Detecting exact breakpoints of deletions with diversity in hepatitis B viral genomic DNA from next-generation sequencing data.

PubMed

Cheng, Ji-Hong; Liu, Wen-Chun; Chang, Ting-Tsung; Hsieh, Sun-Yuan; Tseng, Vincent S

2017-10-01

Many studies have suggested that deletions of Hepatitis B Viral (HBV) are associated with the development of progressive liver diseases, even ultimately resulting in hepatocellular carcinoma (HCC). Among the methods for detecting deletions from next-generation sequencing (NGS) data, few methods considered the characteristics of virus, such as high evolution rates and high divergence among the different HBV genomes. Sequencing high divergence HBV genome sequences using the NGS technology outputs millions of reads. Thus, detecting exact breakpoints of deletions from these big and complex data incurs very high computational cost. We proposed a novel analytical method named VirDelect (Virus Deletion Detect), which uses split read alignment base to detect exact breakpoint and diversity variable to consider high divergence in single-end reads data, such that the computational cost can be reduced without losing accuracy. We use four simulated reads datasets and two real pair-end reads datasets of HBV genome sequence to verify VirDelect accuracy by score functions. The experimental results show that VirDelect outperforms the state-of-the-art method Pindel in terms of accuracy score for all simulated datasets and VirDelect had only two base errors even in real datasets. VirDelect is also shown to deliver high accuracy in analyzing the single-end read data as well as pair-end data. VirDelect can serve as an effective and efficient bioinformatics tool for physiologists with high accuracy and efficient performance and applicable to further analysis with characteristics similar to HBV on genome length and high divergence. The software program of VirDelect can be downloaded at https://sourceforge.net/projects/virdelect/. Copyright © 2017. Published by Elsevier Inc.

Deletion endpoint allele-specificity in the developmentally regulated elimination of an internal sequence (IES) in Paramecium.

PubMed Central

Dubrana, K; Le Mouël, A; Amar, L

1997-01-01

Ciliated protozoa undergo thousands of site-specific DNA deletion events during the programmed development of micronuclear genomes to macronuclear genomes. Two deletion elements, W1 and W2, were identified in the Paramecium primaurelia wild-type 156 strain. Here, we report the characterization of both elements in wild-type strain 168 and show that they display variant deletion patterns when compared with those of strain 156. The W1 ( 168 ) element is defective for deletion. The W2 ( 168 ) element is excised utilizing two alternative boundaries on one side, both are different from the boundary utilized to excise the W2156 element. By crossing the 156 and 168 strains, we demonstrate that the definition of all deletion endpoints are each controlled by cis -acting determinant(s) rather than by strain-specific trans-acting factor(s). Sequence comparison of all deleted DNA segments indicates that the 5'-TA-3'terminal sequence is strictly required at their ends. Furthermore the identity of the first eight base pairs of these ends to a previously established consensus sequence correlates with the frequency of the corresponding deletion events. Our data implies the existence of an adaptive convergent evolution of these Paramecium deleted DNA segment end sequences. PMID:9171098

Problem-Solving Test: Conditional Gene Targeting Using the Cre/loxP Recombination System

ERIC Educational Resources Information Center

Szeberényi, József

2013-01-01

Terms to be familiar with before you start to solve the test: gene targeting, knock-out mutation, bacteriophage, complementary base-pairing, homologous recombination, deletion, transgenic organisms, promoter, polyadenylation element, transgene, DNA replication, RNA polymerase, Shine-Dalgarno sequence, restriction endonuclease, polymerase chain…

Two novel mutations in the Norrie disease gene associated with the classical ocular phenotype.

PubMed

Caballero, M; Veske, A; Rodriguez, J J; Lugo, N; Schroeder, B; Hesse, L; Gal, A

1996-12-01

Norrie disease (ND) is a rare X-linked recessive disorder characterized by congenital blindness due to a degenerative and proliferative dysplasia of the neuroretina and, occasionally, by deafness and mental handicap. Here, we report two novel mutations detected in patients with the classical eye features of ND. Both the one-base pair insertion in exon II (544/545 insA) and the two-base pair deletion in the start codon (418delTG) of the ND gene predict a functional 'null allele', i.e. the complete absence of the corresponding gene product.

Genetic and DNA sequence analysis of the kanamycin resistance transposon Tn903.

PubMed Central

Grindley, N D; Joyce, C M

1980-01-01

The kanamycin resistance transposon Tn903 consists of a unique region of about 1000 base pairs bounded by a pair of 1050-base-pair inverted repeat sequences. Each repeat contains two Pvu II endonuclease cleavage sites separated by 520 base pairs. We have constructed derivatives of Tn903 in which this 520-base-pair fragment is deleted from one or both repeats. Those derivatives that lack both 520-base-pair fragments cannot transpose, whereas those that lack just one remain transposition proficient. One such transposable derivative, Tn903 delta I, has been selected for further study. We have determined the sequence of the intact inverted repeat. The 18 base pairs at each end are identical and inverted relative to one another, a structure characteristic of insertion sequences. Additional experiments indicate that a single inverted repeat from Tn903 can, in fact, transpose; we propose that this element be called IS903. To correlate the DNA sequence with genetic activities, we have created mutations by inserting a 10-base-pair DNA fragment at several sites within the intact repeat of Tn903 delta 1, and we have examined the effect of such insertions on transposability. The results suggest that IS903 encodes a 307-amino-acid polypeptide (a "transposase") that is absolutely required for transposition of IS903 or Tn903. Images PMID:6261245

Novel Single-Base Deletional Mutation in Major Intrinsic Protein (MIP) in Autosomal Dominant Cataract

PubMed Central

Geyer, David D.; Spence, M. Anne; Johannes, Meriam; Flodman, Pamela; Clancy, Kevin P.; Berry, Rebecca; Sparkes, Robert S.; Jonsen, Matthew D.; Isenberg, Sherwin J.; Bateman, J. Bronwyn

2006-01-01

PURPOSE To further elucidate the cataract phenotype, and identify the gene and mutation for autosomal dominant cataract (ADC) in an American family of European descent (ADC2) by sequencing the major intrinsic protein gene (MIP), a candidate based on linkage to chromosome 12q13. DESIGN Observational case series and laboratory experimental study. METHODS We examined two at-risk individuals in ADC2. We PCR-amplified and sequenced all four exons and all intron-exon boundaries of the MIP gene from genomic and cloned DNA in affected members to confirm one variant as the putative mutation. RESULTS We found a novel single deletion of nucleotide (nt) 3223 (within codon 235) in exon four, causing a frameshift that alters 41 of 45 subsequent amino acids and creates a premature stop codon. CONCLUSIONS We identified a novel single base pair deletion in the MIP gene and conclude that it is a pathogenic sequence alteration. PMID:16564824

The Canine POMC Gene, Obesity in Labrador Retrievers and Susceptibility to Diabetes Mellitus.

PubMed

Davison, L J; Holder, A; Catchpole, B; O'Callaghan, C A

2017-03-01

Diabetes mellitus (DM) in dogs is a common endocrinopathy with a complex genetic architecture. Disease susceptibility in several breeds is associated with polymorphisms in immune response genes, but in the Labrador retriever breed, no genetic associations with DM have been identified. A deletion in the pro-opiomelanocortin (POMC) gene in Labrador retrievers is associated with increased appetite and risk of obesity. To characterize the POMC deletion in Labrador retrievers, to develop a simple genetic test for this mutation, and to test the hypothesis that the POMC gene deletion is associated with an increased risk of DM in this breed. Sixty-one non-diabetic Labrador retrievers aged >6 years and 57 Labrador retrievers with DM. Case-control genotyping study to compare the frequency of the POMC deletion in dogs with and without DM. After polymerase chain reaction (PCR) and sequencing to characterize the mutation, a PCR-based test was developed and validated using 2 different restriction fragment length polymorphism assays. A 14-base-pair deletion was confirmed and localized to exon 3 of the canine POMC gene. A PCR-based test for the deletion was successfully developed. There was no association between the presence of the POMC deletion mutation and DM in this population of Labrador retriever dogs (P = .31). This study adds to the existing scientific literature indicating that there is little evidence for a direct link between obesity and DM in dogs. Copyright © 2016 The Authors. Journal of Veterinary Internal Medicine published by Wiley Periodicals, Inc. on behalf of the American College of Veterinary Internal Medicine.

Novel and differential accumulation of mitochondrial DNA deletions in Swedish and vietnamese patients with colorectal cancer.

PubMed

Dimberg, Jan; Hong, Thai Trinh; Skarstedt, Marita; Löfgren, Sture; Zar, Niklas; Matussek, Andreas

2014-01-01

Mitochondrial DNA (mtDNA) has been proposed to be involved in carcinogenesis and aging. The mtDNA 4977 bp deletion is one of the most frequently observed mtDNA mutations in human tissues and may play a role in colorectal cancer (CRC). In the present study, we aimed to evaluate the frequency of mtDNA 4977 bp deletion in CRC tissues and its association with clinical factors. We determined the presence of the 4977 bp common deletion in cancer and normal paired tissue samples from 105 Swedish and 88 Vietnamese patients with CRC using polymerase chain reaction (PCR) assays. The mtDNA 4977 bp deletion was shown to be significantly more frequent in normal tissues in comparison with paired cancer tissues in both Swedish and Vietnamese patients. The 4977 bp common deletion was significantly more frequent in cancer tissues of the Vietnamese patients compared to the Swedish patients, and in Vietnamese cancer tissues, the 4977 bp deletion was significantly over represented in those with localized disease compared to those with disseminated disease. Moreover, we detected nine novel mtDNA deletions and found a significantly higher rate of these in CRC tissues in Swedish in comparison to Vietnamese patients. The mtDNA 4977 bp deletion seems to have an impact on the clinical outcome of CRC in Vietnamese patients, that the Swedish patients accumulate more of the detected novel deletions in CRC tissue compared to Vietnamese patients probably indicates divergent mechanisms in colorectal carcinogenesis.

Rapid genotyping assays for the 4-base pair deletion of canine MDR1/ABCB1 gene and low frequency of the mutant allele in Border Collie dogs.

PubMed

Mizukami, Keijiro; Chang, Hye-Sook; Yabuki, Akira; Kawamichi, Takuji; Hossain, Mohammad A; Rahman, Mohammad M; Uddin, Mohammad M; Yamato, Osamu

2012-01-01

P-glycoprotein, encoded by the MDR1 or ABCB1 gene, is an integral component of the blood-brain barrier as an efflux pump for xenobiotics crucial in limiting drug uptake into the central nervous system. Dogs homozygous for a 4-base pair deletion of the canine MDR1 gene show altered expression or function of P-glycoprotein, resulting in neurotoxicosis after administration of the substrate drugs. In the present study, the usefulness of microchip electrophoresis for genotyping assays detecting this deletion mutation was evaluated. Mutagenically separated polymerase chain reaction (MS-PCR) and real-time PCR assays were newly developed and evaluated. Furthermore, a genotyping survey was carried out in a population of Border Collies dogs in Japan to determine the allele frequency in this breed. Microchip electrophoresis showed advantages in detection sensitivity and time saving over other modes of electrophoresis. The MS-PCR assay clearly discriminated all genotypes. Real-time PCR assay was most suitable for a large-scale survey due to its high throughput and rapidity. The genotyping survey demonstrated that the carrier and mutant allele frequencies were 0.49% and 0.25%, respectively, suggesting that the mutant allele frequency in Border Collies is markedly low compared to that in the susceptible dog breeds such as rough and smooth Collies.

Accurate indel prediction using paired-end short reads

PubMed Central

2013-01-01

Background One of the major open challenges in next generation sequencing (NGS) is the accurate identification of structural variants such as insertions and deletions (indels). Current methods for indel calling assign scores to different types of evidence or counter-evidence for the presence of an indel, such as the number of split read alignments spanning the boundaries of a deletion candidate or reads that map within a putative deletion. Candidates with a score above a manually defined threshold are then predicted to be true indels. As a consequence, structural variants detected in this manner contain many false positives. Results Here, we present a machine learning based method which is able to discover and distinguish true from false indel candidates in order to reduce the false positive rate. Our method identifies indel candidates using a discriminative classifier based on features of split read alignment profiles and trained on true and false indel candidates that were validated by Sanger sequencing. We demonstrate the usefulness of our method with paired-end Illumina reads from 80 genomes of the first phase of the 1001 Genomes Project ( http://www.1001genomes.org) in Arabidopsis thaliana. Conclusion In this work we show that indel classification is a necessary step to reduce the number of false positive candidates. We demonstrate that missing classification may lead to spurious biological interpretations. The software is available at: http://agkb.is.tuebingen.mpg.de/Forschung/SV-M/. PMID:23442375

Homozygous hereditary C3 deficiency due to a partial gene deletion.

PubMed Central

Botto, M; Fong, K Y; So, A K; Barlow, R; Routier, R; Morley, B J; Walport, M J

1992-01-01

The molecular mechanism of C3 deficiency in an Afrikaans patient with recurrent pyogenic infections was studied. Restriction enzyme analysis showed a gene deletion of 800 base pairs (bp) mapping to the alpha chain of C3. Amplification of genomic DNA, using the PCR, demonstrated that the deletion included exons 22 and 23 of the C3 gene. Truncated mRNA was shown in an Epstein-Barr virus-transformed B-cell line by PCR amplification of first-strand cDNA. A consequence of this deletion was that the RNA transcribed 3' to the deletion was out of frame, resulting in formation of a stop codon 19 bp downstream from the deletion. The molecular basis of the deletion was compatible with homologous recombination between two Alu sequences located in introns 21 and 23. An unrelated nonconsanguineous relative and two of a sample of 174 Afrikaans-speaking individuals were heterozygous carriers of the same gene deletion. The wide prevalence of this null allele in this population is probably due to the effects of a small founder population. The presence of this deletion in the C3 gene is not compatible with production of any functional C3, supporting the idea that study of such patients offers a valid model for understanding physiological activities of C3 in vivo in humans. Images PMID:1350678

Canine GM2-Gangliosidosis Sandhoff Disease Associated with a 3-Base Pair Deletion in the HEXB Gene.

PubMed

Wang, P; Henthorn, P S; Galban, E; Lin, G; Takedai, T; Casal, M

2018-01-01

GM2-gangliosidosis is a fatal neurodegenerative lysosomal storage disease (LSD) caused by deficiency of either β-hexosaminidase A (Hex-A) and β-hexosaminidase B (Hex-B) together, or the GM2 activator protein. Clinical signs can be variable and are not pathognomonic for the specific, causal deficiency. To characterize the phenotype and genotype of GM2-gangliosidosis disease in an affected dog. One affected Shiba Inu and a clinically healthy dog. Clinical and neurologic evaluation, brain magnetic resonance imaging (MRI), assays of lysosomal enzyme activities, and sequencing of all coding regions of HEXA, HEXB, and GM2A genes. A 14-month-old, female Shiba Inu presented with clinical signs resembling GM2-gangliosidosis in humans and GM1-gangliosidosis in the Shiba Inu. Magnetic resonance imaging (MRI) of the dog's brain indicated neurodegenerative disease, and evaluation of cerebrospinal fluid (CSF) identified storage granules in leukocytes. Lysosomal enzyme assays of plasma and leukocytes showed deficiencies of Hex-A and Hex-B activities in both tissues. Genetic analysis identified a homozygous, 3-base pair deletion in the HEXB gene (c.618-620delCCT). Clinical, biochemical, and molecular features are characterized in a Shiba Inu with GM2-gangliosidosis. The deletion of 3 adjacent base pairs in HEXB predicts the loss of a leucine residue at amino acid position 207 (p.Leu207del) supporting the hypothesis that GM2-gangliosidosis seen in this dog is the Sandhoff type. Because GM1-gangliosidosis also exists in this breed with almost identical clinical signs, genetic testing for both GM1- and GM2-gangliosidosis should be considered to make a definitive diagnosis. Copyright © 2017 The Authors. Journal of Veterinary Internal Medicine published by Wiley Periodicals, Inc. on behalf of the American College of Veterinary Internal Medicine.

Polarity of recombination in transformation of Streptococcus pneumoniae

PubMed Central

Pasta, Franck; Sicard, Michel A.

1999-01-01

In transformation of Streptococcus pneumoniae DNA enters the cell as single-strand fragments and integrates into the chromosome by homologous recombination. Deletions and insertions of a few hundred base pairs frequently stop the recombination process of a donor strand. In this work we took advantage of such interruptions of recombination to compare the transformation efficiencies of the segments 5′- and 3′-ward from a deletion. The deletion was created in the center of a fragment of the ami locus, and sites around the deletion were labeled by a frameshift generating a restriction site. Heteroduplexes were constructed containing two restriction sites on one strand and two different ones on the complementary strand. ami+ bacteria were transformed with such heteroduplexes. ami− transformants were isolated and individually underwent amplification of the transformed ami region. We have obtained two kinds of amplification products: short when the deletion was integrated, long when recombination stops at the deletion. Each long fragment was tested by the four restriction enzymes to detect which strand and which side of the deletion had recombined. We found that 80% of the cuts were located 5′ to the deletion, showing that, in vivo, the 5′ side is strongly favored by recombination. Further results suggest that exchanges occurring from 5′ to 3′ relative to the donor strand are more efficient than in the opposite direction, thus accounting for the 5′ preference. PMID:10077616

Polarity of recombination in transformation of Streptococcus pneumoniae.

PubMed

Pasta, F; Sicard, M A

1999-03-16

In transformation of Streptococcus pneumoniae DNA enters the cell as single-strand fragments and integrates into the chromosome by homologous recombination. Deletions and insertions of a few hundred base pairs frequently stop the recombination process of a donor strand. In this work we took advantage of such interruptions of recombination to compare the transformation efficiencies of the segments 5'- and 3'-ward from a deletion. The deletion was created in the center of a fragment of the ami locus, and sites around the deletion were labeled by a frameshift generating a restriction site. Heteroduplexes were constructed containing two restriction sites on one strand and two different ones on the complementary strand. ami+ bacteria were transformed with such heteroduplexes. ami- transformants were isolated and individually underwent amplification of the transformed ami region. We have obtained two kinds of amplification products: short when the deletion was integrated, long when recombination stops at the deletion. Each long fragment was tested by the four restriction enzymes to detect which strand and which side of the deletion had recombined. We found that 80% of the cuts were located 5' to the deletion, showing that, in vivo, the 5' side is strongly favored by recombination. Further results suggest that exchanges occurring from 5' to 3' relative to the donor strand are more efficient than in the opposite direction, thus accounting for the 5' preference.

Entropy Beacon: A Hairpin-Free DNA Amplification Strategy for Efficient Detection of Nucleic Acids

PubMed Central

2015-01-01

Here, we propose an efficient strategy for enzyme- and hairpin-free nucleic acid detection called an entropy beacon (abbreviated as Ebeacon). Different from previously reported DNA hybridization/displacement-based strategies, Ebeacon is driven forward by increases in the entropy of the system, instead of free energy released from new base-pair formation. Ebeacon shows high sensitivity, with a detection limit of 5 pM target DNA in buffer and 50 pM in cellular homogenate. Ebeacon also benefits from the hairpin-free amplification strategy and zero-background, excellent thermostability from 20 °C to 50 °C, as well as good resistance to complex environments. In particular, based on the huge difference between the breathing rate of a single base pair and two adjacent base pairs, Ebeacon also shows high selectivity toward base mutations, such as substitution, insertion, and deletion and, therefore, is an efficient nucleic acid detection method, comparable to most reported enzyme-free strategies. PMID:26505212

Impact of the canine double-deletion β1 adrenoreceptor polymorphisms on protein structure and heart rate response to atenolol, a β1-selective β-blocker.

PubMed

Meurs, Kathryn M; Stern, Josh A; Reina-Doreste, Yamir; Maran, Brian A; Chdid, Lhoucine; Lahmers, Sunshine; Keene, Bruce W; Mealey, Katrina L

2015-09-01

β-Adrenergic receptor antagonists are widely utilized for the management of cardiac diseases in dogs. We have recently identified two deletion polymorphisms in the canine adrenoreceptor 1 (ADRB1) gene.We hypothesized that canine ADRB1 deletions would alter the structure of the protein, as well as the heart rate response to the β-adrenergic receptor antagonist, atenolol. The objectives of this study were to predict the impact of these deletions on the predicted structure of the protein and on the heart rate response to atenolol in a population of healthy adult dogs. Eighteen apparently healthy, mature dogs with (11) and without (seven) ADRB1 deletions were evaluated. The heart rate of the dogs was evaluated with a baseline ambulatory ECG before and 14-21 days after atenolol therapy (1 mg/kg orally q12 h). Minimum, average, and maximum heart rates were compared between groups of dogs (deletions, controls) using an unpaired t-test and within each group of dogs using a paired t-test. The protein structure of ADRB1 was predicted by computer modeling. Deletions were predicted to alter the structure of the ADRB1 protein. The heart rates of the dogs with deletions were lower than those of the control dogs (the average heart rates were significantly lower). ADRB1 deletions appear to have structural and functional consequences. Individual genome-based treatment recommendations could impact the management of dogs with heart disease.

Child Development and Structural Variation in the Human Genome

ERIC Educational Resources Information Center

Zhang, Ying; Haraksingh, Rajini; Grubert, Fabian; Abyzov, Alexej; Gerstein, Mark; Weissman, Sherman; Urban, Alexander E.

2013-01-01

Structural variation of the human genome sequence is the insertion, deletion, or rearrangement of stretches of DNA sequence sized from around 1,000 to millions of base pairs. Over the past few years, structural variation has been shown to be far more common in human genomes than previously thought. Very little is currently known about the effects…

A novel mutation in SOX3 polyalanine tract: a case of Kabuki syndrome with combined pituitary hormone deficiency harboring double mutations in MLL2 and SOX3.

PubMed

Takagi, Masaki; Ishii, Tomohiro; Torii, Chiharu; Kosaki, Kenjiro; Hasegawa, Tomonobu

2014-12-01

Both duplications encompassing SOX3 and loss-of function mutations in SOX3 have been reported in a minor portion of X-linked isolated growth hormone deficiency (GHD) or combined pituitary hormone deficiency (CPHD) patients with or without mental retardation. We report a Japanese male patient with molecularly confirmed Kabuki syndrome who was found to have CPHD. We analyzed all coding exons and flanking introns of currently known nine genes responsible for CPHD by PCR-based sequencing. In this CPHD patient, we identified a novel hemizygous 21-base pair deletion, resulting in the loss of 7 alanine residues from polyalanine (PA) tracts of SOX3. The clinically and endocrinologically normal mother of the patient carried the same deletion in a heterozygous manner. In vitro experiments showed that the del 7A SOX3 had increased transactivation of the HESX1 promoter. Our study provides additional evidence that deletion in PA tracts of SOX3 is associated with hypopituitarism. Female carriers of SOX3 PA tract deletions will show a broad phenotypic spectrum, ranging from clinically normal to CPHD.

The preS deletion of hepatitis B virus (HBV) is associated with liver fibrosis progression in patients with chronic HBV infection.

PubMed

Li, Fan; Li, Xiaodong; Yan, Tao; Liu, Yan; Cheng, Yongqian; Xu, Zhihui; Shao, Qing; Liao, Hao; Huang, Pengyu; Li, Jin; Chen, Guo-Feng; Xu, Dongping

2018-03-01

Limited data are available regarding the association of hepatitis B virus (HBV) mutations with liver fibrosis in HBV infection. The study aimed to clarify whether HBV preS deletion mutation is associated with liver fibrosis progression. A total of 469 patients were enrolled, including 324 with chronic hepatitis B (CHB), 28 with HBV-related compensated liver cirrhosis (LC), and 117 with HBV-related decompensated LC. All CHB and compensated LC patients received liver biopsy. Fibrosis grade was assessed using METAVIR score. HBV preS deletion was determined by direct sequencing and verified by clonal sequencing. Overall preS deletion was detected in 12.6% (59/469) patients, specifically, in 7.51% (13/173), 10.60% (16/151), and 20.69% (30/145) of patients with no-to-mild liver fibrosis (F0-1), moderate-to-severe liver fibrosis (F2-3), and cirrhosis (F4), respectively (p < 0.01). Patients with preS-deleted HBV had lower serum HBV DNA and albumin levels compared to patients with wild-type HBV. The median length of preS deletion was 39-base pairs (bp) (3-204 bp) and the deletion most frequently emerged in preS2 initial region. Multivariate analysis identified the preS2 deletion rather than preS1 deletion to be an independent risk factor of significant fibrosis, i.e., METAVIR F ≥ 2 (p = 0.007). In addition, preS-deleted viral sequences were detected in the pool of intrahepatic HBV covalently closed circular DNA. HBV preS deletion is positively associated with liver fibrosis progression in chronic HBV-infected patients. HBV preS2 deletion may serve as a warning indicator for liver fibrosis progression.

Sequence analysis of laci mutations obtained from lung cells of radon-exposed big blue{trademark} transgenic mice

DOE Office of Scientific and Technical Information (OSTI.GOV)

Layton, A.D.; Cross, F.T.; Steigler, G.L.

1994-12-31

We have exposed Big Blue{trademark} transgenic mice by inhalation to 320, 640 and 960 Working Level Months (WLM) of radon progeny. Mice were sacrificed after 3, 6 and 9 days; the time periods required to obtain the exposures. Control mice were also sacrificed at each time interval. In each case all tissues were excised, flash frozen in liquid nitrogen, and stored at -80{degrees}C for further analysis. Twelve lacI mutations have been isolated from the lung tissue of a mouse from the 960-WLM exposure group; the lacI genes from these mutants have been sequenced. Sequence data indicate that three of themore » mutants have a C;G deletion at BP 978 and are possibly clonal in origin. Two mutants have multiple events within the gene: one has a an A:T to C:G transversion and a C:G insertion separated by 291 BPs; the second has a G:C to A:T transition as well as an A:T deletion followed by 6 base pairs downstream by a T:A insertion. Other mutations include a single G:C to A:T transition, a two base pair deletion, and a C:G to T:A transition. Mutant plaques are being evaluated from individual mice at other dose levels. Time course experiments are also planned. These studies will help define the molecular fine structure of mutations induced by high-LET radiation exposure.« less

A Pyrosequencing-Based Assay for the Rapid Detection of the 22q11.2 Deletion in DNA from Buccal and Dried Blood Spot Samples

PubMed Central

Koontz, Deborah; Baecher, Kirsten; Kobrynski, Lisa; Nikolova, Stanimila; Gallagher, Margaret

2015-01-01

The 22q11.2 deletion syndrome is one of the most common deletion syndromes in newborns. Some affected newborns may be diagnosed shortly after birth because of the presence of heart defects, palatal defects, or severe immune deficiencies. However, diagnosis is often delayed in patients presenting with other associated conditions that would benefit from early recognition and treatment, such as speech delays, learning difficulties, and schizophrenia. Fluorescence in situ hybridization (FISH) is the gold standard for deletion detection, but it is costly and time consuming and requires a whole blood specimen. Our goal was to develop a suitable assay for population-based screening of easily collectible specimens, such as buccal swabs and dried blood spots (DBS). We designed a pyrosequencing assay and validated it using DNA from FISH–confirmed 22q11 deletion syndrome patients and normal controls. We tested DBS from nine patients and paired buccal cell and venous blood specimens from 20 patients. Results were 100% concordant with FISH assay results. DNA samples from normal controls (n = 180 cell lines, n = 15 DBS, and n = 88 buccal specimens) were negative for the deletion. Limiting dilution experiments demonstrated that accurate results could be obtained from as little as 1 ng of DNA. This method represents a reliable and low-cost alternative for detection of the common 22q11.2 microdeletions and can be adapted to high-throughput population screening. PMID:24973633

DNA sequence analysis of simian virus 40 mutants with deletions mapping in the leader region of the late viral mRNA's: mutants with deletions similar in size and position exhibit varied phenotypes.

PubMed

Barkan, A; Mertz, J E

1981-02-01

The nucleotide sequences of 10 viable yet partially defective deletion mutants of simian virus 40 were determined. The deletions mapped within, and, in many cases, 5' to, the predominant leader sequence of the late viral mRNA's. They ranged from 74 to 187 nucleotide pairs in length. Six of the mutants had lost the sequence that corresponds to the "cap" site (5' terminus) of the most abundant class of 16S mRNA's. One of these mutants had a deletion that extended 103 nucleotide pairs into the region preceding this primary cap site and, therefore, was missing many secondary cap sites as well. A seventh mutant lacked the entire major 16S leader sequence except for the first six nucleotides at its 5' end and the last nine at its 3' end. Although these mutants differed in the size and position of their deletions, we were unable to discover any simple correlations between their growth characteristics and their DNA sequences. This finding indicates that the secondary structures of the RNA transcripts may play a more important role than the exact nucleotide sequence of the RNAs in determining how they function within the cell.

The 5S ribosomal RNAs of Paracoccus denitrificans and Prochloron

NASA Technical Reports Server (NTRS)

Mackay, R. M.; Salgado, D.; Bonen, L.; Doolittle, W. F.; Stackebrandt, E.

1982-01-01

The nucleotide sequences of the 5S rRNAs of Paracoccus denitrificans and Prochloron sp. are presented, along with the demonstrated phylogenetic relationships of P. denitrificans with purple nonsulfur bacteria, and of Prochloron with cyanobacteria. Structural findings include the following: (1) helix II in both models is much shorter than in other eubacteria, (2) a base-pair has been deleted from helix IV of P. denitrificans 5S, and (3) Prochloron 5S has the potential to form four base-pairs between residues. Also covered are the differences between pairs of sequences in P. denitrificans, Prochloron, wheat mitochondion, spinach chloroplast, and nine diverse eubacteria. Findings include the observation that Prochloron 5S rRNA is much more similar to the 5S of the cyanobacterium Anacystis nidulans (25 percent difference) than either are to any of the other nine eubacterial 5S rRNAs.

Effects of the deletion of early region 4 (E4) open reading frame 1 (orf1), orf1-2, orf1-3 and orf1-4 on virus-host cell interaction, transgene expression, and immunogenicity of replicating adenovirus HIV vaccine vectors.

PubMed

Thomas, Michael A; Song, Rui; Demberg, Thorsten; Vargas-Inchaustegui, Diego A; Venzon, David; Robert-Guroff, Marjorie

2013-01-01

The global health burden engendered by human immunodeficiency virus (HIV)-induced acquired immunodeficiency syndrome (AIDS) is a sobering reminder of the pressing need for a preventative vaccine. In non-human primate models replicating adenovirus (Ad)-HIV/SIV recombinant vaccine vectors have been shown to stimulate potent immune responses culminating in protection against challenge exposures. Nonetheless, an increase in the transgene carrying capacity of these Ad vectors, currently limited to approximately 3000 base pairs, would greatly enhance their utility. Using a replicating, E3-deleted Ad type 5 host range mutant (Ad5 hr) encoding full-length single-chain HIVBaLgp120 linked to the D1 and D2 domains of rhesus macaque CD4 (rhFLSC) we systematically deleted the genes encoding early region 4 open reading frame 1 (E4orf1) through E4orf4. All the Ad-rhFLSC vectors produced similar levels of viral progeny. Cell cycle analysis of infected human and monkey cells revealed no differences in virus-host interaction. The parental and E4-deleted viruses expressed comparable levels of the transgene with kinetics similar to Ad late proteins. Similar levels of cellular immune responses and transgene-specific antibodies were elicited in vaccinated mice. However, differences in recognition of Ad proteins and induced antibody subtypes were observed, suggesting that the E4 gene products might modulate antibody responses by as yet unknown mechanisms. In short, we have improved the transgene carrying capacity by one thousand base pairs while preserving the replicability, levels of transgene expression, and immunogenicity critical to these vaccine vectors. This additional space allows for flexibility in vaccine design that could not be obtained with the current vector and as such should facilitate the goal of improving vaccine efficacy. To the best of our knowledge, this is the first report describing the effects of these E4 deletions on transgene expression and immunogenicity in a replicating Ad vector.

Effects of the Deletion of Early Region 4 (E4) Open Reading Frame 1 (orf1), orf1-2, orf1-3 and orf1-4 on Virus-Host Cell Interaction, Transgene Expression, and Immunogenicity of Replicating Adenovirus HIV Vaccine Vectors

PubMed Central

Thomas, Michael A.; Song, Rui; Demberg, Thorsten; Vargas-Inchaustegui, Diego A.; Venzon, David; Robert-Guroff, Marjorie

2013-01-01

The global health burden engendered by human immunodeficiency virus (HIV)-induced acquired immunodeficiency syndrome (AIDS) is a sobering reminder of the pressing need for a preventative vaccine. In non-human primate models replicating adenovirus (Ad)-HIV/SIV recombinant vaccine vectors have been shown to stimulate potent immune responses culminating in protection against challenge exposures. Nonetheless, an increase in the transgene carrying capacity of these Ad vectors, currently limited to approximately 3000 base pairs, would greatly enhance their utility. Using a replicating, E3-deleted Ad type 5 host range mutant (Ad5 hr) encoding full-length single-chain HIVBaLgp120 linked to the D1 and D2 domains of rhesus macaque CD4 (rhFLSC) we systematically deleted the genes encoding early region 4 open reading frame 1 (E4orf1) through E4orf4. All the Ad-rhFLSC vectors produced similar levels of viral progeny. Cell cycle analysis of infected human and monkey cells revealed no differences in virus-host interaction. The parental and E4-deleted viruses expressed comparable levels of the transgene with kinetics similar to Ad late proteins. Similar levels of cellular immune responses and transgene-specific antibodies were elicited in vaccinated mice. However, differences in recognition of Ad proteins and induced antibody subtypes were observed, suggesting that the E4 gene products might modulate antibody responses by as yet unknown mechanisms. In short, we have improved the transgene carrying capacity by one thousand base pairs while preserving the replicability, levels of transgene expression, and immunogenicity critical to these vaccine vectors. This additional space allows for flexibility in vaccine design that could not be obtained with the current vector and as such should facilitate the goal of improving vaccine efficacy. To the best of our knowledge, this is the first report describing the effects of these E4 deletions on transgene expression and immunogenicity in a replicating Ad vector. PMID:24143187

A pyrosequencing-based assay for the rapid detection of the 22q11.2 deletion in DNA from buccal and dried blood spot samples.

PubMed

Koontz, Deborah; Baecher, Kirsten; Kobrynski, Lisa; Nikolova, Stanimila; Gallagher, Margaret

2014-09-01

The 22q11.2 deletion syndrome is one of the most common deletion syndromes in newborns. Some affected newborns may be diagnosed shortly after birth because of the presence of heart defects, palatal defects, or severe immune deficiencies. However, diagnosis is often delayed in patients presenting with other associated conditions that would benefit from early recognition and treatment, such as speech delays, learning difficulties, and schizophrenia. Fluorescence in situ hybridization (FISH) is the gold standard for deletion detection, but it is costly and time consuming and requires a whole blood specimen. Our goal was to develop a suitable assay for population-based screening of easily collectible specimens, such as buccal swabs and dried blood spots (DBS). We designed a pyrosequencing assay and validated it using DNA from FISH-confirmed 22q11 deletion syndrome patients and normal controls. We tested DBS from nine patients and paired buccal cell and venous blood specimens from 20 patients. Results were 100% concordant with FISH assay results. DNA samples from normal controls (n = 180 cell lines, n = 15 DBS, and n = 88 buccal specimens) were negative for the deletion. Limiting dilution experiments demonstrated that accurate results could be obtained from as little as 1 ng of DNA. This method represents a reliable and low-cost alternative for detection of the common 22q11.2 microdeletions and can be adapted to high-throughput population screening. Copyright © 2014 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

Core promoter mutations 3 years after anti-hepatitis B e seroconversion in patients with chronic hepatitis B or hepatitis B and C infection and cancer remission.

PubMed

Zampino, Rosa; Marrone, Aldo; Karayiannis, Peter; Cirillo, Grazia; del Giudice, Emanuele Miraglia; Rania, Giovanni; Utili, Riccardo; Ruggiero, Giuseppe

2002-09-01

In this study, we aimed to evaluate the persistence of hepatitis B virus (HBV) DNA and the role of HBV core promoter and precore region mutations in 28 young cancer survivor patients with HBV or HBV and hepatitis C virus (HCV) infections, and persistently normal ALT levels, after spontaneous or interferon (IFN)-induced anti-hepatitis B e (HBe) seroconversion. Sera from 15 patients with HBV and 13 with dual HBV-HCV infection were analyzed for the presence of HBV-DNA and HCV-RNA by polymerase chain reaction 3 yr after anti-HBe seroconversion. A total of 21 patients had seroconverted spontaneously and seven did so after IFN treatment. The core promoter and the precore regions were amplified sequenced directly. Among patients with HBV infection, HBV-DNA was detected in five of nine (55%) with spontaneous anti-HBe and in all six treated patients (p = 0.092). In the coinfected patients, four had cleared both HBV-DNA and HCV-RNA, five were HBV-DNA negative/HCV-RNA positive and four had the reverse viral pattern. Among the 15 patients with persistence of HBV-DNA, a 7-base pair nucleotide deletion in the core promoter (1757-1763) was present in seven of 10 patients with spontaneous and in one of five patients with IFN-induced seroconversion (p = 0.033). The G1896A precore stop codon mutation was never observed. HBV-DNA levels were significantly lower in patients with the core promoter deletion (p = 0.011). The 7-base pair deletion generated a truncated X protein at amino-acid position 132. A core promoter deletion after anti-HBe seroconversion was associated with low HBV-DNA levels, probably because of downregulation of pregenomic RNA production and truncation of the X protein. HBV-DNA persistence was a frequent event, even in the absence of active liver disease.

Characterization of Genomic Deletion Efficiency Mediated by Clustered Regularly Interspaced Palindromic Repeats (CRISPR)/Cas9 Nuclease System in Mammalian Cells*♦

PubMed Central

Canver, Matthew C.; Bauer, Daniel E.; Dass, Abhishek; Yien, Yvette Y.; Chung, Jacky; Masuda, Takeshi; Maeda, Takahiro; Paw, Barry H.; Orkin, Stuart H.

2014-01-01

The clustered regularly interspaced palindromic repeats (CRISPR)/CRISPR-associated (Cas) 9 nuclease system has provided a powerful tool for genome engineering. Double strand breaks may trigger nonhomologous end joining repair, leading to frameshift mutations, or homology-directed repair using an extrachromosomal template. Alternatively, genomic deletions may be produced by a pair of double strand breaks. The efficiency of CRISPR/Cas9-mediated genomic deletions has not been systematically explored. Here, we present a methodology for the production of deletions in mammalian cells, ranging from 1.3 kb to greater than 1 Mb. We observed a high frequency of intended genomic deletions. Nondeleted alleles are nonetheless often edited with inversions or small insertion/deletions produced at CRISPR recognition sites. Deleted alleles also typically include small insertion/deletions at predicted deletion junctions. We retrieved cells with biallelic deletion at a frequency exceeding that of probabilistic expectation. We demonstrate an inverse relationship between deletion frequency and deletion size. This work suggests that CRISPR/Cas9 is a robust system to produce a spectrum of genomic deletions to allow investigation of genes and genetic elements. PMID:24907273

New t-gap insertion-deletion-like metrics for DNA hybridization thermodynamic modeling.

PubMed

D'yachkov, Arkadii G; Macula, Anthony J; Pogozelski, Wendy K; Renz, Thomas E; Rykov, Vyacheslav V; Torney, David C

2006-05-01

We discuss the concept of t-gap block isomorphic subsequences and use it to describe new abstract string metrics that are similar to the Levenshtein insertion-deletion metric. Some of the metrics that we define can be used to model a thermodynamic distance function on single-stranded DNA sequences. Our model captures a key aspect of the nearest neighbor thermodynamic model for hybridized DNA duplexes. One version of our metric gives the maximum number of stacked pairs of hydrogen bonded nucleotide base pairs that can be present in any secondary structure in a hybridized DNA duplex without pseudoknots. Thermodynamic distance functions are important components in the construction of DNA codes, and DNA codes are important components in biomolecular computing, nanotechnology, and other biotechnical applications that employ DNA hybridization assays. We show how our new distances can be calculated by using a dynamic programming method, and we derive a Varshamov-Gilbert-like lower bound on the size of some of codes using these distance functions as constraints. We also discuss software implementation of our DNA code design methods.

MinGenome: An In Silico Top-Down Approach for the Synthesis of Minimized Genomes.

PubMed

Wang, Lin; Maranas, Costas D

2018-02-16

Genome minimized strains offer advantages as production chassis by reducing transcriptional cost, eliminating competing functions and limiting unwanted regulatory interactions. Existing approaches for identifying stretches of DNA to remove are largely ad hoc based on information on presumably dispensable regions through experimentally determined nonessential genes and comparative genomics. Here we introduce a versatile genome reduction algorithm MinGenome that implements a mixed-integer linear programming (MILP) algorithm to identify in size descending order all dispensable contiguous sequences without affecting the organism's growth or other desirable traits. Known essential genes or genes that cause significant fitness or performance loss can be flagged and their deletion can be prohibited. MinGenome also preserves needed transcription factors and promoter regions ensuring that retained genes will be properly transcribed while also avoiding the simultaneous deletion of synthetic lethal pairs. The potential benefit of removing even larger contiguous stretches of DNA if only one or two essential genes (to be reinserted elsewhere) are within the deleted sequence is explored. We applied the algorithm to design a minimized E. coli strain and found that we were able to recapitulate the long deletions identified in previous experimental studies and discover alternative combinations of deletions that have not yet been explored in vivo.

Spatial harmonics and pattern specification in early Drosophila development. Part II. The four colour wheels model.

PubMed

Kauffman, S A; Goodwin, B C

1990-06-07

We review the evidence presented in Part I showing that transcripts and protein products of maternal, gap, pair-rule, and segment polarity genes exhibit increasingly complex, multipeaked longitudinal waveforms in the early Drosophila embryo. The central problem we address in Part II is the use the embryo makes of these wave forms to specify longitudinal pattern. Based on the fact that mutants of many of these genes generate deletions and mirror symmetrical duplications of pattern elements on length scales ranging from about half the egg to within segments, we propose that position is specified by measuring a "phase angle" by use of the ratios of two or more variables. Pictorially, such a phase angle can be thought of as a colour on a colour wheel. Any such model contains a phaseless singularity where all or many phases, or colours, come together. We suppose as well that positional values sufficiently close to the singularity are meaningless, hence a "dead zone". Duplications and deletions are accounted for by deformation of the cycle of morphogen values occurring along the antero-posterior axis. If the cycle of values surrounds the singularity and lies outside the dead zone, pattern is normal. If the curve transects the dead zone, pattern elements are deleted. If the curve lies entirely on one side of the singularity, pattern elements are deleted and others are duplicated with mirror symmetry. The existence of different wavelength transcript patterns in maternal, gap, pair-rule, and segment polarity genes and the roles of those same genes in generating deletions and mirror symmetrical duplications on a variety of length scales lead us to propose that position is measured simultaneously on at least four colour wheels, which cycle different numbers of times along the anterior-posterior axis. These yield progressively finer grained positional information. Normal pattern specification requires a unique angle, outside of the dead zone, from each of the four wheels. Deformations of the cycle of gene product concentrations yield the deletions and mirror symmetric duplications observed in the mutants discussed. The alternative familiar hypothesis that longitudinal position is specified in an "on" "off" combinatorial code does not readily account for the duplication deletion phenomena.

Blind prediction of noncanonical RNA structure at atomic accuracy.

PubMed

Watkins, Andrew M; Geniesse, Caleb; Kladwang, Wipapat; Zakrevsky, Paul; Jaeger, Luc; Das, Rhiju

2018-05-01

Prediction of RNA structure from nucleotide sequence remains an unsolved grand challenge of biochemistry and requires distinct concepts from protein structure prediction. Despite extensive algorithmic development in recent years, modeling of noncanonical base pairs of new RNA structural motifs has not been achieved in blind challenges. We report a stepwise Monte Carlo (SWM) method with a unique add-and-delete move set that enables predictions of noncanonical base pairs of complex RNA structures. A benchmark of 82 diverse motifs establishes the method's general ability to recover noncanonical pairs ab initio, including multistrand motifs that have been refractory to prior approaches. In a blind challenge, SWM models predicted nucleotide-resolution chemical mapping and compensatory mutagenesis experiments for three in vitro selected tetraloop/receptors with previously unsolved structures (C7.2, C7.10, and R1). As a final test, SWM blindly and correctly predicted all noncanonical pairs of a Zika virus double pseudoknot during a recent community-wide RNA-Puzzle. Stepwise structure formation, as encoded in the SWM method, enables modeling of noncanonical RNA structure in a variety of previously intractable problems.

Novel mutations in the STK11 gene in Thai patients with Peutz-Jeghers syndrome

PubMed Central

Ausavarat, Surasawadee; Leoyklang, Petcharat; Vejchapipat, Paisarn; Chongsrisawat, Voranush; Suphapeetiporn, Kanya; Shotelersuk, Vorasuk

2009-01-01

Peutz-Jeghers syndrome (PJS), a rare autosomal dominant inherited disorder, is characterized by hamartomatous gastrointestinal polyps and mucocutaneous pigmentation. Patients with this syndrome have a predisposition to a variety of cancers in multiple organs. Mutations in the serine/threonine kinase 11 (STK11) gene have been identified as a major cause of PJS. Here we present the clinical and molecular findings of two unrelated Thai individuals with PJS. Mutation analysis by Polymerase Chain Reaction-sequencing of the entire coding region of STK11 revealed two potentially pathogenic mutations. One harbored a single nucleotide deletion (c.182delG) in exon 1 resulting in a frameshift leading to premature termination at codon 63 (p.Gly61AlafsX63). The other carried an in-frame 9-base-pair (bp) deletion in exon 7, c.907_915del9 (p.Ile303_Gln305del). Both deletions were de novo and have never been previously described. This study has expanded the genotypic spectrum of the STK11 gene. PMID:19908348

Characterization of a highly polymorphic region 5′ to JH in the human immunoglobulin heavy chain

PubMed Central

Silva, Alcino J.; Johnson, John P.; White, Raymond L.

1987-01-01

A cloned DNA segment 1.25 kilobases (kb) upstream from the joining segments of the human heavy chain immunoglobulin gene revealed extensive polymorphic variation at this locus, and the polymorphic pattern was stably transmitted to the next generation. Genomic restriction analysis showed that the polymorphism was caused by insertions/deletions within an MspI/BamHI fragment. Sequencing of one allele, 848 base pairs (bp) long, revealed eleven 50-base-pair tandem repeats. A second allele, 648 bp long, was cloned from a human genomic cosmid library, sequenced, and found to contain four fewer repeats than the first allele. A survey of 186 chromosomes from unrelated individuals of primarily northern European descent revealed at least six alleles. Images PMID:2884636

Characterization of genomic deletion efficiency mediated by clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 nuclease system in mammalian cells.

PubMed

Canver, Matthew C; Bauer, Daniel E; Dass, Abhishek; Yien, Yvette Y; Chung, Jacky; Masuda, Takeshi; Maeda, Takahiro; Paw, Barry H; Orkin, Stuart H

2014-08-01

The clustered regularly interspaced short [corrected] palindromic repeats (CRISPR)/CRISPR-associated (Cas) 9 nuclease system has provided a powerful tool for genome engineering. Double strand breaks may trigger nonhomologous end joining repair, leading to frameshift mutations, or homology-directed repair using an extrachromosomal template. Alternatively, genomic deletions may be produced by a pair of double strand breaks. The efficiency of CRISPR/Cas9-mediated genomic deletions has not been systematically explored. Here, we present a methodology for the production of deletions in mammalian cells, ranging from 1.3 kb to greater than 1 Mb. We observed a high frequency of intended genomic deletions. Nondeleted alleles are nonetheless often edited with inversions or small insertion/deletions produced at CRISPR recognition sites. Deleted alleles also typically include small insertion/deletions at predicted deletion junctions. We retrieved cells with biallelic deletion at a frequency exceeding that of probabilistic expectation. We demonstrate an inverse relationship between deletion frequency and deletion size. This work suggests that CRISPR/Cas9 is a robust system to produce a spectrum of genomic deletions to allow investigation of genes and genetic elements. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

Genotyping of alpha-thalassemia deletions using multiplex polymerase chain reactions and gold nanoparticle-filled capillary electrophoresis.

PubMed

Chen, Yen-Ling; Shih, Chi-Jen; Ferrance, Jerome; Chang, Ya-Sian; Chang, Jan-Gowth; Wu, Shou-Mei

2009-02-13

A gold nanoparticle-filled capillary electrophoresis method combined with three multiplex polymerase chain reactions (PCRs) was established for simultaneous diagnosis of five common alpha-thalassemia deletions, including the -alpha(3.7) deletion, -alpha(4.2) deletion, Southeast Asian (--(SEA)), Filipino (--(FIL)) and Thai (--(THAI)) deletions. Gold nanoparticles (GNPs) were used as a pseudostationary phase to improve the resolution between DNA fragments in a low-viscosity polymer. To achieve the best CE separation, several parameters were evaluated for optimizing the separation conditions, including the capillary coating, the concentrations of polymer sieving matrix, the sizes and concentrations of GNPs, the buffer concentrations, and the pH. The final CE method for separating a 200-base pair (bp) DNA ladder and alpha-thalassemia deletions used a DB-17 capillary, 0.6% poly(ethylene oxide) (PEO) prepared in a mixture of GNP(32nm) solution and glycine buffer (25mM, pH 9.0) (80:20, v/v) as the sieving matrix with 1microM YO-PRO-1 for fluorescence detection; the applied voltage was -10kV (detector at anode side) and the separation temperature was 25 degrees C. Under these optimal conditions, 15 DNA fragments with sizes ranging from 0.2kb to 3.0kb were resolved within 11.5min. The RSDs of migration times were less than 2.81%. A total of 21 patients with alpha-thalassemia deletions were analyzed using this method, and all results showed good agreement with those obtained by gel electrophoresis.

Comparing Medline citations using modified N-grams

PubMed Central

Nawab, Rao Muhammad Adeel; Stevenson, Mark; Clough, Paul

2014-01-01

Objective We aim to identify duplicate pairs of Medline citations, particularly when the documents are not identical but contain similar information. Materials and methods Duplicate pairs of citations are identified by comparing word n-grams in pairs of documents. N-grams are modified using two approaches which take account of the fact that the document may have been altered. These are: (1) deletion, an item in the n-gram is removed; and (2) substitution, an item in the n-gram is substituted with a similar term obtained from the Unified Medical Language System  Metathesaurus. N-grams are also weighted using a score derived from a language model. Evaluation is carried out using a set of 520 Medline citation pairs, including a set of 260 manually verified duplicate pairs obtained from the Deja Vu database. Results The approach accurately detects duplicate Medline document pairs with an F1 measure score of 0.99. Allowing for word deletions and substitution improves performance. The best results are obtained by combining scores for n-grams of length 1–5 words. Discussion Results show that the detection of duplicate Medline citations can be improved by modifying n-grams and that high performance can also be obtained using only unigrams (F1=0.959), particularly when allowing for substitutions of alternative phrases. PMID:23715801

Comparing Medline citations using modified N-grams.

PubMed

Nawab, Rao Muhammad Adeel; Stevenson, Mark; Clough, Paul

2014-01-01

We aim to identify duplicate pairs of Medline citations, particularly when the documents are not identical but contain similar information. Duplicate pairs of citations are identified by comparing word n-grams in pairs of documents. N-grams are modified using two approaches which take account of the fact that the document may have been altered. These are: (1) deletion, an item in the n-gram is removed; and (2) substitution, an item in the n-gram is substituted with a similar term obtained from the Unified Medical Language System Metathesaurus. N-grams are also weighted using a score derived from a language model. Evaluation is carried out using a set of 520 Medline citation pairs, including a set of 260 manually verified duplicate pairs obtained from the Deja Vu database. The approach accurately detects duplicate Medline document pairs with an F1 measure score of 0.99. Allowing for word deletions and substitution improves performance. The best results are obtained by combining scores for n-grams of length 1-5 words. Results show that the detection of duplicate Medline citations can be improved by modifying n-grams and that high performance can also be obtained using only unigrams (F1=0.959), particularly when allowing for substitutions of alternative phrases.

Specialized Genetic Recombination Systems in Bacteria: Their Involvement in Gene Expression and Evolution,

DTIC Science & Technology

1980-01-01

genetics (Hayes 1968). This marvelous process is important in providing us with the breadth of phenotypic diversity that one sees within a single plant or...separate overall pro- cesses, but may share common components of DNA metabolism, such as winding/unwinding enzymes, ligase, polymerases , various nucle...incorpuoted DNA segmnent are re- paired by DNA polymerase and ligase. Any diffoernces (base mispairing’S, nil- cleotide additions or deletions) between

The crystal structure of an oligo(U):pre-mRNA duplex from a trypanosome RNA editing substrate

PubMed Central

Mooers, Blaine H.M.; Singh, Amritanshu

2011-01-01

Guide RNAs bind antiparallel to their target pre-mRNAs to form editing substrates in reaction cycles that insert or delete uridylates (Us) in most mitochondrial transcripts of trypanosomes. The 5′ end of each guide RNA has an anchor sequence that binds to the pre-mRNA by base-pair complementarity. The template sequence in the middle of the guide RNA directs the editing reactions. The 3′ ends of most guide RNAs have ∼15 contiguous Us that bind to the purine-rich unedited pre-mRNA upstream of the editing site. The resulting U-helix is rich in G·U wobble base pairs. To gain insights into the structure of the U-helix, we crystallized 8 bp of the U-helix in one editing substrate for the A6 mRNA of Trypanosoma brucei. The fragment provides three samples of the 5′-AGA-3′/5′-UUU-3′ base-pair triple. The fusion of two identical U-helices head-to-head promoted crystallization. We obtained X-ray diffraction data with a resolution limit of 1.37 Å. The U-helix had low and high twist angles before and after each G·U wobble base pair; this variation was partly due to shearing of the wobble base pairs as revealed in comparisons with a crystal structure of a 16-nt RNA with all Watson–Crick base pairs. Both crystal structures had wider major grooves at the junction between the poly(U) and polypurine tracts. This junction mimics the junction between the template helix and the U-helix in RNA-editing substrates and may be a site of major groove invasion by RNA editing proteins. PMID:21878548

ABCA7 frameshift deletion associated with Alzheimer disease in African Americans

PubMed Central

Cukier, Holly N.; Kunkle, Brian W.; Vardarajan, Badri N.; Rolati, Sophie; Hamilton-Nelson, Kara L.; Kohli, Martin A.; Whitehead, Patrice L.; Dombroski, Beth A.; Van Booven, Derek; Lang, Rosalyn; Dykxhoorn, Derek M.; Farrer, Lindsay A.; Cuccaro, Michael L.; Vance, Jeffery M.; Gilbert, John R.; Beecham, Gary W.; Martin, Eden R.; Carney, Regina M.; Mayeux, Richard; Schellenberg, Gerard D.; Byrd, Goldie S.; Haines, Jonathan L.

2016-01-01

Objective: To identify a causative variant(s) that may contribute to Alzheimer disease (AD) in African Americans (AA) in the ATP-binding cassette, subfamily A (ABC1), member 7 (ABCA7) gene, a known risk factor for late-onset AD. Methods: Custom capture sequencing was performed on ∼150 kb encompassing ABCA7 in 40 AA cases and 37 AA controls carrying the AA risk allele (rs115550680). Association testing was performed for an ABCA7 deletion identified in large AA data sets (discovery n = 1,068; replication n = 1,749) and whole exome sequencing of Caribbean Hispanic (CH) AD families. Results: A 44-base pair deletion (rs142076058) was identified in all 77 risk genotype carriers, which shows that the deletion is in high linkage disequilibrium with the risk allele. The deletion was assessed in a large data set (531 cases and 527 controls) and, after adjustments for age, sex, and APOE status, was significantly associated with disease (p = 0.0002, odds ratio [OR] = 2.13 [95% confidence interval (CI): 1.42–3.20]). An independent data set replicated the association (447 cases and 880 controls, p = 0.0117, OR = 1.65 [95% CI: 1.12–2.44]), and joint analysis increased the significance (p = 1.414 × 10−5, OR = 1.81 [95% CI: 1.38–2.37]). The deletion is common in AA cases (15.2%) and AA controls (9.74%), but in only 0.12% of our non-Hispanic white cohort. Whole exome sequencing of multiplex, CH families identified the deletion cosegregating with disease in a large sibship. The deleted allele produces a stable, detectable RNA strand and is predicted to result in a frameshift mutation (p.Arg578Alafs) that could interfere with protein function. Conclusions: This common ABCA7 deletion could represent an ethnic-specific pathogenic alteration in AD. PMID:27231719

Parameters of proteome evolution from histograms of amino-acid sequence identities of paralogous proteins

PubMed Central

Axelsen, Jacob Bock; Yan, Koon-Kiu; Maslov, Sergei

2007-01-01

Background The evolution of the full repertoire of proteins encoded in a given genome is mostly driven by gene duplications, deletions, and sequence modifications of existing proteins. Indirect information about relative rates and other intrinsic parameters of these three basic processes is contained in the proteome-wide distribution of sequence identities of pairs of paralogous proteins. Results We introduce a simple mathematical framework based on a stochastic birth-and-death model that allows one to extract some of this information and apply it to the set of all pairs of paralogous proteins in H. pylori, E. coli, S. cerevisiae, C. elegans, D. melanogaster, and H. sapiens. It was found that the histogram of sequence identities p generated by an all-to-all alignment of all protein sequences encoded in a genome is well fitted with a power-law form ~ p-γ with the value of the exponent γ around 4 for the majority of organisms used in this study. This implies that the intra-protein variability of substitution rates is best described by the Gamma-distribution with the exponent α ≈ 0.33. Different features of the shape of such histograms allow us to quantify the ratio between the genome-wide average deletion/duplication rates and the amino-acid substitution rate. Conclusion We separately measure the short-term ("raw") duplication and deletion rates rdup∗, rdel∗ which include gene copies that will be removed soon after the duplication event and their dramatically reduced long-term counterparts rdup, rdel. High deletion rate among recently duplicated proteins is consistent with a scenario in which they didn't have enough time to significantly change their functional roles and thus are to a large degree disposable. Systematic trends of each of the four duplication/deletion rates with the total number of genes in the genome were analyzed. All but the deletion rate of recent duplicates rdel∗ were shown to systematically increase with Ngenes. Abnormally flat shapes of sequence identity histograms observed for yeast and human are consistent with lineages leading to these organisms undergoing one or more whole-genome duplications. This interpretation is corroborated by our analysis of the genome of Paramecium tetraurelia where the p-4 profile of the histogram is gradually restored by the successive removal of paralogs generated in its four known whole-genome duplication events. PMID:18039386

Whole-genome resequencing of Escherichia coli K-12 MG1655 undergoing short-term laboratory evolution in lactate minimal media reveals flexible selection of adaptive mutations

PubMed Central

2009-01-01

Background Short-term laboratory evolution of bacteria followed by genomic sequencing provides insight into the mechanism of adaptive evolution, such as the number of mutations needed for adaptation, genotype-phenotype relationships, and the reproducibility of adaptive outcomes. Results In the present study, we describe the genome sequencing of 11 endpoints of Escherichia coli that underwent 60-day laboratory adaptive evolution under growth rate selection pressure in lactate minimal media. Two to eight mutations were identified per endpoint. Generally, each endpoint acquired mutations to different genes. The most notable exception was an 82 base-pair deletion in the rph-pyrE operon that appeared in 7 of the 11 adapted strains. This mutation conferred an approximately 15% increase to the growth rate when experimentally introduced to the wild-type background and resulted in an approximately 30% increase to growth rate when introduced to a background already harboring two adaptive mutations. Additionally, most endpoints had a mutation in a regulatory gene (crp or relA, for example) or the RNA polymerase. Conclusions The 82 base-pair deletion found in the rph-pyrE operon of many endpoints may function to relieve a pyrimidine biosynthesis defect present in MG1655. In contrast, a variety of regulators acquire mutations in the different endpoints, suggesting flexibility in overcoming regulatory challenges in the adaptation. PMID:19849850

Development of a PCR-based marker utilizing a deletion mutation in the dihydroflavonol 4-reductase (DFR) gene responsible for the lack of anthocyanin production in yellow onions (Allium cepa).

PubMed

Kim, Sunggil; Yoo, Kil Sun; Pike, Leonard M

2005-02-01

Bulb color in onions (Allium cepa) is an important trait, but the mechanism of color inheritance is poorly understood at the molecular level. A previous study showed that inactivation of the dihydroflavonol 4-reductase (DFR) gene at the transcriptional level resulted in a lack of anthocyanin production in yellow onions. The objectives of the present study were the identification of the critical mutations in the DFR gene (DFR-A) and the development of a PCR-based marker for allelic selection. We report the isolation of two additional DFR homologs (DFR-B and DFR-C). No unique sequences were identified in either DFR homolog, even in the untranslated region (UTR). Both genes shared more than 95% nucleotide sequence identity with the DFR-A gene. To obtain a unique sequence from each gene, we isolated the promoter regions. Sequences of the DFR-A and DFR-B promoters differed completely from one another, except for an approximately 100-bp sequence adjacent to the 5'UTR. It was possible to specifically amplify only the DFR-A gene using primers designed to anneal to the unique promoter region. The sequences of yellow and red DFR-A alleles were the same except for a single base-pair change in the promoter and an approximately 800-bp deletion within the 3' region of the yellow DFR-A allele. This deletion was used to develop a co-dominant PCR-based marker that segregated perfectly with color phenotypes in the F2 population. These results indicate that a deletion mutation in the yellow DFR-A gene results in the lack of anthocyanin production in yellow onions.

A 1.5 million–base pair inversion polymorphism in families with Williams-Beuren syndrome

PubMed Central

Osborne, Lucy R.; Li, Martin; Pober, Barbara; Chitayat, David; Bodurtha, Joann; Mandel, Ariane; Costa, Teresa; Grebe, Theresa; Cox, Sarah; Tsui, Lap-Chee; Scherer, Stephen W.

2010-01-01

Williams-Beuren syndrome (WBS) is most often caused by hemizygous deletion of a 1.5-Mb interval encompassing at least 17 genes at 7q11.23 (refs. 1, 2). As with many other haploinsufficiency diseases, the mechanism underlying the WBS deletion is thought to be unequal meiotic recombination, probably mediated by the highly homologous DNA that flanks the commonly deleted region3. Here, we report the use of interphase fluorescence in situ hybridization (FISH) and pulsed-field gel electrophoresis (PFGE) to identify a genomic polymorphism in families with WBS, consisting of an inversion of the WBS region. We have observed that the inversion is hemizygous in 3 of 11 (27%) atypical affected individuals who show a subset of the WBS phenotypic spectrum but do not carry the typical WBS microdeletion. Two of these individuals also have a parent who carries the inversion. In addition, in 4 of 12 (33%) families with a proband carrying the WBS deletion, we observed the inversion exclusively in the parent transmitting the disease-related chromosome. These results suggest the presence of a newly identified genomic variant within the population that may be associated with the disease. It may result in predisposition to primarily WBS-causing microdeletions, but may also cause translocations and inversions. PMID:11685205

Deletion of ultraconserved elements yields viable mice

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ahituv, Nadav; Zhu, Yiwen; Visel, Axel

2007-07-15

Ultraconserved elements have been suggested to retainextended perfect sequence identity between the human, mouse, and ratgenomes due to essential functional properties. To investigate thenecessities of these elements in vivo, we removed four non-codingultraconserved elements (ranging in length from 222 to 731 base pairs)from the mouse genome. To maximize the likelihood of observing aphenotype, we chose to delete elements that function as enhancers in amouse transgenic assay and that are near genes that exhibit markedphenotypes both when completely inactivated in the mouse as well as whentheir expression is altered due to other genomic modifications.Remarkably, all four resulting lines of mice lackingmore » these ultraconservedelements were viable and fertile, and failed to reveal any criticalabnormalities when assayed for a variety of phenotypes including growth,longevity, pathology and metabolism. In addition more targeted screens,informed by the abnormalities observed in mice where genes in proximityto the investigated elements had been altered, also failed to revealnotable abnormalities. These results, while not inclusive of all thepossible phenotypic impact of the deleted sequences, indicate thatextreme sequence constraint does not necessarily reflect crucialfunctions required for viability.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rechkoblit, Olga; Delaney, James C.; Essigmann, John M.

DNA is susceptible to alkylation damage by a number of environmental agents that modify the Watson-Crick edge of the bases. Such lesions, if not repaired, may be bypassed by Y-family DNA polymerases. The bypass polymerase Dpo4 is strongly inhibited by 1-methylguanine (m1G) and 3-methylcytosine (m3C), with nucleotide incorporation opposite these lesions being predominantly mutagenic. Further, extension after insertion of both correct and incorrect bases, introduces additional base substitution and deletion errors. Crystal structures of the Dpo4 ternary extension complexes with correct and mismatched 3'-terminal primer bases opposite the lesions reveal that both m1G and m3C remain positioned within the DNAmore » template/primer helix. However, both correct and incorrect pairing partners exhibit pronounced primer terminal nucleotide distortion, being primarily evicted from the DNA helix when opposite m1G or misaligned when pairing with m3C. Our studies provide insights into mechanisms related to hindered and mutagenic bypass of methylated lesions and models associated with damage recognition by repair demethylases.« less

Correlation between Waardenburg syndrome phenotype and genotype in a population of individuals with identified PAX3 mutations.

PubMed

DeStefano, A L; Cupples, L A; Arnos, K S; Asher, J H; Baldwin, C T; Blanton, S; Carey, M L; da Silva, E O; Friedman, T B; Greenberg, J; Lalwani, A K; Milunsky, A; Nance, W E; Pandya, A; Ramesar, R S; Read, A P; Tassabejhi, M; Wilcox, E R; Farrer, L A

1998-05-01

Waardenburg syndrome (WS) type 1 is an autosomal dominant disorder characterized by sensorineural hearing loss, pigmentary abnormalities of the eye, hair, and skin, and dystopia canthorum. The phenotype is variable and affected individuals may exhibit only one or a combination of several of the associated features. To assess the relationship between phenotype and gene defect, clinical and genotype data on 48 families (271 WS individuals) collected by members of the Waardenburg Consortium were pooled. Forty-two unique mutations in the PAX3 gene, previously identified in these families, were grouped in five mutation categories: amino acid (AA) substitution in the paired domain, AA substitution in the homeodomain, deletion of the Ser-Thr-Pro-rich region, deletion of the homeodomain and the Ser-Thr-Pro-rich region, and deletion of the entire gene. These mutation classes are based on the structure of the PAX3 gene and were chosen to group mutations predicted to have similar defects in the gene product. Association between mutation class and the presence of hearing loss, eye pigment abnormality, skin hypopigmentation, or white forelock was evaluated using generalized estimating equations, which allowed for incorporation of a correlation structure that accounts for potential similarity among members of the same family. Odds for the presence of eye pigment abnormality, white forelock, and skin hypopigmentation were 2, 8, and 5 times greater, respectively, for individuals with deletions of the homeodomain and the Pro-Ser-Thr-rich region compared to individuals with an AA substitution in the homeodomain. Odds ratios that differ significantly from 1.0 for these traits may indicate that the gene products resulting from different classes of mutations act differently in the expression of WS. Although a suggestive association was detected for hearing loss with an odds ratio of 2.6 for AA substitution in the paired domain compared with AA substitution in the homeodomain, this odds ratio did not differ significantly from 1.0.

Partial USH2A deletions contribute to Usher syndrome in Denmark.

PubMed

Dad, Shzeena; Rendtorff, Nanna D; Kann, Erik; Albrechtsen, Anders; Mehrjouy, Mana M; Bak, Mads; Tommerup, Niels; Tranebjærg, Lisbeth; Rosenberg, Thomas; Jensen, Hanne; Møller, Lisbeth B

2015-12-01

Usher syndrome is an autosomal recessive disorder characterized by congenital hearing impairment, progressive visual loss owing to retinitis pigmentosa and in some cases vestibular dysfunction. Usher syndrome is divided into three subtypes, USH1, USH2 and USH3. Twelve loci and eleven genes have so far been identified. Duplications and deletions in PCDH15 and USH2A that lead to USH1 and USH2, respectively, have previously been identified in patients from United Kingdom, Spain and Italy. In this study, we investigate the proportion of exon deletions and duplications in PCDH15 and USH2A in 20 USH1 and 30 USH2 patients from Denmark using multiplex ligation-dependent probe amplification (MLPA). Two heterozygous deletions were identified in USH2A, but no deletions or duplications were identified in PCDH15. Next-generation mate-pair sequencing was used to identify the exact breakpoints of the two deletions identified in USH2A. Our results suggest that USH2 is caused by USH2A exon deletions in a small fraction of the patients, whereas deletions or duplications in PCDH15 might be rare in Danish Usher patients.

pgRNAFinder: a web-based tool to design distance independent paired-gRNA.

PubMed

Xiong, Yuanyan; Xie, Xiaowei; Wang, Yanzhi; Ma, Wenbing; Liang, Puping; Songyang, Zhou; Dai, Zhiming

2017-11-15

The CRISPR/Cas System has been shown to be an efficient and accurate genome-editing technique. There exist a number of tools to design the guide RNA sequences and predict potential off-target sites. However, most of the existing computational tools on gRNA design are restricted to small deletions. To address this issue, we present pgRNAFinder, with an easy-to-use web interface, which enables researchers to design single or distance-free paired-gRNA sequences. The web interface of pgRNAFinder contains both gRNA search and scoring system. After users input query sequences, it searches gRNA by 3' protospacer-adjacent motif (PAM), and possible off-targets, and scores the conservation of the deleted sequences rapidly. Filters can be applied to identify high-quality CRISPR sites. PgRNAFinder offers gRNA design functionality for 8 vertebrate genomes. Furthermore, to keep pgRNAFinder open, extensible to any organism, we provide the source package for local use. The pgRNAFinder is freely available at http://songyanglab.sysu.edu.cn/wangwebs/pgRNAFinder/, and the source code and user manual can be obtained from https://github.com/xiexiaowei/pgRNAFinder. songyang@bcm.edu or daizhim@mail.sysu.edu.cn. Supplementary data are available at Bioinformatics online. © The Author(s) 2017. Published by Oxford University Press.

Characterization of the Complex Locus of Bean Encoding Polygalacturonase-Inhibiting Proteins Reveals Subfunctionalization for Defense against Fungi and Insects1

PubMed Central

D'Ovidio, Renato; Raiola, Alessandro; Capodicasa, Cristina; Devoto, Alessandra; Pontiggia, Daniela; Roberti, Serena; Galletti, Roberta; Conti, Eric; O'Sullivan, Donal; De Lorenzo, Giulia

2004-01-01

Polygalacturonase-inhibiting proteins (PGIPs) are extracellular plant inhibitors of fungal endopolygalacturonases (PGs) that belong to the superfamily of Leu-rich repeat proteins. We have characterized the full complement of pgip genes in the bean (Phaseolus vulgaris) genotype BAT93. This comprises four clustered members that span a 50-kb region and, based on their similarity, form two pairs (Pvpgip1/Pvpgip2 and Pvpgip3/Pvpgip4). Characterization of the encoded products revealed both partial redundancy and subfunctionalization against fungal-derived PGs. Notably, the pair PvPGIP3/PvPGIP4 also inhibited PGs of two mirid bugs (Lygus rugulipennis and Adelphocoris lineolatus). Characterization of Pvpgip genes of Pinto bean showed variations limited to single synonymous substitutions or small deletions. A three-amino acid deletion encompassing a residue previously identified as crucial for recognition of PG of Fusarium moniliforme was responsible for the inability of BAT93 PvPGIP2 to inhibit this enzyme. Consistent with the large variations observed in the promoter sequences, reverse transcription-PCR expression analysis revealed that the different family members differentially respond to elicitors, wounding, and salicylic acid. We conclude that both biochemical and regulatory redundancy and subfunctionalization of pgip genes are important for the adaptation of plants to pathogenic fungi and phytophagous insects. PMID:15299124

Characterization of the complex locus of bean encoding polygalacturonase-inhibiting proteins reveals subfunctionalization for defense against fungi and insects.

PubMed

D'Ovidio, Renato; Raiola, Alessandro; Capodicasa, Cristina; Devoto, Alessandra; Pontiggia, Daniela; Roberti, Serena; Galletti, Roberta; Conti, Eric; O'Sullivan, Donal; De Lorenzo, Giulia

2004-08-01

Polygalacturonase-inhibiting proteins (PGIPs) are extracellular plant inhibitors of fungal endopolygalacturonases (PGs) that belong to the superfamily of Leu-rich repeat proteins. We have characterized the full complement of pgip genes in the bean (Phaseolus vulgaris) genotype BAT93. This comprises four clustered members that span a 50-kb region and, based on their similarity, form two pairs (Pvpgip1/Pvpgip2 and Pvpgip3/Pvpgip4). Characterization of the encoded products revealed both partial redundancy and subfunctionalization against fungal-derived PGs. Notably, the pair PvPGIP3/PvPGIP4 also inhibited PGs of two mirid bugs (Lygus rugulipennis and Adelphocoris lineolatus). Characterization of Pvpgip genes of Pinto bean showed variations limited to single synonymous substitutions or small deletions. A three-amino acid deletion encompassing a residue previously identified as crucial for recognition of PG of Fusarium moniliforme was responsible for the inability of BAT93 PvPGIP2 to inhibit this enzyme. Consistent with the large variations observed in the promoter sequences, reverse transcription-PCR expression analysis revealed that the different family members differentially respond to elicitors, wounding, and salicylic acid. We conclude that both biochemical and regulatory redundancy and subfunctionalization of pgip genes are important for the adaptation of plants to pathogenic fungi and phytophagous insects.

DNA Sequences Proximal to Human Mitochondrial DNA Deletion Breakpoints Prevalent in Human Disease Form G-quadruplexes, a Class of DNA Structures Inefficiently Unwound by the Mitochondrial Replicative Twinkle Helicase*

PubMed Central

Bharti, Sanjay Kumar; Sommers, Joshua A.; Zhou, Jun; Kaplan, Daniel L.; Spelbrink, Johannes N.; Mergny, Jean-Louis; Brosh, Robert M.

2014-01-01

Mitochondrial DNA deletions are prominent in human genetic disorders, cancer, and aging. It is thought that stalling of the mitochondrial replication machinery during DNA synthesis is a prominent source of mitochondrial genome instability; however, the precise molecular determinants of defective mitochondrial replication are not well understood. In this work, we performed a computational analysis of the human mitochondrial genome using the “Pattern Finder” G-quadruplex (G4) predictor algorithm to assess whether G4-forming sequences reside in close proximity (within 20 base pairs) to known mitochondrial DNA deletion breakpoints. We then used this information to map G4P sequences with deletions characteristic of representative mitochondrial genetic disorders and also those identified in various cancers and aging. Circular dichroism and UV spectral analysis demonstrated that mitochondrial G-rich sequences near deletion breakpoints prevalent in human disease form G-quadruplex DNA structures. A biochemical analysis of purified recombinant human Twinkle protein (gene product of c10orf2) showed that the mitochondrial replicative helicase inefficiently unwinds well characterized intermolecular and intramolecular G-quadruplex DNA substrates, as well as a unimolecular G4 substrate derived from a mitochondrial sequence that nests a deletion breakpoint described in human renal cell carcinoma. Although G4 has been implicated in the initiation of mitochondrial DNA replication, our current findings suggest that mitochondrial G-quadruplexes are also likely to be a source of instability for the mitochondrial genome by perturbing the normal progression of the mitochondrial replication machinery, including DNA unwinding by Twinkle helicase. PMID:25193669

Genetic diagnosis of Duchenne and Becker muscular dystrophy using next-generation sequencing technology: comprehensive mutational search in a single platform.

PubMed

Lim, Byung Chan; Lee, Seungbok; Shin, Jong-Yeon; Kim, Jong-Il; Hwang, Hee; Kim, Ki Joong; Hwang, Yong Seung; Seo, Jeong-Sun; Chae, Jong Hee

2011-11-01

Duchenne muscular dystrophy or Becker muscular dystrophy might be a suitable candidate disease for application of next-generation sequencing in the genetic diagnosis because the complex mutational spectrum and the large size of the dystrophin gene require two or more analytical methods and have a high cost. The authors tested whether large deletions/duplications or small mutations, such as point mutations or short insertions/deletions of the dystrophin gene, could be predicted accurately in a single platform using next-generation sequencing technology. A custom solution-based target enrichment kit was designed to capture whole genomic regions of the dystrophin gene and other muscular-dystrophy-related genes. A multiplexing strategy, wherein four differently bar-coded samples were captured and sequenced together in a single lane of the Illumina Genome Analyser, was applied. The study subjects were 25 16 with deficient dystrophin expression without a large deletion/duplication and 9 with a known large deletion/duplication. Nearly 100% of the exonic region of the dystrophin gene was covered by at least eight reads with a mean read depth of 107. Pathogenic small mutations were identified in 15 of the 16 patients without a large deletion/duplication. Using these 16 patients as the standard, the authors' method accurately predicted the deleted or duplicated exons in the 9 patients with known mutations. Inclusion of non-coding regions and paired-end sequence analysis enabled accurate identification by increasing the read depth and providing information about the breakpoint junction. The current method has an advantage for the genetic diagnosis of Duchenne muscular dystrophy and Becker muscular dystrophy wherein a comprehensive mutational search may be feasible using a single platform.

Rare Copy Number Deletions Predict Individual Variation in Intelligence

PubMed Central

Yeo, Ronald A.; Gangestad, Steven W.; Liu, Jingyu; Calhoun, Vince D.; Hutchison, Kent E.

2011-01-01

Phenotypic variation in human intellectual functioning shows substantial heritability, as demonstrated by a long history of behavior genetic studies. Many recent molecular genetic studies have attempted to uncover specific genetic variations responsible for this heritability, but identified effects capture little variance and have proven difficult to replicate. The present study, motivated an interest in “mutation load” emerging from evolutionary perspectives, examined the importance of the number of rare (or infrequent) copy number variations (CNVs), and the total number of base pairs included in such deletions, for psychometric intelligence. Genetic data was collected using the Illumina 1MDuoBeadChip Array from a sample of 202 adult individuals with alcohol dependence, and a subset of these (N = 77) had been administered the Wechsler Abbreviated Scale of Intelligence (WASI). After removing CNV outliers, the impact of rare genetic deletions on psychometric intelligence was investigated in 74 individuals. The total length of the rare deletions significantly and negatively predicted intelligence (r = −.30, p = .01). As prior studies have indicated greater heritability in individuals with relatively higher parental socioeconomic status (SES), we also examined the impact of ethnicity (Anglo/White vs. Other), as a proxy measure of SES; these groups did not differ on any genetic variable. This categorical variable significantly moderated the effect of length of deletions on intelligence, with larger effects being noted in the Anglo/White group. Overall, these results suggest that rare deletions (between 5% and 1% population frequency or less) adversely affect intellectual functioning, and that pleotropic effects might partly account for the association of intelligence with health and mental health status. Significant limitations of this research, including issues of generalizability and CNV measurement, are discussed. PMID:21298096

MinION Analysis and Reference Consortium: Phase 2 data release and analysis of R9.0 chemistry.

PubMed

Jain, Miten; Tyson, John R; Loose, Matthew; Ip, Camilla L C; Eccles, David A; O'Grady, Justin; Malla, Sunir; Leggett, Richard M; Wallerman, Ola; Jansen, Hans J; Zalunin, Vadim; Birney, Ewan; Brown, Bonnie L; Snutch, Terrance P; Olsen, Hugh E

2017-01-01

Long-read sequencing is rapidly evolving and reshaping the suite of opportunities for genomic analysis. For the MinION in particular, as both the platform and chemistry develop, the user community requires reference data to set performance expectations and maximally exploit third-generation sequencing. We performed an analysis of MinION data derived from whole genome sequencing of Escherichia coli K-12 using the R9.0 chemistry, comparing the results with the older R7.3 chemistry. We computed the error-rate estimates for insertions, deletions, and mismatches in MinION reads. Run-time characteristics of the flow cell and run scripts for R9.0 were similar to those observed for R7.3 chemistry, but with an 8-fold increase in bases per second (from 30 bps in R7.3 and SQK-MAP005 library preparation, to 250 bps in R9.0) processed by individual nanopores, and less drop-off in yield over time. The 2-dimensional ("2D") N50 read length was unchanged from the prior chemistry. Using the proportion of alignable reads as a measure of base-call accuracy, 99.9% of "pass" template reads from 1-dimensional ("1D")  experiments were mappable and ~97% from 2D experiments. The median identity of reads was ~89% for 1D and ~94% for 2D experiments. The total error rate (miscall + insertion + deletion ) decreased for 2D "pass" reads from 9.1% in R7.3 to 7.5% in R9.0 and for template "pass" reads from 26.7% in R7.3 to 14.5% in R9.0. These Phase 2 MinION experiments serve as a baseline by providing estimates for read quality, throughput, and mappability. The datasets further enable the development of bioinformatic tools tailored to the new R9.0 chemistry and the design of novel biological applications for this technology. K: thousand, Kb: kilobase (one thousand base pairs), M: million, Mb: megabase (one million base pairs), Gb: gigabase (one billion base pairs).

Non-intrusive ultrasonic liquid-in-line detector for small diameter tubes

DOEpatents

Piper, Thomas C.

1982-01-01

An arrangement for deleting liquid in a line, using non-intrusive ultrasonic techniques is disclosed. In this arrangement, four piezoelectric crystals are arranged in pairs about a 0.072 inch o.d. pipe. An ultrasonic tone burst is transmitted along the pipe, between crystal pairs, and the amplitude of the received tone burst indicates the absence/presence of liquid in the pipe.

Testicular expressed genes are missing in familial X-Linked Kallmann syndrome due to two large different deletions in daughter's X chromosomes.

PubMed

Hershkovitz, Eli; Loewenthal, Neta; Peretz, Asaf; Parvari, Ruti

2008-01-01

X-linked Kallmann syndrome (KS) is caused mainly by point mutations, in the KAL1 gene. Large deletions >1 Mb are rare events in the human population and commonly result in contiguous gene syndromes. A search for the mutation causing KS carried out on two pairs of first-degree cousins of 2 sisters. Two different apparently independent deletions were found. The deleted sequences encompass the KAL1 gene and four known additional genes exclusively expressed in testis. Two of these genes belong to the FAM9 gene family, which shares some homology with the SCYP3 gene, previously implicated in azoospermia. One of the events causing the deletion may have been mediated by an L1 transposition, the other by a non-homologous end joining. Such non-homologous recombinations have not yet been reported in the KAL genomic region and thus this area may be more prone to deletions than previously expected. This is the first report on genetic characterization of KS with a deletion of solely testis-expressed genes. The absence of these genes may have unfavorable implications for the patients regarding future fertility. (c) 2008 S. Karger AG, Basel

Hereditary neuropathy with liability to pressure palsy: two cases of difficult diagnosis.

PubMed

Beydoun, Said R; Cho, Justin

2013-09-01

Hereditary neuropathy with liability to pressure palsies (HNPP) is an inherited autosomal dominant disorder that causes a polyneuropathy with predisposition for involvement at sites of compression and is often underdiagnosed or misdiagnosed due to its heterogeneity in clinical and electrophysiological presentation. We report 2 cases of HNPP, which were initially diagnosed and treated as either an acquired demyelinating disorder or alternative inherited demyelinating disorder. Thorough evaluation of repeat electrodiagnostic studies and genetic testing confirmed the diagnosis of HNPP in both cases. One case showed the classic peripheral myelin protein 22 (PMP22) deletion and the other case showed a previously reported single base pair deletion at Leu145 causing a frameshift mutation at the PMP22 gene. These cases underscore the difficulty of diagnosing HNPP, because of the variations in clinical and electrophysiological findings and reinforce the importance of a combination high index of clinical suspicion, electrodiagnostic testing, and genetic testing to make the diagnosis.

Cloning, sequencing, and expression of cDNA for human. beta. -glucuronidase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Oshima, A.; Kyle, J.W.; Miller, R.D.

1987-02-01

The authors report here the cDNA sequence for human placental ..beta..-glucuronidase (..beta..-D-glucuronoside glucuronosohydrolase, EC 3.2.1.31) and demonstrate expression of the human enzyme in transfected COS cells. They also sequenced a partial cDNA clone from human fibroblasts that contained a 153-base-pair deletion within the coding sequence and found a second type of cDNA clone from placenta that contained the same deletion. Nuclease S1 mapping studies demonstrated two types of mRNAs in human placenta that corresponded to the two types of cDNA clones isolated. The NH/sub 2/-terminal amino acid sequence determined for human spleen ..beta..-glucuronidase agreed with that inferred from the DNAmore » sequence of the two placental clones, beginning at amino acid 23, suggesting a cleaved signal sequence of 22 amino acids. When transfected into COS cells, plasmids containing either placental clone expressed an immunoprecipitable protein that contained N-linked oligosaccharides as evidenced by sensitivity to endoglycosidase F. However, only transfection with the clone containing the 153-base-pair segment led to expression of human ..beta..-glucuronidase activity. These studies provide the sequence for the full-length cDNA for human ..beta..-glucuronidase, demonstrate the existence of two populations of mRNA for ..beta..-glucuronidase in human placenta, only one of which specifies a catalytically active enzyme, and illustrate the importance of expression studies in verifying that a cDNA is functionally full-length.« less

Insertion and deletion mutagenesis of the human cytomegalovirus genome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Spaete, R.R.; Mocarski, E.S.

1987-10-01

Studies on human cytomegalovirus (CMV) have been limited by a paucity of molecular genetic techniques available for manipulating the viral genome. The authors have developed methods for site-specific insertion and deletion mutagenesis of CMV utilizing a modified Escherichia coli lacZ gene as a genetic marker. The lacZ gene was placed under the control of the major ..beta.. gene regulatory signals and inserted into the viral genome by homologous recombination, disrupting one of two copies of this ..beta.. gene within the L-component repeats of CMV DNA. They observed high-level expression of ..beta..-galactosidase by the recombinant in a temporally authentic manner, withmore » levels of this enzyme approaching 1% of total protein in infected cells. Thus, CMV is an efficient vector for high-level expression of foreign gene products in human cells. Using back selection of lacZ-deficient virus in the presence of the chromogenic substrate 5-bromo-4-chloro-3-indolyl ..beta..-D-galactoside, they generated random endpoint deletion mutants. Analysis of these mutant revealed that CMV DNA sequences flanking the insert had been removed, thereby establishing this approach as a means of determining whether sequences flanking a lacZ insertion are dispensable for viral growth. In an initial test of the methods, they have shown that 7800 base pairs of one copy of L-component repeat sequences can be deleted without affecting viral growth in human fibroblasts.« less

GM2 Gangliosidosis in Shiba Inu Dogs with an In-Frame Deletion in HEXB.

PubMed

Kolicheski, A; Johnson, G S; Villani, N A; O'Brien, D P; Mhlanga-Mutangadura, T; Wenger, D A; Mikoloski, K; Eagleson, J S; Taylor, J F; Schnabel, R D; Katz, M L

2017-09-01

Consistent with a tentative diagnosis of neuronal ceroid lipofuscinosis (NCL), autofluorescent cytoplasmic storage bodies were found in neurons from the brains of 2 related Shiba Inu dogs with a young-adult onset, progressive neurodegenerative disease. Unexpectedly, no potentially causal NCL-related variants were identified in a whole-genome sequence generated with DNA from 1 of the affected dogs. Instead, the whole-genome sequence contained a homozygous 3 base pair (bp) deletion in a coding region of HEXB. The other affected dog also was homozygous for this 3-bp deletion. Mutations in the human HEXB ortholog cause Sandhoff disease, a type of GM2 gangliosidosis. Thin-layer chromatography confirmed that GM2 ganglioside had accumulated in an affected Shiba Inu brain. Enzymatic analysis confirmed that the GM2 gangliosidosis resulted from a deficiency in the HEXB encoded protein and not from a deficiency in products from HEXA or GM2A, which are known alternative causes of GM2 gangliosidosis. We conclude that the homozygous 3-bp deletion in HEXB is the likely cause of the Shiba Inu neurodegenerative disease and that whole-genome sequencing can lead to the early identification of potentially disease-causing DNA variants thereby refocusing subsequent diagnostic analyses toward confirming or refuting candidate variant causality. Copyright © 2017 The Authors. Journal of Veterinary Internal Medicine published by Wiley Periodicals, Inc. on behalf of the American College of Veterinary Internal Medicine.

Muver, a computational framework for accurately calling accumulated mutations.

PubMed

Burkholder, Adam B; Lujan, Scott A; Lavender, Christopher A; Grimm, Sara A; Kunkel, Thomas A; Fargo, David C

2018-05-09

Identification of mutations from next-generation sequencing data typically requires a balance between sensitivity and accuracy. This is particularly true of DNA insertions and deletions (indels), that can impart significant phenotypic consequences on cells but are harder to call than substitution mutations from whole genome mutation accumulation experiments. To overcome these difficulties, we present muver, a computational framework that integrates established bioinformatics tools with novel analytical methods to generate mutation calls with the extremely low false positive rates and high sensitivity required for accurate mutation rate determination and comparison. Muver uses statistical comparison of ancestral and descendant allelic frequencies to identify variant loci and assigns genotypes with models that include per-sample assessments of sequencing errors by mutation type and repeat context. Muver identifies maximally parsimonious mutation pathways that connect these genotypes, differentiating potential allelic conversion events and delineating ambiguities in mutation location, type, and size. Benchmarking with a human gold standard father-son pair demonstrates muver's sensitivity and low false positive rates. In DNA mismatch repair (MMR) deficient Saccharomyces cerevisiae, muver detects multi-base deletions in homopolymers longer than the replicative polymerase footprint at rates greater than predicted for sequential single-base deletions, implying a novel multi-repeat-unit slippage mechanism. Benchmarking results demonstrate the high accuracy and sensitivity achieved with muver, particularly for indels, relative to available tools. Applied to an MMR-deficient Saccharomyces cerevisiae system, muver mutation calls facilitate mechanistic insights into DNA replication fidelity.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wu, Hong; Zeng, Hong; Lam, Robert

Mismatch repair prevents the accumulation of erroneous insertions/deletions and non-Watson–Crick base pairs in the genome. Pathogenic mutations in theMLH1gene are associated with a predisposition to Lynch and Turcot's syndromes. Although genetic testing for these mutations is available, robust classification of variants requires strong clinical and functional support. Here, the first structure of the N-terminus of human MLH1, determined by X-ray crystallography, is described. Lastly, the structure shares a high degree of similarity with previously determined prokaryoticMLH1homologs; however, this structure affords a more accurate platform for the classification ofMLH1variants.

[Pearson syndrome. Case report].

PubMed

Cammarata-Scalisi, Francisco; López-Gallardo, Ester; Emperador, Sonia; Ruiz-Pesini, Eduardo; Da Silva, Gloria; Camacho, Nolis; Montoya, Julio

2011-09-01

Among the etiologies of anemia in the infancy, the mitochondrial cytopathies are infrequent. Pearson syndrome is diagnosed principally during the initial stages of life and it is characterized by refractory sideroblastic anemia with vacuolization of marrow progenitor cells, exocrine pancreatic dysfunction and variable neurologic, hepatic, renal and endocrine failures. We report the case of a 14 month-old girl evaluated by a multicentric study, with clinic and molecular diagnosis of Pearson syndrome, with the 4,977-base pair common deletion of mitochondrial DNA. This entity has been associated to diverse phenotypes within the broad clinical spectrum of mitochondrial disease.

Transcriptional regulation by retinoic acid of interleukin-2 alpha receptors in human B cells.

PubMed Central

Bhatti, L; Sidell, N

1994-01-01

In this study, we demonstrated that retinoic acid (RA) up-regulated interleukin-2 receptor-alpha (IL-2R alpha) expression on two human B-cell lines, IE8.6 and SKW6.4. Deleted forms of the human IL-2R alpha promoter linked to the bacterial chloramphenicol acetyltransferase reporter gene were transfected into IE8.6 cells in order to define RA-responsive regulatory domains. Experiments using the -1.6 kb construct, which contains all known regulatory regions in the IL-2R alpha promoter, indicated that RA could induce IL-2R alpha promoter activity. The basal activity of the -471 construct was initially low, but was markedly enhanced by the addition of RA. Deletion of promoter sequences between -471 and -317 resulted in a significant augmentation of basal promoter activity and abolished promoter induction by RA. This finding revealed a requirement for sequences 5' of base -317 for RA-induced promoter activation, raising the possibility of the presence of both a RA response element and a negative regulatory element (NRE) upstream of base -317. Transfection studies with internal deletion mutants with the putative NRE removed resulted in increases in basal promoter activity and unresponsiveness to RA similar to the -317 construct. In contrast, an internal deletion mutant with the NRE intact had low basal activity and was inducible by RA similar to the -471 construct. Taken together, our results suggested that RA-induced activation of the IL-2R alpha promoter was through changes in the function of a NRE present between bases -400 and -368. This 31-base pair element may interact with an adjacent RA-responsive regulatory site as well as being responsible for down-regulation of basal IL-2R alpha expression under certain conditions. Images Figure 3 Figure 4 Figure 5 Figure 6 PMID:8157276

Analyses of interactions among pair-rule genes and the gap gene Krüppel in Bombyx segmentation.

PubMed

Nakao, Hajime

2015-09-01

In the short-germ insect Tribolium, a pair-rule gene circuit consisting of the Tribolium homologs of even-skipped, runt, and odd-skipped (Tc-eve, Tc-run and Tc-odd, respectively) has been implicated in segment formation. To examine the application of the model to other taxa, I studied the expression and function of pair-rule genes in Bombyx mori, together with a Bombyx homolog of Krüppel (Bm-Kr), a known gap gene. Knockdown embryos of Bombyx homologs of eve, run and odd (Bm-eve, Bm-run and Bm-odd) exhibited asegmental phenotypes similar to those of Tribolium knockdowns. However, pair-rule gene interactions were similar to those of both Tribolium and Drosophila, which, different from Tribolium, shows a hierarchical segmentation mode. Additionally, the Bm-odd expression pattern shares characteristics with those of Drosophila pair-rule genes that receive upstream regulatory input. On the other hand, Bm-Kr knockdowns exhibited a large posterior segment deletion as observed in short-germ insects. However, a detailed analysis of these embryos indicated that Bm-Kr modulates expression of pair-rule genes like in Drosophila, although the mechanisms appear to be different. This suggested hierarchical interactions between Bm-Kr and pair-rule genes. Based on these results, I concluded that the pair-rule gene circuit model that describes Tribolium development is not applicable to Bombyx. Copyright © 2015 Elsevier Inc. All rights reserved.

Novel factor VIII variants with a modified furin cleavage site improve the efficacy of gene therapy for hemophilia A.

PubMed

Nguyen, G N; George, L A; Siner, J I; Davidson, R J; Zander, C B; Zheng, X L; Arruda, V R; Camire, R M; Sabatino, D E

2017-01-01

Essentials Factor (F) VIII is an inefficiently expressed protein. Furin deletion FVIII variants were purified and characterized using in vitro and in vivo assays. These minimally modified novel FVIII variants have enhanced function. These variants provide a strategy for increasing FVIII expression in hemophilia A gene therapy. Background The major challenge for developing gene-based therapies for hemophilia A is that human factor VIII (hFVIII) has intrinsic properties that result in inefficient biosynthesis. During intracellular processing, hFVIII is predominantly cleaved at a paired basic amino acid cleaving enzyme (PACE) or furin cleavage site to yield a heterodimer that is the major form of secreted protein. Previous studies with B-domain-deleted (BDD) canine FVIII and hFVIII-R1645H, both differing from hFVIII by a single amino acid at this site, suggested that these proteins are secreted mainly in a single polypeptide chain (SC) form and exhibit enhanced function. Objective We hypothesized that deletion(s) of the furin site modulates FVIII biology and may enhance its function. Methods A series of recombinant hFVIII-furin deletion variants were introduced into hFVIII-BDD [Δ1645, 1645-46(Δ2), 1645-47(Δ3), 1645-48(Δ4), or Δ1648] and characterized. Results In vitro, recombinant purified Δ3 and Δ4 were primarily SC and, interestingly, had 2-fold higher procoagulant activity compared with FVIII-BDD. In vivo, the variants also have improved hemostatic function. After adeno-associated viral (AAV) vector delivery, the expression of these variants is 2-4-fold higher than hFVIII-BDD. Protein challenges of each variant in mice tolerant to hFVIII-BDD showed no anti-FVIII immune response. Conclusions These data suggest that the furin deletion hFVIII variants are superior to hFVIII-BDD without increased immunogenicity. In the setting of gene-based therapeutics, these novel variants provide a unique strategy to increase FVIII expression, thus lowering the vector dose, a critical factor for hemophilia A gene therapy. © 2016 The Authors. Journal of Thrombosis and Haemostasis published by Wiley Periodicals, Inc. on behalf of International Society on Thrombosis and Haemostasis.

Identification of a region of homozygous deletion in cervical carcinoma

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aburatani, H.; Housman, D.E.; Wang, Y.

1994-09-01

To identify the possible location of a tumor suppressor gene (TSG) for cervical carcinoma, we have scanned the tumor DNAs for homozygous deletion by Representational Difference Analysis (RDA). Matched pairs of tumor and normal DNA were restriction digested and PCR-amplified. The tumor DNA amplicon was used as a driver for subtraction to identify DNA fragments homozygously deleted in tumor DNA. We analysed 6 cervical cancer specimens (5 cell lines, 1 fresh tumor). Four out of 6 analyses produced difference products present only in normal DNA, which were either hemizygously or homozygously deleted in tumor DNA. The two samples which failedmore » to produce any difference products were cell lines established from dysplasia patients, on which genetic changes might be minimal. One cervical carcinoma cell line CC6 produced 11 difference products deleted homozygously, all of which are clustered in 3p12-13 region. The proximal short arm of chromosome 3 is known to have a high incidence of L.O.H. in cervical carcinoma and thus may be a locus for TSG. A 4 Mb YAC contig has been established over the deletion and its characterization is under way to facilitate the identification of possible TSGs in this region.« less

Identification of novel alleles of the rice blast resistance gene Pi54

NASA Astrophysics Data System (ADS)

Vasudevan, Kumar; Gruissem, Wilhelm; Bhullar, Navreet K.

2015-10-01

Rice blast is one of the most devastating rice diseases and continuous resistance breeding is required to control the disease. The rice blast resistance gene Pi54 initially identified in an Indian cultivar confers broad-spectrum resistance in India. We explored the allelic diversity of the Pi54 gene among 885 Indian rice genotypes that were found resistant in our screening against field mixture of naturally existing M. oryzae strains as well as against five unique strains. These genotypes are also annotated as rice blast resistant in the International Rice Genebank database. Sequence-based allele mining was used to amplify and clone the Pi54 allelic variants. Nine new alleles of Pi54 were identified based on the nucleotide sequence comparison to the Pi54 reference sequence as well as to already known Pi54 alleles. DNA sequence analysis of the newly identified Pi54 alleles revealed several single polymorphic sites, three double deletions and an eight base pair deletion. A SNP-rich region was found between a tyrosine kinase phosphorylation site and the nucleotide binding site (NBS) domain. Together, the newly identified Pi54 alleles expand the allelic series and are candidates for rice blast resistance breeding programs.

Genetic testing for oculocutaneous albinism type 1 and 2 and Hermansky-Pudlak syndrome type 1 and 3 mutations in Puerto Rico.

PubMed

Santiago Borrero, Pedro J; Rodríguez-Pérez, Yolanda; Renta, Jessicca Y; Izquierdo, Natalio J; Del Fierro, Laura; Muñoz, Daniel; Molina, Norma López; Ramírez, Sonia; Pagán-Mercado, Glorivee; Ortíz, Idith; Rivera-Caragol, Enid; Spritz, Richard A; Cadilla, Carmen L

2006-01-01

Hermansky-Pudlak syndrome (HPS) (MIM #203300) is a heterogeneous group of autosomal recessive disorders characterized by oculocutaneous albinism (OCA), bleeding tendency, and lysosomal dysfunction. HPS is very common in Puerto Rico (PR), particularly in the northwest part of the island, with a frequency of approximately 1:1,800. Two HPS genes and mutations have been identified in PR, a 16-base pair (bp) duplication in HPS1 and a 3,904-bp deletion in HPS3. In Puerto Ricans with more typical OCA, the most common mutation of the tyrosinase (TYR) (human tyrosinase (OCA1) gene) gene was G47D. We describe screening 229 Puerto Rican OCA patients for these mutations, and for mutations in the OCA2 gene. We found the HPS1 mutation in 42.8% of cases, the HPS3 deletion in 17%, the TYR G47D mutation in 3.0%, and a 2.4-kb deletion of the OCA2 gene in 1.3%. Among Puerto Rican newborns, the frequency of the HPS1 mutation is highest in northwest PR (1:21; 4.8%) and lower in central PR (1:64; 1.6%). The HPS3 gene deletion is most frequent in central PR (1:32; 3.1%). Our findings provide insights into the genetics of albinism and HPS in PR, and provide the basis for genetic screening for these disorders in this minority population.

Genetic Testing for Oculocutaneous Albinism Type 1 and 2 and Hermansky–Pudlak Syndrome Type 1 and 3 Mutations in Puerto Rico

PubMed Central

Santiago Borrero, Pedro J.; Rodríguez-Pérez, Yolanda; Renta, Jessicca Y.; Izquierdo, Natalio J.; del Fierro, Laura; Muñoz, Daniel; Molina, Norma López; Ramírez, Sonia; Pagán-Mercado, Glorivee; Ortíz, Idith; Rivera-Caragol, Enid; Spritz, Richard A.; Cadilla, Carmen L.

2013-01-01

Hermansky–Pudlak syndrome (HPS) (MIM #203300) is a heterogeneous group of autosomal recessive disorders characterized by oculocutaneous albinism (OCA), bleeding tendency, and lysosomal dysfunction. HPS is very common in Puerto Rico (PR), particularly in the northwest part of the island, with a frequency of ~1:1,800. Two HPS genes and mutations have been identified in PR, a 16-base pair (bp) duplication in HPS1 and a 3,904-bp deletion in HPS3. In Puerto Ricans with more typical OCA, the most common mutation of the tyrosinase (TYR) (human tyrosinase (OCA1) gene) gene was G47D. We describe screening 229 Puerto Rican OCA patients for these mutations, and for mutations in the OCA2 gene. We found the HPS1 mutation in 42.8% of cases, the HPS3 deletion in 17%, the TYR G47D mutation in 3.0%, and a 2.4-kb deletion of the OCA2 gene in 1.3%. Among Puerto Rican newborns, the frequency of the HPS1 mutation is highest in northwest PR (1:21; 4.8%) and lower in central PR (1:64; 1.6%). The HPS3 gene deletion is most frequent in central PR (1:32; 3.1%). Our findings provide insights into the genetics of albinism and HPS in PR, and provide the basis for genetic screening for these disorders in this minority population. PMID:16417222

Regulation of COL1A1 expression in type I collagen producing tissues: identification of a 49 base pair region which is required for transgene expression in bone of transgenic mice

NASA Technical Reports Server (NTRS)

Bedalov, A.; Salvatori, R.; Dodig, M.; Kronenberg, M. S.; Kapural, B.; Bogdanovic, Z.; Kream, B. E.; Woody, C. O.; Clark, S. H.; Mack, K.;

Disinfection by-products exposure and intra-uterine growth restriction: Do genetic polymorphisms of CYP2E1or deletion of GSTM1 or GSTT1 modify the association?

PubMed

Levallois, Patrick; Giguère, Yves; Nguile-Makao, Molière; Rodriguez, Manuel; Campagna, Céline; Tardif, Robert; Bureau, Alexandre

2016-01-01

Exposure to disinfection by-products (DBPs) during pregnancy was associated with reduced foetal growth. Genetic susceptibility might play a role, especially for genes encoding for the Cytochrome P450 (CYP2E1) and Glutathione S-Transferase (GST) enzymes, involved in metabolism and activation of DBPs. Few epidemiological studies evaluated these gene-environment interactions and their results were never replicated. This study aims to examine interactions between trihalomethanes (THM) or haloacetic acids (HAA) exposure and genetic polymorphisms on small for gestational age (SGA) neonates by investigating single nucleotide polymorphisms (SNPs) in CYP2E1 gene and GSTM1 and GSTT1 deletions in mothers-children pairs. A population-based case-control study of 1549 mothers and 1455 children was conducted on SGA and THM/HAA exposure. DNA was extracted from blood or saliva cells. Targeted SNPs and deletions were genotyped. Statistical interaction between SNPs/deletions and THMs or HAAs in utero exposure with regard to SGA occurrence was evaluated by unconditional logistic regression with control of potential confounders. Previously reported positive modification of the effect of THM uterine exposure by mothers or newborns CYP2E1 rs3813867 C allele or GSTM1 deletion was not replicated. However interactions with CYP2E1 rs117618383 and rs2515641 were observed but were not statistically significant after correction for multiple testing. Previous positive interactions between THMs exposure and CYP2E1 and GSTM1 were not replicated but interactions with other CYP2E1 polymorphisms are reported. Copyright © 2016 Elsevier Ltd. All rights reserved.

Cryptic deletions are a common finding in “balanced” reciprocal and complex chromosome rearrangements: a study of 59 patients

PubMed Central

De Gregori, M; Ciccone, R; Magini, P; Pramparo, T; Gimelli, S; Messa, J; Novara, F; Vetro, A; Rossi, E; Maraschio, P; Bonaglia, M C; Anichini, C; Ferrero, G B; Silengo, M; Fazzi, E; Zatterale, A; Fischetto, R; Previderé, C; Belli, S; Turci, A; Calabrese, G; Bernardi, F; Meneghelli, E; Riegel, M; Rocchi, M; SGuerneri; Lalatta, F; Zelante, L; Romano, C; Fichera, Ma; Mattina, T; Arrigo, G; Zollino, M; Giglio, S; Lonardo, F; Bonfante, A; Ferlini, A; Cifuentes, F; Van Esch, H; Backx, L; Schinzel, A; Vermeesch, J R; Zuffardi, O

2007-01-01

Using array comparative genome hybridisation (CGH) 41 de novo reciprocal translocations and 18 de novo complex chromosome rearrangements (CCRs) were screened. All cases had been interpreted as “balanced” by conventional cytogenetics. In all, 27 cases of reciprocal translocations were detected in patients with an abnormal phenotype, and after array CGH analysis, 11 were found to be unbalanced. Thus 40% (11 of 27) of patients with a “chromosomal phenotype” and an apparently balanced translocation were in fact unbalanced, and 18% (5 of 27) of the reciprocal translocations were instead complex rearrangements with >3 breakpoints. Fourteen fetuses with de novo, apparently balanced translocations, all but two with normal ultrasound findings, were also analysed and all were found to be normal using array CGH. Thirteen CCRs were detected in patients with abnormal phenotypes, two in women who had experienced repeated spontaneous abortions and three in fetuses. Sixteen patients were found to have unbalanced mutations, with up to 4 deletions. These results suggest that genome‐wide array CGH may be advisable in all carriers of “balanced” CCRs. The parental origin of the deletions was investigated in 5 reciprocal translocations and 11 CCRs; all were found to be paternal. Using customised platforms in seven cases of CCRs, the deletion breakpoints were narrowed down to regions of a few hundred base pairs in length. No susceptibility motifs were associated with the imbalances. These results show that the phenotypic abnormalities of apparently balanced de novo CCRs are mainly due to cryptic deletions and that spermatogenesis is more prone to generate multiple chaotic chromosome imbalances and reciprocal translocations than oogenesis. PMID:17766364

Disinfection by-products exposure and intra-uterine growth restriction: do genetic polymorphisms of CYP2E1or deletion of GSTM1 or GSTT1 modify the association?

PubMed Central

Levallois, Patrick; Giguère, Yves; Nguile-Makao, Molière; Rodriguez, Manuel; Campagna, Céline; Tardif, Robert; Bureau, Alexandre

2016-01-01

Background Exposure to disinfection by-products (DBPs) during pregnancy was associated with reduced fetal growth. Genetic susceptibility might play a role, especially for genes encoding for the Cytochrome P450 (CYP2E1) and Glutathione S-Transferase (GST) enzymes, involved in metabolism and activation of DBPs. Few epidemiological studies evaluated these gene-environment interactions and their results were never replicated. Objective This study aims to examine interactions between trihalomethanes (THM) or haloacetic acids (HAA) exposure and genetic polymorphisms on small for gestational age (SGA) neonates by investigating single nucleotide polymorphisms (SNPs) in CYP2E1 gene and GSTM1 and GSTT1 deletions in mothers-children pairs. Methods A population-based case-control study of 1549 mothers and 1455 children was conducted on SGA and THM/HAA exposure. DNA was extracted from blood or saliva cells. Targeted SNPs and deletions were genotyped. Statistical interaction between SNPs/deletions and THMs or HAAs in utero exposure with regard to SGA occurrence was evaluated by unconditional logistic regression with control of potential confounders. Results Previously reported positive modification of the effect of THM uterine exposure by mothers or newborns CYP2E1 rs3813867 C allele or GSTM1 deletion was not replicated. However interactions with CYP2E1 rs117618383 and rs2515641 were observed but were not statistically significant after correction for multiple testing. Conclusions Previous positive interactions between THMs exposure and CYP2E1 and GSTM1 were not replicated but interactions with other CYP2E1 polymorphisms are reported. PMID:27107227

Waardenburg syndrome type 3 (Klein-Waardenburg syndrome) segregating with a heterozygous deletion in the paired box domain of PAX3: a simple variant or a true syndrome?

PubMed

Tekin, M; Bodurtha, J N; Nance, W E; Pandya, A

2001-10-01

Klein-Waardenburg syndrome or Waardenburg syndrome type 3 (WS-III; MIM 148820) is characterized by the presence of musculoskeletal abnormalities in association with clinical features of Waardenburg syndrome type 1 (WS-I). Since the description of the first patient in 1947 (D. Klein, Arch Klaus Stift Vererb Forsch 1947: 22: 336-342), a few cases have been reported. Only occasional families have demonstrated autosomal-dominant inheritance of WS-III. In a previous report, a missense mutation in the paired domain of the PAX3 gene has been described in a family with dominant segregation of WS-III. In this report, we present a second family (mother and son) with typical clinical findings of WS-III segregating with a heterozygous 13-bp deletion in the paired domain of the PAX3 gene. Although homozygosity or compound heterozygosity has also been documented in patients with severe limb involvement, a consistent genotype-phenotype correlation for limb abnormalities associated with heterozygous PAX3 mutations has not previously been apparent. Heterozygous mutations could either reflect a unique dominant-negative effect or possibly the contribution of other unlinked genetic modifiers in determining the phenotype.

Plasticity of genetic interactions in metabolic networks of yeast.

PubMed

Harrison, Richard; Papp, Balázs; Pál, Csaba; Oliver, Stephen G; Delneri, Daniela

2007-02-13

Why are most genes dispensable? The impact of gene deletions may depend on the environment (plasticity), the presence of compensatory mechanisms (mutational robustness), or both. Here, we analyze the interaction between these two forces by exploring the condition-dependence of synthetic genetic interactions that define redundant functions and alternative pathways. We performed systems-level flux balance analysis of the yeast (Saccharomyces cerevisiae) metabolic network to identify genetic interactions and then tested the model's predictions with in vivo gene-deletion studies. We found that the majority of synthetic genetic interactions are restricted to certain environmental conditions, partly because of the lack of compensation under some (but not all) nutrient conditions. Moreover, the phylogenetic cooccurrence of synthetically interacting pairs is not significantly different from random expectation. These findings suggest that these gene pairs have at least partially independent functions, and, hence, compensation is only a byproduct of their evolutionary history. Experimental analyses that used multiple gene deletion strains not only confirmed predictions of the model but also showed that investigation of false predictions may both improve functional annotation within the model and also lead to the discovery of higher-order genetic interactions. Our work supports the view that functional redundancy may be more apparent than real, and it offers a unified framework for the evolution of environmental adaptation and mutational robustness.

Mitochondrial DNA deletions in patients with chronic suppurative otitis media.

PubMed

Tatar, Arzu; Tasdemir, Sener; Sahin, Ibrahim; Bozoglu, Ceyda; Erdem, Haktan Bagis; Yoruk, Ozgur; Tatar, Abdulgani

2016-09-01

The aim of this study was to investigate the 4977 and 7400 bp deletions of mitochondrial DNA in patients with chronic suppurative otitis media and to indicate the possible association of mitochondrial DNA deletions with chronic suppurative otitis media. Thirty-six patients with chronic suppurative otitis media were randomly selected to assess the mitochondrial DNA deletions. Tympanomastoidectomy was applied for the treatment of chronic suppurative otitis media, and the curettage materials including middle ear tissues were collected. The 4977 and 7400 bp deletion regions and two control regions of mitochondrial DNA were assessed by using the four pair primers. DNA was extracted from middle ear tissues and peripheral blood samples of the patients, and then polymerase chain reactions (PCRs) were performed. PCR products were separated in 2 % agarose gel. Seventeen of 36 patients had the heterozygote 4977 bp deletion in the middle ear tissue but not in peripheral blood. There wasn't any patient who had the 7400 bp deletion in mtDNA of their middle ear tissue or peripheral blood tissue. The patients with the 4977 bp deletion had a longer duration of chronic suppurative otitis media and a higher level of hearing loss than the others (p < 0.01). Long time chronic suppurative otitis media and the reactive oxygen species can cause the mitochondrial DNA deletions and this may be a predisposing factor to sensorineural hearing loss in chronic suppurative otitis media. An antioxidant drug as a scavenger agent may be used in long-term chronic suppurative otitis media.

Interactions between the promoter and first intron are involved in transcriptional control of alpha 1(I) collagen gene expression.

PubMed Central

Bornstein, P; McKay, J; Liska, D J; Apone, S; Devarayalu, S

1988-01-01

The first intron of the human collagen alpha 1(I) gene contains several positively and negatively acting elements. We have studied the transcription of collagen-human growth hormone fusion genes, containing deletions and rearrangements of collagen intronic sequences, by transient transfection of chick tendon fibroblasts and NIH 3T3 cells. In chick tendon fibroblasts, but not in 3T3 cells, inversion of intronic sequences containing a previously studied 274-base-pair segment, A274, resulted in markedly reduced human growth hormone mRNA levels as determined by an RNase protection assay. This inhibitory effect was largely alleviated when deletions were introduced in the collagen promoter of plasmids containing negatively oriented intronic sequences. Evidence for interaction of the promoter with the intronic segment, A274, was obtained by gel mobility shift assays. We suggest that promoter-intron interactions, mediated by DNA-binding proteins, regulate collagen gene transcription. Inversion of intronic segments containing critical interactive elements might then lead to an altered geometry and reduced activity of a transcriptional complex in those cells with sufficiently high levels of appropriate transcription factors. We further suggest that the deleted promoter segment plays a key role in directing DNA interactions involved in transcriptional control. Images PMID:3211130

The Common Inversion of the Williams–Beuren Syndrome Region at 7q11.23 Does Not Cause Clinical Symptoms

PubMed Central

Tam, Elaine; Young, Edwin J.; Morris, Colleen A.; Marshall, Christian R.; Loo, Wayne; Scherer, Stephen W.; Mervis, Carolyn B.; Osborne, Lucy R.

2010-01-01

Williams–Beuren syndrome (WBS) is caused by a ~1.5 million base pair deletion at 7q11.23. A common inversion of the region, WBSinv-1, exists as a polymorphism but was also found in individuals with WBS-like features but no deletion, suggesting it could cause clinical symptoms. We performed a full clinical, developmental and genetic assessment of two previously reported individuals with clinical symptoms and WBSinv-1 but no 7q11.23 deletion. We also examined expression of genes at 7q11.23 in individuals in the general population who have WBSinv-1. We show that individuals with clinical symptoms and WBSinv-1 do not show significant clinical or psychological overlap with individuals with WBS. In addition, a 1.3 Mb duplication of part of the velocardiofacial syndrome region on chromosome 22q11.2 was found in one participant with WBSinv-1 and clinical symptoms. We also demonstrate that individuals with WBSinv-1 show normal expression of genes from the WBS region. These results suggest that WBSinv-1 does not cause clinical symptoms and we advise caution when diagnosing individuals with atypical presentation of rare syndromes. Whole genome analysis may reveal previously unidentified copy number variants that could contribute to syndromic features. PMID:18553513

A Frameshift Mutation within LAMC2 Is Responsible for Herlitz Type Junctional Epidermolysis Bullosa (HJEB) in Black Headed Mutton Sheep

PubMed Central

Mömke, Stefanie; Kerkmann, Andrea; Wöhlke, Anne; Ostmeier, Miriam; Hewicker-Trautwein, Marion; Ganter, Martin; Kijas, James; Distl, Ottmar

2011-01-01

Junctional epidermolysis bullosa (JEB) is a hereditary mechanobullous skin disease in humans and animals. A Herlitz type JEB was identified in German Black Headed Mutton (BHM) sheep and affected lambs were reproduced in a breeding trial. Affected lambs showed skin and mucous membranes blistering and all affected lambs died within the first weeks of life. The pedigree data were consistent with a monogenic autosomal recessive inheritance. Immunofluorescence showed a reduced expression of laminin 5 protein which consists of 3 subunits encoded by the genes LAMA3, LAMB3 and LAMC2. We screened these genes for polymorphisms. Linkage and genome-wide association analyses identified LAMC2 as the most likely candidate for HJEB. A two base pair deletion within exon 18 of the LAMC2 gene (FM872310:c.2746delCA) causes a frameshift mutation resulting in a premature stop codon (p.A928*) 13 triplets downstream of this mutation and in addition, introduces an alternative splicing of exon 18 LAMC2. This deletion showed a perfect co-segregation with HJEB in all 740 analysed BHM sheep. Identification of the LAMC2 deletion means an animal model for HJEB is now available to develop therapeutic approaches of relevance to the human form of this disease. PMID:21573221

Chimerism for 20q11.2 microdeletion of GDF5 explains discordant phenotypes in monochorionic-diamniotic twins.

PubMed

Meredith, Matthew M; Crabb, Beau; Vargas, Marcelo; Hirsch, Betsy A

2017-12-01

Microdeletions of 20q11.2 are rare but have been associated with characteristic clinical findings. A 1.6 Mb minimal critical region has been identified that includes three OMIM genes: GDF5, EPB41L1, and SAMHD. Here we describe a male monozygotic, monochorionic-diamniotic twin pair with discordant phenotypes, one with multiple findings that overlap with those reported in 20q11.2 deletions, and the other unaffected. Microarray analysis revealed mosaicism for a 363 Kb deletion encompassing GDF5 in the peripheral blood of both twins, which was confirmed by FISH. Subsequent FISH on buccal cells identified the deletion only in the affected twin. The blood FISH findings were interpreted as representing chimerism resulting from anastomosis and the blood exchange between the twins in utero. The implications of this finding are discussed, as is the contribution of GDF5 to the associated clinical findings of 20q11.2 deletions. © 2017 Wiley Periodicals, Inc.

Identification of essential genes and synthetic lethal gene combinations in Escherichia coli K-12.

PubMed

Mori, Hirotada; Baba, Tomoya; Yokoyama, Katsushi; Takeuchi, Rikiya; Nomura, Wataru; Makishi, Kazuichi; Otsuka, Yuta; Dose, Hitomi; Wanner, Barry L

2015-01-01

Here we describe the systematic identification of single genes and gene pairs, whose knockout causes lethality in Escherichia coli K-12. During construction of precise single-gene knockout library of E. coli K-12, we identified 328 essential gene candidates for growth in complex (LB) medium. Upon establishment of the Keio single-gene deletion library, we undertook the development of the ASKA single-gene deletion library carrying a different antibiotic resistance. In addition, we developed tools for identification of synthetic lethal gene combinations by systematic construction of double-gene knockout mutants. We introduce these methods herein.

Life without tRNAIle-lysidine synthetase: translation of the isoleucine codon AUA in Bacillus subtilis lacking the canonical tRNA2Ile

PubMed Central

Köhrer, Caroline; Mandal, Debabrata; Gaston, Kirk W.; Grosjean, Henri; Limbach, Patrick A.; RajBhandary, Uttam L.

2014-01-01

Translation of the isoleucine codon AUA in most prokaryotes requires a modified C (lysidine or agmatidine) at the wobble position of tRNA2Ile to base pair specifically with the A of the AUA codon but not with the G of AUG. Recently, a Bacillus subtilis strain was isolated in which the essential gene encoding tRNAIle-lysidine synthetase was deleted for the first time. In such a strain, C34 at the wobble position of tRNA2Ile is expected to remain unmodified and cells depend on a mutant suppressor tRNA derived from tRNA1Ile, in which G34 has been changed to U34. An important question, therefore, is how U34 base pairs with A without also base pairing with G. Here, we show (i) that unlike U34 at the wobble position of all B. subtilis tRNAs of known sequence, U34 in the mutant tRNA is not modified, and (ii) that the mutant tRNA binds strongly to the AUA codon on B. subtilis ribosomes but only weakly to AUG. These in vitro data explain why the suppressor strain displays only a low level of misreading AUG codons in vivo and, as shown here, grows at a rate comparable to that of the wild-type strain. PMID:24194599

Deletions at SLC18A1 increased the risk of CRC and lower SLC18A1 expression associated with poor CRC outcome.

PubMed

Zhang, Dandan; Li, Zhenli; Xu, Xiaohong; Zhou, Dan; Tang, Shunli; Yin, Xiaoyang; Xu, Fangying; Li, Hui; Zhou, Yuan; Zhu, Tao; Deng, Hong; Zhang, Shuai; Huang, Qiong; Wang, Jing; Yin, Wei; Zhu, Yimin; Lai, Maode

2017-10-26

Copy number variations (CNVs) contribute to the development of colorectal cancer (CRC). We conducted a two-stage association study to identify CNV risk loci for CRC. We performed a gene-based rare CNV study on 694 sporadic CRC and 1641 controls using Illumina Human-OmniExpress-12v1.0 BeadChips, and further replicated in 934 CRC cases and 2680 controls for risk CNVs by using TaqMan Copy Number Assay. Tumor buddings, cancer cells in the center of primary tumor and normal intestinal epithelial cells were captured using laser capture microdissection (LCM) and were assayed using AffymetrixGeneChip® Human Genome U133 Plus 2.0 Array. In addition, The Cancer Genome Atlas (TCGA) and Gene Expression Omnibus data were assessed for the effects of risk CNVs. We found that germline deletions affecting the last six exons of SLC18A1 significantly associated with CRC with a combined P value of 6.4 × 10-5 by a two-stage analysis. Both in TCGA CRC RNA seq dataset and GDS4382, SLC18A1 was significantly down regulated in CRC tissues than in paired normal tissues (N = 32 and 17 pairs, P = 0.004 and 0.009, respectively). In LCM samples, similar observations were obtained that the expression levels of SLC18A1 in the tumor buddings, cancer cells in the center of primary tumor, and stroma of both tumor budding and cancer cells were lower than normal intestinal epithelial and stromal cells (fold change = 0.17-0.62, 0.12-0.57 and 0.37-0.68, respectively). In summary, the germline deletions at SLC18A1 contributed to the development of CRC. The role of SLC18A1 required further exploration. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Gustaf: Detecting and correctly classifying SVs in the NGS twilight zone.

PubMed

Trappe, Kathrin; Emde, Anne-Katrin; Ehrlich, Hans-Christian; Reinert, Knut

2014-12-15

The landscape of structural variation (SV) including complex duplication and translocation patterns is far from resolved. SV detection tools usually exhibit low agreement, are often geared toward certain types or size ranges of variation and struggle to correctly classify the type and exact size of SVs. We present Gustaf (Generic mUlti-SpliT Alignment Finder), a sound generic multi-split SV detection tool that detects and classifies deletions, inversions, dispersed duplications and translocations of ≥ 30 bp. Our approach is based on a generic multi-split alignment strategy that can identify SV breakpoints with base pair resolution. We show that Gustaf correctly identifies SVs, especially in the range from 30 to 100 bp, which we call the next-generation sequencing (NGS) twilight zone of SVs, as well as larger SVs >500 bp. Gustaf performs better than similar tools in our benchmark and is furthermore able to correctly identify size and location of dispersed duplications and translocations, which otherwise might be wrongly classified, for example, as large deletions. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Effects of Spirulina platensis on DNA damage and chromosomal aberration against cadmium chloride-induced genotoxicity in rats.

PubMed

Aly, Fayza M; Kotb, Ahmed M; Hammad, Seddik

2018-04-01

Todays, bioactive compounds extracted from Spirulina platensis have been intensively studied for their therapeutical values. Therefore, in the present study, we aimed to evaluate the effects of S. platensis extract on DNA damage and chromosomal aberrations induced by cadmium in rats. Four groups of male albino rats (n = 7 rats) were used. The first group served as a control group and received distilled water. The second group was exposed intraperitoneally to cadmium chloride (CdCl 2 ) (3.5 mg/kg body weight dissolved in 2 ml distilled water). The third group included the rats that were orally treated with S. platensis extract (1 g/kg dissolved in 5 ml distilled water, every other day for 30 days). The fourth group included the rats that were intraperitoneally and orally exposed to cadmium chloride and S. platensis, respectively. The experiment in all groups was extended for 60 days. The results of cadmium-mediated toxicity revealed significant genetic effects (DNA fragmentation, deletion or disappearance of some base pairs of DNA, and appearance of few base pairs according to ISSR-PCR analysis). Moreover, chromosomes showed structural aberrations such as reduction of chromosomal number, chromosomal ring, chromatid deletions, chromosomal fragmentations, and dicentric chromosomes. Surprisingly, S. platensis extract plus CdCl 2 -treated group showed less genetic effects compared with CdCl 2 alone. Further, S. platensis extract upon CdCl 2 toxicity was associated with less chromosomal aberration number and nearly normal appearance of DNA fragments as indicated by the bone marrow and ISSR-PCR analysis, respectively. In conclusion, the present novel study showed that co-treatment with S. platensis extract could reduce the genotoxic effects of CdCl 2 in rats.

Diagnosis of Xeroderma Pigmentosum Groups A and C by Detection of Two Prevalent Mutations in West Algerian Population: A Rapid Genotyping Tool for the Frequent XPC Mutation c.1643_1644delTG

PubMed Central

Bensenouci, Salima; Louhibi, Lotfi; De Verneuil, Hubert; Mahmoudi, Khadidja; Saidi-Mehtar, Nadhira

2016-01-01

Xeroderma pigmentosum (XP) is a rare autosomal recessive disorder. Considering that XP patients have a defect of the nucleotide excision repair (NER) pathway which enables them to repair DNA damage caused by UV light, they have an increased risk of developing skin and eyes cancers. In the present study, we investigated the involvement of the prevalent XPA and XPC genes mutations—nonsense mutation (c.682C>T, p.Arg228X) and a two-base-pair (2 bp) deletion (c.1643_1644delTG or p.Val548Ala fsX25), respectively—in 19 index cases from 19 unrelated families in the West of Algeria. For the genetic diagnosis of XPA gene, we proceeded to PCR-RFLP. For the XPC gene, we validated a routine analysis which includes a specific amplification of a short region surrounding the 2 bp deletion using a fluorescent primer and fragment sizing (GeneScan size) on a sequencing gel. Among the 19 index cases, there were 17 homozygous patients for the 2 bp deletion in the XPC gene and 2 homozygous patients carrying the nonsense XPA mutation. Finally, XPC appears to be the major disease-causing gene concerning xeroderma pigmentosum in North Africa. The use of fragment sizing is the simplest method to analyze this 2 bp deletion for the DNA samples coming from countries where the mutation c.1643_1644delTG of XPC gene is prevalent. PMID:27413738

Diagnosis of Xeroderma Pigmentosum Groups A and C by Detection of Two Prevalent Mutations in West Algerian Population: A Rapid Genotyping Tool for the Frequent XPC Mutation c.1643_1644delTG.

PubMed

Bensenouci, Salima; Louhibi, Lotfi; De Verneuil, Hubert; Mahmoudi, Khadidja; Saidi-Mehtar, Nadhira

2016-01-01

Xeroderma pigmentosum (XP) is a rare autosomal recessive disorder. Considering that XP patients have a defect of the nucleotide excision repair (NER) pathway which enables them to repair DNA damage caused by UV light, they have an increased risk of developing skin and eyes cancers. In the present study, we investigated the involvement of the prevalent XPA and XPC genes mutations-nonsense mutation (c.682C>T, p.Arg228X) and a two-base-pair (2 bp) deletion (c.1643_1644delTG or p.Val548Ala fsX25), respectively-in 19 index cases from 19 unrelated families in the West of Algeria. For the genetic diagnosis of XPA gene, we proceeded to PCR-RFLP. For the XPC gene, we validated a routine analysis which includes a specific amplification of a short region surrounding the 2 bp deletion using a fluorescent primer and fragment sizing (GeneScan size) on a sequencing gel. Among the 19 index cases, there were 17 homozygous patients for the 2 bp deletion in the XPC gene and 2 homozygous patients carrying the nonsense XPA mutation. Finally, XPC appears to be the major disease-causing gene concerning xeroderma pigmentosum in North Africa. The use of fragment sizing is the simplest method to analyze this 2 bp deletion for the DNA samples coming from countries where the mutation c.1643_1644delTG of XPC gene is prevalent.

The chicken skeletal alpha-actin gene promoter region exhibits partial dyad symmetry and a capacity to drive bidirectional transcription.

PubMed Central

Grichnik, J M; French, B A; Schwartz, R J

1988-01-01

The chicken skeletal alpha-actin gene promoter region (-202 to -12) provides myogenic transcriptional specificity. This promoter contains partial dyad symmetry about an axis at nucleotide -108 and in transfection experiments is capable of directing transcription in a bidirectional manner. At least three different transcription initiation start sites, oriented toward upstream sequences, were mapped 25 to 30 base pairs from TATA-like regions. The opposing transcriptional activity was potentiated upon the deletion of sequences proximal to the alpha-actin transcription start site. Thus, sequences which serve to position RNA polymerase for alpha-actin transcription may allow, in their absence, the selection of alternative and reverse-oriented start sites. Nuclear runoff transcription assays of embryonic muscle indicated that divergent transcription may occur in vivo but with rapid turnover of nuclear transcripts. Divergent transcriptional activity enabled us to define the 3' regulatory boundary of the skeletal alpha-actin promoter which retains a high level of myogenic transcriptional activity. The 3' regulatory border was detected when serial 3' deletions bisected the element (-91 CCAAA TATGG -82) which reduced transcriptional activity by 80%. Previously we showed that disruption of its upstream counterpart (-127 CCAAAGAAGG -136) resulted in about a 90% decrease in activity. These element pairs, which we describe as CCAAT box-associated repeats, are conserved in all sequenced vertebrate sarcomeric actin genes and may act in a cooperative manner to facilitate transcription in myogenic cells. Images PMID:3211124

Nonhomologous Pairing in Mice Heterozygous for a t Haplotype Can Produce Recombinant Chromosomes with Duplications and Deletions

PubMed Central

Sarvetnick, Nora; Fox, Howard S.; Mann, Elizabeth; Mains, Paul E.; Elliott, Rosemary W.; Silver, Lee M.

1986-01-01

We have investigated the structure and properties of a chromosomal product recovered from a rare recombination event between a t haplotype and a wild-type form of mouse chromosome 17. Our embryological and molecular studies indicate that this chromosome (twLub2 ) is characterized by both a deletion and duplication of adjacent genetic material. The deletion appears to be responsible for a dominant lethal maternal effect and a recessive embryonic lethality. The duplication provides an explanation for the twLub2 suppression of the dominant T locus phenotype. A reanalysis of previously described results with another chromosome 17 variant called TtOrl indicates a structure for this chromosome that is reciprocal to that observed for twLub2. We have postulated the existence of an inversion over the proximal portion of all complete t haplotypes in order to explain the generation of the partial t haplotypes t wLub2 and TtOrl. This proximal inversion and the previously described distal inversion are sufficient to account for all of the recombination properties that are characteristic of complete t haplotypes. The structures determined for twLub2 and TtOrl indicate that rare recombination can occur between nonequivalent genomic sequences within the inverted proximal t region when wild-type and t chromosomes are paired in a linear, nonhomologous configuration. PMID:3732789

Avoidance of pseudogene interference in the detection of 3' deletions in PMS2.

PubMed

Vaughn, Cecily P; Hart, Kimberly J; Samowitz, Wade S; Swensen, Jeffrey J

2011-09-01

Lynch syndrome is characterized by mutations in the mismatch repair genes MLH1, MSH2, MSH6, and PMS2. In PMS2, detection of mutations is confounded by numerous pseudogenes. Detection of 3' deletions is particularly complicated by the pseudogene PMS2CL, which has strong similarity to PMS2 exons 9 and 11-15, due to extensive gene conversion. A newly designed multiplex ligation-dependent probe amplification (MLPA) kit incorporates probes for variants found in both PMS2 and PMS2CL. This provides detection of deletions, but does not allow localization of deletions to the gene or pseudogene. To address this, we have developed a methodology incorporating reference samples with known copy numbers of variants, and paired MLPA results with sequencing of PMS2 and PMS2CL. We tested a subset of clinically indicated samples for which mutations were either unidentified or not fully characterized using existing methods. We identified eight unrelated patients with deletions encompassing exons 9-15, 11-15, 13-15, 14-15, and 15. By incorporating specific, characterized reference samples and sequencing the gene and pseudogene it is possible to identify deletions in this region of PMS2 and provide clinically relevant results. This methodology represents a significant advance in the diagnosis of patients with Lynch syndrome caused by PMS2 mutations. © 2011 Wiley-Liss, Inc.

Sulphur responsiveness of the Chlamydomonas reinhardtii LHCBM9 promoter.

PubMed

Sawyer, Anne L; Hankamer, Ben D; Ross, Ian L

2015-05-01

A 44-base-pair region in the Chlamydomonas reinhardtii LHCBM9 promoter is essential for sulphur responsiveness. The photosynthetic light-harvesting complex (LHC) proteins play essential roles both in light capture, the first step of photosynthesis, and in photoprotective mechanisms. In contrast to the other LHC proteins and the majority of photosynthesis proteins, the Chlamydomonas reinhardtii photosystem II-associated LHC protein, LHCBM9, was recently reported to be up-regulated under sulphur deprivation conditions, which also induce hydrogen production. Here, we examined the sulphur responsiveness of the LHCBM9 gene at the transcriptional level, through promoter deletion analysis. The LHCBM9 promoter was found to be responsive to sulphur deprivation, with a 44-base-pair region between nucleotide positions -136 and -180 relative to the translation start site identified as essential for this response. Anaerobiosis was found to enhance promoter activity under sulphur deprivation conditions, however, alone was unable to induce promoter activity. The study of LHCBM9 is of biological and biotechnological importance, as its expression is linked to photobiological hydrogen production, theoretically the most efficient process for biofuel production, while the simplicity of using an S-deprivation trigger enables the development of a novel C. reinhardtii-inducible promoter system based on LHCBM9.

PCR amplification of up to 35-kb DNA with high fidelity and high yield from lambda bacteriophage templates.

PubMed Central

Barnes, W M

1994-01-01

A target length limitation to PCR amplification of DNA has been identified and addressed. Concomitantly, the base-pair fidelity, the ability to use PCR products as primers, and the maximum yield of target fragment were increased. These improvements were achieved by the combination of a high level of an exonuclease-free, N-terminal deletion mutant of Taq DNA polymerase, Klentaq1, with a very low level of a thermostable DNA polymerase exhibiting a 3'-exonuclease activity (Pfu, Vent, or Deep Vent). At least 35 kb can be amplified to high yields from 1 ng of lambda DNA template. Images PMID:8134376

Structure of the human MLH1 N-terminus: implications for predisposition to Lynch syndrome

DOE PAGES

Wu, Hong; Zeng, Hong; Lam, Robert; ...

2015-08-01

Mismatch repair prevents the accumulation of erroneous insertions/deletions and non-Watson–Crick base pairs in the genome. Pathogenic mutations in theMLH1gene are associated with a predisposition to Lynch and Turcot's syndromes. Although genetic testing for these mutations is available, robust classification of variants requires strong clinical and functional support. Here, the first structure of the N-terminus of human MLH1, determined by X-ray crystallography, is described. Lastly, the structure shares a high degree of similarity with previously determined prokaryoticMLH1homologs; however, this structure affords a more accurate platform for the classification ofMLH1variants.

Sequential computation of elementary modes and minimal cut sets in genome-scale metabolic networks using alternate integer linear programming

DOE Office of Scientific and Technical Information (OSTI.GOV)

Song, Hyun-Seob; Goldberg, Noam; Mahajan, Ashutosh

Elementary (flux) modes (EMs) have served as a valuable tool for investigating structural and functional properties of metabolic networks. Identification of the full set of EMs in genome-scale networks remains challenging due to combinatorial explosion of EMs in complex networks. It is often, however, that only a small subset of relevant EMs needs to be known, for which optimization-based sequential computation is a useful alternative. Most of the currently available methods along this line are based on the iterative use of mixed integer linear programming (MILP), the effectiveness of which significantly deteriorates as the number of iterations builds up. Tomore » alleviate the computational burden associated with the MILP implementation, we here present a novel optimization algorithm termed alternate integer linear programming (AILP). Results: Our algorithm was designed to iteratively solve a pair of integer programming (IP) and linear programming (LP) to compute EMs in a sequential manner. In each step, the IP identifies a minimal subset of reactions, the deletion of which disables all previously identified EMs. Thus, a subsequent LP solution subject to this reaction deletion constraint becomes a distinct EM. In cases where no feasible LP solution is available, IP-derived reaction deletion sets represent minimal cut sets (MCSs). Despite the additional computation of MCSs, AILP achieved significant time reduction in computing EMs by orders of magnitude. The proposed AILP algorithm not only offers a computational advantage in the EM analysis of genome-scale networks, but also improves the understanding of the linkage between EMs and MCSs.« less

Unexpected effects of gene deletion on mercury interactions with the methylation-deficient mutant hgcAB

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lin, Hui; Hurt, Jr., Richard Ashley; Johs, Alexander

2014-01-01

The hgcA and hgcB gene pair is essential for mercury (Hg) methylation by certain anaerobic bacteria,1 but little is known about how deletion of hgcAB affects cell surface interactions and intracellular uptake of Hg. Here, we compare hgcAB mutants with the wild-type (WT) strains of both Geobacter sulfurreducens PCA and Desulfovibrio desulfuricans ND132 and observe differences in Hg redox transformations, adsorption, and uptake in laboratory incubation studies. In both strains, deletion of hgcAB increased the reduction of Hg(II) but decreased the oxidation of Hg(0) under anaerobic conditions. The measured cellular thiol content in hgcAB mutants was lower than the WT,more » accounting for decreased adsorption and uptake of Hg. Despite the lack of methylation activity, Hg uptake by the hgcAB continued, albeit at a slower rate than the WT. These findings demonstrate that deletion of the hgcAB gene not only eliminates Hg methylation but also alters cell physiology, resulting in changes to Hg redox reactions, sorption, and uptake by cells.« less

Deletion of the Bombyx mori odorant receptor co-receptor (BmOrco) impairs olfactory sensitivity in silkworms.

PubMed

Liu, Qun; Liu, Wei; Zeng, Baosheng; Wang, Guirong; Hao, Dejun; Huang, Yongping

2017-07-01

Olfaction plays an essential role in many important insect behaviors such as feeding and reproduction. To detect olfactory stimuli, an odorant receptor co-receptor (Orco) is required. In this study, we deleted the Orco gene in the Lepidopteran model insect, Bombyx mori, using a binary transgene-based clustered regulatory interspaced short palindromic repeats (CRISPR)/Cas9 system. We initially generated somatic mutations in two targeted sites, from which we obtained homozygous mutants with deletion of a 866 base pair sequence. Because of the flight inability of B. mori, we developed a novel method to examine the adult mating behavior. Considering the specialization in larval feeding, we examined food selection behavior in Orco somatic mutants by the walking trail analysis of silkworm position over time. Single sensillum recordings indicated that the antenna of the homozygous mutant was unable to respond to either of the two sex pheromones, bombykol or bombykal. An adult mating behavior assay revealed that the Orco mutant displayed a significantly impaired mating selection behavior in response to natural pheromone released by a wild-type female moth as well as an 11:1 mixture of bombykol/bombykal. The mutants also exhibited a decreased response to bombykol and, similar to wild-type moths, they displayed no response to bombykal. A larval feeding behavior assay revealed that the Orco mutant displayed defective selection for mulberry leaves and different concentrations of the volatile compound cis-jasmone found in mulberry leaves. Deletion of BmOrco severely disrupts the olfactory system, suggesting that BmOrco is indispensable in the olfactory pathway. The approach used for generating somatic and homozygous mutations also highlights a novel method for mutagenesis. This study on BmOrco function provides insights into the insect olfactory system and also provides a paradigm for agroforestry pest control. Copyright © 2017 Elsevier Ltd. All rights reserved.

Mutant quantity and quality in mammalian cells (AL) exposed to cesium-137 gamma radiation: effect of caffeine

NASA Technical Reports Server (NTRS)

McGuinness, S. M.; Shibuya, M. L.; Ueno, A. M.; Vannais, D. B.; Waldren, C. A.; Chatterjee, A. (Principal Investigator)

1995-01-01

We examined the effect of caffeine (1,3,7-trimethylxanthine) on the quantity and quality of mutations in cultured mammalian AL human-hamster hybrid cells exposed to 137Cs gamma radiation. At a dose (1.5 mg/ml for 16 h) that reduced the plating efficiency (PE) by 20%, caffeine was not itself a significant mutagen, but it increased by approximately twofold the slope of the dose-response curve for induction of S1- mutants by 137Cs gamma radiation. Molecular analysis of 235 S1- mutants using a series of DNA probes mapped to the human chromosome 11 in the AL hybrid cells revealed that 73 to 85% of the mutations in unexposed cells and in cells treated with caffeine alone, 137Cs gamma rays alone or 137Cs gamma rays plus caffeine were large deletions involving millions of base pairs of DNA. Most of these deletions were contiguous with the region of the MIC1 gene at 11p13 that encodes the S1 cell surface antigen. In other mutants that had suffered multiple marker loss, the deletions were intermittent along chromosome 11. These "complex" mutations were rare for 137Cs gamma irradiation (1/63 = 1.5%) but relatively prevalent (23-50%) for other exposure conditions. Thus caffeine appears to alter both the quantity and quality of mutations induced by 137Cs gamma irradiation.

Heavy ion mutagenesis: linear energy transfer effects and genetic linkage

NASA Technical Reports Server (NTRS)

Kronenberg, A.; Gauny, S.; Criddle, K.; Vannais, D.; Ueno, A.; Kraemer, S.; Waldren, C. A.; Chatterjee, A. (Principal Investigator)

1995-01-01

We have characterized a series of 69 independent mutants at the endogenous hprt locus of human TK6 lymphoblasts and over 200 independent S1-deficient mutants of the human x hamster hybrid cell line AL arising spontaneously or following low-fluence exposures to densely ionizing Fe ions (600 MeV/amu, linear energy transfer = 190 keV/microns). We find that large deletions are common. The entire hprt gene (> 44 kb) was missing in 19/39 Fe-induced mutants, while only 2/30 spontaneous mutants lost the entire hprt coding sequence. When the gene of interest (S1 locus = M1C1 gene) is located on a nonessential human chromosome 11, multilocus deletions of several million base pairs are observed frequently. The S1 mutation frequency is more than 50-fold greater than the frequency of hprt mutants in the same cells. Taken together, these results suggest that low-fluence exposures to Fe ions are often cytotoxic due to their ability to create multilocus deletions that may often include the loss of essential genes. In addition, the tumorigenic potential of these HZE heavy ions may be due to the high potential for loss of tumor suppressor genes. The relative insensitivity of the hprt locus to mutation is likely due to tight linkage to a gene that is required for viability.

A resource of vectors and ES cells for targeted deletion of microRNAs in mice

PubMed Central

Prosser, Haydn M.; Koike-Yusa, Hiroko; Cooper, James D.; Law, Frances C.; Bradley, Allan

2011-01-01

The 21-23 nucleotide single-stranded RNAs classified as microRNAs (miRNA) perform fundamental roles in a wide range of cellular and developmental processes. miRNAs regulate protein expression through sequence-specific base pairing with target messenger RNAs (mRNA) reducing both their stability and the process of protein translation1, 2. At least 30% of protein coding genes appear to be conserved targets for miRNAs1. In contrast to the protein coding genes3, 4, no public resource of miRNA mouse mutant alleles exists. We have generated a library of highly germ-line transmissible C57BL/6N mouse mutant embryonic stem (ES) cells with targeted deletions for the majority of miRNA genes currently annotated within the miRBase registry5. These alleles have been designed to be highly adaptable research tools that can be efficiently altered to create reporter, conditional and other allelic variants. This ES cell resource can be searched electronically and is available from ES cell repositories for distribution to the scientific community6. PMID:21822254

Effect of the Molecular Nature of Mutation on the Efficiency of Intrachromosomal Gene Conversion in Mouse Cells

PubMed Central

Letsou, Anthea; Liskay, R. Michael

1987-01-01

With the intent of further exploring the nature of gene conversion in mammalian cells, we systematically addressed the effects of the molecular nature of mutation on the efficiency of intrachromosomal gene conversion in cultured mouse cells. Comparison of conversion rates revealed that all mutations studied were suitable substrates for gene conversion; however, we observed that the rates at which different mutations converted to wild-type could differ by two orders of magnitude. Differences in conversion rates were correlated with the molecular nature of the mutations. In general, rates of conversion decreased with increasing size of the molecular lesions. In comparisons of conversion rates for single base pair insertions and deletions we detected a genotype-directed path for conversion, by which an insertion was converted to wild-type three to four times more efficiently than was a deletion which maps to the same site. The data are discussed in relation to current theories of gene conversion, and are consistent with the idea that gene conversion in mammalian cells can result from repair of heteroduplex DNA (hDNA) intermediates. PMID:2828159

An Unbiased Genome-Wide View of the Mutation Rate and Spectrum of the Endosymbiotic Bacterium Teredinibacter turnerae.

PubMed

Senra, Marcus V X; Sung, Way; Ackerman, Matthew; Miller, Samuel F; Lynch, Michael; Soares, Carlos Augusto G

2018-03-01

Mutations contribute to genetic variation in all living systems. Thus, precise estimates of mutation rates and spectra across a diversity of organisms are required for a full comprehension of evolution. Here, a mutation-accumulation (MA) assay was carried out on the endosymbiotic bacterium Teredinibacter turnerae. After ∼3,025 generations, base-pair substitutions (BPSs) and insertion-deletion (indel) events were characterized by whole-genome sequencing analysis of 47 independent MA lines, yielding a BPS rate of 1.14 × 10-9 per site per generation and indel rate of 1.55 × 10-10 events per site per generation, which are among the highest within free-living and facultative intracellular bacteria. As in other endosymbionts, a significant bias of BPSs toward A/T and an excess of deletion mutations over insertion mutations are observed for these MA lines. However, even with a deletion bias, the genome remains relatively large (∼5.2 Mb) for an endosymbiotic bacterium. The estimate of the effective population size (Ne) in T. turnerae is quite high and comparable to free-living bacteria (∼4.5 × 107), suggesting that the heavy bottlenecking associated with many endosymbiotic relationships is not prevalent during the life of this endosymbiont. The efficiency of selection scales with increasing Ne and such strong selection may have been operating against the deletion bias, preventing genome erosion. The observed mutation rate in this endosymbiont is of the same order of magnitude of those with similar Ne, consistent with the idea that population size is a primary determinant of mutation-rate evolution within endosymbionts, and that not all endosymbionts have low Ne.

Changes in latent fingerprint examiners' markup between analysis and comparison.

PubMed

Ulery, Bradford T; Hicklin, R Austin; Roberts, Maria Antonia; Buscaglia, JoAnn

2015-02-01

After the initial analysis of a latent print, an examiner will sometimes revise the assessment during comparison with an exemplar. Changes between analysis and comparison may indicate that the initial analysis of the latent was inadequate, or that confirmation bias may have affected the comparison. 170 volunteer latent print examiners, each randomly assigned 22 pairs of prints from a pool of 320 total pairs, provided detailed markup documenting their interpretations of the prints and the bases for their comparison conclusions. We describe changes in value assessments and markup of features and clarity. When examiners individualized, they almost always added or deleted minutiae (90.3% of individualizations); every examiner revised at least some markups. For inconclusive and exclusion determinations, changes were less common, and features were added more frequently when the image pair was mated (same source). Even when individualizations were based on eight or fewer corresponding minutiae, in most cases some of those minutiae had been added during comparison. One erroneous individualization was observed: the markup changes were notably extreme, and almost all of the corresponding minutiae had been added during comparison. Latents assessed to be of value for exclusion only (VEO) during analysis were often individualized when compared to a mated exemplar (26%); in our previous work, where examiners were not required to provide markup of features, VEO individualizations were much less common (1.8%). Published by Elsevier Ireland Ltd.

Rapid change of chromomeric and pairing patterns of polytene chromosome tips in D. melanogaster: migration of polytene-nonpolytene transition zone?

PubMed

Roberts, P A

1979-07-01

The high variability of chromomeric patterns in near-terminal regions of polytene chromosome arms has been explored in a number of races, strains and hybrids of Drosophila melanogaster. Traditional explanations for tip differences between strains (differential compaction of chromatin, somatic or germinal deletion) are examined and, in the light of the reported observations, rejected. The range of polytene tip variability and rates of change in wild races are greater than has been supposed: strains formerly considered to be terminally deleted appear to gain terminal bands; others, formerly considered normal, appear to have lost them. Strains with high cell-to-cell tip variability are also described. Cell-to-cell variations, as well as much of the observed rapid changes in tip appearance, are probably due to heritable differences in the location of an abrupt transition zone between polytene and nonpolytene chromatin. A quantitative relationship between the amount of certain subterminal bands present and the frequency of tip association of nonhomologous chromosomes is shown and its possible significance for chromosome is shown and its possible for chromosome pairing discussed.

Trypanosoma brucei RNA Editing Complex

PubMed Central

O'Hearn, Sean F.; Huang, Catherine E.; Hemann, Mike; Zhelonkina, Alevtina; Sollner-Webb, Barbara

2003-01-01

Maturation of Trypanosoma brucei mitochondrial mRNA involves massive posttranscriptional insertion and deletion of uridine residues. This RNA editing utilizes an enzymatic complex with seven major proteins, band I through band VII. We here use RNA interference (RNAi) to examine the band II and band V proteins. Band II is found essential for viability; it is needed to maintain the normal structure of the editing complex and to retain the band V ligase protein. Previously, band III was found essential for certain activities, including maintenance of the editing complex and retention of the band IV ligase protein. Thus, band II and band V form a protein pair with features analogous to the band III/band IV ligase pair. Since band V is specific for U insertion and since band IV is needed for U deletion, their parallel organization suggests that the editing complex has a pseudosymmetry. However, unlike the essential band IV ligase, RNAi to band V has only a morphological but no growth rate effect, suggesting that it is stimulatory but nonessential. Indeed, in vitro analysis of band V RNAi cell extract demonstrates that band IV can seal U insertion when band V is lacking. Thus, band IV ligase is the first activity of the basic editing complex shown able to serve in both forms of editing. Our studies also indicate that the U insertional portion may be less central in the editing complex than the corresponding U deletional portion. PMID:14560033

Copy number profiling of adult relapsed B-cell precursor acute lymphoblastic leukemia reveals potential leukemia progression mechanisms.

PubMed

Ribera, Jordi; Zamora, Lurdes; Morgades, Mireia; Mallo, Mar; Solanes, Neus; Batlle, Montserrat; Vives, Susana; Granada, Isabel; Juncà, Jordi; Malinverni, Roberto; Genescà, Eulàlia; Guàrdia, Ramon; Mercadal, Santiago; Escoda, Lourdes; Martinez-Lopez, Joaquín; Tormo, Mar; Esteve, Jordi; Pratcorona, Marta; Martinez-Losada, Carmen; Solé, Francesc; Feliu, Evarist; Ribera, Josep-Maria

2017-11-01

The outcome of relapsed adult acute lymphoblastic leukemia (ALL) remains dismal despite new therapeutic approaches. Previous studies analyzing relapse samples have shown a high degree of heterogeneity regarding gene alterations without an evident relapse signature. Bone marrow or peripheral blood samples from 31 adult B-cell precursor ALL patients at first relapse, and 21 paired diagnostic samples were analyzed by multiplex ligation probe-dependent amplification (MLPA). Nineteen paired diagnostic and relapse samples of these 21 patients were also analyzed by SNP arrays. A trend to acquire homozygous CDKN2A/B deletions and a significant increase in the number of copy number alterations (CNA) was observed from diagnosis to first relapse. Evolution from an ancestral clone was the main pattern of clonal evolution. Relapse samples were extremely heterogeneous regarding CNA frequencies. However, CDKN2A/B, PAX5, ETV6, ATM, IKZF1, VPREB1, and TP53 deletions and duplications of 1q, 8q, 17q, 21, X/Y PAR1, and Xp were frequently detected at relapse. Duplications of genes involved in cell proliferation, drug resistance and stem cell homeostasis regulation, as well as deletions of KDM6A and STAG2 genes emerged as specific alterations at relapse. Genomics of relapsed adult B-cell precursor ALL is highly heterogeneous, although some recurrent lesions involved in essential pathways deregulation were frequently observed. Selective and simultaneous targeting of these deregulated pathways may improve the results of current salvage therapies. © 2017 Wiley Periodicals, Inc.

Inhibition of colorectal cancer genomic copy number alterations and chromosomal fragile site tumor suppressor FHIT and WWOX deletions by DNA mismatch repair

PubMed Central

Gelincik, Ozkan; Blecua, Pedro; Edelmann, Winfried; Kucherlapati, Raju; Zhou, Kathy; Jasin, Maria; Gümüş, Zeynep H.; Lipkin, Steven M.

2017-01-01

Homologous recombination (HR) enables precise DNA repair after DNA double strand breaks (DSBs) using identical sequence templates, whereas homeologous recombination (HeR) uses only partially homologous sequences. Homeologous recombination introduces mutations through gene conversion and genomic deletions through single-strand annealing (SSA). DNA mismatch repair (MMR) inhibits HeR, but the roles of mammalian MMR MutL homologues (MLH1, PMS2 and MLH3) proteins in HeR suppression are poorly characterized. Here, we demonstrate that mouse embryonic fibroblasts (MEFs) carrying Mlh1, Pms2, and Mlh3 mutations have higher HeR rates, by using 7,863 uniquely mapping paired direct repeat sequences (DRs) in the mouse genome as endogenous gene conversion and SSA reporters. Additionally, when DSBs are induced by gamma-radiation, Mlh1, Pms2 and Mlh3 mutant MEFs have higher DR copy number alterations (CNAs), including DR CNA hotspots previously identified in mouse MMR-deficient colorectal cancer (dMMR CRC). Analysis of The Cancer Genome Atlas CRC data revealed that dMMR CRCs have higher genome-wide DR HeR rates than MMR proficient CRCs, and that dMMR CRCs have deletion hotspots in tumor suppressors FHIT/WWOX at chromosomal fragile sites FRA3B and FRA16D (which have elevated DSB rates) flanked by paired homologous DRs and inverted repeats (IR). Overall, these data provide novel insights into the MMR-dependent HeR inhibition mechanism and its role in tumor suppression. PMID:29069730

Genomic analysis of adult B-ALL identifies potential markers of shorter survival.

PubMed

Patel, Shiven; Mason, Clinton C; Glenn, Martha J; Paxton, Christian N; South, Sara T; Cessna, Melissa H; Asch, Julie; Cobain, Erin F; Bixby, Dale L; Smith, Lauren B; Reshmi, Shalini; Gastier-Foster, Julie M; Schiffman, Joshua D; Miles, Rodney R

2017-05-01

B lymphoblastic leukemia (B-ALL) in adults has a higher risk of relapse and lower long-term survival than pediatric B-ALL, but data regarding genetic prognostic biomarkers are much more limited for adult patients. We identified 70 adult B-ALL patients from three institutions and performed genome-wide analysis via single nucleotide polymorphism (SNP) arrays on DNA isolated from their initial diagnostic sample and, when available, relapse bone marrow specimens to identify recurring copy number alterations (CNA). As B-cell developmental genes play a crucial role in this leukemia, we assessed such for recurrent deletions in diagnostic and relapse samples. We confirmed previous findings that the most prevalent deletions of these genes occur in CDKN2A, IKZF1, and PAX5, with several others at lower frequencies. Of the 16 samples having paired diagnostic and relapse samples, 5 showed new deletions in these recurrent B-cell related genes and 8 showed abolishment. Deletion of EBF1 heralded a significant negative prognostic impact on relapse free survival in univariate and multivariate analyses. The combination of both a CDKN2A/B deletion and an IKZF1 alteration (26% of cases) also showed a trend toward predicting worse overall survival compared to having only one or neither of these deletions. These findings add to the understanding of genomic influences on this comparably understudied disease cohort that upon further validation may help identify patients who would benefit from upfront treatment intensification. Copyright © 2017 Elsevier Ltd. All rights reserved.

Slack KNa Channels Influence Dorsal Horn Synapses and Nociceptive Behavior.

PubMed

Evely, Katherine M; Pryce, Kerri D; Bausch, Anne E; Lukowski, Robert; Ruth, Peter; Haj-Dahmane, Samir; Bhattacharjee, Arin

2017-01-01

The sodium-activated potassium channel Slack (Kcnt1, Slo2.2) is highly expressed in dorsal root ganglion neurons where it regulates neuronal firing. Several studies have implicated the Slack channel in pain processing, but the precise mechanism or the levels within the sensory pathway where channels are involved remain unclear. Here, we furthered the behavioral characterization of Slack channel knockout mice and for the first time examined the role of Slack channels in the superficial, pain-processing lamina of the dorsal horn. We performed whole-cell recordings from spinal cord slices to examine the intrinsic and synaptic properties of putative inhibitory and excitatory lamina II interneurons. Slack channel deletion altered intrinsic properties and synaptic drive to favor an overall enhanced excitatory tone. We measured the amplitudes and paired pulse ratio of paired excitatory post-synaptic currents at primary afferent synapses evoked by electrical stimulation of the dorsal root entry zone. We found a substantial decrease in the paired pulse ratio at synapses in Slack deleted neurons compared to wildtype, indicating increased presynaptic release from primary afferents. Corroborating these data, plantar test showed Slack knockout mice have an enhanced nociceptive responsiveness to localized thermal stimuli compared to wildtype mice. Our findings suggest that Slack channels regulate synaptic transmission within the spinal cord dorsal horn and by doing so establishes the threshold for thermal nociception.

Identification of mutations in regions corresponding to the two putative nucleotide (ATP)-binding folds of the cystic fibrosis gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kerem, B.; Zielenski, J.; Markiewicz, D.

1990-11-01

Additional mutations in the cystic fibrosis (CF) gene were identified in the regions corresponding to the two putative nucleotide (ATP)-binding folds (NBFs) of the predicted polypeptide. The patient cohort included 46 Canadian CF families with well-characterized DNA marker haplotypes spanning the disease locus and several other families from Israel. Eleven mutations were found in the first NBF, 2 were found in the second NBF, but none was found in the R-domain. Seven of the mutations were of the missense type affecting some of the highly conserved amino acid residues in the first NBF; 3 were nonsense mutations; 2 would probablymore » affect mRNA splicing; 2 corresponded to small deletions, including another 3-base-pair deletion different from the major mutation ({delta}F508), which could account for 70% of the CF chromosomes in the population. Nine of these mutations accounted for 12 of the 31 non-{delta}F508 CF chromosomes in the Canadian families. The highly heterogeneous nature of the remaining CF mutations provides important insights into the structure and function of the protein, but it also suggests that DNA-based genetic screening for CF carrier status will not be straightforward.« less

LookSeq: a browser-based viewer for deep sequencing data.

PubMed

Manske, Heinrich Magnus; Kwiatkowski, Dominic P

2009-11-01

Sequencing a genome to great depth can be highly informative about heterogeneity within an individual or a population. Here we address the problem of how to visualize the multiple layers of information contained in deep sequencing data. We propose an interactive AJAX-based web viewer for browsing large data sets of aligned sequence reads. By enabling seamless browsing and fast zooming, the LookSeq program assists the user to assimilate information at different levels of resolution, from an overview of a genomic region to fine details such as heterogeneity within the sample. A specific problem, particularly if the sample is heterogeneous, is how to depict information about structural variation. LookSeq provides a simple graphical representation of paired sequence reads that is more revealing about potential insertions and deletions than are conventional methods.

Investigation of recurrent deletion loci specific to conventional renal cell carcinoma by comparative allelotyping in major epithelial carcinomas

PubMed Central

Bhat (Singh), Rashmi R.; Amare (Kadam), Pratibha S.

2012-01-01

Objective: Loss of heterozygosity (LOH) studies were undertaken to investigate the consistently deleted loci/? tumor suppressor gene loci (TSG) on 3p in conventional renal cell carcinoma (cRCC). Materials and Methods: LOH studies were performed by polymerase chain reaction (PCR) using 15 micro satellite markers mapped in region 3p12-p26 on 40 paired cRCC tumors and normal kidney at Stages I-IV. Simultaneously, fluorescent in-situ hybridization (FISH) studies were performed to investigate the allelic deletion of fragile histidine triad (FHIT). Results: Our studies revealed three affected regions; 3p12.2-p14.1, 3p14.2-p21.1, and 3p24.2-p26.1 with differential frequencies in Group I (Stage I and II) and Group II (Stage III and IV). Incidence for D3S1234 (FHIT locus) and D3S2454 (3p13) was 75% and 83% in Group I and II, respectively. Comparative allelotyping in epithelial malignancies like lung, bladder, and breast tumors revealed LOH (frequency 14–20%) only in breast tumors for D3S2406, D3S1766 (distal to FHIT), and D3S1560 (distal to VHL, Von-Hippal Lindau). FISH using FHIT gene probe revealed deletions in cRCC (88%), breast (30%), and lung tumors (10%) with no deletions in bladder tumors and leukemias, signifying the importance of FHIT in the pathogenesis of tumors of epithelial origin. Conclusion: Our findings suggested FHIT deletion as an early and VHL deletion as an early and/or late event in cRCC. Additionally, studies also disclosed the recurrent deletions of flanking loci to FHIT and VHL in cRCC. The dilemma of interstitial or continuous deletion on 3p needs to be resolved by implementation of latest sensitive molecular techniques that would further help to narrow down search for TSG loci specific to cRCC, other than VHL and FHIT. PMID:22557717

Investigation of recurrent deletion loci specific to conventional renal cell carcinoma by comparative allelotyping in major epithelial carcinomas.

PubMed

Bhat Singh, Rashmi R; Amare Kadam, Pratibha S

2012-01-01

Loss of heterozygosity (LOH) studies were undertaken to investigate the consistently deleted loci/? tumor suppressor gene loci (TSG) on 3p in conventional renal cell carcinoma (cRCC). LOH studies were performed by polymerase chain reaction (PCR) using 15 micro satellite markers mapped in region 3p12-p26 on 40 paired cRCC tumors and normal kidney at Stages I-IV. Simultaneously, fluorescent in-situ hybridization (FISH) studies were performed to investigate the allelic deletion of fragile histidine triad (FHIT). Our studies revealed three affected regions; 3p12.2-p14.1, 3p14.2-p21.1, and 3p24.2-p26.1 with differential frequencies in Group I (Stage I and II) and Group II (Stage III and IV). Incidence for D3S1234 (FHIT locus) and D3S2454 (3p13) was 75% and 83% in Group I and II, respectively. Comparative allelotyping in epithelial malignancies like lung, bladder, and breast tumors revealed LOH (frequency 14-20%) only in breast tumors for D3S2406, D3S1766 (distal to FHIT), and D3S1560 (distal to VHL, Von-Hippal Lindau). FISH using FHIT gene probe revealed deletions in cRCC (88%), breast (30%), and lung tumors (10%) with no deletions in bladder tumors and leukemias, signifying the importance of FHIT in the pathogenesis of tumors of epithelial origin. Our findings suggested FHIT deletion as an early and VHL deletion as an early and/or late event in cRCC. Additionally, studies also disclosed the recurrent deletions of flanking loci to FHIT and VHL in cRCC. The dilemma of interstitial or continuous deletion on 3p needs to be resolved by implementation of latest sensitive molecular techniques that would further help to narrow down search for TSG loci specific to cRCC, other than VHL and FHIT.

Detection of three-base deletion by exciplex formation with perylene derivatives.

PubMed

Kashida, Hiromu; Kondo, Nobuyo; Sekiguchi, Koji; Asanuma, Hiroyuki

2011-06-14

Here, we synthesized fluorescent DNA probes labeled with two perylene derivatives for the detection of a three-base deletion mutant. One such probe discriminated the three-base deletion mutant from the wild-type sequence by exciplex emission, and the deletion mutant was identifiable even by the naked eye. This journal is © The Royal Society of Chemistry 2011

Development of a Generic PCR Detection of 3-Acetyldeoxy-nivalenol-, 15-Acetyldeoxynivalenol- and Nivalenol-Chemotypes of Fusarium graminearum Clade

PubMed Central

Wang, Jian-Hua; Li, He-Ping; Qu, Bo; Zhang, Jing-Bo; Huang, Tao; Chen, Fang-Fang; Liao, Yu-Cai

2008-01-01

Fusarium graminearum clade pathogens cause Fusarium head blight (FHB) or scab of wheat and other small cereal grains, producing different kinds of trichothecene mycotoxins that are detrimental to human and domestic animals. Type B trichothecene mycotoxins such as deoxynivalenol, 3-acetyldeoxynivalenol (3-AcDON), 15-acetyldeoxynivalenol (15-AcDON) and nivalenol (NIV) are the principal Fusarium mycotoxins reported in China, as well as in other countries. A genomic polymerase chain reaction (PCR) to predict chemotypes was developed based on the structural gene sequences of Tri13 genes involved in trichothecene mycotoxin biosynthesis pathways. A single pair of primers derived from the Tri13 genes detected a 583 bp fragment from 15-AcDON-chemotypes, a 644 bp fragment from 3-AcDON-chemotypes and an 859 bp fragment from NIV-producing strains. Fusarium strains from China, Nepal, USA and Europe were identified by this method, revealing their mycotoxin chemotypes identical to that obtained by chemical analyses of HPLC or GC/MS and other PCR assays. The mycotoxin chemotype-specific fragments were amplified from a highly variable region located in Tri13 genes with three deletions for 15-AcDON-chemotypes, two deletions for 3-AcDON-chemotypes and no deletion for NIV-producers. This PCR assay generated a single amplicon and thus should be more reliable than other PCR-based assays that showed the absence or presence of a PCR fragment since these assays may generate false-negative results. The results with strains from several different countries as well as from different hosts further indicated that this method should be globally applicable. This is a rapid, reliable and cost-effective method for the identification of type B trichothecene mycotoxin chemotypes in Fusarium species and food safety controls. PMID:19330088

Variants in hormone biosynthesis genes and risk of endometrial cancer

PubMed Central

Olson, Sara H.; Orlow, Irene; Bayuga, Sharon; Sima, Camelia; Bandera, Elisa V.; Pulick, Katherine; Faulkner, Shameka; Tommasi, Diana; Egan, Daniel; Roy, Pampa; Wilcox, Homer; Asya, Ali; Modica, Ippolito; Asad, Haider; Soslow, Robert; Zauber, Ann G.

2009-01-01

We investigated the risk associated with variants in three genes involved in estrogen biosynthesis, CYP11A1, CYP17A1, and CYP19A1, in the population-based case control study of Estrogen, Diet, Genetics, and Endometrial Cancer. This study was conducted in New Jersey in 2001–2006 with 417 cases and 402 controls. For CYP11A1, there was no association between the number of [TTTTA]n repeats (D15S520) and risk. For CYP17A1, risk was somewhat lower among women with the C/C genotype at T-34C (rs743572) (adjusted OR=0.65, 95% CI 0.41–1.02). For CYP19A1, risk was lower among women homozygous for the 3-base pair deletion (rs11575899) in exon 4 (adjusted OR=0.44, 95% CI 0.26–0.76), while the number of [TTTA]n repeats was not significantly related to risk: the adjusted OR for n=7/7 repeats vs n>7/>7 repeats was 0.81 (95% CI 0.54–1.23). In stratified analyses, results for CYP19A1 were stronger among women with higher (>27.4) body mass index: for the homozygous deletion, OR=0.30 (95% CI 0.15–0.62); for the n=7/7 genotype, OR=0.49 (95% CI 0.26–0.93). The interaction between the n=7/7 genotype and BMI was statistically significant (p=0.01). The insertion/deletion variant in CYP19A1 appears to be related to risk of endometrial cancer; risk associated with variants in this gene may vary according to BMI. PMID:18437511

Case-Deletion Diagnostics for Maximum Likelihood Multipoint Quantitative Trait Locus Linkage Analysis

PubMed Central

Mendoza, Maria C.B.; Burns, Trudy L.; Jones, Michael P.

2009-01-01

Objectives Case-deletion diagnostic methods are tools that allow identification of influential observations that may affect parameter estimates and model fitting conclusions. The goal of this paper was to develop two case-deletion diagnostics, the exact case deletion (ECD) and the empirical influence function (EIF), for detecting outliers that can affect results of sib-pair maximum likelihood quantitative trait locus (QTL) linkage analysis. Methods Subroutines to compute the ECD and EIF were incorporated into the maximum likelihood QTL variance estimation components of the linkage analysis program MAPMAKER/SIBS. Performance of the diagnostics was compared in simulation studies that evaluated the proportion of outliers correctly identified (sensitivity), and the proportion of non-outliers correctly identified (specificity). Results Simulations involving nuclear family data sets with one outlier showed EIF sensitivities approximated ECD sensitivities well for outlier-affected parameters. Sensitivities were high, indicating the outlier was identified a high proportion of the time. Simulations also showed the enormous computational time advantage of the EIF. Diagnostics applied to body mass index in nuclear families detected observations influential on the lod score and model parameter estimates. Conclusions The EIF is a practical diagnostic tool that has the advantages of high sensitivity and quick computation. PMID:19172086

Efficient CRISPR/Cas9-Mediated Versatile, Predictable, and Donor-Free Gene Knockout in Human Pluripotent Stem Cells.

PubMed

Liu, Zhongliang; Hui, Yi; Shi, Lei; Chen, Zhenyu; Xu, Xiangjie; Chi, Liankai; Fan, Beibei; Fang, Yujiang; Liu, Yang; Ma, Lin; Wang, Yiran; Xiao, Lei; Zhang, Quanbin; Jin, Guohua; Liu, Ling; Zhang, Xiaoqing

2016-09-13

Loss-of-function studies in human pluripotent stem cells (hPSCs) require efficient methodologies for lesion of genes of interest. Here, we introduce a donor-free paired gRNA-guided CRISPR/Cas9 knockout strategy (paired-KO) for efficient and rapid gene ablation in hPSCs. Through paired-KO, we succeeded in targeting all genes of interest with high biallelic targeting efficiencies. More importantly, during paired-KO, the cleaved DNA was repaired mostly through direct end joining without insertions/deletions (precise ligation), and thus makes the lesion product predictable. The paired-KO remained highly efficient for one-step targeting of multiple genes and was also efficient for targeting of microRNA, while for long non-coding RNA over 8 kb, cleavage of a short fragment of the core promoter region was sufficient to eradicate downstream gene transcription. This work suggests that the paired-KO strategy is a simple and robust system for loss-of-function studies for both coding and non-coding genes in hPSCs. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.

Reduced rDNA Copy Number Does Not Affect “Competitive” Chromosome Pairing in XYY Males of Drosophila melanogaster

PubMed Central

Maggert, Keith A.

2014-01-01

The ribosomal DNA (rDNA) arrays are causal agents in X-Y chromosome pairing in meiosis I of Drosophila males. Despite broad variation in X-linked and Y-linked rDNA copy number, polymorphisms in regulatory/spacer sequences between rRNA genes, and variance in copy number of interrupting R1 and R2 retrotransposable elements, there is little evidence that different rDNA arrays affect pairing efficacy. I investigated whether induced rDNA copy number polymorphisms affect chromosome pairing in a “competitive” situation in which complex pairing configurations were possible using males with XYY constitution. Using a common normal X chromosome, one of two different full-length Y chromosomes, and a third chromosome from a series of otherwise-isogenic rDNA deletions, I detected no differences in X-Y or Y-Y pairing or chromosome segregation frequencies that could not be attributed to random variation alone. This work was performed in the context of an undergraduate teaching program at Texas A&M University, and I discuss the pedagogical utility of this and other such experiments. PMID:24449686

Chromosomal Targeting by the Type III-A CRISPR-Cas System Can Reshape Genomes in Staphylococcus aureus

PubMed Central

Guan, Jing; Wang, Wanying

2017-01-01

ABSTRACT CRISPR-Cas (clustered regularly interspaced short palindromic repeat [CRISPR]-CRISPR-associated protein [Cas]) systems can provide protection against invading genetic elements by using CRISPR RNAs (crRNAs) as a guide to locate and degrade the target DNA. CRISPR-Cas systems have been classified into two classes and five types according to the content of cas genes. Previous studies have indicated that CRISPR-Cas systems can avoid viral infection and block plasmid transfer. Here we show that chromosomal targeting by the Staphylococcus aureus type III-A CRISPR-Cas system can drive large-scale genome deletion and alteration within integrated staphylococcal cassette chromosome mec (SCCmec). The targeting activity of the CRISPR-Cas system is associated with the complementarity between crRNAs and protospacers, and 10- to 13-nucleotide truncations of spacers partially block CRISPR attack and more than 13-nucleotide truncation can fully abolish targeting, suggesting that a minimal length is required to license cleavage. Avoiding base pairings in the upstream region of protospacers is also necessary for CRISPR targeting. Successive trinucleotide complementarity between the 5′ tag of crRNAs and protospacers can disrupt targeting. Our findings reveal that type III-A CRISPR-Cas systems can modulate bacterial genome stability and may serve as a high-efficiency tool for deleting resistance or virulence genes in bacteria. IMPORTANCE Staphylococcus aureus is a pathogen that can cause a wide range of infections in humans. Studies have suggested that CRISPR-Cas systems can drive the loss of integrated mobile genetic elements (MGEs) by chromosomal targeting. Here we demonstrate that CRISPR-mediated cleavage contributes to the partial deletion of integrated SCCmec in methicillin-resistant S. aureus (MRSA), which provides a strategy for the treatment of MRSA infections. The spacer within artificial CRISPR arrays should contain more than 25 nucleotides for immunity, and consecutive trinucleotide pairings between a selected target and the 5′ tag of crRNA can block targeting. These findings add to our understanding of the molecular mechanisms of the type III-A CRISPR-Cas system and provide a novel strategy for the exploitation of engineered CRISPR immunity against integrated MGEs in bacteria for clinical and industrial applications. PMID:29152580

Chromosomal Targeting by the Type III-A CRISPR-Cas System Can Reshape Genomes in Staphylococcus aureus.

PubMed

Guan, Jing; Wang, Wanying; Sun, Baolin

2017-01-01

CRISPR-Cas (clustered regularly interspaced short palindromic repeat [CRISPR]-CRISPR-associated protein [Cas]) systems can provide protection against invading genetic elements by using CRISPR RNAs (crRNAs) as a guide to locate and degrade the target DNA. CRISPR-Cas systems have been classified into two classes and five types according to the content of cas genes. Previous studies have indicated that CRISPR-Cas systems can avoid viral infection and block plasmid transfer. Here we show that chromosomal targeting by the Staphylococcus aureus type III-A CRISPR-Cas system can drive large-scale genome deletion and alteration within integrated staphylococcal cassette chromosome mec (SCC mec ). The targeting activity of the CRISPR-Cas system is associated with the complementarity between crRNAs and protospacers, and 10- to 13-nucleotide truncations of spacers partially block CRISPR attack and more than 13-nucleotide truncation can fully abolish targeting, suggesting that a minimal length is required to license cleavage. Avoiding base pairings in the upstream region of protospacers is also necessary for CRISPR targeting. Successive trinucleotide complementarity between the 5' tag of crRNAs and protospacers can disrupt targeting. Our findings reveal that type III-A CRISPR-Cas systems can modulate bacterial genome stability and may serve as a high-efficiency tool for deleting resistance or virulence genes in bacteria. IMPORTANCE Staphylococcus aureus is a pathogen that can cause a wide range of infections in humans. Studies have suggested that CRISPR-Cas systems can drive the loss of integrated mobile genetic elements (MGEs) by chromosomal targeting. Here we demonstrate that CRISPR-mediated cleavage contributes to the partial deletion of integrated SCC mec in methicillin-resistant S. aureus (MRSA), which provides a strategy for the treatment of MRSA infections. The spacer within artificial CRISPR arrays should contain more than 25 nucleotides for immunity, and consecutive trinucleotide pairings between a selected target and the 5' tag of crRNA can block targeting. These findings add to our understanding of the molecular mechanisms of the type III-A CRISPR-Cas system and provide a novel strategy for the exploitation of engineered CRISPR immunity against integrated MGEs in bacteria for clinical and industrial applications.

Giant Subependymoma Developed in a Patient with Aniridia: Analyses of PAX6 and Tumor-relevant Genes

PubMed Central

Maekawa, Motoko; Fujisawa, Hironori; Iwayama, Yoshimi; Tamase, Akira; Toyota, Tomoko; Osumi, Noriko; Yoshikawa, Takeo

2010-01-01

We observed an unusually large subependymoma in a female patient with congenital aniridia. To analyze the genetic mechanisms of tumorigenesis, we first examined the paired box 6 (PAX6) gene using both tumor tissue and peripheral lymphocytes. Tumor suppressor activity has been proposed for PAX6 in gliomas, in addition to its well-known role in the eye development. Using genomic quantitative PCR and loss of heterozygosity analysis, we identified hemizygous deletions in the 5′-region of PAX6. In lymphocytes, the deletion within PAX6 spanned from between exons 6 and 7 to the 5′-upstream region of the gene, but did not reach the upstream gene, RNC1, which is reported to be associated with tumors. The subependymoma had an additional de novo deletion spanning from the intron 4 to intron 6 of PAX6, although we could not completely determine whether these two deletions are on the same chromosome or not. We also examined other potentially relevant tumor suppressor genes: PTEN, TP53 and SOX2. However, we detected no exonic mutations or deletions in these genes. Collectively, we speculate that the defect in PAX6 may have contributed to the extremely large size of the subependymoma, due to a loss of tumor suppressor activity in glial cell lineage. PMID:20500513

[Construction and characterization of enterohemorrhagic Escherichia coli O157:H7 ppk- deleted strain].

PubMed

Han, Peng; Sun, Qi; Zhao, Suhui; Zhang, Qiwei; Wan, Chengsong

2014-06-01

To construct enterohemorrhagic Escherichia coli (EHEC) O157: H7 ppk gene deletion strains and study its biological characteristics. The gene fragment of kanamycin resistance was amplified using a pair of homologous arm primers whose 5' and 3' ends were homologous with ppk gene and kanamycin resistance gene, respectively. EHEC O157: H7 EDL933w competent strains were prepared and transformed via electroporation with the amplification products. The ppk gene was replaced by kanamycin resistance gene using pKD46-mediated Red recombination system. The recombinant strain was confirmed by PCR and sequencing, and its morphology, growth ability and adhesion were assessed using Gram staining, OD600 value and Giemsa staining. We established a ppk-deleted EHEC O157:H7 EDL933w strain with kanamycin resistance and compared the biological characteristics of the wild-type and mutant strains, which may facilitate further study of the regulatory mechanism of ppk gene.

Simultaneous quantification of alternatively spliced transcripts in a single droplet digital PCR reaction.

PubMed

Sun, Bing; Tao, Lian; Zheng, Yun-Ling

2014-06-01

Human telomerase reverse transcriptase (hTERT) is an essential component required for telomerase activity and telomere maintenance. Several alternatively spliced forms of hTERT mRNA have been reported in human primary and tumor cells. Currently, however, there is no sensitive and accurate method for the simultaneous quantification of multiple alternatively spliced RNA transcripts, such as in the case of hTERT. Here we show droplet digital PCR (ddPCR) provides sensitive, simultaneous digital quantification in a single reaction of two alternatively spliced single deletion hTERT transcripts (α-/β+ and α+/β-) as well as the opportunity to manually quantify non-deletion (α+/β+) and double deletion (α-/β-) transcripts. Our ddPCR method enables direct comparison among four alternatively spliced mRNAs without the need for internal standards or multiple primer pairs specific for each variant as real-time PCR (qPCR) requires, thus eliminating potential variation due to differences in PCR amplification efficiency.

Characterization of a tandemly repeated DNA sequence family originally derived by retroposition of tRNA(Glu) in the newt.

PubMed

Nagahashi, S; Endoh, H; Suzuki, Y; Okada, N

1991-11-20

A previous report from this laboratory showed that in vitro transcription of total genomic DNA of the newt Cynopus pyrrhogaster resulted in a discrete sized 8 S RNA, which represented highly repetitive and transcribable sequences with a glutamic acid tRNA-like structure in the newt genome. We isolated four independent clones from a newt genomic library and determined the complete sequences of three 2000 to 2400 base-pair PstI fragments spanning the 8 S RNA gene. The glutamic acid tRNA-related segment in the 8 S RNA gene contains the CCA sequence expected as the 3' terminus of a tRNA molecule. Further, the 11 nucleotides located 13 nucleotides upstream from one of the two transcription initiation sites of the 8 S RNA were found to be repeated in the region upstream from the termination site, suggesting that the original unit, which is shorter than the 8 S RNA, was retrotransposed via cDNA intermediates from the PolIII transcript. In the upstream region of the 8 S RNA gene, a 360 nucleotide unit containing the glutamic acid tRNA-related segment was found to be duplicated (clones NE1 and NE10) or triplicated (clone NE3). Except for the difference in the number of the 360 nucleotide unit, the three sequences of the 2000 to 2400 base-pair PstI fragment were essentially the same with only a few mutations and minor deletions. Inverse polymerase chain reaction and sequence determination of the products, together with a Southern hybridization experiment, demonstrated that the family consists of a tandemly repeated unit of 3300, 3700 or 4100 base-pairs. Thus during evolution, this family in the newt was created by retroposition via cDNA intermediates, followed by duplication or triplication of the 360 nucleotide unit and multiplication of the 3300 to 4100 base-pair region at the DNA level.

[Analysis of the primary and secondary structure of the mitochondrial serine transfer RNA in seven species of Lutzomyia].

PubMed

Vivero, Rafael José; Contreras-Gutiérrez, Maria Angélica; Bejarano, Eduar Elías

2007-09-01

Lutzomyia sand flies are involved in the transmission of the parasite Leishmania spp. in America. The taxonomy of these vectors is traditionally based on morphological features of the adult stage, particularly the paired structures of the head and genitalia. Although these characters are useful to distinguish most species of Lutzomyia, morphological identification may be complicated by the similarities within subgenera and species group. To evaluate the utility of mitochondrial serine transfer RNA tRNA Ser for taxonomic identification of Lutzomyia. Seven sand fly species, each representing one of the 27 taxonomic subdivisions in genus Lutzomyia, were analyzed including L. trinidadensis (Oswaldoi group), L. (Psychodopygus) panamensis, L.(Micropygomyia) cayennensis cayennensis, L. dubitans (Migonei group), L. (Lutzomyia) gomezi, L. rangeliana (ungrouped) and L. evansi (Verrucarum group). The mitochondrial tRNA Ser gene, flanked by the cytochrome b and NAD dehydrogenase subunit one genes, was extracted, amplified and sequenced from each specimen. Secondary structure of the tRNA Ser was predicted by comparisons with previously described homologous structures from other dipteran species. The tRNA Ser gene ranged in size from 66 base pairs in L. gomezi to 69 base pairs in L. trinidadensis. Fourteen polymorphic sites, including four insertion-deletion events, were observed in the aligned 70 nucleotide positions. The majority of the substitutions were located in the dihydrouridine, ribothymidine-pseudouridine-cytosine and variable loops, as well as in the basal extreme of the anticodon arm. Changes of primary sequence of the tRNASer provided useful molecular characters for taxonomic identification of the sand fly species under consideration.

Functional Effects of Genetic Polymorphisms in the N-acetyltransferase 1 Coding and 3′ Untranslated Regions

PubMed Central

Zhu, Yuanqi; States, J. Christopher; Wang, Yang; Hein, David W.

2011-01-01

BACKGROUND The functional effects of N-acetyltransferase 1 (NAT1) polymorphisms and haplotypes are poorly understood, compromising the validity of associations reported with diseases including birth defects and numerous cancers. METHODS We investigated the effects of genetic polymorphisms within the NAT1 coding region and the 3′-untranslated region (3′-UTR) and their associated haplotypes on N- and O-acetyltransferase catalytic activities, and NAT1 mRNA and protein levels following recombinant expression in COS-1 cells. RESULTS 1088T>A (rs1057126; 3′-UTR) and 1095C>A (rs15561; 3′-UTR) each slightly reduced NAT1 catalytic activity and NAT1 mRNA and protein levels. A 9-base pair (TAATAATAA) deletion between nucleotides 1065-1090 (3′-UTR) reduced NAT1 catalytic activity and NAT1 mRNA and protein levels. In contrast, a 445G>A (rs4987076; V149I), 459G>A (rs4986990; T153T), 640T>G (rs4986783; S214A) coding region haplotype present in NAT1*11 increased NAT1 catalytic activity and NAT1 protein, but not NAT1 mRNA levels. A combination of the 9-base pair (TAATAATAA) deletion and the 445G>A, 459G>A, 640T>G coding region haplotypes, both present in NAT1*11, appeared to neutralize the opposing effects on NAT1 protein and catalytic activity, resulting in levels of NAT1 protein and catalytic activity that did not differ significantly from the NAT1*4 reference. CONCLUSIONS Since 1095C>A (3′-UTR) is the sole polymorphism present in NAT1*3, our data suggests that NAT1*3 is not functionally equivalent to the NAT1*4 reference. Furthermore, our findings provide biological support for reported associations of 1088T>A and 1095C>A polymorphisms with birth defects. PMID:21290563

Mitotic Evolution of Plasmodium falciparum Shows a Stable Core Genome but Recombination in Antigen Families

PubMed Central

Bopp, Selina E. R.; Manary, Micah J.; Bright, A. Taylor; Johnston, Geoffrey L.; Dharia, Neekesh V.; Luna, Fabio L.; McCormack, Susan; Plouffe, David; McNamara, Case W.; Walker, John R.; Fidock, David A.; Denchi, Eros Lazzerini; Winzeler, Elizabeth A.

2013-01-01

Malaria parasites elude eradication attempts both within the human host and across nations. At the individual level, parasites evade the host immune responses through antigenic variation. At the global level, parasites escape drug pressure through single nucleotide variants and gene copy amplification events conferring drug resistance. Despite their importance to global health, the rates at which these genomic alterations emerge have not been determined. We studied the complete genomes of different Plasmodium falciparum clones that had been propagated asexually over one year in the presence and absence of drug pressure. A combination of whole-genome microarray analysis and next-generation deep resequencing (totaling 14 terabases) revealed a stable core genome with only 38 novel single nucleotide variants appearing in seventeen evolved clones (avg. 5.4 per clone). In clones exposed to atovaquone, we found cytochrome b mutations as well as an amplification event encompassing the P. falciparum multidrug resistance associated protein (mrp1) on chromosome 1. We observed 18 large-scale (>1 kb on average) deletions of telomere-proximal regions encoding multigene families, involved in immune evasion (9.5×10−6 structural variants per base pair per generation). Six of these deletions were associated with chromosomal crossovers generated during mitosis. We found only minor differences in rates between genetically distinct strains and between parasites cultured in the presence or absence of drug. Using these derived mutation rates for P. falciparum (1.0–9.7×10−9 mutations per base pair per generation), we can now model the frequency at which drug or immune resistance alleles will emerge under a well-defined set of assumptions. Further, the detection of mitotic recombination events in var gene families illustrates how multigene families can arise and change over time in P. falciparum. These results will help improve our understanding of how P. falciparum evolves to evade control efforts within both the individual hosts and large populations. PMID:23408914

High fidelity of driver chromosomal alterations among primary and metastatic renal cell carcinomas: implications for tumor clonal evolution and treatment.

PubMed

Kouba, Eril J; Eble, John N; Simper, Novae; Grignon, David J; Wang, Mingsheng; Zhang, Shaobo; Wang, Lisha; Martignoni, Guido; Williamson, Sean R; Brunelli, Matteo; Luchini, Claudio; Calió, Anna; Cheng, Liang

2016-11-01

Recent studies have demonstrated considerable genomic heterogeneity in both primary and metastatic renal cell carcinoma (RCC). This mutational diversity has serious implications for the development and implementation of targeted molecular therapies. We evaluated 39 cases of primary RCC tumors with their matched metastatic tumors to determine if the hallmark chromosomal anomalies of these tumors are preserved over the course of disease progression. Thirty-nine matched pairs of primary and metastatic RCCs (20 clear cell RCC, 16 papillary RCC, and 3 chromophobe RCC) were analyzed. All clear cell RCC and papillary RCC tumors were evaluated for chromosome 3p deletion, trisomy 7 and 17 using fluorescence in situ hybridization. Chromophobe RCC tumors were evaluated for genetic alterations in chromosomes 1, 2, 6, 10, and 17. Of the 20 clear cell RCC tumors, 18 primary tumors (90%) showed a deletion of chromosome 3p and were disomic for chromosomes 7 and 17. All molecular aberrations were conserved within the matched metastatic tumor. Of the 16 papillary RCC tumors, 10 primary tumors (62%) showed trisomy for both chromosomes 7 and 17 without 3p deletion. These molecular aberrations and others were conserved in the paired metastatic tumors. Of the three chromophobe RCC tumors, multiple genetic anomalies were identified in chromosomes 1, 2, 6, 10, and 17. These chromosomal aberrations were conserved in the matched metastatic tumors. Our results demonstrated genomic fidelity among the primary and metastatic lesions in RCCs. These findings may have important clinical and diagnostic implications.

Mutations at the PAX6 locus are found in heterogeneous anterior segment malformations including Peters' anomaly.

PubMed

Hanson, I M; Fletcher, J M; Jordan, T; Brown, A; Taylor, D; Adams, R J; Punnett, H H; van Heyningen, V

1994-02-01

Mutation or deletion of the PAX6 gene underlies many cases of aniridia. Three lines of evidence now converge to implicate PAX6 more widely in anterior segment malformations including Peters' anomaly. First, a child with Peters' anomaly is deleted for one copy of PAX6. Second, affected members of a family with dominantly inherited anterior segment malformations, including Peters' anomaly are heterozygous for an R26G mutation in the PAX6 paired box. Third, a proportion of Sey/+ Smalleye mice, heterozygous for a nonsense mutation in murine Pax-6, have an ocular phenotype resembling Peters' anomaly. We therefore propose that a variety of anterior segment anomalies may be associated with PAX6 mutations.

Novel insertion mutation of ABCB1 gene in an ivermectin-sensitive Border Collie.

PubMed

Han, Jae-Ik; Son, Hyoung-Won; Park, Seung-Cheol; Na, Ki-Jeong

2010-12-01

P-glycoprotein (P-gp) is encoded by the ABCB1 gene and acts as an efflux pump for xenobiotics. In the Border Collie, a nonsense mutation caused by a 4-base pair deletion in the ABCB1 gene is associated with a premature stop to P-gp synthesis. In this study, we examined the full-length coding sequence of the ABCB1 gene in an ivermectin-sensitive Border Collie that lacked the aforementioned deletion mutation. The sequence was compared to the corresponding sequences of a wild-type Beagle and seven ivermectin-tolerant family members of the Border Collie. When compared to the wild-type Beagle sequence, that of the ivermectin-sensitive Border Collie was found to have one insertion mutation and eight single nucleotide polymorphisms (SNPs) in the coding sequence of the ABCB1 gene. While the eight SNPs were also found in the family members' sequences, the insertion mutation was found only in the ivermectin-sensitive dog. These results suggest the possibility that the SNPs are species-specific features of the ABCB1 gene in Border Collies, and that the insertion mutation may be related to ivermectin intolerance.

Novel insertion mutation of ABCB1 gene in an ivermectin-sensitive Border Collie

PubMed Central

Han, Jae-Ik; Son, Hyoung-Won; Park, Seung-Cheol

2010-01-01

P-glycoprotein (P-gp) is encoded by the ABCB1 gene and acts as an efflux pump for xenobiotics. In the Border Collie, a nonsense mutation caused by a 4-base pair deletion in the ABCB1 gene is associated with a premature stop to P-gp synthesis. In this study, we examined the full-length coding sequence of the ABCB1 gene in an ivermectin-sensitive Border Collie that lacked the aforementioned deletion mutation. The sequence was compared to the corresponding sequences of a wild-type Beagle and seven ivermectin-tolerant family members of the Border Collie. When compared to the wild-type Beagle sequence, that of the ivermectin-sensitive Border Collie was found to have one insertion mutation and eight single nucleotide polymorphisms (SNPs) in the coding sequence of the ABCB1 gene. While the eight SNPs were also found in the family members' sequences, the insertion mutation was found only in the ivermectin-sensitive dog. These results suggest the possibility that the SNPs are species-specific features of the ABCB1 gene in Border Collies, and that the insertion mutation may be related to ivermectin intolerance. PMID:21113104

Negative and positive regulation by a short segment in the 5'-flanking region of the human cytomegalovirus major immediate-early gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nelson, J.A.; Reynolds-Kohler, C.; Smith, B.A.

1987-11-01

To analyze the significance of inducible DNase I-hypersensitive sites occurring in the 5'-flanking sequence of the major immediate-early gene of human cytomegalovirus (HCMV), various deleted portions of the HCMV immediate-early promoter regulatory region were attached to the chloramphenicol acetyltransferase (CAT) gene and assayed for activity in transiently transfected undifferentiated and differentiated human teratocarcinoma cells, Tera-2. Assays of progressive deletions in the promoter regulatory region indicated that removal of a 395-base-pair portion of this element (nucleotides -750 to -1145) containing two inducible DNase I sites which correlate with gene expression resulted in a 7.5-fold increase in CAT activity in undifferentiated cells.more » However, in permissive differentiated Tera-2, human foreskin fibroblast, and HeLa cells, removal of this regulatory region resulted in decreased activity. In addition, attachment of this HCMV upstream element to a homologous or heterologous promoter increased activity three-to fivefold in permissive cells. Therefore, a cis regulatory element exists 5' to the enhancer of the major immediate-early gene of HCMV. This element negatively modulates expression in nonpermissive cells but positively influences expression in permissive cells.« less

Antigen-driven C–C Chemokine-mediated HIV-1 Suppression by CD4+ T Cells from Exposed Uninfected Individuals Expressing the Wild-type CCR-5 Allele

PubMed Central

Furci, Lucinda; Scarlatti, Gabriella; Burastero, Samuele; Tambussi, Giuseppe; Colognesi, Claudia; Quillent, Caroline; Longhi, Renato; Loverro, Patrizia; Borgonovo, Barbara; Gaffi, Davide; Carrow, Emily; Malnati, Mauro; Lusso, Paolo; Siccardi, Antonio G.; Lazzarin, Adriano; Beretta, Alberto

1997-01-01

Despite repeated exposure to HIV-1, certain individuals remain persistently uninfected. Such exposed uninfected (EU) people show evidence of HIV-1–specific T cell immunity and, in rare cases, selective resistance to infection by macrophage-tropic strains of HIV-1. The latter has been associated with a 32–base pair deletion in the C–C chemokine receptor gene CCR-5, the major coreceptor of macrophage-tropic strains of HIV-1. We have undertaken an analysis of the HIV-specific T cell responses in 12 EU individuals who were either homozygous for the wild-type CCR-5 allele or heterozygous for the deletion allele (CCR-5Δ32). We have found evidence of an oligoclonal T cell response mediated by helper T cells specific for a conserved region of the HIV-1 envelope. These cells produce very high levels of C–C chemokines when stimulated by the specific antigen and suppress selectively the replication of macrophage-tropic, but not T cell–tropic, strains of HIV-1. These chemokine-producing helper cells may be part of a protective immune response that could be potentially exploited for vaccine development. PMID:9236198

Simultaneous Quantification of Multiple Alternatively Spliced mRNA Transcripts Using Droplet Digital PCR.

PubMed

Sun, Bing; Zheng, Yun-Ling

2018-01-01

Currently there is no sensitive, precise, and reproducible method to quantitate alternative splicing of mRNA transcripts. Droplet digital™ PCR (ddPCR™) analysis allows for accurate digital counting for quantification of gene expression. Human telomerase reverse transcriptase (hTERT) is one of the essential components required for telomerase activity and for the maintenance of telomeres. Several alternatively spliced forms of hTERT mRNA in human primary and tumor cells have been reported in the literature. Using one pair of primers and two probes for hTERT, four alternatively spliced forms of hTERT (α-/β+, α+/β- single deletions, α-/β- double deletion, and nondeletion α+/β+) were accurately quantified through a novel analysis method via data collected from a single ddPCR reaction. In this chapter, we describe this ddPCR method that enables direct quantitative comparison of four alternatively spliced forms of the hTERT messenger RNA without the need for internal standards or multiple pairs of primers specific for each variant, eliminating the technical variation due to differential PCR amplification efficiency for different amplicons and the challenges of quantification using standard curves. This simple and straightforward method should have general utility for quantifying alternatively spliced gene transcripts.

Conversion of Deletions during Recombination in Pneumococcal Transformation

PubMed Central

Lefevre, J. C.; Mostachfi, P.; Gasc, A. M.; Guillot, E.; Pasta, F.; Sicard, M.

1989-01-01

Genetic analysis of 16 deletions obtained in the amiA locus of pneumococcus is described. When present on donor DNA, all deletions increased drastically the frequency of wild-type recombinants in two-point crosses. This effect was maximal for deletions longer than 200 bases. It was reduced for heterologies shorter than 76 bases and did not exist for very short deletions. In three-point crosses in which the deletion was localized between two point mutations, we demonstrated that this excess of wild-type recombinants was the result of a genetic conversion. This conversion extended over several scores of bases outside the deletion. Conversion takes place during the heteroduplex stage of recombination. Therefore, in pneumococcal transformation, long heterologies participated in this heteroduplex configuration. As this conversion did not require an active DNA polymerase A gene it is proposed that the mechanism of conversion is not a DNA repair synthesis but involves breakage and ligation between DNA molecules. Conversion of deletions did not require the Hex system of correction of mismatched bases. It differs also from localized conversion. It appears that it is a process that evolved to correct errors of replication which lead to long heterologies and which are not eliminated by other systems. PMID:2599365

Characterization of Deletions of the HBA and HBB Loci by Array Comparative Genomic Hybridization

PubMed Central

Sabath, Daniel E.; Bender, Michael A.; Sankaran, Vijay G.; Vamos, Esther; Kentsis, Alex; Yi, Hye-Son; Greisman, Harvey A.

2017-01-01

Thalassemia is among the most common genetic diseases worldwide. α-Thalassemia is usually caused by deletion of one or more of the duplicated HBA genes on chromosome 16. In contrast, most β-thalassemia results from point mutations that decrease or eliminate expression of the HBB gene on chromosome 11. Deletions within the HBB locus result in thalassemia or hereditary persistence of fetal Hb. Although routine diagnostic testing cannot distinguish thalassemia deletions from point mutations, deletional hereditary persistence of fetal Hb is notable for having an elevated HbF level with a normal mean corpuscular volume. A small number of deletions accounts for most α-thalassemias; in contrast, there are no predominant HBB deletions causing β-thalassemia. To facilitate the identification and characterization of deletions of the HBA and HBB globin loci, we performed array-based comparative genomic hybridization using a custom oligonucleotide microarray. We accurately mapped the breakpoints of known and previously uncharacterized HBB deletions defining previously uncharacterized deletion breakpoints by PCR amplification and sequencing. The array also successfully identified the common HBA deletions --SEA and --FIL. In summary, comparative genomic hybridization can be used to characterize deletions of the HBA and HBB loci, allowing high-resolution characterization of novel deletions that are not readily detected by PCR-based methods. PMID:26612711

Statistical alignment: computational properties, homology testing and goodness-of-fit.

PubMed

Hein, J; Wiuf, C; Knudsen, B; Møller, M B; Wibling, G

2000-09-08

The model of insertions and deletions in biological sequences, first formulated by Thorne, Kishino, and Felsenstein in 1991 (the TKF91 model), provides a basis for performing alignment within a statistical framework. Here we investigate this model.Firstly, we show how to accelerate the statistical alignment algorithms several orders of magnitude. The main innovations are to confine likelihood calculations to a band close to the similarity based alignment, to get good initial guesses of the evolutionary parameters and to apply an efficient numerical optimisation algorithm for finding the maximum likelihood estimate. In addition, the recursions originally presented by Thorne, Kishino and Felsenstein can be simplified. Two proteins, about 1500 amino acids long, can be analysed with this method in less than five seconds on a fast desktop computer, which makes this method practical for actual data analysis.Secondly, we propose a new homology test based on this model, where homology means that an ancestor to a sequence pair can be found finitely far back in time. This test has statistical advantages relative to the traditional shuffle test for proteins.Finally, we describe a goodness-of-fit test, that allows testing the proposed insertion-deletion (indel) process inherent to this model and find that real sequences (here globins) probably experience indels longer than one, contrary to what is assumed by the model. Copyright 2000 Academic Press.

Role of the CCA bulge of prohead RNA of bacteriophage ø29 in DNA packaging.

PubMed

Zhao, Wei; Morais, Marc C; Anderson, Dwight L; Jardine, Paul J; Grimes, Shelley

2008-11-14

The oligomeric ring of prohead RNA (pRNA) is an essential component of the ATP-driven DNA packaging motor of bacteriophage ø29. The A-helix of pRNA binds the DNA translocating ATPase gp16 (gene product 16) and the CCA bulge in this helix is essential for DNA packaging in vitro. Mutation of the bulge by base substitution or deletion showed that the size of the bulge, rather than its sequence, is primary in DNA packaging activity. Proheads reconstituted with CCA bulge mutant pRNAs bound the packaging ATPase gp16 and the packaging substrate DNA-gp3, although DNA translocation was not detected with several mutants. Prohead/bulge-mutant pRNA complexes with low packaging activity had a higher rate of ATP hydrolysis per base pair of DNA packaged than proheads with wild-type pRNA. Cryoelectron microscopy three-dimensional reconstruction of proheads reconstituted with a CCA deletion pRNA showed that the protruding pRNA spokes of the motor occupy a different position relative to the head when compared to particles with wild-type pRNA. Therefore, the CCA bulge seems to dictate the orientation of the pRNA spokes. The conformational changes observed for this mutant pRNA may affect gp16 conformation and/or subsequent ATPase-DNA interaction and, consequently, explain the decreased packaging activity observed for CCA mutants.

Looking beyond the exome: a phenotype-first approach to molecular diagnostic resolution in rare and undiagnosed diseases.

PubMed

Pena, Loren D M; Jiang, Yong-Hui; Schoch, Kelly; Spillmann, Rebecca C; Walley, Nicole; Stong, Nicholas; Rapisardo Horn, Sarah; Sullivan, Jennifer A; McConkie-Rosell, Allyn; Kansagra, Sujay; Smith, Edward C; El-Dairi, Mays; Bellet, Jane; Keels, Martha Ann; Jasien, Joan; Kranz, Peter G; Noel, Richard; Nagaraj, Shashi K; Lark, Robert K; Wechsler, Daniel S G; Del Gaudio, Daniela; Leung, Marco L; Hendon, Laura G; Parker, Collette C; Jones, Kelly L; Goldstein, David B; Shashi, Vandana

2018-04-01

PurposeTo describe examples of missed pathogenic variants on whole-exome sequencing (WES) and the importance of deep phenotyping for further diagnostic testing.MethodsGuided by phenotypic information, three children with negative WES underwent targeted single-gene testing.ResultsIndividual 1 had a clinical diagnosis consistent with infantile systemic hyalinosis, although WES and a next-generation sequencing (NGS)-based ANTXR2 test were negative. Sanger sequencing of ANTXR2 revealed a homozygous single base pair insertion, previously missed by the WES variant caller software. Individual 2 had neurodevelopmental regression and cerebellar atrophy, with no diagnosis on WES. New clinical findings prompted Sanger sequencing and copy number testing of PLA2G6. A novel homozygous deletion of the noncoding exon 1 (not included in the WES capture kit) was detected, with extension into the promoter, confirming the clinical suspicion of infantile neuroaxonal dystrophy. Individual 3 had progressive ataxia, spasticity, and magnetic resonance image changes of vanishing white matter leukoencephalopathy. An NGS leukodystrophy gene panel and WES showed a heterozygous pathogenic variant in EIF2B5; no deletions/duplications were detected. Sanger sequencing of EIF2B5 showed a frameshift indel, probably missed owing to failure of alignment.ConclusionThese cases illustrate potential pitfalls of WES/NGS testing and the importance of phenotype-guided molecular testing in yielding diagnoses.

Looking beyond the exome: a phenotype-first approach to molecular diagnostic resolution in rare and undiagnosed diseases

PubMed Central

Pena, Loren DM; Jiang, Yong-Hui; Schoch, Kelly; Spillmann, Rebecca C.; Walley, Nicole; Stong, Nicholas; Horn, Sarah Rapisardo; Sullivan, Jennifer A.; McConkie-Rosell, Allyn; Kansagra, Sujay; Smith, Edward C.; El-Dairi, Mays; Bellet, Jane; Ann Keels, Martha; Jasien, Joan; Kranz, Peter G.; Noel, Richard; Nagaraj, Shashi K.; Lark, Robert K.; Wechsler, Daniel SG; del Gaudio, Daniela; Leung, Marco L.; Hendon, Laura G.; Parker, Collette C.; Jones, Kelly L.; Goldstein, David B.; Shashi, Vandana

2017-01-01

Purpose To describe examples of missed pathogenic variants on whole exome sequencing (WES) and the importance of deep phenotyping for further diagnostic testing. Methods Guided by phenotypic information, three children with negative WES underwent targeted single gene testing. Results Individual 1 had a clinical diagnosis consistent with infantile systemic hyalinosis, although WES and an NGS-based ANTXR2 test were negative. Sanger sequencing of ANTXR2 revealed a homozygous single base pair insertion, previously missed by the WES variant caller software. Individual 2 had neurodevelopmental regression and cerebellar atrophy, with no diagnosis on WES. New clinical findings prompted Sanger sequencing and copy number testing of PLA2G6. A novel homozygous deletion of the non-coding exon 1 (not included in the WES capture kit) was detected, with extension into the promoter, confirming the clinical suspicion of infantile neuroaxonal dystrophy. Individual 3 had progressive ataxia, spasticity and MRI changes of vanishing white matter leukoencephalopathy. An NGS leukodystrophy gene panel and WES showed a heterozygous pathogenic variant in EIF2B5; no deletions/duplications were detected. Sanger sequencing of EIF2B5 showed a frameshift indel, likely missed due to failure of alignment. Conclusions These cases illustrate potential pitfalls of WES/NGS testing, and the importance of phenotype-guided molecular testing in yielding diagnoses. PMID:28914269

Sequence Requirements of the 5-Enolpyruvylshikimate-3-phosphate Synthase 5[prime]-Upstream Region for Tissue-Specific Expression in Flowers and Seedlings.

PubMed Central

Benfey, PN; Takatsuji, H; Ren, L; Shah, DM; Chua, NH

1990-01-01

We have analyzed expression from deletion derivatives of the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) 5[prime]-upstream region in transgenic petunia flowers and seedlings. In seedlings, expression was strongest in root cortex cells and in trichomes. High-level expression in petals and in seedling roots was conferred by large (>500 base-pair) stretches of sequence, but was lost when smaller fragments were analyzed individually. This apparent requirement for extensive sequence suggests that combinations of cis-elements that are widely separated control tissue-specific expression from the EPSPS promoter. We have also used the high-level, petal-specific expression of the EPSPS promoter to change petal color in two mutant petunia lines. PMID:12354968

Juvenile-onset Sporadic Amyotrophic Lateral Sclerosis with a Frameshift FUS Gene Mutation Presenting Unique Neuroradiological Findings and Cognitive Impairment.

PubMed

Hirayanagi, Kimitoshi; Sato, Masayuki; Furuta, Natsumi; Makioka, Kouki; Ikeda, Yoshio

2016-01-01

A 24-year-old Japanese woman developed anterocollis, weakness of the proximal arms, and subsequent cognitive impairment. A neurological examination revealed amyotrophic lateral sclerosis (ALS) without a family history. Systemic muscle atrophy progressed rapidly. Cerebral MRI clearly exhibited high signal intensities along the bilateral pyramidal tracts. An analysis of the FUS gene revealed a heterozygous two-base pair deletion, c.1507-1508delAG (p.G504WfsX515). A subset of juvenile-onset familial/sporadic ALS cases with FUS gene mutations reportedly demonstrates mental retardation or learning difficulty. Our study emphasizes the importance of conducting a FUS gene analysis in juvenile-onset ALS cases, even when no family occurrence is confirmed.

37 CFR 2.35 - Adding, deleting, or substituting bases.

Code of Federal Regulations, 2013 CFR

2013-07-01

... 37 Patents, Trademarks, and Copyrights 1 2013-07-01 2013-07-01 false Adding, deleting, or substituting bases. 2.35 Section 2.35 Patents, Trademarks, and Copyrights UNITED STATES PATENT AND TRADEMARK..., deleting, or substituting bases. (a) In an application under section 66(a) of the Act, an applicant may not...

37 CFR 2.35 - Adding, deleting, or substituting bases.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 37 Patents, Trademarks, and Copyrights 1 2011-07-01 2011-07-01 false Adding, deleting, or substituting bases. 2.35 Section 2.35 Patents, Trademarks, and Copyrights UNITED STATES PATENT AND TRADEMARK..., deleting, or substituting bases. (a) In an application under section 66(a) of the Act, an applicant may not...

37 CFR 2.35 - Adding, deleting, or substituting bases.

Code of Federal Regulations, 2012 CFR

2012-07-01

... 37 Patents, Trademarks, and Copyrights 1 2012-07-01 2012-07-01 false Adding, deleting, or substituting bases. 2.35 Section 2.35 Patents, Trademarks, and Copyrights UNITED STATES PATENT AND TRADEMARK..., deleting, or substituting bases. (a) In an application under section 66(a) of the Act, an applicant may not...

37 CFR 2.35 - Adding, deleting, or substituting bases.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Adding, deleting, or substituting bases. 2.35 Section 2.35 Patents, Trademarks, and Copyrights UNITED STATES PATENT AND TRADEMARK..., deleting, or substituting bases. (a) In an application under section 66(a) of the Act, an applicant may not...

Sequence-specific epigenetic effects of the maternal somatic genome on developmental rearrangements of the zygotic genome in Paramecium primaurelia.

PubMed Central

Meyer, E; Butler, A; Dubrana, K; Duharcourt, S; Caron, F

1997-01-01

In ciliates, the germ line genome is extensively rearranged during the development of the somatic macronucleus from a mitotic product of the zygotic nucleus. Germ line chromosomes are fragmented in specific regions, and a large number of internal sequence elements are eliminated. It was previously shown that transformation of the vegetative macronucleus of Paramecium primaurelia with a plasmid containing a subtelomeric surface antigen gene can affect the processing of the homologous germ line genomic region during development of a new macronucleus in sexual progeny of transformed clones. The gene and telomere-proximal flanking sequences are deleted from the new macronuclear genome, although the germ line genome remains wild type. Here we show that plasmids containing nonoverlapping segments of the same genomic region are able to induce similar terminal deletions; the locations of deletion end points depend on the particular sequence used. Transformation of the maternal macronucleus with a sequence internal to a macronuclear chromosome also causes the occurrence of internal deletions between short direct repeats composed of alternating thymines and adenines. The epigenetic influence of maternal macronuclear sequences on developmental rearrangements of the zygotic genome thus appears to be both sequence specific and general, suggesting that this trans-nucleus effect is mediated by pairing of homologous sequences. PMID:9199294

Comprehensive Genomic Profiling Aids in Distinguishing Metastatic Recurrence from Second Primary Cancers

PubMed Central

Weinberg, Benjamin A.; Gowen, Kyle; Lee, Thomas K.; Ou, Sai‐Hong Ignatius; Bristow, Robert; Krill, Lauren; Almira‐Suarez, M. Isabel; Ali, Siraj M.; Miller, Vincent A.; Liu, Stephen V.

2017-01-01

Abstract Background. Metastatic recurrence after treatment for locoregional cancer is a major cause of morbidity and cancer‐specific mortality. Distinguishing metastatic recurrence from the development of a second primary cancer has important prognostic and therapeutic value and represents a difficult clinical scenario. Advances beyond histopathological comparison are needed. We sought to interrogate the ability of comprehensive genomic profiling (CGP) to aid in distinguishing between these clinical scenarios. Materials and Methods. We identified three prospective cases of recurrent tumors in patients previously treated for localized cancers in which histologic analyses suggested subsequent development of a distinct second primary. Paired samples from the original primary and recurrent tumor were subjected to hybrid capture next‐generation sequencing‐based CGP to identify base pair substitutions, insertions, deletions, copy number alterations (CNA), and chromosomal rearrangements. Genomic profiles between paired samples were compared using previously established statistical clonality assessment software to gauge relatedness beyond global CGP similarities. Results. A high degree of similarity was observed among genomic profiles from morphologically distinct primary and recurrent tumors. Genomic information suggested reclassification as recurrent metastatic disease, and patients received therapy for metastatic disease based on the molecular determination. Conclusions. Our cases demonstrate an important adjunct role for CGP technologies in separating metastatic recurrence from development of a second primary cancer. Larger series are needed to confirm our observations, but comparative CGP may be considered in patients for whom distinguishing metastatic recurrence from a second primary would alter the therapeutic approach. Implications for Practice. Distinguishing a metastatic recurrence from a second primary cancer can represent a difficult clinicopathologic problem but has important prognostic and therapeutic implications. Approaches to aid histologic analysis may improve clinician and pathologist confidence in this increasingly common clinical scenario. Our series provides early support for incorporating paired comprehensive genomic profiling in clinical situations in which determination of metastatic recurrence versus a distinct second primary cancer would influence patient management. PMID:28193735

Mutant quantity and quality in mammalian cells (A{sub L}) exposed to cesium-137 gamma radiation: Effect of caffeine

DOE Office of Scientific and Technical Information (OSTI.GOV)

McGuinness, S.M.; Shibuya, M.L.; Ueno, A.M.

1995-06-01

We examined the effect of caffeine (1,3,7-trimethylxanthine) on the quantity and quality of mutations in cultured mammalian A{sub L} human-hamster hybrid cells exposed to {sup 137}Cs {gamma} radiation. At a dose (1.5 mg/ml for 16 h) that reduced the plating efficiency (PE) by 20%, caffeine was not itself a significant mutagen, but it increased by approximately twofold the slope of the dose-response curve for induction of S1{sup {minus}} mutants by {sup 137}Cs {gamma} radiation. Molecular analysis of 235 S1{sup {minus}} mutants using a series of DNA probes mapped to the human chromosome 11 in the A{sub L} hybrid cells revealedmore » that 73 to 85% of the mutations in unexposed cells and in cells treated with caffeine alone, {sup 137}Cs {gamma} rays alone or {sup 137}Cs {gamma} rays plus caffeine were large deletions involving millions of base pairs of DNA. Most of these deletions were contiguous with the region of the MIC1 gene at 11p13 that encodes the S1 cell surface antigen. In other mutants that had suffered multiple marker loss, the deletions were intermittent along chromosome 11. These {open_quotes}complex{close_quotes} mutations were rare for {sup 137}Cs {gamma} irradiation (1/63 = 1.5%) but relatively prevalent (23-50%) for other exposure conditions. Thus caffeine appears to alter both the quantity and quality of mutations induced by {sup 137}Cs {gamma} irradiation. 62 refs., 3 figs., 3 tabs.« less

Genome-wide survey of artificial mutations induced by ethyl methanesulfonate and gamma rays in tomato.

PubMed

Shirasawa, Kenta; Hirakawa, Hideki; Nunome, Tsukasa; Tabata, Satoshi; Isobe, Sachiko

2016-01-01

Genome-wide mutations induced by ethyl methanesulfonate (EMS) and gamma irradiation in the tomato Micro-Tom genome were identified by a whole-genome shotgun sequencing analysis to estimate the spectrum and distribution of whole-genome DNA mutations and the frequency of deleterious mutations. A total of ~370 Gb of paired-end reads for four EMS-induced mutants and three gamma-ray-irradiated lines as well as a wild-type line were obtained by next-generation sequencing technology. Using bioinformatics analyses, we identified 5920 induced single nucleotide variations and insertion/deletion (indel) mutations. The predominant mutations in the EMS mutants were C/G to T/A transitions, while in the gamma-ray mutants, C/G to T/A transitions, A/T to T/A transversions, A/T to G/C transitions and deletion mutations were equally common. Biases in the base composition flanking mutations differed between the mutagenesis types. Regarding the effects of the mutations on gene function, >90% of the mutations were located in intergenic regions, and only 0.2% were deleterious. In addition, we detected 1,140,687 spontaneous single nucleotide polymorphisms and indel polymorphisms in wild-type Micro-Tom lines. We also found copy number variation, deletions and insertions of chromosomal segments in both the mutant and wild-type lines. The results provide helpful information not only for mutation research, but also for mutant screening methodology with reverse-genetic approaches. © 2015 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Characterization of the hyperrecombination phenotype of the pol3-t mutation of Saccharomyces cerevisiae.

PubMed

Galli, Alvaro; Cervelli, Tiziana; Schiestl, Robert H

2003-05-01

The DNA polymerase delta (Pol3p/Cdc2p) allele pol3-t of Saccharomyces cerevisiae has previously been shown to increase the frequency of deletions between short repeats (several base pairs), between homologous DNA sequences separated by long inverted repeats, and between distant short repeats, increasing the frequency of genomic deletions. We found that the pol3-t mutation increased intrachromosomal recombination events between direct DNA repeats up to 36-fold and interchromosomal recombination 14-fold. The hyperrecombination phenotype of pol3-t was partially dependent on the Rad52p function but much more so on Rad1p. However, in the double-mutant rad1 Delta rad52 Delta, the pol3-t mutation still increased spontaneous intrachromosomal recombination frequencies, suggesting that a Rad1p Rad52p-independent single-strand annealing pathway is involved. UV and gamma-rays were less potent inducers of recombination in the pol3-t mutant, indicating that Pol3p is partly involved in DNA-damage-induced recombination. In contrast, while UV- and gamma-ray-induced intrachromosomal recombination was almost completely abolished in the rad52 or the rad1 rad52 mutant, there was still good induction in those mutants in the pol3-t background, indicating channeling of lesions into the above-mentioned Rad1p Rad52p-independent pathway. Finally, a heterozygous pol3-t/POL3 mutant also showed an increased frequency of deletions and MMS sensitivity at the restrictive temperature, indicating that even a heterozygous polymerase delta mutation might increase the frequency of genetic instability.

Production of Mutated Porcine Embryos Using Zinc Finger Nucleases and a Reporter-based Cell Enrichment System.

PubMed

Koo, Ok Jae; Park, Sol Ji; Lee, Choongil; Kang, Jung Taek; Kim, Sujin; Moon, Joon Ho; Choi, Ji Yei; Kim, Hyojin; Jang, Goo; Kim, Jin-Soo; Kim, Seokjoong; Lee, Byeong-Chun

2014-03-01

To facilitate the construction of genetically-modified pigs, we produced cloned embryos derived from porcine fibroblasts transfected with a pair of engineered zinc finger nuclease (ZFN) plasmids to create targeted mutations and enriched using a reporter plasmid system. The reporter expresses RFP and eGFP simultaneously when ZFN-mediated site-specific mutations occur. Thus, double positive cells (RFP(+)/eGFP(+)) were selected and used for somatic cell nuclear transfer. Two types of reporter based enrichment systems were used in this study; the cloned embryos derived from cells enriched using a magnetic sorting-based system showed better developmental competence than did those derived from cells enriched by flow cytometry. Mutated sequences, such as insertions, deletions, or substitutions, together with the wild-type sequence, were found in the cloned porcine blastocysts. Therefore, genetic mutations can be achieved in cloned porcine embryos reconstructed with ZFN-treated cells that were enriched by a reporter-based system.

Identification of genomic indels and structural variations using split reads

PubMed Central

2011-01-01

Background Recent studies have demonstrated the genetic significance of insertions, deletions, and other more complex structural variants (SVs) in the human population. With the development of the next-generation sequencing technologies, high-throughput surveys of SVs on the whole-genome level have become possible. Here we present split-read identification, calibrated (SRiC), a sequence-based method for SV detection. Results We start by mapping each read to the reference genome in standard fashion using gapped alignment. Then to identify SVs, we score each of the many initial mappings with an assessment strategy designed to take into account both sequencing and alignment errors (e.g. scoring more highly events gapped in the center of a read). All current SV calling methods have multilevel biases in their identifications due to both experimental and computational limitations (e.g. calling more deletions than insertions). A key aspect of our approach is that we calibrate all our calls against synthetic data sets generated from simulations of high-throughput sequencing (with realistic error models). This allows us to calculate sensitivity and the positive predictive value under different parameter-value scenarios and for different classes of events (e.g. long deletions vs. short insertions). We run our calculations on representative data from the 1000 Genomes Project. Coupling the observed numbers of events on chromosome 1 with the calibrations gleaned from the simulations (for different length events) allows us to construct a relatively unbiased estimate for the total number of SVs in the human genome across a wide range of length scales. We estimate in particular that an individual genome contains ~670,000 indels/SVs. Conclusions Compared with the existing read-depth and read-pair approaches for SV identification, our method can pinpoint the exact breakpoints of SV events, reveal the actual sequence content of insertions, and cover the whole size spectrum for deletions. Moreover, with the advent of the third-generation sequencing technologies that produce longer reads, we expect our method to be even more useful. PMID:21787423

Lack of association between increased mitochondrial DNA4977 deletion and ATP levels of sputum cells from chronic obstructive pulmonary disease patients versus healthy smokers.

PubMed

Karimova, A; Oltulu, Y M; Azaklı, H; Kara, M; Ustek, D; Tutluoglu, B; Onaran, I

2017-05-01

In this study we looked at smokers with and without chronic obstructive pulmonary disease (COPD) patients in order to evaluate the incidence of 4977 base pair (bp) mtDNA (mtDNA 4977 ) deletion and mtDNA copy number in sputum cells and in peripheral blood leukocytes (PBLs) in relation to mitochondrial function and oxidative stress status. Twenty-five COPD patients who were current smokers, 22 smokers and 23 healthy nonsmokers (for only PBLs studies) participated in this study. The 4977-bp deletion was detected in all examined samples within 40 cyles of PCR amplification, using a quantitative real time PCR. The frequency of the mtDNA 4977 was significantly higher in the sputum cells of patients with COPD compared to smokers without COPD (p < 0.0001). This difference was not observed in PBLs. Levels of cellular oxidative stress were significantly higher in the sputum cells of subjects with COPD than in the smoker group. However, mtDNA copy number, mitochondrial membrane potential (ΔΨm) and cellular ATP levels in PBLs and sputum cells were not significantly different between the studied groups. The Pearson analysis revealed no correlations between the accumulation of mtDNA 4977 , and intracellular ATP content and ΔΨm values of the sputum cells, although there was a positive correlation between the increase in the percentage of deleted mtDNA 4977 and the levels of cellular oxidative stress in COPD patients (r = 0.80, p < 0.0001). Our studies may suggest that the accumulation of mtDNA 4977 in the sputum cells of smokers with COPD does not seem to have an important impact on mitochondrial dysfunction in relation to ATP production and ΔΨm when compared to those of healthy smokers.

Nablus mask-like facial syndrome: deletion of chromosome 8q22.1 is necessary but not sufficient to cause the phenotype.

PubMed

Allanson, Judith; Smith, Amanda; Hare, Heather; Albrecht, Beate; Bijlsma, Emilia; Dallapiccola, Bruno; Donti, Emilio; Fitzpatrick, David; Isidor, Bertrand; Lachlan, Katherine; Le Caignec, Cedric; Prontera, Paolo; Raas-Rothschild, Annick; Rogaia, Daniela; van Bon, Bregje; Aradhya, Swaroop; Crocker, Susan F; Jarinova, Olga; McGowan-Jordan, Jean; Boycott, Kym; Bulman, Dennis; Fagerberg, Christina Ringmann

2012-09-01

Nablus mask-like facial syndrome (NMLFS) has many distinctive phenotypic features, particularly tight glistening skin with reduced facial expression, blepharophimosis, telecanthus, bulky nasal tip, abnormal external ear architecture, upswept frontal hairline, and sparse eyebrows. Over the last few years, several individuals with NMLFS have been reported to have a microdeletion of 8q21.3q22.1, demonstrated by microarray analysis. The minimal overlapping region is 93.98-96.22 Mb (hg19). Here we present clinical and microarray data from five singletons and two mother-child pairs who have heterozygous deletions significantly overlapping the region associated with NMLFS. Notably, while one mother and child were said to have mild tightening of facial skin, none of these individuals exhibited reduced facial expression or the classical facial phenotype of NMLFS. These findings indicate that deletion of the 8q21.3q22.1 region is necessary but not sufficient for development of the NMLFS. We discuss possible genetic mechanisms underlying the complex pattern of inheritance for this condition. Copyright © 2012 Wiley Periodicals, Inc.

Screening of polymorphisms for MTHFR and DHFR genes in spina bifida children and their mothers

NASA Astrophysics Data System (ADS)

Husna, M. Z.; Endom, I.; Ibrahim, S.; Selvi, N. Amaramalar; Fakhrurazi, H.; Htwe, R. Ohnmar; Kanehaswari, Y.; Halim, A. R. Abdul; Wong, S. W.; Subashini, K.; Syahira, O. Nur; Aishah, S.

2013-11-01

Mechanism underlying the beneficial effect of folic acid supplementation in reducing the risk of neural tube defect is still not well understood. Current evidences show the involvement of folic acid metabolic gene's polymorphism as contributing factors that regulate this pathway. Therefore, the objective of this research was to determine the presence of C677T polymorphism for methylenetetrahydrofolate reductase (MTHFR) and dihydrofolate reductase (DHFR-19 bp deletion) genes between mother-children pairs of case and control. With the approval of UKMMC ethic committee, genomic DNA was extracted from one hundred and forty consented bloods. Polymerase chain reaction (PCR), PCR-RFLP (Restriction Fragment Length Polymorphism) and sequencing were employed to verify each nucleotide change. Our result shows that mutant MTHFR and DHFR alleles are present in all Malaysian sub-ethnic groups, case and control. Even though mutant MTHFR are found to be slightly higher in the case groups, 75% of the affected child is a non carrier for this allele and 62.5% of the mothers with an affected child are genotypically normal. For DHFR, almost all (87.5-100%) investigated samples are a carrier or having a double DHFR deletion be it a case or control pairs. However, strong maternal inheritance shown by the deleted allele might be due to a cascade effect of lacks of folate consumption or maternal uniparental disomy. In conclusion, the use of MTHFR and DHFR as markers in determining the risk of having spina bifida baby is uninformative and plays a small indirect role as the genetic causes of spina bifida. Therefore, spina bifida remains etiologically unknown polygenic and quantitative developmental trait whereby the searches for positive genetic marker need to be continued.

Frazzled/DCC facilitates cardiac cell outgrowth and attachment during Drosophila dorsal vessel formation.

PubMed

Macabenta, Frank D; Jensen, Amber G; Cheng, Yi-Shan; Kramer, Joseph J; Kramer, Sunita G

2013-08-15

Drosophila embryonic dorsal vessel (DV) morphogenesis is a highly stereotyped process that involves the migration and morphogenesis of 52 pairs of cardioblasts (CBs) in order to form a linear tube. This process requires spatiotemporally-regulated localization of signaling and adhesive proteins in order to coordinate the formation of a central lumen while maintaining simultaneous adhesion between CBs. Previous studies have shown that the Slit/Roundabout and Netrin/Unc5 repulsive signaling pathways facilitate site-specific loss of adhesion between contralateral CBs in order to form a luminal space. However, the concomitant mechanism by which attraction initiates CB outgrowth and discrete localization of adhesive proteins remains poorly understood. Here we provide genetic evidence that Netrin signals through DCC (Deleted in Colorectal Carcinoma)/UNC-40/Frazzled (Fra) to mediate CB outgrowth and attachment and that this function occurs prior to and independently of Netrin/UNC-5 signaling. fra mRNA is expressed in the CBs prior to and during DV morphogenesis. Loss-of-fra-function results in significant defects in cell shape and alignment between contralateral CB rows. In addition, CB outgrowth and attachment is impaired in both fra loss- and gain-of-function mutants. Deletion of both Netrin genes (NetA and NetB) results in CB attachment phenotypes similar to fra mutants. Similar defects are also seen when both fra and unc5 are deleted. Finally we show that Fra accumulates at dorsal and ventral leading edges of paired CBs, and this localization is dependent upon Netrin. We propose that while repulsive guidance mechanisms contribute to lumen formation by preventing luminal domains from coming together, site-specific Netrin/Frazzled signaling mediates CB attachment. Copyright © 2013 Elsevier Inc. All rights reserved.

Nuclease-mediated double-strand break (DSB) enhancement of small fragment homologous recombination (SFHR) gene modification in human-induced pluripotent stem cells (hiPSCs).

PubMed

Sargent, R Geoffrey; Suzuki, Shingo; Gruenert, Dieter C

2014-01-01

Recent developments in methods to specifically modify genomic DNA using sequence-specific endonucleases and donor DNA have opened the door to a new therapeutic paradigm for cell and gene therapy of inherited diseases. Sequence-specific endonucleases, in particular transcription activator-like (TAL) effector nucleases (TALENs), have been coupled with polynucleotide small/short DNA fragments (SDFs) to correct the most common mutation in the cystic fibrosis (CF) transmembrane conductance regulator (CFTR) gene, a 3-base-pair deletion at codon 508 (delF508), in induced pluripotent stem (iPS) cells. The studies presented here describe the generation of candidate TALENs and their co-transfection with wild-type (wt) CFTR-SDFs into CF-iPS cells homozygous for the delF508 mutation. Using an allele-specific PCR (AS-PCR)-based cyclic enrichment protocol, clonal populations of corrected CF-iPS cells were isolated and expanded.

Application of TALE-Based Approach for Dissecting Functional MicroRNA-302/367 in Cellular Reprogramming.

PubMed

Zhang, Zhonghui; Wu, Wen-Shu

2018-01-01

MicroRNAs are small 18-24 nt single-stranded noncoding RNA molecules involved in many biological processes, including stemness maintenance and cellular reprogramming. Current methods used in loss-of-function studies of microRNAs have several limitations. Here, we describe a new approach for dissecting miR-302/367 functions by transcription activator-like effectors (TALEs), which are natural effector proteins secreted by Xanthomonas and Ralstonia bacteria. Knockdown of the miR-302/367 cluster uses the Kruppel-associated box repressor domain fused with specific TALEs designed to bind the miR-302/367 cluster promoter. Knockout of the miR-302/367 cluster uses two pairs of TALE nucleases (TALENs) to delete the miR-302/367 cluster in human primary cells. Together, both TALE-based transcriptional repressor and TALENs are two promising approaches for loss-of-function studies of microRNA cluster in human primary cells.

Historic, clinical, and prognostic features of epileptic encephalopathies caused by CDKL5 mutations.

PubMed

Moseley, Brian D; Dhamija, Radhika; Wirrell, Elaine C; Nickels, Katherine C

2012-02-01

Mutations within the X-linked cyclin-dependent kinase-like 5 (CDKL5) gene are important causes of early-onset epileptic encephalopathies. We sought to determine the historic, clinical, and prognostic features of epilepsy secondary to CDKL5 mutations. We performed retrospective chart reviews of children at our institution with epilepsy and CDKL5 mutations. Six children were identified. One manifested a deletion in exons 10-15 of the CDKL5 gene, another manifested a single base-pair duplication in exon 3, and the rest manifested base-pair exchanges. The mean age of seizure onset was 1.8 months (range, 1-3 months). Although the majority (4/6, 67%) presented with partial-onset seizures, all children developed infantile spasms. All children demonstrated developmental delay and visual impairment. Although such mutations are X-linked, two children were boys. They did not present with more severe phenotypes than their female counterparts. Despite trials of antiepileptic drugs (mean, 5; range, 3-7), steroids/adrenocorticotropic hormone (4/6; 67%), and the ketogenic diet (6/6; 100%), all children manifested refractory seizures at last follow-up. Although no treatment eliminated seizures, topiramate, vigabatrin, and the ketogenic diet were most helpful at reducing seizure frequency. Copyright © 2012 Elsevier Inc. All rights reserved.

SEQUOIA: significance enhanced network querying through context-sensitive random walk and minimization of network conductance.

PubMed

Jeong, Hyundoo; Yoon, Byung-Jun

2017-03-14

Network querying algorithms provide computational means to identify conserved network modules in large-scale biological networks that are similar to known functional modules, such as pathways or molecular complexes. Two main challenges for network querying algorithms are the high computational complexity of detecting potential isomorphism between the query and the target graphs and ensuring the biological significance of the query results. In this paper, we propose SEQUOIA, a novel network querying algorithm that effectively addresses these issues by utilizing a context-sensitive random walk (CSRW) model for network comparison and minimizing the network conductance of potential matches in the target network. The CSRW model, inspired by the pair hidden Markov model (pair-HMM) that has been widely used for sequence comparison and alignment, can accurately assess the node-to-node correspondence between different graphs by accounting for node insertions and deletions. The proposed algorithm identifies high-scoring network regions based on the CSRW scores, which are subsequently extended by maximally reducing the network conductance of the identified subnetworks. Performance assessment based on real PPI networks and known molecular complexes show that SEQUOIA outperforms existing methods and clearly enhances the biological significance of the query results. The source code and datasets can be downloaded from http://www.ece.tamu.edu/~bjyoon/SEQUOIA .

Surveying a supercoil domain by using the gamma delta resolution system in Salmonella typhimurium.

PubMed Central

Higgins, N P; Yang, X; Fu, Q; Roth, J R

1996-01-01

A genetic system was developed to investigate the supercoil structure of bacterial chromosomes. New res-carrying transposons were derived from MudI1734 (MudJr1 and MudJr2) and Tn10 (Tn10dGn). The MudJr1 and MudJr2 elements each have a res site in opposite orientation so that when paired with a Tn10dGn element in the same chromosome, one MudJr res site will be ordered as a direct repeat. Deletion formation was studied in a nonessential region (approximately 100 kb) that extends from the his operon through the cob operon. Strains with a MudJr insertion in the cobT gene at the 5' end of the cob operon plus a Tn10dGn insertion positioned either clockwise or counterclockwise from cobT were exposed to a burst of RES protein. Following a pulse of resolvase expression, deletion formation was monitored by scoring the loss of the Lac+ phenotype or by loss of tetracycline resistance. In exponentially growing populations, deletion products appeared quickly in some cells (in 10 min) but also occurred more than an hour after RES induction. The frequency of deletion (y) diminished with increasing distance (x) between res sites. Results from 15 deletion intervals fit the exponential equation y = 120 . 10(-0.02x). We found that res sites can be plectonemically interwound over long distances ( > 100 kb) and that barriers to supercoil diffusion are placed stochastically within the 43- to 45-min region of the chromosome. PMID:8631670

Construction and characterization of outbreak Escherichia coli O157:H7 surrogate strains for use in field studies.

PubMed

Webb, Cathy C; Erickson, Marilyn C; Davey, Lindsey E; Payton, Alison S; Doyle, Michael P

2014-11-01

Escherichia coli O157:H7 has been the causative agent of many outbreaks associated with leafy green produce consumption. Elucidating the mechanism by which contamination occurs requires monitoring interactions between the pathogen and the plant under typical production conditions. Intentional introduction of virulent strains into fields is not an acceptable practice. As an alternative, attenuated strains of natural isolates have been used as surrogates of the virulent strains; however, the attachment properties and environmental stabilities of these attenuated isolates may differ from the unattenuated outbreak strains. In this study, the Shiga toxin (stx1, stx2, and/or stx2c) genes as well as the eae gene encoding intimin of two E. coli O157:H7 outbreak isolates, F4546 (1997 alfalfa sprout) and K4492 (2006 lettuce), were deleted. Individual gene deletions were confirmed by polymerase chain reaction (PCR) and DNA sequencing. The mutant strains did not produce Shiga toxin. The growth kinetics of these mutant strains under nutrient-rich and minimal conditions were identical to those of their wild-type strains. Attachment to the surface of lettuce leaves was comparable between wild-type/mutant pairs F4546/MD46 and K4492/MD47. Adherence to soil particles was also comparable between the virulent and surrogate pairs, although the F4546/MD46 pair exhibited statistically greater attachment than the K4492/MD47 pair (p≤0.05). Wild-type and mutant pairs F4546/MD46 and K4492/MD47 inoculated into wet or dry soils had statistically similar survival rates over the 7-day storage period at 20°C. A plasmid, pGFPuv, containing green fluorescent protein was transformed into each of the mutant strains, allowing for ease of identification and detection of surrogate strains on plant material or soil. These pGFPuv-containing surrogate strains will enable the investigation of pathogen interaction with plants and soil in the farm production environment where the virulent pathogen cannot be used.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wu, Hong; Zeng, Hong; Lam, Robert

The crystal structure of the human MLH1 N-terminus is reported at 2.30 Å resolution. The overall structure is described along with an analysis of two clinically important mutations. Mismatch repair prevents the accumulation of erroneous insertions/deletions and non-Watson–Crick base pairs in the genome. Pathogenic mutations in the MLH1 gene are associated with a predisposition to Lynch and Turcot’s syndromes. Although genetic testing for these mutations is available, robust classification of variants requires strong clinical and functional support. Here, the first structure of the N-terminus of human MLH1, determined by X-ray crystallography, is described. The structure shares a high degree ofmore » similarity with previously determined prokaryotic MLH1 homologs; however, this structure affords a more accurate platform for the classification of MLH1 variants.« less

Sequential computation of elementary modes and minimal cut sets in genome-scale metabolic networks using alternate integer linear programming.

PubMed

Song, Hyun-Seob; Goldberg, Noam; Mahajan, Ashutosh; Ramkrishna, Doraiswami

2017-08-01

Elementary (flux) modes (EMs) have served as a valuable tool for investigating structural and functional properties of metabolic networks. Identification of the full set of EMs in genome-scale networks remains challenging due to combinatorial explosion of EMs in complex networks. It is often, however, that only a small subset of relevant EMs needs to be known, for which optimization-based sequential computation is a useful alternative. Most of the currently available methods along this line are based on the iterative use of mixed integer linear programming (MILP), the effectiveness of which significantly deteriorates as the number of iterations builds up. To alleviate the computational burden associated with the MILP implementation, we here present a novel optimization algorithm termed alternate integer linear programming (AILP). Our algorithm was designed to iteratively solve a pair of integer programming (IP) and linear programming (LP) to compute EMs in a sequential manner. In each step, the IP identifies a minimal subset of reactions, the deletion of which disables all previously identified EMs. Thus, a subsequent LP solution subject to this reaction deletion constraint becomes a distinct EM. In cases where no feasible LP solution is available, IP-derived reaction deletion sets represent minimal cut sets (MCSs). Despite the additional computation of MCSs, AILP achieved significant time reduction in computing EMs by orders of magnitude. The proposed AILP algorithm not only offers a computational advantage in the EM analysis of genome-scale networks, but also improves the understanding of the linkage between EMs and MCSs. The software is implemented in Matlab, and is provided as supplementary information . hyunseob.song@pnnl.gov. Supplementary data are available at Bioinformatics online. Published by Oxford University Press 2017. This work is written by US Government employees and are in the public domain in the US.

Characterisation of pks15/1 in clinical isolates of Mycobacterium tuberculosis from Mexico

PubMed Central

Zenteno-Cuevas, Roberto; Silva-Hernández, Francisco X; Mendoza-Damián, Fabiola; Ramírez-Hernández, Maria Dolores; Vázquez-Medina, Karen; Widrobo-García, Lorena; Cuellar-Sanchez, Aremy; Muñíz-Salazar, Raquel; Enciso-Moreno, Leonor; Pérez-Navarro, Lucia Monserrat; Enciso-Moreno, José Antonio

2013-01-01

Tuberculosis (TB) is an infectocontagious respiratory disease caused by members of the Mycobacterium tuberculosis complex. A 7 base pair (bp) deletion in the locus polyketide synthase (pks)15/1 is described as polymorphic among members of the M. tuberculosis complex, enabling the identification of Euro-American, Indo-Oceanic and Asian lineages. The aim of this study was to characterise this locus in TB isolates from Mexico. One hundred twenty clinical isolates were recovered from the states of Veracruz and Estado de Mexico. We determined the nucleotide sequence of a ± 400 bp fragment of the locus pks15/1, while genotypic characterisation was performed by spoligotyping. One hundred and fifty isolates contained the 7 bp deletion, while five had the wild type locus. Lineages X (22%), LAM (18%) and T (17%) were the most frequent; only three (2%) of the isolates were identified as Beijing and two (1%) EAI-Manila. The wild type pks15/1 locus was observed in all Asian lineage isolates tested. Our results confirm the utility of locus pks15/1 as a molecular marker for identifying Asian lineages of the M. tuberculosis complex. This marker could be of great value in the epidemiological surveillance of TB, especially in countries like Mexico, where the prevalence of such lineages is unknown. PMID:24037193

Fibrinogen Lincoln: a new truncated alpha chain variant with delayed clotting.

PubMed

Ridgway, H J; Brennan, S O; Gibbons, S; George, P M

1996-04-01

A patient referred for preoperative investigation of prolonged bleeding and easy bruising was found to have increased thrombin and reptilase times; however, the thrombin catalysed release of fibrinopeptides A and B was normal. Analysis of five other family members, spanning three generations, indicated that three had a similar defect and suggested autosomal dominant inheritance. Non-reducing SDS-PAGE of purified fibrinogen from affected individuals showed that the 340 kD form of their fibrinogen ran as a doublet. SSCP (single-stranded conformational polymorphism) analysis of exon 5 of the A alpha gene, which encodes the C-terminal half of the chain, confirmed the presence of a mutation. Cycle sequencing of PCR amplified DNA revealed a 13 base pair deletion (nt 4758-4770), resulting in a frame-shift at Ala 475, which translates as four new amino acids before terminating at a new stop codon (-476His-Cys-Leu-Ala-Stop). The presence of a circulating truncated A alpha chain was confirmed when SDS-PAGE gels were probed with an alpha chain specific antisera; which showed that the variant A alpha chain comigrated with gamma chains. The truncation results in a variant A alpha chain with a deletion of 131 amino acids (480-610), and four new amino acids at the C-terminal.

Cellular and molecular analysis of mutagenesis induced by charged particles of defined linear energy transfer.

PubMed

Zhu, L X; Waldren, C A; Vannias, D; Hei, T K

1996-03-01

Mutation induction by charged particles of defined linear energy transfer (LET) and gamma rays was scored using human-hamster hybrid AL cells. The LET values for charged particles accelerated at the Radiological Research Accelerator Facility ranged from 10 keV/microm protons to 150 keV/microm 4He ions. The induced mutant fractions at both the S1 and HGPRT loci were dependent on the dose and LET. In addition, for each dose examined, the mutant yield at the S1 locus was 30-60 fold higher than at the corresponding HGPRT locus. To determine whether the mutation spectrum was comparably dependent on dose and LET, independent S1- and HGPRT- mutants induced by 150 keV/microm 4He ions and gamma rays were isolated, and their DNA was analyzed by both Southern blotting and multiplex PCR methods. While the majority of radiation-induced mutants showed deletions of varying sizes, the relative percentage of large deletions was found to be related to both the dose and LET of the radiation examined. Using a mutation system that can detect multilocus changes, results of the present study show that radiation-induced chromosomal loss can be in the millions of base pairs.

Cellular and molecular analysis of mutagenesis induced by charged particles of defined linear energy transfer

NASA Technical Reports Server (NTRS)

Zhu, L. X.; Waldren, C. A.; Vannias, D.; Hei, T. K.; Chatterjee, A. (Principal Investigator)

1996-01-01

Mutation induction by charged particles of defined linear energy transfer (LET) and gamma rays was scored using human-hamster hybrid AL cells. The LET values for charged particles accelerated at the Radiological Research Accelerator Facility ranged from 10 keV/microm protons to 150 keV/microm 4He ions. The induced mutant fractions at both the S1 and HGPRT loci were dependent on the dose and LET. In addition, for each dose examined, the mutant yield at the S1 locus was 30-60 fold higher than at the corresponding HGPRT locus. To determine whether the mutation spectrum was comparably dependent on dose and LET, independent S1- and HGPRT- mutants induced by 150 keV/microm 4He ions and gamma rays were isolated, and their DNA was analyzed by both Southern blotting and multiplex PCR methods. While the majority of radiation-induced mutants showed deletions of varying sizes, the relative percentage of large deletions was found to be related to both the dose and LET of the radiation examined. Using a mutation system that can detect multilocus changes, results of the present study show that radiation-induced chromosomal loss can be in the millions of base pairs.

Copy Number Variation in Fungi and Its Implications for Wine Yeast Genetic Diversity and Adaptation

PubMed Central

Steenwyk, Jacob L.; Rokas, Antonis

2018-01-01

In recent years, copy number (CN) variation has emerged as a new and significant source of genetic polymorphisms contributing to the phenotypic diversity of populations. CN variants are defined as genetic loci that, due to duplication and deletion, vary in their number of copies across individuals in a population. CN variants range in size from 50 base pairs to whole chromosomes, can influence gene activity, and are associated with a wide range of phenotypes in diverse organisms, including the budding yeast Saccharomyces cerevisiae. In this review, we introduce CN variation, discuss the genetic and molecular mechanisms implicated in its generation, how they can contribute to genetic and phenotypic diversity in fungal populations, and consider how CN variants may influence wine yeast adaptation in fermentation-related processes. In particular, we focus on reviewing recent work investigating the contribution of changes in CN of fermentation-related genes in yeast wine strains and offer notable illustrations of such changes, including the high levels of CN variation among the CUP genes, which confer resistance to copper, a metal with fungicidal properties, and the preferential deletion and duplication of the MAL1 and MAL3 loci, respectively, which are responsible for metabolizing maltose and sucrose. Based on the available data, we propose that CN variation is a substantial dimension of yeast genetic diversity that occurs largely independent of single nucleotide polymorphisms. As such, CN variation harbors considerable potential for understanding and manipulating yeast strains in the wine fermentation environment and beyond. PMID:29520259

Homozygous single base deletion in TUSC3 causes intellectual disability with developmental delay in an Omani family.

PubMed

Al-Amri, Ahmed; Saegh, Abeer Al; Al-Mamari, Watfa; El-Asrag, Mohammed E; Ivorra, Jose L; Cardno, Alastair G; Inglehearn, Chris F; Clapcote, Steven J; Ali, Manir

2016-07-01

Intellectual disability (ID) is the term used to describe a diverse group of neurological conditions with congenital or juvenile onset, characterized by an IQ score of less than 70 and difficulties associated with limitations in cognitive function and adaptive behavior. The condition can be inherited or caused by environmental factors. The genetic forms are heterogeneous, with mutations in over 500 known genes shown to cause the disorder. We report a consanguineous Omani family in which multiple individuals have ID and developmental delay together with some variably present features including short stature, microcephaly, moderate facial dysmorphism, and congenital malformations of the toes or hands. Homozygosity mapping combined with whole exome next generation sequencing identified a novel homozygous single base pair deletion in TUSC3, c.222delA, p.R74 fs. The mutation segregates with the disease phenotype in a recessive manner and is absent in 60,706 unrelated individuals from various disease-specific and population genetic studies. TUSC3 mutations have been previously identified as causing either syndromic or non-syndromic ID in patients from France, Italy, Iran and Pakistan. This paper supports the previous clinical descriptions of the condition caused by TUSC3 mutations and describes the seventh family with mutations in this gene, thus contributing to the genetic spectrum of mutations. This is the first report of a family from the Arabian peninsula with this form of ID. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Zebrafish foxP2 Zinc Finger Nuclease Mutant Has Normal Axon Pathfinding

PubMed Central

Xing, Lingyan; Hoshijima, Kazuyuki; Grunwald, David J.; Fujimoto, Esther; Quist, Tyler S.; Sneddon, Jacob; Chien, Chi-Bin; Stevenson, Tamara J.; Bonkowsky, Joshua L.

2012-01-01

foxP2, a forkhead-domain transcription factor, is critical for speech and language development in humans, but its role in the establishment of CNS connectivity is unclear. While in vitro studies have identified axon guidance molecules as targets of foxP2 regulation, and cell culture assays suggest a role for foxP2 in neurite outgrowth, in vivo studies have been lacking regarding a role for foxP2 in axon pathfinding. We used a modified zinc finger nuclease methodology to generate mutations in the zebrafish foxP2 gene. Using PCR-based high resolution melt curve analysis (HRMA) of G0 founder animals, we screened and identified three mutants carrying nonsense mutations in the 2nd coding exon: a 17 base-pair (bp) deletion, an 8bp deletion, and a 4bp insertion. Sequence analysis of cDNA confirmed that these were frameshift mutations with predicted early protein truncations. Homozygous mutant fish were viable and fertile, with unchanged body morphology, and no apparent differences in CNS apoptosis, proliferation, or patterning at embryonic stages. There was a reduction in expression of the known foxP2 target gene cntnap2 that was rescued by injection of wild-type foxP2 transcript. When we examined axon pathfinding using a pan-axonal marker or transgenic lines, including a foxP2-neuron-specific enhancer, we did not observe any axon guidance errors. Our findings suggest that foxP2 is not necessary for axon pathfinding during development. PMID:22937139

Zebrafish foxP2 zinc finger nuclease mutant has normal axon pathfinding.

PubMed

Xing, Lingyan; Hoshijima, Kazuyuki; Grunwald, David J; Fujimoto, Esther; Quist, Tyler S; Sneddon, Jacob; Chien, Chi-Bin; Stevenson, Tamara J; Bonkowsky, Joshua L

2012-01-01

foxP2, a forkhead-domain transcription factor, is critical for speech and language development in humans, but its role in the establishment of CNS connectivity is unclear. While in vitro studies have identified axon guidance molecules as targets of foxP2 regulation, and cell culture assays suggest a role for foxP2 in neurite outgrowth, in vivo studies have been lacking regarding a role for foxP2 in axon pathfinding. We used a modified zinc finger nuclease methodology to generate mutations in the zebrafish foxP2 gene. Using PCR-based high resolution melt curve analysis (HRMA) of G0 founder animals, we screened and identified three mutants carrying nonsense mutations in the 2(nd) coding exon: a 17 base-pair (bp) deletion, an 8bp deletion, and a 4bp insertion. Sequence analysis of cDNA confirmed that these were frameshift mutations with predicted early protein truncations. Homozygous mutant fish were viable and fertile, with unchanged body morphology, and no apparent differences in CNS apoptosis, proliferation, or patterning at embryonic stages. There was a reduction in expression of the known foxP2 target gene cntnap2 that was rescued by injection of wild-type foxP2 transcript. When we examined axon pathfinding using a pan-axonal marker or transgenic lines, including a foxP2-neuron-specific enhancer, we did not observe any axon guidance errors. Our findings suggest that foxP2 is not necessary for axon pathfinding during development.

Molecular detection of a 4p deletion using PCR-based polymorphisms: a technique for the rapid detection of the Wolf-Hirschhorn syndrome.

PubMed

Altherr, M R; Gusella, J F; Wasmuth, J J; Kummer, M A; McKercher, S W; Johnson, V P

1992-11-01

Wolf-Hirschhorn syndrome (WHS) results from a deletion of part of chromosome 4p. The region of 4p consistently deleted in WHS is near the tip of 4p. Two loci in this region D4S95 and D4S125 are associated with highly informative VNTR polymorphisms and were recently converted to allow PCR-based screening. PCR analysis was used successfully to identify a small de novo deletion of 4p in a patient suspected of having WHS. This procedure allows a rapid and accurate confirmation of 4p deletions in cases where cytogenetics alone cannot provide a clear answer.

Roles for the yeast RAD18 and RAD52 DNA repair genes in UV mutagenesis.

PubMed

Armstrong, J D; Chadee, D N; Kunz, B A

1994-11-01

Experimental evidence indicates that although the Saccharomyces cerevisiae RAD18 and RAD52 genes are not required for nucleotide excision repair, they function in the processing of UV-induced DNA damage in yeast. Conflicting statements regarding the UV mutability of strains deleted for RAD18 prompted us to re-examine the influence of RAD18, and RAD52, on UV mutagenesis. To do so, we characterized mutations induced by UV in SUP4-o, a yeast suppressor tRNA gene. SUP4-o was maintained on a plasmid in isogenic strains that either carried one of two different rad18 deletions (rad18 delta) or had RAD52 disrupted. Both rad18 deletions decreased the frequency of UV-induced SUP4-o mutations to levels close to those for spontaneous mutagenesis in the rad18 delta backgrounds, and prevented a net increase in mutant yield. A detailed analysis of mutations isolated after UV irradiation of one of the rad18 delta strains uncovered little evidence of the specificity features typical for UV mutagenesis in the isogenic repair-proficient (RAD) parent (e.g., predominance of G.C-->A.T transitions). Evidently, UV induction of SUP4-o mutations is highly dependent on the RAD18 gene. Compared to the RAD strain, disruption of RAD52 reduced the frequency and yield of UV mutagenesis by about two-thirds. Closer inspection revealed that 80% of this reduction was due to a decrease in the frequency of G.C-->A.T transitions. In addition, there were differences in the distributions and site specificities of single base-pair substitutions. Thus, RAD52 also participates in UV mutagenesis of a plasmid-borne gene in yeast, but to a lesser extent than RAD18.

WWOX-related encephalopathies: delineation of the phenotypical spectrum and emerging genotype-phenotype correlation.

PubMed

Mignot, Cyril; Lambert, Laetitia; Pasquier, Laurent; Bienvenu, Thierry; Delahaye-Duriez, Andrée; Keren, Boris; Lefranc, Jérémie; Saunier, Aline; Allou, Lila; Roth, Virginie; Valduga, Mylène; Moustaïne, Aissa; Auvin, Stéphane; Barrey, Catherine; Chantot-Bastaraud, Sandra; Lebrun, Nicolas; Moutard, Marie-Laure; Nougues, Marie-Christine; Vermersch, Anne-Isabelle; Héron, Bénédicte; Pipiras, Eva; Héron, Delphine; Olivier-Faivre, Laurence; Guéant, Jean-Louis; Jonveaux, Philippe; Philippe, Christophe

2015-01-01

Homozygous mutations in WWOX were reported in eight individuals of two families with autosomal recessive spinocerebellar ataxia type 12 and in two siblings with infantile epileptic encephalopathy (IEE), including one who deceased prior to DNA sampling. By combining array comparative genomic hybridisation, targeted Sanger sequencing and next generation sequencing, we identified five further patients from four families with IEE due to biallelic alterations of WWOX. We identified eight deleterious WWOX alleles consisting in four deletions, a four base-pair frameshifting deletion, one missense and two nonsense mutations. Genotype-phenotype correlation emerges from the seven reported families. The phenotype in four patients carrying two predicted null alleles was characterised by (1) little if any psychomotor acquisitions, poor spontaneous motility and absent eye contact from birth, (2) pharmacoresistant epilepsy starting in the 1st weeks of life, (3) possible retinal degeneration, acquired microcephaly and premature death. This contrasted with the less severe autosomal recessive spinocerebellar ataxia type 12 phenotype due to hypomorphic alleles. In line with this correlation, the phenotype in two siblings carrying a null allele and a missense mutation was intermediate. Our results obtained by a combination of different molecular techniques undoubtedly incriminate WWOX as a gene for recessive IEE and illustrate the usefulness of high throughput data mining for the identification of genes for rare autosomal recessive disorders. The structure of the WWOX locus encompassing the FRA16D fragile site might explain why constitutive deletions are recurrently reported in genetic databases, suggesting that WWOX-related encephalopathies, although likely rare, may not be exceptional. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

Evidence for degenerate tetraploidy in bdelloid rotifers.

PubMed

Mark Welch, David B; Mark Welch, Jessica L; Meselson, Matthew

2008-04-01

Rotifers of class Bdelloidea have evolved for millions of years apparently without sexual reproduction. We have sequenced 45- to 70-kb regions surrounding the four copies of the hsp82 gene of the bdelloid rotifer Philodina roseola, each of which is on a separate chromosome. The four regions comprise two colinear gene-rich pairs with gene content, order, and orientation conserved within each pair. Only a minority of genes are common to both pairs, also in the same orientation and order, but separated by gene-rich segments present in only one or the other pair. The pattern is consistent with degenerate tetraploidy with numerous segmental deletions, some in one pair of colinear chromosomes and some in the other. Divergence in 1,000-bp windows varies along an alignment of a colinear pair, from zero to as much as 20% in a pattern consistent with gene conversion associated with recombinational repair of DNA double-strand breaks. Although pairs of colinear chromosomes are a characteristic of sexually reproducing diploids and polyploids, a quite different explanation for their presence in bdelloids is suggested by the recent finding that bdelloid rotifers can recover and resume reproduction after suffering hundreds of radiation-induced DNA double-strand breaks per oocyte nucleus. Because bdelloid primary oocytes are in G(1) and therefore lack sister chromatids, we propose that bdelloid colinear chromosome pairs are maintained as templates for the repair of DNA double-strand breaks caused by the frequent desiccation and rehydration characteristic of bdelloid habitats.

Dual Regulation of Bacillus subtilis kinB Gene Encoding a Sporulation Trigger by SinR through Transcription Repression and Positive Stringent Transcription Control.

PubMed

Fujita, Yasutaro; Ogura, Mitsuo; Nii, Satomi; Hirooka, Kazutake

2017-01-01

It is known that transcription of kinB encoding a trigger for Bacillus subtilis sporulation is under repression by SinR, a master repressor of biofilm formation, and under positive stringent transcription control depending on the adenine species at the transcription initiation nucleotide (nt). Deletion and base substitution analyses of the kinB promoter (P kinB ) region using lacZ fusions indicated that either a 5-nt deletion (Δ5, nt -61/-57, +1 is the transcription initiation nt) or the substitution of G at nt -45 with A (G-45A) relieved kinB repression. Thus, we found a pair of SinR-binding consensus sequences (GTTCTYT; Y is T or C) in an inverted orientation (SinR-1) between nt -57/-42, which is most likely a SinR-binding site for kinB repression. This relief from SinR repression likely requires SinI, an antagonist of SinR. Surprisingly, we found that SinR is essential for positive stringent transcription control of P kinB . Electrophoretic mobility shift assay (EMSA) analysis indicated that SinR bound not only to SinR-1 but also to SinR-2 (nt -29/-8) consisting of another pair of SinR consensus sequences in a tandem repeat arrangement; the two sequences partially overlap the '-35' and '-10' regions of P kinB . Introduction of base substitutions (T-27C C-26T) in the upstream consensus sequence of SinR-2 affected positive stringent transcription control of P kinB , suggesting that SinR binding to SinR-2 likely causes this positive control. EMSA also implied that RNA polymerase and SinR are possibly bound together to SinR-2 to form a transcription initiation complex for kinB transcription. Thus, it was suggested in this work that derepression of kinB from SinR repression by SinI induced by Spo0A∼P and occurrence of SinR-dependent positive stringent transcription control of kinB might induce effective sporulation cooperatively, implying an intimate interplay by stringent response, sporulation, and biofilm formation.

Deletion of mitochondrial DNA in a case of early-onset diabetes mellitus, optic atrophy, and deafness (Wolfram syndrome, MIM 222300).

PubMed Central

Rötig, A; Cormier, V; Chatelain, P; Francois, R; Saudubray, J M; Rustin, P; Munnich, A

1993-01-01

The Wolfram syndrome (MIM 222300) is a disease of unknown origin consisting of diabetes insipidus, diabetes mellitus, optic atrophy, and deafness. Here we report on a generalized deficiency of the mitochondrial respiratory enzyme activities in skeletal muscle and lymphocyte homogenate of a girl suffering from the Wolfram syndrome. In addition, we provide evidence for a 7.6-kilobase pair heteroplasmic deletion (spanning nucleotides 6465-14135) of the mitochondrial DNA in the two tissues and show that directly repeated sequences (11 bp) were present in the wild-type mitochondrial genome at the boundaries of the deletion. Neither of the patient's parents was found to bear rearranged molecules. This study supports the view that a respiratory chain defect can present with insulin-dependent diabetes mellitus as the onset symptom. It also suggests that a defect of oxidative phosphorylation should be considered when investigating other cases of Wolfram syndrome, especially because this syndrome fulfills the criteria for a genetic defect of the mitochondrial energy supply: (a) an unexplained association of symptoms (b) with early onset and rapidly progressive course, (c) involving seemingly unrelated organs and tissues. Images PMID:8383698

An inferential study of the phenotype for the chromosome 15q24 microdeletion syndrome: a bootstrap analysis

PubMed Central

Ramírez-Prado, Dolores; Cortés, Ernesto; Aguilar-Segura, María Soledad; Gil-Guillén, Vicente Francisco

2016-01-01

In January 2012, a review of the cases of chromosome 15q24 microdeletion syndrome was published. However, this study did not include inferential statistics. The aims of the present study were to update the literature search and calculate confidence intervals for the prevalence of each phenotype using bootstrap methodology. Published case reports of patients with the syndrome that included detailed information about breakpoints and phenotype were sought and 36 were included. Deletions in megabase (Mb) pairs were determined to calculate the size of the interstitial deletion of the phenotypes studied in 2012. To determine confidence intervals for the prevalence of the phenotype and the interstitial loss, we used bootstrap methodology. Using the bootstrap percentiles method, we found wide variability in the prevalence of the different phenotypes (3–100%). The mean interstitial deletion size was 2.72 Mb (95% CI [2.35–3.10 Mb]). In comparison with our work, which expanded the literature search by 45 months, there were differences in the prevalence of 17% of the phenotypes, indicating that more studies are needed to analyze this rare disease. PMID:26925314

Translocation and gross deletion breakpoints in human inherited disease and cancer II: Potential involvement of repetitive sequence elements in secondary structure formation between DNA ends.

PubMed

Chuzhanova, Nadia; Abeysinghe, Shaun S; Krawczak, Michael; Cooper, David N

2003-09-01

Translocations and gross deletions are responsible for a significant proportion of both cancer and inherited disease. Although such gene rearrangements are nonuniformly distributed in the human genome, the underlying mutational mechanisms remain unclear. We have studied the potential involvement of various types of repetitive sequence elements in the formation of secondary structure intermediates between the single-stranded DNA ends that recombine during rearrangements. Complexity analysis was used to assess the potential of these ends to form secondary structures, the maximum decrease in complexity consequent to a gross rearrangement being used as an indicator of the type of repeat and the specific DNA ends involved. A total of 175 pairs of deletion/translocation breakpoint junction sequences available from the Gross Rearrangement Breakpoint Database [GRaBD; www.uwcm.ac.uk/uwcm/mg/grabd/grabd.html] were analyzed. Potential secondary structure was noted between the 5' flanking sequence of the first breakpoint and the 3' flanking sequence of the second breakpoint in 49% of rearrangements and between the 5' flanking sequence of the second breakpoint and the 3' flanking sequence of the first breakpoint in 36% of rearrangements. Inverted repeats, inversions of inverted repeats, and symmetric elements were found in association with gross rearrangements at approximately the same frequency. However, inverted repeats and inversions of inverted repeats accounted for the vast majority (83%) of deletions plus small insertions, symmetric elements for one-half of all antigen receptor-mediated translocations, while direct repeats appear only to be involved in mediating simple deletions. These findings extend our understanding of illegitimate recombination by highlighting the importance of secondary structure formation between single-stranded DNA ends at breakpoint junctions. Copyright 2003 Wiley-Liss, Inc.

Familial co-segregation of Coffin-Lowry syndrome inherited from the mother and autosomal dominant Waardenburg type IV syndrome due to deletion of EDNRB inherited from the father.

PubMed

Loupe, Jacob; Sampath, Srirangan; Lacassie, Yves

2014-10-01

We report an African-American family that was identified after the proposita was referred for diagnostic evaluation at 4½ months with a history of Hirschsprung and dysmorphic features typical of Waardenburg syndrome (WS). Family evaluation revealed that the father had heterochromidia irides and hypertelorism supporting the clinical diagnosis of WS; however, examination of the mother revealed characteristic facial and digital features of Coffin-Lowry syndrome (CLS). Molecular testing of the mother identified a novel 2 bp deletion (c.865_866delCA) in codon 289 of RPS6KA3 leading to a frame-shift and premature termination of translation 5 codons downstream (NM_004586.2:p.Gln289ValfsX5). This deletion also was identified in the proposita and her three sisters with a clinical suspicion of CLS, all of whom as carriers for this X-linked disorder had very subtle manifestations. The molecular confirmation of WS type 4 (Shah-Waardenburg; WS4) was not as straightforward. To evaluate WS types 1-4, multiple sequential molecular tests were requested, including Sanger sequencing of all exons, and deletion/duplication analysis using MLPA for PAX3, MITF, SOX10, EDN3 and EDNRB. Although sequencing did not identify any disease causing variants, MLPA identified a heterozygous deletion of the entire EDNRB in the father. This deletion was also found in the proposita and the oldest child. Since the heterozygous deletion was the only change identified in EDNRB, this family represents one of the few cases of an autosomal dominant inheritance of WS4 involving the endothelin pathway. Altogether, clinical evaluation of the family revealed one child to be positive for WS4 and two positive for CLS, while two children were positive for both diseases simultaneously (including the proposita) while another pair test negative for either disease. This kinship is an example of the coincidence of two conditions co-segregating in one family, with variable phenotypes requiring molecular testing to confirm the clinical diagnoses. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

The Ubx Polycomb response element bypasses an unpaired Fab-8 insulator via cis transvection in Drosophila.

PubMed

Lu, Danfeng; Li, Zhuoran; Li, Lingling; Yang, Liping; Chen, Guijun; Yang, Deying; Zhang, Yue; Singh, Vikrant; Smith, Sheryl; Xiao, Yu; Wang, Erlin; Ye, Yunshuang; Zhang, Wei; Zhou, Lei; Rong, Yikang; Zhou, Jumin

2018-01-01

Chromatin insulators or boundary elements protect genes from regulatory activities from neighboring genes or chromatin domains. In the Drosophila Abdominal-B (Abd-B) locus, the deletion of such elements, such as Frontabdominal-7 (Fab-7) or Fab-8 led to dominant gain of function phenotypes, presumably due to the loss of chromatin barriers. Homologous chromosomes are paired in Drosophila, creating a number of pairing dependent phenomena including transvection, and whether transvection may affect the function of Polycomb response elements (PREs) and thus contribute to the phenotypes are not known. Here, we studied the chromatin barrier activity of Fab-8 and how it is affected by the zygosity of the transgene, and found that Fab-8 is able to block the silencing effect of the Ubx PRE on the DsRed reporter gene in a CTCF binding sites dependent manner. However, the blocking also depends on the zygosity of the transgene in that the barrier activity is present when the transgene is homozygous, but absent when the transgene is heterozygous. To analyze this effect, we performed chromatin immunoprecipitation and quantitative PCR (ChIP-qPCR) experiments on homozygous transgenic embryos, and found that H3K27me3 and H3K9me3 marks are restricted by Fab-8, but they spread beyond Fab-8 into the DsRed gene when the two CTCF binding sites within Fab-8 were mutated. Consistent with this, the mutation reduced H3K4me3 and RNA Pol II binding to the DsRed gene, and consequently, DsRed expression. Importantly, in heterozygous embryos, Fab-8 is unable to prevent the spread of H3K27me3 and H3K9me3 marks from crossing Fab-8 into DsRed, suggesting an insulator bypass. These results suggest that in the Abd-B locus, deletion of the insulator in one copy of the chromosome could lead to the loss of insulator activity on the homologous chromosome, and in other loci where chromosomal deletion created hemizygous regions of the genome, the chromatin barrier could be compromised. This study highlights a role of homologous chromosome pairing in the regulation of gene expression in the Drosophila genome.

Autosomal-dominant Leber Congenital Amaurosis Caused by a Heterozygous CRX Mutation in a Father and Son.

PubMed

Arcot Sadagopan, Karthikeyan; Battista, Robert; Keep, Rosanne B; Capasso, Jenina E; Levin, Alex V

2015-06-01

Leber congenital amaurosis (LCA) is most often an autosomal recessive disorder. We report a father and son with autosomal dominant LCA due to a mutation in the CRX gene. DNA screening using an allele specific assay of 90 of the most common LCA-causing variations in the coding sequences of AIPL1, CEP290, CRB1, CRX, GUCY2D, RDH12 and RPE65 was performed on the father. Automated DNA sequencing of his son examining exon 3 of the CRX gene was subsequently performed. Both father and son have a heterozygous single base pair deletion of an adenine at codon 153 in the coding sequence of the CRX gene resulting in a frameshift mutation. Mutations involving the CRX gene may demonstrate an autosomal dominant inheritance pattern for LCA.

Restriction fragment length polymorphism of the human c-fms gene.

PubMed Central

Xu, D Q; Guilhot, S; Galibert, F

1985-01-01

By using blot hybridization with a v-fms probe, a polymorphism for EcoRI, HindIII, and BamHI restriction endonuclease sites associated with the human c-fms locus was observed in a random adult population. This restriction fragment length polymorphism can be explained on the basis of the existence of two alleles, a and b, and is due to a short (congruent to 500 base pairs) deletion characteristic of allele a. The distribution in the analyzed population (48 unrelated individuals) is 23% heterozygotes ab, 75% homozygotes bb, and 2% homozygotes aa. Though the inheritance of this polymorphism follows a Mendelian pattern, the children from couples ab X bb are of the following genotype: 74% ab and 26% bb. These deviations from the expected frequencies of 50% suggest a selective pressure in favor of heterozygotes. Images PMID:2986142

Dose-sensitivity, conserved non-coding sequences, and duplicate gene retention through multiple tetraploidies in the grasses.

PubMed

Schnable, James C; Pedersen, Brent S; Subramaniam, Sabarinath; Freeling, Michael

2011-01-01

Whole genome duplications, or tetraploidies, are an important source of increased gene content. Following whole genome duplication, duplicate copies of many genes are lost from the genome. This loss of genes is biased both in the classes of genes deleted and the subgenome from which they are lost. Many or all classes are genes preferentially retained as duplicate copies are engaged in dose sensitive protein-protein interactions, such that deletion of any one duplicate upsets the status quo of subunit concentrations, and presumably lowers fitness as a result. Transcription factors are also preferentially retained following every whole genome duplications studied. This has been explained as a consequence of protein-protein interactions, just as for other highly retained classes of genes. We show that the quantity of conserved noncoding sequences (CNSs) associated with genes predicts the likelihood of their retention as duplicate pairs following whole genome duplication. As many CNSs likely represent binding sites for transcriptional regulators, we propose that the likelihood of gene retention following tetraploidy may also be influenced by dose-sensitive protein-DNA interactions between the regulatory regions of CNS-rich genes - nicknamed bigfoot genes - and the proteins that bind to them. Using grass genomes, we show that differential loss of CNSs from one member of a pair following the pre-grass tetraploidy reduces its chance of retention in the subsequent maize lineage tetraploidy.

Dose–Sensitivity, Conserved Non-Coding Sequences, and Duplicate Gene Retention Through Multiple Tetraploidies in the Grasses

PubMed Central

Schnable, James C.; Pedersen, Brent S.; Subramaniam, Sabarinath; Freeling, Michael

2011-01-01

Whole genome duplications, or tetraploidies, are an important source of increased gene content. Following whole genome duplication, duplicate copies of many genes are lost from the genome. This loss of genes is biased both in the classes of genes deleted and the subgenome from which they are lost. Many or all classes are genes preferentially retained as duplicate copies are engaged in dose sensitive protein–protein interactions, such that deletion of any one duplicate upsets the status quo of subunit concentrations, and presumably lowers fitness as a result. Transcription factors are also preferentially retained following every whole genome duplications studied. This has been explained as a consequence of protein–protein interactions, just as for other highly retained classes of genes. We show that the quantity of conserved noncoding sequences (CNSs) associated with genes predicts the likelihood of their retention as duplicate pairs following whole genome duplication. As many CNSs likely represent binding sites for transcriptional regulators, we propose that the likelihood of gene retention following tetraploidy may also be influenced by dose–sensitive protein–DNA interactions between the regulatory regions of CNS-rich genes – nicknamed bigfoot genes – and the proteins that bind to them. Using grass genomes, we show that differential loss of CNSs from one member of a pair following the pre-grass tetraploidy reduces its chance of retention in the subsequent maize lineage tetraploidy. PMID:22645525

Nucleotide sequence analysis establishes the role of endogenous murine leukemia virus DNA segments in formation of recombinant mink cell focus-forming murine leukemia viruses.

PubMed Central

Khan, A S

1984-01-01

The sequence of 363 nucleotides near the 3' end of the pol gene and 564 nucleotides from the 5' terminus of the env gene in an endogenous murine leukemia viral (MuLV) DNA segment, cloned from AKR/J mouse DNA and designated as A-12, was obtained. For comparison, the nucleotide sequence in an analogous portion of AKR mink cell focus-forming (MCF) 247 MuLV provirus was also determined. Sequence features unique to MCF247 MuLV DNA in the 3' pol and 5' env regions were identified by comparison with nucleotide sequences in analogous regions of NFS -Th-1 xenotropic and AKR ecotropic MuLV proviruses. These included (i) an insertion of 12 base pairs encoding four amino acids located 60 base pairs from the 3' terminus of the pol gene and immediately preceding the env gene, (ii) the deletion of 12 base pairs (encoding four amino acids) and the insertion of 3 base pairs (encoding one amino acid) in the 5' portion of the env gene, and (iii) single base substitutions resulting in 2 MCF247 -specific amino acids in the 3' pol and 23 in the 5' env regions. Nucleotide sequence comparison involving the 3' pol and 5' env regions of AKR MCF247 , NFS xenotropic, and AKR ecotropic MuLV proviruses with the cloned endogenous MuLV DNA indicated that MCF247 proviral DNA sequences were conserved in the cloned endogenous MuLV proviral segment. In fact, total nucleotide sequence identity existed between the endogenous MuLV DNA and the MCF247 MuLV provirus in the 3' portion of the pol gene. In the 5' env region, only 4 of 564 nucleotides were different, resulting in three amino acid changes between AKR MCF247 MuLV DNA and the endogenous MuLV DNA present in clone A-12. In addition, nucleotide sequence comparison indicated that Moloney-and Friend-MCF MuLVs were also highly related in the 3' pol and 5' env regions to the cloned endogenous MuLV DNA. These results establish the role of endogenous MuLV DNA segments in generation of recombinant MCF viruses. PMID:6328017

TSKS concentrates in spermatid centrioles during flagellogenesis.

PubMed

Xu, Bingfang; Hao, Zhonglin; Jha, Kula N; Zhang, Zhibing; Urekar, Craig; Digilio, Laura; Pulido, Silvia; Strauss, Jerome F; Flickinger, Charles J; Herr, John C

2008-07-15

Centrosomal coiled-coil proteins paired with kinases play critical roles in centrosomal functions within somatic cells, however knowledge regarding gamete centriolar proteins is limited. In this study, the substrate of TSSK1 and 2, TSKS, was localized during spermiogenesis to the centrioles of post-meiotic spermatids, where it reached its greatest concentration during the period of flagellogenesis. This centriolar localization persisted in ejaculated human spermatozoa, while centriolar TSKS diminished in mouse sperm, where centrioles are known to undergo complete degeneration. In addition to the centriolar localization during flagellogenesis, mouse TSKS and the TSSK2 kinase localized in the tail and acrosomal regions of mouse epididymal sperm, while TSSK2 was found in the equatorial segment, neck and the midpiece of human spermatozoa. TSSK2/TSKS is the first kinase/substrate pair localized to the centrioles of spermatids and spermatozoa. Coupled with the infertility due to haploinsufficiency noted in chimeric mice with deletion of Tssk1 and 2 (companion paper) this centriolar kinase/substrate pair is predicted to play an indispensable role during spermiogenesis.

Population Level Purifying Selection and Gene Expression Shape Subgenome Evolution in Maize.

PubMed

Pophaly, Saurabh D; Tellier, Aurélien

2015-12-01

The maize ancestor experienced a recent whole-genome duplication (WGD) followed by gene erosion which generated two subgenomes, the dominant subgenome (maize1) experiencing fewer deletions than maize2. We take advantage of available extensive polymorphism and gene expression data in maize to study purifying selection and gene expression divergence between WGD retained paralog pairs. We first report a strong correlation in nucleotide diversity between duplicate pairs, except for upstream regions. We then show that maize1 genes are under stronger purifying selection than maize2. WGD retained genes have higher gene dosage and biased Gene Ontologies consistent with previous studies. The relative gene expression of paralogs across tissues demonstrates that 98% of duplicate pairs have either subfunctionalized in a tissuewise manner or have diverged consistently in their expression thereby preventing functional complementation. Tissuewise subfunctionalization seems to be a hallmark of transcription factors, whereas consistent repression occurs for macromolecular complexes. We show that dominant gene expression is a strong determinant of the strength of purifying selection, explaining the inferred stronger negative selection on maize1 genes. We propose a novel expression-based classification of duplicates which is more robust to explain observed polymorphism patterns than the subgenome location. Finally, upstream regions of repressed genes exhibit an enrichment in transposable elements which indicates a possible mechanism for expression divergence. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Altools: a user friendly NGS data analyser.

PubMed

Camiolo, Salvatore; Sablok, Gaurav; Porceddu, Andrea

2016-02-17

Genotyping by re-sequencing has become a standard approach to estimate single nucleotide polymorphism (SNP) diversity, haplotype structure and the biodiversity and has been defined as an efficient approach to address geographical population genomics of several model species. To access core SNPs and insertion/deletion polymorphisms (indels), and to infer the phyletic patterns of speciation, most such approaches map short reads to the reference genome. Variant calling is important to establish patterns of genome-wide association studies (GWAS) for quantitative trait loci (QTLs), and to determine the population and haplotype structure based on SNPs, thus allowing content-dependent trait and evolutionary analysis. Several tools have been developed to investigate such polymorphisms as well as more complex genomic rearrangements such as copy number variations, presence/absence variations and large deletions. The programs available for this purpose have different strengths (e.g. accuracy, sensitivity and specificity) and weaknesses (e.g. low computation speed, complex installation procedure and absence of a user-friendly interface). Here we introduce Altools, a software package that is easy to install and use, which allows the precise detection of polymorphisms and structural variations. Altools uses the BWA/SAMtools/VarScan pipeline to call SNPs and indels, and the dnaCopy algorithm to achieve genome segmentation according to local coverage differences in order to identify copy number variations. It also uses insert size information from the alignment of paired-end reads and detects potential large deletions. A double mapping approach (BWA/BLASTn) identifies precise breakpoints while ensuring rapid elaboration. Finally, Altools implements several processes that yield deeper insight into the genes affected by the detected polymorphisms. Altools was used to analyse both simulated and real next-generation sequencing (NGS) data and performed satisfactorily in terms of positive predictive values, sensitivity, the identification of large deletion breakpoints and copy number detection. Altools is fast, reliable and easy to use for the mining of NGS data. The software package also attempts to link identified polymorphisms and structural variants to their biological functions thus providing more valuable information than similar tools.

Sequence Variation in the Small-Subunit rRNA Gene of Plasmodium malariae and Prevalence of Isolates with the Variant Sequence in Sichuan, China

PubMed Central

Liu, Qing; Zhu, Shenghua; Mizuno, Sahoko; Kimura, Masatsugu; Liu, Peina; Isomura, Shin; Wang, Xingzhen; Kawamoto, Fumihiko

1998-01-01

By two PCR-based diagnostic methods, Plasmodium malariae infections have been rediscovered at two foci in the Sichuan province of China, a region where no cases of P. malariae have been officially reported for the last 2 decades. In addition, a variant form of P. malariae which has a deletion of 19 bp and seven substitutions of base pairs in the target sequence of the small-subunit (SSU) rRNA gene was detected with high frequency. Alignment analysis of Plasmodium sp. SSU rRNA gene sequences revealed that the 5′ region of the variant sequence is identical to that of P. vivax or P. knowlesi and its 3′ region is identical to that of P. malariae. The same sequence variations were also found in P. malariae isolates collected along the Thai-Myanmar border, suggesting a wide distribution of this variant form from southern China to Southeast Asia. PMID:9774600

The Promiscuity of [beta]-Strand Pairing Allows for Rational Design of [beta]-Sheet Face Inversion

DOE Office of Scientific and Technical Information (OSTI.GOV)

Makabe, Koki; Koide, Shohei

2009-06-17

Recent studies suggest the dominant role of main-chain H-bond formation in specifying {beta}-sheet topology. Its essentially sequence-independent nature implies a large degree of freedom in designing {beta}-sheet-based nanomaterials. Here we show rational design of {beta}-sheet face inversions by incremental deletions of {beta}-strands from the single-layer {beta}-sheet of Borrelia outer surface protein A. We show that a {beta}-sheet structure can be maintained when a large number of native contacts are removed and that one can design large-scale conformational transitions of a {beta}-sheet such as face inversion by exploiting the promiscuity of strand-strand interactions. High-resolution X-ray crystal structures confirmed the success ofmore » the design and supported the importance of main-chain H-bonds in determining {beta}-sheet topology. This work suggests a simple but effective strategy for designing and controlling nanomaterials based on {beta}-rich peptide self-assemblies.« less

Detailed dissection of the chromosomal region containing the Ph1 locus in wheat Triticum aestivum: with deletion mutants and expression profiling.

PubMed

Al-Kaff, Nadia; Knight, Emilie; Bertin, Isabelle; Foote, Tracie; Hart, Nicola; Griffiths, Simon; Moore, Graham

2008-04-01

Understanding Ph1, a dominant homoeologous chromosome pairing suppressor locus on the long arm of chromosome 5B in wheat Triticum aestivum L., is the core of the investigation in this article. The Ph1 locus restricts chromosome pairing and recombination at meiosis to true homologues. The importance of wheat as a crop and the need to exploit its wild relatives as donors for economically important traits in wheat breeding programmes is the main drive to uncover the mechanism of the Ph1 locus and regulate its activity. Following the molecular genetic characterization of the Ph1 locus, five additional deletion mutants covering the region have been identified. In addition, more bacterial artificial chromosomes (BACs) were sequenced and analysed to elucidate the complexity of this locus. A semi-quantitative RT-PCR was used to compare the expression profiles of different genes in the 5B region containing the Ph1 locus with their homoeologues on 5A and 5D. PCR products were cloned and sequenced to identify the gene from which they were derived. Deletion mutants and expression profiling of genes in the region containing the Ph1 locus on 5B has further restricted Ph1 to a cluster of cdk-like genes. Bioinformatic analysis of the cdk-like genes revealed their close homology to the checkpoint kinase Cdk2 from humans. Cdk2 is involved in the initiation of replication and is required in early meiosis. Expression profiling has revealed that the cdk-like gene cluster is unique within the region analysed on 5B in that these genes are transcribed. Deletion of the cdk-like locus on 5B results in activation of transcription of functional cdk-like copies on 5A and 5D. Thus the cdk locus on 5B is dominant to those on 5A and 5D in determining the overall activity, which will be dependent on a complex interplay between transcription from non-functional and functional cdk-like genes. The Ph1 locus has been defined to a cdk-like gene cluster related to Cdk2 in humans, a master checkpoint gene involved in the initiation of replication and required for early meiosis.

Complete Chloroplast Genome of Pinus massoniana (Pinaceae): Gene Rearrangements, Loss of ndh Genes, and Short Inverted Repeats Contraction, Expansion.

PubMed

Ni, ZhouXian; Ye, YouJu; Bai, Tiandao; Xu, Meng; Xu, Li-An

2017-09-11

The chloroplast genome (CPG) of Pinus massoniana belonging to the genus Pinus (Pinaceae), which is a primary source of turpentine, was sequenced and analyzed in terms of gene rearrangements, ndh genes loss, and the contraction and expansion of short inverted repeats (IRs). P. massoniana CPG has a typical quadripartite structure that includes large single copy (LSC) (65,563 bp), small single copy (SSC) (53,230 bp) and two IRs (IRa and IRb, 485 bp). The 108 unique genes were identified, including 73 protein-coding genes, 31 tRNAs, and 4 rRNAs. Most of the 81 simple sequence repeats (SSRs) identified in CPG were mononucleotides motifs of A/T types and located in non-coding regions. Comparisons with related species revealed an inversion (21,556 bp) in the LSC region; P. massoniana CPG lacks all 11 intact ndh genes (four ndh genes lost completely; the five remained truncated as pseudogenes; and the other two ndh genes remain as pseudogenes because of short insertions or deletions). A pair of short IRs was found instead of large IRs, and size variations among pine species were observed, which resulted from short insertions or deletions and non-synchronized variations between "IRa" and "IRb". The results of phylogenetic analyses based on whole CPG sequences of 16 conifers indicated that the whole CPG sequences could be used as a powerful tool in phylogenetic analyses.

Mutation update and uncommon phenotypes in a French cohort of 96 patients with WFS1-related disorders.

PubMed

Chaussenot, A; Rouzier, C; Quere, M; Plutino, M; Ait-El-Mkadem, S; Bannwarth, S; Barth, M; Dollfus, H; Charles, P; Nicolino, M; Chabrol, B; Vialettes, B; Paquis-Flucklinger, V

2015-05-01

WFS1 mutations are responsible for Wolfram syndrome (WS) characterized by juvenile-onset diabetes mellitus and optic atrophy, and for low-frequency sensorineural hearing loss (LFSNHL). Our aim was to analyze the French cohort of 96 patients with WFS1-related disorders in order (i) to update clinical and molecular data with 37 novel affected individuals, (ii) to describe uncommon phenotypes and, (iii) to precise the frequency of large-scale rearrangements in WFS1. We performed quantitative polymerase chain reaction (PCR) in 13 patients, carrying only one heterozygous variant, to identify large-scale rearrangements in WFS1. Among the 37 novel patients, 15 carried 15 novel deleterious putative mutations, including one large deletion of 17,444 base pairs. The analysis of the cohort revealed unexpected phenotypes including (i) late-onset symptoms in 13.8% of patients with a probable autosomal recessive transmission; (ii) two siblings with recessive optic atrophy without diabetes mellitus and, (iii) six patients from four families with dominantly-inherited deafness and optic atrophy. We highlight the expanding spectrum of WFS1-related disorders and we show that, even if large deletions are rare events, they have to be searched in patients with classical WS carrying only one WFS1 mutation after sequencing. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Targeted genome editing in a quail cell line using a customized CRISPR/Cas9 system.

PubMed

Ahn, Jinsoo; Lee, Joonbum; Park, Ju Yeon; Oh, Keon Bong; Hwang, Seongsoo; Lee, Chang-Won; Lee, Kichoon

2017-05-01

Soon after RNA-guided Cas9 (CRISPR-associated protein 9) endonuclease opened a new era of targeted genome editing, the CRISPR/Cas9 platform began to be extensively used to modify genes in various types of cells and organisms. However, successful CRISPR/Cas9-mediated insertion/deletion (indel) mutation remains to be demonstrated in avian cell lines. The objective of this study was to design a poultry-specific CRISPR/Cas9 system to efficiently introduce targeted deletion mutation in chromosomes of the quail muscle clone 7 (QM7) cell line using a customized quail CRISPR vector. In this study, two avian-specific promoters, quail 7SK (q7SK) promoter and CBh promoter, the hybrid form of cytomegalovirus and chicken β-actin promoters, were cloned into a CRISPR vector for the expression of guide RNA and Cas9 protein, respectively. Then, guide RNA, which was designed to target 20-base pair (bp) nucleotides in the quail melanophilin (MLPH) locus, was ligated to the modified CRISPR vector and transfected to QM7 cells. Our results showed multiple indel mutations in the quail MLPH locus in nearly half of the alleles being tested, suggesting the high efficiency of the system for targeted gene modification. The new CRISPR vector developed from this study has the potential application to generate knockout avian cell lines and knockout poultry. © 2016 Poultry Science Association Inc.

Machine-learning classification of 22q11.2 deletion syndrome: A diffusion tensor imaging study.

PubMed

Tylee, Daniel S; Kikinis, Zora; Quinn, Thomas P; Antshel, Kevin M; Fremont, Wanda; Tahir, Muhammad A; Zhu, Anni; Gong, Xue; Glatt, Stephen J; Coman, Ioana L; Shenton, Martha E; Kates, Wendy R; Makris, Nikos

2017-01-01

Chromosome 22q11.2 deletion syndrome (22q11.2DS) is a genetic neurodevelopmental syndrome that has been studied intensively in order to understand relationships between the genetic microdeletion, brain development, cognitive function, and the emergence of psychiatric symptoms. White matter microstructural abnormalities identified using diffusion tensor imaging methods have been reported to affect a variety of neuroanatomical tracts in 22q11.2DS. In the present study, we sought to combine two discovery-based approaches: (1) white matter query language was used to parcellate the brain's white matter into tracts connecting pairs of 34, bilateral cortical regions and (2) the diffusion imaging characteristics of the resulting tracts were analyzed using a machine-learning method called support vector machine in order to optimize the selection of a set of imaging features that maximally discriminated 22q11.2DS and comparison subjects. With this unique approach, we both confirmed previously-recognized 22q11.2DS-related abnormalities in the inferior longitudinal fasciculus (ILF), and identified, for the first time, 22q11.2DS-related anomalies in the middle longitudinal fascicle and the extreme capsule, which may have been overlooked in previous, hypothesis-guided studies. We further observed that, in participants with 22q11.2DS, ILF metrics were significantly associated with positive prodromal symptoms of psychosis.

Fetal HLA-G alleles and their effect on miscarriage.

PubMed

Koc, Altug; Kirbiyik, Ozgur; Kutbay, Yasar B; Ozyilmaz, Berk; Ozdemir, Taha R; Kaya, Ozge Ozer; Kubat, Gozde; Koc, Zeynep Peker

2018-05-29

Immunosuppression at the feto-maternal interface is crucial for a successful pregnancy outcome. Human leukocyte antigen-G (HLA-G) seems to be a major contributor to fetal tolerance. The HLA-G expression is seen in cytotrophoblasts and in maternal blood. Fetal HLA-G acts on decidual antigen-presenting cells (APCs), natural killers (NKs) and T cells. Recent findings revealed that defects in placentation and their consequences are associated with maternal HLA-G variants and their expression levels. The objective of this article is to investigate the relationship between fetal HLA-G alleles and miscarriage, which has not been investigated to date. The present study includes 204 recurrent miscarriage (RM) cases who were admitted to our clinic between 2012 and 2016. Twenty-eight miscarriage products without maternal cell contamination and any known pathology were analyzed by HLA-G typing. In addition, 3' untranslated region (UTR) 14-base pair (bp) insertion/deletion polymorphism was also investigated by Sanger sequencing. For our population, the most frequent HLA-G type was G*01:01, both in the study group (30.3%) and in the control group (47%). The study revealed that the G*01:04 allele was significantly associated with miscarriage (p = 0.007). The 3' UTR 14bp deletion was more frequent in the miscarriage group, but there was no significant correlation. HLA-G alleles seem to be related with miscarriage and should be considered in RM cases.

Recessive mutations in the INS gene result in neonatal diabetes through reduced insulin biosynthesis

PubMed Central

Garin, Intza; Edghill, Emma L.; Akerman, Ildem; Rubio-Cabezas, Oscar; Rica, Itxaso; Locke, Jonathan M.; Maestro, Miguel Angel; Alshaikh, Adnan; Bundak, Ruveyde; del Castillo, Gabriel; Deeb, Asma; Deiss, Dorothee; Fernandez, Juan M.; Godbole, Koumudi; Hussain, Khalid; O’Connell, Michele; Klupa, Thomasz; Kolouskova, Stanislava; Mohsin, Fauzia; Perlman, Kusiel; Sumnik, Zdenek; Rial, Jose M.; Ugarte, Estibaliz; Vasanthi, Thiruvengadam; Johnstone, Karen; Flanagan, Sarah E.; Martínez, Rosa; Castaño, Carlos; Patch, Ann-Marie; Fernández-Rebollo, Eduardo; Raile, Klemens; Morgan, Noel; Harries, Lorna W.; Castaño, Luis; Ellard, Sian; Ferrer, Jorge; de Nanclares, Guiomar Perez; Hattersley, Andrew T.

2010-01-01

Heterozygous coding mutations in the INS gene that encodes preproinsulin were recently shown to be an important cause of permanent neonatal diabetes. These dominantly acting mutations prevent normal folding of proinsulin, which leads to beta-cell death through endoplasmic reticulum stress and apoptosis. We now report 10 different recessive INS mutations in 15 probands with neonatal diabetes. Functional studies showed that recessive mutations resulted in diabetes because of decreased insulin biosynthesis through distinct mechanisms, including gene deletion, lack of the translation initiation signal, and altered mRNA stability because of the disruption of a polyadenylation signal. A subset of recessive mutations caused abnormal INS transcription, including the deletion of the C1 and E1 cis regulatory elements, or three different single base-pair substitutions in a CC dinucleotide sequence located between E1 and A1 elements. In keeping with an earlier and more severe beta-cell defect, patients with recessive INS mutations had a lower birth weight (−3.2 SD score vs. −2.0 SD score) and were diagnosed earlier (median 1 week vs. 10 weeks) compared to those with dominant INS mutations. Mutations in the insulin gene can therefore result in neonatal diabetes as a result of two contrasting pathogenic mechanisms. Moreover, the recessively inherited mutations provide a genetic demonstration of the essential role of multiple sequence elements that regulate the biosynthesis of insulin in man. PMID:20133622

Short communication: novel truncating mutations in the CFTR gene causing a severe form of cystic fibrosis in Italian patients.

PubMed

Lenarduzzi, S; Morgutti, M; Crovella, S; Coiana, A; Rosatelli, M C

2014-11-14

Cystic fibrosis (CF) is a common recessive genetic disease caused by mutations in the gene encoding for the cystic fibrosis transmembrane conductance regulator (CFTR) protein. More than 1800 different mutations have been described to date. Here, we report 3 novel mutations in CFTR in 3 Italian CF patients. To detect and identify 36 frequent mutations in Caucasians, we used the INNO-LiPA CFTR19 and INNO-LiPA CFTR17+Tn Update kits (Innogenetics; Ghent, Belgium). Our first analysis did not reveal both of the responsible mutations; thus, direct sequencing of the CFTR gene coding region was performed. The 3 patients were compound heterozygous. In one allele, the F508del (c.1521_1523delCTT, p.PHE508del) mutation in exon 11 was observed in each case. For the second allele, in patient No.1, direct sequencing revealed an 11-base pair deletion (GAGGCGATACT) in exon 14 (c.2236_2246del; pGlu746Alafs*29). In patient No. 2, direct sequencing revealed a nonsense mutation at nucleotide 3892 (c.3892G>T) in exon 24. In patient No. 3, direct sequencing revealed a deletion of cytosine in exon 27 (c.4296delC; p.Asn1432Lysfs*16). These 3 novel mutations indicate the production of a truncated protein, which consequently results in a non-functional polypeptide.

Microarray and FISH-based genotype-phenotype analysis of 22 Japanese patients with Wolf-Hirschhorn syndrome.

PubMed

Shimizu, Kenji; Wakui, Keiko; Kosho, Tomoki; Okamoto, Nobuhiko; Mizuno, Seiji; Itomi, Kazuya; Hattori, Shigeto; Nishio, Kimio; Samura, Osamu; Kobayashi, Yoshiyuki; Kako, Yuko; Arai, Takashi; Tsutomu, Oh-ishi; Kawame, Hiroshi; Narumi, Yoko; Ohashi, Hirofumi; Fukushima, Yoshimitsu

2014-03-01

Wolf-Hirschhorn syndrome (WHS) is a contiguous gene deletion syndrome of the distal 4p chromosome, characterized by craniofacial features, growth impairment, intellectual disability, and seizures. Although genotype-phenotype correlation studies have previously been published, several important issues remain to be elucidated including seizure severity. We present detailed clinical and molecular-cytogenetic findings from a microarray and fluorescence in situ hybridization (FISH)-based genotype-phenotype analysis of 22 Japanese WHS patients, the first large non-Western series. 4p deletions were terminal in 20 patients and interstitial in two, with deletion sizes ranging from 2.06 to 29.42 Mb. The new Wolf-Hirschhorn syndrome critical region (WHSCR2) was deleted in all cases, and duplication of other chromosomal regions occurred in four. Complex mosaicism was identified in two cases: two different 4p terminal deletions; a simple 4p terminal deletion and an unbalanced translocation with the same 4p breakpoint. Seizures began in infancy in 33% (2/6) of cases with small (<6 Mb) deletions and in 86% (12/14) of cases with larger deletions (>6 Mb). Status epilepticus occurred in 17% (1/6) with small deletions and in 87% (13/15) with larger deletions. Renal hypoplasia or dysplasia and structural ocular anomalies were more prevalent in those with larger deletions. A new susceptible region for seizure occurrence is suggested between 0.76 and 1.3 Mb from 4 pter, encompassing CTBP1 and CPLX1, and distal to the previously-supposed candidate gene LETM1. The usefulness of bromide therapy for seizures and additional clinical features including hypercholesterolemia are also described. © 2013 Wiley Periodicals, Inc.

A physical map, including a BAC/PAC clone contig, of the Williams-Beuren syndrome--deletion region at 7q11.23.

PubMed

Peoples, R; Franke, Y; Wang, Y K; Pérez-Jurado, L; Paperna, T; Cisco, M; Francke, U

2000-01-01

Williams-Beuren syndrome (WBS) is a developmental disorder caused by haploinsufficiency for genes in a 2-cM region of chromosome band 7q11.23. With the exception of vascular stenoses due to deletion of the elastin gene, the various features of WBS have not yet been attributed to specific genes. Although >/=16 genes have been identified within the WBS deletion, completion of a physical map of the region has been difficult because of the large duplicated regions flanking the deletion. We present a physical map of the WBS deletion and flanking regions, based on assembly of a bacterial artificial chromosome/P1-derived artificial chromosome contig, analysis of high-throughput genome-sequence data, and long-range restriction mapping of genomic and cloned DNA by pulsed-field gel electrophoresis. Our map encompasses 3 Mb, including 1.6 Mb within the deletion. Two large duplicons, flanking the deletion, of >/=320 kb contain unique sequence elements from the internal border regions of the deletion, such as sequences from GTF2I (telomeric) and FKBP6 (centromeric). A third copy of this duplicon exists in inverted orientation distal to the telomeric flanking one. These duplicons show stronger sequence conservation with regard to each other than to the presumptive ancestral loci within the common deletion region. Sequence elements originating from beyond 7q11.23 are also present in these duplicons. Although the duplicons are not present in mice, the order of the single-copy genes in the conserved syntenic region of mouse chromosome 5 is inverted relative to the human map. A model is presented for a mechanism of WBS-deletion formation, based on the orientation of duplicons' components relative to each other and to the ancestral elements within the deletion region.

Unique and atypical deletions in Prader–Willi syndrome reveal distinct phenotypes

PubMed Central

Kim, Soo-Jeong; Miller, Jennifer L; Kuipers, Paul J; German, Jennifer Ruth; Beaudet, Arthur L; Sahoo, Trilochan; Driscoll, Daniel J

2012-01-01

Prader–Willi syndrome (PWS) is a multisystem, contiguous gene disorder caused by an absence of paternally expressed genes within the 15q11.2-q13 region via one of the three main genetic mechanisms: deletion of the paternally inherited 15q11.2-q13 region, maternal uniparental disomy and imprinting defect. The deletion class is typically subdivided into Type 1 and Type 2 based on their proximal breakpoints (BP1–BP3 and BP2–BP3, respectively). Despite PWS being a well-characterized genetic disorder the role of the specific genes contributing to various aspects of the phenotype are not well understood. Methylation-specific multiplex ligation-dependent probe amplification (MS-MLPA) is a recently developed technique that detects copy number changes and aberrant DNA methylation. In this study, we initially applied MS-MLPA to elucidate the deletion subtypes of 88 subjects. In our cohort, 32 had a Type 1 and 49 had a Type 2 deletion. The remaining seven subjects had unique or atypical deletions that were either smaller (n=5) or larger (n=2) than typically described and were further characterized by array-based comparative genome hybridization. In two subjects both the PWS region (15q11.2) and the newly described 15q13.3 microdeletion syndrome region were deleted. The subjects with a unique or an atypical deletion revealed distinct phenotypic features. In conclusion, unique or atypical deletions were found in ∼8% of the deletion subjects with PWS in our cohort. These novel deletions provide further insight into the potential role of several of the genes within the 15q11.2 and the 15q13.3 regions. PMID:22045295

Unique and atypical deletions in Prader-Willi syndrome reveal distinct phenotypes.

PubMed

Kim, Soo-Jeong; Miller, Jennifer L; Kuipers, Paul J; German, Jennifer Ruth; Beaudet, Arthur L; Sahoo, Trilochan; Driscoll, Daniel J

2012-03-01

Prader-Willi syndrome (PWS) is a multisystem, contiguous gene disorder caused by an absence of paternally expressed genes within the 15q11.2-q13 region via one of the three main genetic mechanisms: deletion of the paternally inherited 15q11.2-q13 region, maternal uniparental disomy and imprinting defect. The deletion class is typically subdivided into Type 1 and Type 2 based on their proximal breakpoints (BP1-BP3 and BP2-BP3, respectively). Despite PWS being a well-characterized genetic disorder the role of the specific genes contributing to various aspects of the phenotype are not well understood. Methylation-specific multiplex ligation-dependent probe amplification (MS-MLPA) is a recently developed technique that detects copy number changes and aberrant DNA methylation. In this study, we initially applied MS-MLPA to elucidate the deletion subtypes of 88 subjects. In our cohort, 32 had a Type 1 and 49 had a Type 2 deletion. The remaining seven subjects had unique or atypical deletions that were either smaller (n=5) or larger (n=2) than typically described and were further characterized by array-based comparative genome hybridization. In two subjects both the PWS region (15q11.2) and the newly described 15q13.3 microdeletion syndrome region were deleted. The subjects with a unique or an atypical deletion revealed distinct phenotypic features. In conclusion, unique or atypical deletions were found in ∼8% of the deletion subjects with PWS in our cohort. These novel deletions provide further insight into the potential role of several of the genes within the 15q11.2 and the 15q13.3 regions.

The effect of homogeneous and heterogeneous review pairs on student achievement and attitude when utilizing computer-assisted instruction in middle-level Earth science classes

NASA Astrophysics Data System (ADS)

Lyon, Ellen Beth

1998-09-01

This research project investigated the influence of homogeneous (like-ability) review pairs coupled with heterogeneous (mixed-ability) cooperative learning groups using computer-assisted instruction (CAI) on academic achievement and attitude toward science in eighth grade Earth science students. Subjects were placed into academic quartiles (Hi, Med-Hi, Med-Lo, and Lo) based on achievement. Cooperative learning groups of four (one student from each academic quartile) were formed in all classes, within which students completed CAI through a software package entitled Geoscience Education Through Interactive Technology, or GETITspTM. Each day, when computer activities were completed, students in the experimental classes were divided into homogeneous review pairs to review their work. The students in the control classes were divided into heterogeneous review pairs to review their work. The effects of the experimental treatment were measured by pretest, posttest, and delayed posttest measures, by pre- and post-student attitude scales, and by evaluation of amendments students made to their work during the time spent in review pairs. Results showed that student achievement was not significantly influenced by placement in homogeneous or heterogeneous review pairs, regardless of academic quartile assignment. Student attitude toward science as a school subject did not change significantly due to experimental treatment. Achievement retention of students in experimental and control groups within each quartile showed no significant difference. Notebook amendment patterns showed some significant differences in a few categories. For the Hi quartile, there were significant differences in numbers of deletion amendments and substitution amendments between the experimental and the control group. In both cases, subjects in the experimental group (homogeneous review pairs) made greater number of amendments then those in the control group (heterogeneous review pairs). For the Lo quartile, there was a significant difference in the number of grammar/usage/mechanics (GUM) amendments between the experimental and control groups. The experimental group made far more GUM amendments than the control group. This research highlights the fact that many factors may influence a successful learning environment in which CAI is successfully implemented. Educational research projects should be designed and used to help teachers create learning environments in which CAI is maximized.

The frequency of previously undetectable deletions involving 3' Exons of the PMS2 gene.

PubMed

Vaughn, Cecily P; Baker, Christine L; Samowitz, Wade S; Swensen, Jeffrey J

2013-01-01

Lynch syndrome is characterized by mutations in one of four mismatch repair genes, MLH1, MSH2, MSH6, or PMS2. Clinical mutation analysis of these genes includes sequencing of exonic regions and deletion/duplication analysis. However, detection of deletions and duplications in PMS2 has previously been confined to Exons 1-11 due to gene conversion between PMS2 and the pseudogene PMS2CL in the remaining 3' exons (Exons 12-15). We have recently described an MLPA-based method that permits detection of deletions of PMS2 Exons 12-15; however, the frequency of such deletions has not yet been determined. To address this question, we tested for 3' deletions in 58 samples that were reported to be negative for PMS2 mutations using previously available methods. All samples were from individuals whose tumors exhibited loss of PMS2 immunohistochemical staining without concomitant loss of MLH1 immunostaining. We identified seven samples in this cohort with deletions in the 3' region of PMS2, including three previously reported samples with deletions of Exons 13-15 (two samples) and Exons 14-15. Also detected were deletions of Exons 12-15, Exon 13, and Exon 14 (two samples). Breakpoint analysis of the intragenic deletions suggests they occurred through Alu-mediated recombination. Our results indicate that ∼12% of samples suspected of harboring a PMS2 mutation based on immunohistochemical staining, for which mutations have not yet been identified, would benefit from testing using the new methodology. Copyright © 2012 Wiley Periodicals, Inc.

Type 2 diabetes susceptibility genes on chromosome 1q21-24.

PubMed

Hasstedt, S J; Chu, W S; Das, S K; Wang, H; Elbein, S C

2008-03-01

Type 2 diabetes (T2D) has been linked to chromosome 1q21-24 in multiple samples, including a Utah family sample. Variants in 13 of the numerous candidate genes in the 1q region were tested for association with T2D in a Utah case-control sample. The most promising, 19 variants in 6 candidates, were genotyped on the Utah family sample. Herein, we tested the 19 variants individually and in pairs for an effect on T2D risk in family members using a logistic regression model that accounted for gender, age, and BMI and attributed residual genetic effects to a polygenic component. Seven variants increased risk significantly through 5 pairs of interactions. The significant variant pairs were apolipoprotein A-II (APOA2) rs6413453 interacting with calsequestrin 1 (CASQ1) rs617698, dual specificity phosphatase 12 (DUSP12) rs1503814, and retinoid X receptor gamma (RXRG) rs10918169, a poly-T insertion-deletion polymorphism in liver pyruvate kinase (PKLR) interacting with APOA2 rs12143180, and DUSP12 rs1027702 interacting with RXRG rs10918169. Genotypes of these 5 variant pairs accounted for 25.8% of the genetic variance in T2D in these pedigrees.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Horodecki, Michal; Sen, Aditi; Sen, Ujjwal

The impossibility of cloning and deleting of unknown states constitute important restrictions on processing of information in the quantum world. On the other hand, a known quantum state can always be cloned or deleted. However, if we restrict the class of allowed operations, there will arise restrictions on the ability of cloning and deleting machines. We have shown that cloning and deleting of known states is in general not possible by local operations. This impossibility hints at quantum correlation in the state. We propose dual measures of quantum correlation based on the dual restrictions of no local cloning and nomore » local deleting. The measures are relative entropy distances of the desired states in a (generally impossible) perfect local cloning or local deleting process from the best approximate state that is actually obtained by imperfect local cloning or deleting machines. Just like the dual measures of entanglement cost and distillable entanglement, the proposed measures are based on important processes in quantum information. We discuss their properties. For the case of pure states, estimations of these two measures are also provided. Interestingly, the entanglement of cloning for a maximally entangled state of two two-level systems is not unity.« less

Synaptonemal Complex Components Persist at Centromeres and Are Required for Homologous Centromere Pairing in Mouse Spermatocytes

PubMed Central

Kouznetsova, Anna; Scherthan, Harry; Höög, Christer; Dawson, Dean S.; Pezza, Roberto J.

2012-01-01

Recent studies in simple model organisms have shown that centromere pairing is important for ensuring high-fidelity meiotic chromosome segregation. However, this process and the mechanisms regulating it in higher eukaryotes are unknown. Here we present the first detailed study of meiotic centromere pairing in mouse spermatogenesis and link it with key events of the G2/metaphase I transition. In mouse we observed no evidence of the persistent coupling of centromeres that has been observed in several model organisms. We do however find that telomeres associate in non-homologous pairs or small groups in B type spermatogonia and pre-leptotene spermatocytes, and this association is disrupted by deletion of the synaptonemal complex component SYCP3. Intriguingly, we found that, in mid prophase, chromosome synapsis is not initiated at centromeres, and centromeric regions are the last to pair in the zygotene-pachytene transition. In late prophase, we first identified the proteins that reside at paired centromeres. We found that components of the central and lateral element and transverse filaments of the synaptonemal complex are retained at paired centromeres after disassembly of the synaptonemal complex along diplotene chromosome arms. The absence of SYCP1 prevents centromere pairing in knockout mouse spermatocytes. The localization dynamics of SYCP1 and SYCP3 suggest that they play different roles in promoting homologous centromere pairing. SYCP1 remains only at paired centromeres coincident with the time at which some kinetochore proteins begin loading at centromeres, consistent with a role in assembly of meiosis-specific kinetochores. After removal of SYCP1 from centromeres, SYCP3 then accumulates at paired centromeres where it may promote bi-orientation of homologous centromeres. We propose that, in addition to their roles as synaptonemal complex components, SYCP1 and SYCP3 act at the centromeres to promote the establishment and/or maintenance of centromere pairing and, by doing so, improve the segregation fidelity of mammalian meiotic chromosomes. PMID:22761579

Rapid deletion plasmid construction methods for protoplast and Agrobacterium based fungal transformation systems

USDA-ARS?s Scientific Manuscript database

Increasing availability of genomic data and sophistication of analytical methodology in fungi has elevated the need for functional genomics tools in these organisms. Gene deletion is a critical tool for functional analysis. The targeted deletion of genes requires both a suitable method for the trans...

Genome evolution in Reptilia: in silico chicken mapping of 12,000 BAC-end sequences from two reptiles and a basal bird

PubMed Central

2009-01-01

Background With the publication of the draft chicken genome and the recent production of several BAC clone libraries from non-avian reptiles and birds, it is now possible to undertake more detailed comparative genomic studies in Reptilia. Of interest in particular are the genomic events that transformed the large, repeat-rich genomes of mammals and non-avian reptiles into the minimalist chicken genome. We have used paired BAC end sequences (BESs) from the American alligator (Alligator mississippiensis), painted turtle (Chrysemys picta) and emu (Dromaius novaehollandiae) to investigate patterns of sequence divergence, gene and retroelement content, and microsynteny between these species and chicken. Results From a total of 11,967 curated BESs, we successfully mapped 725, 773 and 2597 sequences in alligator, turtle, and emu, respectively, to sites in the draft chicken genome using a stringent BLAST protocol. Most commonly, sequences mapped to a single site in the chicken genome. Of 1675, 1828 and 2936 paired BESs obtained for alligator, turtle, and emu, respectively, a total of 34 (alligator, 2%), 24 (turtle, 1.3%) and 479 (emu, 16.3%) pairs were found to map with high confidence and in the correct orientation and with BAC-sized intermarker distances to single chicken chromosomes, including 25 such paired hits in emu mapping to the chicken Z chromosome. By determining the insert sizes of a subset of BAC clones from these three species, we also found a significant correlation between the intermarker distance in alligator and turtle and in chicken, with slopes as expected on the basis of the ratio of the genome sizes. Conclusion Our results suggest that a large number of small-scale chromosomal rearrangements and deletions in the lineage leading to chicken have drastically reduced the number of detected syntenies observed between the chicken and alligator, turtle, and emu genomes and imply that small deletions occurring widely throughout the genomes of reptilian and avian ancestors led to the ~50% reduction in genome size observed in birds compared to reptiles. We have also mapped and identified likely gene regions in hundreds of new BAC clones from these species. PMID:19607659

Genome evolution in Reptilia: in silico chicken mapping of 12,000 BAC-end sequences from two reptiles and a basal bird.

PubMed

Chapus, Charles; Edwards, Scott V

2009-07-14

With the publication of the draft chicken genome and the recent production of several BAC clone libraries from non-avian reptiles and birds, it is now possible to undertake more detailed comparative genomic studies in Reptilia. Of interest in particular are the genomic events that transformed the large, repeat-rich genomes of mammals and non-avian reptiles into the minimalist chicken genome. We have used paired BAC end sequences (BESs) from the American alligator (Alligator mississippiensis), painted turtle (Chrysemys picta) and emu (Dromaius novaehollandiae) to investigate patterns of sequence divergence, gene and retroelement content, and microsynteny between these species and chicken. From a total of 11,967 curated BESs, we successfully mapped 725, 773 and 2597 sequences in alligator, turtle, and emu, respectively, to sites in the draft chicken genome using a stringent BLAST protocol. Most commonly, sequences mapped to a single site in the chicken genome. Of 1675, 1828 and 2936 paired BESs obtained for alligator, turtle, and emu, respectively, a total of 34 (alligator, 2%), 24 (turtle, 1.3%) and 479 (emu, 16.3%) pairs were found to map with high confidence and in the correct orientation and with BAC-sized intermarker distances to single chicken chromosomes, including 25 such paired hits in emu mapping to the chicken Z chromosome. By determining the insert sizes of a subset of BAC clones from these three species, we also found a significant correlation between the intermarker distance in alligator and turtle and in chicken, with slopes as expected on the basis of the ratio of the genome sizes. Our results suggest that a large number of small-scale chromosomal rearrangements and deletions in the lineage leading to chicken have drastically reduced the number of detected syntenies observed between the chicken and alligator, turtle, and emu genomes and imply that small deletions occurring widely throughout the genomes of reptilian and avian ancestors led to the ~50% reduction in genome size observed in birds compared to reptiles. We have also mapped and identified likely gene regions in hundreds of new BAC clones from these species.

Mechanism of mismatch recognition revealed by human MutS[beta] bound to unpaired DNA loops

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gupta, Shikha; Gellert, Martin; Yang, Wei

2012-04-17

DNA mismatch repair corrects replication errors, thus reducing mutation rates and microsatellite instability. Genetic defects in this pathway cause Lynch syndrome and various cancers in humans. Binding of a mispaired or unpaired base by bacterial MutS and eukaryotic MutS{alpha} is well characterized. We report here crystal structures of human MutS{beta} in complex with DNA containing insertion-deletion loops (IDL) of two, three, four or six unpaired nucleotides. In contrast to eukaryotic MutS{alpha} and bacterial MutS, which bind the base of a mismatched nucleotide, MutS{beta} binds three phosphates in an IDL. DNA is severely bent at the IDL; unpaired bases are flippedmore » out into the major groove and partially exposed to solvent. A normal downstream base pair can become unpaired; a single unpaired base can thereby be converted to an IDL of two nucleotides and recognized by MutS{beta}. The C-terminal dimerization domains form an integral part of the MutS structure and coordinate asymmetrical ATP hydrolysis by Msh2 and Msh3 with mismatch binding to signal for repair.« less

The genomic and transcriptomic architecture of 2,000 breast tumours reveals novel subgroups.

PubMed

Curtis, Christina; Shah, Sohrab P; Chin, Suet-Feung; Turashvili, Gulisa; Rueda, Oscar M; Dunning, Mark J; Speed, Doug; Lynch, Andy G; Samarajiwa, Shamith; Yuan, Yinyin; Gräf, Stefan; Ha, Gavin; Haffari, Gholamreza; Bashashati, Ali; Russell, Roslin; McKinney, Steven; Langerød, Anita; Green, Andrew; Provenzano, Elena; Wishart, Gordon; Pinder, Sarah; Watson, Peter; Markowetz, Florian; Murphy, Leigh; Ellis, Ian; Purushotham, Arnie; Børresen-Dale, Anne-Lise; Brenton, James D; Tavaré, Simon; Caldas, Carlos; Aparicio, Samuel

2012-04-18

The elucidation of breast cancer subgroups and their molecular drivers requires integrated views of the genome and transcriptome from representative numbers of patients. We present an integrated analysis of copy number and gene expression in a discovery and validation set of 997 and 995 primary breast tumours, respectively, with long-term clinical follow-up. Inherited variants (copy number variants and single nucleotide polymorphisms) and acquired somatic copy number aberrations (CNAs) were associated with expression in ~40% of genes, with the landscape dominated by cis- and trans-acting CNAs. By delineating expression outlier genes driven in cis by CNAs, we identified putative cancer genes, including deletions in PPP2R2A, MTAP and MAP2K4. Unsupervised analysis of paired DNA–RNA profiles revealed novel subgroups with distinct clinical outcomes, which reproduced in the validation cohort. These include a high-risk, oestrogen-receptor-positive 11q13/14 cis-acting subgroup and a favourable prognosis subgroup devoid of CNAs. Trans-acting aberration hotspots were found to modulate subgroup-specific gene networks, including a TCR deletion-mediated adaptive immune response in the ‘CNA-devoid’ subgroup and a basal-specific chromosome 5 deletion-associated mitotic network. Our results provide a novel molecular stratification of the breast cancer population, derived from the impact of somatic CNAs on the transcriptome.

A Bioinformatics Approach for Detecting Repetitive Nested Motifs using Pattern Matching.

PubMed

Romero, José R; Carballido, Jessica A; Garbus, Ingrid; Echenique, Viviana C; Ponzoni, Ignacio

2016-01-01

The identification of nested motifs in genomic sequences is a complex computational problem. The detection of these patterns is important to allow the discovery of transposable element (TE) insertions, incomplete reverse transcripts, deletions, and/or mutations. In this study, a de novo strategy for detecting patterns that represent nested motifs was designed based on exhaustive searches for pairs of motifs and combinatorial pattern analysis. These patterns can be grouped into three categories, motifs within other motifs, motifs flanked by other motifs, and motifs of large size. The methodology used in this study, applied to genomic sequences from the plant species Aegilops tauschii and Oryza sativa , revealed that it is possible to identify putative nested TEs by detecting these three types of patterns. The results were validated through BLAST alignments, which revealed the efficacy and usefulness of the new method, which is called Mamushka.

Indel Group in Genomes (IGG) Molecular Genetic Markers1[OPEN

PubMed Central

Burkart-Waco, Diana; Kuppu, Sundaram; Britt, Anne; Chetelat, Roger

2016-01-01

Genetic markers are essential when developing or working with genetically variable populations. Indel Group in Genomes (IGG) markers are primer pairs that amplify single-locus sequences that differ in size for two or more alleles. They are attractive for their ease of use for rapid genotyping and their codominant nature. Here, we describe a heuristic algorithm that uses a k-mer-based approach to search two or more genome sequences to locate polymorphic regions suitable for designing candidate IGG marker primers. As input to the IGG pipeline software, the user provides genome sequences and the desired amplicon sizes and size differences. Primer sequences flanking polymorphic insertions/deletions are produced as output. IGG marker files for three sets of genomes, Solanum lycopersicum/Solanum pennellii, Arabidopsis (Arabidopsis thaliana) Columbia-0/Landsberg erecta-0 accessions, and S. lycopersicum/S. pennellii/Solanum tuberosum (three-way polymorphic) are included. PMID:27436831

Association of 5-HTTLPR Polymorphism with the Nursing Diagnoses and the Achievement of Nursing Outcomes in Patients with Major Depression.

PubMed

Prokofieva, Margarita; Karadima, Georgia; Koukia, Evmorfia; Michou, Vassiliki; Kyprianidou, Chrysoula; Papageorgiou, Chrysovalantis V; Alexiadis, Evangelos; Constantoulakis, Pantelis; Dikeos, Dimitris

2017-10-01

The aim of this study is to investigate whether a 44-base-pair insertion/deletion polymorphism in the upstream regulatory region of the serotonin transporter gene (5-HTTLPR) is associated with the nursing diagnoses and the achievement of the desired nursing outcomes in inpatients with major depression. Thirty five patients were evaluated. The nursing diagnoses of risk for suicide and imbalanced nutrition are reported less often in homozygotes of the high-expressing gene (L A ). Carriers of the low-expressing genes (L G or S) have a worse response to interventions which aim to increase low self-esteem, indicating that they may need more intensive care in order to achieve the desired outcome. Genetics in psychiatric nursing could help refine personalized care, however further studies with large sample sizes and multiple gene evaluations are needed.

CRISPR-Cas9; an efficient tool for precise plant genome editing.

PubMed

Islam, Waqar

2018-06-01

Efficient plant genome editing is dependent upon induction of double stranded DNA breaks (DSBs) through site specified nucleases. These DSBs initiate the process of DNA repair which can either base upon homologous recombination (HR) or non-homologous end jointing (NHEJ). Recently, CRISPR-Cas9 mechanism got highlighted as revolutionizing genetic tool due to its simpler frame work along with the broad range of adaptability and applications. So, in this review, I have tried to sum up the application of this biotechnological tool in plant genome editing. Furthermore, I have tried to explain successful adaptation of CRISPR in various plant species where it is used for the successful generation of stable mutations in a steadily growing number of species through NHEJ. The review also sheds light upon other biotechnological approaches relying upon single DNA lesion induction such as genomic deletion or pair wise nickases for evasion of offsite effects. Copyright © 2018 Elsevier Ltd. All rights reserved.

The genetic landscape of a physical interaction

PubMed Central

Diss, Guillaume

2018-01-01

A key question in human genetics and evolutionary biology is how mutations in different genes combine to alter phenotypes. Efforts to systematically map genetic interactions have mostly made use of gene deletions. However, most genetic variation consists of point mutations of diverse and difficult to predict effects. Here, by developing a new sequencing-based protein interaction assay – deepPCA – we quantified the effects of >120,000 pairs of point mutations on the formation of the AP-1 transcription factor complex between the products of the FOS and JUN proto-oncogenes. Genetic interactions are abundant both in cis (within one protein) and trans (between the two molecules) and consist of two classes – interactions driven by thermodynamics that can be predicted using a three-parameter global model, and structural interactions between proximally located residues. These results reveal how physical interactions generate quantitatively predictable genetic interactions. PMID:29638215

Low dose irradiation facilitates hepatocellular carcinoma genesis involving HULC.

PubMed

Li, Yuan; Ge, Chang; Feng, Guoxing; Xiao, Huiwen; Dong, Jiali; Zhu, Changchun; Jiang, Mian; Cui, Ming; Fan, Saijun

2018-03-24

Irradiation exposure positive correlates with tumor formation, such as breast cancer and lung cancer. However, whether low dose irradiation induces hepatocarcinogenesis and the underlying mechanism remain poorly defined. In the present study, we reported that low dose irradiation facilitated the proliferation of hepatocyte through up-regulating HULC in vitro and in vivo. Low dose irradiation exposure elevated HULC expression level in hepatocyte. Deletion of heightened HULC erased the cells growth accelerated following low dose irradiation exposure. CDKN1, the neighbor gene of HULC, was down-regulated by overexpression of HULC following low dose irradiation exposure via complementary base pairing, resulting in promoting cell cycle process. Thus, our findings provide new insights into the mechanism of low dose irradiation-induced hepatocarcinogenesis through HULC/CDKN1 signaling, and shed light on the potential risk of low dose irradiation for the development of hepatocellular carcinoma in pre-clinical settings. © 2018 Wiley Periodicals, Inc.

Smoking has no impact on survival and it is not associated with ACE gene I/D polymorphism in hemodialysis patients.

PubMed

Kiss, István; Kiss, Zoltán; Kerkovits, Lóránt; Paksy, András; Ambrus, Csaba

2017-01-01

The relationship between smoking and mortality in patients on hemodialysis is controversial. Earlier studies showed that the insertion/deletion (I/D) polymorphism of the ACE gene might have an effect on mortality. The aim of this study was to test the impact of smoking on survival and whether this association was influenced by ACE gene I/D polymorphism in patients on maintenance hemodialysis. In this prospective, multicenter cohort study we analyzed 709 prevalent patients on maintenance hemodialysis. Patients were allocated into groups based on their smoking habit. Outcome data were collected during the 144-month follow-up period. Outcomes of current smokers and lifelong non-smokers were compared. In order to control for interactions between predictor variables, we also identified 160 matched pairs for further sub-analysis. The vast majority of patients (67%) were non-smokers, followed by current smokers (22.2%) and ex-smokers (9.8%). Smoking had no impact on survival in the matched pair analysis ( p = 0.99). After adjustment for ACE I/D polymorphism and other co-variates, smoking had no effect on survival. Our data suggest that smoking has no impact on survival; neither is it associated with ACE gene I/D polymorphism in hemodialysis patients.

Molecular and morphological differentiation between the crop and weedy types in velvetleaf (Abutilon theophrasti Medik.) using a chloroplast DNA marker: seed source of the present invasive velvetleaf in Japan.

PubMed

Kurokawa, S; Shibaike, H; Akiyama, H; Yoshimura, Y

2004-12-01

A comparison of chloroplast DNA (cpDNA) sequences was carried out between the crop and weed types of Abutilon theophrasti to clarify the seed source of the present weedy velvetleaf in Japan. A sequencing analysis of approx. 6% of the chloroplast genome (ca 10 kbp) detected three nucleotide substitutions, one six-base-pair insertion/deletion (indel) and one 30-base pair inversion, which distinguish two haplotypes of cpDNA. A PCR-based survey of the indel and the inversion revealed that the 93 accessions of velvetleaf collected from the world could be divided into two groups. A morphological marker (capsule color) could be used to discriminate the crop type and the weed type, and hence, along with cpDNA haplotype, to distinguish three genotypes (Type I, II, and III). All Japanese cultivars and crop accessions from other countries were Type I. Weed types were divided into Type II and III. All of the samples from the USA, and the samples taken from grain imports to Japan were Type III. Since most of the weedy types distributed in Japan were of Type III, it is argued that they were introduced as seeds in the imported grain. We also found that the Type II plants sporadically occurred in Japan. It is suggested that they originated as hybrids, with indigenous cultivars as the maternal ancestor. Such hybrids must have survived since the cessation of velvetleaf cultivation about a century ago.

Prevalence of pfhrp2 and/or pfhrp3 Gene Deletion in Plasmodium falciparum Population in Eight Highly Endemic States in India

PubMed Central

Bharti, Praveen Kumar; Chandel, Himanshu Singh; Ahmad, Amreen; Krishna, Sri; Udhayakumar, Venkatachalam; Singh, Neeru

2016-01-01

Background Plasmodium falciparum encoded histidine rich protein (HRP2) based malaria rapid diagnostic tests (RDTs) are used in India. Deletion of pfhrp2 and pfhrp3 genes contributes to false negative test results, and large numbers of such deletions have been reported from South America, highlighting the importance of surveillance to detect such deletions. Methods This is the first prospective field study carried out at 16 sites located in eight endemic states of India to assess the performance of PfHRP2 based RDT kits used in the national malaria control programme. In this study, microscopically confirmed P. falciparum but RDT negative samples were assessed for presence of pfhrp2, pfhrp3, and their flanking genes using PCR. Results Among 1521 microscopically positive P. falciparum samples screened, 50 were negative by HRP2 based RDT test. Molecular testing was carried out using these 50 RDT negative samples by assuming that 1471 RDT positive samples carried pfhrp2 gene. It was found that 2.4% (36/1521) and 1.8% (27/1521) of samples were negative for pfhrp2 and pfhrp3 genes, respectively. However, the frequency of pfhrp2 deletions varied between the sites ranging from 0–25% (2.4, 95% CI; 1.6–3.3). The frequency of both pfhrp2 and pfhrp3 gene deletion varied from 0–8% (1.6, 95% CI; 1.0–2.4). Conclusion This study provides evidence for low level presence of pfhrp2 and pfhrp3 deleted P. falciparum parasites in different endemic regions of India, and periodic surveillance is warranted for reliable use of PfHRP2 based RDTs. PMID:27518538

A Deletion of More than 800 kb Is the Most Recurrent Mutation in Chilean Patients with SHOX Gene Defects.

PubMed

Poggi, Helena; Vera, Alejandra; Avalos, Carolina; Lagos, Marcela; Mellado, Cecilia; Aracena, Mariana; Aravena, Teresa; Garcia, Hernan; Godoy, Claudia; Cattani, Andreina; Reyes, Loreto; Lacourt, Patricia; Rumie, Hana; Mericq, Veronica; Arriaza, Marta; Martinez-Aguayo, Alejandro

2015-01-01

Deletions in the SHOX gene are the most frequent genetic cause of Leri-Weill syndrome and Langer mesomelic dysplasia, which are also present in idiopathic short stature. To describe the molecular and clinical findings observed in 23 of 45 non-consanguineous Chilean patients with different phenotypes related to SHOX deficiency. Multiplex ligation-dependent probe amplification was used to detect the deletions; the SHOX coding region and deletion-flanking areas were sequenced to identify point mutations and single-nucleotide polymorphisms (SNPs). The main genetic defects identified in 21 patients consisted of deletions; one of them, a large deletion of >800 kb, was found in 8 patients. Also, a smaller deletion of >350 kb was observed in 4 patients. Although we could not precisely determine the deletion breakpoint, we were able to identify a common haplotype in 7 of the 8 patients with the larger deletion based on 22 informative SNPs. These results suggest that the large deletion-bearing allele has a common ancestor and was either introduced by European immigrants or had originated in our Amerindian population. This study allowed us to identify one recurrent deletion in Chilean patients; also, it contributed to expanding our knowledge about the genetic background of our population. © 2015 S. Karger AG, Basel.

Pheromones and Pheromone Receptors Are Required for Proper Sexual Development in the Homothallic Ascomycete Sordaria macrospora

PubMed Central

Mayrhofer, Severine; Weber, Jan M.; Pöggeler, Stefanie

2006-01-01

The homothallic, filamentous ascomycete Sordaria macrospora is self-fertile and produces sexual fruiting bodies (perithecia) without a mating partner. Even so, S. macrospora transcriptionally expresses two pheromone-precursor genes (ppg1 and ppg2) and two pheromone-receptor genes (pre1 and pre2). The proteins encoded by these genes are similar to α-factor-like and a-factor-like pheromones and to G-protein-coupled pheromone receptors of the yeast Saccharomyces cerevisiae. It has been suggested that in S. macrospora, PPG1/PRE2 and PPG2/PRE1 form two cognate pheromone–receptor pairs. To investigate their function, we deleted (Δ) pheromone-precursor genes (Δppg1, Δppg2) and receptor genes (Δpre1, Δpre2) and generated single- as well as double-knockout strains. No effect on vegetative growth, fruiting-body, and ascospore development was seen in the single pheromone-mutant and receptor-mutant strains, respectively. However, double-knockout strains lacking any compatible pheromone-receptor pair (Δpre2/Δppg2, Δpre1/Δppg1) and the double-pheromone mutant (Δppg1/Δppg2) displayed a drastically reduced number of perithecia and sexual spores, whereas deletion of both receptor genes (Δpre1/Δpre2) completely eliminated fruiting-body and ascospore formation. The results suggest that pheromones and pheromone receptors are required for optimal sexual reproduction of the homothallic S. macrospora. PMID:16387884

Pheromones and pheromone receptors are required for proper sexual development in the homothallic ascomycete Sordaria macrospora.

PubMed

Mayrhofer, Severine; Weber, Jan M; Pöggeler, Stefanie

2006-03-01

The homothallic, filamentous ascomycete Sordaria macrospora is self-fertile and produces sexual fruiting bodies (perithecia) without a mating partner. Even so, S. macrospora transcriptionally expresses two pheromone-precursor genes (ppg1 and ppg2) and two pheromone-receptor genes (pre1 and pre2). The proteins encoded by these genes are similar to alpha-factor-like and a-factor-like pheromones and to G-protein-coupled pheromone receptors of the yeast Saccharomyces cerevisiae. It has been suggested that in S. macrospora, PPG1/PRE2 and PPG2/PRE1 form two cognate pheromone-receptor pairs. To investigate their function, we deleted (delta) pheromone-precursor genes (delta ppg1, delta ppg2) and receptor genes (delta pre1, delta pre2) and generated single- as well as double-knockout strains. No effect on vegetative growth, fruiting-body, and ascospore development was seen in the single pheromone-mutant and receptor-mutant strains, respectively. However, double-knockout strains lacking any compatible pheromone-receptor pair (delta pre2/delta ppg2, delta pre1/delta ppg1) and the double-pheromone mutant (delta ppg1/delta ppg2) displayed a drastically reduced number of perithecia and sexual spores, whereas deletion of both receptor genes (delta pre1/delta pre2) completely eliminated fruiting-body and ascospore formation. The results suggest that pheromones and pheromone receptors are required for optimal sexual reproduction of the homothallic S. macrospora.

Bovine papilloma virus contains an activator of gene expression at the distal end of the early transcription unit.

PubMed Central

Lusky, M; Berg, L; Weiher, H; Botchan, M

1983-01-01

Bovine papilloma virus (BPV) contains a cis-acting DNA element which can enhance transcription of distal promoters. Utilizing both direct and indirect transient transfection assays, we showed that a 59-base-pair DNA sequence from the BPV genome could activate the simian virus 40 promoter from distances exceeding 2.5 kilobases and in an orientation-independent manner. In contrast to the promoter 5'-proximal localization of other known viral activators, this element was located immediately 3' to the early polyadenylation signal in the BPV genome. Deletion of these sequences from the BPV genome inactivated the transforming ability of BPV recombinant plasmids. Orientation-independent reinsertion of this 59-base-pair sequence, or alternatively of activator DNA sequences from simian virus 40 or polyoma virus, restored the transforming activity of the BPV recombinant plasmids. Furthermore, the stable transformation frequency of the herpes simplex virus type 1 thymidine kinase gene was enhanced when linked to restriction fragments of BPV DNA which included the defined activator element. This enhancement was orientation independent with respect to the thymidine kinase promoter. The enhancement also appeared to be unrelated to the establishment of the recombinant plasmids as episomes, since in transformed cells these sequences are found linked to high-molecular-weight DNA. We propose that the enhancement of stable transformation frequencies and the activation of transcription units are in this case alternate manifestations of the same biochemical events. Images PMID:6308425

Identification of somatic mutations in cancer through Bayesian-based analysis of sequenced genome pairs

PubMed Central

2013-01-01

Background The field of cancer genomics has rapidly adopted next-generation sequencing (NGS) in order to study and characterize malignant tumors with unprecedented resolution. In particular for cancer, one is often trying to identify somatic mutations – changes specific to a tumor and not within an individual’s germline. However, false positive and false negative detections often result from lack of sufficient variant evidence, contamination of the biopsy by stromal tissue, sequencing errors, and the erroneous classification of germline variation as tumor-specific. Results We have developed a generalized Bayesian analysis framework for matched tumor/normal samples with the purpose of identifying tumor-specific alterations such as single nucleotide mutations, small insertions/deletions, and structural variation. We describe our methodology, and discuss its application to other types of paired-tissue analysis such as the detection of loss of heterozygosity as well as allelic imbalance. We also demonstrate the high level of sensitivity and specificity in discovering simulated somatic mutations, for various combinations of a) genomic coverage and b) emulated heterogeneity. Conclusion We present a Java-based implementation of our methods named Seurat, which is made available for free academic use. We have demonstrated and reported on the discovery of different types of somatic change by applying Seurat to an experimentally-derived cancer dataset using our methods; and have discussed considerations and practices regarding the accurate detection of somatic events in cancer genomes. Seurat is available at https://sites.google.com/site/seuratsomatic. PMID:23642077

Identification of somatic mutations in cancer through Bayesian-based analysis of sequenced genome pairs.

PubMed

Christoforides, Alexis; Carpten, John D; Weiss, Glen J; Demeure, Michael J; Von Hoff, Daniel D; Craig, David W

2013-05-04

The field of cancer genomics has rapidly adopted next-generation sequencing (NGS) in order to study and characterize malignant tumors with unprecedented resolution. In particular for cancer, one is often trying to identify somatic mutations--changes specific to a tumor and not within an individual's germline. However, false positive and false negative detections often result from lack of sufficient variant evidence, contamination of the biopsy by stromal tissue, sequencing errors, and the erroneous classification of germline variation as tumor-specific. We have developed a generalized Bayesian analysis framework for matched tumor/normal samples with the purpose of identifying tumor-specific alterations such as single nucleotide mutations, small insertions/deletions, and structural variation. We describe our methodology, and discuss its application to other types of paired-tissue analysis such as the detection of loss of heterozygosity as well as allelic imbalance. We also demonstrate the high level of sensitivity and specificity in discovering simulated somatic mutations, for various combinations of a) genomic coverage and b) emulated heterogeneity. We present a Java-based implementation of our methods named Seurat, which is made available for free academic use. We have demonstrated and reported on the discovery of different types of somatic change by applying Seurat to an experimentally-derived cancer dataset using our methods; and have discussed considerations and practices regarding the accurate detection of somatic events in cancer genomes. Seurat is available at https://sites.google.com/site/seuratsomatic.

A Partial E3 Deletion in Replication-Defective Adenoviral Vectors Allows for Stable Expression of Potentially Toxic Transgene Products.

PubMed

Haut, Larissa H; Gill, Amanda L; Kurupati, Raj K; Bian, Ang; Li, Yan; Giles-Davis, Wynetta; Xiang, Zhiquan; Zhou, Xiang Yang; Ertl, Hildegund C J

2016-10-01

Adenovirus (Ad) is used extensively for construction of viral vectors, most commonly with deletion in its E1 and/or E3 genomic regions. Previously, our attempts to insert envelope proteins (Env) of HIV-1 into such vectors based on chimpanzee-derived Ad (AdC) viruses were thwarted. Here, we describe that genetic instability of an E1- and E3-deleted AdC vector of serotype C6 expressing Env of HIV-1 can be overcome by reinsertion of E3 sequences with anti-apoptotic activities. This partial E3 deletion presumably delays premature death of HEK-293 packaging cell lines due to Env-induced cell apoptosis. The same partial E3 deletion also allows for the generation of stable glycoprotein 140 (gp140)- and gp160-expressing Ad vectors based on AdC7, a distinct AdC serotype. Env-expressing AdC vectors containing the partial E3 deletion are genetically stable upon serial cell culture passaging, produce yields comparable to those of other AdC vectors, and induce transgene product-specific antibody responses in mice. A partial E3 deletion thereby allows expansion of the repertoire of transgenes that can be expressed by Ad vectors.

A Physical Map, Including a BAC/PAC Clone Contig, of the Williams-Beuren Syndrome–Deletion Region at 7q11.23

PubMed Central

Peoples, Risa; Franke, Yvonne; Wang, Yu-Ker; Pérez-Jurado, Luis; Paperna, Tamar; Cisco, Michael; Francke, Uta

2000-01-01

Summary Williams-Beuren syndrome (WBS) is a developmental disorder caused by haploinsufficiency for genes in a 2-cM region of chromosome band 7q11.23. With the exception of vascular stenoses due to deletion of the elastin gene, the various features of WBS have not yet been attributed to specific genes. Although ⩾16 genes have been identified within the WBS deletion, completion of a physical map of the region has been difficult because of the large duplicated regions flanking the deletion. We present a physical map of the WBS deletion and flanking regions, based on assembly of a bacterial artificial chromosome/P1-derived artificial chromosome contig, analysis of high-throughput genome-sequence data, and long-range restriction mapping of genomic and cloned DNA by pulsed-field gel electrophoresis. Our map encompasses 3 Mb, including 1.6 Mb within the deletion. Two large duplicons, flanking the deletion, of ⩾320 kb contain unique sequence elements from the internal border regions of the deletion, such as sequences from GTF2I (telomeric) and FKBP6 (centromeric). A third copy of this duplicon exists in inverted orientation distal to the telomeric flanking one. These duplicons show stronger sequence conservation with regard to each other than to the presumptive ancestral loci within the common deletion region. Sequence elements originating from beyond 7q11.23 are also present in these duplicons. Although the duplicons are not present in mice, the order of the single-copy genes in the conserved syntenic region of mouse chromosome 5 is inverted relative to the human map. A model is presented for a mechanism of WBS-deletion formation, based on the orientation of duplicons' components relative to each other and to the ancestral elements within the deletion region. PMID:10631136

Characterization of hemizygous deletions in Citrus using array-Comparative Genomic Hybridization and microsynteny comparisons with the poplar genome

PubMed Central

Ríos, Gabino; Naranjo, Miguel A; Iglesias, Domingo J; Ruiz-Rivero, Omar; Geraud, Marion; Usach, Antonio; Talón, Manuel

2008-01-01

Background Many fruit-tree species, including relevant Citrus spp varieties exhibit a reproductive biology that impairs breeding and strongly constrains genetic improvements. In citrus, juvenility increases the generation time while sexual sterility, inbreeding depression and self-incompatibility prevent the production of homozygous cultivars. Genomic technology may provide citrus researchers with a new set of tools to address these various restrictions. In this work, we report a valuable genomics-based protocol for the structural analysis of deletion mutations on an heterozygous background. Results Two independent fast neutron mutants of self-incompatible clementine (Citrus clementina Hort. Ex Tan. cv. Clemenules) were the subject of the study. Both mutants, named 39B3 and 39E7, were expected to carry DNA deletions in hemizygous dosage. Array-based Comparative Genomic Hybridization (array-CGH) using a Citrus cDNA microarray allowed the identification of underrepresented genes in these two mutants. Subsequent comparison of citrus deleted genes with annotated plant genomes, especially poplar, made possible to predict the presence of a large deletion in 39B3 of about 700 kb and at least two deletions of approximately 100 and 500 kb in 39E7. The deletion in 39B3 was further characterized by PCR on available Citrus BACs, which helped us to build a partial physical map of the deletion. Among the deleted genes, ClpC-like gene coding for a putative subunit of a multifunctional chloroplastic protease involved in the regulation of chlorophyll b synthesis was directly related to the mutated phenotype since the mutant showed a reduced chlorophyll a/b ratio in green tissues. Conclusion In this work, we report the use of array-CGH for the successful identification of genes included in a hemizygous deletion induced by fast neutron irradiation on Citrus clementina. The study of gene content and order into the 39B3 deletion also led to the unexpected conclusion that microsynteny and local gene colinearity in this species were higher with Populus trichocarpa than with the phylogenetically closer Arabidopsis thaliana. This work corroborates the potential of Citrus genomic resources to assist mutagenesis-based approaches for functional genetics, structural studies and comparative genomics, and hence to facilitate citrus variety improvement. PMID:18691431

Altered Striatal Synaptic Function and Abnormal Behaviour in Shank3 Exon4-9 Deletion Mouse Model of Autism.

PubMed

Jaramillo, Thomas C; Speed, Haley E; Xuan, Zhong; Reimers, Jeremy M; Liu, Shunan; Powell, Craig M

2016-03-01

Shank3 is a multi-domain, synaptic scaffolding protein that organizes proteins in the postsynaptic density of excitatory synapses. Clinical studies suggest that ∼ 0.5% of autism spectrum disorder (ASD) cases may involve SHANK3 mutation/deletion. Patients with SHANK3 mutations exhibit deficits in cognition along with delayed/impaired speech/language and repetitive and obsessive/compulsive-like (OCD-like) behaviors. To examine how mutation/deletion of SHANK3 might alter brain function leading to ASD, we have independently created mice with deletion of Shank3 exons 4-9, a region implicated in ASD patients. We find that homozygous deletion of exons 4-9 (Shank3(e4-9) KO) results in loss of the two highest molecular weight isoforms of Shank3 and a significant reduction in other isoforms. Behaviorally, both Shank3(e4-9) heterozygous (HET) and Shank3(e4-9) KO mice display increased repetitive grooming, deficits in novel and spatial object recognition learning and memory, and abnormal ultrasonic vocalizations. Shank3(e4-9) KO mice also display abnormal social interaction when paired with one another. Analysis of synaptosome fractions from striata of Shank3(e4-9) KO mice reveals decreased Homer1b/c, GluA2, and GluA3 expression. Both Shank3(e4-9) HET and KO demonstrated a significant reduction in NMDA/AMPA ratio at excitatory synapses onto striatal medium spiny neurons. Furthermore, Shank3(e4-9) KO mice displayed reduced hippocampal LTP despite normal baseline synaptic transmission. Collectively these behavioral, biochemical and physiological changes suggest Shank3 isoforms have region-specific roles in regulation of AMPAR subunit localization and NMDAR function in the Shank3(e4-9) mutant mouse model of autism. © 2015 International Society for Autism Research, Wiley Periodicals, Inc.

Parental origin impairment of synaptic functions and behaviors in cytoplasmic FMRP interacting protein 1 (Cyfip1) deficient mice.

PubMed

Chung, Leeyup; Wang, Xiaoming; Zhu, Li; Towers, Aaron J; Cao, Xinyu; Kim, Il Hwan; Jiang, Yong-hui

2015-12-10

CYFIP1 maps to the interval between proximal breakpoint 1 (BP1) and breakpoint 2 (BP2) of chromosomal 15q11-q13 deletions that are implicated in the Angelman (AS) and Prader-Willi syndrome (PWS). There is only one breakpoint (BP3) at the distal end of deletion. CYFIP1 is deleted in AS patients with the larger class I deletion (BP1 to BP3) and the neurological presentations in these patients are more severe than that of patients with class II (BP2 to BP3) deletion. The haploinsufficiency of CYFIP1 is hypothesized to contribute to more severe clinical presentations in class I AS patients. The expression of CYFIP1 is suggested to be bi-allelic in literature but the possibility of parental origin of expression is not completely excluded. We generated and characterized Cyfip1 mutant mice. Homozygous Cyfip1 mice were early embryonic lethal. However, there was a parental origin specific effect between paternal Cyfip1 deficiency (m+/p-) and maternal deficiency (m-/p+) on both synaptic transmissions and behaviors in hippocampal CA1 synapses despite no evidence supporting the parental origin difference for the expression. Both m-/p+ and m+/p- showed the impaired input-output response and paired-pulse facilitation. While the long term-potentiation and group I mGluR mediated long term depression induced by DHPG was not different between Cyfip1 m-/p+ and m+/p- mice, the initial DHPG induced response was significantly enhanced in m-/p+ but not in m+/p- mice. m+/p- but not m-/p+ mice displayed increased freezing in cued fear conditioning and abnormal transitions in zero-maze test. The impaired synaptic transmission and behaviors in haploinsufficiency of Cyfip1 mice provide the evidence supporting the role of CYFIP1 modifying the clinical presentation of class I AS patients and in human neuropsychiatric disorders. Copyright © 2015 Elsevier B.V. All rights reserved.

Design and Validation of a New MLPA-Based Assay for the Detection of RS1 Gene Deletions and Application in a Large Family with X-Linked Juvenile Retinoschisis.

PubMed

Nicoletti, Annalisa; Ziccardi, Lucia; Maltese, Paolo Enrico; Benedetti, Sabrina; Palumbo, Orazio; Rendina, Michelina; D'Agruma, Leonardo; Falsini, Benedetto; Wang, Xinjing; Bertelli, Matteo

2017-02-01

X-linked juvenile retinoschisis (XLRS) is a severe ocular disorder that can evolve to blindness. More than 200 different disease-causing mutations have been reported in the RS1 gene and approximately 10% of these are deletions. Since transmission is X-linked, males are always affected and females are usually carriers. The identification of female carriers is always important and poses a technical challenge. Therefore, we sought to develop a multiplex ligation dependent probe amplification (MLPA)-based method to identify deletions or duplications in this gene. We then used our assay to study a large XLRS family. We designed six probes specific for each RS1 exon and then optimized and validated our method using control samples with known gene deletions. In the XLRS family, RS1 gene copy number variation was assessed by "home-made" MLPA analysis and by single nucleotide polymorphism (SNP) array analysis using the CytoScan HD Array. Direct sequencing was used for deletion breakpoint mapping. Our assay detected all deletions in control samples. All affected males of the family were positive for a deletion of exon 2 of the RS1 gene (RS1:NM_000330:c.53-?_78+?del). Carrier females were also identified. Our method is easily replicated, reliable, and inexpensive and allows female carriers to be detected. This is the first report of deep characterization of a whole exon deletion in the RS1 gene.

Structural and Functional Analysis of Sulfolobus solfataricus Y-Family DNA Polymerase Dpo4-Catalyzed Bypass of the Malondialdehyde−Deoxyguanosine Adduct

DOE Office of Scientific and Technical Information (OSTI.GOV)

Eoff, Robert L.; Stafford, Jennifer B.; Szekely, Jozsef

2010-01-12

Oxidative stress can induce the formation of reactive electrophiles, such as DNA peroxidation products, e.g., base propenals, and lipid peroxidation products, e.g., malondialdehyde. Base propenals and malondialdehyde react with DNA to form adducts, including 3-(2'-deoxy-{beta}-d-erythro-pentofuranosyl)pyrimido[1,2-{alpha}]purin-10(3H)-one (M{sub 1}dG). When paired opposite cytosine in duplex DNA at physiological pH, M{sub 1}dG undergoes ring opening to form N{sup 2}-(3-oxo-1-propenyl)-dG (N{sup 2}-OPdG). Previous work has shown that M{sub 1}dG is mutagenic in bacteria and mammalian cells and that its mutagenicity in Escherichia coli is dependent on induction of the SOS response, indicating a role for translesion DNA polymerases in the bypass of M{sub 1}dG.more » To probe the mechanism by which translesion polymerases bypass M{sub 1}dG, kinetic and structural studies were conducted with a model Y-family DNA polymerase, Dpo4 from Sulfolobus solfataricus. The level of steady-state incorporation of dNTPs opposite M{sub 1}dG was reduced 260-2900-fold and exhibited a preference for dATP incorporation. Liquid chromatography-tandem mass spectrometry analysis of the full-length extension products revealed a spectrum of products arising principally by incorporation of dC or dA opposite M{sub 1}dG followed by partial or full-length extension. A greater proportion of -1 deletions were observed when dT was positioned 5' of M{sub 1}dG. Two crystal structures were determined, including a 'type II' frameshift deletion complex and another complex with Dpo4 bound to a dC-M{sub 1}dG pair located in the postinsertion context. Importantly, M{sub 1}dG was in the ring-closed state in both structures, and in the structure with dC opposite M{sub 1}dG, the dC residue moved out of the Dpo4 active site, into the minor groove. The results are consistent with the reported mutagenicity of M{sub 1}dG and illustrate how the lesion may affect replication events.« less

Haploinsufficiency of CELF4 at 18q12.2 is associated with developmental and behavioral disorders, seizures, eye manifestations, and obesity

PubMed Central

Halgren, Christina; Bache, Iben; Bak, Mads; Myatt, Mikkel Wanting; Anderson, Claire Marie; Brøndum-Nielsen, Karen; Tommerup, Niels

2012-01-01

Only 20 patients with deletions of 18q12.2 have been reported in the literature and the associated phenotype includes borderline intellectual disability, behavioral problems, seizures, obesity, and eye manifestations. Here, we report a male patient with a de novo translocation involving chromosomes 12 and 18, with borderline IQ, developmental and behavioral disorders, myopia, obesity, and febrile seizures in childhood. We characterized the rearrangement with Affymetrix SNP 6.0 Array analysis and next-generation mate pair sequencing and found truncation of CELF4 at 18q12.2. This second report of a patient with a neurodevelopmental phenotype and a translocation involving CELF4 supports that CELF4 is responsible for the phenotype associated with deletion of 18q12.2. Our study illustrates the utility of high-resolution genome-wide techniques in identifying neurodevelopmental and neurobehavioral genes, and it adds to the growing evidence, including a transgenic mouse model, that CELF4 is important for human brain development. PMID:22617346

CCCTC-Binding Factor Acts as a Heterochromatin Barrier on Herpes Simplex Viral Latent Chromatin and Contributes to Poised Latent Infection

PubMed Central

2018-01-01

ABSTRACT Herpes simplex virus 1 (HSV-1) establishes latent infection in neurons via a variety of epigenetic mechanisms that silence its genome. The cellular CCCTC-binding factor (CTCF) functions as a mediator of transcriptional control and chromatin organization and has binding sites in the HSV-1 genome. We constructed an HSV-1 deletion mutant that lacked a pair of CTCF-binding sites (CTRL2) within the latency-associated transcript (LAT) coding sequences and found that loss of these CTCF-binding sites did not alter lytic replication or levels of establishment of latent infection, but their deletion reduced the ability of the virus to reactivate from latent infection. We also observed increased heterochromatin modifications on viral chromatin over the LAT promoter and intron. We therefore propose that CTCF binding at the CTRL2 sites acts as a chromatin insulator to keep viral chromatin in a form that is poised for reactivation, a state which we call poised latency. PMID:29437926

Genomic aberrations in borderline ovarian tumors

PubMed Central

2010-01-01

Background According to the scientific literature, less than 30 borderline ovarian tumors have been karyotyped and less than 100 analyzed for genomic imbalances by CGH. Methods We report a series of borderline ovarian tumors (n = 23) analyzed by G-banding and karyotyping as well as high resolution CGH; in addition, the tumors were analyzed for microsatellite stability status and by FISH for possible 6q deletion. Results All informative tumors were microsatellite stable and none had a deletion in 6q27. All cases with an abnormal karyotype had simple chromosomal aberrations with +7 and +12 as the most common. In three tumors with single structural rearrangements, a common breakpoint in 3q13 was detected. The major copy number changes detected in the borderline tumors were gains from chromosome arms 2q, 6q, 8q, 9p, and 13q and losses from 1p, 12q, 14q, 15q, 16p, 17p, 17q, 19p, 19q, and 22q. The series included five pairs of bilateral tumors and, in two of these pairs, informative data were obtained as to their clonal relationship. In both pairs, similarities were found between the tumors from the right and left side, strongly indicating that bilaterality had occurred via a metastatic process. The bilateral tumors as a group showed more aberrations than did the unilateral ones, consistent with the view that bilaterality is a sign of more advanced disease. Conclusion Because some of the imbalances found in borderline ovarian tumors seem to be similar to imbalances already known from the more extensively studied overt ovarian carcinomas, we speculate that the subset of borderline tumors with detectable imbalances or karyotypic aberrations may contain a smaller subset of tumors with a tendency to develop a more malignant phenotype. The group of borderline tumors with no imbalances would, in this line of thinking, have less or no propensity for clonal evolution and development to full-blown carcinomas. PMID:20184781

Genome-wide comparative analysis of NBS-encoding genes between Brassica species and Arabidopsis thaliana.

PubMed

Yu, Jingyin; Tehrim, Sadia; Zhang, Fengqi; Tong, Chaobo; Huang, Junyan; Cheng, Xiaohui; Dong, Caihua; Zhou, Yanqiu; Qin, Rui; Hua, Wei; Liu, Shengyi

2014-01-03

Plant disease resistance (R) genes with the nucleotide binding site (NBS) play an important role in offering resistance to pathogens. The availability of complete genome sequences of Brassica oleracea and Brassica rapa provides an important opportunity for researchers to identify and characterize NBS-encoding R genes in Brassica species and to compare with analogues in Arabidopsis thaliana based on a comparative genomics approach. However, little is known about the evolutionary fate of NBS-encoding genes in the Brassica lineage after split from A. thaliana. Here we present genome-wide analysis of NBS-encoding genes in B. oleracea, B. rapa and A. thaliana. Through the employment of HMM search and manual curation, we identified 157, 206 and 167 NBS-encoding genes in B. oleracea, B. rapa and A. thaliana genomes, respectively. Phylogenetic analysis among 3 species classified NBS-encoding genes into 6 subgroups. Tandem duplication and whole genome triplication (WGT) analyses revealed that after WGT of the Brassica ancestor, NBS-encoding homologous gene pairs on triplicated regions in Brassica ancestor were deleted or lost quickly, but NBS-encoding genes in Brassica species experienced species-specific gene amplification by tandem duplication after divergence of B. rapa and B. oleracea. Expression profiling of NBS-encoding orthologous gene pairs indicated the differential expression pattern of retained orthologous gene copies in B. oleracea and B. rapa. Furthermore, evolutionary analysis of CNL type NBS-encoding orthologous gene pairs among 3 species suggested that orthologous genes in B. rapa species have undergone stronger negative selection than those in B .oleracea species. But for TNL type, there are no significant differences in the orthologous gene pairs between the two species. This study is first identification and characterization of NBS-encoding genes in B. rapa and B. oleracea based on whole genome sequences. Through tandem duplication and whole genome triplication analysis in B. oleracea, B. rapa and A. thaliana genomes, our study provides insight into the evolutionary history of NBS-encoding genes after divergence of A. thaliana and the Brassica lineage. These results together with expression pattern analysis of NBS-encoding orthologous genes provide useful resource for functional characterization of these genes and genetic improvement of relevant crops.

Cotargeting the lncRNA-PIP3 Interaction and AKT/PI3K Signaling Axis: A Novel Paradigm for Treating Triple-Negative Breast Cancer

DTIC Science & Technology

2017-10-01

Model Core Facility at MD Anderson has generated a genomic deletion of LINK-A using CRISPR /Cas9 technology based on collaboration. The single...Generation of LINK-A deletion mutant using CRISPR /Cas9 technology. A, Illustration of genomic deletion region of LINK-A (Chr1: 238644075-238644134

Genetic diversity of Plasmodium falciparum histidine-rich protein 2 in the China-Myanmar border area

PubMed Central

Li, Peipei; Xing, Hua; Zhao, Zhenjun; Yang, Zhaoqing; Cao, Yaming; Yan, Guiyun; Sattabongkot, Jetsumon; Cui, Liwang; Fan, Qi

2016-01-01

Deletion of the Plasmodium falciparum histidine-rich protein 2 (pfhrp2) gene may affect the performance of PfHRP2-based rapid diagnostic tests (RDTs). Here we investigated the genetic diversity of the pfhrp2 gene in clinical parasite isolates collected in recent years from the China-Myanmar border area. Deletion of pfhrp2 has been identified in 4 out of 97 parasite isolates. Sequencing of the pfhrp2 exon 2 from 67 isolates revealed a high level of genetic diversity in pfhrp2, which is reflected in the presence of many repeat types and their variants, as well as variable copy numbers and different arrangements of these repeats in parasite isolates. In addition, we observed pfhrp3 deletion in three of the four parasites harboring pfhrp2 deletion, suggesting of double deletions of both genes in these three isolates. Analysis of two cases, which were P. falciparum-positive by microscopy and PCR but failed by two PfHRP2-based RDTs, did not find pfhrp2 deletion. Further correlational studies of pfhrp2 polymorphisms with detection sensitivity are needed to identify factors influencing the performance of RDTs in malaria-endemic areas. PMID:26297799

Molecular Population Genetics of the Alcohol Dehydrogenase Gene Region of DROSOPHILA MELANOGASTER

PubMed Central

Aquadro, Charles F.; Desse, Susan F.; Bland, Molly M.; Langley, Charles H.; Laurie-Ahlberg, Cathy C.

1986-01-01

Variation in the DNA restriction map of a 13-kb region of chromosome II including the alcohol dehydrogenase structural gene (Adh) was examined in Drosophila melanogaster from natural populations. Detailed analysis of 48 D. melanogaster lines representing four eastern United States populations revealed extensive DNA sequence variation due to base substitutions, insertions and deletions. Cloning of this region from several lines allowed characterization of length variation as due to unique sequence insertions or deletions [nine sizes; 21–200 base pairs (bp)] or transposable element insertions (several sizes, 340 bp to 10.2 kb, representing four different elements). Despite this extensive variation in sequences flanking the Adh gene, only one length polymorphism is clearly associated with altered Adh expression (a copia element approximately 250 bp 5' to the distal transcript start site). Nonetheless, the frequency spectra of transposable elements within and between Drosophila species suggests they are slightly deleterious. Strong nonrandom associations are observed among Adh region sequence variants, ADH allozyme (Fast vs. Slow), ADH enzyme activity and the chromosome inversion ln(2L) t. Phylogenetic analysis of restriction map haplotypes suggest that the major twofold component of ADH activity variation (high vs. low, typical of Fast and Slow allozymes, respectively) is due to sequence variation tightly linked to and possibly distinct from that underlying the allozyme difference. The patterns of nucleotide and haplotype variation for Fast and Slow allozyme lines are consistent with the recent increase in frequency and spread of the Fast haplotype associated with high ADH activity. These data emphasize the important role of evolutionary history and strong nonrandom associations among tightly linked sequence variation as determinants of the patterns of variation observed in natural populations. PMID:3026893

Basal exon skipping and nonsense-associated altered splicing allows bypassing complete CEP290 loss-of-function in individuals with unusually mild retinal disease.

PubMed

Barny, Iris; Perrault, Isabelle; Michel, Christel; Soussan, Mickael; Goudin, Nicolas; Rio, Marlène; Thomas, Sophie; Attié-Bitach, Tania; Hamel, Christian; Dollfus, Hélène; Kaplan, Josseline; Rozet, Jean-Michel; Gerard, Xavier

2018-05-16

CEP290 mutations cause a spectrum of ciliopathies from Leber congenital amaurosis type 10 (LCA10) to embryo-lethal Meckel syndrome (MKS). Using panel-based molecular diagnosis testing for inherited retinal diseases, we identified two individuals with some preserved vision despite biallelism for presumably truncating CEP290 mutations. The first one carried a homozygous 1 base-pair deletion in exon 17, introducing a premature termination codon (PTC) in exon 18 (c.1666del; p.Ile556Phefs*17). mRNA analysis revealed a basal exon skipping (BES) of exon 18, providing mutant cells with the ability to escape protein truncation, while disrupting the reading frame in controls. The second individual harbored compound heterozygous nonsense mutations in exon 8 (c.508A>T, p.Lys170*) and exon 32 (c.4090G>T, p.Glu1364*), respectively. Some CEP290 lacking exon 8 were detected in mutant fibroblasts but not in controls whereas some skipping of exon 32 occurred in both lines, but with higher amplitude in the mutant. Considering that the deletion of either exon maintains the reading frame in either line, skipping in mutant cells likely involves nonsense-associated altered splicing (NAS) alone (exon 8), or with BES (exon 32). Skipping of PTC-containing exons in mutant cells allowed production of CEP290 isoforms with preserved ability to assemble into a high molecular weight complex and to interact efficiently with proteins important for cilia formation and intraflagellar trafficking. In contrast, studying LCA10 and MKS fibroblasts we show moderate to severe cilia alterations, providing support for a correlation between disease severity and the ability of cells to express shortened, yet functional, CEP290 isoforms.

A novel KCNQ4 one-base deletion in a large pedigree with hearing loss: implication for the genotype-phenotype correlation.

PubMed

Kamada, Fumiaki; Kure, Shigeo; Kudo, Takayuki; Suzuki, Yoichi; Oshima, Takeshi; Ichinohe, Akiko; Kojima, Kanako; Niihori, Tetsuya; Kanno, Junko; Narumi, Yoko; Narisawa, Ayumi; Kato, Kumi; Aoki, Yoko; Ikeda, Katsuhisa; Kobayashi, Toshimitsu; Matsubara, Yoichi

2006-01-01

Autosomal-dominant, nonsyndromic hearing impairment is clinically and genetically heterogeneous. We encountered a large Japanese pedigree in which nonsyndromic hearing loss was inherited in an autosomal-dominant fashion. A genome-wide linkage study indicated linkage to the DFNA2 locus on chromosome 1p34. Mutational analysis of KCNQ4 encoding a potassium channel revealed a novel one-base deletion in exon 1, c.211delC, which generated a profoundly truncated protein without transmembrane domains (p.Q71fsX138). Previously, six missense mutations and one 13-base deletion, c.211_223del, had been reported in KCNQ4. Patients with the KCNQ4 missense mutations had younger-onset and more profound hearing loss than patients with the 211_223del mutation. In our current study, 12 individuals with the c.211delC mutation manifested late-onset and pure high-frequency hearing loss. Our results support the genotype-phenotype correlation that the KCNQ4 deletions are associated with later-onset and milder hearing impairment than the missense mutations. The phenotypic difference may be caused by the difference in pathogenic mechanisms: haploinsufficiency in deletions and dominant-negative effect in missense mutations.

Low X/Y divergence in four pairs of papaya sex-linked genes.

PubMed

Yu, Qingyi; Hou, Shaobin; Feltus, F Alex; Jones, Meghan R; Murray, Jan E; Veatch, Olivia; Lemke, Cornelia; Saw, Jimmy H; Moore, Richard C; Thimmapuram, Jyothi; Liu, Lei; Moore, Paul H; Alam, Maqsudul; Jiang, Jiming; Paterson, Andrew H; Ming, Ray

2008-01-01

Sex chromosomes in flowering plants, in contrast to those in animals, evolved relatively recently and only a few are heteromorphic. The homomorphic sex chromosomes of papaya show features of incipient sex chromosome evolution. We investigated the features of paired X- and Y-specific bacterial artificial chromosomes (BACs), and estimated the time of divergence in four pairs of sex-linked genes. We report the results of a comparative analysis of long contiguous genomic DNA sequences between the X and hermaphrodite Y (Y(h)) chromosomes. Numerous chromosomal rearrangements were detected in the male-specific region of the Y chromosome (MSY), including inversions, deletions, insertions, duplications and translocations, showing the dynamic evolutionary process on the MSY after recombination ceased. DNA sequence expansion was documented in the two regions of the MSY, demonstrating that the cytologically homomorphic sex chromosomes are heteromorphic at the molecular level. Analysis of sequence divergence between four X and Y(h) gene pairs resulted in a estimated age of divergence of between 0.5 and 2.2 million years, supporting a recent origin of the papaya sex chromosomes. Our findings indicate that sex chromosomes did not evolve at the family level in Caricaceae, and reinforce the theory that sex chromosomes evolve at the species level in some lineages.

Dual gene activation and knockout screen reveals directional dependencies in genetic networks. | Office of Cancer Genomics

Cancer.gov

Understanding the direction of information flow is essential for characterizing how genetic networks affect phenotypes. However, methods to find genetic interactions largely fail to reveal directional dependencies. We combine two orthogonal Cas9 proteins from Streptococcus pyogenes and Staphylococcus aureus to carry out a dual screen in which one gene is activated while a second gene is deleted in the same cell. We analyze the quantitative effects of activation and knockout to calculate genetic interaction and directionality scores for each gene pair.

Synergistic mixtures for control of slime-forming bacteria and other delete rious micro-organisms and processes using same

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tant, C.O.; Turner, N.E.; Bennett, E.O.

1969-09-30

Microbiocide compositions are described having a synergistic biocide effect on microorganisms, such as slime- forming bateria and other microorganisms considered to be deleterious or troublesome in water and especially in waterflooding operations, such as are used in the secondary recovery of petroleum oil in subterranean formations. The synergistic compositions consist of paired or multiple combinations of at least one of each of (1) compounds having furan, dihydrofuran or tetrahydrofuran nuclei, and (2) compounds having phenol nuclei or chloroanilines. (17 claims)

Enhanced brainstem and cortical evoked response amplitudes: single-trial covariance analysis.

PubMed

Galbraith, G C

2001-06-01

The purpose of the present study was to develop analytic procedures that improve the definition of sensory evoked response components. Such procedures could benefit all recordings but would especially benefit difficult recordings where many trials are contaminated by muscle and movement artifacts. First, cross-correlation and latency adjustment analyses were applied to the human brainstem frequency-following response and cortical auditory evoked response recorded on the same trials. Lagged cross-correlation functions were computed, for each of 17 subjects, between single-trial data and templates consisting of the sinusoid stimulus waveform for the brainstem response and the subject's own smoothed averaged evoked response P2 component for the cortical response. Trials were considered in the analysis only if the maximum correlation-squared (r2) exceeded .5 (negatively correlated trials were thus included). Identical correlation coefficients may be based on signals with quite different amplitudes, but it is possible to assess amplitude by the nonnormalized covariance function. Next, an algorithm is applied in which each trial with negative covariance is matched to a trial with similar, but positive, covariance and these matched-trial pairs are deleted. When an evoked response signal is present in the data, the majority of trials positively correlate with the template. Thus, a residual of positively correlated trials remains after matched covariance trials are deleted. When these residual trials are averaged, the resulting brainstem and cortical responses show greatly enhanced amplitudes. This result supports the utility of this analysis technique in clarifying and assessing evoked response signals.

The lavender plumage colour in Japanese quail is associated with a complex mutation in the region of MLPH that is related to differences in growth, feed consumption and body temperature

PubMed Central

2012-01-01

Background The lavender phenotype in quail is a dilution of both eumelanin and phaeomelanin in feathers that produces a blue-grey colour on a wild-type feather pattern background. It has been previously demonstrated by intergeneric hybridization that the lavender mutation in quail is homologous to the same phenotype in chicken, which is caused by a single base-pair change in exon 1 of MLPH. Results In this study, we have shown that a mutation of MLPH is also associated with feather colour dilution in quail, but that the mutational event is extremely different. In this species, the lavender phenotype is associated with a non-lethal complex mutation involving three consecutive overlapping chromosomal changes (two inversions and one deletion) that have consequences on the genomic organization of four genes (MLPH and the neighbouring PRLH, RAB17 and LRRFIP1). The deletion of PRLH has no effect on the level of circulating prolactin. Lavender birds have lighter body weight, lower body temperature and increased feed consumption and residual feed intake than wild-type plumage quail, indicating that this complex mutation is affecting the metabolism and the regulation of homeothermy. Conclusions An extensive overlapping chromosome rearrangement was associated with a non-pathological Mendelian trait and minor, non deleterious effects in the lavender Japanese quail which is a natural knockout for PRLH. PMID:22937744

Regional neural tube closure defined by the Grainy head-like transcription factors.

PubMed

Rifat, Yeliz; Parekh, Vishwas; Wilanowski, Tomasz; Hislop, Nikki R; Auden, Alana; Ting, Stephen B; Cunningham, John M; Jane, Stephen M

2010-09-15

Primary neurulation in mammals has been defined by distinct anatomical closure sites, at the hindbrain/cervical spine (closure 1), forebrain/midbrain boundary (closure 2), and rostral end of the forebrain (closure 3). Zones of neurulation have also been characterized by morphologic differences in neural fold elevation, with non-neural ectoderm-induced formation of paired dorso-lateral hinge points (DLHP) essential for neural tube closure in the cranial and lower spinal cord regions, and notochord-induced bending at the median hinge point (MHP) sufficient for closure in the upper spinal region. Here we identify a unifying molecular basis for these observations based on the function of the non-neural ectoderm-specific Grainy head-like genes in mice. Using a gene-targeting approach we show that deletion of Grhl2 results in failed closure 3, with mutants exhibiting a split-face malformation and exencephaly, associated with failure of neuro-epithelial folding at the DLHP. Loss of Grhl3 alone defines a distinct lower spinal closure defect, also with defective DLHP formation. The two genes contribute equally to closure 2, where only Grhl gene dosage is limiting. Combined deletion of Grhl2 and Grhl3 induces severe rostral and caudal neural tube defects, but DLHP-independent closure 1 proceeds normally in the upper spinal region. These findings provide a molecular basis for non-neural ectoderm mediated formation of the DLHP that is critical for complete neuraxis closure. (c) 2010 Elsevier Inc. All rights reserved.

A splice site mutation in a gene encoding for PDK4, a mitochondrial protein, is associated with the development of dilated cardiomyopathy in the Doberman pinscher.

PubMed

Meurs, Kathryn M; Lahmers, Sunshine; Keene, Bruce W; White, Stephen N; Oyama, Mark A; Mauceli, Evan; Lindblad-Toh, Kerstin

2012-08-01

Familial dilated cardiomyopathy is a primary myocardial disease that can result in the development of congestive heart failure and sudden cardiac death. Spontaneous animal models of familial dilated cardiomyopathy exist and the Doberman pinscher dog is one of the most commonly reported canine breeds. The objective of this study was to evaluate familial dilated cardiomyopathy in the Doberman pinscher dog using a genome-wide association study for a genetic alteration(s) associated with the development of this disease in this canine model. Genome-wide association analysis identified an area of statistical significance on canine chromosome 14 (p(raw) = 9.999e-05 corrected for genome-wide significance), fine-mapping of additional SNPs flanking this region localized a signal to 23,774,190-23,781,919 (p = 0.001) and DNA sequencing identified a 16-base pair deletion in the 5' donor splice site of intron 10 of the pyruvate dehydrogenase kinase 4 gene in affected dogs (p < 0.0001). Electron microscopy of myocardium from affected dogs demonstrated disorganization of the Z line, mild to moderate T tubule and sarcoplasmic reticulum dilation, marked pleomorphic mitochondrial alterations with megamitochondria, scattered mitochondria with whorling and vacuolization and mild aggregates of lipofuscin granules. In conclusion, we report the identification of a splice site deletion in the PDK4 gene that is associated with the development of familial dilated cardiomyopathy in the Doberman pinscher dog.

Giardia telomeric sequence d(TAGGG)4 forms two intramolecular G-quadruplexes in K+ solution: effect of loop length and sequence on the folding topology.

PubMed

Hu, Lanying; Lim, Kah Wai; Bouaziz, Serge; Phan, Anh Tuân

2009-11-25

Recently, it has been shown that in K(+) solution the human telomeric sequence d[TAGGG(TTAGGG)(3)] forms a (3 + 1) intramolecular G-quadruplex, while the Bombyx mori telomeric sequence d[TAGG(TTAGG)(3)], which differs from the human counterpart only by one G deletion in each repeat, forms a chair-type intramolecular G-quadruplex, indicating an effect of G-tract length on the folding topology of G-quadruplexes. To explore the effect of loop length and sequence on the folding topology of G-quadruplexes, here we examine the structure of the four-repeat Giardia telomeric sequence d[TAGGG(TAGGG)(3)], which differs from the human counterpart only by one T deletion within the non-G linker in each repeat. We show by NMR that this sequence forms two different intramolecular G-quadruplexes in K(+) solution. The first one is a novel basket-type antiparallel-stranded G-quadruplex containing two G-tetrads, a G x (A-G) triad, and two A x T base pairs; the three loops are consecutively edgewise-diagonal-edgewise. The second one is a propeller-type parallel-stranded G-quadruplex involving three G-tetrads; the three loops are all double-chain-reversal. Recurrence of several structural elements in the observed structures suggests a "cut and paste" principle for the design and prediction of G-quadruplex topologies, for which different elements could be extracted from one G-quadruplex and inserted into another.

Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

PubMed

Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing

2016-01-01

In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

Deletion Diagnostics for the Generalised Linear Mixed Model with independent random effects

PubMed Central

Ganguli, B.; Roy, S. Sen; Naskar, M.; Malloy, E. J.; Eisen, E. A.

2015-01-01

The Generalised Linear Mixed Model (GLMM) is widely used for modelling environmental data. However, such data are prone to influential observations which can distort the estimated exposure-response curve particularly in regions of high exposure. Deletion diagnostics for iterative estimation schemes commonly derive the deleted estimates based on a single iteration of the full system holding certain pivotal quantities such as the information matrix to be constant. In this paper, we present an approximate formula for the deleted estimates and Cook’s distance for the GLMM which does not assume that the estimates of variance parameters are unaffected by deletion. The procedure allows the user to calculate standardised DFBETAs for mean as well as variance parameters. In certain cases, such as when using the GLMM as a device for smoothing, such residuals for the variance parameters are interesting in their own right. In general, the procedure leads to deleted estimates of mean parameters which are corrected for the effect of deletion on variance components as estimation of the two sets of parameters is interdependent. The probabilistic behaviour of these residuals is investigated and a simulation based procedure suggested for their standardisation. The method is used to identify influential individuals in an occupational cohort exposed to silica. The results show that failure to conduct post model fitting diagnostics for variance components can lead to erroneous conclusions about the fitted curve and unstable confidence intervals. PMID:26626135

[Replication of Streptomyces plasmids: the DNA nucleotide sequence of plasmid pSB 24.2].

PubMed

Bolotin, A P; Sorokin, A V; Aleksandrov, N N; Danilenko, V N; Kozlov, Iu I

1985-11-01

The nucleotide sequence of DNA in plasmid pSB 24.2, a natural deletion derivative of plasmid pSB 24.1 isolated from S. cyanogenus was studied. The plasmid amounted by its size to 3706 nucleotide pairs. The G-C composition was equal to 73 per cent. The analysis of the DNA structure in plasmid pSB 24.2 revealed the protein-encoding sequence of DNA, the continuity of which was significant for replication of the plasmid containing more than 1300 nucleotide pairs. The analysis also revealed two A-T-rich areas of DNA, the G-C composition of which was less than 55 per cent and a DNA area with a branched pin structure. The results may be of value in investigation of plasmid replication in actinomycetes and experimental cloning of DNA with this plasmid as a vector.

Similar clinical and neuroimaging features in monozygotic twin pair with mutation in progranulin

PubMed Central

McDade, E.; Burrus, T.M.; Boot, B.P.; Kantarci, K.; Fields, J.; Lowe, V.J.; Peller, P.; Knopman, D.; Baker, M.; Finch, N.; Rademakers, R.; Petersen, R.

2012-01-01

Objective: To report the phenotypic characterization of monozygotic twins with mutations encoding progranulin (PGRN). Methods: We studied a twin pair with an exon 4 gene deletion in the PGRN gene. Both twins had clinical and neuropsychological examinations as well as structural MRI and fluorodeoxyglucose PET (FDG-PET) scans. PGRN gene sequencing was performed followed by progranulin ELISA in plasma. Results: Both twins manifested symptoms within 3 years of each other, with early behavioral, language, dysexecutive, and memory problems. MRI and FDG-PET imaging demonstrated a strikingly similar topography of findings with clear left hemisphere predominance. Serum progranulin levels in both were well below those from a normal population sample. Conclusions: Compared with the heterogeneity seen in many families with PGRN mutations, these monozygotic twins demonstrated strong clinical, neuroimaging, and serum progranulin level similarities, demonstrating the importance of shared genetic profiles beyond environmental influences in the symptomatic expression of the disease. PMID:22491866

Genome Engineering in Bacillus anthracis Using Cre Recombinase

PubMed Central

Pomerantsev, Andrei P.; Sitaraman, Ramakrishnan; Galloway, Craig R.; Kivovich, Violetta; Leppla, Stephen H.

2006-01-01

Genome engineering is a powerful method for the study of bacterial virulence. With the availability of the complete genomic sequence of Bacillus anthracis, it is now possible to inactivate or delete selected genes of interest. However, many current methods for disrupting or deleting more than one gene require use of multiple antibiotic resistance determinants. In this report we used an approach that temporarily inserts an antibiotic resistance marker into a selected region of the genome and subsequently removes it, leaving the target region (a single gene or a larger genomic segment) permanently mutated. For this purpose, a spectinomycin resistance cassette flanked by bacteriophage P1 loxP sites oriented as direct repeats was inserted within a selected gene. After identification of strains having the spectinomycin cassette inserted by a double-crossover event, a thermo-sensitive plasmid expressing Cre recombinase was introduced at the permissive temperature. Cre recombinase action at the loxP sites excised the spectinomycin marker, leaving a single loxP site within the targeted gene or genomic segment. The Cre-expressing plasmid was then removed by growth at the restrictive temperature. The procedure could then be repeated to mutate additional genes. In this way, we sequentially mutated two pairs of genes: pepM and spo0A, and mcrB and mrr. Furthermore, loxP sites introduced at distant genes could be recombined by Cre recombinase to cause deletion of large intervening regions. In this way, we deleted the capBCAD region of the pXO2 plasmid and the entire 30 kb of chromosomal DNA between the mcrB and mrr genes, and in the latter case we found that the 32 intervening open reading frames were not essential to growth. PMID:16369025

Identifying allelic loss and homozygous deletions in pancreatic cancer without matched normals using high-density single-nucleotide polymorphism arrays.

PubMed

Calhoun, Eric S; Hucl, Tomas; Gallmeier, Eike; West, Kristen M; Arking, Dan E; Maitra, Anirban; Iacobuzio-Donahue, Christine A; Chakravarti, Aravinda; Hruban, Ralph H; Kern, Scott E

2006-08-15

Recent advances in oligonucleotide arrays and whole-genome complexity reduction data analysis now permit the evaluation of tens of thousands of single-nucleotide polymorphisms simultaneously for a genome-wide analysis of allelic status. Using these arrays, we created high-resolution allelotype maps of 26 pancreatic cancer cell lines. The areas of heterozygosity implicitly served to reveal regions of allelic loss. The array-derived maps were verified by a panel of 317 microsatellite markers used in a subset of seven samples, showing a 97.1% concordance between heterozygous calls. Three matched tumor/normal pairs were used to estimate the false-negative and potential false-positive rates for identifying loss of heterozygosity: 3.6 regions (average minimal region of loss, 720,228 bp) and 2.3 regions (average heterozygous gap distance, 4,434,994 bp) per genome, respectively. Genomic fractional allelic loss calculations showed that cumulative levels of allelic loss ranged widely from 17.1% to 79.9% of the haploid genome length. Regional increases in "NoCall" frequencies combined with copy number loss estimates were used to identify 41 homozygous deletions (19 first reports), implicating an additional 13 regions disrupted in pancreatic cancer. Unexpectedly, 23 of these occurred in just two lines (BxPc3 and MiaPaCa2), suggesting the existence of at least two subclasses of chromosomal instability (CIN) patterns, distinguished here by allelic loss and copy number changes (original CIN) and those also highly enriched in the genomic "holes" of homozygous deletions (holey CIN). This study provides previously unavailable high-resolution allelotype and deletion breakpoint maps in widely shared pancreatic cancer cell lines and effectively eliminates the need for matched normal tissue to define informative loci.

Genetic deletion of P-glycoprotein alters stress responsivity and increases depression-like behavior, social withdrawal and microglial activation in the hippocampus of female mice.

PubMed

Brzozowska, Natalia I; Smith, Kristie L; Zhou, Cilla; Waters, Peter M; Cavalcante, Ligia Menezes; Abelev, Sarah V; Kuligowski, Michael; Clarke, David J; Todd, Stephanie M; Arnold, Jonathon C

2017-10-01

P-glycoprotein (P-gp) is an ABC transporter expressed at the blood brain barrier and regulates the brain uptake of various xenobiotics and endogenous mediators including glucocorticoid hormones which are critically important to the stress response. Moreover, P-gp is expressed on microglia, the brain's immune cells, which are activated by stressors and have an emerging role in psychiatric disorders. We therefore hypothesised that germline P-gp deletion in mice might alter the behavioral and microglial response to stressors. Female P-gp knockout mice displayed an unusual, frantic anxiety response to intraperitoneal injection stress in the light-dark test. They also tended to display reduced conditioned fear responses compared to wild-type (WT) mice in a paradigm where a single electric foot-shock stressor was paired to a context. Foot-shock stress reduced social interaction and decreased microglia cell density in the amygdala which was not varied by P-gp genotype. Independently of stressor exposure, female P-gp deficient mice displayed increased depression-like behavior, idiosyncratic darting behavior, age-related social withdrawal and hyperactivity, facilitated sensorimotor gating and altered startle reactivity. In addition, P-gp deletion increased microglia cell density in the CA3 region of the hippocampus, and the microglial cells exhibited a reactive, hypo-ramified morphology. Further, female P-gp KO mice displayed increased glucocorticoid receptor (GR) expression in the hippocampus. In conclusion, this research shows that germline P-gp deletion affected various behaviors of relevance to psychiatric conditions, and that altered microglial cell activity and enhanced GR expression in the hippocampus may play a role in mediating these behaviors. Copyright © 2017 Elsevier Inc. All rights reserved.

Design and Validation of a New MLPA-Based Assay for the Detection of RS1 Gene Deletions and Application in a Large Family with X-Linked Juvenile Retinoschisis

PubMed Central

Nicoletti, Annalisa; Ziccardi, Lucia; Benedetti, Sabrina; Palumbo, Orazio; Rendina, Michelina; D'Agruma, Leonardo; Falsini, Benedetto; Wang, Xinjing; Bertelli, Matteo

2017-01-01

Aims: X-linked juvenile retinoschisis (XLRS) is a severe ocular disorder that can evolve to blindness. More than 200 different disease-causing mutations have been reported in the RS1 gene and approximately 10% of these are deletions. Since transmission is X-linked, males are always affected and females are usually carriers. The identification of female carriers is always important and poses a technical challenge. Therefore, we sought to develop a multiplex ligation dependent probe amplification (MLPA)-based method to identify deletions or duplications in this gene. We then used our assay to study a large XLRS family. Methods: We designed six probes specific for each RS1 exon and then optimized and validated our method using control samples with known gene deletions. In the XLRS family, RS1 gene copy number variation was assessed by “home-made” MLPA analysis and by single nucleotide polymorphism (SNP) array analysis using the CytoScan HD Array. Direct sequencing was used for deletion breakpoint mapping. Results: Our assay detected all deletions in control samples. All affected males of the family were positive for a deletion of exon 2 of the RS1 gene (RS1:NM_000330:c.53-?_78+?del). Carrier females were also identified. Conclusion: Our method is easily replicated, reliable, and inexpensive and allows female carriers to be detected. This is the first report of deep characterization of a whole exon deletion in the RS1 gene. PMID:27997221

Genomic Variability of Mycobacterium tuberculosis Strains of the Euro-American Lineage Based on Large Sequence Deletions and 15-Locus MIRU-VNTR Polymorphism

PubMed Central

Rindi, Laura; Medici, Chiara; Bimbi, Nicola; Buzzigoli, Andrea; Lari, Nicoletta; Garzelli, Carlo

2014-01-01

A sample of 260 Mycobacterium tuberculosis strains assigned to the Euro-American family was studied to identify phylogenetically informative genomic regions of difference (RD). Mutually exclusive deletions of regions RD115, RD122, RD174, RD182, RD183, RD193, RD219, RD726 and RD761 were found in 202 strains; the RDRio deletion was detected exclusively among the RD174-deleted strains. Although certain deletions were found more frequently in certain spoligotype families (i.e., deletion RD115 in T and LAM, RD174 in LAM, RD182 in Haarlem, RD219 in T and RD726 in the “Cameroon” family), the RD-defined sublineages did not specifically match with spoligotype-defined families, thus arguing against the use of spoligotyping for establishing exact phylogenetic relationships between strains. Notably, when tested for katG463/gyrA95 polymorphism, all the RD-defined sublineages belonged to Principal Genotypic Group (PGG) 2, except sublineage RD219 exclusively belonging to PGG3; the 58 Euro-American strains with no deletion were of either PGG2 or 3. A representative sample of 197 isolates was then analyzed by standard 15-locus MIRU-VNTR typing, a suitable approach to independently assess genetic relationships among the strains. Analysis of the MIRU-VNTR typing results by using a minimum spanning tree (MST) and a classical dendrogram showed groupings that were largely concordant with those obtained by RD-based analysis. Isolates of a given RD profile show, in addition to closely related MIRU-VNTR profiles, related spoligotype profiles that can serve as a basis for better spoligotype-based classification. PMID:25197794

Enhanced hexose fermentation by Saccharomyces cerevisiae through integration of stoichiometric modeling and genetic screening.

PubMed

Quarterman, Josh; Kim, Soo Rin; Kim, Pan-Jun; Jin, Yong-Su

2015-01-20

In order to determine beneficial gene deletions for ethanol production by the yeast Saccharomyces cerevisiae, we performed an in silico gene deletion experiment based on a genome-scale metabolic model. Genes coding for two oxidative phosphorylation reactions (cytochrome c oxidase and ubiquinol cytochrome c reductase) were identified by the model-based simulation as potential deletion targets for enhancing ethanol production and maintaining acceptable overall growth rate in oxygen-limited conditions. Since the two target enzymes are composed of multiple subunits, we conducted a genetic screening study to evaluate the in silico results and compare the effect of deleting various portions of the respiratory enzyme complexes. Over two-thirds of the knockout mutants identified by the in silico study did exhibit experimental behavior in qualitative agreement with model predictions, but the exceptions illustrate the limitation of using a purely stoichiometric model-based approach. Furthermore, there was a substantial quantitative variation in phenotype among the various respiration-deficient mutants that were screened in this study, and three genes encoding respiratory enzyme subunits were identified as the best knockout targets for improving hexose fermentation in microaerobic conditions. Specifically, deletion of either COX9 or QCR9 resulted in higher ethanol production rates than the parental strain by 37% and 27%, respectively, with slight growth disadvantages. Also, deletion of QCR6 led to improved ethanol production rate by 24% with no growth disadvantage. The beneficial effects of these gene deletions were consistently demonstrated in different strain backgrounds and with four common hexoses. The combination of stoichiometric modeling and genetic screening using a systematic knockout collection was useful for narrowing a large set of gene targets and identifying targets of interest. Copyright © 2014 Elsevier B.V. All rights reserved.

The role of phase synchronisation between low frequency amplitude modulations in child phonology and morphology speech tasks.

PubMed

Flanagan, Sheila; Goswami, Usha

2018-03-01

Recent models of the neural encoding of speech suggest a core role for amplitude modulation (AM) structure, particularly regarding AM phase alignment. Accordingly, speech tasks that measure linguistic development in children may exhibit systematic properties regarding AM structure. Here, the acoustic structure of spoken items in child phonological and morphological tasks, phoneme deletion and plural elicitation, was investigated. The phase synchronisation index (PSI), reflecting the degree of phase alignment between pairs of AMs, was computed for 3 AM bands (delta, theta, beta/low gamma; 0.9-2.5 Hz, 2.5-12 Hz, 12-40 Hz, respectively), for five spectral bands covering 100-7250 Hz. For phoneme deletion, data from 94 child participants with and without dyslexia was used to relate AM structure to behavioural performance. Results revealed that a significant change in magnitude of the phase synchronisation index (ΔPSI) of slower AMs (delta-theta) systematically accompanied both phoneme deletion and plural elicitation. Further, children with dyslexia made more linguistic errors as the delta-theta ΔPSI increased. Accordingly, ΔPSI between slower temporal modulations in the speech signal systematically distinguished test items from accurate responses and predicted task performance. This may suggest that sensitivity to slower AM information in speech is a core aspect of phonological and morphological development.

The genomic and transcriptomic architecture of 2,000 breast tumours reveals novel subgroups

PubMed Central

Curtis, Christina; Shah, Sohrab P.; Chin, Suet-Feung; Turashvili, Gulisa; Rueda, Oscar M.; Dunning, Mark J.; Speed, Doug; Lynch, Andy G.; Samarajiwa, Shamith; Yuan, Yinyin; Gräf, Stefan; Ha, Gavin; Haffari, Gholamreza; Bashashati, Ali; Russell, Roslin; McKinney, Steven; Langerød, Anita; Green, Andrew; Provenzano, Elena; Wishart, Gordon; Pinder, Sarah; Watson, Peter; Markowetz, Florian; Murphy, Leigh; Ellis, Ian; Purushotham, Arnie; Børresen-Dale, Anne-Lise; Brenton, James D.; Tavaré, Simon; Caldas, Carlos; Aparicio, Samuel

2012-01-01

The elucidation of breast cancer subgroups and their molecular drivers requires integrated views of the genome and transcriptome from representative numbers of patients. We present an integrated analysis of copy number and gene expression in a discovery and validation set of 997 and 995 primary breast tumours, respectively, with long-term clinical follow-up. Inherited variants (copy number variants and single nucleotide polymorphisms) and acquired somatic copy number aberrations (CNAs) were associated with expression in ~40% of genes, with the landscape dominated by cis- and trans-acting CNAs. By delineating expression outlier genes driven in cis by CNAs, we identified putative cancer genes, including deletions in PPP2R2A, MTAP and MAP2K4. Unsupervised analysis of paired DNA–RNA profiles revealed novel subgroups with distinct clinical outcomes, which reproduced in the validation cohort. These include a high-risk, oestrogen-receptor-positive 11q13/14 cis-acting subgroup and a favourable prognosis subgroup devoid of CNAs. Trans-acting aberration hotspots were found to modulate subgroup-specific gene networks, including a TCR deletion-mediated adaptive immune response in the ‘CNA-devoid’ subgroup and a basal-specific chromosome 5 deletion-associated mitotic network. Our results provide a novel molecular stratification of the breast cancer population, derived from the impact of somatic CNAs on the transcriptome. PMID:22522925

CRISPR/Cas9 and active genetics-based trans-species replacement of the endogenous Drosophila kni-L2 CRM reveals unexpected complexity.

PubMed

Xu, Xiang-Ru Shannon; Gantz, Valentino Matteo; Siomava, Natalia; Bier, Ethan

2017-12-23

The knirps ( kni ) locus encodes transcription factors required for induction of the L2 wing vein in Drosophila . Here, we employ diverse CRISPR/Cas9 genome editing tools to generate a series of targeted lesions within the endogenous cis-regulatory module (CRM) required for kni expression in the L2 vein primordium. Phenotypic analysis of these ' in locus ' mutations based on both expression of Kni protein and adult wing phenotypes, reveals novel unexpected features of L2-CRM function including evidence for a chromosome pairing-dependent process that promotes transcription. We also demonstrate that self-propagating active genetic elements (CopyCat elements) can efficiently delete and replace the L2-CRM with orthologous sequences from other divergent fly species. Wing vein phenotypes resulting from these trans-species enhancer replacements parallel features of the respective donor fly species. This highly sensitive phenotypic readout of enhancer function in a native genomic context reveals novel features of CRM function undetected by traditional reporter gene analysis. © 2017, Xu et al.

CRISPR/Cas9 and active genetics-based trans-species replacement of the endogenous Drosophila kni-L2 CRM reveals unexpected complexity

PubMed Central

Siomava, Natalia

2017-01-01

The knirps (kni) locus encodes transcription factors required for induction of the L2 wing vein in Drosophila. Here, we employ diverse CRISPR/Cas9 genome editing tools to generate a series of targeted lesions within the endogenous cis-regulatory module (CRM) required for kni expression in the L2 vein primordium. Phenotypic analysis of these ‘in locus’ mutations based on both expression of Kni protein and adult wing phenotypes, reveals novel unexpected features of L2-CRM function including evidence for a chromosome pairing-dependent process that promotes transcription. We also demonstrate that self-propagating active genetic elements (CopyCat elements) can efficiently delete and replace the L2-CRM with orthologous sequences from other divergent fly species. Wing vein phenotypes resulting from these trans-species enhancer replacements parallel features of the respective donor fly species. This highly sensitive phenotypic readout of enhancer function in a native genomic context reveals novel features of CRM function undetected by traditional reporter gene analysis. PMID:29274230

SNP-based Microdeletion and Aneuploidy RegisTry (SMART)

ClinicalTrials.gov

2017-09-20

22q11 Deletion Syndrome; DiGeorge Syndrome; Trisomy 21; Trisomy 18; Trisomy 13; Monosomy X; Sex Chromosome Abnormalities; Cri-du-Chat Syndrome; Angelman Syndrome; Prader-Willi Syndrome; 1p36 Deletion Syndrome

3D GIS spatial operation based on extended Euler operators

NASA Astrophysics Data System (ADS)

Xu, Hongbo; Lu, Guonian; Sheng, Yehua; Zhou, Liangchen; Guo, Fei; Shang, Zuoyan; Wang, Jing

2008-10-01

The implementation of 3 dimensions spatial operations, based on certain data structure, has a lack of universality and is not able to treat with non-manifold cases, at present. ISO/DIS 19107 standard just presents the definition of Boolean operators and set operators for topological relationship query, and OGC GeoXACML gives formal definitions for several set functions without implementation detail. Aiming at these problems, based mathematical foundation on cell complex theory, supported by non-manifold data structure and using relevant research in the field of non-manifold geometry modeling for reference, firstly, this paper according to non-manifold Euler-Poincaré formula constructs 6 extended Euler operators and inverse operators to carry out creating, updating and deleting 3D spatial elements, as well as several pairs of supplementary Euler operators to convenient for implementing advanced functions. Secondly, we change topological element operation sequence of Boolean operation and set operation as well as set functions defined in GeoXACML into combination of extended Euler operators, which separates the upper functions and lower data structure. Lastly, we develop underground 3D GIS prototype system, in which practicability and credibility of extended Euler operators faced to 3D GIS presented by this paper are validated.

Tn4556, a 6.8-kilobase-pair transposable element of Streptomyces fradiae.

PubMed Central

Chung, S T

1987-01-01

A 6.8-kilobase-pair (kbp) transposable element (Tn4556) was found in a neomycin-producing strain of Streptomyces fradiae. This element was first observed in two 30.3-kbp plasmids (pUC1123 and pUC1124) which arose when a thiostrepton resistance gene (1 kbp) was ligated with the BclI-2 fragment (22.5 kbp) that contains the origin of replication of phage SF1. The Tn4556 segment was deleted when these plasmids were transduced into another S. fradiae host with phage SF1. These deletion plasmids (pUC1210 and pUC1211) had copy numbers of less than 1 per chromosome and were unstable. In contrast, pUC1123 and pUC1124, with copy numbers of 12 to 15 per chromosome, respectively, were relatively stable. When pUC1210 and pUC1211 were reintroduced into S. fradiae by protoplast transformation, the Tn4556 element transposed again to the plasmids at numerous new locations in either of two orientations. A copy of Tn4556 was found in the S. fradiae chromosome by hybridization studies. It appears that Tn4556 originated from the chromosome, transposed into unstable pUC1210 and pUC1211, and made stable plasmids. A temperature-sensitive hybrid plasmid carrying a viomycin resistance derivative of Tn4556 (pMT660::Tn4556::vph) was constructed. When Streptomyces lividans UC8390 containing the hybrid plasmid was grown at 39 degrees C, Tn4556::vph (Tn4560) transposed to random positions in the host chromosome. Images PMID:2820925

E2fl1 is a meiosis-specific transcription factor in the protist Tetrahymena thermophila

PubMed Central

Zhang, Jing; Tian, Miao; Miao, Wei

2017-01-01

ABSTRACT Members of the E2F family of transcription factors have been reported to regulate the expression of genes involved in cell cycle control, DNA replication, and DNA repair in multicellular eukaryotes. Here, E2FL1, a meiosis-specific E2F transcription factor gene, was identified in the model ciliate Tetrahymena thermophila. Loss of this gene resulted in meiotic arrest prior to anaphase I. The cytological experiments revealed that the meiotic homologous pairing was not affected in the absence of E2FL1, but the paired homologous chromosomes did not separate and assumed a peculiar tandem arrangement. This is the first time that an E2F family member has been shown to regulate meiotic events. Moreover, BrdU incorporation showed that DSB processing during meiosis was abnormal upon the deletion of E2FL1. Transcriptome sequencing analysis revealed that E2FL1 knockout decreased the expression of genes involved in DNA replication and DNA repair in T. thermophila, suggesting that the function of E2F is highly conserved in eukaryotes. In addition, E2FL1 deletion inhibited the expression of related homologous chromosome segregation genes in T. thermophila. The result may explain the meiotic arrest phenotype at anaphase I. Finally, by searching for E2F DNA-binding motifs in the entire T. thermophila genome, we identified 714 genes containing at least one E2F DNA-binding motif; of these, 235 downregulated represent putative E2FL1 target genes. PMID:27892792

Brain and Behavior in Children with 22Q11.2 Deletion Syndrome: A Volumetric and Voxel-Based Morphometry MRI Study

ERIC Educational Resources Information Center

Campbell, Linda E.; Daly, Eileen; Toal, Fiona; Stevens, Angela; Azuma, Rayna; Catani, Marco; Ng, Virginia; Van Amelsvoort, Therese; Chitnis, Xavier; Cutter, William; Murphy, Declan G. M.; Murphy, Kieran C.

2006-01-01

In people with velo-cardio-facial syndrome [or 22q11.2 deletion syndrome (22qDS)], a single interstitial deletion of chromosome 22q11.2 causes a wide spectrum of cognitive deficits ranging from global learning difficulties to specific cognitive deficits. People with 22qDS are also at high risk of developing attention-deficit hyperactivity disorder…

A novel deletion in the thyrotropin Beta-subunit gene identified by array comparative genomic hybridization analysis causes central congenital hypothyroidism in a boy originating from Turkey.

PubMed

Hermanns, Pia; Couch, Robert; Leonard, Norma; Klotz, Cherise; Pohlenz, Joachim

2014-01-01

Isolated central congenital hypothyroidism (ICCH) is rare but important. Most ICCH patients are diagnosed later, which results in severe growth failure and intellectual disability. We describe a boy with ICCH due to a large homozygous TSHβ gene deletion. A 51-day-old male Turkish infant, whose parents were first cousins, was admitted for evaluation of prolonged jaundice. His clinical appearance was compatible with hypothyroidism. Venous thyrotropin (TSH) was undetectably low, with a subsequent low free T4 and a low free T3, suggestive of central hypothyroidism. Using different PCR protocols, we could not amplify both coding exons of the boy's TSHβ gene, which suggested a deletion. An array comparative genomic hybridization (aCGH) using specific probes around the TSHβ gene locus showed him to be homozygous for a 6-kb deletion spanning all exons and parts of the 5' untranslated region of the gene. Infants who are clinically suspected of having hypothyroidism should be evaluated thoroughly, even if their TSH-based screening result is normal. In cases with ICCH and undetectably low TSH serum concentrations, a TSHβ gene deletion should be considered; aCGH should be performed when gene deletions are suspected. In such cases, PCR-based sequencing techniques give negative results.

[Markerless DNA deletion based on Red recombination and in vivo I-Sec I endonuclease cleavage in Escherichia coli chromosome].

PubMed

Zhu, Meiqin; Yu, Jian; Zhou, Changlin; Fang, Hongqing

2016-01-01

Red-based recombineering has been widely used in Escherichia coli genome modification through electroporating PCR fragments into electrocompetent cells to replace target sequences. Some mutations in the PCR fragments may be brought into the homologous regions near the target. To solve this problem in markeless gene deletion we developed a novel method characterized with two-step recombination and a donor plasmid. First, generated by PCR a linear DNA cassette which comprises a I-Sec I site-containing marker gene and homologous arms was electroporated into cells for marker-substitution deletion of the target sequence. Second, after a donor plasmid carrying the I-Sec I site-containing fusion homologous arm was chemically transformed into the marker-containing cells, the fusion arms and the marker was simultaneously cleaved by I-Sec I endonuclease and the marker-free deletion was stimulated by double-strand break-mediated intermolecular recombination. Eleven nonessential regions in E. coli DH1 genome were sequentially deleted by our method, resulting in a 10.59% reduced genome size. These precise deletions were also verified by PCR sequencing and genome resequencing. Though no change in the growth rate on the minimal medium, we found the genome-reduced strains have some alteration in the acid resistance and for the synthesis of lycopene.

The HDAC inhibitor SB939 overcomes resistance to BCR-ABL kinase Inhibitors conferred by the BIM deletion polymorphism in chronic myeloid leukemia.

PubMed

Rauzan, Muhammad; Chuah, Charles T H; Ko, Tun Kiat; Ong, S Tiong

2017-01-01

Chronic myeloid leukemia (CML) treatment has been improved by tyrosine kinase inhibitors (TKIs) such as imatinib mesylate (IM) but various factors can cause TKI resistance in patients with CML. One factor which contributes to TKI resistance is a germline intronic deletion polymorphism in the BCL2-like 11 (BIM) gene which impairs the expression of pro-apoptotic splice isoforms of BIM. SB939 (pracinostat) is a hydroxamic acid based HDAC inhibitor with favorable pharmacokinetic, physicochemical and pharmaceutical properties, and we investigated if this drug could overcome BIM deletion polymorphism-induced TKI resistance. We found that SB939 corrects BIM pre-mRNA splicing in CML cells with the BIM deletion polymorphism, and induces apoptotic cell death in CML cell lines and primary cells with the BIM deletion polymorphism. More importantly, SB939 both decreases the viability of CML cell lines and primary CML progenitors with the BIM deletion and restores TKI-sensitivity. Our results demonstrate that SB939 overcomes BIM deletion polymorphism-induced TKI resistance, and suggest that SB939 may be useful in treating CML patients with BIM deletion-associated TKI resistance.

PCR-based detection of a rare linear DNA in cell culture.

PubMed

Saveliev, Sergei V.

2002-11-11

The described method allows for detection of rare linear DNA fragments generated during genomic deletions. The predicted limit of the detection is one DNA molecule per 10(7) or more cells. The method is based on anchor PCR and involves gel separation of the linear DNA fragment and chromosomal DNA before amplification. The detailed chemical structure of the ends of the linear DNA can be defined with the use of additional PCR-based protocols. The method was applied to study the short-lived linear DNA generated during programmed genomic deletions in a ciliate. It can be useful in studies of spontaneous DNA deletions in cell culture or for tracking intracellular modifications at the ends of transfected DNA during gene therapy trials.

PCR-based detection of a rare linear DNA in cell culture

PubMed Central

2002-01-01

The described method allows for detection of rare linear DNA fragments generated during genomic deletions. The predicted limit of the detection is one DNA molecule per 107 or more cells. The method is based on anchor PCR and involves gel separation of the linear DNA fragment and chromosomal DNA before amplification. The detailed chemical structure of the ends of the linear DNA can be defined with the use of additional PCR-based protocols. The method was applied to study the short-lived linear DNA generated during programmed genomic deletions in a ciliate. It can be useful in studies of spontaneous DNA deletions in cell culture or for tracking intracellular modifications at the ends of transfected DNA during gene therapy trials. PMID:12734566

Identification and characterization of RAPD-SCAR markers linked to glyphosate-susceptible and -resistant biotypes of Eleusine indica (L.) Gaertn.

PubMed

Cha, Thye San; Anne-Marie, Kaben; Chuah, Tse Seng

2014-02-01

Eleusine indica is one of the most common weed species found in agricultural land worldwide. Although herbicide-glyphosate provides good control of the weed, its frequent uses has led to abundant reported cases of resistance. Hence, the development of genetic markers for quick detection of glyphosate-resistance in E. indica population is imperative for the control and management of the weed. In this study, a total of 14 specific random amplified polymorphic DNA (RAPD) markers were identified and two of the markers, namely S4R727 and S26R6976 were further sequence characterized. Sequence alignment revealed that marker S4R727 showing a 12-bp nucleotides deletion in resistant biotypes, while marker S26R6976 contained a 167-bp nucleotides insertion in the resistant biotypes. Based on these sequence differences, three pairs of new sequence characterized amplified region (SCAR) primers were developed. The specificity of these primer pairs were further validated with genomic DNA extracted from ten individual plants of one glyphosate-susceptible and five glyphosate-resistant (R2, R4, R6, R8 and R11) populations. The resulting RAPD-SCAR markers provided the basis for assessing genetic diversity between glyphosate-susceptible and -resistant E. indica biotypes, as well for the identification of genetic locus link to glyphosate-resistance event in the species.

SOX2 anophthalmia syndrome: 12 new cases demonstrating broader phenotype and high frequency of large gene deletions.

PubMed

Bakrania, P; Robinson, D O; Bunyan, D J; Salt, A; Martin, A; Crolla, J A; Wyatt, A; Fielder, A; Ainsworth, J; Moore, A; Read, S; Uddin, J; Laws, D; Pascuel-Salcedo, D; Ayuso, C; Allen, L; Collin, J R O; Ragge, N K

2007-11-01

Developmental eye anomalies, which include anophthalmia (absent eye) or microphthalmia (small eye) are an important cause of severe visual impairment in infants and young children. Heterozygous mutations in SOX2, a SOX1B-HMG box transcription factor, have been found in up to 10% of individuals with severe microphthalmia or anophthalmia and such mutations could also be associated with a range of non-ocular abnormalities. We performed mutation analysis on a new cohort of 120 patients with congenital eye abnormalities, mainly anophthalmia, microphthalmia and coloboma. Multiplex ligation-dependent probe amplification (MLPA) and fluorescence in situ hybridisation (FISH) were used to detect whole gene deletion. We identified four novel intragenic SOX2 mutations (one single base deletion, one single base duplication and two point mutations generating premature translational termination codons) and two further cases with the previously reported c.70del20 mutation. Of 52 patients with severe microphthalmia or anophthalmia analysed by MLPA, 5 were found to be deleted for the whole SOX2 gene and 1 had a partial deletion. In two of these, FISH studies identified sub-microscopic deletions involving a minimum of 328 Kb and 550 Kb. The SOX2 phenotypes include a patient with anophthalmia, oesophageal abnormalities and horseshoe kidney, and a patient with a retinal dystrophy implicating SOX2 in retinal development. Our results provide further evidence that SOX2 haploinsufficiency is a common cause of severe developmental ocular malformations and that background genetic variation determines the varying phenotypes. Given the high incidence of whole gene deletion we recommend that all patients with severe microphthalmia or anophthalmia, including unilateral cases be screened by MLPA and FISH for SOX2 deletions.

Familial Xp22.33-Xp22.12 deletion delineated by chromosomal microarray analysis causes proportionate short stature.

PubMed

Cho, Sung Yoon; Ki, Chang-Seok; Jang, Ja-Hyun; Sohn, Young Bae; Park, Sung Won; Kim, Se Hwa; Kim, Su Jin; Jin, Dong-Kyu

2012-06-01

Patients with Xp deletions have short stature and may have some somatic traits typical of Turner syndrome (TS), whereas gonadal function is generally preserved. In most studies of these patients, microsatellites have been used to determine the break point of the Xp deletion. In the present study, we describe the clinical, cytogenetic, and chromosomal microarray (CMA) analysis of a family with an Xp22.33-Xp22.12 deletion. Two female siblings, aged 8 years 9 months and 11 years 10 months, presented with short stature. The older sibling's height (index case) was 137.9 cm (-1.81 SDS) and the younger sibling's height was 118.6 cm (-2.13 SDS). The mother and both daughters had only a short stature; a skeletal survey showed normal findings except for mildly shortened 4th and 5th metacarpal bones. No features of TS were present. The deletion appeared terminal with a breakpoint within Xp22.2 located about 19.9 Mb from the Xp telomere. The deletion contained 102 protein-coding genes. A probe of the end breakage point was located at the 19,908,986th base of the X chromosome, and a probe of the marginal normal region near the breakage point was located at the 19,910,848th base of the X chromosome. Therefore, the breakage point was concluded to be located between these two probes. In summary, we report a familial case of an Xp deletion. The findings of our study may be helpful in further analyzing the phenotypes associated with Xp deletions. Copyright © 2012 Wiley Periodicals, Inc.

SU-E-T-789: Validation of 3DVH Accuracy On Quantifying Delivery Errors Based On Clinical Relevant DVH Metrics

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ma, T; Kumaraswamy, L

Purpose: Detection of treatment delivery errors is important in radiation therapy. However, accurate quantification of delivery errors is also of great importance. This study aims to evaluate the 3DVH software’s ability to accurately quantify delivery errors. Methods: Three VMAT plans (prostate, H&N and brain) were randomly chosen for this study. First, we evaluated whether delivery errors could be detected by gamma evaluation. Conventional per-beam IMRT QA was performed with the ArcCHECK diode detector for the original plans and for the following modified plans: (1) induced dose difference error up to ±4.0% and (2) control point (CP) deletion (3 to 10more » CPs were deleted) (3) gantry angle shift error (3 degree uniformly shift). 2D and 3D gamma evaluation were performed for all plans through SNC Patient and 3DVH, respectively. Subsequently, we investigated the accuracy of 3DVH analysis for all cases. This part evaluated, using the Eclipse TPS plans as standard, whether 3DVH accurately can model the changes in clinically relevant metrics caused by the delivery errors. Results: 2D evaluation seemed to be more sensitive to delivery errors. The average differences between ECLIPSE predicted and 3DVH results for each pair of specific DVH constraints were within 2% for all three types of error-induced treatment plans, illustrating the fact that 3DVH is fairly accurate in quantifying the delivery errors. Another interesting observation was that even though the gamma pass rates for the error plans are high, the DVHs showed significant differences between original plan and error-induced plans in both Eclipse and 3DVH analysis. Conclusion: The 3DVH software is shown to accurately quantify the error in delivered dose based on clinically relevant DVH metrics, where a conventional gamma based pre-treatment QA might not necessarily detect.« less

Deletion of a 77-base-pair inverted repeat element alters the synthesis of surface polysaccharides in Porphyromonas gingivalis.

PubMed

Bainbridge, Brian W; Hirano, Takanori; Grieshaber, Nicole; Davey, Mary E

2015-04-01

Bacterial cell surface glycans, such as capsular polysaccharides and lipopolysaccharides (LPS), influence host recognition and are considered key virulence determinants. The periodontal pathogen Porphyromonas gingivalis is known to display at least three different types of surface glycans: O-LPS, A-LPS, and K-antigen capsule. We have shown that PG0121 (in strain W83) encodes a DNABII histone-like protein and that this gene is transcriptionally linked to the K-antigen capsule synthesis genes, generating a large ∼19.4-kb transcript (PG0104-PG0121). Furthermore, production of capsule is deficient in a PG0121 mutant strain. In this study, we report on the identification of an antisense RNA (asRNA) molecule located within a 77-bp inverted repeat (77bpIR) element located near the 5' end of the locus. We show that overexpression of this asRNA decreases the amount of capsule produced, indicating that this asRNA can impact capsule synthesis in trans. We also demonstrate that deletion of the 77bpIR element and thereby synthesis of the large 19.4-kb transcript also diminishes, but does not eliminate, capsule synthesis. Surprisingly, LPS structures were also altered by deletion of the 77bpIR element, and reactivity to monoclonal antibodies specific to both O-LPS and A-LPS was eliminated. Additionally, reduced reactivity to these antibodies was also observed in a PG0106 mutant, indicating that this putative glycosyltransferase, which is required for capsule synthesis, is also involved in LPS synthesis in strain W83. We discuss our finding in the context of how DNABII proteins, an antisense RNA molecule, and the 77bpIR element may modulate expression of surface polysaccharides in P. gingivalis. The periodontal pathogen Porphyromonas gingivalis displays at least three different types of cell surface glycans: O-LPS, A-LPS, and K-antigen capsule. We have shown using Northern analysis that the K-antigen capsule locus encodes a large transcript (∼19.4 kb), encompassing a 77-bp inverted repeat (77bpIR) element near the 5' end. Here, we report on the identification of an antisense RNA (asRNA) encoded within the 77bpIR. We show that overexpression of this asRNA or deletion of the element decreases the amount of capsule. LPS structures were also altered by deletion of the 77bpIR, and reactivity to monoclonal antibodies to both O-LPS and A-LPS was eliminated. Our data indicate that the 77bpIR element is involved in modulating both LPS and capsule synthesis in P. gingivalis. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Deletion of a 77-Base-Pair Inverted Repeat Element Alters the Synthesis of Surface Polysaccharides in Porphyromonas gingivalis

PubMed Central

Bainbridge, Brian W.; Hirano, Takanori; Grieshaber, Nicole

2015-01-01

ABSTRACT Bacterial cell surface glycans, such as capsular polysaccharides and lipopolysaccharides (LPS), influence host recognition and are considered key virulence determinants. The periodontal pathogen Porphyromonas gingivalis is known to display at least three different types of surface glycans: O-LPS, A-LPS, and K-antigen capsule. We have shown that PG0121 (in strain W83) encodes a DNABII histone-like protein and that this gene is transcriptionally linked to the K-antigen capsule synthesis genes, generating a large ∼19.4-kb transcript (PG0104-PG0121). Furthermore, production of capsule is deficient in a PG0121 mutant strain. In this study, we report on the identification of an antisense RNA (asRNA) molecule located within a 77-bp inverted repeat (77bpIR) element located near the 5′ end of the locus. We show that overexpression of this asRNA decreases the amount of capsule produced, indicating that this asRNA can impact capsule synthesis in trans. We also demonstrate that deletion of the 77bpIR element and thereby synthesis of the large 19.4-kb transcript also diminishes, but does not eliminate, capsule synthesis. Surprisingly, LPS structures were also altered by deletion of the 77bpIR element, and reactivity to monoclonal antibodies specific to both O-LPS and A-LPS was eliminated. Additionally, reduced reactivity to these antibodies was also observed in a PG0106 mutant, indicating that this putative glycosyltransferase, which is required for capsule synthesis, is also involved in LPS synthesis in strain W83. We discuss our finding in the context of how DNABII proteins, an antisense RNA molecule, and the 77bpIR element may modulate expression of surface polysaccharides in P. gingivalis. IMPORTANCE The periodontal pathogen Porphyromonas gingivalis displays at least three different types of cell surface glycans: O-LPS, A-LPS, and K-antigen capsule. We have shown using Northern analysis that the K-antigen capsule locus encodes a large transcript (∼19.4 kb), encompassing a 77-bp inverted repeat (77bpIR) element near the 5′ end. Here, we report on the identification of an antisense RNA (asRNA) encoded within the 77bpIR. We show that overexpression of this asRNA or deletion of the element decreases the amount of capsule. LPS structures were also altered by deletion of the 77bpIR, and reactivity to monoclonal antibodies to both O-LPS and A-LPS was eliminated. Our data indicate that the 77bpIR element is involved in modulating both LPS and capsule synthesis in P. gingivalis. PMID:25622614

Identification of novel deletions of 15q11q13 in Angelman syndrome by array-CGH: molecular characterization and genotype-phenotype correlations.

PubMed

Sahoo, Trilochan; Bacino, Carlos A; German, Jennifer R; Shaw, Chad A; Bird, Lynne M; Kimonis, Virginia; Anselm, Irinia; Waisbren, Susan; Beaudet, Arthur L; Peters, Sarika U

2007-09-01

Angelman syndrome (AS) is a neurodevelopmental disorder characterized by mental retardation, absent speech, ataxia, and a happy disposition. Deletions of the 15q11q13 region are found in approximately 70% of AS patients. The deletions are sub-classified into class I and class II based on their sizes of approximately 6.8 and approximately 6.0, respectively, with two different proximal breakpoints and a common distal breakpoint. Utilizing a chromosome 15-specific comparative genomic hybridization genomic microarray (array-CGH), we have identified, determined the deletion sizes, and mapped the breakpoints in a cohort of 44 cases, to relate those breakpoints to the genomic architecture and derive more precise genotype-phenotype correlations. Interestingly four patients of the 44 studied (9.1%) had novel and unusually large deletions, and are reported here. This is the first report of very large deletions of 15q11q13 resulting in AS; the largest deletion being >10.6 Mb. These novel deletions involve three different distal breakpoints, two of which have been earlier shown to be involved in the generation of isodicentric 15q chromosomes (idic15). Additionally, precise determination of the deletion breakpoints reveals the presence of directly oriented low-copy repeats (LCRs) flanking the recurrent and novel breakpoints. The LCRs are adequate in size, orientation, and homology to enable abnormal recombination events leading to deletions and duplications. This genomic organization provides evidence for a common mechanism for the generation of both common and rare deletion types. Larger deletions result in a loss of several genes outside the common Angelman syndrome-Prader-Willi syndrome (AS-PWS) critical interval, and a more severe phenotype.

PTEN Loss Increases the Connectivity of Fast Synaptic Motifs and Functional Connectivity in a Developing Hippocampal Network.

PubMed

Barrows, Caitlynn M; McCabe, Matthew P; Chen, Hongmei; Swann, John W; Weston, Matthew C

2017-09-06

Changes in synaptic strength and connectivity are thought to be a major mechanism through which many gene variants cause neurological disease. Hyperactivation of the PI3K-mTOR signaling network, via loss of function of repressors such as PTEN, causes epilepsy in humans and animal models, and altered mTOR signaling may contribute to a broad range of neurological diseases. Changes in synaptic transmission have been reported in animal models of PTEN loss; however, the full extent of these changes, and their effect on network function, is still unknown. To better understand the scope of these changes, we recorded from pairs of mouse hippocampal neurons cultured in a two-neuron microcircuit configuration that allowed us to characterize all four major connection types within the hippocampus. Loss of PTEN caused changes in excitatory and inhibitory connectivity, and these changes were postsynaptic, presynaptic, and transynaptic, suggesting that disruption of PTEN has the potential to affect most connection types in the hippocampal circuit. Given the complexity of the changes at the synaptic level, we measured changes in network behavior after deleting Pten from neurons in an organotypic hippocampal slice network. Slices containing Pten -deleted neurons showed increased recruitment of neurons into network bursts. Importantly, these changes were not confined to Pten -deleted neurons, but involved the entire network, suggesting that the extensive changes in synaptic connectivity rewire the entire network in such a way that promotes a widespread increase in functional connectivity. SIGNIFICANCE STATEMENT Homozygous deletion of the Pten gene in neuronal subpopulations in the mouse serves as a valuable model of epilepsy caused by mTOR hyperactivation. To better understand how gene deletions lead to altered neuronal activity, we investigated the synaptic and network effects that occur 1 week after Pten deletion. PTEN loss increased the connectivity of all four types of hippocampal synaptic connections, including two forms of increased inhibition of inhibition, and increased network functional connectivity. These data suggest that single gene mutations that cause neurological diseases such as epilepsy may affect a surprising range of connection types. Moreover, given the robustness of homeostatic plasticity, these diverse effects on connection types may be necessary to cause network phenotypes such as increased synchrony. Copyright © 2017 the authors 0270-6474/17/378595-17$15.00/0.

PTEN Loss Increases the Connectivity of Fast Synaptic Motifs and Functional Connectivity in a Developing Hippocampal Network

PubMed Central

McCabe, Matthew P.; Chen, Hongmei; Swann, John W.

2017-01-01

Changes in synaptic strength and connectivity are thought to be a major mechanism through which many gene variants cause neurological disease. Hyperactivation of the PI3K-mTOR signaling network, via loss of function of repressors such as PTEN, causes epilepsy in humans and animal models, and altered mTOR signaling may contribute to a broad range of neurological diseases. Changes in synaptic transmission have been reported in animal models of PTEN loss; however, the full extent of these changes, and their effect on network function, is still unknown. To better understand the scope of these changes, we recorded from pairs of mouse hippocampal neurons cultured in a two-neuron microcircuit configuration that allowed us to characterize all four major connection types within the hippocampus. Loss of PTEN caused changes in excitatory and inhibitory connectivity, and these changes were postsynaptic, presynaptic, and transynaptic, suggesting that disruption of PTEN has the potential to affect most connection types in the hippocampal circuit. Given the complexity of the changes at the synaptic level, we measured changes in network behavior after deleting Pten from neurons in an organotypic hippocampal slice network. Slices containing Pten-deleted neurons showed increased recruitment of neurons into network bursts. Importantly, these changes were not confined to Pten-deleted neurons, but involved the entire network, suggesting that the extensive changes in synaptic connectivity rewire the entire network in such a way that promotes a widespread increase in functional connectivity. SIGNIFICANCE STATEMENT Homozygous deletion of the Pten gene in neuronal subpopulations in the mouse serves as a valuable model of epilepsy caused by mTOR hyperactivation. To better understand how gene deletions lead to altered neuronal activity, we investigated the synaptic and network effects that occur 1 week after Pten deletion. PTEN loss increased the connectivity of all four types of hippocampal synaptic connections, including two forms of increased inhibition of inhibition, and increased network functional connectivity. These data suggest that single gene mutations that cause neurological diseases such as epilepsy may affect a surprising range of connection types. Moreover, given the robustness of homeostatic plasticity, these diverse effects on connection types may be necessary to cause network phenotypes such as increased synchrony. PMID:28751459

Haploid deletion strains of Saccharomyces cerevisiae that determine survival during space flight

NASA Astrophysics Data System (ADS)

Johanson, Kelly; Allen, Patricia L.; Gonzalez-Villalobos, Romer A.; Nesbit, Jacqueline; Nickerson, Cheryl A.; Höner zu Bentrup, Kerstin; Wilson, James W.; Ramamurthy, Rajee; D'Elia, Riccardo; Muse, Kenneth E.; Hammond, Jeffrey; Freeman, Jake; Stodieck, Louis S.; Hammond, Timothy G.

2007-02-01

This study identifies genes that determine survival during a space flight, using the model eukaryotic organism, Saccharomyces cerevisiae. Select strains of a haploid yeast deletion series grew during storage in distilled water in space, but not in ground based static or clinorotation controls. The survival advantages in space in distilled water include a 133-fold advantage for the deletion of PEX19, a chaperone and import receptor for newly- synthesized class I peroxisomal membrane proteins, to 77-40 fold for deletion strains lacking elements of aerobic respiration, isocitrate metabolism, and mitochondrial electron transport. Following automated addition of rich growth media, the space flight was associated with a marked survival advantage of strains with deletions in catalytically active genes including hydrolases, oxidoreductases and transferases. When compared to static controls, space flight was associated with a marked survival disadvantage of deletion strains lacking transporter, antioxidant and catalytic activity. This study identifies yeast deletion strains with a survival advantage during storage in distilled water and space flight, and amplifies our understanding of the genes critical for survival in space.

Internal loop/bulge and hairpin loop of the iron-responsive element of ferritin mRNA contribute to maximal iron regulatory protein 2 binding and translational regulation in the iso-iron-responsive element/iso-iron regulatory protein family.

PubMed

Ke, Y; Sierzputowska-Gracz, H; Gdaniec, Z; Theil, E C

2000-05-23

Iron-responsive elements (IREs), a natural group of mRNA-specific sequences, bind iron regulatory proteins (IRPs) differentially and fold into hairpins [with a hexaloop (HL) CAGUGX] with helical distortions: an internal loop/bulge (IL/B) (UGC/C) or C-bulge. C-bulge iso-IREs bind IRP2 more poorly, as oligomers (n = 28-30), and have a weaker signal response in vivo. Two trans-loop GC base pairs occur in the ferritin IRE (IL/B and HL) but only one in C-bulge iso-IREs (HL); metal ions and protons perturb the IL/B [Gdaniec et al. (1998) Biochemistry 37, 1505-1512]. IRE function (translation) and physical properties (T(m) and accessibility to nucleases) are now compared for IL/B and C-bulge IREs and for HL mutants. Conversion of the IL/B into a C-bulge by a single deletion in the IL/B or by substituting the HL CG base pair with UA both derepressed ferritin synthesis 4-fold in rabbit reticulocyte lysates (IRP1 + IRP2), confirming differences in IRP2 binding observed for the oligomers. Since the engineered C-bulge IRE was more helical near the IL/B [Cu(phen)(2) resistant] and more stable (T(m) increased) and the HL mutant was less helical near the IL/B (ribonuclease T1 sensitive) and less stable (T(m) decreased), both CG trans-loop base pairs contribute to maximum IRP2 binding and translational regulation. The (1)H NMR spectrum of the Mg-IRE complex revealed, in contrast to the localized IL/B effects of Co(III) hexaammine observed previously, perturbation of the IL/B plus HL and interloop helix. The lower stability and greater helix distortion in the ferritin IL/B-IRE compared to the C-bulge iso-IREs create a combinatorial set of RNA/protein interactions that control protein synthesis rates with a range of signal sensitivities.

Chromosomal location and genetic mapping of the mismatch repair gene homologs MSH2, MSH3, and MSH6 in rye and wheat

PubMed

Korzun; Borner; Siebert; Malyshev; Hilpert; Kunze; Puchta

1999-12-01

The efficiency of homeologous recombination is influenced by mismatch repair genes in bacteria, yeast, and mammals. To elucidate a possible role of these genes in homeologous pairing and cross-compatibility in plants, gene probes of wheat (Triticum aestivum) specific for the mismatch repair gene homologues MSH2, MSH3, and MSH6 were used to map them to their genomic positions in rye (Secale cereale). Whereas MSH2 was mapped to the short arm of chromosome 1R, MSH3 was mapped to the long arm of chromosome 2R and MSH6 to the long arm of chromosome 5R. Southern blots with nullisomic-tetrasomic (NT) lines of wheat indicated the presence of the sequences on the respective homeologous group of wheat chromosomes. Additionally, an MSH6-specific homologue could also be detected on homoeologous group 3 of wheat. However, in the well-known, highly homoeologous pairing wheat mutant ph1b the MSH6-specific sequence is not within the deleted part of chromosome 5BL, indicating that the pairing phenotype is not due to a loss of one of the mismatch repair genes tested.

Geometric figure–ground cues override standard depth from accretion-deletion

PubMed Central

Tanrıkulu, Ömer Dağlar; Froyen, Vicky; Feldman, Jacob; Singh, Manish

2016-01-01

Accretion-deletion is widely considered a decisive cue to surface depth ordering, with the accreting or deleting surface interpreted as behind an adjoining surface. However, Froyen, Feldman, and Singh (2013) have shown that when accretion-deletion occurs on both sides of a contour, accreting-deleting regions can also be perceived as in front and as self-occluding due to rotation in three dimensions. In this study we ask whether geometric figure–ground cues can override the traditional “depth from accretion-deletion” interpretation even when accretion-deletion takes place only on one side of a contour. We used two tasks: a relative-depth task (front/back), and a motion-classification task (translation/rotation). We conducted two experiments, in which texture in only one set of alternating regions was moving; the other set was static. Contrary to the traditional interpretation of accretion-deletion, the moving convex and symmetric regions were perceived as figural and rotating in three dimensions in roughly half of the trials. In the second experiment, giving different motion directions to the moving regions (thereby weakening motion-based grouping) further weakened the traditional accretion-deletion interpretation. Our results show that the standard “depth from accretion-deletion” interpretation is overridden by static geometric cues to figure–ground. Overall, the results demonstrate a rich interaction between accretion-deletion, figure–ground, and structure from motion that is not captured by existing models of depth from motion. PMID:26982528

Haploinsufficiency of SOX5 at 12p12.1 is associated with developmental delays with prominent language delay, behavior problems, and mild dysmorphic features.

PubMed

Lamb, Allen N; Rosenfeld, Jill A; Neill, Nicholas J; Talkowski, Michael E; Blumenthal, Ian; Girirajan, Santhosh; Keelean-Fuller, Debra; Fan, Zheng; Pouncey, Jill; Stevens, Cathy; Mackay-Loder, Loren; Terespolsky, Deborah; Bader, Patricia I; Rosenbaum, Kenneth; Vallee, Stephanie E; Moeschler, John B; Ladda, Roger; Sell, Susan; Martin, Judith; Ryan, Shawnia; Jones, Marilyn C; Moran, Rocio; Shealy, Amy; Madan-Khetarpal, Suneeta; McConnell, Juliann; Surti, Urvashi; Delahaye, Andrée; Heron-Longe, Bénédicte; Pipiras, Eva; Benzacken, Brigitte; Passemard, Sandrine; Verloes, Alain; Isidor, Bertrand; Le Caignec, Cedric; Glew, Gwen M; Opheim, Kent E; Descartes, Maria; Eichler, Evan E; Morton, Cynthia C; Gusella, James F; Schultz, Roger A; Ballif, Blake C; Shaffer, Lisa G

2012-04-01

SOX5 encodes a transcription factor involved in the regulation of chondrogenesis and the development of the nervous system. Despite its important developmental roles, SOX5 disruption has yet to be associated with human disease. We report one individual with a reciprocal translocation breakpoint within SOX5, eight individuals with intragenic SOX5 deletions (four are apparently de novo and one inherited from an affected parent), and seven individuals with larger 12p12 deletions encompassing SOX5. Common features in these subjects include prominent speech delay, intellectual disability, behavior abnormalities, and dysmorphic features. The phenotypic impact of the deletions may depend on the location of the deletion and, consequently, which of the three major SOX5 protein isoforms are affected. One intragenic deletion, involving only untranslated exons, was present in a more mildly affected subject, was inherited from a healthy parent and grandparent, and is similar to a deletion found in a control cohort. Therefore, some intragenic SOX5 deletions may have minimal phenotypic effect. Based on the location of the deletions in the subjects compared to the controls, the de novo nature of most of these deletions, and the phenotypic similarities among cases, SOX5 appears to be a dosage-sensitive, developmentally important gene. © 2012 Wiley Periodicals, Inc.

Recurrent Deletions of Puroindoline Genes at the Grain Hardness Locus in Four Independent Lineages of Polyploid Wheat1[W][OA

PubMed Central

Li, Wanlong; Huang, Li; Gill, Bikram S.

2008-01-01

Polyploidy is known to induce numerous genetic and epigenetic changes but little is known about their physiological bases. In wheat, grain texture is mainly determined by the Hardness (Ha) locus consisting of genes Puroindoline a (Pina) and b (Pinb). These genes are conserved in diploid progenitors but were deleted from the A and B genomes of tetraploid Triticum turgidum (AB). We now report the recurrent deletions of Pina-Pinb in other lineages of polyploid wheat. We analyzed the Ha haplotype structure in 90 diploid and 300 polyploid accessions of Triticum and Aegilops spp. Pin genes were conserved in all diploid species and deletion haplotypes were detected in all polyploid Triticum and most of the polyploid Aegilops spp. Two Pina-Pinb deletion haplotypes were found in hexaploid wheat (Triticum aestivum; ABD). Pina and Pinb were eliminated from the G genome, but maintained in the A genome of tetraploid Triticum timopheevii (AG). Subsequently, Pina and Pinb were deleted from the A genome but retained in the Am genome of hexaploid Triticum zhukovskyi (AmAG). Comparison of deletion breakpoints demonstrated that the Pina-Pinb deletion occurred independently and recurrently in the four polyploid wheat species. The implications of Pina-Pinb deletions for polyploid-driven evolution of gene and genome and its possible physiological significance are discussed. PMID:18024553

1p36 deletion syndrome associated with Prader-Willi-like phenotype.

PubMed

Tsuyusaki, Yu; Yoshihashi, Hiroshi; Furuya, Noritaka; Adachi, Masanori; Osaka, Hitoshi; Yamamoto, Kayono; Kurosawa, Kenji

2010-08-01

1p36 deletion syndrome is one of the most common subtelomeric deletion syndromes, characterized by moderate to severe mental retardation, characteristic facial appearance, hypotonia, obesity, and seizures. The clinical features often overlap with those of Prader-Willi syndrome (PWS). To elucidate the phenotype-genotype correlation in 1p36 deletion syndrome, two cases involving a PWS-like phenotype were analyzed on molecular cytogenetics. Two patients presenting with the PWS-like phenotype but having negative results for PWS underwent fluorescence in situ hybridization (FISH). The size of the chromosome 1p36 deletions was characterized using probes of BAC clones based on the University of California, Santa Cruz (UCSC) Genome Browser. PWS was excluded on FISH and methylation-specific polymerase chain reaction. Subsequent FISH using the probe D1Z2 showed deletion of the 1p36.3 region, confirming the diagnosis of 1p36 deletion syndrome. Further analysis characterized the 1p36 deletions as being located between 4.17 and 4.36 Mb in patient 1 and between 4.89 and 6.09 Mb in patient 2. Patients with 1p36 deletion syndrome exhibit a PWS-like phenotype and are therefore probably underdiagnosed. The possible involvement of the terminal 4 Mb region of chromosome 1p36 in the PWS-like phenotype is hypothesized. © 2010 Japan Pediatric Society.

Structural and functional analysis of an enhancer GPEI having a phorbol 12-O-tetradecanoate 13-acetate responsive element-like sequence found in the rat glutathione transferase P gene.

PubMed

Okuda, A; Imagawa, M; Maeda, Y; Sakai, M; Muramatsu, M

1989-10-05

We have recently identified a typical enhancer, termed GPEI, located about 2.5 kilobases upstream from the transcription initiation site of the rat glutathione transferase P gene. Analyses of 5' and 3' deletion mutants revealed that the cis-acting sequence of GPEI contained the phorbol 12-O-tetradecanoate 13-acetate responsive element (TRE)-like sequence in it. For the maximal activity, however, GPEI required an adjacent upstream sequence of about 19 base pairs in addition to the TRE-like sequence. With the DNA binding gel-shift assay, we could detect protein(s) that specifically binds to the TRE-like sequence of GPEI fragment, which was possibly c-jun.c-fos complex or a similar protein complex. The sequence immediately upstream of the TRE-like sequence did not have any activity by itself, but augmented the latter activity by about 5-fold.

DMRTA2 (DMRT5) is mutated in a novel cortical brain malformation.

PubMed

Urquhart, J E; Beaman, G; Byers, H; Roberts, N A; Chervinsky, E; O'Sullivan, J; Pilz, D; Fry, A; Williams, S G; Bhaskar, S S; Khayat, M; Simanovsky, N; Shachar, I B; Shalev, S A; Newman, W G

2016-06-01

Lissencephaly is a phenotypically and genetically heterogeneous group of cortical brain malformations due to abnormal neuronal migration. The identification of many causative genes has increased the understanding of normal brain development. A consanguineous family was ascertained with three siblings affected by a severe prenatal neurodevelopmental disorder characterised by fronto-parietal pachygyria, agenesis of the corpus callosum and progressive severe microcephaly. Autozygosity mapping and exome sequencing identified a homozygous novel single base pair deletion, c.1197delT in DMRTA2, predicted to result in a frameshift variant p.(Pro400Leufs*33). DMRTA2 encodes doublesex and mab-3-related transcription factor a2, a transcription factor key to the development of the dorsal telencephalon. Data from murine and zebrafish knockout models are consistent with the variant of DMTRA2 (DMRT5) as responsible for the cortical brain phenotype. Our study suggests that loss of function of DMRTA2 leads to a novel disorder of cortical development. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Familial recurrence of SOX2 anophthalmia syndrome: phenotypically normal mother with two affected daughters.

PubMed

Schneider, Adele; Bardakjian, Tanya M; Zhou, Jie; Hughes, Nkecha; Keep, Rosanne; Dorsainville, Darnelle; Kherani, Femida; Katowitz, James; Schimmenti, Lisa A; Hummel, Marybeth; Fitzpatrick, David R; Young, Terri L

2008-11-01

The SOX2 anophthalmia syndrome is emerging as a clinically recognizable disorder that has been identified in 10-15% of individuals with bilateral anophthalmia. Extra-ocular anomalies are common. The majority of SOX2 mutations identified appear to arise de novo in probands ascertained through the presence of anophthalmia or microphthalmia. In this report, we describe two sisters with bilateral anophthalmia/microphthalmia, brain anomalies and a novel heterozygous SOX2 gene single-base pair nucleotide deletion, c.551delC, which predicts p.Pro184ArgfsX19. The hypothetical protein product is predicted to lead to haploinsufficient SOX2 function. Mosaicism for this mutation in the SOX2 gene was also identified in their clinically unaffected mother in peripheral blood DNA. Thus it cannot be assumed that all SOX2 mutations in individuals with anophthalmia/microphthalmia are de novo. Testing of parents is indicated when a SOX2 mutation is identified in a proband. Copyright 2008 Wiley-Liss, Inc.

Familial Recurrence of SOX2 Anophthalmia Syndrome: Phenotypically Normal Mother with Two Affected Daughters

PubMed Central

Schneider, Adele; Bardakjian, Tanya M.; Zhou, Jie; Hughes, Nkecha; Keep, Rosanne; Dorsainville, Darnelle; Kherani, Femida; Katowitz, James; Schimmenti, Lisa A.; Hummel, Marybeth; FitzPatrick, David R; Young, Terri L.

2013-01-01

The SOX2 anophthalmia syndrome is emerging as a clinically recognizable disorder that has been identified in 10–15% of individuals with bilateral anophthalmia. Extra-ocular anomalies are common. The majority of SOX2 mutations identified appear to arise de novo in probands ascertained through the presence of anophthalmia or microphthalmia. In this report, we describe two sisters with bilateral anophthalmia/microphthalmia, brain anomalies and a novel heterozygous SOX2 gene single-base pair nucleotide deletion, c.551delC, which predicts p.Pro184ArgfsX19. The hypothetical protein product is predicted to lead to haploinsufficient SOX2 function. Mosaicism for this mutation in the SOX2 gene was also identified in their clinically unaffected mother in peripheral blood DNA. Thus it cannot be assumed that all SOX2 mutations in individuals with anophthalmia /microphthalmia are de novo. Testing of parents is indicated when a SOX2 mutation is identified in a proband. PMID:18831064

Involvement of a Polyketide Synthetase ClPKS18 in the Regulation of Vegetative Growth, Melanin and Toxin Synthesis, and Virulence in Curvularia lunata.

PubMed

Gao, Jin-Xin; Chen, Jie

2017-12-01

The clpks18 gene was first cloned and identified in Curvularia lunata. It contains 6571 base pairs (bp) and an 6276 bp open reading frame encoding 2091 amino acids. The ClPKS18 deletion mutant displayed an albino phenotype, and almost lost the ability to product 5-(hydroxymethyl) furan-2-carboxylate (M5HF2C) toxin, implying that clpks18 gene in C. lunata is not only involved in 1,8-dihydroxynaphthalene melanin synthesis, but also relatively associated with M5HF2C toxin biosynthesis of the pathogen. The pathogenicity assays revealed that ΔClPKS18 was impaired in colonizing the maize leaves, which corresponds to the finding that ClPKS18 controls the production of melanin and M5HF2C in C. lunata . Results indicate that ClPKS18 plays a vital role in regulating pathogenicity of in C. lunata .

Effective oligonucleotide-mediated gene disruption in ES cells lacking the mismatch repair protein MSH3.

PubMed

Dekker, M; Brouwers, C; Aarts, M; van der Torre, J; de Vries, S; van de Vrugt, H; te Riele, H

2006-04-01

We have previously demonstrated that site-specific insertion, deletion or substitution of one or two nucleotides in mouse embryonic stem cells (ES cells) by single-stranded deoxyribo-oligonucleotides is several hundred-fold suppressed by DNA mismatch repair (MMR) activity. Here, we have investigated whether compound mismatches and larger insertions escape detection by the MMR machinery and can be effectively introduced in MMR-proficient cells. We identified several compound mismatches that escaped detection by the MMR machinery to some extent, but could not define general rules predicting the efficacy of complex base-pair substitutions. In contrast, we found that four-nucleotide insertions were largely subject to suppression by the MSH2/MSH3 branch of MMR and could be effectively introduced in Msh3-deficient cells. As these cells have no overt mutator phenotype and Msh3-deficient mice do not develop cancer, Msh3-deficient ES cells can be used for oligonucleotide-mediated gene disruption. As an example, we present disruption of the Fanconi anemia gene Fancf.

Plasmid P1 replication: negative control by repeated DNA sequences.

PubMed Central

Chattoraj, D; Cordes, K; Abeles, A

1984-01-01

The incompatibility locus, incA, of the unit-copy plasmid P1 is contained within a fragment that is essentially a set of nine 19-base-pair repeats. One or more copies of the fragment destabilizes the plasmid when present in trans. Here we show that extra copies of incA interfere with plasmid DNA replication and that a deletion of most of incA increases plasmid copy number. Thus, incA is not essential for replication but is required for its control. When cloned in a high-copy-number vector, pieces of the incA fragment that each contain only three repeats destabilize P1 plasmids efficiently. This result makes it unlikely that incA specifies a regulatory product. Our in vivo results suggest that the repeating DNA sequence itself negatively controls replication by titrating a P1-determined protein, RepA, that is essential for replication. Consistent with this hypothesis is the observation that the RepA protein binds to the incA fragment in vitro. Images PMID:6387706

Precise assignment of the heavy-strand promoter of mouse mitochondrial DNA: cognate start sites are not required for transcriptional initiation.

PubMed Central

Chang, D D; Clayton, D A

1986-01-01

Transcription of the heavy strand of mouse mitochondrial DNA starts from two closely spaced, distinct sites located in the displacement loop region of the genome. We report here an analysis of regulatory sequences required for faithful transcription from these two sites. Data obtained from in vitro assays demonstrated that a 51-base-pair region, encompassing nucleotides -40 to +11 of the downstream start site, contains sufficient information for accurate transcription from both start sites. Deletion of the 3' flanking sequences, including one or both start sites to -17, resulted in the initiation of transcription by the mitochondrial RNA polymerase from alternative sites within vector DNA sequences. This feature places the mouse heavy-strand promoter uniquely among other known mitochondrial promoters, all of which absolutely require cognate start sites for transcription. Comparison of the heavy-strand promoter with those of other vertebrate mitochondrial DNAs revealed a remarkably high rate of sequence divergence among species. Images PMID:3785226

Impact of DNA mismatch repair system alterations on human fertility and related treatments.

PubMed

Hu, Min-hao; Liu, Shu-yuan; Wang, Ning; Wu, Yan; Jin, Fan

2016-01-01

DNA mismatch repair (MMR) is one of the biological pathways, which plays a critical role in DNA homeostasis, primarily by repairing base-pair mismatches and insertion/deletion loops that occur during DNA replication. MMR also takes part in other metabolic pathways and regulates cell cycle arrest. Defects in MMR are associated with genomic instability, predisposition to certain types of cancers and resistance to certain therapeutic drugs. Moreover, genetic and epigenetic alterations in the MMR system demonstrate a significant relationship with human fertility and related treatments, which helps us to understand the etiology and susceptibility of human infertility. Alterations in the MMR system may also influence the health of offspring conceived by assisted reproductive technology in humans. However, further studies are needed to explore the specific mechanisms by which the MMR system may affect human infertility. This review addresses the physiological mechanisms of the MMR system and associations between alterations of the MMR system and human fertility and related treatments, and potential effects on the next generation.

Constitutional chromothripsis rearrangements involve clustered double-stranded DNA breaks and nonhomologous repair mechanisms.

PubMed

Kloosterman, Wigard P; Tavakoli-Yaraki, Masoumeh; van Roosmalen, Markus J; van Binsbergen, Ellen; Renkens, Ivo; Duran, Karen; Ballarati, Lucia; Vergult, Sarah; Giardino, Daniela; Hansson, Kerstin; Ruivenkamp, Claudia A L; Jager, Myrthe; van Haeringen, Arie; Ippel, Elly F; Haaf, Thomas; Passarge, Eberhard; Hochstenbach, Ron; Menten, Björn; Larizza, Lidia; Guryev, Victor; Poot, Martin; Cuppen, Edwin

2012-06-28

Chromothripsis represents a novel phenomenon in the structural variation landscape of cancer genomes. Here, we analyze the genomes of ten patients with congenital disease who were preselected to carry complex chromosomal rearrangements with more than two breakpoints. The rearrangements displayed unanticipated complexity resembling chromothripsis. We find that eight of them contain hallmarks of multiple clustered double-stranded DNA breaks (DSBs) on one or more chromosomes. In addition, nucleotide resolution analysis of 98 breakpoint junctions indicates that break repair involves nonhomologous or microhomology-mediated end joining. We observed that these eight rearrangements are balanced or contain sporadic deletions ranging in size between a few hundred base pairs and several megabases. The two remaining complex rearrangements did not display signs of DSBs and contain duplications, indicative of rearrangement processes involving template switching. Our work provides detailed insight into the characteristics of chromothripsis and supports a role for clustered DSBs driving some constitutional chromothripsis rearrangements. Copyright © 2012 The Authors. Published by Elsevier Inc. All rights reserved.

Genome-Wide Analysis of Syntenic Gene Deletion in the Grasses

PubMed Central

Schnable, James C.; Freeling, Michael; Lyons, Eric

2012-01-01

The grasses, Poaceae, are one of the largest and most successful angiosperm families. Like many radiations of flowering plants, the divergence of the major grass lineages was preceded by a whole-genome duplication (WGD), although these events are not rare for flowering plants. By combining identification of syntenic gene blocks with measures of gene pair divergence and different frequencies of ancient gene loss, we have separated the two subgenomes present in modern grasses. Reciprocal loss of duplicated genes or genomic regions has been hypothesized to reproductively isolate populations and, thus, speciation. However, in contrast to previous studies in yeast and teleost fishes, we found very little evidence of reciprocal loss of homeologous genes between the grasses, suggesting that post-WGD gene loss may not be the cause of the grass radiation. The sets of homeologous and orthologous genes and predicted locations of deleted genes identified in this study, as well as links to the CoGe comparative genomics web platform for analyzing pan-grass syntenic regions, are provided along with this paper as a resource for the grass genetics community. PMID:22275519

Characterization of a complex chromosomal rearrangement using chromosome, FISH, and microarray assays in a girl with multiple congenital abnormalities and developmental delay.

PubMed

Hemmat, Morteza; Yang, Xiaojing; Chan, Patricia; McGough, Robert A; Ross, Leslie; Mahon, Loretta W; Anguiano, Arturo L; Boris, Wang T; Elnaggar, Mohamed M; Wang, Jia-Chi J; Strom, Charles M; Boyar, Fatih Z

2014-01-01

Complex chromosomal rearrangements (CCRs) are balanced or unbalanced structural rearrangements involving three or more cytogenetic breakpoints on two or more chromosomal pairs. The phenotypic anomalies in such cases are attributed to gene disruption, superimposed cryptic imbalances in the genome, and/or position effects. We report a 14-year-old girl who presented with multiple congenital anomalies and developmental delay. Chromosome and FISH analysis indicated a highly complex chromosomal rearrangement involving three chromosomes (3, 7 and 12), seven breakpoints as a result of one inversion, two insertions, and two translocations forming three derivative chromosomes. Additionally, chromosomal microarray study (CMA) revealed two submicroscopic deletions at 3p12.3 (467 kb) and 12q13.12 (442 kb). We postulate that microdeletion within the ROBO1 gene at 3p12.3 may have played a role in the patient's developmental delay, since it has potential activity-dependent role in neurons. Additionally, factors other than genomic deletions such as loss of function or position effects may also contribute to the abnormal phenotype in our patient.

2q37 Deletion syndrome confirmed by high-resolution cytogenetic analysis

PubMed Central

Cho, Eun-Kyung; Kim, Jinsup; Yang, Aram; Jin, Dong-Kyu

2017-01-01

Chromosome 2q37 deletion syndrome is a rare chromosomal disorder characterized by mild to moderate developmental delay, brachydactyly of the third to fifth digits or toes, short stature, obesity, hypotonia, a characteristic facial appearance, and autism spectrum disorder. Here, we report on a patient with 2q37 deletion presenting with dilated cardiomyopathy (DCMP). Congenital heart malformations have been noted in up to 20% of patients with 2q37 deletions. However, DCMP has not been reported in 2q37 deletion patients previously. The patient exhibited the characteristic facial appearance (a flat nasal bridge, deep-set eyes, arched eyebrows, and a thin upper lip), developmental delay, mild mental retardation, peripheral nerve palsy, and Albright hereditary osteodystrophy (AHO)-like phenotypes (short stature and brachydactyly). Conventional chromosomal analysis results were normal; however, microarray-based comparative genomic hybridization revealed terminal deletion at 2q37.1q37.3. In addition, the patient was confirmed to have partial growth hormone (GH) deficiency and had shown a significant increase in growth rate after substitutive GH therapy. Chromosome 2q37 deletion syndrome should be considered in the differential diagnosis of patients presenting with AHO features, especially in the presence of facial dysmorphism. When patients are suspected of having a 2q37 deletion, high-resolution cytogenetic analysis is recommended. PMID:28690993

Are syllabification and resyllabification strategies phonotactically directed in French children with dyslexia? A preliminary report.

PubMed

Maïonchi-Pino, Norbert; de Cara, Bruno; Ecalle, Jean; Magnan, Annie

2012-04-01

In this study, the authors queried whether French-speaking children with dyslexia were sensitive to consonant sonority and position within syllable boundaries to influence a phonological syllable-based segmentation in silent reading. Participants included 15 French-speaking children with dyslexia, compared with 30 chronological age-matched and reading level-matched controls. Children were tested with an audiovisual recognition task. A target pseudoword (TOLPUDE) was simultaneously presented visually and auditorily and then was compared with a printed test pseudoword that either was identical or differed after the coda deletion (TOPUDE) or the onset deletion (TOLUDE). The intervocalic consonant sequences had either a sonorant coda-sonorant onset (TOR.LADE), sonorant coda-obstruent onset (TOL.PUDE), obstruent coda-sonorant onset (DOT.LIRE), or obstruent coda-obstruent onset (BIC.TADE) sonority profile. All children processed identity better than they processed deletion, especially with the optimal sonorant coda-obstruent onset sonority profile. However, children preserved syllabification (coda deletion; TO.PUDE) rather than resyllabification (onset deletion; TO.LUDE) with intervocalic consonant sequence reductions, especially when sonorant codas were deleted but the optimal intersyllable contact was respected. It was surprising to find that although children with dyslexia generally exhibit phonological and acoustic-phonetic impairments (voicing), they showed sensitivity to the optimal sonority profile and a preference for preserved syllabification. The authors proposed a sonority-modulated explanation to account for phonological syllable-based processing. Educational implications are discussed.

Pathological mechanisms underlying single large‐scale mitochondrial DNA deletions

PubMed Central

Rocha, Mariana C.; Rosa, Hannah S.; Grady, John P.; Blakely, Emma L.; He, Langping; Romain, Nadine; Haller, Ronald G.; Newman, Jane; McFarland, Robert; Ng, Yi Shiau; Gorman, Grainne S.; Schaefer, Andrew M.; Tuppen, Helen A.; Taylor, Robert W.

2018-01-01

Objective Single, large‐scale deletions in mitochondrial DNA (mtDNA) are a common cause of mitochondrial disease. This study aimed to investigate the relationship between the genetic defect and molecular phenotype to improve understanding of pathogenic mechanisms associated with single, large‐scale mtDNA deletions in skeletal muscle. Methods We investigated 23 muscle biopsies taken from adult patients (6 males/17 females with a mean age of 43 years) with characterized single, large‐scale mtDNA deletions. Mitochondrial respiratory chain deficiency in skeletal muscle biopsies was quantified by immunoreactivity levels for complex I and complex IV proteins. Single muscle fibers with varying degrees of deficiency were selected from 6 patient biopsies for determination of mtDNA deletion level and copy number by quantitative polymerase chain reaction. Results We have defined 3 “classes” of single, large‐scale deletion with distinct patterns of mitochondrial deficiency, determined by the size and location of the deletion. Single fiber analyses showed that fibers with greater respiratory chain deficiency harbored higher levels of mtDNA deletion with an increase in total mtDNA copy number. For the first time, we have demonstrated that threshold levels for complex I and complex IV deficiency differ based on deletion class. Interpretation Combining genetic and immunofluorescent assays, we conclude that thresholds for complex I and complex IV deficiency are modulated by the deletion of complex‐specific protein‐encoding genes. Furthermore, removal of mt‐tRNA genes impacts specific complexes only at high deletion levels, when complex‐specific protein‐encoding genes remain. These novel findings provide valuable insight into the pathogenic mechanisms associated with these mutations. Ann Neurol 2018;83:115–130 PMID:29283441

An Improved Single-Step Cloning Strategy Simplifies the Agrobacterium tumefaciens-Mediated Transformation (ATMT)-Based Gene-Disruption Method for Verticillium dahliae.

PubMed

Wang, Sheng; Xing, Haiying; Hua, Chenlei; Guo, Hui-Shan; Zhang, Jie

2016-06-01

The soilborne fungal pathogen Verticillium dahliae infects a broad range of plant species to cause severe diseases. The availability of Verticillium genome sequences has provided opportunities for large-scale investigations of individual gene function in Verticillium strains using Agrobacterium tumefaciens-mediated transformation (ATMT)-based gene-disruption strategies. Traditional ATMT vectors require multiple cloning steps and elaborate characterization procedures to achieve successful gene replacement; thus, these vectors are not suitable for high-throughput ATMT-based gene deletion. Several advancements have been made that either involve simplification of the steps required for gene-deletion vector construction or increase the efficiency of the technique for rapid recombinant characterization. However, an ATMT binary vector that is both simple and efficient is still lacking. Here, we generated a USER-ATMT dual-selection (DS) binary vector, which combines both the advantages of the USER single-step cloning technique and the efficiency of the herpes simplex virus thymidine kinase negative-selection marker. Highly efficient deletion of three different genes in V. dahliae using the USER-ATMT-DS vector enabled verification that this newly-generated vector not only facilitates the cloning process but also simplifies the subsequent identification of fungal homologous recombinants. The results suggest that the USER-ATMT-DS vector is applicable for efficient gene deletion and suitable for large-scale gene deletion in V. dahliae.

Functional Studies and Homology Modeling of Msh2-Msh3 Predict that Mispair Recognition Involves DNA Bending and Strand Separation▿ †

PubMed Central

Dowen, Jill M.; Putnam, Christopher D.; Kolodner, Richard D.

2010-01-01

The Msh2-Msh3 heterodimer recognizes various DNA mispairs, including loops of DNA ranging from 1 to 14 nucleotides and some base-base mispairs. Homology modeling of the mispair-binding domain (MBD) of Msh3 using the related Msh6 MBD revealed that mismatch recognition must be different, even though the MBD folds must be similar. Model-based point mutation alleles of Saccharomyces cerevisiae msh3 designed to disrupt mispair recognition fell into two classes. One class caused defects in repair of both small and large insertion/deletion mispairs, whereas the second class caused defects only in the repair of small insertion/deletion mispairs; mutations of the first class also caused defects in the removal of nonhomologous tails present at the ends of double-strand breaks (DSBs) during DSB repair, whereas mutations of the second class did not cause defects in the removal of nonhomologous tails during DSB repair. Thus, recognition of small insertion/deletion mispairs by Msh3 appears to require a greater degree of interactions with the DNA conformations induced by small insertion/deletion mispairs than with those induced by large insertion/deletions that are intrinsically bent and strand separated. Mapping of the two classes of mutations onto the Msh3 MBD model appears to distinguish mispair recognition regions from DNA stabilization regions. PMID:20421420

Functional studies and homology modeling of Msh2-Msh3 predict that mispair recognition involves DNA bending and strand separation.

PubMed

Dowen, Jill M; Putnam, Christopher D; Kolodner, Richard D

2010-07-01

The Msh2-Msh3 heterodimer recognizes various DNA mispairs, including loops of DNA ranging from 1 to 14 nucleotides and some base-base mispairs. Homology modeling of the mispair-binding domain (MBD) of Msh3 using the related Msh6 MBD revealed that mismatch recognition must be different, even though the MBD folds must be similar. Model-based point mutation alleles of Saccharomyces cerevisiae msh3 designed to disrupt mispair recognition fell into two classes. One class caused defects in repair of both small and large insertion/deletion mispairs, whereas the second class caused defects only in the repair of small insertion/deletion mispairs; mutations of the first class also caused defects in the removal of nonhomologous tails present at the ends of double-strand breaks (DSBs) during DSB repair, whereas mutations of the second class did not cause defects in the removal of nonhomologous tails during DSB repair. Thus, recognition of small insertion/deletion mispairs by Msh3 appears to require a greater degree of interactions with the DNA conformations induced by small insertion/deletion mispairs than with those induced by large insertion/deletions that are intrinsically bent and strand separated. Mapping of the two classes of mutations onto the Msh3 MBD model appears to distinguish mispair recognition regions from DNA stabilization regions.

Fine-mapping, mutation analyses, and structural mapping of cerebrotendinous xanthomatosis in U.S. pedigrees.

PubMed

Lee, M H; Hazard, S; Carpten, J D; Yi, S; Cohen, J; Gerhardt, G T; Salen, G; Patel, S B

2001-02-01

Cerebrotendinous xanthomatosis (CTX) is a rare autosomal recessive disorder of bile acid biosynthesis. Clinically, CTX patients present with tendon xanthomas, juvenile cataracts, and progressive neurological dysfunction and can be diagnosed by the detection of elevated plasma cholestanol levels. CTX is caused by mutations affecting the sterol 27-hydroxylase gene (CYP27 ). CTX has been identified in a number of populations, but seems to have a higher prevalence in the Japanese, Sephardic Jewish, and Italian populations. We have assembled 12 previously unreported pedigrees from the United States. The CYP27 locus had been previously mapped to chromosome 2q33-qter. We performed linkage analyses and found no evidence of genetic heterogeneity. All CTX patients showed segregation with the CYP27 locus, and haplotype analysis and recombinant events allowed us to precisely map CYP27 to chromosome 2q35, between markers D2S1371 and D2S424. Twenty-three mutations were identified from 13 probands analyzed thus far; 11 were compound heterozygotes and 2 had homozygous mutations. Of these, five are novel mutations [Trp100Stop, Pro408Ser, Gln428Stop, a 10-base pair (bp) deletion in exon 1, and a 2-bp deletion in exon 6 of the CYP27 gene]. Three-dimensional structural modeling of sterol 27-hydroxylase showed that, while the majority of the missense mutations disrupt the heme-binding and adrenodoxin-binding domains critical for enzyme activity, two missense mutations (Arg94Trp/Gln and Lys226Arg) are clearly located outside these sites and may identify a potential substrate-binding or other protein contact site.

Genetic mapping and predictive testing for multiple endocrine neoplasia type 1 (MEN1)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pandit, S.D.; Read, C.; Liu, L.

1994-09-01

Multiple endocrine neoplasia type 1 (MEN1) is an autosomal dominant disorder with an estimated prevalance of 20-200 per million persons. It is characterized by the combined occurence of tumors involving two or more endocrine glands, namely the parathyroid glands, the endocrine pancreas and the anterior pituitary. This disorder affects virtually all age groups with an average range of 20-60 years. Linkage analysis mapped the MEN1 locus to 11q13 near the human muscle glycogen phosphorylase (PYGM) locus. Additional genetic mapping and deletion analysis studies have refined the region containing the MEN1 locus to a 3 cM interval flanked by markers PYGMmore » and D11S146/D11S97, a physical distance of approximately 1.5 Mb. We have identified 8 large families segregating MEN1 (71 affected from a population of 389 individuals). A high resolution reference map for the 11q13 region has been constructed using four new microsatellite markers, the CEPH reference (40 family) pedigree resource, and the CRI-MAP program package. Subsequent analyses using the LINKAGE program package and 8 MEN 1 families placed the MEN1 locus within the context of the microsatellite map. This map was used to develop a linkage-based predictive test. These markers have also been used to further refine the interval containing the MEN1 locus from the study of chromosome deletions (loss of heterozygosity, LOH studies) in paired sets of tumor and germline DNA from 87 MEN 1 affected individuals.« less

Shortening the HIV-1 TAR RNA Bulge by a Single Nucleotide Preserves Motional Modes over a Broad Range of Time Scales.

PubMed

Merriman, Dawn K; Xue, Yi; Yang, Shan; Kimsey, Isaac J; Shakya, Anisha; Clay, Mary; Al-Hashimi, Hashim M

2016-08-16

Helix-junction-helix (HJH) motifs are flexible building blocks of RNA architecture that help define the orientation and dynamics of helical domains. They are also frequently involved in adaptive recognition of proteins and small molecules and in the formation of tertiary contacts. Here, we use a battery of nuclear magnetic resonance techniques to examine how deleting a single bulge residue (C24) from the human immunodeficiency virus type 1 (HIV-1) transactivation response element (TAR) trinucleotide bulge (U23-C24-U25) affects dynamics over a broad range of time scales. Shortening the bulge has an effect on picosecond-to-nanosecond interhelical and local bulge dynamics similar to that casued by increasing the Mg(2+) and Na(+) concentration, whereby a preexisting two-state equilibrium in TAR is shifted away from a bent flexible conformation toward a coaxial conformation, in which all three bulge residues are flipped out and flexible. Surprisingly, the point deletion minimally affects microsecond-to-millisecond conformational exchange directed toward two low-populated and short-lived excited conformational states that form through reshuffling of bases pairs throughout TAR. The mutant does, however, adopt a slightly different excited conformational state on the millisecond time scale, in which U23 is intrahelical, mimicking the expected conformation of residue C24 in the excited conformational state of wild-type TAR. Thus, minor changes in HJH topology preserve motional modes in RNA occurring over the picosecond-to-millisecond time scales but alter the relative populations of the sampled states or cause subtle changes in their conformational features.

Detection of inherited mutations for breast and ovarian cancer using genomic capture and massively parallel sequencing

PubMed Central

Walsh, Tom; Lee, Ming K.; Casadei, Silvia; Thornton, Anne M.; Stray, Sunday M.; Pennil, Christopher; Nord, Alex S.; Mandell, Jessica B.; Swisher, Elizabeth M.; King, Mary-Claire

2010-01-01

Inherited loss-of-function mutations in the tumor suppressor genes BRCA1, BRCA2, and multiple other genes predispose to high risks of breast and/or ovarian cancer. Cancer-associated inherited mutations in these genes are collectively quite common, but individually rare or even private. Genetic testing for BRCA1 and BRCA2 mutations has become an integral part of clinical practice, but testing is generally limited to these two genes and to women with severe family histories of breast or ovarian cancer. To determine whether massively parallel, “next-generation” sequencing would enable accurate, thorough, and cost-effective identification of inherited mutations for breast and ovarian cancer, we developed a genomic assay to capture, sequence, and detect all mutations in 21 genes, including BRCA1 and BRCA2, with inherited mutations that predispose to breast or ovarian cancer. Constitutional genomic DNA from subjects with known inherited mutations, ranging in size from 1 to >100,000 bp, was hybridized to custom oligonucleotides and then sequenced using a genome analyzer. Analysis was carried out blind to the mutation in each sample. Average coverage was >1200 reads per base pair. After filtering sequences for quality and number of reads, all single-nucleotide substitutions, small insertion and deletion mutations, and large genomic duplications and deletions were detected. There were zero false-positive calls of nonsense mutations, frameshift mutations, or genomic rearrangements for any gene in any of the test samples. This approach enables widespread genetic testing and personalized risk assessment for breast and ovarian cancer. PMID:20616022

Off-line compatible electronic cash method and system

DOEpatents

Kravitz, D.W.; Gemmell, P.S.; Brickell, E.F.

1998-11-03

An off-line electronic cash system having an electronic coin, a bank B, a payee S, and a user U with an account at the bank B as well as a user password z{sub u,i}, has a method for performing an electronic cash transfer. An electronic coin is withdrawn from the bank B by the user U and an electronic record of the electronic coin is stored by the bank B. The coin is paid to the payee S by the user U. The payee S deposits the coin with the bank B. A determination is made that the coin is spent and the record of the coin is deleted by the bank B. A further deposit of the same coin after the record is deleted is determined. Additionally, a determination is made which user U originally withdrew the coin after deleting the record. To perform these operations a key pair is generated by the user, including public and secret signature keys. The public signature key along with a user password z{sub u,i} and a withdrawal amount are sent to the bank B by the user U. In response, the bank B sends a coin to the user U signed by the secret key of the bank indicating the value of the coin and the public key of the user U. The payee S transmits a challenge counter to the user U prior to receiving the coin. 16 figs.

Off-line compatible electronic cash method and system

DOEpatents

Kravitz, David W.; Gemmell, Peter S.; Brickell, Ernest F.

1998-01-01

An off-line electronic cash system having an electronic coin, a bank B, a payee S, and a user U with an account at the bank B as well as a user password z.sub.u,i, has a method for performing an electronic cash transfer. An electronic coin is withdrawn from the bank B by the user U and an electronic record of the electronic coin is stored by the bank B. The coin is paid to the payee S by the user U. The payee S deposits the coin with the bank B. A determination is made that the coin is spent and the record of the coin is deleted by the bank B. A further deposit of the same coin after the record is deleted is determined. Additionally, a determination is made which user U originally withdrew the coin after deleting the record. To perform these operations a key pair is generated by the user, including public and secret signature keys. The public signature key along with a user password z.sub.u,i and a withdrawal amount are sent to the bank B by the user U. In response, the bank B sends a coin to the user U signed by the secret key of the bankindicating the value of the coin and the public key of the user U. The payee S transmits a challenge counter to the user U prior to receiving the coin.

A continuous analog of run length distributions reflecting accumulated fractionation events.

PubMed

Yu, Zhe; Sankoff, David

2016-11-11

We propose a new, continuous model of the fractionation process (duplicate gene deletion after polyploidization) on the real line. The aim is to infer how much DNA is deleted at a time, based on segment lengths for alternating deleted (invisible) and undeleted (visible) regions. After deriving a number of analytical results for "one-sided" fractionation, we undertake a series of simulations that help us identify the distribution of segment lengths as a gamma with shape and rate parameters evolving over time. This leads to an inference procedure based on observed length distributions for visible and invisible segments. We suggest extensions of this mathematical and simulation work to biologically realistic discrete models, including two-sided fractionation.

What Can We Learn From Point-of-Care Blood Glucose Values Deleted and Repeated by Nurses?

PubMed

Corl, Dawn; Yin, Tom; Ulibarri, May; Lien, Heather; Tylee, Tracy; Chao, Jing; Wisse, Brent E

2018-03-01

Hospitals rely on point-of-care (POC) blood glucose (BG) values to guide important decisions related to insulin administration and glycemic control. Evaluation of POC BG in hospitalized patients is associated with measurement and operator errors. Based on a previous quality improvement (QI) project we introduced an option for operators to delete and repeat POC BG values suspected as erroneous. The current project evaluated our experience with deleted POC BG values over a 2-year period. A retrospective QI project included all patients hospitalized at two regional academic medical centers in the Pacific Northwest during 2014 and 2015. Laboratory Medicine POC BG data were reviewed to evaluate all inpatient episodes of deleted and repeated POC BG. Inpatient operators choose to delete and repeat only 0.8% of all POC BG tests. Hypoglycemic and extreme hyperglycemic BG values are more likely to be deleted and repeated. Of initial values <40 mg/dL, 58% of deleted values (18% of all values) are errors. Of values >400 mg/dL, 40% of deleted values (5% of all values) are errors. Not all repeated POC BG values are first deleted. Optimal use of the option to delete and repeat POC BG values <40 mg/dL could decrease reported rates of severe hypoglycemia by as much as 40%. This project demonstrates that operators are frequently able to identify POC BG values that are measurement/operator errors. Eliminating these errors significantly reduces documented rates of severe hypoglycemia and hyperglycemia, and has the potential to improve patient safety.

Establishment of a Cre recombinase based mutagenesis protocol for markerless gene deletion in Streptococcus suis.

PubMed

Koczula, A; Willenborg, J; Bertram, R; Takamatsu, D; Valentin-Weigand, P; Goethe, R

2014-12-01

The lack of knowledge about pathogenicity mechanisms of Streptococcus (S.) suis is, at least partially, attributed to limited methods for its genetic manipulation. Here, we established a Cre-lox based recombination system for markerless gene deletions in S. suis serotype 2 with high selective pressure and without undesired side effects. Copyright © 2014 Elsevier B.V. All rights reserved.

A high-throughput method for the detection of homoeologous gene deletions in hexaploid wheat

PubMed Central

2010-01-01

Background Mutational inactivation of plant genes is an essential tool in gene function studies. Plants with inactivated or deleted genes may also be exploited for crop improvement if such mutations/deletions produce a desirable agronomical and/or quality phenotype. However, the use of mutational gene inactivation/deletion has been impeded in polyploid plant species by genetic redundancy, as polyploids contain multiple copies of the same genes (homoeologous genes) encoded by each of the ancestral genomes. Similar to many other crop plants, bread wheat (Triticum aestivum L.) is polyploid; specifically allohexaploid possessing three progenitor genomes designated as 'A', 'B', and 'D'. Recently modified TILLING protocols have been developed specifically for mutation detection in wheat. Whilst extremely powerful in detecting single nucleotide changes and small deletions, these methods are not suitable for detecting whole gene deletions. Therefore, high-throughput methods for screening of candidate homoeologous gene deletions are needed for application to wheat populations generated by the use of certain mutagenic agents (e.g. heavy ion irradiation) that frequently generate whole-gene deletions. Results To facilitate the screening for specific homoeologous gene deletions in hexaploid wheat, we have developed a TaqMan qPCR-based method that allows high-throughput detection of deletions in homoeologous copies of any gene of interest, provided that sufficient polymorphism (as little as a single nucleotide difference) amongst homoeologues exists for specific probe design. We used this method to identify deletions of individual TaPFT1 homoeologues, a wheat orthologue of the disease susceptibility and flowering regulatory gene PFT1 in Arabidopsis. This method was applied to wheat nullisomic-tetrasomic lines as well as other chromosomal deletion lines to locate the TaPFT1 gene to the long arm of chromosome 5. By screening of individual DNA samples from 4500 M2 mutant wheat lines generated by heavy ion irradiation, we detected multiple mutants with deletions of each TaPFT1 homoeologue, and confirmed these deletions using a CAPS method. We have subsequently designed, optimized, and applied this method for the screening of homoeologous deletions of three additional wheat genes putatively involved in plant disease resistance. Conclusions We have developed a method for automated, high-throughput screening to identify deletions of individual homoeologues of a wheat gene. This method is also potentially applicable to other polyploidy plants. PMID:21114819

Developmentally programmed DNA deletion in Tetrahymena thermophila by a transposition-like reaction pathway.

PubMed Central

Saveliev, S V; Cox, M M

1996-01-01

We provide a molecular description of key intermediates in the deletion of two internal eliminated sequences (IES elements), the M and R regions, during macronuclear development in Tetrahymena thermophila. Using a variety of PCR-based methods in vivo, double-strand breaks are detected that are generated by hydrolytic cleavage and correspond closely to the observed chromosomal junctions left behind in the macronuclei. The breaks exhibit a temporal and structural relationship to the deletion reaction that provides strong evidence that they are intermediates in the deletion pathway. Breaks in the individual strands are staggered by 4 bp, producing a four nucleotide 5' extension. Evidence is presented that breaks do not occur simultaneously at both ends. The results are most consistent with a deletion mechanism featuring initiation by double-strand cleavage at one end of the deleted element, followed by transesterification to generate the macronuclear junction on one DNA strand. An adenosine residue is found at all the nucleophilic 3' ends used in the postulated transesterification step. Evidence for the transesterification step is provided by detection of a 3' hydroxyl that would be liberated by such a step at a deletion boundary where no other DNA strand ends are detected. Images PMID:8654384

Hotspot mutation panel testing reveals clonal evolution in a study of 265 paired primary and metastatic tumors.

PubMed

Goswami, Rashmi S; Patel, Keyur P; Singh, Rajesh R; Meric-Bernstam, Funda; Kopetz, E Scott; Subbiah, Vivek; Alvarez, Ricardo H; Davies, Michael A; Jabbar, Kausar J; Roy-Chowdhuri, Sinchita; Lazar, Alexander J; Medeiros, L Jeffrey; Broaddus, Russell R; Luthra, Rajyalakshmi; Routbort, Mark J

2015-06-01

We used a clinical next-generation sequencing (NGS) hotspot mutation panel to investigate clonal evolution in paired primary and metastatic tumors. A total of 265 primary and metastatic tumor pairs were sequenced using a 46-gene cancer mutation panel capable of detecting one or more single-nucleotide variants as well as small insertions/deletions. Mutations were tabulated together with tumor type and percentage, mutational variant frequency, time interval between onset of primary tumor and metastasis, and neoadjuvant therapy status. Of note, 227 of 265 (85.7%) tumor metastasis pairs showed identical mutation calls. Of the tumor pairs with identical mutation calls, 160 (60.4%) possessed defining somatic mutation signatures and 67 (25.3%) did not exhibit any somatic mutations. There were 38 (14.3%) cases that showed at least one novel mutation call between the primary and metastasis. Metastases were almost two times more likely to show novel mutations (n = 20, 7.5%) than primary tumors (n = 12, 4.5%). TP53 was the most common additionally mutated gene in metastatic lesions, followed by PIK3CA and SMAD4. PIK3CA mutations were more often associated with metastasis in colon carcinoma samples. Clinical NGS hotspot panels can be useful in analyzing clonal evolution within tumors as well as in determining subclonal mutations that can expand in future metastases. PIK3CA, SMAD4, and TP53 are most often involved in clonal divergence, providing potential targets that may help guide the clinical management of tumor progression or metastases. ©2015 American Association for Cancer Research.

Comparative Genome Analyses of Streptococcus suis Isolates from Endocarditis Demonstrate Persistence of Dual Phenotypic Clones

PubMed Central

Tohya, Mari; Watanabe, Takayasu; Maruyama, Fumito; Arai, Sakura; Ota, Atsushi; Athey, Taryn B. T.; Fittipaldi, Nahuel; Nakagawa, Ichiro; Sekizaki, Tsutomu

2016-01-01

Many bacterial species coexist in the same niche as heterogeneous clones with different phenotypes; however, understanding of infectious diseases by polyphenotypic bacteria is still limited. In the present study, encapsulation in isolates of the porcine pathogen Streptococcus suis from persistent endocarditis lesions was examined. Coexistence of both encapsulated and unencapsulated S. suis isolates was found in 26 out of 59 endocarditis samples. The isolates were serotype 2, and belonged to two different sequence types (STs), ST1 and ST28. The genomes of each of the 26 pairs of encapsulated and unencapsulated isolates from the 26 samples were sequenced. The data showed that each pair of isolates had one or more unique nonsynonymous mutations in the cps gene, and the encapsulated and unencapsulated isolates from the same samples were closest to each other. Pairwise comparisons of the sequences of cps genes in 7 pairs of encapsulated and unencapsulated isolates identified insertion/deletions (indels) ranging from one to 104 bp in different cps genes of unencapsulated isolates. Capsule expression was restored in a subset of unencapsulated isolates by complementation in trans with cps expression vectors. Examination of gene content common to isolates indicated that mutation frequency was higher in ST28 pairs than in ST1 pairs. Genes within mobile genetic elements were mutation hot spots among ST28 isolates. Taken all together, our results demonstrate the coexistence of dual phenotype (encapsulated and unencapsulated) bacterial clones and suggest that the dual phenotypes arose independently in each farm by means of spontaneous mutations in cps genes. PMID:27433935

Periventricular heterotopia in a boy with interstitial deletion of chromosome 4p.

PubMed

Gawlik-Kuklinska, Katarzyna; Wierzba, Jolanta; Wozniak, Agnieszka; Iliszko, Mariola; Debiec-Rychter, Maria; Dubaniewicz-Wybieralska, Miroslawa; Limon, Janusz

2008-01-01

We report on a 4-year-old boy with a proximal interstitial deletion in the short arm of chromosome 4p with the karyotype 46,XY,del(4)(p14p15.32),inv(9)(p13q13). For a precise delineation of the deleted region, an array-based comparative genomic hybridization (a-CGH) analysis was performed. The proband's phenotype and cytogenetic findings are compared with previously reported cases with proximal 4p deletion syndrome. The syndrome is associated with normal growth, varying degrees of mental retardation, characteristic facial appearance and minor dysmorphic features. Additionally, our patient developed a seizure disorder due to abnormal neuronal migration, i.e., periventricular heterotopia.

Detection of 1p36 deletion by clinical exome-first diagnostic approach.

PubMed

Watanabe, Miki; Hayabuchi, Yasunobu; Ono, Akemi; Naruto, Takuya; Horikawa, Hideaki; Kohmoto, Tomohiro; Masuda, Kiyoshi; Nakagawa, Ryuji; Ito, Hiromichi; Kagami, Shoji; Imoto, Issei

2016-01-01

Although chromosome 1p36 deletion syndrome is considered clinically recognizable based on characteristic features, the clinical manifestations of patients during infancy are often not consistent with those observed later in life. We report a 4-month-old girl who showed multiple congenital anomalies and developmental delay, but no clinical signs of syndromic disease caused by a terminal deletion in 1p36.32-p36.33 that was first identified by targeted-exome sequencing for molecular diagnosis.

Detection of 1p36 deletion by clinical exome-first diagnostic approach

PubMed Central

Watanabe, Miki; Hayabuchi, Yasunobu; Ono, Akemi; Naruto, Takuya; Horikawa, Hideaki; Kohmoto, Tomohiro; Masuda, Kiyoshi; Nakagawa, Ryuji; Ito, Hiromichi; Kagami, Shoji; Imoto, Issei

2016-01-01

Although chromosome 1p36 deletion syndrome is considered clinically recognizable based on characteristic features, the clinical manifestations of patients during infancy are often not consistent with those observed later in life. We report a 4-month-old girl who showed multiple congenital anomalies and developmental delay, but no clinical signs of syndromic disease caused by a terminal deletion in 1p36.32-p36.33 that was first identified by targeted-exome sequencing for molecular diagnosis. PMID:28428889

Two novel types of contiguous gene deletion of the AVPR2 and ARHGAP4 genes in unrelated Japanese kindreds with nephrogenic diabetes insipidus.

PubMed

Demura, Masashi; Takeda, Yoshiyu; Yoneda, Takashi; Furukawa, Kenji; Usukura, Mikiya; Itoh, Yuji; Mabuchi, Hiroshi

2002-01-01

Study of two families containing individuals with nephrogenic diabetes insipidus (NDI) indicated different types of 21.3 kb and 26.3 kb deletions involving the AVPR2 and ARHGAP4 (RhoGAP C1) genes. In the case of the 21.3 kb deletion, the deletion consensus motif (5'-TGAAGG-3') and polypurine runs, known as the arrest site of polymerase alpha, were detected in the vicinity of the deletion junction. Inverted repeats (7/8 matches), believed to potentiate DNA loop formation, flank the deletion breakpoint. We propose this deletion to be the result of slipped mispairing during DNA replication. In the case of the 26.3 kb deletion, the 12,945 bp inverted region with the 10,003 bp internal deletion was accompanied with the 2,509 bp deletion in the 5'-side and the 13,785 bp deletion in the 3'-side. We defined three deletion junctions in this rearrangement (DJ1, DJ2, and DJ3) from the 5'-side. The surrounding sequence of DJ1 (5'-CCC-3') closely resembled that of DJ3 (5'-AGGG-3') (DJ1; 5'-cCCCgaggg-3', DJ3; 5'-ccccAGGG-3'), and DJ1 was located in the 5'-side of DJ3 without any overlapping in sequence. The immunoglobulin class switch (ICS) motif (5'-TGGGG-3') was found around the complementary sequence of DJ3. There was a 10-base palindrome (5'-aGACAtgtct-3') in the alignment of the DJ2 (5'-GACA-3') region. From these findings, we propose a novel mutation process with the rearrangement probably resulting from stem-loop induced non-homologous recombination in an ICS-like fashion. Both patients, despite lacking ARHGAP4, had no morphological, clinical, or laboratory abnormalities except for those usually found in patients with NDI. Copyright 2001 Wiley-Liss, Inc.

Domain architecture conservation in orthologs

PubMed Central

2011-01-01

Background As orthologous proteins are expected to retain function more often than other homologs, they are often used for functional annotation transfer between species. However, ortholog identification methods do not take into account changes in domain architecture, which are likely to modify a protein's function. By domain architecture we refer to the sequential arrangement of domains along a protein sequence. To assess the level of domain architecture conservation among orthologs, we carried out a large-scale study of such events between human and 40 other species spanning the entire evolutionary range. We designed a score to measure domain architecture similarity and used it to analyze differences in domain architecture conservation between orthologs and paralogs relative to the conservation of primary sequence. We also statistically characterized the extents of different types of domain swapping events across pairs of orthologs and paralogs. Results The analysis shows that orthologs exhibit greater domain architecture conservation than paralogous homologs, even when differences in average sequence divergence are compensated for, for homologs that have diverged beyond a certain threshold. We interpret this as an indication of a stronger selective pressure on orthologs than paralogs to retain the domain architecture required for the proteins to perform a specific function. In general, orthologs as well as the closest paralogous homologs have very similar domain architectures, even at large evolutionary separation. The most common domain architecture changes observed in both ortholog and paralog pairs involved insertion/deletion of new domains, while domain shuffling and segment duplication/deletion were very infrequent. Conclusions On the whole, our results support the hypothesis that function conservation between orthologs demands higher domain architecture conservation than other types of homologs, relative to primary sequence conservation. This supports the notion that orthologs are functionally more similar than other types of homologs at the same evolutionary distance. PMID:21819573

Clinical utility of an array comparative genomic hybridization analysis for Williams syndrome.

PubMed

Yagihashi, Tatsuhiko; Torii, Chiharu; Takahashi, Reiko; Omori, Mikimasa; Kosaki, Rika; Yoshihashi, Hiroshi; Ihara, Masahiro; Minagawa-Kawai, Yasuyo; Yamamoto, Junichi; Takahashi, Takao; Kosaki, Kenjiro

2014-11-01

To reveal the relation between intellectual disability and the deleted intervals in Williams syndrome, we performed an array comparative genomic hybridization analysis and standardized developmental testing for 11 patients diagnosed as having Williams syndrome based on fluorescent in situ hybridization testing. One patient had a large 4.2-Mb deletion spanning distally beyond the common 1.5-Mb intervals observed in 10/11 patients. We formulated a linear equation describing the developmental age of the 10 patients with the common deletion; the developmental age of the patient with the 4.2-Mb deletion was significantly below the expectation (developmental age = 0.51 × chronological age). The large deletion may account for the severe intellectual disability; therefore, the use of array comparative genomic hybridization may provide practical information regarding individuals with Williams syndrome. © 2014 Japanese Teratology Society.

A single-base deletion in soybean flavonol synthase gene is associated with magenta flower color.

PubMed

Takahashi, Ryoji; Githiri, Stephen M; Hatayama, Kouta; Dubouzet, Emilyn G; Shimada, Norimoto; Aoki, Toshio; Ayabe, Shin-ichi; Iwashina, Tsukasa; Toda, Kyoko; Matsumura, Hisakazu

2007-01-01

The Wm locus of soybean [Glycine max (L.) Merr.] controls flower color. Dominant Wm and recessive wm allele of the locus produce purple and magenta flower, respectively. A putative full-length cDNA of flavonol synthase (FLS), gmfls1 was isolated by 5' RACE and end-to-end PCR from a cultivar Harosoy with purple flower (WmWm). Sequence analysis revealed that gmfls1 consisted of 1,208 nucleotides encoding 334 amino acids. It had 59-72% homology with FLS proteins of other plant species. Conserved dioxygenase domains A and B were found in the deduced polypeptide. Sequence comparison between Harosoy and Harosoy-wm (magenta flower mutant of Harosoy; wmwm) revealed that they differed by a single G deletion in the coding region of Harosoy-wm. The deletion changed the subsequent reading frame resulting in a truncated polypeptide consisting of 37 amino acids that lacked the dioxygenase domains A and B. Extracts of E. coli cells expressing gmfls1 of Harosoy catalyzed the formation of quercetin from dihydroquercetin, whereas cell extracts expressing gmfls1 of Harosoy-wm had no FLS activity. Genomic Southern analysis suggested the existence of three to four copies of the FLS gene in the soybean genome. CAPS analysis was performed to detect the single-base deletion. Harosoy and Clark (WmWm) exhibited longer fragments, while Harosoy-wm had shorter fragments due to the single-base deletion. The CAPS marker co-segregated with genotypes at Wm locus in a F(2) population segregating for the locus. Linkage mapping using SSR markers revealed that the Wm and gmfls1 were mapped at similar position in the molecular linkage group F. The above results strongly suggest that gmfls1 represents the Wm gene and that the single-base deletion may be responsible for magenta flower color.

Deletion Diagnostics for Alternating Logistic Regressions

PubMed Central

Preisser, John S.; By, Kunthel; Perin, Jamie; Qaqish, Bahjat F.

2013-01-01

Deletion diagnostics are introduced for the regression analysis of clustered binary outcomes estimated with alternating logistic regressions, an implementation of generalized estimating equations (GEE) that estimates regression coefficients in a marginal mean model and in a model for the intracluster association given by the log odds ratio. The diagnostics are developed within an estimating equations framework that recasts the estimating functions for association parameters based upon conditional residuals into equivalent functions based upon marginal residuals. Extensions of earlier work on GEE diagnostics follow directly, including computational formulae for one-step deletion diagnostics that measure the influence of a cluster of observations on the estimated regression parameters and on the overall marginal mean or association model fit. The diagnostic formulae are evaluated with simulations studies and with an application concerning an assessment of factors associated with health maintenance visits in primary care medical practices. The application and the simulations demonstrate that the proposed cluster-deletion diagnostics for alternating logistic regressions are good approximations of their exact fully iterated counterparts. PMID:22777960

Investigation of tumor suppressor genes apart from VHL on 3p by deletion mapping in sporadic clear cell renal cell carcinoma (cRCC).

PubMed

Singh, Rashmi Bhat; Amare Kadam, Pratibha S

2013-10-01

To investigate the most recurrent deletion loci on 3p12-p26 by deletion mapping studies by PCR-LOH and BAC array-FISH in sporadic conventional renal cell carcinoma (cRCC) and further, to evaluate the their clinicopathologic significance in cRCC. Comparative allelotyping studies in cRCC and major epithelial carcinomas (MEC) such as lung, breast, and bladder tumors were also carried out to investigate the specificity of the targeted loci in cRCC. A total of 40 c-RCC patients were enrolled in this study, categorized in to 2 groups: group I comprises of patients of stages I and II and group II includes patients at stages III and IV. Loss of heterozygosity (LOH) studies were performed by PCR using 15 microsatellite markers of region 3p12-p26 on paired normal-tumor tissues. The recurrent LOH loci found in 27 cRCC tumors were further validated by BAC array-FISH using 23 serially mapped BAC clones. Simultaneously, the allelic deletion status of fragile histidine triad (FHIT) gene was studied by FISH in cRCC and major epithelial carcinoma (MEC) tumors. The numerical aberrations of chromosome 3 were also studied using the centromere enumeration probe (CEP) probe for chromosome 3 to validate the observed allelic losses by BAC array-FISH in cRCC as well as MECs. Our study revealed 3 affected regions of LOH on 3p in cRCC: 3p12.2-p14.1, 3p14.2-p21.1, and 3p24.2-p26.1 in both group I (stages I and II) and group II (stage III and IV). Comparative allelotyping studies revealed that except for LOH loci D3S2406 (20%), D3S1766 (14%), and D3S1560 (20%), remaining affected loci revealed retention of heterozygosity (ROH) in breast carcinomas. Lung and bladder tumors revealed ROH at all affected LOH loci. FISH with FHIT gene probe revealed deletions in cRCC (88%), breast (30%), and lung tumors (10%). FHIT gene deletions frequency was almost equal in both groups I and II (>70%), whereas a locus 3p13 (D3S2454) revealed the highest LOH in group II (83%) patients in comparison to group I (16%). BAC array-FISH studies in cRCC identified 15 recurrent deletion loci at crucial regions, 3p12.2, 3p14.2, 3p21.3, and 3p24.2-p26 with long continuous deletion of 3p14.1-p26.1 exclusively in patients of stages III and IV. Validation of LOH loci in breast carcinomas by BAC array-FISH with BAC clones mapped at these loci revealed comparatively lower deletion frequency for RP11-59E22 (3p12.2) (30%), RP11-759B7(3p21.1) (12%), and RP11-57D6 (3p25.2, proximal to VHL) (15%) than cRCC. Molecular cytogenetic studies by BAC array-FISH was found to be more sensitive over LOH. Deletion patterns on 3p explored that deletion of FHIT and flanking loci may occur as an initiating event followed by deletions at 3p12.2, 3p21.31-3p21.32, and 3p24.2-3p26.1 in the initial stage of development of disease, while continuous large deletions of 3p21.3-3p26.1 and 3p14.1-3p26.1 occur as progressive deletion due to genetic instability. Lack of VHL along with flanking loci in 50% cRCC patients that included both groups I and II supported the hypothesis of both VHL dependent and VHL independent pathways in cRCC tumorigenesis. Comparative allelotyping studies in cRCC and MECs indicated association of specific targeted loci including VHL in cRCC. Further expansion of these studies with characterization of the genes at targeted loci and correlation with clinical outcome will explore the prognostic significance and also provide an insight into the mechanisms of tumor suppressive pathways in genitourinary cancers such as CRCC. Copyright © 2013 Elsevier Inc. All rights reserved.

AB020. Chromosome rearrangement in patients with 46,XY disorders of sex development

PubMed Central

Vu, Dung Chi; Nguyen, Khanh Ngoc; Can, Ngoc Bich; Bui, Thao Phuong; Fukami, Maki

2017-01-01

Background Disorders of sex development (DSD) is defined by congenital conditions in which development of chromosomal, gonadal, or anatomical sex is atypical. Causative mutations have not been identified in more than 50% 46,XY DSD cases. We aimed to identify chromosomal rearrangement in the development of 46,XY DSD in Vietnamese patients. Methods Case series report including clinical presentations and data from array-based comparative genomic hybridization analysis for six genetic males with genital abnormalities combines with mental disability and other congenital anomalies. Results Heterozygous submicroscopic deletions and/or duplications were identified in six cases. A 7.2 Mb terminal deletion at chromosome 9 including deletion of DMRT1 gene and a 2.7 Mb terminal duplication at chromosome 17 were detected in case 1 that presented with prematurity, dysmorphism and ambiguous genitalia. A terminal deletion affects DMRT1-3 at 9p22-23 was identified in case 2 with ambiguous genitalia, mental disability and dysmorphism. An 18 Mb terminal duplication at chromosome 5 was detected in case 3 with DSD, growth retardation, microcephaly and dysmorphism, ptosis, ventricular septal defect and craniosynostosis. An interstitial deletion including deletions of WT1, PAX6, and PRRG4 genes at chromosome 11 was detected in case 4 with WAGR syndrome. A terminal duplication at chromosome 7 was detected in case 5 with DSD, severe hypospadias, small phallus size (1 cm at 3 years of age), and no testis found clinically. A 5 Mb terminal deletion at chromosome 4 and a 6 Mb terminal duplication of chromosome 16 were detected in case 6 with severe motor-mental retardation, microcephaly (head circumference −3.5 SD), micrognathia, and DSD. Conclusions The results indicate that chromosomal rearrangements constitute an important part of the molecular bases of 46,XY DSD and that submicroscopic deletions and/or duplication can lead to various types of 46,XY DSD combined with other congenital anomalies and/or mental disability.

Radiation-induced total-deletion mutations in the human hprt gene: a biophysical model based on random walk interphase chromatin geometry

NASA Technical Reports Server (NTRS)

Wu, H.; Sachs, R. K.; Yang, T. C.

1998-01-01

PURPOSE: To develop a biophysical model that explains the sizes of radiation-induced hprt deletions. METHODS: Key assumptions: (1) Deletions are produced by two DSB that are closer than an interaction distance at the time of DSB induction; (2) Interphase chromatin is modelled by a biphasic random walk distribution; and (3) Misrejoining of DSB from two separate tracks dominates at low-LET and misrejoining of DSB from a single track dominates at high-LET. RESULTS: The size spectra for radiation-induced total deletions of the hprt gene are calculated. Comparing with the results of Yamada and coworkers for gamma-irradiated human fibroblasts the study finds that an interaction distance of 0.75 microm will fit both the absolute frequency and the size spectrum of the total deletions. It is also shown that high-LET radiations produce, relatively, more total deletions of sizes below 0.5 Mb. The model predicts an essential gene to be located between 2 and 3 Mb from the hprt locus towards the centromere. Using the same assumptions and parameters as for evaluating mutation frequencies, a frequency of intra-arm chromosome deletions is calculated that is in agreement with experimental data. CONCLUSIONS: Radiation-induced total-deletion mutations of the human hprt gene and intrachange chromosome aberrations share a common mechanism for their induction.

Parallel Mapping and Simultaneous Sequencing Reveals Deletions in BCAN and FAM83H Associated with Discrete Inherited Disorders in a Domestic Dog Breed

PubMed Central

Forman, Oliver P.; Hayward, Louisa J.; Ricketts, Sally L.; Mellersh, Cathryn S.

2012-01-01

The domestic dog (Canis familiaris) segregates more naturally-occurring diseases and phenotypic variation than any other species and has become established as an unparalled model with which to study the genetics of inherited traits. We used a genome-wide association study (GWAS) and targeted resequencing of DNA from just five dogs to simultaneously map and identify mutations for two distinct inherited disorders that both affect a single breed, the Cavalier King Charles Spaniel. We investigated episodic falling (EF), a paroxysmal exertion-induced dyskinesia, alongside the phenotypically distinct condition congenital keratoconjunctivitis sicca and ichthyosiform dermatosis (CKCSID), commonly known as dry eye curly coat syndrome. EF is characterised by episodes of exercise-induced muscular hypertonicity and abnormal posturing, usually occurring after exercise or periods of excitement. CKCSID is a congenital disorder that manifests as a rough coat present at birth, with keratoconjunctivitis sicca apparent on eyelid opening at 10–14 days, followed by hyperkeratinisation of footpads and distortion of nails that develops over the next few months. We undertook a GWAS with 31 EF cases, 23 CKCSID cases, and a common set of 38 controls and identified statistically associated signals for EF and CKCSID on chromosome 7 (Praw 1.9×10−14; Pgenome = 1.0×10−5) and chromosome 13 (Praw 1.2×10−17; Pgenome = 1.0×10−5), respectively. We resequenced both the EF and CKCSID disease-associated regions in just five dogs and identified a 15,724 bp deletion spanning three exons of BCAN associated with EF and a single base-pair exonic deletion in FAM83H associated with CKCSID. Neither BCAN or FAM83H have been associated with equivalent disease phenotypes in any other species, thus demonstrating the ability to use the domestic dog to study the genetic basis of more than one disease simultaneously in a single breed and to identify multiple novel candidate genes in parallel. PMID:22253609

Functional Genomics Using the Saccharomyces cerevisiae Yeast Deletion Collections.

PubMed

Nislow, Corey; Wong, Lai Hong; Lee, Amy Huei-Yi; Giaever, Guri

2016-09-01

Constructed by a consortium of 16 laboratories, the Saccharomyces genome-wide deletion collections have, for the past decade, provided a powerful, rapid, and inexpensive approach for functional profiling of the yeast genome. Loss-of-function deletion mutants were systematically created using a polymerase chain reaction (PCR)-based gene deletion strategy to generate a start-to-stop codon replacement of each open reading frame by homologous recombination. Each strain carries two molecular barcodes that serve as unique strain identifiers, enabling their growth to be analyzed in parallel and the fitness contribution of each gene to be quantitatively assessed by hybridization to high-density oligonucleotide arrays or through the use of next-generation sequencing technologies. Functional profiling of the deletion collections, using either strain-by-strain or parallel assays, provides an unbiased approach to systematically survey the yeast genome. The Saccharomyces yeast deletion collections have proved immensely powerful in contributing to the understanding of gene function, including functional relationships between genes and genetic pathways in response to diverse genetic and environmental perturbations. © 2016 Cold Spring Harbor Laboratory Press.

Two novel partial deletions of LDL-receptor gene in Italian patients with familial hypercholesterolemia (FH Siracusa and FH Reggio Emilia).

PubMed

Garuti, R; Lelli, N; Barozzini, M; Tiozzo, R; Ghisellini, M; Simone, M L; Li Volti, S; Garozzo, R; Mollica, F; Vergoni, W; Bertolini, S; Calandra, S

1996-03-01

In the present study we report two novel partial deletions of the LDL-R gene. The first (FH Siracusa), found in an FH-heterozygote, consists of a 20 kb deletion spanning from the 5' flanking region to the intron 2 of the LDL-receptor gene. The elimination of the promoter and the first two exons prevents the transcription of the deleted allele, as shown by Northern blot analysis of LDL-R mRNA isolated from the proband's fibroblasts. The second deletion (FH Reggio Emilia), which eliminates 11 nucleotides of exon 10, was also found in an FH heterozygote. The characterization of this deletion was made possible by a combination of techniques such as single strand conformation polymorphism (SSCP) analysis, direct sequence of exon 10 and cloning of the normal and deleted exon 10 from the proband's DNA. The 11 nt deletion occurs in a region of exon 10 which contains three triplets (CTG) and two four-nucleotides (CTGG) direct repeats. This structural feature might render this region more susceptible to a slipped mispairing during DNA duplication. Since this deletion causes a shift of the BamHI site at the 5' end of exon 10, a method has been devised for its rapid screening which is based on the PCR amplification of exon 10 followed by BamHI digestion. FH Reggio Emilia deletion produces a shift in the reading frame downstream from Lys458, leading to a sequence of 51 novel amino acids before the occurrence of a premature stop codon (truncated receptor). However, since RT-PCR failed to demonstrate the presence of the mutant LDL-R mRNA in proband fibroblasts, it is likely that the amount of truncated receptor produced in these cells is negligible.

Novel features of 3q29 deletion syndrome: Results from the 3q29 registry

PubMed Central

Glassford, Megan R.; Rosenfeld, Jill A.; Freedman, Alexa A.; Zwick, Michael E.

2016-01-01

3q29 deletion syndrome is caused by a recurrent, typically de novo heterozygous 1.6 Mb deletion, but because incidence of the deletion is rare (1 in 30,000 births) the phenotype is not well described. To characterize the range of phenotypic manifestations associated with 3q29 deletion syndrome, we have developed an online registry (3q29deletion.org) for ascertainment of study subjects and phenotypic data collection via Internet‐based survey instruments. We report here on data collected during the first 18 months of registry operation, from 44 patients. This is the largest cohort of 3q29 deletion carriers ever assembled and surveyed in a systematic way. Our data reveal that 28% of registry participants report neuropsychiatric phenotypes, including anxiety disorder, panic attacks, depression, bipolar disorder, and schizophrenia. Other novel findings include a high prevalence (64%) of feeding problems in infancy and reduced weight at birth for 3q29 deletion carriers (average reduction 13.9 oz (394 g), adjusted for gestational age and sex, P = 6.5e‐07). We further report on the frequency of heart defects, autism, recurrent ear infections, gastrointestinal phenotypes, and dental phenotypes, among others. We also report on the expected timing of delayed developmental milestones. This is the most comprehensive description of the 3q29 deletion phenotype to date. These results are clinically actionable toward improving patient care for 3q29 deletion carriers, and can guide the expectations of physicians and parents. These data also demonstrate the value of patient‐reported outcomes to reveal the full phenotypic spectrum of rare genomic disorders. © 2016 The Authors. American Journal of Medical Genetics Part A Published by Wiley Periodicals, Inc. PMID:26738761

Independent De Novo 22q11.2 Deletions in First Cousins With DiGeorge/Velocardiofacial Syndrome

PubMed Central

Saitta, Sulagna C.; Harris, Stacy E.; McDonald-McGinn, Donna M.; Emanuel, Beverly S.; Tonnesen, Melissa K.; Zackai, Elaine H.; Seitz, Suzanne C.; Driscoll, Deborah A.

2010-01-01

Deletions of chromosome 22q11.2 are found in the vast majority of patients with DiGeorge/velocardiofacial syndrome (DGS/VCFS). This most frequent microdeletion syndrome is estimated to occur in 1 in 4,000 live births. The majority of deletions are de novo, with 10% or less inherited from an affected parent. Here, we report two separate families with recurrence of a 22q11.2 deletion in first cousins. In each family, unaffected siblings (brother and sister) had an affected child. Fluorescence in situ hybridization (FISH) studies of the parents of each affected child were normal and hence, relatives were not considered at an increased risk for recurrence in another pregnancy. We used highly polymorphic microsatellite repeat markers from within 22q11.2 to determine the parental origin of each cousin’s deletion and to assess whether parental germline mosaicism for the 22q11.2 deletion might be a factor in these cases. This analysis confirmed that in each case, the deletion occurred on a chromosome 22 derived from unrelated parents, consistent with independent de novo deletion events. Thus, we concluded that germline mosaicism as the underlying mechanism for affected cousins in these families was unlikely. Our findings underscore the high frequency with which the 22q11.2 deletion occurs in the general population and demonstrate the important role that PCR-based parental origin determination can have in recurrence risk counselling. Furthermore, relatives of affected individuals may benefit from genetic counselling and consider prenatal testing for the 22q11.2 deletion in future pregnancies, despite a low recurrence risk. PMID:14708107

Thorough analysis of unorthodox ABO deletions called by the 1000 Genomes project.

PubMed

Möller, M; Hellberg, Å; Olsson, M L

2018-02-01

ABO remains the clinically most important blood group system, but despite earlier extensive research, significant findings are still being made. The vast majority of catalogued ABO null alleles are based on the c.261delG polymorphism. Apart from c.802G>A, other mechanisms for O alleles are rare. While analysing the data set from the 1000 Genomes (1000G) project, we encountered two previously uncharacterized deletions, which needed further exploration. The Erythrogene database, complemented with bioinformatics software, was used to analyse ABO in 2504 individuals from 1000G. DNA samples from selected 1000G donors and African blood donors were examined by allele-specific PCR and Sanger sequencing to characterize predicted deletions. A 5821-bp deletion encompassing exons 5-7 was called in twenty 1000G individuals, predominantly Africans. This allele was confirmed and its exact deletion point defined by bioinformatic analyses and in vitro experiments. A PCR assay was developed, and screening of African samples revealed three donors heterozygous for this deletion, which was thereby phenotypically established as an O allele. Analysis of upstream genetic markers indicated an ancestral origin from ABO*O.01.02. We estimate this deletion as the 3rd most common mechanism behind O alleles. A 24-bp deletion was called in nine individuals and showed greater diversity regarding ethnic distribution and allelic background. It could neither be confirmed by in silico nor in vitro experiments. A previously uncharacterized ABO deletion among Africans was comprehensively mapped and a genotyping strategy devised. The false prediction of another deletion emphasizes the need for cautious interpretation of NGS data and calls for strict validation routines. © 2017 International Society of Blood Transfusion.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fang, Xu-Qian; Liu, Xiang-Fan; Yao, Ling

Highlights: •A novel FAK splicing mutation identified in breast tumor. •FAK-Del33 mutation promotes cell migration and invasion. •FAK-Del33 mutation regulates FAK/Src signal pathway. -- Abstract: Focal adhesion kinase (FAK) regulates cell adhesion, migration, proliferation, and survival. We identified a novel splicing mutant, FAK-Del33 (exon 33 deletion, KF437463), in both breast and thyroid cancers through colony sequencing. Considering the low proportion of mutant transcripts in samples, this mutation was detected by TaqMan-MGB probes based qPCR. In total, three in 21 paired breast tissues were identified with the FAK-Del33 mutation, and no mutations were found in the corresponding normal tissues. When introducedmore » into a breast cell line through lentivirus infection, FAK-Del33 regulated cell motility and migration based on a wound healing assay. We demonstrated that the expression of Tyr397 (main auto-phosphorylation of FAK) was strongly increased in FAK-Del33 overexpressed breast tumor cells compared to wild-type following FAK/Src RTK signaling activation. These results suggest a novel and unique role of the FAK-Del33 mutation in FAK/Src signaling in breast cancer with significant implications for metastatic potential.« less

Genome-Wide Spectra of Transcription Insertions and Deletions Reveal That Slippage Depends on RNA:DNA Hybrid Complementarity.

PubMed

Traverse, Charles C; Ochman, Howard

2017-08-29

Advances in sequencing technologies have enabled direct quantification of genome-wide errors that occur during RNA transcription. These errors occur at rates that are orders of magnitude higher than rates during DNA replication, but due to technical difficulties such measurements have been limited to single-base substitutions and have not yet quantified the scope of transcription insertions and deletions. Previous reporter gene assay findings suggested that transcription indels are produced exclusively by elongation complex slippage at homopolymeric runs, so we enumerated indels across the protein-coding transcriptomes of Escherichia coli and Buchnera aphidicola , which differ widely in their genomic base compositions and incidence of repeat regions. As anticipated from prior assays, transcription insertions prevailed in homopolymeric runs of A and T; however, transcription deletions arose in much more complex sequences and were rarely associated with homopolymeric runs. By reconstructing the relocated positions of the elongation complex as inferred from the sequences inserted or deleted during transcription, we show that continuation of transcription after slippage hinges on the degree of nucleotide complementarity within the RNA:DNA hybrid at the new DNA template location. IMPORTANCE The high level of mistakes generated during transcription can result in the accumulation of malfunctioning and misfolded proteins which can alter global gene regulation and in the expenditure of energy to degrade these nonfunctional proteins. The transcriptome-wide occurrence of base substitutions has been elucidated in bacteria, but information on transcription insertions and deletions-errors that potentially have more dire effects on protein function-is limited to reporter gene constructs. Here, we capture the transcriptome-wide spectrum of insertions and deletions in Escherichia coli and Buchnera aphidicola and show that they occur at rates approaching those of base substitutions. Knowledge of the full extent of sequences subject to transcription indels supports a new model of bacterial transcription slippage, one that relies on the number of complementary bases between the transcript and the DNA template to which it slipped. Copyright © 2017 Traverse and Ochman.

The Vibrio parahaemolyticus small RNA RyhB promotes production of the siderophore vibrioferrin by stabilizing the polycistronic mRNA.

PubMed

Tanabe, Tomotaka; Funahashi, Tatsuya; Nakao, Hiroshi; Maki, Jun; Yamamoto, Shigeo

2013-08-01

High-affinity iron acquisition in Vibrio parahaemolyticus is mediated by the cognate siderophore vibrioferrin. We have previously reported that the vibrioferrin biosynthesis operon (pvsOp) is regulated at the transcriptional level by the iron-responsive repressor Fur (T. Tanabe, T. Funahashi, H. Nakao, S. Miyoshi, S. Shinoda, and S. Yamamoto, J. Bacteriol. 185:6938-6949, 2003). In this study, we identified the Fur-regulated small RNA RyhB and the RNA chaperone Hfq protein as additional regulatory proteins of vibrioferrin biosynthesis. We found that vibrioferrin production was greatly impaired in both the ryhB and hfq deletion mutants, and a TargetRNA search (http://snowwhite.wellesley.edu/targetRNA/index2.html) revealed that the 5'-untranslated region of pvsOp mRNA (pvsOp 5'-UTR) contains a potential base-pairing region required for the formation of the RyhB-pvsOp 5'-UTR duplex. An electrophoresis mobility shift assay indicated that RyhB can directly bind to the pvsOp 5'-UTR with the aid of Hfq. Rifampin chase experiments indicated that the half-life of pvsOp mRNA in the ryhB and hfq mutants was approximately 3-fold shorter than that in the parental strain, suggesting that both RyhB and Hfq are engaged in the stabilization of pvsOp mRNA. Chrome azurol S assays followed by electrophoresis mobility shift assays and rifampin chase experiments carried out for mutant strains indicated that base pairing between RyhB and the pvsOp 5'-UTR results in an increase in the stability of pvsOp mRNA, thereby leading to the promotion of vibrioferrin production. It is unprecedented that RyhB confers increased stability on a polycistronic mRNA involved in siderophore biosynthesis as a direct target.

Expanding the scope of noninvasive prenatal testing: detection of fetal microdeletion syndromes.

PubMed

Wapner, Ronald J; Babiarz, Joshua E; Levy, Brynn; Stosic, Melissa; Zimmermann, Bernhard; Sigurjonsson, Styrmir; Wayham, Nicholas; Ryan, Allison; Banjevic, Milena; Lacroute, Phil; Hu, Jing; Hall, Megan P; Demko, Zachary; Siddiqui, Asim; Rabinowitz, Matthew; Gross, Susan J; Hill, Matthew; Benn, Peter

2015-03-01

The purpose of this study was to estimate the performance of a single-nucleotide polymorphism (SNP)-based noninvasive prenatal test for 5 microdeletion syndromes. Four hundred sixty-nine samples (358 plasma samples from pregnant women, 111 artificial plasma mixtures) were amplified with the use of a massively multiplexed polymerase chain reaction, sequenced, and analyzed with the use of the Next-generation Aneuploidy Test Using SNPs algorithm for the presence or absence of deletions of 22q11.2, 1p36, distal 5p, and the Prader-Willi/Angelman region. Detection rates were 97.8% for a 22q11.2 deletion (45/46) and 100% for Prader-Willi (15/15), Angelman (21/21), 1p36 deletion (1/1), and cri-du-chat syndromes (24/24). False-positive rates were 0.76% for 22q11.2 deletion syndrome (3/397) and 0.24% for cri-du-chat syndrome (1/419). No false positives occurred for Prader-Willi (0/428), Angelman (0/442), or 1p36 deletion syndromes (0/422). SNP-based noninvasive prenatal microdeletion screening is highly accurate. Because clinically relevant microdeletions and duplications occur in >1% of pregnancies, regardless of maternal age, noninvasive screening for the general pregnant population should be considered. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

Detection of pseudorabies virus by duplex droplet digital PCR assay.

PubMed

Ren, Meishen; Lin, Hua; Chen, Shijie; Yang, Miao; An, Wei; Wang, Yin; Xue, Changhua; Sun, Yinjie; Yan, Yubao; Hu, Juan

2018-01-01

Aujeszky's disease, caused by pseudorabies virus (PRV), has damaged the economy of the Chinese swine industry. A large number of PRV gene-deleted vaccines have been constructed based on deletion of the glycoprotein E ( gE) gene combined with other virulence-related gene deletions, such as thymidine kinase ( TK), whereas PRV wild-type strains contain an intact gE gene. We developed a sensitive duplex droplet digital PCR (ddPCR) assay to rapidly detect PRV wild-type isolates and gE gene-deleted viral vaccines. We compared this assay with a TaqMan real-time PCR (qPCR) using the same primers and probes. Both assays exhibited good linearity and repeatability; however, ddPCR maintained linearity at extremely low concentrations, whereas qPCR did not. Based on positive results for both gE and gB, the detection limit of ddPCR was found to be 4.75 copies/µL in contrast of 76 copies/µL for qPCR, showing that ddPCR provided a 16-fold improvement in sensitivity. In addition, no nonspecific amplification was shown in specificity testing, and the PRV wild-type was distinguished from a gE-deleted strain. The ddPCR was more sensitive when analyzing clinical serum samples. Thus, ddPCR may become an appropriate detection platform for PRV.

Pfhrp2-Deleted Plasmodium falciparum Parasites in the Democratic Republic of the Congo: A National Cross-sectional Survey.

PubMed

Parr, Jonathan B; Verity, Robert; Doctor, Stephanie M; Janko, Mark; Carey-Ewend, Kelly; Turman, Breanna J; Keeler, Corinna; Slater, Hannah C; Whitesell, Amy N; Mwandagalirwa, Kashamuka; Ghani, Azra C; Likwela, Joris L; Tshefu, Antoinette K; Emch, Michael; Juliano, Jonathan J; Meshnick, Steven R

2017-07-01

Rapid diagnostic tests (RDTs) account for more than two-thirds of malaria diagnoses in Africa. Deletions of the Plasmodium falciparum hrp2 (pfhrp2) gene cause false-negative RDT results and have never been investigated on a national level. Spread of pfhrp2-deleted P. falciparum mutants, resistant to detection by HRP2-based RDTs, would represent a serious threat to malaria elimination efforts. Using a nationally representative cross-sectional study of 7,137 children under five years of age from the Democratic Republic of Congo (DRC), we tested 783 subjects with RDT-/PCR+ results using PCR assays to detect and confirm deletions of the pfhrp2 gene. Spatial and population genetic analyses were employed to examine the distribution and evolution of these parasites. We identified 149 pfhrp2-deleted parasites, representing 6.4% of all P. falciparum infections country-wide (95% confidence interval 5.1-8.0%). Bayesian spatial analyses identified statistically significant clustering of pfhrp2 deletions near Kinshasa and Kivu. Population genetic analysis revealed significant genetic differentiation between wild-type and pfhrp2-deleted parasite populations (GST = .046, p ≤ .00001). Pfhrp2-deleted P. falciparum is a common cause of RDT-/PCR+ malaria among asymptomatic children in the DRC and appears to be clustered within select communities. Surveillance for these deletions is needed, and alternatives to HRP2-specific RDTs may be necessary. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.

Chromosomal alterations in the clonal evolution to the metastatic stage ofquamous cell carcinomas of the lung

PubMed Central

Petersen, S; Aninat-Meyer, M; Schlüns, K; Gellert, K; Dietel, M; Petersen, I

1999-01-01

Comparative genomic hybridization (CGH) was applied to squamous cellcarcinomas (SCC) of the lung to define chromosomal imbalances that are associated with the metastatic phenotype. In total, 64 lung SCC from 50 patients were investigated, 25 each with or without evidence of metastasis formation. The chromosomal imbalances summarized by a CGH histogram of the 50 cases revealed deletions most frequently on chromosomes 1p21–p31, 2q34–q36, 3p, 4p, 4q, 5q, 6q14–q24, 8p, 9p, 10q, 11p12–p14, 13q13–qter, 18q12–qter and 21q21. DNA over-representations were most pronounced for chromosomes 1q11–q25, 1q32–q41, 3q, 5p, 8q22–qter, 11q13, 12p, 17q21–q22, 17q24–q25, 19, 20q and 22q. In ten cases, paired samples of primaries and at least one metastasis were analysed. The comparison revealed a considerable chromosomal instability and genetic heterogeneity; however, the CGH pattern indicated a clonal relationship in each case. The difference in histograms from the metastatic and non-metastatic tumour groups was most useful in pinpointing chromosomal imbalances associated with the metastatic phenotype, indicating that the deletions at 3p12–p14, 3p21, 4p15–p16, 6q24–qter, 8p22–p23, 10q21–qter and 21q22, as well as the over-representations at 1q21–q25, 8q, 9q34, 14q12 and 15q12–q15, occurred significantly more often in the metastatic tumour group. The comparison of the paired samples confirmed these findings in individual cases and suggested distinct genetic changes, in particular the extension of small interstitial deletions, during tumour progression. Importantly, metastasis-associated lesions were frequently detectable in the primary tumour providing a method of identifying patients at risk for tumour dissemination. Individual profiles and histograms are accessible at our web site http://amba.charite.de/cgh. © 2000 Cancer Research Campaign PMID:10638968

Performing monkeys of Bangladesh: characterizing their source and genetic variation.

PubMed

Hasan, M Kamrul; Feeroz, M Mostafa; Jones-Engel, Lisa; Engel, Gregory A; Akhtar, Sharmin; Kanthaswamy, Sree; Smith, David Glenn

2016-04-01

The acquisition and training of monkeys to perform is a centuries-old tradition in South Asia, resulting in a large number of rhesus macaques kept in captivity for this purpose. The performing monkeys are reportedly collected from free-ranging populations, and may escape from their owners or may be released into other populations. In order to determine whether this tradition involving the acquisition and movement of animals has influenced the population structure of free-ranging rhesus macaques in Bangladesh, we first characterized the source of these monkeys. Biological samples from 65 performing macaques collected between January 2010 and August 2013 were analyzed for genetic variation using 716 base pairs of mitochondrial DNA. Performing monkey sequences were compared with those of free-ranging rhesus macaque populations in Bangladesh, India and Myanmar. Forty-five haplotypes with 116 (16 %) polymorphic nucleotide sites were detected among the performing monkeys. As for the free-ranging rhesus population, most of the substitutions (89 %) were transitions, and no indels (insertion/deletion) were observed. The estimate of the mean number of pair-wise differences for the performing monkey population was 10.1264 ± 4.686, compared to 14.076 ± 6.363 for the free-ranging population. Fifteen free-ranging rhesus macaque populations were identified as the source of performing monkeys in Bangladesh; several of these populations were from areas where active provisioning has resulted in a large number of macaques. The collection of performing monkeys from India was also evident.

Performing monkeys of Bangladesh: characterizing their source and genetic variation

PubMed Central

Hasan, M Kamrul; Feeroz, M Mostafa; Jones-Engel, Lisa; Engel, Gregory A; Akhtar, Sharmin; Kanthaswamy, Sree; Smith, David Glenn

2016-01-01

The acquisition and training of monkeys to perform is a century's old tradition in South Asia, resulting in a large number of rhesus macaques kept in captivity for this purpose. The performing monkeys are reportedly collected from free-ranging populations and may escape from their owners or be released into other populations. In order to determine whether this tradition, that involves the acquisition and movement of animals, has influenced the population structure of free-ranging rhesus macaques in Bangladesh we first characterized the source of these monkeys. Biological samples from 65 performing macaques, collected between January 2010 and August 2013 were analyzed for genetic variation using 716 base pairs of mitochondrial DNA. Performing monkey sequences were compared with those of free-ranging rhesus macaque populations in Bangladesh, India and Myanmar. Forty-five haplotypes with 116 (16%) polymorphic nucleotide sites were detected among the performing monkeys. As for the free-ranging rhesus population, most of the substitutions (89%) were transitions and no indels (insertion/deletion) were observed. The estimate of the mean number of pair-wise difference for the performing monkey population was 10.1264 ± 4.686, compared to 14.076 ± 6.363 for the free-ranging population. Fifteen free-ranging rhesus macaque populations were identified as the source of performing monkeys in Bangladesh; several of these populations were from areas where active provisioning has resulted in a large number of macaques. Collection of performing monkeys from India was also evident. PMID:26758818

Novel deletion of the E3A ubiquitin protein ligase gene detected by multiplex ligation-dependent probe amplification in a patient with Angelman syndrome

PubMed Central

Calì, Francesco; Ragalmuto, Alda; Chiavetta, Valeria; Calabrese, Giuseppe; Fichera, Marco; Vinci, Mirella; Ruggeri, Giuseppa; Schinocca, Pietro; Sturnio, Maurizio; Romano, Salvatore; Elia, Maurizio

2010-01-01

Angelman syndrome (AS) is a severe neurobehavioural disorder caused by failure of expression of the maternal copy of the imprinted domain located on 15q11-q13. There are different mechanisms leading to AS: maternal microdeletion, uniparental disomy, defects in a putative imprinting centre, mutations of the E3 ubiquitin protein ligase (UBE3A) gene. However, some of suspected cases of AS are still scored negative to all the latter mutations. Recently, it has been shown that a proportion of negative cases bear large deletions overlapping one or more exons of the UBE3A gene. These deletions are difficult to detect by conventional gene-scanning methods due to the masking effect by the non-deleted allele. In this study, we have used for the first time multiplex ligation-dependent probe amplification (MLPA) and comparative multiplex dosage analysis (CMDA) to search for large deletions affecting the UBE3A gene. Using this approach, we identified a novel causative deletion involving exon 8 in an affected sibling. Based on our results, we propose the use of MLPA as a fast, accurate and inexpensive test to detect large deletions in the UBE3A gene in a small but significant percentage of AS patients. PMID:21072004

Mitochondrial DNA deletion percentage in sun exposed and non sun exposed skin.

PubMed

Powers, Julia M; Murphy, Gillian; Ralph, Nikki; O'Gorman, Susan M; Murphy, James E J

2016-12-01

The percentages of mitochondrial genomes carrying the mtDNA 3895 and the mtDNA 4977 (common) deletion were quantified in sun exposed and non sun exposed skin biopsies, for five cohorts of patients varying either in sun exposure profile, age or skin cancer status. Non-melanoma skin cancer diagnoses are rising in Ireland and worldwide [12] but most risk prediction is based on subjective visual estimations of sun exposure history. A quantitative objective test for pre-neoplastic markers may result in better adherence to sun protective behaviours. Mitochondrial DNA (mtDNA) is known to be subject to the loss of a significant proportion of specific sections of genetic code due to exposure to ultraviolet light in sunlight. Although one such deletion has been deemed more sensitive, another, called the mtDNA 4977 or common deletion, has proved to be a more useful indicator of possible risk in this study. Quantitative molecular analysis was carried out to determine the percentage of genomes carrying the deletion using non sun exposed and sun exposed skin biopsies in cohorts of patients with high or low sun exposure profiles and two high exposure groups undergoing treatment for NMSC. Results indicate that mtDNA deletions correlate to sun exposure; in groups with high sun exposure habits a significant increase in deletion number in exposed over non sun exposed skin occurred. An increase in deletion percentage was also seen in older cohorts compared to the younger group. The mtDNA 3895 deletion was detected in small amounts in exposed skin of many patients, the mtDNA 4977 common deletion, although present to some extent in non sun exposed skin, is suggested to be the more reliable and easily detected marker. In all cohorts except the younger group with relatively lower sun exposure, the mtDNA 4977 deletion was more frequent in sun exposed skin samples compared to non-sun exposed skin. Copyright © 2016 Elsevier B.V. All rights reserved.

Robinow syndrome: phenotypic variability in a family with a novel intragenic ROR2 mutation.

PubMed

Brunetti-Pierri, Nicola; Del Gaudio, Daniela; Peters, Hartmut; Justino, Henri; Ott, Claus-Eric; Mundlos, Stefan; Bacino, Carlos A

2008-11-01

Robinow syndrome comprises dysmorphic facial features, short stature, brachymesomelia, segmental spine defects, and genital hypoplasia. The range of severity in this disorder is broad. We report on the clinical and molecular findings of two sib pairs from the same extended family with Robinow syndrome due to a novel intragenic ROR2 deletion involving exons 6 and 7 that could not be detected by sequencing. The affected individuals exhibited variability with respect to the cleft lip, cleft palate, and cardiac findings and for the presence in one of the patients of syringomyelia, which has not been previously reported in Robinow syndrome. Copyright 2008 Wiley-Liss, Inc.

The Drosophila gypsy Insulator Supports Transvection in the Presence of the vestigial Enhancer

PubMed Central

Rickels, Ryan; Labrador, Mariano

2013-01-01

Though operationally defined as cis-regulatory elements, enhancers can also communicate with promoters on a separate homolog in trans, a mechanism that has been suggested to account for the ability of certain alleles of the same gene to complement one another in a process otherwise known as transvection. This homolog-pairing dependent process is facilitated in Drosophila by chromatin-associated pairing proteins, many of which remain unknown and their mechanism of action uncharacterized. Here we have tested the role of the gypsy chromatin insulator in facilitating pairing and communication between enhancers and promoters in trans using a transgenic eGFP reporter system engineered to allow for targeted deletions in the vestigial Boundary Enhancer (vgBE) and the hsp70 minimal promoter, along with one or two flanking gypsy elements. We found a modest 2.5-3x increase in eGFP reporter levels from homozygotes carrying an intact copy of the reporter on each homolog compared to unpaired hemizygotes, although this behavior was independent of gypsy. However, detectable levels of GFP protein along the DV wing boundary in trans-heterozygotes lacking a single enhancer and promoter was only observed in the presence of two flanking gypsy elements. Our results demonstrate that gypsy can stimulate enhancer-promoter communication in trans throughout the genome in a context-dependent manner, likely through modulation of local chromatin dynamics once pairing has been established by other elements and highlights chromatin structure as the master regulator of this phenomenon. PMID:24236213

Spectra of spontaneous frameshift mutations at the hisD3052 allele of Salmonella typhimurium in four DNA repair backgrounds.

PubMed Central

DeMarini, D M; Shelton, M L; Abu-Shakra, A; Szakmary, A; Levine, J G

1998-01-01

To characterize the hisD3052 -1 frameshift allele of Salmonella typhimurium, we analyzed approximately 6000 spontaneous revertants (rev) for a 2-base deletion hotspot within the sequence (CG)4, and we sequenced approximately 500 nonhotspot rev. The reversion target is a minimum of 76 bases (nucleotides 843-918) that code for amino acids within a nonconserved region of the histidinol dehydrogenase protein. Only 0.4-3.9% were true rev. Of the following classes, 182 unique second-site mutations were identified: hotspot, complex frameshifts requiring DeltauvrB + pKM101 (TA98-specific) or not (concerted), 1-base insertions, duplications, and nonhotspot deletions. The percentages of hotspot mutations were 13.8% in TA1978 (wild type), 24.5% in UTH8413 (pKM101), 31.6% in TA1538 (DeltauvrB), and 41.0% in TA98 (DeltauvrB, pKM101). The DeltauvrB allele decreased by three times the mutant frequency (MF, rev/10(8) survivors) of duplications and increased by about two times the MF of deletions. Separately, the DeltauvrB allele or pKM101 plasmid increased by two to three times the MF of hotspot mutations; combined, they increased this MF by five times. The percentage of 1-base insertions was not influenced by either DeltauvrB or pKM101. Hotspot deletions and TA98-specific complex frameshifts are inducible by some mutagens; concerted complex frameshifts and 1-base insertions are not; and there is little evidence for mutagen-induced duplications and nonhotspot deletions. Except for the base substitutions in TA98-specific complex frameshifts, all spontaneous mutations of the hisD3052 allele are likely templated. The mechanisms may involve (1) the potential of direct and inverted repeats to undergo slippage and misalignment and to form quasi-palindromes and (2) the interaction of these sequences with DNA replication and repair proteins. PMID:9584083

Deletion of Plasmodium falciparum Histidine-Rich Protein 2 (pfhrp2) and Histidine-Rich Protein 3 (pfhrp3) Genes in Colombian Parasites.

PubMed

Murillo Solano, Claribel; Akinyi Okoth, Sheila; Abdallah, Joseph F; Pava, Zuleima; Dorado, Erika; Incardona, Sandra; Huber, Curtis S; Macedo de Oliveira, Alexandre; Bell, David; Udhayakumar, Venkatachalam; Barnwell, John W

2015-01-01

A number of studies have analyzed the performance of malaria rapid diagnostic tests (RDTs) in Colombia with discrepancies in performance being attributed to a combination of factors such as parasite levels, interpretation of RDT results and/or the handling and storage of RDT kits. However, some of the inconsistencies observed with results from Plasmodium falciparum histidine-rich protein 2 (PfHRP2)-based RDTs could also be explained by the deletion of the gene that encodes the protein, pfhrp2, and its structural homolog, pfhrp3, in some parasite isolates. Given that pfhrp2- and pfhrp3-negative P. falciparum isolates have been detected in the neighboring Peruvian and Brazilian Amazon regions, we hypothesized that parasites with deletions of pfhrp2 and pfhrp3 may also be present in Colombia. In this study we tested 100 historical samples collected between 1999 and 2009 from six Departments in Colombia for the presence of pfhrp2, pfhrp3 and their flanking genes. Seven neutral microsatellites were also used to determine the genetic background of these parasites. In total 18 of 100 parasite isolates were found to have deleted pfhrp2, a majority of which (14 of 18) were collected from Amazonas Department, which borders Peru and Brazil. pfhrp3 deletions were found in 52 of the 100 samples collected from all regions of the country. pfhrp2 flanking genes PF3D7_0831900 and PF3D7_0831700 were deleted in 22 of 100 and in 1 of 100 samples, respectively. pfhrp3 flanking genes PF3D7_1372100 and PF3D7_1372400 were missing in 55 of 100 and in 57 of 100 samples. Structure analysis of microsatellite data indicated that Colombian samples tested in this study belonged to four clusters and they segregated mostly based on their geographic region. Most of the pfhrp2-deleted parasites were assigned to a single cluster and originated from Amazonas Department although a few pfhrp2-negative parasites originated from the other three clusters. The presence of a high proportion of pfhrp2-negative isolates in the Colombian Amazon may have implications for the use of PfHRP2-based RDTs in the region and may explain inconsistencies observed when PfHRP2-based tests and assays are performed.

Deletion of Plasmodium falciparum Histidine-Rich Protein 2 (pfhrp2) and Histidine-Rich Protein 3 (pfhrp3) Genes in Colombian Parasites

PubMed Central

Murillo Solano, Claribel; Akinyi Okoth, Sheila; Abdallah, Joseph F.; Pava, Zuleima; Dorado, Erika; Incardona, Sandra; Huber, Curtis S.; Macedo de Oliveira, Alexandre; Bell, David; Udhayakumar, Venkatachalam; Barnwell, John W.

2015-01-01

A number of studies have analyzed the performance of malaria rapid diagnostic tests (RDTs) in Colombia with discrepancies in performance being attributed to a combination of factors such as parasite levels, interpretation of RDT results and/or the handling and storage of RDT kits. However, some of the inconsistencies observed with results from Plasmodium falciparum histidine-rich protein 2 (PfHRP2)-based RDTs could also be explained by the deletion of the gene that encodes the protein, pfhrp2, and its structural homolog, pfhrp3, in some parasite isolates. Given that pfhrp2- and pfhrp3-negative P. falciparum isolates have been detected in the neighboring Peruvian and Brazilian Amazon regions, we hypothesized that parasites with deletions of pfhrp2 and pfhrp3 may also be present in Colombia. In this study we tested 100 historical samples collected between 1999 and 2009 from six Departments in Colombia for the presence of pfhrp2, pfhrp3 and their flanking genes. Seven neutral microsatellites were also used to determine the genetic background of these parasites. In total 18 of 100 parasite isolates were found to have deleted pfhrp2, a majority of which (14 of 18) were collected from Amazonas Department, which borders Peru and Brazil. pfhrp3 deletions were found in 52 of the100 samples collected from all regions of the country. pfhrp2 flanking genes PF3D7_0831900 and PF3D7_0831700 were deleted in 22 of 100 and in 1 of 100 samples, respectively. pfhrp3 flanking genes PF3D7_1372100 and PF3D7_1372400 were missing in 55 of 100 and in 57 of 100 samples. Structure analysis of microsatellite data indicated that Colombian samples tested in this study belonged to four clusters and they segregated mostly based on their geographic region. Most of the pfhrp2-deleted parasites were assigned to a single cluster and originated from Amazonas Department although a few pfhrp2-negative parasites originated from the other three clusters. The presence of a high proportion of pfhrp2-negative isolates in the Colombian Amazon may have implications for the use of PfHRP2-based RDTs in the region and may explain inconsistencies observed when PfHRP2-based tests and assays are performed. PMID:26151448

PSE-HMM: genome-wide CNV detection from NGS data using an HMM with Position-Specific Emission probabilities.

PubMed

Malekpour, Seyed Amir; Pezeshk, Hamid; Sadeghi, Mehdi

2016-11-03

Copy Number Variation (CNV) is envisaged to be a major source of large structural variations in the human genome. In recent years, many studies apply Next Generation Sequencing (NGS) data for the CNV detection. However, still there is a necessity to invent more accurate computational tools. In this study, mate pair NGS data are used for the CNV detection in a Hidden Markov Model (HMM). The proposed HMM has position specific emission probabilities, i.e. a Gaussian mixture distribution. Each component in the Gaussian mixture distribution captures a different type of aberration that is observed in the mate pairs, after being mapped to the reference genome. These aberrations may include any increase (decrease) in the insertion size or change in the direction of mate pairs that are mapped to the reference genome. This HMM with Position-Specific Emission probabilities (PSE-HMM) is utilized for the genome-wide detection of deletions and tandem duplications. The performance of PSE-HMM is evaluated on a simulated dataset and also on a real data of a Yoruban HapMap individual, NA18507. PSE-HMM is effective in taking observation dependencies into account and reaches a high accuracy in detecting genome-wide CNVs. MATLAB programs are available at http://bs.ipm.ir/softwares/PSE-HMM/ .

Prevalence of pfhrp2 and pfhrp3 gene deletions in Puerto Lempira, Honduras.

PubMed

Abdallah, Joseph F; Okoth, Sheila Akinyi; Fontecha, Gustavo A; Torres, Rosa Elena Mejia; Banegas, Engels I; Matute, María Luisa; Bucheli, Sandra Tamara Mancero; Goldman, Ira F; de Oliveira, Alexandre Macedo; Barnwell, John W; Udhayakumar, Venkatachalam

2015-01-21

Recent studies have demonstrated the deletion of the histidine-rich protein 2 (PfHRP2) gene (pfhrp2) in field isolates of Plasmodium falciparum, which could result in false negative test results when PfHRP2-based rapid diagnostic tests (RDTs) are used for malaria diagnosis. Although primary diagnosis of malaria in Honduras is determined based on microscopy, RDTs may be useful in remote areas. In this study, it was investigated whether there are deletions of the pfhrp2, pfhrp3 and their respective flanking genes in 68 P. falciparum parasite isolates collected from the city of Puerto Lempira, Honduras. In addition, further investigation considered the possible correlation between parasite population structure and the distribution of these gene deletions by genotyping seven neutral microsatellites. Sixty-eight samples used in this study, which were obtained from a previous chloroquine efficacy study, were utilized in the analysis. All samples were genotyped for pfhrp2, pfhrp3 and flanking genes by PCR. The samples were then genotyped for seven neutral microsatellites in order to determine the parasite population structure in Puerto Lempira at the time of sample collection. It was found that all samples were positive for pfhrp2 and its flanking genes on chromosome 8. However, only 50% of the samples were positive for pfhrp3 and its neighboring genes while the rest were either pfhrp3-negative only or had deleted a combination of pfhrp3 and its neighbouring genes on chromosome 13. Population structure analysis predicted that there are at least two distinct parasite population clusters in this sample population. It was also determined that a greater proportion of parasites with pfhrp3-(and flanking gene) deletions belonged to one cluster compared to the other. The findings indicate that the P. falciparum parasite population in the municipality of Puerto Lempira maintains the pfhrp2 gene and that PfHRP2-based RDTs could be considered for use in this region; however continued monitoring of parasite population will be useful to detect any parasites with deletions of pfhrp2.

Total alpha-globin gene cluster deletion has high frequency in Filipinos

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hunt, J.A.; Haruyama, A.Z.; Chu, B.M.

1994-09-01

Most {alpha}-thalassemias [Thal] are due to large deletions. In Southeast Asians, the (--{sup SEA}) double {alpha}-globin gene deletion is common, 3 (--{sup Tot}) total {alpha}-globin cluster deletions are known: Filipino (--{sup Fil}), Thai (--{sup Thai}), and Chinese (--{sup Chin}). In a Hawaii Thal project, provisional diagnosis of {alpha}-Thal-1 heterozygotes was based on microcytosis, normal isoelectric focusing, and no iron deficiency. One in 10 unselected Filipinos was an {alpha}-Thal-1 heterozygote, 2/3 of these had a (--{sup Tot}) deletion: a {var_sigma}-cDNA probe consistently showed fainter intensity of the constant 5.5 kb {var_sigma}{sub 2} BamHI band, with no heterzygosity for {var_sigma}-globin region polymorphisms;more » {alpha}-cDNA or {var_sigma}-cDNA probes showed no BamHI or BglII bands diagnostic of the (--{sup SEA}) deletion; bands for the (-{alpha}) {alpha}-Thal-2 single {alpha}-globin deletions were only seen in Hb H cases. A reliable monoclonal anti-{var_sigma}-peptide antibody test for the (--{sup SEA}) deletion was always negative in (--{sup Tot}) samples. Southern digests with the Lo probe, a gift from D. Higgs of Oxford Univ., confirmed that 49 of 50 (--{sup Tot}) chromosomes in Filipinos were (--{sup Fil}). Of 20 {alpha}-Thal-1 hydrops born to Filipinos, 11 were (--{sup Fil}/--{sup SEA}) compound heterozygotes; 9 were (--{sup SEA}/--{sup SEA}) homozygotes, but none was a (--{sup Fil}/--{sup Fil}).« less

An atypical deletion of the Williams–Beuren syndrome interval implicates genes associated with defective visuospatial processing and autism

PubMed Central

Edelmann, Lisa; Prosnitz, Aaron; Pardo, Sherly; Bhatt, Jahnavi; Cohen, Ninette; Lauriat, Tara; Ouchanov, Leonid; González, Patricia J; Manghi, Elina R; Bondy, Pamela; Esquivel, Marcela; Monge, Silvia; Delgado, Marietha F; Splendore, Alessandra; Francke, Uta; Burton, Barbara K; McInnes, L Alison

2007-01-01

Background During a genetic study of autism, a female child who met diagnostic criteria for autism spectrum disorder, but also exhibited the cognitive–behavioural profile (CBP) associated with Williams–Beuren syndrome (WBS) was examined. The WBS CBP includes impaired visuospatial ability, an overly friendly personality, excessive non‐social anxiety and language delay. Methods Using array‐based comparative genomic hybridisation (aCGH), a deletion corresponding to BAC RP11‐89A20 in the distal end of the WBS deletion interval was detected. Hemizygosity was confirmed using fluorescence in situ hybridisation and fine mapping was performed by measuring the copy number of genomic DNA using quantitative polymerase chain reaction. Results The proximal breakpoint was mapped to intron 1 of GTF2IRD1 and the distal breakpoint lies 2.4–3.1 Mb towards the telomere. The subject was completely hemizygous for GTF2I, commonly deleted in carriers of the classic ∼1.5 Mb WBS deletion, and GTF2IRD2, deleted in carriers of the rare ∼1.84 Mb WBS deletion. Conclusion Hemizygosity of the GTF2 family of transcription factors is sufficient to produce many aspects of the WBS CBP, and particularly implicate the GTF2 transcription factors in the visuospatial construction deficit. Symptoms of autism in this case may be due to deletion of additional genes outside the typical WBS interval or remote effects on gene expression at other loci. PMID:16971481

Report on Pairing-based Cryptography.

PubMed

Moody, Dustin; Peralta, Rene; Perlner, Ray; Regenscheid, Andrew; Roginsky, Allen; Chen, Lily

2015-01-01

This report summarizes study results on pairing-based cryptography. The main purpose of the study is to form NIST's position on standardizing and recommending pairing-based cryptography schemes currently published in research literature and standardized in other standard bodies. The report reviews the mathematical background of pairings. This includes topics such as pairing-friendly elliptic curves and how to compute various pairings. It includes a brief introduction to existing identity-based encryption (IBE) schemes and other cryptographic schemes using pairing technology. The report provides a complete study of the current status of standard activities on pairing-based cryptographic schemes. It explores different application scenarios for pairing-based cryptography schemes. As an important aspect of adopting pairing-based schemes, the report also considers the challenges inherent in validation testing of cryptographic algorithms and modules. Based on the study, the report suggests an approach for including pairing-based cryptography schemes in the NIST cryptographic toolkit. The report also outlines several questions that will require further study if this approach is followed.

Report on Pairing-based Cryptography

PubMed Central

Moody, Dustin; Peralta, Rene; Perlner, Ray; Regenscheid, Andrew; Roginsky, Allen; Chen, Lily

2015-01-01

This report summarizes study results on pairing-based cryptography. The main purpose of the study is to form NIST’s position on standardizing and recommending pairing-based cryptography schemes currently published in research literature and standardized in other standard bodies. The report reviews the mathematical background of pairings. This includes topics such as pairing-friendly elliptic curves and how to compute various pairings. It includes a brief introduction to existing identity-based encryption (IBE) schemes and other cryptographic schemes using pairing technology. The report provides a complete study of the current status of standard activities on pairing-based cryptographic schemes. It explores different application scenarios for pairing-based cryptography schemes. As an important aspect of adopting pairing-based schemes, the report also considers the challenges inherent in validation testing of cryptographic algorithms and modules. Based on the study, the report suggests an approach for including pairing-based cryptography schemes in the NIST cryptographic toolkit. The report also outlines several questions that will require further study if this approach is followed. PMID:26958435

Widespread Transient Hoogsteen Base-Pairs in Canonical Duplex DNA with Variable Energetics

PubMed Central

Alvey, Heidi S.; Gottardo, Federico L.; Nikolova, Evgenia N.; Al-Hashimi, Hashim M.

2015-01-01

Hoogsteen base-pairing involves a 180 degree rotation of the purine base relative to Watson-Crick base-pairing within DNA duplexes, creating alternative DNA conformations that can play roles in recognition, damage induction, and replication. Here, using Nuclear Magnetic Resonance R1ρ relaxation dispersion, we show that transient Hoogsteen base-pairs occur across more diverse sequence and positional contexts than previously anticipated. We observe sequence-specific variations in Hoogsteen base-pair energetic stabilities that are comparable to variations in Watson-Crick base-pair stability, with Hoogsteen base-pairs being more abundant for energetically less favorable Watson-Crick base-pairs. Our results suggest that the variations in Hoogsteen stabilities and rates of formation are dominated by variations in Watson-Crick base pair stability, suggesting a late transition state for the Watson-Crick to Hoogsteen conformational switch. The occurrence of sequence and position-dependent Hoogsteen base-pairs provide a new potential mechanism for achieving sequence-dependent DNA transactions. PMID:25185517

Probing light chain mutation effects on thrombin via molecular dynamics simulations and machine learning.

PubMed

Xiao, Jiajie; Melvin, Ryan L; Salsbury, Freddie R

2018-03-02

Thrombin is a key component for chemotherapeutic and antithrombotic therapy development. As the physiologic and pathologic roles of the light chain still remain vague, here, we continue previous efforts to understand the impacts of the disease-associated single deletion of LYS9 in the light chain. By combining supervised and unsupervised machine learning methodologies and more traditional structural analyses on data from 10 μs molecular dynamics simulations, we show that the conformational ensemble of the ΔK9 mutant is significantly perturbed. Our analyses consistently indicate that LYS9 deletion destabilizes both the catalytic cleft and regulatory functional regions and result in some conformational changes that occur in tens to hundreds of nanosecond scaled motions. We also reveal that the two forms of thrombin each prefer a distinct binding mode of a Na + ion. We expand our understanding of previous experimental observations and shed light on the mechanisms of the LYS9 deletion associated bleeding disorder by providing consistent but more quantitative and detailed structural analyses than early studies in literature. With a novel application of supervised learning, i.e. the decision tree learning on the hydrogen bonding features in the wild-type and ΔK9 mutant forms of thrombin, we predict that seven pairs of critical hydrogen bonding interactions are significant for establishing distinct behaviors of wild-type thrombin and its ΔK9 mutant form. Our calculations indicate the LYS9 in the light chain has both localized and long-range allosteric effects on thrombin, supporting the opinion that light chain has an important role as an allosteric effector.

A Catalog of Genes Homozygously Deleted in Human Lung Cancer and the Candidacy of PTPRD as a Tumor Suppressor Gene

PubMed Central

Kohno, Takashi; Otsuka, Ayaka; Girard, Luc; Sato, Masanori; Iwakawa, Reika; Ogiwara, Hideaki; Sanchez-Cespedes, Montse; Minna, John D.; Yokota, Jun

2010-01-01

A total of 176 genes homozygously deleted in human lung cancer were identified by DNA array-based whole genome scanning of 52 lung cancer cell lines and subsequent genomic PCR in 74 cell lines, including the 52 cell lines scanned. One or more exons of these genes were homozygously deleted in one (1%) to 20 (27%) cell lines. These genes included known tumor suppressor genes, e.g., CDKN2A/p16, RB1, and SMAD4, and candidate tumor suppressor genes whose hemizygous or homozygous deletions were reported in several types of human cancers, such as FHIT, KEAP1, and LRP1B/LRP-DIP. CDKN2A/p16 and p14ARF located in 9p21 were most frequently deleted (20/74, 27%). The PTPRD gene was most frequently deleted (8/74, 11%) among genes mapping to regions other than 9p21. Somatic mutations, including a nonsense mutation, of the PTPRD gene were detected in 8/74 (11%) of cell lines and 4/95 (4%) of surgical specimens of lung cancer. Reduced PTPRD expression was observed in the majority (>80%) of cell lines and surgical specimens of lung cancer. Therefore, PTPRD is a candidate tumor suppressor gene in lung cancer. Microarray-based expression profiling of 19 lung cancer cell lines also indicated that some of the 176 genes, such as KANK and ADAMTS1, are preferentially inactivated by epigenetic alterations. Genetic/epigenetic as well as functional studies of these 176 genes will increase our understanding of molecular mechanisms behind lung carcinogenesis. PMID:20073072

Characterizing cognitive control abilities in children with 16p11.2 deletion using adaptive 'video game' technology: a pilot study.

PubMed

Anguera, J A; Brandes-Aitken, A N; Rolle, C E; Skinner, S N; Desai, S S; Bower, J D; Martucci, W E; Chung, W K; Sherr, E H; Marco, E J

2016-09-20

Assessing cognitive abilities in children is challenging for two primary reasons: lack of testing engagement can lead to low testing sensitivity and inherent performance variability. Here we sought to explore whether an engaging, adaptive digital cognitive platform built to look and feel like a video game would reliably measure attention-based abilities in children with and without neurodevelopmental disabilities related to a known genetic condition, 16p11.2 deletion. We assessed 20 children with 16p11.2 deletion, a genetic variation implicated in attention deficit/hyperactivity disorder and autism, as well as 16 siblings without the deletion and 75 neurotypical age-matched children. Deletion carriers showed significantly slower response times and greater response variability when compared with all non-carriers; by comparison, traditional non-adaptive selective attention assessments were unable to discriminate group differences. This phenotypic characterization highlights the potential power of administering tools that integrate adaptive psychophysical mechanics into video-game-style mechanics to achieve robust, reliable measurements.

Targeted Gene Deletion in Cordyceps militaris Using the Split-Marker Approach.

PubMed

Lou, HaiWei; Ye, ZhiWei; Yun, Fan; Lin, JunFang; Guo, LiQiong; Chen, BaiXiong; Mu, ZhiXian

2018-05-01

The macrofungus Cordyceps militaris contains many kinds of bioactive ingredients that are regulated by functional genes, but the functions of many genes in C. militaris are still unknown. In this study, to improve the frequency of homologous integration, a genetic transformation system based on a split-marker approach was developed for the first time in C. militaris to knock out a gene encoding a terpenoid synthase (Tns). The linear and split-marker deletion cassettes were constructed and introduced into C. militaris protoplasts by PEG-mediated transformation. The transformation of split-marker fragments resulted in a higher efficiency of targeted gene disruption than the transformation of linear deletion cassettes did. The color phenotype of the Tns gene deletion mutants was different from that of wild-type C. militaris. Moreover, a PEG-mediated protoplast transformation system was established, and stable genetic transformants were obtained. This method of targeted gene deletion represents an important tool for investigating the role of C. militaris genes.

A Study of Airbase Facility/Utility Energy R and D Requirements

DTIC Science & Technology

1992-04-01

facility/utility energy requirements for system implementations, modifications, or deletions were collected, entered into the database, and compared with...BASE_________ ENERGY LOS1 %) 200 MBtu TOTAL COSTS 100 Motu ELECTRIC 100 Motu THERMAL337 Motu ,, OF1FUEL 100 MBtu OF(10 11 PURCHASED S 1800.00 ELECTRIC...this page. Usage Data = *.BTU I. Correct spelling of Base name and Command 2. Macro does the following: Inserts or deletes columns or rows so that D4

Genome-wide analysis of mutations in mutant lineages selected following fast-neutron irradiation mutagenesis of Arabidopsis thaliana

PubMed Central

Belfield, Eric J.; Gan, Xiangchao; Mithani, Aziz; Brown, Carly; Jiang, Caifu; Franklin, Keara; Alvey, Elizabeth; Wibowo, Anjar; Jung, Marko; Bailey, Kit; Kalwani, Sharan; Ragoussis, Jiannis; Mott, Richard; Harberd, Nicholas P.

2012-01-01

Ionizing radiation has long been known to induce heritable mutagenic change in DNA sequence. However, the genome-wide effect of radiation is not well understood. Here we report the molecular properties and frequency of mutations in phenotypically selected mutant lines isolated following exposure of the genetic model flowering plant Arabidopsis thaliana to fast neutrons (FNs). Previous studies suggested that FNs predominantly induce deletions longer than a kilobase in A. thaliana. However, we found a higher frequency of single base substitution than deletion mutations. While the overall frequency and molecular spectrum of fast-neutron (FN)–induced single base substitutions differed substantially from those of “background” mutations arising spontaneously in laboratory-grown plants, G:C>A:T transitions were favored in both. We found that FN-induced G:C>A:T transitions were concentrated at pyrimidine dinucleotide sites, suggesting that FNs promote the formation of mutational covalent linkages between adjacent pyrimidine residues. In addition, we found that FNs induced more single base than large deletions, and that these single base deletions were possibly caused by replication slippage. Our observations provide an initial picture of the genome-wide molecular profile of mutations induced in A. thaliana by FN irradiation and are particularly informative of the nature and extent of genome-wide mutation in lines selected on the basis of mutant phenotypes from FN-mutagenized A. thaliana populations. PMID:22499668

Case-Deletion Diagnostics for Nonlinear Structural Equation Models

ERIC Educational Resources Information Center

Lee, Sik-Yum; Lu, Bin

2003-01-01

In this article, a case-deletion procedure is proposed to detect influential observations in a nonlinear structural equation model. The key idea is to develop the diagnostic measures based on the conditional expectation of the complete-data log-likelihood function in the EM algorithm. An one-step pseudo approximation is proposed to reduce the…

Psi- vectors: murine leukemia virus-based self-inactivating and self-activating retroviral vectors.

PubMed Central

Delviks, K A; Hu, W S; Pathak, V K

1997-01-01

We have developed murine leukemia virus (MLV)-based self-inactivating and self-activating vectors to show that the previously demonstrated high-frequency direct repeat deletions are not unique to spleen necrosis virus (SNV) or the neomycin drug resistance gene. Retroviral vectors pKD-HTTK and pKD-HTpTK containing direct repeats composed of segments of the herpes simplex virus type 1 thymidine kinase (HTK) gene were constructed; in pKD-HTpTK, the direct repeat flanked the MLV packaging signal. The generation of hypoxanthine-aminopterin-thymidine-resistant colonies after one cycle of retroviral replication demonstrated functional reconstitution of the HTK gene. Quantitative Southern analysis indicated that direct repeat deletions occurred in 57 and 91% of the KD-HTTK and KD-HTpTK proviruses, respectively. These results demonstrate that (i) deletion of direct repeats occurs at similar high frequencies in SNV and MLV vectors, (ii) MLV psi can be efficiently deleted by using direct repeats, (iii) suicide genes can be functionally reconstituted during reverse transcription, and (iv) the psi region may be a hot spot for reverse transcriptase template switching events. PMID:9223521

Digital PCR methods improve detection sensitivity and measurement precision of low abundance mtDNA deletions.

PubMed

Belmonte, Frances R; Martin, James L; Frescura, Kristin; Damas, Joana; Pereira, Filipe; Tarnopolsky, Mark A; Kaufman, Brett A

2016-04-28

Mitochondrial DNA (mtDNA) mutations are a common cause of primary mitochondrial disorders, and have also been implicated in a broad collection of conditions, including aging, neurodegeneration, and cancer. Prevalent among these pathogenic variants are mtDNA deletions, which show a strong bias for the loss of sequence in the major arc between, but not including, the heavy and light strand origins of replication. Because individual mtDNA deletions can accumulate focally, occur with multiple mixed breakpoints, and in the presence of normal mtDNA sequences, methods that detect broad-spectrum mutations with enhanced sensitivity and limited costs have both research and clinical applications. In this study, we evaluated semi-quantitative and digital PCR-based methods of mtDNA deletion detection using double-stranded reference templates or biological samples. Our aim was to describe key experimental assay parameters that will enable the analysis of low levels or small differences in mtDNA deletion load during disease progression, with limited false-positive detection. We determined that the digital PCR method significantly improved mtDNA deletion detection sensitivity through absolute quantitation, improved precision and reduced assay standard error.

Digital PCR methods improve detection sensitivity and measurement precision of low abundance mtDNA deletions

PubMed Central

Belmonte, Frances R.; Martin, James L.; Frescura, Kristin; Damas, Joana; Pereira, Filipe; Tarnopolsky, Mark A.; Kaufman, Brett A.

2016-01-01

Mitochondrial DNA (mtDNA) mutations are a common cause of primary mitochondrial disorders, and have also been implicated in a broad collection of conditions, including aging, neurodegeneration, and cancer. Prevalent among these pathogenic variants are mtDNA deletions, which show a strong bias for the loss of sequence in the major arc between, but not including, the heavy and light strand origins of replication. Because individual mtDNA deletions can accumulate focally, occur with multiple mixed breakpoints, and in the presence of normal mtDNA sequences, methods that detect broad-spectrum mutations with enhanced sensitivity and limited costs have both research and clinical applications. In this study, we evaluated semi-quantitative and digital PCR-based methods of mtDNA deletion detection using double-stranded reference templates or biological samples. Our aim was to describe key experimental assay parameters that will enable the analysis of low levels or small differences in mtDNA deletion load during disease progression, with limited false-positive detection. We determined that the digital PCR method significantly improved mtDNA deletion detection sensitivity through absolute quantitation, improved precision and reduced assay standard error. PMID:27122135

Boyer-Moore Algorithm in Retrieving Deleted Short Message Service in Android Platform

NASA Astrophysics Data System (ADS)

Rahmat, R. F.; Prayoga, D. F.; Gunawan, D.; Sitompul, O. S.

2018-02-01

Short message service (SMS) can be used as digital evidence of disclosure of crime because it can strengthen the charges against the offenders. Criminals use various ways to destroy the evidence, including by deleting SMS. On the Android OS, SMS is stored in a SQLite database file. Deletion of SMS data is not followed by bit deletion in memory so that it is possible to rediscover the deleted SMS. Based on this case, the mobile forensic needs to be done to rediscover the short message service. The proposed method in this study is Boyer-Moore algorithm for searching string matching. An auto finds feature is designed to rediscover the short message service by searching using a particular pattern to rematch a text with the result of the hex value conversion in the database file. The system will redisplay the message for each of a match. From all the testing results, the proposed method has quite a high accuracy in rediscovering the short message service using the used dataset. The search results to rediscover the deleted SMS depend on the possibility of overwriting process and the vacuum procedure on the database file.

[Construction of enterohemorrhagic Escherichia coli O157:H7 strains with espF gene deletion and complementation].

PubMed

Hua, Ying; Sun, Qi; Wang, Xiangyu; DU, Yanli; Shao, Na; Zhang, Qiwei; Zhao, Wei; Wan, Chengsong

2015-11-01

To construct enterohemorrhagic Escherichia coli (EHEC) O157:H7 strains with delection espF gene and its nucleotide fragment and with espF gene complementation. A pair of homologous arm primers was designed to amplify the gene fragment of kanamycin resistance, which was transformed into EHEC O157:H7 EDL933w strain via the PKD46 plasmid by electroporation. The replacement of the espF gene by kanamycin resistance gene through the PKD46-mediated red recombination system was confirmed by PCR and sequencing. The entire coding region of espF along with its nucleotide fragment was amplified by PCR and cloned into pBAD33 plasmid, which was transformed into a mutant strain to construct the strain with espF complementation. RT-PCR was used to verify the transcription of espF and its nucleotide fragment in the complemented mutant strain. We established EHEC O157:H7 EDL933w strains with espF gene deletion and with espF gene complementation. Both espF and its nucleotide fragment were transcribed in the complemented mutant strain. The two strains provide a basis for further study of the regulatory mechanism of espF.

Characterization of a complex chromosomal rearrangement using chromosome, FISH, and microarray assays in a girl with multiple congenital abnormalities and developmental delay

PubMed Central

2014-01-01

Complex chromosomal rearrangements (CCRs) are balanced or unbalanced structural rearrangements involving three or more cytogenetic breakpoints on two or more chromosomal pairs. The phenotypic anomalies in such cases are attributed to gene disruption, superimposed cryptic imbalances in the genome, and/or position effects. We report a 14-year-old girl who presented with multiple congenital anomalies and developmental delay. Chromosome and FISH analysis indicated a highly complex chromosomal rearrangement involving three chromosomes (3, 7 and 12), seven breakpoints as a result of one inversion, two insertions, and two translocations forming three derivative chromosomes. Additionally, chromosomal microarray study (CMA) revealed two submicroscopic deletions at 3p12.3 (467 kb) and 12q13.12 (442 kb). We postulate that microdeletion within the ROBO1 gene at 3p12.3 may have played a role in the patient’s developmental delay, since it has potential activity-dependent role in neurons. Additionally, factors other than genomic deletions such as loss of function or position effects may also contribute to the abnormal phenotype in our patient. PMID:25478007

Targeted 'next-generation' sequencing in anophthalmia and microphthalmia patients confirms SOX2, OTX2 and FOXE3 mutations.

PubMed

Jimenez, Nelson Lopez; Flannick, Jason; Yahyavi, Mani; Li, Jiang; Bardakjian, Tanya; Tonkin, Leath; Schneider, Adele; Sherr, Elliott H; Slavotinek, Anne M

2011-12-28

Anophthalmia/microphthalmia (A/M) is caused by mutations in several different transcription factors, but mutations in each causative gene are relatively rare, emphasizing the need for a testing approach that screens multiple genes simultaneously. We used next-generation sequencing to screen 15 A/M patients for mutations in 9 pathogenic genes to evaluate this technology for screening in A/M. We used a pooled sequencing design, together with custom single nucleotide polymorphism (SNP) calling software. We verified predicted sequence alterations using Sanger sequencing. We verified three mutations - c.542delC in SOX2, resulting in p.Pro181Argfs*22, p.Glu105X in OTX2 and p.Cys240X in FOXE3. We found several novel sequence alterations and SNPs that were likely to be non-pathogenic - p.Glu42Lys in CRYBA4, p.Val201Met in FOXE3 and p.Asp291Asn in VSX2. Our analysis methodology gave one false positive result comprising a mutation in PAX6 (c.1268A > T, predicting p.X423LeuextX*15) that was not verified by Sanger sequencing. We also failed to detect one 20 base pair (bp) deletion and one 3 bp duplication in SOX2. Our results demonstrated the power of next-generation sequencing with pooled sample groups for the rapid screening of candidate genes for A/M as we were correctly able to identify disease-causing mutations. However, next-generation sequencing was less useful for small, intragenic deletions and duplications. We did not find mutations in 10/15 patients and conclude that there is a need for further gene discovery in A/M.

Targeted 'Next-Generation' sequencing in anophthalmia and microphthalmia patients confirms SOX2, OTX2 and FOXE3 mutations

PubMed Central

2011-01-01

Background Anophthalmia/microphthalmia (A/M) is caused by mutations in several different transcription factors, but mutations in each causative gene are relatively rare, emphasizing the need for a testing approach that screens multiple genes simultaneously. We used next-generation sequencing to screen 15 A/M patients for mutations in 9 pathogenic genes to evaluate this technology for screening in A/M. Methods We used a pooled sequencing design, together with custom single nucleotide polymorphism (SNP) calling software. We verified predicted sequence alterations using Sanger sequencing. Results We verified three mutations - c.542delC in SOX2, resulting in p.Pro181Argfs*22, p.Glu105X in OTX2 and p.Cys240X in FOXE3. We found several novel sequence alterations and SNPs that were likely to be non-pathogenic - p.Glu42Lys in CRYBA4, p.Val201Met in FOXE3 and p.Asp291Asn in VSX2. Our analysis methodology gave one false positive result comprising a mutation in PAX6 (c.1268A > T, predicting p.X423LeuextX*15) that was not verified by Sanger sequencing. We also failed to detect one 20 base pair (bp) deletion and one 3 bp duplication in SOX2. Conclusions Our results demonstrated the power of next-generation sequencing with pooled sample groups for the rapid screening of candidate genes for A/M as we were correctly able to identify disease-causing mutations. However, next-generation sequencing was less useful for small, intragenic deletions and duplications. We did not find mutations in 10/15 patients and conclude that there is a need for further gene discovery in A/M. PMID:22204637

Enhancer‐promoter Activity of Human Papillomavirus Type 16 Long Control Regions Isolated from Cell Lines SiHa and CaSki and Cervical Cancer Biopsies

PubMed Central

Kozuka, Takuyo; Aoki, Yukimasa; Nakagawa, Keiichi; Ohtomo, Kuni; Yoshikawa, Hiroyuki; Matsumoto, Koji; Yoshiike, Kunito

2000-01-01

Expression of human papillomavirus 16 (HPV‐16) oncogenes is markedly higher in cervical cancer cells than in precancerous cells, and the elevated expression is believed to be required for the malignant phenotypes. We compared cancer cell lines CaSki (with 200 to 400 copies of HPV‐16 DNA per cell) and SiHa (with one to two copies of HPV‐16 DNA per cell) for the E7 expression in cells and the enhancer‐promoter activity of the isolated viral long control region (LCR). Although these parameters per cell were 10‐fold higher in CaSki than in SiHa, the levels of the E7 mRNA and protein per HPV DNA copy were 10‐ to 20‐fold higher in SiHa than in CaSki. Characterization of the isolated LCRs showed that, whereas the LCR from CaSki resembled the prototype in structure and activity, the LCR from SiHa, with a deletion of 38 base pairs, enhanced transcription from P97 as assayed by using a plasmid capable of expressing luciferase. The upregulation appeared to be due to removal of one of the silencer YY1‐binding sites. Furthermore, we isolated and characterized LCRs from 51 cervical cancer patients’ biopsies. Among them, one with a deletion including YY1‐binding sites and the other with a substitution in a YY1‐motif were found to enhance the transcription. These findings suggest that mutation affecting YY1‐motifs in the LCR is one of the mechanisms enhancing the viral oncogene expression in the course of progression of cancer cells. PMID:10760685

Prognostic value of a CCR5 defective allele in pediatric HIV-1 infection.

PubMed Central

Romiti, M. L.; Colognesi, C.; Cancrini, C.; Mas, A.; Berrino, M.; Salvatori, F.; Orlandi, P.; Jansson, M.; Palomba, E.; Plebani, A.; Bertran, J. M.; Hernandez, M.; de Martino, M.; Amoroso, A.; Tovo, P. A.; Rossi, P.; Espanol, T.; Scarlatti, G.

2000-01-01

BACKGROUND: A deletion of 32 base pairs in the CCR5 gene (delta32 CCR5) has been linked to resistance to HIV-1 infection in exposed adults and to the delay of disease progression in infected adults. MATERIALS AND METHODS: To determine the role of delta32 CCR5 in disease progression of HIV-1 infected children born to seropositive mothers, we studied a polymerase chain reaction in 301 HIV-1 infected, 262 HIV-1 exposed-uninfected and 47 HIV-1 unexposed-uninfected children of Spanish and Italian origin. Infected children were further divided into two groups according to their rate of HIV-1 disease progression: rapid progressors who developed severe clinical and/or immunological conditions within the second year of life, and delayed progressors with any other evolution of disease. Among the latter were the long-term, non-progressors (LTNP) who presented with mild or no symptoms of HIV-1 infection above 8 years of age. Viral phenotype was studied for 45 delayed progressors. RESULTS: No correlation was found between delta32 CCR5 and mother-to-child transmission of HIV-1. However, the frequency of the deletion was substantially higher in LTNP, compared with delayed (p = 0.019) and rapid progressors (p = 0.0003). In children carrying the delta32 CCRS mutation, the presence of MT-2 tropic virus isolate was associated with a severe immune suppression (p = 0.028); whereas, the presence of MT-2 negative viruses correlated with LTNP (p = 0.010). CONCLUSIONS: Given the rapidity and simplicity of the assay, the delta32 CCR5 mutation may be a useful predictive marker to identify children with delayed disease progression who, consequently, may not require immediate antiretroviral treatment. PMID:10803406

Prognostic value of a CCR5 defective allele in pediatric HIV-1 infection.

PubMed

Romiti, M L; Colognesi, C; Cancrini, C; Mas, A; Berrino, M; Salvatori, F; Orlandi, P; Jansson, M; Palomba, E; Plebani, A; Bertran, J M; Hernandez, M; de Martino, M; Amoroso, A; Tovo, P A; Rossi, P; Espanol, T; Scarlatti, G

2000-01-01

A deletion of 32 base pairs in the CCR5 gene (delta32 CCR5) has been linked to resistance to HIV-1 infection in exposed adults and to the delay of disease progression in infected adults. To determine the role of delta32 CCR5 in disease progression of HIV-1 infected children born to seropositive mothers, we studied a polymerase chain reaction in 301 HIV-1 infected, 262 HIV-1 exposed-uninfected and 47 HIV-1 unexposed-uninfected children of Spanish and Italian origin. Infected children were further divided into two groups according to their rate of HIV-1 disease progression: rapid progressors who developed severe clinical and/or immunological conditions within the second year of life, and delayed progressors with any other evolution of disease. Among the latter were the long-term, non-progressors (LTNP) who presented with mild or no symptoms of HIV-1 infection above 8 years of age. Viral phenotype was studied for 45 delayed progressors. No correlation was found between delta32 CCR5 and mother-to-child transmission of HIV-1. However, the frequency of the deletion was substantially higher in LTNP, compared with delayed (p = 0.019) and rapid progressors (p = 0.0003). In children carrying the delta32 CCRS mutation, the presence of MT-2 tropic virus isolate was associated with a severe immune suppression (p = 0.028); whereas, the presence of MT-2 negative viruses correlated with LTNP (p = 0.010). Given the rapidity and simplicity of the assay, the delta32 CCR5 mutation may be a useful predictive marker to identify children with delayed disease progression who, consequently, may not require immediate antiretroviral treatment.

Disruption of MBD5 contributes to a spectrum of psychopathology and neurodevelopmental abnormalities

PubMed Central

Hodge, Jennelle C.; Mitchell, Elyse; Pillalamarri, Vamsee; Toler, Tomi L.; Bartel, Frank; Kearney, Hutton M.; Zou, Ying S.; Tan, Wen-Hann; Hanscom, Carrie; Kirmani, Salman; Hanson, Rae R.; Skinner, Steven A.; Rogers, Curtis; Everman, David B.; Boyd, Ellen; Mullegama, Sureni V.; Keelean-Fuller, Debra; Powell, Cynthia M.; Elsea, Sarah H.; Morton, Cynthia C.; Gusella, James F.; DuPont, Barbara; Chaubey, Alka; Lin, Angela E.; Talkowski, Michael E.

2016-01-01

Microdeletions of chromosomal region 2q23.1 that disrupt MBD5 contribute to a spectrum of neurodevelopmental phenotypes, however the impact of this locus in human psychopathology has not been described. To characterize the structural variation landscape of MBD5 disruptions and the associated psychopathology, 22 individuals with genomic disruption of MBD5 (translocation, point mutation, and deletion) were identified through whole-genome sequencing or cytogenomic microarray at 11 molecular diagnostic centers. The genomic impact ranged from a single base pair to 5.4 Mb. Parents were available for 11 cases, all of which confirmed the rearrangement arose de novo. Phenotypes were largely indistinguishable between patients with full-segment 2q23.1 deletions and those with intragenic MBD5 rearrangements, including alterations confined entirely to the 5′UTR, confirming the critical impact of non-coding sequence at this locus. We found heterogeneous, multi-system pathogenic effects of MBD5 disruption and characterized the associated spectrum of psychopathology, which includes sensory integration disorder, anxiety, self-hugging, bipolar disorder and others. Importantly, unique features of the oldest assessed patient were early-onset dementia and behavioral regression. Analyses also revealed phenotypes that distinguish MBD5 disruptions from seven well-established syndromes with significant diagnostic overlap. This study indicates that haploinsufficiency of MBD5 causes diverse phenotypes, yields insight into the spectrum of resulting neurodevelopmental and behavioral psychopathology, and provides clinical context for interpretation of MBD5 structural variations. Empirical evidence also suggests that disruption of non-coding MBD5 regulatory regions is sufficient for clinical manifestation, highlighting the limitations of exon-focused assessments. These results suggest an ongoing perturbation of neurological function throughout the lifespan, including risks for neurobehavioral regression and early-onset dementia. PMID:23587880

Whole exome sequencing identified 1 base pair novel deletion in BCL2-associated athanogene 3 (BAG3) gene associated with severe dilated cardiomyopathy (DCM) requiring heart transplant in multiple family members.

PubMed

Rafiq, Muhammad Arshad; Chaudhry, Ayeshah; Care, Melanie; Spears, Danna A; Morel, Chantal F; Hamilton, Robert M

2017-03-01

Dilated cardiomyopathy (DCM) is characterized by dilation and impaired contraction of the left ventricle or both ventricles. Among hereditary DCM, the genetic causes are heterogeneous, and include mutations encoding cytoskeletal, nucleoskeletal, mitochondrial, and calcium-handling proteins. We report three severely affected males, in a four-generation pedigree, with DCM phenotype who underwent cardiac transplant. Cardiomegaly with marked biventricular dilation and fibrosis were noticeable histopathological findings. The affected males had tested negative on a 46-gene pancardiomyopathy panel. Whole Exome Sequencing (WES) was performed to reveal mutation in the gene responsible in generation of DCM phenotypes. The 1-bp (Chr10:121435979delC; c.913delC) novel heterozygous deletion in exon 4 of BAG3, was identified in three affected males, resulted in frame-shift and a premature termination codon (p.Met306-Stop) producing a truncated BAG3 protein lacking functionally important PXXP and BAG domains. WES data were further utilized to map 10 SNP markers around the discovered mutation to generate shared disease haplotype in all affected individuals encompassing 11 Mb on 10q25.3-26.2 harboring BAG3. Finally genotypes were inferred for the unavailable/deceased individuals in the pedigrees. Here we propose that Chr10:121435979delC in BAG3 is a causal mutation in these subjects. Our and earlier studies indicate that BAG3 mutations are associated with DCM phenotypes. BAG3 should be added to cardiomyopathy gene panels for screening of DCM patients, and patients previously considered gene elusive should undergo sequencing of the BAG3 gene. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

Massively parallel sequencing of 68 insertion/deletion markers identifies novel microhaplotypes for utility in human identity testing.

PubMed

Wendt, Frank R; Warshauer, David H; Zeng, Xiangpei; Churchill, Jennifer D; Novroski, Nicole M M; Song, Bing; King, Jonathan L; LaRue, Bobby L; Budowle, Bruce

2016-11-01

Short tandem repeat (STR) loci are the traditional markers used for kinship, missing persons, and direct comparison human identity testing. These markers hold considerable value due to their highly polymorphic nature, amplicon size, and ability to be multiplexed. However, many STRs are still too large for use in analysis of highly degraded DNA. Small bi-allelic polymorphisms, such as insertions/deletions (INDELs), may be better suited for analyzing compromised samples, and their allele size differences are amenable to analysis by capillary electrophoresis. The INDEL marker allelic states range in size from 2 to 6 base pairs, enabling small amplicon size. In addition, heterozygote balance may be increased by minimizing preferential amplification of the smaller allele, as is more common with STR markers. Multiplexing a large number of INDELs allows for generating panels with high discrimination power. The Nextera™ Rapid Capture Custom Enrichment Kit (Illumina, Inc., San Diego, CA) and massively parallel sequencing (MPS) on the Illumina MiSeq were used to sequence 68 well-characterized INDELs in four major US population groups. In addition, the STR Allele Identification Tool: Razor (STRait Razor) was used in a novel way to analyze INDEL sequences and detect adjacent single nucleotide polymorphisms (SNPs) and other polymorphisms. This application enabled the discovery of unique allelic variants, which increased the discrimination power and decreased the single-locus random match probabilities (RMPs) of 22 of these well-characterized INDELs which can be considered as microhaplotypes. These findings suggest that additional microhaplotypes containing human identification (HID) INDELs may exist elsewhere in the genome. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

A genetic study of the ghrelin and growth hormone secretagogue receptor (GHSR) genes and stature.

PubMed

Gueorguiev, M; Lecoeur, C; Benzinou, M; Mein, C A; Meyre, D; Vatin, V; Weill, J; Heude, B; Grossman, A B; Froguel, P; Korbonits, M

2009-01-01

Growth and nutrition are interrelated and influenced by multiple genetic and environmental factors. We studied whether common variants in ghrelin and ghrelin receptor (GHSR) genes could play a role in stature variation in the general population and in families ascertained for obesity. Selected tagging SNPs in the ghrelin and GHSR genes were genotyped in 263 Caucasian families recruited for childhood obesity (1,275 subjects), and in 287 families from a general population (1,072 subjects). We performed familial testing for associations in the entire population and in a sub-set of the samples selected for a case-control study. In the case-control study for height (cases were selected from the obese cohort with mean ZH = 3.17 +/- 0.15 confidence interval (CI) versus controls with mean ZH 0.14 +/- 0.09), we found an association with a 2 base-pair intronic deletion in the GHSR gene (rs10618418) (p = 0.006, odds ratio (OR) 1.86, 95% CI [1.26;2.74] under additive model), although when adjusting for BMI, the association disappeared (p = 0.06). Individuals carrying no deletion or who were heterozygous were significantly more frequent among the tall obese population (52% vs. 36% in controls, p = 0.007, OR 1.97, 95%CI [1.22;3.18]). However, the association was not maintained after correcting for multiple testing. Familial association testing of the ghrelin and GHSR genes and their interaction testing failed to show that any combination of SNPs had any significant effect. Thus, our results suggest that common variants of the ghrelin and GHSR genes are not major contributors to height variation in a French population.

Abscisic Acid-Dependent and -Independent Expression of the Carrot Late-Embryogenesis-Abundant-Class Gene Dc3 in Transgenic Tobacco Seedlings1

PubMed Central

Siddiqui, Najeeb U.; Chung, Hwa-Jee; Thomas, Terry L.; Drew, Malcolm C.

1998-01-01

We studied the expression of three promoter 5′ deletion constructs (−218, −599, and −1312) of the LEA (late embryogenesis abundant)-class gene Dc3 fused to β-glucuronidase (GUS), where each construct value refers to the number of base pairs upstream of the transcription start site at which the deletion occurred. The Dc3 gene is noted for its induction by abscisic acid (ABA), but its response to other plant hormones and various environmental stresses has not been reported previously for vegetative cells. Fourteen-day-old transgenic tobacco (Nicotiana tabacum L.) seedlings were exposed to dehydration, hypoxia, salinity, exogenous ethylene, or exogenous methyl jasmonate (MeJa). GUS activity was quantified fluorimetrically and expression was observed by histochemical staining of the seedlings. An increase in GUS activity was observed in plants with constructs −599 and −1312 in response to dehydration and salinity within 6 h of stress, and at 12 h in response to hypoxia. No increase in endogenous ABA was found in any of the three lines, even after 72 h of hypoxia. An ABA-independent increase in GUS activity was observed when endogenous ABA biosynthesis was blocked by fluridone and plants were exposed to 5 μL L−1 ethylene in air or 100 μm MeJa. Virtually no expression was observed in construct −218 in response to dehydration, salinity, or MeJa, but there was a moderate response to ethylene and hypoxia. This suggests that the region between −218 and −599 is necessary for ABA (dehydration and salinity)- and MeJa-dependent expression, whereas ethylene-mediated expression does not require this region of the promoter. PMID:9847092

Characteristics of MHC class I genes in house sparrows Passer domesticus as revealed by long cDNA transcripts and amplicon sequencing.

PubMed

Karlsson, Maria; Westerdahl, Helena

2013-08-01

In birds the major histocompatibility complex (MHC) organization differs both among and within orders; chickens Gallus gallus of the order Galliformes have a simple arrangement, while many songbirds of the order Passeriformes have a more complex arrangement with larger numbers of MHC class I and II genes. Chicken MHC genes are found at two independent loci, classical MHC-B and non-classical MHC-Y, whereas non-classical MHC genes are yet to be verified in passerines. Here we characterize MHC class I transcripts (α1 to α3 domain) and perform amplicon sequencing using a next-generation sequencing technique on exon 3 from house sparrow Passer domesticus (a passerine) families. Then we use phylogenetic, selection, and segregation analyses to gain a better understanding of the MHC class I organization. Trees based on the α1 and α2 domain revealed a distinct cluster with short terminal branches for transcripts with a 6-bp deletion. Interestingly, this cluster was not seen in the tree based on the α3 domain. 21 exon 3 sequences were verified in a single individual and the average numbers within an individual were nine and five for sequences with and without a 6-bp deletion, respectively. All individuals had exon 3 sequences with and without a 6-bp deletion. The sequences with a 6-bp deletion have many characteristics in common with non-classical MHC, e.g., highly conserved amino acid positions were substituted compared with the other alleles, low nucleotide diversity and just a single site was subject to positive selection. However, these alleles also have characteristics that suggest they could be classical, e.g., complete linkage and absence of a distinct cluster in a tree based on the α3 domain. Thus, we cannot determine for certain whether or not the alleles with a 6-bp deletion are non-classical based on our present data. Further analyses on segregation patterns of these alleles in combination with dating the 6-bp deletion through MHC characterization across the genus Passer may solve this matter in the future.

An assessment of heavy ion irradiation mutagenesis for reverse genetics in wheat (Triticum aestivum L.).

PubMed

Fitzgerald, Timothy L; Powell, Jonathan J; Stiller, Jiri; Weese, Terri L; Abe, Tomoko; Zhao, Guangyao; Jia, Jizeng; McIntyre, C Lynne; Li, Zhongyi; Manners, John M; Kazan, Kemal

2015-01-01

Reverse genetic techniques harnessing mutational approaches are powerful tools that can provide substantial insight into gene function in plants. However, as compared to diploid species, reverse genetic analyses in polyploid plants such as bread wheat can present substantial challenges associated with high levels of sequence and functional similarity amongst homoeologous loci. We previously developed a high-throughput method to identify deletions of genes within a physically mutagenized wheat population. Here we describe our efforts to combine multiple homoeologous deletions of three candidate disease susceptibility genes (TaWRKY11, TaPFT1 and TaPLDß1). We were able to produce lines featuring homozygous deletions at two of the three homoeoloci for all genes, but this was dependent on the individual mutants used in crossing. Intriguingly, despite extensive efforts, viable lines possessing homozygous deletions at all three homoeoloci could not be produced for any of the candidate genes. To investigate deletion size as a possible reason for this phenomenon, we developed an amplicon sequencing approach based on synteny to Brachypodium distachyon to assess the size of the deletions removing one candidate gene (TaPFT1) in our mutants. These analyses revealed that genomic deletions removing the locus are relatively large, resulting in the loss of multiple additional genes. The implications of this work for the use of heavy ion mutagenesis for reverse genetic analyses in wheat are discussed.

An Assessment of Heavy Ion Irradiation Mutagenesis for Reverse Genetics in Wheat (Triticum aestivum L.)

PubMed Central

Fitzgerald, Timothy L.; Powell, Jonathan J.; Stiller, Jiri; Weese, Terri L.; Abe, Tomoko; Zhao, Guangyao; Jia, Jizeng; McIntyre, C. Lynne; Li, Zhongyi; Manners, John M.; Kazan, Kemal

2015-01-01

Reverse genetic techniques harnessing mutational approaches are powerful tools that can provide substantial insight into gene function in plants. However, as compared to diploid species, reverse genetic analyses in polyploid plants such as bread wheat can present substantial challenges associated with high levels of sequence and functional similarity amongst homoeologous loci. We previously developed a high-throughput method to identify deletions of genes within a physically mutagenized wheat population. Here we describe our efforts to combine multiple homoeologous deletions of three candidate disease susceptibility genes (TaWRKY11, TaPFT1 and TaPLDß1). We were able to produce lines featuring homozygous deletions at two of the three homoeoloci for all genes, but this was dependent on the individual mutants used in crossing. Intriguingly, despite extensive efforts, viable lines possessing homozygous deletions at all three homoeoloci could not be produced for any of the candidate genes. To investigate deletion size as a possible reason for this phenomenon, we developed an amplicon sequencing approach based on synteny to Brachypodium distachyon to assess the size of the deletions removing one candidate gene (TaPFT1) in our mutants. These analyses revealed that genomic deletions removing the locus are relatively large, resulting in the loss of multiple additional genes. The implications of this work for the use of heavy ion mutagenesis for reverse genetic analyses in wheat are discussed. PMID:25719507

Histidine-rich protein 2 (pfhrp2) and pfhrp3 gene deletions in Plasmodium falciparum isolates from select sites in Brazil and Bolivia.

PubMed

Rachid Viana, Giselle Maria; Akinyi Okoth, Sheila; Silva-Flannery, Luciana; Lima Barbosa, Danielle Regina; Macedo de Oliveira, Alexandre; Goldman, Ira F; Morton, Lindsay C; Huber, Curtis; Anez, Arletta; Dantas Machado, Ricardo Luiz; Aranha Camargo, Luís Marcelo; Costa Negreiros do Valle, Suiane; Marins Póvoa, Marinete; Udhayakumar, Venkatachalam; Barnwell, John W

2017-01-01

More than 80% of available malaria rapid diagnostic tests (RDTs) are based on the detection of histidine-rich protein-2 (PfHRP2) for diagnosis of Plasmodium falciparum malaria. Recent studies have shown the genes that code for this protein and its paralog, histidine-rich protein-3 (PfHRP3), are absent in parasites from the Peruvian Amazon Basin. Lack of PfHRP2 protein through deletion of the pfhrp2 gene leads to false-negative RDT results for P. falciparum. We have evaluated the extent of pfhrp2 and pfhrp3 gene deletions in a convenience sample of 198 isolates from six sites in three states across the Brazilian Amazon Basin (Acre, Rondonia and Para) and 25 isolates from two sites in Bolivia collected at different times between 2010 and 2012. Pfhrp2 and pfhrp3 gene and their flanking genes on chromosomes 7 and 13, respectively, were amplified from 198 blood specimens collected in Brazil. In Brazil, the isolates collected in Acre state, located in the western part of the Brazilian Amazon, had the highest percentage of deletions for pfhrp2 25 (31.2%) of 79, while among those collected in Rondonia, the prevalence of pfhrp2 gene deletion was only 3.3% (2 out of 60 patients). In isolates from Para state, all parasites were pfhrp2-positive. In contrast, we detected high proportions of isolates from all 3 states that were pfhrp3-negative ranging from 18.3% (11 out of 60 samples) to 50.9% (30 out of 59 samples). In Bolivia, only one of 25 samples (4%) tested had deleted pfhrp2 gene, while 68% (17 out of 25 samples) were pfhrp3-negative. Among the isolates tested, P. falciparum pfhrp2 gene deletions were present mainly in those from Acre State in the Brazilian Amazon. These results indicate it is important to reconsider the use of PfHRP2-based RDTs in the western region of the Brazilian Amazon and to implement appropriate surveillance systems to monitor pfhrp2 gene deletions in this and other parts of the Amazon region.

Histidine-rich protein 2 (pfhrp2) and pfhrp3 gene deletions in Plasmodium falciparum isolates from select sites in Brazil and Bolivia

PubMed Central

Rachid Viana, Giselle Maria; Akinyi Okoth, Sheila; Silva-Flannery, Luciana; Lima Barbosa, Danielle Regina; Macedo de Oliveira, Alexandre; Goldman, Ira F.; Morton, Lindsay C.; Huber, Curtis; Anez, Arletta; Dantas Machado, Ricardo Luiz; Aranha Camargo, Luís Marcelo; Costa Negreiros do Valle, Suiane; Marins Póvoa, Marinete; Barnwell, John W.

2017-01-01

More than 80% of available malaria rapid diagnostic tests (RDTs) are based on the detection of histidine-rich protein-2 (PfHRP2) for diagnosis of Plasmodium falciparum malaria. Recent studies have shown the genes that code for this protein and its paralog, histidine-rich protein-3 (PfHRP3), are absent in parasites from the Peruvian Amazon Basin. Lack of PfHRP2 protein through deletion of the pfhrp2 gene leads to false-negative RDT results for P. falciparum. We have evaluated the extent of pfhrp2 and pfhrp3 gene deletions in a convenience sample of 198 isolates from six sites in three states across the Brazilian Amazon Basin (Acre, Rondonia and Para) and 25 isolates from two sites in Bolivia collected at different times between 2010 and 2012. Pfhrp2 and pfhrp3 gene and their flanking genes on chromosomes 7 and 13, respectively, were amplified from 198 blood specimens collected in Brazil. In Brazil, the isolates collected in Acre state, located in the western part of the Brazilian Amazon, had the highest percentage of deletions for pfhrp2 25 (31.2%) of 79, while among those collected in Rondonia, the prevalence of pfhrp2 gene deletion was only 3.3% (2 out of 60 patients). In isolates from Para state, all parasites were pfhrp2-positive. In contrast, we detected high proportions of isolates from all 3 states that were pfhrp3-negative ranging from 18.3% (11 out of 60 samples) to 50.9% (30 out of 59 samples). In Bolivia, only one of 25 samples (4%) tested had deleted pfhrp2 gene, while 68% (17 out of 25 samples) were pfhrp3-negative. Among the isolates tested, P. falciparum pfhrp2 gene deletions were present mainly in those from Acre State in the Brazilian Amazon. These results indicate it is important to reconsider the use of PfHRP2-based RDTs in the western region of the Brazilian Amazon and to implement appropriate surveillance systems to monitor pfhrp2 gene deletions in this and other parts of the Amazon region. PMID:28301474

Nucleic acid duplexes incorporating a dissociable covalent base pair

NASA Technical Reports Server (NTRS)

Gao, K.; Orgel, L. E.; Bada, J. L. (Principal Investigator)

1999-01-01

We have used molecular modeling techniques to design a dissociable covalently bonded base pair that can replace a Watson-Crick base pair in a nucleic acid with minimal distortion of the structure of the double helix. We introduced this base pair into a potential precursor of a nucleic acid double helix by chemical synthesis and have demonstrated efficient nonenzymatic template-directed ligation of the free hydroxyl groups of the base pair with appropriate short oligonucleotides. The nonenzymatic ligation reactions, which are characteristic of base paired nucleic acid structures, are abolished when the covalent base pair is reduced and becomes noncoplanar. This suggests that the covalent base pair linking the two strands in the duplex is compatible with a minimally distorted nucleic acid double-helical structure.

YAC contigs covering an 8-megabase region of 3p deleted in the small-cell lung cancer cell line U2020

DOE Office of Scientific and Technical Information (OSTI.GOV)

Todd, S.; Bolin, R.; Drabkin, H.A.

1995-01-01

Somatic deletions of chromosome 3p occur at high frequencies in cancers of kidney, breast, cervix, head and neck, nasopharynx, and lung. The frequency of 3p deletion in lung cancer approaches 100% among small cell lesions and 70 to 80% in non-small cell lesions. This evidence strongly implies that one or more tumor suppressor genes of potentially widespread significance reside within the deleted region(s). Precise definition of the deleted target region(s) has been difficult due to the extensive area(s) lost and use of markers with low informativeness. However, improved definition remains essential to permit isolation of putative tumor suppressor genes frommore » 3p. The identification of several small, homozygous 3p deletions in lung cancer cell lines has provided a critical resource that will assist this search. The U2020 cell line contains a small homozygous deletion that maps to a very proximal region of 3p and includes the marker D3S3. We previously identified a subset of DNA markers located within the deleted region and determined their relative order by pulsed-field gel mapping studies. In the present report, we describe the development of YAC contigs that span the majority of the deleted region and link up to flanking markers on both sides. The centromere proximal portion of the contig crosses the breakpoint from an X;3 translocation located within 3p12 providing both location and orientation to the map. PCR-based (CA){sub n} microsatellite polymorphisms have been localized within and flanking the deletion region. These markers should greatly facilitate loss-of-heterozygosity studies of this region in human cancer. The contig provides a direct means for isolation of putative tumor suppressor genes from this segment of 3p. 51 refs., 3 figs., 3 tabs.« less

High-Resolution Crystal Structure of a Silver(I)-RNA Hybrid Duplex Containing Watson-Crick-like C-Silver(I)-C Metallo-Base Pairs.

PubMed

Kondo, Jiro; Tada, Yoshinari; Dairaku, Takenori; Saneyoshi, Hisao; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira

2015-11-02

Metallo-base pairs have been extensively studied for applications in nucleic acid-based nanodevices and genetic code expansion. Metallo-base pairs composed of natural nucleobases are attractive because nanodevices containing natural metallo-base pairs can be easily prepared from commercially available sources. Previously, we have reported a crystal structure of a DNA duplex containing T-Hg(II)-T base pairs. Herein, we have determined a high-resolution crystal structure of the second natural metallo-base pair between pyrimidine bases C-Ag(I)-C formed in an RNA duplex. One Ag(I) occupies the center between two cytosines and forms a C-Ag(I)-C base pair through N3-Ag(I)-N3 linear coordination. The C-Ag(I)-C base pair formation does not disturb the standard A-form conformation of RNA. Since the C-Ag(I)-C base pair is structurally similar to the canonical Watson-Crick base pairs, it can be a useful building block for structure-based design and fabrication of nucleic acid-based nanodevices. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Ferrocene Orientation Determined Intramolecular Interactions Using Energy Decomposition Analysis.

PubMed

Wang, Feng; Islam, Shawkat; Vasilyev, Vladislav

2015-11-16

Two very different quantum mechanically based energy decomposition analyses (EDA) schemes are employed to study the dominant energy differences between the eclipsed and staggered ferrocene conformers. One is the extended transition state (ETS) based on the Amsterdam Density Functional (ADF) package and the other is natural EDA (NEDA) based in the General Atomic and Molecular Electronic Structure System (GAMESS) package. It reveals that in addition to the model (theory and basis set), the fragmentation channels more significantly affect the interaction energy terms (Δ E ) between the conformers. It is discovered that such an interaction energy can be absorbed into the pre-partitioned fragment channels so that to affect the interaction energies in a particular conformer of Fc. To avoid this, the present study employs a complete fragment channel-the fragments of ferrocene are individual neutral atoms. It therefore discovers that the major difference between the ferrocene conformers is due to the quantum mechanical Pauli repulsive energy and orbital attractive energy, leading to the eclipsed ferrocene the energy preferred structure. The NEDA scheme further indicates that the sum of attractive (negative) polarization (POL) and charge transfer (CL) energies prefers the eclipsed ferrocene. The repulsive (positive) deformation (DEF) energy, which is dominated by the cyclopentadienyle (Cp) rings, prefers the staggered ferrocene. Again, the cancellation results in a small energy residue in favour of the eclipsed ferrocene, in agreement with the ETS scheme. Further Natural Bond Orbital (NBO) analysis indicates that all NBO energies, total Lewis (no Fe) and lone pair (LP) deletion all prefer the eclipsed Fc conformer. The most significant energy preferring the eclipsed ferrocene without cancellation is the interactions between the donor lone pairs (LP) of the Fe atom and the acceptor antibond (BD*) NBOs of all C-C and C-H bonds in the ligand, LP(Fe)-BD*(C-C & C-H), which strongly stabilizes the eclipsed (D 5h ) conformation by -457.6 kcal·mol -1 .

Array-based comparative genomic hybridization analysis reveals recurrent chromosomal alterations and prognostic parameters in primary cutaneous large B-cell lymphoma.

PubMed

Dijkman, Remco; Tensen, Cornelis P; Jordanova, Ekaterina S; Knijnenburg, Jeroen; Hoefnagel, Juliette J; Mulder, Aat A; Rosenberg, Carla; Raap, Anton K; Willemze, Rein; Szuhai, Károly; Vermeer, Maarten H

2006-01-10

To evaluate the clinical relevance of genomic aberrations in primary cutaneous large B-cell lymphoma (PCLBCL). Skin biopsy samples of 31 patients with a PCLBCL classified as either primary cutaneous follicle center lymphoma (PCFCL; n = 19) or PCLBCL, leg type (n = 12), according to the WHO-European Organisation for Research and Treatment of Cancer (EORTC) classification, were investigated using array-based comparative genomic hybridization, fluorescence in situ hybridization (FISH), and examination of promoter hypermethylation. The most recurrent alterations in PCFCL were high-level DNA amplifications at 2p16.1 (63%) and deletion of chromosome 14q32.33 (68%). FISH analysis confirmed c-REL amplification in patients with gains at 2p16.1. In PCLBCL, leg type, most prominent aberrations were a high-level DNA amplification of 18q21.31-q21.33 (67%), including the BCL-2 and MALT1 genes as confirmed by FISH, and deletions of a small region within 9p21.3 containing the CDKN2A, CDKN2B, and NSG-x genes. Homozygous deletion of 9p21.3 was detected in five of 12 patients with PCLBCL, leg type, but in zero of 19 patients with PCFCL. Complete methylation of the promoter region of the CDKN2A gene was demonstrated in one PCLBCL, leg type, patient with hemizygous deletion, in one patient without deletion, but in zero of 19 patients with PCFCL. Seven of seven PCLBCL, leg type, patients with deletion of 9p21.3 and/or complete methylation of CDKN2A died as a result of their lymphoma. Our results demonstrate prominent differences in chromosomal alterations between PCFCL and PCLBCL, leg type, that support their classification as separate entities within the WHO-EORTC scheme. Inactivation of CDKN2A by either deletion or methylation of its promoter could be an important prognostic parameter for the group of PCLBCL, leg type.

Patients with Exon 19 Deletion Were Associated with Longer Progression-Free Survival Compared to Those with L858R Mutation after First-Line EGFR-TKIs for Advanced Non-Small Cell Lung Cancer: A Meta-Analysis

PubMed Central

Fang, Wenfeng; Yan, Yue; Hu, Zhihuang; Hong, Shaodong; Wu, Xuan; Qin, Tao; Liang, Wenhua; Zhang, Li

2014-01-01

Backgrounds It has been extensively proved that the efficacy of epidermal growth factor receptor-tyrosine kinase inhibitors (EGFR-TKIs) is superior to that of cytotoxic chemotherapy in advanced non-small cell lung cancer (NSCLC) patients harboring sensitive EGFR mutations. However, the question of whether the efficacy of EGFR-TKIs differs between exon 19 deletion and exon 21 L858R mutation has not been yet statistically answered. Methods Subgroup data on hazard ratio (HR) for progression-free survival (PFS) of correlative studies were extracted and synthesized based on random-effect model. Comparison of outcomes between specific mutations was estimated through indirect and direct methods, respectively. Results A total of 13 studies of advanced NSCLC patients with either 19 or 21 exon alteration receiving first-line EGFR-TKIs were included. Based on the data from six clinical trials for indirect meta-analysis, the pooled HRTKI/chemotherapy for PFS were 0.28 (95% CI 0.20–0.38, P<0.001) in patients with 19 exon deletion and 0.47 (95% CI 0.35–0.64, P<0.001) in those with exon 21 L858R mutation. Indirect comparison revealed that the patients with exon 19 deletion had longer PFS than those with exon 21 L858R mutation (HR19 exon deletion/exon 21 L858R mutation  = 0.59, 95% CI 0.38–0.92; P = 0.019). Additionally, direct meta-analysis showed similar result (HR19 exon deletion/exon 21 L858R mutation  = 0.75, 95% CI 0.65 to 0.85; P<0.001) by incorporating another seven studies. Conclusions For advanced NSCLC patients, exon 19 deletion might be associated with longer PFS compared to L858 mutation at exon 21 after first-line EGFR-TKIs. PMID:25222496

Phenotypic Characterization of a Novel Virulence-Factor Deletion Strain of Burkholderia mallei that Provides Partial Protection against Inhalational Glanders in Mice

DTIC Science & Technology

2016-02-26

minimal to mild expansion of the white pulp by lymphoid hyperplasia with variable numbers of plasma cells within the white and red pulp (Figures 8G–I... Cell . Infect. Microbiol. 6:21. doi: 10.3389/fcimb.2016.00021 Phenotypic Characterization of a Novel Virulence-Factor Deletion Strain of Burkholderia...respect to intracellular growth, macrophage uptake and phagosomal escape, actin-based motility, and multinucleated giant cell formation. Based on observed

Germline APOBEC3B deletion is associated with breast cancer risk in an Asian multi-ethnic cohort and with immune cell presentation.

PubMed

Wen, Wei Xiong; Soo, Jaslyn Sian-Siu; Kwan, Pui Yoke; Hong, Elaine; Khang, Tsung Fei; Mariapun, Shivaani; Lee, Christine Shu-Mei; Hasan, Siti Norhidayu; Rajadurai, Pathmanathan; Yip, Cheng Har; Mohd Taib, Nur Aishah; Teo, Soo Hwang

2016-05-27

APOBEC3B is a cytosine deaminase implicated in immune response to viral infection, cancer predisposition and carcinogenesis. Germline APOBEC3B deletion is more common in East Asian women and confers a modest risk to breast cancer in both East Asian and Caucasian women. Analysis of tumour samples from women of European descent has shown that germline APOBEC3B deletion is associated with an increased propensity to develop somatic mutations and with an enrichment for immune response-related gene sets. However, this has not been examined in Asian tumour samples, where population differences in genetic and dietary factors may have an impact on the immune system. In this study, we determined the prevalence of germline APOBEC3B deletion and its association with breast cancer risk in a cross-sectional hospital-based Asian multi-ethnic cohort of 1451 cases and 1442 controls from Malaysia. We compared gene expression profiles of breast cancers arising from APOBEC3B deletion carriers and non-carriers using microarray analyses. Finally, we characterised the overall abundance of tumour-infiltrating immune cells in breast cancers from TCGA and METABRIC using ESTIMATE and relative frequency of 22 immune cell subsets in breast cancers from METABRIC using CIBERSORT. The minor allelic frequency of APOBEC3B deletion was estimated to be 0.35, 0.42 and 0.16 in female populations of Chinese, Malay and Indian descent, respectively, and that germline APOBEC3B deletion was associated with breast cancer risk with odds ratios of 1.23 (95 % CI: [1.05, 1.44]) for one-copy deletion and 1.38 (95 % CI: [1.10, 1.74]) for two-copy deletion compared to women with no deletion. Germline APOBEC3B deletion was not associated with any clinicopathologic features or the expression of any APOBEC family members but was associated with immune response-related gene sets (FDR q values < 0.05). Analysis of breast cancers from METABRIC revealed breast cancers from APOBEC3B deletion carriers to have significantly higher abundance of tumour-infiltrating immune cells (P < 0.001). Taken together, our data suggests that tumour-infiltrating immune cells may be an important feature of breast cancers arising in women with APOBEC3B germline deletion, and that this may be of particular interest in Asian women where the germline deletion is more common.

Quantitative PCR analysis reveals a high incidence of large intragenic deletions in the FANCA gene in Spanish Fanconi anemia patients.

PubMed

Callén, E; Tischkowitz, M D; Creus, A; Marcos, R; Bueren, J A; Casado, J A; Mathew, C G; Surrallés, J

2004-01-01

Fanconi anaemia is an autosomal recessive disease characterized by chromosome fragility, multiple congenital abnormalities, progressive bone marrow failure and a high predisposition to develop malignancies. Most of the Fanconi anaemia patients belong to complementation group FA-A due to mutations in the FANCA gene. This gene contains 43 exons along a 4.3-kb coding sequence with a very heterogeneous mutational spectrum that makes the mutation screening of FANCA a difficult task. In addition, as the FANCA gene is rich in Alu sequences, it was reported that Alu-mediated recombination led to large intragenic deletions that cannot be detected in heterozygous state by conventional PCR, SSCP analysis, or DNA sequencing. To overcome this problem, a method based on quantitative fluorescent multiplex PCR was proposed to detect intragenic deletions in FANCA involving the most frequently deleted exons (exons 5, 11, 17, 21 and 31). Here we apply the proposed method to detect intragenic deletions in 25 Spanish FA-A patients previously assigned to complementation group FA-A by FANCA cDNA retroviral transduction. A total of eight heterozygous deletions involving from one to more than 26 exons were detected. Thus, one third of the patients carried a large intragenic deletion that would have not been detected by conventional methods. These results are in agreement with previously published data and indicate that large intragenic deletions are one of the most frequent mutations leading to Fanconi anaemia. Consequently, this technology should be applied in future studies on FANCA to improve the mutation detection rate. Copyright 2003 S. Karger AG, Basel

Weak D caused by a founder deletion in the RHD gene.

PubMed

Fichou, Yann; Chen, Jian-Min; Le Maréchal, Cédric; Jamet, Déborah; Dupont, Isabelle; Chuteau, Claude; Durousseau, Cécile; Loirat, Marie-Jeanne; Bailly, Pascal; Férec, Claude

2012-11-01

The RhD blood group system exemplifies a genotype-phenotype correlation by virtue of its highly polymorphic and immunogenic nature. Weak D phenotypes are generally thought to result from missense mutations leading to quantitative change of the D antigen in the red blood cell membrane or intracellularly. Different sets of polymerase chain reaction primers were designed to map and clone a deletion involving RHD Exon 10, which was found in approximately 3% of approximately 2000 RHD hemizygous subjects with D phenotype ambiguity. D antigen density was measured by flow cytometry. Transcript analysis was carried out by 3'-rapid amplification of complementary DNA ends. Haplotype analysis was performed by microsatellite genotyping. A 5405-bp deletion that removed nearly two-thirds of Intron 9 and almost all of Exon 10 of the RHD gene was characterized. It is predicted to result in the replacement of the last eight amino acids of the wild-type RhD protein by another four amino acids. The mean RhD antigen density from two deletion carriers was determined to be only 30. A consensus haplotype could be deduced from the deletion carriers based on the microsatellite genotyping data. The currently reported deletion was derived from a common founder. This deletion appears to represent not only the first large deletion associated with weak D but also the weakest of weak D alleles so far reported. This highly unusual genotype-phenotype relationship may be attributable to the additive effect of three distinct mechanisms that affect mRNA formation, mRNA stability, and RhD/ankyrin-R interaction, respectively. © 2012 American Association of Blood Banks.

Dandy-Walker malformation and Wisconsin syndrome: novel cases add further insight into the genotype-phenotype correlations of 3q23q25 deletions.

PubMed

Ferraris, Alessandro; Bernardini, Laura; Sabolic Avramovska, Vesna; Zanni, Ginevra; Loddo, Sara; Sukarova-Angelovska, Elena; Parisi, Valentina; Capalbo, Anna; Tumini, Stefano; Travaglini, Lorena; Mancini, Francesca; Duma, Filip; Barresi, Sabina; Novelli, Antonio; Mercuri, Eugenio; Tarani, Luigi; Bertini, Enrico; Dallapiccola, Bruno; Valente, Enza Maria

2013-05-16

The Dandy-Walker malformation (DWM) is one of the commonest congenital cerebellar defects, and can be associated with multiple congenital anomalies and chromosomal syndromes. The occurrence of overlapping 3q deletions including the ZIC1 and ZIC4 genes in few patients, along with data from mouse models, have implicated both genes in the pathogenesis of DWM. Using a SNP-array approach, we recently identified three novel patients carrying heterozygous 3q deletions encompassing ZIC1 and ZIC4. Magnetic resonance imaging showed that only two had a typical DWM, while the third did not present any defect of the DWM spectrum. SNP-array analysis in further eleven children diagnosed with DWM failed to identify deletions of ZIC1-ZIC4. The clinical phenotype of the three 3q deleted patients included multiple congenital anomalies and peculiar facial appearance, related to the localization and extension of each deletion. In particular, phenotypes resulted from the variable combination of three recognizable patterns: DWM (with incomplete penetrance); blepharophimosis, ptosis, and epicanthus inversus syndrome; and Wisconsin syndrome (WS), recently mapped to 3q. Our data indicate that the 3q deletion is a rare defect associated with DWM, and suggest that the hemizygosity of ZIC1-ZIC4 genes is neither necessary nor sufficient per se to cause this condition. Furthermore, based on a detailed comparison of clinical features and molecular data from 3q deleted patients, we propose clinical diagnostic criteria and refine the critical region for WS.

Subtelomeric deletions of chromosome 6p: molecular and cytogenetic characterization of three new cases with phenotypic overlap with Ritscher-Schinzel (3C) syndrome.

PubMed

Descipio, Cheryl; Schneider, Lori; Young, Terri L; Wasserman, Nora; Yaeger, Dinah; Lu, Fengmin; Wheeler, Patricia G; Williams, Marc S; Bason, Lynn; Jukofsky, Lori; Menon, Ammini; Geschwindt, Ryan; Chudley, Albert E; Saraiva, Jorge; Schinzel, Albert A G L; Guichet, Agnes; Dobyns, William E; Toutain, Annick; Spinner, Nancy B; Krantz, Ian D

2005-04-01

We have identified six children in three families with subtelomeric deletions of 6p25 and a recognizable phenotype consisting of ptosis, posterior embryotoxon, optic nerve abnormalities, mild glaucoma, Dandy-Walker malformation, hydrocephalus, atrial septal defect, patent ductus arteriosus, and mild mental retardation. There is considerable clinical overlap between these children and individuals with the Ritscher-Schinzel (or cranio-cerebello-cardiac (3C)) syndrome (OMIM #220210). Clinical features of 3C syndrome include craniofacial anomalies (macrocephaly, prominent forehead and occiput, foramina parietalia, hypertelorism, down-slanting palpebral fissures, ocular colobomas, depressed nasal bridge, narrow or cleft palate, and low-set ears), cerebellar malformations (variable manifestations of a Dandy-Walker malformation with moderate mental retardation), and cardiac defects (primarily septal defects). Since the original report, over 25 patients with 3C syndrome have been reported. Recessive inheritance has been postulated based on recurrence in siblings born to unaffected parents and parental consanguinity in two familial cases. Molecular and cytogenetic mapping of the 6p deletions in these three families with subtelomeric deletions of chromosome 6p have defined a 1.3 Mb minimally deleted critical region. To determine if 6p deletions are common in 3C syndrome, we analyzed seven unrelated individuals with 3C syndrome for deletions of this region. Three forkhead genes (FOXF1 and FOXQ1 from within the critical region, and FOXC1 proximal to this region) were evaluated as potential candidate disease genes for this disorder. No deletions or disease-causing mutations were identified.

Dandy-Walker malformation and Wisconsin syndrome: novel cases add further insight into the genotype-phenotype correlations of 3q23q25 deletions

PubMed Central

2013-01-01

Background The Dandy-Walker malformation (DWM) is one of the commonest congenital cerebellar defects, and can be associated with multiple congenital anomalies and chromosomal syndromes. The occurrence of overlapping 3q deletions including the ZIC1 and ZIC4 genes in few patients, along with data from mouse models, have implicated both genes in the pathogenesis of DWM. Methods and results Using a SNP-array approach, we recently identified three novel patients carrying heterozygous 3q deletions encompassing ZIC1 and ZIC4. Magnetic resonance imaging showed that only two had a typical DWM, while the third did not present any defect of the DWM spectrum. SNP-array analysis in further eleven children diagnosed with DWM failed to identify deletions of ZIC1-ZIC4. The clinical phenotype of the three 3q deleted patients included multiple congenital anomalies and peculiar facial appearance, related to the localization and extension of each deletion. In particular, phenotypes resulted from the variable combination of three recognizable patterns: DWM (with incomplete penetrance); blepharophimosis, ptosis, and epicanthus inversus syndrome; and Wisconsin syndrome (WS), recently mapped to 3q. Conclusions Our data indicate that the 3q deletion is a rare defect associated with DWM, and suggest that the hemizygosity of ZIC1-ZIC4 genes is neither necessary nor sufficient per se to cause this condition. Furthermore, based on a detailed comparison of clinical features and molecular data from 3q deleted patients, we propose clinical diagnostic criteria and refine the critical region for WS. PMID:23679990

The effect of amino acid deletions and substitutions in the longest loop of GFP

PubMed Central

Flores-Ramírez, Gabriela; Rivera, Manuel; Morales-Pablos, Alfredo; Osuna, Joel; Soberón, Xavier; Gaytán, Paul

2007-01-01

Background The effect of single and multiple amino acid substitutions in the green fluorescent protein (GFP) from Aequorea victoria has been extensively explored, yielding several proteins of diverse spectral properties. However, the role of amino acid deletions in this protein -as with most proteins- is still unknown, due to the technical difficulties involved in generating combinatorial in-phase amino acid deletions on a target region. Results In this study, the region I129-L142 of superglo GFP (sgGFP), corresponding to the longest loop of the protein and located far away from the central chromophore, was subjected to a random amino acid deletion approach, employing an in-house recently developed mutagenesis method termed Codon-Based Random Deletion (COBARDE). Only two mutants out of 16384 possible variant proteins retained fluorescence: sgGFP-Δ I129 and sgGFP-Δ D130. Interestingly, both mutants were thermosensitive and at 30°C sgGFP-Δ D130 was more fluorescent than the parent protein. In contrast with deletions, substitutions of single amino acids from residues F131 to L142 were well tolerated. The substitution analysis revealed a particular importance of residues F131, G135, I137, L138, H140 and L142 for the stability of the protein. Conclusion The behavior of GFP variants with both amino acid deletions and substitutions demonstrate that this loop is playing an important structural role in GFP folding. Some of the amino acids which tolerated any substitution but no deletion are simply acting as "spacers" to localize important residues in the protein structure. PMID:17594481

The nearest neighbor and next nearest neighbor effects on the thermodynamic and kinetic properties of RNA base pair

NASA Astrophysics Data System (ADS)

Wang, Yujie; Wang, Zhen; Wang, Yanli; Liu, Taigang; Zhang, Wenbing

2018-01-01

The thermodynamic and kinetic parameters of an RNA base pair with different nearest and next nearest neighbors were obtained through long-time molecular dynamics simulation of the opening-closing switch process of the base pair near its melting temperature. The results indicate that thermodynamic parameters of GC base pair are dependent on the nearest neighbor base pair, and the next nearest neighbor base pair has little effect, which validated the nearest-neighbor model. The closing and opening rates of the GC base pair also showed nearest neighbor dependences. At certain temperature, the closing and opening rates of the GC pair with nearest neighbor AU is larger than that with the nearest neighbor GC, and the next nearest neighbor plays little role. The free energy landscape of the GC base pair with the nearest neighbor GC is rougher than that with nearest neighbor AU.

A Case of Birt-Hogg-Dubé (BHD) Syndrome Harboring a Novel Folliculin (FLCN) Gene Mutation.

PubMed

Yukawa, Takuro; Fukazawa, Takuya; Yoshida, Masakazu; Morita, Ichiro; Kato, Katsuya; Monobe, Yasumasa; Furuya, Mitsuko; Naomoto, Yoshio

2016-10-26

BACKGROUND Birt-Hogg-Dubé (BHD) syndrome is an autosomal dominant disorder clinically characterized by pulmonary cysts, spontaneous pneumothorax, renal cell cancer, and skin fibrofolliculomas. The disorder is caused by germline mutations in the FLCN gene. CASE REPORT A 56-year-old female was admitted to our hospital with a diagnosis of bilateral spontaneous pneumothorax. A computed tomography (CT) scan of the chest revealed bilateral multiple bullae predominantly located in the subpleural and mediastinal areas in the bilateral upper and lower lobes. Although she was cured by thoracic cavity drainage, she underwent resection of bilateral lung bullae because she had a prior history of right pneumothorax at 37- and 45-years of age. She had no signs of renal tumor but had fibrofolliculoma in her face and a family history of pneumothorax, we therefore suspected BHD syndrome. DNA sequence analyses determined that there was a two base pair deletion in exon 4 of the FLCN gene, confirming the diagnosis of BHD syndrome. CONCLUSIONS Here we report a case of BHD syndrome with a previously unreported FLCN mutation.

The nucleotide sequence and a first generation gene transfer vector of species B human adenovirus serotype 3.

PubMed

Sirena, Dominique; Ruzsics, Zsolt; Schaffner, Walter; Greber, Urs F; Hemmi, Silvio

2005-12-20

Human adenovirus (Ad) serotype 3 causes respiratory infections. It is considered highly virulent, accounting for about 13% of all Ad isolates. We report here the complete Ad3 DNA sequence of 35,343 base pairs (GenBank accession DQ086466). Ad3 shares 96.43% nucleotide identity with Ad7, another virulent subspecies B1 serotype, and 82.56 and 62.75% identity with the less virulent species B2 Ad11 and species C Ad5, respectively. The genomic organization of Ad3 is similar to the other human Ads comprising five early transcription units, E1A, E1B, E2, E3, and E4, two delayed early units IX and IVa2, and the major late unit, in total 39 putative and 7 hypothetical open reading frames. A recombinant E1-deleted Ad3 was generated on a bacterial artificial chromosome. This prototypic virus efficiently transduced CD46-positive rodent and human cells. Our results will help in clarifying the biology and pathology of adenoviruses and enhance therapeutic applications of viral vectors in clinical settings.

Mutation in PLK4, encoding a master regulator of centriole formation, defines a novel locus for primordial dwarfism.

PubMed

Shaheen, Ranad; Al Tala, Saeed; Almoisheer, Agaadir; Alkuraya, Fowzan S

2014-12-01

Primordial dwarfism (PD) is a heterogeneous clinical entity characterised by severe prenatal and postnatal growth deficiency. Despite the recent wave of disease gene discovery, the causal mutations in many PD patients remain unknown. To describe a PD family that maps to a novel locus. Clinical, imaging and laboratory phenotyping of a new family with PD followed by autozygosity mapping, linkage analysis and candidate gene sequencing. We describe a multiplex consanguineous Saudi family in which two full siblings and one half-sibling presented with classical features of Seckel syndrome in addition to optic nerve hypoplasia. We were able to map the phenotype to a single novel locus on 4q25-q28.2, in which we identified a five base-pair deletion in PLK4, which encodes a master regulator of centriole duplication. Our discovery further confirms the role of genes involved in centriole biology in the pathogenesis of PD. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

Dynamic nuclear envelope phenotype in rats overexpressing mutated human torsinA protein.

PubMed

Yu-Taeger, Libo; Gaiser, Viktoria; Lotzer, Larissa; Roenisch, Tina; Fabry, Benedikt Timo; Stricker-Shaver, Janice; Casadei, Nicolas; Walter, Michael; Schaller, Martin; Riess, Olaf; Nguyen, Huu Phuc; Ott, Thomas; Grundmann-Hauser, Kathrin

2018-05-08

A three-base-pair deletion in the human TOR1A gene is causative for the most common form of primary dystonia, the early-onset dystonia type 1 (DYT1 dystonia). The pathophysiological consequences of this mutation are still unknown.To study the pathology of the mutant torsinA (TOR1A) protein, we have generated a transgenic rat line that overexpresses the human mutant protein under the control of the human TOR1A promoter. This new animal model was phenotyped with several approaches, including behavioral tests and neuropathological analyses. A motor phenotype and cellular and ultrastructural key features of torsinA pathology were found in this new transgenic rat line supporting that it can be used as a model system for investigating the disease development. Analyses of mutant TOR1A protein expression in various brain regions also showed a dynamic expression pattern and a reversible nuclear envelope pathology. These findings suggest the differential vulnerabilities of distinct neuronal subpopulations. Furthermore the reversibility of the nuclear envelope pathology might be a therapeutic target to treat the disease. © 2018. Published by The Company of Biologists Ltd.

Frazzled promotes growth cone attachment at the source of a Netrin gradient in the Drosophila visual system

PubMed Central

Akin, Orkun; Zipursky, S Lawrence

2016-01-01

Axon guidance is proposed to act through a combination of long- and short-range attractive and repulsive cues. The ligand-receptor pair, Netrin (Net) and Frazzled (Fra) (DCC, Deleted in Colorectal Cancer, in vertebrates), is recognized as the prototypical effector of chemoattraction, with roles in both long- and short-range guidance. In the Drosophila visual system, R8 photoreceptor growth cones were shown to require Net-Fra to reach their target, the peak of a Net gradient. Using live imaging, we show, however, that R8 growth cones reach and recognize their target without Net, Fra, or Trim9, a conserved binding partner of Fra, but do not remain attached to it. Thus, despite the graded ligand distribution along the guidance path, Net-Fra is not used for chemoattraction. Based on findings in other systems, we propose that adhesion to substrate-bound Net underlies both long- and short-range Net-Fra-dependent guidance in vivo, thereby eroding the distinction between them. DOI: http://dx.doi.org/10.7554/eLife.20762.001 PMID:27743477

Novel mutations in the inhibitory adaptor protein LNK drive JAK-STAT signaling in patients with myeloproliferative neoplasms

PubMed Central

Oh, Stephen T.; Simonds, Erin F.; Jones, Carol; Hale, Matthew B.; Goltsev, Yury; Gibbs, Kenneth D.; Merker, Jason D.; Zehnder, James L.; Nolan, Garry P.

2010-01-01

Dysregulated Janus kinase–signal transducer and activator of transcription (JAK-STAT) signaling due to activation of tyrosine kinases is a common feature of myeloid malignancies. Here we report the first human disease-related mutations in the adaptor protein LNK, a negative regulator of JAK-STAT signaling, in 2 patients with JAK2 V617F–negative myeloproliferative neoplasms (MPNs). One patient exhibited a 5 base-pair deletion and missense mutation leading to a premature stop codon and loss of the pleckstrin homology (PH) and Src homology 2 (SH2) domains. A second patient had a missense mutation (E208Q) in the PH domain. BaF3-MPL cells transduced with these LNK mutants displayed augmented and sustained thrombopoietin-dependent growth and signaling. Primary samples from MPN patients bearing LNK mutations exhibited aberrant JAK-STAT activation, and cytokine-responsive CD34+ early progenitors were abnormally abundant in both patients. These findings indicate that JAK-STAT activation due to loss of LNK negative feedback regulation is a novel mechanism of MPN pathogenesis. PMID:20404132

CNNdel: Calling Structural Variations on Low Coverage Data Based on Convolutional Neural Networks

PubMed Central

2017-01-01

Many structural variations (SVs) detection methods have been proposed due to the popularization of next-generation sequencing (NGS). These SV calling methods use different SV-property-dependent features; however, they all suffer from poor accuracy when running on low coverage sequences. The union of results from these tools achieves fairly high sensitivity but still produces low accuracy on low coverage sequence data. That is, these methods contain many false positives. In this paper, we present CNNdel, an approach for calling deletions from paired-end reads. CNNdel gathers SV candidates reported by multiple tools and then extracts features from aligned BAM files at the positions of candidates. With labeled feature-expressed candidates as a training set, CNNdel trains convolutional neural networks (CNNs) to distinguish true unlabeled candidates from false ones. Results show that CNNdel works well with NGS reads from 26 low coverage genomes of the 1000 Genomes Project. The paper demonstrates that convolutional neural networks can automatically assign the priority of SV features and reduce the false positives efficaciously. PMID:28630866

Precision-engineering the Pseudomonas aeruginosa genome with two-step allelic exchange

PubMed Central

Hmelo, Laura R.; Borlee, Bradley R.; Almblad, Henrik; Love, Michelle E.; Randall, Trevor E.; Tseng, Boo Shan; Lin, Chuyang; Irie, Yasuhiko; Storek, Kelly M.; Yang, Jaeun Jane; Siehnel, Richard J.; Howell, P. Lynne; Singh, Pradeep K.; Tolker-Nielsen, Tim; Parsek, Matthew R.; Schweizer, Herbert P.; Harrison, Joe J.

2016-01-01

Allelic exchange is an efficient method of bacterial genome engineering. This protocol describes the use of this technique to make gene knockouts and knockins, as well as single nucleotide insertions, deletions and substitutions in Pseudomonas aeruginosa. Unlike other approaches to allelic exchange, this protocol does not require heterologous recombinases to insert or excise selective markers from the target chromosome. Rather, positive and negative selection are enabled solely by suicide vector-encoded functions and host cell proteins. Here, mutant alleles, which are flanked by regions of homology to the recipient chromosome, are synthesized in vitro and then cloned into allelic exchange vectors using standard procedures. These suicide vectors are then introduced into recipient cells by conjugation. Homologous recombination then results in antibiotic resistant single-crossover mutants in which the plasmid has integrated site-specifically into the chromosome. Subsequently, unmarked double-crossover mutants are isolated directly using sucrose-mediated counter-selection. This two-step process yields seamless mutations that are precise to a single base pair of DNA. The entire procedure requires ~2 weeks. PMID:26492139

[Structural and Dipole Structure Peculiarities of Hoogsteen Base Pairs Formed in Complementary Nucleobases according to ab initio Quantum Mechanics Studies].

PubMed

Petrenko, Y M

2015-01-01

Ab initio quantum mechanics studies for the detection of structure and dipole structure peculiarities of Hoogsteen base pairs relative to Watson-Crick base pairs, were performed during our work. These base pairs are formed as a result of complementary interactions. It was revealed, that adenine-thymine Hoogsteen base pair and adenine-thymine Watson-Crick base pairs can be formed depending on initial configuration. Cytosine-guanine Hoogsteen pairs are formed only when cytosine was originally protonated. Both types of Hoogsteen pairs have noticeable difference in the bond distances and angles. These differences appeared in purine as well as in pyrimidine parts of the pairs. Hoogsteen pairs have mostly shorter hydrogen bond lengths and significantly larger angles of hydrogen bonds and larger angles between the hydrogen bonds than Watson-Crick base pairs. Notable differences are also observed with respect to charge distribution and dipole moment. Quantitative data on these differences are shown in our work. It is also reported that the values of local parameters (according to Cambridge classification of the parameters which determine DNA properties) in Hoogsteen base pairs, are greatly different from Watson-Crick ones.

Nucleic acid duplexes incorporating a dissociable covalent base pair

PubMed Central

Gao, Kui; Orgel, Leslie E.

1999-01-01

We have used molecular modeling techniques to design a dissociable covalently bonded base pair that can replace a Watson-Crick base pair in a nucleic acid with minimal distortion of the structure of the double helix. We introduced this base pair into a potential precursor of a nucleic acid double helix by chemical synthesis and have demonstrated efficient nonenzymatic template-directed ligation of the free hydroxyl groups of the base pair with appropriate short oligonucleotides. The nonenzymatic ligation reactions, which are characteristic of base paired nucleic acid structures, are abolished when the covalent base pair is reduced and becomes noncoplanar. This suggests that the covalent base pair linking the two strands in the duplex is compatible with a minimally distorted nucleic acid double-helical structure. PMID:10611299

Detection of large scale 3' deletions in the PMS2 gene amongst Colon-CFR participants: have we been missing anything?

PubMed

Clendenning, Mark; Walsh, Michael D; Gelpi, Judith Balmana; Thibodeau, Stephen N; Lindor, Noralane; Potter, John D; Newcomb, Polly; LeMarchand, Loic; Haile, Robert; Gallinger, Steve; Hopper, John L; Jenkins, Mark A; Rosty, Christophe; Young, Joanne P; Buchanan, Daniel D

2013-09-01

Current screening practices have been able to identify PMS2 mutations in 78 % of cases of colorectal cancer from the Colorectal Cancer Family Registry (Colon CFR) which showed solitary loss of the PMS2 protein. However the detection of large-scale deletions in the 3' end of the PMS2 gene has not been possible due to technical difficulties associated with pseudogene sequences. Here, we utilised a recently described MLPA/long-range PCR-based approach to screen the remaining 22 % (n = 16) of CRC-affected probands for mutations in the 3' end of the PMS2 gene. No deletions encompassing any or all of exons 12 through 15 were identified; therefore, our results suggest that 3' deletions in PMS2 are not a frequent occurrence in such families.

Prevalence of the Prefoldin Subunit 5 Gene Deletion in Canine Mammary Tumors

PubMed Central

Bornemann-Kolatzki, Kirsten; Neumann, Stephan; Escobar, Hugo Murua; Nolte, Ingo; Hammer, Susanne Conradine; Hewicker-Trautwein, Marion; Junginger, Johannes; Kaup, Franz-Josef; Brenig, Bertram; Schütz, Ekkehard

2015-01-01

Background A somatic deletion at the proximal end of canine chromosome 27 (CFA27) was recently reported in 50% of malignant mammary tumors. This region harbours the tumor suppressor gene prefoldin subunit 5 (PFDN5) and the deletion correlated with a higher Ki-67 score. PFDN5 has been described to repress c-MYC and is, therefore, a candidate tumor-suppressor and cancer-driver gene in canine mammary cancer. Aim of this study was to confirm the recurrent deletion in a larger number of tumors. Methods Droplet digital PCR for PFDN5 was performed in DNA from 102 malignant, 40 benign mammary tumors/dysplasias, 11 non-neoplastic mammary tissues and each corresponding genomic DNA from leukocytes. The copy number of PFDN5 was normalized to a reference amplicon on canine chromosome 32 (CFA32). Z-scores were calculated, based on Gaussian distributed normalized PFDN5 copy numbers of the leukocyte DNA. Z-scores ≤ -3.0 in tissue were considered as being indicative of the PFDN5 deletion and called as such. The Ki-67 proliferation index was assessed in a subset of 79 tissue samples by immunohistochemistry. Results The deletion was confirmed in 24% of all malignant tumors, detected in only 7.5% of the benign tumors and was not present in any normal mammary tissue sample. The subgroup of solid carcinomas (n = 9) showed the highest frequency of the deletion (67%) and those malignomas without microscopical high fraction of benign tissue (n = 71) had a 32% frequency (p<0.01 vs. benign samples). The Ki-67 score was found to be significantly higher (p<0.05) in the PFDN5-deleted group compared to malignant tumors without the deletion. Conclusions A somatic deletion of the PFDN5 gene is recurrently present in canine mammary cancer, supporting a potential role in carcinogenesis. The association of this deletion with higher Ki-67 indicates an increased proliferation rate and thus a link to tumor aggressiveness can be hypothesized. The confirmation of earlier results warrants further studies on PFDN5 as cancer-driver gene. PMID:26132936

A set of primers for analyzing chloroplast DNA diversity in Citrus and related genera.

PubMed

Cheng, Yunjiang; de Vicente, M Carmen; Meng, Haijun; Guo, Wenwu; Tao, Nengguo; Deng, Xiuxin

2005-06-01

Chloroplast simple sequence repeat (cpSSR) markers in Citrus were developed and used to analyze chloroplast diversity of Citrus and closely related genera. Fourteen cpSSR primer pairs from the chloroplast genomes of tobacco (Nicotiana tabacum L.) and Arabidopsis were found useful for analyzing the Citrus chloroplast genome (cpDNA) and recoded with the prefix SPCC (SSR Primers for Citrus Chloroplast). Eleven of the 14 primer pairs revealed some degree of polymorphism among 34 genotypes of Citrus, Fortunella, Poncirus and some of their hybrids, with polymorphism information content (PIC) values ranging from 0.057 to 0.732, and 18 haplotypes were identified. The cpSSR data were analyzed with NTSYS-pc software, and the genetic relationships suggested by the unweighted pair group method based on arithmetic means (UPGMA) dendrogram were congruent with previous taxonomic investigations: the results showed that all samples fell into seven major clusters, i.e., Citrus medica L., Poncirus, Fortunella, C. ichangensis Blanco, C. reticulata Swingle, C. aurantifolia (Christm.) Swingle and C. grandis (L.) Osbeck. The results of previous studies combined with our cpSSR analyses revealed that: (1) Calamondin (C. madurensis Swingle) is the result of hybridization between kumquat (Fortunella) and mandarin (C. reticulata), where kumquat acted as the female parent; (2) Ichang papeda (C. ichangensis) has a unique taxonomic status; and (3) although Bendiguangju mandarin (C. reticulata) and Satsuma mandarin (C. reticulata) are similar in fruit shape and leaf morphology, they have different maternal parents. Bendiguangju mandarin has the same cytoplasm as sweet orange (C. sinensis), whereas Satsuma mandarin has the cytoplasm of C. reticulata. Seventeen PCR products from SPCC1 and 21 from SPCC11 were cloned and sequenced. The results revealed that mononucleotide repeats as well as insertions and deletions of small segments of DNA were associated with SPCC1 polymorphism, whereas polymorphism generated by SPCC11 was essentially due to the variation in length of the mononucleotide repeats.

Defining new guidelines for screening the 22q11.2 deletion based on a clinical and dysmorphologic evaluation of 194 individuals and review of the literature.

PubMed

Monteiro, Fabíola P; Vieira, Társis P; Sgardioli, Ilária C; Molck, Miriam C; Damiano, Ana Paula; Souza, Josiane; Monlleó, Isabella L; Fontes, Marshall I B; Fett-Conte, Agnes C; Félix, Têmis M; Leal, Gabriela F; Ribeiro, Erlane M; Banzato, Claudio E M; Dantas, Clarissa de R; Lopes-Cendes, Iscia; Gil-da-Silva-Lopes, Vera Lúcia

2013-07-01

The 22q11.2 deletion is the most frequent interstitial deletion in humans and presents a wide phenotypic spectrum, with over 180 clinical manifestations described. Distinct studies have detected frequencies of the deletion ranging from 0 % to 75 %, depending on the studied population and selection criteria adopted. Due to the lack of consensus in this matter, several studies have been conducted aiming to define which patients would be eligible for screening; however, the issue is still up for debate. In order to contribute to the delineation of possible clinical and dysmorphologic guidelines to optimize decision making in the clinical setting, 194 individuals with variable features of the 22q11.2 deletion syndromes (22q11.2DS) were evaluated. Group I, clinical suspicion of 22q11.2DS with palatal anomalies; Group II, clinical suspicion without palatal anomalies; Group III, cardiac malformations associated with the 22q11.2DS; and Group IV, juvenile-onset schizophrenia. Multiplex ligation-dependent probe amplification was used for screening the 22q11.2 deletion, which was detected in 45 patients (23.2 %), distributed as such: Group I, 35/101 (34.7 %); Group II, 4/18 (22.2 %); Group III, 6/52 (11.5 %); and Group IV, 0/23 (0 %). Clinical data were analyzed by frequency distribution and statistically. Based on the present results and on the review of the literature, we propose a set of guidelines for screening patients with distinct manifestations of the 22q11.2DS in order to maximize resources. In addition, we report the dysmorphic features which we found to be statistically correlated with the presence of the 22q11.2DS.

Network-based analysis of oligodendrogliomas predicts novel cancer gene candidates within the region of the 1p/19q co-deletion.

PubMed

Gladitz, Josef; Klink, Barbara; Seifert, Michael

2018-06-11

Oligodendrogliomas are primary human brain tumors with a characteristic 1p/19q co-deletion of important prognostic relevance, but little is known about the pathology of this chromosomal mutation. We developed a network-based approach to identify novel cancer gene candidates in the region of the 1p/19q co-deletion. Gene regulatory networks were learned from gene expression and copy number data of 178 oligodendrogliomas and further used to quantify putative impacts of differentially expressed genes of the 1p/19q region on cancer-relevant pathways. We predicted 8 genes with strong impact on signaling pathways and 14 genes with strong impact on metabolic pathways widespread across the region of the 1p/19 co-deletion. Many of these candidates (e.g. ELTD1, SDHB, SEPW1, SLC17A7, SZRD1, THAP3, ZBTB17) are likely to push, whereas others (e.g. CAP1, HBXIP, KLK6, PARK7, PTAFR) might counteract oligodendroglioma development. For example, ELTD1, a functionally validated glioblastoma oncogene located on 1p, was overexpressed. Further, the known glioblastoma tumor suppressor SLC17A7 located on 19q was underexpressed. Moreover, known epigenetic alterations triggered by mutated SDHB in paragangliomas suggest that underexpressed SDHB in oligodendrogliomas may support and possibly enhance the epigenetic reprogramming induced by the IDH-mutation. We further analyzed rarely observed deletions and duplications of chromosomal arms within oligodendroglioma subcohorts identifying putative oncogenes and tumor suppressors that possibly influence the development of oligodendroglioma subgroups. Our in-depth computational study contributes to a better understanding of the pathology of the 1p/19q co-deletion and other chromosomal arm mutations. This might open opportunities for functional validations and new therapeutic strategies.

Partial AZFc duplications not deletions are associated with male infertility in the Yi population of Yunnan Province, China.

PubMed

Ye, Jun-jie; Ma, Li; Yang, Li-juan; Wang, Jin-huan; Wang, Yue-li; Guo, Hai; Gong, Ning; Nie, Wen-hui; Zhao, Shu-hua

2013-09-01

There are many reports on associations between spermatogenesis and partial azoospermia factor c (AZFc) deletions as well as duplications; however, results are conflicting, possibly due to differences in methodology and ethnic background. The purpose of this study is to investigate the association of AZFc polymorphisms and male infertility in the Yi ethnic population, residents within Yunnan Province, China. A total of 224 infertile patients and 153 fertile subjects were selected in the Yi ethnic population. The study was performed by sequence-tagged site plus/minus (STS+/-) analysis followed by gene dosage and gene copy definition analysis. Y haplotypes of 215 cases and 115 controls were defined by 12 binary markers using single nucleotide polymorphism on Y chromosome (Y-SNP) multiplex assays based on single base primer extension technology. The distribution of Y haplotypes was not significantly different between the case and control groups. The frequencies of both gr/gr (7.6% vs. 8.5%) and b2/b3 (6.3% vs. 8.5%) deletions do not show significant differences. Similarly, single nucleotide variant (SNV) analysis shows no significant difference of gene copy definition between the cases and controls. However, the frequency of partial duplications in the infertile group (4.0%) is significantly higher than that in the control group (0.7%). Further, we found a case with sY1206 deletion which had two CDY1 copies but removed half of DAZ genes. Our results show that male infertility is associated with partial AZFc duplications, but neither gr/gr nor b2/b3 deletions, suggesting that partial AZFc duplications rather than deletions are risk factors for male infertility in Chinese-Yi population.

Genetic Relatedness of Clostridium difficile Isolates from Various Origins Determined by Triple-Locus Sequence Analysis Based on Toxin Regulatory Genes tcdC, tcdR, and cdtR▿

PubMed Central

Bouvet, Philippe J. M.; Popoff, Michel R.

2008-01-01

A triple-locus nucleotide sequence analysis based on toxin regulatory genes tcdC, tcdR and cdtR was initiated to assess the sequence variability of these genes among Clostridium difficile isolates and to study the genetic relatedness between isolates. A preliminary investigation of the variability of the tcdC gene was done with 57 clinical and veterinary isolates. Twenty-three isolates representing nine main clusters were selected for tcdC, tcdR, and cdtR analysis. The numbers of alleles found for tcdC, tcdR and cdtR were nine, six, and five, respectively. All strains possessed the cdtR gene except toxin A-negative toxin B-positive variants. All but one binary toxin CDT-positive isolate harbored a deletion (>1 bp) in the tcdC gene. The combined analyses of the three genes allowed us to distinguish five lineages correlated with the different types of deletion in tcdC, i.e., 18 bp (associated or not with a deletion at position 117), 36 bp, 39 bp, and 54 bp, and with the wild-type tcdC (no deletion). The tcdR and tcdC genes, though located within the same pathogenicity locus, were found to have evolved separately. Coevolution of the three genes was noted only with strains harboring a 39-bp or a 54-bp deletion in tcdC that formed two homogeneous, separate divergent clusters. Our study supported the existence of the known clones (PCR ribotype 027 isolates and toxin A-negative toxin B-positive C. difficile variants) and evidence for clonality of isolates with a 39-bp deletion (toxinotype V, PCR ribotype 078) that are frequently isolated worldwide from human infections and from food animals. PMID:18832125

Molecular recognition of DNA base pairs by the formamido/pyrrole and formamido/imidazole pairings in stacked polyamides.

PubMed

Buchmueller, Karen L; Staples, Andrew M; Uthe, Peter B; Howard, Cameron M; Pacheco, Kimberly A O; Cox, Kari K; Henry, James A; Bailey, Suzanna L; Horick, Sarah M; Nguyen, Binh; Wilson, W David; Lee, Moses

2005-01-01

Polyamides containing an N-terminal formamido (f) group bind to the minor groove of DNA as staggered, antiparallel dimers in a sequence-specific manner. The formamido group increases the affinity and binding site size, and it promotes the molecules to stack in a staggered fashion thereby pairing itself with either a pyrrole (Py) or an imidazole (Im). There has not been a systematic study on the DNA recognition properties of the f/Py and f/Im terminal pairings. These pairings were analyzed here in the context of f-ImPyPy, f-ImPyIm, f-PyPyPy and f-PyPyIm, which contain the central pairing modes, -ImPy- and -PyPy-. The specificity of these triamides towards symmetrical recognition sites allowed for the f/Py and f/Im terminal pairings to be directly compared by SPR, CD and DeltaT (M) experiments. The f/Py pairing, when placed next to the -ImPy- or -PyPy- central pairings, prefers A/T and T/A base pairs to G/C base pairs, suggesting that f/Py has similar DNA recognition specificity to Py/Py. With -ImPy- central pairings, f/Im prefers C/G base pairs (>10 times) to the other Watson-Crick base pairs; therefore, f/Im behaves like the Py/Im pair. However, the f/Im pairing is not selective for the C/G base pair when placed next to the -PyPy- central pairings.

Some Protocols For Optical-Fiber Digital Communications

NASA Technical Reports Server (NTRS)

Yeh, Cavour; Gerla, Mario

1989-01-01

One works best in heavy traffic, another, in light traffic. Three protocols proposed for digital communications among stations connected by passive taps to pair of uni-directional optical-fiber buses. Mediate round-robin, bounded-delay access to buses by all stations and particularly suited to fast transmission. Partly because transmission medium passive (no relay stations) and partly because protocols distribute control of network among all stations with provision for addition and deletion of stations (no control stations), communication network able to resist and recover from failures. Implicit token propagates in one direction on one bus and in opposite direction on other bus, minimizing interval of silence between end of one round and beginning of next.

A Complex 6p25 Rearrangement in a Child With Multiple Epiphyseal Dysplasia

PubMed Central

Bedoyan, Jirair K.; Lesperance, Marci M.; Ackley, Todd; Iyer, Ramaswamy K.; Innis, Jeffrey W.; Misra, Vinod K.

2015-01-01

Genomic rearrangements are increasingly recognized as important contributors to human disease. Here we report on an 11½-year-old child with myopia, Duane retraction syndrome, bilateral mixed hearing loss, skeletal anomalies including multiple epiphyseal dysplasia, and global developmental delay, and a complex 6p25 genomic rearrangement. We have employed oligonucleotide-based comparative genomic hybridization arrays (aCGH) of different resolutions (44 and 244K) as well as a 1 M single nucleotide polymorphism (SNP) array to analyze this complex rearrangement. Our analyses reveal a complex rearrangement involving a ~2.21 Mb interstitial deletion, a ~240 kb terminal deletion, and a 70–80 kb region in between these two deletions that shows maintenance of genomic copy number. The interstitial deletion contains eight known genes, including three Forkhead box containing (FOX) transcription factors (FOXQ1, FOXF2, and FOXC1). The region maintaining genomic copy number partly overlaps the dual specificity protein phosphatase 22 (DUSP22) gene. Array analyses suggest a homozygous loss of genomic material at the 5′ end of DUSP22, which was corroborated using TaqMan® copy number analysis. It is possible that this homozygous genomic loss may render both copies of DUSP22 or its products non-functional. Our analysis suggests a rearrangement mechanism distinct from a previously reported replication-based error-prone mechanism without template switching for a specific 6p25 rearrangement with a 1.22 Mb interstitial deletion. Our study demonstrates the utility and limitations of using oligonucleotide-based aCGH and SNP array technologies of increasing resolutions in order to identify complex DNA rearrangements and gene disruptions. PMID:21204225

Genomic alterations in Warthin tumors of the parotid gland.

PubMed

Wemmert, Silke; Willnecker, Vivienne; Sauter, Birgit; Schuh, Sebastian; Brunner, Christian; Bohle, Rainer Maria; Urbschat, Steffi; Schick, Bernhard

2014-04-01

Despite the fact that Warthin tumors are the second most common type of benign salivary gland tumors, information regarding genetic alterations is extremely limited, and the tumorigenesis of these tumors has not been elucidated. The present results of the largest series of 30 tumors analyzed by comparative genomic hybridization (CGH) to date confirmed previous genetic findings and identified significant new candidate regions. The most commonly observed alterations were deletions of the short arm of chromosome 8, followed by deletions on 9p. Further representative changes were deletions on 16p and 22q with the minimal overlapping region at 16p12p13.1 and 22q12.1q12.3. Moreover, we indicated two different patterns of chromosomal aberrations. One group harbors deletions on 8p partly apparent with deletions on 9q, 11q 15q, 16p and 22. The second group shows gains on 22, partly apparent with gains on 1p and 20q and deletions on 9p. This leads to the assumption that Warthin tumors, in particular those with a high number of alterations, can be divided into two different genetic groups based on the pattern of numerical chromosomal aberrations. Further studies should address whether these subgroups also reflect a different clinical presentation.

A 590 kb deletion caused by non-allelic homologous recombination between two LINE-1 elements in a patient with mesomelia-synostosis syndrome.

PubMed

Kohmoto, Tomohiro; Naruto, Takuya; Watanabe, Miki; Fujita, Yuji; Ujiro, Sae; Okamoto, Nana; Horikawa, Hideaki; Masuda, Kiyoshi; Imoto, Issei

2017-04-01

Mesomelia-synostoses syndrome (MSS) is a rare, autosomal-dominant, syndromal osteochondrodysplasia characterized by mesomelic limb shortening, acral synostoses, and multiple congenital malformations due to a non-recurrent deletion at 8q13 that always encompasses two coding-genes, SULF1 and SLCO5A1. To date, five unrelated patients have been reported worldwide, and MMS was previously proposed to not be a genomic disorder associated with deletions recurring from non-allelic homologous recombination (NAHR) in at least two analyzed cases. We conducted targeted gene panel sequencing and subsequent array-based copy number analysis in an 11-year-old undiagnosed Japanese female patient with multiple congenital anomalies that included mesomelic limb shortening and detected a novel 590 Kb deletion at 8q13 encompassing the same gene set as reported previously, resulting in the diagnosis of MSS. Breakpoint sequences of the deleted region in our case demonstrated the first LINE-1s (L1s)-mediated unequal NAHR event utilizing two distant L1 elements as homology substrates in this disease, which may represent a novel causative mechanism of the 8q13 deletion, expanding the range of mechanisms involved in the chromosomal rearrangements responsible for MSS. © 2017 Wiley Periodicals, Inc.

P53 oncosuppressor influences selection of genomic imbalances in response to ionizing radiations in human osteosarcoma cell line SAOS-2.

PubMed

Zuffa, Elisa; Mancini, Manuela; Brusa, Gianluca; Pagnotta, Eleonora; Hattinger, Claudia Maria; Serra, Massimo; Remondini, Daniel; Castellani, Gastone; Corrado, Patrizia; Barbieri, Enza; Santucci, Maria Alessandra

2008-07-01

To investigate the impact of TP53 (tumor protein 53, p53) on genomic stability of osteosarcoma (OS). In first instance, we expressed in OS cell line SAOS-2 (lacking p53) a wild type (wt) p53 construct, whose protein undergoes nuclear import and activation in response to ionizing radiations (IR). Thereafter, we investigated genomic imbalances (amplifications and deletions at genes or DNA regions most frequently altered in human cancers) associated with radio-resistance relative to p53 expression by mean of an array-based comparative genomic hybridization (aCGH) strategy. Finally we investigated a putative marker of radio-induced oxidative stress, a 4,977 bp deletion at mitochondrial (mt) DNA usually referred to as 'common' deletion, by mean of a polimerase chain reaction (PCR) strategy. In radio-resistant subclones generated from wt p53-transfected SAOS-2 cells DNA deletions were remarkably reduced and the accumulation of 'common' deletion at mtDNA (that may let the persistence of oxidative damage by precluding detoxification from reactive oxygen species [ROS]) completely abrogated. The results of our study confirm that wt p53 has a role in protection of OS cell DNA integrity. Multiple mechanisms involved in p53 safeguard of genomic integrity and prevention of deletion outcome are discussed.

Genomic interval engineering of mice identified a novel modulator of triglyceride production

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhu, Y.; Jong, M.C.; Frazer, K.A.

1999-10-01

To accelerate the biological annotation of novel genes discovered in sequenced of mammalian genomes, we are creating large deletions in the mouse genome targeted to include clusters of such genes. Here we describe the targeted deletion of a 450 kb region on mouse chromosome 11 which, based on computational analysis of the deleted murine sequences and human 5q orthologous sequences, codes for nine putative genes. Mice homozygous for the deletion had a variety of abnormalities including severe hypertriglyceridemia, hepatic and cardiac enlargement, growth retardation and premature mortality. Analysis of triglyceride metabolism in these animals demonstrated a several-fold increase in hepaticmore » very-low density lipoprotein (VLDL) triglyceride secretion, the most prevalent mechanism responsible for hypertriglyceridemia in humans. A series of mouse BAC and human YAC transgenes covering different intervals of the 450 kb deleted region were assessed for their ability to complement the deletion induced abnormalities. These studies revealed that OCTN2, a gene recently shown to play a role in carnitine transport, was able to correct the triglyceride abnormalities. The discovery of this previously unappreciated relationship between OCTN2, carnitine and hepatic triglyceride production is of particular importance due to the clinical consequence of hypertriglyceridemia and the paucity of genes known to modulate triglyceride secretion.« less

Unique Thermal Stability of Unnatural Hydrophobic Ds Bases in Double-Stranded DNAs.

PubMed

Kimoto, Michiko; Hirao, Ichiro

2017-10-20

Genetic alphabet expansion technology, the introduction of unnatural bases or base pairs into replicable DNA, has rapidly advanced as a new synthetic biology area. A hydrophobic unnatural base pair between 7-(2-thienyl)imidazo[4,5-b]pyridine (Ds) and 2-nitro-4-propynylpyrrole (Px) exhibited high fidelity as a third base pair in PCR. SELEX methods using the Ds-Px pair enabled high-affinity DNA aptamer generation, and introducing a few Ds bases into DNA aptamers extremely augmented their affinities and selectivities to target proteins. Here, to further scrutinize the functions of this highly hydrophobic Ds base, the thermal stabilities of double-stranded DNAs (dsDNA) containing a noncognate Ds-Ds or G-Ds pair were examined. The thermal stability of the Ds-Ds self-pair was as high as that of the natural G-C pair, and apart from the generally higher stability of the G-C pair than that of the A-T pair, most of the 5'-pyrimidine-Ds-purine-3' sequences, such as CDsA and TDsA, exhibited higher stability than the 5'-purine-Ds-pyrimidine-3' sequences, such as GDsC and ADsC, in dsDNAs. This trait enabled the GC-content-independent control of the thermal stability of the designed dsDNA fragments. The melting temperatures of dsDNA fragments containing the Ds-Ds pair can be predicted from the nearest-neighbor parameters including the Ds base. In addition, the noncognate G-Ds pair can efficiently distinguish its neighboring cognate natural base pairs from noncognate pairs. We demonstrated that real-time PCR using primers containing Ds accurately detected a single-nucleotide mismatch in target DNAs. These unique properties of the Ds base that affect the stabilities of the neighboring base pairs could impart new functions to DNA molecules and technologies.

Mismatch repair proteins, meiosis, and mice: understanding the complexities of mammalian meiosis.

PubMed

Svetlanov, Anton; Cohen, Paula E

2004-05-15

Mammalian meiosis differs from that seen in lower eukaryotes in several respects, not least of which is the added complexity of dealing with chromosomal interactions across a much larger genome (12 MB over 16 chromosome pairs in Saccharomyces cerevisiae compared to 2500 MB over 19 autosome pairs in Mus musculus). Thus, the recombination machinery, while being highly conserved through eukaryotes, has evolved to accommodate such issues to preserve genome integrity and to ensure propagation of the species. One group of highly conserved meiotic regulators is the DNA mismatch repair protein family that, as their name implies, were first identified as proteins that act to repair DNA mismatches that arise primarily during DNA replication. Their function in ensuring chromosomal integrity has also translated into a critical role for this family in meiotic recombination in most sexually reproducing organisms. In mice, targeted deletion of certain family members results in severe consequences for meiotic progression and infertility. This review will focus on the studies involving these mutant mouse models, with occasional comparison to the function of these proteins in other organisms.

Disruption of the psbA gene by the copy correction mechanism reveals that the expression of plastid-encoded genes is regulated by photosynthesis activity.

PubMed

Khan, Muhammad Sarwar; Hameed, Waqar; Nozoe, Mikio; Shiina, Takashi

2007-05-01

The functional analysis of genes encoded by the chloroplast genome of tobacco by reverse genetics is routine. Nevertheless, for a small number of genes their deletion generates heteroplasmic genotypes, complicating their analysis. There is thus the need for additional strategies to develop deletion mutants for these genes. We have developed a homologous copy correction-based strategy for deleting/mutating genes encoded on the chloroplast genome. This system was used to produce psbA knockouts. The resulting plants are homoplasmic and lack photosystem II (PSII) activity. Further, the deletion mutants exhibit a distinct phenotype; young leaves are green, whereas older leaves are bleached, irrespective of light conditions. This suggests that senescence is promoted by the absence of psbA. Analysis of the transcript levels indicates that NEP (nuclear-encoded plastid RNA polymerase)-dependent plastid genes are up regulated in the psbA deletion mutants, whereas the bleached leaves retain plastid-encoded plastid RNA polymerase activity. Hence, the expression of NEP-dependent plastid genes may be regulated by photosynthesis, either directly or indirectly.

Multiple genetic origins of histidine-rich protein 2 gene deletion in Plasmodium falciparum parasites from Peru

PubMed Central

Akinyi, Sheila; Hayden, Tonya; Gamboa, Dionicia; Torres, Katherine; Bendezu, Jorge; Abdallah, Joseph F.; Griffing, Sean M.; Quezada, Wilmer Marquiño; Arrospide, Nancy; De Oliveira, Alexandre Macedo; Lucas, Carmen; Magill, Alan J.; Bacon, David J.; Barnwell, John W.; Udhayakumar, Venkatachalam

2013-01-01

The majority of malaria rapid diagnostic tests (RDTs) detect Plasmodium falciparum histidine-rich protein 2 (PfHRP2), encoded by the pfhrp2 gene. Recently, P. falciparum isolates from Peru were found to lack pfhrp2 leading to false-negative RDT results. We hypothesized that pfhrp2-deleted parasites in Peru derived from a single genetic event. We evaluated the parasite population structure and pfhrp2 haplotype of samples collected between 1998 and 2005 using seven neutral and seven chromosome 8 microsatellite markers, respectively. Five distinct pfhrp2 haplotypes, corresponding to five neutral microsatellite-based clonal lineages, were detected in 1998-2001; pfhrp2 deletions occurred within four haplotypes. In 2003-2005, outcrossing among the parasite lineages resulted in eight population clusters that inherited the five pfhrp2 haplotypes seen previously and a new haplotype; pfhrp2 deletions occurred within four of these haplotypes. These findings indicate that the genetic origin of pfhrp2 deletion in Peru was not a single event, but likely occurred multiple times. PMID:24077522

Detection of large deletion in human BRCA1 gene in human breast carcinoma MCF-7 cells by using DNA-Silver Nanoclusters

NASA Astrophysics Data System (ADS)

Borghei, Yasaman-Sadat; Hosseini, Morteza; Ganjali, Mohammad Reza

2018-01-01

Here we describe a label-free detection strategy for large deletion mutation in breast cancer (BC) related gene BRCA1 based on a DNA-silver nanocluster (NC) fluorescence upon recognition-induced hybridization. The specific hybridization of DNA templated silver NCs fluorescent probe to target DNAs can act as effective templates for enhancement of AgNCs fluorescence, which can be used to distinguish the deletion of BRCA1 due to different fluorescence intensities. Under the optimal conditions, the fluorescence intensity of the DNA-AgNCs at emission peaks around 440 nm (upon excitation at 350 nm) increased with the increasing deletion type within a dynamic range from 1.0 × 10-10 to 2.4 × 10-6 M with a detection limit (LOD) of 6.4 × 10-11 M. In this sensing system, the normal type shows no significant fluorescence; on the other hand, the deletion type emits higher fluorescence than normal type. Using this nanobiosensor, we successfully determined mutation using the non-amplified genomic DNAs that were isolated from the BC cell line.

The detection of large deletions or duplications in genomic DNA.

PubMed

Armour, J A L; Barton, D E; Cockburn, D J; Taylor, G R

2002-11-01

While methods for the detection of point mutations and small insertions or deletions in genomic DNA are well established, the detection of larger (>100 bp) genomic duplications or deletions can be more difficult. Most mutation scanning methods use PCR as a first step, but the subsequent analyses are usually qualitative rather than quantitative. Gene dosage methods based on PCR need to be quantitative (i.e., they should report molar quantities of starting material) or semi-quantitative (i.e., they should report gene dosage relative to an internal standard). Without some sort of quantitation, heterozygous deletions and duplications may be overlooked and therefore be under-ascertained. Gene dosage methods provide the additional benefit of reporting allele drop-out in the PCR. This could impact on SNP surveys, where large-scale genotyping may miss null alleles. Here we review recent developments in techniques for the detection of this type of mutation and compare their relative strengths and weaknesses. We emphasize that comprehensive mutation analysis should include scanning for large insertions and deletions and duplications. Copyright 2002 Wiley-Liss, Inc.

Characterizing cognitive control abilities in children with 16p11.2 deletion using adaptive ‘video game' technology: a pilot study

PubMed Central

Anguera, J A; Brandes-Aitken, A N; Rolle, C E; Skinner, S N; Desai, S S; Bower, J D; Martucci, W E; Chung, W K; Sherr, E H; Marco, E J

2016-01-01

Assessing cognitive abilities in children is challenging for two primary reasons: lack of testing engagement can lead to low testing sensitivity and inherent performance variability. Here we sought to explore whether an engaging, adaptive digital cognitive platform built to look and feel like a video game would reliably measure attention-based abilities in children with and without neurodevelopmental disabilities related to a known genetic condition, 16p11.2 deletion. We assessed 20 children with 16p11.2 deletion, a genetic variation implicated in attention deficit/hyperactivity disorder and autism, as well as 16 siblings without the deletion and 75 neurotypical age-matched children. Deletion carriers showed significantly slower response times and greater response variability when compared with all non-carriers; by comparison, traditional non-adaptive selective attention assessments were unable to discriminate group differences. This phenotypic characterization highlights the potential power of administering tools that integrate adaptive psychophysical mechanics into video-game-style mechanics to achieve robust, reliable measurements. PMID:27648915

Targeted Deletion and Lipidomic Analysis Identify Epithelial Cell COX-2 as a Major Driver of Chemically-induced Skin Cancer

PubMed Central

Jiao, Jing; Ishikawa, Tomo-o; Dumlao, Darren S.; Norris, Paul C.; Magyar, Clara E.; Mikulec, Carol; Catapang, Art; Dennis, Edward A.; Fischer, Susan M.; Herschman, Harvey R.

2014-01-01

Pharmacologic and global gene deletion studies demonstrate that cyclooxygenase-2 (PTGS2/COX2) plays a critical role in DMBA/TPA-induced skin tumor induction. While many cell types in the tumor microenvironment express COX-2, the cell types in which COX-2 expression is required for tumor promotion are not clearly established. Here, cell-type specific Cox-2 gene deletion reveals a vital role for skin epithelial cell COX-2 expression in DMBA/TPA tumor induction. In contrast, myeloid Cox-2 gene deletion has no effect on DMBA/TPA tumorigenesis. The infrequent, small tumors that develop on mice with an epithelial cell-specific Cox-2 gene deletion have decreased proliferation and increased cell differentiation properties. Blood vessel density is reduced in tumors with an epithelial cell-specific Cox-2 gene deletion, compared to littermate control tumors, suggesting a reciprocal relationship in tumor progression between COX-2 expressing tumor epithelial cells and microenvironment endothelial cells. Lipidomics analysis of skin and tumors from DMBA/TPA-treated mice suggests that the prostaglandins PGE2 and PGF2α are likely candidates for the epithelial cell COX-2-dependent eicosanoids that mediate tumor progression. This study both illustrates the value of cell-type specific gene deletions in understanding the cellular roles of signal-generating pathways in complex microenvironments and emphasizes the benefit of a systems-based lipidomic analysis approach to identify candidate lipid mediators of biological responses. PMID:25063587

Association between F508 deletion in CFTR and chronic pancreatitis risk.

PubMed

Zhao, Dong; Xu, Yanzhen; Li, Jiatong; Fu, Shien; Xiao, Feifan; Song, Xiaowei; Xie, Zhibin; Jiang, Min; He, Yan; Liu, Chengwu; Wen, Qiongxian; Yang, Xiaoli

2017-09-01

The cystic fibrosis transmembrane conductance regulator (CFTR) has been reported to influence individual susceptibility to chronic pancreatitis (CP), but the results of previous studies are controversial. We performed a study to demonstrate the relationship between CFTR and CP. We searched PubMed, Scopus, and Embase for studies of patients with CP. Seven studies from 1995 to 2016 were identified, and included 64,832 patients. Pooled prevalence and 95% confidence intervals (CIs) were calculated. F508 deletion in CFTR was significantly positively associated with CP risk in the overall analysis (odds ratio [OR]=3.20, 95% CI: 2.30-4.44, I 2 =31.7%). In subgroup analysis stratified by ethnicity, F508 deletion was significantly associated with CP risk in Indian populations, using a fixed effects model (ORs=5.45, 95% CI: 2.52-11.79, I 2 =0.0%), and in non-Indian populations, using a random effects model (ORs=3.59, 95% CI: 1.73-7.48, I 2 =60.9%). At the same time, we found that Indians with F508 deletion had much higher CP prevalence than non-Indians. Interestingly, F508 deletion was also associated with CP and idiopathic CP risk in subgroup analysis stratified by aeitiology, using the fixed effects model. Based on current evidence, F508 deletion is a risk factor for CP, and Indians with F508 deletion have much higher CP morbidity. Copyright © 2017 Editrice Gastroenterologica Italiana S.r.l. Published by Elsevier Ltd. All rights reserved.

[Detection of bcr/abl fusion gene and its derivative chromosome 9 deletions in CML by using home-made bcr/abl extra-signal probe].

PubMed

Lai, Yue-Yun; Feng, Lin; Wang, Zheng; Lü, Shan; Dang, Hui; Shi, Yan; He, Qi; Huang, Xiao-Jun

2010-02-01

This study was aimed to verify the efficacy of home-made LSI bcr/abl ES probe for detection of bcr/abl fusion gene and derivative chromosome 9 deletions in chronic myeloid leukemia (CML). Fluorescence in situ hybridization (FISH) was carried out with dual color bcr/abl extra signal (ES) probe in 97 cases of CML based on morphology and cytogenetic karyotype and 129 cases of non-hematological malignancies/non-myeloproliferative diseases with normal cytogenetic karyotype. For the patients with signals of 1R1G1F indicating der(9) deletions, FISH were done using ASS DNA probe. The results showed that 91 cases with standard t(9;22) and 6 cases with variant translocation of t(9;22) were detected by conventional G banding technique. All of the 97 patients displayed bcr/abl fusion gene by ES-FISH, including 16 cases with signal patterns of 1R1G1F showing der(9) deletions. Among the 16 cases with der(9) deletions, 13 cases were detected to have deletions of ASS gene. Meanwhile, none of the 129 cases of negative control showed bcr/abl fusion gene by ES-FISH. It is concluded that home-made LSI bcr/abl ES probe is effective to identify the bcr/abl fusion gene and der(9) deletions in CML, and the ES-FISH results are consistent with conventional cytogenetic karyotype.

A stochastic evolution model for residue Insertion-Deletion Independent from Substitution.

PubMed

Lèbre, Sophie; Michel, Christian J

2010-12-01

We develop here a new class of stochastic models of gene evolution based on residue Insertion-Deletion Independent from Substitution (IDIS). Indeed, in contrast to all existing evolution models, insertions and deletions are modeled here by a concept in population dynamics. Therefore, they are not only independent from each other, but also independent from the substitution process. After a separate stochastic analysis of the substitution and the insertion-deletion processes, we obtain a matrix differential equation combining these two processes defining the IDIS model. By deriving a general solution, we give an analytical expression of the residue occurrence probability at evolution time t as a function of a substitution rate matrix, an insertion rate vector, a deletion rate and an initial residue probability vector. Various mathematical properties of the IDIS model in relation with time t are derived: time scale, time step, time inversion and sequence length. Particular expressions of the nucleotide occurrence probability at time t are given for classical substitution rate matrices in various biological contexts: equal insertion rate, insertion-deletion only and substitution only. All these expressions can be directly used for biological evolutionary applications. The IDIS model shows a strongly different stochastic behavior from the classical substitution only model when compared on a gene dataset. Indeed, by considering three processes of residue insertion, deletion and substitution independently from each other, it allows a more realistic representation of gene evolution and opens new directions and applications in this research field. Copyright © 2010 Elsevier Ltd. All rights reserved.

Novel deletions involving the USH2A gene in patients with Usher syndrome and retinitis pigmentosa.

PubMed

García-García, Gema; Aller, Elena; Jaijo, Teresa; Aparisi, Maria J; Larrieu, Lise; Faugère, Valérie; Blanco-Kelly, Fiona; Ayuso, Carmen; Roux, Anne-Francoise; Millán, José M

2014-01-01

The aim of the present work was to identify and characterize large rearrangements involving the USH2A gene in patients with Usher syndrome and nonsyndromic retinitis pigmentosa. The multiplex ligation-dependent probe amplification (MLPA) technique combined with a customized array-based comparative genomic hybridization (aCGH) analysis was applied to 40 unrelated patients previously screened for point mutations in the USH2A gene in which none or only one pathologic mutation was identified. We detected six large deletions involving USH2A in six out of the 40 cases studied. Three of the patients were homozygous for the deletion, and the remaining three were compound heterozygous with a previously identified USH2A point mutation. In five of these cases, the patients displayed Usher type 2, and the remaining case displayed nonsyndromic retinitis pigmentosa. The exact breakpoint junctions of the deletions found in USH2A in four of these cases were characterized. Our study highlights the need to develop improved efficient strategies of mutation screening based upon next generation sequencing (NGS) that reduce cost, time, and complexity and allow simultaneous identification of all types of disease-causing mutations in diagnostic procedures.

Genome-Wide Spectra of Transcription Insertions and Deletions Reveal That Slippage Depends on RNA:DNA Hybrid Complementarity

PubMed Central

Traverse, Charles C.

2017-01-01

ABSTRACT Advances in sequencing technologies have enabled direct quantification of genome-wide errors that occur during RNA transcription. These errors occur at rates that are orders of magnitude higher than rates during DNA replication, but due to technical difficulties such measurements have been limited to single-base substitutions and have not yet quantified the scope of transcription insertions and deletions. Previous reporter gene assay findings suggested that transcription indels are produced exclusively by elongation complex slippage at homopolymeric runs, so we enumerated indels across the protein-coding transcriptomes of Escherichia coli and Buchnera aphidicola, which differ widely in their genomic base compositions and incidence of repeat regions. As anticipated from prior assays, transcription insertions prevailed in homopolymeric runs of A and T; however, transcription deletions arose in much more complex sequences and were rarely associated with homopolymeric runs. By reconstructing the relocated positions of the elongation complex as inferred from the sequences inserted or deleted during transcription, we show that continuation of transcription after slippage hinges on the degree of nucleotide complementarity within the RNA:DNA hybrid at the new DNA template location. PMID:28851848

Targeted deletion and lipidomic analysis identify epithelial cell COX-2 as a major driver of chemically induced skin cancer.

PubMed

Jiao, Jing; Ishikawa, Tomo-O; Dumlao, Darren S; Norris, Paul C; Magyar, Clara E; Mikulec, Carol; Catapang, Art; Dennis, Edward A; Fischer, Susan M; Herschman, Harvey R

2014-11-01

Pharmacologic and global gene deletion studies demonstrate that cyclooxygenase-2 (PTGS2/COX-2) plays a critical role in DMBA/TPA-induced skin tumor induction. Although many cell types in the tumor microenvironment express COX-2, the cell types in which COX-2 expression is required for tumor promotion are not clearly established. Here, cell type-specific Cox-2 gene deletion reveals a vital role for skin epithelial cell COX-2 expression in DMBA/TPA tumor induction. In contrast, myeloid Cox-2 gene deletion has no effect on DMBA/TPA tumorigenesis. The infrequent, small tumors that develop on mice with an epithelial cell-specific Cox-2 gene deletion have decreased proliferation and increased cell differentiation properties. Blood vessel density is reduced in tumors with an epithelial cell-specific Cox-2 gene deletion, compared with littermate control tumors, suggesting a reciprocal relationship in tumor progression between COX-2-expressing tumor epithelial cells and microenvironment endothelial cells. Lipidomics analysis of skin and tumors from DMBA/TPA-treated mice suggests that the prostaglandins PGE2 and PGF2α are likely candidates for the epithelial cell COX-2-dependent eicosanoids that mediate tumor progression. This study both illustrates the value of cell type-specific gene deletions in understanding the cellular roles of signal-generating pathways in complex microenvironments and emphasizes the benefit of a systems-based lipidomic analysis approach to identify candidate lipid mediators of biologic responses. Cox-2 gene deletion demonstrates that intrinsic COX-2 expression in initiated keratinocytes is a principal driver of skin carcinogenesis; lipidomic analysis identifies likely prostanoid effectors. ©2014 American Association for Cancer Research.

Disparities in visuo-spatial constructive abilities in Williams syndrome patients with typical deletion on chromosome 7q11.23.

PubMed

Muramatsu, Yukako; Tokita, Yoshihito; Mizuno, Seiji; Nakamura, Miho

2017-02-01

Williams syndrome (WS) is known for its uneven cognitive abilities, especially the difficulty in visuo-spatial cognition, though there are some inter-individual phenotypic differences. It has been proposed that the difficulty in visuo-spatial cognition of WS patients can be attributed to a haploinsufficiency of some genes located on the deleted region in 7q11.23, based on an examination of atypical deletions identified in WS patients with atypical cognitive deficits. According to this hypothesis, the inter-individual differences in visuo-spatial cognitive ability arise from variations in deletion. We investigated whether there were inter-individual differences in the visuo-spatial constructive abilities of five unrelated WS patients with the typical deletion on chromosome 7q11.23 that includes the candidate genes contributing visuo-spatial difficulty in WS patients. We used tests with three-dimensional factors such as Benton's three-dimensional block construction test, which are considered to be more sensitive than those with only two-dimensional factors. There were diverse inter-individual differences in the visuo-spatial constructive abilities among the present participants who shared the same typical genomic deletion of WS. One of the participants showed almost equivalent performances to typically developing adults in those tests. In the present study, we found a wide range of cognitive abilities in visuo-spatial construction even among the patients with a common deletion pattern of WS. The findings suggest that attributing differences in the phenotypes entirely to genetic factors such as an atypical deletion may not be always correct. Copyright © 2016 The Japanese Society of Child Neurology. Published by Elsevier B.V. All rights reserved.

Assessment of the Toxicity of CuO Nanoparticles by Using Saccharomyces cerevisiae Mutants with Multiple Genes Deleted

PubMed Central

Bao, Shaopan; Lu, Qicong; Dai, Heping; Zhang, Chao

2015-01-01

To develop applicable and susceptible models to evaluate the toxicity of nanoparticles, the antimicrobial effects of CuO nanoparticles (CuO-NPs) on various Saccharomyces cerevisiae (S. cerevisiae) strains (wild type, single-gene-deleted mutants, and multiple-gene-deleted mutants) were determined and compared. Further experiments were also conducted to analyze the mechanisms associated with toxicity using copper salt, bulk CuO (bCuO), carbon-shelled copper nanoparticles (C/Cu-NPs), and carbon nanoparticles (C-NPs) for comparisons. The results indicated that the growth inhibition rates of CuO-NPs for the wild-type and the single-gene-deleted strains were comparable, while for the multiple-gene deletion mutant, significantly higher toxicity was observed (P < 0.05). When the toxicity of the CuO-NPs to yeast cells was compared with the toxicities of copper salt and bCuO, we concluded that the toxicity of CuO-NPs should be attributed to soluble copper rather than to the nanoparticles. The striking difference in adverse effects of C-NPs and C/Cu-NPs with equivalent surface areas also proved this. A toxicity assay revealed that the multiple-gene-deleted mutant was significantly more sensitive to CuO-NPs than the wild type. Specifically, compared with the wild-type strain, copper was readily taken up by mutant strains when cell permeability genes were knocked out, and the mutants with deletions of genes regulated under oxidative stress (OS) were likely producing more reactive oxygen species (ROS). Hence, as mechanism-based gene inactivation could increase the susceptibility of yeast, the multiple-gene-deleted mutants should be improved model organisms to investigate the toxicity of nanoparticles. PMID:26386067

Contiguous gene deletion of chromosome 2p16.3-p21 as a cause of Lynch syndrome.

PubMed

Salo-Mullen, Erin E; Lynn, Patricio B; Wang, Lu; Walsh, Michael; Gopalan, Anuradha; Shia, Jinru; Tran, Christina; Man, Fung Ying; McBride, Sean; Schattner, Mark; Zhang, Liying; Weiser, Martin R; Stadler, Zsofia K

2018-01-01

Lynch syndrome is an autosomal dominant condition caused by pathogenic mutations in the DNA mismatch repair (MMR) genes. Although commonly associated with clinical features such as intellectual disability and congenital anomalies, contiguous gene deletions may also result in cancer predisposition syndromes. We report on a 52-year-old male with Lynch syndrome caused by deletion of chromosome 2p16.3-p21. The patient had intellectual disability and presented with a prostatic adenocarcinoma with an incidentally identified synchronous sigmoid adenocarcinoma that exhibited deficient MMR with an absence of MSH2 and MSH6 protein expression. Family history was unrevealing. Physical exam revealed short stature, brachycephaly with a narrow forehead and short philtrum, brachydactyly of the hands, palmar transverse crease, broad and small feet with hyperpigmentation of the soles. The patient underwent total colectomy with ileorectal anastomosis for a pT3N1 sigmoid adenocarcinoma. Germline genetic testing of the MSH2, MSH6, and EPCAM genes revealed full gene deletions. SNP-array based DNA copy number analysis identified a deletion of 4.8 Mb at 2p16.3-p21. In addition to the three Lynch syndrome associated genes, the deleted chromosomal section encompassed genes including NRXN1, CRIPT, CALM2, FBXO11, LHCGR, MCFD2, TTC7A, EPAS1, PRKCE, and 15 others. Contiguous gene deletions have been described in other inherited cancer predisposition syndromes, such as Familial Adenomatous Polyposis. Our report and review of the literature suggests that contiguous gene deletion within the 2p16-p21 chromosomal region is a rare cause of Lynch syndrome, but presents with distinct phenotypic features, highlighting the need for recognition and awareness of this syndromic entity.

Alteration of complex sphingolipid composition and its physiological significance in yeast Saccharomyces cerevisiae lacking vacuolar ATPase.

PubMed

Tani, Motohiro; Toume, Moeko

2015-12-01

In the yeast Saccharomyces cerevisiae, complex sphingolipids have three types of polar head group and five types of ceramide; however, the physiological significance of the structural diversity is not fully understood. Here, we report that deletion of vacuolar H+-ATPase (V-ATPase) in yeast causes dramatic alteration of the complex sphingolipid composition, which includes decreases in hydroxylation at the C-4 position of long-chain bases and the C-2 position of fatty acids in the ceramide moiety, decreases in inositol phosphorylceramide (IPC) levels, and increases in mannosylinositol phosphorylceramide (MIPC) and mannosyldiinositol phosphorylceramide [M(IP)2C] levels. V-ATPase-deleted cells exhibited slow growth at pH 7.2, whereas the increase in MIPC levels was significantly enhanced when V-ATPase-deleted cells were incubated at pH 7.2. The protein expression levels of MIPC and M(IP)2C synthases were significantly increased in V-ATPase-deleted cells incubated at pH 7.2. Loss of MIPC synthesis or an increase in the hydroxylation level of the ceramide moiety of sphingolipids on overexpression of Scs7 and Sur2 sphingolipid hydroxylases enhanced the growth defect of V-ATPase-deleted cells at pH 7.2. On the contrary, the growth rate of V-ATPase-deleted cells was moderately increased on the deletion of SCS7 and SUR2. In addition, supersensitivities to Ca2+, Zn2+ and H2O2, which are typical phenotypes of V-ATPase-deleted cells, were enhanced by the loss of MIPC synthesis. These results indicate the possibility that alteration of the complex sphingolipid composition is an adaptation mechanism for a defect of V-ATPase.

A reference human genome dataset of the BGISEQ-500 sequencer.

PubMed

Huang, Jie; Liang, Xinming; Xuan, Yuankai; Geng, Chunyu; Li, Yuxiang; Lu, Haorong; Qu, Shoufang; Mei, Xianglin; Chen, Hongbo; Yu, Ting; Sun, Nan; Rao, Junhua; Wang, Jiahao; Zhang, Wenwei; Chen, Ying; Liao, Sha; Jiang, Hui; Liu, Xin; Yang, Zhaopeng; Mu, Feng; Gao, Shangxian

2017-05-01

BGISEQ-500 is a new desktop sequencer developed by BGI. Using DNA nanoball and combinational probe anchor synthesis developed from Complete Genomics™ sequencing technologies, it generates short reads at a large scale. Here, we present the first human whole-genome sequencing dataset of BGISEQ-500. The dataset was generated by sequencing the widely used cell line HG001 (NA12878) in two sequencing runs of paired-end 50 bp (PE50) and two sequencing runs of paired-end 100 bp (PE100). We also include examples of the raw images from the sequencer for reference. Finally, we identified variations using this dataset, estimated the accuracy of the variations, and compared to that of the variations identified from similar amounts of publicly available HiSeq2500 data. We found similar single nucleotide polymorphism (SNP) detection accuracy for the BGISEQ-500 PE100 data (false positive rate [FPR] = 0.00020%, sensitivity = 96.20%) compared to the PE150 HiSeq2500 data (FPR = 0.00017%, sensitivity = 96.60%) better SNP detection accuracy than the PE50 data (FPR = 0.0006%, sensitivity = 94.15%). But for insertions and deletions (indels), we found lower accuracy for BGISEQ-500 data (FPR = 0.00069% and 0.00067% for PE100 and PE50 respectively, sensitivity = 88.52% and 70.93%) than the HiSeq2500 data (FPR = 0.00032%, sensitivity = 96.28%). Our dataset can serve as the reference dataset, providing basic information not just for future development, but also for all research and applications based on the new sequencing platform. © The Authors 2017. Published by Oxford University Press.

Evolution of Transcription Activator-Like Effectors in Xanthomonas oryzae

PubMed Central

Erkes, Annett; Reschke, Maik; Boch, Jens

2017-01-01

Abstract Transcription activator-like effectors (TALEs) are secreted by plant–pathogenic Xanthomonas bacteria into plant cells where they act as transcriptional activators and, hence, are major drivers in reprogramming the plant for the benefit of the pathogen. TALEs possess a highly repetitive DNA-binding domain of typically 34 amino acid (AA) tandem repeats, where AA 12 and 13, termed repeat variable di-residue (RVD), determine target specificity. Different Xanthomonas strains possess different repertoires of TALEs. Here, we study the evolution of TALEs from the level of RVDs determining target specificity down to the level of DNA sequence with focus on rice-pathogenic Xanthomonas oryzae pv. oryzae (Xoo) and Xanthomonas oryzae pv. oryzicola (Xoc) strains. We observe that codon pairs coding for individual RVDs are conserved to a similar degree as the flanking repeat sequence. We find strong indications that TALEs may evolve 1) by base substitutions in codon pairs coding for RVDs, 2) by recombination of N-terminal or C-terminal regions of existing TALEs, or 3) by deletion of individual TALE repeats, and we propose possible mechanisms. We find indications that the reassortment of TALE genes in clusters is mediated by an integron-like mechanism in Xoc. We finally study the effect of the presence/absence and evolutionary modifications of TALEs on transcriptional activation of putative target genes in rice, and find that even single RVD swaps may lead to considerable differences in activation. This correlation allowed a refined prediction of TALE targets, which is the crucial step to decipher their virulence activity. PMID:28637323

Detection of large scale 3′ deletions in the PMS2 gene amongst Colon-CFR participants – have we been missing anything?

PubMed Central

Clendenning, Mark; Walsh, Michael D; Gelpi, Judith Balmana; Thibodeau, Stephen N.; Lindor, Noralane; Potter, John D.; Newcomb, Polly; LeMarchand, Loic; Haile, Robert; Gallinger, Steve; Hopper, John L.; Jenkins, Mark A.; Rosty, Christophe; Young, Joanne P.; Buchanan, Daniel D.

2013-01-01

Current screening practices have been able to identify PMS2 mutations in 78% of cases of colorectal cancer from the Colorectal Cancer Family Registry (Colon CFR) which showed solitary loss of the PMS2 protein. However the detection of large-scale deletions in the 3′ end of the PMS2 gene has not been possible due to technical difficulties associated with pseudogene sequences. Here, we utilised a recently described MLPA/long-range PCR-based approach to screen the remaining 22% (n = 16) of CRC-affected probands for mutations in the 3′ end of the PMS2 gene. No deletions encompassing any or all of exons 12 through 15 were identified; therefore, our results suggest that 3′ deletions in PMS2 are not a frequent occurrence in such families. PMID:23288611

Molecular recognition of DNA base pairs by the formamido/pyrrole and formamido/imidazole pairings in stacked polyamides

PubMed Central

Buchmueller, Karen L.; Staples, Andrew M.; Uthe, Peter B.; Howard, Cameron M.; Pacheco, Kimberly A. O.; Cox, Kari K.; Henry, James A.; Bailey, Suzanna L.; Horick, Sarah M.; Nguyen, Binh; Wilson, W. David; Lee, Moses

2005-01-01

Polyamides containing an N-terminal formamido (f) group bind to the minor groove of DNA as staggered, antiparallel dimers in a sequence-specific manner. The formamido group increases the affinity and binding site size, and it promotes the molecules to stack in a staggered fashion thereby pairing itself with either a pyrrole (Py) or an imidazole (Im). There has not been a systematic study on the DNA recognition properties of the f/Py and f/Im terminal pairings. These pairings were analyzed here in the context of f-ImPyPy, f-ImPyIm, f-PyPyPy and f-PyPyIm, which contain the central pairing modes, –ImPy– and –PyPy–. The specificity of these triamides towards symmetrical recognition sites allowed for the f/Py and f/Im terminal pairings to be directly compared by SPR, CD and ΔTM experiments. The f/Py pairing, when placed next to the –ImPy– or –PyPy– central pairings, prefers A/T and T/A base pairs to G/C base pairs, suggesting that f/Py has similar DNA recognition specificity to Py/Py. With –ImPy– central pairings, f/Im prefers C/G base pairs (>10 times) to the other Watson–Crick base pairs; therefore, f/Im behaves like the Py/Im pair. However, the f/Im pairing is not selective for the C/G base pair when placed next to the –PyPy– central pairings. PMID:15703305

Whole-exome sequencing and digital PCR identified a novel compound heterozygous mutation in the NPHP1 gene in a case of Joubert syndrome and related disorders.

PubMed

Koyama, Shingo; Sato, Hidenori; Wada, Manabu; Kawanami, Toru; Emi, Mitsuru; Kato, Takeo

2017-03-27

Joubert syndrome and related disorders (JSRD) is a clinically and genetically heterogeneous condition with autosomal recessive or X-linked inheritance, which share a distinctive neuroradiological hallmark, the so-called molar tooth sign. JSRD is classified into six clinical subtypes based on associated variable multiorgan involvement. To date, 21 causative genes have been identified in JSRD, which makes genetic diagnosis difficult. We report here a case of a 28-year-old Japanese woman diagnosed with JS with oculorenal defects with a novel compound heterozygous mutation (p.Ser219*/deletion) in the NPHP1 gene. Whole-exome sequencing (WES) of the patient identified the novel nonsense mutation in an apparently homozygous state. However, it was absent in her mother and heterozygous in her father. A read depth-based copy number variation (CNV) detection algorithm using WES data of the family predicted a large heterozygous deletion mutation in the patient and her mother, which was validated by digital polymerase chain reaction, indicating that the patient was compound heterozygous for the paternal nonsense mutation and the maternal deletion mutation spanning the site of the single nucleotide change. It should be noted that analytical pipelines that focus purely on sequence information cannot distinguish homozygosity from hemizygosity because of its inability to detect large deletions. The ability to detect CNVs in addition to single nucleotide variants and small insertion/deletions makes WES an attractive diagnostic tool for genetically heterogeneous disorders.

Base-Pairing Energies of Protonated Nucleoside Base Pairs of dCyd and m5dCyd: Implications for the Stability of DNA i-Motif Conformations

NASA Astrophysics Data System (ADS)

Yang, Bo; Rodgers, M. T.

2015-08-01

Hypermethylation of cytosine in expanded (CCG)n•(CGG)n trinucleotide repeats results in Fragile X syndrome, the most common cause of inherited mental retardation. The (CCG)n•(CGG)n repeats adopt i-motif conformations that are preferentially stabilized by base-pairing interactions of protonated base pairs of cytosine. Here we investigate the effects of 5-methylation and the sugar moiety on the base-pairing energies (BPEs) of protonated cytosine base pairs by examining protonated nucleoside base pairs of 2'-deoxycytidine (dCyd) and 5-methyl-2'-deoxycytidine (m5dCyd) using threshold collision-induced dissociation techniques. 5-Methylation of a single or both cytosine residues leads to very small change in the BPE. However, the accumulated effect may be dramatic in diseased state trinucleotide repeats where many methylated base pairs may be present. The BPEs of the protonated nucleoside base pairs examined here significantly exceed those of Watson-Crick dGuo•dCyd and neutral dCyd•dCyd base pairs, such that these base-pairing interactions provide the major forces responsible for stabilization of DNA i-motif conformations. Compared with isolated protonated nucleobase pairs of cytosine and 1-methylcytosine, the 2'-deoxyribose sugar produces an effect similar to the 1-methyl substituent, and leads to a slight decrease in the BPE. These results suggest that the base-pairing interactions may be slightly weaker in nucleic acids, but that the extended backbone is likely to exert a relatively small effect on the total BPE. The proton affinity (PA) of m5dCyd is also determined by competitive analysis of the primary dissociation pathways that occur in parallel for the protonated (m5dCyd)H+(dCyd) nucleoside base pair and the absolute PA of dCyd previously reported.

The prevalence of ABCB1:c.227_230delATAG mutation in affected dog breeds from European countries.

PubMed

Firdova, Zuzana; Turnova, Evelina; Bielikova, Marcela; Turna, Jan; Dudas, Andrej

2016-06-01

Deletion of 4-base pairs in the canine ABCB1 (MDR1) gene, responsible for encoding P-glycoprotein, leads to nonsense frame-shift mutation, which causes hypersensitivity to macrocyclic lactones drugs (e.g. ivermectin). To date, at least 12 purebred dog breeds have been found to be affected by this mutation. The aim of this study was to update information about the prevalence of ABCB1 mutation (c.227_230delATAG) in predisposed breeds in multiple European countries. This large scale survey also includes countries which were not involved in previous studies. The samples were collected in the period from 2012 to 2014. The overview is based on genotyping data of 4729 individuals. The observed mutant allele frequencies were 58.5% (Smooth Collie), 48.3% (Rough Collie), 35% (Australian Shepherd), 30.3% (Shetland Sheepdog), 28.1% (Silken Windhound), 26.1% (Miniature Australian Shepherd), 24.3% (Longhaired Whippet), 16.2% (White Swiss Shepherd) and 0% (Border Collie). The possible presence of an ABCB1 mutant allele in Akita-Inu breed has been investigated with negative results. This information could be helpful for breeders in optimization of their breeding strategy and for veterinarians when prescribing drug therapy for dogs of predisposed breeds. Copyright © 2016 Elsevier Ltd. All rights reserved.

Leveraging long read sequencing from a single individual to provide a comprehensive resource for benchmarking variant calling methods

PubMed Central

Mu, John C.; Tootoonchi Afshar, Pegah; Mohiyuddin, Marghoob; Chen, Xi; Li, Jian; Bani Asadi, Narges; Gerstein, Mark B.; Wong, Wing H.; Lam, Hugo Y. K.

2015-01-01

A high-confidence, comprehensive human variant set is critical in assessing accuracy of sequencing algorithms, which are crucial in precision medicine based on high-throughput sequencing. Although recent works have attempted to provide such a resource, they still do not encompass all major types of variants including structural variants (SVs). Thus, we leveraged the massive high-quality Sanger sequences from the HuRef genome to construct by far the most comprehensive gold set of a single individual, which was cross validated with deep Illumina sequencing, population datasets, and well-established algorithms. It was a necessary effort to completely reanalyze the HuRef genome as its previously published variants were mostly reported five years ago, suffering from compatibility, organization, and accuracy issues that prevent their direct use in benchmarking. Our extensive analysis and validation resulted in a gold set with high specificity and sensitivity. In contrast to the current gold sets of the NA12878 or HS1011 genomes, our gold set is the first that includes small variants, deletion SVs and insertion SVs up to a hundred thousand base-pairs. We demonstrate the utility of our HuRef gold set to benchmark several published SV detection tools. PMID:26412485

Complete Genome Sequence of ER2796, a DNA Methyltransferase-Deficient Strain of Escherichia coli K-12.

PubMed

Anton, Brian P; Mongodin, Emmanuel F; Agrawal, Sonia; Fomenkov, Alexey; Byrd, Devon R; Roberts, Richard J; Raleigh, Elisabeth A

2015-01-01

We report the complete sequence of ER2796, a laboratory strain of Escherichia coli K-12 that is completely defective in DNA methylation. Because of its lack of any native methylation, it is extremely useful as a host into which heterologous DNA methyltransferase genes can be cloned and the recognition sequences of their products deduced by Pacific Biosciences Single-Molecule Real Time (SMRT) sequencing. The genome was itself sequenced from a long-insert library using the SMRT platform, resulting in a single closed contig devoid of methylated bases. Comparison with K-12 MG1655, the first E. coli K-12 strain to be sequenced, shows an essentially co-linear relationship with no major rearrangements despite many generations of laboratory manipulation. The comparison revealed a total of 41 insertions and deletions, and 228 single base pair substitutions. In addition, the long-read approach facilitated the surprising discovery of four gene conversion events, three involving rRNA operons and one between two cryptic prophages. Such events thus contribute both to genomic homogenization and to bacteriophage diversification. As one of relatively few laboratory strains of E. coli to be sequenced, the genome also reveals the sequence changes underlying a number of classical mutant alleles including those affecting the various native DNA methylation systems.

Complete Genome Sequence of ER2796, a DNA Methyltransferase-Deficient Strain of Escherichia coli K-12

PubMed Central

Anton, Brian P.; Mongodin, Emmanuel F.; Agrawal, Sonia; Fomenkov, Alexey; Byrd, Devon R.; Roberts, Richard J.; Raleigh, Elisabeth A.

2015-01-01

We report the complete sequence of ER2796, a laboratory strain of Escherichia coli K-12 that is completely defective in DNA methylation. Because of its lack of any native methylation, it is extremely useful as a host into which heterologous DNA methyltransferase genes can be cloned and the recognition sequences of their products deduced by Pacific Biosciences Single-Molecule Real Time (SMRT) sequencing. The genome was itself sequenced from a long-insert library using the SMRT platform, resulting in a single closed contig devoid of methylated bases. Comparison with K-12 MG1655, the first E. coli K-12 strain to be sequenced, shows an essentially co-linear relationship with no major rearrangements despite many generations of laboratory manipulation. The comparison revealed a total of 41 insertions and deletions, and 228 single base pair substitutions. In addition, the long-read approach facilitated the surprising discovery of four gene conversion events, three involving rRNA operons and one between two cryptic prophages. Such events thus contribute both to genomic homogenization and to bacteriophage diversification. As one of relatively few laboratory strains of E. coli to be sequenced, the genome also reveals the sequence changes underlying a number of classical mutant alleles including those affecting the various native DNA methylation systems. PMID:26010885

Development of Genetic Markers in Eucalyptus Species by Target Enrichment and Exome Sequencing

PubMed Central

Dasgupta, Modhumita Ghosh; Dharanishanthi, Veeramuthu; Agarwal, Ishangi; Krutovsky, Konstantin V.

2015-01-01

The advent of next-generation sequencing has facilitated large-scale discovery, validation and assessment of genetic markers for high density genotyping. The present study was undertaken to identify markers in genes supposedly related to wood property traits in three Eucalyptus species. Ninety four genes involved in xylogenesis were selected for hybridization probe based nuclear genomic DNA target enrichment and exome sequencing. Genomic DNA was isolated from the leaf tissues and used for on-array probe hybridization followed by Illumina sequencing. The raw sequence reads were trimmed and high-quality reads were mapped to the E. grandis reference sequence and the presence of single nucleotide variants (SNVs) and insertions/ deletions (InDels) were identified across the three species. The average read coverage was 216X and a total of 2294 SNVs and 479 InDels were discovered in E. camaldulensis, 2383 SNVs and 518 InDels in E. tereticornis, and 1228 SNVs and 409 InDels in E. grandis. Additionally, SNV calling and InDel detection were conducted in pair-wise comparisons of E. tereticornis vs. E. grandis, E. camaldulensis vs. E. tereticornis and E. camaldulensis vs. E. grandis. This study presents an efficient and high throughput method on development of genetic markers for family– based QTL and association analysis in Eucalyptus. PMID:25602379

Metal-mediated DNA base pairing: alternatives to hydrogen-bonded Watson-Crick base pairs.

PubMed

Takezawa, Yusuke; Shionoya, Mitsuhiko

2012-12-18

With its capacity to store and transfer the genetic information within a sequence of monomers, DNA forms its central role in chemical evolution through replication and amplification. This elegant behavior is largely based on highly specific molecular recognition between nucleobases through the specific hydrogen bonds in the Watson-Crick base pairing system. While the native base pairs have been amazingly sophisticated through the long history of evolution, synthetic chemists have devoted considerable efforts to create alternative base pairing systems in recent decades. Most of these new systems were designed based on the shape complementarity of the pairs or the rearrangement of hydrogen-bonding patterns. We wondered whether metal coordination could serve as an alternative driving force for DNA base pairing and why hydrogen bonding was selected on Earth in the course of molecular evolution. Therefore, we envisioned an alternative design strategy: we replaced hydrogen bonding with another important scheme in biological systems, metal-coordination bonding. In this Account, we provide an overview of the chemistry of metal-mediated base pairing including basic concepts, molecular design, characteristic structures and properties, and possible applications of DNA-based molecular systems. We describe several examples of artificial metal-mediated base pairs, such as Cu(2+)-mediated hydroxypyridone base pair, H-Cu(2+)-H (where H denotes a hydroxypyridone-bearing nucleoside), developed by us and other researchers. To design the metallo-base pairs we carefully chose appropriate combinations of ligand-bearing nucleosides and metal ions. As expected from their stronger bonding through metal coordination, DNA duplexes possessing metallo-base pairs exhibited higher thermal stability than natural hydrogen-bonded DNAs. Furthermore, we could also use metal-mediated base pairs to construct or induce other high-order structures. These features could lead to metal-responsive functional DNA molecules such as artificial DNAzymes and DNA machines. In addition, the metallo-base pairing system is a powerful tool for the construction of homogeneous and heterogeneous metal arrays, which can lead to DNA-based nanomaterials such as electronic wires and magnetic devices. Recently researchers have investigated these systems as enzyme replacements, which may offer an additional contribution to chemical biology and synthetic biology through the expansion of the genetic alphabet.

Theoretical determination of one-electron redox potentials for DNA bases, base pairs, and stacks.

PubMed

Paukku, Y; Hill, G

2011-05-12

Electron affinities, ionization potentials, and redox potentials for DNA bases, base pairs, and N-methylated derivatives are computed at the DFT/M06-2X/6-31++G(d,p) level of theory. Redox properties of a guanine-guanine stack model are explored as well. Reduction and oxidation potentials are in good agreement with the experimental ones. Electron affinities of base pairs were found to be negative. Methylation of canonical bases affects the ionization potentials the most. Base pair formation and base stacking lower ionization potentials by 0.3 eV. Pairing of guanine with the 5-methylcytosine does not seem to influence the redox properties of this base pair much.

Reducing false-positive incidental findings with ensemble genotyping and logistic regression based variant filtering methods.

PubMed

Hwang, Kyu-Baek; Lee, In-Hee; Park, Jin-Ho; Hambuch, Tina; Choe, Yongjoon; Kim, MinHyeok; Lee, Kyungjoon; Song, Taemin; Neu, Matthew B; Gupta, Neha; Kohane, Isaac S; Green, Robert C; Kong, Sek Won

2014-08-01

As whole genome sequencing (WGS) uncovers variants associated with rare and common diseases, an immediate challenge is to minimize false-positive findings due to sequencing and variant calling errors. False positives can be reduced by combining results from orthogonal sequencing methods, but costly. Here, we present variant filtering approaches using logistic regression (LR) and ensemble genotyping to minimize false positives without sacrificing sensitivity. We evaluated the methods using paired WGS datasets of an extended family prepared using two sequencing platforms and a validated set of variants in NA12878. Using LR or ensemble genotyping based filtering, false-negative rates were significantly reduced by 1.1- to 17.8-fold at the same levels of false discovery rates (5.4% for heterozygous and 4.5% for homozygous single nucleotide variants (SNVs); 30.0% for heterozygous and 18.7% for homozygous insertions; 25.2% for heterozygous and 16.6% for homozygous deletions) compared to the filtering based on genotype quality scores. Moreover, ensemble genotyping excluded > 98% (105,080 of 107,167) of false positives while retaining > 95% (897 of 937) of true positives in de novo mutation (DNM) discovery in NA12878, and performed better than a consensus method using two sequencing platforms. Our proposed methods were effective in prioritizing phenotype-associated variants, and an ensemble genotyping would be essential to minimize false-positive DNM candidates. © 2014 WILEY PERIODICALS, INC.

Reducing false positive incidental findings with ensemble genotyping and logistic regression-based variant filtering methods

PubMed Central

Hwang, Kyu-Baek; Lee, In-Hee; Park, Jin-Ho; Hambuch, Tina; Choi, Yongjoon; Kim, MinHyeok; Lee, Kyungjoon; Song, Taemin; Neu, Matthew B.; Gupta, Neha; Kohane, Isaac S.; Green, Robert C.; Kong, Sek Won

2014-01-01

As whole genome sequencing (WGS) uncovers variants associated with rare and common diseases, an immediate challenge is to minimize false positive findings due to sequencing and variant calling errors. False positives can be reduced by combining results from orthogonal sequencing methods, but costly. Here we present variant filtering approaches using logistic regression (LR) and ensemble genotyping to minimize false positives without sacrificing sensitivity. We evaluated the methods using paired WGS datasets of an extended family prepared using two sequencing platforms and a validated set of variants in NA12878. Using LR or ensemble genotyping based filtering, false negative rates were significantly reduced by 1.1- to 17.8-fold at the same levels of false discovery rates (5.4% for heterozygous and 4.5% for homozygous SNVs; 30.0% for heterozygous and 18.7% for homozygous insertions; 25.2% for heterozygous and 16.6% for homozygous deletions) compared to the filtering based on genotype quality scores. Moreover, ensemble genotyping excluded > 98% (105,080 of 107,167) of false positives while retaining > 95% (897 of 937) of true positives in de novo mutation (DNM) discovery, and performed better than a consensus method using two sequencing platforms. Our proposed methods were effective in prioritizing phenotype-associated variants, and ensemble genotyping would be essential to minimize false positive DNM candidates. PMID:24829188

Artificial Potential Field Controllers for Robust Communications in a Network of Swarm Robots

DTIC Science & Technology

2005-05-18

vectors are less than 90◦ apart. Algorithm 1 The Algorithm for generating a feasible set of vectors P ← set of high priority vectors Csum ← [( LOS1 +R1...the 46 C program was finished reading and writing the values to the serial line it would delete the timing file. Only after the timing file had been... deleted would the base station write new values for the wheel velocities. The timing file kept both the Linux PC and the base station synchronized so

Base pairing and base mis-pairing in nucleic acids

NASA Technical Reports Server (NTRS)

Wang, A. H. J.; Rich, A.

1986-01-01

In recent years we have learned that DNA is conformationally active. It can exist in a number of different stable conformations including both right-handed and left-handed forms. Using single crystal X-ray diffraction analysis we are able to discover not only additional conformations of the nucleic acids but also different types of hydrogen bonded base-base interactions. Although Watson-Crick base pairings are the predominant type of interaction in double helical DNA, they are not the only types. Recently, we have been able to examine mismatching of guanine-thymine base pairs in left-handed Z-DNA at atomic resolution (1A). A minimum amount of distortion of the sugar phosphate backbone is found in the G x T pairing in which the bases are held together by two hydrogen bonds in the wobble pairing interaction. Because of the high resolution of the analysis we can visualize water molecules which fill in to accommodate the other hydrogen bonding positions in the bases which are not used in the base-base interactions. Studies on other DNA oligomers have revealed that other types of non-Watson-Crick hydrogen bonding interactions can occur. In the structure of a DNA octamer with the sequence d(GCGTACGC) complexed to an antibiotic triostin A, it was found that the two central AT base pairs are held together by Hoogsteen rather than Watson-Crick base pairs. Similarly, the G x C base pairs at the ends are also Hoogsteen rather than Watson-Crick pairing. Hoogsteen base pairs make a modified helix which is distinct from the Watson-Crick double helix.

Hidden in Plain Sight: Subtle Effects of the 8-Oxoguanine Lesion on the Structure, Dynamics, and Thermodynamics of a 15-Base-Pair Oligodeoxynucleotide Duplex†

PubMed Central

Crenshaw, Charisse M.; Wade, Jacqueline E.; Arthanari, Haribabu; Frueh, Dominique; Lane, Benjamin F.; Núñez, Megan E.

2011-01-01

The base lesion 8-oxoguanine is formed readily by oxidation of DNA, potentially leading to G→T transversion mutations. Despite the apparent similarity of 8-oxoguanine-cytosine base pairs to normal guanine-cytosine base pairs, cellular base excision repair systems effectively recognize the lesion base. Here we apply several techniques to examine a single 8-oxoguanine lesion at the center of a nonpalindromic 15-mer duplex oligonucleotide in an effort to determine what, if anything, distinguishes an 8-oxoguanine-cytosine base pair from a normal base pair. The lesion duplex is globally almost indistinguishable from the unmodified parent duplex using CD spectroscopy and UV melting thermodynamics. The DNA mismatch-detecting photocleavage agent Rh(bpy)2chrysi3+ cleaves only weakly and nonspecifically, revealing that the 8oxoG-C pair is locally stable at the level of the individual base pairs. NMR spectra are also consistent with a well-conserved B-form duplex structure. In the 2D NOESY spectra, base-sugar and imino-imino crosspeaks are strikingly similar between parent and lesion duplexes. Changes in chemical shift due to the 8oxoG lesion are localized to its complementary cytosine and to the 2–3 base pairs immediately flanking the lesion on the lesion strand. Residues further removed from the lesion are shown to be unperturbed by its presence. Notably, imino exchange experiments indicate that the 8-oxoguanine-cytosine pair is strong and stable, with an apparent equilibrium constant for opening equal to that of other internal guanine-cytosine base pairs, on the order of 10−6. This collection of experiments shows that the 8-oxoguanine-cytosine base pair is incredibly stable and similar to the native pair. PMID:21902242

Analysis of copy number variations in Holstein-Friesian cow genomes based on whole-genome sequence data.

PubMed

Mielczarek, M; Frąszczak, M; Giannico, R; Minozzi, G; Williams, John L; Wojdak-Maksymiec, K; Szyda, J

2017-07-01

Thirty-two whole genome DNA sequences of cows were analyzed to evaluate inter-individual variability in the distribution and length of copy number variations (CNV) and to functionally annotate CNV breakpoints. The total number of deletions per individual varied between 9,731 and 15,051, whereas the number of duplications was between 1,694 and 5,187. Most of the deletions (81%) and duplications (86%) were unique to a single cow. No relation between the pattern of variant sharing and a family relationship or disease status was found. The animal-averaged length of deletions was from 5,234 to 9,145 bp and the average length of duplications was between 7,254 and 8,843 bp. Highly significant inter-individual variation in length and number of CNV was detected for both deletions and duplications. The majority of deletion and duplication breakpoints were located in intergenic regions and introns, whereas fewer were identified in noncoding transcripts and splice regions. Only 1.35 and 0.79% of the deletion and duplication breakpoints were observed within coding regions. A gene with the highest number of deletion breakpoints codes for protein kinase cGMP-dependent type I, whereas the T-cell receptor α constant gene had the most duplication breakpoints. The functional annotation of genes with the largest incidence of deletion/duplication breakpoints identified 87/112 Kyoto Encyclopedia of Genes and Genomes pathways, but none of the pathways were significantly enriched or depleted with breakpoints. The analysis of Gene Ontology (GO) terms revealed that a cluster with the highest enrichment score among genes with many deletion breakpoints was represented by GO terms related to ion transport, whereas the GO term cluster mostly enriched among the genes with many duplication breakpoints was related to binding of macromolecules. Furthermore, when considering the number of deletion breakpoints per gene functional category, no significant differences were observed between the "housekeeping" and "strong selection" categories, but genes representing the "low selection pressure" group showed a significantly higher number of breakpoints. Copyright © 2017 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Structural landscape of base pairs containing post-transcriptional modifications in RNA

PubMed Central

Seelam, Preethi P.; Sharma, Purshotam

2017-01-01

Base pairs involving post-transcriptionally modified nucleobases are believed to play important roles in a wide variety of functional RNAs. Here we present our attempts toward understanding the structural and functional role of naturally occurring modified base pairs using a combination of X-ray crystal structure database analysis, sequence analysis, and advanced quantum chemical methods. Our bioinformatics analysis reveals that despite their presence in all major secondary structural elements, modified base pairs are most prevalent in tRNA crystal structures and most commonly involve guanine or uridine modifications. Further, analysis of tRNA sequences reveals additional examples of modified base pairs at structurally conserved tRNA regions and highlights the conservation patterns of these base pairs in three domains of life. Comparison of structures and binding energies of modified base pairs with their unmodified counterparts, using quantum chemical methods, allowed us to classify the base modifications in terms of the nature of their electronic structure effects on base-pairing. Analysis of specific structural contexts of modified base pairs in RNA crystal structures revealed several interesting scenarios, including those at the tRNA:rRNA interface, antibiotic-binding sites on the ribosome, and the three-way junctions within tRNA. These scenarios, when analyzed in the context of available experimental data, allowed us to correlate the occurrence and strength of modified base pairs with their specific functional roles. Overall, our study highlights the structural importance of modified base pairs in RNA and points toward the need for greater appreciation of the role of modified bases and their interactions, in the context of many biological processes involving RNA. PMID:28341704

Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides.

PubMed

Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu

2004-03-01

A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non-Watson-Crick base pair in SECIS element plays an important role in the selenocysteine expression by UGA codon.

Introducing a model of pairing based on base pair specific interactions between identical DNA sequences

NASA Astrophysics Data System (ADS)

(O' Lee, Dominic J.

2018-02-01

At present, there have been suggested two types of physical mechanism that may facilitate preferential pairing between DNA molecules, with identical or similar base pair texts, without separation of base pairs. One mechanism solely relies on base pair specific patterns of helix distortion being the same on the two molecules, discussed extensively in the past. The other mechanism proposes that there are preferential interactions between base pairs of the same composition. We introduce a model, built on this second mechanism, where both thermal stretching and twisting fluctuations are included, as well as the base pair specific helix distortions. Firstly, we consider an approximation for weak pairing interactions, or short molecules. This yields a dependence of the energy on the square root of the molecular length, which could explain recent experimental data. However, analysis suggests that this approximation is no longer valid at large DNA lengths. In a second approximation, for long molecules, we define two adaptation lengths for twisting and stretching, over which the pairing interaction can limit the accumulation of helix disorder. When the pairing interaction is sufficiently strong, both adaptation lengths are finite; however, as we reduce pairing strength, the stretching adaptation length remains finite but the torsional one becomes infinite. This second state persists to arbitrarily weak values of the pairing strength; suggesting that, if the molecules are long enough, the pairing energy scales as length. To probe differences between the two pairing mechanisms, we also construct a model of similar form. However, now, pairing between identical sequences solely relies on the intrinsic helix distortion patterns. Between the two models, we see interesting qualitative differences. We discuss our findings, and suggest new work to distinguish between the two mechanisms.

Assessment of Listeria monocytogenes virulence in the Galleria mellonella insect larvae model.

PubMed

Rakic Martinez, Mira; Wiedmann, Martin; Ferguson, Martine; Datta, Atin R

2017-01-01

Several animal models have been used to understand the molecular basis of the pathogenicity, infectious dose and strain to strain variation of Listeria monocytogenes. The greater wax worm Galleria mellonella, as an alternative model, provides some useful advantages not available with other models and has already been described as suitable for the virulence assessment of various pathogens including L. monocytogenes. The objectives of this study are: 1) confirming the usefulness of this model with a wide panel of Listeria spp. including non-pathogenic L. innocua, L. seeligeri, L. welshimeri and animal pathogen L. ivanovii; 2) assessment of virulence of several isogenic in-frame deletion mutants in virulence and stress related genes of L. monocytogenes and 3) virulence assessment of paired food and clinical isolates of L. monocytogenes from 14 major listeriosis outbreaks occurred worldwide between 1980 and 2015. Larvae injected with different concentrations of Listeria were incubated at 37°C and monitored over seven days for time needed to kill 50% of larvae (LT50) and to determine change of bacterial population in G. mellonella, 2 and 24 hours post-inoculation. Non-pathogenic members of Listeria and L. ivanovii showed significantly (P < 0.05) higher LT50 (lower virulence) than the wild type L. monocytogenes strains. Isogenic mutants of L. monocytogenes with the deletions in prfA, plcA, hly, actA and virR genes, also showed significantly (P < 0.05) higher LT50 than the wild type strain at the inoculum of 106CFU/larva. Food isolates had significantly (P < 0.05) lower virulence than the paired clinical isolates, at all three inoculum concentrations. L. monocytogenes strains related to non-invasive (gastroenteritis) outbreaks of listeriosis showed significantly (P < 0.05) lower virulence than isolates of the same serotype obtained from outbreaks with invasive symptoms. The difference, however, was dose and strain- dependent. No significant differences in virulence were observed among the serotype tested in this study.

Assessment of Listeria monocytogenes virulence in the Galleria mellonella insect larvae model

PubMed Central

Rakic Martinez, Mira; Ferguson, Martine; Datta, Atin R.

2017-01-01

Several animal models have been used to understand the molecular basis of the pathogenicity, infectious dose and strain to strain variation of Listeria monocytogenes. The greater wax worm Galleria mellonella, as an alternative model, provides some useful advantages not available with other models and has already been described as suitable for the virulence assessment of various pathogens including L. monocytogenes. The objectives of this study are: 1) confirming the usefulness of this model with a wide panel of Listeria spp. including non-pathogenic L. innocua, L. seeligeri, L. welshimeri and animal pathogen L. ivanovii; 2) assessment of virulence of several isogenic in-frame deletion mutants in virulence and stress related genes of L. monocytogenes and 3) virulence assessment of paired food and clinical isolates of L. monocytogenes from 14 major listeriosis outbreaks occurred worldwide between 1980 and 2015. Larvae injected with different concentrations of Listeria were incubated at 37°C and monitored over seven days for time needed to kill 50% of larvae (LT50) and to determine change of bacterial population in G. mellonella, 2 and 24 hours post-inoculation. Non-pathogenic members of Listeria and L. ivanovii showed significantly (P < 0.05) higher LT50 (lower virulence) than the wild type L. monocytogenes strains. Isogenic mutants of L. monocytogenes with the deletions in prfA, plcA, hly, actA and virR genes, also showed significantly (P < 0.05) higher LT50 than the wild type strain at the inoculum of 106CFU/larva. Food isolates had significantly (P < 0.05) lower virulence than the paired clinical isolates, at all three inoculum concentrations. L. monocytogenes strains related to non-invasive (gastroenteritis) outbreaks of listeriosis showed significantly (P < 0.05) lower virulence than isolates of the same serotype obtained from outbreaks with invasive symptoms. The difference, however, was dose and strain- dependent. No significant differences in virulence were observed among the serotype tested in this study. PMID:28898264

Efficient genome engineering of a virulent Klebsiella bacteriophage using CRISPR-Cas9.

PubMed

Shen, Juntao; Zhou, Jinjie; Chen, Guo-Qiang; Xiu, Zhi-Long

2018-06-13

Klebsiella pneumoniae is one of the most common nosocomial opportunistic pathogens usually with multiple drug-resistance. Phage therapy, a potential new therapeutics to replace or supplement antibiotics, has attracted much attention. However, very few Klebsiella phages have been well-characterized as the lack of efficient genome editing tools. Here, Cas9 from Streptococcus pyogenes and a single guide RNA (sgRNA) were used to modify a virulent Klebsiella bacteriophage phiKpS2. We firstly evaluated the distribution of sgRNA activity in phages and proved that it's largely inconsistent with the predicted activity from current models trained on eukaryotic cell datasets. A simple CRISPR-based phage genome editing procedure was developed based on the discovery that homologous arms as short as 30-60 bp was sufficient to introduce point mutation, gene deletion and swap. We also demonstrated that weak sgRNAs could be used for precise phage genome editing but failed to select random recombinants, possibly because inefficient cleavage can be tolerated through continuous repair by homologous recombination with the uncut genomes. Small frameshift deletion was proved to be an efficient way to evaluate the essentiality of phage genes. By using the above strategies, a putative promoter and nine genes of phiKpS2 were successfully deleted. Interestingly, the holin gene can be deleted with little effect on phiKpS2 infection, but the reason is not yet clear. This study established an efficient, time-saving, and cost-effective procedure for phage genome editing, which is expected to significantly promote the development of bacteriophage therapy. IMPORTANCE In the present study, we have addressed an efficient, time-saving and cost-effective CRISPR-based phage genome editing of Klebsiella phage, which has the potential to significantly expand our knowledge of phage-host interactions and to promote the applications of phage therapy. The distribution of sgRNA activity was first evaluated in phages. Short homologous arms were proved enough to introduce point mutation, small frameshift deletion, gene deletion and swap into phages, and weak sgRNAs were proved useful for precise phage genome editing but failed to select random recombinants, which all make the CRISPR-based phage genome editing easier to use. Copyright © 2018 American Society for Microbiology.

Perceptual Recovery from Consonant-Cluster Simplification in Korean Using Language-Specific Phonological Knowledge

ERIC Educational Resources Information Center

Cho, Taehong; McQueen, James M.

2011-01-01

Two experiments examined whether perceptual recovery from Korean consonant-cluster simplification is based on language-specific phonological knowledge. In tri-consonantal C1C2C3 sequences such as /lkt/ and /lpt/ in Seoul Korean, either C1 or C2 can be completely deleted. Seoul Koreans monitored for C2 targets (/p/ or /k/, deleted or preserved) in…

Social Cognitive Training in Adolescents with Chromosome 22q11.2 Deletion Syndrome: Feasibility and Preliminary Effects of the Intervention

ERIC Educational Resources Information Center

Shashi, V.; Harrell, W.; Eack, S.; Sanders, C.; McConkie-Rosell, A.; Keshavan, M. S.; Bonner, M. J.; Schoch, K.; Hooper, S. R.

2015-01-01

Background: Children with chromosome 22q11.2 deletion syndrome (22q11DS) often have deficits in social cognition and social skills that contribute to poor adaptive functioning. These deficits may be of relevance to the later occurrence of serious psychiatric illnesses such as schizophrenia. Yet, there are no evidence-based interventions to improve…