for office blood pressure measurement over a wide range of arm sizes.

PubMed

Palatini, Paolo; Fania, Claudio; Gasparotti, Federica

2018-04-01

The aim of this study was to determine the accuracy of the WatchBP Office ABI monitor for office blood pressure measurement over a wide range of arm circumferences using the ANSI/AAMI/ISO 81060-2:2013 protocol. The device accuracy was tested in 88 participants whose mean±SD age was 54.5±17.6 years, whose arm circumference was 30.6±8.3 cm (range: 15-46 cm), and whose entry blood pressure (BP) was 138.3±23.4 mmHg for systolic and 83.7±14.6 mmHg for diastolic BP. Four cuffs (small, standard, large, and extra-large) suitable for arm circumferences ranging from 14.0 to 52.0 cm were used. The mean device-observer difference in the 264 separate BP data pairs was 0.7±3.8 mmHg for systolic BP and was 0.0±3.7 mmHg for diastolic BP. These data were in agreement with criterion 1 of the ANSI/AAMI/ISO 81060-2:2013 standard requirements (≤5±8 mmHg). Moreover, criterion 2 was satisfied, the mean±SD device-observer difference of the 88 participants being 0.7±3.1 and 0.0±3.2 mmHg, respectively, for systolic and diastolic BP. Good agreement between observer and device was present across the whole range of arm circumferences. These data show that the Microlife WatchBP Office ABI monitor satisfied the ANSI/AAMI/ISO 81060-2:2013 standard requirements across a wide range of arm sizes.

Characterization of the global transcriptome for cotton (Gossypium hirsutum L.) anther and development of SSR marker.

PubMed

Zhang, Xianwen; Ye, Zhenwei; Wang, Tiankang; Xiong, Hairong; Yuan, Xiaoling; Zhang, Zhigang; Yuan, Youlu; Liu, Zhi

2014-11-10

Cotton is an important fiber plant, and it's attractive to elucidate the molecular mechanism of anther development due to the close relationship between the anther fertility and boll-setting, and also fiber yield. In the present paper, 47.2 million paired-end reads with average length of 82.87 bp from the anthers of TM-1 (Gossypium hirsutum L.), a genetic standard line, were generated through transcriptome sequencing, and 210,965 unigenes of more than 100 bp were obtained. BLAST, KEGG, COG, and GO analyses showed that the genes were enriched in the processes of transcription, translation, and post-translation as well as hormone signal transduction, the transcription factor families, and cell wall-related genes mainly participating in cell expansion and carbohydrate metabolism. Further analysis identified 11,153 potential SSRs. A suit of 5122 primer pair sequences were designed, and 82 of 300 randomly selected primer pairs produced reproducible amplicons that were polymorphic among 22 cotton accessions from G. hirsutum, Gossypium barbadense and Gossypium arboreum. The UPGMA clustering analysis further confirmed high quality and effectiveness of these novel SSR markers. The present study provided insights into the transcriptome profile of the cotton and established a public information platform for functional genomics and molecular breeding. Copyright © 2014 Elsevier B.V. All rights reserved.

Validation of the AVITA BPM64 upper-arm blood pressure monitor for home blood pressure monitoring according to the European Society of Hypertension International Protocol revision 2010.

PubMed

Kang, Yuan-Yuan; Chen, Qi; Liu, Chang-Yuan; Li, Yan; Wang, Ji-Guang

2018-02-01

The aim of this study was to evaluate the accuracy of the automated oscillometric upper arm blood pressure (BP) monitor AVITA BPM64 for home BP monitoring according to the International Protocol of the European Society of Hypertension revision 2010. Systolic and diastolic BPs were measured sequentially in 33 adult Chinese (14 women, mean age 47.0 years) using a mercury sphygmomanometer (two observers) and the AVITA BPM64 device (one supervisor). A total of 99 pairs of comparisons were obtained from 33 participants for judgments in two parts with three grading phases. The AVITA BPM64 device achieved the targets in part 1 of the validation study. The number of absolute differences between device and observers within 5, 10, and 15 mmHg was 91/99, 98/99, and 98/99, respectively, for systolic BP and 92/99, 99/99, and 99/99, respectively, for diastolic BP. The device also fulfilled the criteria in part 2 of the validation study. Thirty-two participants for both systolic and diastolic BP had at least two of the three device-observer differences within 5 mmHg (required ≥24). Only one participant for systolic BP had all three device-observer comparisons greater than 5 mmHg. The AVITA upper arm BP monitor BPM64 has passed the requirements of the International Protocol revision 2010, and hence can be recommended for home use in adults.

Comparative studies of the quantification of genetically modified organisms in foods processed from maize and soy using trial producing.

PubMed

Yoshimura, Tomoaki; Kuribara, Hideo; Kodama, Takashi; Yamata, Seiko; Futo, Satoshi; Watanabe, Satoshi; Aoki, Nobutaro; Iizuka, Tayoshi; Akiyama, Hiroshi; Maitani, Tamio; Naito, Shigehiro; Hino, Akihiro

2005-03-23

Seven types of processed foods, namely, cornstarch, cornmeal, corn puffs, corn chips, tofu, soy milk, and boiled beans, were trial produced from 1 and 5% (w/w) genetically modified (GM) mixed raw materials. In this report, insect resistant maize (MON810) and herbicide tolerant soy (Roundup Ready soy, 40-3-2) were used as representatives of GM maize and soy, respectively. Deoxyribonucleic acid (DNA) was extracted from the raw materials and the trial-produced processed food using two types of methods, i.e., the silica membrane method and the anion exchange method. The GM% values of these samples were quantified, and the significant differences between the raw materials and the trial-produced processed foods were statistically confirmed. There were some significant differences in the comparisons of all processed foods. However, our quantitative methods could be applied as a screening assay to tofu and soy milk because the differences in GM% between the trial-produced processed foods and their raw materials were lower than 13 and 23%, respectively. In addition, when quantitating with two primer pairs (SSIIb 3, 114 bp; SSIIb 4, 83 bp for maize and Le1n02, 118 bp; Le1n03, 89 bp for soy), which were targeted within the same taxon specific DNA sequence with different amplicon sizes, the ratios of the copy numbers of the two primer pairs (SSIIb 3/4 and Le1n02/03) decreased with time in a heat-treated processing model using an autoclave. In this report, we suggest that the degradation level of DNA in processed foods could be estimated from these ratios, and the probability of GM quantification could be experimentally predicted from the results of the trial producing.

A significant role of non-thermal equilibrated electrons in the formation of deleterious complex DNA damage.

PubMed

Kai, Takeshi; Yokoya, Akinari; Ukai, Masatoshi; Fujii, Kentaro; Toigawa, Tomohiro; Watanabe, Ritsuko

2018-01-24

Although most of the radiation damage to genomic DNA could be rendered harmless using repair enzymes in a living cell, a certain fraction of the damage is persistent resulting in serious genetic effects, such as mutation induction. In order to understand the mechanisms of the deleterious DNA damage formation in terms of its earliest physical stage at the radiation track end, dynamics of low energy electrons and their thermalization processes around DNA molecules were investigated using a dynamic Monte Carlo code. The primary incident (1 keV) electrons multiply collide within 1 nm (equivalent to three DNA-base-pairs, 3bp) and generate secondary electrons which show non-Gaussian and non-thermal equilibrium distributions within 300 fs. On the other hand, the secondary electrons are mainly distributed within approximately 10 nm from their parent cations although approximately 5% of the electrons are localized within 1 nm of the cations owing to the interaction of their Coulombic fields. The mean electron energy is 0.7 eV; however, more than 10% of the electrons fall into a much lower-energy region than 0.1 eV at 300 fs. These results indicate that pre-hydrated electrons are formed from the extremely decelerated electrons over a few nm from the cations. DNA damage sites comprising multiple nucleobase lesions or single strand breaks can therefore be formed by multiple collisions of these electrons within 3bp. This multiple damage site is hardly processed by base excision repair enzymes. However, pre-hydrated electrons can also be produced resulting in an additional base lesion (or a strand break) more than 3bp away from the multi-damage site. These damage sites may be finally converted into a double strand break (DSB) when base excision enzymes process the additional base lesions. This DSB includes another base lesion(s) at their termini, and may introduce miss-rejoining by DSB repair enzymes, and hence may result in biological effects such as mutation in surviving cells.

Cross-species bacterial artificial chromosome (BAC) library screening via overgo-based hybridization and BAC-contig mapping of a yield enhancement quantitative trait locus (QTL) yld1.1 in the Malaysian wild rice Oryza rufipogon.

PubMed

Song, Beng-Kah; Nadarajah, Kalaivani; Romanov, Michael N; Ratnam, Wickneswari

2005-01-01

The construction of BAC-contig physical maps is an important step towards a partial or ultimate genome sequence analysis. Here, we describe our initial efforts to apply an overgo approach to screen a BAC library of the Malaysian wild rice species, Oryza rufipogon. Overgo design is based on repetitive element masking and sequence uniqueness, and uses short probes (approximately 40 bp), making this method highly efficient and specific. Pairs of 24-bp oligos that contain an 8-bp overlap were developed from the publicly available genomic sequences of the cultivated rice, O. sativa, to generate 20 overgo probes for a 1-Mb region that encompasses a yield enhancement QTL yld1.1 in O. rufipogon. The advantages of a high similarity in melting temperature, hybridization kinetics and specific activities of overgos further enabled a pooling strategy for library screening by filter hybridization. Two pools of ten overgos each were hybridized to high-density filters representing the O. rufipogon genomic BAC library. These screening tests succeeded in providing 69 PCR-verified positive hits from a total of 23,040 BAC clones of the entire O. rufipogon library. A minimal tilling path of clones was generated to contribute to a fully covered BAC-contig map of the targeted 1-Mb region. The developed protocol for overgo design based on O. sativa sequences as a comparative genomic framework, and the pooled overgo hybridization screening technique are suitable means for high-resolution physical mapping and the identification of BAC candidates for sequencing.

Validation of the iHealth BP7 wrist blood pressure monitor, for self-measurement, according to the European Society of Hypertension International Protocol revision 2010.

PubMed

Wang, Qing; Zhao, Huadong; Chen, Wan; Li, Ni; Wan, Yi

2014-02-01

The aim of this study was to validate the iHealth BP7 wireless wrist blood pressure monitor according to the European Society of Hypertension International Protocol (ESH-IP) revision 2010. A total of 99 pairs of test device and reference blood pressure measurements (three pairs for each of the 33 participants) were obtained for validation. The ESH-IP revision 2010 for the validation of blood pressure measuring devices in adults was followed precisely. The device produced 66, 87, and 97 measurements within 5, 10, and 15 mmHg for systolic blood pressure (SBP) and 72, 93, and 99 mmHg for diastolic blood pressure (DBP), respectively. The mean±SD device-observer difference was -0.7±6.9 mmHg for SBP and -1.0±5.1 mmHg for DBP. The number of participants with two or three device-observer differences within 5 mmHg was 25 for SBP and 26 for DBP; furthermore, there were three participants for SBP and one participant for DBP, with none of the device-observer differences within 5 mmHg. On the basis of the validation results, the iHealth BP7 wireless wrist blood pressure monitor can be recommended for self-measurement in an adult population.

Molecular evidence for deep phylogenetic divergence in Mandrillus sphinx.

PubMed

Telfer, P T; Souquière, S; Clifford, S L; Abernethy, K A; Bruford, M W; Disotell, T R; Sterner, K N; Roques, P; Marx, P A; Wickings, E J

2003-07-01

Mandrills (Mandrillus sphinx) are forest primates indigenous to western central Africa. Phylogenetic analysis of 267 base pairs (bp) of the cytochrome b gene from 53 mandrills of known and 17 of unknown provenance revealed two phylogeographical groups, with haplotypes differentiated by 2.6% comprising seven synonymous transitions. The distribution of the haplotypes suggests that the Ogooué River, Gabon, which bisects their range, separates mandrill populations in Cameroon and northern Gabon from those in southern Gabon. The haplotype distribution is also concordant with that of two known mandrill simian immunodeficiency viruses, suggesting that these two mandrill phylogroups have followed different evolutionary trajectories since separation.

DNA lability induced by nimustine and ramustine in rat glioma cells.

PubMed Central

Mineura, K; Fushimi, S; Itoh, Y; Kowada, M

1988-01-01

The DNA labile sites induced by two nitrosoureas, nimustine (ACNU) and ramustine (MCNU) synthesised in Japan, have been examined in highly reiterated DNA sequences of rat glioma cells. Reiterated fragments of 167 and 203 base pairs (bp), obtained after Hind III and Hae III restriction endonuclease digestion of rat glioma cells DNA, were used as target DNA sequences to determine the labile sites. In vitro reaction with ACNU and MCNU resulted in scission products corresponding to the locations of guanine. Subsequent piperidine hydrolysis produced more frequent breaks of the phosphodiester bonds at guanine positions, thus forming alkali-labile sites. Images PMID:3236017

The complete mitochondrial genome of Anoplocnemis curvipes F. (Coreinea, Coreidae, Heteroptera), a pest of fresh cowpea pods

USDA-ARS?s Scientific Manuscript database

The complete 16,345-bp mitochondrial genome of the agriculturally-destructive pod sucking pest, the giant coreid bug, Anoplocnemis curvipes (Hemiptera: Coreidae), was assembled from paired end next generation sequencing reads. The A. curvipes mitochondrial genome consists of 13 protein coding genes...

GM2 Gangliosidosis in Shiba Inu Dogs with an In-Frame Deletion in HEXB.

PubMed

Kolicheski, A; Johnson, G S; Villani, N A; O'Brien, D P; Mhlanga-Mutangadura, T; Wenger, D A; Mikoloski, K; Eagleson, J S; Taylor, J F; Schnabel, R D; Katz, M L

2017-09-01

Consistent with a tentative diagnosis of neuronal ceroid lipofuscinosis (NCL), autofluorescent cytoplasmic storage bodies were found in neurons from the brains of 2 related Shiba Inu dogs with a young-adult onset, progressive neurodegenerative disease. Unexpectedly, no potentially causal NCL-related variants were identified in a whole-genome sequence generated with DNA from 1 of the affected dogs. Instead, the whole-genome sequence contained a homozygous 3 base pair (bp) deletion in a coding region of HEXB. The other affected dog also was homozygous for this 3-bp deletion. Mutations in the human HEXB ortholog cause Sandhoff disease, a type of GM2 gangliosidosis. Thin-layer chromatography confirmed that GM2 ganglioside had accumulated in an affected Shiba Inu brain. Enzymatic analysis confirmed that the GM2 gangliosidosis resulted from a deficiency in the HEXB encoded protein and not from a deficiency in products from HEXA or GM2A, which are known alternative causes of GM2 gangliosidosis. We conclude that the homozygous 3-bp deletion in HEXB is the likely cause of the Shiba Inu neurodegenerative disease and that whole-genome sequencing can lead to the early identification of potentially disease-causing DNA variants thereby refocusing subsequent diagnostic analyses toward confirming or refuting candidate variant causality. Copyright © 2017 The Authors. Journal of Veterinary Internal Medicine published by Wiley Periodicals, Inc. on behalf of the American College of Veterinary Internal Medicine.

Mitochondrial genome of the sweet potato hornworm, Agrius convolvuli (Lepidoptera: Sphingidae), and comparison with other Lepidoptera species.

PubMed

Dai, Li-Shang; Li, Sheng; Yu, Hui-Min; Wei, Guo-Qing; Wang, Lei; Qian, Cen; Zhang, Cong-Fen; Li, Jun; Sun, Yu; Zhao, Yue; Zhu, Bao-Jian; Liu, Chao-Liang

2017-02-01

In the present study, we sequenced the complete mitochondrial genome (mitogenome) of Agrius convolvuli (Lepidoptera: Sphingidae) and compared it with previously sequenced mitogenomes of lepidopteran species. The mitogenome was a circular molecule, 15 349 base pairs (bp) long, containing 37 genes. The order and orientation of genes in the A. convolvuli mitogenome were similar to those in sequenced mitogenomes of other lepidopterans. All 13 protein-coding genes (PCGs) were initiated by ATN codons, except for the cytochrome c oxidase subunit 1 (cox1) gene, which seemed to be initiated by the codon CGA, as observed in other lepidopterans. Three of the 13 PCGs had the incomplete termination codon T, while the remainder terminated with TAA. Additionally, the codon distributions of the 13 PCGs revealed that Asn, Ile, Leu2, Lys, Phe, and Tyr were the most frequently used codon families. All transfer RNAs were folded into the expected cloverleaf structure except for tRNA Ser (AGN), which lacked a stable dihydrouridine arm. The length of the adenine (A) + thymine (T)-rich region was 331 bp. This region included the motif ATAGA followed by a 19-bp poly-T stretch and a microsatellite-like (TA) 8 element next to the motif ATTTA. Phylogenetic analyses (maximum likelihood and Bayesian methods) showed that A. convolvuli belongs to the family Sphingidae.

Complete mitochondrial genomes of three crickets (Orthoptera: Gryllidae) and comparative analyses within Ensifera mitogenomes.

PubMed

Yang, Jing; Ren, Qianli; Huang, Yuan

2016-03-17

The complete mitochondrial genomes (mitogenomes) of Velarifictorus hemelytrus, Loxoblemmus equestris and Teleogryllus emma are 16123 bp, 16314 bp and 15697 bp, in size, respectively. All three mitogenomes possess the same gene order of the inversion of the gene cluster trnE-trnS^(AGN)-trnN compared with the ancestral gene order of Orthoptera. The atypical initiation codon for the cox1 gene in three crickets is TTA. Pronounced A skew and T skew have been found in Grylloidea comparing with Gryllotalpoidea and Tettigonioidea. The T-stretch in the minority strand is interrupted by C to form (T)_n(C)₂(T)_n sequences in five species of Gryllinae (V. hemelytrus, L. equestris, T. emma, T. oceanicus, T. commodus). This T-stretch variant with its neighbouring A-stretch variant (A-stretch is interrupted by G), which were discovered in the A+T-rich regions of all taxa from infraorder Gryllidea, could form a conserved stem-loop structure (including 15 ~ 17 base pairs). This potential stem-loop structure is a favorable candidate that may participate in the replication origin of the minority strand of Gryllidea mitogenome. Phylogenetic analysis indicated that within the Gryllinae, genus Teleogryllus and Velarifictorus are closely related, sister to the genus Loxoblemmus. The relationships among the five superfamilies of Ensifera presented here were ((Grylloidea, Gryllotalpoidea) (Tettigonioidea, (Hagloidea, Rhaphidophoroidea))).

An improved least cost routing approach for WDM optical network without wavelength converters

NASA Astrophysics Data System (ADS)

Bonani, Luiz H.; Forghani-elahabad, Majid

2016-12-01

Routing and wavelength assignment (RWA) problem has been an attractive problem in optical networks, and consequently several algorithms have been proposed in the literature to solve this problem. The most known techniques for the dynamic routing subproblem are fixed routing, fixed-alternate routing, and adaptive routing methods. The first one leads to a high blocking probability (BP) and the last one includes a high computational complexity and requires immense backing from the control and management protocols. The second one suggests a trade-off between performance and complexity, and hence we consider it to improve in our work. In fact, considering the RWA problem in a wavelength routed optical network with no wavelength converter, an improved technique is proposed for the routing subproblem in order to decrease the BP of the network. Based on fixed-alternate approach, the first k shortest paths (SPs) between each node pair is determined. We then rearrange the SPs according to a newly defined cost for the links and paths. Upon arriving a connection request, the sorted paths are consecutively checked for an available wavelength according to the most-used technique. We implement our proposed algorithm and the least-hop fixed-alternate algorithm to show how the rearrangement of SPs contributes to a lower BP in the network. The numerical results demonstrate the efficiency of our proposed algorithm in comparison with the others, considering different number of available wavelengths.

Structure and characterization of a cDNA clone for phenylalanine ammonia-lyase from cut-injured roots of sweet potato

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tanaka, Yoshiyuki; Matsuoka, Makoto; Yamanoto, Naoki

A cDNA clone for phenylalanine ammonia-lyase (PAL) induced in wounded sweet potato (Ipomoea batatas Lam.) root was obtained by immunoscreening a cDNA library. The protein produced in Escherichia coli cells containing the plasmid pPAL02 was indistinguishable from sweet potato PAL as judged by Ouchterlony double diffusion assays. The M{sub r} of its subunit was 77,000. The cells converted ({sup 14}C)-L-phenylalanine into ({sup 14}C)-t-cinnamic acid and PAL activity was detected in the homogenate of the cells. The activity was dependent on the presence of the pPAL02 plasmid DNA. The nucleotide sequence of the cDNA contained a 2,121-base pair (bp) open-reading framemore » capable of coding for a polypeptide with 707 amino acids (M{sub r} 77,137), a 22-bp 5{prime}-noncoding region and a 207-bp 3{prime}-noncoding region. The results suggest that the insert DNA fully encoded the amino acid sequence for sweet potato PAL that is induced by wounding. Comparison of the deduced amino acid sequence with that of a PAL cDNA fragment from Phaseolus vulgaris revealed 78.9% homology. The sequence from amino acid residues 258 to 494 was highly conserved, showing 90.7% homology.« less

Complete chloroplast genome of Tetragonia tetragonioides: Molecular phylogenetic relationships and evolution in Caryophyllales.

PubMed

Choi, Kyoung Su; Kwak, Myounghai; Lee, Byoungyoon; Park, SeonJoo

2018-01-01

The chloroplast genome of Tetragonia tetragonioides (Aizoaceae; Caryophyllales) was sequenced to provide information for studies on phylogeny and evolution within Caryophyllales. The chloroplast genome of Tetragonia tetragonioides is 149,506 bp in length and includes a pair of inverted repeats (IRs) of 24,769 bp that separate a large single copy (LSC) region of 82,780 bp and a small single copy (SSC) region of 17,188 bp. Comparative analysis of the chloroplast genome showed that Caryphyllales species have lost many genes. In particular, the rpl2 intron and infA gene were not found in T. tetragonioides, and core Caryophyllales lack the rpl2 intron. Phylogenetic analyses were conducted using 55 genes in 16 complete chloroplast genomes. Caryophyllales was found to divide into two clades; core Caryophyllales and noncore Caryophyllales. The genus Tetragonia is closely related to Mesembryanthemum. Comparisons of the synonymous (Ks), nonsynonymous (Ka), and Ka/Ks substitution rates revealed that nonsynonymous substitution rates were lower than synonymous substitution rates and that Ka/Ks rates were less than 1. The findings of the present study suggest that most genes are a purified selection.

The pPSU Plasmids for Generating DNA Molecular Weight Markers.

PubMed

Henrici, Ryan C; Pecen, Turner J; Johnston, James L; Tan, Song

2017-05-26

Visualizing nucleic acids by gel electrophoresis is one of the most common techniques in molecular biology, and reference molecular weight markers or ladders are commonly used for size estimation. We have created the pPSU1 & pPSU2 pair of molecular weight marker plasmids which produce both 100 bp and 1 kb DNA ladders when digested with two common restriction enzymes. The 100 bp ladder fragments have been optimized to migrate appropriately on both agarose and native polyacrylamide, unlike many currently available DNA ladders. Sufficient plasmid DNA can be isolated from 100 ml E. coli cultures for the two plasmids to produce 100 bp or 1 kb ladders for 1000 gels. As such, the pPSU1 and pPSU2 plasmids provide reference fragments from 50 to 10000 bp at a fraction of the cost of commercial DNA ladders. The pPSU1 and pPSU2 plasmids are available without licensing restrictions to nonprofit academic users, affording freely available high-quality, low-cost molecular weight standards for molecular biology applications.

Effect of intensive versus standard clinic-based hypertension management on ambulatory blood pressure – results from the SPRINT ambulatory blood pressure study

PubMed Central

Drawz, Paul; Pajewski, Nicholas M.; Bates, Jeffrey T.; Bello, Natalie A.; Cushman, William C.; Dwyer, Jamie P.; Fine, Lawrence J.; Goff, David C.; Haley, William E.; Krousel-Wood, Marie; McWilliams, Andrew; Rifkin, Dena E.; Slinin, Yelena; Taylor, Addison; Townsend, Raymond; Wall, Barry; Wright, Jackson T.; Rahman, Mahboob

2016-01-01

The effect of clinic-based intensive hypertension treatment on ambulatory blood pressure (BP) is unknown. The goal of the Systolic Blood Pressure Intervention Trial (SPRINT) Ambulatory BP Ancillary Study was to evaluate the effect of intensive versus standard clinic-based BP targets on ambulatory BP. Ambulatory BP was obtained within 3 weeks of the 27 month study visit in 897 SPRINT participants. Intensive treatment resulted in lower clinic systolic BP (mean difference between groups = 16.0 mmHg (95% CI: 14.1 to 17.8 mmHg)), nighttime systolic BP (mean difference = 9.6 mmHg (95% CI: 7.7 to 11.5 mmHg)), daytime systolic BP (mean difference = 12.3 mmHg (95% CI: 10.6 to 13.9 mmHg)), and 24 hour systolic BP (mean difference = 11.2 mmHg (95% CI: 9.7 to 12.8 mmHg)). The night/day systolic BP ratio was similar between the intensive (0.92 ± 0.09) and standard treatment groups (0.91 ± 0.09). There was considerable lack of agreement within participants between clinic systolic BP and daytime ambulatory systolic BP with wide limits of agreement on Bland-Altman plots. In conclusion, targeting a systolic BP of less than 120 mmHg, as compared with less than 140 mmHg, resulted in lower nighttime, daytime, and 24 hour systolic BP, but did not change the night/day systolic BP ratio. Ambulatory BP monitoring may be required to assess the effect of targeted hypertension therapy on out of office BP. Further studies are needed to assess whether targeting hypertension therapy based on ambulatory BP improves clinical outcomes. PMID:27849563

Effect of Intensive Versus Standard Clinic-Based Hypertension Management on Ambulatory Blood Pressure: Results From the SPRINT (Systolic Blood Pressure Intervention Trial) Ambulatory Blood Pressure Study.

PubMed

Drawz, Paul E; Pajewski, Nicholas M; Bates, Jeffrey T; Bello, Natalie A; Cushman, William C; Dwyer, Jamie P; Fine, Lawrence J; Goff, David C; Haley, William E; Krousel-Wood, Marie; McWilliams, Andrew; Rifkin, Dena E; Slinin, Yelena; Taylor, Addison; Townsend, Raymond; Wall, Barry; Wright, Jackson T; Rahman, Mahboob

2017-01-01

The effect of clinic-based intensive hypertension treatment on ambulatory blood pressure (BP) is unknown. The goal of the SPRINT (Systolic Blood Pressure Intervention Trial) ambulatory BP ancillary study was to evaluate the effect of intensive versus standard clinic-based BP targets on ambulatory BP. Ambulatory BP was obtained within 3 weeks of the 27-month study visit in 897 SPRINT participants. Intensive treatment resulted in lower clinic systolic BP (mean difference between groups=16.0 mm Hg; 95% confidence interval, 14.1-17.8 mm Hg), nighttime systolic BP (mean difference=9.6 mm Hg; 95% confidence interval, 7.7-11.5 mm Hg), daytime systolic BP (mean difference=12.3 mm Hg; 95% confidence interval, 10.6-13.9 mm Hg), and 24-hour systolic BP (mean difference=11.2 mm Hg; 95% confidence interval, 9.7-12.8 mm Hg). The night/day systolic BP ratio was similar between the intensive (0.92±0.09) and standard-treatment groups (0.91±0.09). There was considerable lack of agreement within participants between clinic systolic BP and daytime ambulatory systolic BP with wide limits of agreement on Bland-Altman plots. In conclusion, targeting a systolic BP of <120 mm Hg, when compared with <140 mm Hg, resulted in lower nighttime, daytime, and 24-hour systolic BP, but did not change the night/day systolic BP ratio. Ambulatory BP monitoring may be required to assess the effect of targeted hypertension therapy on out of office BP. Further studies are needed to assess whether targeting hypertension therapy based on ambulatory BP improves clinical outcomes. URL: http://www.clinicaltrials.gov. Unique identifier: NCT01835249. © 2016 American Heart Association, Inc.

Apolipoprotein B-52 mutation associated with hypobetalipoproteinemia is compatible with a misaligned pairing deletion mechanism.

PubMed

Groenewegen, W A; Krul, E S; Schonfeld, G

1993-06-01

We have identified a new truncation of apoB in a large kindred with hypobetalipoproteinemia that arose by an ambiguous deletion of one of four different groups of base-pairs. Eleven affected members of the kindred had total cholesterols (C) of 114 +/- 28, LDL-Cs of 46 +/- 21, and apoBs of 47 +/- 25 (all in mg/dl, mean +/- SD). These levels were lower (P < 0.0001) than in 15 unaffected relatives. On Western blotting, apoB-100 and a second major band corresponding to apoB-52 were seen in the affected individuals. The majority of the plasma apoB-52 was associated with a smaller than normal low density lipoprotein (LDL) particle. The molecular basis for this apoB-52 truncation is a 5-bp deletion, converting the sequence between cDNA nucleotide 7276 and 7283 from 5'-AAGTTAAG-3' into the mutant sequence 5'-AAG-3'. This results in a frameshift starting at amino acid residue 2357 and a termination codon at amino acid residue 2362. Deletion of one of four different groups of five consecutive bases, i.e., AAGTT, AGTTA, GTTAA, and TTAAG, all result in the same mutant sequence. Thus, the precise deletion is ambiguous. We propose that a misaligned pairing mechanism involving repeat sequences is compatible with this deletion mutation. We have noted similar ambiguous deletions associated with apoB-37, apoB-40, and a number of single base deletions and some may also be explained by a misaligned pairing mechanism. Small ambiguous deletions appear to constitute a major proportion of the apoB gene mutation spectrum suggesting that it may be a suitable model for studying the mechanisms of such mutations.

Rabies among African wild dogs (Lycaon pictus) in the Masai Mara, Kenya.

PubMed

Kat, P W; Alexander, K A; Smith, J S; Richardson, J D; Munson, L

1996-10-01

A pack of African wild dogs (Lycaon pictus) ranging to the north of the Masai Mara National Reserve in southwestern Kenya was monitored from 1988 to 1989. During a 6-week period (August 1-September 13, 1989), 21 of 23 members of this pack died. Seven carcasses were retrieved, of which 4 were suitable for necropsy and histopathologic examination. Gross findings varied among individuals and included multiple bite wounds, synovitis, lymphadenopathy, submandibular, cervical, and vocal cord edema, blood in bronchi, bronchioles, stomach, and intestine, and interioventral lung lobe consolidation. Histologic examination of 2 available brain samples revealed nonsuppurative encephalitis with eosinophilic intracytoplasmic inclusions (Negri bodies). An additional brain sample tested positive for rabies via a fluorescent antibody test. Other histologic features included severe suppurative bronchopneumonia, myocarditis, and lymphoid depletion of the lymph nodes, tonsils, and spleen. A 304-base pair (bp) nucleotide sequence from the N gene and a 310-bp sequence from the G gene from rabies isolates of 4 wild dogs indicated that infection was with a rabies variant common among domestic dogs in Kenya and Tanzania.

Trichinella murrelli in scavenging mammals from south-central Wisconsin, USA

USGS Publications Warehouse

Hill, D.E.; Samuel, M.D.; Nolden, C.A.; Sundar, N.; Zarlenga, D.S.; Dubey, J.P.

2008-01-01

Tissues and serum from 59 raccoons (Procyon lotor), 42 coyotes (Canis latrans), and seven Striped Skunks (Mephitis mephitis) collected in Dane and Iowa Counties, Wisconsin, USA, between October 2005 and March 2006 were microscopically and serologically examined for the presence of Trichinella spp. Encapsulated larvae were found on compression slides prepared from tongue tissues from a few animals. Complete tissue digestion of tongues revealed that 19% of the raccoons, 26% of the coyotes, and none of the seven skunks tested were infected with Trichinella spp. Cats were subsequently experimentally infected by feeding them the raccoon tissues containing muscle larvae, and muscle larvae isolated from the collected tongues were experimentally transmitted to mice. Multiplex polymerase chain reaction analysis of the isolated muscle larvae demonstrated two distinct bands migrating at 127 base pairs (bp) and 316 bp in all samples, which together are diagnostic for Trichinella murrelli; the isolates were assigned Istituto Superiore di Sanita (ISS) codes ISS1656 through ISS1667, and ISS1708 through ISS1710 by the International Trichinella Reference Centre. These findings extend the geographic range of T. murrelli into Wisconsin, USA. ?? Wildlife Disease Association 2008.

Protein-mediated loops in supercoiled DNA create large topological domains

PubMed Central

Yan, Yan; Ding, Yue; Leng, Fenfei; Dunlap, David; Finzi, Laura

2018-01-01

Abstract Supercoiling can alter the form and base pairing of the double helix and directly impact protein binding. More indirectly, changes in protein binding and the stress of supercoiling also influence the thermodynamic stability of regulatory, protein-mediated loops and shift the equilibria of fundamental DNA/chromatin transactions. For example, supercoiling affects the hierarchical organization and function of chromatin in topologically associating domains (TADs) in both eukaryotes and bacteria. On the other hand, a protein-mediated loop in DNA can constrain supercoiling within a plectonemic structure. To characterize the extent of constrained supercoiling, 400 bp, lac repressor-secured loops were formed in extensively over- or under-wound DNA under gentle tension in a magnetic tweezer. The protein-mediated loops constrained variable amounts of supercoiling that often exceeded the maximum writhe expected for a 400 bp plectoneme. Loops with such high levels of supercoiling appear to be entangled with flanking domains. Thus, loop-mediating proteins operating on supercoiled substrates can establish topological domains that may coordinate gene regulation and other DNA transactions across spans in the genome that are larger than the separation between the binding sites. PMID:29538766

Complementary DNA cloning and functional characterization of cytochrome P450 3A138 in common carp (Cyprinus carpio L.).

PubMed

Ma, Junguo; Bu, Yanzhen; Li, Yao; Niu, Daichun; Li, Xiaoyu

2014-06-01

The full-length sequence of a cytochrome P450 3A 138 (CYP3A138) cDNA in common carp was cloned and sequenced. The transcriptional and microsome enzyme activities of CYP3A138 in the fish liver after rifampicin exposure were also determined in this study. The results showed that the full-length CYP3A138 cDNA is 1912 base pairs (bp) long and contains an open reading frame of 1551 bp encoding a protein of 517 amino acids. Sequence analysis revealed that CYP3A138 is highly conserved in fish. Furthermore, the results of quantitative real-time PCR revealed that CYP3A138 in common carp is constitutively expressed in all tissues, but mainly in the liver and intestine. Additionally, rifampicin exposure promoted both the expression of CYP3A138 at the transcriptional level and the activity of the protein, suggesting that CYP3A138 is a member of the CYP3A subfamily. © 2014 Wiley Periodicals, Inc.

Biotic and abiotic degradation of 1,1,2,2-tetrachloroethane in wetland sediments: Geochemical and microbial community analyses

USGS Publications Warehouse

Lorah, M.M.; Voytek, M.A.; Kirshtein, J.

2000-01-01

Additional microcosm experiments with the wetland sediment and groundwater at the Aberdeen Proving Ground, MD, site was presented to assist in elucidating the conditions under which these potentially competing biotic and abiotic degradation reactions for 1,1,2,2-tetrachloroethane (PCA) occur in the environment and to evaluate potential seasonal changes in degradation reactions. PCA concentration decreased to below detection within 21 days in the March 1999 experiment, while PCA was still present at day 35 in the July 1999 experiment. Compared to March 1999 experiment, peak concentrations of all daughter products except trichloroethylene (TCE) were delayed in the July 1999 experiment. The relative intensity of the peaks was directly related to the biomass present for each fragment length (bp, base pair). The relative intensities were lower in sediment collected in August 1999 than in March 1999, especially in the bp size range of ??? 160??-240??. These microbial community analyses, along with the geochemical analyses of the microcosms, provide evidence that abiotic production of TCE from PCA degradation is more significant under conditions of low bacterial biomass in the wetland sediments.

Characterization of complete genome sequence of the spring viremia of carp virus isolated from common carp (Cyprinus carpio) in China.

PubMed

Teng, Y; Liu, H; Lv, J Q; Fan, W H; Zhang, Q Y; Qin, Q W

2007-01-01

The complete genome of spring viraemia of carp virus (SVCV) strain A-1 isolated from cultured common carp (Cyprinus carpio) in China was sequenced and characterized. Reverse transcription-polymerase chain reaction (RT-PCR) derived clones were constructed and the DNA was sequenced. It showed that the entire genome of SVCV A-1 consists of 11,100 nucleotide base pairs, the predicted size of the viral RNA of rhabdoviruses. However, the additional insertions in bp 4633-4676 and bp 4684-4724 of SVCV A-1 were different from the other two published SVCV complete genomes. Five open reading frames (ORFs) of SVCV A-1 were identified and further confirmed by RT-PCR and DNA sequencing of their respective RT-PCR products. The 5 structural proteins encoded by the viral RNA were ordered 3'-N-P-M-G-L-5'. This is the first report of a complete genome sequence of SVCV isolated from cultured carp in China. Phylogenetic analysis indicates that SVCV A-1 is closely related to the members of the genus Vesiculovirus, family Rhabdoviridae.

Deletion of a 77-base-pair inverted repeat element alters the synthesis of surface polysaccharides in Porphyromonas gingivalis.

PubMed

Bainbridge, Brian W; Hirano, Takanori; Grieshaber, Nicole; Davey, Mary E

2015-04-01

Bacterial cell surface glycans, such as capsular polysaccharides and lipopolysaccharides (LPS), influence host recognition and are considered key virulence determinants. The periodontal pathogen Porphyromonas gingivalis is known to display at least three different types of surface glycans: O-LPS, A-LPS, and K-antigen capsule. We have shown that PG0121 (in strain W83) encodes a DNABII histone-like protein and that this gene is transcriptionally linked to the K-antigen capsule synthesis genes, generating a large ∼19.4-kb transcript (PG0104-PG0121). Furthermore, production of capsule is deficient in a PG0121 mutant strain. In this study, we report on the identification of an antisense RNA (asRNA) molecule located within a 77-bp inverted repeat (77bpIR) element located near the 5' end of the locus. We show that overexpression of this asRNA decreases the amount of capsule produced, indicating that this asRNA can impact capsule synthesis in trans. We also demonstrate that deletion of the 77bpIR element and thereby synthesis of the large 19.4-kb transcript also diminishes, but does not eliminate, capsule synthesis. Surprisingly, LPS structures were also altered by deletion of the 77bpIR element, and reactivity to monoclonal antibodies specific to both O-LPS and A-LPS was eliminated. Additionally, reduced reactivity to these antibodies was also observed in a PG0106 mutant, indicating that this putative glycosyltransferase, which is required for capsule synthesis, is also involved in LPS synthesis in strain W83. We discuss our finding in the context of how DNABII proteins, an antisense RNA molecule, and the 77bpIR element may modulate expression of surface polysaccharides in P. gingivalis. The periodontal pathogen Porphyromonas gingivalis displays at least three different types of cell surface glycans: O-LPS, A-LPS, and K-antigen capsule. We have shown using Northern analysis that the K-antigen capsule locus encodes a large transcript (∼19.4 kb), encompassing a 77-bp inverted repeat (77bpIR) element near the 5' end. Here, we report on the identification of an antisense RNA (asRNA) encoded within the 77bpIR. We show that overexpression of this asRNA or deletion of the element decreases the amount of capsule. LPS structures were also altered by deletion of the 77bpIR, and reactivity to monoclonal antibodies to both O-LPS and A-LPS was eliminated. Our data indicate that the 77bpIR element is involved in modulating both LPS and capsule synthesis in P. gingivalis. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Deletion of a 77-Base-Pair Inverted Repeat Element Alters the Synthesis of Surface Polysaccharides in Porphyromonas gingivalis

PubMed Central

Bainbridge, Brian W.; Hirano, Takanori; Grieshaber, Nicole

2015-01-01

ABSTRACT Bacterial cell surface glycans, such as capsular polysaccharides and lipopolysaccharides (LPS), influence host recognition and are considered key virulence determinants. The periodontal pathogen Porphyromonas gingivalis is known to display at least three different types of surface glycans: O-LPS, A-LPS, and K-antigen capsule. We have shown that PG0121 (in strain W83) encodes a DNABII histone-like protein and that this gene is transcriptionally linked to the K-antigen capsule synthesis genes, generating a large ∼19.4-kb transcript (PG0104-PG0121). Furthermore, production of capsule is deficient in a PG0121 mutant strain. In this study, we report on the identification of an antisense RNA (asRNA) molecule located within a 77-bp inverted repeat (77bpIR) element located near the 5′ end of the locus. We show that overexpression of this asRNA decreases the amount of capsule produced, indicating that this asRNA can impact capsule synthesis in trans. We also demonstrate that deletion of the 77bpIR element and thereby synthesis of the large 19.4-kb transcript also diminishes, but does not eliminate, capsule synthesis. Surprisingly, LPS structures were also altered by deletion of the 77bpIR element, and reactivity to monoclonal antibodies specific to both O-LPS and A-LPS was eliminated. Additionally, reduced reactivity to these antibodies was also observed in a PG0106 mutant, indicating that this putative glycosyltransferase, which is required for capsule synthesis, is also involved in LPS synthesis in strain W83. We discuss our finding in the context of how DNABII proteins, an antisense RNA molecule, and the 77bpIR element may modulate expression of surface polysaccharides in P. gingivalis. IMPORTANCE The periodontal pathogen Porphyromonas gingivalis displays at least three different types of cell surface glycans: O-LPS, A-LPS, and K-antigen capsule. We have shown using Northern analysis that the K-antigen capsule locus encodes a large transcript (∼19.4 kb), encompassing a 77-bp inverted repeat (77bpIR) element near the 5′ end. Here, we report on the identification of an antisense RNA (asRNA) encoded within the 77bpIR. We show that overexpression of this asRNA or deletion of the element decreases the amount of capsule. LPS structures were also altered by deletion of the 77bpIR, and reactivity to monoclonal antibodies to both O-LPS and A-LPS was eliminated. Our data indicate that the 77bpIR element is involved in modulating both LPS and capsule synthesis in P. gingivalis. PMID:25622614

A ~25 ka Indian Ocean monsoon variability record from the Andaman Sea

USGS Publications Warehouse

Rashid, H.; Flower, B.P.; Poore, R.Z.; Quinn, T.M.

2007-01-01

Recent paleoclimatic work on terrestrial and marine deposits from Asia and the Indian Ocean has indicated abrupt changes in the strength of the Asian monsoon during the last deglaciation. Comparison of marine paleoclimate records that track salinity changes from Asian rivers can help evaluate the coherence of the Indian Ocean monsoon (IOM) with the larger Asian monsoon. Here we present paired Mg/Ca and δ18O data on the planktic foraminifer Globigerinoides ruber (white) from Andaman Sea core RC12-344 that provide records of sea-surface temperature (SST) and δ18O of seawater (δ18Osw) over the past 25,000 years (ka) before present (BP). Age control is based on nine accelerator mass spectrometry (AMS) dates on mixed planktic foraminifera. Mg/Ca-SST data indicate that SST was ∼3 °C cooler during the last glacial maximum (LGM) than the late Holocene. Andaman Sea δ18Osw exhibited higher than present values during the Lateglacial interval ca 19–15 ka BP and briefly during the Younger Dryas ca 12 ka BP. Lower than present δ18Osw values during the BØlling/AllerØd ca 14.5–12.6 ka BP and during the early Holocene ca 10.8–5.5 ka BP are interpreted to indicate lower salinity, reflect some combination of decreased evaporation–precipitation (E–P) over the Andaman Sea and increased Irrawaddy River outflow. Our results are consistent with the suggestion that IOM intensity was stronger than present during the BØlling/AllerØd and early Holocene, and weaker during the late glaciation, Younger Dryas, and the late Holocene. These findings support the hypothesis that rapid climate change during the last deglaciation and Holocene included substantial hydrologic changes in the IOM system that were coherent with the larger Asian monsoon.

Community-based Randomized Controlled Trial of Non-pharmacological Interventions in Prevention and Control of Hypertension among Young Adults.

PubMed

Saptharishi, Lg; Soudarssanane, Mb; Thiruselvakumar, D; Navasakthi, D; Mathanraj, S; Karthigeyan, M; Sahai, A

2009-10-01

Hypertension is a major chronic lifestyle disease. Several non-pharmacological interventions are effective in bringing down the blood pressure (BP). This study focuses on the effectiveness of such interventions among young adults. To measure the efficacy of physical exercise, reduction in salt intake, and yoga, in lowering BP among young (20-25) pre-hypertensives and hypertensives, and to compare their relative efficacies. The study was done in the urban service area of JIPMER. Pre-hypertensives and hypertensives, identified from previous studies, constituted the universe. The participants were randomized into one control and three interventional groups. A total of 113 subjects: 30, 28, 28 and 27 in four groups respectively participated for eight weeks: control (I), physical exercise (II) - brisk walking for 50-60 minutes, four days/week, salt intake reduction (III) - to at least half of their previous intake, and practice of yoga (IV) - for 30-45 minutes/day on at least five days/week. Efficacy was assessed using paired t test and ANOVA with Games Howell post hoc test. An intention to treat analysis was also performed. A total of 102 participants (29, 27, 25 and 21 in groups I, II, III and IV) completed the study. All three intervention groups showed a significant reduction in BP (SBP/DBP: 5.3/6.0 in group II, 2.6/3.7 in III, and 2.0/2.6 mm Hg in IV respectively). There was no significant change (SBP/DBP: 0.2/0.5 mmHg) of BP in control group (I). Physical exercise was most effective (considered individually); salt intake reduction and yoga were also effective. Physical exercise, salt intake reduction, and yoga are effective non-pharmacological interventions in significantly reducing BP among young hypertensives and pre-hypertensives. These can therefore be positively recommended for hypertensives. There is also a case to deploy these interventions in the general population.

Working memory and attention deficits in adolescent offspring of schizophrenia or bipolar patients: comparing vulnerability markers.

PubMed

Diwadkar, Vaibhav A; Goradia, Dhruman; Hosanagar, Avinash; Mermon, Diana; Montrose, Debra M; Birmaher, Boris; Axelson, David; Rajarathinem, R; Haddad, Luay; Amirsadri, Ali; Zajac-Benitez, Caroline; Rajan, Usha; Keshavan, Matcheri S

2011-07-01

Working memory deficits abound in schizophrenia and attention deficits have been documented in schizophrenia and bipolar disorder. Adolescent offspring of patients may inherit vulnerabilities in brain circuits that subserve these cognitive domains. Here we assess impairments in offspring of schizophrenia (SCZ-Offspring) or bipolar (BP-Offspring) patients compared to controls (HC) with no family history of mood or psychotic disorders to the second degree. Three groups (n=100 subjects; range: 10-20 yrs) of HC, SCZ-Offspring and BP-Offspring gave informed consent. Working memory was assessed using a delayed spatial memory paradigm with two levels of delay (2s & 12s); sustained attention processing was assessed using the Continuous Performance Task-Identical Pairs version. SCZ-Offspring (but not BP-Offspring) showed impairments in working memory (relative to HC) at the longer memory delay indicating a unique deficit. Both groups showed reduced sensitivity during attention but only BP-Offspring significantly differed from controls. These results suggest unique (working memory/dorsal frontal cortex) and potentially overlapping (attention/fronto-striatal cortex) vulnerability pathways in adolescent offspring of patients with schizophrenia and bipolar disorder. Working memory and attention assessments in these offspring may assist in the clinical characterization of the adolescents vulnerable to SCZ or BP. Copyright © 2011 Elsevier Inc. All rights reserved.

Genomic differentiation between Asturiana de los Valles, Avileña-Negra Ibérica, Bruna dels Pirineus, Morucha, Pirenaica, Retinta and Rubia Gallega cattle breeds.

PubMed

González-Rodríguez, A; Munilla, S; Mouresan, E F; Cañas-Álvarez, J J; Baro, J A; Molina, A; Díaz, C; Altarriba, J; Piedrafita, J; Varona, L

2017-10-01

The Spanish local beef cattle breeds have most likely common origin followed by a process of differentiation. This particular historical evolution has most probably left detectable signatures in the genome. The objective of this study was to identify genomic regions associated with differentiation processes in seven Spanish autochthonous populations (Asturiana de los Valles (AV), Avileña-Negra Ibérica (ANI), Bruna dels Pirineus (BP), Morucha (Mo), Pirenaica (Pi), Retinta (Re) and Rubia Gallega (RG)). The BovineHD 777K BeadChip was used on 342 individuals (AV, n=50; ANI, n=48; BP, n=50; Mo, n=50; Pi, n=48; Re, n=48; RG, n=48) chosen to be as unrelated as possible. We calculated the fixation index (F ST ) and performed a Bayesian analysis named SelEstim. The output of both procedures was very similar, although the Bayesian analysis provided a richer inference and allowed us to calculate significance thresholds by generating a pseudo-observed data set from the estimated posterior distributions. We identified a very large number of genomic regions, but when a very restrictive significance threshold was applied these regions were reduced to only 10. Among them, four regions can be highlighted because they comprised a large number of single nucleotide polymorphisms and showed extremely high signals (Kullback-Leiber divergence (KLD)>6). They are located in BTA 2 (5 575 950 to 10 152 228 base pairs (bp)), BTA 5 (17 596 734 to 18 850 702 bp), BTA 6 (37 853 912 to 39 441 548 bp) and BTA 18 (13 345 515 to 15 243 838 bp) and harbor, among others, the MSTN (Myostatin), KIT-LG (KIT Ligand), LAP3 (leucine aminopeptidase 3), NAPCG (non-SMC condensing I complex, subunit G), LCORL (ligand dependent nuclear receptor corepressor-like) and MC1R (Melanocortin 1 receptor) genes. Knowledge on these genomic regions allows to identify potential targets of recent selection and helps to define potential candidate genes associated with traits of interest, such as coat color, muscle development, fertility, growth, carcass and immunological response.

Validation of the BPUMP BF1112 upper-arm blood pressure monitor for home blood pressure monitoring according to the European Society of Hypertension International Protocol revision 2010.

PubMed

Chen, Qi; Kang, Yuan-Yuan; Li, Yan; Wang, Ji-Guang

2017-04-01

The present study aimed to evaluate the accuracy of the automated oscillometric upper-arm blood pressure (BP) monitor BPUMP BF1112 for home BP monitoring according to the International Protocol of the European Society of Hypertension revision 2010 (ESH-IP2010). Systolic and diastolic BPs were sequentially measured in 33 adult Chinese (13 women, mean age 46.7 years) using a mercury sphygmomanometer (two observers) and the BF1112 device (one supervisor). A total of 99 pairs of comparisons were obtained from 33 participants for judgments in two parts with three grading phases. The BPUMP BF1112 device achieved the targets in part 1 of the validation study. The number of absolute differences between device and observers within 5, 10, and 15 mmHg was 85/99, 96/99, and 97/99, respectively, for systolic BP, and 83/99, 97/99, and 99/99, respectively, for diastolic BP. The device also fulfilled the criteria in part 2 of the validation study. A total of 31 and 30 participants for systolic and diastolic BP, respectively, had at least two of the three device-observer differences within 5 mmHg (required≥24mmHg). No participant for systolic or diastolic BP had all the three device-observer comparisons greater than 5 mmHg. The BPUMP BP monitor BF1112 has passed the requirements of the ESH-IP2010, and hence can be recommended for home use in adults.

Effects of short-term heated water-based exercise training on systemic blood pressure in patients with resistant hypertension: a pilot study.

PubMed

Guimarães, Guilherme V; Cruz, Lais G B; Tavares, Aline C; Dorea, Egidio L; Fernandes-Silva, Miguel M; Bocchi, Edimar A

2013-12-01

High blood pressure (BP) increases the risk of cardiovascular diseases, and its control is a clinical challenge. Regular exercise lowers BP in patients with mild-to-moderate hypertension. No data are available on the effects of heated water-based exercise in hypertensive patients. Our objective was to evaluate the effects of heated water-based exercise on BP in patients with resistant hypertension. We tested the effects of 60-min heated water-based exercise training three times per week in 16 patients with resistant hypertension (age 55±6 years). The protocol included walking and callisthenic exercises. All patients underwent 24-h ambulatory blood pressure monitoring (ABPM) before and after a 2-week exercise program in a heated pool. Systolic office BP was reduced from 162 to 144 mmHg (P<0.004) after heated-water training. After the heated-water exercise training during 24-h ABPM, systolic BP decreased from 135 to 123 mmHg (P=0.02), diastolic BP decreased from 83 to 74 mmHg (P=0.001), daytime systolic BP decreased from 141 to 125 mmHg (P=0.02), diastolic BP decreased from 87 to 77 mmHg (P=0.009), night-time systolic BP decreased from 128 to 118 mmHg (P=0.06), and diastolic BP decreased from 77 to 69 mmHg (P=0.01). In addition, BP cardiovascular load was reduced significantly during the 24-h daytime and night-time period after the heated water-based exercise. Heated water-based exercise reduced office BP and 24-h daytime and night-time ABPM levels. These effects suggest that heated water-based exercise may have a potential as a new therapeutic approach to resistant hypertensive patients.

The spacing between adjacent binding sites in the family of repeats affects the functions of Epstein-Barr nuclear antigen 1 in transcription activation and stable plasmid maintenance.

PubMed

Hebner, Christy; Lasanen, Julie; Battle, Scott; Aiyar, Ashok

2003-07-05

Epstein-Barr virus (EBV) and the closely related Herpesvirus papio (HVP) are stably replicated as episomes in proliferating latently infected cells. Maintenance and partitioning of these viral plasmids requires a viral sequence in cis, termed the family of repeats (FR), that is bound by a viral protein, Epstein-Barr nuclear antigen 1 (EBNA1). Upon binding FR, EBNA1 maintains viral genomes in proliferating cells and activates transcription from viral promoters required for immortalization. FR from either virus encodes multiple binding sites for the viral maintenance protein, EBNA1, with the FR from the prototypic B95-8 strain of EBV containing 20 binding sites, and FR from HVP containing 8 binding sites. In addition to differences in the number of EBNA1-binding sites, adjacent binding sites in the EBV FR are typically separated by 14 base pairs (bp), but are separated by 10 bp in HVP. We tested whether the number of binding sites, as well as the distance between adjacent binding sites, affects the function of EBNA1 in transcription activation or plasmid maintenance. Our results indicate that EBNA1 activates transcription more efficiently when adjacent binding sites are separated by 10 bp, the spacing observed in HVP. In contrast, using two separate assays, we demonstrate that plasmid maintenance is greatly augmented when adjacent EBNA1-binding sites are separated by 14 bp, and therefore, presumably lie on the same face of the DNA double helix. These results provide indication that the functions of EBNA1 in transcription activation and plasmid maintenance are separable.

Estimation from PET data of transient changes in dopamine concentration induced by alcohol: support for a non-parametric signal estimation method

NASA Astrophysics Data System (ADS)

Constantinescu, C. C.; Yoder, K. K.; Kareken, D. A.; Bouman, C. A.; O'Connor, S. J.; Normandin, M. D.; Morris, E. D.

2008-03-01

We previously developed a model-independent technique (non-parametric ntPET) for extracting the transient changes in neurotransmitter concentration from paired (rest & activation) PET studies with a receptor ligand. To provide support for our method, we introduced three hypotheses of validation based on work by Endres and Carson (1998 J. Cereb. Blood Flow Metab. 18 1196-210) and Yoder et al (2004 J. Nucl. Med. 45 903-11), and tested them on experimental data. All three hypotheses describe relationships between the estimated free (synaptic) dopamine curves (FDA(t)) and the change in binding potential (ΔBP). The veracity of the FDA(t) curves recovered by nonparametric ntPET is supported when the data adhere to the following hypothesized behaviors: (1) ΔBP should decline with increasing DA peak time, (2) ΔBP should increase as the strength of the temporal correlation between FDA(t) and the free raclopride (FRAC(t)) curve increases, (3) ΔBP should decline linearly with the effective weighted availability of the receptor sites. We analyzed regional brain data from 8 healthy subjects who received two [11C]raclopride scans: one at rest, and one during which unanticipated IV alcohol was administered to stimulate dopamine release. For several striatal regions, nonparametric ntPET was applied to recover FDA(t), and binding potential values were determined. Kendall rank-correlation analysis confirmed that the FDA(t) data followed the expected trends for all three validation hypotheses. Our findings lend credence to our model-independent estimates of FDA(t). Application of nonparametric ntPET may yield important insights into how alterations in timing of dopaminergic neurotransmission are involved in the pathologies of addiction and other psychiatric disorders.

Structural characterization and regulatory element analysis of the heart isoform of cytochrome c oxidase VIa

NASA Technical Reports Server (NTRS)

Wan, B.; Moreadith, R. W.; Blomqvist, C. G. (Principal Investigator)

1995-01-01

In order to investigate the mechanism(s) governing the striated muscle-specific expression of cytochrome c oxidase VIaH we have characterized the murine gene and analyzed its transcriptional regulatory elements in skeletal myogenic cell lines. The gene is single copy, spans 689 base pairs (bp), and is comprised of three exons. The 5'-ends of transcripts from the gene are heterogeneous, but the most abundant transcript includes a 5'-untranslated region of 30 nucleotides. When fused to the luciferase reporter gene, the 3.5-kilobase 5'-flanking region of the gene directed the expression of the heterologous protein selectively in differentiated Sol8 cells and transgenic mice, recapitulating the pattern of expression of the endogenous gene. Deletion analysis identified a 300-bp fragment sufficient to direct the myotube-specific expression of luciferase in Sol8 cells. The region lacks an apparent TATA element, and sequence motifs predicted to bind NRF-1, NRF-2, ox-box, or PPAR factors known to regulate other nuclear genes encoding mitochondrial proteins are not evident. Mutational analysis, however, identified two cis-elements necessary for the high level expression of the reporter protein: a MEF2 consensus element at -90 to -81 bp and an E-box element at -147 to -142 bp. Additional E-box motifs at closely located positions were mutated without loss of transcriptional activity. The dependence of transcriptional activation of cytochrome c oxidase VIaH on cis-elements similar to those found in contractile protein genes suggests that the striated muscle-specific expression is coregulated by mechanisms that control the lineage-specific expression of several contractile and cytosolic proteins.

Complete chloroplast genome sequences of Praxelis (Eupatorium catarium Veldkamp), an important invasive species.

PubMed

Zhang, Ying; Li, Lei; Yan, Ting Liang; Liu, Qiang

2014-10-01

Praxelis (Eupatorium catarium Veldkamp) is a new hazardous invasive plant species that has caused serious economic losses and environmental damage in the Northern hemisphere tropical and subtropical regions. Although previous studies focused on detecting the biological characteristics of this plant to prevent its expansion, little effort has been made to understand the impact of Praxelis on the ecosystem in an evolutionary process. The genetic information of Praxelis is required for further phylogenetic identification and evolutionary studies. Here, we report the complete Praxelis chloroplast (cp) genome sequence. The Praxelis chloroplast genome is 151,410 bp in length including a small single-copy region (18,547 bp) and a large single-copy region (85,311 bp) separated by a pair of inverted repeats (IRs; 23,776 bp). The genome contains 85 unique and 18 duplicated genes in the IR region. The gene content and organization are similar to other Asteraceae tribe cp genomes. We also analyzed the whole cp genome sequence, repeat structure, codon usage, contraction of the IR and gene structure/organization features between native and invasive Asteraceae plants, in order to understand the evolution of organelle genomes between native and invasive Asteraceae. Comparative analysis identified the 14 markers containing greater than 2% parsimony-informative characters, indicating that they are potential informative markers for barcoding and phylogenetic analysis. Moreover, a sister relationship between Praxelis and seven other species in Asteraceae was found based on phylogenetic analysis of 28 protein-coding sequences. Complete cp genome information is useful for plant phylogenetic and evolutionary studies within this invasive species and also within the Asteraceae family. Copyright © 2014 Elsevier B.V. All rights reserved.

Alcohol preference influences the subthalamic nucleus control on motivation for alcohol in rats.

PubMed

Lardeux, Sylvie; Baunez, Christelle

2008-02-01

In addition to its role in motor and attentional processes, the subthalamic nucleus (STN) has also been recently demonstrated to be involved in motivational function. Indeed, bilateral STN lesions modulate differentially the motivation for natural rewards and drugs of abuse, increasing motivation for food and decreasing motivation for cocaine in rats. Here, we show that in outbred rats, the STN can modulate the motivation for alcohol according to alcohol preference, without affecting alcohol intake. When performed on 'High-Drinker' rats, STN lesions enhanced the breaking point (BP) under a progressive ratio schedule of reinforcement and increased the time spent in the environment previously paired with alcohol access in the place preference paradigm. In contrast, when performed on 'Low-Drinker' rats, STN lesions decreased the BP and increased the time spent in the environment paired with water. These results show that STN lesions enhance the motivation for alcohol in rats showing a high alcohol preference, whereas they decrease it in rats showing a low preference for alcohol. These results suggest that the STN plays a complex role in the reward circuit, that is not limited to a

A rapid method for differentiating Saccharomyces sensu stricto strains from other yeast species in an enological environment.

PubMed

Nardi, Tiziana; Carlot, Milena; De Bortoli, Elena; Corich, Viviana; Giacomini, Alessio

2006-11-01

During programs for the selection of enological yeasts, several hundred natural isolates are usually screened. The scope of these operations is to isolate strains possessing good fermentative properties without necessarily arriving at a precise species designation: in other words, to detect strains belonging to the Saccharomyces sensu stricto complex. In the present study, a pair of primers, designed within the variable D1/D2 region of the 26S subunit of ribosomal yeast RNA, have been constructed. These generate an amplification fragment of 471 bp that is specific for the seven Saccharomyces sensu stricto species, while no signal was obtained for Saccharomyces sensu lato strains (17 species) or for another 18 selected species commonly found in enological environments. A second pair of primers was also constructed, within the 18S rRNA gene, composed of perfectly conserved sequences common for all 42 yeast species examined, which generate a 900 bp (c.) band for all strains. This was used as a positive experimental control in multiplex PCR analysis using all four primers.

A reference human genome dataset of the BGISEQ-500 sequencer.

PubMed

Huang, Jie; Liang, Xinming; Xuan, Yuankai; Geng, Chunyu; Li, Yuxiang; Lu, Haorong; Qu, Shoufang; Mei, Xianglin; Chen, Hongbo; Yu, Ting; Sun, Nan; Rao, Junhua; Wang, Jiahao; Zhang, Wenwei; Chen, Ying; Liao, Sha; Jiang, Hui; Liu, Xin; Yang, Zhaopeng; Mu, Feng; Gao, Shangxian

2017-05-01

BGISEQ-500 is a new desktop sequencer developed by BGI. Using DNA nanoball and combinational probe anchor synthesis developed from Complete Genomics™ sequencing technologies, it generates short reads at a large scale. Here, we present the first human whole-genome sequencing dataset of BGISEQ-500. The dataset was generated by sequencing the widely used cell line HG001 (NA12878) in two sequencing runs of paired-end 50 bp (PE50) and two sequencing runs of paired-end 100 bp (PE100). We also include examples of the raw images from the sequencer for reference. Finally, we identified variations using this dataset, estimated the accuracy of the variations, and compared to that of the variations identified from similar amounts of publicly available HiSeq2500 data. We found similar single nucleotide polymorphism (SNP) detection accuracy for the BGISEQ-500 PE100 data (false positive rate [FPR] = 0.00020%, sensitivity = 96.20%) compared to the PE150 HiSeq2500 data (FPR = 0.00017%, sensitivity = 96.60%) better SNP detection accuracy than the PE50 data (FPR = 0.0006%, sensitivity = 94.15%). But for insertions and deletions (indels), we found lower accuracy for BGISEQ-500 data (FPR = 0.00069% and 0.00067% for PE100 and PE50 respectively, sensitivity = 88.52% and 70.93%) than the HiSeq2500 data (FPR = 0.00032%, sensitivity = 96.28%). Our dataset can serve as the reference dataset, providing basic information not just for future development, but also for all research and applications based on the new sequencing platform. © The Authors 2017. Published by Oxford University Press.

Analysis of de novo sequencing and transcriptome assembly and lignocellulolytic enzymes gene expression of Coriolopsis gallica HTC.

PubMed

Chen, Yuehong; Cao, Qinghua; Tao, Xiang; Shao, Huanhuan; Zhang, Kun; Zhang, Yizheng; Tan, Xuemei

2017-03-01

White-rot basidiomycete Coriolopsis gallica HTC is one of the main biodegraders of poplar. In our previous study, we have shown the strong capacity of C. gallica HTC to degrade lignocellulose. In this study, equal amounts of total RNA fromC. Gallica HTC cultures grown in different conditions were pooled together. Illumina paired-end RNA sequencing was performed, and 13.2 million 90-bp paired-end reads were generated. We chose the Merged Assembly of Oases data-set for the following blast searches and gene ontology analyses. The reads were assembled de novo into 28,034 transcripts (≥ 100 bp) using combined assembly strategy MAO. The transcripts were annotated using Blast2GO. In all, 18,810 transcripts (≥100 bp) achieved BLASTX hits, of which, 7048 transcripts had GO term and 2074 had ECs. The expression level of 11 lignocellulolytic enzyme genes from the assembled C. gallica HTC transcriptome were detected by real-time quantitative polymerase chain reaction. The results showed that expression levels of these genes were affected by carbon source and nitrogen source at the level of transcription. The current abundant transcriptome data allowed the identification of many new transcripts in C. gallica HTC. Data provided here represent the most comprehensive and integrated genomic resources for cloning and identifying genes of interest from C. gallica HTC. Characterization of C. gallica HTC transcriptome provides an effective tool to understand mechanisms underlying cellular and molecular functions of C. gallica HTC.

rpoB Gene Sequence-Based Identification of Aerobic Gram-Positive Cocci of the Genera Streptococcus, Enterococcus, Gemella, Abiotrophia, and Granulicatella

PubMed Central

Drancourt, Michel; Roux, Véronique; Fournier, Pierre-Edouard; Raoult, Didier

2004-01-01

We developed a new molecular tool based on rpoB gene (encoding the beta subunit of RNA polymerase) sequencing to identify streptococci. We first sequenced the complete rpoB gene for Streptococcus anginosus, S. equinus, and Abiotrophia defectiva. Sequences were aligned with these of S. pyogenes, S. agalactiae, and S. pneumoniae available in GenBank. Using an in-house analysis program (SVARAP), we identified a 740-bp variable region surrounded by conserved, 20-bp zones and, by using these conserved zones as PCR primer targets, we amplified and sequenced this variable region in an additional 30 Streptococcus, Enterococcus, Gemella, Granulicatella, and Abiotrophia species. This region exhibited 71.2 to 99.3% interspecies homology. We therefore applied our identification system by PCR amplification and sequencing to a collection of 102 streptococci and 60 bacterial isolates belonging to other genera. Amplicons were obtained in streptococci and Bacillus cereus, and sequencing allowed us to make a correct identification of streptococci. Molecular signatures were determined for the discrimination of closely related species within the S. pneumoniae-S. oralis-S. mitis group and the S. agalactiae-S. difficile group. These signatures allowed us to design a S. pneumoniae-specific PCR and sequencing primer pair. PMID:14766807

Sequence analysis of Chinese and Japanese Curcuma drugs on the 18S rRNA gene and trnK gene and the application of amplification-refractory mutation system analysis for their authentication.

PubMed

Sasaki, Yohei; Fushimi, Hirotoshi; Cao, Hui; Cai, Shao-Qing; Komatsu, Katsuko

2002-12-01

The botanical origins of Chinese and Japanese Curcuma drugs were determined to be Curcuma longa, C. phaeocaulis, the Japanese population of C. zedoaria, C. kwangsiensis, C. wenyujin, and C. aromatica based on a comparison of their 18S rRNA gene and trnK gene sequences with those of six Curcuma species reported previously. Moreover, to develop a more convenient identification method, amplification-refractory mutation system (ARMS) analysis of both gene regions was performed on plants. The ARMS method for the 18S rRNA gene was established using two types of forward primers designed based on the nucleotide difference at position 234. When DNAs of four Curcuma species were used as templates, PCR amplification with either of the two primers only generated a fragment of 912 base pairs (bp). However, when DNAs of the purple-cloud type of C. kwangsiensis and C. wenyujin were used, PCR amplifications with both primers unexpectedly generated the fragment, suggesting that these two were heterozygotes. The ARMS method for the trnK gene was also established using a mixture of four types of specific reverse primers designed on the basis of base substitutions and indels among six species, and common reverse and forward primers. C. phaeocaulis or the Chinese population of C. zedoaria, the Japanese population of C. zedoaria or the purple-cloud type of C. kwangsiensis, the pubescent type of C. kwangsiensis or C. wenyujin, and C. aromatica were found to show specific fragments of 730, 185, 527 or 528, and 641 or 642 bp, respectively. All species including C. longa also showed a common fragment of 897-904 bp. Using both ARMS methods, together with information on producing areas, the identification of Curcuma plants was achieved. Moreover, the ARMS method for the trnK gene was also useful for authentication of Curcuma drugs.

[A study of PDE6B gene mutation and phenotype in Chinese cases with retinitis pigmentosa].

PubMed

Cui, Yun; Zhao, Kan-xing; Wang, Li; Wang, Qing; Zhang, Wei; Chen, Wei-ying; Wang, Li-ming

2003-01-01

To identify the mutation spectrum of phosphodiesterase beta subunit (PDE6B) gene, the incidence in Chinese patients with retinitis pigmentosa (RP) and their clinical phenotypic characteristics. Screening of mutations within PDE6B gene was performed using polymerase chain reaction-heteroduplex-single strand conformation polymorphism (PCR-SSCP) and DNA sequence in 35 autosomal recessive (AR) RP and 55 sporadic RP cases. The phenotypes of the patients with the gene mutation were examined and analyzed. Novel complex heterozygous variants of PDE6B gene in a sporadic case, a T to C transversion in codon 323 resulting in the substitution of Gly by Ser and 2 base pairs (bp: G and T) insert between the 27th-28th bp upstream of the 5'-end of exon 10 were both present in a same isolate RP. But they are not found in 100 unrelated healthy individuals. Ocular findings showed diffuse pigmentary retinal degeneration in the midperipheral and peripheral fundi, optic atrophy and vessel attenuation. Multi-focal ERG indicated that the rod function was more severely deteriorated. A mutation was found in a case with RP in a ARRP family, a G to A transversion at 19th base upstream 5'-end of exon 11 (within intron 10) of PDE6B gene. A sporadic RP carried a sequence variant of PDE6B gene, a G to C transition, at the 15th base adjacent to the 3'-end of exon l8. In another isolate case with RP was found 2 bp (GT) insert between 31st and 32nd base upstream 5'-end of exon 4 (in intron 3) of PDE6B gene. There are novel complex heterozygous mutations of PDE6B gene responsible for a sporadic RP patient in China. This gene mutation associated with rod deterioration and RP. Several DNA variants were found in introns of PDE6B gene in national population.

Validation of four devices: Omron M6 Comfort, Omron HEM-7420, Withings BP-800, and Polygreen KP-7670 for home blood pressure measurement according to the European Society of Hypertension International Protocol.

PubMed

Topouchian, Jirar; Agnoletti, Davide; Blacher, Jacques; Youssef, Ahmed; Chahine, Mirna N; Ibanez, Isabel; Assemani, Nathalie; Asmar, Roland

2014-01-01

Four oscillometric devices, including the Omron M6 Comfort, Omron HEM-7420, Withings BP-800, and Polygreen KP-7670, designed for self-blood pressure measurement (SBPM) were evaluated according to the European Society of Hypertension (ESH) International Protocol Revision 2010 in four separate studies. The four devices measure brachial blood pressure (BP) using the oscillometric method. The Withings BP-800 has to be connected to an Apple® iOS device such as an iPhone®, iPad®, or iPod®. The ESH International Protocol Revision 2010 includes a total number of 33 subjects. The difference between observer and device BP values was calculated for each measure. Ninety-nine pairs of BP differences were classified into three categories (≤5 mmHg, ≤10 mmHg, ≤15 mmHg). The protocol procedures were followed precisely in each of the four studies. All four tested devices passed the validation process. The mean differences between the device and mercury readings were: -1.8±5.1 mmHg and -0.4±2.8 mmHg for systolic and diastolic BP, respectively, using the Omron M6 Comfort device; 2.5±4.6 mmHg and -1.2±4.3 mmHg for the Omron HEM-7420 device; -0.2±5.0 mmHg and 0.4±4.2 mmHg for the Withings BP-800 device; and 3.0±5.3 mmHg and 0.3±5.2 mmHg for the Polygreen KP-7670 device. Omron M6 Comfort, Omron HEM-7420, Withings BP-800, and Polygreen KP-7670 readings differing by less than 5 mmHg, 10 mmHg, and 15 mmHg fulfill the ESH International Protocol Revision 2010 requirements, and therefore are suitable for use by patients for SBPM, if used correctly.

Normal-Mode Analysis of Circular DNA at the Base-Pair Level. 2. Large-Scale Configurational Transformation of a Naturally Curved Molecule.

PubMed

Matsumoto, Atsushi; Tobias, Irwin; Olson, Wilma K

2005-01-01

Fine structural and energetic details embedded in the DNA base sequence, such as intrinsic curvature, are important to the packaging and processing of the genetic material. Here we investigate the internal dynamics of a 200 bp closed circular molecule with natural curvature using a newly developed normal-mode treatment of DNA in terms of neighboring base-pair "step" parameters. The intrinsic curvature of the DNA is described by a 10 bp repeating pattern of bending distortions at successive base-pair steps. We vary the degree of intrinsic curvature and the superhelical stress on the molecule and consider the normal-mode fluctuations of both the circle and the stable figure-8 configuration under conditions where the energies of the two states are similar. To extract the properties due solely to curvature, we ignore other important features of the double helix, such as the extensibility of the chain, the anisotropy of local bending, and the coupling of step parameters. We compare the computed normal modes of the curved DNA model with the corresponding dynamical features of a covalently closed duplex of the same chain length constructed from naturally straight DNA and with the theoretically predicted dynamical properties of a naturally circular, inextensible elastic rod, i.e., an O-ring. The cyclic molecules with intrinsic curvature are found to be more deformable under superhelical stress than rings formed from naturally straight DNA. As superhelical stress is accumulated in the DNA, the frequency, i.e., energy, of the dominant bending mode decreases in value, and if the imposed stress is sufficiently large, a global configurational rearrangement of the circle to the figure-8 form takes place. We combine energy minimization with normal-mode calculations of the two states to decipher the configurational pathway between the two states. We also describe and make use of a general analytical treatment of the thermal fluctuations of an elastic rod to characterize the motions of the minicircle as a whole from knowledge of the full set of normal modes. The remarkable agreement between computed and theoretically predicted values of the average deviation and dispersion of the writhe of the circular configuration adds to the reliability in the computational approach. Application of the new formalism to the computed modes of the figure-8 provides insights into macromolecular motions which are beyond the scope of current theoretical treatments.

Development of a Generic PCR Detection of 3-Acetyldeoxy-nivalenol-, 15-Acetyldeoxynivalenol- and Nivalenol-Chemotypes of Fusarium graminearum Clade

PubMed Central

Wang, Jian-Hua; Li, He-Ping; Qu, Bo; Zhang, Jing-Bo; Huang, Tao; Chen, Fang-Fang; Liao, Yu-Cai

2008-01-01

Fusarium graminearum clade pathogens cause Fusarium head blight (FHB) or scab of wheat and other small cereal grains, producing different kinds of trichothecene mycotoxins that are detrimental to human and domestic animals. Type B trichothecene mycotoxins such as deoxynivalenol, 3-acetyldeoxynivalenol (3-AcDON), 15-acetyldeoxynivalenol (15-AcDON) and nivalenol (NIV) are the principal Fusarium mycotoxins reported in China, as well as in other countries. A genomic polymerase chain reaction (PCR) to predict chemotypes was developed based on the structural gene sequences of Tri13 genes involved in trichothecene mycotoxin biosynthesis pathways. A single pair of primers derived from the Tri13 genes detected a 583 bp fragment from 15-AcDON-chemotypes, a 644 bp fragment from 3-AcDON-chemotypes and an 859 bp fragment from NIV-producing strains. Fusarium strains from China, Nepal, USA and Europe were identified by this method, revealing their mycotoxin chemotypes identical to that obtained by chemical analyses of HPLC or GC/MS and other PCR assays. The mycotoxin chemotype-specific fragments were amplified from a highly variable region located in Tri13 genes with three deletions for 15-AcDON-chemotypes, two deletions for 3-AcDON-chemotypes and no deletion for NIV-producers. This PCR assay generated a single amplicon and thus should be more reliable than other PCR-based assays that showed the absence or presence of a PCR fragment since these assays may generate false-negative results. The results with strains from several different countries as well as from different hosts further indicated that this method should be globally applicable. This is a rapid, reliable and cost-effective method for the identification of type B trichothecene mycotoxin chemotypes in Fusarium species and food safety controls. PMID:19330088

Chloroplast Genome Evolution in Early Diverged Leptosporangiate Ferns

PubMed Central

Kim, Hyoung Tae; Chung, Myong Gi; Kim, Ki-Joong

2014-01-01

In this study, the chloroplast (cp) genome sequences from three early diverged leptosporangiate ferns were completed and analyzed in order to understand the evolution of the genome of the fern lineages. The complete cp genome sequence of Osmunda cinnamomea (Osmundales) was 142,812 base pairs (bp). The cp genome structure was similar to that of eusporangiate ferns. The gene/intron losses that frequently occurred in the cp genome of leptosporangiate ferns were not found in the cp genome of O. cinnamomea. In addition, putative RNA editing sites in the cp genome were rare in O. cinnamomea, even though the sites were frequently predicted to be present in leptosporangiate ferns. The complete cp genome sequence of Diplopterygium glaucum (Gleicheniales) was 151,007 bp and has a 9.7 kb inversion between the trnL-CAA and trnV-GCA genes when compared to O. cinnamomea. Several repeated sequences were detected around the inversion break points. The complete cp genome sequence of Lygodium japonicum (Schizaeales) was 157,142 bp and a deletion of the rpoC1 intron was detected. This intron loss was shared by all of the studied species of the genus Lygodium. The GC contents and the effective numbers of co-dons (ENCs) in ferns varied significantly when compared to seed plants. The ENC values of the early diverged leptosporangiate ferns showed intermediate levels between eusporangiate and core leptosporangiate ferns. However, our phylogenetic tree based on all of the cp gene sequences clearly indicated that the cp genome similarity between O. cinnamomea (Osmundales) and eusporangiate ferns are symplesiomorphies, rather than synapomorphies. Therefore, our data is in agreement with the view that Osmundales is a distinct early diverged lineage in the leptosporangiate ferns. PMID:24823358

Chloroplast genome evolution in early diverged leptosporangiate ferns.

PubMed

Kim, Hyoung Tae; Chung, Myong Gi; Kim, Ki-Joong

2014-05-01

In this study, the chloroplast (cp) genome sequences from three early diverged leptosporangiate ferns were completed and analyzed in order to understand the evolution of the genome of the fern lineages. The complete cp genome sequence of Osmunda cinnamomea (Osmundales) was 142,812 base pairs (bp). The cp genome structure was similar to that of eusporangiate ferns. The gene/intron losses that frequently occurred in the cp genome of leptosporangiate ferns were not found in the cp genome of O. cinnamomea. In addition, putative RNA editing sites in the cp genome were rare in O. cinnamomea, even though the sites were frequently predicted to be present in leptosporangiate ferns. The complete cp genome sequence of Diplopterygium glaucum (Gleicheniales) was 151,007 bp and has a 9.7 kb inversion between the trnL-CAA and trnVGCA genes when compared to O. cinnamomea. Several repeated sequences were detected around the inversion break points. The complete cp genome sequence of Lygodium japonicum (Schizaeales) was 157,142 bp and a deletion of the rpoC1 intron was detected. This intron loss was shared by all of the studied species of the genus Lygodium. The GC contents and the effective numbers of codons (ENCs) in ferns varied significantly when compared to seed plants. The ENC values of the early diverged leptosporangiate ferns showed intermediate levels between eusporangiate and core leptosporangiate ferns. However, our phylogenetic tree based on all of the cp gene sequences clearly indicated that the cp genome similarity between O. cinnamomea (Osmundales) and eusporangiate ferns are symplesiomorphies, rather than synapomorphies. Therefore, our data is in agreement with the view that Osmundales is a distinct early diverged lineage in the leptosporangiate ferns.

Bacteroides fragilis mobilizable transposon Tn5520 requires a 71 base pair origin of transfer sequence and a single mobilization protein for relaxosome formation during conjugation.

PubMed

Vedantam, Gayatri; Knopf, Sarah; Hecht, David W

2006-01-01

Tn5520 is the smallest known bacterial mobilizable transposon and was isolated from an antibiotic resistant Bacteroides fragilis clinical isolate. When a conjugation apparatus is provided in trans, Tn5520 is mobilized (transferred) efficiently within, and from, both Bacteroides spp. and Escherichia coli. Only two genes are present on Tn5520; one encodes an integrase, and the other a multifunctional mobilization (Mob) protein BmpH. BmpH is essential for Tn5520 mobility. The focus of this study was to identify the Tn5520 origin of conjugative transfer (oriT) and to study BmpH-oriT binding. We delimited the functional Tn5520 oriT to a 71 bp sequence upstream of the bmpH gene. A plasmid vector harbouring this minimal 71 bp oriT was mobilized at the same frequency as that of intact Tn5520. The minimal oriT contains one 17 bp inverted repeat (IR) sequence. We constructed and tested multiple IR mutants and showed that the IR was essential in its entirety for mobilization. A nick site sequence (5'-GCTAC-3') was also identified within the minimal oriT; this sequence resembled nick sites found in plasmids of Gram positive origin. We further showed that mutation of a highly conserved GC dinucleotide in the nick site sequence completely abolished mobilization. We also purified BmpH and showed that it specifically bound a Tn5520 oriT fragment in electrophoretic mobility shift assays. We also identified non-nick site sequences within the minimal oriT that were essential for mobilization. We hypothesize that transposon-based single Mob protein systems may contribute to efficient gene dissemination from Bacteroides spp., because fewer DNA processing proteins are required for relaxosome formation.

Molecular Population Genetics of the Alcohol Dehydrogenase Gene Region of DROSOPHILA MELANOGASTER

PubMed Central

Aquadro, Charles F.; Desse, Susan F.; Bland, Molly M.; Langley, Charles H.; Laurie-Ahlberg, Cathy C.

1986-01-01

Variation in the DNA restriction map of a 13-kb region of chromosome II including the alcohol dehydrogenase structural gene (Adh) was examined in Drosophila melanogaster from natural populations. Detailed analysis of 48 D. melanogaster lines representing four eastern United States populations revealed extensive DNA sequence variation due to base substitutions, insertions and deletions. Cloning of this region from several lines allowed characterization of length variation as due to unique sequence insertions or deletions [nine sizes; 21–200 base pairs (bp)] or transposable element insertions (several sizes, 340 bp to 10.2 kb, representing four different elements). Despite this extensive variation in sequences flanking the Adh gene, only one length polymorphism is clearly associated with altered Adh expression (a copia element approximately 250 bp 5' to the distal transcript start site). Nonetheless, the frequency spectra of transposable elements within and between Drosophila species suggests they are slightly deleterious. Strong nonrandom associations are observed among Adh region sequence variants, ADH allozyme (Fast vs. Slow), ADH enzyme activity and the chromosome inversion ln(2L) t. Phylogenetic analysis of restriction map haplotypes suggest that the major twofold component of ADH activity variation (high vs. low, typical of Fast and Slow allozymes, respectively) is due to sequence variation tightly linked to and possibly distinct from that underlying the allozyme difference. The patterns of nucleotide and haplotype variation for Fast and Slow allozyme lines are consistent with the recent increase in frequency and spread of the Fast haplotype associated with high ADH activity. These data emphasize the important role of evolutionary history and strong nonrandom associations among tightly linked sequence variation as determinants of the patterns of variation observed in natural populations. PMID:3026893

Typing SNP based on the near-infrared spectroscopy and artificial neural network

NASA Astrophysics Data System (ADS)

Ren, Li; Wang, Wei-Peng; Gao, Yu-Zhen; Yu, Xiao-Wei; Xie, Hong-Ping

2009-07-01

Based on the near-infrared spectra (NIRS) of the measured samples as the discriminant variables of their genotypes, the genotype discriminant model of SNP has been established by using back-propagation artificial neural network (BP-ANN). Taking a SNP (857G > A) of N-acetyltransferase 2 (NAT2) as an example, DNA fragments containing the SNP site were amplified by the PCR method based on a pair of primers to obtain the three-genotype (GG, AA, and GA) modeling samples. The NIRS-s of the amplified samples were directly measured in transmission by using quartz cell. Based on the sample spectra measured, the two BP-ANN-s were combined to obtain the stronger ability of the three-genotype classification. One of them was established to compress the measured NIRS variables by using the resilient back-propagation algorithm, and another network established by Levenberg-Marquardt algorithm according to the compressed NIRS-s was used as the discriminant model of the three-genotype classification. For the established model, the root mean square error for the training and the prediction sample sets were 0.0135 and 0.0132, respectively. Certainly, this model could rightly predict the three genotypes (i.e. the accuracy of prediction samples was up to100%) and had a good robust for the prediction of unknown samples. Since the three genotypes of SNP could be directly determined by using the NIRS-s without any preprocessing for the analyzed samples after PCR, this method is simple, rapid and low-cost.

Molecular phylogeny and SNP variation of polar bears (Ursus maritimus), brown bears (U. arctos), and black bears (U. americanus) derived from genome sequences.

PubMed

Cronin, Matthew A; Rincon, Gonzalo; Meredith, Robert W; MacNeil, Michael D; Islas-Trejo, Alma; Cánovas, Angela; Medrano, Juan F

2014-01-01

We assessed the relationships of polar bears (Ursus maritimus), brown bears (U. arctos), and black bears (U. americanus) with high throughput genomic sequencing data with an average coverage of 25× for each species. A total of 1.4 billion 100-bp paired-end reads were assembled using the polar bear and annotated giant panda (Ailuropoda melanoleuca) genome sequences as references. We identified 13.8 million single nucleotide polymorphisms (SNP) in the 3 species aligned to the polar bear genome. These data indicate that polar bears and brown bears share more SNP with each other than either does with black bears. Concatenation and coalescence-based analysis of consensus sequences of approximately 1 million base pairs of ultraconserved elements in the nuclear genome resulted in a phylogeny with black bears as the sister group to brown and polar bears, and all brown bears are in a separate clade from polar bears. Genotypes for 162 SNP loci of 336 bears from Alaska and Montana showed that the species are genetically differentiated and there is geographic population structure of brown and black bears but not polar bears.

The complete chloroplast genome of Capsicum annuum var. glabriusculum using Illumina sequencing.

PubMed

Raveendar, Sebastin; Na, Young-Wang; Lee, Jung-Ro; Shim, Donghwan; Ma, Kyung-Ho; Lee, Sok-Young; Chung, Jong-Wook

2015-07-20

Chloroplast (cp) genome sequences provide a valuable source for DNA barcoding. Molecular phylogenetic studies have concentrated on DNA sequencing of conserved gene loci. However, this approach is time consuming and more difficult to implement when gene organization differs among species. Here we report the complete re-sequencing of the cp genome of Capsicum pepper (Capsicum annuum var. glabriusculum) using the Illumina platform. The total length of the cp genome is 156,817 bp with a 37.7% overall GC content. A pair of inverted repeats (IRs) of 50,284 bp were separated by a small single copy (SSC; 18,948 bp) and a large single copy (LSC; 87,446 bp). The number of cp genes in C. annuum var. glabriusculum is the same as that in other Capsicum species. Variations in the lengths of LSC; SSC and IR regions were the main contributors to the size variation in the cp genome of this species. A total of 125 simple sequence repeat (SSR) and 48 insertions or deletions variants were found by sequence alignment of Capsicum cp genome. These findings provide a foundation for further investigation of cp genome evolution in Capsicum and other higher plants.

Complete mitochondrial genome of Helicoverpa zea (Boddie) and expression profiles of mitochondrial-encoded genes in early and late embryos

USDA-ARS?s Scientific Manuscript database

The mitochondrial genome of the bollworm, Helicoverpa zea, was assembled using paired-end nucleotide sequence reads generated with a next-generation sequencing platform. Assembly resulted in a mitogenome of 15,348 bp with greater than 17,000-fold average coverage. Organization of the H. zea mitogen...

Durability of effect of massage therapy on blood pressure.

PubMed

Givi, Mahshid

2013-05-01

Pre-hypertension is considered as a cardiovascular disease predicator. Management of pre-hypertension is an appropriate objective for clinicians in a wide range of medical centers. Treatment of pre-hypertension is primarily non-pharmacological, one of which is massage therapy that is used to control the BP. This study aimed to evaluate the survival effect of Swedish massage (face, neck, shoulders, and chest) on BP of the women with pre-hypertension. This was a single-blind clinical trial study. Fifty pre-hypertensive women selected by simple random sampling which divided into control and test groups. The test group (25 patients) received Swedish massage 10-15 min, 3 times a week for 10 sessions and the control groups (25 patients) also were relaxed at the same environment with receiving no massage. Their BP was measured before and after each session and 72 h after finishing the massage therapy. Analyzing the data was done using descriptive and inferential statistical methods (Chi- square, Mann-Whitney, paired t-test and Student t-test) through SPSS software. The results indicated that mean systolic and diastolic BP in the massage group was significantly lower in comparison with the control group (P < 0.001). Evaluation of durability of the massage effects on BP also indicated that 72 h after finishing the study, still there was a significant difference between the test and control groups in systolic and diastolic BP (P < 0.001). Findings of the study indicated that massage therapy was a safe, effective, applicable and cost-effective intervention in controlling BP of the pre-hypertension women and it can be used in the health care centers and even at home.

Development and validation of a multiplex conventional PCR assay for simultaneous detection and grouping of porcine bocaviruses.

PubMed

Zheng, Xiaowen; Liu, Gaopeng; Opriessnig, Tanja; Wang, Zining; Yang, Zongqi; Jiang, Yonghou

2016-10-01

Porcine bocavirus (PBoV), a newly described porcine parvovirus, has received attention because it can be commonly identified in clinically affected pigs including pigs with post-weaning multisystemic wasting syndrome (PWMS) and pigs with diarrhea. In recent years, novel PBoVs have been identified and were classified into three genogroups, but the ability to detect and classify these novel PBoVs is not comprehensive to date. In this study, a multiplex conventional PCR assay for simultaneous detection and grouping of PBoVs was developed by screening combinations of mixed primer pairs followed by optimization of the PCR conditions. This method exclusively amplifies targeted fragments of 531bp from the VP1 gene of PBoV G1, 291bp from the NP1 gene of PBoV G2, and 384bp from the NP1/VP1 gene of PBoV G3. The assay has a detection limit of 1.0×10(3)copies/μL for PBoV G1 4.5×10(3) for PBoV G2 and 3.8×10(3) for PBoV G3 based on testing mixed purified plasmid constructs containing the specific viral target fragments. The performance of the multiplex PCR assay was comparable to that of the single PCRs which used the same primer pairs. Using the newly established multiplex PCR assay, 227 field samples including faeces, serum and tissue samples from pigs were investigated. All three PBoV genogroups were detected in the clinical samples with a detection rate of 1.3%, 2.6% and 12.3%, respectively for PBoV G1, G2 and G3. Additionally, coinfections with two or more PBoV were detected in 1.7% of the samples investigated. These results indicate the multiplex PCR assay is specific, sensitive and rapid, and can be used for the detection and differentiation of single and multiple infections of the three PBoV genogroups in pigs. Copyright © 2016 Elsevier B.V. All rights reserved.

Priming affects the activity of a specific region of the promoter of the human beta interferon gene.

PubMed Central

Dron, M; Lacasa, M; Tovey, M G

1990-01-01

Treatment of Daudi or HeLa cells with human interferon (IFN) alpha 8 before induction with either poly(I)-poly(C) or Sendai virus resulted in an 8- to 100-fold increase in IFN production. The extent of priming in Daudi cells paralleled the increase in the intracellular content of IFN-beta mRNA. IFN-alpha mRNA remained undetectable in poly(I)-poly(C)-treated Daudi cells either before or after priming. An IFN-resistant clone of Daudi cells was found to produce 4- to 20-fold more IFN after priming, indicating that priming was unrelated to the phenotype of IFN sensitivity. IFN treatment of either Daudi or HeLa cells transfected with the human IFN-beta promoter (-282 to -37) linked to the chloramphenicol acetyltransferase (CAT) gene resulted in an increase in CAT activity after induction with poly(I)-poly(C) or Sendai virus. A synthetic double-stranded oligonucleotide corresponding to an authentic 30-base-pair (bp) region of the human IFN-beta promoter between positions -91 and -62 was found to confer virus inducibility upon the reporter CAT gene in HeLa cells. IFN treatment of HeLa cells transfected with this 30-bp region of the IFN-beta promoter in either the correct or reversed orientation also increased CAT activity upon subsequent induction. IFN treatment alone had no detectable effect on the activity of either the 30-bp region or the complete human IFN promoter. Images PMID:2153928

ICAM-1-related long non-coding RNA: promoter analysis and expression in human retinal endothelial cells.

PubMed

Lumsden, Amanda L; Ma, Yuefang; Ashander, Liam M; Stempel, Andrew J; Keating, Damien J; Smith, Justine R; Appukuttan, Binoy

2018-05-09

Regulation of intercellular adhesion molecule (ICAM)-1 in retinal endothelial cells is a promising druggable target for retinal vascular diseases. The ICAM-1-related (ICR) long non-coding RNA stabilizes ICAM-1 transcript, increasing protein expression. However, studies of ICR involvement in disease have been limited as the promoter is uncharacterized. To address this issue, we undertook a comprehensive in silico analysis of the human ICR gene promoter region. We used genomic evolutionary rate profiling to identify a 115 base pair (bp) sequence within 500 bp upstream of the transcription start site of the annotated human ICR gene that was conserved across 25 eutherian genomes. A second constrained sequence upstream of the orthologous mouse gene (68 bp; conserved across 27 Eutherian genomes including human) was also discovered. Searching these elements identified 33 matrices predictive of binding sites for transcription factors known to be responsive to a broad range of pathological stimuli, including hypoxia, and metabolic and inflammatory proteins. Five phenotype-associated single nucleotide polymorphisms (SNPs) in the immediate vicinity of these elements included four SNPs (i.e. rs2569693, rs281439, rs281440 and rs11575074) predicted to impact binding motifs of transcription factors, and thus the expression of ICR and ICAM-1 genes, with potential to influence disease susceptibility. We verified that human retinal endothelial cells expressed ICR, and observed induction of expression by tumor necrosis factor-α.

Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

PubMed

Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing

2016-01-01

In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

The Mitochondrial Cytochrome Oxidase Subunit I Gene Occurs on a Minichromosome with Extensive Heteroplasmy in Two Species of Chewing Lice, Geomydoecus aurei and Thomomydoecus minor

PubMed Central

Pietan, Lucas L.; Spradling, Theresa A.

2016-01-01

In animals, mitochondrial DNA (mtDNA) typically occurs as a single circular chromosome with 13 protein-coding genes and 22 tRNA genes. The various species of lice examined previously, however, have shown mitochondrial genome rearrangements with a range of chromosome sizes and numbers. Our research demonstrates that the mitochondrial genomes of two species of chewing lice found on pocket gophers, Geomydoecus aurei and Thomomydoecus minor, are fragmented with the 1,536 base-pair (bp) cytochrome-oxidase subunit I (cox1) gene occurring as the only protein-coding gene on a 1,916–1,964 bp minicircular chromosome in the two species, respectively. The cox1 gene of T. minor begins with an atypical start codon, while that of G. aurei does not. Components of the non-protein coding sequence of G. aurei and T. minor include a tRNA (isoleucine) gene, inverted repeat sequences consistent with origins of replication, and an additional non-coding region that is smaller than the non-coding sequence of other lice with such fragmented mitochondrial genomes. Sequences of cox1 minichromosome clones for each species reveal extensive length and sequence heteroplasmy in both coding and noncoding regions. The highly variable non-gene regions of G. aurei and T. minor have little sequence similarity with one another except for a 19-bp region of phylogenetically conserved sequence with unknown function. PMID:27589589

Molecular DNA-based detection of ionising radiation in meat.

PubMed

Şakalar, Ergün

2017-05-01

Ionising radiation induces molecular alterations, such as formation of ions, free radicals, and new stable molecules, and cleavage of the chemical bonds of the molecules present in food. Irradiation-treated meat should be labelled to control the process and to ensure free consumer choice. Therefore, sensitive analytical methods are required to detect the irradiation dose. Meat samples were exposed to radiation doses of 0, 0.272, 0.497, 1.063, 3.64, 8.82 and 17.42 kGy in an industrial 60 Co gamma cell. Primers were designed to amplify 998, 498 and 250-base pair (bp) regions of the 18S rRNA gene of nuclear DNA from the irradiated samples. A new DNA-based method was developed to quantify the radiation exposed to the unstored meat and the meat stored at -20 °C for 3 and 6 months. The method was able to detect meat samples stored and unstored with dose limits of 1.063 and 3.64 kGy, respectively. The level of irradiation can be detected using primer pairs that target particularly different-sized sequences for DNA amplification by PCR. This method can be widely used for the analysis of not only meat samples, but also all biological materials containing DNA. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

The complete chloroplast genome sequence of Mahonia bealei (Berberidaceae) reveals a significant expansion of the inverted repeat and phylogenetic relationship with other angiosperms.

PubMed

Ma, Ji; Yang, Bingxian; Zhu, Wei; Sun, Lianli; Tian, Jingkui; Wang, Xumin

2013-10-10

Mahonia bealei (Berberidaceae) is a frequently-used traditional Chinese medicinal plant with efficient anti-inflammatory ability. This plant is one of the sources of berberine, a new cholesterol-lowering drug with anti-diabetic activity. We have sequenced the complete nucleotide sequence of the chloroplast (cp) genome of M. bealei. The complete cp genome of M. bealei is 164,792 bp in length, and has a typical structure with large (LSC 73,052 bp) and small (SSC 18,591 bp) single-copy regions separated by a pair of inverted repeats (IRs 36,501 bp) of large size. The Mahonia cp genome contains 111 unique genes and 39 genes are duplicated in the IR regions. The gene order and content of M. bealei are almost unarranged which is consistent with the hypothesis that large IRs stabilize cp genome and reduce gene loss-and-gain probabilities during evolutionary process. A large IR expansion of over 12 kb has occurred in M. bealei, 15 genes (rps19, rpl22, rps3, rpl16, rpl14, rps8, infA, rpl36, rps11, petD, petB, psbH, psbN, psbT and psbB) have expanded to have an additional copy in the IRs. The IR expansion rearrangement occurred via a double-strand DNA break and subsequence repair, which is different from the ordinary gene conversion mechanism. Repeat analysis identified 39 direct/inverted repeats 30 bp or longer with a sequence identity ≥ 90%. Analysis also revealed 75 simple sequence repeat (SSR) loci and almost all are composed of A or T, contributing to a distinct bias in base composition. Comparison of protein-coding sequences with ESTs reveals 9 putative RNA edits and 5 of them resulted in non-synonymous modifications in rpoC1, rps2, rps19 and ycf1. Phylogenetic analysis using maximum parsimony (MP) and maximum likelihood (ML) was performed on a dataset composed of 65 protein-coding genes from 25 taxa, which yields an identical tree topology as previous plastid-based trees, and provides strong support for the sister relationship between Ranunculaceae and Berberidaceae. Molecular dating analyses suggest that Ranunculaceae and Berberidaceae diverged between 90 and 84 mya, which is congruent with the fossil records and with recent estimates of the divergence time of these two taxa. © 2013.

Research and Development of Information and Communication Technology-based Home Blood Pressure Monitoring from Morning to Nocturnal Hypertension.

PubMed

Kario, Kazuomi; Tomitani, Naoko; Matsumoto, Yuri; Hamasaki, Haruna; Okawara, Yukie; Kondo, Maiko; Nozue, Ryoko; Yamagata, Hiromi; Okura, Ayako; Hoshide, Satoshi

2016-01-01

Asians have specific characteristics of hypertension (HTN) and its relationship with cardiovascular disease. The morning surge in blood pressure (BP) in Asians is more extended, and the association slope between higher BP and the risk for cardiovascular events is steeper in this population than in whites. Thus, 24-hour BP control including at night and in the morning is especially important for Asian patients with HTN. There are 3 components of "perfect 24-hour BP control": the 24-hour BP level, adequate dipping of nocturnal BP (dipper type), and adequate BP variability such as the morning BP surge. The morning BP-guided approach using home BP monitoring (HBPM) is the first step toward perfect 24-hour BP control. After controlling morning HTN, nocturnal HTN is the second target. We have been developing HBPM that can measure nocturnal BP. First, we developed a semiautomatic HBPM device with the function of automatic fixed-interval BP measurement during sleep. In the J-HOP (Japan Morning Surge Home Blood Pressure) study, the largest nationwide home BP cohort, we successfully measured nocturnal home BP using this device with data memory, 3 times during sleep (2, 3, and 4 am), and found that nocturnal home BP is significantly correlated with organ damage independently of office and morning BP values. The second advance was the development of trigger nocturnal BP (TNP) monitoring with an added trigger function that initiates BP measurements when oxygen desaturation falls below a variable threshold continuously monitored by pulse oximetry. TNP can detect the specific nocturnal BP surges triggered by hypoxic episodes in patients with sleep apnea syndrome. We also added the lowest heart rate-trigger function to TNP to detect the "basal nocturnal BP," which is determined by the circulating volume and structural cardiovascular system without any increase in sympathetic tonus. This double TNP is a novel concept for evaluating the pathogenic pressor mechanism of nocturnal BP. These data are now collected using an information and communication technology (ICT)-based monitoring system. The BP variability includes different time-phase variability from the shortest beat-by-beat, positional, diurnal, day-by-day, visit-to-visit, seasonal, and the longest yearly changes. The synergistic resonance of each type of BP variability would produce great dynamic BP surges, which trigger cardiovascular events. Thus, in the future, the management of HTN based on the simultaneous assessment of the resonance of all of the BP variability phenotypes using a wearable "surge" BP monitoring device with an ICT-based data analysis system will contribute to the ultimate individualized medication for cardiovascular disease. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Development of a species-diagnostic marker and its application for population genetics studies of the stingless bee Trigona collina in Thailand.

PubMed

Theeraapisakkun, M; Klinbunga, S; Sittipraneed, S

2010-05-18

A molecular maker for authenticating species origin of the stingless bee (Trigona collina) was developed. Initially, amplified fragment length polymorphism analysis was made of 11 stingless bee species using 64 primer combinations. A 316-bp band found only in T. collina was cloned and sequenced. A primer pair (CUTc1-F/R) was designed and tested for species-specificity in 15 stingless bee species (239 nests). The expected 259-bp fragment was consistently amplified in all T. collina individuals (134/134 nests, 100%). Cross-species amplification was observed in T. pagdeni (43/51 nests; 84.3%), but not in other species. SSCP analysis of CUTc1 unambiguously differentiated T. collina from T. pagdeni. CUTc1 generated three genotypes in Thai T. collina (134 nests). An AA (259/259 bp) genotype was found in all stingless bees from the north (21 nests) and northeast (32 nests), and 23/28 nests from the Central region, whereas a BB (253/253 bp) genotype was observed in most samples from peninsular Thailand (42/53 nests). Heterozygotes exhibiting the AB (253/259 bp) genotype were observed in 5 of 28 nests from Prachuap Khiri Khan located slightly above the Kra ecotone and 11 of 53 nests originated further south of the Kra ecotone. Genotype distribution patterns of CUTc1 clearly indicated intraspecific population differentiation of Thai T. collina.

The genome and transcriptome of perennial ryegrass mitochondria

PubMed Central

2013-01-01

Background Perennial ryegrass (Lolium perenne L.) is one of the most important forage and turf grass species of temperate regions worldwide. Its mitochondrial genome is inherited maternally and contains genes that can influence traits of agricultural importance. Moreover, the DNA sequence of mitochondrial genomes has been established and compared for a large number of species in order to characterize evolutionary relationships. Therefore, it is crucial to understand the organization of the mitochondrial genome and how it varies between and within species. Here, we report the first de novo assembly and annotation of the complete mitochondrial genome from perennial ryegrass. Results Intact mitochondria from perennial ryegrass leaves were isolated and used for mtDNA extraction. The mitochondrial genome was sequenced to a 167-fold coverage using the Roche 454 GS-FLX Titanium platform, and assembled into a circular master molecule of 678,580 bp. A total of 34 proteins, 14 tRNAs and 3 rRNAs are encoded by the mitochondrial genome, giving a total gene space of 48,723 bp (7.2%). Moreover, we identified 149 open reading frames larger than 300 bp and covering 67,410 bp (9.93%), 250 SSRs, 29 tandem repeats, 5 pairs of large repeats, and 96 pairs of short inverted repeats. The genes encoding subunits of the respiratory complexes – nad1 to nad9, cob, cox1 to cox3 and atp1 to atp9 – all showed high expression levels both in absolute numbers and after normalization. Conclusions The circular master molecule of the mitochondrial genome from perennial ryegrass presented here constitutes an important tool for future attempts to compare mitochondrial genomes within and between grass species. Our results also demonstrate that mitochondria of perennial ryegrass contain genes crucial for energy production that are well conserved in the mitochondrial genome of monocotyledonous species. The expression analysis gave us first insights into the transcriptome of these mitochondrial genes in perennial ryegrass. PMID:23521852

A multiplex reverse transcription-nested polymerase chain reaction for detection and differentiation of wild-type and vaccine strains of canine distemper virus

PubMed Central

2010-01-01

A multiplex reverse transcription-nested polymerase chain reaction (RT-nPCR) method was developed for the detection and differentiation of wild-type and vaccine strains of canine distemper virus (CDV). A pair of primers (P1 and P4) specific for CDV corresponding to the highly conserved region of the CDV genome were used as a common primer pair in the first-round PCR of the nested PCR. Primers P2 specific for CDV wild-type strains, were used as the forward primer together with the common reverse primer P4 in the second round of nested PCR. Primers P3, P5 specific for CDV wild-type strain or vaccine strain, were used as the forward primer together with the common reverse primer P4+P6 in the second round of nested PCR. A fragment of 177 bp was amplified from vaccine strain genomic RNA, and a fragment of 247 bp from wild-type strain genomic RNA in the RT-nPCR, and two fragments of 247 bp and 177 bp were amplified from the mixed samples of vaccine and wild-type strains. No amplification was achieved for uninfected cells, or cells infected with Newcastle disease virus (NDV), canine parvovirus (CPV), canine coronavirus (CCV), rabies virus (RV), or canine adenovirus (CAV). The RT-nPCR method was used to detect 30 field samples suspected of canine distemper from Heilongjiang and Jilin Provinces, and 51 samples in Shandong province. As a result of 30 samples, were found to be wild-type-like, and 5 to be vaccine-strain-like. The RT-nPCR method can be used to effectively detect and differentiate wild-type CDV-infected dogs from dogs vaccinated with CDV vaccine, and thus can be used in clinical detection and epidemiological surveillance. PMID:20433759

Complete chloroplast genome sequence of green foxtail (Setaria viridis), a promising model system for C4 photosynthesis.

PubMed

Wang, Shuo; Gao, Li-Zhi

2016-09-01

The complete chloroplast genome of green foxtail (Setaria viridis), a promising model system for C4 photosynthesis, is first reported in this study. The genome harbors a large single copy (LSC) region of 81 016 bp and a small single copy (SSC) region of 12 456  bp separated by a pair of inverted repeat (IRa and IRb) regions of 22 315 bp. GC content is 38.92%. The proportion of coding sequence is 57.97%, comprising of 111 (19 duplicated in IR regions) unique genes, 71 of which are protein-coding genes, four are rRNA genes, and 36 are tRNA genes. Phylogenetic analysis indicated that S. viridis was clustered with its cultivated species S. italica in the tribe Paniceae of the family Poaceae. This newly determined chloroplast genome will provide valuable genetic resources to assist future studies on C4 photosynthesis in grasses.

Norrie disease gene sequence variants in an ethnically diverse population with retinopathy of prematurity.

PubMed

Hutcheson, Kelly A; Paluru, Prasuna C; Bernstein, Steven L; Koh, Jamie; Rappaport, Eric F; Leach, Richard A; Young, Terri L

2005-07-14

Retinopathy of prematurity (ROP) is a leading cause of visual loss in the pediatric population. Mutations in the Norrie disease gene (NDP) are associated with heritable retinal vascular disorders, and have been found in a small subset of patients with severe retinopathy of prematurity. Varying rates of progression to threshold disease in different races may have a genetic basis, as recent studies suggest that the incidence of NDP mutations may vary in different groups. African Americans, for example, are less likely to develop severe degrees of ROP. We screened a large cohort of ethnically diverse patients for mutations in the entire NDP. A total of 143 subjects of different ethnic backgrounds were enrolled in the study. Fifty-four patients had severe ROP (Stage 3 or worse). Of these, 38 were threshold in at least one eye (with a mean gestational age of 26.1 weeks and mean birth weight of 788.4 g). There were 36 patients with mild or no ROP, 31 parents with no history of retinal disease or prematurity, and 22 wild type (normal) controls. There were 70 African American subjects, 55 Caucasians, and 18 of other races. Severe ROP was noted in 29 African American subjects, 17 Caucasians, and 8 of other races. Seven polymerase chain reaction primer pairs spanning the NDP were optimized for denaturing high performance liquid chromatography and direct sequencing. Three primer pairs covered the coding region, and the remaining four spanned the 3' and 5' untranslated regions (UTR). Six of 54 (11%) infants with severe ROP had polymorphisms in the NDP. Five of the infants were African American, and one was Caucasian. Two parents were heterozygous for the same polymorphism as their child. One parent-child pair had a single base pair (bp) insertion in the 3' UTR region. Another parent-child pair had two mutations: a 14 bp deletion in the 5' UTR region of exon 1 and a single nucleotide polymorphism in the 5' UTR region of exon 2. No coding region sequence changes were found. No polymorphisms were observed in infants with mild or no ROP, or in the wild type controls. Of the six sequence alterations found, five were novel nucleotide changes: One in the 5' UTR region of exon 2, and four in the 3' UTR region of exon 3. The extent of NDP polymorphisms in this large, racially diverse group of infants is moderate. NDP polymorphisms may play a role in the pathogenesis of ROP, but do not appear to be a major causative factor.

Intronic deletions in the SLC34A3 gene: A cautionary tale for mutation analysis of hereditary hypophosphatemic rickets with hypercalciuria

PubMed Central

Ichikawa, Shoji; Tuchman, Shamir; Padgett, Leah R.; Gray, Amie K.; Baluarte, H. Jorge; Econs, Michael J.

2013-01-01

Hereditary hypophosphatemic rickets with hypercalciuria (HHRH) is a rare metabolic disorder, characterized by hypophosphatemia, variable degrees of rickets/osteomalacia, and hypercalciuria secondary to increased serum 1,25-dihydroxyvitamin D [1,25(OH)2D] levels. HHRH is caused by mutations in the SLC34A3 gene, which encodes sodium-phosphate co-transporter type IIc. A 6 ½-year-old female presented with a history of nephrolithiasis. Her metabolic evaluation revealed increased 24- hour urine calcium excretion with high serum calcium, low intact parathyroid hormone (PTH) levels, and elevated 1,25(OH)2D level. In addition, the patient had low to low-normal serum phosphorus with high urine phosphorus. The patient had normal stature; without rachitic or boney deformities or a history of fractures. Genetic analysis of SLC34A3 revealed the patient to be a compound heterozygote for a novel single base pair deletion in exon 12 (c.1304delG) and 30-base pair deletion in intron 6 (g.1440–1469del). The single-base pair mutation causes a frameshift, which results in premature stop codon. The intronic deletion is likely caused by misalignment of the 4-basepair homologous repeats and results in the truncation of an already small intron to 63 bp, which would impair proper RNA splicing of the intron. This is the fourth unique intronic deletion identified in patients with HHRH, suggesting the frequent occurrence of sequence misalignments in SLC34A3 and the importance of screening introns in patients with HHRH. PMID:24176905

Intronic deletions in the SLC34A3 gene: a cautionary tale for mutation analysis of hereditary hypophosphatemic rickets with hypercalciuria.

PubMed

Ichikawa, Shoji; Tuchman, Shamir; Padgett, Leah R; Gray, Amie K; Baluarte, H Jorge; Econs, Michael J

2014-02-01

Hereditary hypophosphatemic rickets with hypercalciuria (HHRH) is a rare metabolic disorder, characterized by hypophosphatemia, variable degrees of rickets/osteomalacia, and hypercalciuria secondary to increased serum 1,25-dihydroxyvitamin D [1,25(OH)2D] levels. HHRH is caused by mutations in the SLC34A3 gene, which encodes sodium-phosphate co-transporter type IIc. A 6-1/2-year-old female presented with a history of nephrolithiasis. Her metabolic evaluation revealed increased 24-hour urine calcium excretion with high serum calcium, low intact parathyroid hormone (PTH), and elevated 1,25(OH)2D. In addition, the patient had low to low-normal serum phosphorus with high urine phosphorus. The patient had normal stature; without rachitic or boney deformities or a history of fractures. Genetic analysis of SLC34A3 revealed the patient to be a compound heterozygote for a novel single base pair deletion in exon 12 (c.1304delG) and 30-base pair deletion in intron 6 (g.1440-1469del). The single-base pair mutation causes a frameshift, which results in premature stop codon. The intronic deletion is likely caused by misalignment of the 4-basepair homologous repeats and results in the truncation of an already small intron to 63bp, which would impair proper RNA splicing of the intron. This is the fourth unique intronic deletion identified in patients with HHRH, suggesting the frequent occurrence of sequence misalignments in SLC34A3 and the importance of screening introns in patients with HHRH. © 2013.

How Y-Family DNA polymerase IV is more accurate than Dpo4 at dCTP insertion opposite an N2-dG adduct of benzo[a]pyrene.

PubMed

Sholder, Gabriel; Creech, Amanda; Loechler, Edward L

2015-11-01

To bypass DNA damage, cells have Y-Family DNA polymerases (DNAPs). One Y-Family-class includes DNAP κ and DNAP IV, which accurately insert dCTP opposite N(2)-dG adducts, including from the carcinogen benzo[a]pyrene (BP). Another class includes DNAP η and DNAP V, which insert accurately opposite UV-damage, but inaccurately opposite BP-N(2)-dG. To investigate structural differences between Y-Family-classes, regions are swapped between DNAP IV (a κ/IV-class-member) and Dpo4 (a η/V-class-member); the kinetic consequences are evaluated via primer-extension studies with a BP-N(2)-dG-containing template. Four key structural elements are revealed. (1) Y-Family DNAPs have discreet non-covalent contacts between their little finger-domain (LF-Domain) and their catalytic core-domain (CC-Domain), which we call "non-covalent bridges" (NCBs). Arg37 and Arg38 in DNAP IV's CC-Domain near the active site form a non-covalent bridge (AS-NCB) by interacting with Glu251 and Asp252, respectively, in DNAP IV's LF-Domain. Without these interactions dATP/dGTP/dTTP misinsertions increase. DNAP IV's AS-NCB suppresses misinsertions better than Dpo4's equivalent AS-NCB. (2) DNAP IV also suppresses dATP/dGTP/dTTP misinsertions via a second non-covalent bridge, which is ∼8Å from the active site (Distal-NCB). Dpo4 has no Distal-NCB, rendering it inferior at dATP/dGTP/dTTP suppression. (3) dCTP insertion is facilitated by the larger minor groove opening near the active site in DNAP IV versus Dpo4, which is sensible given that Watson/Crick-like [dCTP:BP-N(2)-dG] pairing requires the BP-moiety to be in the minor groove. (4) Compared to Dpo4, DNAP IV has a smaller major groove opening, which suppresses dGTP misinsertion, implying BP-N(2)-dG bulk in the major groove during Hoogsteen syn-adduct-dG:dGTP pairing. In summary, DNAP IV has a large minor groove opening to enhance dCTP insertion, a plugged major groove opening to suppress dGTP misinsertion, and two non-covalent bridges (near and distal to the active site) to suppress dATP/dGTP/dTTP misinsertions; collectively these four structural features enhance DNAP IV's dNTP insertion fidelity opposite a BP-N(2)-dG adduct compared to Dpo4. Copyright © 2015 Elsevier B.V. All rights reserved.

[Characteristics of hypotensive effect in patients with arterial hypertension and desaturation signs of obstructive sleep apnea syndrome during sleep].

PubMed

Zelveian, P A; Oshchepkova, E V; Buniatian, M S; Rogoza, A N

2004-01-01

To estimate the efficacy of 8-week antihypertensive monotherapy in patients with arterial hypertension (AH) regarding the presence of obstructive sleep apnea syndrome (OSAS). We analysed the results of 24-h blood pressure (BP) monitoring of 26 inpatients (mean age 54 +/- 2 years) with mild (n = 18) and moderate (n = 8) AH before and after 8 weeks of treatment with 5-10 mg amlodipine or 50-100 mg of losartan once daily to assess blood pressure profile parameters. The patients underwent nocturnal monitoring of arterial oxygen saturation (pulsoximeter NONIN-8500 M, USA). The presence of OSAS was confirmed when a characteristic clinical picture was combined with the presence of significant (> 4%) sleep desaturation episodes > 15 episodes per hour or the presence of group desaturation episodes below 90%. Seven hypertensive patients with OSAS were assigned to group 1, nineteen patients without OSAS--to group 2. The differences in estimated parameters between the groups were tested by Mann-Whitney U test, the dynamics of BP profile parameters--by Wilcoxon matched pairs test. In group 1 there were no significant differences by most of BP profile parameters before and after antihypertensive treatment, except mean nocturnal systolic BP. In group 2 a significant hypotensive effect was seen by all parameters of BP profile except BP variability. Hypotensive efficacy in group 2 was 1.5-2 times higher vs group 1, but the difficulties were not significant. Antihypertensive therapy in hypertensive patients with OSAS is less effective than in those without OSAS but it is not uneffective.

Understanding the impact of the central atom on the ionic liquid behavior: phosphonium vs ammonium cations.

PubMed

Carvalho, Pedro J; Ventura, Sónia P M; Batista, Marta L S; Schröder, Bernd; Gonçalves, Fernando; Esperança, José; Mutelet, Fabrice; Coutinho, João A P

2014-02-14

The influence of the cation's central atom in the behavior of pairs of ammonium- and phosphonium-based ionic liquids was investigated through the measurement of densities, viscosities, melting temperatures, activity coefficients at infinite dilution, refractive indices, and toxicity against Vibrio fischeri. All the properties investigated are affected by the cation's central atom nature, with ammonium-based ionic liquids presenting higher densities, viscosities, melting temperatures, and enthalpies. Activity coefficients at infinite dilution show the ammonium-based ionic liquids to present slightly higher infinite dilution activity coefficients for non-polar solvents, becoming slightly lower for polar solvents, suggesting that the ammonium-based ionic liquids present somewhat higher polarities. In good agreement these compounds present lower toxicities than the phosphonium congeners. To explain this behavior quantum chemical gas phase DFT calculations were performed on isolated ion pairs at the BP-TZVP level of theory. Electronic density results were used to derive electrostatic potentials of the identified minimum conformers. Electrostatic potential-derived CHelpG and Natural Population Analysis charges show the P atom of the tetraalkylphosphonium-based ionic liquids cation to be more positively charged than the N atom in the tetraalkylammonium-based analogous IL cation, and a noticeable charge delocalization occurring in the tetraalkylammonium cation, when compared with the respective phosphonium congener. It is argued that this charge delocalization is responsible for the enhanced polarity observed on the ammonium based ionic liquids explaining the changes in the thermophysical properties observed.

Understanding the impact of the central atom on the ionic liquid behavior: Phosphonium vs ammonium cations

NASA Astrophysics Data System (ADS)

Carvalho, Pedro J.; Ventura, Sónia P. M.; Batista, Marta L. S.; Schröder, Bernd; Gonçalves, Fernando; Esperança, José; Mutelet, Fabrice; Coutinho, João A. P.

2014-02-01

The influence of the cation's central atom in the behavior of pairs of ammonium- and phosphonium-based ionic liquids was investigated through the measurement of densities, viscosities, melting temperatures, activity coefficients at infinite dilution, refractive indices, and toxicity against Vibrio fischeri. All the properties investigated are affected by the cation's central atom nature, with ammonium-based ionic liquids presenting higher densities, viscosities, melting temperatures, and enthalpies. Activity coefficients at infinite dilution show the ammonium-based ionic liquids to present slightly higher infinite dilution activity coefficients for non-polar solvents, becoming slightly lower for polar solvents, suggesting that the ammonium-based ionic liquids present somewhat higher polarities. In good agreement these compounds present lower toxicities than the phosphonium congeners. To explain this behavior quantum chemical gas phase DFT calculations were performed on isolated ion pairs at the BP-TZVP level of theory. Electronic density results were used to derive electrostatic potentials of the identified minimum conformers. Electrostatic potential-derived CHelpG and Natural Population Analysis charges show the P atom of the tetraalkylphosphonium-based ionic liquids cation to be more positively charged than the N atom in the tetraalkylammonium-based analogous IL cation, and a noticeable charge delocalization occurring in the tetraalkylammonium cation, when compared with the respective phosphonium congener. It is argued that this charge delocalization is responsible for the enhanced polarity observed on the ammonium based ionic liquids explaining the changes in the thermophysical properties observed.

Species-Specific Detection of Mycosphaerella polygoni-cuspidati as a Biological Control Agent for Fallopia japonica by PCR Assay.

PubMed

Kurose, Daisuke; Furuya, Naruto; Saeki, Tetsuya; Tsuchiya, Kenichi; Tsushima, Seiya; Seier, Marion K

2016-10-01

The ascomycete fungus Mycosphaerella polygoni-cuspidati has been undergoing evaluation as a potential classical biological control agent for the invasive weed Fallopia japonica (Japanese knotweed), which has become troublesome in Europe and North America. In advance of the potential release of a biocontrol agent into a new environment, it is crucial to develop an effective monitoring system to enable the evaluation of agent establishment and dispersal within the target host population, as well as any potential attacks on non-target species. Therefore, a primer pair was designed for direct, rapid, and specific detection of the Japanese knotweed pathogen M. polygoni-cuspidati based on the sequences of the internal transcribed spacer regions including the 5.8S rDNA. A PCR product of approximately 298 bp was obtained only when the DNA extracted from mycelial fragments of M. polygoni-cuspidati was used. The lower limit of detection of the PCR method was 100 fg of genomic DNA. Using the specific primer pair, M. polygoni-cuspidati could be detected from both naturally and artificially infected Japanese knotweed plants. No amplification was observed for other Mycosphaerella spp. or fungal endophytes isolated from F. japonica. The designed primer pair is thus effective for the specific detection of M. polygoni-cuspidati in planta.

Team-Based Care with Pharmacists to Improve Blood Pressure: a Review of Recent Literature.

PubMed

Kennelty, Korey A; Polgreen, Linnea A; Carter, Barry L

2018-01-18

We review studies published since 2014 that examined team-based care strategies and involved pharmacists to improve blood pressure (BP). We then discuss opportunities and challenges to sustainment of team-based care models in primary care clinics. Multiple studies presented in this review have demonstrated that team-based care including pharmacists can improve BP management. Studies highlighted the cost-effectiveness of a team-based pharmacy intervention for BP control in primary care clinics. Little information was found on factors influencing sustainability of team-based care interventions to improve BP control. Future work is needed to determine the best populations to target with team-based BP programs and how to implement team-based approaches utilizing pharmacists in diverse clinical settings. Future studies need to not only identify unmet clinical needs but also address reimbursement issues and stakeholder engagement that may impact sustainment of team-based care interventions.

Differences between office and 24-hour blood pressure control in hypertensive patients with CKD: A 5,693-patient cross-sectional analysis from Spain.

PubMed

Gorostidi, Manuel; Sarafidis, Pantelis A; de la Sierra, Alejandro; Segura, Julian; de la Cruz, Juan J; Banegas, Jose R; Ruilope, Luis M

2013-08-01

Previous studies have examined control rates of office blood pressure (BP) in chronic kidney disease (CKD). However, recent evidence suggests major discrepancies between office and 24-hour BP values in hypertensive populations. This study examined concordance/discordance between office- and ambulatory-based BP control in a large cohort of patients with CKD. Cross-sectional. 5,693 hypertensive individuals with CKD stages 1-5 from the Spanish ABPM (ambulatory BP monitoring) Registry. Thresholds of 140/90 and 130/80 mm Hg for office BP and 24-hour ambulatory BP, respectively. Age, sex, body mass index, waist circumference, hypertension duration, kidney measures, diabetes, dyslipidemia, target-organ damage, and cardiovascular comorbid conditions. Misclassification of BP control as "white-coat" hypertension (office BP ≥140/90 mm Hg, 24-hour BP <130/80 mm Hg) or masked hypertension (office BP <140/90 mm Hg, 24-hour BP ≥130/80 mm Hg). Standardized office-based BP and 24-hour ABPM. Mean age was 61.0 ± 13.9 (SD) years and 52.6% were men. The proportion with white-coat hypertension was 28.8% (36.8% of patients with office BP ≥140/90 mm Hg) and that of masked hypertension was 7.0% (but 32.1% of patients with office BP <140/90 mm Hg). Female sex, aging, obesity, and target-organ damage were associated with white-coat hypertension; aging and obesity were associated with masked hypertension. Only 21.7% and 8.1% of the CKD population had office BP <140/90 and <130/80 mm Hg, respectively. In contrast, 43.5% of individuals had average 24-hour BP <130/80 mm Hg. Cross-sectional design, longitudinal associations cannot be established. Misclassification of BP control at the office was observed in 1 of 3 hypertensive patients with CKD. Ambulatory-based control rates were far better than office-based rates. Nevertheless, the burden of uncontrolled ambulatory BP and misclassification of BP control at the office constitutes a call for wider use of ABPM to evaluate the success of hypertension treatment in patients with CKD. Copyright © 2013 National Kidney Foundation, Inc. Published by Elsevier Inc. All rights reserved.

Development and Validation of a Multiplex Reverse Transcription PCR Assay for Simultaneous Detection of Three Papaya Viruses

PubMed Central

Tuo, Decai; Shen, Wentao; Yang, Yong; Yan, Pu; Li, Xiaoying; Zhou, Peng

2014-01-01

Papaya ringspot virus (PRSV), Papaya leaf distortion mosaic virus (PLDMV), and Papaya mosaic virus (PapMV) produce similar symptoms in papaya. Each threatens commercial production of papaya on Hainan Island, China. In this study, a multiplex reverse transcription PCR assay was developed to detect simultaneously these three viruses by screening combinations of mixed primer pairs and optimizing the multiplex RT-PCR reaction conditions. A mixture of three specific primer pairs was used to amplify three distinct fragments of 613 bp from the P3 gene of PRSV, 355 bp from the CP gene of PLDMV, and 205 bp from the CP gene of PapMV, demonstrating the assay’s specificity. The sensitivity of the multiplex RT-PCR was evaluated by showing plasmids containing each of the viral target genes with 1.44 × 103, 1.79 × 103, and 1.91 × 102 copies for the three viruses could be detected successfully. The multiplex RT-PCR was applied successfully for detection of three viruses from 341 field samples collected from 18 counties of Hainan Island, China. Rates of single infections were 186/341 (54.5%), 93/341 (27.3%), and 3/341 (0.9%), for PRSV, PLDMV, and PapMV, respectively; 59/341 (17.3%) of the samples were co-infected with PRSV and PLDMV, which is the first time being reported in Hainan Island. This multiplex RT-PCR assay is a simple, rapid, sensitive, and cost-effective method for detecting multiple viruses in papaya and can be used for routine molecular diagnosis and epidemiological studies in papaya. PMID:25337891

Cloning of a cDNA encoding 1-aminocyclopropane-1-carboxylate synthase and expression of its mRNA in ripening apple fruit.

PubMed

Dong, J G; Kim, W T; Yip, W K; Thompson, G A; Li, L; Bennett, A B; Yang, S F

1991-08-01

1-Aminocyclopropane-1-carboxylate (ACC) synthase (EC 4.4.1.14) purified from apple (Malus sylvestris Mill.) fruit was subjected to trypsin digestion. Following separation by reversed-phase high-pressure liquid chromatography, ten tryptic peptides were sequenced. Based on the sequences of three tryptic peptides, three sets of mixed oligonucleotide probes were synthesized and used to screen a plasmid cDNA library prepared from poly(A)(+) RNA of ripe apple fruit. A 1.5-kb (kilobase) cDNA clone which hybridized to all three probes were isolated. The clone contained an open reading frame of 1214 base pairs (bp) encoding a sequence of 404 amino acids. While the polyadenine tail at the 3'-end was intact, it lacked a portion of sequence at the 5'-end. Using the RNA-based polymerase chain reaction, an additional sequence of 148 bp was obtained at the 5'-end. Thus, 1362 bp were sequenced and they encode 454 amino acids. The deduced amino-acid sequence contained peptide sequences corresponding to all ten tryptic fragments, confirming the identity of the cDNA clone. Comparison of the deduced amino-acid sequence between ACC synthase from apple fruit and those from tomato (Lycopersicon esculentum Mill.) and winter squash (Cucurbita maxima Duch.) fruits demonstrated the presence of seven highly conserved regions, including the previously identified region for the active site. The size of the translation product of ACC-synthase mRNA was similar to that of the mature protein on sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), indicating that apple ACC-synthase undergoes only minor, if any, post-translational proteolytic processing. Analysis of ACC-synthase mRNA by in-vitro translation-immunoprecipitation, and by Northern blotting indicates that the ACC-synthase mRNA was undetectable in unripe fruit, but was accumulated massively during the ripening proccess. These data demonstrate that the expression of the ACC-synthase gene is developmentally regulated.

Cytochrome P450 1C1 complementary DNA cloning, sequence analysis and constitutive expression induced by benzo-a-pyrene in Nile tilapia (Oreochromis niloticus).

PubMed

Hassanin, Abeer A I; Kaminishi, Yoshino; Funahashi, Aki; Itakura, Takao

2012-03-01

CYP1C is the newest member of the CYP1 family of P450s; however, its physiological significance, inducers, and metabolic functions are unknown. In this study, a new complementary DNA of the CYP1C subfamily encoding CYP1C1 was isolated from Nile tilapia (Oreochromis niloticus) liver after intracoelomic injection with benzo-a-pyrene (BaP). The full-length cDNA was 2223 base pair (bp) long and contained an open reading frame of 1581 bp encoding a protein of 526 amino acids and a stop codon. The sequence exhibited 3' non-coding region of 642 bp. The deduced amino acid sequence of O. niloticus CYP1C1 shows similarities of 86, 82.5, 79.7, 78.7, 77.8, 75.5, 69.6 and 61.3% with scup CYP1C1, killifish CYP1C1,1C2, Japanese eel CYP1C1, zebra fish CYP1C1, common carp CYP1C1, scup CYP1C2, common carp CYP1C2 and zebra fish CYP1C2, respectively. Phylogenetic tree based on the amino acids sequences clearly shows tilapia CYP1C1 and scup CYP1C1 to be more closely related to each other than to CYP1C genes from other species. Furthermore, for measuring BaP induction of CYP1C1 mRNA in different organs of tilapia (O. niloticus), β-actin gene as internal control was selected based on previous studies to assess their expression variability. Real time RCR results revealed that there was a large increase in CYP1C1 mRNA in liver (43.1), intestine (5.1) and muscle (2.4). Copyright © 2011 Elsevier B.V. All rights reserved.

The Molecular Cytogenetic Characterization of Pistachio (Pistacia vera L.) Suggests the Arrest of Recombination in the Largest Heteropycnotic Pair HC1.

PubMed

Sola-Campoy, Pedro J; Robles, Francisca; Schwarzacher, Trude; Ruiz Rejón, Carmelo; de la Herrán, Roberto; Navajas-Pérez, Rafael

2015-01-01

This paper represents the first molecular cytogenetic characterization of the strictly dioecious pistachio tree (Pistacia vera L.). The karyotype was characterized by fluorescent in situ hybridization (FISH) with probes for 5S and 45S rDNAs, and the pistachio specific satellite DNAs PIVE-40, and PIVE-180, together with DAPI-staining. PIVE-180 has a monomeric unit of 176-178 bp and high sequence homology between family members; PIVE-40 has a 43 bp consensus monomeric unit, and is most likely arranged in higher order repeats (HORs) of two units. The P. vera genome is highly heterochromatic, and prominent DAPI positive blocks are detected in most chromosomes. Despite the difficulty in classifying chromosomes according to morphology, 10 out of 15 pairs (2n = 30) could be distinguished by their unique banding patterns using a combination of FISH probes. Significantly, the largest pair, designated HC1, is strongly heteropycnotic, shows differential condensation, and has massive enrichment in PIVE-40 repeats. There are two types of HC1 chromosomes (type-I and type-II) with differing PIVE-40 hybridization signal. Only type-I/II heterozygotes and type-I homozygotes individuals were found. We speculate that the differentiation between the two HC1 chromosomes is due to suppression of homologous recombination at meiosis, reinforced by the presence of PIVE-40 HORs and differences in PIVE-40 abundance. This would be compatible with a ZW sex-determination system in the pistachio tree.

The Molecular Cytogenetic Characterization of Pistachio (Pistacia vera L.) Suggests the Arrest of Recombination in the Largest Heteropycnotic Pair HC1

PubMed Central

Sola-Campoy, Pedro J.; Robles, Francisca; Schwarzacher, Trude; Ruiz Rejón, Carmelo; de la Herrán, Roberto; Navajas-Pérez, Rafael

2015-01-01

This paper represents the first molecular cytogenetic characterization of the strictly dioecious pistachio tree (Pistacia vera L.). The karyotype was characterized by fluorescent in situ hybridization (FISH) with probes for 5S and 45S rDNAs, and the pistachio specific satellite DNAs PIVE-40, and PIVE-180, together with DAPI-staining. PIVE-180 has a monomeric unit of 176–178 bp and high sequence homology between family members; PIVE-40 has a 43 bp consensus monomeric unit, and is most likely arranged in higher order repeats (HORs) of two units. The P. vera genome is highly heterochromatic, and prominent DAPI positive blocks are detected in most chromosomes. Despite the difficulty in classifying chromosomes according to morphology, 10 out of 15 pairs (2n = 30) could be distinguished by their unique banding patterns using a combination of FISH probes. Significantly, the largest pair, designated HC1, is strongly heteropycnotic, shows differential condensation, and has massive enrichment in PIVE-40 repeats. There are two types of HC1 chromosomes (type-I and type-II) with differing PIVE-40 hybridization signal. Only type-I/II heterozygotes and type-I homozygotes individuals were found. We speculate that the differentiation between the two HC1 chromosomes is due to suppression of homologous recombination at meiosis, reinforced by the presence of PIVE-40 HORs and differences in PIVE-40 abundance. This would be compatible with a ZW sex-determination system in the pistachio tree. PMID:26633808

Cytogenetics-based risk prediction of blastic transformation of chronic myeloid leukemia in the era of TKI therapy

PubMed Central

Gong, Zimu; Medeiros, L. Jeffrey; Cortes, Jorge E.; Chen, Zi; Zheng, Lan; Li, Yan; Bai, Shi; Lin, Pei; Miranda, Roberto N.; Jorgensen, Jeffrey L.; McDonnell, Timothy J.; Wang, Wei; Kantarjian, Hagop M.

2017-01-01

The high fatality of patients with blast phase (BP) chronic myeloid leukemia (CML) necessitates identification of high-risk (HR) patients to prevent onset of BP. Here, we investigated the risk of BP based on additional chromosomal abnormality (ACA) profiles in a cohort of 2326 CML patients treated with tyrosine kinase inhibitors (TKIs). We examined the time intervals from initial diagnosis to ACA emergence (interval 1), from ACA emergence to onset of BP (interval 2), and survival after onset of BP (interval 3). Based on BP risk associated with each ACA, patients were stratified into intermediate-1, intermediate-2, and HR groups, with a median duration of interval 2 of unreached, 19.2 months, and 1.9 months, respectively. There was no difference in durations of intervals 1 or 3 among 3 groups. Including patients without ACAs who formed the standard-risk group, the overall 5-year cumulative probability of BP was 9.8%, 28.0%, 41.7%, and 67.4% for these 4 groups, respectively. The pre-BP disease course in those who developed BP was similar regardless of cytogenetic alterations, and 84.4% of BP patients developed BP within the first 5 years of diagnosis. In summary, interval 2 is the predominant determinant of BP risk and patient outcome. By prolonging the duration of interval 2, TKI therapy mitigates BP risk associated with low-risk ACAs or no ACAs but does not alter the natural course of CML with HR ACAs. Thus, we have identified a group of patients who have HR of BP and may benefit from timely alternative treatment to prevent onset of BP. PMID:29296906

Draft genome sequence of Bradyrhizobium manausense strain BR 3351T, an effective symbiont isolated from Amazon rainforest.

PubMed

Simões-Araújo, Jean Luiz; Rumjanek, Norma Gouvêa; Xavier, Gustavo Ribeiro; Zilli, Jerri Édson

The strain BR 3351 T (Bradyrhizobium manausense) was obtained from nodules of cowpea (Vigna unguiculata L. Walp) growing in soil collected from Amazon rainforest. Furthermore, it was observed that the strain has high capacity to fix nitrogen symbiotically in symbioses with cowpea. We report here the draft genome sequence of strain BR 3351 T . The information presented will be important for comparative analysis of nodulation and nitrogen fixation for diazotrophic bacteria. A draft genome with 9,145,311bp and 62.9% of GC content was assembled in 127 scaffolds using 100bp pair-end Illumina MiSeq system. The RAST annotation identified 8603 coding sequences, 51 RNAs genes, classified in 504 subsystems. Published by Elsevier Editora Ltda.

Dynamic Conformations of Nucleosome Arrays in Solution from Small-Angle X-ray Scattering

NASA Astrophysics Data System (ADS)

Howell, Steven C.

Chromatin conformation and dynamics remains unsolved despite the critical role of the chromatin in fundamental genetic functions such as transcription, replication, and repair. At the molecular level, chromatin can be viewed as a linear array of nucleosomes, each consisting of 147 base pairs (bp) of double-stranded DNA (dsDNA) wrapped around a protein core and connected by 10 to 90 bp of linker dsDNA. Using small-angle X-ray scattering (SAXS), we investigated how the conformations of model nucleosome arrays in solution are modulated by ionic condition as well as the effect of linker histone proteins. To facilitate ensemble modeling of these SAXS measurements, we developed a simulation method that treats coarse-grained DNA as a Markov chain, then explores possible DNA conformations using Metropolis Monte Carlo (MC) sampling. This algorithm extends the functionality of SASSIE, a program used to model intrinsically disordered biological molecules, adding to the previous methods for simulating protein, carbohydrates, and single-stranded DNA. Our SAXS measurements of various nucleosome arrays together with the MC generated models provide valuable solution structure information identifying specific differences from the structure of crystallized arrays.

Genetic diversity analysis of tree peony germplasm using iPBS markers.

PubMed

Duan, Y B; Guo, D L; Guo, L L; Wei, D F; Hou, X G

2015-07-06

We examined the genetic diversity of 10 wild species (populations) and 55 varieties of tree peony using inter-primer binding site (iPBS) markers. From a total of 36 iPBS primers, 16 were selected based on polymorphic amplification. The number of bands amplified by each primer ranged from 9 to 19, with an average of 12.88 bands per primer. The length of bands ranged from 100 to 2000 bp, concentrated at 200 to 1800 bp. Sixteen primers amplified 206 bands in total, of which 173 bands were polymorphic with a polymorphism ratio of 83.98%. Each primer amplified 10.81 polymorphic bands on average. The data were then used to construct a phylogenetic tree using unweighted pair group method with arithmetic mean methods. Clustering analysis showed that the genetic relationships among the varieties were not only related to the genetic background or geographic origin, but also to the flowering phase, flower color, and flower type. Our data also indicated that iPBS markers were useful tools for classifying tree peony germplasms and for tree peony breeding, and the specific bands were helpful for molecular identification of tree peony varieties.

Interchromosomal recombination in Zea mays.

PubMed Central

Hu, W; Timmermans, M C; Messing, J

1998-01-01

A new allele of the 27-kD zein locus in maize has been generated by interchromosomal recombination between chromosomes of two different inbred lines. A continuous patch of at least 11,817 bp of inbred W64A, containing the previously characterized Ra allele of the 27-kD zein gene, has been inserted into the genome of A188 by a single crossover. While both junction sequences are conserved, sequences of the two homologs between these junctions differ considerably. W64A contains the 7313-bp-long retrotransposon, Zeon-1. A188 contains a second copy of the 27-kD zein gene and a 2-kb repetitive element. Therefore, recombination results in a 7.3-kb insertion and a 14-kb deletion compared to the original S+A188 allele. If nonpairing sequences are looped out, 206 single base changes, frequently clustered, are present. The structure of this allele may explain how a recently discovered example of somatic recombination occurred in an A188/W64A hybrid. This would indicate that despite these sequence differences, pairing between these alleles could occur early during plant development. Therefore, such a somatically derived chimeric chromosome can also be heritable and give rise to new alleles. PMID:9799274

DNA barcoding commercially important aquatic invertebrates of Turkey.

PubMed

Keskin, Emre; Atar, Hasan Hüseyin

2013-08-01

DNA barcoding was used in order to identify aquatic invertebrates sampled from fisheries bycatch and discards. A total of 440 unique cytochrome c oxidase sub unit I (COI) barcodes were generated for 22 species from three important phyla (Arthropoda, Cnidaria, and Mollusca). All the species were sequenced and submitted to GenBank and Barcode of Life Database (BOLD) databases using 654 bp-long fragment of mitochondrial COI gene. Two of them (Pontastacus leptodactylus and Rapana bezoar) were first records of the species for the BOLD database and six of them (Carcinus aestuarii, Loligo vulgaris, Melicertus kerathurus, Nephrops norvegicus, Scyllarides latus, and Scyllarus arctus) were first standard (>648 bp) COI barcode records for the GenBank database. COI barcodes were analyzed for nucleotide composition, nucleotide pair frequencies, and Kimura's two-parameter genetic distance. Mean genetic distance among species was found increasing at higher taxonomic levels. Neighbor-joining trees generated were congruent with morphometric-based taxonomic classification. Findings of this study clearly demonstrate that DNA barcodes could be used as an efficient molecular tool in identification of not only target species from fisheries but also bycatch and discard species, and so it could provide us leverage for a better understanding in monitoring and management of fisheries and biodiversity.

A novel method for the transport and analysis of genetic material from polyps and zooxanthellae of scleractinian corals.

PubMed

Crabbe, M James C

2003-08-29

We have developed a new simple method for transport, storage, and analysis of genetic material from the corals Agaricia agaricites, Dendrogyra cylindrica, Eusmilia ancora, Meandrina meandrites, Montastrea annularis, Porites astreoides, Porites furcata, Porites porites, and Siderastrea siderea at room temperature. All species yielded sufficient DNA from a single FTA card (19 microg-43 ng) for subsequent PCR amplification of both coral and zooxanthellar DNA. The D1 and D2 variable region of the large subunit rRNA gene (LSUrDNA) was amplified from the DNA of P. furcata and S. siderea by PCR. Electrophoresis yielded two major DNA bands: an 800-base pair (bp) DNA, which represented the coral ribosomal RNA (rRNA) gene, and a 600-bp DNA, which represented the zooxanthellar srRNA gene. Extraction of DNA from the bands yielded between 290 microg total DNA (S. siderea coral DNA) and 9 microg total DNA (P. furcata zooxanthellar DNA). The ability to transport and store genetic material from scleractinian corals without resort to laboratory facilities in the field allows for the molecular study of a far wider range and variety of coral sites than have been studied to date.

Mapping DNA cleavage by the Type ISP restriction-modification enzymes following long-range communication between DNA sites in different orientations

PubMed Central

van Aelst, Kara; Saikrishnan, Kayarat; Szczelkun, Mark D.

2015-01-01

The prokaryotic Type ISP restriction-modification enzymes are single-chain proteins comprising an Mrr-family nuclease, a superfamily 2 helicase-like ATPase, a coupler domain, a methyltransferase, and a DNA-recognition domain. Upon recognising an unmodified DNA target site, the helicase-like domain hydrolyzes ATP to cause site release (remodeling activity) and to then drive downstream translocation consuming 1–2 ATP per base pair (motor activity). On an invading foreign DNA, double-strand breaks are introduced at random wherever two translocating enzymes form a so-called collision complex following long-range communication between a pair of target sites in inverted (head-to-head) repeat. Paradoxically, structural models for collision suggest that the nuclease domains are too far apart (>30 bp) to dimerise and produce a double-strand DNA break using just two strand-cleavage events. Here, we examined the organisation of different collision complexes and how these lead to nuclease activation. We mapped DNA cleavage when a translocating enzyme collides with a static enzyme bound to its site. By following communication between sites in both head-to-head and head-to-tail orientations, we could show that motor activity leads to activation of the nuclease domains via distant interactions of the helicase or MTase-TRD. Direct nuclease dimerization is not required. To help explain the observed cleavage patterns, we also used exonuclease footprinting to demonstrate that individual Type ISP domains can swing off the DNA. This study lends further support to a model where DNA breaks are generated by multiple random nicks due to mobility of a collision complex with an overall DNA-binding footprint of ∼30 bp. PMID:26507855

Genetic identification and evolutionary trends of the seagrass Halophila nipponica in temperate coastal waters of Korea.

PubMed

Kim, Young Kyun; Kim, Seung Hyeon; Yi, Joo Mi; Kang, Chang-Keun; Short, Frederick; Lee, Kun-Seop

2017-01-01

Although seagrass species in the genus Halophila are generally distributed in tropical or subtropical regions, H. nipponica has been reported to occur in temperate coastal waters of the northwestern Pacific. Because H. nipponica occurs only in the warm temperate areas influenced by the Kuroshio Current and shows a tropical seasonal growth pattern, such as severely restricted growth in low water temperatures, it was hypothesized that this temperate Halophila species diverged from tropical species in the relatively recent evolutionary past. We used a phylogenetic analysis of internal transcribed spacer (ITS) regions to examine the genetic variability and evolutionary trend of H. nipponica. ITS sequences of H. nipponica from various locations in Korea and Japan were identical or showed very low sequence divergence (less than 3-base pair, bp, difference), confirming that H. nipponica from Japan and Korea are the same species. Halophila species in the section Halophila, which have simple phyllotaxy (a pair of petiolate leaves at the rhizome node), were separated into five well-supported clades by maximum parsimony analysis. H. nipponica grouped with H. okinawensis and H. gaudichaudii from the subtropical regions in the same clade, the latter two species having quite low ITS sequence divergence from H. nipponica (7-15-bp). H. nipponica in Clade I diverged 2.95 ± 1.08 million years ago from species in Clade II, which includes H. ovalis. According to geographical distribution and genetic similarity, H. nipponica appears to have diverged from a tropical species like H. ovalis and adapted to warm temperate environments. The results of divergence time estimates suggest that the temperate H. nipponica is an older species than the subtropical H. okinawensis and H. gaudichaudii and they may have different evolutionary histories.

Genetic identification and evolutionary trends of the seagrass Halophila nipponica in temperate coastal waters of Korea

PubMed Central

Kim, Young Kyun; Kim, Seung Hyeon; Yi, Joo Mi; Kang, Chang-Keun; Short, Frederick; Lee, Kun-Seop

2017-01-01

Although seagrass species in the genus Halophila are generally distributed in tropical or subtropical regions, H. nipponica has been reported to occur in temperate coastal waters of the northwestern Pacific. Because H. nipponica occurs only in the warm temperate areas influenced by the Kuroshio Current and shows a tropical seasonal growth pattern, such as severely restricted growth in low water temperatures, it was hypothesized that this temperate Halophila species diverged from tropical species in the relatively recent evolutionary past. We used a phylogenetic analysis of internal transcribed spacer (ITS) regions to examine the genetic variability and evolutionary trend of H. nipponica. ITS sequences of H. nipponica from various locations in Korea and Japan were identical or showed very low sequence divergence (less than 3-base pair, bp, difference), confirming that H. nipponica from Japan and Korea are the same species. Halophila species in the section Halophila, which have simple phyllotaxy (a pair of petiolate leaves at the rhizome node), were separated into five well-supported clades by maximum parsimony analysis. H. nipponica grouped with H. okinawensis and H. gaudichaudii from the subtropical regions in the same clade, the latter two species having quite low ITS sequence divergence from H. nipponica (7–15-bp). H. nipponica in Clade I diverged 2.95 ± 1.08 million years ago from species in Clade II, which includes H. ovalis. According to geographical distribution and genetic similarity, H. nipponica appears to have diverged from a tropical species like H. ovalis and adapted to warm temperate environments. The results of divergence time estimates suggest that the temperate H. nipponica is an older species than the subtropical H. okinawensis and H. gaudichaudii and they may have different evolutionary histories. PMID:28505209

The genome of flax (Linum usitatissimum) assembled de novo from short shotgun sequence reads.

PubMed

Wang, Zhiwen; Hobson, Neil; Galindo, Leonardo; Zhu, Shilin; Shi, Daihu; McDill, Joshua; Yang, Linfeng; Hawkins, Simon; Neutelings, Godfrey; Datla, Raju; Lambert, Georgina; Galbraith, David W; Grassa, Christopher J; Geraldes, Armando; Cronk, Quentin C; Cullis, Christopher; Dash, Prasanta K; Kumar, Polumetla A; Cloutier, Sylvie; Sharpe, Andrew G; Wong, Gane K-S; Wang, Jun; Deyholos, Michael K

2012-11-01

Flax (Linum usitatissimum) is an ancient crop that is widely cultivated as a source of fiber, oil and medicinally relevant compounds. To accelerate crop improvement, we performed whole-genome shotgun sequencing of the nuclear genome of flax. Seven paired-end libraries ranging in size from 300 bp to 10 kb were sequenced using an Illumina genome analyzer. A de novo assembly, comprised exclusively of deep-coverage (approximately 94× raw, approximately 69× filtered) short-sequence reads (44-100 bp), produced a set of scaffolds with N(50) =694 kb, including contigs with N(50)=20.1 kb. The contig assembly contained 302 Mb of non-redundant sequence representing an estimated 81% genome coverage. Up to 96% of published flax ESTs aligned to the whole-genome shotgun scaffolds. However, comparisons with independently sequenced BACs and fosmids showed some mis-assembly of regions at the genome scale. A total of 43384 protein-coding genes were predicted in the whole-genome shotgun assembly, and up to 93% of published flax ESTs, and 86% of A. thaliana genes aligned to these predicted genes, indicating excellent coverage and accuracy at the gene level. Analysis of the synonymous substitution rates (K(s) ) observed within duplicate gene pairs was consistent with a recent (5-9 MYA) whole-genome duplication in flax. Within the predicted proteome, we observed enrichment of many conserved domains (Pfam-A) that may contribute to the unique properties of this crop, including agglutinin proteins. Together these results show that de novo assembly, based solely on whole-genome shotgun short-sequence reads, is an efficient means of obtaining nearly complete genome sequence information for some plant species. © 2012 The Authors. The Plant Journal © 2012 Blackwell Publishing Ltd.

Colistin-Resistant Acinetobacter baumannii Clinical Strains with Deficient Biofilm Formation

PubMed Central

Dafopoulou, Konstantina; Xavier, Basil Britto; Hotterbeekx, An; Janssens, Lore; Lammens, Christine; Dé, Emmanuelle; Goossens, Herman; Tsakris, Athanasios; Malhotra-Kumar, Surbhi

2015-01-01

In two pairs of clinical colistin-susceptible/colistin-resistant (Csts/Cstr) Acinetobacter baumannii strains, the Cstr strains showed significantly decreased biofilm formation in static and dynamic assays (P < 0.001) and lower relative fitness (P < 0.05) compared with those of the Csts counterparts. The whole-genome sequencing comparison of strain pairs identified a mutation converting a stop codon to lysine (*241K) in LpsB (involved in lipopolysaccharide [LPS] synthesis) in one Cstr strain and a frameshift mutation in CarO and the loss of a 47,969-bp element containing multiple genes associated with biofilm production in the other. PMID:26666921

Short-Read Sequencing for Genomic Analysis of the Brown Rot Fungus Fibroporia radiculosa

Treesearch

J. D. Tang; A. D. Perkins; T. S. Sonstegard; S. G. Schroeder; S. C. Burgess; S. V. Diehl

2012-01-01

The feasibility of short-read sequencing for genomic analysis was demonstrated for Fibroporia radiculosa, a copper-tolerant fungus that causes brown rot decay of wood. The effect of read quality on genomic assembly was assessed by filtering Illumina GAIIx reads from a single run of a paired-end library (75-nucleotide read length and 300-bp fragment...

TBS and BMD at the end of AI-therapy: A prospective study of the B-ABLE cohort.

PubMed

María, Rodríguez-Sanz; Marta, Pineda-Moncusí; Sonia, Servitja; Natalia, Garcia-Giralt; Tamara, Martos; Ignasi, Tusquets; Maria, Martínez-García; Jaime, Rodriguez-Morera; Adolfo, Diez-Perez; Joan, Albanell; Xavier, Nogués

2016-11-01

Patients with breast cancer under aromatase inhibitor (AI) treatment often develop osteoporosis and their average bone loss rate is twice that of natural reduction during menopause, increasing fracture risk. As the current diagnostic technique based on bone mineral density (BMD) provides no information on bone quality, the Trabecular Bone Score (TBS) has been proposed to reflect bone microarchitecture status. The present study was designed to assess prospective changes in TBS and lumbar spine (LS) BMD in postmenopausal women with breast cancer at completion of AI treatment. B-ABLE is a prospective cohort of 735 women with breast cancer treated with AIs according to American Society of Clinical Oncology recommendations: 5years of AI starting within 6weeks post-surgery or 1month after the last cycle of chemotherapy (5y-AI group), or switching to an AI to complete 5-year therapy after 2-3years of tamoxifen (pTMX-AI group). Patients with osteoporosis were treated with oral bisphosphonates (BP). TBS and LS-BMD changes at completion of AI therapy were evaluated by Student t-test for paired samples. Pearson correlation coefficients were computed for correlations between LS-BMD and TBS. AI treatment was completed by 277 women. Of these, 70 (25.3%) were allocated to BP therapy. The non-BP-treated patients (74.7%) showed significant decreases in TBS (-2.94% in pTMX-AI and -2.93% in 5y-AI groups) and in LS-BMD (-4.14% in pTMX-AI and -2.28% in 5y-AI groups) at the end of AI treatment. In BP-treated patients, TBS remained stable at the end of AI treatment, whereas LS-BMD showed significant increases (+2.30% in pTMX-AI and +5.33% in 5y-AI groups). Moderate associations between TBS and LS-BMD values at baseline and at the end of AI treatment (r=0.4; P<0.001) were observed. At the end of treatment, changes in spine BMD and TBS were weakly correlated (r=0.1, P<0.01). AI therapy induces significant decreases in TBS, comparable to BMD loss. BP-treated patients maintained TBS values, whereas BMD increased. AI treatment leads to deterioration of bone microarchitecture, which seems to be attenuated by BP therapy. Copyright © 2016 Elsevier Inc. All rights reserved.

A Novel Continuous Blood Pressure Estimation Approach Based on Data Mining Techniques.

PubMed

Miao, Fen; Fu, Nan; Zhang, Yuan-Ting; Ding, Xiao-Rong; Hong, Xi; He, Qingyun; Li, Ye

2017-11-01

Continuous blood pressure (BP) estimation using pulse transit time (PTT) is a promising method for unobtrusive BP measurement. However, the accuracy of this approach must be improved for it to be viable for a wide range of applications. This study proposes a novel continuous BP estimation approach that combines data mining techniques with a traditional mechanism-driven model. First, 14 features derived from simultaneous electrocardiogram and photoplethysmogram signals were extracted for beat-to-beat BP estimation. A genetic algorithm-based feature selection method was then used to select BP indicators for each subject. Multivariate linear regression and support vector regression were employed to develop the BP model. The accuracy and robustness of the proposed approach were validated for static, dynamic, and follow-up performance. Experimental results based on 73 subjects showed that the proposed approach exhibited excellent accuracy in static BP estimation, with a correlation coefficient and mean error of 0.852 and -0.001 ± 3.102 mmHg for systolic BP, and 0.790 and -0.004 ± 2.199 mmHg for diastolic BP. Similar performance was observed for dynamic BP estimation. The robustness results indicated that the estimation accuracy was lower by a certain degree one day after model construction but was relatively stable from one day to six months after construction. The proposed approach is superior to the state-of-the-art PTT-based model for an approximately 2-mmHg reduction in the standard derivation at different time intervals, thus providing potentially novel insights for cuffless BP estimation.

Comparison of Two Capillary Gel Electrophoresis Systems for Clostridium difficile Ribotyping, Using a Panel of Ribotype 027 Isolates and Whole-Genome Sequences as a Reference Standard

PubMed Central

Xiao, Meng; Kong, Fanrong; Jin, Ping; Wang, Qinning; Xiao, Kelin; Jeoffreys, Neisha; James, Gregory

2012-01-01

PCR ribotyping is the most commonly used Clostridium difficile genotyping method, but its utility is limited by lack of standardization. In this study, we analyzed four published whole genomes and tested an international collection of 21 well-characterized C. difficile ribotype 027 isolates as the basis for comparison of two capillary gel electrophoresis (CGE)-based ribotyping methods. There were unexpected differences between the 16S-23S rRNA intergenic spacer region (ISR) allelic profiles of the four ribotype 027 genomes, but six bands were identified in all four and a seventh in three genomes. All seven bands and another, not identified in any of the whole genomes, were found in all 21 isolates. We compared sequencer-based CGE (SCGE) with three different primer pairs to the Qiagen QIAxcel CGE (QCGE) platform. Deviations from individual reference/consensus band sizes were smaller for SCGE (0 to 0.2 bp) than for QCGE (4.2 to 9.5 bp). Compared with QCGE, SCGE more readily distinguished bands of similar length (more discriminatory), detected bands of larger size and lower intensity (more sensitive), and assigned band sizes more accurately and reproducibly, making it more suitable for standardization. Specifically, QCGE failed to identify the largest ISR amplicon. Based on several criteria, we recommend the primer set 16S-USA/23S-USA for use in a proposed standard SCGE method. Similar differences between SCGE and QCGE were found on testing of 14 isolates of four other C. difficile ribotypes. Based on our results, ISR profiles based on accurate sequencer-based band lengths would be preferable to agarose gel-based banding patterns for the assignment of ribotypes. PMID:22692737

Comparative Genomics and Phylogenomics of East Asian Tulips (Amana, Liliaceae)

PubMed Central

Li, Pan; Lu, Rui-Sen; Xu, Wu-Qin; Ohi-Toma, Tetsuo; Cai, Min-Qi; Qiu, Ying-Xiong; Cameron, Kenneth M.; Fu, Cheng-Xin

2017-01-01

The genus Amana Honda (Liliaceae), when it is treated as separate from Tulipa, comprises six perennial herbaceous species that are restricted to China, Japan and the Korean Peninsula. Although all six Amana species have important medicinal and horticultural uses, studies focused on species identification and molecular phylogenetics are few. Here we report the nucleotide sequences of six complete Amana chloroplast (cp) genomes. The cp genomes of Amana range from 150,613 bp to 151,136 bp in length, all including a pair of inverted repeats (25,629–25,859 bp) separated by the large single-copy (81,482–82,218 bp) and small single-copy (17,366–17,465 bp) regions. Each cp genome equivalently contains 112 unique genes consisting of 30 transfer RNA genes, four ribosomal RNA genes, and 78 protein coding genes. Gene content, gene order, AT content, and IR/SC boundary structure are nearly identical among all Amana cp genomes. However, the relative contraction and expansion of the IR/SC borders among the six Amana cp genomes results in length variation among them. Simple sequence repeat (SSR) analyses of these Amana cp genomes indicate that the richest SSRs are A/T mononucleotides. The number of repeats among the six Amana species varies from 54 (A. anhuiensis) to 69 (Amana kuocangshanica) with palindromic (28–35) and forward repeats (23–30) as the most common types. Phylogenomic analyses based on these complete cp genomes and 74 common protein-coding genes strongly support the monophyly of the genus, and a sister relationship between Amana and Erythronium, rather than a shared common ancestor with Tulipa. Nine DNA markers (rps15–ycf1, accD–psaI, petA–psbJ, rpl32–trnL, atpH–atpI, petD–rpoA, trnS–trnG, psbM–trnD, and ycf4–cemA) with number of variable sites greater than 0.9% were identified, and these may be useful for future population genetic and phylogeographic studies of Amana species. PMID:28421090

WS-BP: An efficient wolf search based back-propagation algorithm

NASA Astrophysics Data System (ADS)

Nawi, Nazri Mohd; Rehman, M. Z.; Khan, Abdullah

2015-05-01

Wolf Search (WS) is a heuristic based optimization algorithm. Inspired by the preying and survival capabilities of the wolves, this algorithm is highly capable to search large spaces in the candidate solutions. This paper investigates the use of WS algorithm in combination with back-propagation neural network (BPNN) algorithm to overcome the local minima problem and to improve convergence in gradient descent. The performance of the proposed Wolf Search based Back-Propagation (WS-BP) algorithm is compared with Artificial Bee Colony Back-Propagation (ABC-BP), Bat Based Back-Propagation (Bat-BP), and conventional BPNN algorithms. Specifically, OR and XOR datasets are used for training the network. The simulation results show that the WS-BP algorithm effectively avoids the local minima and converge to global minima.

Impact of heart disease and calibration interval on accuracy of pulse transit time-based blood pressure estimation.

PubMed

Ding, Xiaorong; Zhang, Yuanting; Tsang, Hon Ki

2016-02-01

Continuous blood pressure (BP) measurement without a cuff is advantageous for the early detection and prevention of hypertension. The pulse transit time (PTT) method has proven to be promising for continuous cuffless BP measurement. However, the problem of accuracy is one of the most challenging aspects before the large-scale clinical application of this method. Since PTT-based BP estimation relies primarily on the relationship between PTT and BP under certain assumptions, estimation accuracy will be affected by cardiovascular disorders that impair this relationship and by the calibration frequency, which may violate these assumptions. This study sought to examine the impact of heart disease and the calibration interval on the accuracy of PTT-based BP estimation. The accuracy of a PTT-BP algorithm was investigated in 37 healthy subjects and 48 patients with heart disease at different calibration intervals, namely 15 min, 2 weeks, and 1 month after initial calibration. The results showed that the overall accuracy of systolic BP estimation was significantly lower in subjects with heart disease than in healthy subjects, but diastolic BP estimation was more accurate in patients than in healthy subjects. The accuracy of systolic and diastolic BP estimation becomes less reliable with longer calibration intervals. These findings demonstrate that both heart disease and the calibration interval can influence the accuracy of PTT-based BP estimation and should be taken into consideration to improve estimation accuracy.

Molecular cloning and nucleotide sequence of CYP6BF1 from the diamondback moth, Plutella xylostella

PubMed Central

Li, Hongshan; Dai, Huaguo; Wei, Hui

2005-01-01

A novel cDNA clong encoding a cytochrome P450 was screened from the insecticide-susceptible strain of Plutella xylostella (L.) (Lepidoptera:Yponomeutidae). The nucleotide sequence of the clone, designated CYP6BF1, was determined. This is the first full-length sequence of the CYP6 family from Plutella xylostella (L.). The cDNA is 1661bp in length and contains an open reading frame from base pairs 26 to 1570, encoding a protein of 514 amino acid residues. It is similar to the other insect P450s in gene family 6, including CYP6AE1 from Depressaria pastinacella, (46%). The GenBank accession number is AY971374. PMID:17119627

High spin states in 162Lu

NASA Astrophysics Data System (ADS)

Gupta, S. L.; Pancholi, S. C.; Juneja, P.; Mehta, D.; Kumar, Ashok; Bhowmik, R. K.; Muralithar, S.; Rodrigues, G.; Singh, R. P.

1997-09-01

An experimental investigation of the odd-odd 162Lu nucleus, following the 148Sm(19F,5n) reaction at beam energy Elab=112 MeV, has been performed through in-beam gamma-ray spectroscopy. It revealed three signature-split bands. The yrast band based on πh11/2⊗νi13/2 configuration exhibits anomalous signature splitting (the unfavored signature Routhian lying lower than the favored one) whose magnitude Δe'~25 keV, is considerably reduced in contrast to sizable normal signature splitting Δe'~125 and 60 keV observed in the yrast πh11/2 bands of the neighboring odd-A 161,163Lu nuclei, respectively. The signature inversion in this band occurs at spin ~20ħ (frequency=0.37 MeV). The second signature-split band, observed above the band crossing associated with the alignment of a pair of i13/2 quasineutrons, is a band based on the four-quasiparticle [πh11/2[523]7/2-⊗νh9/2[521]3/2-⊗(νi13/2)2], i.e., EABAp(Bp), configuration. The third signature-split band is also likely to be a four-quasiparticle band with configuration similar to the second band but involving F quasineutron, i.e., FABAp(Bp). The experimental results are discussed in comparison with the existing data in the neighboring nuclei and in the framework of the cranking shell model.

Oslerus osleri (metastrongyloidea; filaroididae) in gray wolves (Canis lupus) from Banff National Park, Alberta, Canada.

PubMed

Verocai, Guilherme G; Schock, Danna M; Lejeune, Manigandan; Warren, Amy L; Duignan, Pádraig J; Kutz, Susan J

2013-04-01

Oslerus osleri is a filaroid parasite of the respiratory tract of canids. In North America, it is most commonly reported from coyotes (Canis latrans) and domestic dogs (Canis lupus familiaris), but reports in gray wolves (Canis lupus) are infrequent. We report a new geographic record for O. osleri in four gray wolves from Banff National Park, Alberta, Canada. Adult nematodes found in nodules in the submucosa of the trachea and bronchi were identified as O. osleri based on morphometry of spicules of males. We sequenced two segments of the genome of adult nematodes: a 1,111-base pair (bp) segment of the 18S region that was 100% identical to the 18S region of O. osleri from a coyote in California and a 537-bp segment that included the ITS-2 region and partial 5.8S and 28S genes. Histopathologically, there were submucosal nodules of adult nematodes surrounded by fibrosis and lymphoplasmacytic inflammation. These findings are consistent with O. osleri infections in other canids. The importance of this parasite in wild canid populations is unknown, but prevalence may be underestimated because many studies have focused on gastrointestinal parasites or used routine fecal flotation that has low sensitivity for this parasite. The ecology and population genetics of this parasite where multiple species of canids are sympatric warrant closer investigation to determine potential for interspecies transmission.

Comparison of associated features and drug treatment between co-occurring unipolar and bipolar disorders in depressed eating disorder patients.

PubMed

Tseng, Mei-Chih Meg; Chang, Chin-Hao; Liao, Shih-Cheng; Chen, Hsi-Chung

2017-02-27

To examine the differences of associated characteristics and prescription drug use between co-occurring unipolar and bipolar disorders in patients with eating disorders (EDs). Patients with EDs and major depressive episode (MDE) were recruited from psychiatric outpatient clinics. They were interviewed and completed self-administered measures assessing eating and general psychopathology. The prescribed drugs at the index outpatient visit were recorded. Clinical characteristics and prescription drugs of groups with major depressive disorder (ED-MDD), MDE with lifetime mania (ED-BP I), and MDE with lifetime hypomania (ED-BP II) were compared. Continuous variables between groups were compared using generalized linear regression with adjustments of age, gender, and ED subtype for pair-wise comparisons. Multivariate logistic regression with adjustments of age, gender, and ED subtype was employed to estimate adjusted odds ratios with 95% confidence intervals between groups. Two hundred and twenty-seven patients with EDs had a current MDE. Among them, 17.2% and 24.2% experienced associated manic and hypomanic episodes, respectively. Bipolar I and II patients displayed significantly poorer weight regulation, more severe impulsivity and emotional lability, and higher rates of co-occurring alcohol use disorders than ED-MDD patients. ED-BP I patients were found to have the lowest IQ, poorest working memory, and the most severe depression, suicidality and functional impairment among all patients. Patients with ED-BP II shared affect and behavioral dysregulations with ED-BP I, but had less severe degrees of cognitive and functional impairments than ED-BP I. Patients with ED-BP I were significantly less likely than those in the ED-MDD and ED-BP II groups to be on antidepressant monotherapy, but a great rate (27%) of ED-BP I individuals taking antidepressant monotherapy had potential risk of mood switch during the course of treatment. Our study identified discriminative features of bipolar I and II disorders from MDD among a group of depressed ED patients. We suggest that the associated mania, hypomania, and mood lability are predictors of clinical severity and should be identified from ED patients presented with depressive features. Accurate diagnosis of bipolar disorders may have implications for pharmacotherapy in patients with EDs.

Validation of four devices: Omron M6 Comfort, Omron HEM-7420, Withings BP-800, and Polygreen KP-7670 for home blood pressure measurement according to the European Society of Hypertension International Protocol

PubMed Central

Topouchian, Jirar; Agnoletti, Davide; Blacher¹, Jacques; Youssef, Ahmed; Chahine, Mirna N; Ibanez, Isabel; Assemani, Nathalie; Asmar, Roland

2014-01-01

Background Four oscillometric devices, including the Omron M6 Comfort, Omron HEM-7420, Withings BP-800, and Polygreen KP-7670, designed for self-blood pressure measurement (SBPM) were evaluated according to the European Society of Hypertension (ESH) International Protocol Revision 2010 in four separate studies. Methods The four devices measure brachial blood pressure (BP) using the oscillometric method. The Withings BP-800 has to be connected to an Apple® iOS device such as an iPhone®, iPad®, or iPod®. The ESH International Protocol Revision 2010 includes a total number of 33 subjects. The difference between observer and device BP values was calculated for each measure. Ninety-nine pairs of BP differences were classified into three categories (≤5 mmHg, ≤10 mmHg, ≤15 mmHg). The protocol procedures were followed precisely in each of the four studies. Results All four tested devices passed the validation process. The mean differences between the device and mercury readings were: −1.8±5.1 mmHg and −0.4±2.8 mmHg for systolic and diastolic BP, respectively, using the Omron M6 Comfort device; 2.5±4.6 mmHg and −1.2±4.3 mmHg for the Omron HEM-7420 device; −0.2±5.0 mmHg and 0.4±4.2 mmHg for the Withings BP-800 device; and 3.0±5.3 mmHg and 0.3±5.2 mmHg for the Polygreen KP-7670 device. Conclusion Omron M6 Comfort, Omron HEM-7420, Withings BP-800, and Polygreen KP-7670 readings differing by less than 5 mmHg, 10 mmHg, and 15 mmHg fulfill the ESH International Protocol Revision 2010 requirements, and therefore are suitable for use by patients for SBPM, if used correctly. PMID:24476688

A low-cost efficient multiplex PCR for prenatal sex determination in bovine fetus using free fetal DNA in maternal plasma.

PubMed

Davoudi, Arash; Seighalani, Ramin; Aleyasin, Seyed Ahmad; Tarang, Alireza; Salehi, Abdolreza Salehi; Tahmoressi, Farideh

2012-04-01

In order to establish a reliable non-invasive method for sex determination in a bovine fetus in a routine setting, the possibility of identifying specific sequence in the fetal X and Y-chromosomes has been evaluated in maternal plasma using conventional multiplex polymerase chain reaction (PCR) analysis. The aim of this study was to provide a rapid and reliable method for sexing bovine fetuses. In this experimental study, peripheral blood samples were taken from 38 pregnant heifers with 8 to 38 weeks of gestation. DNA template was extracted by phenol-chloroform method from 350 µl maternal plasma. Two primer pairs for bovine amelogenin gene (bAML) and BC1.2 were used to amplify fragments from X and Y chromosomes. A multiplex PCR reaction has been optimized for amplification of 467 bp and 341 bp fragments from X and Y bAML gene and a 190 bp fragment from BC1.2 related to Y chromosome. The 467 bp fragment was observed in all 38 samples. Both 341 and 190 bp fragments were detected only in 24 plasma samples from male calves. The sensitivity and specificity of test were 100% with no false negative or false positive results. The results showed that phenol-chloroform method is a simple and suitable method for isolation of fetal DNA in maternal plasma. The multiplex PCR method is an available non-invasive approach which is cost efficient and reliable for sexing bovine fetuses.

Validation of the Beurer BM 44 upper arm blood pressure monitor for home measurement, according to the European Society of Hypertension International Protocol 2002.

PubMed

Lüders, Stephan; Krüger, Ralf; Zemmrich, Claudia; Forstner, Klaus; Sturm, Claus-Dieter; Bramlage, Peter

2012-12-01

The present study aimed to validate the automated upper arm blood pressure (BP) measuring device BM 44 for home BP monitoring according to the 2002 Protocol of the European Society of Hypertension. The most important new feature of the new device was an integrated 'WHO indicator', which categorizes the patient's individual result within the WHO recommendations for target BP by a coloured scale. Systolic and diastolic BPs were measured sequentially in 35 adult participants (16 men, 19 women) using a standard mercury y-tubed reference sphygmomanometer (two observers) and the BM 44 device (one supervisor). Ninety-nine pairs of comparisons were obtained from 15 participants in phase 1 and a further 18 participants in phase 2 of the validation study. The BM 44 device passed phase 1 of the validation study successfully with a number of absolute differences between device and observers of 5, 10 and 15 mmHg for at least 28 out of 25, 35 out of 35 and 40 out of 40 measurements, respectively. The device also achieved the targets for phases 2.1 and 2.2, with 23 and 26 participants having had at least two of three device-observers differences within 5 mmHg for systolic and diastolic BP, respectively. The Beurer BM 44 upper arm BP monitor has passed the International Protocol requirements, and hence can be recommended for home use in adults. © 2012 Wolters Kluwer Health | Lippincott Williams & Wilkins.

The Complete Plastid Genome of Lagerstroemia fauriei and Loss of rpl2 Intron from Lagerstroemia (Lythraceae)

PubMed Central

Gu, Cuihua; Tembrock, Luke R.; Johnson, Nels G.; Simmons, Mark P.; Wu, Zhiqiang

2016-01-01

Lagerstroemia (crape myrtle) is an important plant genus used in ornamental horticulture in temperate regions worldwide. As such, numerous hybrids have been developed. However, DNA sequence resources and genome information for Lagerstroemia are limited, hindering evolutionary inferences regarding interspecific relationships. We report the complete plastid genome of Lagerstroemia fauriei. To our knowledge, this is the first reported whole plastid genome within Lythraceae. This genome is 152,440 bp in length with 38% GC content and consists of two single-copy regions separated by a pair of 25,793 bp inverted repeats. The large single copy and the small single copy regions span 83,921 bp and 16,933 bp, respectively. The genome contains 129 genes, including 17 located in each inverted repeat. Phylogenetic analysis of genera sampled from Geraniaceae, Myrtaceae, and Onagraceae corroborated the sister relationship between Lythraceae and Onagraceae. The plastid genomes of L. fauriei and several other Lythraceae species lack the rpl2 intron, which indicating an early loss of this intron within the Lythraceae lineage. The plastid genome of L. fauriei provides a much needed genetic resource for further phylogenetic research in Lagerstroemia and Lythraceae. Highly variable markers were identified for application in phylogenetic, barcoding and conservation genetic applications. PMID:26950701

Taxonomic Characterization of Honey Bee (Apis mellifera) Pollen Foraging Based on Non-Overlapping Paired-End Sequencing of Nuclear Ribosomal Loci.

PubMed

Cornman, R Scott; Otto, Clint R V; Iwanowicz, Deborah; Pettis, Jeffery S

2015-01-01

Identifying plant taxa that honey bees (Apis mellifera) forage upon is of great apicultural interest, but traditional methods are labor intensive and may lack resolution. Here we evaluate a high-throughput genetic barcoding approach to characterize trap-collected pollen from multiple North Dakota apiaries across multiple years. We used the Illumina MiSeq platform to generate sequence scaffolds from non-overlapping 300-bp paired-end sequencing reads of the ribosomal internal transcribed spacers (ITS). Full-length sequence scaffolds represented ~530 bp of ITS sequence after adapter trimming, drawn from the 5' of ITS1 and the 3' of ITS2, while skipping the uninformative 5.8S region. Operational taxonomic units (OTUs) were picked from scaffolds clustered at 97% identity, searched by BLAST against the nt database, and given taxonomic assignments using the paired-read lowest common ancestor approach. Taxonomic assignments and quantitative patterns were consistent with known plant distributions, phenology, and observational reports of pollen foraging, but revealed an unexpected contribution from non-crop graminoids and wetland plants. The mean number of plant species assignments per sample was 23.0 (+/- 5.5) and the mean species diversity (effective number of equally abundant species) was 3.3 (+/- 1.2). Bray-Curtis similarities showed good agreement among samples from the same apiary and sampling date. Rarefaction plots indicated that fewer than 50,000 reads are typically needed to characterize pollen samples of this complexity. Our results show that a pre-compiled, curated reference database is not essential for genus-level assignments, but species-level assignments are hindered by database gaps, reference length variation, and probable errors in the taxonomic assignment, requiring post-hoc evaluation. Although the effective per-sample yield achieved using custom MiSeq amplicon primers was less than the machine maximum, primarily due to lower "read2" quality, further protocol optimization and/or a modest reduction in multiplex scale should offset this difficulty. As small quantities of pollen are sufficient for amplification, our approach might be extendable to other questions or species for which large pollen samples are not available.

Taxonomic Characterization of Honey Bee (Apis mellifera) Pollen Foraging Based on Non-Overlapping Paired-End Sequencing of Nuclear Ribosomal Loci

PubMed Central

Cornman, R. Scott; Otto, Clint R. V.; Iwanowicz, Deborah; Pettis, Jeffery S.

2015-01-01

Identifying plant taxa that honey bees (Apis mellifera) forage upon is of great apicultural interest, but traditional methods are labor intensive and may lack resolution. Here we evaluate a high-throughput genetic barcoding approach to characterize trap-collected pollen from multiple North Dakota apiaries across multiple years. We used the Illumina MiSeq platform to generate sequence scaffolds from non-overlapping 300-bp paired-end sequencing reads of the ribosomal internal transcribed spacers (ITS). Full-length sequence scaffolds represented ~530 bp of ITS sequence after adapter trimming, drawn from the 5’ of ITS1 and the 3’ of ITS2, while skipping the uninformative 5.8S region. Operational taxonomic units (OTUs) were picked from scaffolds clustered at 97% identity, searched by BLAST against the nt database, and given taxonomic assignments using the paired-read lowest common ancestor approach. Taxonomic assignments and quantitative patterns were consistent with known plant distributions, phenology, and observational reports of pollen foraging, but revealed an unexpected contribution from non-crop graminoids and wetland plants. The mean number of plant species assignments per sample was 23.0 (+/- 5.5) and the mean species diversity (effective number of equally abundant species) was 3.3 (+/- 1.2). Bray-Curtis similarities showed good agreement among samples from the same apiary and sampling date. Rarefaction plots indicated that fewer than 50,000 reads are typically needed to characterize pollen samples of this complexity. Our results show that a pre-compiled, curated reference database is not essential for genus-level assignments, but species-level assignments are hindered by database gaps, reference length variation, and probable errors in the taxonomic assignment, requiring post-hoc evaluation. Although the effective per-sample yield achieved using custom MiSeq amplicon primers was less than the machine maximum, primarily due to lower “read2” quality, further protocol optimization and/or a modest reduction in multiplex scale should offset this difficulty. As small quantities of pollen are sufficient for amplification, our approach might be extendable to other questions or species for which large pollen samples are not available. PMID:26700168

Taxonomic characterization of honey bee (Apis mellifera) pollen foraging based on non-overlapping paired-end sequencing of nuclear ribosomal loci

USGS Publications Warehouse

Cornman, Robert S.; Otto, Clint R.; Iwanowicz, Deborah; Pettis, Jeffery S

2015-01-01

Identifying plant taxa that honey bees (Apis mellifera) forage upon is of great apicultural interest, but traditional methods are labor intensive and may lack resolution. Here we evaluate a high-throughput genetic barcoding approach to characterize trap-collected pollen from multiple North Dakota apiaries across multiple years. We used the Illumina MiSeq platform to generate sequence scaffolds from non-overlapping 300-bp paired-end sequencing reads of the ribosomal internal transcribed spacers (ITS). Full-length sequence scaffolds represented ~530 bp of ITS sequence after adapter trimming, drawn from the 5’ of ITS1 and the 3’ of ITS2, while skipping the uninformative 5.8S region. Operational taxonomic units (OTUs) were picked from scaffolds clustered at 97% identity, searched by BLAST against the nt database, and given taxonomic assignments using the paired-read lowest common ancestor approach. Taxonomic assignments and quantitative patterns were consistent with known plant distributions, phenology, and observational reports of pollen foraging, but revealed an unexpected contribution from non-crop graminoids and wetland plants. The mean number of plant species assignments per sample was 23.0 (+/- 5.5) and the mean species diversity (effective number of equally abundant species) was 3.3 (+/- 1.2). Bray-Curtis similarities showed good agreement among samples from the same apiary and sampling date. Rarefaction plots indicated that fewer than 50,000 reads are typically needed to characterize pollen samples of this complexity. Our results show that a pre-compiled, curated reference database is not essential for genus-level assignments, but species-level assignments are hindered by database gaps, reference length variation, and probable errors in the taxonomic assignment, requiring post-hoc evaluation. Although the effective per-sample yield achieved using custom MiSeq amplicon primers was less than the machine maximum, primarily due to lower “read2” quality, further protocol optimization and/or a modest reduction in multiplex scale should offset this difficulty. As small quantities of pollen are sufficient for amplification, our approach might be extendable to other questions or species for which large pollen samples are not available.

RNA-based FLT3-ITD allelic ratio is associated with outcome and ex vivo response to FLT3 inhibitors in pediatric AML.

PubMed

Cucchi, David G J; Denys, Barbara; Kaspers, Gertjan J L; Janssen, Jeroen J W M; Ossenkoppele, Gert J; de Haas, Valérie; Zwaan, C Michel; van den Heuvel-Eibrink, Marry M; Philippé, Jan; Csikós, Tamás; Kwidama, Zinia; de Moerloose, Barbara; de Bont, Eveline S J M; Lissenberg-Witte, Birgit I; Zweegman, Sonja; Verwer, Femke; Vandepoele, Karl; Schuurhuis, Gerrit Jan; Sonneveld, Edwin; Cloos, Jacqueline

2018-05-31

Controversy exists whether internal tandem duplication of FMS-like tyrosine kinase 3 ( FLT3- internal tandem duplication [ITD]) allelic ratio (AR) and/or length of the ITD should be taken into account for risk stratification of pediatric acute myeloid leukemia (AML) and whether it should be measured on RNA or DNA. Moreover, the ITD status may be of relevance for selecting patients eligible for FLT3 inhibitors. Here, we included 172 pediatric AML patients, of whom 36 (21%) harbored FLT3 -ITD as determined on both RNA and DNA. Although there was a good correlation between both parameters AR spearman = 0.62 (95% confidence interval, 0.22-0.87) and ITDlength spearman = 0.98 (95% confidence interval, 0.90-1.00), only AR ≥ 0.5 and length ≥48 base pairs (bps) based on RNA measurements were significantly associated with overall survival (AR: P logrank = .008; ITDlength: P logrank = .011). In large ITDs (>156 bp on DNA) a remarkable 90-bp difference exists between DNA and RNA, including intron 14, which is spliced out in RNA. Ex vivo exposure (n = 30) to FLT3 inhibitors, in particular to the FLT3-specific inhibitor gilteritinib, showed that colony-forming capacity was significantly more reduced in FLT3 -ITD-AR ≥ 0.5 compared with ITD-AR-low and ITD - patient samples ( P < .001). RNA-based FLT3 -ITD measurements are recommended for risk stratification, and the relevance of AR regarding eligibility for FLT3-targeted therapy warrants further study. © 2018 by The American Society of Hematology.

Separate aftereffects of morning and evening exercise on ambulatory blood pressure in prehypertensive men.

PubMed

Brito, Leandro C; Rezende, Rafael A; Mendes, Caroline; Silva-Junior, Natan D; Tinucci, Taís; Cipolla-Neto, José; de Moraes Forjaz, Cláudia L

2018-01-01

Clinic postexercise hypotension (PEH) is different after aerobic exercise performed in the morning and in the evening. Thus, ambulatory PEH should also differ after exercises conducted at different times of day. However, because of the circadian pattern of blood pressure (BP), ambulatory PEH should be assessed considering a control condition. Thus, this study was designed to verify the effects of morning and evening exercises on postexercise ambulatory BP averages and circadian parameters by comparing responses obtained at each time of day after an exercise and a control session. Thirteen prehypertensive men underwent four sessions (randomized order): two in the morning (9 am) and two in the evening (6:30 pm). At each time of day, a control (C) and an exercise (E: cycle ergometer 45 min, 50% VO2peak) sessions were performed. After the sessions, an ambulatory BP and heart rate (HR) monitoring was started for 24 h. Paired t-test or Wilcoxon Signed Rank Test were used to compare the E and the C sessions at each time of day. In the morning, 24 h, daytime and nighttime HR were higher after the E than the C session. In the evening, nighttime systolic BP (116±11 vs. 120±10 mmHg, P=0.04) and rate pressure product (7981±1294 vs. 8583±1523 mmHg.bpm, P=0.04), as well as MESOR (128±11 vs. 130±10 mmHg, P=0.03) were lower in the E than the C session. In prehypertensive men, morning exercise increased ambulatory HR, while evening exercise decreased nighttime BP and cardiac work, reducing the MESOR of systolic BP.

Effects of autonomic ganglion blockade on fractal and spectral components of blood pressure and heart rate variability in free-moving rats.

PubMed

Castiglioni, Paolo; Di Rienzo, Marco; Radaelli, Alberto

2013-11-01

Fractal analysis is a promising tool for assessing autonomic influences on heart rate (HR) and blood pressure (BP) variability. The temporal spectrum of scale coefficients, α(t), was recently proposed to describe the cardiovascular fractal dynamics. Aim of our work is to evaluate sympathetic influences on cardiovascular variability analyzing α(t) and spectral powers of HR and BP after ganglionic blockade. BP was recorded in 11 rats before and after autonomic blockade by hexamethonium infusion (HEX). Systolic and diastolic BP, pulse pressure and pulse interval were derived beat-by-beat. Segments longer than 5 min were selected at baseline and HEX to estimate power spectra and α(t). Comparisons were made by paired t-test. HEX reduced all spectral components of systolic and diastolic BP, the reduction being particularly significant around the frequency of Mayer waves; it induced a reduction on α(t) coefficients at t<2s and an increase on coefficients at t>8s. HEX reduced only slower components of pulse interval power spectrum, but decreased significantly faster scale coefficients (t<8s). HEX only marginally affected pulse pressure variability. Results indicate that the sympathetic outflow contributes to BP fractal dynamics with fractional Gaussian noise (α<1) at longer scales and fractional Brownian motion (α>1) at shorter scales. Ganglionic blockade also removes a fractional Brownian motion component at shorter scales from HR dynamics. Results may be explained by the characteristic time constants between sympathetic efferent activity and cardiovascular effectors. Therefore fractal analysis may complete spectral analysis with information on the correlation structure of the data. Copyright © 2013 Elsevier B.V. All rights reserved.

Pulse Transit Time Based Continuous Cuffless Blood Pressure Estimation: A New Extension and A Comprehensive Evaluation.

PubMed

Ding, Xiaorong; Yan, Bryan P; Zhang, Yuan-Ting; Liu, Jing; Zhao, Ni; Tsang, Hon Ki

2017-09-14

Cuffless technique enables continuous blood pressure (BP) measurement in an unobtrusive manner, and thus has the potential to revolutionize the conventional cuff-based approaches. This study extends the pulse transit time (PTT) based cuffless BP measurement method by introducing a new indicator - the photoplethysmogram (PPG) intensity ratio (PIR). The performance of the models with PTT and PIR was comprehensively evaluated in comparison with six models that are based on sole PTT. The validation conducted on 33 subjects with and without hypertension, at rest and under various maneuvers with induced BP changes, and over an extended calibration interval, respectively. The results showed that, comparing to the PTT models, the proposed methods achieved better accuracy on each subject group at rest state and over 24 hours calibration interval. Although the BP estimation errors under dynamic maneuvers and over extended calibration interval were significantly increased for all methods, the proposed methods still outperformed the compared methods in the latter situation. These findings suggest that additional BP-related indicator other than PTT has added value for improving the accuracy of cuffless BP measurement. This study also offers insights into future research in cuffless BP measurement for tracking dynamic BP changes and over extended periods of time.

EXONSAMPLER: a computer program for genome-wide and candidate gene exon sampling for targeted next-generation sequencing.

PubMed

Cosart, Ted; Beja-Pereira, Albano; Luikart, Gordon

2014-11-01

The computer program EXONSAMPLER automates the sampling of thousands of exon sequences from publicly available reference genome sequences and gene annotation databases. It was designed to provide exon sequences for the efficient, next-generation gene sequencing method called exon capture. The exon sequences can be sampled by a list of gene name abbreviations (e.g. IFNG, TLR1), or by sampling exons from genes spaced evenly across chromosomes. It provides a list of genomic coordinates (a bed file), as well as a set of sequences in fasta format. User-adjustable parameters for collecting exon sequences include a minimum and maximum acceptable exon length, maximum number of exonic base pairs (bp) to sample per gene, and maximum total bp for the entire collection. It allows for partial sampling of very large exons. It can preferentially sample upstream (5 prime) exons, downstream (3 prime) exons, both external exons, or all internal exons. It is written in the Python programming language using its free libraries. We describe the use of EXONSAMPLER to collect exon sequences from the domestic cow (Bos taurus) genome for the design of an exon-capture microarray to sequence exons from related species, including the zebu cow and wild bison. We collected ~10% of the exome (~3 million bp), including 155 candidate genes, and ~16,000 exons evenly spaced genomewide. We prioritized the collection of 5 prime exons to facilitate discovery and genotyping of SNPs near upstream gene regulatory DNA sequences, which control gene expression and are often under natural selection. © 2014 John Wiley & Sons Ltd.

A compact, in vivo screen of all 6-mers reveals drivers of tissue-specific expression and guides synthetic regulatory element design.

PubMed

Smith, Robin P; Riesenfeld, Samantha J; Holloway, Alisha K; Li, Qiang; Murphy, Karl K; Feliciano, Natalie M; Orecchia, Lorenzo; Oksenberg, Nir; Pollard, Katherine S; Ahituv, Nadav

2013-07-18

Large-scale annotation efforts have improved our ability to coarsely predict regulatory elements throughout vertebrate genomes. However, it is unclear how complex spatiotemporal patterns of gene expression driven by these elements emerge from the activity of short, transcription factor binding sequences. We describe a comprehensive promoter extension assay in which the regulatory potential of all 6 base-pair (bp) sequences was tested in the context of a minimal promoter. To enable this large-scale screen, we developed algorithms that use a reverse-complement aware decomposition of the de Bruijn graph to design a library of DNA oligomers incorporating every 6-bp sequence exactly once. Our library multiplexes all 4,096 unique 6-mers into 184 double-stranded 15-bp oligomers, which is sufficiently compact for in vivo testing. We injected each multiplexed construct into zebrafish embryos and scored GFP expression in 15 tissues at two developmental time points. Twenty-seven constructs produced consistent expression patterns, with the majority doing so in only one tissue. Functional sequences are enriched near biologically relevant genes, match motifs for developmental transcription factors, and are required for enhancer activity. By concatenating tissue-specific functional sequences, we generated completely synthetic enhancers for the notochord, epidermis, spinal cord, forebrain and otic lateral line, and show that short regulatory sequences do not always function modularly. This work introduces a unique in vivo catalog of short, functional regulatory sequences and demonstrates several important principles of regulatory element organization. Furthermore, we provide resources for designing compact, reverse-complement aware k-mer libraries.

The 193-base pair Gsg2 (haspin) promoter region regulates germ cell-specific expression bidirectionally and synchronously.

PubMed

Tokuhiro, Keizo; Miyagawa, Yasushi; Yamada, Shuichi; Hirose, Mika; Ohta, Hiroshi; Nishimune, Yoshitake; Tanaka, Hiromitsu

2007-03-01

Haspin is a unique protein kinase expressed predominantly in haploid male germ cells. The genomic structure of haspin (Gsg2) has revealed it to be intronless, and the entire transcription unit is in an intron of the integrin alphaE (Itgae) gene. Transcription occurs from a bidirectional promoter that also generates an alternatively spliced integrin alphaE-derived mRNA (Aed). In mice, the testis-specific alternative splicing of Aed is expressed bidirectionally downstream from the Gsg2 transcription initiation site, and a segment consisting of 26 bp transcribes both genomic DNA strands between Gsg2 and the Aed transcription initiation sites. To investigate the mechanisms for this unique gene regulation, we cloned and characterized the Gsg2 promoter region. The 193-bp genomic fragment from the 5' end of the Gsg2 and Aed genes, fused with EGFP and DsRed genes, drove the expression of both proteins in haploid germ cells of transgenic mice. This promoter element contained only a GC-rich sequence, and not the previously reported DNA sequences known to bind various transcription factors--with the exception of E2F1, TCFAP2A1 (AP2), and SP1. Here, we show that the 193-bp DNA sequence is sufficient for the specific, bidirectional, and synchronous expression in germ cells in the testis. We also demonstrate the existence of germ cell nuclear factors specifically bound to the promoter sequence. This activity may be regulated by binding to the promoter sequence with germ cell-specific nuclear complex(es) without regulation via DNA methylation.

Dance and peer support to improve diabetes outcomes in African American women.

PubMed

Murrock, Carolyn J; Higgins, Patricia A; Killion, Cheryl

2009-01-01

The purpose of this pilot study was to test a dance intervention and explore the role of peer support to improve the diabetes outcomes of A1C, weight, body fat, and blood pressure in African American women with type 2 diabetes. This study was conducted in a community-based outpatient clinic. A mixed methods design was used. A total of 46 women, 26 to 83 years of age, were randomized to either the 12-week dance group or usual care group. Both between group and intraindividual group differences were analyzed from baseline to 12 weeks. Focus group interviews explored the role of peer support through semistructured discussions for the women enrolled in the dance group. Results showed significant group mean differences in systolic blood pressure (BP) and body fat. Paired t tests showed significant reductions in all the diabetes outcomes for the dance group and significant increases in glycolated hemoglobin (A1C) and systolic BP for the usual care group. The emergent themes of the focus groups were that a diabetes diagnosis was devastating, and changing eating habits and taking medications was often difficult. Peer support in the dance group was expressed as camaraderie, enjoyment, and laughter, which fostered attendance. Dancing 2 times per week for 12 weeks produced significant group differences in systolic BP and body fat and significant intraindividual changes. The implications are that dancing in a supportive environment with peers may be an effective strategy for diabetes educators to help those with diabetes to become more physically active and improve diabetes outcomes and overall health.

Simultaneous identification and DNA barcoding of six Eimeria species infecting turkeys using PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus.

PubMed

Hafeez, Mian A; Shivaramaiah, Srichaitanya; Dorsey, Kristi Moore; Ogedengbe, Mosun E; El-Sherry, Shiem; Whale, Julia; Cobean, Julie; Barta, John R

2015-05-01

Species-specific PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus were generated that allow for the specific identification of the most common Eimeria species infecting turkeys (i.e., Eimeria adenoeides, Eimeria meleagrimitis, Eimeria gallopavonis, Eimeria meleagridis, Eimeria dispersa, and Eimeria innocua). PCR reaction chemistries were optimized with respect to divalent cation (MgCl2) and dNTP concentrations, as well as PCR cycling conditions (particularly anneal temperature for primers). Genomic DNA samples from single oocyst-derived lines of six Eimeria species were tested to establish specificity and sensitivity of these newly designed primer pairs. A mixed 60-ng total DNA sample containing 10 ng of each of the six Eimeria species was used as DNA template to demonstrate specific amplification of the correct product using each of the species-specific primer pairs. Ten nanograms of each of the five non-target Eimeria species was pooled to provide a non-target, control DNA sample suitable to test the specificity of each primer pair. The amplifications of the COI region with species-specific primer pairs from pooled samples yielded products of expected sizes (209 to 1,012 bp) and no amplification of non-target Eimeria sp. DNA was detected using the non-target, control DNA samples. These primer pairs specific for Eimeria spp. of turkeys did not amplify any of the seven Eimeria species infecting chickens. The newly developed PCR primers can be used as a diagnostic tool capable of specifically identifying six turkey Eimeria species; additionally, sequencing of the PCR amplification products yields sequence-based genotyping data suitable for identification and molecular phylogenetics.

Combined Analysis of the Chloroplast Genome and Transcriptome of the Antarctic Vascular Plant Deschampsia antarctica Desv

PubMed Central

Lee, Jungeun; Kang, Yoonjee; Shin, Seung Chul; Park, Hyun; Lee, Hyoungseok

2014-01-01

Background Antarctic hairgrass (Deschampsia antarctica Desv.) is the only natural grass species in the maritime Antarctic. It has been researched as an important ecological marker and as an extremophile plant for studies on stress tolerance. Despite its importance, little genomic information is available for D. antarctica. Here, we report the complete chloroplast genome, transcriptome profiles of the coding/noncoding genes, and the posttranscriptional processing by RNA editing in the chloroplast system. Results The complete chloroplast genome of D. antarctica is 135,362 bp in length with a typical quadripartite structure, including the large (LSC: 79,881 bp) and small (SSC: 12,519 bp) single-copy regions, separated by a pair of identical inverted repeats (IR: 21,481 bp). It contains 114 unique genes, including 81 unique protein-coding genes, 29 tRNA genes, and 4 rRNA genes. Sequence divergence analysis with other plastomes from the BEP clade of the grass family suggests a sister relationship between D. antarctica, Festuca arundinacea and Lolium perenne of the Poeae tribe, based on the whole plastome. In addition, we conducted high-resolution mapping of the chloroplast-derived transcripts. Thus, we created an expression profile for 81 protein-coding genes and identified ndhC, psbJ, rps19, psaJ, and psbA as the most highly expressed chloroplast genes. Small RNA-seq analysis identified 27 small noncoding RNAs of chloroplast origin that were preferentially located near the 5′- or 3′-ends of genes. We also found >30 RNA-editing sites in the D. antarctica chloroplast genome, with a dominance of C-to-U conversions. Conclusions We assembled and characterized the complete chloroplast genome sequence of D. antarctica and investigated the features of the plastid transcriptome. These data may contribute to a better understanding of the evolution of D. antarctica within the Poaceae family for use in molecular phylogenetic studies and may also help researchers understand the characteristics of the chloroplast transcriptome. PMID:24647560

[Isolation and identification of Streptococcus suis serotype 2 from sick-pig samples of Sichuan province].

PubMed

Zhu, Hong; He, Jun; Jing, Hong-bo; Wang, Zheng-qiang; Duan, Qing

2006-08-01

Streptococcus suis serotype 2 (SS2) is a major pathogen frequently associated with infections in pigs. There are presently 35 serotypes of S.suis (serotype 1 to 34 and serotype 1/2) recognized on the basis of capsular antigens. Few people were reported to infect with SS2 in the past years. However, an accidental case happened in Sichuan province of China in 2005. Some people got ill and died, and all of them were closely contacted with sick pigs. Based on clinical features and epidemiologic data, this case could be caused by SS2 infection. Liver, spleen, kidney, lung and serum samples were collected and used for pathogen isolation and identification in laboratory, three strain bacteria were isolated. The three strains of SS2 showed typical morphology of SS2 on blood agar and under microscope with Gram stain. They were also agglutinated with standard serum of SS2. Biochemical characteristics of the three bacteria were tested using API 20 strep and analyzed by API software (version 3.3), results showed they were SS2. Four pairs of primer were designed, which were exactly matched the extracellular factor gene, muraminidase released protein gene, capsular polysaccharides gene and 16S rRNA gene respectively. These primers were used on polymerase chain reaction (PCR), and the PCR products were 626bp, 885bp, 487bp and 297bp on agarose gel, respectively. Drug sensitivity test were also done and results showed that they were sensitive to cefazolin, clindamycin, erythromycin, levofloxacin, nitrofurantoin, penicillin-G, and vancomycin and resistive to tetracycline. Balb/c mice infected with the isolated SS2 strain showed swelling in stomach and intestine, cyanochroia at mouth and suggillation under skin, which were similar to the clinical features of patients. Streptococcus suis serotype 2 were also found on lung sheeting sample under microscope with Gram stain. Rabbits infected with the isolated SS2 showed the similar clinical features with mice.

Combined analysis of the chloroplast genome and transcriptome of the Antarctic vascular plant Deschampsia antarctica Desv.

PubMed

Lee, Jungeun; Kang, Yoonjee; Shin, Seung Chul; Park, Hyun; Lee, Hyoungseok

2014-01-01

Antarctic hairgrass (Deschampsia antarctica Desv.) is the only natural grass species in the maritime Antarctic. It has been researched as an important ecological marker and as an extremophile plant for studies on stress tolerance. Despite its importance, little genomic information is available for D. antarctica. Here, we report the complete chloroplast genome, transcriptome profiles of the coding/noncoding genes, and the posttranscriptional processing by RNA editing in the chloroplast system. The complete chloroplast genome of D. antarctica is 135,362 bp in length with a typical quadripartite structure, including the large (LSC: 79,881 bp) and small (SSC: 12,519 bp) single-copy regions, separated by a pair of identical inverted repeats (IR: 21,481 bp). It contains 114 unique genes, including 81 unique protein-coding genes, 29 tRNA genes, and 4 rRNA genes. Sequence divergence analysis with other plastomes from the BEP clade of the grass family suggests a sister relationship between D. antarctica, Festuca arundinacea and Lolium perenne of the Poeae tribe, based on the whole plastome. In addition, we conducted high-resolution mapping of the chloroplast-derived transcripts. Thus, we created an expression profile for 81 protein-coding genes and identified ndhC, psbJ, rps19, psaJ, and psbA as the most highly expressed chloroplast genes. Small RNA-seq analysis identified 27 small noncoding RNAs of chloroplast origin that were preferentially located near the 5'- or 3'-ends of genes. We also found >30 RNA-editing sites in the D. antarctica chloroplast genome, with a dominance of C-to-U conversions. We assembled and characterized the complete chloroplast genome sequence of D. antarctica and investigated the features of the plastid transcriptome. These data may contribute to a better understanding of the evolution of D. antarctica within the Poaceae family for use in molecular phylogenetic studies and may also help researchers understand the characteristics of the chloroplast transcriptome.

Na+/K+-ATPase α-subunit in swimming crab Portunus trituberculatus: molecular cloning, characterization, and expression under low salinity stress

NASA Astrophysics Data System (ADS)

Han, Xiaolin; Liu, Ping; Gao, Baoquan; Wang, Haofeng; Duan, Yafei; Xu, Wenfei; Chen, Ping

2015-07-01

Na+/K+-ATPases are membrane-associated enzymes responsible for the active transport of Na+ and K+ ions across cell membranes, generating chemical and electrical gradients. These enzymes' α-subunit provides catalytic function, binding and hydrolyzing ATP, and itself becoming phosphorylated during the transport cycle. In this study, Na+/K+-ATPase α-subunit cDNA was cloned from gill tissue of the swimming crab Portunus trituberculatus by reverse-transcription polymerase chain reaction (RT-PCR) and rapid amplification of cDNA end methods. Analysis of the nucleotide sequence revealed that the cDNA had a full-length of 3 833 base pairs (bp), with an open reading frame of 3 120 bp, 5' untranslated region (UTR) of 317 bp, and 3' UTR of 396 bp. The sequence encoded a 1 039 amino acid protein with a predicted molecular weight of 115.57 kDa and with estimated pI of 5.21. It was predicted here to possess all expected features of Na+/K+-ATPase members, including eight transmembrane domains, putative ATP-binding site, and phosphorylation site. Comparison of amino acid sequences showed that the P. trituberculatus α-subunit possessed an overall identity of 75%-99% to that of other organisms. Phylogenetic analysis revealed that this α-subunit was in the same category as those of crustaceans. Quantitative real-time RT-PCR analysis indicated that this α-subunit's transcript were most highly expressed in gill and lowest in muscle. RT-PCR analysis also revealed that α-subunit expression in crab gill decreased after 2 and 6 h, but increased after 12, 24, 48, and 72 h. In addition, α-subunit expression in hepatopancreas of crab decreased after 2-72 h. These facts indicated that the crab's Na+/K+-ATPase α-subunit was potentially involved in the observed acute response to low salinity stress.

The Kinetic Mechanism for DNA Unwinding by Multiple Molecules of Dda Helicase Aligned on DNA†

PubMed Central

Eoff, Robert L.; Raney, Kevin D.

2010-01-01

Helicases catalyze the separation of double-stranded nucleic acids to form single-stranded intermediates. Using transient state kinetic methods we have determined the kinetic properties of DNA unwinding under conditions that favor a monomeric form of the Dda helicase as well as conditions that allow multiple molecules to function on the same substrate. Multiple helicase molecules can align like a train on the DNA track. The number of base pairs unwound in a single binding event for Dda is increased from ~19 bp for the monomeric form to ~64 bp when as many as four Dda molecules are aligned on the same substrate, while the kinetic step-size (3.2 ± 0.7 bp) and unwinding rate (242 ± 25 bp s−1) appear to be independent of the number of Dda molecules present on a given substrate. The data support a model in which the helicase molecules bound to the same substrate move along the DNA track independently during DNA unwinding. The observed increase in processivity arises from the increased probability that at least one of the helicases will completely unwind the DNA prior to dissociation. These results are in contrast to previous reports in which multiple Dda molecules on the same track greatly enhanced the rate and amplitude for displacement of protein blocks on the track. Therefore, only when the progress of the lead molecule in the train is impeded by some type of block, such as a protein bound to DNA, do the trailing molecules interact with the lead molecule in order to overcome the block. The fact that trailing helicase molecules have little impact on the lead molecule in the train during routine DNA unwinding suggests that the trailing molecules are moving at similar rates as the lead molecule. This result implicates a step in the translocation mechanism as contributing greatly to the overall rate-limiting step for unwinding of duplex DNA. PMID:20408588

Development of SCoT-Based SCAR Marker for Rapid Authentication of Taxus Media.

PubMed

Hao, Juan; Jiao, Kaili; Yu, Chenliang; Guo, Hong; Zhu, Yujia; Yang, Xiao; Zhang, Siyang; Zhang, Lei; Feng, Shangguo; Song, Yaobin; Dong, Ming; Wang, Huizhong; Shen, Chenjia

2018-06-01

Taxus media is an important species in the family Taxaceae with high medicinal and commercial value. Overexploitation and illegal trade have led T. media to a severe threat of extinction. In addition, T. media and other Taxus species have similar morphological traits and are easily misidentified, particularly during the seedling stage. The purpose of this study is to develop a species-specific marker for T. media. Through a screening of 36 start codon targeted (SCoT) polymorphism primers, among 15 individuals of 4 Taxus species (T. media, T. chinensis, T. cuspidate and T. fuana), a clear species-specific DNA fragment (amplified by primer SCoT3) for T. media was identified. After isolation and sequencing, a DNA sequence with 530 bp was obtained. Based on this DNA fragment, a primer pair for the sequence-characterized amplified region marker was designed and named MHSF/MHSR. PCR analysis with primer pair MHSF/MHSR revealed a clear amplified band for all individuals of T. media but not for T. chinensis, T. cuspidate and T. fuana. Therefore, this marker can be used as a quick, efficient and reliable tool to identify T. media among other related Taxus species. The results of this study will lay an important foundation for the protection and management of T. media as a natural resource.

The Mitochondrial Genome Sequence and Molecular Phylogeny of the Turkey, Meleagris gallopavo

PubMed Central

Guan, Xiaojing; Silva, Pradeepa; Gyenai, Kwaku B.; Xu, Jun; Geng, Tuoyu; Tu, Zhijian; Samuels, David C.; Smith, Edward J.

2009-01-01

Summary The mitochondrial genome (mtGenome) has been very little studied in the turkey (Meleagris gallopavo), for which there is no publicly available whole genome mitochondrial sequence. Here, we used PCR-based methods with 19 pairs of primers designed from the chicken and other species to develop a complete turkey mtGenome sequence. A total length of 16, 717 bp of the whole turkey mtGenome was obtained, with 85% similarity to chicken mtGenome. There were 13 genes and 24 RNA (22 tRNA and 2 rRNA) annotated. The mtGenome-based phylogenetic analysis suggests that the turkey is most closely related to the chicken, Gallus gallus, and quail, Corturnix japonica. Given the importance of the mitochondria genome, the present work adds to the growing genomic resources needed to define the genetic mechanisms that underlie some economic traits in the turkey. PMID:19067672

DNA Damage Signals and Space Radiation Risk

NASA Technical Reports Server (NTRS)

Cucinotta, Francis A.

2011-01-01

Space radiation is comprised of high-energy and charge (HZE) nuclei and protons. The initial DNA damage from HZE nuclei is qualitatively different from X-rays or gamma rays due to the clustering of damage sites which increases their complexity. Clustering of DNA damage occurs on several scales. First there is clustering of single strand breaks (SSB), double strand breaks (DSB), and base damage within a few to several hundred base pairs (bp). A second form of damage clustering occurs on the scale of a few kbp where several DSB?s may be induced by single HZE nuclei. These forms of damage clusters do not occur at low to moderate doses of X-rays or gamma rays thus presenting new challenges to DNA repair systems. We review current knowledge of differences that occur in DNA repair pathways for different types of radiation and possible relationships to mutations, chromosomal aberrations and cancer risks.

Complete genome sequence of Granulicella mallensis type strain MP5ACTX8T, an acidobacterium from tundra soil

PubMed Central

Rawat, Suman R.; Männistö, Minna K.; Starovoytov, Valentin; Goodwin, Lynne; Nolan, Matt; Hauser, Loren J.; Land, Miriam; Davenport, Karen Walston; Woyke, Tanja; Häggblom, Max M.

2013-01-01

Granulicella mallensis MP5ACTX8T is a novel species of the genus Granulicella in subdivision 1of Acidobacteria. G. mallensis is of ecological interest being a member of the dominant soil bacterial community active at low temperatures and nutrient limiting conditions in Arctic alpine tundra. G. mallensis is a cold-adapted acidophile and a versatile heterotroph that hydrolyzes a suite of sugars and complex polysaccharides. Genome analysis revealed metabolic versatility with genes involved in metabolism and transport of carbohydrates. These include gene modules encoding the carbohydrate-active enzyme (CAZyme) family involved in breakdown, utilization and biosynthesis of diverse structural and storage polysaccharides including plant based carbon polymers. The genome of Granulicella mallensis MP5ACTX8T consists of a single replicon of 6,237,577 base pairs (bp) with 4,907 protein-coding genes and 53 RNA genes. PMID:24501646

Complete genome sequence of Granulicella mallensis type strain MP5ACTX8(T), an acidobacterium from tundra soil

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rawat, Suman R.; Mannisto, Minna; Starovoytov, Valentin

2013-01-01

Granulicella mallensis MP5ACTX8(T) is a novel species of the genus Granulicella in subdivision 1 of Acidobacteria. G. mallensis is of ecological interest being a member of the dominant soil bacterial community active at low temperatures and nutrient limiting conditions in Arctic alpine tundra. G. mallensis is a cold-adapted acidophile and a versatile heterotroph that hydrolyzes a suite of sugars and complex polysaccharides. Genome analysis revealed metabolic versatility with genes involved in metabolism and transport of carbohydrates. These include gene modules encoding the carbohydrate-active enzyme (CAZyme) family involved in breakdown, utilization and biosynthesis of diverse structural and storage polysaccharides including plantmore » based carbon polymers. The genome of Granulicella mallensis MP5ACTX8(T) consists of a single replicon of 6,237,577 base pairs (bp) with 4,907 protein-coding genes and 53 RNA« less

Long-term effect of massage therapy on blood pressure in prehypertensive women.

PubMed

Givi, Mahshid; Sadeghi, Masoumeh; Garakyaraghi, Mohammad; Eshghinezhad, Ameneh; Moeini, Mahin; Ghasempour, Zahra

2018-01-01

Prehypertension is one of the cardiovascular disease predicators. Management of prehypertension is an appropriate objective for clinicians in a wide range of medical centers. Massage therapy is primarily nonpharmacological treatment that is used to control blood pressure (BP). This study intends to investigate the long-term effect of massage therapy on BP in prehypertensive women. This was a single-blind clinical trial study conducted on 50 prehypertensive women who referred to Sedigheh Tahereh Cardiovascular Center, during 6 months in 2009. Participants were selected by simple random sampling and were divided into control and intervention groups. The test group (25 patients) received massage for 10-15 min, three times a week for 10 sessions, and the control group (25 patients) was relaxed in the same environment but with no massage. Their BP was measured before and after each session and 72 h and 2 weeks after finishing the massage therapy. Analyzing the data was done using descriptive and inferential statistical methods (Chi-square, Mann-Whitney, paired t -test, and Student's t -test) through SPSS software version 18 and a significant level was considered as P < 0.05. The results indicated that the mean systolic BP (SBP) and diastolic BP (DBP) in the massage group were significantly lower in comparison with the control group ( P < 0.001). Evaluation of durability of the massage effects on BP also indicated that 72 h after finishing the study, still there was a significant difference between the test and control groups in SBP and DBP ( P < 0.001), but after 2 weeks, there was not a significant difference in SBP and DBP ( P > 0.05) between the two groups. Although massage therapy seems to be a safe, effective, applicable, and cost-effective intervention to control BP of prehypertensive women, its effects do not persist for a long time.

Serum levels of IGF-1 and IGF-BP3 are associated with event-free survival in adult Ewing sarcoma patients treated with chemotherapy.

PubMed

de Groot, Stefanie; Gelderblom, Hans; Fiocco, Marta; Bovée, Judith Vmg; van der Hoeven, Jacobus Jm; Pijl, Hanno; Kroep, Judith R

2017-01-01

Activation of the insulin-like growth factor 1 (IGF-1) pathway is involved in cell growth and proliferation and is associated with tumorigenesis, tumor progression, and therapy resistance in solid tumors. We examined whether variability in serum levels of IGF-1, IGF-2, and IGF-binding protein 3 (IGF-BP3) can predict event-free survival (EFS) and overall survival (OS) in Ewing sarcoma patients treated with chemotherapy. Serum levels of IGF-1, IGF-2, and IGF-BP3 of 22 patients with localized or metastasized Ewing sarcoma treated with six cycles of vincristine/ifosfamide/doxorubicin/etoposide (VIDE) chemotherapy were recorded. Baseline levels were compared with presixth cycle levels using paired t -tests and were tested for associations with EFS and OS. Continuous variables were dichotomized according to the Contal and O'Quigley procedure. Survival analyses were performed using Cox regression analysis. High baseline IGF-1 and IGF-BP3 serum levels were associated with EFS (hazard ratio [HR] 0.075, 95% confidence interval [CI] 0.009-0.602 and HR 0.090, 95% CI 0.011-0.712, respectively) in univariate and multivariate analyses (HR 0.063, 95% CI 0.007-0.590 and HR 0.057, 95% CI 0.005-0.585, respectively). OS was improved, but this was not statistically significant. IGF-BP3 and IGF-2 serum levels increased during treatment with VIDE chemotherapy ( P =0.055 and P =0.023, respectively). High circulating serum levels of IGF-1 and IGF-BP3 and the molar ratio of IGF-1:IGF-BP3 serum levels were associated with improved EFS and a trend for improved OS in Ewing sarcoma patients treated with VIDE chemotherapy. These findings suggest the need for further investigation of the IGF-1 pathway as a biomarker of disease progression in patients with Ewing sarcoma.

Parental origin impairment of synaptic functions and behaviors in cytoplasmic FMRP interacting protein 1 (Cyfip1) deficient mice.

PubMed

Chung, Leeyup; Wang, Xiaoming; Zhu, Li; Towers, Aaron J; Cao, Xinyu; Kim, Il Hwan; Jiang, Yong-hui

2015-12-10

CYFIP1 maps to the interval between proximal breakpoint 1 (BP1) and breakpoint 2 (BP2) of chromosomal 15q11-q13 deletions that are implicated in the Angelman (AS) and Prader-Willi syndrome (PWS). There is only one breakpoint (BP3) at the distal end of deletion. CYFIP1 is deleted in AS patients with the larger class I deletion (BP1 to BP3) and the neurological presentations in these patients are more severe than that of patients with class II (BP2 to BP3) deletion. The haploinsufficiency of CYFIP1 is hypothesized to contribute to more severe clinical presentations in class I AS patients. The expression of CYFIP1 is suggested to be bi-allelic in literature but the possibility of parental origin of expression is not completely excluded. We generated and characterized Cyfip1 mutant mice. Homozygous Cyfip1 mice were early embryonic lethal. However, there was a parental origin specific effect between paternal Cyfip1 deficiency (m+/p-) and maternal deficiency (m-/p+) on both synaptic transmissions and behaviors in hippocampal CA1 synapses despite no evidence supporting the parental origin difference for the expression. Both m-/p+ and m+/p- showed the impaired input-output response and paired-pulse facilitation. While the long term-potentiation and group I mGluR mediated long term depression induced by DHPG was not different between Cyfip1 m-/p+ and m+/p- mice, the initial DHPG induced response was significantly enhanced in m-/p+ but not in m+/p- mice. m+/p- but not m-/p+ mice displayed increased freezing in cued fear conditioning and abnormal transitions in zero-maze test. The impaired synaptic transmission and behaviors in haploinsufficiency of Cyfip1 mice provide the evidence supporting the role of CYFIP1 modifying the clinical presentation of class I AS patients and in human neuropsychiatric disorders. Copyright © 2015 Elsevier B.V. All rights reserved.

Molecular cloning and characterization of satellite DNA sequences from constitutive heterochromatin of the habu snake (Protobothrops flavoviridis, Viperidae) and the Burmese python (Python bivittatus, Pythonidae).

PubMed

Matsubara, Kazumi; Uno, Yoshinobu; Srikulnath, Kornsorn; Seki, Risako; Nishida, Chizuko; Matsuda, Yoichi

2015-12-01

Highly repetitive DNA sequences of the centromeric heterochromatin provide valuable molecular cytogenetic markers for the investigation of genomic compartmentalization in the macrochromosomes and microchromosomes of sauropsids. Here, the relationship between centromeric heterochromatin and karyotype evolution was examined using cloned repetitive DNA sequences from two snake species, the habu snake (Protobothrops flavoviridis, Crotalinae, Viperidae) and Burmese python (Python bivittatus, Pythonidae). Three satellite DNA (stDNA) families were isolated from the heterochromatin of these snakes: 168-bp PFL-MspI from P. flavoviridis and 196-bp PBI-DdeI and 174-bp PBI-MspI from P. bivittatus. The PFL-MspI and PBI-DdeI sequences were localized to the centromeric regions of most chromosomes in the respective species, suggesting that the two sequences were the major components of the centromeric heterochromatin in these organisms. The PBI-MspI sequence was localized to the pericentromeric region of four chromosome pairs. The PFL-MspI and the PBI-DdeI sequences were conserved only in the genome of closely related species, Gloydius blomhoffii (Crotalinae) and Python molurus, respectively, although their locations on the chromosomes were slightly different. In contrast, the PBI-MspI sequence was also in the genomes of P. molurus and Boa constrictor (Boidae), and additionally localized to the centromeric regions of eight chromosome pairs in B. constrictor, suggesting that this sequence originated in the genome of a common ancestor of Pythonidae and Boidae, approximately 86 million years ago. The three stDNA sequences showed no genomic compartmentalization between the macrochromosomes and microchromosomes, suggesting that homogenization of the centromeric and/or pericentromeric stDNA sequences occurred in the macrochromosomes and microchromosomes of these snakes.

In silico cloning, expression of Rieske-like apoprotein gene and protein subcellular localization in the Pacific oyster, Crassostrea gigas.

PubMed

He, Xiaocui; Zhang, Yang; Yu, Ziniu

2010-10-01

Rieske protein gene in the Pacific oyster Crassostrea gigas was obtained by in silico cloning for the first time, and its expression profiles and subcellular localization were determined, respectively. The full-length cDNA of Cgisp is 985 bp in length and contains a 5'- and 3'-untranslated regions of 35 and 161 bp, respectively, with an open reading frame of 786 bp encoding a protein of 262 amino acids. The predicted molecular weight of 30 kDa of Cgisp protein was verified by prokaryotic expression. Conserved Rieske [2Fe-2S] cluster binding sites and highly matched-pair tertiary structure with 3CWB_E (Gallus gallus) were revealed by homologous analysis and molecular modeling. Eleven putative SNP sites and two conserved hexapeptide sequences, box I (THLGC) and II (PCHGS), were detected by multiple alignments. Real-time PCR analysis showed that Cgisp is expressed in a wide range of tissues, with adductor muscle exhibiting the top expression level, suggesting its biological function of energy transduction. The GFP tagging Cgisp indicated a mitochondrial localization, further confirming its physiological function.

Maternal prepregnancy overweight and offspring fatness and blood pressure: role of physical activity.

PubMed

Eisenman, Joey C; Sarzynski, Mark A; Tucker, Jerod; Heelan, Kate A

2010-08-01

The purpose of this study was to examine if offspring physical activity may affect the relationship between maternal overweight and offspring fatness and blood pressure (BP). Subjects included 144 maternal-child pairs (n = 74 boys and 70 girls, mean age = 7.3 yrs). Maternal prepregnancy BMI was determined by self-report. Offspring characteristics included resting systolic and diastolic BP, body fatness by dual energy x-ray absorbtiometry, and moderate-to-vigorous physical activity (MVPA) using the Actigraph accelerometer. Children whose mothers were overweight or obese prepregnancy (Prepreg OW) were significantly larger and fatter than children from mothers with a normal prepregnancy BMI (Prepreg NORM). Prepreg OW children also had higher mean arterial pressure than Prepreg NORM children. BP values were not different across maternal Prepreg BMI/ MVPA groups. Percent fat was significantly different across Prepreg BMI/MVPA groups. Prepreg OW children that did not meet the daily recommended value of MVPA were the fattest. Prepreg OW children that attained (3)60 min of MVPA/ day had a mean percent body fat that was similar to Prepreg NORM children of either MVPA group.

Stable high-power saturable absorber based on polymer-black-phosphorus films

NASA Astrophysics Data System (ADS)

Mao, Dong; Li, Mingkun; Cui, Xiaoqi; Zhang, Wending; Lu, Hua; Song, Kun; Zhao, Jianlin

2018-01-01

Black phosphorus (BP), a rising two-dimensional material with a layer-number-dependent direct bandgap of 0.3-1.5 eV, is very interesting for optoelectronics applications from near- to mid-infrared wavebands. In the atmosphere, few-layer BP tends to be oxidized or degenerated during interacting with lasers. Here, we fabricate few-layer BP nanosheets based on a liquid exfoliation method using N-methylpyrrolidone as the dispersion liquid. By incorporating BP nanosheets with polymers (polyvinyl alcohol or high-melting-point polyimide), two flexible filmy BP saturable absorbers are fabricated to realize passive mode locking in erbium-doped fiber lasers. The polymer-BP saturable absorber, especially the polyimide-BP saturable absorber, can prevent the oxidation or water-induced etching under high-power laser illuminations, providing a promising candidate for Q-switchers, mode lockers, and light modulators.

Blood pressure (BP) assessment-from BP level to BP variability.

PubMed

Feber, Janusz; Litwin, Mieczyslaw

2016-07-01

The assessment of blood pressure (BP) can be challenging in children, especially in very young individuals, due to their variable body size and lack of cooperation. In the absence of data relating BP with cardiovascular outcomes in children, there is a need to convert absolute BP values (in mmHg) into age-, gender- and height appropriate BP percentiles or Z-scores in order to compare a patient's BP with the BP of healthy children of the same age, but also of children of different ages. Traditionally, the interpretation of BP has been based mainly on the assessment of the BP level obtained by office, home or 24-h BP monitoring. Recent studies suggest that it is not only BP level (i.e. average BP) but also BP variability that is clinically important for the development of target organ damage, including the progression of chronic kidney disease. In this review we describe current methods to evaluate of BP level, outline available methods for BP variability assessment and discuss the clinical consequences of BP variability, including its potential role in the management of hypertension.

High Resolution Size Analysis of Fetal DNA in the Urine of Pregnant Women by Paired-End Massively Parallel Sequencing

PubMed Central

Tsui, Nancy B. Y.; Jiang, Peiyong; Chow, Katherine C. K.; Su, Xiaoxi; Leung, Tak Y.; Sun, Hao; Chan, K. C. Allen; Chiu, Rossa W. K.; Lo, Y. M. Dennis

2012-01-01

Background Fetal DNA in maternal urine, if present, would be a valuable source of fetal genetic material for noninvasive prenatal diagnosis. However, the existence of fetal DNA in maternal urine has remained controversial. The issue is due to the lack of appropriate technology to robustly detect the potentially highly degraded fetal DNA in maternal urine. Methodology We have used massively parallel paired-end sequencing to investigate cell-free DNA molecules in maternal urine. Catheterized urine samples were collected from seven pregnant women during the third trimester of pregnancies. We detected fetal DNA by identifying sequenced reads that contained fetal-specific alleles of the single nucleotide polymorphisms. The sizes of individual urinary DNA fragments were deduced from the alignment positions of the paired reads. We measured the fractional fetal DNA concentration as well as the size distributions of fetal and maternal DNA in maternal urine. Principal Findings Cell-free fetal DNA was detected in five of the seven maternal urine samples, with the fractional fetal DNA concentrations ranged from 1.92% to 4.73%. Fetal DNA became undetectable in maternal urine after delivery. The total urinary cell-free DNA molecules were less intact when compared with plasma DNA. Urinary fetal DNA fragments were very short, and the most dominant fetal sequences were between 29 bp and 45 bp in length. Conclusions With the use of massively parallel sequencing, we have confirmed the existence of transrenal fetal DNA in maternal urine, and have shown that urinary fetal DNA was heavily degraded. PMID:23118982

A k-mer-based barcode DNA classification methodology based on spectral representation and a neural gas network.

PubMed

Fiannaca, Antonino; La Rosa, Massimo; Rizzo, Riccardo; Urso, Alfonso

2015-07-01

In this paper, an alignment-free method for DNA barcode classification that is based on both a spectral representation and a neural gas network for unsupervised clustering is proposed. In the proposed methodology, distinctive words are identified from a spectral representation of DNA sequences. A taxonomic classification of the DNA sequence is then performed using the sequence signature, i.e., the smallest set of k-mers that can assign a DNA sequence to its proper taxonomic category. Experiments were then performed to compare our method with other supervised machine learning classification algorithms, such as support vector machine, random forest, ripper, naïve Bayes, ridor, and classification tree, which also consider short DNA sequence fragments of 200 and 300 base pairs (bp). The experimental tests were conducted over 10 real barcode datasets belonging to different animal species, which were provided by the on-line resource "Barcode of Life Database". The experimental results showed that our k-mer-based approach is directly comparable, in terms of accuracy, recall and precision metrics, with the other classifiers when considering full-length sequences. In addition, we demonstrate the robustness of our method when a classification is performed task with a set of short DNA sequences that were randomly extracted from the original data. For example, the proposed method can reach the accuracy of 64.8% at the species level with 200-bp fragments. Under the same conditions, the best other classifier (random forest) reaches the accuracy of 20.9%. Our results indicate that we obtained a clear improvement over the other classifiers for the study of short DNA barcode sequence fragments. Copyright © 2015 Elsevier B.V. All rights reserved.

Team-Based Care and Improved Blood Pressure Control

PubMed Central

Proia, Krista K.; Thota, Anilkrishna B.; Njie, Gibril J.; Finnie, Ramona K.C.; Hopkins, David P.; Mukhtar, Qaiser; Pronk, Nicolaas P.; Zeigler, Donald; Kottke, Thomas E.; Rask, Kimberly J.; Lackland, Daniel T.; Brooks, Joy F.; Braun, Lynne T.; Cooksey, Tonya

2015-01-01

Context Uncontrolled hypertension remains a widely prevalent cardiovascular risk factor in the U.S. team-based care, established by adding new staff or changing the roles of existing staff such as nurses and pharmacists to work with a primary care provider and the patient. Team-based care has the potential to improve the quality of hypertension management. The goal of this Community Guide systematic review was to examine the effectiveness of team-based care in improving blood pressure (BP) outcomes. Evidence acquisition An existing systematic review (search period, January 1980–July 2003) assessing team-based care for BP control was supplemented with a Community Guide update (January 2003–May 2012). For the Community Guide update, two reviewers independently abstracted data and assessed quality of eligible studies. Evidence synthesis Twenty-eight studies in the prior review (1980–2003) and an additional 52 studies from the Community Guide update (2003–2012) qualified for inclusion. Results from both bodies of evidence suggest that team-based care is effective in improving BP outcomes. From the update, the proportion of patients with controlled BP improved (median increase=12 percentage points); systolic BP decreased (median reduction=5.4 mmHg); and diastolic BP also decreased (median reduction=1.8 mmHg). Conclusions Team-based care increased the proportion of people with controlled BP and reduced both systolic and diastolic BP, especially when pharmacists and nurses were part of the team. Findings are applicable to a range of U.S. settings and population groups. Implementation of this multidisciplinary approach will require health system–level organizational changes and could be an important element of the medical home. PMID:24933494

Team-based care and improved blood pressure control: a community guide systematic review.

PubMed

Proia, Krista K; Thota, Anilkrishna B; Njie, Gibril J; Finnie, Ramona K C; Hopkins, David P; Mukhtar, Qaiser; Pronk, Nicolaas P; Zeigler, Donald; Kottke, Thomas E; Rask, Kimberly J; Lackland, Daniel T; Brooks, Joy F; Braun, Lynne T; Cooksey, Tonya

2014-07-01

Uncontrolled hypertension remains a widely prevalent cardiovascular risk factor in the U.S. team-based care, established by adding new staff or changing the roles of existing staff such as nurses and pharmacists to work with a primary care provider and the patient. Team-based care has the potential to improve the quality of hypertension management. The goal of this Community Guide systematic review was to examine the effectiveness of team-based care in improving blood pressure (BP) outcomes. An existing systematic review (search period, January 1980-July 2003) assessing team-based care for BP control was supplemented with a Community Guide update (January 2003-May 2012). For the Community Guide update, two reviewers independently abstracted data and assessed quality of eligible studies. Twenty-eight studies in the prior review (1980-2003) and an additional 52 studies from the Community Guide update (2003-2012) qualified for inclusion. Results from both bodies of evidence suggest that team-based care is effective in improving BP outcomes. From the update, the proportion of patients with controlled BP improved (median increase=12 percentage points); systolic BP decreased (median reduction=5.4 mmHg); and diastolic BP also decreased (median reduction=1.8 mmHg). Team-based care increased the proportion of people with controlled BP and reduced both systolic and diastolic BP, especially when pharmacists and nurses were part of the team. Findings are applicable to a range of U.S. settings and population groups. Implementation of this multidisciplinary approach will require health system-level organizational changes and could be an important element of the medical home. Published by Elsevier Inc.

Mesoporous silica aerogel as a drug carrier for the enhancement of the sunscreen ability of benzophenone-3.

PubMed

Li, C C; Chen, Y T; Lin, Y T; Sie, S F; Chen-Yang, Y W

2014-03-01

In the present study, about 45 and 34 wt% of benzophenone-3 (BP-3), an organic UV filter, was adsorbed on a high surface area mesoporous silica (MS) drug carrier to prepare BP-3-bearing MS (MSBP) sunscreen materials MSBP-1 and MSBP-2, respectively. The effect of the adsorption of BP-3 by MS on the UV protection ability of MSBP was demonstrated and a synergistic UV protection effect was observed in the as-prepared MSBP UV filters. Compared with free BP-3, adsorbed BP-3 had greatly reduced crystallinity and the dispersion of MSBP was significantly improved in the sunscreen. The in vitro sun protection factor (SPF) and in vitro UV-A values of the MSBP-2-based sunscreen was about 17.3% and 17.0% higher than that of free BP-3-based sunscreen, respectively, indicating that the ability of the sunscreen to protect against UV-B and UV-A improved because of the BP-3 content of the MS matrix. In addition, the decrease in SPF and UV-A values over time was significantly less in the MSBP-based sunscreens than in free BP-3-based sunscreen. Results of this study reveal that MS is a promising organic sunscreen carrier as well as a potential carrier for other topical drugs. Copyright © 2013 Elsevier B.V. All rights reserved.

Evidence and Perspectives on the 24-hour Management of Hypertension: Hemodynamic Biomarker-Initiated 'Anticipation Medicine' for Zero Cardiovascular Event.

PubMed

Kario, Kazuomi

There are notable differences between Asians and Westerners regarding hypertension (HTN) and the relationship between HTN and cardiovascular disease (CVD). Asians show greater morning surges in blood pressure (BP) and a steeper slope illustrating the link between higher BP and the risk of CVD events. It is thus particularly important for Asian hypertensives to achieve 24-h BP control, including morning and night-time control. There are three components of 'perfect 24-h BP control:' the 24-h BP level, nocturnal BP dipping, and BP variability (BPV), such as the morning BP surge that can be assessed by ambulatory BP monitoring. The morning BP-guided approach using home BP monitoring (HBPM) is the first step toward perfect 24-h BP control, followed by the control of nocturnal HTN. We have been developing new HBPM devices that can measure nocturnal BP. BPV includes different time-phase variability from the shortest beat-by-beat, positional, diurnal, day-by-day, visit-to-visit, seasonal, and yearly changes. The synergistic resonance of each type of BPV would produce a great dynamic BP surge (resonance hypothesis), which triggers a CVD event, especially in the high-risk patients with systemic hemodynamic atherothrombotic syndrome (SHATS). In the future, the innovative management of HTN based on the simultaneous assessment of the resonance of all of the BPV phenotypes using a beat by beat wearable 'surge' BP monitoring device (WSP) and an information and communication technology (ICT)-based data analysis system will produce a paradigm shift from 'dots' BP management to 'seamless' ultimate individualized 'anticipation medication' for reaching a zero CVD event rate. Copyright © 2016 The Author. Published by Elsevier Inc. All rights reserved.

A Single Session of Low-Volume High-Intensity Interval Exercise Reduces Ambulatory Blood Pressure in Normotensive Men.

PubMed

Dantas, Teresa C B; Farias Junior, Luiz F; Frazão, Danniel T; Silva, Paulo H M; Sousa Junior, Altieres E; Costa, Ingrid B B; Ritti-Dias, Raphael M; Forjaz, Cláudia L M; Duhamel, Todd A; Costa, Eduardo C

2017-08-01

Dantas, TCB, Farias Junior, LF, Frazão, DT, Silva, PHM, Sousa Junior, AE, Costa, IBB, Ritti-Dias, RM, Forjaz, CLM, Duhamel, TA, and Costa, EC. A single session of low-volume high-intensity interval exercise reduces ambulatory blood pressure in normotensive men. J Strength Cond Res 31(8): 2263-2269, 2017-The magnitude and duration of postexercise hypotension (PEH) may provide valuable information on the efficacy of an exercise approach to blood pressure (BP) control. We investigated the acute effect of a time-efficient high-intensity interval exercise (HIIE) on ambulatory BP. Twenty-one normotensive men (23.6 ± 3.6 years) completed 2 experimental sessions in a randomized order: (a) control (no exercise) and (b) low-volume HIIE: 10 × 1 minute at 100% of maximal treadmill velocity interspersed with 1 minute of recovery. After each experimental session, an ambulatory BP monitoring was initiated. Paired sample t-test was used to compare BP averages for awake, asleep, and 20-hour periods between the control and the low-volume HIIE sessions. A 2-way repeated measures analysis of variance was used to analyze hourly BP after both experimental sessions. Blood pressure averages during the awake (systolic: 118 ± 6 vs. 122 ± 6 mm Hg; diastolic: 65 ± 7 vs. 67 ± 7 mm Hg) and 20-hour (systolic: 115 ± 7 vs. 118 ± 6 mm Hg; diastolic: 62 ± 7 vs. 64 ± 7 mm Hg) periods were lower after the low-volume HIIE compared with the control (p ≤ 0.05). Systolic and diastolic PEH presented medium (Cohen's d = 0.50-0.67) and small (Cohen's d = 0.29) effect sizes, respectively. Systolic PEH occurred in a greater magnitude during the first 5 hours (3-5 mm Hg). No changes were found in asleep BP (p > 0.05). In conclusion, a single session of low-volume HIIE reduced ambulatory BP in normotensive men. The PEH occurred mainly in systolic BP during the first 5 hours postexercise.

Disruption in the relationship between blood pressure and salty taste thresholds among overweight and obese children

PubMed Central

Bobowski, Nuala K.

2015-01-01

Background Prevalence of high blood pressure (BP) among American children has increased over the past two decades, due in part to increasing rates of obesity and excessive dietary salt intake. Objective We tested the hypotheses that the relationships among BP, salty taste sensitivity, and salt intake differ between normal-weight and overweight/obese children. Design In an observational study, sodium chloride (NaCl) and monosodium glutamate (MSG) taste detection thresholds were measured using the Monell two-alternative, forced-choice, paired-comparison tracking method. Weight and BP were measured, and salt intake was determined by 24-hour dietary recall. Participants/Setting Eight- to 14-year-olds (N=97; 52% overweight or obese) from the Philadelphia area completed anthropometrics and BP measurements; 97% completed one or both thresholds. Seventy-six percent provided valid dietary recall data. Testing was completed between December 2011 and August 2012. Main outcome measures NaCl and MSG detection thresholds, BP, and dietary salt intake. Statistical analyses Outcome measures were compared between normal-weight and overweight/obese children with t-tests. Relationships among outcome measures within groups were examined with Pearson correlations, and multiple regression analysis was used to examine the relationship between BP and thresholds, controlling for age, BMI-Z score, and dietary salt intake. Results Salt and MSG thresholds were positively correlated (r(71)=0.30, p=0.01) and did not differ between body-weight groups (p>0.20). Controlling for age, BMI-Z score, and salt intake, systolic BP was associated with NaCl thresholds among normal-weight children (p=0.01), but not among overweight/obese children. All children consumed excess salt (>8 g/day). Grain and meat products were the primary source of dietary sodium. Conclusions The apparent disruption in the relationship between salty taste response and BP among overweight/obese children suggests the relationship may be influenced by body weight. Further research is warranted to explore this relationship as a potential measure to prevent development of hypertension. PMID:25843808

GapFiller: a de novo assembly approach to fill the gap within paired reads

PubMed Central

2012-01-01

Background Next Generation Sequencing technologies are able to provide high genome coverages at a relatively low cost. However, due to limited reads' length (from 30 bp up to 200 bp), specific bioinformatics problems have become even more difficult to solve. De novo assembly with short reads, for example, is more complicated at least for two reasons: first, the overall amount of "noisy" data to cope with increased and, second, as the reads' length decreases the number of unsolvable repeats grows. Our work's aim is to go at the root of the problem by providing a pre-processing tool capable to produce (in-silico) longer and highly accurate sequences from a collection of Next Generation Sequencing reads. Results In this paper a seed-and-extend local assembler is presented. The kernel algorithm is a loop that, starting from a read used as seed, keeps extending it using heuristics whose main goal is to produce a collection of error-free and longer sequences. In particular, GapFiller carefully detects reliable overlaps and operates clustering similar reads in order to reconstruct the missing part between the two ends of the same insert. Our tool's output has been validated on 24 experiments using both simulated and real paired reads datasets. The output sequences are declared correct when the seed-mate is found. In the experiments performed, GapFiller was able to extend high percentages of the processed seeds and find their mates, with a false positives rate that turned out to be nearly negligible. Conclusions GapFiller, starting from a sufficiently high short reads coverage, is able to produce high coverages of accurate longer sequences (from 300 bp up to 3500 bp). The procedure to perform safe extensions, together with the mate-found check, turned out to be a powerful criterion to guarantee contigs' correctness. GapFiller has further potential, as it could be applied in a number of different scenarios, including the post-processing validation of insertions/deletions detection pipelines, pre-processing routines on datasets for de novo assembly pipelines, or in any hierarchical approach designed to assemble, analyse or validate pools of sequences. PMID:23095524

Did Heinrich Events Impact Climate in the Southwest Pacific? - Evidence From New Zealand Speleothems

NASA Astrophysics Data System (ADS)

Whittaker, T. E.; Hendy, C. H.; Hellstrom, J.

2008-12-01

Speleothems, layered calcium-carbonate cave deposits such as stalagmites, stalactites and flowstones, have been shown to offer much potential as paleoclimate archives. We present a new, high-resolution, independently-dated, paleoclimate record from a stalagmite which formed in Hollywood Cave (42.0°S, 171.5°E) on South Island, New Zealand. Over 700 stable oxygen and carbon isotope measurement pairs are supported by a chronology from 18 sequential 230Th dates. The stalagmite grew between 73 and 11 kyr B.P. Growth rates varied from ~1-54 mm/kyr and data resolution yields one sample per 10- 320 years. Weak covariance between δ13C and δ18O in the speleothem calcite suggests that recorded climate signals are primarily driven by mean annual precipitation amount and source. Both stable isotope proxies indicate relatively cold and dry conditions prevailed for much of the period 73-11 kyr B.P. However, abrupt-onset, millennial-scale shifts to wet and cool climate interrupt the dry conditions at 67.7-61, 56-55, 50.5-47.5, 40-39, 30.5-29, 25.5-24.3, 16.1-15, and 12.2-11.8 kyr B.P. Significantly, these eight abrupt climate changes occur synchronously with widely accepted ages for Heinrich events H6-H0 (including H5a). Many of these abrupt events can also be matched to known periods of glacier advance in the Southern Alps, New Zealand, which, arguably, were driven by increased mean annual precipitation and reduced potential for summer melting. In addition, preliminary stable isotope data (> 550 δ13C and δ18O pairs) from two North Island, New Zealand (~38°S), stalagmites will be shown that also displays abrupt shifts from relatively dry to wet climate during the period 60-6 kyr B.P. In combination, these results argue stongly for coeval climate changes in antipodean locations, and therefore provide compelling evidence for globally synchronous climate variability during the last glacial period.

Identification on commercialized products of AFLP markers able to discriminate slow- from fast-growing chicken strains.

PubMed

Fumière, Olivier; Dubois, Marc; Grégoire, Dimitrie; Théwis, André; Berben, Gilbert

2003-02-26

The European chicken meat market is characterized by numerous quality marks: "Label de Qualité Wallon" in Belgium, "Label Rouge" in France, denominations of geographical origin, organic agriculture, etc. Most of those certified productions have specifications requiring the use of slow-growing chicken strains. The amplified fragment length polymorphism (AFLP) technique has been used to search molecular markers able to discriminate slow-growing chicken strains from fast-growing ones and to authenticate certified products. Two pairs of restriction enzymes (EcoRI/MseI and EcoRI/TaqI) and 121 selective primer combinations were tested on individual DNA samples from chicken products essentially in carcass form that were ascribed as belonging to either slow- or fast-growing strains. Within the resulting fingerprints, two fragments were identified as type-strains specific markers. One primer combination gives a band (333 bp) that is specific for slow-growing chickens, and another primer pair generates a band (372 bp) that was found to be characteristic of fast-growing chickens. The two markers were isolated, cloned, and sequenced. The effectiveness and the specificity of the two interesting determinants were assessed on individuals of two well-known strains (ISA 657 and Cobb 500) and on commercialized products coming from various origins.

One-step multiplex PCR method for the determination of pecan and Brazil nut allergens in food products.

PubMed

Hubalkova, Zora; Rencova, Eva

2011-10-01

A one-step polymerase chain reaction (PCR) method for the simultaneous detection of the major allergens of pecan and Brazil nuts was developed. Primer pairs for the amplification of partial sequences of genes encoding the allergens were designed and tested for their specificity on a range of food components. The targeted amplicon size was 173 bp of Ber e 1 gene of Brazil nuts and 72 bp of vicilin-like seed storage protein gene in pecan nuts. The primer pair detecting the noncoding region of the chloroplast DNA was used as the internal control of amplification. The intrinsic detection limit of the PCR method was 100 pg mL(-1) pecan or Brazil nuts DNA. The practical detection limit was 0.1% w/w (1 g kg(-1)). The method was applied for the investigation of 63 samples with the declaration of pecans, Brazil nuts, other different nut species or nuts generally. In 15 food samples pecans and Brazil nuts allergens were identified in the conformity with the food declaration. The presented multiplex PCR method is specific enough and can be used as a fast approach for the detection of major allergens of pecan or Brazil nuts in food. Copyright © 2011 Society of Chemical Industry.

SOPRA: Scaffolding algorithm for paired reads via statistical optimization.

PubMed

Dayarian, Adel; Michael, Todd P; Sengupta, Anirvan M

2010-06-24

High throughput sequencing (HTS) platforms produce gigabases of short read (<100 bp) data per run. While these short reads are adequate for resequencing applications, de novo assembly of moderate size genomes from such reads remains a significant challenge. These limitations could be partially overcome by utilizing mate pair technology, which provides pairs of short reads separated by a known distance along the genome. We have developed SOPRA, a tool designed to exploit the mate pair/paired-end information for assembly of short reads. The main focus of the algorithm is selecting a sufficiently large subset of simultaneously satisfiable mate pair constraints to achieve a balance between the size and the quality of the output scaffolds. Scaffold assembly is presented as an optimization problem for variables associated with vertices and with edges of the contig connectivity graph. Vertices of this graph are individual contigs with edges drawn between contigs connected by mate pairs. Similar graph problems have been invoked in the context of shotgun sequencing and scaffold building for previous generation of sequencing projects. However, given the error-prone nature of HTS data and the fundamental limitations from the shortness of the reads, the ad hoc greedy algorithms used in the earlier studies are likely to lead to poor quality results in the current context. SOPRA circumvents this problem by treating all the constraints on equal footing for solving the optimization problem, the solution itself indicating the problematic constraints (chimeric/repetitive contigs, etc.) to be removed. The process of solving and removing of constraints is iterated till one reaches a core set of consistent constraints. For SOLiD sequencer data, SOPRA uses a dynamic programming approach to robustly translate the color-space assembly to base-space. For assessing the quality of an assembly, we report the no-match/mismatch error rate as well as the rates of various rearrangement errors. Applying SOPRA to real data from bacterial genomes, we were able to assemble contigs into scaffolds of significant length (N50 up to 200 Kb) with very few errors introduced in the process. In general, the methodology presented here will allow better scaffold assemblies of any type of mate pair sequencing data.

Prediction of Industrial Electric Energy Consumption in Anhui Province Based on GA-BP Neural Network

NASA Astrophysics Data System (ADS)

Zhang, Jiajing; Yin, Guodong; Ni, Youcong; Chen, Jinlan

2018-01-01

In order to improve the prediction accuracy of industrial electrical energy consumption, a prediction model of industrial electrical energy consumption was proposed based on genetic algorithm and neural network. The model use genetic algorithm to optimize the weights and thresholds of BP neural network, and the model is used to predict the energy consumption of industrial power in Anhui Province, to improve the prediction accuracy of industrial electric energy consumption in Anhui province. By comparing experiment of GA-BP prediction model and BP neural network model, the GA-BP model is more accurate with smaller number of neurons in the hidden layer.

Mutant type glutathione S-transferase theta 1 gene homologue to mTOR in myelodysplastic syndrome: possible clinical application of rapamycin.

PubMed

Maeda, Yasuhiro; Yamaguchi, Terufumi; Ueda, Satomi; Matsuo, Koki; Morita, Yasuyoshi; Naiki, Yoshito; Miyazato, Hajime; Shimada, Takahiro; Miyatake, Jun-Ichi; Matsuda, Mitsuhiro; Kanamaru, Akihisa

2003-07-01

In this study, we observed the expression of the GSTT-1 gene in patients with myelodysplastic syndrome (MDS) at the messenger RNA level. Reverse transcription-polymerase chain reaction (RT-PCR) for GSTT-1 was performed with a pair of primers complementary to the 5' coding section and the 3' coding section of the GSTT-1 cDNA for amplifying the 623-bp band. Among 20 patients with MDS, 8 patients showed the expected 623-bp band on RT-PCR, and 12 patients showed a 500-bp band on RT-PCR, indicating that a 123-bp sequence was deleted as a mutant of the GSTT-1 gene. Furthermore, a BLAST DNA search showed that the deletion of a 123 bp sequence creates a sequence that is 63% homologous to human FKBP-rapamycin associated protein (FRAP); this protein has been termed a mammalian target of rapamycin (mTOR). We respectively transfected the wild type and the mutant type GSTT-1 gene in an expression vector to two cell lines (K562 and HL-60). The stable transformants for the wild type and the mutant type GSTT-1 genes were made by G418 selection. Interestingly, rapamycin could induce significant growth inhibition of the stable transformants for mutant type GSTT-1, which was indicative of apoptosis, but not that of those for wild type GSTT-1. These results suggest that rapamycin could be included in the therapeutic modality for the patients with MDS who have the mTOR sequences in GSTT-1 gene.

Validation of the Kingyield BP210 wrist blood pressure monitor for home blood pressure monitoring according to the European Society of Hypertension-International Protocol.

PubMed

Zeng, Wei-Fang; Huang, Qi-Fang; Sheng, Chang-Sheng; Li, Yan; Wang, Ji-Guang

2012-02-01

The present study aimed to evaluate the accuracy of the automated oscillometric wrist blood pressure monitor BP210 for home blood pressure monitoring according to the International Protocol of the European Society of Hypertension. Systolic and diastolic blood pressures were sequentially measured in 33 adult Chinese participants (21 women, 51 years of mean age) using a mercury sphygmomanometer (two observers) and the BP210 device (one supervisor). Ninety-nine pairs of comparisons were obtained from 15 participants in phase 1 and a further 18 participants in phase 2 of the validation study. Data analysis was conducted using the ESHIP analyzer. The BP210 device successfully passed phase 1 of the validation study with a number of absolute differences between device and observers within 5, 10, and 15 mmHg for at least 33/45, 44/45, and 44/45 measurements, respectively. The device also achieved the targets for phase 2.1, with 77/99, 95/99, and 97/99 differences within 5, 10, and 15 mmHg, respectively for systolic blood pressure, and with 78/99, 97/99, and 99/99 within 5, 10, and 15 mmHg, respectively for diastolic blood pressure. In phase 2.2, 29 and 25 participants had at least two of the three device-observers differences within 5 mmHg (required≥22) for systolic blood pressure and diastolic blood pressure, respectively. The Kingyield wrist blood pressure monitor BP210 has passed the International Protocol requirements, and hence can be recommended for home use in adults.

Complete Chloroplast Genome of the Multifunctional Crop Globe Artichoke and Comparison with Other Asteraceae

PubMed Central

Curci, Pasquale L.; De Paola, Domenico; Danzi, Donatella; Vendramin, Giovanni G.; Sonnante, Gabriella

2015-01-01

With over 20,000 species, Asteraceae is the second largest plant family. High-throughput sequencing of nuclear and chloroplast genomes has allowed for a better understanding of the evolutionary relationships within large plant families. Here, the globe artichoke chloroplast (cp) genome was obtained by a combination of whole-genome and BAC clone high-throughput sequencing. The artichoke cp genome is 152,529 bp in length, consisting of two single-copy regions separated by a pair of inverted repeats (IRs) of 25,155 bp, representing the longest IRs found in the Asteraceae family so far. The large (LSC) and the small (SSC) single-copy regions span 83,578 bp and 18,641 bp, respectively. The artichoke cp sequence was compared to the other eight Asteraceae complete cp genomes available, revealing an IR expansion at the SSC/IR boundary. This expansion consists of 17 bp of the ndhF gene generating an overlap between the ndhF and ycf1 genes. A total of 127 cp simple sequence repeats (cpSSRs) were identified in the artichoke cp genome, potentially suitable for future population studies in the Cynara genus. Parsimony-informative regions were evaluated and allowed to place a Cynara species within the Asteraceae family tree. The eight most informative coding regions were also considered and tested for “specific barcode” purpose in the Asteraceae family. Our results highlight the usefulness of cp genome sequencing in exploring plant genome diversity and retrieving reliable molecular resources for phylogenetic and evolutionary studies, as well as for specific barcodes in plants. PMID:25774672

Complete chloroplast genome of the multifunctional crop globe artichoke and comparison with other Asteraceae.

PubMed

Curci, Pasquale L; De Paola, Domenico; Danzi, Donatella; Vendramin, Giovanni G; Sonnante, Gabriella

2015-01-01

With over 20,000 species, Asteraceae is the second largest plant family. High-throughput sequencing of nuclear and chloroplast genomes has allowed for a better understanding of the evolutionary relationships within large plant families. Here, the globe artichoke chloroplast (cp) genome was obtained by a combination of whole-genome and BAC clone high-throughput sequencing. The artichoke cp genome is 152,529 bp in length, consisting of two single-copy regions separated by a pair of inverted repeats (IRs) of 25,155 bp, representing the longest IRs found in the Asteraceae family so far. The large (LSC) and the small (SSC) single-copy regions span 83,578 bp and 18,641 bp, respectively. The artichoke cp sequence was compared to the other eight Asteraceae complete cp genomes available, revealing an IR expansion at the SSC/IR boundary. This expansion consists of 17 bp of the ndhF gene generating an overlap between the ndhF and ycf1 genes. A total of 127 cp simple sequence repeats (cpSSRs) were identified in the artichoke cp genome, potentially suitable for future population studies in the Cynara genus. Parsimony-informative regions were evaluated and allowed to place a Cynara species within the Asteraceae family tree. The eight most informative coding regions were also considered and tested for "specific barcode" purpose in the Asteraceae family. Our results highlight the usefulness of cp genome sequencing in exploring plant genome diversity and retrieving reliable molecular resources for phylogenetic and evolutionary studies, as well as for specific barcodes in plants.

Mitochondrial DNA deletions in patients with chronic suppurative otitis media.

PubMed

Tatar, Arzu; Tasdemir, Sener; Sahin, Ibrahim; Bozoglu, Ceyda; Erdem, Haktan Bagis; Yoruk, Ozgur; Tatar, Abdulgani

2016-09-01

The aim of this study was to investigate the 4977 and 7400 bp deletions of mitochondrial DNA in patients with chronic suppurative otitis media and to indicate the possible association of mitochondrial DNA deletions with chronic suppurative otitis media. Thirty-six patients with chronic suppurative otitis media were randomly selected to assess the mitochondrial DNA deletions. Tympanomastoidectomy was applied for the treatment of chronic suppurative otitis media, and the curettage materials including middle ear tissues were collected. The 4977 and 7400 bp deletion regions and two control regions of mitochondrial DNA were assessed by using the four pair primers. DNA was extracted from middle ear tissues and peripheral blood samples of the patients, and then polymerase chain reactions (PCRs) were performed. PCR products were separated in 2 % agarose gel. Seventeen of 36 patients had the heterozygote 4977 bp deletion in the middle ear tissue but not in peripheral blood. There wasn't any patient who had the 7400 bp deletion in mtDNA of their middle ear tissue or peripheral blood tissue. The patients with the 4977 bp deletion had a longer duration of chronic suppurative otitis media and a higher level of hearing loss than the others (p < 0.01). Long time chronic suppurative otitis media and the reactive oxygen species can cause the mitochondrial DNA deletions and this may be a predisposing factor to sensorineural hearing loss in chronic suppurative otitis media. An antioxidant drug as a scavenger agent may be used in long-term chronic suppurative otitis media.

The promising anticancer drug 3-bromopyruvate is metabolized through glutathione conjugation which affects chemoresistance and clinical practice: An evidence-based view.

PubMed

El Sayed, Salah Mohamed; Baghdadi, Hussam; Zolaly, Mohammed; Almaramhy, Hamdi H; Ayat, Mongi; Donki, Jagadish G

2017-03-01

3-Bromopyruvate (3BP) is a promising effective anticancer drug against many different tumors in children and adults. 3BP exhibited strong anticancer effects in both preclinical and human studies e.g. energy depletion, oxidative stress, anti-angiogenesis, anti-metastatic effects, targeting cancer stem cells and antagonizing the Warburg effect. There is no report about 3BP metabolism to guide researchers and oncologists to improve clinical practice and prevent drug resistance. In this article, we provide evidences that 3BP is metabolized through glutathione (GSH) conjugation as a novel report where 3BP was confirmed to be attached to GSH followed by permanent loss of pharmacological effects in a picture similar to cisplatin. Both cisplatin and 3BP are alkylating agents. Reported decrease in endogenous cellular GSH content upon 3BP treatment was confirmed to be due to the formation of 3BP-GSH complex i.e. GSH consumption for conjugation with 3BP. Cancer cells having high endogenous GSH exhibit resistance to 3BP while 3BP sensitive cells acquire resistance upon adding exogenous GSH. Being a thiol blocker, 3BP may attack thiol groups in tissues and serum proteins e.g. albumin and GSH. That may decrease 3BP-induced anticancer effects and the functions of those proteins. We proved here that 3BP metabolism is different from metabolism of hydroxypyruvate that results from metabolism of D-serine using D-amino acid oxidase. Clinically, 3BP administration should be monitored during albumin infusion and protein therapy where GSH should be added to emergency medications. GSH exerts many physiological effects and is safe for human administration both orally and intravenously. Based on that, reported GSH-induced inhibition of 3BP effects makes 3BP effects reversible, easily monitored and easily controlled. This confers a superiority of 3BP over many anticancer agents. Copyright © 2017 Elsevier Ltd. All rights reserved.

Bandgap- and local field-dependent photoactivity of Ag/black phosphorus nanohybrids

DOE PAGES

Lei, Wanying; Zhang, Tingting; Liu, Ping; ...

2016-10-18

Black phosphorus (BP) is the most exciting post-graphene layered nanomaterial that serendipitously bridges the 2D materials gap between semimetallic graphene and large bandgap transition-metal dichalcogenides in terms of high charge-carrier mobility and tunable direct bandgap, yet research into BP-based solar to chemical energy conversion is still in its infancy. Herein, a novel hybrid photocatalyst with Ag nanoparticles supported on BP nanosheets is prepared using a chemical reduction approach. Spin-polarized density functional theory (DFT) calculations show that Ag nanoparticles are stabilized on BP by covalent bonds at the Ag/BP interface and Ag–Ag interactions. In the visible-light photocatalysis of rhodamine B bymore » Ag/BP plasmonic nanohybrids, a significant rise in photoactivity compared with pristine BP nanosheets is observed either by decreasing BP layer thickness or increasing Ag particle size, with the greatest enhancement being up to ~20-fold. By virtue of finite-difference time domain (FDTD) simulations and photocurrent measurements, we give insights into the enhanced photocatalytic performance of Ag/BP nanohybrids, including the effects of BP layer thickness and Ag particle size. In comparison with BP, Ag/BP nanohybrids present intense local field amplification at the perimeter of Ag NPs, which is increased by either decreasing the BP layer thickness from multiple to few layers or increasing the Ag particle size from 20 to 40 nm. Additionally, when the BP layer thickness is decreased from multiple to few layers, the bandgap becomes favorable to generate more strongly oxidative holes in the proximity of the Ag/BP interface to enhance photoactivity. Our findings illustrate a synergy between locally enhanced electric fields and BP bandgap, in which BP layer thickness and Ag particle size can be independently tuned to enhance photoactivity. Lastly, this study may open a new avenue for further exploiting BP-based plasmonic nanostructures in photocatalysis, photodetectors, and photovoltaics.« less

Bandgap- and local field-dependent photoactivity of Ag/black phosphorus nanohybrids

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lei, Wanying; Zhang, Tingting; Liu, Ping

Black phosphorus (BP) is the most exciting post-graphene layered nanomaterial that serendipitously bridges the 2D materials gap between semimetallic graphene and large bandgap transition-metal dichalcogenides in terms of high charge-carrier mobility and tunable direct bandgap, yet research into BP-based solar to chemical energy conversion is still in its infancy. Herein, a novel hybrid photocatalyst with Ag nanoparticles supported on BP nanosheets is prepared using a chemical reduction approach. Spin-polarized density functional theory (DFT) calculations show that Ag nanoparticles are stabilized on BP by covalent bonds at the Ag/BP interface and Ag–Ag interactions. In the visible-light photocatalysis of rhodamine B bymore » Ag/BP plasmonic nanohybrids, a significant rise in photoactivity compared with pristine BP nanosheets is observed either by decreasing BP layer thickness or increasing Ag particle size, with the greatest enhancement being up to ~20-fold. By virtue of finite-difference time domain (FDTD) simulations and photocurrent measurements, we give insights into the enhanced photocatalytic performance of Ag/BP nanohybrids, including the effects of BP layer thickness and Ag particle size. In comparison with BP, Ag/BP nanohybrids present intense local field amplification at the perimeter of Ag NPs, which is increased by either decreasing the BP layer thickness from multiple to few layers or increasing the Ag particle size from 20 to 40 nm. Additionally, when the BP layer thickness is decreased from multiple to few layers, the bandgap becomes favorable to generate more strongly oxidative holes in the proximity of the Ag/BP interface to enhance photoactivity. Our findings illustrate a synergy between locally enhanced electric fields and BP bandgap, in which BP layer thickness and Ag particle size can be independently tuned to enhance photoactivity. Lastly, this study may open a new avenue for further exploiting BP-based plasmonic nanostructures in photocatalysis, photodetectors, and photovoltaics.« less

Clusters of DNA induced by ionizing radiation: formation of short DNA fragments. I. Theoretical modeling

NASA Technical Reports Server (NTRS)

Holley, W. R.; Chatterjee, A.

1996-01-01

We have developed a general theoretical model for the interaction of ionizing radiation with chromatin. Chromatin is modeled as a 30-nm-diameter solenoidal fiber comprised of 20 turns of nucleosomes, 6 nucleosomes per turn. Charged-particle tracks are modeled by partitioning the energy deposition between primary track core, resulting from glancing collisions with 100 eV or less per event, and delta rays due to knock-on collisions involving energy transfers >100 eV. A Monte Carlo simulation incorporates damages due to the following molecular mechanisms: (1) ionization of water molecules leading to the formation of OH, H, eaq, etc.; (2) OH attack on sugar molecules leading to strand breaks: (3) OH attack on bases; (4) direct ionization of the sugar molecules leading to strand breaks; (5) direct ionization of the bases. Our calculations predict significant clustering of damage both locally, over regions up to 40 bp and over regions extending to several kilobase pairs. A characteristic feature of the regional damage predicted by our model is the production of short fragments of DNA associated with multiple nearby strand breaks. The shapes of the spectra of DNA fragment lengths depend on the symmetries or approximate symmetries of the chromatin structure. Such fragments have subsequently been detected experimentally and are reported in an accompanying paper (B. Rydberg, Radiat, Res. 145, 200-209, 1996) after exposure to both high- and low-LET radiation. The overall measured yields agree well quantitatively with the theoretical predictions. Our theoretical results predict the existence of a strong peak at about 85 bp, which represents the revolution period about the nucleosome. Other peaks at multiples of about 1,000 bp correspond to the periodicity of the particular solenoid model of chromatin used in these calculations. Theoretical results in combination with experimental data on fragmentation spectra may help determine the consensus or average structure of the chromatin fibers in mammalian DNA.

A Phylogenomic Approach Based on PCR Target Enrichment and High Throughput Sequencing: Resolving the Diversity within the South American Species of Bartsia L. (Orobanchaceae)

PubMed Central

Tank, David C.

2016-01-01

Advances in high-throughput sequencing (HTS) have allowed researchers to obtain large amounts of biological sequence information at speeds and costs unimaginable only a decade ago. Phylogenetics, and the study of evolution in general, is quickly migrating towards using HTS to generate larger and more complex molecular datasets. In this paper, we present a method that utilizes microfluidic PCR and HTS to generate large amounts of sequence data suitable for phylogenetic analyses. The approach uses the Fluidigm Access Array System (Fluidigm, San Francisco, CA, USA) and two sets of PCR primers to simultaneously amplify 48 target regions across 48 samples, incorporating sample-specific barcodes and HTS adapters (2,304 unique amplicons per Access Array). The final product is a pooled set of amplicons ready to be sequenced, and thus, there is no need to construct separate, costly genomic libraries for each sample. Further, we present a bioinformatics pipeline to process the raw HTS reads to either generate consensus sequences (with or without ambiguities) for every locus in every sample or—more importantly—recover the separate alleles from heterozygous target regions in each sample. This is important because it adds allelic information that is well suited for coalescent-based phylogenetic analyses that are becoming very common in conservation and evolutionary biology. To test our approach and bioinformatics pipeline, we sequenced 576 samples across 96 target regions belonging to the South American clade of the genus Bartsia L. in the plant family Orobanchaceae. After sequencing cleanup and alignment, the experiment resulted in ~25,300bp across 486 samples for a set of 48 primer pairs targeting the plastome, and ~13,500bp for 363 samples for a set of primers targeting regions in the nuclear genome. Finally, we constructed a combined concatenated matrix from all 96 primer combinations, resulting in a combined aligned length of ~40,500bp for 349 samples. PMID:26828929

Novel methods to enhance single strand conformation polymorphism (SSCP) senstivity and efficiency: Application to mutation detection in cystic fibrosis (CF)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hagstrom, D.J.; Snow, K.; Yuan, Z.

1994-09-01

For single gene defects in which there are a variety of mutations with significant frequencies, it is a challenge to find an efficient and sensitive method for mutation detection. For example, although 70% to 75% of CF chromosomes in a North American Caucasian population have the mutation {delta}F508, more than 400 mutations (mostly single base pair substitutions) are represented on the remaining chromosomes. SSCP analysis is a relatively straightforward procedure and therefore suitable for routine use in a clinical laboratory. However, previous reports have demonstrated suboptimal sensitivity rates in screening for mutations. We have developed a novel set of conditionsmore » which greatly enhances sensitivity and efficiency of SSCP. Our protocol incorporates multiplex PCR, stepping of wattages during electrophoresis and increased salt concentration at the anode relative to the gel. To screen for mutations in the CFTR gene, three multiplex PCR reactions are performed using identical thermocycler parameters. Sizes of PCR products range from 441 bp to 196 bp: size differences of > 30 bp are necessary to ensure separation during electrophoresis. All PCR products are separated by electrophoresis at room temperature on a single gel containing 8% (37.5:1) polyacrylamide, 5% glycerol and 1x TBE. Using an anode buffer with increased salt (2x TBE) sharpens smaller sized bands, and stepping watts from 5W to 20W during electrophoresis enhances sensitivity. Positive controls were used to demonstrate that mutations could be detected. Other mutations or polymorphisms were verified by cycle sequencing of PCR products or by alternative PCR-based assays for the more common mutations. Thus, using 3 PCR reactions per patient and one gel condition, we are able to achieve a CF mutation detection rate of approximately 90% in a North American Caucasian population.« less

The predictive value of 53BP1 and BRCA1 mRNA expression in advanced non-small-cell lung cancer patients treated with first-line platinum-based chemotherapy

PubMed Central

Bonanno, Laura; Costa, Carlota; Majem, Margarita; Sanchez, Jose Javier; Gimenez-Capitan, Ana; Rodriguez, Ignacio; Vergenegre, Alain; Massuti, Bartomeu; Favaretto, Adolfo; Rugge, Massimo; Pallares, Cinta; Taron, Miquel; Rosell, Rafael

2013-01-01

Platinum-based chemotherapy is the standard first-line treatment for non-oncogene-addicted non-small cell lung cancers (NSCLCs) and the analysis of multiple DNA repair genes could improve current models for predicting chemosensitivity. We investigated the potential predictive role of components of the 53BP1 pathway in conjunction with BRCA1. The mRNA expression of BRCA1, MDC1, CASPASE3, UBC13, RNF8, 53BP1, PIAS4, UBC9 and MMSET was analyzed by real-time PCR in 115 advanced NSCLC patients treated with first-line platinum-based chemotherapy. Patients expressing low levels of both BRCA1 and 53BP1 obtained a median progression-free survival of 10.3 months and overall survival of 19.3 months, while among those with low BRCA1 and high 53BP1 progression-free survival was 5.9 months (P <0.0001) and overall survival was 8.2 months (P=0.001). The expression of 53BP1 refines BRCA1-based predictive modeling to identify patients most likely to benefit from platinum-based chemotherapy. PMID:24197907

Seasonal variation in home blood pressure: findings from nationwide web-based monitoring in Japan

PubMed Central

Miura, Katsuyuki; Obayashi, Keiichi; Ohkubo, Takayoshi; Nakajima, Hiroshi; Shiga, Toshikazu; Ueshima, Hirotsugu

2018-01-01

Objectives Our aim was to assess seasonal variation in home blood pressure (BP) among free-living nationwide participants using home BP values accumulated from a web-based healthcare platform established in Japan. Settings An observational study. OMRON Healthcare Co., Ltd. has been developing web-based personal healthcare record systems in Japan since November 2010; over two million voluntary participants had joined this platform in September 2015. Nationwide home BP measurements made by oscillometric-type electronic sphygmomanometers from over 110 000 voluntary participants have been transmitted to the system from devices. Participants Seasonal variation in home BP was evaluated among 64 536 (51 335 men, 13 201 women; mean age 52.9 years) free-living nationwide users for whom data were automatically and simultaneously transmitted to the system from devices. Primary outcome measures Mean monthly and weekly home BP. Results In multiple regression analysis, the relationship between BP and temperature was a significant inverse association, independent of age, gender and geological locations. Highest and lowest BP was observed in December and July, respectively. Substantial seasonal differences in the mean values of morning and evening home systolic BP between summer and winter were 6.2 mmHg and 5.5 mmHg in men, and 7.3 mmHg and 6.5 mmHg in women. Seasonal variation was a little greater in older (7.3 mmHg in men, 8.7 mmHg in women) than in younger individuals (5.8 mmHg in men, 6.5 mmHg in women). BP from February to July was approximately 1.5 mmHg lower than the value from August to December. Conclusions A web-based healthcare platform has enabled easier monitoring of population-wide BP. Tighter BP control is necessary in winter than in summer, and especially in a colder climate toward winter than toward summer. New technologies using web-based self-monitoring systems for health-related indexes are expected to initiate a new phase of cardiovascular disease prevention and public health promotion. PMID:29306878

Insights into Watson-Crick/Hoogsteen breathing dynamics and damage repair from the solution structure and dynamic ensemble of DNA duplexes containing m1A.

PubMed

Sathyamoorthy, Bharathwaj; Shi, Honglue; Zhou, Huiqing; Xue, Yi; Rangadurai, Atul; Merriman, Dawn K; Al-Hashimi, Hashim M

2017-05-19

In the canonical DNA double helix, Watson-Crick (WC) base pairs (bps) exist in dynamic equilibrium with sparsely populated (∼0.02-0.4%) and short-lived (lifetimes ∼0.2-2.5 ms) Hoogsteen (HG) bps. To gain insights into transient HG bps, we used solution-state nuclear magnetic resonance spectroscopy, including measurements of residual dipolar couplings and molecular dynamics simulations, to examine how a single HG bp trapped using the N1-methylated adenine (m1A) lesion affects the structural and dynamic properties of two duplexes. The solution structure and dynamic ensembles of the duplexes reveals that in both cases, m1A forms a m1A•T HG bp, which is accompanied by local and global structural and dynamic perturbations in the double helix. These include a bias toward the BI backbone conformation; sugar repuckering, major-groove directed kinking (∼9°); and local melting of neighboring WC bps. These results provide atomic insights into WC/HG breathing dynamics in unmodified DNA duplexes as well as identify structural and dynamic signatures that could play roles in m1A recognition and repair. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Ubiquitin-conjugating enzyme E2-like gene associated to pathogen response in Concholepas concholepas: SNP identification and transcription expression.

PubMed

Núñez-Acuña, Gustavo; Aguilar-Espinoza, Andrea; Chávez-Mardones, Jacqueline; Gallardo-Escárate, Cristian

2012-10-01

Ubiquitin-conjugated E2 enzyme (UBE2) is one of the main components of the proteasome degradation cascade. Previous studies have shown an increase of expression levels in individuals challenged to some pathogen organism such as virus and bacteria. The study was to characterize the immune response of UBE2 gene in the gastropod Concholepas concholepas through expression analysis and single nucleotide polymorphisms (SNP) discovery. Hence, UBE2 was identified from a cDNA library by 454 pyrosequencing, while SNP identification and validation were performed using De novo assembly and high resolution melting analysis. Challenge trials with Vibrio anguillarum was carried out to evaluate the relative transcript abundance of UBE2 gene from two to thirty-three hours post-treatment. The results showed a partial UBE2 sequence of 889 base pair (bp) with a partial coding region of 291 bp. SNP variation (A/C) was observed at the 546th position. Individuals challenged by V. anguillarum showed an overexpression of the UBE2 gene, the expression being significantly higher in homozygous individuals (AA) than (CC) or heterozygous individuals (A/C). This study contributes useful information relating to the UBE2 gene and its association with innate immune response in marine invertebrates. Copyright © 2012 Elsevier Ltd. All rights reserved.

Prohibitin-2 gene reveals sex-related differences in the salmon louse Caligus rogercresseyi.

PubMed

Farlora, Rodolfo; Nuñez-Acuña, Gustavo; Gallardo-Escárate, Cristian

2015-06-10

Prohibitins are evolutionarily conserved proteins present in multiple cellular compartments, and are involved in diverse cellular processes, including steroid hormone transcription and gametogenesis. In the present study, we report for the first time the characterization of the prohibitin-2 (Phb2) gene in the sea lice Caligus rogercresseyi. The CrPhb2 cDNA showed a total length of 1406 bp, which contained a predicted open reading frame (ORF) of 894 base pairs (bp) encoding for 298 amino acids. Multiple sequence alignments of prohibitin proteins from other arthropods revealed a high degree of amino acid sequence conservation. In silico Illumina read counts and RT-qPCR analyses showed a sex-dependent differential expression, with mRNA levels exhibiting a 1.7-fold (RT-qPCR) increase in adult females compared with adult males. A total of nine single nucleotide polymorphisms (SNPs) were identified, three were located in the 5' UTR of the Phb2 messenger and six in the ORF, but no mutations associated with sex were found. These results contribute to expand the present knowledge of the reproduction-related genes in C. rogercresseyi, and may be useful in future experiments aimed at controlling the impacts of sea lice in fish farming. Copyright © 2015 Elsevier B.V. All rights reserved.

Universal and idiosyncratic characteristic lengths in bacterial genomes

NASA Astrophysics Data System (ADS)

Junier, Ivan; Frémont, Paul; Rivoire, Olivier

2018-05-01

In condensed matter physics, simplified descriptions are obtained by coarse-graining the features of a system at a certain characteristic length, defined as the typical length beyond which some properties are no longer correlated. From a physics standpoint, in vitro DNA has thus a characteristic length of 300 base pairs (bp), the Kuhn length of the molecule beyond which correlations in its orientations are typically lost. From a biology standpoint, in vivo DNA has a characteristic length of 1000 bp, the typical length of genes. Since bacteria live in very different physico-chemical conditions and since their genomes lack translational invariance, whether larger, universal characteristic lengths exist is a non-trivial question. Here, we examine this problem by leveraging the large number of fully sequenced genomes available in public databases. By analyzing GC content correlations and the evolutionary conservation of gene contexts (synteny) in hundreds of bacterial chromosomes, we conclude that a fundamental characteristic length around 10–20 kb can be defined. This characteristic length reflects elementary structures involved in the coordination of gene expression, which are present all along the genome of nearly all bacteria. Technically, reaching this conclusion required us to implement methods that are insensitive to the presence of large idiosyncratic genomic features, which may co-exist along these fundamental universal structures.

Evidence from mitochondrial DNA that head lice and body lice of humans (Phthiraptera: Pediculidae) are conspecific.

PubMed

Leo, N P; Campbell, N J H; Yang, X; Mumcuoglu, K; Barker, S C

2002-07-01

The specific status of the head and body lice of humans has been debated for more than 200 yr. To clarify the specific status of head and body lice, we sequenced 524 base pairs (bp) of the cytochrome oxidase I (COI) gene of 28 head and 28 body lice from nine countries. Ten haplotypes that differed by 1-5 bp at 11 nucleotide positions were identified. A phylogeny of these sequences indicates that these head and body lice are not from reciprocally monophyletic lineages. Indeed, head and body lice share three of the 10 haplotypes we found. F(ST) values and exact tests of haplotype frequencies showed significant differences between head and body lice. However, the same tests also showed significant differences among lice from different countries. Indeed, more of the variation in haplotype frequencies was explained by differences among lice from different countries than by differences between head and body lice. Our results indicate the following: (1) head and body lice do not represent reciprocally monophyletic lineages and are conspecific; (2) gene flow among populations of lice from different countries is limited; and (3) frequencies of COI haplotypes can be used to study maternal gene flow among populations of head and body lice and thus transmission of lice among their human hosts.

Insights into Watson–Crick/Hoogsteen breathing dynamics and damage repair from the solution structure and dynamic ensemble of DNA duplexes containing m1A

PubMed Central

Sathyamoorthy, Bharathwaj; Shi, Honglue; Zhou, Huiqing; Xue, Yi; Rangadurai, Atul; Merriman, Dawn K.

2017-01-01

Abstract In the canonical DNA double helix, Watson–Crick (WC) base pairs (bps) exist in dynamic equilibrium with sparsely populated (∼0.02–0.4%) and short-lived (lifetimes ∼0.2–2.5 ms) Hoogsteen (HG) bps. To gain insights into transient HG bps, we used solution-state nuclear magnetic resonance spectroscopy, including measurements of residual dipolar couplings and molecular dynamics simulations, to examine how a single HG bp trapped using the N1-methylated adenine (m1A) lesion affects the structural and dynamic properties of two duplexes. The solution structure and dynamic ensembles of the duplexes reveals that in both cases, m1A forms a m1A•T HG bp, which is accompanied by local and global structural and dynamic perturbations in the double helix. These include a bias toward the BI backbone conformation; sugar repuckering, major-groove directed kinking (∼9°); and local melting of neighboring WC bps. These results provide atomic insights into WC/HG breathing dynamics in unmodified DNA duplexes as well as identify structural and dynamic signatures that could play roles in m1A recognition and repair. PMID:28369571

Interlaboratory comparison of autoradiographic DNA profiling measurements: precision and concordance.

PubMed

Duewer, D L; Lalonde, S A; Aubin, R A; Fourney, R M; Reeder, D J

1998-05-01

Knowledge of the expected uncertainty in restriction fragment length polymorphism (RFLP) measurements is required for confident exchange of such data among different laboratories. The total measurement uncertainty among all Technical Working Group for DNA Analysis Methods laboratories has previously been characterized and found to be acceptably small. Casework cell line control measurements provided by six Royal Canadian Mounted Police (RCMP) and 30 U.S. commercial, local, state, and Federal forensic laboratories enable quantitative determination of the within-laboratory precision and among-laboratory concordance components of measurement uncertainty typical of both sets of laboratories. Measurement precision is the same in the two countries for DNA fragments of size 1000 base pairs (bp) to 10,000 bp. However, the measurement concordance among the RCMP laboratories is clearly superior to that within the U.S. forensic community. This result is attributable to the use of a single analytical protocol in all RCMP laboratories. Concordance among U.S. laboratories cannot be improved through simple mathematical adjustments. Community-wide efforts focused on improved concordance may be the most efficient mechanism for further reduction of among-laboratory RFLP measurement uncertainty, should the resources required to fully evaluate potential cross-jurisdictional matches become burdensome as the number of RFLP profiles on record increases.

A rapid method of accurate detection and differentiation of Newcastle disease virus pathotypes by demonstrating multiple bands in degenerate primer based nested RT-PCR.

PubMed

Desingu, P A; Singh, S D; Dhama, K; Kumar, O R Vinodh; Singh, R; Singh, R K

2015-02-01

A rapid and accurate method of detection and differentiation of virulent and avirulent Newcastle disease virus (NDV) pathotypes was developed. The NDV detection was carried out for different domestic avian field isolates and pigeon paramyxo virus-1 (25 field isolates and 9 vaccine strains) by using APMV-I "fusion" (F) gene Class II specific external primer A and B (535bp), internal primer C and D (238bp) based reverses transcriptase PCR (RT-PCR). The internal degenerative reverse primer D is specific for F gene cleavage position of virulent strain of NDV. The nested RT-PCR products of avirulent strains showed two bands (535bp and 424bp) while virulent strains showed four bands (535bp, 424bp, 349bp and 238bp) on agar gel electrophoresis. This is the first report regarding development and use of degenerate primer based nested RT-PCR for accurate detection and differentiation of NDV pathotypes by demonstrating multiple PCR band patterns. Being a rapid, simple, and economical test, the developed method could serve as a valuable alternate diagnostic tool for characterizing NDV isolates and carrying out molecular epidemiological surveillance studies for this important pathogen of poultry. Copyright © 2014 Elsevier B.V. All rights reserved.

The complete chloroplast genome sequence of Aster spathulifolius (Asteraceae); genomic features and relationship with Asteraceae.

PubMed

Choi, Kyoung Su; Park, SeonJoo

2015-11-10

Aster spathulifolius, a member of the Asteraceae family, is distributed along the coast of Japan and Korea. This plant is used for medicinal and ornamental purposes. The complete chloroplast (cp) genome of A. sphathulifolius consists of 149,473 bp that include a pair of inverted repeats of 24,751 bp separated by a large single copy region of 81,998 bp and a small single copy region of 17,973 bp. The chloroplast genome contains 78 coding genes, four rRNA genes and 29 tRNA genes. When compared to other cpDNA sequences of Asteraceae, A. spathulifolius showed the closest relationship with Jacobaea vulgaris, and its atpB gene was found to be a pseudogene, unlike J. vulgaris. Furthermore, evaluation of the gene compositions of J. vulgaris, Helianthus annuus, Guizotia abyssinica and A. spathulifolius revealed that 13.6-kb showed inversion from ndhF to rps15, unlike Lactuca of Asteraceae. Comparison of the synonymous (Ks) and nonsynonymous (Ka) substitution rates with J. vulgaris revealed that synonymous genes related to a small subunit of the ribosome showed the highest value (0.1558), while nonsynonymous rates of genes related to ATP synthase genes were highest (0.0118). These findings revealed that substitution has occurred at similar rates in most genes, and the substitution rates suggested that most genes is a purified selection. Copyright © 2015 Elsevier B.V. All rights reserved.

1400 yr multiproxy record of climate variability from the northern Gulf of Mexico

USGS Publications Warehouse

Richey, J.N.; Poore, R.Z.; Flower, B.P.; Quinn, T.M.

2007-01-01

A continuous decadal-scale resolution record of climate variability over the past 1400 yr in the northern Gulf of Mexico was constructed from a box core recovered in the Pigmy Basin, northern Gulf of Mexico. Proxies include paired analyses of Mg/Ca and δ18O in the white variety of the planktic foraminifer Globigerinoides ruber and relative abundance variations of G. sacculifer in the foraminifer assemblages. Two multi-decadal intervals of sustained high Mg/Ca indicate that Gulf of Mexico sea surface temperatures (SSTs) were as warm or warmer than near-modern conditions between 1000 and 1400 yr B.P. Foraminiferal Mg/Ca during the coolest interval of the Little Ice Age (ca. 250 yr B.P.) indicate that SST was 2–2.5 °C below modern SST. Four minima in the Mg/Ca record between 900 and 250 yr B.P. correspond with the Maunder, Spörer, Wolf, and Oort sunspot minima, suggesting a link between changes in solar insolation and SST variability in the Gulf of Mexico. An abrupt shift recorded in both δ18Ocalcite and relative abundance of G. sacculifer occurred ca. 600 yr B.P. The shift in the Pigmy Basin record corresponds with a shift in the sea-salt-sodium (ssNa) record from the Greenland Ice Sheet Project 2 ice core, linking changes in high-latitude atmospheric circulation with the subtropical Atlantic Ocean.

Mapping of Micro-Tom BAC-End Sequences to the Reference Tomato Genome Reveals Possible Genome Rearrangements and Polymorphisms

PubMed Central

Asamizu, Erika; Shirasawa, Kenta; Hirakawa, Hideki; Sato, Shusei; Tabata, Satoshi; Yano, Kentaro; Ariizumi, Tohru; Shibata, Daisuke; Ezura, Hiroshi

2012-01-01

A total of 93,682 BAC-end sequences (BESs) were generated from a dwarf model tomato, cv. Micro-Tom. After removing repetitive sequences, the BESs were similarity searched against the reference tomato genome of a standard cultivar, “Heinz 1706.” By referring to the “Heinz 1706” physical map and by eliminating redundant or nonsignificant hits, 28,804 “unique pair ends” and 8,263 “unique ends” were selected to construct hypothetical BAC contigs. The total physical length of the BAC contigs was 495, 833, 423 bp, covering 65.3% of the entire genome. The average coverage of euchromatin and heterochromatin was 58.9% and 67.3%, respectively. From this analysis, two possible genome rearrangements were identified: one in chromosome 2 (inversion) and the other in chromosome 3 (inversion and translocation). Polymorphisms (SNPs and Indels) between the two cultivars were identified from the BLAST alignments. As a result, 171,792 polymorphisms were mapped on 12 chromosomes. Among these, 30,930 polymorphisms were found in euchromatin (1 per 3,565 bp) and 140,862 were found in heterochromatin (1 per 2,737 bp). The average polymorphism density in the genome was 1 polymorphism per 2,886 bp. To facilitate the use of these data in Micro-Tom research, the BAC contig and polymorphism information are available in the TOMATOMICS database. PMID:23227037

The complete chloroplast genome of Tianshan Snow Lotus (Saussurea involucrata), a famous traditional Chinese medicinal plant of the family Asteraceae.

PubMed

Xie, Qing; Shen, Kang-Ning; Hao, Xiuying; Nam, Phan Nhut; Ngoc Hieu, Bui Thi; Chen, Ching-Hung; Zhu, Changqing; Lin, Yen-Chang; Hsiao, Chung-Der

2017-03-01

abtract We decoded the complete chloroplast DNA (cpDNA) sequence of the Tianshan Snow Lotus (Saussurea involucrata), a famous traditional Chinese medicinal plant of the family Asteraceae, by using next-generation sequencing technology. The genome consists of 152 490 bp containing a pair of inverted repeats (IRs) of 25 202 bp, which was separated by a large single-copy region and a small single-copy region of 83 446 bp and 18 639 bp, respectively. The genic regions account for 57.7% of whole cpDNA, and the GC content of the cpDNA was 37.7%. The S. involucrata cpDNA encodes 114 unigenes (82 protein-coding genes, 4 rRNA genes, and 28 tRNA genes). There are eight protein-coding genes (atpF, ndhA, ndhB, rpl2, rpoC1, rps16, clpP, and ycf3) and five tRNA genes (trnA-UGC, trnI-GAU, trnK-UUU, trnL-UAA, and trnV-UAC) containing introns. A phylogenetic analysis of the 11 complete cpDNA from Asteracease showed that S. involucrata is closely related to Centaurea diffusa (Diffuse Knapweed). The complete cpDNA of S. involucrata provides essential and important DNA molecular data for further phylogenetic and evolutionary analysis for Asteraceae.

Therapeutic Implications of Vitamin D and Calcium in Overweight Women with Polycystic Ovary Syndrome

PubMed Central

Pal, Lubna; Berry, Amber; Coraluzzi, Luisa; Kustan, Erin; Danton, Cheryl; Shaw, Julia; Taylor, Hugh

2013-01-01

Objective To assess effects of vitamin D and Calcium (Ca) on hormonal and metabolic milieu of polycystic ovary syndrome (PCOS) Design Single arm open label trial Methods Twelve overweight and vitamin D deficient women with PCOS underwent a 2 hour oral glucose tolerance testing at baseline and following 3 month supplementation with vitamin D (daily dose of 3533 IU, increased to 8533 IU after the first 5 participants) and 530mg elemental Ca daily. Main Outcome Measures Blood pressure (BP), plasma glucose, insulin, total testosterone (T) androstenedione (A), sex hormone binding globulin, lifestyle parameters were assessed at baseline and following 3 months intervention. Insulin resistance and AUC for glucose and insulin were computed; paired analyses were conducted. Results Improved serum 25OHD (p<0.001) and reductions in total T (p=0.036) and A (p=0.090) levels were noted following 3 month supplementation, compared to baseline. Significant lowering in BP parameters was seen in participants with baseline BP ≥ 120/80 mmHg (n=8) and in those with baseline serum 25OHD ≤ 20ng/ml (n=9). Parameters of glucose homeostasis and insulin resistance remained unchanged (p>0.05). Conclusions Androgen and BP profiles improved followed three month intervention, suggesting therapeutic implications of vitamin D and Ca in overweight and vitamin D deficient women with PCOS. PMID:22780885

Therapeutic implications of vitamin D and calcium in overweight women with polycystic ovary syndrome.

PubMed

Pal, Lubna; Berry, Amber; Coraluzzi, Luisa; Kustan, Erin; Danton, Cheryl; Shaw, Julia; Taylor, Hugh

2012-12-01

To assess effects of vitamin D and Calcium (Ca) on hormonal and metabolic milieu of polycystic ovary syndrome (PCOS). Single arm open label trial. Twelve overweight and vitamin D deficient women with PCOS underwent a 2 hour oral glucose tolerance testing at baseline and following 3-month supplementation with vitamin D (daily dose of 3533 IU, increased to 8533 IU after the first five participants) and 530 mg elemental Ca daily. Blood pressure (BP), plasma glucose, insulin, total testosterone (T) androstenedione (A), sex hormone binding globulin, lifestyle parameters were assessed at baseline and following 3-month intervention. Insulin resistance (IR) and area under the curve for glucose and insulin were computed; paired analyses were conducted. Improved serum 25OHD (p < 0.001) and reductions in total T (p = 0.036) and A (p = 0.090) levels were noted following 3-month supplementation, compared to baseline. Significant lowering in BP parameters was seen in participants with baseline BP ≥ 120/80 mmHg (n = 8) and in those with baseline serum 25OHD ≤20 ng/ml (n = 9). Parameters of glucose homeostasis and IR remained unchanged (p > 0.05). Androgen and BP profiles improved followed three month intervention, suggesting therapeutic implications of vitamin D and Ca in overweight and vitamin D deficient women with PCOS.

Reductions in blood pressure during a community-based overweight and obesity treatment in children and adolescents with prehypertension and hypertension.

PubMed

Mollerup, P M; Lausten-Thomsen, U; Fonvig, C E; Baker, J L; Holm, J-C

2017-10-01

Due to the pandemic of childhood obesity and thus obesity-related hypertension, improvements in treatment availability are needed. Hence, we investigated whether reductions in blood pressure (BP) would occur in children with overweight and obesity exhibiting prehypertension/hypertension during a community-based overweight and obesity treatment program, and if changes in body mass index (BMI) are associated with changes in BP. The study included 663 children aged 3-18 years with a BMI ⩾85th percentile for sex and age that entered treatment from June 2012 to January 2015. Height, weight and BP were measured upon entry and every 3-6 months. BMI and BP s.d. scores (SDSs) were calculated according to sex and age, or sex, age and height. Prehypertension was defined as a BP SDS ⩾1.28 and <1.65. Hypertension was defined as a BP SDS ⩾1.65. Upon entry, 52% exhibited prehypertension (11.9%) or exhibited hypertension (40.1%). After 12 months (range: 3-29) of treatment, 29.3% of the children with prehypertension/hypertension were normotensive. Children with systolic prehypertension/hypertension upon entry reduced their systolic BP SDSs by 0.31 (95% confidence interval (CI): 0.70-0.83, P<0.0001). Children with diastolic prehypertension/hypertension upon entry reduced their diastolic BP SDSs by 0.78 (95% CI: 0.78-0.86, P<0.0001). BMI SDS changes were positively associated with BP SDS changes (P<0.0001). Nonetheless, some children reduced BP SDSs while increasing their BMI SDSs, and prehypertension/hypertension developed in 23.3% of the normotensive children despite reductions in BMI SDSs (P<0.0001). These results suggest that community-based overweight and obesity treatment can reduce BP, and thus may help improve treatment availability.

Biodegradable black phosphorus-based nanomaterials in biomedicine: theranostic applications.

PubMed

Wang, Zhen; Liu, Zhiming; Su, Chengkang; Yang, Biwen; Fei, Xixi; Li, Yi; Hou, Yuqing; Zhao, Henan; Guo, Yanxian; Zhuang, Zhengfei; Zhong, Huiqing; Guo, Zhouyi

2017-09-20

Ascribe to the unique two-dimensional planar nanostructure with exceptional physical and chemical properties, black phosphorous (BP) as the emerging inorganic two-dimensional nanomaterial with high biocompatibility and degradability has been becoming one of the most promising materials of great potentials in biomedicine. The exfoliated BP sheets possess ultra-high surface area available for valid bio-conjugation and molecular loading for chemotherapy. Utilizing the intrinsic near-infrared optical absorbance, BP-based photothermal therapy in vivo, photodynamic therapy and biomedical imaging has been realized, achieving unprecedented anti-tumor therapeutic efficacy in animal experiments. Additionally, the BP nanosheets can strongly react with oxygen and water, and finally degrade to non-toxic phosphate and phosphonate in the aqueous solution. This manuscript aimed to summarize the preliminary progresses on theranostic application of BP and its derivatives black phosphorus quantum dots (BPQDs), and discussed the prospects and the state-of-art unsolved critical issues of using BP-based material for theranostic applications. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Identification of Sinorhizobium (Ensifer) medicae based on a specific genomic sequence unveiled by M13-PCR fingerprinting.

PubMed

Dourado, Ana Catarina; Alves, Paula I L; Tenreiro, Tania; Ferreira, Eugénio M; Tenreiro, Rogério; Fareleira, Paula; Crespo, M Teresa Barreto

2009-12-01

A collection of nodule isolates from Medicago polymorpha obtained from southern and central Portugal was evaluated by M13-PCR fingerprinting and hierarchical cluster analysis. Several genomic clusters were obtained which, by 16S rRNA gene sequencing of selected representatives, were shown to be associated with particular taxonomic groups of rhizobia and other soil bacteria. The method provided a clear separation between rhizobia and co-isolated non-symbiotic soil contaminants. Ten M13-PCR groups were assigned to Sinorhizobium (Ensifer) medicae and included all isolates responsible for the formation of nitrogen-fixing nodules upon re-inoculation of M. polymorpha test-plants. In addition, enterobacterial repetitive intergenic consensus (ERIC)-PCR fingerprinting indicated a high genomic heterogeneity within the major M13- PCR clusters of S. medicae isolates. Based on nucleotide sequence data of an M13-PCR amplicon of ca. 1500 bp, observed only in S. medicae isolates and spanning locus Smed_3707 to Smed_3709 from the pSMED01 plasmid sequence of S. medicae WSM419 genome's sequence, a pair of PCR primers was designed and used for direct PCR amplification of a 1399-bp sequence within this fragment. Additional in silico and in vitro experiments, as well as phylogenetic analysis, confirmed the specificity of this primer combination and therefore the reliability of this approach in the prompt identification of S. medicae isolates and their distinction from other soil bacteria.

Screening and identification of male-specific DNA fragments in common carps Cyprinus carpio using suppression subtractive hybridization.

PubMed

Chen, J J; Du, Q Y; Yue, Y Y; Dang, B J; Chang, Z J

2010-08-01

In this study, a sex subtractive genomic DNA library was constructed using suppression subtractive hybridization (SSH) between male and female Cyprinus carpio. Twenty-two clones with distinguishable hybridization signals were selected and sequenced. The specific primers were designed based on the sequence data. Those primers were then used to amplify the sex-specific fragments from the genomic DNA of male and female carp. The amplified fragments from two clones showed specificity to males but not to females, which were named as Ccmf2 [387 base pairs (bp)] and Ccmf3 (183 bp), respectively. The sex-specific pattern was analysed in a total of 40 individuals from three other different C. carpio. stocks and grass carp Ctenopharyngodon idella using Ccmf2 and Ccmf3 as dot-blotting probes. The results revealed that the molecular diversity exists on the Y chromosome of C. carpio. No hybridization signals, however, were detected from individuals of C. idella, suggesting that the two sequences are specific to C. carpio. No significant homologous sequences of Ccmf2 and Ccmf3 were found in GenBank. Therefore, it was interpreted that the results as that Ccmf2 and Ccmf3 are two novel male-specific sequences; and both fragments could be used as markers to rapidly and accurately identify the genetic sex of part of C. carpio. This may provide a very efficient selective tool for practically breeding monosex female populations in aquacultural production.

Prediction of hypertensive crisis based on average, variability and approximate entropy of 24-h ambulatory blood pressure monitoring.

PubMed

Schoenenberger, A W; Erne, P; Ammann, S; Perrig, M; Bürgi, U; Stuck, A E

2008-01-01

Approximate entropy (ApEn) of blood pressure (BP) can be easily measured based on software analysing 24-h ambulatory BP monitoring (ABPM), but the clinical value of this measure is unknown. In a prospective study we investigated whether ApEn of BP predicts, in addition to average and variability of BP, the risk of hypertensive crisis. In 57 patients with known hypertension we measured ApEn, average and variability of systolic and diastolic BP based on 24-h ABPM. Eight of these fifty-seven patients developed hypertensive crisis during follow-up (mean follow-up duration 726 days). In bivariate regression analysis, ApEn of systolic BP (P<0.01), average of systolic BP (P=0.02) and average of diastolic BP (P=0.03) were significant predictors of hypertensive crisis. The incidence rate ratio of hypertensive crisis was 14.0 (95% confidence interval (CI) 1.8, 631.5; P<0.01) for high ApEn of systolic BP as compared to low values. In multivariable regression analysis, ApEn of systolic (P=0.01) and average of diastolic BP (P<0.01) were independent predictors of hypertensive crisis. A combination of these two measures had a positive predictive value of 75%, and a negative predictive value of 91%, respectively. ApEn, combined with other measures of 24-h ABPM, is a potentially powerful predictor of hypertensive crisis. If confirmed in independent samples, these findings have major clinical implications since measures predicting the risk of hypertensive crisis define patients requiring intensive follow-up and intensified therapy.

Development of a PCR-based marker utilizing a deletion mutation in the dihydroflavonol 4-reductase (DFR) gene responsible for the lack of anthocyanin production in yellow onions (Allium cepa).

PubMed

Kim, Sunggil; Yoo, Kil Sun; Pike, Leonard M

2005-02-01

Bulb color in onions (Allium cepa) is an important trait, but the mechanism of color inheritance is poorly understood at the molecular level. A previous study showed that inactivation of the dihydroflavonol 4-reductase (DFR) gene at the transcriptional level resulted in a lack of anthocyanin production in yellow onions. The objectives of the present study were the identification of the critical mutations in the DFR gene (DFR-A) and the development of a PCR-based marker for allelic selection. We report the isolation of two additional DFR homologs (DFR-B and DFR-C). No unique sequences were identified in either DFR homolog, even in the untranslated region (UTR). Both genes shared more than 95% nucleotide sequence identity with the DFR-A gene. To obtain a unique sequence from each gene, we isolated the promoter regions. Sequences of the DFR-A and DFR-B promoters differed completely from one another, except for an approximately 100-bp sequence adjacent to the 5'UTR. It was possible to specifically amplify only the DFR-A gene using primers designed to anneal to the unique promoter region. The sequences of yellow and red DFR-A alleles were the same except for a single base-pair change in the promoter and an approximately 800-bp deletion within the 3' region of the yellow DFR-A allele. This deletion was used to develop a co-dominant PCR-based marker that segregated perfectly with color phenotypes in the F2 population. These results indicate that a deletion mutation in the yellow DFR-A gene results in the lack of anthocyanin production in yellow onions.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Molina-Molina, Jose-Manuel; INSERM, U896, Montpellier, F-34298; Universite Montpellier1, Montpellier, F-34298

Benzophenone (BP) derivatives, BP1 (2,4-dihydroxybenzophenone), BP2 (2,2',4,4'-tetrahydroxybenzophenone), BP3 (2-hydroxy-4-methoxybenzophenone), and THB (2,4,4'-trihydroxybenzophenone) are UV-absorbing chemicals widely used in pharmaceutical, cosmetics, and industrial applications, such as topical sunscreens in lotions and hair sprays to protect skin and hair from UV irradiation. Studies on their endocrine disrupting properties have mostly focused on their interaction with human estrogen receptor alpha (hER{alpha}), and there has been no comprehensive analysis of their potency in a system allowing comparison between hER{alpha} and hER{beta} activities. The objective of this study was to provide a comprehensive ER activation profile of BP derivatives using ER from human and fishmore » origin in a battery of in vitro tests, i.e., competitive binding, reporter gene based assays, vitellogenin (Vtg) induction in isolated rainbow trout hepatocytes, and proliferation based assays. The ability to induce human androgen receptor (hAR)-mediated reporter gene expression was also examined. All BP derivatives tested except BP3 were full hER{alpha} and hER{beta} agonists (BP2 > THB > BP1) and displayed a stronger activation of hER{beta} compared with hER{alpha}, the opposite effect to that of estradiol (E{sub 2}). Unlike E{sub 2}, BPs were more active in rainbow trout ER{alpha} (rtER{alpha}) than in hER{alpha} assay. All four BP derivatives showed anti-androgenic activity (THB > BP2 > BP1 > BP3). Overall, the observed anti-androgenic potencies of BP derivatives, together with their proposed greater effect on ER{beta} versus ER{alpha} activation, support further investigation of their role as endocrine disrupters in humans and wildlife.« less

Predicting Out-of-Office Blood Pressure in the Clinic for the Diagnosis of Hypertension in Primary Care: An Economic Evaluation.

PubMed

Monahan, Mark; Jowett, Sue; Lovibond, Kate; Gill, Paramjit; Godwin, Marshall; Greenfield, Sheila; Hanley, Janet; Hobbs, F D Richard; Martin, Una; Mant, Jonathan; McKinstry, Brian; Williams, Bryan; Sheppard, James P; McManus, Richard J

2018-02-01

Clinical guidelines in the United States and United Kingdom recommend that individuals with suspected hypertension should have ambulatory blood pressure (BP) monitoring to confirm the diagnosis. This approach reduces misdiagnosis because of white coat hypertension but will not identify people with masked hypertension who may benefit from treatment. The Predicting Out-of-Office Blood Pressure (PROOF-BP) algorithm predicts masked and white coat hypertension based on patient characteristics and clinic BP, improving the accuracy of diagnosis while limiting subsequent ambulatory BP monitoring. This study assessed the cost-effectiveness of using this tool in diagnosing hypertension in primary care. A Markov cost-utility cohort model was developed to compare diagnostic strategies: the PROOF-BP approach, including those with clinic BP ≥130/80 mm Hg who receive ambulatory BP monitoring as guided by the algorithm, compared with current standard diagnostic strategies including those with clinic BP ≥140/90 mm Hg combined with further monitoring (ambulatory BP monitoring as reference, clinic, and home monitoring also assessed). The model adopted a lifetime horizon with a 3-month time cycle, taking a UK Health Service/Personal Social Services perspective. The PROOF-BP algorithm was cost-effective in screening all patients with clinic BP ≥130/80 mm Hg compared with current strategies that only screen those with clinic BP ≥140/90 mm Hg, provided healthcare providers were willing to pay up to £20 000 ($26 000)/quality-adjusted life year gained. Deterministic and probabilistic sensitivity analyses supported the base-case findings. The PROOF-BP algorithm seems to be cost-effective compared with the conventional BP diagnostic options in primary care. Its use in clinical practice is likely to lead to reduced cardiovascular disease, death, and disability. © 2017 American Heart Association, Inc.

Blood pressure load does not add to ambulatory blood pressure level for cardiovascular risk stratification.

PubMed

Li, Yan; Thijs, Lutgarde; Boggia, José; Asayama, Kei; Hansen, Tine W; Kikuya, Masahiro; Björklund-Bodegård, Kristina; Ohkubo, Takayoshi; Jeppesen, Jørgen; Torp-Pedersen, Christian; Dolan, Eamon; Kuznetsova, Tatiana; Stolarz-Skrzypek, Katarzyna; Tikhonoff, Valérie; Malyutina, Sofia; Casiglia, Edoardo; Nikitin, Yuri; Lind, Lars; Sandoya, Edgardo; Kawecka-Jaszcz, Kalina; Filipovsky, Jan; Imai, Yutaka; Ibsen, Hans; O'Brien, Eoin; Wang, Jiguang; Staessen, Jan A

2014-05-01

Experts proposed blood pressure (BP) load derived from 24-hour ambulatory BP recordings as a more accurate predictor of outcome than level, in particular in normotensive people. We analyzed 8711 subjects (mean age, 54.8 years; 47.0% women) randomly recruited from 10 populations. We expressed BP load as percentage (%) of systolic/diastolic readings ≥135/≥85 mm Hg and ≥120/≥70 mm Hg during day and night, respectively, or as the area under the BP curve (mm Hg×h) using the same ceiling values. During a period of 10.7 years (median), 1284 participants died and 1109 experienced a fatal or nonfatal cardiovascular end point. In multivariable-adjusted models, the risk of cardiovascular complications gradually increased across deciles of BP level and load (P<0.001), but BP load did not substantially refine risk prediction based on 24-hour systolic or diastolic BP level (generalized R(2) statistic ≤0.294%; net reclassification improvement ≤0.28%; integrated discrimination improvement ≤0.001%). Systolic/diastolic BP load of 40.0/42.3% or 91.8/73.6 mm Hg×h conferred a 10-year risk of a composite cardiovascular end point similar to a 24-hour systolic/diastolic BP of 130/80 mm Hg. In analyses dichotomized according to these thresholds, increased BP load did not refine risk prediction in the whole study population (R(2)≤0.051) or in untreated participants with 24-hour ambulatory normotension (R(2)≤0.034). In conclusion, BP load does not improve risk stratification based on 24-hour BP level. This also applies to subjects with normal 24-hour BP for whom BP load was proposed to be particularly useful in risk stratification.

Evidence for degenerate tetraploidy in bdelloid rotifers.

PubMed

Mark Welch, David B; Mark Welch, Jessica L; Meselson, Matthew

2008-04-01

Rotifers of class Bdelloidea have evolved for millions of years apparently without sexual reproduction. We have sequenced 45- to 70-kb regions surrounding the four copies of the hsp82 gene of the bdelloid rotifer Philodina roseola, each of which is on a separate chromosome. The four regions comprise two colinear gene-rich pairs with gene content, order, and orientation conserved within each pair. Only a minority of genes are common to both pairs, also in the same orientation and order, but separated by gene-rich segments present in only one or the other pair. The pattern is consistent with degenerate tetraploidy with numerous segmental deletions, some in one pair of colinear chromosomes and some in the other. Divergence in 1,000-bp windows varies along an alignment of a colinear pair, from zero to as much as 20% in a pattern consistent with gene conversion associated with recombinational repair of DNA double-strand breaks. Although pairs of colinear chromosomes are a characteristic of sexually reproducing diploids and polyploids, a quite different explanation for their presence in bdelloids is suggested by the recent finding that bdelloid rotifers can recover and resume reproduction after suffering hundreds of radiation-induced DNA double-strand breaks per oocyte nucleus. Because bdelloid primary oocytes are in G(1) and therefore lack sister chromatids, we propose that bdelloid colinear chromosome pairs are maintained as templates for the repair of DNA double-strand breaks caused by the frequent desiccation and rehydration characteristic of bdelloid habitats.

Molecular Cloning, Characterization, and Expression Analysis of an Estrogen Receptor-Related Receptor Homologue in the Cricket, Teleogryllus emma

PubMed Central

He, Hui; Xi, Gengsi; Lu, Xiao

2010-01-01

The estrogen receptor-related receptors (ERRs) are a group of nuclear receptors that were originally identified on the basis of sequence similarity to estrogen receptors. The three mammalian ERR genes have been implicated in diverse physiological processes ranging from placental development to maintenance of bone density, but the function and regulation of ERRs in invertebrates are not well understood. A homologue of human ERR was isolated from the cricket Teleogryllus emma (Ohmachi and Matsumura) (Orthoptera: Gryllidae). The full-length cDNA of T. emma ERR, termed TeERR, has 1618 base pair (bp) and contains a 5′?-untranslated region of 140 bp and a 3′?-untranslated region of 272 bp. The open reading frame of TeERR encodes a deduced 401 amino acid peptide with a predicted molecular mass of 45.75 kilodaltons. The results of sequence alignments indicate that the TeERR protein shares an overall identity of 65%–82% with other known ERR homologues, and is most closely related to that of Nasonia vitripennis (Hymenoptera: Pteromalidae) and Apis mellifera (Apidae). Real-time quantitative reverse transcription-polymerase chain reaction was performed to compare the TeERR mRNA expression level at the whole body and gonad during T. emma development. The data revealed that TeERR mRNA is differentially expressed during T. emma development, with the highest expression level in embryos and the lowest in the body of late-instar larvae. The levels of TeERR transcripts also varied throughout gonad development; interestingly testicles had higher higher expression levels than ovaries at every development stage. These results suggest that TeERR has potential significance in the regulation of development in T. emma, due to its expression during different developmental periods. PMID:21265615

Regulatory interactions between the human HOXB1, HOXB2, and HOXB3 proteins and the upstream sequence of the Otx2 gene in embryonal carcinoma cells.

PubMed

Guazzi, S; Pintonello, M L; Viganò, A; Boncinelli, E

1998-05-01

Vertebrate Hox and Otx genes encode homeodomain-containing transcription factors thought to transduce positional information along the body axis in the segmental portion of the trunk and in the rostral brain, respectively. Moreover, Hox and Otx2 genes show a complementary spatial regulation during embryogenesis. In this report, we show that a 1821-base pair (bp) upstream DNA fragment of the Otx2 gene is positively regulated by co-transfection with expression vectors for the human HOXB1, HOXB2, and HOXB3 proteins in an embryonal carcinoma cell line (NT2/D1) and that a shorter fragment of only 534 bp is able to drive this regulation. We also identified the HOXB1, HOXB2, and HOXB3 DNA-binding region on the 534-bp Otx2 genomic fragment using nuclear extracts from Hox-transfected COS cells and 12.5 days postcoitum mouse embryos or HOXB3 homeodomain-containing bacterial extracts. HOXB1, HOXB3, and nuclear extracts from 12.5 days postcoitum mouse embryos bind to a sequence containing two palindromic TAATTA sites, which bear four copies of the ATTA core sequence, a common feature of most HOM-C/HOX binding sites. HOXB2 protected an adjacent site containing a direct repeat of an ACTT sequence, quite divergent from the ATTA consensus. The region bound by the three homeoproteins is strikingly conserved through evolution and necessary (at least for HOXB1 and HOXB3) to mediate the up-regulation of the Otx2 transcription. Taken together, our data support the hypothesis that anteriorly expressed Hox genes might play a role in the refinement of the Otx2 early expression boundaries in vivo.

Employment and work schedule are related to telomere length in women

PubMed Central

Parks, C G; DeRoo, L A; Miller, D B; McCanlies, E C; Cawthon, R M; Sandler, D P

2011-01-01

Objectives To examine the association of employment and work schedule with shorter DNA telomeres, a marker of cellular ageing and disease risk factor, and consider whether differences were related to health, behaviours and sociodemographic factors, or varied by stress levels or menopausal status. Methods This cross-sectional analysis of 608 women aged 35–74 in the Sister Study examined determinants of relative telomere length (rTL) measured by quantitative PCR in leucocyte DNA. Age-adjusted regression models estimated base pair (bp) rTL differences for current and lifetime schedule characteristics (ie, part-time, full-time or overtime hours; multiple jobs; irregular hours; shiftwork; work at night). Covariates included race, smoking, perceived stress, sleep, physical activity, health and menopausal status, education, marital status, live births, children under 18, measured body mass index and urinary stress hormones. Results Compared with non-employed women with moderate or substantial past work histories (n=190), those currently working full-time (n=247; median 40 h/week) had a shorter rTL, an age-adjusted difference of −329 bp (95% CI −110 to −548). Longer-duration full-time work was also associated with shorter rTL (age-adjusted difference of −472 bp, 95% CI −786 to −158 for 20+ vs 1–5 years). Findings were not explained by health and demographic covariates. However, rTL differences for working at least full-time were greater in women with higher stress and epinephrine levels. Conclusions Current and long-term full-time work were associated with shorter rTL, with differences of similar magnitude to smoking and history of heart disease or diabetes. Longitudinal data with specific stress measures are needed to further evaluate the impact of work schedule on rTL. PMID:21540175

Employment and work schedule are related to telomere length in women.

PubMed

Parks, C G; DeRoo, L A; Miller, D B; McCanlies, E C; Cawthon, R M; Sandler, D P

2011-08-01

To examine the association of employment and work schedule with shorter DNA telomeres, a marker of cellular ageing and disease risk factor, and consider whether differences were related to health, behaviours and sociodemographic factors, or varied by stress levels or menopausal status. This cross-sectional analysis of 608 women aged 35-74 in the Sister Study examined determinants of relative telomere length (rTL) measured by quantitative PCR in leucocyte DNA. Age-adjusted regression models estimated base pair (bp) rTL differences for current and lifetime schedule characteristics (ie, part-time, full-time or overtime hours; multiple jobs; irregular hours; shiftwork; work at night). Covariates included race, smoking, perceived stress, sleep, physical activity, health and menopausal status, education, marital status, live births, children under 18, measured body mass index and urinary stress hormones. Compared with non-employed women with moderate or substantial past work histories (n=190), those currently working full-time (n=247; median 40 h/week) had a shorter rTL, an age-adjusted difference of -329 bp (95% CI -110 to -548). Longer-duration full-time work was also associated with shorter rTL (age-adjusted difference of -472 bp, 95% CI -786 to -158 for 20+ vs 1-5 years). Findings were not explained by health and demographic covariates. However, rTL differences for working at least full-time were greater in women with higher stress and epinephrine levels. Current and long-term full-time work were associated with shorter rTL, with differences of similar magnitude to smoking and history of heart disease or diabetes. Longitudinal data with specific stress measures are needed to further evaluate the impact of work schedule on rTL.

Analysis of a repetitive DNA sequence from Bordetella pertussis and its application to the diagnosis of pertussis using the polymerase chain reaction.

PubMed Central

Glare, E M; Paton, J C; Premier, R R; Lawrence, A J; Nisbet, I T

1990-01-01

A tandemly repeated 1,046-base-pair (bp) ClaI DNA fragment from Bordetella pertussis was cloned into Escherichia coli by using the vector pUC19. This fragment, when isolated, hybridized strongly to DNA from all 100 clinical isolates of B. pertussis tested. It was shown to have homology to single-copy sequences in Bordetella bronchiseptica but not Bordetella parapertussis and did not hybridize to lysate blots of a wide range of other bacteria, including members of the closely related genera Pasteurella, Alcaligenes, and Haemophilus. The 1,046-bp fragment was sequenced, and complementary synthetic oligonucleotides flanking a 153-bp region within the repeated element were used as primers for specific amplification of this region using the polymerase chain reaction (PCR). This procedure was then applied to the rapid (5-h) detection of B. pertussis in nasopharyngeal secretions collected from 332 children with suspected pertussis. The test yielded positive results in a total of 98 samples, compared with 66 for culture and 33 for direct immunofluorescence (IF). All of the IF-positive samples were PCR positive, as were 63 of the samples from which B. pertussis was eventually cultured. Two hundred thirty-one specimens which were negative by IF and culture were also negative in the PCR assay. However, 33 culture- and IF-negative specimens were positive by PCR assay. Several of these specimens were collected from close contacts of culture-proven pertussis patients, were follow-up specimens from such patients, or were from patients with serological evidence of pertussis and therefore may be true-rather than false-positives. Images PMID:2229381

Interleukin-1 gene cluster variants in hemodialysis patients with end stage renal disease: An association and meta-analysis

PubMed Central

Tripathi, G.; Rangaswamy, D.; Borkar, M.; Prasad, N.; Sharma, R. K.; Sankhwar, S. N.; Agrawal, S.

2015-01-01

We evaluated whether polymorphisms in interleukin (IL-1) gene cluster (IL-1 alpha [IL-1A], IL-1 beta [IL-1B], and IL-1 receptor antagonist [IL-1RN]) are associated with end stage renal disease (ESRD). A total of 258 ESRD patients and 569 ethnicity matched controls were examined for IL-1 gene cluster. These were genotyped for five single-nucleotide gene polymorphisms in the IL-1A, IL-1B and IL-1RN genes and a variable number of tandem repeats (VNTR) in the IL-1RN. The IL-1B − 3953 and IL-1RN + 8006 polymorphism frequencies were significantly different between the two groups. At IL-1B, the T allele of − 3953C/T was increased among ESRD (P = 0.0001). A logistic regression model demonstrated that two repeat (240 base pair [bp]) of the IL-1Ra VNTR polymorphism was associated with ESRD (P = 0.0001). The C/C/C/C/C/1 haplotype was more prevalent in ESRD = 0.007). No linkage disequilibrium (LD) was observed between six loci of IL-1 gene. We further conducted a meta-analysis of existing studies and found that there is a strong association of IL-1 RN VNTR 86 bp repeat polymorphism with susceptibility to ESRD (odds ratio = 2.04, 95% confidence interval = 1.48-2.82; P = 0.000). IL-1B − 5887, +8006 and the IL-1RN VNTR polymorphisms have been implicated as potential risk factors for ESRD. The meta-analysis showed a strong association of IL-1RN 86 bp VNTR polymorphism with susceptibility to ESRD. PMID:25684870

Construction of new EST-SSRs for Fusarium resistant wheat breeding.

PubMed

Yumurtaci, Aysen; Sipahi, Hulya; Al-Abdallat, Ayed; Jighly, Abdulqader; Baum, Michael

2017-06-01

Surveying Fusarium resistance in wheat with easy applicable molecular markers such as simple sequence repeats (SSRs) is a prerequest for molecular breeding. Expressed sequence tags (ESTs) are one of the main sources for development of new SSR candidates. Therefore, 18.292 publicly available wheat ESTs were mined and genotyping of newly developed 55 EST-SSR derived primer pairs produced clear fragments in ten wheat cultivars carrying different levels of Fusarium resistance. Among the proved markers, 23 polymorphic EST-SSRs were obtained and related alleles were mostly found on B and D genome. Based on the fragment profiling and similarity analysis, a 327bp amplicon, which was a product of contig 1207 (chromosome 5BL), was detected only in Fusarium head blight (FHB) resistant cultivars (CM82036 and Sumai) and the amino acid sequences showed a similarity to pathogen related proteins. Another FHB resistance related EST-SSR, Contig 556 (chromosome 1BL) produced a 151bp fragment in Sumai and was associated to wax2-like protein. A polymorphic 204bp fragment, derived from Contig 578 (chromosome 1DL), was generated from root rot (FRR) resistant cultivars (2-49; Altay2000 and Sunco). A total of 98 alleles were displayed with an average of 1.8 alleles per locus and the polymorphic information content (PIC) ranged from 0.11 to 0.78. Dendrogram tree with two main and five sub-groups were displayed the highest genetic relationship between FRR resistant cultivars (2-49 and Altay2000), FRR sensitive cultivars (Seri82 and Scout66) and FHB resistant cultivars (CM82036 and Sumai). Thus, exploitation of these candidate EST-SSRs may help to genotype other wheat sources for Fusarium resistance. Copyright © 2017 Elsevier Ltd. All rights reserved.

Part-per-trillion level detection of estradiol by competitive fluorescence immunoassay using DNA/dye conjugate as antibody multiple labels.

PubMed

Zhu, Shengchao; Zhang, Qin; Guo, Liang-Hong

2008-08-22

Fluorescent organic dyes are currently the standard signal-generating labels used in microarray quantification. However, new labeling strategies are needed to meet the demand for high sensitivity in the detection of low-abundance proteins and small molecules. In this report, a long-chain DNA/dye conjugate was used to attach multiple fluorescence labels on antibodies to improve signal intensity and immunoassay sensitivity. Compared with the 30 base-pair (bp) oligonucleotide used in our previous work [Q. Zhang, L.-H. Guo, Bioconjugate Chem. 18 (2007) 1668-1672], conjugation of a 219 bp DNA in solution with a fluorescent DNA binder SYBR Green I resulted in more than sixfold increase in signal intensity, consistent with the increase in bp number. In a direct immunoassay for the detection of goat anti-mouse IgG in a mouse IgG-coated 96-well plate, the long DNA conjugate label also produced higher fluorescence than the short one, accompanied by about 15-fold improvement in the detection limit. To demonstrate its advantage in real applications, the DNA/dye conjugate was employed in the competitive immunoassay of 17beta-estradiol, a clinically and environmentally important analyte. The biotin-terminated DNA was attached to biotinylated anti-estradiol antibody through the biotin/streptavidin/biotin bridge after the immuno-reaction was completed, followed by conjugation with SYBR Green I. The limit of detection for 17beta-estradiol is 1.9 pg mL(-1), which is 200-fold lower than the assay using fluorescein-labeled antibodies. The new multiple labeling strategy uses readily available reagents, and is also compatible with current biochip platform. It has great potential in the sensitive detection of protein and antibody microarrays.

Fine structure of the 21S ribosomal RNA region on yeast mitochondrial DNA. III. Physical location of mitochondrial genetic markers and the molecular nature of omega.

PubMed

Heyting, C; Menke, H H

1979-01-11

1. We have determined the physical location of mitochondrial genetic markers in the 21S region of yeast mtDNA by genetic analysis of petite mutants whose mtDNA has been physically mapped on the wild-type mtDNA. 2. The order of loci, determined in this study, is in agreement with the order deduced from recombination analysis and coretention analysis except for the position of omega+: we conclude that omega+ is located between C321 (RIB-1) and E514 (RIB-3). 3. The marker E514 (RIB-3) has been localized on a DNA segment of 3800 bp, and the markers E354, E553 and cs23 (RIB-2) on a DNA segment of 1100 base pairs; both these segments overlap the 21S rRNA cistron. The marker C321 (RIB-1) has been localized within a segment of 240 bp which also overlaps the 21S rRNA cistron, and we infer on the basis of indirect evidence that this marker lies within this cistron. 4. In all our rho+ as well as rho- strains there is a one-to-one correlation between the omega+ phenotype, the ability to transmit the omega+ allele and the presence of a mtDNA segment of about 1000 bp long, located between sequences specifying RIB-3 and sequences corresponding to the loci RIB-1 and RIB-2. This segment may be inserted at this same position into omega- mtDNA by recombination. 5. The role which the different allelic forms of omega may play in the polarity of recombination is discussed.

Genome-wide distribution comparative and composition analysis of the SSRs in Poaceae.

PubMed

Wang, Yi; Yang, Chao; Jin, Qiaojun; Zhou, Dongjie; Wang, Shuangshuang; Yu, Yuanjie; Yang, Long

2015-02-15

The Poaceae family is of great importance to human beings since it comprises the cereal grasses which are the main sources for human food and animal feed. With the rapid growth of genomic data from Poaceae members, comparative genomics becomes a convinent method to study genetics of diffierent species. The SSRs (Simple Sequence Repeats) are widely used markers in the studies of Poaceae for their high abundance and stability. In this study, using the genomic sequences of 9 Poaceae species, we detected 11,993,943 SSR loci and developed 6,799,910 SSR primer pairs. The results show that SSRs are distributed on all the genomic elements in grass. Hexamer is the most frequent motif and AT/TA is the most frequent motif in dimer. The abundance of the SSRs has a positive linear relationship with the recombination rate. SSR sequences in the coding regions involve a higher GC content in the Poaceae than that in the other species. SSRs of 70-80 bp in length showed the highest AT/GC base ratio among all of these loci. The result shows the highest polymorphism rate belongs to the SSRs ranged from 30 bp to 40 bp. Using all the SSR primers of Japonica, nineteen universal primers were selected and located on the genome of the grass family. The information of SSR loci, the SSR primers and the tools of mining and analyzing SSR are provided in the PSSRD (Poaceae SSR Database, http://biodb.sdau.edu.cn/pssrd/). Our study and the PSSRD database provide a foundation for the comparative study in the Poaceae and it will accelerate the study on markers application, gene mapping and molecular breeding.

CHANGES IN CHOROIDAL THICKNESS IN AND OUTSIDE THE MACULA AFTER HEMODIALYSIS IN PATIENTS WITH END-STAGE RENAL DISEASE

PubMed Central

Chang, In Boem; Lee, Jeong Hyun

2017-01-01

Purpose: To evaluate changes in choroidal thickness in and outside the macula as a result of hemodialysis (HD) in patients with end-stage renal disease. Methods: Patients with end-stage renal disease treated with maintenance HD in the Dialysis Unit of Sanggye Paik Hospital, Seoul, South Korea, were included in this study. The choroidal thickness was measured in and outside the macula before and after HD (paired t-test). Choroidal thickness in the macula was measured at the foveal center and 1.5 mm temporal to the foveal center and outside the macula was measured at superior, inferior, and nasal area 3.5 mm from the optic disk margin. Peripapillary retinal nerve fiber layer thickness, intraocular pressure, central corneal thickness, and systemic parameters such as serum osmolarity and blood pressure (BP) were measured before and after HD (paired t-test). We divided patients into two groups, diabetic and nondiabetic groups to compare the changes in choroidal thickness. Patients with diabetes were subdivided into two groups: severe retinal change group and moderate retinal change group (Mann–Whitney test). Pearson's correlation test was used to evaluate the correlations between choroidal thickness and changes in serum osmolarity, BP, and body weight loss. Choroidal thickness and peripapillary retinal nerve fiber layer thickness were measured using spectral-domain optical coherence tomography. Results: Fifty-four eyes of 31 patients with end-stage renal disease were included. After HD, the mean intraocular pressure was significantly decreased from 14.8 ± 2.5 mmHg to 13.0 ± 2.6 mmHg (P < 0.001). Choroidal thickness was reduced in all areas (P < 0.001). The reduction in choroidal thickness correlated with body weight loss, decrease in serum osmolarity, and decrease in systolic BP (P < 0.05). In the diabetic group, the mean choroidal thickness changes were greater than those in the nondiabetic group (P < 0.05). The severe retinal change group showed greater changes in choroidal thickness in all areas (P < 0.05). Other factors that significantly decreased after HD included serum osmolarity, body weight, and systolic BP (all P < 0.001). The diabetic group showed greater changes in serum osmolarity and body weight (P < 0.001, P = 0.048, respectively). The measured overall changes in peripapillary retinal nerve fiber layer thickness or central corneal thickness were not statistically significant. Conclusion: Changes in body weight, serum osmolarity, and BP during HD may affect choroidal thickness in and outside the macula. PMID:27557086

Electric Power Engineering Cost Predicting Model Based on the PCA-GA-BP

NASA Astrophysics Data System (ADS)

Wen, Lei; Yu, Jiake; Zhao, Xin

2017-10-01

In this paper a hybrid prediction algorithm: PCA-GA-BP model is proposed. PCA algorithm is established to reduce the correlation between indicators of original data and decrease difficulty of BP neural network in complex dimensional calculation. The BP neural network is established to estimate the cost of power transmission project. The results show that PCA-GA-BP algorithm can improve result of prediction of electric power engineering cost.

Genomics of Three New Bacteriophages Useful in the Biocontrol of Salmonella

PubMed Central

Bardina, Carlota; Colom, Joan; Spricigo, Denis A.; Otero, Jennifer; Sánchez-Osuna, Miquel; Cortés, Pilar; Llagostera, Montserrat

2016-01-01

Non-typhoid Salmonella is the principal pathogen related to food-borne diseases throughout the world. Widespread antibiotic resistance has adversely affected human health and has encouraged the search for alternative antimicrobial agents. The advances in bacteriophage therapy highlight their use in controlling a broad spectrum of food-borne pathogens. One requirement for the use of bacteriophages as antibacterials is the characterization of their genomes. In this work, complete genome sequencing and molecular analyses were carried out for three new virulent Salmonella-specific bacteriophages (UAB_Phi20, UAB_Phi78, and UAB_Phi87) able to infect a broad range of Salmonella strains. Sequence analysis of the genomes of UAB_Phi20, UAB_Phi78, and UAB_Phi87 bacteriophages did not evidence the presence of known virulence-associated and antibiotic resistance genes, and potential immunoreactive food allergens. The UAB_Phi20 genome comprised 41,809 base pairs with 80 open reading frames (ORFs); 24 of them with assigned function. Genome sequence showed a high homology of UAB_Phi20 with Salmonella bacteriophage P22 and other P22likeviruses genus of the Podoviridae family, including ST64T and ST104. The DNA of UAB_Phi78 contained 44,110 bp including direct terminal repeats (DTR) of 179 bp and 58 putative ORFs were predicted and 20 were assigned function. This bacteriophage was assigned to the SP6likeviruses genus of the Podoviridae family based on its high similarity not only with SP6 but also with the K1-5, K1E, and K1F bacteriophages, all of which infect Escherichia coli. The UAB_Phi87 genome sequence consisted of 87,669 bp with terminal direct repeats of 608 bp; although 148 ORFs were identified, putative functions could be assigned to only 29 of them. Sequence comparisons revealed the mosaic structure of UAB_Phi87 and its high similarity with bacteriophages Felix O1 and wV8 of E. coli with respect to genetic content and functional organization. Phylogenetic analysis of large terminase subunits confirms their packaging strategies and grouping to the different phage genus type. All these studies are necessary for the development and the use of an efficient cocktail with commercial applications in bacteriophage therapy against Salmonella. PMID:27148229

A study of renal function influence by integrating cloud-based manometers and physician order entry systems.

PubMed

Lin, Yuh-Feng; Sheng, Li-Huei; Wu, Mei-Yi; Zheng, Cai-Mei; Chang, Tian-Jong; Li, Yu-Chuan; Huang, Yu-Hui; Lu, Hsi-Peng

2014-12-01

No evidence exists from randomized trials to support using cloud-based manometers integrated with available physician order entry systems for tracking patient blood pressure (BP) to assist in the control of renal function deterioration. We investigated how integrating cloud-based manometers with physician order entry systems benefits our outpatient chronic kidney disease patients compared with typical BP tracking systems. We randomly assigned 36 chronic kidney disease patients to use cloud-based manometers integrated with physician order entry systems or typical BP recording sheets, and followed the patients for 6 months. The composite outcome was that the patients saw improvement both in BP and renal function. We compared the systolic and diastolic BP (SBP and DBP), and renal function of our patients at 0 months, 3 months, and 6 months after using the integrated manometers and typical BP monitoring sheets. Nighttime SBP and DBP were significantly lower in the study group compared with the control group. Serum creatinine level in the study group improved significantly compared with the control group after the end of Month 6 (2.83 ± 2.0 vs. 4.38 ± 3.0, p = 0.018). Proteinuria improved nonsignificantly in Month 6 in the study group compared with the control group (1.05 ± 0.9 vs. 1.90 ± 1.3, p = 0.09). Both SBP and DBP during the nighttime hours improved significantly in the study group compared with the baseline. In pre-end-stage renal disease patients, regularly monitoring BP by integrating cloud-based manometers appears to result in a significant decrease in creatinine and improvement in nighttime BP control. Estimated glomerular filtration rate and proteinuria were found to be improved nonsignificantly, and thus, larger population and longer follow-up studies may be needed.

Designing a SCAR molecular marker for monitoring Trichoderma cf. harzianum in experimental communities.

PubMed

Pérez, Gabriel; Verdejo, Valentina; Gondim-Porto, Clarissa; Orlando, Julieta; Carú, Margarita

2014-11-01

Several species of the fungal genus Trichoderma establish biological interactions with various micro- and macro-organisms. Some of these interactions are relevant in ecological terms and in biotechnological applications, such as biocontrol, where Trichoderma could be considered as an invasive species that colonizes a recipient community. The success of this invasion depends on multiple factors, which can be assayed using experimental communities as study models. Therefore, the aim of this work is to develop a species-specific sequence-characterized amplified region (SCAR) marker to monitor the colonization and growth of T. cf. harzianum when it invades experimental communities. For this study, 16 randomly amplified polymorphic DNA (RAPD) primers of 10-mer were used to generate polymorphic patterns, one of which generated a band present only in strains of T. cf. harzianum. This band was cloned, sequenced, and five primers of 20-23 mer were designed. Primer pairs 2F2/2R2 and 2F2/2R3 successfully and specifically amplified fragments of 278 and 448 bp from the T. cf. harzianum BpT10a strain DNA, respectively. Both primer pairs were also tested against the DNA from 14 strains of T. cf. harzianum and several strains of different fungal genera as specificity controls. Only the DNA from the strains of T. cf. harzianum was successfully amplified. Moreover, primer pair 2F2/2R2 was assessed by quantitative real-time polymerase chain reaction (PCR) using fungal DNA mixtures and DNA extracted from fungal experimental communities as templates. T. cf. harzianum was detectable even when as few as 100 copies of the SCAR marker were available or even when its population represented only 0.1% of the whole community.

Designing a SCAR molecular marker for monitoring Trichoderma cf. harzianum in experimental communities* #

PubMed Central

Pérez, Gabriel; Verdejo, Valentina; Gondim-Porto, Clarissa; Orlando, Julieta; Carú, Margarita

2014-01-01

Several species of the fungal genus Trichoderma establish biological interactions with various micro- and macro-organisms. Some of these interactions are relevant in ecological terms and in biotechnological applications, such as biocontrol, where Trichoderma could be considered as an invasive species that colonizes a recipient community. The success of this invasion depends on multiple factors, which can be assayed using experimental communities as study models. Therefore, the aim of this work is to develop a species-specific sequence-characterized amplified region (SCAR) marker to monitor the colonization and growth of T. cf. harzianum when it invades experimental communities. For this study, 16 randomly amplified polymorphic DNA (RAPD) primers of 10-mer were used to generate polymorphic patterns, one of which generated a band present only in strains of T. cf. harzianum. This band was cloned, sequenced, and five primers of 20–23 mer were designed. Primer pairs 2F2/2R2 and 2F2/2R3 successfully and specifically amplified fragments of 278 and 448 bp from the T. cf. harzianum BpT10a strain DNA, respectively. Both primer pairs were also tested against the DNA from 14 strains of T. cf. harzianum and several strains of different fungal genera as specificity controls. Only the DNA from the strains of T. cf. harzianum was successfully amplified. Moreover, primer pair 2F2/2R2 was assessed by quantitative real-time polymerase chain reaction (PCR) using fungal DNA mixtures and DNA extracted from fungal experimental communities as templates. T. cf. harzianum was detectable even when as few as 100 copies of the SCAR marker were available or even when its population represented only 0.1% of the whole community. PMID:25367789

Removal of 2-ClBP from soil-water system using activated carbon supported nanoscale zerovalent iron.

PubMed

Zhang, Wei; Yu, Tian; Han, Xiaolin; Ying, Weichi

2016-09-01

We explored the feasibility and removal mechanism of removing 2-chlorobiphenyl (2-ClBP) from soil-water system using granular activated carbon (GAC) impregnated with nanoscale zerovalent iron (reactive activated carbon or RAC). The RAC samples were successfully synthesized by the liquid precipitation method. The mesoporous GAC based RAC with low iron content (1.32%) exhibited higher 2-ClBP removal efficiency (54.6%) in the water phase. The result of Langmuir-Hinshelwood kinetic model implied that the different molecular structures between 2-ClBP and trichloroethylene (TCE) resulted in more difference in dechlorination reaction rates on RAC than adsorption capacities. Compared to removing 2-ClBP in the water phase, RAC removed the 2-ClBP more slowly in the soil phase due to the significant external mass transfer resistance. However, in the soil phase, a better removal capacity of RAC was observed than its base GAC because the chemical dechlorination played a more important role in total removal process for 2-ClBP. This important result verified the effectiveness of RAC for removing 2-ClBP in the soil phase. Although reducing the total RAC removal rate of 2-ClBP, soil organic matter (SOM), especially the soft carbon, also served as an electron transfer medium to promote the dechlorination of 2-ClBP in the long term. Copyright © 2016. Published by Elsevier B.V.

Detection of Ophiocordyceps sinensis and Its Common Adulterates Using Species-Specific Primers

PubMed Central

Liu, Yang; Wang, Xiao-yue; Gao, Zi-tong; Han, Jian-ping; Xiang, Li

2017-01-01

Ophiocordyceps sinensis is a fungus that infects Hepialidae caterpillars, mummifying the larvae and producing characteristic fruiting bodies (stromata) that are processed into one of the most valued traditional Chinese medicines (TCM). The product commands a very high price due to a high demand but a very limited supply. Adulteration with other fungi is a common problem and there is a need to test preparation for the presence of the correct fungus. In the current study, a PCR-based approach for the identification of O. sinensis based on a segment of the internal transcribed spacer (ITS) region was developed. The segments is 146-bp in size and is likely to be amplified even in materials where processing led to DNA fragmentation. Primer development was based on the alignment of sequence data generated from a total of 89 samples of O. sinensis and potential adulterants as well as sequences date from 41 Ophiocordyceps species and 26 Cordyceps species available in GenBank. Tests with primer pair, DCF4/DCR4, demonstrated generation of an amplicon from DNA extracted from O. sinensis stromata, but not from extracts derived from adulterants. Species-specific primer pairs were also developed and tested for detection of the common adulterants, Cordyceps gunnii, Cordyceps cicadae, Cordyceps militaris, Cordyceps liangshanensis and Ophiocordyceps nutans. The collection of primers developed in the present study will be useful for the authentication of preparation claiming to only contain O. sinensis and for the detection of fungi used as adulterants in these preparations. PMID:28680424

Research on Environmental Adjustment of Cloud Ranch Based on BP Neural Network PID Control

NASA Astrophysics Data System (ADS)

Ren, Jinzhi; Xiang, Wei; Zhao, Lin; Wu, Jianbo; Huang, Lianzhen; Tu, Qinggang; Zhao, Heming

2018-01-01

In order to make the intelligent ranch management mode replace the traditional artificial one gradually, this paper proposes a pasture environment control system based on cloud server, and puts forward the PID control algorithm based on BP neural network to control temperature and humidity better in the pasture environment. First, to model the temperature and humidity (controlled object) of the pasture, we can get the transfer function. Then the traditional PID control algorithm and the PID one based on BP neural network are applied to the transfer function. The obtained step tracking curves can be seen that the PID controller based on BP neural network has obvious superiority in adjusting time and error, etc. This algorithm, calculating reasonable control parameters of the temperature and humidity to control environment, can be better used in the cloud service platform.

Sequence determination and analysis of three plasmids of Pseudomonas sp. GLE121, a psychrophile isolated from surface ice of Ecology Glacier (Antarctica).

PubMed

Dziewit, Lukasz; Grzesiak, Jakub; Ciok, Anna; Nieckarz, Marta; Zdanowski, Marek K; Bartosik, Dariusz

2013-09-01

Pseudomonas sp. GLE121 (a psychrophilic Antarctic strain) carries three plasmids: pGLE121P1 (6899 bp), pGLE121P2 (8330 bp) and pGLE121P3 (39,583 bp). Plasmids pGLE121P1 and pGLE121P2 show significant sequence similarity to members of the IncP-9 and IncP-7 incompatibility groups, respectively, while the largest replicon, pGLE121P3, is highly related to plasmid pNCPPB880-40 of Pseudomonas syringae pathovar tomato NCPPB880. All three plasmids have a narrow host range, limited to members of the genus Pseudomonas. Plasmid pGLE121P3 encodes a conjugal transfer system, while pGLE121P1 carries only a putative MOB module, conserved in many mobilizable plasmids. Plasmid pGLE121P3 contains an additional load of genetic information, including a pair of genes with homology to the rulAB operon, responsible for ultraviolet radiation (UVR) tolerance. Given the increasing UV exposure in Antarctic regions, the expression of these genes is likely to be an important adaptive response. Copyright © 2013 Elsevier Inc. All rights reserved.

Solvent Extraction Separation of Trivalent Americium from Curium and the Lanthanides

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jensen, Mark P.; Chiarizia, Renato; Ulicki, Joseph S.

2015-02-27

The sterically constrained, macrocyclic, aqueous soluble ligand N,N'-bis[(6-carboxy-2-pyridyl)methyl]-1,10-diaza-18-crown-6 (H2BP18C6) was investigated for separating americium from curium and all the lanthanides by solvent extraction. Pairing H2BP18C6, which favors complexation of larger f-element cations, with acidic organophosphorus extractants that favor extraction of smaller f-element cations, such as bis-(2-ethylhexyl)phosphoric acid (HDEHP) or (2-ethylhexyl)phosphonic acid mono(2-ethylhexyl) ester (HEH[EHP]), created solvent extraction systems with good Cm/Am selectivity, excellent trans-lanthanide selectivity (Kex,Lu/Kex,La = 108), but poor selectivity for Am against the lightest lanthanides. However, using an organic phase containing both a neutral extractant, N,N,N’,N’-tetra(2-ethylhexyl)diglycolamide (TEHDGA), and HEH[EHP] enabled rejection of the lightest lanthanides during loading ofmore » the organic phase from aqueous nitric acid, eliminating their interference in the americium stripping stages. In addition, although it is a macrocyclic ligand, H2BP18C6 does not significantly impede the mass transfer kinetics of the HDEHP solvent extraction system« less

Blood pressure and heart rate response to posteriorly directed pressure applied to the cervical spine in young, pain-free individuals: a randomized, repeated-measures, double-blind, placebo-controlled study.

PubMed

Yung, Emmanuel; Wong, Michael; Williams, Haddie; Mache, Kyle

2014-08-01

Randomized clinical trial. Objectives To compare the blood pressure (BP) and heart rate (HR) response of healthy volunteers to posteriorly directed (anterior-to-posterior [AP]) pressure applied to the cervical spine versus placebo. Manual therapists employ cervical spine AP mobilizations for various cervical-shoulder pain conditions. However, there is a paucity of literature describing the procedure, cardiovascular response, and safety profile. Thirty-nine (25 female) healthy participants (mean ± SD age, 24.7 ± 1.9 years) were randomly assigned to 1 of 2 groups. Group 1 received a placebo, consisting of light touch applied to the right C6 costal process. Group 2 received AP pressure at the same location. Blood pressure and HR were measured prior to, during, and after the application of AP pressure. One-way analysis of variance and paired-difference statistics were used for data analysis. There was no statistically significant difference between groups for mean systolic BP, mean diastolic BP, and mean HR (P >.05) for all time points. Within-group comparisons indicated statistically significant differences between baseline and post-AP pressure HR (-2.8 bpm; 95% confidence interval: -4.6, -1.1) and between baseline and post-AP pressure systolic BP (-2.4 mmHg; 95% confidence interval: -3.7, -1.0) in the AP group, and between baseline and postplacebo systolic BP (-2.6 mmHg; 95% confidence interval: -4.2, -1.0) in the placebo group. No participants reported any adverse reactions or side effects within 24 hours of testing. AP pressure caused a statistically significant physiologic response that resulted in a minor drop in HR (without causing asystole or vasodepression) after the procedure, whereas this cardiovascular change did not occur for those in the placebo group. Within both groups, there was a small but statistically significant reduction in systolic BP following the procedure.

Antimicrobial resistance of Listeria monocytogenes isolated from dairy-based food products.

PubMed

Harakeh, Steve; Saleh, Imane; Zouhairi, Omar; Baydoun, Elias; Barbour, Elie; Alwan, Nisreen

2009-06-15

In this study Listeria monocytogenes (L. monocytogenes) was isolated from three traditionally consumed Lebanese dairy-based food products. One hundred and sixty four samples (45 samples of Baladi cheese, 36 samples of Shankleesh and 83 of Kishk) were collected from the Bekaa Valley in the Northeast region of Lebanon. Suspected Listeria colonies were selected and initially identified by using standard biochemical tests. Initial identification of the positive L. monocytogenes colonies was confirmed at the molecular level by Polymerase Chain Reaction (n=30) and the confirmed isolates were evaluated for their susceptibility to 10 commonly used antimicrobials. All of the 30 isolates were confirmed to be L. monocytogenes yielding a PCR product of approximately 660 base pairs (bp). L. monocytogenes was detected in 26.67%, 13.89% and 7.23% of the Baladi cheese, Shankleesh and Kishk samples, respectively. The highest resistance in L. monocytogenes isolates was noted against oxacillin (93.33%) followed by penicillin (90%). The results provide an indication of the contamination levels of dairy-based foods in Lebanon and highlight the emergence of multi-drug resistant Listeria in the environment.

UPLC-MS/MS based diagnostics for epithelial ovarian cancer using fully sialylated C4-binding protein.

PubMed

Tanabe, Kazuhiro; Matsuo, Koji; Miyazawa, Masaki; Hayashi, Masaru; Ikeda, Masae; Shida, Masako; Hirasawa, Takeshi; Sho, Ryuichiro; Mikami, Mikio

2018-05-01

Serum levels of fully sialylated C4-binding protein (FS-C4BP) are remarkably elevated in patients with epithelial ovarian cancer (EOC) and can be used as a marker to distinguish ovarian clear cell carcinoma from endometrioma. This study aimed to develop a stable, robust and reliable liquid chromatography-hybrid mass spectrometry (UPLC-MS/MS) based diagnostic method that would generalize FS-C4BP as a clinical EOC biomarker. Glycopeptides derived from 20 μL of trypsin-digested serum glycoprotein were analyzed via UPLC equipped with an electrospray ionization time-of-flight mass spectrometer. This UPLC-MS/MS-based diagnostic method was optimized for FS-C4BP and validated using sera from 119 patients with EOC and 127 women without cancer. A1958 (C4BP peptide with two fully sialylated biantennary glycans) was selected as a marker of FS-C4BP because its level in serum was highest among FS-C4BP family members. Preparation and UPLC-MS/MS were optimized for A1958, and performance and robustness were significantly improved relative to our previous method. An area under the curve analysis of the FS-C4BP index receiver operating characteristic curve revealed that the ratio between A1958 and A1813 (C4BP peptide with two partially sialylated biantennary glycans) reached 85%. A combination of the FS-C4BP index and carbohydrate antigen-125 levels further enhanced the sensitivity and specificity. © 2017 The Authors. Biomedical Chromatography published by John Wiley & Sons Ltd.

An optimized BP neural network based on genetic algorithm for static decoupling of a six-axis force/torque sensor

NASA Astrophysics Data System (ADS)

Fu, Liyue; Song, Aiguo

2018-02-01

In order to improve the measurement precision of 6-axis force/torque sensor for robot, BP decoupling algorithm optimized by GA (GA-BP algorithm) is proposed in this paper. The weights and thresholds of a BP neural network with 6-10-6 topology are optimized by GA to develop decouple a six-axis force/torque sensor. By comparison with other traditional decoupling algorithm, calculating the pseudo-inverse matrix of calibration and classical BP algorithm, the decoupling results validate the good decoupling performance of GA-BP algorithm and the coupling errors are reduced.

Genetic study of kelp ``901'' strain

NASA Astrophysics Data System (ADS)

Xia, Peng; Wang, Xiuliang; Li, Xiaojie; Zhao, Yushan; Yao, Lin; Duan, Delin

2005-06-01

Based on DNA extraction and optimization of random amplified reaction (RAPD) to the gametophytes and sporophytes of Kelp “901” strain, genetic study on variation was conducted to its parents and offsprings of F6, F7, F8, and F9 generation. RAPD results have shown that among 30 selected primers for gametophytes, 297 loci ranging from 200 to 3 000 bp were obtained in the average of 9.9 loci for each primer. This indicated a high polymorphic rate with RAPD detection. UPGMA (unweighted pair-group method arithmetic average) analysis showed that each male and female gametophyte of a generation could be clustered into one pair separately. The genetic distances of the Kelp 901 generation were 0.3212 0.4767, and the maximum was between F7 and F8 (0.4767). Identity analysis showed that F6 generation was more close to the female parent (0.6593), and F7 generation was more close to the male parent (0.578 8). To the sporophytes study in 24 selected primers for RAPD amplification, 191 loci ranging from 230 2800 bp were obtained, in the average to each primer of 8.0 loci. The heterozygosity to six populations were male parent (0.2239), female parent (0.1072), F6 (0.2164), F7(0.2286), F8(0.2296) and F9(0.3172). The nearest genetic distance was 0.083 5(F8, F9). Total heterozygosity (HT) of F6, F7, F8 and F9 generations was 0.3186, the average heterozygosity (HS) for F6, F7, F8 and F9 generations was 0.2480, and deduced coefficient of population differentiation (Gst) was 22.2%. Six sequence characterized amplified regions (SCAR) were preliminary screened through RAPD analysis. It needed to be verified in detail as they are significant for molecular marker assistance in breeding and selecting Laminaria.

Effectiveness of home blood pressure monitoring, Web communication, and pharmacist care on hypertension control: a randomized controlled trial.

PubMed

Green, Beverly B; Cook, Andrea J; Ralston, James D; Fishman, Paul A; Catz, Sheryl L; Carlson, James; Carrell, David; Tyll, Lynda; Larson, Eric B; Thompson, Robert S

2008-06-25

Treating hypertension decreases mortality and disability from cardiovascular disease, but most hypertension remains inadequately controlled. To determine if a new model of care that uses patient Web services, home blood pressure (BP) monitoring, and pharmacist-assisted care improves BP control. A 3-group randomized controlled trial, the Electronic Communications and Home Blood Pressure Monitoring study was based on the Chronic Care Model. The trial was conducted at an integrated group practice in Washington state, enrolling 778 participants aged 25 to 75 years with uncontrolled essential hypertension and Internet access. Care was delivered over a secure patient Web site from June 2005 to December 2007. Participants were randomly assigned to usual care, home BP monitoring and secure patient Web site training only, or home BP monitoring and secure patient Web site training plus pharmacist care management delivered through Web communications. Percentage of patients with controlled BP (<140/90 mm Hg) and changes in systolic and diastolic BP at 12 months. Of 778 patients, 730 (94%) completed the 1-year follow-up visit. Patients assigned to the home BP monitoring and Web training only group had a nonsignificant increase in the percentage of patients with controlled BP (<140/90 mm Hg) compared with usual care (36% [95% confidence interval {CI}, 30%-42%] vs 31% [95% CI, 25%-37%]; P = .21). Adding Web-based pharmacist care to home BP monitoring and Web training significantly increased the percentage of patients with controlled BP (56%; 95% CI, 49%-62%) compared with usual care (P < .001) and home BP monitoring and Web training only (P < .001). Systolic BP was decreased stepwise from usual care to home BP monitoring and Web training only to home BP monitoring and Web training plus pharmacist care. Diastolic BP was decreased only in the pharmacist care group compared with both the usual care and home BP monitoring and Web training only groups. Compared with usual care, the patients who had baseline systolic BP of 160 mm Hg or higher and received home BP monitoring and Web training plus pharmacist care had a greater net reduction in systolic BP (-13.2 mm Hg [95% CI, -19.2 to -7.1]; P < .001) and diastolic BP (-4.6 mm Hg [95% CI, -8.0 to -1.2]; P < .001), and improved BP control (relative risk, 3.32 [95% CI, 1.86 to 5.94]; P<.001). Pharmacist care management delivered through secure patient Web communications improved BP control in patients with hypertension. Trial Registration clinicaltrials.gov Identifier: NCT00158639.

Limitations of analyses based on achieved blood pressure: lessons from the African American study of kidney disease and hypertension trial.

PubMed

Davis, Esa M; Appel, Lawrence J; Wang, Xuelei; Greene, Tom; Astor, Brad C; Rahman, Mahboob; Toto, Robert; Lipkowitz, Michael S; Pogue, Velvie A; Wright, Jackson T

2011-06-01

Blood pressure (BP) guidelines that set target BP levels often rely on analyses of achieved BP from hypertension treatment trials. The objective of this article was to compare the results of analyses of achieved BP to intention-to-treat analyses on renal disease progression. Participants (n=1094) in the African-American Study of Kidney Disease and Hypertension Trial were randomly assigned to either usual BP goal defined by a mean arterial pressure goal of 102 to 107 mm Hg or lower BP goal defined by a mean arterial pressure goal of ≤92 mm Hg. Median follow-up was 3.7 years. Primary outcomes were rate of decline in measured glomerular filtration rate and a composite of a decrease in glomerular filtration rate by >50% or >25 mL/min per 1.73 m(2), requirement for dialysis, transplantation, or death. Intention-to-treat analyses showed no evidence of a BP effect on either the rate of decline in glomerular filtration rate or the clinical composite outcome. In contrast, the achieved BP analyses showed that each 10-mm Hg increment in mean follow-up achieved mean arterial pressure was associated with a 0.35 mL/min per 1.73 m(2) (95% CI: 0.08 to 0.62 mL/min per 1.73 m(2); P=0.01) faster mean glomerular filtration rate decline and a 17% (95% CI: 5% to 32%; P=0.006) increased risk of the clinical composite outcome. Analyses based on achieved BP lead to markedly different inferences than traditional intention-to-treat analyses, attributed in part to confounding of achieved BP with comorbidities, disease severity, and adherence. Clinicians and policy makers should exercise caution when making treatment recommendations based on analyses relating outcomes to achieved BP.

Comparison of Species Richness Estimates Obtained Using Nearly Complete Fragments and Simulated Pyrosequencing-Generated Fragments in 16S rRNA Gene-Based Environmental Surveys▿ †

PubMed Central

Youssef, Noha; Sheik, Cody S.; Krumholz, Lee R.; Najar, Fares Z.; Roe, Bruce A.; Elshahed, Mostafa S.

2009-01-01

Pyrosequencing-based 16S rRNA gene surveys are increasingly utilized to study highly diverse bacterial communities, with special emphasis on utilizing the large number of sequences obtained (tens to hundreds of thousands) for species richness estimation. However, it is not yet clear how the number of operational taxonomic units (OTUs) and, hence, species richness estimates determined using shorter fragments at different taxonomic cutoffs correlates with the number of OTUs assigned using longer, nearly complete 16S rRNA gene fragments. We constructed a 16S rRNA clone library from an undisturbed tallgrass prairie soil (1,132 clones) and used it to compare species richness estimates obtained using eight pyrosequencing candidate fragments (99 to 361 bp in length) and the nearly full-length fragment. Fragments encompassing the V1 and V2 (V1+V2) region and the V6 region (generated using primer pairs 8F-338R and 967F-1046R) overestimated species richness; fragments encompassing the V3, V7, and V7+V8 hypervariable regions (generated using primer pairs 338F-530R, 1046F-1220R, and 1046F-1392R) underestimated species richness; and fragments encompassing the V4, V5+V6, and V6+V7 regions (generated using primer pairs 530F-805R, 805F-1046R, and 967F-1220R) provided estimates comparable to those obtained with the nearly full-length fragment. These patterns were observed regardless of the alignment method utilized or the parameter used to gauge comparative levels of species richness (number of OTUs observed, slope of scatter plots of pairwise distance values for short and nearly complete fragments, and nonparametric and parametric species richness estimates). Similar results were obtained when analyzing three other datasets derived from soil, adult Zebrafish gut, and basaltic formations in the East Pacific Rise. Regression analysis indicated that these observed discrepancies in species richness estimates within various regions could readily be explained by the proportions of hypervariable, variable, and conserved base pairs within an examined fragment. PMID:19561178

Complete genomic sequence of the Lactobacillus temperate phage LF1.

PubMed

Yoon, Bo Hyun; Chang, Hyo Ihl

2011-10-01

Bacteriophage LF1, a newly isolated temperate phage from a mitomycin-C-induced lysate of wild type Lactobacillus fermentum, was found to contain a double-strand DNA of 42,606 base pairs (bp) with a G+C content of 45%. Bioinformatic analysis of the phage genome revealed 57 putative open reading frames (ORFs). The predicted protein products of ORFs were determined and described. According to morphological analysis by transmission electron microscopy (TEM), LF1 has an isometric head and a non-contractile tail, indicating that it belongs to the family Siphoviridae. The temperate phage LF1 has a good genetic mosaic relationship with ΦPYB5 in the packaging module. To our knowledge, this is first report of genomic sequencing and characterization of temperate phage LF1 from wild-type L. fermentum isolated from Kimchi in Korea.

The de novo Transcriptome and Its Analysis in the Worldwide Vegetable Pest, Delia antiqua (Diptera: Anthomyiidae)

PubMed Central

Zhang, Yu-Juan; Hao, Youjin; Si, Fengling; Ren, Shuang; Hu, Ganyu; Shen, Li; Chen, Bin

2014-01-01

The onion maggot Delia antiqua is a major insect pest of cultivated vegetables, especially the onion, and a good model to investigate the molecular mechanisms of diapause. To better understand the biology and diapause mechanism of the insect pest species, D. antiqua, the transcriptome was sequenced using Illumina paired-end sequencing technology. Approximately 54 million reads were obtained, trimmed, and assembled into 29,659 unigenes, with an average length of 607 bp and an N50 of 818 bp. Among these unigenes, 21,605 (72.8%) were annotated in the public databases. All unigenes were then compared against Drosophila melanogaster and Anopheles gambiae. Codon usage bias was analyzed and 332 simple sequence repeats (SSRs) were detected in this organism. These data represent the most comprehensive transcriptomic resource currently available for D. antiqua and will facilitate the study of genetics, genomics, diapause, and further pest control of D. antiqua. PMID:24615268

Development of a species-diagnostic marker for identification of the stingless bee Trigona pagdeni in Thailand.

PubMed

Thummajitsakul, Sirikul; Klinbunga, Sirawut; Sittipraneed, Siriporn

2010-04-01

A species-diagnostic SCAR marker for identification of the stingless bee (Trigona pagdeni Schwarz) was successfully developed. Initially, amplified fragment length polymorphism analysis was carried out across representatives of 12 stingless bee species using 64 primer combinations. A 284 bp band restrictively found in T. pagdeni was cloned and sequenced. A primer pair (CUTP1-F/R) was designed and tested for species-specificity in 15 stingless bees. The expected 163 bp fragment was successfully amplified in all examined individuals of T. pagdeni (129/129). Nevertheless, cross-species amplification was also observed in T. fimbriata (1/3), T. collina (11/112), T. laeviceps (1/12), and T. fuscobalteata (15/15), but not in other species. SSCP analysis of CUTP1 further differentiated T. fuscobalteata and T. collina from T. pagdeni. Although T. laeviceps, T. fimbriata, and T. pagdeni shared an identical SSCP genotype, they are not taxonomically problematic species.

DNA detection rates of host mtDNA in bloodmeals of human body lice (Pediculus humanus L., 1758).

PubMed

Davey, J S; Casey, C S; Burgess, I F; Cable, J

2007-09-01

Using polymerase chain reaction, we investigated the extent to which digestion affects the potential to amplify 12S mitochondrial DNA sequences from bloodmeals of individual human body lice (Pediculus humanus L.) (Phthiraptera, Pediculidae) up to 72 h after feeding on a surrogate rabbit host (Oryctolagus cuniculus L.) (Lagomorpha, Leporidae). Two rabbit-specific primer pairs were developed to produce amplicons of 199 bp and 283 bp, the smaller of which was found to have a significantly slower decay rate. Median detection periods (T50) for the amplicons were 20 h and 12 h, with maximum detection periods of 24 h and 12 h, respectively, suggesting an inversely proportional linear relationship between amplicon size and digestion time. The data provide an indication of timeframes essential for the design of forensic sampling protocols and a basis for investigating the feeding frequency of human lice.

High Diversity of Myocyanophage in Various Aquatic Environments Revealed by High-Throughput Sequencing of Major Capsid Protein Gene With a New Set of Primers.

PubMed

Hou, Weiguo; Wang, Shang; Briggs, Brandon R; Li, Gaoyuan; Xie, Wei; Dong, Hailiang

2018-01-01

Myocyanophages, a group of viruses infecting cyanobacteria, are abundant and play important roles in elemental cycling. Here we investigated the particle-associated viral communities retained on 0.2 μm filters and in sediment samples (representing ancient cyanophage communities) from four ocean and three lake locations, using high-throughput sequencing and a newly designed primer pair targeting a gene fragment (∼145-bp in length) encoding the cyanophage gp23 major capsid protein (MCP). Diverse viral communities were detected in all samples. The fragments of 142-, 145-, and 148-bp in length were most abundant in the amplicons, and most sequences (>92%) belonged to cyanophages. Additionally, different sequencing depths resulted in different diversity estimates of the viral community. Operational taxonomic units obtained from deep sequencing of the MCP gene covered the majority of those obtained from shallow sequencing, suggesting that deep sequencing exhibited a more complete picture of cyanophage community than shallow sequencing. Our results also revealed a wide geographic distribution of marine myocyanophages, i.e., higher dissimilarities of the myocyanophage communities corresponded with the larger distances between the sampling sites. Collectively, this study suggests that the newly designed primer pair can be effectively used to study the community and diversity of myocyanophage from different environments, and the high-throughput sequencing represents a good method to understand viral diversity.

Development of a combined canine distemper virus specific RT-PCR protocol for the differentiation of infected and vaccinated animals (DIVA) and genetic characterization of the hemagglutinin gene of seven Chinese strains demonstrated in dogs.

PubMed

Yi, Li; Cheng, Shipeng; Xu, Hongli; Wang, Jianke; Cheng, Yuening; Yang, Shen; Luo, Bin

2012-01-01

A combined reverse-transcription polymerase chain reaction (RT-PCR) method was developed for the detection and differentiation of wild-type and vaccine strains of the canine distemper virus (CDV). A pair of primers (P1/P2) was used to detect both CDV wild-type strains and vaccines. Another pair (P3/P4) was used to detect only CDV wild-type strains. A 335bp fragment was amplified from the genomic RNA of the vaccine and wild-type strains. A 555bp fragment was amplified specifically from the genomic RNA of the wild-type strains. No amplification was achieved for the uninfected cells, cells infected with canine parvovirus, canine coronavirus, or canine adenovirus. The combined RT-PCR method detected effectively and differentiated the CDV wild-type and vaccine strains by two separate RT-PCRs. The method can be used for clinical detection and epidemiological surveillance. The phylogenetic analysis of the hemagglutinin gene of the local wild-type CDV strains revealed that the seven local isolates all belonged to the Asia-1 lineage, and were clustered closely with one another at the same location. These results suggested that the CDV genotype Asia-1 is circulating currently in domestic dogs in China. Copyright © 2011 Elsevier B.V. All rights reserved.

High Diversity of Myocyanophage in Various Aquatic Environments Revealed by High-Throughput Sequencing of Major Capsid Protein Gene With a New Set of Primers

PubMed Central

Hou, Weiguo; Wang, Shang; Briggs, Brandon R.; Li, Gaoyuan; Xie, Wei; Dong, Hailiang

2018-01-01

Myocyanophages, a group of viruses infecting cyanobacteria, are abundant and play important roles in elemental cycling. Here we investigated the particle-associated viral communities retained on 0.2 μm filters and in sediment samples (representing ancient cyanophage communities) from four ocean and three lake locations, using high-throughput sequencing and a newly designed primer pair targeting a gene fragment (∼145-bp in length) encoding the cyanophage gp23 major capsid protein (MCP). Diverse viral communities were detected in all samples. The fragments of 142-, 145-, and 148-bp in length were most abundant in the amplicons, and most sequences (>92%) belonged to cyanophages. Additionally, different sequencing depths resulted in different diversity estimates of the viral community. Operational taxonomic units obtained from deep sequencing of the MCP gene covered the majority of those obtained from shallow sequencing, suggesting that deep sequencing exhibited a more complete picture of cyanophage community than shallow sequencing. Our results also revealed a wide geographic distribution of marine myocyanophages, i.e., higher dissimilarities of the myocyanophage communities corresponded with the larger distances between the sampling sites. Collectively, this study suggests that the newly designed primer pair can be effectively used to study the community and diversity of myocyanophage from different environments, and the high-throughput sequencing represents a good method to understand viral diversity.

Short-term blood pressure variability - variation between arm side, body position and successive measurements: a population-based cohort study.

PubMed

Lacruz, Maria Elena; Kluttig, Alexander; Kuss, Oliver; Tiller, Daniel; Medenwald, Daniel; Nuding, Sebastian; Greiser, Karin Halina; Frantz, Stefan; Haerting, Johannes

2017-01-18

Precise blood pressure (BP) measurements are central for the diagnosis of hypertension in clinical and epidemiological studies. The purpose of this study was to quantify the variability in BP associated with arm side, body position, and successive measurements in the setting of a population-based observational study. Additionally, we aimed to evaluate the influence of different measurement conditions on prevalence of hypertension. The sample included 967 men and 812 women aged 45 to 83 years at baseline. BP was measured according to a standardized protocol with oscillometric devices including three sitting measurements at left arm, one simultaneous supine measurement at both arms, and four supine measurements at the arm with the higher BP. Hypertension was defined as systolic BP (SBP) ≥140 mmHg and/or diastolic BP (DBP) ≥90 mmHg. Variability in SBP and DBP were analysed with sex-stratified linear covariance pattern models. We found that overall, no mean BP differences were measured according to arm-side, but substantial higher DBP and for men also higher SBP was observed in sitting than in supine position and there was a clear BP decline by consecutive measurement. Accordingly, the prevalence of hypertension depends strongly on the number and scheme of BP measurements taken to calculate the index values. Thus, BP measurements should only be compared between studies applying equal measurement conditions and index calculation. Moreover, the first BP measurement should not be used to define hypertension since it overestimates BP. The mean of second and third measurement offers the advantage of better reproducibility over single measurements.

Supercritical carbon dioxide-assisted rapid synthesis of few-layer black phosphorus for hydrogen peroxide sensing.

PubMed

Yan, Shancheng; Wang, Bojun; Wang, Zhulan; Hu, Dong; Xu, Xin; Wang, Junzhuan; Shi, Yi

2016-06-15

Solutions with large-scale dispersions of 2D black phosphorus (BP), often referred to as phosphorene, are obtained through solvent exfoliation. But, rapid phosphorene synthesis remains a challenge. Furthermore, although the chemical sensing capability of BP-based sensors has been theoretically predicted, its experimental verification remains lacking. In this study, we demonstrate the use of supercritical carbon dioxide-assisted rapid synthesis (5h) of few-layer BP. In addition, we construct a non-enzymatic hydrogen peroxide (H2O2) sensor based on few-layer BP for the first time to utilize BP degradation under ambient conditions. The proposed H2O2 sensor exhibits a considerably lower detection limit of 1 × 10(-7) M compared with the general detection limit of 1 × 10(-7) M-5 × 10(-5)M via electrochemical methods. Overall, the results of this study will not only expand the coverage of BP research but will also identify the important sensing characteristics of BP. Copyright © 2016 Elsevier B.V. All rights reserved.

The design, rationale, and baseline characteristics of a nationwide cohort registry in China: blood pressure and clinical outcome in TIA or ischemic stroke.

PubMed

Xu, Jie; Liu, Yi; Tao, Yongli; Xie, Xuewei; Gu, Hongqiu; Pan, Yuesong; Zhao, Xingquan; Wang, Yongjun; Yan, Aoshuang; Wang, Yilong

2016-01-01

The relationship between poststroke blood pressure (BP) and clinical outcomes in ischemic stroke (IS) is still controversial. However, there is no large BP database for IS or transient ischemic attack (TIA) in China. This study aims to describe the rationale, study design, and baseline characteristics of a nationwide BP database in IS or TIA patients in China. The BOSS (blood pressure and clinical outcome in TIA or ischemic stroke) study was a hospital-based, prospective cohort study aiming to assess BP parameters and clinical outcome in IS/TIA patients. BP parameters were based on office BP, ambulatory BP, and home BP. Clinical outcomes included stroke recurrence, combined vascular events, and disability. Electronic case-report forms were used to record baseline and follow-up data. The patients were followed up for clinical outcomes at 3 months through face-to-face interview and at 12 months by telephone. Between October 2012 and February 2014, the BOSS registry recruited 2,608 patients from 61 hospitals, with a mean age of 62.5 years, 32.4% of whom were female, 88.9% with an entry diagnosis of IS, and 86% diagnosed with hypertension. The rates of patients lost-to-follow-up were 3.1% at 3 months and 5.1% at 1 year; 93% of patients completed ambulatory BP monitoring during hospitalization and 94.7% finished a 3-month BP diary. The BOSS registry will provide important evidence about BP management in the acute phase and secondary prevention for IS/TIA patients.

Cloud-based BP system integrated with CPOE improves self-management of the hypertensive patients: A randomized controlled trial.

PubMed

Lee, Peisan; Liu, Ju-Chi; Hsieh, Ming-Hsiung; Hao, Wen-Rui; Tseng, Yuan-Teng; Liu, Shuen-Hsin; Lin, Yung-Kuo; Sung, Li-Chin; Huang, Jen-Hung; Yang, Hung-Yu; Ye, Jong-Shiuan; Zheng, He-Shun; Hsu, Min-Huei; Syed-Abdul, Shabbir; Lu, Richard; Nguyen, Phung-Anh; Iqbal, Usman; Huang, Chih-Wei; Jian, Wen-Shan; Li, Yu-Chuan Jack

2016-08-01

Less than 50% of patients with hypertensive disease manage to maintain their blood pressure (BP) within normal levels. The aim of this study is to evaluate whether cloud BP system integrated with computerized physician order entry (CPOE) can improve BP management as compared with traditional care. A randomized controlled trial done on a random sample of 382 adults recruited from 786 patients who had been diagnosed with hypertension and receiving treatment for hypertension in two district hospitals in the north of Taiwan. Physicians had access to cloud BP data from CPOE. Neither patients nor physicians were blinded to group assignment. The study was conducted over a period of seven months. At baseline, the enrollees were 50% male with a mean (SD) age of 58.18 (10.83) years. The mean sitting BP of both arms was no different. The proportion of patients with BP control at two, four and six months was significantly greater in the intervention group than in the control group. The average capture rates of blood pressure in the intervention group were also significantly higher than the control group in all three check-points. Cloud-based BP system integrated with CPOE at the point of care achieved better BP control compared to traditional care. This system does not require any technical skills and is therefore suitable for every age group. The praise and assurance to the patients from the physicians after reviewing the Cloud BP records positively reinforced both BP measuring and medication adherence behaviors. Copyright © 2016. Published by Elsevier Ireland Ltd.

Genome-wide profiles of CtBP link metabolism with genome stability and epithelial reprogramming in breast cancer.

PubMed

Di, Li-Jun; Byun, Jung S; Wong, Madeline M; Wakano, Clay; Taylor, Tara; Bilke, Sven; Baek, Songjoon; Hunter, Kent; Yang, Howard; Lee, Maxwell; Zvosec, Cecilia; Khramtsova, Galina; Cheng, Fan; Perou, Charles M; Miller, C Ryan; Raab, Rachel; Olopade, Olufunmilayo I; Gardner, Kevin

2013-01-01

The C-terminal binding protein (CtBP) is a NADH-dependent transcriptional repressor that links carbohydrate metabolism to epigenetic regulation by recruiting diverse histone-modifying complexes to chromatin. Here global profiling of CtBP in breast cancer cells reveals that it drives epithelial-to-mesenchymal transition, stem cell pathways and genome instability. CtBP expression induces mesenchymal and stem cell-like features, whereas CtBP depletion or caloric restriction reverses gene repression and increases DNA repair. Multiple members of the CtBP-targeted gene network are selectively downregulated in aggressive breast cancer subtypes. Differential expression of CtBP-targeted genes predicts poor clinical outcome in breast cancer patients, and elevated levels of CtBP in patient tumours predict shorter median survival. Finally, both CtBP promoter targeting and gene repression can be reversed by small molecule inhibition. These findings define broad roles for CtBP in breast cancer biology and suggest novel chromatin-based strategies for pharmacologic and metabolic intervention in cancer.

Evidence for an RNA pseudoknot loop-helix interaction essential for efficient -1 ribosomal frameshifting.

PubMed

Liphardt, J; Napthine, S; Kontos, H; Brierley, I

1999-05-07

RNA pseudoknots are structural elements that participate in a variety of biological processes. At -1 ribosomal frameshifting sites, several types of pseudoknot have been identified which differ in their organisation and functionality. The pseudoknot found in infectious bronchitis virus (IBV) is typical of those that possess a long stem 1 of 11-12 bp and a long loop 2 (30-164 nt). A second group of pseudoknots are distinguishable that contain stems of only 5 to 7 bp and shorter loops. The NMR structure of one such pseudoknot, that of mouse mammary tumor virus (MMTV), has revealed that it is kinked at the stem 1-stem 2 junction, and that this kinked conformation is essential for efficient frameshifting. We recently investigated the effect on frameshifting of modulating stem 1 length and stability in IBV-based pseudoknots, and found that a stem 1 with at least 11 bp was needed for efficient frameshifting. Here, we describe the sequence manipulations that are necessary to bypass the requirement for an 11 bp stem 1 and to convert a short non-functional IBV-derived pseudoknot into a highly efficient, kinked frameshifter pseudoknot. Simple insertion of an adenine residue at the stem 1-stem 2 junction (an essential feature of a kinked pseudoknot) was not sufficient to create a functional pseudoknot. An additional change was needed: efficient frameshifting was recovered only when the last nucleotide of loop 2 was changed from a G to an A. The requirement for an A at the end of loop 2 is consistent with a loop-helix contact similar to those described in other RNA tertiary structures. A mutational analysis of both partners of the proposed interaction, the loop 2 terminal adenine residue and two G.C pairs near the top of stem 1, revealed that the interaction was essential for efficient frameshifting. The specific requirement for a 3'-terminal A residue was lost when loop 2 was increased from 8 to 14 nt, suggesting that the loop-helix contact may be required only in those pseudoknots with a short loop 2. Copyright 1999 Academic Press.

On the connection between inherent DNA flexure and preferred binding of hydroxymethyluracil-containing DNA by the type II DNA-binding protein TF1.

PubMed

Grove, A; Galeone, A; Mayol, L; Geiduschek, E P

1996-07-12

TF1 is a member of the family of type II DNA-binding proteins, which also includes the bacterial HU proteins and the Escherichia coli integration host factor (IHF). Distinctive to TF1, which is encoded by the Bacillus subtilis bacteriophage SPO1, is its preferential binding to DNA in which thymine is replaced by 5-hydroxymethyluracil (hmU), as it is in the phage genome. TF1 binds to preferred sites within the phage genome and generates pronounced DNA bending. The extent to which DNA flexibility contributes to the sequence-specific binding of TF1, and the connection between hmU preference and DNA flexibility has been examined. Model flexible sites, consisting of consecutive mismatches, increase the affinity of thymine-containing DNA for TF1. In particular, tandem mismatches separated by nine base-pairs generate an increase, by orders of magnitude, in the affinity of TF1 for T-containing DNA with the sequence of a preferred TF1 binding site, and fully match the affinity of TF1 for this cognate site in hmU-containing DNA (Kd approximately 3 nM). Other placements of loops generate suboptimal binding. This is consistent with a significant contribution of site-specific DNA flexibility to complex formation. Analysis of complexes with hmU-DNA of decreasing length shows that a major part of the binding affinity is generated within a central 19 bp segment (delta G0 = 41.7 kJ mol-1) with more-distal DNA contributing modestly to the affinity (delta delta G = -0.42 kJ mol-1 bp-1 on increasing duplex length to 37 bp). However, a previously characterised thermostable and more tightly binding mutant TF1, TF1(E15G/T32I), derives most of its extra affinity from interaction with flanking DNA. We propose that inherent but sequence-dependent deformability of hmU-containing DNA underlies the preferential binding of TF1 and that TF1-induced DNA bendings is a result of distortions at two distinct sites separated by 9 bp of duplex DNA.

Molecular and functional roles of 6C CC chemokine 19 in defense system of striped murrel Channa striatus.

PubMed

Arockiaraj, Jesu; Bhatt, Prasanth; Harikrishnan, Ramasamy; Arasu, Mariadhas Valan; Al-Dhabi, Naif Abdullah

2015-08-01

In this study, we have reported the molecular information of chemokine-19 (Chem19) from striped murrel Channa striatus (Cs). CsCC-Chem19 cDNA sequence was 555 base pair (bp) in length which is 68bp 5' untranslated region (UTR), 339bp translated region and 149bp 3' UTR. The translated region is encoded for a polypeptide of 112 amino acids. CsCC-Chem19 peptide contains a signal sequence between 1 and 26 and an interleukin (IL) 8 like domain between 24 and 89. The multiple sequence alignment showed a 'DCCL' motif, an indispensable motif present in all CC chemokines which was conserved throughout the evolution. Phylogenetic tree showed that CsCC-Chem19 formed a cluster with chemokine 19 from fishes. Secondary structure of CsCC-Chem19 revealed that the peptide contains maximum amount of coils (61.6%) compared to α-helices (25.9%%) and β-sheet (12.5%). Further, 3D analysis indicated that the cysteine residues at 33, 34, 59 and 75 making the disulfide bridges as 33 = 59 and 34 = 75. Significantly (P < 0.05) highest CsCC-Chem19 mRNA expression was observed in blood and it was up-regulated upon fungus and bacterial infection. Utilizing the coding region of CsCC-Chem19, recombinant CsCC-Chem19 protein was produced. The recombinant CsCC-Chem19 protein induced the cellular proliferation and respiratory burst activity of C. striatus peripheral blood leukocytes (PBL) in a concentration dependent manner. Moreover, the chemotactic activity showed that the recombinant CsCC-Chem19 significantly (P < 0.05) enhanced the movement of PBL of C. striatus. Conclusively, CsCC-Chem19 is a 6C CC chemokine having an ability to perform both inflammatory and homeostatic functions. However, further research is necessary to understand the potential of 6C CC chemokine 19 of C. striatus, particularly their regulatory ability on different cellular components in the defense system. Copyright © 2015 Elsevier Ltd. All rights reserved.

A Ribeiroia spp. (Class: Trematoda) - Specific PCR-based diagnostic

USGS Publications Warehouse

Reinitz, David M.; Yoshino, T.P.; Cole, Rebecca A.

2007-01-01

Increased reporting of amphibian malformations in North America has been noted with concern in light of reports that amphibian numbers and species are declining worldwide. Ribeiroia ondatrae has been shown to cause a variety of types of malformations in amphibians. However, little is known about the prevalence of R. ondatrae in North America. To aid in conducting field studies of Ribeiroia spp., we have developed a polymerase chain reaction (PCR)-based diagnostic. Herein, we describe the development of an accurate, rapid, simple, and cost-effective diagnostic for detection of Ribeiroia spp. infection in snails (Planorbella trivolvis). Candidate oligonucleotide primers for PCR were designed via DNA sequence analyses of multiple ribosomal internal transcribed spacer-2 regions from Ribeiroia spp. and Echinostoma spp. Comparison of consensus sequences determined from both genera identified areas of sequence potentially unique to Ribeiroia spp. The PCR reliably produced a diagnostic 290-base pair (bp) product in the presence of a wide concentration range of snail or frog DNA. Sensitivity was examined with DNA extracted from single R. ondatrae cercaria. The single-tube PCR could routinely detect less than 1 cercariae equivalent, because DNA isolated from a single cercaria could be diluted at least 1:50 and still yield a positive result via gel electrophoresis. An even more sensitive nested PCR also was developed that routinely detected 100 fg of the 290-bp fragment. The assay did not detect furcocercous cercariae of certain Schistosomatidae, Echinostoma sp., or Sphaeridiotrema globulus nor adults of Clinostomum sp. or Cyathocotyle bushiensis. Field testing of 137 P. trivolvis identified 3 positives with no overt environmental cross-reactivity, and results concurred with microscopic examinations in all cases. ?? American Society of Parasitologists 2007.

Transcriptome analysis of Kuruma shrimp (Marsupenaeus japonicus) hepatopancreas in response to white spot syndrome virus (WSSV) under experimental infection.

PubMed

Zhong, Shengping; Mao, Yong; Wang, Jun; Liu, Min; Zhang, Man; Su, Yongquan

2017-11-01

Kuruma shrimp (Marsupenaeus japonicus) is one of the most valuable crustacean species in capture fisheries and mariculture in the Indo-West Pacific. White spot syndrome virus (WSSV) is a highly virulent pathogen which has seriously threatened Kuruma shrimp aquaculture sector. However, little information is available in relation to underlying mechanisms of host-virus interaction in Kuruma shrimp. In this study, we performed a transcriptome analysis from the hepatopancreas of Kuruma shrimp challenged by WSSV, using Illumina-based RNA-Seq. A total of 39,084,942 pair end (PE) reads, including 19,566,190 reads from WSSV-infected group and 19,518,752 reads from non-infected (control) group, were obtained and assembled into 33,215 unigenes with an average length of 503.7 bp and N50 of 601 bp. Approximately 17,000 unigenes were predicted and classified based on homology search, gene ontology, clusters of orthologous groups of proteins, and biological pathway mapping. Differentially expressed genes (DEGs), including 2150 up-regulated and 1931 down-regulated, were found. Among those, 805 DEGs were identified and categorized into 14 groups based on their possible functions. Many genes associated with JAK-STAT signaling pathways, Integrin-mediated signal transduction, Ras signaling pathways, apoptosis and phagocytosis were positively modified after WSSV challenge. The proteolytic cascades including Complement-like activation and Hemolymph coagulations likely participated in antiviral immune response. The transcriptome data from hepatopancreas of Kuruma shrimp under WSSV challenge provided comprehensive information for identifying novel immune related genes in this valuable crustacean species despite the absence of the genome database of crustaceans. Copyright © 2017 Elsevier Ltd. All rights reserved.

Estimating EQ-5D values from the Oswestry Disability Index and numeric rating scales for back and leg pain.

PubMed

Carreon, Leah Y; Bratcher, Kelly R; Das, Nandita; Nienhuis, Jacob B; Glassman, Steven D

2014-04-15

Cross-sectional cohort. The purpose of this study is to determine whether the EuroQOL-5D (EQ-5D) can be derived from commonly available low back disease-specific health-related quality of life measures. The Oswestry Disability Index (ODI) and numeric rating scales (0-10) for back pain (BP) and leg pain (LP) are widely used disease-specific measures in patients with lumbar degenerative disorders. Increasingly, the EQ-5D is being used as a measure of utility due to ease of administration and scoring. The EQ-5D, ODI, BP, and LP were prospectively collected in 14,544 patients seen in clinic for lumbar degenerative disorders. Pearson correlation coefficients for paired observations from multiple time points between ODI, BP, LP, and EQ-5D were determined. Regression modeling was done to compute the EQ-5D score from the ODI, BP, and LP. The mean age was 53.3 ± 16.4 years and 41% were male. Correlations between the EQ-5D and the ODI, BP, and LP were statistically significant (P < 0.0001) with correlation coefficients of -0.77, -0.50, and -0.57, respectively. The regression equation: [0.97711 + (-0.00687 × ODI) + (-0.01488 × LP) + (-0.01008 × BP)] to predict EQ-5D, had an R2 of 0.61 and a root mean square error of 0.149. The model using ODI alone had an R2 of 0.57 and a root mean square error of 0.156. The model using the individual ODI items had an R2 of 0.64 and a root mean square error of 0.143. The correlation coefficient between the observed and estimated EQ-5D score was 0.78. There was no statistically significant difference between the actual EQ-5D (0.553 ± 0.238) and the estimated EQ-5D score (0.553 ± 0.186) using the ODI, BP, and LP regression model. However, rounding off the coefficients to less than 5 decimal places produced less accurate results. Unlike previous studies showing a robust relationship between low back-specific measures and the Short Form-6D, a similar relationship was not seen between the ODI, BP, LP, and the EQ-5D. Thus, the EQ-5D cannot be accurately estimated from the ODI, BP, and LP. 2.

Sequence Variation in the Small-Subunit rRNA Gene of Plasmodium malariae and Prevalence of Isolates with the Variant Sequence in Sichuan, China

PubMed Central

Liu, Qing; Zhu, Shenghua; Mizuno, Sahoko; Kimura, Masatsugu; Liu, Peina; Isomura, Shin; Wang, Xingzhen; Kawamoto, Fumihiko

1998-01-01

By two PCR-based diagnostic methods, Plasmodium malariae infections have been rediscovered at two foci in the Sichuan province of China, a region where no cases of P. malariae have been officially reported for the last 2 decades. In addition, a variant form of P. malariae which has a deletion of 19 bp and seven substitutions of base pairs in the target sequence of the small-subunit (SSU) rRNA gene was detected with high frequency. Alignment analysis of Plasmodium sp. SSU rRNA gene sequences revealed that the 5′ region of the variant sequence is identical to that of P. vivax or P. knowlesi and its 3′ region is identical to that of P. malariae. The same sequence variations were also found in P. malariae isolates collected along the Thai-Myanmar border, suggesting a wide distribution of this variant form from southern China to Southeast Asia. PMID:9774600

Identification of antisense nucleic acid hybridization sites in mRNA molecules with self-quenching fluorescent reporter molecules

PubMed Central

Gifford, Lida K.; Opalinska, Joanna B.; Jordan, David; Pattanayak, Vikram; Greenham, Paul; Kalota, Anna; Robbins, Michelle; Vernovsky, Kathy; Rodriguez, Lesbeth C.; Do, Bao T.; Lu, Ponzy; Gewirtz, Alan M.

2005-01-01

We describe a physical mRNA mapping strategy employing fluorescent self-quenching reporter molecules (SQRMs) that facilitates the identification of mRNA sequence accessible for hybridization with antisense nucleic acids in vitro and in vivo, real time. SQRMs are 20–30 base oligodeoxynucleotides with 5–6 bp complementary ends to which a 5′ fluorophore and 3′ quenching group are attached. Alone, the SQRM complementary ends form a stem that holds the fluorophore and quencher in contact. When the SQRM forms base pairs with its target, the structure separates the fluorophore from the quencher. This event can be reported by fluorescence emission when the fluorophore is excited. The stem–loop of the SQRM suggests that SQRM be made to target natural stem–loop structures formed during mRNA synthesis. The general utility of this method is demonstrated by SQRM identification of targetable sequence within c-myb and bcl-6 mRNA. Corresponding antisense oligonucleotides reduce these gene products in cells. PMID:15718294

Rice Domestication Revealed by Reduced Shattering of Archaeological rice from the Lower Yangtze valley

NASA Astrophysics Data System (ADS)

Zheng, Yunfei; Crawford, Gary W.; Jiang, Leping; Chen, Xugao

2016-06-01

Plant remains dating to between 9000 and 8400 BP from a probable ditch structure at the Huxi site include the oldest rice (Oryza sativa) spikelet bases and associated plant remains recovered in China. The remains document an early stage of rice domestication and the ecological setting in which early cultivation was taking place. The rice spikelet bases from Huxi include wild (shattering), intermediate, and domesticated (non-shattering) forms. The relative frequency of intermediate and non-shattering spikelet bases indicates that selection for, at the very least, non-shattering rice was underway at Huxi. The rice also has characteristics of japonica rice (Oryza sativa subsp. japonica), helping to clarify the emergence of a significant lineage of the crop. Seeds, phytoliths and their context provide evidence of increasing anthropogenesis and cultivation during the occupation. Rice spikelet bases from Kuahuqiao (8000-7700 BP), Tianluoshan (7000-6500 BP), Majiabang (6300-6000 BP), and Liangzhu (5300-4300 BP) sites indicate that rice underwent continuing selection for reduced shattering and japonica rice characteristics, confirming a prolonged domestication process for rice.

Candesartan versus imidapril in hypertension: a randomised study to assess effects of anti-AT1 receptor autoantibodies.

PubMed

Wei, Fen; Jia, Xiu-Jie; Yu, Su-Qin; Gu, Ye; Wang, Li; Guo, Xiao-Mei; Wang, Min; Zhu, Feng; Cheng, Xiang; Wei, Yu-Miao; Zhou, Zi-Hua; Fu, Micheal; Liao, Yu-Hua

2011-03-01

Anti-angiotensin II receptor subtype 1 (AT1 receptor) autoantibodies have previously been shown in sera of hypertensive patients. This study assessed whether anti-AT1-receptor autoantibody in serum is correlated with the efficacy of an AT1-receptor blocker (ARB; candesartan)-based regimen in hypertensive patients after 8 weeks of treatment. The Study of Optimal Treatment in Hypertensive Patients with Anti-AT1-Receptor Autoantibodies is a multicentre, randomised, blinded endpoint, open-label, parallel-group comparison clinical trial conducted in five centres in Wuhan, China. Treatment is designed as stepwise added-on therapy to reduce blood pressure (BP) < 140/90 mm Hg. 512 patients with moderate to severe primary hypertension were randomly assigned to an 8-week treatment with either ARB (candesartan)-based regimen (n=257) or ACE inhibitor (imidapril)-based regimen (n=255). Systolic and diastolic BP was reduced significantly in both treatment groups. The candesartan-based regimen achieved a significantly greater systolic BP reduction than imdapril (30.8 ± 10.3 vs 28.8 ± 10.3 mm Hg, p = 0.023). In those anti-AT1 receptor autoantibody-positive hypertensive patients, the mean systolic BP at baseline was higher than in the anti-AT1 receptor autoantibody-negative group (160.5 ± 16.5 vs 156.2 ± 17.7 mm Hg; p = 0.006). The mean BP reduction was greater in the candesartan-based regimen than the imidapril-based regimen (-35.4 ± 9.8/16.9 ± 6.9 vs -29.4 ± 9.8/14.2 ± 6.9 mm Hg; p = 0.000 and 0.002, respectively), and more patients on imidapril required add-on medications to achieve BP control (94% vs 86%; p=0.03). No correlation was observed between the titre of anti-AT1 receptor autoantibody and the efficacy of candesartan-based therapy. In those anti-AT1 receptor autoantibody-negative patients similar BP lowering was reached in the candesartan and the imidapril-based regimens. An ARB-based regimen is more effective in BP lowering than an ACE inhibitor-based regimen in the presence of anti-AT1 receptor autoantibodies. Trial registration number This trial has been registered at http://www.register.clinicaltrials.gov/ (identifier: NCT00360763).

Prevalence of pseudoresistant hypertension due to inaccurate blood pressure measurement

PubMed Central

Bhatt, Hemal; Siddiqui, Mohammed; Judd, Eric; Oparil, Suzanne; Calhoun, David

2016-01-01

Background The prevalence of pseudoresistant hypertension (HTN) due to inaccurate BP measurement remains unknown. Methods Triage BP measurements and measurements obtained at the same clinic visit by trained physicians were compared in consecutive adult patients referred for uncontrolled resistant HTN (RHTN). Triage BP measurements were taken by the clinic staff during normal intake procedures. BP measurements were obtained by trained physicians using the BpTRU device. The prevalence of uncontrolled RHTN and differences in BP measurements were compared. Results Of 130 patients with uncontrolled RHTN, 33.1% (n=43) were falsely identified as having uncontrolled RHTN based on triage BP measurements. The median (IQR) of differences in systolic BP between pseudoresistant and true resistant groups were 23 (17 – 33) mm Hg and 13 (6 – 21) mm Hg, respectively (P=0.0001). The median (IQR) of differences in diastolic BP between the two groups were 12 (7 – 18) mm Hg and 8 (4 – 11) mm Hg, respectively (P=0.001). Conclusion Triage BP technique overestimated the prevalence of uncontrolled RHTN in approximately 33% of the patients emphasizing the importance of obtaining accurate BP measurements. PMID:27129931

An assessment of discriminatory power of office blood pressure measurements in predicting optimal ambulatory blood pressure control in people with type 2 diabetes.

PubMed

Kengne, Andre Pascal; Libend, Christelle Nong; Dzudie, Anastase; Menanga, Alain; Dehayem, Mesmin Yefou; Kingue, Samuel; Sobngwi, Eugene

2014-01-01

Ambulatory blood pressure (BP) measurements (ABPM) predict health outcomes better than office BP, and are recommended for assessing BP control, particularly in high-risk patients. We assessed the performance of office BP in predicting optimal ambulatory BP control in sub-Saharan Africans with type 2 diabetes (T2DM). Participants were a random sample of 51 T2DM patients (25 men) drug-treated for hypertension, receiving care in a referral diabetes clinic in Yaounde, Cameroon. A quality control group included 46 non-diabetic individuals with hypertension. Targets for BP control were systolic (and diastolic) BP. Mean age of diabetic participants was 60 years (standard deviation: 10) and median duration of diabetes was 6 years (min-max: 0-29). Correlation coefficients between each office-based variable and the 24-h ABPM equivalent (diabetic vs. non-diabetic participants) were 0.571 and 0.601 for systolic (SBP), 0.520 and 0.539 for diastolic (DBP), 0.631 and 0.549 for pulse pressure (PP), and 0.522 and 0.583 for mean arterial pressure (MAP). The c-statistic for the prediction of optimal ambulatory control from office-BP in diabetic participants was 0.717 for SBP, 0.494 for DBP, 0.712 for PP, 0.582 for MAP, and 0.721 for either SBP + DBP or PP + MAP. Equivalents in diabetes-free participants were 0.805, 0.763, 0.695, 0.801 and 0.813. Office DBP was ineffective in discriminating optimal ambulatory BP control in diabetic patients, and did not improve predictions based on office SBP alone. Targeting ABPM to those T2DM patients who are already at optimal office-based SBP would likely be more cost effective in this setting.

Identification of chromosomal locations associated with tail biting and being a victim of tail-biting behaviour in the domestic pig (Sus scrofa domesticus).

PubMed

Wilson, Kaitlin; Zanella, Ricardo; Ventura, Carlos; Johansen, Hanne Lind; Framstad, Tore; Janczak, Andrew; Zanella, Adroaldo J; Neibergs, Holly Louise

2012-11-01

The objective of this study was to identify loci associated with tail biting or being a victim of tail biting in Norwegian crossbred pigs using a genome-wide association study with PLINK case-control analysis. DNA was extracted from hair or blood samples collected from 98 trios of crossbred pigs located across Norway. Each trio came from the same pen and consisted of one pig observed to initiate tail biting, one pig which was the victim of tail biting and a control pig which was not involved in either behaviour. DNA was genotyped using the Illumina PorcineSNP60 BeadChip whole-genome single-nucleotide polymorphism (SNP) assay. After quality assurance filtering, 53,952 SNPs remained comprising 74 animals (37 pairs) for the tail biter versus control comparison and 53,419 SNPs remained comprising 80 animals (40 pairs) for the victim of tail biting versus control comparison. An association with being a tail biter was observed on Sus scrofa chromosome 16 (SSC16; p = 1.6 × 10(-5)) and an unassigned chromosome (p = 3.9 × 10(-5)). An association with being the victim of tail biting was observed on Sus scrofa chromosomes 1 (SSC1; p = 4.7 × 10(-5)), 9 (SSC9; p = 3.9 × 10(-5)), 18 (SSC18; p = 7 × 10(-5) for 9,602,511 bp, p = 3.4 × 10(-5) for 9,653,881 bp and p = 5.3 × 10(-5) for 29,577,783 bp) and an unassigned chromosome (p = 6.1 × 10(-5)). An r(2) = 0.96 and a D' = 1 between the two SNPs at 9 Mb on SSC18 indicated extremely high linkage disequilibrium, suggesting that these two markers represent a single locus. These results provide evidence of a moderate genetic association between the propensity to participate in tail-biting behaviour and the likelihood of becoming a victim of this behaviour.

Office and 24-h ambulatory blood pressure control by treatment in general practice: the 'Monitoraggio della pressione ARteriosa nella medicina TErritoriale' study.

PubMed

Zaninelli, Augusto; Parati, Gianfranco; Cricelli, Claudio; Bignamini, Angelo A; Modesti, Pietro A; Pamparana, Franco; Bilo, Grzegorz; Mancia, Giuseppe; Gensini, Gian F

2010-05-01

Guidelines recommend that blood pressure (BP) should be lowered in hypertensive patients to prevent cardiovascular accidents. Management of antihypertensive treatment by general practitioners is usually based on office measurements, which may not allow an assessment of BP control over 24 h, which requires ambulatory BP monitoring (ABPM) to be implemented. This is rarely done in general practice, and limited information is available on the consistency between the evaluations of the response to treatment provided by office measurement and by ABPM in this setting. To assess concordance between office BP measurements and ABPM-based estimates of hypertension control in a general practice setting. Prospective, comparative between techniques. General practice. Seventy-eight general practices, representative of all Italian regions, participated in this study by recruiting sequential hypertensive adults on stabilized treatment, who were subdivided into even groups with office BP, respectively, controlled or noncontrolled by treatment. In each individual, ABPM was applied by the general practitioner after appropriate training, and 24-h ABP values were defined as controlled or not according to current guidelines. Concordance between office and ABPM evaluation of BP control was assessed with kappa statistics. Positive and negative predictive values of office measurement versus ABPM were estimated. Between July 2005 and November 2006, 190 general practitioners recruited 2059 hypertensive patients based on office BP measurements; in 1728 patients, a 24-h ABPM was performed, yielding 1524 recordings considered as valid for further analysis. The agreement between the assessment of BP control by office measurement and by ABPM was poor (kappa = 0.120), with office measurements showing a satisfactory positive predictive value (0.842) and a poor negative predictive value (0.278); the situation was worse in patients with three or more among the following features: male sex, age of at least 65 years, alcohol consumption, diabetes, and obesity (negative predictive value = 0.149). In general practice, the agreement between assessment of BP control by treatment provided by office and ambulatory BP measurements is better in patients of 'uncontrolled' office BP than in 'controlled' office BP patients. This emphasizes the need for the larger use of out-of-office BP monitoring in a general practice setting, in particular, in patients considered as 'controlled' during consultation.

ELECTRONIC STRUCTURE AND LINEAR OPTICAL PROPERTIES OF MIXED ALKALI-METAL BOROPHOSPHATES (LiK2BP2O8, Li3K2BP4O14): A FIRST-PRINCIPLES STUDY

NASA Astrophysics Data System (ADS)

Zhang, Bei; Jing, Qun; Yang, Zhihua; Wang, Ying; Su, Xin; Pan, Shilie; Zhang, Jun

2013-07-01

LiK2BP2O8 and Li3K2BP4O14 are synthesized by high-temperature solution method with the same elements, while contain different fundamental building units. Li3K2BP4O14 is a novel P-O-P linking structure which gives a rare example of violation of Pauling's fourth rule. The electronic structures of LiK2BP2O8 and Li3K2BP4O14 are investigated by density functional calculations. Direct gaps of 5.038 eV (LiK2BP2O8) and 5.487 eV (Li3K2BP4O14) are obtained. By analyzing the density of states (DOS) of LiK2BP2O8 and Li3K2BP4O14, the P-O-P linking in fundamental building units of Li3K2BP4O14 crystal is proved theoretically. Based on the electronic properties, the linear optical information is captured.

A New Cuffless Device for Measuring Blood Pressure: A Real-Life Validation Study.

PubMed

Schoot, Tessa S; Weenk, Mariska; van de Belt, Tom H; Engelen, Lucien J L P G; van Goor, Harry; Bredie, Sebastian J H

2016-05-05

Cuffless blood pressure (BP) monitoring devices, based on pulse transit time, are being developed as an easy-to-use, more convenient, fast, and relatively cheap alternative to conventional BP measuring devices based on cuff occlusion. Thereby they may provide a great alternative to BP self-measurement. The objective of our study was to evaluate the performance of the first release of the Checkme Health Monitor (Viatom Technology), a cuffless BP monitor, in a real-life setting. Furthermore, we wanted to investigate whether the posture of the volunteer and the position of the device relative to the heart level would influence its outcomes. Study volunteers fell into 3 BP ranges: high (>160 mmHg), normal (130-160 mmHg), and low (<130 mmHg). All requirements for test environment, observer qualification, volunteer recruitment, and BP measurements were met according to the European Society of Hypertension International Protocol (ESH-IP) for the validation of BP measurement devices. After calibrating the Checkme device, we measured systolic BP with Checkme and a validated, oscillometric reference BP monitor (RM). Measurements were performed in randomized order both in supine and in sitting position, and with Checkme at and above heart level. We recruited 52 volunteers, of whom we excluded 15 (12 due to calibration failure with Checkme, 3 due to a variety of reasons). The remaining 37 volunteers were divided into low (n=14), medium (n=13), and high (n=10) BP ranges. There were 18 men and 19 women, with a mean age of 54.1 (SD 14.5) years, and mean recruitment systolic BP of 141.7 (SD 24.7) mmHg. BP results obtained by RM and Checkme correlated well. In the supine position, the difference between the RM and Checkme was >5 mmHg in 17 of 37 volunteers (46%), of whom 9 of 37 (24%) had a difference >10 mmHg and 5 of 37 (14%) had a difference >15 mmHg. BP obtained with Checkme correlated well with RM BP, particularly in the position (supine) in which the device was calibrated. These preliminary results are promising for conducting further research on cuffless BP measurement in the clinical and outpatient settings.

Functional analysis of coordinated cleavage in V(D)J recombination.

PubMed

Kim, D R; Oettinger, M A

1998-08-01

V(D)J recombination in vivo requires a pair of signals with distinct spacer elements of 12 and 23 bp that separate conserved heptamer and nonamer motifs. Cleavage in vitro by the RAG1 and RAG2 proteins can occur at individual signals when the reaction buffer contains Mn2+, but cleavage is restricted to substrates containing two signals when Mg2+ is the divalent cation. By using a novel V(D)J cleavage substrate, we show that while the RAG proteins alone establish a moderate preference for a 12/23 pair versus a 12/12 pair, a much stricter dependence of cleavage on the 12/23 signal pair is produced by the inclusion of HMG1 and competitor double-stranded DNA. The competitor DNA serves to inhibit the cleavage of substrates carrying a 12/12 or 23/23 pair, as well as the cutting at individual signals in 12/23 substrates. We show that a 23/33 pair is more efficiently recombined than a 12/33 pair, suggesting that the 12/23 rule can be generalized to a requirement for spacers that differ from each other by a single helical turn. Furthermore, we suggest that a fixed spatial orientation of signals is required for cleavage. In general, the same signal variants that can be cleaved singly can function under conditions in which a signal pair is required. However, a chemically modified substrate with one noncleavable signal enables us to show that formation of a functional cleavage complex is mechanistically separable from the cleavage reaction itself and that although cleavage requires a pair of signals, cutting does not have to occur simultaneously at both. The implications of these results are discussed with respect to the mechanism of V(D)J recombination and the generation of chromosomal translocations.

Sequence-dependent nanometer-scale conformational dynamics of individual RecBCD–DNA complexes

PubMed Central

Carter, Ashley R.; Seaberg, Maasa H.; Fan, Hsiu-Fang; Sun, Gang; Wilds, Christopher J.; Li, Hung-Wen; Perkins, Thomas T.

2016-01-01

RecBCD is a multifunctional enzyme that possesses both helicase and nuclease activities. To gain insight into the mechanism of its helicase function, RecBCD unwinding at low adenosine triphosphate (ATP) (2–4 μM) was measured using an optical-trapping assay featuring 1 base-pair (bp) precision. Instead of uniformly sized steps, we observed forward motion convolved with rapid, large-scale (∼4 bp) variations in DNA length. We interpret this motion as conformational dynamics of the RecBCD–DNA complex in an unwinding-competent state, arising, in part, by an enzyme-induced, back-and-forth motion relative to the dsDNA that opens and closes the duplex. Five observations support this interpretation. First, these dynamics were present in the absence of ATP. Second, the onset of the dynamics was coupled to RecBCD entering into an unwinding-competent state that required a sufficiently long 5′ strand to engage the RecD helicase. Third, the dynamics were modulated by the GC-content of the dsDNA. Fourth, the dynamics were suppressed by an engineered interstrand cross-link in the dsDNA that prevented unwinding. Finally, these dynamics were suppressed by binding of a specific non-hydrolyzable ATP analog. Collectively, these observations show that during unwinding, RecBCD binds to DNA in a dynamic mode that is modulated by the nucleotide state of the ATP-binding pocket. PMID:27220465

[Effect of an on-line health promotion program connected with a hospital health examination center on health promotion behavior and health status].

PubMed

Park, Jeong Sook; Kwon, Sang Min

2008-06-01

The purpose of this study was to evaluate the effect of an On-line health promotion program connected with a hospital health examination center. Based on contents developed, the www.kmwellbeing.com homepage was developed. The research design was a one group pretest-posttest design. Seventy-three clients participated in this study. The data were collected from January 3 to June 30, 2005. As a way of utilizing the homepage, this paper attempted to measure the change of pre and post program health promotion behavior and health status (perceived health status, objective health index-blood pressure, pulse, total cholesterol, blood sugar, waist flexibility, grip strength and lower extremity strength). Data were analyzed by descriptive statistics and paired t-test with the SPSS/Win 12.0 program. There were significant differences of perceived health status, systolic BP, waist flexibility and grip strength. However, there were no significant differences in health promotion behavior, diastolic BP, pulse, lower extremity strength, blood sugar and total cholesterol between pre program and post program. It is expected that an on-line health promotion program connected with a hospital health examination center will provide an effective learning media for health education and partially contribute to client's health promotion. A strategy, however, is needed to facilitate the continuous use of the on-line health promotion program for adult clients.

Molecular characterization of three common olive (Olea europaea L.) cultivars in Palestine, using simple sequence repeat (SSR) markers.

PubMed

Obaid, Ramiz; Abu-Qaoud, Hassan; Arafeh, Rami

2014-09-03

Eight accessions of olive trees from three common varieties in Palestine, Nabali Baladi, Nabali Mohassan and Surri, were genetically evaluated using five simple sequence repeat (SSR) markers. A total of 17 alleles from 5 loci were observed in which 15 (88.2%) were polymorphic and 2 (11.8%) were monomorphic. An average of 3.4 alleles per locus was found ranging from 2.0 alleles with the primers GAPU-103 and DCA-9 to 5.0 alleles with U9932 and DCA-16. The smallest amplicon size observed was 50 bp with the primer DCA-16, whereas the largest one (450 bp) with the primer U9932. Cluster analysis with the unweighted pair group method with arithmetic average (UPGMA) showed three clusters: a cluster with four accessions from the 'Nabali Baladi' cultivar, another cluster with three accessions that represents the 'Nabali Mohassen' cultivar and finally the 'Surri' cultivar. The similarity coefficient for the eight olive tree samples ranged from a maximum of 100% between two accessions from Nabali Baladi and also in two other samples from Nabali Mohassan, to a minimum similarity coefficient (0.315) between the Surri and two Nabali Baladi accessions. The results in this investigation clearly highlight the genetic dissimilarity between the three main olive cultivars that have been misidentified and mixed up in the past, based on conventional morphological characters.

Primary structure of stanniocalcin in two basal Actinopterygii.

PubMed

Amemiya, Yutaka; Youson, John H

2004-01-15

The primary structure of stanniocalcin (STC), the principal product of the corpuscles of Stannius (CS) in ray-finned fishes, was deduced from STC cDNA clones for two species of holostean, the gar, Lepisosteus osseus and the bowfin, Amia calva. Overlapping partial cDNA clones were amplified by polymerase chain reaction (PCR) from single-strand cDNA of the CS. Excluding the poly(A) tail, the cDNAs of 1863 base pairs [bp] (gar) and 914 bp (bowfin) contained the 5' untranslated region followed by the coding region and the 3' untranslated region. Both the gar and bowfin STC cDNA encode a prehormone of 252 amino acids (aa) with a signal peptide of 32 aa and a mature protein of 220 aa. The deduced aa sequence of gar STC shows 87% identity with bowfin STC, 60-72% identity with most vertebrate STCs and 26% identity with mouse STC2. Phylogenetic analysis of the sequences support a view that the gar and bowfin form a monophyletic holostean clade. RT-PCR revealed in the gar and bowfin that, just as in mammals and rainbow trout, the expression of STC mRNA is widely spread in many tissues and organs. Since the gar and bowfin are representatives of the most ancient fishes known to possess CS, the corpuscular-derived STC molecule in fish has had a conserved evolution.

Fetal HLA-G alleles and their effect on miscarriage.

PubMed

Koc, Altug; Kirbiyik, Ozgur; Kutbay, Yasar B; Ozyilmaz, Berk; Ozdemir, Taha R; Kaya, Ozge Ozer; Kubat, Gozde; Koc, Zeynep Peker

2018-05-29

Immunosuppression at the feto-maternal interface is crucial for a successful pregnancy outcome. Human leukocyte antigen-G (HLA-G) seems to be a major contributor to fetal tolerance. The HLA-G expression is seen in cytotrophoblasts and in maternal blood. Fetal HLA-G acts on decidual antigen-presenting cells (APCs), natural killers (NKs) and T cells. Recent findings revealed that defects in placentation and their consequences are associated with maternal HLA-G variants and their expression levels. The objective of this article is to investigate the relationship between fetal HLA-G alleles and miscarriage, which has not been investigated to date. The present study includes 204 recurrent miscarriage (RM) cases who were admitted to our clinic between 2012 and 2016. Twenty-eight miscarriage products without maternal cell contamination and any known pathology were analyzed by HLA-G typing. In addition, 3' untranslated region (UTR) 14-base pair (bp) insertion/deletion polymorphism was also investigated by Sanger sequencing. For our population, the most frequent HLA-G type was G*01:01, both in the study group (30.3%) and in the control group (47%). The study revealed that the G*01:04 allele was significantly associated with miscarriage (p = 0.007). The 3' UTR 14bp deletion was more frequent in the miscarriage group, but there was no significant correlation. HLA-G alleles seem to be related with miscarriage and should be considered in RM cases.

Complete mitochondrial genome of Concholepas concholepas inferred by 454 pyrosequencing and mtDNA expression in two mollusc populations.

PubMed

Núñez-Acuña, Gustavo; Aguilar-Espinoza, Andrea; Gallardo-Escárate, Cristian

2013-03-01

Despite the great relevance of mitochondrial genome analysis in evolutionary studies, there is scarce information on how the transcripts associated with the mitogenome are expressed and their role in the genetic structuring of populations. This work reports the complete mitochondrial genome of the marine gastropod Concholepas concholepas, obtained by 454 pryosequencing, and an analysis of mitochondrial transcripts of two populations 1000 km apart along the Chilean coast. The mitochondrion of C. concholepas is 15,495 base pairs (bp) in size and contains the 37 subunits characteristic of metazoans, as well as a non-coding region of 330 bp. In silico analysis of mitochondrial gene variability showed significant differences among populations. In terms of levels of relative abundance of transcripts associated with mitochondrion in the two populations (assessed by qPCR), the genes associated with complexes III and IV of the mitochondrial genome had the highest levels of expression in the northern population while transcripts associated with the ATP synthase complex had the highest levels of expression in the southern population. Moreover, fifteen polymorphic SNPs were identified in silico between the mitogenomes of the two populations. Four of these markers implied different amino acid substitutions (non-synonymous SNPs). This work contributes novel information regarding the mitochondrial genome structure and mRNA expression levels of C. concholepas. Copyright © 2012 Elsevier Inc. All rights reserved.

The genetic signature of recent speciation in manta rays (Manta alfredi and M. birostris).

PubMed

Kashiwagi, Tom; Marshall, Andrea D; Bennett, Michael B; Ovenden, Jennifer R

2012-07-01

Manta rays have been taxonomically revised as two species, Manta alfredi and M. birostris, on the basis of morphological and meristic data, yet the two species occur in extensive mosaic sympatry. We analysed the genetic signatures of the species boundary using a portion of the nuclear RAG1 (681 base pairs), mitochondrial CO1 (574 bp) and ND5 genes (1188 bp). The assay with CO1 sequences, widely used in DNA barcoding, failed to distinguish the two species. The two species were clearly distinguishable, however, with no shared RAG1 or ND5 haplotypes. The species were reciprocally monophyletic for RAG1, but paraphyletic for ND5 sequences. Qualitative evidence and statistical inferences using the 'Isolation-with-Migration models' indicated that these results were better explained with post-divergence gene flow in the recent past rather than incomplete lineage sorting with zero gene flow since speciation. An estimate of divergence time was less than 0.5 Ma with an upper confidence limit of within 1 Ma. Recent speciation of highly mobile species in the marine environment is of great interest, as it suggests that speciation may have occurred in the absence of long-term physical barriers to gene flow. We propose that the ecologically driven forces such as habitat choice played a significant role in speciation in manta rays. Copyright © 2012 Elsevier Inc. All rights reserved.

Homozygous hereditary C3 deficiency due to a partial gene deletion.

PubMed Central

Botto, M; Fong, K Y; So, A K; Barlow, R; Routier, R; Morley, B J; Walport, M J

1992-01-01

The molecular mechanism of C3 deficiency in an Afrikaans patient with recurrent pyogenic infections was studied. Restriction enzyme analysis showed a gene deletion of 800 base pairs (bp) mapping to the alpha chain of C3. Amplification of genomic DNA, using the PCR, demonstrated that the deletion included exons 22 and 23 of the C3 gene. Truncated mRNA was shown in an Epstein-Barr virus-transformed B-cell line by PCR amplification of first-strand cDNA. A consequence of this deletion was that the RNA transcribed 3' to the deletion was out of frame, resulting in formation of a stop codon 19 bp downstream from the deletion. The molecular basis of the deletion was compatible with homologous recombination between two Alu sequences located in introns 21 and 23. An unrelated nonconsanguineous relative and two of a sample of 174 Afrikaans-speaking individuals were heterozygous carriers of the same gene deletion. The wide prevalence of this null allele in this population is probably due to the effects of a small founder population. The presence of this deletion in the C3 gene is not compatible with production of any functional C3, supporting the idea that study of such patients offers a valid model for understanding physiological activities of C3 in vivo in humans. Images PMID:1350678

Structure-Function Model for Kissing Loop Interactions That Initiate Dimerization of Ty1 RNA

PubMed Central

Gamache, Eric R.; Doh, Jung H.; Ritz, Justin; Laederach, Alain; Bellaousov, Stanislav; Mathews, David H.; Curcio, M. Joan

2017-01-01

The genomic RNA of the retrotransposon Ty1 is packaged as a dimer into virus-like particles. The 5′ terminus of Ty1 RNA harbors cis-acting sequences required for translation initiation, packaging and initiation of reverse transcription (TIPIRT). To identify RNA motifs involved in dimerization and packaging, a structural model of the TIPIRT domain in vitro was developed from single-nucleotide resolution RNA structural data. In general agreement with previous models, the first 326 nucleotides of Ty1 RNA form a pseudoknot with a 7-bp stem (S1), a 1-nucleotide interhelical loop and an 8-bp stem (S2) that delineate two long, structured loops. Nucleotide substitutions that disrupt either pseudoknot stem greatly reduced helper-Ty1-mediated retrotransposition of a mini-Ty1, but only mutations in S2 destabilized mini-Ty1 RNA in cis and helper-Ty1 RNA in trans. Nested in different loops of the pseudoknot are two hairpins with complementary 7-nucleotide motifs at their apices. Nucleotide substitutions in either motif also reduced retrotransposition and destabilized mini- and helper-Ty1 RNA. Compensatory mutations that restore base-pairing in the S2 stem or between the hairpins rescued retrotransposition and RNA stability in cis and trans. These data inform a model whereby a Ty1 RNA kissing complex with two intermolecular kissing-loop interactions initiates dimerization and packaging. PMID:28445416

Isolation and sequencing of the gene encoding Sp23, a structural protein of spermatophore of the mealworm beetle, Tenebrio molitor.

PubMed

Feng, X; Happ, G M

1996-11-14

The cDNA for Sp23, a structural protein of the spermatophore of Tenebrio molitor, had been previously cloned and characterized (Paesen, G.C., Schwartz, M.B., Peferoen, M., Weyda, F. and Happ, G.M. (1992a) Amino acid sequence of Sp23, a structure protein of the spermatophore of the mealworm beetle, Tenebrio molitor. J. Biol. Chem. 257, 18852-18857). Using the labeled cDNA for Sp23 as a probe to screen a library of genomic DNA from Tenebrio molitor, we isolated a genomic clone for Sp23. A 5373-base pair (bp) restriction fragment containing the Sp23 gene was sequenced. The coding region is separated by a 55-bp intron which is located close to the translation start site. Three putative ecdysone response elements (EcRE) are identified in the 5' flanking region of the Sp23 gene. Comparison of the flanking regions of the Sp23 gene with those of the D-protein gene expressed in the accessory glands of Tenebrio reveals similar sequences present in the flanking regions of the two genes. The genomic organization of the coding region of the Sp23 gene shares similarities with that of the D-protein gene, three Drosophila accessory gland genes and two Drosophila 20-OH ecdysone-responsive genes.

Polarization and Thickness Dependent Absorption Properties of Black Phosphorus: New Saturable Absorber for Ultrafast Pulse Generation

PubMed Central

Li, Diao; Jussila, Henri; Karvonen, Lasse; Ye, Guojun; Lipsanen, Harri; Chen, Xianhui; Sun, Zhipei

2015-01-01

Black phosphorus (BP) has recently been rediscovered as a new and interesting two-dimensional material due to its unique electronic and optical properties. Here, we study the linear and nonlinear optical properties of BP flakes. We observe that both the linear and nonlinear optical properties are anisotropic and can be tuned by the film thickness in BP, completely different from other typical two-dimensional layered materials (e.g., graphene and the most studied transition metal dichalcogenides). We then use the nonlinear optical properties of BP for ultrafast (pulse duration down to ~786 fs in mode-locking) and large-energy (pulse energy up to >18 nJ in Q-switching) pulse generation in fiber lasers at the near-infrared telecommunication band ~1.5 μm. We observe that the output of our BP based pulsed lasers is linearly polarized (with a degree-of-polarization ~98% in mode-locking, >99% in Q-switching, respectively) due to the anisotropic optical property of BP. Our results underscore the relatively large optical nonlinearity of BP with unique polarization and thickness dependence, and its potential for polarized optical pulse generation, paving the way to BP based nonlinear and ultrafast photonic applications (e.g., ultrafast all-optical polarization switches/modulators, frequency converters etc.). PMID:26514090

Long-term blood pressure variability in patients with rheumatoid arthritis (RA) and its impact on cardiovascular events and all-cause mortality in RA: a population-based comparative cohort study

PubMed Central

Myasoedova, Elena; Crowson, Cynthia S.; Green, Abigail B.; Matteson, Eric L.; Gabriel, Sherine E.

2014-01-01

Objectives To examine long-term visit-to-visit blood pressure (BP) variability in rheumatoid arthritis (RA) vs non-RA subjects and to assess its impact on cardiovascular events and mortality in RA. Methods Clinic BP measures were collected in a population-based incident cohort of RA patients (1987 ACR criteria met between 1/1/1995 and 1/1/2008) and non-RA subjects. BP variability was defined as within-subject standard deviation (SD) in systolic and diastolic BP. Results Study included 442 RA patients (mean age 55.5 years, 70% females) and 424 non-RA subjects (mean age 55.7 years, 69% females). RA patients had higher visit-to-visit variability in systolic BP (13.8±4.7 mm Hg), than non-RA subjects (13.0±5.2 mm Hg, p=0.004). Systolic BP variability declined after the index date in RA (p<0.001), but not in the non-RA cohort (p=0.73), adjusting for age, sex and calendar year of RA. During the mean follow-up of 7.1 years, 33 cardiovascular events and 57 deaths occurred in RA cohort. Visit-to-visit systolic BP variability was associated with increased risk of cardiovascular events (hazard ratio [HR] per 1 mm Hg increase in BP variability 1.12, 95% confidence interval [CI] 1.01-1.25); diastolic BP variability was associated with all-cause mortality in RA (HR 1.14, 95%CI 1.03-1.27), adjusting for systolic and diastolic BP, body mass index, smoking, diabetes, dyslipidemia, use of antihypertensives. Conclusion Patients with RA had higher visit-to-visit systolic BP variability vs non-RA subjects. There was a significant decline in systolic BP variability after RA incidence. Higher visit-to-visit BP variability was associated with adverse cardiovascular outcomes and all-cause mortality in RA. PMID:24986852