Four base recognition by triplex-forming oligonucleotides at physiological pH

PubMed Central

Rusling, David A.; Powers, Vicki E. C.; Ranasinghe, Rohan T.; Wang, Yang; Osborne, Sadie D.; Brown, Tom; Fox, Keith R.

2005-01-01

We have achieved recognition of all 4 bp by triple helix formation at physiological pH, using triplex-forming oligonucleotides that contain four different synthetic nucleotides. BAU [2′-aminoethoxy-5-(3-aminoprop-1-ynyl)uridine] recognizes AT base pairs with high affinity, MeP (3-methyl-2 aminopyridine) binds to GC at higher pHs than cytosine, while APP (6-(3-aminopropyl)-7-methyl-3H-pyrrolo[2,3-d]pyrimidin-2(7H)-one) and S [N-(4-(3-acetamidophenyl)thiazol-2-yl-acetamide)] bind to CG and TA base pairs, respectively. Fluorescence melting and DNase I footprinting demonstrate successful triplex formation at a 19mer oligopurine sequence that contains two CG and two TA interruptions. The complexes are pH dependent, but are still stable at pH 7.0. BAU, MeP and APP retain considerable selectivity, and single base pair changes opposite these residues cause a large reduction in affinity. In contrast, S is less selective and tolerates CG pairs as well as TA. PMID:15911633

Free energy landscape and transition pathways from Watson–Crick to Hoogsteen base pairing in free duplex DNA

PubMed Central

Yang, Changwon; Kim, Eunae; Pak, Youngshang

2015-01-01

Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson–Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine–thymine (A–T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. PMID:26250116

[Under what conditions does G.C Watson-Crick DNA base pair acquire all four configurations characteristic for A.T Watson-Crick DNA base pair?].

PubMed

Brovarets', O O

2013-01-01

At the MP2/6-311++G(2df,pd)//B3LYP/6-311++G(d,p) level of theory it was established for the first time, that the Löwdin's G*.C* DNA base pair formed by the mutagenic tautomers can acquire, as the A-T Watson-Crick DNA base pair, four biologically important configurations, namely: Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen. This fact demonstrates rather unexpected role of the tautomerisation of the one of the Watson-Crick DNA base pairs, in particular, via double proton transfer: exactly the G.C-->G*.C* tautomerisation allows to overcome steric hindrances for the implementation of the above mentioned configurations. Geometric, electron-topological and energetic properties of the H-bonds that stabilise the studied pairs, as well as the energetic characteristics of the latters are presented.

Myotonic Dystrophy Type 1 RNA Crystal Structures Reveal Heterogeneous 1×1 Nucleotide UU Internal Loop Conformations⊥

PubMed Central

Kumar, Amit; Park, HaJeung; Fang, Pengfei; Parkesh, Raman; Guo, Min; Nettles, Kendall W.; Disney, Matthew D.

2011-01-01

RNA internal loops often display a variety of conformations in solution. Herein, we visualize conformational heterogeneity in the context of the 5′CUG/3′GUC repeat motif present in the RNA that causes myotonic dystrophy type 1 (DM1). Specifically, two crystal structures are disclosed of a model DM1 triplet repeating construct, 5′r(UUGGGC(CUG)3GUCC)2, refined to 2.20 Å and 1.52 Å resolution. Here, differences in orientation of the 5′ dangling UU end between the two structures induce changes in the backbone groove width, which reveals that non-canonical 1×1 nucleotide UU internal loops can display an ensemble of pairing conformations. In the 2.20 Å structure, CUGa, the 5′UU forms one hydrogen-bonded pairs with a 5′UU of a neighboring helix in the unit cell to form a pseudo-infinite helix. The central 1×1 nucleotide UU internal loop has no hydrogen bonds, while the terminal 1×1 nucleotide UU internal loops each form a one hydrogen-bonded pair. In the 1.52 Å structure, CUGb, the 5′ UU dangling end is tucked into the major groove of the duplex. While the canonical paired bases show no change in base pairing, in CUGb the terminal 1×1 nucleotide UU internal loops form now two hydrogen-bonded pairs. Thus, the shift in major groove induced by the 5′UU dangling end alters non-canonical base patterns. Collectively, these structures indicate that 1×1 nucleotide UU internal loops in DM1 may sample multiple conformations in vivo. This observation has implications for the recognition of this RNA, and other repeating transcripts, by protein and small molecule ligands. PMID:21988728

Myotonic dystrophy type 1 RNA crystal structures reveal heterogeneous 1 × 1 nucleotide UU internal loop conformations.

PubMed

Kumar, Amit; Park, HaJeung; Fang, Pengfei; Parkesh, Raman; Guo, Min; Nettles, Kendall W; Disney, Matthew D

2011-11-15

RNA internal loops often display a variety of conformations in solution. Herein, we visualize conformational heterogeneity in the context of the 5'CUG/3'GUC repeat motif present in the RNA that causes myotonic dystrophy type 1 (DM1). Specifically, two crystal structures of a model DM1 triplet repeating construct, 5'r[UUGGGC(CUG)(3)GUCC](2), refined to 2.20 and 1.52 Å resolution are disclosed. Here, differences in the orientation of the 5' dangling UU end between the two structures induce changes in the backbone groove width, which reveals that noncanonical 1 × 1 nucleotide UU internal loops can display an ensemble of pairing conformations. In the 2.20 Å structure, CUGa, the 5' UU forms a one hydrogen-bonded pair with a 5' UU of a neighboring helix in the unit cell to form a pseudoinfinite helix. The central 1 × 1 nucleotide UU internal loop has no hydrogen bonds, while the terminal 1 × 1 nucleotide UU internal loops each form a one-hydrogen bond pair. In the 1.52 Å structure, CUGb, the 5' UU dangling end is tucked into the major groove of the duplex. While the canonically paired bases show no change in base pairing, in CUGb the terminal 1 × 1 nucleotide UU internal loops now form two hydrogen-bonded pairs. Thus, the shift in the major groove induced by the 5' UU dangling end alters noncanonical base patterns. Collectively, these structures indicate that 1 × 1 nucleotide UU internal loops in DM1 may sample multiple conformations in vivo. This observation has implications for the recognition of this RNA, and other repeating transcripts, by protein and small molecule ligands.

Myotonic Dystrophy Type 1 RNA Crystal Structures Reveal Heterogeneous 1 × 1 Nucleotide UU Internal Loop Conformations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kumar, Amit; Park, HaJeung; Fang, Pengfei

2012-03-27

RNA internal loops often display a variety of conformations in solution. Herein, we visualize conformational heterogeneity in the context of the 5'CUG/3'GUC repeat motif present in the RNA that causes myotonic dystrophy type 1 (DM1). Specifically, two crystal structures of a model DM1 triplet repeating construct, 5'r[{und UU}GGGC(C{und U}G){sub 3}GUCC]{sub 2}, refined to 2.20 and 1.52 {angstrom} resolution are disclosed. Here, differences in the orientation of the 5' dangling UU end between the two structures induce changes in the backbone groove width, which reveals that noncanonical 1 x 1 nucleotide UU internal loops can display an ensemble of pairing conformations.more » In the 2.20 {angstrom} structure, CUGa, the 5' UU forms a one hydrogen-bonded pair with a 5' UU of a neighboring helix in the unit cell to form a pseudoinfinite helix. The central 1 x 1 nucleotide UU internal loop has no hydrogen bonds, while the terminal 1 x 1 nucleotide UU internal loops each form a one-hydrogen bond pair. In the 1.52 {angstrom} structure, CUGb, the 5' UU dangling end is tucked into the major groove of the duplex. While the canonically paired bases show no change in base pairing, in CUGb the terminal 1 x 1 nucleotide UU internal loops now form two hydrogen-bonded pairs. Thus, the shift in the major groove induced by the 5' UU dangling end alters noncanonical base patterns. Collectively, these structures indicate that 1 x 1 nucleotide UU internal loops in DM1 may sample multiple conformations in vivo. This observation has implications for the recognition of this RNA, and other repeating transcripts, by protein and small molecule ligands.« less

Comparable stability of Hoogsteen and Watson-Crick base pairs in ionic liquid choline dihydrogen phosphate.

PubMed

Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

2014-01-08

The instability of Hoogsteen base pairs relative to Watson-Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson-Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson-Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo.

Comparable Stability of Hoogsteen and Watson–Crick Base Pairs in Ionic Liquid Choline Dihydrogen Phosphate

PubMed Central

Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

2014-01-01

The instability of Hoogsteen base pairs relative to Watson–Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson–Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson–Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo. PMID:24399194

Error simulation of paired-comparison-based scaling methods

NASA Astrophysics Data System (ADS)

Cui, Chengwu

2000-12-01

Subjective image quality measurement usually resorts to psycho physical scaling. However, it is difficult to evaluate the inherent precision of these scaling methods. Without knowing the potential errors of the measurement, subsequent use of the data can be misleading. In this paper, the errors on scaled values derived form paired comparison based scaling methods are simulated with randomly introduced proportion of choice errors that follow the binomial distribution. Simulation results are given for various combinations of the number of stimuli and the sampling size. The errors are presented in the form of average standard deviation of the scaled values and can be fitted reasonably well with an empirical equation that can be sued for scaling error estimation and measurement design. The simulation proves paired comparison based scaling methods can have large errors on the derived scaled values when the sampling size and the number of stimuli are small. Examples are also given to show the potential errors on actually scaled values of color image prints as measured by the method of paired comparison.

Base pairing and base mis-pairing in nucleic acids

NASA Technical Reports Server (NTRS)

Wang, A. H. J.; Rich, A.

1986-01-01

In recent years we have learned that DNA is conformationally active. It can exist in a number of different stable conformations including both right-handed and left-handed forms. Using single crystal X-ray diffraction analysis we are able to discover not only additional conformations of the nucleic acids but also different types of hydrogen bonded base-base interactions. Although Watson-Crick base pairings are the predominant type of interaction in double helical DNA, they are not the only types. Recently, we have been able to examine mismatching of guanine-thymine base pairs in left-handed Z-DNA at atomic resolution (1A). A minimum amount of distortion of the sugar phosphate backbone is found in the G x T pairing in which the bases are held together by two hydrogen bonds in the wobble pairing interaction. Because of the high resolution of the analysis we can visualize water molecules which fill in to accommodate the other hydrogen bonding positions in the bases which are not used in the base-base interactions. Studies on other DNA oligomers have revealed that other types of non-Watson-Crick hydrogen bonding interactions can occur. In the structure of a DNA octamer with the sequence d(GCGTACGC) complexed to an antibiotic triostin A, it was found that the two central AT base pairs are held together by Hoogsteen rather than Watson-Crick base pairs. Similarly, the G x C base pairs at the ends are also Hoogsteen rather than Watson-Crick pairing. Hoogsteen base pairs make a modified helix which is distinct from the Watson-Crick double helix.

Extension of helix II of an HIV-1-directed hammerhead ribozyme with long antisense flanks does not alter kinetic parameters in vitro but causes loss of the inhibitory potential in living cells.

PubMed Central

Homann, M; Tabler, M; Tzortzakaki, S; Sczakiel, G

1994-01-01

When designed to cleave a target RNA in trans, the hammerhead ribozyme contains two antisense flanks which form helix I and helix III by pairing with the complementary target RNA. The sequences forming helix II are contained on the ribozyme strand and represent a major structural component of the hammerhead structure. In the case of an inhibitory 429 nucleotides long trans-ribozyme (2as-Rz12) which was directed against the 5'-leader/gag region of the human immunodeficiency virus type 1 (HIV-1), helix II was not pre-formed in the single-stranded molecule. Thus, major structural changes are necessary before cleavage can occur. To study whether pre-formation of helix II in the non-paired 2as-Rz12 RNA could influence the observed cleavage rate in vitro and its inhibitory activity on HIV-1 replication, we extended the 4 base pair helix II of 2as-Rz12 to 6, 10, 21, and 22 base pairs respectively. Limited RNase cleavage reactions performed in vitro at 37 degrees C and at physiological ion strength indicated that a helix II of the hammerhead domain was pre-formed when its length was at least six base pairs. This modification neither affected the association rate with target RNA nor the cleavage rate in vitro. In contrast to this, extension of helix II led to a significantly decreased inhibition of HIV-1 replication in human cells. Together with the finding of others that shortening of helix II to less than two base pairs reduces the catalytic activity in vitro, this observation indicates that the length of helix II in the naturally occurring RNAs with a hammerhead domain is already close or identical to the optimal length for catalytic activity in vitro and in vivo. Images PMID:7524030

Extractive Spectrophotometric Methods for the Determination of Zolmitriptan in Bulk Drug and Pharmaceutical Formulation Using Bromocresol Green

NASA Astrophysics Data System (ADS)

Prashanth, K. N.; Swamy, N.; Basavaiah, K.

2013-11-01

Considering the basic property of zolmitriptan (ZMT) to generate ion-pairs with sulfonephthalein dyes two methods have been developed for its assay in bulk drug and dosage form. The first method (method A) is based on the formation of a colored ion-pair complex (1:1 drug:dye) of ZMT with bromocresol green (BCG) at pH 4.20 ± 0.01 and extraction of the complex into chloroform followed by measurement of the yellow ion-pair complex at 435 nm. In the second method (method B), the drug-dye ion-pair complex was treated with ethanolic potassium hydroxide in ethanolic medium and the resulting base form of the dye was measured at 630 nm. Beer's law was obeyed in the concentration range of 0.8-18.0 and 0.08-1.4 μg/ml for method A and B, respectively, and the corresponding molar absorptivity values were 1.50ṡ104 and 1.52ṡ105 l/(molṡcm). The Sandell sensitivity values were 0.0191 and 0.0019 μg/cm2 for method A and method B, respectively. The stoichiometry of the ion-pair complex formed between the drug and dye (1:1) was determined by Job's continuous variation method and the stability constant of the complex was also calculated. The proposed method was successfully extended to dosage form (tablets).

THz spectra and corresponding vibrational modes of DNA base pair cocrystals and polynucleotides

NASA Astrophysics Data System (ADS)

Wang, Fang; Zhao, Dongbo; Dong, Hao; Jiang, Ling; Huang, Lin; Liu, Yunfei; Li, Shuhua

2018-07-01

The generalized energy-based fragmentation (GEBF) approach has been applied to study the THz spectra and vibrational modes of base pair cocrystals under periodic boundary conditions (denoted as PBC-GEBF). Results of vibrational mode reveal that hydrogen bonds play a pivotal role in the pairing process of base crystals, where most Nsbnd H and Csbnd H bonds stretch to some extent. We also found that hydrogen bonds of a self-made A:T cocrystal completely break in a transition from liquid to the solid state, while self-made C:G cocrystal is different and easier to form a cocrystal, as confirmed by X-ray diffraction (XRD) and terahertz (THz) spectra. Furthermore, we have studied DNA polynucleotides (in both A and B forms) found that the vibrational modes changed a lot during the process of their forming double strand. Despite the key role played by hydrogen bonds, the key contribution originates from collective motions of the main skeleton. A comparative study of the spectra of some stranded fragments suggests that different sequences or forms have similar spectra in THz band. They distinguish from each other mainly in the low-frequency regions, especially below 1 THz. This study would make great contributions to the molecular dynamics model based DNA long-chain structure simulation in the future study.

Free energy landscape and transition pathways from Watson-Crick to Hoogsteen base pairing in free duplex DNA.

PubMed

Yang, Changwon; Kim, Eunae; Pak, Youngshang

2015-09-18

Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson-Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine-thymine (A-T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Characterization of the Trans Watson-Crick GU Base Pair Located in the Catalytic Core of the Antigenomic HDV Ribozyme

PubMed Central

Lévesque, Dominique; Reymond, Cédric; Perreault, Jean-Pierre

2012-01-01

The HDV ribozyme’s folding pathway is, by far, the most complex folding pathway elucidated to date for a small ribozyme. It includes 6 different steps that have been shown to occur before the chemical cleavage. It is likely that other steps remain to be discovered. One of the most critical of these unknown steps is the formation of the trans Watson-Crick GU base pair within loop III. The U23 and G28 nucleotides that form this base pair are perfectly conserved in all natural variants of the HDV ribozyme, and therefore are considered as being part of the signature of HDV-like ribozymes. Both the formation and the transformation of this base pair have been studied mainly by crystal structure and by molecular dynamic simulations. In order to obtain physical support for the formation of this base pair in solution, a set of experiments, including direct mutagenesis, the site-specific substitution of chemical groups, kinetic studies, chemical probing and magnesium-induced cleavage, were performed with the specific goal of characterizing this trans Watson-Crick GU base pair in an antigenomic HDV ribozyme. Both U23 and G28 can be substituted for nucleotides that likely preserve some of the H-bond interactions present before and after the cleavage step. The formation of the more stable trans Watson-Crick base pair is shown to be a post-cleavage event, while a possibly weaker trans Watson-Crick/Hoogsteen interaction seems to form before the cleavage step. The formation of this unusually stable post-cleavage base pair may act as a driving force on the chemical cleavage by favouring the formation of a more stable ground state of the product-ribozyme complex. To our knowledge, this represents the first demonstration of a potential stabilising role of a post-cleavage conformational switch event in a ribozyme-catalyzed reaction. PMID:22768274

Self-association and base pairing of guanosine, cytidine, adenosine, and uridine in dimethyl sulfoxide solution measured by 15N nuclear magnetic resonance spectroscopy.

PubMed Central

Dyllick-Brenzinger, C; Sullivan, G R; Pang, P P; Roberts, J D

1980-01-01

The self-association of guanosine, cytidine, and adenosine and base pairing between guanosine, cytidine, adenosine, and uridine in dimethyl sulfoxide have been investigated by the variation of their 15N NMR chemical shifts with concentration and temperature. Guanosine, cytidine, and adenosine all showed evidence of self-association by hydrogen bonding. In guanosine/cytidine mixtures, a hydrogen-bonded dimer is formed; however, no base pairing could be detected with adenosine/cytidine or adenosine/uridine mixtures. PMID:6932658

Introducing a model of pairing based on base pair specific interactions between identical DNA sequences

NASA Astrophysics Data System (ADS)

(O' Lee, Dominic J.

2018-02-01

At present, there have been suggested two types of physical mechanism that may facilitate preferential pairing between DNA molecules, with identical or similar base pair texts, without separation of base pairs. One mechanism solely relies on base pair specific patterns of helix distortion being the same on the two molecules, discussed extensively in the past. The other mechanism proposes that there are preferential interactions between base pairs of the same composition. We introduce a model, built on this second mechanism, where both thermal stretching and twisting fluctuations are included, as well as the base pair specific helix distortions. Firstly, we consider an approximation for weak pairing interactions, or short molecules. This yields a dependence of the energy on the square root of the molecular length, which could explain recent experimental data. However, analysis suggests that this approximation is no longer valid at large DNA lengths. In a second approximation, for long molecules, we define two adaptation lengths for twisting and stretching, over which the pairing interaction can limit the accumulation of helix disorder. When the pairing interaction is sufficiently strong, both adaptation lengths are finite; however, as we reduce pairing strength, the stretching adaptation length remains finite but the torsional one becomes infinite. This second state persists to arbitrarily weak values of the pairing strength; suggesting that, if the molecules are long enough, the pairing energy scales as length. To probe differences between the two pairing mechanisms, we also construct a model of similar form. However, now, pairing between identical sequences solely relies on the intrinsic helix distortion patterns. Between the two models, we see interesting qualitative differences. We discuss our findings, and suggest new work to distinguish between the two mechanisms.

Comparison of the conformation of an oligonucleotide containing a central G-T base pair with the non-mismatch sequence by proton NMR.

PubMed Central

Quignard, E; Fazakerley, G V; van der Marel, G; van Boom, J H; Guschlbauer, W

1987-01-01

We have recorded NOESY spectra of two non-selfcomplementary undecanucleotide duplexes. From the observed NOEs we do not detect any significant distortion of the helix when a G-C pair is replaced by a G-T pair and the normal interresidue connectivities can be followed through the mismatch site. We conclude that the 2D spectra of the non-exchangeable protons do not allow differentiation between a wobble or rare tautomer form for the mismatch. NOE measurements in H2O, however, clearly show that the mismatch adopts a wobble structure and give information on the hydration in the minor groove for the G-T base pair which is embedded between two A-T base pairs in the sequence. PMID:3033602

Direct NMR Evidence that Transient Tautomeric and Anionic States in dG·dT Form Watson-Crick-like Base Pairs.

PubMed

Szymanski, Eric S; Kimsey, Isaac J; Al-Hashimi, Hashim M

2017-03-29

The replicative and translational machinery utilizes the unique geometry of canonical G·C and A·T/U Watson-Crick base pairs to discriminate against DNA and RNA mismatches in order to ensure high fidelity replication, transcription, and translation. There is growing evidence that spontaneous errors occur when mismatches adopt a Watson-Crick-like geometry through tautomerization and/or ionization of the bases. Studies employing NMR relaxation dispersion recently showed that wobble dG·dT and rG·rU mismatches in DNA and RNA duplexes transiently form tautomeric and anionic species with probabilities (≈0.01-0.40%) that are in concordance with replicative and translational errors. Although computational studies indicate that these exceptionally short-lived and low-abundance species form Watson-Crick-like base pairs, their conformation could not be directly deduced from the experimental data, and alternative pairing geometries could not be ruled out. Here, we report direct NMR evidence that the transient tautomeric and anionic species form hydrogen-bonded Watson-Crick-like base pairs. A guanine-to-inosine substitution, which selectively knocks out a Watson-Crick-type (G)N2H 2 ···O2(T) hydrogen bond, significantly destabilized the transient tautomeric and anionic species, as assessed by lack of any detectable chemical exchange by imino nitrogen rotating frame spin relaxation (R 1ρ ) experiments. An 15 N R 1ρ NMR experiment targeting the amino nitrogen of guanine (dG-N2) provides direct evidence for Watson-Crick (G)N2H 2 ···O2(T) hydrogen bonding in the transient tautomeric state. The strategy presented in this work can be generally applied to examine hydrogen-bonding patterns in nucleic acid transient states including in other tautomeric and anionic species that are postulated to play roles in replication and translational errors.

Exploring the Limits of DNA Size: Naphtho-homologated DNA Bases and Pairs

PubMed Central

Lee, Alex H. F.; Kool, Eric T.

2008-01-01

A new design for DNA bases and base pairs is described in which the pyrimidine bases are widened by naphtho-homologation. Two naphtho-homologated deoxyribosides, dyyT (1) and dyyC (2) were synthesized and could be incorporated into oligonucleotides as suitably protected phosphoramidite derivatives. The deoxyribosides were found to be fluorescent, with emission maxima at 446 and 433 nm, respectively. Studies with single substitutions of 1 and 2 in the natural DNA context revealed exceptionally strong base stacking propensity for both. Sequences containing multiple substitutions of 1 and 2 paired opposite adenine and guanine were subsequently mixed and studied by several analytical methods. Data from UV mixing experiments, FRET measurements, fluorescence quenching experiments, and hybridizations on beads suggest that complementary “doublewide DNA” (yyDNA) strands may self-assemble into helical complexes with 1:1 stoichiometry. Data from thermal denaturation plots and CD spectra were less conclusive. Control experiments in one sequence context gave evidence that yyDNA helices, if formed, are preferentially antiparallel and are sequence selective. Hypothesized base pairing schemes are analogous to Watson-Crick pairing, but with glycosidic C1′-C1′ distances widened by over 45%, to ca. 15.2 Å. The possible self-assembly of the double-wide DNA helix establishes a new limit for the size of information-encoding, DNA-like molecules, and the fluorescence of yyDNA bases suggests uses as reporters in monomeric and oligomeric forms. PMID:16834396

Modified Extraction-Free Ion-Pair Methods for the Determination of Flunarizine Dihydrochloride in Bulk Drug, Tablets, and Human Urine

NASA Astrophysics Data System (ADS)

Prashanth, K. N.; Basavaiah, K.

2018-01-01

Two simple and sensitive extraction-free spectrophotometric methods are described for the determination of flunarizine dihydrochloride. The methods are based on the ion-pair complex formation between the nitrogenous compound flunarizine (FNZ), converted from flunarizine dihydrochloride (FNH), and the acidic dye phenol red (PR), in which experimental variables were circumvented. The first method (method A) is based on the formation of a yellow-colored ion-pair complex (1:1 drug:dye) between FNZ and PR in chloroform, which is measured at 415 nm. In the second method (method B), the formed drug-dye ion-pair complex is treated with ethanolic potassium hydroxide in an ethanolic medium, and the resulting base form of the dye is measured at 580 nm. The stoichiometry of the formed ion-pair complex between the drug and dye (1:1) is determined by Job's continuous variations method, and the stability constant of the complex is also calculated. These methods quantify FNZ over the concentration ranges 5.0-70.0 in method A and 0.5-7.0 μg/mL in method B. The calculated molar absorptivities are 6.17 × 103 and 5.5 × 104 L/mol·cm-1 for method A and method B, respectively, with corresponding Sandell sensitivity values of 0.0655 and 0.0074 μg/cm2. The methods are applied to the determination of FNZ in pure drug and human urine.

Concealed d -wave pairs in the s ± condensate of iron-based superconductors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ong, Tzen; Coleman, Piers; Schmalian, Jörg

A central question in iron-based superconductivity is the mechanism by which the paired electrons minimize their strong mutual Coulomb repulsion. In most unconventional superconductors, Coulomb repulsion is minimized through the formation of higher angular momentum Cooper pairs, with Fermi surface nodes in the pair wavefunction. The apparent absence of such nodes in the iron-based superconductors has led to a belief they form an s-wave (s ±) singlet state, which changes sign between the electron and hole pockets. However, the multiorbital nature of these systems opens an alternative possibility. In this paper, we propose a new class of s ± statemore » containing a condensate of d-wave Cooper pairs, concealed by their entanglement with the iron orbitals. By combining the d-wave (L=2) motion of the pairs with the internal angular momenta I =2 of the iron orbitals to make a singlet (J =L+I =0), an s ± superconductor with a nontrivial topology is formed. This scenario allows us to understand the development of octet nodes in potassium-doped Ba 1$-$xK XFe 2As 2 as a reconfiguration of the orbital and internal angular momentum into a high spin (J =L+I =4) state; the reverse transition under pressure into a fully gapped state can then be interpreted as a return to the low-spin singlet. Finally, the formation of orbitally entangled pairs is predicted to give rise to a shift in the orbital content at the Fermi surface, which can be tested via laser-based angle-resolved photoemission spectroscopy.« less

Concealed d -wave pairs in the s ± condensate of iron-based superconductors

DOE PAGES

Ong, Tzen; Coleman, Piers; Schmalian, Jörg

2016-05-02

A central question in iron-based superconductivity is the mechanism by which the paired electrons minimize their strong mutual Coulomb repulsion. In most unconventional superconductors, Coulomb repulsion is minimized through the formation of higher angular momentum Cooper pairs, with Fermi surface nodes in the pair wavefunction. The apparent absence of such nodes in the iron-based superconductors has led to a belief they form an s-wave (s ±) singlet state, which changes sign between the electron and hole pockets. However, the multiorbital nature of these systems opens an alternative possibility. In this paper, we propose a new class of s ± statemore » containing a condensate of d-wave Cooper pairs, concealed by their entanglement with the iron orbitals. By combining the d-wave (L=2) motion of the pairs with the internal angular momenta I =2 of the iron orbitals to make a singlet (J =L+I =0), an s ± superconductor with a nontrivial topology is formed. This scenario allows us to understand the development of octet nodes in potassium-doped Ba 1$-$xK XFe 2As 2 as a reconfiguration of the orbital and internal angular momentum into a high spin (J =L+I =4) state; the reverse transition under pressure into a fully gapped state can then be interpreted as a return to the low-spin singlet. Finally, the formation of orbitally entangled pairs is predicted to give rise to a shift in the orbital content at the Fermi surface, which can be tested via laser-based angle-resolved photoemission spectroscopy.« less

Concealed d-wave pairs in the s± condensate of iron-based superconductors.

PubMed

Ong, Tzen; Coleman, Piers; Schmalian, Jörg

2016-05-17

A central question in iron-based superconductivity is the mechanism by which the paired electrons minimize their strong mutual Coulomb repulsion. In most unconventional superconductors, Coulomb repulsion is minimized through the formation of higher angular momentum Cooper pairs, with Fermi surface nodes in the pair wavefunction. The apparent absence of such nodes in the iron-based superconductors has led to a belief they form an s-wave ([Formula: see text]) singlet state, which changes sign between the electron and hole pockets. However, the multiorbital nature of these systems opens an alternative possibility. Here, we propose a new class of [Formula: see text] state containing a condensate of d-wave Cooper pairs, concealed by their entanglement with the iron orbitals. By combining the d-wave ([Formula: see text]) motion of the pairs with the internal angular momenta [Formula: see text] of the iron orbitals to make a singlet ([Formula: see text]), an [Formula: see text] superconductor with a nontrivial topology is formed. This scenario allows us to understand the development of octet nodes in potassium-doped Ba1-x KXFe2As2 as a reconfiguration of the orbital and internal angular momentum into a high spin ([Formula: see text]) state; the reverse transition under pressure into a fully gapped state can then be interpreted as a return to the low-spin singlet. The formation of orbitally entangled pairs is predicted to give rise to a shift in the orbital content at the Fermi surface, which can be tested via laser-based angle-resolved photoemission spectroscopy.

A single Watson-Crick G x C base pair in water: aqueous hydrogen bonds in hydrophobic cavities.

PubMed

Sawada, Tomohisa; Fujita, Makoto

2010-05-26

Hydrogen bond (H-bond) formation in water has been a challenging task because water molecules are constant competitors. In biological systems, however, stable H-bonds are formed by shielding the H-bonding sites from the competing water molecules within hydrophobic pockets. Inspired by the nature's elaborated way, we found that even mononucleotides (G and C) can form the minimal G x C Watson-Crick pair in water by simply providing a synthetic cavity that efficiently shields the Watson-Crick H-bonding sites. The minimal Watson-Crick structure in water was elucidated by NMR study and firmly characterized by crystallographic analysis. The crystal structure also displays that, within the cavity, coencapsulated anions and solvents efficiently mediate the minimal G x C Watson-Crick pair formation. Furthermore, the competition experiments with the other nucleobases clearly revealed the evident selectivity for the G x C base pairing in water. These results show the fact that a H-bonded nucleobase pair was effectively induced and stabilized in the local environment of an artificial hydrophobic cavity.

Architecture of a Diels-Alderase ribozyme with a preformed catalytic pocket.

PubMed

Keiper, Sonja; Bebenroth, Dirk; Seelig, Burckhard; Westhof, Eric; Jäschke, Andres

2004-09-01

Artificial ribozymes catalyze a variety of chemical reactions. Their structures and reaction mechanisms are largely unknown. We have analyzed a ribozyme catalyzing Diels-Alder cycloaddition reactions by comprehensive mutation analysis and a variety of probing techniques. New tertiary interactions involving base pairs between nucleotides of the 5' terminus and a large internal loop forming a pseudoknot fold were identified. The probing data indicate a preformed tertiary structure that shows no major changes on substrate or product binding. Based on these observations, a molecular architecture featuring a Y-shaped arrangement is proposed. The tertiary structure is formed in a rather unusual way; that is, the opposite sides of the asymmetric internal loop are clamped by the four 5'-terminal nucleotides, forming two adjacent two base-pair helices. It is proposed that the catalytic pocket is formed by a wedge within one of these helices.

THz spectra and corresponding vibrational modes of DNA base pair cocrystals and polynucleotides.

PubMed

Wang, Fang; Zhao, Dongbo; Dong, Hao; Jiang, Ling; Huang, Lin; Liu, Yunfei; Li, Shuhua

2018-07-05

The generalized energy-based fragmentation (GEBF) approach has been applied to study the THz spectra and vibrational modes of base pair cocrystals under periodic boundary conditions (denoted as PBC-GEBF). Results of vibrational mode reveal that hydrogen bonds play a pivotal role in the pairing process of base crystals, where most NH and CH bonds stretch to some extent. We also found that hydrogen bonds of a self-made A:T cocrystal completely break in a transition from liquid to the solid state, while self-made C:G cocrystal is different and easier to form a cocrystal, as confirmed by X-ray diffraction (XRD) and terahertz (THz) spectra. Furthermore, we have studied DNA polynucleotides (in both A and B forms) found that the vibrational modes changed a lot during the process of their forming double strand. Despite the key role played by hydrogen bonds, the key contribution originates from collective motions of the main skeleton. A comparative study of the spectra of some stranded fragments suggests that different sequences or forms have similar spectra in THz band. They distinguish from each other mainly in the low-frequency regions, especially below 1 THz. This study would make great contributions to the molecular dynamics model based DNA long-chain structure simulation in the future study. Copyright © 2018 Elsevier B.V. All rights reserved.

Effect of Watson-Crick and Hoogsteen base pairing on the conformational stability of C8-phenoxyl-2'-deoxyguanosine adducts.

PubMed

Millen, Andrea L; Churchill, Cassandra D M; Manderville, Richard A; Wetmore, Stacey D

2010-10-14

Bulky DNA addition products (adducts) formed through attack at the C8 site of guanine can adopt the syn orientation about the glycosidic bond due to changes in conformational stability or hydrogen-bonding preferences directly arising from the bulky group. Indeed, the bulky substituent may improve the stability of (non-native) Hoogsteen pairs. Therefore, such adducts often result in mutations upon DNA replication. This work examines the hydrogen-bonded pairs between the Watson-Crick and Hoogsteen faces of the ortho or para C8-phenoxyl-2'-deoxyguanosine adduct and each natural (undamaged) nucleobase with the goal to clarify the conformational preference of this type of damage, as well as provide insight into the likelihood of subsequent mutation events. B3LYP/6-311+G(2df,p)//B3LYP/6-31G(d) hydrogen-bond strengths were determined using both nucleobase and nucleoside models for adduct pairs, as well as the corresponding complexes involving natural 2'-deoxyguanosine. In addition to the magnitude of the binding strengths, the R(C1'···C1') distances and ∠(N9C1'C1') angles, as well as the degree of propeller-twist and buckle distortions, were carefully compared to the values observed in natural DNA strands. Due to structural changes in the adduct monomer upon inclusion of the sugar moiety, the monomer deformation energy significantly affects the relative hydrogen-bond strengths calculated with the nucleobase and nucleoside models. Therefore, we recommend the use of at least a nucleoside model to accurately evaluate hydrogen-bond strengths of base pairs involving flexible, bulky nucleobase adducts. Our results also emphasize the importance of considering both the magnitude of the hydrogen-bond strength and the structure of the base pair when predicting the preferential binding patterns of nucleobases. Using our best models, we conclude that the Watson-Crick face of the ortho phenoxyl adduct forms significantly more stable complexes than the Hoogsteen face, which implies that the anti orientation of the damaged base will be favored by hydrogen bonding in DNA helices. Additionally, regardless of the hydrogen-bonding face involved, cytosine forms the most stable base pair with the ortho adduct, which implies that misincorporation due to this type of damage is unlikely. Similarly, cytosine is the preferred binding partner for the Watson-Crick face of the para adduct. However, Hoogsteen interactions with the para adduct are stronger than those with natural 2'-deoxyguanosine or the ortho adduct, and this form of damage binds with nearly equal stability to both cytosine and guanine in the Hoogsteen orientation. Therefore, the para adduct may adopt multiple orientations in DNA helices and potentially cause mutations by forming pairs with different natural bases. Models of oligonucleotide duplexes must be used in future work to further evaluate other factors (stacking, major groove contacts) that may influence the conformation and binding preference of these adducts in DNA helices.

Discrimination of Single Base Pair Differences Among Individual DNA Molecules Using a Nanopore

NASA Technical Reports Server (NTRS)

Vercoutere, Wenonah; DeGuzman, Veronica

2003-01-01

The protein toxin alpha-hemolysin form nanometer scale channels across lipid membranes. Our lab uses a single channel in an artificial lipid bilayer in a patch clamp device to capture and examine individual DNA molecules. This nanopore detector used with a support vector machine (SVM) can analyze DNA hairpin molecules on the millisecond time scale. We distinguish duplex stem length, base pair mismatches, loop length, and single base pair differences. The residual current fluxes also reveal structural molecular dynamics elements. DNA end-fraying (terminal base pair dissociation) can be observed as near full blockades, or spikes, in current. This technique can be used to investigate other biological processes dependent on DNA end-fraying, such as the processing of HIV DNA by HIV integrase.

Silver(I)-Mediated Base Pairs in DNA Sequences Containing 7-Deazaguanine/Cytosine: towards DNA with Entirely Metallated Watson-Crick Base Pairs.

PubMed

Méndez-Arriaga, José M; Maldonado, Carmen R; Dobado, José A; Galindo, Miguel A

2018-03-26

DNA sequences comprising noncanonical 7-deazaguanine ( 7C G) and canonical cytosine (C) are capable of forming Watson-Crick base pairs via hydrogen bonds as well as silver(I)-mediated base pairs by coordination to central silver(I) ions. Duplexes I and II containing 7C G and C have been synthesized and characterized. The incorporation of silver(I) ions into these duplexes has been studied by means of temperature-dependent UV spectroscopy, circular dichroism, and DFT calculations. The results suggest the formation of DNA molecules comprising contiguous metallated 7C G-Ag I -C Watson-Crick base pairs that preserve the original B-type conformation. Furthermore, additional studies performed on duplex III indicated that, in the presence of Ag I ions, 7C G-C and 7C A-T Watson-Crick base pairs ( 7C A, 7-deazadenine; T, thymine) can be converted to metallated 7C G-Ag I -C and 7C A-Ag I -T base pairs inside the same DNA molecule whilst maintaining its initial double helix conformation. These findings are very important for the development of customized silver-DNA nanostructures based on a Watson-Crick complementarity pattern. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Signature scheme based on bilinear pairs

NASA Astrophysics Data System (ADS)

Tong, Rui Y.; Geng, Yong J.

2013-03-01

An identity-based signature scheme is proposed by using bilinear pairs technology. The scheme uses user's identity information as public key such as email address, IP address, telephone number so that it erases the cost of forming and managing public key infrastructure and avoids the problem of user private generating center generating forgery signature by using CL-PKC framework to generate user's private key.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vyas, Rajan; Reed, Andrew J.; Tokarsky, E. John

One common oxidative DNA lesion, 8-oxo-7,8-dihydro-2'-deoxyguanine (8-oxoG), is highly mutagenic in vivo due to its anti-conformation forming a Watson–Crick base pair with correct deoxycytidine 5'-triphosphate (dCTP) and its syn-conformation forming a Hoogsteen base pair with incorrect deoxyadenosine 5'-triphosphate (dATP). Here in this article, we utilized time-resolved X-ray crystallography to follow 8-oxoG bypass by human DNA polymerase β (hPolβ). In the 12 solved structures, both Watson–Crick (anti-8-oxoG:anti-dCTP) and Hoogsteen (syn-8-oxoG:anti-dATP) base pairing were clearly visible and were maintained throughout the chemical reaction. Additionally, a third Mg 2+ appeared during the process of phosphodiester bond formation and was located between the reactingmore » α- and β-phosphates of the dNTP, suggesting its role in stabilizing reaction intermediates. After phosphodiester bond formation, hPolβ reopened its conformation, pyrophosphate was released, and the newly incorporated primer 3'-terminal nucleotide stacked, rather than base paired, with 8-oxoG. These structures provide the first real-time pictures, to our knowledge, of how a polymerase correctly and incorrectly bypasses a DNA lesion.« less

Metal-mediated DNA base pairing: alternatives to hydrogen-bonded Watson-Crick base pairs.

PubMed

Takezawa, Yusuke; Shionoya, Mitsuhiko

2012-12-18

With its capacity to store and transfer the genetic information within a sequence of monomers, DNA forms its central role in chemical evolution through replication and amplification. This elegant behavior is largely based on highly specific molecular recognition between nucleobases through the specific hydrogen bonds in the Watson-Crick base pairing system. While the native base pairs have been amazingly sophisticated through the long history of evolution, synthetic chemists have devoted considerable efforts to create alternative base pairing systems in recent decades. Most of these new systems were designed based on the shape complementarity of the pairs or the rearrangement of hydrogen-bonding patterns. We wondered whether metal coordination could serve as an alternative driving force for DNA base pairing and why hydrogen bonding was selected on Earth in the course of molecular evolution. Therefore, we envisioned an alternative design strategy: we replaced hydrogen bonding with another important scheme in biological systems, metal-coordination bonding. In this Account, we provide an overview of the chemistry of metal-mediated base pairing including basic concepts, molecular design, characteristic structures and properties, and possible applications of DNA-based molecular systems. We describe several examples of artificial metal-mediated base pairs, such as Cu(2+)-mediated hydroxypyridone base pair, H-Cu(2+)-H (where H denotes a hydroxypyridone-bearing nucleoside), developed by us and other researchers. To design the metallo-base pairs we carefully chose appropriate combinations of ligand-bearing nucleosides and metal ions. As expected from their stronger bonding through metal coordination, DNA duplexes possessing metallo-base pairs exhibited higher thermal stability than natural hydrogen-bonded DNAs. Furthermore, we could also use metal-mediated base pairs to construct or induce other high-order structures. These features could lead to metal-responsive functional DNA molecules such as artificial DNAzymes and DNA machines. In addition, the metallo-base pairing system is a powerful tool for the construction of homogeneous and heterogeneous metal arrays, which can lead to DNA-based nanomaterials such as electronic wires and magnetic devices. Recently researchers have investigated these systems as enzyme replacements, which may offer an additional contribution to chemical biology and synthetic biology through the expansion of the genetic alphabet.

An interatomic pair potential for cadmium selenide

NASA Astrophysics Data System (ADS)

Rabani, Eran

2002-01-01

We have developed a set of interatomic pair potentials for cadmium selenide based on a form similar to the Born-Mayer model. We show that this simple form of the pair potential, which has been used to describe the properties of alkali halides in the sixfold-coordinate structure, provides a realistic description of the properties of cadmium selenide in all three crystal structures: wurtzite, zinc blende, and rocksalt. Using the new pair potential we have studied the pressure-induced phase transition from the fourfold-coordinate wurtzite structure to the sixfold-coordinate rocksalt structure. The pressure transformation and the equation of state are in good agreement with experimental observations. Using the dispersion term in our pair potential we have also calculated the Hamaker constant for cadmium selenide within the framework of the original microscopic approach due to Hamaker. The results indicate that for ionic materials many-body terms that are included in the Lifshitz theory are well captured by the simple pair potential.

Conformational changes of the phenyl and naphthyl isocyanate-DNA adducts during DNA replication and by minor groove binding molecules

PubMed Central

Nakano, Shu-ichi; Uotani, Yuuki; Sato, Yuichi; Oka, Hirohito; Fujii, Masayuki; Sugimoto, Naoki

2013-01-01

DNA lesions produced by aromatic isocyanates have an extra bulky group on the nucleotide bases, with the capability of forming stacking interaction within a DNA helix. In this work, we investigated the conformation of the 2′-deoxyadenosine and 2′-deoxycytidine derivatives tethering a phenyl or naphthyl group, introduced in a DNA duplex. The chemical modification experiments using KMnO4 and 1-cyclohexyl-3 -(2-morpholinoethyl) carbodiimide metho-p-toluenesulfonate have shown that the 2′-deoxycytidine lesions form the base pair with guanine while the 2′-deoxyadenosine lesions have less ability of forming the base pair with thymine in solution. Nevertheless, the kinetic analysis shows that these DNA lesions are compatible with DNA ligase and DNA polymerase reactions, as much as natural DNA bases. We suggest that the adduct lesions have a capability of adopting dual conformations, depending on the difference in their interaction energies between stacking of the attached aromatic group and base pairing through hydrogen bonds. It is also presented that the attached aromatic groups change their orientation by interacting with the minor groove binding netropsin, distamycin and synthetic polyamide. The nucleotide derivatives would be useful for enhancing the phenotypic diversity of DNA molecules and for exploring new non-natural nucleotides. PMID:23873956

Effect of BrU on the transition between wobble Gua-Thy and tautomeric Gua-Thy base-pairs: ab initio molecular orbital calculations

NASA Astrophysics Data System (ADS)

Nomura, Kazuya; Hoshino, Ryota; Hoshiba, Yasuhiro; Danilov, Victor I.; Kurita, Noriyuki

2013-04-01

We investigated transition states (TS) between wobble Guanine-Thymine (wG-T) and tautomeric G-T base-pair as well as Br-containing base-pairs by MP2 and density functional theory (DFT) calculations. The obtained TS between wG-T and G*-T (asterisk is an enol-form of base) is different from TS got by the previous DFT calculation. The activation energy (17.9 kcal/mol) evaluated by our calculation is significantly smaller than that (39.21 kcal/mol) obtained by the previous calculation, indicating that our TS is more preferable. In contrast, the obtained TS and activation energy between wG-T and G-T* are similar to those obtained by the previous DFT calculation. We furthermore found that the activation energy between wG-BrU and tautomeric G-BrU is smaller than that between wG-T and tautomeric G-T. This result elucidates that the replacement of CH3 group of T by Br increases the probability of the transition reaction producing the enol-form G* and T* bases. Because G* prefers to bind to T rather than to C, and T* to G not A, our calculated results reveal that the spontaneous mutation from C to T or from A to G base is accelerated by the introduction of wG-BrU base-pair.

Negatively supercoiled simian virus 40 DNA contains Z-DNA segments within transcriptional enhancer sequences

NASA Technical Reports Server (NTRS)

Nordheim, A.; Rich, A.

1983-01-01

Three 8-base pair (bp) segments of alternating purine-pyrimidine from the simian virus 40 enhancer region form Z-DNA on negative supercoiling; minichromosome DNase I-hypersensitive sites determined by others bracket these three segments. A survey of transcriptional enhancer sequences reveals a pattern of potential Z-DNA-forming regions which occur in pairs 50-80 bp apart. This may influence local chromatin structure and may be related to transcriptional activation.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Otto, C., Thomas, G.A.; Peticolas, W.L.; Rippe, K.

Raman spectra of the parallel-stranded duplex formed from the deoxyoligonucleotides 5{prime}-d-((A){sub 10}TAATTTTAAATATTT)-3{prime} (D1) and 5{prime}-d((T){sub 10}ATTAAAATTTATAAA)-3{prime} (D2) in H{sub 2}O and D{sub 2}O have been acquired. The spectra of the parallel-stranded DNA are then compared to the spectra of the antiparallel double helix formed from the deoxyoligonucleotides D1 and 5{prime}-d(AAATATTTAAAATTA-(T){sub 10})-3{prime} (D3). The Raman spectra of the antiparallel-stranded (aps) duplex are reminiscent of the spectra of poly(d(A)){center dot}poly(d(T)) and a B-form structure similar to that adopted by the homopolymer duplex is assigned to the antiparallel double helix. The spectra of the parallel-stranded (ps) and antiparallel-stranded duplexes differ significantly due tomore » changes in helical organization, i.e., base pairing, base stacking, and backbone conformation. Large changes observed in the carbonyl stretching region implicate the involvement of the C(2) carbonyl of thymine in base pairing. The interaction of adenine with the C(2) carbonyl of thymine is consistent with formation of reverse Watson-Crick base pairing in parallel-stranded DNA. Phosphate-furanose vibrations similar to those observed for B-form DNA of heterogeneous sequence and high A,T content are observed at 843 and 1,092 cm{sup {minus}1} in the spectra of the parallel-stranded duplex.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Weina; Hellinga, Homme W.; Beese, Lorena S.

Even though high-fidelity polymerases copy DNA with remarkable accuracy, some base-pair mismatches are incorporated at low frequency, leading to spontaneous mutagenesis. Using high-resolution X-ray crystallographic analysis of a DNA polymerase that catalyzes replication in crystals, we observe that a C {center_dot} A mismatch can mimic the shape of cognate base pairs at the site of incorporation. This shape mimicry enables the mismatch to evade the error detection mechanisms of the polymerase, which would normally either prevent mismatch incorporation or promote its nucleolytic excision. Movement of a single proton on one of the mismatched bases alters the hydrogen-bonding pattern such thatmore » a base pair forms with an overall shape that is virtually indistinguishable from a canonical, Watson-Crick base pair in double-stranded DNA. These observations provide structural evidence for the rare tautomer hypothesis of spontaneous mutagenesis, a long-standing concept that has been difficult to demonstrate directly.« less

Hydroxylamine and methoxyamine mutagenesis: displacement of the tautomeric equilibrium of the promutagen N6-methoxyadenosine by complementary base pairing.

PubMed

Stolarski, R; Kierdaszuk, B; Hagberg, C E; Shugar, D

1984-06-19

The imino-amino tautomeric equilibrium of the promutagenic adenosine analogue N6-methoxy-2',3',5'-tri-O-methyladenosine [OMe6A(Me)3], in solvents of various polarities, has been studied with the aid of 1H and 13C NMR spectroscopy. The high energy barrier (free enthalpy delta G = 80 +/- 5 kJ X mol-1) between the two tautomeric species renders possible direct observation of the independent sets of all 1H and 13C signals from each of them. The equilibrium ranges from 10% imino in CCl4 to 90% in aqueous medium. Thermodynamic parameters, including energy barriers and lifetimes, were calculated from the temperature dependence of the equilibrium. Essentially similar results prevail for the promutagenic N6-hydroxy analogue. The conformations of the sugar moieties, and of the base about the glycosidic bond, for both tautomers are similar to those for adenosine. The conformation of the exocyclic N6-OCH3 group, which determines the ability of each species to form planar associates (hydrogen-bonded base pairs), has also been evaluated. Formation of autoassociates of OMe6A(Me)3 and of heteroassociates with the potentially complementary 2',3',5'-tri-O-methyluridine and -cytidine, in chloroform solution, was also investigated. The amino form base pairs with uridine and the imino form with cytidine. Formation of a complementary base pair by a given tautomeric species was accompanied by an increase of up to 10% in the population of this species and a concomitant decrease in population of the other species.(ABSTRACT TRUNCATED AT 250 WORDS)

A structural determinant in the uracil DNA glycosylase superfamily for the removal of uracil from adenine/uracil base pairs

PubMed Central

Lee, Dong-Hoon; Liu, Yinling; Lee, Hyun-Wook; Xia, Bo; Brice, Allyn R.; Park, Sung-Hyun; Balduf, Hunter; Dominy, Brian N.; Cao, Weiguo

2015-01-01

The uracil DNA glycosylase superfamily consists of several distinct families. Family 2 mismatch-specific uracil DNA glycosylase (MUG) from Escherichia coli is known to exhibit glycosylase activity on three mismatched base pairs, T/U, G/U and C/U. Family 1 uracil N-glycosylase (UNG) from E. coli is an extremely efficient enzyme that can remove uracil from any uracil-containing base pairs including the A/U base pair. Here, we report the identification of an important structural determinant that underlies the functional difference between MUG and UNG. Substitution of a Lys residue at position 68 with Asn in MUG not only accelerates the removal of uracil from mismatched base pairs but also enables the enzyme to gain catalytic activity on A/U base pairs. Binding and kinetic analysis demonstrate that the MUG-K68N substitution results in enhanced ground state binding and transition state interactions. Molecular modeling reveals that MUG-K68N, UNG-N123 and family 5 Thermus thermophiles UDGb-A111N can form bidentate hydrogen bonds with the N3 and O4 moieties of the uracil base. Genetic analysis indicates the gain of function for A/U base pairs allows the MUG-K68N mutant to remove uracil incorporated into the genome during DNA replication. The implications of this study in the origin of life are discussed. PMID:25550433

Formation of ion-pairs in aqueous solutions of diclofenac salts.

PubMed

Fini, A; Fazio, G; Gonzalez-Rodriguez, M; Cavallari, C; Passerini, N; Rodriguez, L

1999-10-05

In this work we studied the ability of the diclofenac anion to form ion-pairs in aqueous solution in the presence of organic and inorganic cations: ion-pairs have a polarity and hydrophobicity more suitable to the partition than each ion considered separately and can be extracted by a lipid phase. The cations considered were those of the organic bases diethylamine, diethanolamine, pyrrolidine, N-(2-hydroxyethyl) pyrrolidine and N-(2-hydroxyethyl) piperidine; the inorganic cations studied were Li(+), Na(+), K(+), Rb(+), Cs(+). Related to each cation we determined the equilibrium constant (K(XD)) for the ion-pair formation with the diclofenac anion in aqueous solution and the water/n-octanol partition coefficient (P(XD)) for each type of ion-pair formed. Among the alkali metal cations, only Li(+) shows some interaction with the diclofenac anion, in agreement with its physiological behaviour of increasing clearance during the administration of diclofenac. The influence of the ionic radius and desolvation enthalpy of the alkali metal cations on the ion-pair formation and partition was briefly discussed. Organic cations promote the formation of ion-pairs with the diclofenac anion better than the inorganic ones, and improve the partition of the ion-pair according to their hydrophobicity. The values of the equilibrium parameters for the formation and partition of ion-pairs are not high enough to allow the direct detection of their presence in the aqueous solution. Their formation can be appreciated in the presence of a lipid phase that continuously extracts the ion-pair. Extraction constants (E(XD)=P(XD) times K(XD)) increase passing from inorga to organic cations. This study could help to clarify the mechanism of the percutaneous absorption of diclofenac in the form of a salt, a route where the formation of ion-pairs appears to play an important role.

Olfactory Interference during Inhibitory Backward Pairing in Honey Bees

PubMed Central

Dacher, Matthieu; Smith, Brian H.

2008-01-01

Background Restrained worker honey bees are a valuable model for studying the behavioral and neural bases of olfactory plasticity. The proboscis extension response (PER; the proboscis is the mouthpart of honey bees) is released in response to sucrose stimulation. If sucrose stimulation is preceded one or a few times by an odor (forward pairing), the bee will form a memory for this association, and subsequent presentations of the odor alone are sufficient to elicit the PER. However, backward pairing between the two stimuli (sucrose, then odor) has not been studied to any great extent in bees, although the vertebrate literature indicates that it elicits a form of inhibitory plasticity. Methodology/Principal Findings If hungry bees are fed with sucrose, they will release a long lasting PER; however, this PER can be interrupted if an odor is presented 15 seconds (but not 7 or 30 seconds) after the sucrose (backward pairing). We refer to this previously unreported process as olfactory interference. Bees receiving this 15 second backward pairing show reduced performance after a subsequent single forward pairing (excitatory conditioning) trial. Analysis of the results supported a relationship between olfactory interference and a form of backward pairing-induced inhibitory learning/memory. Injecting the drug cimetidine into the deutocerebrum impaired olfactory interference. Conclusions/Significance Olfactory interference depends on the associative link between odor and PER, rather than between odor and sucrose. Furthermore, pairing an odor with sucrose can lead either to association of this odor to PER or to the inhibition of PER by this odor. Olfactory interference may provide insight into processes that gate how excitatory and inhibitory memories for odor-PER associations are formed. PMID:18946512

Twisted injectivity in projected entangled pair states and the classification of quantum phases

DOE Office of Scientific and Technical Information (OSTI.GOV)

Buerschaper, Oliver, E-mail: obuerschaper@perimeterinstitute.ca

We introduce a class of projected entangled pair states (PEPS) which is based on a group symmetry twisted by a 3-cocycle of the group. This twisted symmetry is expressed as a matrix product operator (MPO) with bond dimension greater than 1 and acts on the virtual boundary of a PEPS tensor. We show that it gives rise to a new standard form for PEPS from which we construct a family of local Hamiltonians which are gapped, frustration-free and include fixed points of the renormalization group flow. Based on this insight, we advance the classification of 2D gapped quantum spin systems bymore » showing how this new standard form for PEPS determines the emergent topological order of these local Hamiltonians. Specifically, we identify their universality class as DIJKGRAAF–WITTEN topological quantum field theory (TQFT). - Highlights: • We introduce a new standard form for projected entangled pair states via a twisted group symmetry which is given by nontrivial matrix product operators. • We construct a large family of gapped, frustration-free Hamiltonians in two dimensions from this new standard form. • We rigorously show how this new standard form for low energy states determines the emergent topological order.« less

Viewing Human DNA Polymerase β Faithfully and Unfaithfully Bypass an Oxidative Lesion by Time-Dependent Crystallography

DOE PAGES

Vyas, Rajan; Reed, Andrew J.; Tokarsky, E. John; ...

2015-03-31

One common oxidative DNA lesion, 8-oxo-7,8-dihydro-2'-deoxyguanine (8-oxoG), is highly mutagenic in vivo due to its anti-conformation forming a Watson–Crick base pair with correct deoxycytidine 5'-triphosphate (dCTP) and its syn-conformation forming a Hoogsteen base pair with incorrect deoxyadenosine 5'-triphosphate (dATP). Here in this article, we utilized time-resolved X-ray crystallography to follow 8-oxoG bypass by human DNA polymerase β (hPolβ). In the 12 solved structures, both Watson–Crick (anti-8-oxoG:anti-dCTP) and Hoogsteen (syn-8-oxoG:anti-dATP) base pairing were clearly visible and were maintained throughout the chemical reaction. Additionally, a third Mg 2+ appeared during the process of phosphodiester bond formation and was located between the reactingmore » α- and β-phosphates of the dNTP, suggesting its role in stabilizing reaction intermediates. After phosphodiester bond formation, hPolβ reopened its conformation, pyrophosphate was released, and the newly incorporated primer 3'-terminal nucleotide stacked, rather than base paired, with 8-oxoG. These structures provide the first real-time pictures, to our knowledge, of how a polymerase correctly and incorrectly bypasses a DNA lesion.« less

Viewing Human DNA Polymerase β Faithfully and Unfaithfully Bypass an Oxidative Lesion by Time-Dependent Crystallography

PubMed Central

Vyas, Rajan; Reed, Andrew J.; Tokarsky, E. John; Suo, Zucai

2015-01-01

One common oxidative DNA lesion, 8-oxo-7,8-dihydro-2′-deoxyguanine (8-oxoG), is highly mutagenic in vivo due to its anti-conformation forming a Watson–Crick base pair with correct deoxycytidine 5′-triphosphate (dCTP) and its syn-conformation forming a Hoogsteen base pair with incorrect deoxyadenosine 5′-triphosphate (dATP). Here, we utilized time-resolved X-ray crystallography to follow 8-oxoG bypass by human DNA polymerase β (hPolβ). In the 12 solved structures, both Watson–Crick (anti-8-oxoG:anti-dCTP) and Hoogsteen (syn-8-oxoG:anti-dATP) base pairing were clearly visible and were maintained throughout the chemical reaction. Additionally, a third Mg2+ appeared during the process of phosphodiester bond formation and was located between the reacting α- and β-phosphates of the dNTP, suggesting its role in stabilizing reaction intermediates. After phosphodiester bond formation, hPolβ reopened its conformation, pyrophosphate was released, and the newly incorporated primer 3′-terminal nucleotide stacked, rather than base paired, with 8-oxoG. These structures provide the first real-time pictures, to our knowledge, of how a polymerase correctly and incorrectly bypasses a DNA lesion. PMID:25825995

Loss of G-A base pairs is insufficient for achieving a large opening of U4 snRNA K-turn motif.

PubMed

Cojocaru, Vlad; Klement, Reinhard; Jovin, Thomas M

2005-01-01

Upon binding to the 15.5K protein, two tandem-sheared G-A base pairs are formed in the internal loop of the kink-turn motif of U4 snRNA (Kt-U4). We have reported that the folding of Kt-U4 is assisted by protein binding. Unstable interactions that contribute to a large opening of the free RNA ('k-e motion') were identified using locally enhanced sampling molecular dynamics simulations, results that agree with experiments. A detailed analysis of the simulations reveals that the k-e motion in Kt-U4 is triggered both by loss of G-A base pairs in the internal loop and backbone flexibility in the stems. Essential dynamics show that the loss of G-A base pairs is correlated along the first mode but anti-correlated along the third mode with the k-e motion. Moreover, when enhanced sampling was confined to the internal loop, the RNA adopted an alternative conformation characterized by a sharper kink, opening of G-A base pairs and modified stacking interactions. Thus, loss of G-A base pairs is insufficient for achieving a large opening of the free RNA. These findings, supported by previously published RNA structure probing experiments, suggest that G-A base pair formation occurs upon protein binding, thereby stabilizing a selective orientation of the stems.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Egli, Martin; Pallan, Pradeep S.; Pattanayek, Rekha

An experimental rationalization of the structure type encountered in DNA and RNA by systematically investigating the chemical and physical properties of alternative nucleic acids has identified systems with a variety of sugar-phosphate backbones that are capable of Watson-Crick base pairing and in some cases cross-pairing with the natural nucleic acids. The earliest among the model systems tested to date, (4{prime} {yields} 6{prime})-linked oligo(2{prime},3{prime}-dideoxy-{beta}-d-glucopyranosyl)nucleotides or homo-DNA, shows stable self-pairing, but the pairing rules for the four natural bases are not the same as those in DNA. However, a complete interpretation and understanding of the properties of the hexapyranosyl (4{prime} {yields} 6{prime})more » family of nucleic acids has been impeded until now by the lack of detailed 3D-structural data. We have determined the crystal structure of a homo-DNA octamer. It reveals a weakly twisted right-handed duplex with a strong inclination between the hexose-phosphate backbones and base-pair axes, and highly irregular values for helical rise and twist at individual base steps. The structure allows a rationalization of the inability of allo-, altro-, and glucopyranosyl-based oligonucleotides to form stable pairing systems.« less

Acid-induced exchange of the imino proton in G.C pairs.

PubMed Central

Nonin, S; Leroy, J L; Gueron, M

1996-01-01

Acid-induced catalysis of imino proton exchange in G.C pairs of DNA duplexes is surprisingly fast, being nearly as fast as for the isolated nucleoside, despite base-pair dissociation constants in the range of 10(-5) at neutral or basic pH. It is also observed in terminal G.C pairs of duplexes and in base pairs of drug-DNA complexes. We have measured imino proton exchange in deoxyguanosine and in the duplex (ATATAGATCTATAT) as a function of pH. We show that acid-induced exchange can be assigned to proton transfer from N7-protonated guanosine to cytidine in the open state of the pair. This is faster than transfer from neutral guanosine (the process of intrinsic catalysis previously characterized at neutral ph) due to the lower imino proton pK of the protonated form, 7.2 instead of 9.4. Other interpretations are excluded by a study of exchange catalysis by formiate and cytidine as exchange catalysts. The cross-over pH between the regimes of pH-independent and acid-induced exchange rates is more basic in the case of base pairs than in the mononucleoside, suggestive of an increase by one to two decades in the dissociation constant of the base pair upon N7 protonation of G. Acid-induced catalysis is much weaker in A.T base pairs, as expected in view of the low pK for protonation of thymidine. PMID:8604298

Acid-induced exchange of the imino proton in G.C pairs.

PubMed

Nonin, S; Leroy, J L; Gueron, M

1996-02-15

Acid-induced catalysis of imino proton exchange in G.C pairs of DNA duplexes is surprisingly fast, being nearly as fast as for the isolated nucleoside, despite base-pair dissociation constants in the range of 10(-5) at neutral or basic pH. It is also observed in terminal G.C pairs of duplexes and in base pairs of drug-DNA complexes. We have measured imino proton exchange in deoxyguanosine and in the duplex (ATATAGATCTATAT) as a function of pH. We show that acid-induced exchange can be assigned to proton transfer from N7-protonated guanosine to cytidine in the open state of the pair. This is faster than transfer from neutral guanosine (the process of intrinsic catalysis previously characterized at neutral ph) due to the lower imino proton pK of the protonated form, 7.2 instead of 9.4. Other interpretations are excluded by a study of exchange catalysis by formiate and cytidine as exchange catalysts. The cross-over pH between the regimes of pH-independent and acid-induced exchange rates is more basic in the case of base pairs than in the mononucleoside, suggestive of an increase by one to two decades in the dissociation constant of the base pair upon N7 protonation of G. Acid-induced catalysis is much weaker in A.T base pairs, as expected in view of the low pK for protonation of thymidine.

Quantum chemical investigations of AlN-doped C60 for use as a nano-biosensor in detection of mispairing between DNA bases.

PubMed

Siddiqui, Shamoon Ahmad; Bouarissa, Nadir; Rasheed, Tabish; Al-Hajry, A

2014-12-01

Quantum chemical calculations were carried out to study the electronic structure and stability of adenine-thymine and the rare tautomer of adenine-thymine base pairs along with their Cu 2+ complexes and their interactions with AlN-modified fullerene (C58AlN) using Density Functional Theory (B3LYP method). Since, these two forms of base pairs and their Cu 2+ complexes have almost similar electronic structures, their chemical differentiation is an extremely difficult task. In this investigation, we have observed that AlN-doped C 60 could be used as a potentially viable nanoscale sensor to detect these two base pairs as well as their Cu2+ complexes.

Base Pair Opening in a Deoxynucleotide Duplex Containing a cis-syn Thymine Cyclobutane Dimer Lesion

PubMed Central

Wenke, Belinda B.; Huiting, Leah N.; Frankel, Elisa B.; Lane, Benjamin F.; Núñez, Megan E.

2014-01-01

The cis-syn thymine cyclobutane dimer is a DNA photoproduct implicated in skin cancer. We compared the stability of individual base pairs in thymine dimer-containing duplexes to undamaged parent 10-mer duplexes. UV melting thermodynamic measurements, CD spectroscopy, and 2D NOESY NMR spectroscopy confirm that the thymine dimer lesion is locally and moderately destabilizing within an overall B-form duplex conformation. We measured the rates of exchange of individual imino protons by NMR using magnetization transfer from water and determined the equilibrium constant for the opening of each base pair Kop. In the normal duplex Kop decreases from the frayed ends of the duplex toward the center, such that the central TA pair is the most stable with a Kop of 8×10−7. In contrast, base pair opening at the 5’T of the thymine dimer is facile. The 5’T of the dimer has the largest equilibrium constant (Kop =3×10−4) in its duplex, considerably larger than even the frayed penultimate base pairs. Notably, base pairing by the 3’T of the dimer is much more stable than by the 5’T, indicating that the predominant opening mechanism for the thymine dimer lesion is not likely to be flipping out into solution as a single unit. The dimer asymmetrically affects the stability of the duplex in its vicinity, destabilizing base pairing on its 5’ side more than on the 3’ side. The striking differences in base pair opening between parent and dimer duplexes occur independently of the duplex-single strand melting transitions. PMID:24328089

Synthesis and Properties of Size-expanded DNAs: Toward Designed, Functional Genetic Systems

PubMed Central

Krueger, Andrew T.; Lu, Haige; Lee, Alex H. F.; Kool, Eric T.

2008-01-01

We describe the design, synthesis, and properties of DNA-like molecules in which the base pairs are expanded by benzo homologation. The resulting size-expanded genetic helices are called xDNA (“expanded DNA”) and yDNA (“wide DNA”). The large component bases are fluorescent, and they display high stacking affinity. When singly substituted into natural DNA, they are destabilizing because the benzo-expanded base pair size is too large for the natural helix. However, when all base pairs are expanded, xDNA and yDNA form highly stable, sequence-selective double helices. The size-expanded DNAs are candidates for components of new, functioning genetic systems. In addition, the fluorescence of expanded DNA bases makes them potentially useful in probing nucleic acids. PMID:17309194

2-Methoxypyridine as a Thymidine Mimic in Watson-Crick Base Pairs of DNA and PNA: Synthesis, Thermal Stability, and NMR Structural Studies.

PubMed

Novosjolova, Irina; Kennedy, Scott D; Rozners, Eriks

2017-11-02

The development of nucleic acid base-pair analogues that use new modes of molecular recognition is important both for fundamental research and practical applications. The goal of this study was to evaluate 2-methoxypyridine as a cationic thymidine mimic in the A-T base pair. The hypothesis was that including protonation in the Watson-Crick base pairing scheme would enhance the thermal stability of the DNA double helix without compromising the sequence selectivity. DNA and peptide nucleic acid (PNA) sequences containing the new 2-methoxypyridine nucleobase (P) were synthesized and studied by using UV thermal melting and NMR spectroscopy. Introduction of P nucleobase caused a loss of thermal stability of ≈10 °C in DNA-DNA duplexes and ≈20 °C in PNA-DNA duplexes over a range of mildly acidic to neutral pH. Despite the decrease in thermal stability, the NMR structural studies showed that P-A formed the expected protonated base pair at pH 4.3. Our study demonstrates the feasibility of cationic unnatural base pairs; however, future optimization of such analogues will be required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Prospective very young asteroid pairs

NASA Astrophysics Data System (ADS)

Galád, A.; Vokrouhlický, D.; Zizka, J.

2014-07-01

Several tens of asteroid pairs can be discerned from the background main-belt asteroids. The majority of them are thought to have formed within only the last few 10^6 yr. The youngest recognized pairs have formed more than ≈ 10 kyr ago. As some details of pair formation are still not understood well, the study of young pairs is of great importance. It is mainly because the conditions at the time of the pair formation could be deduced much more reliably for young pairs. For example, space weathering on the surfaces of the components, or changes in their rotational properties (in spin rates, tumbling, coordinates of rotational pole) could be negligible since the formation of young pairs. Also, possible strong perturbations by main-belt bodies on pair formation can be reliably studied only for extremely young pairs. Some pairs can quickly blend in with the background asteroids, so even the frequency of asteroid pair formation could be determined more reliably based on young pairs (though only after a statistically significant sample is at disposal). In our regular search for young pairs in the growing asteroid database, only multiopposition asteroids with very similar orbital and proper elements are investigated. Every pair component is represented by a number of clones within orbital uncertainties and drifting in semimajor axis due to the Yarkovsky effect. We found that, if the previously unrecognized pairs (87887) 2000 SS_{286} - 2002 AT_{49} and (355258) 2007 LY_{4} - 2013AF_{40} formed at the recent very close approach of their components, they could become the youngest known pairs. In both cases, the relative encounter velocities of the components were only ˜ 0.1 m s^{-1}. However, the minimum distances between some clones are too large and a few clones of the latter pair did not encounter recently (within ≈ 10 kyr). The age of some prospective young pairs cannot be determined reliably without improved orbital properties (e.g., the second component of a pair (320025) 2007 DT_{76} - 2007 DP_{16}). It is because some components suffered recently repeated close approaches to Ceres or other large main-belt perturbers. In general, the uncertainties in age estimation can be heavily reduced after the physical properties (e.g., sense of rotation, shape, size, binarity) of the pair components are determined.

N-H Stretching Excitations in Adenosine-Thymidine Base Pairs in Solution: Base Pair Geometries, Infrared Line Shapes and Ultrafast Vibrational Dynamics

PubMed Central

Greve, Christian; Preketes, Nicholas K.; Fidder, Henk; Costard, Rene; Koeppe, Benjamin; Heisler, Ismael A.; Mukamel, Shaul; Temps, Friedrich; Nibbering, Erik T. J.; Elsaesser, Thomas

2013-01-01

We explore the N-H stretching vibrations of adenosine-thymidine base pairs in chloroform solution with linear and nonlinear infrared spectroscopy. Based on estimates from NMR measurements and ab initio calculations, we conclude that adenosine and thymidine form hydrogen bonded base pairs in Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen configurations with similar probability. Steady-state concentration- and temperature dependent linear FT-IR studies, including H/D exchange experiments, reveal that these hydrogen-bonded base pairs have complex N-H/N-D stretching spectra with a multitude of spectral components. Nonlinear 2D-IR spectroscopic results, together with IR-pump-IR-probe measurements, as also corroborated by ab initio calculations, reveal that the number of N-H stretching transitions is larger than the total number of N-H stretching modes. This is explained by couplings to other modes, such as an underdamped low-frequency hydrogen-bond mode, and a Fermi resonance with NH2 bending overtone levels of the adenosine amino-group. Our results demonstrate that modeling based on local N-H stretching vibrations only is not sufficient and call for further refinement of the description of the N-H stretching manifolds of nucleic acid base pairs of adenosine and thymidine, incorporating a multitude of couplings with fingerprint and low-frequency modes. PMID:23234439

Synthesis, base pairing and structure studies of geranylated RNA

PubMed Central

Wang, Rui; Vangaveti, Sweta; Ranganathan, Srivathsan V.; Basanta-Sanchez, Maria; Haruehanroengra, Phensinee; Chen, Alan; Sheng, Jia

2016-01-01

Natural RNAs utilize extensive chemical modifications to diversify their structures and functions. 2-Thiouridine geranylation is a special hydrophobic tRNA modification that has been discovered very recently in several bacteria, such as Escherichia coli, Enterobacter aerogenes, Pseudomonas aeruginosa and Salmonella Typhimurium. The geranylated residues are located in the first anticodon position of tRNAs specific for lysine, glutamine and glutamic acid. This big hydrophobic terpene functional group affects the codon recognition patterns and reduces frameshifting errors during translation. We aimed to systematically study the structure, function and biosynthesis mechanism of this geranylation pathway, as well as answer the question of why nature uses such a hydrophobic modification in hydrophilic RNA systems. Recently, we have synthesized the deoxy-analog of S-geranyluridine and showed the geranylated T-G pair is much stronger than the geranylated T-A pair and other mismatched pairs in the B-form DNA duplex context, which is consistent with the observation that the geranylated tRNAGluUUC recognizes GAG more efficiently than GAA. In this manuscript we report the synthesis and base pairing specificity studies of geranylated RNA oligos. We also report extensive molecular simulation studies to explore the structural features of the geranyl group in the context of A-form RNA and its effect on codon–anticodon interaction during ribosome binding. PMID:27307604

Ultraviolet Absorption Induces Hydrogen-Atom Transfer in G⋅C Watson-Crick DNA Base Pairs in Solution.

PubMed

Röttger, Katharina; Marroux, Hugo J B; Grubb, Michael P; Coulter, Philip M; Böhnke, Hendrik; Henderson, Alexander S; Galan, M Carmen; Temps, Friedrich; Orr-Ewing, Andrew J; Roberts, Gareth M

2015-12-01

Ultrafast deactivation pathways bestow photostability on nucleobases and hence preserve the structural integrity of DNA following absorption of ultraviolet (UV) radiation. One controversial recovery mechanism proposed to account for this photostability involves electron-driven proton transfer (EDPT) in Watson-Crick base pairs. The first direct observation is reported of the EDPT process after UV excitation of individual guanine-cytosine (G⋅C) Watson-Crick base pairs by ultrafast time-resolved UV/visible and mid-infrared spectroscopy. The formation of an intermediate biradical species (G[-H]⋅C[+H]) with a lifetime of 2.9 ps was tracked. The majority of these biradicals return to the original G⋅C Watson-Crick pairs, but up to 10% of the initially excited molecules instead form a stable photoproduct G*⋅C* that has undergone double hydrogen-atom transfer. The observation of these sequential EDPT mechanisms across intermolecular hydrogen bonds confirms an important and long debated pathway for the deactivation of photoexcited base pairs, with possible implications for the UV photochemistry of DNA. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Micrometer-Scale Ballistic Transport of Electron Pairs in LaAlO_{3}/SrTiO_{3} Nanowires.

PubMed

Tomczyk, Michelle; Cheng, Guanglei; Lee, Hyungwoo; Lu, Shicheng; Annadi, Anil; Veazey, Joshua P; Huang, Mengchen; Irvin, Patrick; Ryu, Sangwoo; Eom, Chang-Beom; Levy, Jeremy

2016-08-26

High-mobility complex-oxide heterostructures and nanostructures offer new opportunities for extending the paradigm of quantum transport beyond the realm of traditional III-V or carbon-based materials. Recent quantum transport investigations with LaAlO_{3}/SrTiO_{3}-based quantum dots reveal the existence of a strongly correlated phase in which electrons form spin-singlet pairs without becoming superconducting. Here, we report evidence for the micrometer-scale ballistic transport of electron pairs in quasi-1D LaAlO_{3}/SrTiO_{3} nanowire cavities. In the paired phase, Fabry-Perot-like quantum interference is observed, in sync with conductance oscillations observed in the superconducting regime (at a zero magnetic field). Above a critical magnetic field B_{p}, the electron pairs unbind and the conductance oscillations shift with the magnetic field. These experimental observations extend the regime of ballistic electronic transport to strongly correlated phases.

A systematic molecular dynamics study of nearest-neighbor effects on base pair and base pair step conformations and fluctuations in B-DNA

PubMed Central

Lavery, Richard; Zakrzewska, Krystyna; Beveridge, David; Bishop, Thomas C.; Case, David A.; Cheatham, Thomas; Dixit, Surjit; Jayaram, B.; Lankas, Filip; Laughton, Charles; Maddocks, John H.; Michon, Alexis; Osman, Roman; Orozco, Modesto; Perez, Alberto; Singh, Tanya; Spackova, Nada; Sponer, Jiri

2010-01-01

It is well recognized that base sequence exerts a significant influence on the properties of DNA and plays a significant role in protein–DNA interactions vital for cellular processes. Understanding and predicting base sequence effects requires an extensive structural and dynamic dataset which is currently unavailable from experiment. A consortium of laboratories was consequently formed to obtain this information using molecular simulations. This article describes results providing information not only on all 10 unique base pair steps, but also on all possible nearest-neighbor effects on these steps. These results are derived from simulations of 50–100 ns on 39 different DNA oligomers in explicit solvent and using a physiological salt concentration. We demonstrate that the simulations are converged in terms of helical and backbone parameters. The results show that nearest-neighbor effects on base pair steps are very significant, implying that dinucleotide models are insufficient for predicting sequence-dependent behavior. Flanking base sequences can notably lead to base pair step parameters in dynamic equilibrium between two conformational sub-states. Although this study only provides limited data on next-nearest-neighbor effects, we suggest that such effects should be analyzed before attempting to predict the sequence-dependent behavior of DNA. PMID:19850719

Light-emitting self-assembled peptide nucleic acids exhibit both stacking interactions and Watson-Crick base pairing.

PubMed

Berger, Or; Adler-Abramovich, Lihi; Levy-Sakin, Michal; Grunwald, Assaf; Liebes-Peer, Yael; Bachar, Mor; Buzhansky, Ludmila; Mossou, Estelle; Forsyth, V Trevor; Schwartz, Tal; Ebenstein, Yuval; Frolow, Felix; Shimon, Linda J W; Patolsky, Fernando; Gazit, Ehud

2015-04-01

The two main branches of bionanotechnology involve the self-assembly of either peptides or DNA. Peptide scaffolds offer chemical versatility, architectural flexibility and structural complexity, but they lack the precise base pairing and molecular recognition available with nucleic acid assemblies. Here, inspired by the ability of aromatic dipeptides to form ordered nanostructures with unique physical properties, we explore the assembly of peptide nucleic acids (PNAs), which are short DNA mimics that have an amide backbone. All 16 combinations of the very short di-PNA building blocks were synthesized and assayed for their ability to self-associate. Only three guanine-containing di-PNAs-CG, GC and GG-could form ordered assemblies, as observed by electron microscopy, and these di-PNAs efficiently assembled into discrete architectures within a few minutes. The X-ray crystal structure of the GC di-PNA showed the occurrence of both stacking interactions and Watson-Crick base pairing. The assemblies were also found to exhibit optical properties including voltage-dependent electroluminescence and wide-range excitation-dependent fluorescence in the visible region.

[Biological and neural bases of partner preferences in rodents: models to understand human pair bonds].

PubMed

Coria-Avila, G A; Hernández-Aguilar, M E; Toledo-Cárdenas, R; García-Hernández, L I; Manzo, J; Pacheco, P; Miquel, M; Pfaus, J G

To analyse the biological and neural bases of partner preference formation in rodents as models to understand human pair bonding. Rodents are social individuals, capable of forming short- or long-lasting partner preferences that develop slowly by stimuli like cohabitation, or rapidly by stimuli like sex and stress. Dopamine, corticosteroids, oxytocin, vasopressin, and opioids form the neurochemical substrate for pair bonding in areas like the nucleus accumbens, the prefrontal cortex, the piriform cortex, the medial preoptic area, the ventral tegmental area and the medial amygdala, among others. Additional areas may participate depending on the nature of the conditioned stimuli by which and individual recognizes a preferred partner. Animal models help us understand that the capacity of an individual to display long-lasting and selective preferences depends on neural bases, selected throughout evolution. The challenge in neuroscience is to use this knowledge to create new solutions for mental problems associated with the incapacity of an individual to display a social bond, keep one, or cope with the disruption of a consolidated one.

Ion pair-based liquid-phase microextraction combined with cuvetteless UV-vis micro-spectrophotometry as a miniaturized assay for monitoring ammonia in waters.

PubMed

Senra-Ferreiro, Sonia; Pena-Pereira, Francisco; Costas-Mora, Isabel; Romero, Vanesa; Lavilla, Isela; Bendicho, Carlos

2011-09-15

A miniaturized method based on liquid-phase microextraction (LPME) in combination with microvolume UV-vis spectrophotometry for monitoring ammonia in waters is proposed. The methodology is based on the extraction of the ion pair formed between the blue indophenol obtained according to the Berthelot reaction and a quaternary ammonium salt into a microvolume of organic solvent. Experimental parameters affecting the LPME performance such as type and concentration of the quaternary ammonium ion salt required to form the ion pair, type and volume of extractant solvent, effect of disperser solvent, ionic strength and extraction time, were optimized. A detection limit of 5.0 μg L(-1) ammonia and an enrichment factor of 30 can be attained after a microextraction time of 4 min. The repeatability, expressed as relative standard deviation, was 7.6% (n=7). The proposed method can be successfully applied to the determination of trace amounts of ammonia in several environmental water samples. Copyright © 2011 Elsevier B.V. All rights reserved.

Synthetic Biology Parts for the Storage of Increased Genetic Information in Cells.

PubMed

Morris, Sydney E; Feldman, Aaron W; Romesberg, Floyd E

2017-10-20

To bestow cells with novel forms and functions, the goal of synthetic biology, we have developed the unnatural nucleoside triphosphates dNaMTP and dTPT3TP, which form an unnatural base pair (UBP) and expand the genetic alphabet. While the UBP may be retained in the DNA of a living cell, its retention is sequence-dependent. We now report a steady-state kinetic characterization of the rate with which the Klenow fragment of E. coli DNA polymerase I synthesizes the UBP and its mispairs in a variety of sequence contexts. Correct UBP synthesis is as efficient as for a natural base pair, except in one sequence context, and in vitro performance is correlated with in vivo performance. The data elucidate the determinants of efficient UBP synthesis, show that the dNaM-dTPT3 UBP is the first generally recognized natural-like base pair, and importantly, demonstrate that dNaMTP and dTPT3TP are well optimized and standardized parts for the expansion of the genetic alphabet.

Mechanism Underlying the Nucleobase-Distinguishing Ability of Benzopyridopyrimidine (BPP).

PubMed

Kochman, Michał A; Bil, Andrzej; Miller, R J Dwayne

2017-11-02

Benzopyridopyrimidine (BPP) is a fluorescent nucleobase analogue capable of forming base pairs with adenine (A) and guanine (G) at different sites. When incorporated into oligodeoxynucleotides, it is capable of differentiating between the two purine nucleobases by virtue of the fact that its fluorescence is largely quenched when it is base-paired to guanine, whereas base-pairing to adenine causes only a slight reduction of the fluorescence quantum yield. In the present article, the photophysics of BPP is investigated through computer simulations. BPP is found to be a good charge acceptor, as demonstrated by its positive and appreciably large electron affinity. The selective quenching process is attributed to charge transfer (CT) from the purine nucleobase, which is predicted to be efficient in the BPP-G base pair, but essentially inoperative in the BPP-A base pair. The CT process owes its high selectivity to a combination of two factors: the ionization potential of guanine is lower than that of adenine, and less obviously, the site occupied by guanine enables a greater stabilization of the CT state through electrostatic interactions than the one occupied by adenine. The case of BPP illustrates that molecular recognition via hydrogen bonding can enhance the selectivity of photoinduced CT processes.

Heterospecific pairing and hybridization between Nasutitermes corniger and N. ephratae

NASA Astrophysics Data System (ADS)

Hartke, Tamara R.; Rosengaus, Rebeca B.

2011-09-01

The sympatric neotropical termites Nasutitermes corniger and Nasutitermes ephratae are clearly distinguishable based on morphology, nest architecture, defensive secretion composition, and molecular markers. However, given the extensive ecological, geographical, and behavioral overlap of these closely related species, the potential for interbreeding may exist. To explore this possibility, heterospecific pairs were formed experimentally to examine courtship and colony-establishment behaviors, and reproductive potential. Courtship and nest construction behavior occurred in heterospecific pairs in a similar manner to that of conspecific pairs. Survival of pairs depended upon the species of the female partner. N. ephratae females paired with N. corniger males produced as many offspring as conspecific pairs. N. corniger females mated to N. ephratae males, however, produced significantly fewer offspring at 60 days post-establishment than the reciprocal cross or conspecific N. ephratae or N. corniger pairs. This was also the only pairing in which any aggression was observed. Heterospecific pairs and groups formed in mate choice mesocosms, suggesting that species recognition between these two termites is not an important aspect of mate choice. Overall, species mismatch tolerance and hybrid offspring viability are high. The present data, together with previous evidence from defensive secretions and isozyme analysis, suggest that hybridization may periodically occur in nature, and that reproductive barriers between these two species may be incomplete. Hybridization could provide a rare but important source of genetic diversity and may ensure mating opportunities for the more abundant sex of alates in each species.

Covariant Evolutionary Event Analysis for Base Interaction Prediction Using a Relational Database Management System for RNA.

PubMed

Xu, Weijia; Ozer, Stuart; Gutell, Robin R

2009-01-01

With an increasingly large amount of sequences properly aligned, comparative sequence analysis can accurately identify not only common structures formed by standard base pairing but also new types of structural elements and constraints. However, traditional methods are too computationally expensive to perform well on large scale alignment and less effective with the sequences from diversified phylogenetic classifications. We propose a new approach that utilizes coevolutional rates among pairs of nucleotide positions using phylogenetic and evolutionary relationships of the organisms of aligned sequences. With a novel data schema to manage relevant information within a relational database, our method, implemented with a Microsoft SQL Server 2005, showed 90% sensitivity in identifying base pair interactions among 16S ribosomal RNA sequences from Bacteria, at a scale 40 times bigger and 50% better sensitivity than a previous study. The results also indicated covariation signals for a few sets of cross-strand base stacking pairs in secondary structure helices, and other subtle constraints in the RNA structure.

Covariant Evolutionary Event Analysis for Base Interaction Prediction Using a Relational Database Management System for RNA

PubMed Central

Xu, Weijia; Ozer, Stuart; Gutell, Robin R.

2010-01-01

With an increasingly large amount of sequences properly aligned, comparative sequence analysis can accurately identify not only common structures formed by standard base pairing but also new types of structural elements and constraints. However, traditional methods are too computationally expensive to perform well on large scale alignment and less effective with the sequences from diversified phylogenetic classifications. We propose a new approach that utilizes coevolutional rates among pairs of nucleotide positions using phylogenetic and evolutionary relationships of the organisms of aligned sequences. With a novel data schema to manage relevant information within a relational database, our method, implemented with a Microsoft SQL Server 2005, showed 90% sensitivity in identifying base pair interactions among 16S ribosomal RNA sequences from Bacteria, at a scale 40 times bigger and 50% better sensitivity than a previous study. The results also indicated covariation signals for a few sets of cross-strand base stacking pairs in secondary structure helices, and other subtle constraints in the RNA structure. PMID:20502534

Manipulative interplay of two adozelesin molecules with d(ATTAAT)₂achieving ligand-stacked Watson-Crick and Hoogsteen base-paired duplex adducts.

PubMed

Hopton, Suzanne R; Thompson, Andrew S

2011-05-17

Previous structural studies of the cyclopropapyrroloindole (CPI) antitumor antibiotics have shown that these ligands bind covalently edge-on into the minor groove of double-stranded DNA. Reversible covalent modification of the DNA via N3 of adenine occurs in a sequence-specific fashion. Early nuclear magnetic resonance and molecular modeling studies with both mono- and bis-alkylating ligands indicated that the ligands fit tightly within the minor groove, causing little distortion of the helix. In this study, we propose a new binding model for several of the CPI-based analogues, in which the aromatic secondary rings form π-stacked complexes within the minor groove. One of the adducts, formed with adozelesin and the d(ATTAAT)(2) sequence, also demonstrates the ability of these ligands to manipulate the DNA of the binding site, resulting in a Hoogsteen base-paired adduct. Although this type of base pairing has been previously observed with the bisfunctional CPI analogue bizelesin, this is the first time that such an observation has been made with a monoalkylating nondimeric analogue. Together, these results provide a new model for the design of CPI-based antitumor antibiotics, which also has a significant bearing on other structurally related and structurally unrelated minor groove-binding ligands. They indicate the dynamic nature of ligand-DNA interactions, demonstrating both DNA conformational flexibility and the ability of two DNA-bound ligands to interact to form stable covalent modified complexes.

Biophysics of Artificially Expanded Genetic Information Systems. Thermodynamics of DNA Duplexes Containing Matches and Mismatches Involving 2-Amino-3-nitropyridin-6-one (Z) and Imidazo[1,2-a]-1,3,5-triazin-4(8H)one (P).

PubMed

Wang, Xiaoyu; Hoshika, Shuichi; Peterson, Raymond J; Kim, Myong-Jung; Benner, Steven A; Kahn, Jason D

2017-05-19

Synthetic nucleobases presenting non-Watson-Crick arrangements of hydrogen bond donor and acceptor groups can form additional nucleotide pairs that stabilize duplex DNA independent of the standard A:T and G:C pairs. The pair between 2-amino-3-nitropyridin-6-one 2'-deoxyriboside (presenting a {donor-donor-acceptor} hydrogen bonding pattern on the Watson-Crick face of the small component, trivially designated Z) and imidazo[1,2-a]-1,3,5-triazin-4(8H)one 2'-deoxyriboside (presenting an {acceptor-acceptor-donor} hydrogen bonding pattern on the large component, trivially designated P) is one of these extra pairs for which a substantial amount of molecular biology has been developed. Here, we report the results of UV absorbance melting measurements and determine the energetics of binding of DNA strands containing Z and P to give short duplexes containing Z:P pairs as well as various mismatches comprising Z and P. All measurements were done at 1 M NaCl in buffer (10 mM Na cacodylate, 0.5 mM EDTA, pH 7.0). Thermodynamic parameters (ΔH°, ΔS°, and ΔG° 37 ) for oligonucleotide hybridization were extracted. Consistent with the Watson-Crick model that considers both geometric and hydrogen bonding complementarity, the Z:P pair was found to contribute more to duplex stability than any mismatches involving either nonstandard nucleotide. Further, the Z:P pair is more stable than a C:G pair. The Z:G pair was found to be the most stable mismatch, forming either a deprotonated mismatched pair or a wobble base pair analogous to the stable T:G mismatch. The C:P pair is less stable, perhaps analogous to the wobble pair observed for C:O 6 -methyl-G, in which the pyrimidine is displaced into the minor groove. The Z:A and T:P mismatches are much less stable. Parameters for predicting the thermodynamics of oligonucleotides containing Z and P bases are provided. This represents the first case where this has been done for a synthetic genetic system.

Structure and conversion kinetics of a bi-stable DNA i-motif: broken symmetry in the [d(5mCCTCC)]4 tetramer.

PubMed

Nonin, S; Leroy, J L

1996-08-23

At slightly acidic pH, protonation of C-rich oligomers results in the formation of a four-stranded structure composed of two parallel duplexes in a head to tail orientation with their hemi-protonated C.C+ pairs intercalated in a so-called i-motif. In all cases reported previously the duplexes are identical. The tetramer formed by the d(5mCCTCC) oligomer is different. The structure is computed on the basis of 55 inter-residue distances derived from NOESY cross-peaks measured at short mixing times. It consists of two intercalated non-equivalent symmetrical duplexes. The base stacking order is C5* C1 C4* C2 (T3*) T3 C2* C4 C1* C5, but the thymidine bases (T3*) of one duplex are looped out and lie in the wide grooves of the tetramer. The thymidine bases T3 stack as a symmetrical T.T pair between the sequentially adjacent C2.C2+ pair and the C2*.C2*+ pair of the other duplex. Numerous exchange cross-peaks provide evidence for duplex interconversion. The interconversion rate is 1.4 s-1 at 0 degree C and the activation energy is 94 kJ/mol. The opening of the T3.T3 pair, the closing of the T3*.T3 pair, and the opening of the C2*.C2*+ pair occur simultaneously with the duplex interconversion. This suggests that the concerted opening and closing of the thymidine bases drive the duplex interconversion. Opening of the C4.C4+ and C4*.C4*+ pairs, and dissociation of the tetramer are not part of the interconversion since they occur at much slower rates. Duplex interconversion within the [d(5mCCTCC)]4 tetramer provides the first structural and kinetics characterization of broken symmetry in a biopolymer. The tetramer formed by d(5mCCUCC) adopts a similar structure, but the rate of duplex interconversion is faster: 40 s-1 at 0 degree C. At 32 degrees C, interconversion is fast on the NMR time scale.

A Comparison of Two Methods of Assessing Representation-Mediated Food Aversions Based on Shock or Illness

ERIC Educational Resources Information Center

Holland, Peter C.

2008-01-01

In experiments that measured food consumption, Holland (1981; "Learning and Motivation," 12, 1-18) found that food aversions were formed when an exteroceptive associate of food was paired with illness, but not when such an associate was paired with shock. By contrast, measuring the ability of food to reinforce instrumental responding,…

DNA bases ring-expanded with a cyclopentadiene free radical: a theoretical investigation of building blocks with diradical character.

PubMed

Zhao, Peiwen; Bu, Yuxiang

2016-01-14

In this work, we computationally design radical nucleobases which possess improved electronic properties, especially diradical properties through introducing a cyclopentadiene radical. We predict that the detailed electromagnetic features of base assemblies are based on the orientation of the extra five-membered cyclopentadiene ring. Broken symmetry DFT calculations take into account the relevant structures and properties. Our results reveal that both the radicalized DNA bases and the base pairs formed when they combine with their counterparts remain stable and display larger spin delocalization. The mode of embedding the cyclopentadiene free radical in the structures has some influence on the degree of π-conjugation, which results in various diradical characteristics. Single-layered radical base pairs all have an open-shell singlet ground state, but the energy difference between singlet and triplet is not significant. For two-layered radical base pairs, the situation is more complex. All of them have an open-shell state as their ground state, including an open-shell singlet state and an open-shell triplet state. That is, the majority of radical base pairs possess anti-ferromagnetic or ferromagnetic characteristics. We present here a more in-depth discussion and analyses to study the magnetic characteristics of radical bases and base pairs. As an important factor, two-layered radical base pairs also have been carefully analyzed. We hope that all the measurements and results presented here will stimulate further detailed insights into the related mechanisms in modified DNA bases and the design of better ring-expanded DNA magnetic materials.

Solution structure and base pair opening kinetics of the i-motif dimer of d(5mCCTTTACC): a noncanonical structure with possible roles in chromosome stability.

PubMed

Nonin, S; Phan, A T; Leroy, J L

1997-09-15

Repetitive cytosine-rich DNA sequences have been identified in telomeres and centromeres of eukaryotic chromosomes. These sequences play a role in maintaining chromosome stability during replication and may be involved in chromosome pairing during meiosis. The C-rich repeats can fold into an 'i-motif' structure, in which two parallel-stranded duplexes with hemiprotonated C.C+ pairs are intercalated. Previous NMR studies of naturally occurring repeats have produced poor NMR spectra. This led us to investigate oligonucleotides, based on natural sequences, to produce higher quality spectra and thus provide further information as to the structure and possible biological function of the i-motif. NMR spectroscopy has shown that d(5mCCTTTACC) forms an i-motif dimer of symmetry-related and intercalated folded strands. The high-definition structure is computed on the basis of the build-up rates of 29 intraresidue and 35 interresidue nuclear Overhauser effect (NOE) connectivities. The i-motif core includes intercalated interstrand C.C+ pairs stacked in the order 2*.8/1.7*/1*.7/2.8* (where one strand is distinguished by an asterisk and the numbers relate to the base positions within the repeat). The TTTA sequences form two loops which span the two wide grooves on opposite sides of the i-motif core; the i-motif core is extended at both ends by the stacking of A6 onto C2.C8+. The lifetimes of pairs C2.C8+ and 5mC1.C7+ are 1 ms and 1 s, respectively, at 15 degrees C. Anomalous exchange properties of the T3 imino proton indicate hydrogen bonding to A6 N7 via a water bridge. The d(5mCCTTTTCC) deoxyoligonucleotide, in which position 6 is occupied by a thymidine instead of an adenine, also forms a symmetric i-motif dimer. However, in this structure the two TTTT loops are located on the same side of the i-motif core and the C.C+ pairs are formed by equivalent cytidines stacked in the order 8*.8/1.1*/7*.7/2.2*. Oligodeoxynucleotides containing two C-rich repeats can fold and dimerize into an i-motif. The change of folding topology resulting from the substitution of a single nucleoside emphasizes the influence of the loop residues on the i-motif structure formed by two folded strands.

Intramolecular CH···O hydrogen bonds in the AI and BI DNA-like conformers of canonical nucleosides and their Watson-Crick pairs. Quantum chemical and AIM analysis.

PubMed

Yurenko, Yevgen P; Zhurakivsky, Roman O; Samijlenko, Svitlana P; Hovorun, Dmytro M

2011-08-01

The aim of this work is to cast some light on the H-bonds in double-stranded DNA in its AI and BI forms. For this purpose, we have performed the MP2 and DFT quantum chemical calculations of the canonical nucleoside conformers, relative to the AI and BI DNA forms, and their Watson-Crick pairs, which were regarded as the simplest models of the double-stranded DNA. Based on the atoms-in-molecules analysis (AIM), five types of the CH···O hydrogen bonds, involving bases and sugar, were detected numerically from 1 to 3 per a conformer: C2'H···O5', C1'H···O2, C6H···O5', C8H···O5', and C6H···O4'. The energy values of H-bonds occupy the range of 2.3-5.6 kcal/mol, surely exceeding the kT value (0.62 kcal/mol). The nucleoside CH···O hydrogen bonds appeared to "survive" turns of bases against the sugar, sometimes in rather large ranges of the angle values, pertinent to certain conformations, which points out to the source of the DNA lability, necessary for the conformational adaptation in processes of its functioning. The calculation of the interactions in the dA·T nucleoside pair gives evidence, that additionally to the N6H···O4 and N1···N3H canonical H-bonds, between the bases adenine and thymine the third one (C2H···O2) is formed, which, though being rather weak (about 1 kcal/mol), satisfies the AIM criteria of H-bonding and may be classified as a true H-bond. The total energy of all the CH···O nontraditional intramolecular H-bonds in DNA nucleoside pairs appeared to be commensurable with the energy of H-bonds between the bases in Watson-Crick pairs, which implies their possible important role in the DNA shaping.

Watson-Crick base pairing controls excited-state decay in natural DNA.

PubMed

Bucher, Dominik B; Schlueter, Alexander; Carell, Thomas; Zinth, Wolfgang

2014-10-13

Excited-state dynamics are essential to understanding the formation of DNA lesions induced by UV light. By using femtosecond IR spectroscopy, it was possible to determine the lifetimes of the excited states of all four bases in the double-stranded environment of natural DNA. After UV excitation of the DNA duplex, we detected a concerted decay of base pairs connected by Watson-Crick hydrogen bonds. A comparison of single- and double-stranded DNA showed that the reactive charge-transfer states formed in the single strands are suppressed by base pairing in the duplex. The strong influence of the Watson-Crick hydrogen bonds indicates that proton transfer opens an efficient decay path in the duplex that prohibits the formation or reduces the lifetime of reactive charge-transfer states. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Optical flashes from internal pairs formed in gamma-ray burst afterglows

DOE Office of Scientific and Technical Information (OSTI.GOV)

Panaitescu, A.

We develop a numerical formalism for calculating the distribution with energy of the (internal) pairs formed in a relativistic source from unscattered MeV–TeV photons. For gamma-ray burst (GRB) afterglows, this formalism is more suitable if the relativistic reverse shock that energizes the ejecta is the source of the GeV photons. The number of pairs formed is set by the source GeV output (calculated from the Fermi-LAT fluence), the unknown source Lorentz factor, and the unmeasured peak energy of the LAT spectral component. We show synchrotron and inverse-Compton light curves expected from pairs formed in the shocked medium and identify some criteria for testing a pair origin of GRB optical counterparts. Pairs formed in bright LAT afterglows with a Lorentz factor in the few hundreds may produce bright optical counterparts (more » $$R\\lt 10$$) lasting for up to one hundred seconds. As a result, the number of internal pairs formed from unscattered seed photons decreases very strongly with the source Lorentz factor, thus bright GRB optical counterparts cannot arise from internal pairs if the afterglow Lorentz factor is above several hundreds.« less

Optical flashes from internal pairs formed in gamma-ray burst afterglows

DOE PAGES

Panaitescu, A.

2015-06-09

We develop a numerical formalism for calculating the distribution with energy of the (internal) pairs formed in a relativistic source from unscattered MeV–TeV photons. For gamma-ray burst (GRB) afterglows, this formalism is more suitable if the relativistic reverse shock that energizes the ejecta is the source of the GeV photons. The number of pairs formed is set by the source GeV output (calculated from the Fermi-LAT fluence), the unknown source Lorentz factor, and the unmeasured peak energy of the LAT spectral component. We show synchrotron and inverse-Compton light curves expected from pairs formed in the shocked medium and identify some criteria for testing a pair origin of GRB optical counterparts. Pairs formed in bright LAT afterglows with a Lorentz factor in the few hundreds may produce bright optical counterparts (more » $$R\\lt 10$$) lasting for up to one hundred seconds. As a result, the number of internal pairs formed from unscattered seed photons decreases very strongly with the source Lorentz factor, thus bright GRB optical counterparts cannot arise from internal pairs if the afterglow Lorentz factor is above several hundreds.« less

Quantum-mechanical analysis of the energetic contributions to π stacking in nucleic acids versus rise, twist, and slide.

PubMed

Parker, Trent M; Hohenstein, Edward G; Parrish, Robert M; Hud, Nicholas V; Sherrill, C David

2013-01-30

Symmetry-adapted perturbation theory (SAPT) is applied to pairs of hydrogen-bonded nucleobases to obtain the energetic components of base stacking (electrostatic, exchange-repulsion, induction/polarization, and London dispersion interactions) and how they vary as a function of the helical parameters Rise, Twist, and Slide. Computed average values of Rise and Twist agree well with experimental data for B-form DNA from the Nucleic Acids Database, even though the model computations omitted the backbone atoms (suggesting that the backbone in B-form DNA is compatible with having the bases adopt their ideal stacking geometries). London dispersion forces are the most important attractive component in base stacking, followed by electrostatic interactions. At values of Rise typical of those in DNA (3.36 Å), the electrostatic contribution is nearly always attractive, providing further evidence for the importance of charge-penetration effects in π-π interactions (a term neglected in classical force fields). Comparison of the computed stacking energies with those from model complexes made of the "parent" nucleobases purine and 2-pyrimidone indicates that chemical substituents in DNA and RNA account for 20-40% of the base-stacking energy. A lack of correspondence between the SAPT results and experiment for Slide in RNA base-pair steps suggests that the backbone plays a larger role in determining stacking geometries in RNA than in B-form DNA. In comparisons of base-pair steps with thymine versus uracil, the thymine methyl group tends to enhance the strength of the stacking interaction through a combination of dispersion and electrosatic interactions.

Contact ion pair formation between hard acids and soft bases in aqueous solutions observed with 2DIR spectroscopy.

PubMed

Sun, Zheng; Zhang, Wenkai; Ji, Minbiao; Hartsock, Robert; Gaffney, Kelly J

2013-12-12

The interaction of charged species in aqueous solution has important implications for chemical, biological, and environmental processes. We have used 2DIR spectroscopy to study the equilibrium dynamics of thiocyanate chemical exchange between free ion (NCS(-)) and contact ion pair configurations (MNCS(+)), where M(2+) = Mg(2+) or Ca(2+). Detailed studies of the influence of anion concentration and anion speciation show that the chemical exchange observed with the 2DIR measurements results from NCS(-) exchanging with other anion species in the first solvation shell surrounding Mg(2+) or Ca(2+). The presence of chemical exchange in the 2DIR spectra provides an indirect, but robust, determinant of contact ion pair formation. We observe preferential contact ion pair formation between soft Lewis base anions and hard Lewis acid cations. This observation cannot be easily reconciled with Pearson's acid-base concept or Collins' Law of Matching Water Affinities. The anions that form contact ion pairs also correspond to the ions with an affinity for water and protein surfaces, so similar physical and chemical properties may control these distinct phenomena.

Synthesis, base pairing and structure studies of geranylated RNA.

PubMed

Wang, Rui; Vangaveti, Sweta; Ranganathan, Srivathsan V; Basanta-Sanchez, Maria; Haruehanroengra, Phensinee; Chen, Alan; Sheng, Jia

2016-07-27

Natural RNAs utilize extensive chemical modifications to diversify their structures and functions. 2-Thiouridine geranylation is a special hydrophobic tRNA modification that has been discovered very recently in several bacteria, such as Escherichia coli, Enterobacter aerogenes, Pseudomonas aeruginosa and Salmonella Typhimurium The geranylated residues are located in the first anticodon position of tRNAs specific for lysine, glutamine and glutamic acid. This big hydrophobic terpene functional group affects the codon recognition patterns and reduces frameshifting errors during translation. We aimed to systematically study the structure, function and biosynthesis mechanism of this geranylation pathway, as well as answer the question of why nature uses such a hydrophobic modification in hydrophilic RNA systems. Recently, we have synthesized the deoxy-analog of S-geranyluridine and showed the geranylated T-G pair is much stronger than the geranylated T-A pair and other mismatched pairs in the B-form DNA duplex context, which is consistent with the observation that the geranylated tRNA(Glu) UUC recognizes GAG more efficiently than GAA. In this manuscript we report the synthesis and base pairing specificity studies of geranylated RNA oligos. We also report extensive molecular simulation studies to explore the structural features of the geranyl group in the context of A-form RNA and its effect on codon-anticodon interaction during ribosome binding. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Magnetic field homogeneity of a conical coaxial coil pair.

PubMed

Salazar, F J; Nieves, F J; Bayón, A; Gascón, F

2017-09-01

An analytical study of the magnetic field created by a double-conical conducting sheet is presented. The analysis is based on the expansion of the magnetic field in terms of Legendre polynomials. It is demonstrated analytically that the angle of the conical surface that produces a nearly homogeneous magnetic field coincides with that of a pair of loops that fulfills the Helmholtz condition. From the results obtained, we propose an electric circuit formed by pairs of isolated conducting loops tightly wound around a pair of conical surfaces, calculating numerically the magnetic field produced by this system and its heterogeneity. An experimental setup of the proposed circuit was constructed and its magnetic field was measured. The results were compared with those obtained by numerical calculation, finding a good agreement. The numerical results demonstrate a significant improvement in homogeneity in the field of the proposed pair of conical coils compared with that achieved with a simple pair of Helmholtz loops or with a double solenoid. Moreover, a new design of a double pair of conical coils based on Braunbek's four loops is also proposed to achieve greater homogeneity. Regarding homogeneity, the rating of the analyzed configurations from best to worst is as follows: (1) double pair of conical coils, (2) pair of conical coils, (3) Braunbek's four loops, (4) Helmholtz pair, and (5) solenoid pair.

Magnetic field homogeneity of a conical coaxial coil pair

NASA Astrophysics Data System (ADS)

Salazar, F. J.; Nieves, F. J.; Bayón, A.; Gascón, F.

2017-09-01

An analytical study of the magnetic field created by a double-conical conducting sheet is presented. The analysis is based on the expansion of the magnetic field in terms of Legendre polynomials. It is demonstrated analytically that the angle of the conical surface that produces a nearly homogeneous magnetic field coincides with that of a pair of loops that fulfills the Helmholtz condition. From the results obtained, we propose an electric circuit formed by pairs of isolated conducting loops tightly wound around a pair of conical surfaces, calculating numerically the magnetic field produced by this system and its heterogeneity. An experimental setup of the proposed circuit was constructed and its magnetic field was measured. The results were compared with those obtained by numerical calculation, finding a good agreement. The numerical results demonstrate a significant improvement in homogeneity in the field of the proposed pair of conical coils compared with that achieved with a simple pair of Helmholtz loops or with a double solenoid. Moreover, a new design of a double pair of conical coils based on Braunbek's four loops is also proposed to achieve greater homogeneity. Regarding homogeneity, the rating of the analyzed configurations from best to worst is as follows: (1) double pair of conical coils, (2) pair of conical coils, (3) Braunbek's four loops, (4) Helmholtz pair, and (5) solenoid pair.

Time-Resolved Magnetic Field Effects Distinguish Loose Ion Pairs from Exciplexes

PubMed Central

2013-01-01

We describe the experimental investigation of time-resolved magnetic field effects in exciplex-forming organic donor–acceptor systems. In these systems, the photoexcited acceptor state is predominantly deactivated by bimolecular electron transfer reactions (yielding radical ion pairs) or by direct exciplex formation. The delayed fluorescence emitted by the exciplex is magnetosensitive if the reaction pathway involves loose radical ion pair states. This magnetic field effect results from the coherent interconversion between the electronic singlet and triplet radical ion pair states as described by the radical pair mechanism. By monitoring the changes in the exciplex luminescence intensity when applying external magnetic fields, details of the reaction mechanism can be elucidated. In this work we present results obtained with the fluorophore-quencher pair 9,10-dimethylanthracene/N,N-dimethylaniline (DMA) in solvents of systematically varied permittivity. A simple theoretical model is introduced that allows discriminating the initial state of quenching, viz., the loose ion pair and the exciplex, based on the time-resolved magnetic field effect. The approach is validated by applying it to the isotopologous fluorophore-quencher pairs pyrene/DMA and pyrene-d10/DMA. We detect that both the exciplex and the radical ion pair are formed during the initial quenching stage. Upon increasing the solvent polarity, the relative importance of the distant electron transfer quenching increases. However, even in comparably polar media, the exciplex pathway remains remarkably significant. We discuss our results in relation to recent findings on the involvement of exciplexes in photoinduced electron transfer reactions. PMID:24041160

Complex Mhc-based mate choice in a wild passerine

PubMed Central

Bonneaud, Camille; Chastel, Olivier; Federici, Pierre; Westerdahl, Helena; Sorci, Gabriele

2006-01-01

The extreme polymorphism of the vertebrate major histocompatibility complex (Mhc) is famous for protecting hosts against constantly evolving pathogens. Mate choice is often evoked as a means of maintaining Mhc variability through avoidance of partners with similar Mhc alleles or preference for heterozygotes. Evidence for these two hypotheses mostly comes from studies on humans and laboratory mice. Here, we tested these hypotheses in a wild outbred population of house sparrows (Passer domesticus). Females were not more or less closely related to the males they paired with when considering neutral genetic variation. However, males failed to form breeding pairs when they had too few Mhc alleles and when they were too dissimilar from females at Mhc loci (i.e. had no common alleles). Furthermore, pairs did not form at random as Mhc diversity positively correlated in mating pairs. These results suggest that mate choice evolves in response to (i) benefits in terms of parasite resistance acquired from allelic diversity, and (ii) costs associated with the disruption of co-adapted genes. PMID:16600889

Complex Mhc-based mate choice in a wild passerine.

PubMed

Bonneaud, Camille; Chastel, Olivier; Federici, Pierre; Westerdahl, Helena; Sorci, Gabriele

2006-05-07

The extreme polymorphism of the vertebrate major histocompatibility complex (Mhc) is famous for protecting hosts against constantly evolving pathogens. Mate choice is often evoked as a means of maintaining Mhc variability through avoidance of partners with similar Mhc alleles or preference for heterozygotes. Evidence for these two hypotheses mostly comes from studies on humans and laboratory mice. Here, we tested these hypotheses in a wild outbred population of house sparrows (Passer domesticus). Females were not more or less closely related to the males they paired with when considering neutral genetic variation. However, males failed to form breeding pairs when they had too few Mhc alleles and when they were too dissimilar from females at Mhc loci (i.e. had no common alleles). Furthermore, pairs did not form at random as Mhc diversity positively correlated in mating pairs. These results suggest that mate choice evolves in response to (i) benefits in terms of parasite resistance acquired from allelic diversity, and (ii) costs associated with the disruption of co-adapted genes.

Single-Molecule Mechanical (Un)folding of RNA Hairpins: Effects of Single A-U to A∙C Pair Substitutions and Single Proton Binding and Implications for mRNA Structure-Induced -1 Ribosomal Frameshifting.

PubMed

Yang, Lixia; Zhong, Zhensheng; Tong, Cailing; Jia, Huan; Liu, Yiran; Chen, Gang

2018-06-08

A wobble A∙C pair can be protonated at near physiological pH to form a more stable wobble A+∙C pair. Here, we constructed an RNA hairpin (rHP) and three mutants with one A-U base pair substituted with an A∙C mismatch on the top (near the loop, U22C), middle (U25C) and bottom (U29C) positions of the stem, respectively. Our results on single-molecule mechanical (un)folding using optical tweezers reveal the destabilization effect of A-U to A∙C pair substitution, and protonation-dependent enhancement of mechanical stability facilitated through an increased folding rate, or decreased unfolding rate, or both. Our data show that protonation may occur rapidly upon the formation of apparent mechanical folding transition state. Furthermore, we measured the bulk -1 ribosomal frameshifting efficiencies of the hairpins by a cell-free translation assay. For the mRNA hairpins studied, -1 frameshifting efficiency correlates with mechanical unfolding force at equilibrium and folding rate at around 15 pN. U29C has a frameshifting efficiency similar to that of rHP (~2%). Accordingly, the bottom 2-4 base pairs of U29C may not form under a stretching force at pH 7.3, which is consistent with the fact that the bottom base pairs of the hairpins may be disrupted by ribosome at the slippery site. U22C and U25C have a similar frameshifting efficiency (~1%), indicating that both unfolding and folding rates of an mRNA hairpin in a crowded environment may affect frameshifting. Our data indicate that mechanical (un)folding of RNA hairpins may mimic how mRNAs unfold and fold in the presence of translating ribosomes.

Evidence of pervasive biologically functional secondary structures within the genomes of eukaryotic single-stranded DNA viruses.

PubMed

Muhire, Brejnev Muhizi; Golden, Michael; Murrell, Ben; Lefeuvre, Pierre; Lett, Jean-Michel; Gray, Alistair; Poon, Art Y F; Ngandu, Nobubelo Kwanele; Semegni, Yves; Tanov, Emil Pavlov; Monjane, Adérito Luis; Harkins, Gordon William; Varsani, Arvind; Shepherd, Dionne Natalie; Martin, Darren Patrick

2014-02-01

Single-stranded DNA (ssDNA) viruses have genomes that are potentially capable of forming complex secondary structures through Watson-Crick base pairing between their constituent nucleotides. A few of the structural elements formed by such base pairings are, in fact, known to have important functions during the replication of many ssDNA viruses. Unknown, however, are (i) whether numerous additional ssDNA virus genomic structural elements predicted to exist by computational DNA folding methods actually exist and (ii) whether those structures that do exist have any biological relevance. We therefore computationally inferred lists of the most evolutionarily conserved structures within a diverse selection of animal- and plant-infecting ssDNA viruses drawn from the families Circoviridae, Anelloviridae, Parvoviridae, Nanoviridae, and Geminiviridae and analyzed these for evidence of natural selection favoring the maintenance of these structures. While we find evidence that is consistent with purifying selection being stronger at nucleotide sites that are predicted to be base paired than at sites predicted to be unpaired, we also find strong associations between sites that are predicted to pair with one another and site pairs that are apparently coevolving in a complementary fashion. Collectively, these results indicate that natural selection actively preserves much of the pervasive secondary structure that is evident within eukaryote-infecting ssDNA virus genomes and, therefore, that much of this structure is biologically functional. Lastly, we provide examples of various highly conserved but completely uncharacterized structural elements that likely have important functions within some of the ssDNA virus genomes analyzed here.

Evidence of Pervasive Biologically Functional Secondary Structures within the Genomes of Eukaryotic Single-Stranded DNA Viruses

PubMed Central

Muhire, Brejnev Muhizi; Golden, Michael; Murrell, Ben; Lefeuvre, Pierre; Lett, Jean-Michel; Gray, Alistair; Poon, Art Y. F.; Ngandu, Nobubelo Kwanele; Semegni, Yves; Tanov, Emil Pavlov; Monjane, Adérito Luis; Harkins, Gordon William; Varsani, Arvind; Shepherd, Dionne Natalie

2014-01-01

Single-stranded DNA (ssDNA) viruses have genomes that are potentially capable of forming complex secondary structures through Watson-Crick base pairing between their constituent nucleotides. A few of the structural elements formed by such base pairings are, in fact, known to have important functions during the replication of many ssDNA viruses. Unknown, however, are (i) whether numerous additional ssDNA virus genomic structural elements predicted to exist by computational DNA folding methods actually exist and (ii) whether those structures that do exist have any biological relevance. We therefore computationally inferred lists of the most evolutionarily conserved structures within a diverse selection of animal- and plant-infecting ssDNA viruses drawn from the families Circoviridae, Anelloviridae, Parvoviridae, Nanoviridae, and Geminiviridae and analyzed these for evidence of natural selection favoring the maintenance of these structures. While we find evidence that is consistent with purifying selection being stronger at nucleotide sites that are predicted to be base paired than at sites predicted to be unpaired, we also find strong associations between sites that are predicted to pair with one another and site pairs that are apparently coevolving in a complementary fashion. Collectively, these results indicate that natural selection actively preserves much of the pervasive secondary structure that is evident within eukaryote-infecting ssDNA virus genomes and, therefore, that much of this structure is biologically functional. Lastly, we provide examples of various highly conserved but completely uncharacterized structural elements that likely have important functions within some of the ssDNA virus genomes analyzed here. PMID:24284329

Engaging with Molecular Form to Understand Function

ERIC Educational Resources Information Center

Barber, Nicola C.; Stark, Louisa A.

2014-01-01

Cells are bustling factories with diverse and prolific arrays of molecular machinery. Remarkably, this machinery self-organizes to carry out the complex biochemical activities characteristic of life. When Watson and Crick published the structure of DNA, they noted that DNA base pairing creates a double-stranded form that provides a means of…

Large-scale, Exhaustive Lattice-based Structural Auditing of SNOMED CT.

PubMed

Zhang, Guo-Qiang; Bodenreider, Olivier

2010-11-13

One criterion for the well-formedness of ontologies is that their hierarchical structure forms a lattice. Formal Concept Analysis (FCA) has been used as a technique for assessing the quality of ontologies, but is not scalable to large ontologies such as SNOMED CT (> 300k concepts). We developed a methodology called Lattice-based Structural Auditing (LaSA), for auditing biomedical ontologies, implemented through automated SPARQL queries, in order to exhaustively identify all non-lattice pairs in SNOMED CT. The percentage of non-lattice pairs ranges from 0 to 1.66 among the 19 SNOMED CT hierarchies. Preliminary manual inspection of a limited portion of the over 544k non-lattice pairs, among over 356 million candidate pairs, revealed inconsistent use of precoordination in SNOMED CT, but also a number of false positives. Our results are consistent with those based on FCA, with the advantage that the LaSA pipeline is scalable and applicable to ontological systems consisting mostly of taxonomic links.

Large-scale, Exhaustive Lattice-based Structural Auditing of SNOMED CT

PubMed Central

Zhang, Guo-Qiang; Bodenreider, Olivier

2010-01-01

One criterion for the well-formedness of ontologies is that their hierarchical structure forms a lattice. Formal Concept Analysis (FCA) has been used as a technique for assessing the quality of ontologies, but is not scalable to large ontologies such as SNOMED CT (> 300k concepts). We developed a methodology called Lattice-based Structural Auditing (LaSA), for auditing biomedical ontologies, implemented through automated SPARQL queries, in order to exhaustively identify all non-lattice pairs in SNOMED CT. The percentage of non-lattice pairs ranges from 0 to 1.66 among the 19 SNOMED CT hierarchies. Preliminary manual inspection of a limited portion of the over 544k non-lattice pairs, among over 356 million candidate pairs, revealed inconsistent use of precoordination in SNOMED CT, but also a number of false positives. Our results are consistent with those based on FCA, with the advantage that the LaSA pipeline is scalable and applicable to ontological systems consisting mostly of taxonomic links. PMID:21347113

The tolerance to exchanges of the Watson–Crick base pair in the hammerhead ribozyme core is determined by surrounding elements

PubMed Central

Przybilski, Rita; Hammann, Christian

2007-01-01

Tertiary interacting elements are important features of functional RNA molecules, for example, in all small nucleolytic ribozymes. The recent crystal structure of a tertiary stabilized type I hammerhead ribozyme revealed a conventional Watson–Crick base pair in the catalytic core, formed between nucleotides C3 and G8. We show that any Watson–Crick base pair between these positions retains cleavage competence in two type III ribozymes. In the Arabidopsis thaliana sequence, only moderate differences in cleavage rates are observed for the different base pairs, while the peach latent mosaic viroid (PLMVd) ribozyme exhibits a preference for a pyrimidine at position 3 and a purine at position 8. To understand these differences, we created a series of chimeric ribozymes in which we swapped sequence elements that surround the catalytic core. The kinetic characterization of the resulting ribozymes revealed that the tertiary interacting loop sequences of the PLMVd ribozyme are sufficient to induce the preference for Y3–R8 base pairs in the A. thaliana hammerhead ribozyme. In contrast to this, only when the entire stem–loops I and II of the A. thaliana sequences are grafted on the PLMVd ribozyme is any Watson–Crick base pair similarly tolerated. The data provide evidence for a complex interplay of secondary and tertiary structure elements that lead, mediated by long-range effects, to an individual modulation of the local structure in the catalytic core of different hammerhead ribozymes. PMID:17666711

Control of box C/D snoRNP assembly by N6-methylation of adenine.

PubMed

Huang, Lin; Ashraf, Saira; Wang, Jia; Lilley, David Mj

2017-09-01

N 6 -methyladenine is the most widespread mRNA modification. A subset of human box C/D snoRNA species have target GAC sequences that lead to formation of N 6 -methyladenine at a key trans Hoogsteen-sugar A·G base pair, of which half are methylated in vivo The GAC target is conserved only in those that are methylated. Methylation prevents binding of the 15.5-kDa protein and the induced folding of the RNA Thus, the assembly of the box C/D snoRNP could in principle be regulated by RNA methylation at its critical first stage. Crystallography reveals that N 6 -methylation of adenine prevents the formation of trans Hoogsteen-sugar A·G base pairs, explaining why the box C/D RNA cannot adopt its kinked conformation. More generally, our data indicate that sheared A·G base pairs (but not Watson-Crick base pairs) are more susceptible to disruption by N 6 mA methylation and are therefore possible regulatory sites. The human signal recognition particle RNA and many related Alu retrotransposon RNA species are also methylated at N6 of an adenine that forms a sheared base pair with guanine and mediates a key tertiary interaction. © 2017 The Authors. Published under the terms of the CC BY 4.0 license.

How a low-fidelity DNA polymerase chooses non-Watson-Crick from Watson-Crick incorporation.

PubMed

Wu, Wen-Jin; Su, Mei-I; Wu, Jian-Li; Kumar, Sandeep; Lim, Liang-Hin; Wang, Chun-Wei Eric; Nelissen, Frank H T; Chen, Ming-Chuan Chad; Doreleijers, Jurgen F; Wijmenga, Sybren S; Tsai, Ming-Daw

2014-04-02

A dogma for DNA polymerase catalysis is that the enzyme binds DNA first, followed by MgdNTP. This mechanism contributes to the selection of correct dNTP by Watson-Crick base pairing, but it cannot explain how low-fidelity DNA polymerases overcome Watson-Crick base pairing to catalyze non-Watson-Crick dNTP incorporation. DNA polymerase X from the deadly African swine fever virus (Pol X) is a half-sized repair polymerase that catalyzes efficient dG:dGTP incorporation in addition to correct repair. Here we report the use of solution structures of Pol X in the free, binary (Pol X:MgdGTP), and ternary (Pol X:DNA:MgdGTP with dG:dGTP non-Watson-Crick pairing) forms, along with functional analyses, to show that Pol X uses multiple unprecedented strategies to achieve the mutagenic dG:dGTP incorporation. Unlike high fidelity polymerases, Pol X can prebind purine MgdNTP tightly and undergo a specific conformational change in the absence of DNA. The prebound MgdGTP assumes an unusual syn conformation stabilized by partial ring stacking with His115. Upon binding of a gapped DNA, also with a unique mechanism involving primarily helix αE, the prebound syn-dGTP forms a Hoogsteen base pair with the template anti-dG. Interestingly, while Pol X prebinds MgdCTP weakly, the correct dG:dCTP ternary complex is readily formed in the presence of DNA. H115A mutation disrupted MgdGTP binding and dG:dGTP ternary complex formation but not dG:dCTP ternary complex formation. The results demonstrate the first solution structural view of DNA polymerase catalysis, a unique DNA binding mode, and a novel mechanism for non-Watson-Crick incorporation by a low-fidelity DNA polymerase.

EEG classification of emotions using emotion-specific brain functional network.

PubMed

Gonuguntla, V; Shafiq, G; Wang, Y; Veluvolu, K C

2015-08-01

The brain functional network perspective forms the basis to relate mechanisms of brain functions. This work analyzes the network mechanisms related to human emotion based on synchronization measure - phase-locking value in EEG to formulate the emotion specific brain functional network. Based on network dissimilarities between emotion and rest tasks, most reactive channel pairs and the reactive band corresponding to emotions are identified. With the identified most reactive pairs, the subject-specific functional network is formed. The identified subject-specific and emotion-specific dynamic network pattern show significant synchrony variation in line with the experiment protocol. The same network pattern are then employed for classification of emotions. With the study conducted on the 4 subjects, an average classification accuracy of 62 % was obtained with the proposed technique.

How Mg2+ ion and water network affect the stability and structure of non-Watson-Crick base pairs in E. coli loop E of 5S rRNA: a molecular dynamics and reference interaction site model (RISM) study.

PubMed

Shanker, Sudhanshu; Bandyopadhyay, Pradipta

2017-08-01

The non-Watson-Crick (non-WC) base pairs of Escherichia coli loop E of 5S rRNA are stabilized by Mg 2+ ions through water-mediated interaction. It is important to know the synergic role of Mg 2+ and the water network surrounding Mg 2+ in stabilizing the non-WC base pairs of RNA. For this purpose, free energy change of the system is calculated using molecular dynamics (MD) simulation as Mg 2+ is pulled from RNA, which causes disturbance of the water network. It was found that Mg 2+ remains hexahydrated unless it is close to or far from RNA. In the pentahydrated form, Mg 2+ interacts directly with RNA. Water network has been identified by two complimentary methods; MD followed by a density-based clustering algorithm and three-dimensional-reference interaction site model. These two methods gave similar results. Identification of water network around Mg 2+ and non-WC base pairs gives a clue to the strong effect of water network on the stability of this RNA. Based on sequence analysis of all Eubacteria 5s rRNA, we propose that hexahydrated Mg 2+ is an integral part of this RNA and geometry of base pairs surrounding it adjust to accommodate the [Formula: see text]. Overall the findings from this work can help in understanding the basis of the complex structure and stability of RNA with non-WC base pairs.

DNA hybridization kinetics: zippering, internal displacement and sequence dependence.

PubMed

Ouldridge, Thomas E; Sulc, Petr; Romano, Flavio; Doye, Jonathan P K; Louis, Ard A

2013-10-01

Although the thermodynamics of DNA hybridization is generally well established, the kinetics of this classic transition is less well understood. Providing such understanding has new urgency because DNA nanotechnology often depends critically on binding rates. Here, we explore DNA oligomer hybridization kinetics using a coarse-grained model. Strand association proceeds through a complex set of intermediate states, with successful binding events initiated by a few metastable base-pairing interactions, followed by zippering of the remaining bonds. But despite reasonably strong interstrand interactions, initial contacts frequently dissociate because typical configurations in which they form differ from typical states of similar enthalpy in the double-stranded equilibrium ensemble. Initial contacts must be stabilized by two or three base pairs before full zippering is likely, resulting in negative effective activation enthalpies. Non-Arrhenius behavior arises because the number of base pairs required for nucleation increases with temperature. In addition, we observe two alternative pathways-pseudoknot and inchworm internal displacement-through which misaligned duplexes can rearrange to form duplexes. These pathways accelerate hybridization. Our results explain why experimentally observed association rates of GC-rich oligomers are higher than rates of AT- rich equivalents, and more generally demonstrate how association rates can be modulated by sequence choice.

Beyond triplet: Unconventional superconductivity in a spin-3/2 topological semimetal

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kim, Hyunsoo; Wang, Kefeng; Nakajima, Yasuyuki

In all known fermionic super fluids, Cooper pairs are composed of spin-1/2 quasi-particles that pair to form either spin-singlet or spin-triplet bound states. The "spin" of a Bloch electron, however, is xed by the symmetries of the crystal and the atomic orbitals from which it is derived, and in some cases can behave as if it were a spin-3/2 particle. The superconducting state of such a system allows pairing beyond spin-triplet, with higher spin quasi-particles combining to form quintet or even septet pairs. Here, we report evidence of unconventional superconductivity emerging from a spin-3/2 quasiparticle electronic structure in the half-Heuslermore » semimetal YPtBi, a low-carrier density noncentrosymmetric cubic material with a high symmetry that preserves the p-like j = 3/2 manifold in the Bi-based Γ 8 band in the presence of strong spin-orbit coupling. With a striking linear temperature dependence of the London penetration depth, the existence of line nodes in the superconducting order parameter Δ is directly explained by a mixed-parity Cooper pairing model with high total angular momentum, consistent with a high-spin fermionic super fluid state. We propose a k ∙ p model of the j = 3/2 fermions to explain how a dominant J=3 septet pairing state is the simplest solution that naturally produces nodes in the mixed even-odd parity gap. Together with the underlying topologically non-trivial band structure, the unconventional pairing in this system represents a truly novel form of super fluidity that has strong potential for leading the development of a new generation of topological superconductors.« less

Beyond triplet: Unconventional superconductivity in a spin-3/2 topological semimetal

DOE PAGES

Kim, Hyunsoo; Wang, Kefeng; Nakajima, Yasuyuki; ...

2018-04-06

In all known fermionic super fluids, Cooper pairs are composed of spin-1/2 quasi-particles that pair to form either spin-singlet or spin-triplet bound states. The "spin" of a Bloch electron, however, is xed by the symmetries of the crystal and the atomic orbitals from which it is derived, and in some cases can behave as if it were a spin-3/2 particle. The superconducting state of such a system allows pairing beyond spin-triplet, with higher spin quasi-particles combining to form quintet or even septet pairs. Here, we report evidence of unconventional superconductivity emerging from a spin-3/2 quasiparticle electronic structure in the half-Heuslermore » semimetal YPtBi, a low-carrier density noncentrosymmetric cubic material with a high symmetry that preserves the p-like j = 3/2 manifold in the Bi-based Γ 8 band in the presence of strong spin-orbit coupling. With a striking linear temperature dependence of the London penetration depth, the existence of line nodes in the superconducting order parameter Δ is directly explained by a mixed-parity Cooper pairing model with high total angular momentum, consistent with a high-spin fermionic super fluid state. We propose a k ∙ p model of the j = 3/2 fermions to explain how a dominant J=3 septet pairing state is the simplest solution that naturally produces nodes in the mixed even-odd parity gap. Together with the underlying topologically non-trivial band structure, the unconventional pairing in this system represents a truly novel form of super fluidity that has strong potential for leading the development of a new generation of topological superconductors.« less

Differential stabilities and sequence-dependent base pair opening dynamics of Watson-Crick base pairs with 5-hydroxymethylcytosine, 5-formylcytosine, or 5-carboxylcytosine.

PubMed

Szulik, Marta W; Pallan, Pradeep S; Nocek, Boguslaw; Voehler, Markus; Banerjee, Surajit; Brooks, Sonja; Joachimiak, Andrzej; Egli, Martin; Eichman, Brandt F; Stone, Michael P

2015-02-10

5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson-Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5'-CG-3' sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5'-T(8)X(9)G(10)-3' sequence of the DDD, were compared. The presence of 5caC at the X(9) base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A(5):T(8), whereas 5caC did not. At the oxidized base pair G(4):X(9), 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C(3):G(10). No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G(4):X(9); each favored Watson-Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N(4) exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes.

Differential stabilities and sequence-dependent base pair opening dynamics of Watson–Crick base pairs with 5-hydroxymethylcytosine, 5-formylcytosine, or 5-carboxylcytosine

DOE PAGES

Szulik, Marta W.; Pallan, Pradeep S.; Nocek, Boguslaw; ...

2015-01-29

5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson–Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5'-CG-3' sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5'-T 8X 9G 10-3' sequence of the DDD, were compared. The presence of 5caC at the X9 base increased the stability of the DDD, whereas 5hmC or 5fC didmore » not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A 5:T 8, whereas 5caC did not. At the oxidized base pair G 4:X 9, 5fC exhibited an increase in the imino proton exchange rate and the calculated k op. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C 3:G 10. No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G 4:X 9; each favored Watson–Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N 4 exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. Furthermore, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes.« less

Differential Stabilities and Sequence-Dependent Base Pair Opening Dynamics of Watson–Crick Base Pairs with 5-Hydroxymethylcytosine, 5-Formylcytosine, or 5-Carboxylcytosine

PubMed Central

2016-01-01

5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson–Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5′-CG-3′ sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5′-T8X9G10-3′ sequence of the DDD, were compared. The presence of 5caC at the X9 base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A5:T8, whereas 5caC did not. At the oxidized base pair G4:X9, 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C3:G10. No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G4:X9; each favored Watson–Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N4 exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes. PMID:25632825

Nick-free formation of reciprocal heteroduplexes: a simple solution to the topological problem.

PubMed Central

Wilson, J H

1979-01-01

Because the individual strands of DNA are intertwined, formation of heteroduplex structures between duplexes--as in presumed recombination intermediates--presents a topological puzzle, known as the winding problem. Previous approaches to this problem have assumed that single-strand breaks are required to permit formation of fully coiled heteroduplexes. This paper describes a simple, nick-free solution to the winding problem that satisfies all topological constraints. Homologous duplexes associated by their minor-groove surfaces can switch strand pairing to form reciprocal heteroduplexes that coil together into a compact, four-stranded helix throughout the region of pairing. Model building shows that this fused heteroduplex structure is plausible, being composed entirely of right-handed primary helices with Watson-Crick base pairing throughout. Its simplicity of formation, structural symmetry, and high degree of specificity are suggestive of a natural mechanism for alignment by base pairing between intact homologous duplexes. Implications for genetic recombination are discussed. Images PMID:291028

Biochemical investigations into the mutagenic potential of 8-oxo-2'-deoxyguanosine using nucleotide analogues.

PubMed

Hamm, Michelle L; Crowley, Kelly A; Ghio, Michael; Lindell, Maria A M; McFadden, Emily J; Silberg, Jordan S L; Weaver, Amelia M

2012-11-19

8-Oxo-2'-deoxyguanosine (OdG) is an abundant DNA lesion produced during oxidative damage to DNA. It can form relatively stable base pairs with both dC and dA that mimic natural dG:dC and dT:dA base pairs, respectively. Thus, when in the template strand, OdG can direct the insertion of either dCTP or dATP during replication, the latter of which can lead to a dG → T transversion. The potential for OdG to cause mutation is dependent on the preference for dCTP or dATP insertion opposite OdG, as well as the ability to extend past the resulting base pairs. The C2-amine and C8-oxygen could play major roles during these reactions since both would lie outside the Watson-Crick cognate base pairs shape in the major groove when OdG base pairs to dA and dC, respectively, and both have the ability to form strong interactions, like hydrogen bonds. To gain a more generalized understanding of how the C2-amine and C8-oxygen of OdG affect its mutagenic potential, the incorporation opposite and extension past seven analogues of dG/OdG that vary at C2 and/or C8 were characterized for three DNA polymerases, including an exonuclease-deficient version of the replicative polymerase from RB69 (RB69), human polymerase (pol) β, and polymerase IV from Sulfolobus solfataricus P2 (Dpo4). Based on the results from these studies, as well as those from previous studies with RB69, pol β, Dpo4, and two A-family polymerases, the influence of the C2-amine and C8-oxygen during each incorporation and extension reaction with each polymerase is discussed. In general, it appears that when the C2-amine and the C8-oxygen are in the minor groove, they allow OdG to retain interactions that are normally present during insertion and extension. However, when the two groups are in the major groove, they each tend to form novel active site interactions, both stabilizing and destabilizing, that are not present during insertion and extension with natural DNA.

Distance-dependent duplex DNA destabilization proximal to G-quadruplex/i-motif sequences

PubMed Central

König, Sebastian L. B.; Huppert, Julian L.; Sigel, Roland K. O.; Evans, Amanda C.

2013-01-01

G-quadruplexes and i-motifs are complementary examples of non-canonical nucleic acid substructure conformations. G-quadruplex thermodynamic stability has been extensively studied for a variety of base sequences, but the degree of duplex destabilization that adjacent quadruplex structure formation can cause has yet to be fully addressed. Stable in vivo formation of these alternative nucleic acid structures is likely to be highly dependent on whether sufficient spacing exists between neighbouring duplex- and quadruplex-/i-motif-forming regions to accommodate quadruplexes or i-motifs without disrupting duplex stability. Prediction of putative G-quadruplex-forming regions is likely to be assisted by further understanding of what distance (number of base pairs) is required for duplexes to remain stable as quadruplexes or i-motifs form. Using oligonucleotide constructs derived from precedented G-quadruplexes and i-motif-forming bcl-2 P1 promoter region, initial biophysical stability studies indicate that the formation of G-quadruplex and i-motif conformations do destabilize proximal duplex regions. The undermining effect that quadruplex formation can have on duplex stability is mitigated with increased distance from the duplex region: a spacing of five base pairs or more is sufficient to maintain duplex stability proximal to predicted quadruplex/i-motif-forming regions. PMID:23771141

Binding of DNA hairpins to an assembler-strand as part of a primordial translation device

NASA Astrophysics Data System (ADS)

Baumann, Ulrich

1987-09-01

A crucial event in the process leading to the origin of life is the emergence of a simple translation device. To approach experimental realization of this device the binding ability of short DNA hairpins to complementary oligonucleotides fixed on a solid support was investigated. The binding is achieved by base pairing between the loop nucleotides of the hairpins containing different numbers of adenosine residues and oligothymidylates covalently linked to cellulose. The loop has to consist of at least five nucleotides to achieve binding. The exact number of established base pairs was determined in two ways. First, the elution temperatures of hairpins and those of oligoadenylates which had the length of the loop were compared. Secondly, the architecture of the loop was analyzed by means of the single-strand-specific nuclease from mung bean acting as structural probe. Onlyn-2 of n loop nucleotides of a hairpin are able to form base pairs. Therefore, a strong evidence for the formation of a triplet of base pairs between primeval tRNA and mRNA sufficient to stabilize the complex enzyme-free is given.

Large-Scale, Exhaustive Lattice-Based Structural Auditing of SNOMED CT

NASA Astrophysics Data System (ADS)

Zhang, Guo-Qiang

One criterion for the well-formedness of ontologies is that their hierarchical structure form a lattice. Formal Concept Analysis (FCA) has been used as a technique for assessing the quality of ontologies, but is not scalable to large ontologies such as SNOMED CT. We developed a methodology called Lattice-based Structural Auditing (LaSA), for auditing biomedical ontologies, implemented through automated SPARQL queries, in order to exhaustively identify all non-lattice pairs in SNOMED CT. The percentage of non-lattice pairs ranges from 0 to 1.66 among the 19 SNOMED CT hierarchies. Preliminary manual inspection of a limited portion of the 518K non-lattice pairs, among over 34 million candidate pairs, revealed inconsistent use of precoordination in SNOMED CT, but also a number of false positives. Our results are consistent with those based on FCA, with the advantage that the LaSA computational pipeline is scalable and applicable to ontological systems consisting mostly of taxonomic links. This work is based on collaboration with Olivier Bodenreider from the National Library of Medicine, Bethesda, USA.

The relationship between the content and the form of metaphorical statements.

PubMed

Xu, Xu

2010-04-01

Recent research suggests that the quality of a metaphorical topic-vehicle pairing should be the determinant to the choice of a proper grammatical form, nominal metaphor versus simile. Two studies examined the relationship between the quality of the content of a metaphorical statement and its grammatical form. Study 1 showed that the two grammatical forms did not differ in aptness when the quality of topic-vehicle pairs and the conventionality of vehicles, a factor associated with the quality of metaphorical expressions, were controlled. With an online comprehension measure, Study 2 found that high quality metaphorical pairings were easier to process than low quality metaphorical pairings in both the metaphor form and the simile form. For high quality metaphorical pairings, information related to both the topics and the vehicles was highly activated at an early stage of processing. The relations among factors involved in the interpretive process of metaphorical language are discussed.

Effects of dorsal hippocampus catecholamine depletion on paired-associates learning and place learning in rats.

PubMed

Roschlau, Corinna; Hauber, Wolfgang

2017-04-14

Growing evidence suggests that the catecholamine (CA) neurotransmitters dopamine and noradrenaline support hippocampus-mediated learning and memory. However, little is known to date about which forms of hippocampus-mediated spatial learning are modulated by CA signaling in the hippocampus. Therefore, in the current study we examined the effects of 6-hydroxydopamine-induced CA depletion in the dorsal hippocampus on two prominent forms of hippocampus-based spatial learning, that is learning of object-location associations (paired-associates learning) as well as learning and choosing actions based on a representation of the context (place learning). Results show that rats with CA depletion of the dorsal hippocampus were able to learn object-location associations in an automated touch screen paired-associates learning (PAL) task. One possibility to explain this negative result is that object-location learning as tested in the touchscreen PAL task seems to require relatively little hippocampal processing. Results further show that in rats with CA depletion of the dorsal hippocampus the use of a response strategy was facilitated in a T-maze spatial learning task. We suspect that impaired hippocampus CA signaling may attenuate hippocampus-based place learning and favor dorsolateral striatum-based response learning. Copyright © 2017 Elsevier B.V. All rights reserved.

Optimal self-cleavage activity of the hepatitis delta virus RNA is dependent on a homopurine base pair in the ribozyme core.

PubMed Central

Been, M D; Perrotta, A T

1995-01-01

A non-Watson-Crick G.G interaction within the core region of the hepatitis delta virus (HDV) antigenomic ribozyme is required for optimal rates of self-cleavage activity. Base substitutions for either one or both G's revealed that full activity was obtained only when both G's were replaced with A's. At those positions, substitutions that generate potential Watson-Crick, G.U, heteropurine, or homopyrimidine combinations resulted in dramatically lower cleavage activity. A homopurine symmetric base pair, of the same type identified in the high-affinity binding site of the HIV RRE, is most consistent with this data. Additional features shared between the antigenomic ribozyme and the Rev binding site in the vicinity of the homopurine pairs suggest some structural similarity for this region of the two RNAs and a possible motif associated with this homopurine interaction. Evidence for a homopurine pair at the equivalent position in a modified form of the HDV genomic ribozyme was also found. With the postulated symmetric pairing scheme, large distortions in the nucleotide conformation, the sugar-phosphate backbone, or both would be necessary to accommodate this interaction at the end of a helix; we hypothesize that this distortion is critical to the structure of the active site of the ribozyme and it is stabilized by the homopurine base pair. PMID:8595561

Orbital-selective pairing and superconductivity in iron selenides

NASA Astrophysics Data System (ADS)

Nica, Emilian M.; Yu, Rong; Si, Qimiao

2017-12-01

An important challenge in condensed matter physics is understanding iron-based superconductors. Among these systems, the iron selenides hold the record for highest superconducting transition temperature and pose especially striking puzzles regarding the nature of superconductivity. The pairing state of the alkaline iron selenides appears to be of d-wave type based on the observation of a resonance mode in neutron scattering, while it seems to be of s-wave type from the nodeless gaps observed everywhere on the Fermi surface. Here we propose an orbital-selective pairing state, dubbed sτ3, as a natural explanation of these disparate properties. The pairing function, containing a matrix τ3 in the basis of 3d-electron orbitals, does not commute with the kinetic part of the Hamiltonian. This dictates the existence of both intraband and interband pairing terms in the band basis. A spin resonance arises from a d-wave-type sign change in the intraband pairing component, whereas the quasiparticle excitation is fully gapped on the FS due to an s-wave-like form factor associated with the addition in quadrature of the intraband and interband pairing terms. We demonstrate that this pairing state is energetically favored when the electron correlation effects are orbitally selective. More generally, our results illustrate how the multiband nature of correlated electrons affords unusual types of superconducting states, thereby shedding new light not only on the iron-based materials but also on a broad range of other unconventional superconductors such as heavy fermion and organic systems.

Intracistronic complementation in the simian virus 40 A gene.

PubMed Central

Tornow, J; Cole, C N

1983-01-01

A set of eight simian virus 40 mutants was constructed with lesions in the A gene, which encodes the large tumor (T) antigen. These mutants have small deletions (3-20 base pairs) at either 0.497, 0.288, or 0.243 map units. Mutants having both in-phase and frameshift mutations at each site were isolated. Neither plaque formation nor replication of the mutant DNAs could be detected after transfection of monkey kidney cells. Another nonviable mutant, dlA2459, had a 14-base-pair deletion at 0.193 map unit and was positive for viral DNA replication. Each of the eight mutants were tested for ability to form plaques after cotransfection with dlA2459 DNA. The four mutants that had in-phase deletions were able to complement dlA2459. The other four, which had frameshift deletions, did not. No plaques were formed after cotransfection of cells with any other pair of group A mutants. This suggests that the defect in dlA2459 defines a distinct functional domain of simian virus 40 T antigen. Images PMID:6312452

Early Decomposition in Visual Word Recognition: Dissociating Morphology, Form, and Meaning

ERIC Educational Resources Information Center

Marslen-Wilson, William D.; Bozic, Mirjana; Randall, Billi

2008-01-01

The role of morphological, semantic, and form-based factors in the early stages of visual word recognition was investigated across different SOAs in a masked priming paradigm, focusing on English derivational morphology. In a first set of experiments, stimulus pairs co-varying in morphological decomposability and in semantic and orthographic…

Soliton interactions, Bäcklund transformations, Lax pair for a variable-coefficient generalized dispersive water-wave system

NASA Astrophysics Data System (ADS)

Liu, Lei; Tian, Bo; Zhen, Hui-Ling; Liu, De-Yin; Xie, Xi-Yang

2018-04-01

Under investigation in this paper is a variable-coefficient generalized dispersive water-wave system, which can simulate the propagation of the long weakly non-linear and weakly dispersive surface waves of variable depth in the shallow water. Under certain variable-coefficient constraints, by virtue of the Bell polynomials, Hirota method and symbolic computation, the bilinear forms, one- and two-soliton solutions are obtained. Bäcklund transformations and new Lax pair are also obtained. Our Lax pair is different from that previously reported. Based on the asymptotic and graphic analysis, with different forms of the variable coefficients, we find that there exist the elastic interactions for u, while either the elastic or inelastic interactions for v, with u and v as the horizontal velocity field and deviation height from the equilibrium position of the water, respectively. When the interactions are inelastic, we see the fission and fusion phenomena.

An Evaluation of Stereoscopic Digital Mammography for Earlier Detection of Breast Cancer and Reduced Rate of Recall

DTIC Science & Technology

2004-08-01

on a pair of high -resolution, LCD medical monitors. The change to the new workstation has required us to rewrite the software... In the original CRT-based system, the two 7 images forming a stereo pair were displayed alternately on the same CRT face, at a high frame rate (120 Hz...then, separately, receive the stereo screening exam on the research GE digital mammography unit.

Baecklund transformation, Lax pair, and solutions for the Caudrey-Dodd-Gibbon equation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Qu Qixing; Sun Kun; Jiang Yan

2011-01-15

By using Bell polynomials and symbolic computation, we investigate the Caudrey-Dodd-Gibbon equation analytically. Through a generalization of Bells polynomials, its bilinear form is derived, based on which, the periodic wave solution and soliton solutions are presented. And the soliton solutions with graphic analysis are also given. Furthermore, Baecklund transformation and Lax pair are derived via the Bells exponential polynomials. Finally, the Ablowitz-Kaup-Newell-Segur system is constructed.

Stable loop in the crystal structure of the intercalated four-stranded cytosine-rich metazoan telomere

NASA Technical Reports Server (NTRS)

Kang, C.; Berger, I.; Lockshin, C.; Ratliff, R.; Moyzis, R.; Rich, A.

1995-01-01

In most metazoans, the telomeric cytosine-rich strand repeating sequence is d(TAACCC). The crystal structure of this sequence was solved to 1.9-A resolution. Four strands associate via the cytosine-containing parts to form a four-stranded intercalated structure held together by C.C+ hydrogen bonds. The base-paired strands are parallel to each other, and the two duplexes are intercalated into each other in opposite orientations. One TAA end forms a highly stabilized loop with the 5' thymine Hoogsteen-base-paired to the third adenine. The 5' end of this loop is in close proximity to the 3' end of one of the other intercalated cytosine strands. Instead of being entirely in a DNA duplex, this structure suggests the possibility of an alternative conformation for the cytosine-rich telomere strands.

Supramolecular hydrogen-bonding patterns in 1:1 cocrystals of 5-fluorouracil with 4-methylbenzoic acid and 3-nitrobenzoic acid.

PubMed

Mohana, Marimuthu; Muthiah, Packianathan Thomas; McMillen, Colin D

2017-03-01

The design of a pharmaceutical cocrystal is based on the identification of specific hydrogen-bond donor and acceptor groups in active pharmaceutical ingredients (APIs) in order to choose a `complementary interacting' molecule that can act as an efficient coformer. 5-Fluorouracil (5FU) is a pyrimidine derivative with two N-H donors and C=O acceptors and shows a diversity of hydrogen-bonding motifs. Two 1:1 cocrystals of 5-fluorouracil (5FU), namely 5-fluorouracil-4-methylbenzoic acid (5FU-MBA), C 4 H 3 FN 2 O 2 ·C 8 H 8 O 2 , (I), and 5-fluorouracil-3-nitrobenzoic acid (5FU-NBA), C 4 H 3 FN 2 O 2 ·C 7 H 5 NO 4 , (II), have been prepared and characterized by single-crystal X-ray diffraction. In (I), the MBA molecules form carboxylic acid dimers [R 2 2 (8) homosynthon]. Similarly, the 5FU molecules form two types of base pair via a pair of N-H...O hydrogen bonds [R 2 2 (8) homosynthon]. In (II), 5FU interacts with the carboxylic acid group of NBA via N-H...O and O-H...O hydrogen bonds, generating an R 2 2 (8) ring motif (heterosynthon). Furthermore, the 5FU molecules form base pairs [R 2 2 (8) homosynthon] via N-H...O hydrogen bonds. Both of the crystal structures are stabilized by C-H...F interactions.

Role of Electron-Driven Proton-Transfer Processes in the Ultrafast Deactivation of Photoexcited Anionic 8-oxoGuanine-Adenine and 8-oxoGuanine-Cytosine Base Pairs.

PubMed

Wu, Xiuxiu; Karsili, Tolga N V; Domcke, Wolfgang

2017-01-14

It has been reported that 8-oxo-7,8-dihydro-guanosine (8-oxo-G), which is the main product of oxidative damage of DNA, can repair cyclobutane pyrimidine dimer (CPD) lesions when incorporated into DNA or RNA strands in proximity to such lesions. It has therefore been suggested that the 8-oxo-G nucleoside may have been a primordial precursor of present-day flavins in DNA or RNA repair. Because the electron transfer leading to the splitting of a thymine-thymine pair in a CPD lesion occurs in the photoexcited state, a reasonably long excited-state lifetime of 8-oxo-G is required. The neutral (protonated) form of 8-oxo-G exhibits a very short (sub-picosecond) intrinsic excited-state lifetime which is unfavorable for repair. It has therefore been argued that the anionic (deprotonated) form of 8-oxo-G, which exhibits a much longer excited-state lifetime, is more likely to be a suitable cofactor for DNA repair. Herein, we have investigated the exited-state quenching mechanisms in the hydrogen-bonded complexes of deprotonated 8-oxo-G - with adenine (A) and cytosine (C) using ab initio wave-function-based electronic-structure calculations. The calculated reaction paths and potential-energy profiles reveal the existence of barrierless electron-driven inter-base proton-transfer reactions which lead to low-lying S₁/S₀ conical intersections. The latter can promote ultrafast excited-state deactivation of the anionic base pairs. While the isolated deprotonated 8-oxo-G - nucleoside may have been an efficient primordial repair cofactor, the excited states of the 8-oxo-G - -A and 8-oxo-G - -C base pairs are likely too short-lived to be efficient electron-transfer repair agents.

Terminal base pairs of oligodeoxynucleotides: imino proton exchange and fraying.

PubMed

Nonin, S; Leroy, J L; Guéron, M

1995-08-22

We have estimated the dissociation constant of the terminal base pairs of the B-DNA duplexes formed by 5'-d(CGCGATCGCG) and 5'-d(TAGCGCTA) by two methods, one based on the change in imino proton chemical shift with temperature and the other on the apparent pK shift of the imino proton, as monitored by the change in chemical shift of aromatic protons. These methods do not rely on imino proton exchange, whose rate was also measured. (1) The effect of ammonia on the imino proton exchange rate of the terminal pair of the 5'-d(CGCGATCGCG) duplex is 67 times less than on the isolated nucleoside. This provides an upper limit on the exchange rate from the closed pair. In fact, the effect is just as predicted from the dissociation constant, assuming that there is no exchange at all from the closed pair and that, as has been argued previously, external catalysts act on the open state as they do on the isolated nucleoside. The inhibition of catalyzed proton exchange in the closed pair, despite exposure of one face of the pair to solvent, is a new feature of the exchange process. It will allow determination of the dissociation constant of terminal pairs from the exchange rate. (2) Intrinsic catalysis of proton exchange is less efficient for the terminal pair than for an internal one. A possible explanation is that proton transfer across the water bridge responsible for intrinsic catalysis is slower, as expected if the open-state separation of the bases is larger in a terminal pair. This observation may lead to a direct method for the study of fraying. (3) At 0 degrees C, the dissociation constant of the second pair of the 5'-d(CGCGATCGCG) duplex is close to the square of the constant for the terminal pair, as predicted from a simple model of fraying. The enthalpy and entropy of opening of the terminal pairs may be compared with those of nearest neighbor interactions derived from calorimetry [Breslauer, K. J., et al. (1986) Proc. Natl. Acad. Sci. U.S.A. 83, 3746-3750].

The 5S rRNA loop E: chemical probing and phylogenetic data versus crystal structure.

PubMed

Leontis, N B; Westhof, E

1998-09-01

A significant fraction of the bases in a folded, structured RNA molecule participate in noncanonical base pairing interactions, often in the context of internal loops or multi-helix junction loops. The appearance of each new high-resolution RNA structure provides welcome data to guide efforts to understand and predict RNA 3D structure, especially when the RNA in question is a functionally conserved molecule. The recent publication of the crystal structure of the "Loop E" region of bacterial 5S ribosomal RNA is such an event [Correll CC, Freeborn B, Moore PB, Steitz TA, 1997, Cell 91:705-712]. In addition to providing more examples of already established noncanonical base pairs, such as purine-purine sheared pairings, trans-Hoogsteen UA, and GU wobble pairs, the structure provides the first high-resolution views of two new purine-purine pairings and a new GU pairing. The goal of the present analysis is to expand the capabilities of both chemical probing and phylogenetic analysis to predict with greater accuracy the structures of RNA molecules. First, in light of existing chemical probing data, we investigate what lessons could be learned regarding the interpretation of this widely used method of RNA structure probing. Then we analyze the 3D structure with reference to molecular phylogeny data (assuming conservation of function) to discover what alternative base pairings are geometrically compatible with the structure. The comparisons between previous modeling efforts and crystal structures show that the intricate involvements of ions and water molecules in the maintenance of non-Watson-Crick pairs render the process of correctly identifying the interacting sites in such pairs treacherous, except in cases of trans-Hoogsteen A/U or sheared A/G pairs for the adenine N1 site. The phylogenetic analysis identifies A/A, A/C, A/U and C/A, C/C, and C/U pairings isosteric with sheared A/G, as well as A/A and A/C pairings isosteric with both G/U and G/G bifurcated pairings. Thus, each non-Watson-Crick pair could be characterized by a phylogenetic signature of variations between isosteric-like pairings. In addition to the conservative changes, which form a dictionary of pairings isosterically compatible with those observed in the crystal structure, concerted changes involving several base pairs also occur. The latter covariations may indicate transitions between related but distinctive motifs within the loop E of 5S ribosomal RNA.

All gene-sized DNA molecules in four species of hypotrichs have the same terminal sequence and an unusual 3' terminus.

PubMed Central

Klobutcher, L A; Swanton, M T; Donini, P; Prescott, D M

1981-01-01

In hypotrichous ciliates, all of the macronuclear DNA is in the form of low molecular weight molecules with an average size of approximately 2200 base pairs. Total macronuclear DNA from four hypotrichs has been shown to have inverted terminal repeats by direct sequence analysis. In Oxytricha nova, Oxytricha sp., and Stylonychia pustulata, this terminal sequence may be written as 5'-C4A4C4A4C4 ... 3'-G4T4G4T4G4T4G4T4G4 ... In Euplotes aediculatus, the sequences is similar but differs in the lengths of the duplex region (28 base pairs) and of the putative 3' extension (14 base pairs). Also in Euplotes, a second common sequence of 5 base pairs (A-A-C-T-T-T-T-G-A-A) occurs internal to the terminal repeat and a 17-base-pair heterogeneous region: 5'-C4A4C4A4C4A4C4(X)17T-T-G-A-A ... 3'-G2T4G4T4G4T4G4T4G4T4G4(X)17A-A-C-T-T ... The length of the terminal repeat sequence for O. nova was confirmed in cloned macronuclear DNA molecules. Images PMID:6265931

Exciplexes versus Loose Ion Pairs: How Does the Driving Force Impact the Initial Product Ratio of Photoinduced Charge Separation Reactions?

PubMed Central

2014-01-01

Many donor–acceptor systems can undergo a photoinduced charge separation reaction, yielding loose ion pairs (LIPs). LIPs can be formed either directly via (distant) electron transfer (ET) or indirectly via the dissociation of an initially formed exciplex or tight ion pair. Establishing the prevalence of one of the reaction pathways is challenging because differentiating initially formed exciplexes from LIPs is difficult due to similar spectroscopic footprints. Hence, no comprehensive reaction model has been established for moderately polar solvents. Here, we employ an approach based on the time-resolved magnetic field effect (MFE) of the delayed exciplex luminescence to distinguish the two reaction channels. We focus on the effects of the driving force of ET and the solvent permittivity. We show that, surprisingly, the exciplex channel is significant even for an exergonic ET system with a free energy of ET of −0.58 eV and for the most polar solutions studied (butyronitrile). Our findings demonstrate that exciplexes play a crucial role even in polar solvents and at moderate driving forces, contrary to what is usually assumed. PMID:25243054

Can nuclear physics explain the anomaly observed in the internal pair production in the Beryllium-8 nucleus?

NASA Astrophysics Data System (ADS)

Zhang, Xilin; Miller, Gerald A.

2017-10-01

Recently the experimentalists in Krasznahorkay (2016) [1] announced observing an unexpected enhancement of the e+-e- pair production signal in one of the 8Be nuclear transitions. The subsequent studies have been focused on possible explanations based on introducing new types of particle. In this work, we improve the nuclear physics modeling of the reaction by studying the pair emission anisotropy and the interferences between different multipoles in an effective field theory inspired framework, and examine their possible relevance to the anomaly. The connection between the previously measured on-shell photon production and the pair production in the same nuclear transitions is established. These improvements, absent in the original experimental analysis, should be included in extracting new particle's properties from the experiment of this type. However, the improvements can not explain the anomaly. We then explore the nuclear transition form factor as a possible origin of the anomaly, and find the required form factor to be unrealistic for the 8Be nucleus. The reduction of the anomaly's significance by simply rescaling our predicted event count is also investigated.

Network topology mapper

DOEpatents

Quist, Daniel A [Los Alamos, NM; Gavrilov, Eugene M [Los Alamos, NM; Fisk, Michael E [Jemez, NM

2008-01-15

A method enables the topology of an acyclic fully propagated network to be discovered. A list of switches that comprise the network is formed and the MAC address cache for each one of the switches is determined. For each pair of switches, from the MAC address caches the remaining switches that see the pair of switches are located. For each pair of switches the remaining switches are determined that see one of the pair of switches on a first port and the second one of the pair of switches on a second port. A list of insiders is formed for every pair of switches. It is determined whether the insider for each pair of switches is a graph edge and adjacent ones of the graph edges are determined. A symmetric adjacency matrix is formed from the graph edges to represent the topology of the data link network.

Kinetic mechanism of nick sealing by T4 RNA ligase 2 and effects of 3′-OH base mispairs and damaged base lesions

PubMed Central

Chauleau, Mathieu; Shuman, Stewart

2013-01-01

T4 RNA ligase 2 (Rnl2) repairs 3′-OH/5′-PO4 nicks in duplex nucleic acids in which the broken 3′-OH strand is RNA. Ligation entails three chemical steps: reaction of Rnl2 with ATP to form a covalent Rnl2–(lysyl-Nζ)–AMP intermediate (step 1); transfer of AMP to the 5′-PO4 of the nick to form an activated AppN– intermediate (step 2); and attack by the nick 3′-OH on the AppN– strand to form a 3′–5′ phosphodiester (step 3). Here we used rapid mix-quench methods to analyze the kinetic mechanism and fidelity of single-turnover nick sealing by Rnl2–AMP. For substrates with correctly base-paired 3′-OH nick termini, kstep2 was fast (9.5 to 17.9 sec−1) and similar in magnitude to kstep3 (7.9 to 32 sec−1). Rnl2 fidelity was enforced mainly at the level of step 2 catalysis, whereby 3′-OH base mispairs and oxoguanine, oxoadenine, or abasic lesions opposite the nick 3′-OH elicited severe decrements in the rate of 5′-adenylylation and relatively modest slowing of the rate of phosphodiester synthesis. The exception was the noncanonical A:oxoG base pair, which Rnl2 accepted as a correctly paired end for rapid sealing. These results underscore (1) how Rnl2 requires proper positioning of the 3′-terminal ribonucleoside at the nick for optimal 5′-adenylylation and (2) the potential for nick-sealing ligases to embed mutations during the repair of oxidative damage. PMID:24158792

Enhanced Stability of DNA Nanostructures by Incorporation of Unnatural Base Pairs.

PubMed

Liu, Qing; Liu, Guocheng; Wang, Ting; Fu, Jing; Li, Rujiao; Song, Linlin; Wang, Zhen-Gang; Ding, Baoquan; Chen, Fei

2017-11-03

Self-assembled DNA nanostructures hold great promise in the fields of nanofabrication, biosensing and nanomedicine. However, the inherent low stability of the DNA double helices, formed by weak interactions, largely hinders the assembly and functions of DNA nanostructures. In this study, we redesigned and constructed a six-arm DNA junction by incorporation of the unnatural base pairs 5-Me-isoC/isoG and A/2-thioT into the double helices. They not only retained the structural integrity of the DNA nanostructure, but also showed enhanced thermal stability and resistance to T7 Exonuclease digestion. This research may expand the applications of DNA nanostructures in nanofabrication and biomedical fields, and furthermore, the genetic alphabet expansion with unnatural base pairs may enable us to construct more complicated and diversified self-assembled DNA nanostructures. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Using NMR and molecular dynamics to link structure and dynamics effects of the universal base 8-aza, 7-deaza, N8 linked adenosine analog

PubMed Central

Spring-Connell, Alexander M.; Evich, Marina G.; Debelak, Harald; Seela, Frank; Germann, Markus W.

2016-01-01

A truly universal nucleobase enables a host of novel applications such as simplified templates for PCR primers, randomized sequencing and DNA based devices. A universal base must pair indiscriminately to each of the canonical bases with little or preferably no destabilization of the overall duplex. In reality, many candidates either destabilize the duplex or do not base pair indiscriminatingly. The novel base 8-aza-7-deazaadenine (pyrazolo[3,4-d]pyrimidin- 4-amine) N8-(2′deoxyribonucleoside), a deoxyadenosine analog (UB), pairs with each of the natural DNA bases with little sequence preference. We have utilized NMR complemented with molecular dynamic calculations to characterize the structure and dynamics of a UB incorporated into a DNA duplex. The UB participates in base stacking with little to no perturbation of the local structure yet forms an unusual base pair that samples multiple conformations. These local dynamics result in the complete disappearance of a single UB proton resonance under native conditions. Accommodation of the UB is additionally stabilized via heightened backbone conformational sampling. NMR combined with various computational techniques has allowed for a comprehensive characterization of both structural and dynamic effects of the UB in a DNA duplex and underlines that the UB as a strong candidate for universal base applications. PMID:27566150

Enol tautomers of Watson-Crick base pair models are metastable because of nuclear quantum effects.

PubMed

Pérez, Alejandro; Tuckerman, Mark E; Hjalmarson, Harold P; von Lilienfeld, O Anatole

2010-08-25

Intermolecular enol tautomers of Watson-Crick base pairs could emerge spontaneously via interbase double proton transfer. It has been hypothesized that their formation could be facilitated by thermal fluctuations and proton tunneling, and possibly be relevant to DNA damage. Theoretical and computational studies, assuming classical nuclei, have confirmed the dynamic stability of these rare tautomers. However, by accounting for nuclear quantum effects explicitly through Car-Parrinello path integral molecular dynamics calculations, we find the tautomeric enol form to be dynamically metastable, with lifetimes too insignificant to be implicated in DNA damage.

Systematic and simulation-free coarse graining of homopolymer melts: a relative-entropy-based study.

PubMed

Yang, Delian; Wang, Qiang

2015-09-28

We applied the systematic and simulation-free strategy proposed in our previous work (D. Yang and Q. Wang, J. Chem. Phys., 2015, 142, 054905) to the relative-entropy-based (RE-based) coarse graining of homopolymer melts. RE-based coarse graining provides a quantitative measure of the coarse-graining performance and can be used to select the appropriate analytic functional forms of the pair potentials between coarse-grained (CG) segments, which are more convenient to use than the tabulated (numerical) CG potentials obtained from structure-based coarse graining. In our general coarse-graining strategy for homopolymer melts using the RE framework proposed here, the bonding and non-bonded CG potentials are coupled and need to be solved simultaneously. Taking the hard-core Gaussian thread model (K. S. Schweizer and J. G. Curro, Chem. Phys., 1990, 149, 105) as the original system, we performed RE-based coarse graining using the polymer reference interaction site model theory under the assumption that the intrachain segment pair correlation functions of CG systems are the same as those in the original system, which de-couples the bonding and non-bonded CG potentials and simplifies our calculations (that is, we only calculated the latter). We compared the performance of various analytic functional forms of non-bonded CG pair potential and closures for CG systems in RE-based coarse graining, as well as the structural and thermodynamic properties of original and CG systems at various coarse-graining levels. Our results obtained from RE-based coarse graining are also compared with those from structure-based coarse graining.

Sample size considerations for paired experimental design with incomplete observations of continuous outcomes.

PubMed

Zhu, Hong; Xu, Xiaohan; Ahn, Chul

2017-01-01

Paired experimental design is widely used in clinical and health behavioral studies, where each study unit contributes a pair of observations. Investigators often encounter incomplete observations of paired outcomes in the data collected. Some study units contribute complete pairs of observations, while the others contribute either pre- or post-intervention observations. Statistical inference for paired experimental design with incomplete observations of continuous outcomes has been extensively studied in literature. However, sample size method for such study design is sparsely available. We derive a closed-form sample size formula based on the generalized estimating equation approach by treating the incomplete observations as missing data in a linear model. The proposed method properly accounts for the impact of mixed structure of observed data: a combination of paired and unpaired outcomes. The sample size formula is flexible to accommodate different missing patterns, magnitude of missingness, and correlation parameter values. We demonstrate that under complete observations, the proposed generalized estimating equation sample size estimate is the same as that based on the paired t-test. In the presence of missing data, the proposed method would lead to a more accurate sample size estimate comparing with the crude adjustment. Simulation studies are conducted to evaluate the finite-sample performance of the generalized estimating equation sample size formula. A real application example is presented for illustration.

Twisting Right to Left: A…A Mismatch in a CAG Trinucleotide Repeat Overexpansion Provokes Left-Handed Z-DNA Conformation

PubMed Central

2015-01-01

Conformational polymorphism of DNA is a major causative factor behind several incurable trinucleotide repeat expansion disorders that arise from overexpansion of trinucleotide repeats located in coding/non-coding regions of specific genes. Hairpin DNA structures that are formed due to overexpansion of CAG repeat lead to Huntington’s disorder and spinocerebellar ataxias. Nonetheless, DNA hairpin stem structure that generally embraces B-form with canonical base pairs is poorly understood in the context of periodic noncanonical A…A mismatch as found in CAG repeat overexpansion. Molecular dynamics simulations on DNA hairpin stems containing A…A mismatches in a CAG repeat overexpansion show that A…A dictates local Z-form irrespective of starting glycosyl conformation, in sharp contrast to canonical DNA duplex. Transition from B-to-Z is due to the mechanistic effect that originates from its pronounced nonisostericity with flanking canonical base pairs facilitated by base extrusion, backbone and/or base flipping. Based on these structural insights we envisage that such an unusual DNA structure of the CAG hairpin stem may have a role in disease pathogenesis. As this is the first study that delineates the influence of a single A…A mismatch in reversing DNA helicity, it would further have an impact on understanding DNA mismatch repair. PMID:25876062

Study of base pair mutations in proline-rich homeodomain (PRH)-DNA complexes using molecular dynamics.

PubMed

Jalili, Seifollah; Karami, Leila; Schofield, Jeremy

2013-06-01

Proline-rich homeodomain (PRH) is a regulatory protein controlling transcription and gene expression processes by binding to the specific sequence of DNA, especially to the sequence 5'-TAATNN-3'. The impact of base pair mutations on the binding between the PRH protein and DNA is investigated using molecular dynamics and free energy simulations to identify DNA sequences that form stable complexes with PRH. Three 20-ns molecular dynamics simulations (PRH-TAATTG, PRH-TAATTA and PRH-TAATGG complexes) in explicit solvent water were performed to investigate three complexes structurally. Structural analysis shows that the native TAATTG sequence forms a complex that is more stable than complexes with base pair mutations. It is also observed that upon mutation, the number and occupancy of the direct and water-mediated hydrogen bonds decrease. Free energy calculations performed with the thermodynamic integration method predict relative binding free energies of 0.64 and 2 kcal/mol for GC to AT and TA to GC mutations, respectively, suggesting that among the three DNA sequences, the PRH-TAATTG complex is more stable than the two mutated complexes. In addition, it is demonstrated that the stability of the PRH-TAATTA complex is greater than that of the PRH-TAATGG complex.

On the binding of indeno[1,2-c]isoquinolines in the DNA-topoisomerase I cleavage complex.

PubMed

Xiao, Xiangshu; Antony, Smitha; Pommier, Yves; Cushman, Mark

2005-05-05

An ab initio quantum mechanics calculation is reported which predicts the orientation of indenoisoquinoline 4 in the ternary cleavage complex formed from DNA and topoisomerase I (top1). The results of this calculation are consistent with the hypothetical structures previously proposed for the indenoisoquinoline-DNA-top1 ternary complexes based on molecular modeling, the crystal structure of a recently reported ternary complex, and the biological results obtained with a pair of diaminoalkyl-substituted indenoisoquinoline enantiomers. The results of these studies indicate that the pi-pi stacking interactions between the indenoisoquinolines and the neighboring DNA base pairs play a major role in determining binding orientation. The calculation of the electrostatic potential surface maps of the indenoisoquinolines and the adjacent DNA base pairs shows electrostatic complementarity in the observed binding orientation, leading to the conclusion that electrostatic attraction between the intercalators and the base pairs in the cleavage complex plays a major stabilizing role. On the other hand, the calculation of LUMO and HOMO energies of indenoisoquinoline 13b and neighboring DNA base pairs in conjunction with NBO analysis indicates that charge transfer complex formation plays a relatively minor role in stabilizing the ternary complexes derived from indenoisoquinolines, DNA, and top1. The results of these studies are important in understanding the existing structure-activity relationships for the indenoisoquinolines as top1 inhibitors and as anticancer agents, and they will be important in the future design of indenoisoquinoline-based top1 inhibitors.

Evidence for Watson-Crick and not Hoogsteen or wobble base pairing in the selection of nucleotides for insertion opposite pyrimidines and a thymine dimer by yeast DNA pol eta.

PubMed

Hwang, Hanshin; Taylor, John-Stephen

2005-03-29

We have recently reported that pyrene nucleotide is preferentially inserted opposite an abasic site, the 3'-T of a thymine dimer, and most undamaged bases by yeast DNA polymerase eta (pol eta). Because pyrene is a nonpolar molecule with no H-bonding ability, the unusually high efficiencies of dPMP insertion are ascribed to its superior base stacking ability, and underscore the importance of base stacking in the selection of nucleotides by pol eta. To investigate the role of H-bonding and base pair geometry in the selection of nucleotides by pol eta, we determined the insertion efficiencies of the base-modified nucleotides 2,6-diaminopurine, 2-aminopurine, 6-chloropurine, and inosine which would make a different number of H-bonds with the template base depending on base pair geometry. Watson-Crick base pairing appears to play an important role in the selection of nucleotide analogues for insertion opposite C and T as evidenced by the decrease in the relative insertion efficiencies with a decrease in the number of Watson-Crick H-bonds and an increase in the number of donor-donor and acceptor-acceptor interactions. The selectivity of nucleotide insertion is greater opposite the 5'-T than the 3'-T of the thymine dimer, in accord with previous work suggesting that the 5'-T is held more rigidly than the 3'-T. Furthermore, insertion of A opposite both Ts of the dimer appears to be mediated by Watson-Crick base pairing and not by Hoogsteen base pairing based on the almost identical insertion efficiencies of A and 7-deaza-A, the latter of which lacks H-bonding capability at N7. The relative efficiencies for insertion of nucleotides that can form Watson-Crick base pairs parallel those for the Klenow fragment, whereas the Klenow fragment more strongly discriminates against mismatches, in accord with its greater shape selectivity. These results underscore the importance of H-bonding and Watson-Crick base pair geometry in the selection of nucleotides by both pol eta and the Klenow fragment, and the lesser role of shape selection in insertion by pol eta due to its more open and less constrained active site.

Watson-Crick Base Pair Radical Cation as a Model for Oxidative Damage in DNA.

PubMed

Feketeová, Linda; Chan, Bun; Khairallah, George N; Steinmetz, Vincent; Maitre, Philippe; Radom, Leo; O'Hair, Richard A J

2017-07-06

The deleterious cellular effects of ionizing radiation are well-known, but the mechanisms causing DNA damage are poorly understood. The accepted molecular events involve initial oxidation and deprotonation at guanine sites, triggering hydrogen atom abstraction reactions from the sugar moieties, causing DNA strand breaks. Probing the chemistry of the initially formed radical cation has been challenging. Here, we generate, spectroscopically characterize, and examine the reactivity of the Watson-Crick nucleobase pair radical cation in the gas phase. We observe rich chemistry, including proton transfer between the bases and propagation of the radical site in deoxyguanosine from the base to the sugar, thus rupturing the sugar. This first example of a gas-phase model system providing molecular-level details on the chemistry of an ionized DNA base pair paves the way toward a more complete understanding of molecular processes induced by radiation. It also highlights the role of radical propagation in chemistry, biology, and nanotechnology.

Charge transport through DNA based electronic barriers

NASA Astrophysics Data System (ADS)

Patil, Sunil R.; Chawda, Vivek; Qi, Jianqing; Anantram, M. P.; Sinha, Niraj

2018-05-01

We report charge transport in electronic 'barriers' constructed by sequence engineering in DNA. Considering the ionization potentials of Thymine-Adenine (AT) and Guanine-Cytosine (GC) base pairs, we treat AT as 'barriers'. The effect of DNA conformation (A and B form) on charge transport is also investigated. Particularly, the effect of width of 'barriers' on hole transport is investigated. Density functional theory (DFT) calculations are performed on energy minimized DNA structures to obtain the electronic Hamiltonian. The quantum transport calculations are performed using the Landauer-Buttiker framework. Our main findings are contrary to previous studies. We find that a longer A-DNA with more AT base pairs can conduct better than shorter A-DNA with a smaller number of AT base pairs. We also find that some sequences of A-DNA can conduct better than a corresponding B-DNA with the same sequence. The counterions mediated charge transport and long range interactions are speculated to be responsible for counter-intuitive length and AT content dependence of conductance of A-DNA.

Reduction of CO 2 to methanol using aluminum ester FLPs

DOE PAGES

Smythe, Nathan C.; Dixon, David A.; Garner, III, Edward B.; ...

2015-10-09

Herein we report the synthesis of Al-based esters containing halogenated benzene rings. These Lewis acids were paired with phosphines to form frustrated Lewis pairs (FLPs) which could subsequently bind CO 2. While these FLPs were not sufficiently water-stable to catalyze the reduction of CO 2 to MeOH using NH 3BH 3 as the reductant, we examine the effect of varying Lewis acid strength. Frustrated Lewis pairs (FLPs) are combinations of Lewis acids and Lewis bases where the acid and base are either sterically or geometrically restricted from interacting as strongly as their electronic structures would allow. This effect leads tomore » enhanced reactivity towards small molecules and, consequently, interest in their potential as metal-free catalysts [1], [2], [3], [4] and [5]. Furthermore, to-date, the biggest success has been based around the ability of a myriad of systems to heterolytically cleave H 2 and perform catalytic hydrogenations [2] and [3].« less

Interactions in ion pairs of protic ionic liquids: Comparison with aprotic ionic liquids

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tsuzuki, Seiji, E-mail: s.tsuzuki@aist.go.jp; Shinoda, Wataru; Miran, Md. Shah

2013-11-07

The stabilization energies for the formation (E{sub form}) of 11 ion pairs of protic and aprotic ionic liquids were studied by MP2/6-311G{sup **} level ab initio calculations to elucidate the difference between the interactions of ions in protic ionic liquids and those in aprotic ionic liquids. The interactions in the ion pairs of protic ionic liquids (diethylmethylammonium [dema] and dimethylpropylammonium [dmpa] based ionic liquids) are stronger than those of aprotic ionic liquids (ethyltrimethylammonium [etma] based ionic liquids). The E{sub form} for the [dema][CF{sub 3}SO{sub 3}] and [dmpa][CF{sub 3}SO{sub 3}] complexes (−95.6 and −96.4 kcal/mol, respectively) are significantly larger (more negative)more » than that for the [etma][CF{sub 3}SO{sub 3}] complex (−81.0 kcal/mol). The same trend was observed for the calculations of ion pairs of the three cations with the Cl{sup −}, BF{sub 4}{sup −}, TFSA{sup −} anions. The anion has contact with the N–H bond of the dema{sup +} or dmpa{sup +} cations in the most stable geometries of the dema{sup +} and dmpa{sup +} complexes. The optimized geometries, in which the anions locate on the counter side of the cations, are 11.0–18.0 kcal/mol less stable, which shows that the interactions in the ions pairs of protic ionic liquids have strong directionality. The E{sub form} for the less stable geometries for the dema{sup +} and dmpa{sup +} complexes are close to those for the most stable etma{sup +} complexes. The electrostatic interaction, which is the major source of the attraction in the ion pairs, is responsible for the directionality of the interactions and determining the magnitude of the interaction energy. Molecular dynamic simulations of the [dema][TFSA] and [dmpa][TFSA] ionic liquids show that the N–H bonds of the cations have contact with the negatively charged (oxygen and nitrogen) atoms of TFSA{sup −} anion, while the strong directionality of the interactions was not suggested from the simulation of the [etma][CF{sub 3}SO{sub 3}] ionic liquid.« less

Action-outcome learning and prediction shape the window of simultaneity of audiovisual outcomes.

PubMed

Desantis, Andrea; Haggard, Patrick

2016-08-01

To form a coherent representation of the objects around us, the brain must group the different sensory features composing these objects. Here, we investigated whether actions contribute in this grouping process. In particular, we assessed whether action-outcome learning and prediction contribute to audiovisual temporal binding. Participants were presented with two audiovisual pairs: one pair was triggered by a left action, and the other by a right action. In a later test phase, the audio and visual components of these pairs were presented at different onset times. Participants judged whether they were simultaneous or not. To assess the role of action-outcome prediction on audiovisual simultaneity, each action triggered either the same audiovisual pair as in the learning phase ('predicted' pair), or the pair that had previously been associated with the other action ('unpredicted' pair). We found the time window within which auditory and visual events appeared simultaneous increased for predicted compared to unpredicted pairs. However, no change in audiovisual simultaneity was observed when audiovisual pairs followed visual cues, rather than voluntary actions. This suggests that only action-outcome learning promotes temporal grouping of audio and visual effects. In a second experiment we observed that changes in audiovisual simultaneity do not only depend on our ability to predict what outcomes our actions generate, but also on learning the delay between the action and the multisensory outcome. When participants learned that the delay between action and audiovisual pair was variable, the window of audiovisual simultaneity for predicted pairs increased, relative to a fixed action-outcome pair delay. This suggests that participants learn action-based predictions of audiovisual outcome, and adapt their temporal perception of outcome events based on such predictions. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

Intermolecular interactions of trifluorohalomethanes with Lewis bases in the gas phase: an ab initio study.

PubMed

Wang, Yi-Siang; Yin, Chih-Chien; Chao, Sheng D

2014-10-07

We perform an ab initio computational study of molecular complexes with the general formula CF3X-B that involve one trifluorohalomethane CF3X (X = Cl or Br) and one of a series of Lewis bases B in the gas phase. The Lewis bases are so chosen that they provide a range of electron-donating abilities for comparison. Based on the characteristics of their electron pairs, we consider the Lewis bases with a single n-pair (NH3 and PH3), two n-pairs (H2O and H2S), two n-pairs with an unsaturated bond (H2CO and H2CS), and a single π-pair (C2H4) and two π-pairs (C2H2). The aim is to systematically investigate the influence of the electron pair characteristics and the central atom substitution effects on the geometries and energetics of the formed complexes. The counterpoise-corrected supermolecule MP2 and coupled-cluster single double with perturbative triple [CCSD(T)] levels of theory have been employed, together with a series of basis sets up to aug-cc-pVTZ. The angular and radial configurations, the binding energies, and the electrostatic potentials of the stable complexes have been compared and discussed as the Lewis base varies. For those complexes where halogen bonding plays a significant role, the calculated geometries and energetics are consistent with the σ-hole model. Upon formation of stable complexes, the C-X bond lengths shorten, while the C-X vibrational frequencies increase, thus rendering blueshifting halogen bonds. The central atom substitution usually enlarges the intermolecular bond distances while it reduces the net charge transfers, thus weakening the bond strengths. The analysis based on the σ-hole model is grossly reliable but requires suitable modifications incorporating the central atom substitution effects, in particular, when interaction components other than electrostatic contributions are involved.

Technological applications arising from the interactions of DNA bases with metal ions.

PubMed

Park, Ki Soo; Park, Hyun Gyu

2014-08-01

An intense interest has grown in the unique interactions of nucleic acids with metal ions, which lead to the formation of metal-base pairs and the generation of fluorescent nanomaterials. In this review, different types of metal-base pairs, especially those formed from naturally occurring nucleosides, are described with emphasis also being given to recent advances made in employing these complexes to govern enzymatic reactions. The review also contains a comprehensive description of DNA-templated inorganic nanomaterials such as silver nanoclusters which possess excellent fluorescence properties. Finally, a summary is given about how these materials have led to recent advances in the field of nanobiotechnology. Copyright © 2013 Elsevier Ltd. All rights reserved.

NDI and DAN DNA: nucleic acid-directed assembly of NDI and DAN.

PubMed

Ikkanda, Brian A; Samuel, Stevan A; Iverson, Brent L

2014-03-07

Two novel DNA base surrogate phosphoramidites 1 and 2, based upon relatively electron-rich 1,5-dialkoxynaphthalene (DAN) and relatively electron-deficient 1,4,5,8-naphthalenetetracarboxylic diimide (NDI), respectively, were designed, synthesized, and incorporated into DNA oligonucleotide strands. The DAN and NDI artificial DNA bases were inserted within a three-base-pair region within the interior of a 12-mer oligonucleotide duplex in various sequential arrangements and investigated with CD spectroscopy and UV melting curve analysis. The CD spectra of the modified duplexes indicated B-form DNA topology. Melting curve analyses revealed trends in DNA duplex stability that correlate with the known association of DAN and NDI moieties in aqueous solution as well as the known favorable interactions between NDI and natural DNA base pairs. This demonstrates that DNA duplex stability and specificity can be driven by the electrostatic complementarity between DAN and NDI. In the most favorable case, an NDI-DAN-NDI arrangement in the middle of the DNA duplex was found to be approximately as stabilizing as three A-T base pairs.

Homology between Escherichia coli plasmids ColE1 and p15A.

PubMed Central

Bird, R E

1981-01-01

The location and extent of the homology between plasmids ColE1 and p15A were determined by analysis of heteroduplexes formed between them as well as with a related plasmid, pBR322, and by hybridization of radioactive deoxyribonucleic acids to restriction fragments of p15A and ColE1. The homology between the plasmids contained the entire region of ColE1 required for its replication as well as an additional 400 base pairs downstream from the origin of replication. This region on p15A, which was 980 +/- 43 base pairs, started at 0.1 of the molecular length from one end formed by cleavage with the restriction endonuclease BglI and extended to 0.54 of the molecular length from the same end. Restriction cleavage maps for the enzymes BglI, HpaI, HaeII, HaeIII, and HincII are also presented. Images PMID:6259130

The crystal structure of an oligo(U):pre-mRNA duplex from a trypanosome RNA editing substrate

PubMed Central

Mooers, Blaine H.M.; Singh, Amritanshu

2011-01-01

Guide RNAs bind antiparallel to their target pre-mRNAs to form editing substrates in reaction cycles that insert or delete uridylates (Us) in most mitochondrial transcripts of trypanosomes. The 5′ end of each guide RNA has an anchor sequence that binds to the pre-mRNA by base-pair complementarity. The template sequence in the middle of the guide RNA directs the editing reactions. The 3′ ends of most guide RNAs have ∼15 contiguous Us that bind to the purine-rich unedited pre-mRNA upstream of the editing site. The resulting U-helix is rich in G·U wobble base pairs. To gain insights into the structure of the U-helix, we crystallized 8 bp of the U-helix in one editing substrate for the A6 mRNA of Trypanosoma brucei. The fragment provides three samples of the 5′-AGA-3′/5′-UUU-3′ base-pair triple. The fusion of two identical U-helices head-to-head promoted crystallization. We obtained X-ray diffraction data with a resolution limit of 1.37 Å. The U-helix had low and high twist angles before and after each G·U wobble base pair; this variation was partly due to shearing of the wobble base pairs as revealed in comparisons with a crystal structure of a 16-nt RNA with all Watson–Crick base pairs. Both crystal structures had wider major grooves at the junction between the poly(U) and polypurine tracts. This junction mimics the junction between the template helix and the U-helix in RNA-editing substrates and may be a site of major groove invasion by RNA editing proteins. PMID:21878548

Sequence analysis of Leukemia DNA

NASA Astrophysics Data System (ADS)

Nacong, Nasria; Lusiyanti, Desy; Irawan, Muhammad. Isa

2018-03-01

Cancer is a very deadly disease, one of which is leukemia disease or better known as blood cancer. The cancer cell can be detected by taking DNA in laboratory test. This study focused on local alignment of leukemia and non leukemia data resulting from NCBI in the form of DNA sequences by using Smith-Waterman algorithm. SmithWaterman algorithm was invented by TF Smith and MS Waterman in 1981. These algorithms try to find as much as possible similarity of a pair of sequences, by giving a negative value to the unequal base pair (mismatch), and positive values on the same base pair (match). So that will obtain the maximum positive value as the end of the alignment, and the minimum value as the initial alignment. This study will use sequences of leukemia and 3 sequences of non leukemia.

Pnicogen bonds between X═PH3 (X = O, S, NH, CH2) and phosphorus and nitrogen bases.

PubMed

Alkorta, Ibon; Sánchez-Sanz, Goar; Elguero, José; Del Bene, Janet E

2014-02-27

Ab initio MP2/aug'-cc-pVTZ calculations have been carried out to investigate the pnicogen bonded complexes formed between the acids O═PH3, S═PH3, HN═PH3, and H2C═PH3 and the bases NH3, NCH, N2, PH3, and PCH. All nitrogen and phosphorus bases form complexes in which the bases are lone pair electron donors. The binding energies of complexes involving the stronger bases NH3, NCH, and PH3 differentiate among the acids, but the binding energies of complexes with the weaker bases do not. These complexes are stabilized by charge transfer from the lone pair orbital of N or P to the σ*P═A orbital of X═PH3, where A is the atom of X directly bonded to P. PCH also forms complexes with the X═PH3 acids as a π electron donor to the σ*P═A orbital. The binding energies and the charge-transfer energies of the π complexes are greater than those of the complexes in which PCH is a lone pair donor. Whether the positive charge on P increases, decreases, or remains the same upon complex formation, the chemical shieldings of (31)P decrease in the complexes relative to the corresponding monomers. (1p)J(P-N) and (1p)J(P-P) values correlate best with the corresponding P-N and P-P distances as a function of the nature of the base. (1)J(P-A) values do not correlate with P-A distances. Rather, the absolute values of (1)J(P-O), (1)J(P-S), and (1)J(P-N) decrease upon complexation. Decreasing (1)J(P-A) values correlate linearly with increasing complex binding energies. In contrast, (1)J(P-C) values increase upon complexation and correlate linearly with increasing binding energies.

Interaction of small molecules with double-stranded RNA: spectroscopic, viscometric, and calorimetric study of hoechst and proflavine binding to PolyCG structures.

PubMed

Sinha, Rangana; Hossain, Maidul; Kumar, Gopinatha Suresh

2009-04-01

Design and synthesis of new small molecules binding to double-stranded RNA necessitate complete understanding of the molecular aspects of the binding of many existing molecules. Toward this goal, in this work we evaluated the biophysical aspects of the interaction of a DNA intercalator (proflavine) and a minor groove binder (hoechst 33258) with two polymorphic forms of polyCG, namely, the right-handed Watson-Crick base paired A-form and the left-handed Hoogsteen base paired H(L)-form, by absorption, fluorescence, and viscometry experiments. The energetics of the interaction of these molecules with the RNA structures has also been elucidated by isothermal titration calorimetry (ITC). Results suggest that proflavine strongly intercalates in both forms of polyCG, whereas hoechst shows mainly groove-binding modes. The binding of both drugs to both forms of RNA resulted in significant conformational change to the RNA structure with the bound molecules being placed in the chiral RNA helix. ITC profiles for both proflavine and hoechst show two binding sites. Binding of proflavine to both forms of RNA is endothermic and entropy driven in the first site and exothermic and enthalpy driven in the second site, whereas hoechst binding to both forms of RNA is exothermic and enthalpy driven in the first site and endothermic and entropy driven in the second site. This study suggests that the binding affinity characteristics and energetics of interaction of these DNA binding molecules with the RNA conformations are significantly different and may serve as data for future development of effective structure-selective RNA-based drugs.

Highly Dynamic Anion-Quadrupole Networks in Proteins.

PubMed

Kapoor, Karan; Duff, Michael R; Upadhyay, Amit; Bucci, Joel C; Saxton, Arnold M; Hinde, Robert J; Howell, Elizabeth E; Baudry, Jerome

2016-11-01

The dynamics of anion-quadrupole (or anion-π) interactions formed between negatively charged (Asp/Glu) and aromatic (Phe) side chains are for the first time computationally characterized in RmlC (Protein Data Bank entry 1EP0 ), a homodimeric epimerase. Empirical force field-based molecular dynamics simulations predict anion-quadrupole pairs and triplets (anion-anion-π and anion-π-π) are formed by the protein during the simulated trajectory, which suggests that the anion-quadrupole interactions may provide a significant contribution to the overall stability of the protein, with an average of -1.6 kcal/mol per pair. Some anion-π interactions are predicted to form during the trajectory, extending the number of anion-quadrupole interactions beyond those predicted from crystal structure analysis. At the same time, some anion-π pairs observed in the crystal structure exhibit marginal stability. Overall, most anion-π interactions alternate between an "on" state, with significantly stabilizing energies, and an "off" state, with marginal or null stabilizing energies. The way proteins possibly compensate for transient loss of anion-quadrupole interactions is characterized in the RmlC aspartate 84-phenylalanine 112 anion-quadrupole pair observed in the crystal structure. A double-mutant cycle analysis of the thermal stability suggests a possible loss of anion-π interactions compensated by variations of hydration of the residues and formation of compensating electrostatic interactions. These results suggest that near-planar anion-quadrupole pairs can exist, sometimes transiently, which may play a role in maintaining the structural stability and function of the protein, in an otherwise very dynamic interplay of a nonbonded interaction network as well as solvent effects.

Unique Dynamic Properties of DNA Duplexes Containing Interstrand Crosslinks†

PubMed Central

Friedman, Joshua I.; Jiang, Yu Lin; Miller, Paul S.; Stivers, James T.

2010-01-01

Bifunctional DNA alkylating agents form a diverse assortment of covalent DNA interstrand crosslinked (ICL) structures that are potent cytotoxins. Since it is implausible that cells could possess distinct DNA repair systems for each individual ICL, it is believed that common structural and dynamic features of ICL damage are recognized, rather than specific structural characteristics of each cross-linking agent. Investigation of the structural and dynamic properties of ICLs that might be important for recognition has been complicated by heterogeneous incorporation of these lesions into DNA. To address this problem we have synthesized and characterized several homogenous ICL-DNAs containing site–specific staggered N4-cytosine-ethyl-N4-cytosine crosslinks. Staggered crosslinks were introduced in two ways: in a manner that preserves the overall structure of B-form duplex DNA, and in a manner that highly distorts the DNA structure, with the goal of understanding how structural and dynamic properties of diverse ICL duplexes might flag these sites for repair. Measurements of base pair opening dynamics in the B-form ICL duplex by 1H NMR linewidth or imino proton solvent exchange showed that the guanine base opposite to the crosslinked cytosine opened at least an order of magnitude more slowly than when in a control matched normal duplex. To a lesser degree, the B-form ICL also induced a decrease in base pair opening dynamics that extended from the site of the crosslink to adjacent base pairs. In contrast, the non-B-form ICL showed extensive conformational dynamics at the site of the cross link, which extended over the entire DNA sequence. Since DNA duplexes containing the B-form and non-B-form ICL crosslinks have both been shown to be incised when incubated in mammalian whole cell extracts, while a matched normal duplex is not, we conclude that intrinsic DNA dynamics is not a requirement for specific damage incision of these ICLs. Instead, we propose a general model where destabilized ICL-duplexes serve to energetically facilitate binding of DNA repair factors that must induce bubbles or other distortions in the duplex. However, the essential requirement for incision is an immobile Y-junction where the repair factors are stably bound at the site of the ICL, and the two DNA strands are unpaired. PMID:21174443

Ion Pair Formation between Tertiary Aliphatic Amines and Perchlorate in the Biphasic Water/Dichloromethane System.

PubMed

Badocco, Denis; Di Marco, Valerio; Venzo, Alfonso; Frasconi, Marco; Frezzato, Diego; Pastore, Paolo

2017-10-12

The ability of aliphatic amines (AAs), namely, tripropylamine (TPrA), trisobutylamine (TisoBuA), and tributylamine (TBuA), to form ion pairs with perchlorate anion (ClO 4 - ) in biphasic aqueous/dichloromethane (CH 2 Cl 2 ) mixtures containing ClO 4 - 0.1 M has been demonstrated by GC with flame ionization (FID) and mass detectors (MS) and by NMR measurements. The extraction efficiency of the AAs to the organic phase was modeled by equations that were used to fit the experimental GC data, allowing us to determine values for K P (partition constant of the free AA), K IP (formation constant of the ion pair), and K P IP (partition constant of the ion pair) for TPrA, TisoBuA, and TBuA at 25 °C. Ion pairs were shown to form in CH 2 Cl 2 also when ClO 4 - is replaced by other inorganic anions, like NO 3 - , ClO 3 - , Cl - , H 2 PO 4 - , and IO 3 - . No ion pairs formed when CH 2 Cl 2 was replaced by n-hexane, suggesting that aliphatic amine ion pairs can form in polar organic solvents but not in nonpolar ones.

Sequence-specific activation of the DNA sensor cGAS by Y-form DNA structures as found in primary HIV-1 cDNA.

PubMed

Herzner, Anna-Maria; Hagmann, Cristina Amparo; Goldeck, Marion; Wolter, Steven; Kübler, Kirsten; Wittmann, Sabine; Gramberg, Thomas; Andreeva, Liudmila; Hopfner, Karl-Peter; Mertens, Christina; Zillinger, Thomas; Jin, Tengchuan; Xiao, Tsan Sam; Bartok, Eva; Coch, Christoph; Ackermann, Damian; Hornung, Veit; Ludwig, Janos; Barchet, Winfried; Hartmann, Gunther; Schlee, Martin

2015-10-01

Cytosolic DNA that emerges during infection with a retrovirus or DNA virus triggers antiviral type I interferon responses. So far, only double-stranded DNA (dsDNA) over 40 base pairs (bp) in length has been considered immunostimulatory. Here we found that unpaired DNA nucleotides flanking short base-paired DNA stretches, as in stem-loop structures of single-stranded DNA (ssDNA) derived from human immunodeficiency virus type 1 (HIV-1), activated the type I interferon-inducing DNA sensor cGAS in a sequence-dependent manner. DNA structures containing unpaired guanosines flanking short (12- to 20-bp) dsDNA (Y-form DNA) were highly stimulatory and specifically enhanced the enzymatic activity of cGAS. Furthermore, we found that primary HIV-1 reverse transcripts represented the predominant viral cytosolic DNA species during early infection of macrophages and that these ssDNAs were highly immunostimulatory. Collectively, our study identifies unpaired guanosines in Y-form DNA as a highly active, minimal cGAS recognition motif that enables detection of HIV-1 ssDNA.

Circular dichroism and DNA secondary structure.

PubMed Central

Baase, W A; Johnson, W C

1979-01-01

The change in average rotation of the DNA helix has been determined for the transfer from 0.05 M NaCl to 3.0 M CsCl, 6.2 M LiCl and 5.4 M NH4Cl. This work, combined with data at lower salt from other laboratories, allows us to relate the intensity of the CD of DNA at 275 nm directly to the change in the number of base pairs per turn. The change in secondary structure for the transfer of DNA from 0.05 M NaCl (where it is presumably in the B-form) to high salt (where the characteristic CD has been interpreted as corresponding to C-form geometry) is found to be -0.22 (+/- 0.02) base pairs per turn. In the case of mononucleosomes, where the CD indicates the "C-form", the change in secondary structure (including temperature effects) would add -0.31 (+/- 0.03) turns about the histone core to the -1.25 turns estimated from work on SV40 chromatin. Accurate winding angles and molar extinction coefficients were determined for ethidium. PMID:424316

Pyrvinium pamoate changes alternative splicing of the serotonin receptor 2C by influencing its RNA structure

PubMed Central

Shen, Manli; Bellaousov, Stanislav; Hiller, Michael; de La Grange, Pierre; Creamer, Trevor P.; Malina, Orit; Sperling, Ruth; Mathews, David H.; Stoilov, Peter; Stamm, Stefan

2013-01-01

The serotonin receptor 2C plays a central role in mood and appetite control. It undergoes pre-mRNA editing as well as alternative splicing. The RNA editing suggests that the pre-mRNA forms a stable secondary structure in vivo. To identify substances that promote alternative exons inclusion, we set up a high-throughput screen and identified pyrvinium pamoate as a drug-promoting exon inclusion without editing. Circular dichroism spectroscopy indicates that pyrvinium pamoate binds directly to the pre-mRNA and changes its structure. SHAPE (selective 2′-hydroxyl acylation analysed by primer extension) assays show that part of the regulated 5′-splice site forms intramolecular base pairs that are removed by this structural change, which likely allows splice site recognition and exon inclusion. Genome-wide analyses show that pyrvinium pamoate regulates >300 alternative exons that form secondary structures enriched in A–U base pairs. Our data demonstrate that alternative splicing of structured pre-mRNAs can be regulated by small molecules that directly bind to the RNA, which is reminiscent to an RNA riboswitch. PMID:23393189

Ag(I)-mediated homo and hetero pairs of guanosine and cytidine: monitoring by circular dichroism spectroscopy.

PubMed

Goncharova, Iryna

2014-01-24

Ag(I)-containing compounds are attractive as antibacterial and antifungal agents. The renewed interest in the application of silver(I) compounds has led to the need for detailed knowledge of the mechanism of their action. One of the possible ways is the coordination of Ag(I) to G-C pairs of DNA, where Ag(+) ions form Ag(I)-mediated base pairs and inhibit the transcription. Herein, a systematic chiroptical study on silver(I)-mediated homo and mixed pairs of the C-G complementary-base derivatives cytidine(C) and 5'-guanosine monophosphate(G) in water is presented. Ag(I)-mediated homo and hetero pairs of G and C and their self-assembled species were studied under two pH levels (7.0 and 10.0) by vibrational (VCD) and electronic circular dichroism(ECD). VCD was used for the first time in this field and showed itself to be a powerful method for obtaining specific structural information in solution. Based on results of the VCD experiments, the different geometries of the homo pairs were proposed under pH 7.0 and 10.0. ECD was used as a diagnostic tool to characterize the studied systems and as a contact point between the previously defined structures of the metal or proton mediated pairs of nucleobases and the systems studied here. On the basis of the obtained data, the formation of the self-assembled species of cytidine with a structure similar to the i-motif structure in DNA was proposed at pH 10.0. Copyright © 2013 Elsevier B.V. All rights reserved.

Ag(I)-mediated homo and hetero pairs of guanosine and cytidine: Monitoring by circular dichroism spectroscopy

NASA Astrophysics Data System (ADS)

Goncharova, Iryna

2014-01-01

Ag(I)-containing compounds are attractive as antibacterial and antifungal agents. The renewed interest in the application of silver(I) compounds has led to the need for detailed knowledge of the mechanism of their action. One of the possible ways is the coordination of Ag(I) to G-C pairs of DNA, where Ag+ ions form Ag(I)-mediated base pairs and inhibit the transcription. Herein, a systematic chiroptical study on silver(I)-mediated homo and mixed pairs of the C-G complementary-base derivatives cytidine(C) and 5‧-guanosine monophosphate(G) in water is presented. Ag(I)-mediated homo and hetero pairs of G and C and their self-assembled species were studied under two pH levels (7.0 and 10.0) by vibrational (VCD) and electronic circular dichroism(ECD). VCD was used for the first time in this field and showed itself to be a powerful method for obtaining specific structural information in solution. Based on results of the VCD experiments, the different geometries of the homo pairs were proposed under pH 7.0 and 10.0. ECD was used as a diagnostic tool to characterize the studied systems and as a contact point between the previously defined structures of the metal or proton mediated pairs of nucleobases and the systems studied here. On the basis of the obtained data, the formation of the self-assembled species of cytidine with a structure similar to the i-motif structure in DNA was proposed at pH 10.0.

Fundamental aspects of recoupled pair bonds. I. Recoupled pair bonds in carbon and sulfur monofluoride

NASA Astrophysics Data System (ADS)

Dunning, Thom H.; Xu, Lu T.; Takeshita, Tyler Y.

2015-01-01

The number of singly occupied orbitals in the ground-state atomic configuration of an element defines its nominal valence. For carbon and sulfur, with two singly occupied orbitals in their 3P ground states, the nominal valence is two. However, in both cases, it is possible to form more bonds than indicated by the nominal valence—up to four bonds for carbon and six bonds for sulfur. In carbon, the electrons in the 2s lone pair can participate in bonding, and in sulfur the electrons in both the 3p and 3s lone pairs can participate. Carbon 2s and sulfur 3p recoupled pair bonds are the basis for the tetravalence of carbon and sulfur, and 3s recoupled pair bonds enable sulfur to be hexavalent. In this paper, we report generalized valence bond as well as more accurate calculations on the a4Σ- states of CF and SF, which are archetypal examples of molecules that possess recoupled pair bonds. These calculations provide insights into the fundamental nature of recoupled pair bonds and illustrate the key differences between recoupled pair bonds formed with the 2s lone pair of carbon, as a representative of the early p-block elements, and recoupled pair bonds formed with the 3p lone pair of sulfur, as a representative of the late p-block elements.

Birds choose long-term partners years before breeding

USGS Publications Warehouse

Teitelbaum, Claire S.; Converse, Sarah J.; Mueller, Thomas

2017-01-01

Pair bonds can provide social benefits to long-term monogamous species alongside their benefits for reproduction. However, little is known about when these bonds form, in particular how long they are present before breeding. Previous studies of pair formation in long-term monogamous birds have been rather data-limited, but for many migratory birds they report pair formation on the wintering grounds. We provide the first systematic investigation of prebreeding association patterns of long-term monogamous pairs by examining entire life histories based on tracking data of migratory whooping cranes, Grus americana. We found that a substantial portion (62%) of breeding pairs started associating at least 12 months before first breeding, with 16 of 58 breeding pairs beginning to associate over 2 years before first breeding. For most pairs, these associations with future breeding partners also became unique and distinguishable from association patterns with nonpartner individuals 12 months before first breeding. In addition, 60% of pair associations began before at least one partner had reached nominal sexual maturity. Most pairs began associating in the late spring upon arrival at the summer grounds, while associations beginning at other times of the year were rare. Patterns in the associations of pairs prior to breeding can point to the potential benefits of prebreeding relationships, for instance providing support in competitive interactions or increasing partner familiarity.

A Simpler Nucleic Acid

NASA Technical Reports Server (NTRS)

Orgel, Leslie

2000-01-01

It has been supposed that for a nucleic acid analog to pair with RNA it must, like RNA, have a backbone with at least a sixatom repeat; a shorter backbone presumably would not stretch far enough to bind RNA properly. The Eschenmoser group has shown, however, that this first impression is incorrect.As they report in their new paper, Eschenmoser and co-workers ( I ) have now synthesized a substantial number of these polymers, which are called (L)-a-threofuranosyl oligonucleotides or TNAs. They are composed of bases linked to a threose sugar-phosphate backbone, with phosphodiester bonds connecting the nucleotides. The investigators discovered that pairs of complementary TNAs do indeed form stable Watson-Crick double helices and, perhaps more importantly, that TNAs form stable double helices with complementary RNAs and DNAs.

The quantum needle of the avian magnetic compass

PubMed Central

Hiscock, Hamish G.; Worster, Susannah; Kattnig, Daniel R.; Steers, Charlotte; Jin, Ye; Manolopoulos, David E.; Mouritsen, Henrik; Hore, P. J.

2016-01-01

Migratory birds have a light-dependent magnetic compass, the mechanism of which is thought to involve radical pairs formed photochemically in cryptochrome proteins in the retina. Theoretical descriptions of this compass have thus far been unable to account for the high precision with which birds are able to detect the direction of the Earth's magnetic field. Here we use coherent spin dynamics simulations to explore the behavior of realistic models of cryptochrome-based radical pairs. We show that when the spin coherence persists for longer than a few microseconds, the output of the sensor contains a sharp feature, referred to as a spike. The spike arises from avoided crossings of the quantum mechanical spin energy-levels of radicals formed in cryptochromes. Such a feature could deliver a heading precision sufficient to explain the navigational behavior of migratory birds in the wild. Our results (i) afford new insights into radical pair magnetoreception, (ii) suggest ways in which the performance of the compass could have been optimized by evolution, (iii) may provide the beginnings of an explanation for the magnetic disorientation of migratory birds exposed to anthropogenic electromagnetic noise, and (iv) suggest that radical pair magnetoreception may be more of a quantum biology phenomenon than previously realized. PMID:27044102

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tripathi, S.; Zhang, D.; Paukstelis, P. J.

DNA has proved to be an excellent material for nanoscale construction because complementary DNA duplexes are programmable and structurally predictable. However, in the absence of Watson–Crick pairings, DNA can be structurally more diverse. Here, we describe the crystal structures of d(ACTCGGATGAT) and the brominated derivative, d(AC BrUCGGA BrUGAT). These oligonucleotides form parallel-stranded duplexes with a crystallographically equivalent strand, resulting in the first examples of DNA crystal structures that contains four different symmetric homo base pairs. Two of the parallel-stranded duplexes are coaxially stacked in opposite directions and locked together to form a tetraplex through intercalation of the 5'-most A–A basemore » pairs between adjacent G–G pairs in the partner duplex. The intercalation region is a new type of DNA tertiary structural motif with similarities to the i-motif. 1H– 1H nuclear magnetic resonance and native gel electrophoresis confirmed the formation of a parallel-stranded duplex in solution. Finally, we modified specific nucleotide positions and added d(GAY) motifs to oligonucleotides and were readily able to obtain similar crystals. This suggests that this parallel-stranded DNA structure may be useful in the rational design of DNA crystals and nanostructures.« less

An intercalation-locked parallel-stranded DNA tetraplex

DOE PAGES

Tripathi, S.; Zhang, D.; Paukstelis, P. J.

2015-01-27

DNA has proved to be an excellent material for nanoscale construction because complementary DNA duplexes are programmable and structurally predictable. However, in the absence of Watson–Crick pairings, DNA can be structurally more diverse. Here, we describe the crystal structures of d(ACTCGGATGAT) and the brominated derivative, d(AC BrUCGGA BrUGAT). These oligonucleotides form parallel-stranded duplexes with a crystallographically equivalent strand, resulting in the first examples of DNA crystal structures that contains four different symmetric homo base pairs. Two of the parallel-stranded duplexes are coaxially stacked in opposite directions and locked together to form a tetraplex through intercalation of the 5'-most A–A basemore » pairs between adjacent G–G pairs in the partner duplex. The intercalation region is a new type of DNA tertiary structural motif with similarities to the i-motif. 1H– 1H nuclear magnetic resonance and native gel electrophoresis confirmed the formation of a parallel-stranded duplex in solution. Finally, we modified specific nucleotide positions and added d(GAY) motifs to oligonucleotides and were readily able to obtain similar crystals. This suggests that this parallel-stranded DNA structure may be useful in the rational design of DNA crystals and nanostructures.« less

Spectrophotometric determination of trazodone, amineptine and amitriptyline hydrochlorides through ion-pair formation with molybdenum and thiocyanate

NASA Astrophysics Data System (ADS)

Mohamed, Gehad G.; Nour El-Dien, F. A.; Khalil, S. M.; Mohamed, Nehad A.

2006-12-01

Extraction spectrophotometric method has been developed for the determination of tricyclic drugs such as trazodone (TZH), amineptine (APH) and amitriptyline (ATPH) hydrochlorides in pure form and in the dosage forms coming from different Egyptian markets. The method based on the formation of ion-pairs between these drugs under investigation and inorganic complex of Mo(V)-thiocyanate followed by its extraction with methylene chloride. The optimum conditions for the ion-pairs formation are established. The method permits the determination of TZH, APH and ATPH over the concentration range of 2-28, 2-32 and 1-30 μg ml -1, respectively. The Sandell sensitivity ( S) is found to be 0.105, 0.138 and 0.118 g cm -2 for TZH, APH and ATPH, respectively. The SD is found to be 0.16-0.377, 0.12-0.259 and 0.091-0.286 and the R.S.D. are 0.14-0.55, 0.12-0.399 and 0.095-0.485 for TZH, APH and ATPH, respectively. The method is applicable for the assay of the investigated drugs in different dosage forms and the results are in good agreement with those obtained by the official method.

Integrated resonant micro-optical gyroscope and method of fabrication

DOEpatents

Vawter, G Allen [Albuquerque, NM; Zubrzycki, Walter J [Sandia Park, NM; Guo, Junpeng [Albuquerque, NM; Sullivan, Charles T [Albuquerque, NM

2006-09-12

An integrated optic gyroscope is disclosed which is based on a photonic integrated circuit (PIC) having a bidirectional laser source, a pair of optical waveguide phase modulators and a pair of waveguide photodetectors. The PIC can be connected to a passive ring resonator formed either as a coil of optical fiber or as a coiled optical waveguide. The lasing output from each end of the bidirectional laser source is phase modulated and directed around the passive ring resonator in two counterpropagating directions, with a portion of the lasing output then being detected to determine a rotation rate for the integrated optical gyroscope. The coiled optical waveguide can be formed on a silicon, glass or quartz substrate with a silicon nitride core and a silica cladding, while the PIC includes a plurality of III V compound semiconductor layers including one or more quantum well layers which are disordered in the phase modulators and to form passive optical waveguides.

[Pharmacokinetic research strategies of compatibilities and synergistic effects of classical Danshen herb pairs based on pharmacokinetics of "Danshen-Bingpian" and "Danshen-Honghua"].

PubMed

Zhang, Cui-Ying; Ren, Wei-Guang

2017-06-01

Herb pairs are usual clinical compatibility forms and one of compound prescription sources in Chinese medicine. Pharmacokinetic research in vivo is one of the important items in elucidating the mechanism for synergistic and attenuated mechanisms of herb pairs. The paper comprehensively summarized and systemized the pharmacokinetic researches of marker-ingredients about Danshen-Honghua and Danshen-Bingpian in order to elucidate the rationality and scientificity of herb pairs and provide some feasible suggestions on the pharmacokinetics of drugs in the future. In view of complicated system of Traditional Chinese medicines and a chemical system that is not separated from its natural state, comparative pharmacokinetic researches on marker-ingredients from the herb pairs are reasonable to elucidate the synergistic and attenuated mechanisms of monarch-subjects compatible herbs and monarch-guide compatible herbs. Such pharmacokinetic research can better explain the mechanism of drug compatibility, while the pharmacokinetic researches based on the monomer chemical compositions and marker-ingredients that have been separated from complex chemical environment of traditional Chinese Medicine are still unreasonable and should be discussed deeply. Copyright© by the Chinese Pharmaceutical Association.

Asteroid Systems: Binaries, Triples, and Pairs

NASA Astrophysics Data System (ADS)

Margot, J.-L.; Pravec, P.; Taylor, P.; Carry, B.; Jacobson, S.

In the past decade, the number of known binary near-Earth asteroids has more than quadrupled and the number of known large main-belt asteroids with satellites has doubled. Half a dozen triple asteroids have been discovered, and the previously unrecognized populations of asteroid pairs and small main-belt binaries have been identified. The current observational evidence confirms that small (≲20 km) binaries form by rotational fission and establishes that the Yarkovsky-O'Keefe-Radzievskii-Paddack (YORP) effect powers the spin-up process. A unifying paradigm based on rotational fission and post-fission dynamics can explain the formation of small binaries, triples, and pairs. Large (>~20 km) binaries with small satellites are most likely created during large collisions.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Faucher, Frédérick; Robey-Bond, Susan M.; Wallace, Susan S.

DNA is subject to a multitude of oxidative damages generated by oxidizing agents from metabolism and exogenous sources and by ionizing radiation. Guanine is particularly vulnerable to oxidation, and the most common oxidative product 8-oxoguanine (8-oxoG) is the most prevalent lesion observed in DNA molecules. 8-OxoG can form a normal Watson-Crick pair with cytosine (8-oxoG:C), but it can also form a stable Hoogsteen pair with adenine (8-oxoG:A), leading to a G:C {yields} T:A transversion after replication. Fortunately, 8-oxoG is recognized and excised by either of two DNA glycosylases of the base excision repair pathway: formamidopyrimidine-DNA glycosylase and 8-oxoguanine DNA glycosylasemore » (Ogg). While Clostridium acetobutylicum Ogg (CacOgg) DNA glycosylase can specifically recognize and remove 8-oxoG, it displays little preference for the base opposite the lesion, which is unusual for a member of the Ogg1 family. This work describes the crystal structures of CacOgg in its apo form and in complex with 8-oxo-2'-deoxyguanosine. A structural comparison between the apo form and the liganded form of the enzyme reveals a structural reorganization of the C-terminal domain upon binding of 8-oxoG, similar to that reported for human OGG1. A structural comparison of CacOgg with human OGG1, in complex with 8-oxoG containing DNA, provides a structural rationale for the lack of opposite base specificity displayed by CacOgg.« less

Damage mechanism of hydroxyl radicals toward adenine—thymine base pair

NASA Astrophysics Data System (ADS)

Tan, Rong-Ri; Wang, Dong-Qi; Zhang, Feng-Shou

2014-02-01

The adenine—thymine base pair was studied in the presence of hydroxyl radicals in order to probe the hydrogen bond effect. The results show that the hydrogen bonds have little effect on the hydroxylation and dehydrogenation happened at the sites, which are not involved in a hydrogen bond, while at the sites involved in hydrogen bond formation in the base pair, the reaction becomes more difficult, both in view of the free energy barrier and the exothermicity. With a 6-311++G(d,p) level of description, both B3LYP and MP2 methods confirm that the C8 site of isolated adenine has the highest possibility to form covalent bond with the hydroxyl radicals, though with different energetics: B3LYP predicts a barrierless pathway, while MP2 finds a transition state with an energy of 106.1 kJ/mol. For the dehydrogenation reactions, B3LYP method predicts that the free energy barrier increases in the order of HN9 < HN61 < HN62 < H2 < H8.

Comparative morphology and ultrastructure of the prosomal salivary glands in the unfed larvae Leptotrombidium orientale (Acariformes, Trombiculidae), a possible vector of tsutsugamushi disease agent.

PubMed

Shatrov, Andrew B

2015-07-01

The prosomal salivary glands of the unfed larvae Leptotrombidium orientale (Schluger) were investigated using transmission electron microscopy. In total, four pairs of the prosomal glands were identified--three pairs, the lateral, the medial and the anterior, belong to the podocephalic system, and one pair, the posterior, is separate having an own excretory duct. All glands are simple alveolar/acinous with prismatic cells arranged around a relatively small intra-alveolar lumen with the duct base. The cells of all glands besides the lateral ones contain practically mature electron-dense secretory granules ready to be discharged from the cells. The secretory granules in the lateral glands undergo formation and maturation due to the Golgi body activity. The cells of all gland types contain a large basally located nucleus and variously expressed rough endoplasmic reticulum. Specialized duct-forming cells filled with numerous freely scattered microtubules are situated in the middle zone of each gland's acinus and form the intra-alveolar lumen and the duct base. Both the acinar (secretory) and the duct-forming cells contact each other via gap junctions and septate desmosomes. Axons of nerve cells come close to the basal extensions of the duct-forming cells where they form the bulb-shaped synaptic terminations. The process of secretion is under the control of the nerve system that provides contraction of the duct-forming cells and discharge of secretion from the secretory cells into the intra-alveolar lumen and further to the exterior. Unfed larvae of L. orientale, the potential vector of tsutsugamushi disease agents, contain the most simply organized salivary secretory granules among known trombiculid larvae, and this secretion, besides the lateral glands, does not undergo significant additional maturation. Thus, the larvae are apparently ready to feed on the appropriate host just nearly after hatching.

Replication infidelity via a mismatch with Watson-Crick geometry.

PubMed

Bebenek, Katarzyna; Pedersen, Lars C; Kunkel, Thomas A

2011-02-01

In describing the DNA double helix, Watson and Crick suggested that "spontaneous mutation may be due to a base occasionally occurring in one of its less likely tautomeric forms." Indeed, among many mispairing possibilities, either tautomerization or ionization of bases might allow a DNA polymerase to insert a mismatch with correct Watson-Crick geometry. However, despite substantial progress in understanding the structural basis of error prevention during polymerization, no DNA polymerase has yet been shown to form a natural base-base mismatch with Watson-Crick-like geometry. Here we provide such evidence, in the form of a crystal structure of a human DNA polymerase λ variant poised to misinsert dGTP opposite a template T. All atoms needed for catalysis are present at the active site and in positions that overlay with those for a correct base pair. The mismatch has Watson-Crick geometry consistent with a tautomeric or ionized base pair, with the pH dependence of misinsertion consistent with the latter. The results support the original idea that a base substitution can originate from a mismatch having Watson-Crick geometry, and they suggest a common catalytic mechanism for inserting a correct and an incorrect nucleotide. A second structure indicates that after misinsertion, the now primer-terminal G • T mismatch is also poised for catalysis but in the wobble conformation seen in other studies, indicating the dynamic nature of the pathway required to create a mismatch in fully duplex DNA.

The 5S ribosomal RNAs of Paracoccus denitrificans and Prochloron

NASA Technical Reports Server (NTRS)

Mackay, R. M.; Salgado, D.; Bonen, L.; Doolittle, W. F.; Stackebrandt, E.

1982-01-01

The nucleotide sequences of the 5S rRNAs of Paracoccus denitrificans and Prochloron sp. are presented, along with the demonstrated phylogenetic relationships of P. denitrificans with purple nonsulfur bacteria, and of Prochloron with cyanobacteria. Structural findings include the following: (1) helix II in both models is much shorter than in other eubacteria, (2) a base-pair has been deleted from helix IV of P. denitrificans 5S, and (3) Prochloron 5S has the potential to form four base-pairs between residues. Also covered are the differences between pairs of sequences in P. denitrificans, Prochloron, wheat mitochondion, spinach chloroplast, and nine diverse eubacteria. Findings include the observation that Prochloron 5S rRNA is much more similar to the 5S of the cyanobacterium Anacystis nidulans (25 percent difference) than either are to any of the other nine eubacterial 5S rRNAs.

Structure, stability and behaviour of nucleic acids in ionic liquids

PubMed Central

Tateishi-Karimata, Hisae; Sugimoto, Naoki

2014-01-01

Nucleic acids have become a powerful tool in nanotechnology because of their conformational polymorphism. However, lack of a medium in which nucleic acid structures exhibit long-term stability has been a bottleneck. Ionic liquids (ILs) are potential solvents in the nanotechnology field. Hydrated ILs, such as choline dihydrogen phosphate (choline dhp) and deep eutectic solvent (DES) prepared from choline chloride and urea, are ‘green’ solvents that ensure long-term stability of biomolecules. An understanding of the behaviour of nucleic acids in hydrated ILs is necessary for developing DNA materials. We here review current knowledge about the structures and stabilities of nucleic acids in choline dhp and DES. Interestingly, in choline dhp, A–T base pairs are more stable than G–C base pairs, the reverse of the situation in buffered NaCl solution. Moreover, DNA triplex formation is markedly stabilized in hydrated ILs compared with aqueous solution. In choline dhp, the stability of Hoogsteen base pairs is comparable to that of Watson–Crick base pairs. Moreover, the parallel form of the G-quadruplex is stabilized in DES compared with aqueous solution. The behaviours of various DNA molecules in ILs detailed here should be useful for designing oligonucleotides for the development of nanomaterials and nanodevices. PMID:25013178

DOE Office of Scientific and Technical Information (OSTI.GOV)

Szulik, Marta W.; Pallan, Pradeep S.; Nocek, Boguslaw

5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson–Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5'-CG-3' sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5'-T 8X 9G 10-3' sequence of the DDD, were compared. The presence of 5caC at the X9 base increased the stability of the DDD, whereas 5hmC or 5fC didmore » not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A 5:T 8, whereas 5caC did not. At the oxidized base pair G 4:X 9, 5fC exhibited an increase in the imino proton exchange rate and the calculated k op. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C 3:G 10. No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G 4:X 9; each favored Watson–Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N 4 exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. Furthermore, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes.« less

UGC 4703 Interacting Pair Near the Isolated Spiral Galaxy NGC 2718: A Milky Way Magellanic Cloud Analog

NASA Astrophysics Data System (ADS)

Paudel, Sanjaya; Sengupta, C.

2017-11-01

We present an analysis of physical and morphological properties of an interacting pair of dwarf galaxies, UGC 4703, located in the vicinity of an isolated Milky Way (MW) type spiral galaxy NGC 2718. Based on the comparison of physical and morphological properties with that of the Large and Small Magellanic Clouds (LMC and SMC), we report that the UGC 4703 pair-NGC 2718 system is probably an LMC-SMC-MW analog. Located at a sky-projected distance of 81 kpc from NGC 2718, we find that UGC 4703 is clearly interacting with its nearby lower-mass companion UGC 4703B, forming a bridge of stellar stream between them. Total B-band luminosity of UGC 4703 and its companion is -17.75 and -16.25 mag, respectively. We obtained H I 21 cm line data of UGC 4703 using the GMRT to get a more detailed view of neutral hydrogen (H I) emission. The H I image revealed evidence of interaction between the dwarf galaxy pair but no extended emission, such as the Magellanic Stream. We also detected star-forming regions along the UGC 4703/4703B bridge with stellar mass exceeding 107 M ⊙. While comparing the optical and H I morphology of the interacting dwarf pairs (UGC 4703-4703B and LMC-SMC), we discuss possible differences in interaction histories of these systems.

pH-Modulated Watson-Crick duplex-quadruplex equilibria of guanine-rich and cytosine-rich DNA sequences 140 base pairs upstream of the c-kit transcription initiation site.

PubMed

Bucek, Pavel; Jaumot, Joaquim; Aviñó, Anna; Eritja, Ramon; Gargallo, Raimundo

2009-11-23

Guanine-rich regions of DNA are sequences capable of forming G-quadruplex structures. The formation of a G-quadruplex structure in a region 140 base pairs (bp) upstream of the c-kit transcription initiation site was recently proposed (Fernando et al., Biochemistry, 2006, 45, 7854). In the present study, the acid-base equilibria and the thermally induced unfolding of the structures formed by a guanine-rich region and by its complementary cytosine-rich strand in c-kit were studied by means of circular dichroism and molecular absorption spectroscopies. In addition, competition between the Watson-Crick duplex and the isolated structures was studied as a function of pH value and temperature. Multivariate data analysis methods based on both hard and soft modeling were used to allow accurate quantification of the various acid-base species present in the mixtures. Results showed that the G-quadruplex and i-motif coexist with the Watson-Crick duplex over the pH range from 3.0 to 6.5, approximately, under the experimental conditions tested in this study. At pH 7.0, the duplex is practically the only species present.

Prefixation of Simplex Pairs in Czech: An Analysis of Spatial Semantics, Distributive Verbs, and Procedural Meanings

ERIC Educational Resources Information Center

Hilchey, Christian Thomas

2014-01-01

This dissertation examines prefixation of simplex pairs. A simplex pair consists of an iterative imperfective and a semelfactive perfective verb. When prefixed, both of these verbs are perfective. The prefixed forms derived from semelfactives are labeled single act verbs, while the prefixed forms derived from iterative imperfective simplex verbs…

Building a Semiotic Repertoire for Social Action: Interactional Competence as Biographical Discovery

ERIC Educational Resources Information Center

Eskildsen, Søren W.

2018-01-01

This commentary draws on the four articles in this issue to discuss interactional competence from a usage-based perspective. The usage-based conception of language knowledge as an inventory of form-meaning pairings used for communicative purposes will be qualified by incorporating the idea that these communicative purposes are social actions. L2…

Unique active site promotes error-free replication opposite an 8-oxo-guanine lesion by human DNA polymerase iota

PubMed Central

Kirouac, Kevin N.; Ling, Hong

2011-01-01

The 8-oxo-guanine (8-oxo-G) lesion is the most abundant and mutagenic oxidative DNA damage existing in the genome. Due to its dual coding nature, 8-oxo-G causes most DNA polymerases to misincorporate adenine. Human Y-family DNA polymerase iota (polι) preferentially incorporates the correct cytosine nucleotide opposite 8-oxo-G. This unique specificity may contribute to polι’s biological role in cellular protection against oxidative stress. However, the structural basis of this preferential cytosine incorporation is currently unknown. Here we present four crystal structures of polι in complex with DNA containing an 8-oxo-G lesion, paired with correct dCTP or incorrect dATP, dGTP, and dTTP nucleotides. An exceptionally narrow polι active site restricts the purine bases in a syn conformation, which prevents the dual coding properties of 8-oxo-G by inhibiting syn/anti conformational equilibrium. More importantly, the 8-oxo-G base in a syn conformation is not mutagenic in polι because its Hoogsteen edge does not form a stable base pair with dATP in the narrow active site. Instead, the syn 8-oxo-G template base forms the most stable replicating base pair with correct dCTP due to its small pyrimidine base size and enhanced hydrogen bonding with the Hoogsteen edge of 8-oxo-G. In combination with site directed mutagenesis, we show that Gln59 in the finger domain specifically interacts with the additional O8 atom of the lesion base, which influences nucleotide selection, enzymatic efficiency, and replication stalling at the lesion site. Our work provides the structural mechanism of high-fidelity 8-oxo-G replication by a human DNA polymerase. PMID:21300901

Stereochronoscopy of the optic disc with stereoscopic cameras.

PubMed

Schirmer, K E; Kratky, V

1980-09-01

Goldmann's chronoscopy, a form of time-based photogrammetry of the optic disc, can be accomplished by repeated simultaneous stereophotography. The variations in centration and image orientation are nulled by azimuthal rotation and fusion of two pairs of stereophotographs taken at separate times.

Automated extraction and classification of RNA tertiary structure cyclic motifs

PubMed Central

Lemieux, Sébastien; Major, François

2006-01-01

A minimum cycle basis of the tertiary structure of a large ribosomal subunit (LSU) X-ray crystal structure was analyzed. Most cycles are small, as they are composed of 3- to 5 nt, and repeated across the LSU tertiary structure. We used hierarchical clustering to quantify and classify the 4 nt cycles. One class is defined by the GNRA tetraloop motif. The inspection of the GNRA class revealed peculiar instances in sequence. First is the presence of UA, CA, UC and CC base pairs that substitute the usual sheared GA base pair. Second is the revelation of GNR(Xn)A tetraloops, where Xn is bulged out of the classical GNRA structure, and of GN/RA formed by the two strands of interior-loops. We were able to unambiguously characterize the cycle classes using base stacking and base pairing annotations. The cycles identified correspond to small and cyclic motifs that compose most of the LSU RNA tertiary structure and contribute to its thermodynamic stability. Consequently, the RNA minimum cycles could well be used as the basic elements of RNA tertiary structure prediction methods. PMID:16679452

Intermolecular interactions of trifluorohalomethanes with Lewis bases in the gas phase: An ab initio study

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Yi-Siang; Yin, Chih-Chien; Chao, Sheng D., E-mail: sdchao@spring.iam.ntu.edu.tw

2014-10-07

We perform an ab initio computational study of molecular complexes with the general formula CF{sub 3}X—B that involve one trifluorohalomethane CF{sub 3}X (X = Cl or Br) and one of a series of Lewis bases B in the gas phase. The Lewis bases are so chosen that they provide a range of electron-donating abilities for comparison. Based on the characteristics of their electron pairs, we consider the Lewis bases with a single n-pair (NH{sub 3} and PH{sub 3}), two n-pairs (H{sub 2}O and H{sub 2}S), two n-pairs with an unsaturated bond (H{sub 2}CO and H{sub 2}CS), and a single π-pairmore » (C{sub 2}H{sub 4}) and two π-pairs (C{sub 2}H{sub 2}). The aim is to systematically investigate the influence of the electron pair characteristics and the central atom substitution effects on the geometries and energetics of the formed complexes. The counterpoise-corrected supermolecule MP2 and coupled-cluster single double with perturbative triple [CCSD(T)] levels of theory have been employed, together with a series of basis sets up to aug-cc-pVTZ. The angular and radial configurations, the binding energies, and the electrostatic potentials of the stable complexes have been compared and discussed as the Lewis base varies. For those complexes where halogen bonding plays a significant role, the calculated geometries and energetics are consistent with the σ-hole model. Upon formation of stable complexes, the C–X bond lengths shorten, while the C–X vibrational frequencies increase, thus rendering blueshifting halogen bonds. The central atom substitution usually enlarges the intermolecular bond distances while it reduces the net charge transfers, thus weakening the bond strengths. The analysis based on the σ-hole model is grossly reliable but requires suitable modifications incorporating the central atom substitution effects, in particular, when interaction components other than electrostatic contributions are involved.« less

Generation and analysis of correlated pairs of photons on board a nanosatellite

NASA Astrophysics Data System (ADS)

Chandrasekara, R.; Tang, Z.; Tan, Y. C.; Cheng, C.; Sha, L.; Hiang, G. C.; Oi, D.; Ling, A.

2016-10-01

Progress in quantum computers and their threat to conventional public key infrastructure is driving new forms of encryption. Quantum Key Distribution (QKD) using entangled photons is a promising approach. A global QKD network can be achieved using satellites equipped with optical links. Despite numerous proposals, actual experimental work demonstrating relevant entanglement technology in space is limited due to the prohibitive cost of traditional satellite development. To make progress, we have designed a photon pair source that can operate on modular spacecraft called CubeSats. We report the in-orbit operation of the photon pair source on board an orbiting CubeSat and demonstrate pair generation and polarisation correlation under space conditions. The in-orbit polarisation correlations are compatible with ground-based tests, validating our design. This successful demonstration is a major experimental milestone towards a space-based quantum network. Our approach provides a cost-effective method for proving the space-worthiness of critical components used in entangled photon technology. We expect that it will also accelerate efforts to probe the overlap between quantum and relativistic models of physics.

Alloy solution hardening with solute pairs

DOEpatents

Mitchell, John W.

1976-08-24

Solution hardened alloys are formed by using at least two solutes which form associated solute pairs in the solvent metal lattice. Copper containing equal atomic percentages of aluminum and palladium is an example.

Replication infidelity via a mismatch with Watson–Crick geometry

PubMed Central

Bebenek, Katarzyna; Pedersen, Lars C.; Kunkel, Thomas A.

2011-01-01

In describing the DNA double helix, Watson and Crick suggested that “spontaneous mutation may be due to a base occasionally occurring in one of its less likely tautomeric forms.” Indeed, among many mispairing possibilities, either tautomerization or ionization of bases might allow a DNA polymerase to insert a mismatch with correct Watson–Crick geometry. However, despite substantial progress in understanding the structural basis of error prevention during polymerization, no DNA polymerase has yet been shown to form a natural base–base mismatch with Watson–Crick-like geometry. Here we provide such evidence, in the form of a crystal structure of a human DNA polymerase λ variant poised to misinsert dGTP opposite a template T. All atoms needed for catalysis are present at the active site and in positions that overlay with those for a correct base pair. The mismatch has Watson–Crick geometry consistent with a tautomeric or ionized base pair, with the pH dependence of misinsertion consistent with the latter. The results support the original idea that a base substitution can originate from a mismatch having Watson–Crick geometry, and they suggest a common catalytic mechanism for inserting a correct and an incorrect nucleotide. A second structure indicates that after misinsertion, the now primer-terminal G•T mismatch is also poised for catalysis but in the wobble conformation seen in other studies, indicating the dynamic nature of the pathway required to create a mismatch in fully duplex DNA. PMID:21233421

ATP hydrolysis provides functions that promote rejection of pairings between different copies of long repeated sequences

PubMed Central

Danilowicz, Claudia; Hermans, Laura; Coljee, Vincent; Prévost, Chantal

2017-01-01

Abstract During DNA recombination and repair, RecA family proteins must promote rapid joining of homologous DNA. Repeated sequences with >100 base pair lengths occupy more than 1% of bacterial genomes; however, commitment to strand exchange was believed to occur after testing ∼20–30 bp. If that were true, pairings between different copies of long repeated sequences would usually become irreversible. Our experiments reveal that in the presence of ATP hydrolysis even 75 bp sequence-matched strand exchange products remain quite reversible. Experiments also indicate that when ATP hydrolysis is present, flanking heterologous dsDNA regions increase the reversibility of sequence matched strand exchange products with lengths up to ∼75 bp. Results of molecular dynamics simulations provide insight into how ATP hydrolysis destabilizes strand exchange products. These results inspired a model that shows how pairings between long repeated sequences could be efficiently rejected even though most homologous pairings form irreversible products. PMID:28854739

Gut microbiomes of Malawian twin pairs discordant for kwashiorkor

PubMed Central

Smith, Michelle I.; Yatsunenko, Tanya; Manary, Mark J.; Trehan, Indi; Mkakosya, Rajhab; Cheng, Jiye; Kau, Andrew L.; Rich, Stephen S.; Concannon, Patrick; Mychaleckyj, Josyf C.; Liu, Jie; Houpt, Eric; Li, Jia V.; Holmes, Elaine; Nicholson, Jeremy; Knights, Dan; Ursell, Luke K.; Knight, Rob; Gordon, Jeffrey I.

2013-01-01

Kwashiorkor, an enigmatic form of severe acute malnutrition, is the consequence of inadequate nutrient intake plus additional environmental insults. To investigate the role of the gut microbiome, we studied 317 Malawian twin pairs during the first 3 years of life. During this time, half of the twin pairs remained well-nourished, while 43% became discordant and 7% manifested concordance for acute malnutrition. Both children in twin pairs discordant for kwashiorkor were treated with a peanut-based, ready-to-use therapeutic food (RUTF). Time-series metagenomic studies revealed that RUTF produced a transient maturation of metabolic functions in kwashiorkor microbiomes that regressed when RUTF was stopped. Previously frozen fecal communities from several discordant pairs were each transplanted into gnotobiotic mice. The combination of Malawian diet and kwashiorkor microbiome produced marked weight loss in recipient mice, accompanied by perturbations in amino acid, carbohydrate and intermediary metabolism that were only transiently ameliorated with RUTF. These findings implicate the gut microbiome as a causal factor in kwashiorkor. PMID:23363771

Isoscalar neutron-proton pairing and SU(4)-symmetry breaking in Gamow-Teller transitions

NASA Astrophysics Data System (ADS)

Kaneko, K.; Sun, Y.; Mizusaki, T.

2018-05-01

The isoscalar neutron-proton pairing is thought to be important for nuclei with equal number of protons and neutrons but its manifestation in structure properties remains to be understood. We investigate the Gamow-Teller (GT) transitions for the f7 /2-shell nuclei in large-scale shell-model calculations with the realistic Hamiltonian. We show that the isoscalar T =0 ,Jπ=1+ neutron-proton pairing interaction plays a decisive role for the concentration of GT strengths at the first-excited 11+ state in 42Sc, and that the suppression of these strengths in 46V, 50Mn, and 54Co is mainly caused by the spin-orbit force supplemented by the quadrupole-quadrupole interaction. Based on the good reproduction of the charge-exchange reaction data, we further analyze the interplay between the isoscalar and isovector pairing correlations. We conclude that even for the most promising A =42 nuclei where the SU(4) isoscalar-isovector-pairing symmetry is less broken, the probability of forming an isoscalar neutron-proton pairing condensation is less than 60% as compared to the expectation at the SU(4)-symmetry limit.

A random access memory immune to single event upset using a T-Resistor

DOEpatents

Ochoa, A. Jr.

1987-10-28

In a random access memory cell, a resistance ''T'' decoupling network in each leg of the cell reduces random errors caused by the interaction of energetic ions with the semiconductor material forming the cell. The cell comprises two parallel legs each containing a series pair of complementary MOS transistors having a common gate connected to the node between the transistors of the opposite leg. The decoupling network in each leg is formed by a series pair of resistors between the transistors together with a third resistor interconnecting the junction between the pair of resistors and the gate of the transistor pair forming the opposite leg of the cell. 4 figs.

Random access memory immune to single event upset using a T-resistor

DOEpatents

Ochoa, Jr., Agustin

1989-01-01

In a random access memory cell, a resistance "T" decoupling network in each leg of the cell reduces random errors caused by the interaction of energetic ions with the semiconductor material forming the cell. The cell comprises two parallel legs each containing a series pair of complementary MOS transistors having a common gate connected to the node between the transistors of the opposite leg. The decoupling network in each leg is formed by a series pair of resistors between the transistors together with a third resistor interconnecting the junction between the pair of resistors and the gate of the transistor pair forming the opposite leg of the cell.

Repairing the sickle cell mutation. I. Specific covalent binding of a photoreactive third strand to the mutated base pair.

PubMed

Broitman, S; Amosova, O; Dolinnaya, N G; Fresco, J R

1999-07-30

A DNA third strand with a 3'-psoralen substituent was designed to form a triplex with the sequence downstream of the T.A mutant base pair of the human sickle cell beta-globin gene. Triplex-mediated psoralen modification of the mutant T residue was sought as an approach to gene repair. The 24-nucleotide purine-rich target sequence switches from one strand to the other and has four pyrimidine interruptions. Therefore, a third strand sequence favorable to two triplex motifs was used, one parallel and the other antiparallel to it. To cope with the pyrimidine interruptions, which weaken third strand binding, 5-methylcytosine and 5-propynyluracil were used in the third strand. Further, a six residue "hook" complementary to an overhang of a linear duplex target was added to the 5'-end of the third strand via a T(4) linker. In binding to the overhang by Watson-Crick pairing, the hook facilitates triplex formation. This third strand also binds specifically to the target within a supercoiled plasmid. The psoralen moiety at the 3'-end of the third strand forms photoadducts to the targeted T with high efficiency. Such monoadducts are known to preferentially trigger reversion of the mutation by DNA repair enzymes.

Centromere Pairing in Early Meiotic Prophase Requires Active Centromeres and Precedes Installation of the Synaptonemal Complex in Maize[W

PubMed Central

Zhang, Jing; Pawlowski, Wojciech P.; Han, Fangpu

2013-01-01

Pairing of homologous chromosomes in meiosis is critical for their segregation to daughter cells. In most eukaryotes, clustering of telomeres precedes and facilitates chromosome pairing. In several species, centromeres also form pairwise associations, known as coupling, before the onset of pairing. We found that, in maize (Zea mays), centromere association begins at the leptotene stage and occurs earlier than the formation of the telomere bouquet. We established that centromere pairing requires centromere activity and the sole presence of centromeric repeats is not sufficient for pairing. In several species, homologs of the ZIP1 protein, which forms the central element of the synaptonemal complex in budding yeast (Saccharomyces cerevisiae), play essential roles in centromere coupling. However, we found that the maize ZIP1 homolog ZYP1 installs in the centromeric regions of chromosomes after centromeres form associations. Instead, we found that maize STRUCTURAL MAINTENANCE OF CHROMOSOMES6 homolog forms a central element of the synaptonemal complex, which is required for centromere associations. These data shed light on the poorly understood mechanism of centromere interactions and suggest that this mechanism may vary somewhat in different species. PMID:24143803

Centromere pairing in early meiotic prophase requires active centromeres and precedes installation of the synaptonemal complex in maize.

PubMed

Zhang, Jing; Pawlowski, Wojciech P; Han, Fangpu

2013-10-01

Pairing of homologous chromosomes in meiosis is critical for their segregation to daughter cells. In most eukaryotes, clustering of telomeres precedes and facilitates chromosome pairing. In several species, centromeres also form pairwise associations, known as coupling, before the onset of pairing. We found that, in maize (Zea mays), centromere association begins at the leptotene stage and occurs earlier than the formation of the telomere bouquet. We established that centromere pairing requires centromere activity and the sole presence of centromeric repeats is not sufficient for pairing. In several species, homologs of the ZIP1 protein, which forms the central element of the synaptonemal complex in budding yeast (Saccharomyces cerevisiae), play essential roles in centromere coupling. However, we found that the maize ZIP1 homolog ZYP1 installs in the centromeric regions of chromosomes after centromeres form associations. Instead, we found that maize structural maintenance of chromosomes6 homolog forms a central element of the synaptonemal complex, which is required for centromere associations. These data shed light on the poorly understood mechanism of centromere interactions and suggest that this mechanism may vary somewhat in different species.

Form and meaning in early morphological processing: Comment on Feldman, O'Connor, and Moscoso del Prado Martin (2009).

PubMed

Davis, Matthew H; Rastle, Kathleen

2010-10-01

Feldman, O'Connor, and Moscoso del Prado Martín (2009) reported evidence for differential priming of semantically transparent (talker-talk) and semantically opaque (corner-corn) morphological pairs under masked presentation conditions. The present commentary argues that these data should not call into question the theory that morphologically structured words undergo a segmentation process based solely on form, because (1) these results do not contradict existing evidence for morpho-orthographic segmentation, (2) funnel plots suggest that the lack of priming observed for semantically opaque items in this study is inconsistent with findings in the existing literature, and (3) orthographic characteristics of the semantically opaque pairs in this study (rather than semantic factors) are the most likely explanation for these discrepant results.

Sensitization of photoconductivity in ferrocene-containing oligomer by squarylium and merocyanine dyes

NASA Astrophysics Data System (ADS)

Davidenko, N. A.; Ishchenko, A. A.; Kozinets, A. V.; Kostenko, L. I.; Kurdyukova, I. V.; Mokrinskaya, E. V.; Studzinskii, S. L.; Chuprina, N. G.

2011-03-01

We have studied the photoconducting properties of films of ferrocene-containing oligomer with additives of squarylium and merocyanine dyes based on ferrocene and tetranitrofluorene in the dye absorption region. We have studied the characteristic features of the effect of an external magnetic field on the photocurrents. After the magnetic field is turned on, the photocurrent increases in the samples with squarylium dye and decreases in the samples with merocyanine dye. We discuss the hypothesis that in the first case, as a result of an internal photoelectric effect, predominantly triplet charge pairs are formed, while in the second case predominantly singlet charge pairs are formed. The latter may be one of the reasons for the higher photoconductivity of films with squarylium dye compared with merocyanine dye.

Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3;-terminus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yeo, Hyun Koo; Lee, Jae Young

2012-04-18

The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapor diffusion and diffracted to 2.8 {angstrom} resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 {angstrom}, {alpha} = 91.37, {beta} = 93.21, {gamma} = 92.35{sup o}.

Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus.

PubMed

Yeo, Hyun Koo; Lee, Jae Young

2010-05-01

The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapour diffusion and diffracted to 2.8 A resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 A, alpha = 91.37, beta = 93.21, gamma = 92.35 degrees .

Method for hot press forming articles

DOEpatents

Baker, Robert R.; Hartsock, Dale L.

1982-01-01

This disclosure relates to an improved method for achieving the best bond strength and for minimizing distortion and cracking of hot pressed articles. In particular, in a method for hot press forming both an outer facing circumferential surface of and an inner portion of a hub, and of bonding that so-formed outer facing circumferential surface to an inner facing circumferential surface of a pre-formed ring thereby to form an article, the following improvement is made. Normally, in this method, the outside ring is restrained by a restraining sleeve of ring-shaped cross-section having an inside diameter. A die member, used to hot press form the hub, is so-formed as to have an outside diameter sized to engage the inside diameter of the restraining sleeve in a manner permitting relative movement therebetween. The improved method is one in which several pairs of matched restraining sleeve and die member are formed with each matched pair having a predetermined diameter. The predetermined diameter of each matched pair is different from another matched pair by stepped increments. The largest inside diameter of a restraining sleeve is equal to the diameter of the outer facing circumferential surface of the hub. Each pair of the matched restraining sleeve and die member is used to form an article in which an inside hub is bonded to an outside ring. The several samples so-formed are evaluated to determine which sample has the best bond formed between the hub and the ring with the least or no cracking or distortion in the ring portion of the article. Thereafter, the matched restraining sleeve and die member which form the article having the best bonding characteristics and least distortion cracking is then used for repeated formations of articles.

The First Row Anomaly and Recoupled Pair Bonding in the Halides of the Late p-Block Elements

PubMed Central

2012-01-01

The dramatic differences between the properties of molecules formed from the late p-block elements of the first row of the periodic table (N–F) and those of the corresponding elements in subsequent rows is well recognized as the first row anomaly. Certain properties of the atoms, such as the relative energies and spatial extents of the ns and np orbitals, can explain some of these differences, but not others. In this Account, we summarize the results of our recent computational studies of the halides of the late p-block elements. Our studies point to a single underlying cause for many of these differences: the ability of the late p-block elements in the second and subsequent rows of the periodic table to form recoupled pair bonds and recoupled pair bond dyads with very electronegative ligands. Recoupled pair bonds form when an electron in a singly occupied ligand orbital recouples the pair of electrons in a doubly occupied lone pair orbital on the central atom, leading to a central atom-ligand bond. Recoupled pair bond dyads occur when a second ligand forms a bond with the orbital left over from the initial recoupled pair bond. Recoupled pair bonds and recoupled pair bond dyads enable the late p-block elements to form remarkably stable hypervalent compounds such as PF5 and SF6 and lead to unexpected excited states in smaller halides of the late p-block elements such as SF and SF2. Recoupled pair bonding also causes the Fn–1X–F bond energies to oscillate dramatically once the normal valences of the central atoms have been satisfied. In addition, recoupled pair bonding provides a lower-energy pathway for inversion in heavily fluorinated compounds (PF3 and PF2H, but not PH2F and PH3) and leads to unusual intermediates and products in reactions involving halogens and late p-block element compounds, such as (CH3)2S + F2. Although this Account focuses on the halides of the second row, late p-block elements, recoupled pair bonds and recoupled pair bond dyads are important in the chemistry of p-block elements beyond the second row (As, Se, and Br) and for compounds of these elements with other very electronegative ligands, such as OH and O. Knowledge of recoupled pair bonding is thus critical to understanding the properties and reactivity of molecules containing the late p-block elements beyond the first row. PMID:23151313

The first row anomaly and recoupled pair bonding in the halides of the late p-block elements.

PubMed

Dunning, Thom H; Woon, David E; Leiding, Jeff; Chen, Lina

2013-02-19

The dramatic differences between the properties of molecules formed from the late p-block elements of the first row of the periodic table (N-F) and those of the corresponding elements in subsequent rows is well recognized as the first row anomaly. Certain properties of the atoms, such as the relative energies and spatial extents of the ns and np orbitals, can explain some of these differences, but not others. In this Account, we summarize the results of our recent computational studies of the halides of the late p-block elements. Our studies point to a single underlying cause for many of these differences: the ability of the late p-block elements in the second and subsequent rows of the periodic table to form recoupled pair bonds and recoupled pair bond dyads with very electronegative ligands. Recoupled pair bonds form when an electron in a singly occupied ligand orbital recouples the pair of electrons in a doubly occupied lone pair orbital on the central atom, leading to a central atom-ligand bond. Recoupled pair bond dyads occur when a second ligand forms a bond with the orbital left over from the initial recoupled pair bond. Recoupled pair bonds and recoupled pair bond dyads enable the late p-block elements to form remarkably stable hypervalent compounds such as PF(5) and SF(6) and lead to unexpected excited states in smaller halides of the late p-block elements such as SF and SF(2). Recoupled pair bonding also causes the F(n-1)X-F bond energies to oscillate dramatically once the normal valences of the central atoms have been satisfied. In addition, recoupled pair bonding provides a lower-energy pathway for inversion in heavily fluorinated compounds (PF(3) and PF(2)H, but not PH(2)F and PH(3)) and leads to unusual intermediates and products in reactions involving halogens and late p-block element compounds, such as (CH(3))(2)S + F(2). Although this Account focuses on the halides of the second row, late p-block elements, recoupled pair bonds and recoupled pair bond dyads are important in the chemistry of p-block elements beyond the second row (As, Se, and Br) and for compounds of these elements with other very electronegative ligands, such as OH and O. Knowledge of recoupled pair bonding is thus critical to understanding the properties and reactivity of molecules containing the late p-block elements beyond the first row.

Formation of rings from segments of HeLa-cell nuclear deoxyribonucleic acid

PubMed Central

Hardman, Norman

1974-01-01

Duplex segments of HeLa-cell nuclear DNA were generated by cleavage with DNA restriction endonuclease from Haemophilus influenzae. About 20–25% of the DNA segments produced, when partly degraded with exonuclease III and annealed, were found to form rings visible in the electron microscope. A further 5% of the DNA segments formed structures that were branched in configuration. Similar structures were generated from HeLa-cell DNA, without prior treatment with restriction endonuclease, when the complementary polynucleotide chains were exposed by exonuclease III action at single-chain nicks. After exposure of an average single-chain length of 1400 nucleotides per terminus at nicks in HeLa-cell DNA by exonuclease III, followed by annealing, the physical length of ring closures was estimated and found to be 0.02–0.1μm, or 50–300 base pairs. An almost identical distribution of lengths was recorded for the regions of complementary base sequence responsible for branch formation. It is proposed that most of the rings and branches are formed from classes of reiterated base sequence with an average length of 180 base pairs arranged intermittenly in HeLa-cell DNA. From the rate of formation of branched structures when HeLa-cell DNA segments were heat-denatured and annealed, it is estimated that the reiterated sequences are in families containing approximately 2400–24000 copies. ImagesPLATE 2PLATE 1 PMID:4462738

Intramolecular triple helix as a model for regular polyribonucleotide (CAA)(n).

PubMed

Efimov, Alexander V; Spirin, Alexander S

2009-10-09

The regular (CAA)(n) polyribonucleotide, as well as the omega leader sequence containing (CAA)-rich core, have recently been shown to form cooperatively melted and compact structures. In this report, we propose a structural model for the (CAA)(n) sequence in which the polyribonucleotide chain is folded upon itself, so that it forms an intramolecular triple helix. The triple helix is stabilized by hydrogen bonding between bases thus forming coplanar triads, and by stacking interactions between the base triads. A distinctive feature of the proposed triple helix is that it does not contain the canonical double-helix elements. The difference from the known triple helices is that Watson-Crick hydrogen bond pairings do not take place in the interactions between the bases within the base triads.

Fundamental aspects of recoupled pair bonds. I. Recoupled pair bonds in carbon and sulfur monofluoride

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dunning, Thom H., E-mail: thdjr@uw.edu; Xu, Lu T.; Takeshita, Tyler Y.

2015-01-21

The number of singly occupied orbitals in the ground-state atomic configuration of an element defines its nominal valence. For carbon and sulfur, with two singly occupied orbitals in their {sup 3}P ground states, the nominal valence is two. However, in both cases, it is possible to form more bonds than indicated by the nominal valence—up to four bonds for carbon and six bonds for sulfur. In carbon, the electrons in the 2s lone pair can participate in bonding, and in sulfur the electrons in both the 3p and 3s lone pairs can participate. Carbon 2s and sulfur 3p recoupled pairmore » bonds are the basis for the tetravalence of carbon and sulfur, and 3s recoupled pair bonds enable sulfur to be hexavalent. In this paper, we report generalized valence bond as well as more accurate calculations on the a{sup 4}Σ{sup −} states of CF and SF, which are archetypal examples of molecules that possess recoupled pair bonds. These calculations provide insights into the fundamental nature of recoupled pair bonds and illustrate the key differences between recoupled pair bonds formed with the 2s lone pair of carbon, as a representative of the early p-block elements, and recoupled pair bonds formed with the 3p lone pair of sulfur, as a representative of the late p-block elements.« less

Discriminating tastes

PubMed Central

Storz, Gisela

2011-01-01

Hfq-binding small RNAs (sRNAs) are critical regulators that form limited base-pairing interactions with target mRNAs in bacteria. These sRNAs have been linked to diverse environmental responses, yet little is known how Hfq-binding sRNAs participate in the regulatory networks associated with each response. We recently described how the Hfq-binding sRNA Spot 42 in Escherichia coli contributes to catabolite repression, a regulatory phenomenon that allows bacteria to consume some carbon sources over others. Spot 42 base pairs with numerous mRNAs encoding enzymes in central and secondary metabolism, redox balancing, and the uptake and consumption of non-preferred carbon sources. Many of the corresponding genes are transcriptionally activated by the Spot 42-repressor CRP, forming a regulatory circuit called a multi-output feedforward loop. We found that this loop influences both the steady-state levels and dynamics of gene regulation. In this article, we discuss how the CRP-Spot 42 feedforward loop is integrated into encompassing networks and how this loop may benefit enteric bacteria facing uncertain and changing nutrient conditions. PMID:21788732

Real-time observation of the initiation of RNA polymerase II transcription.

PubMed

Fazal, Furqan M; Meng, Cong A; Murakami, Kenji; Kornberg, Roger D; Block, Steven M

2015-09-10

Biochemical and structural studies have shown that the initiation of RNA polymerase II transcription proceeds in the following stages: assembly of the polymerase with general transcription factors and promoter DNA in a 'closed' preinitiation complex (PIC); unwinding of about 15 base pairs of the promoter DNA to form an 'open' complex; scanning downstream to a transcription start site; synthesis of a short transcript, thought to be about 10 nucleotides long; and promoter escape. Here we have assembled a 32-protein, 1.5-megadalton PIC derived from Saccharomyces cerevisiae, and observe subsequent initiation processes in real time with optical tweezers. Contrary to expectation, scanning driven by the transcription factor IIH involved the rapid opening of an extended transcription bubble, averaging 85 base pairs, accompanied by the synthesis of a transcript up to the entire length of the extended bubble, followed by promoter escape. PICs that failed to achieve promoter escape nevertheless formed open complexes and extended bubbles, which collapsed back to closed or open complexes, resulting in repeated futile scanning.

The structure of the L3 loop from the hepatitis delta virus ribozyme: a syn cytidine.

PubMed Central

Lynch, S R; Tinoco, I

1998-01-01

The structure of the L3 central hairpin loop isolated from the antigenomic sequence of the hepatitis delta virus ribozyme with the P2 and P3 stems from the ribozyme stacked on top of the loop has been determined by NMR spectroscopy. The 26 nt stem-loop structure contains nine base pairs and a 7 nt loop (5'-UCCUCGC-3'). This hairpin loop is critical for efficient catalysis in the intact ribozyme. The structure was determined using homonuclear and heteronuclear NMR techniques on non-labeled and15N-labeled RNA oligonucleotides. The overall root mean square deviation for the structure was 1.15 A (+/- 0.28 A) for the loop and the closing C.G base pair and 0.90 A (+/- 0.18 A) for the loop and the closing C.G base pair but without the lone purine in the loop, which is not well defined in the structure. The structure indicates a U.C base pair between the nucleotides on the 5'- and 3'-ends of the loop. This base pair is formed with a single hydrogen bond involving the cytosine exocyclic amino proton and the carbonyl O4 of the uracil. The most unexpected finding in the loop is a syn cytidine. While not unprecedented, syn pyrimidines are highly unusual. This one can be confidently established by intranucleotide distances between the ribose and the base determined by NMR spectroscopy. A similar study of the structure of this loop showed a somewhat different three-dimensional structure. A discussion of differences in the two structures, as well as possible sites of interaction with the cleavage site, will be presented. PMID:9461457

Same-sex partner preference in zebra finches: pairing flexibility and choice.

PubMed

Tomaszycki, Michelle L; Zatirka, Brendon P

2014-11-01

This study examined flexibility and choice in same-sex pair-bonding behavior in adult zebra finches (Taeniopygia guttata). Zebra finches form life-long monogamous relationships and extra pair behavior is very low, making them an ideal species in which to study same-sex pairing. We examined same-sex behaviors using both semi-naturalistic choice paradigms and skewed sex ratios. In the first experiment, we allowed zebra finches to pair in aviaries with equal sex ratios as part of multiple experiments. On average, 6.4% (N = 78) of unmanipulated pairs were same-sex: all but one was female-female. In a second experiment, we identified pairs from same-sex cages and selected 20 total same-sex pairs (10 of each sex). We then gave pairs a chance to court and pair with members of the opposite sex and observed their behavior for three days. Females did not retain their partner, but most paired with males. In contrast, some males did retain their partner. Similarly, females were more likely to engage in pairing behaviors with males than with their partners or other females whereas males were equally likely to engage in same-sex and opposite-sex pairing behaviors. These findings suggest that same-sex partnerships in zebra finches can be facultative, based on the sex ratio of the group in which they live, but can also be a choice, when opportunities to pair with opposite-sex individuals are possible. Furthermore, it is possible that females are more flexible in this choice of same-sex partnerships than are males.

Economic method for helical gear flank surface characterisation

NASA Astrophysics Data System (ADS)

Koulin, G.; Reavie, T.; Frazer, R. C.; Shaw, B. A.

2018-03-01

Typically the quality of a gear pair is assessed based on simplified geometric tolerances which do not always correlate with functional performance. In order to identify and quantify functional performance based parameters, further development of the gear measurement approach is required. Methodology for interpolation of the full active helical gear flank surface, from sparse line measurements, is presented. The method seeks to identify the minimum number of line measurements required to sufficiently characterise an active gear flank. In the form ground gear example presented, a single helix and three profile line measurements was considered to be acceptable. The resulting surfaces can be used to simulate the meshing engagement of a gear pair and therefore provide insight into functional performance based parameters. Therefore the assessment of the quality can be based on the predicted performance in the context of an application.

Base Pairing between U3 Small Nucleolar RNA and the 5′ End of 18S rRNA Is Required for Pre-rRNA Processing

PubMed Central

Sharma, Kishor; Tollervey, David

1999-01-01

The loop of a stem structure close to the 5′ end of the 18S rRNA is complementary to the box A region of the U3 small nucleolar RNA (snoRNA). Substitution of the 18S loop nucleotides inhibited pre-rRNA cleavage at site A1, the 5′ end of the 18S rRNA, and at site A2, located 1.9 kb away in internal transcribed spacer 1. This inhibition was largely suppressed by a compensatory mutation in U3, demonstrating functional base pairing. The U3–pre-rRNA base pairing is incompatible with the structure that forms in the mature 18S rRNA and may prevent premature folding of the pre-rRNA. In the Escherichia coli pre-rRNA the homologous region of the 16S rRNA is also sequestered, in that case by base pairing to the 5′ external transcribed spacer (5′ ETS). Cleavage at site A0 in the yeast 5′ ETS strictly requires base pairing between U3 and a sequence within the 5′ ETS. In contrast, the U3-18S interaction is not required for A0 cleavage. U3 therefore carries out at least two functionally distinct base pair interactions with the pre-rRNA. The nucleotide at the site of A1 cleavage was shown to be specified by two distinct signals; one of these is the stem-loop structure within the 18S rRNA. However, in contrast to the efficiency of cleavage, the position of A1 cleavage is not dependent on the U3-loop interaction. We conclude that the 18S stem-loop structure is recognized at least twice during pre-rRNA processing. PMID:10454548

Reversed-phase ion-pair liquid chromatography method for purification of duplex DNA with single base pair resolution

PubMed Central

Wysoczynski, Christina L.; Roemer, Sarah C.; Dostal, Vishantie; Barkley, Robert M.; Churchill, Mair E. A.; Malarkey, Christopher S.

2013-01-01

Obtaining quantities of highly pure duplex DNA is a bottleneck in the biophysical analysis of protein–DNA complexes. In traditional DNA purification methods, the individual cognate DNA strands are purified separately before annealing to form DNA duplexes. This approach works well for palindromic sequences, in which top and bottom strands are identical and duplex formation is typically complete. However, in cases where the DNA is non-palindromic, excess of single-stranded DNA must be removed through additional purification steps to prevent it from interfering in further experiments. Here we describe and apply a novel reversed-phase ion-pair liquid chromatography purification method for double-stranded DNA ranging in lengths from 17 to 51 bp. Both palindromic and non-palindromic DNA can be readily purified. This method has the unique ability to separate blunt double-stranded DNA from pre-attenuated (n-1, n-2, etc) synthesis products, and from DNA duplexes with single base pair overhangs. Additionally, palindromic DNA sequences with only minor differences in the central spacer sequence of the DNA can be separated, and the purified DNA is suitable for co-crystallization of protein–DNA complexes. Thus, double-stranded ion-pair liquid chromatography is a useful approach for duplex DNA purification for many applications. PMID:24013567

X-ray-structure of a cytidylyl-3',5'-adenosine-proflavine complex: a self-paired parallel-chain double helical dimer with an intercalated acridine dye.

PubMed Central

Westhof, E; Sundaralingam, M

1980-01-01

The non-self-complementary dinucleoside monophosphate cytidylyl-3',5'-adenosine (CpA) forms a base-paired parallel-chain dimer with an intercalated proflavine. The dimer complex possesses a right-handed helical twist. The dimer helix has an irregular girth with a neutral adenine-adenine (A-A) pair, hydrogen-bonded through the N6 and N7 sites (C1'...C1' separation of 10.97 A), and a triply hydrogen-bonded protonated cytosine-cytosine (C-C) pair with a proton shared between the base N3 sites (Cl'...Cl' separation of 9.59 A). The torsion angles of the sugar-phosphate backbone are within their most preferred ranges and the sugar puckering sequence (5' leads to 3') is C3'-endo, C2'-endo. There is also a second proflavine molecule sandwiched between CpA dimers on the 21-axis. Both proflavines are necessarily disordered, being on dyad axis, and this suggests possible insights into the dynamics of intercalation of planar drugs. This structure shows that intercalation of planar drugs in nucleic acids may not be restricted to antiparallel complementary Watson-Crick pairing regions and provides additional mechanisms for acridine mutagenesis. PMID:6929524

Allograph priming is based on abstract letter identities: Evidence from Japanese kana.

PubMed

Kinoshita, Sachiko; Schubert, Teresa; Verdonschot, Rinus G

2018-04-23

It is well-established that allographs like the uppercase and lowercase forms of the Roman alphabet (e.g., a and A) map onto the same "abstract letter identity," orthographic representations that are independent of the visual form. Consistent with this, in the allograph match task ("Are 'a' and 'A' the same letter?"), priming by a masked letter prime is equally robust for visually dissimilar prime-target pairs (e.g., d and D) and similar pairs (e.g., c and C). However, in principle this pattern of priming is also consistent with the possibility that allograph priming is purely phonological, based on the letter name. Because different allographic forms of the same letter, by definition, share a letter name, it is impossible to rule out this possibility a priori. In the present study, we investigated the influence of shared letter names by taking advantage of the fact that Japanese is written in two distinct writing systems, syllabic kana-that has two parallel forms, hiragana and katakana-and logographic kanji. Using the allograph match task, we tested whether a kanji prime with the same pronunciation as the target kana (e.g., - い, both pronounced /i/) produces the same amount of priming as a kana prime in the opposite kana form (e.g., イ- い). We found that the kana primes produced substantially greater priming than the phonologically identical kanji prime, which we take as evidence that allograph priming is based on abstract kana identity, not purely phonology. (PsycINFO Database Record (c) 2018 APA, all rights reserved).

New size-expanded RNA nucleobase analogs: a detailed theoretical study.

PubMed

Zhang, Laibin; Zhang, Zhenwei; Ren, Tingqi; Tian, Jianxiang; Wang, Mei

2015-04-05

Fluorescent nucleobase analogs have attracted much attention in recent years due to their potential applications in nucleic acids research. In this work, four new size-expanded RNA base analogs were computationally designed and their structural, electronic, and optical properties are investigated by means of DFT calculations. The results indicate that these analogs can form stable Watson-Crick base pairs with natural counterparts and they have smaller ionization potentials and HOMO-LUMO gaps than natural ones. Particularly, the electronic absorption spectra and fluorescent emission spectra are calculated. The calculated excitation maxima are greatly red-shifted compared with their parental and natural bases, allowing them to be selectively excited. In gas phase, the fluorescence from them would be expected to occur around 526, 489, 510, and 462 nm, respectively. The influences of water solution and base pairing on the relevant absorption spectra of these base analogs are also examined. Copyright © 2015 Elsevier B.V. All rights reserved.

Control of preference in children by conditioned positive reinforcement.

PubMed

Favell, J E; Favell, J E

1972-07-01

A preference measure was employed with children to evaluate the conditioned positive reinforcing function of a stimulus that preceded reinforcement. A match-to-sample procedure was arranged in which subjects could respond to either the form or color dimension of a compound sample stimulus. Intermittent token reinforcement was provided equally for color and form matches. Two stimuli were employed (Stimulus A and Stimulus B), each consisting of a distinctive tone and colored light. One of these stimuli (the paired stimulus) preceded each token delivery, and the other did not (nonpaired stimulus). The paired stimulus was dependent upon each response to one match dimension, and the nonpaired stimulus followed each response to the other dimension. Three of the five subjects responded primarily to the dimension that was followed by the paired stimulus. This effect was obtained regardless of which stimulus (A or B) was paired and on which match dimension (color or form) the paired stimulus was dependent. These results were unaltered by discontinuing the nonpaired stimulus. The other two subjects demonstrated consistent preferences for the form dimension and Stimulus A, respectively.

A label-free DNA hairpin biosensor for colorimetric detection of target with suitable functional DNA partners.

PubMed

Nie, Ji; Zhang, De-Wen; Tie, Cai; Zhou, Ying-Lin; Zhang, Xin-Xiang

2013-11-15

The combination of aptamer and peroxidase-mimicking DNAzyme within a hairpin structure can form a functional DNA probe. The activities of both aptamer (as biorecognition element) and DNAzyme (as signal amplification element) are blocked via base pairing in the hairpin structure. The presence of target triggers the opening of the hairpin to form target/aptamer complex and releases G-quadruplex sequence which can generate amplified colorimetric signals. In this work, we elaborated a universal and simple procedure to design an efficient and sensitive hairpin probe with suitable functional DNA partners. A fill-in-the-blank process was developed for sequence design, and two key points including the pretreatment of the hairpin probe and the selection of suitable signal transducer sequence were proved to enhance the detection sensitivity. Cocaine was chosen as a model target for a proof of concept. A series of hairpins with different numbers of base pairs in the stem region were prepared. Hairpin-C10 with ten base pairs was screened out and a lowest detectable cocaine concentration of 5 μM by colorimetry was obtained. The proposed functional DNA hairpin showed good selectivity and satisfactory analysis in spiked biologic fluid. The whole "mix-and-measure" detection based on DNA hairpin without the need of immobilization and labeling was indicated to be time and labor saving. The strategy has potential to be transplanted into more smart hairpins toward other targets for general application in bioanalytical chemistry. Copyright © 2013 Elsevier B.V. All rights reserved.

Using diets of Canis breeding pairs to assess resource partitioning between sympatric red wolves and coyotes

USGS Publications Warehouse

Hinton, Joseph W.; Ashley, Annaliese K.; Dellinger, Justin A.; Gittleman, John L.; van Manen, Frank T.; Chamberlain, Michael J.

2017-01-01

Foraging behaviors of red wolves (Canis rufus) and coyotes (Canis latrans) are complex and their ability to form congeneric breeding pairs and hybridize further complicates our understanding of factors influencing their diets. Through scat analysis, we assessed prey selection of red wolf, coyote, and congeneric breeding pairs formed by red wolves and coyotes, and found that all 3 had similar diets. However, red wolf and congeneric pairs consumed more white-tailed deer (Odocoileus virginianus) than coyote pairs. Coyotes forming breeding pairs with red wolves had 12% more white-tailed deer in their diet than conspecifics paired with coyotes. Contrary to many studies on coyotes in the southeastern United States, we found coyotes in eastern North Carolina to be primarily carnivorous with increased consumption of deer during winter. Although prey selection was generally similar among the 3 groups, differences in diet among different breeding pairs were strongly associated with body mass. Larger breeding pairs consumed more white-tailed deer, and fewer rabbits (Sylvilagus spp.) and other small mammals. Partitioning of food resources by sympatric red wolves and coyotes is likely via differences in the proportions of similar prey consumed, rather than differences in types of prey exploited. Consequently, our results suggest coexistence of red wolves and coyotes in the southeastern United States may not be possible because there are limited opportunities for niche partitioning to reduce competitive interactions.

NMR studies of DNA oligomers and their interactions with minor groove binding ligands

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fagan, Patricia A.

1996-05-01

The cationic peptide ligands distamycin and netropsin bind noncovalently to the minor groove of DNA. The binding site, orientation, stoichiometry, and qualitative affinity of distamycin binding to several short DNA oligomers were investigated by NMR spectroscopy. The oligomers studied contain A,T-rich or I,C-rich binding sites, where I = 2-desaminodeoxyguanosine. I•C base pairs are functional analogs of A•T base pairs in the minor groove. The different behaviors exhibited by distamycin and netropsin binding to various DNA sequences suggested that these ligands are sensitive probes of DNA structure. For sites of five or more base pairs, distamycin can form 1:1 or 2:1more » ligand:DNA complexes. Cooperativity in distamycin binding is low in sites such as AAAAA which has narrow minor grooves, and is higher in sites with wider minor grooves such as ATATAT. The distamycin binding and base pair opening lifetimes of I,C-containing DNA oligomers suggest that the I,C minor groove is structurally different from the A,T minor groove. Molecules which direct chemistry to a specific DNA sequence could be used as antiviral compounds, diagnostic probes, or molecular biology tools. The author studied two ligands in which reactive groups were tethered to a distamycin to increase the sequence specificity of the reactive agent.« less

Cyan-emitting and orange-emitting fluorescent proteins as a donor/acceptor pair for fluorescence resonance energy transfer.

PubMed

Karasawa, Satoshi; Araki, Toshio; Nagai, Takeharu; Mizuno, Hideaki; Miyawaki, Atsushi

2004-07-01

GFP (green fluorescent protein)-based FRET (fluorescence resonance energy transfer) technology has facilitated the exploration of the spatio-temporal patterns of cellular signalling. While most studies have used cyan- and yellow-emitting FPs (fluorescent proteins) as FRET donors and acceptors respectively, this pair of proteins suffers from problems of pH-sensitivity and bleeding between channels. In the present paper, we demonstrate the use of an alternative additional donor/acceptor pair. We have cloned two genes encoding FPs from stony corals. We isolated a cyan-emitting FP from Acropara sp., whose tentacles exhibit cyan coloration. Similar to GFP from Renilla reniformis, the cyan FP forms a tight dimeric complex. We also discovered an orange-emitting FP from Fungia concinna. As the orange FP exists in a complex oligomeric structure, we converted this protein into a monomeric form through the introduction of three amino acid substitutions, recently reported to be effective for converting DsRed into a monomer (Clontech). We used the cyan FP and monomeric orange FP as a donor/acceptor pair to monitor the activity of caspase 3 during apoptosis. Due to the close spectral overlap of the donor emission and acceptor absorption (a large Förster distance), substantial pH-resistance of the donor fluorescence quantum yield and the acceptor absorbance, as well as good separation of the donor and acceptor signals, the new pair can be used for more effective quantitative FRET imaging.

Comparing Facial 3D Analysis With DNA Testing to Determine Zygosities of Twins.

PubMed

Vuollo, Ville; Sidlauskas, Mantas; Sidlauskas, Antanas; Harila, Virpi; Salomskiene, Loreta; Zhurov, Alexei; Holmström, Lasse; Pirttiniemi, Pertti; Heikkinen, Tuomo

2015-06-01

The aim of this study was to compare facial 3D analysis to DNA testing in twin zygosity determinations. Facial 3D images of 106 pairs of young adult Lithuanian twins were taken with a stereophotogrammetric device (3dMD, Atlanta, Georgia) and zygosity was determined according to similarity of facial form. Statistical pattern recognition methodology was used for classification. The results showed that in 75% to 90% of the cases, zygosity determinations were similar to DNA-based results. There were 81 different classification scenarios, including 3 groups, 3 features, 3 different scaling methods, and 3 threshold levels. It appeared that coincidence with 0.5 mm tolerance is the most suitable feature for classification. Also, leaving out scaling improves results in most cases. Scaling was expected to equalize the magnitude of differences and therefore lead to better recognition performance. Still, better classification features and a more effective scaling method or classification in different facial areas could further improve the results. In most of the cases, male pair zygosity recognition was at a higher level compared with females. Erroneously classified twin pairs appear to be obvious outliers in the sample. In particular, faces of young dizygotic (DZ) twins may be so similar that it is very hard to define a feature that would help classify the pair as DZ. Correspondingly, monozygotic (MZ) twins may have faces with quite different shapes. Such anomalous twin pairs are interesting exceptions, but they form a considerable portion in both zygosity groups.

Ab initio study of naphtho-homologated DNA bases.

PubMed

Vazquez-Mayagoita, Alvaro; Huertas, Oscar; Fuentes-Cabrera, Miguel; Sumpter, Bobby G; Orozco, Modesto; Luque, F Javier

2008-02-21

Naphtho-homologated DNA bases have been recently used to build a new type of size-expanded DNA known as yyDNA. We have used theoretical techniques to investigate the structure, tautomeric preferences, base-pairing ability, stacking interactions, and HOMO-LUMO gaps of the naphtho-bases. The structure of these bases is found to be similar to that of the benzo-fused predecessors (y-bases) with respect to the planarity of the aromatic rings and amino groups. Tautomeric studies reveal that the canonical-like forms of naphtho-thymine (yyT) and naphtho-adenine (yyA) are the most stable tautomers, leading to hydrogen-bonded dimers with the corresponding natural nucleobases that mimic the Watson-Crick pairing. However, the canonical-like species of naphtho-guanine (yyG) and naphtho-cytosine (yyC) are not the most stable tautomers, and the most favorable hydrogen-bonded dimers involve wobble-like pairings. The expanded size of the naphtho-bases leads to stacking interactions notably larger than those found for the natural bases, and they should presumably play a dominant contribution in modulating the structure of yyDNA duplexes. Finally, the HOMO-LUMO gap of the naphtho-bases is smaller than that of their benzo-base counterparts, indicating that size-expansion of DNA bases is an efficient way of reducing their HOMO-LUMO gap. These results are examined in light of the available experimental evidence reported for yyT and yyC.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Su, Minfei; Li, Yue; Wyborny, Shane

ATG14 binding to BECN/Beclin homologs is essential for autophagy, a critical catabolic homeostasis pathway. Here, we show that the α-helical, coiled-coil domain (CCD) of BECN2, a recently identified mammalian BECN1 paralog, forms an antiparallel, curved homodimer with seven pairs of nonideal packing interactions, while the BECN2 CCD and ATG14 CCD form a parallel, curved heterodimer stabilized by multiple, conserved polar interactions. Compared to BECN1, the BECN2 CCD forms a weaker homodimer, but binds more tightly to the ATG14 CCD. Mutation of nonideal BECN2 interface residues to more ideal pairs improves homodimer self-association and thermal stability. Unlike BECN1, all BECN2 CCDmore » mutants bind ATG14, although more weakly than wild type. Thus, polar BECN2 CCD interface residues result in a metastable homodimer, facilitating dissociation, but enable better interactions with polar ATG14 residues stabilizing the BECN2:ATG14 heterodimer. These structure-based mechanistic differences in BECN1 and BECN2 homodimerization and heterodimerization likely dictate competitive ATG14 recruitment.« less

Model for an RNA tertiary interaction from the structure of an intermolecular complex between a GAAA tetraloop and an RNA helix.

PubMed

Pley, H W; Flaherty, K M; McKay, D B

1994-11-03

In large structured RNAs, RNA hairpins in which the strands of the duplex stem are connected by a tetraloop of the consensus sequence 5'-GNRA (where N is any nucleotide, and R is either G or A) are unusually frequent. In group I introns there is a covariation in sequence between nucleotides in the third and fourth positions of the loop with specific distant base pairs in putative RNA duplex stems: GNAA loops correlate with successive 5'-C-C.G-C base pairs in stems, whereas GNGA loops correlate with 5'-C-U.G-A. This has led to the suggestion that GNRA tetraloops may be involved in specific long-range tertiary interactions, with each A in position 3 or 4 of the loop interacting with a C-G base pair in the duplex, and G in position 3 interacting with a U-A base pair. This idea is supported experimentally for the GAAA loop of the P5b extension of the group I intron of Tetrahymena thermophila and the L9 GUGA terminal loop of the td intron of bacteriophage T4 (ref. 4). NMR has revealed the overall structure of the tetraloop for 12-nucleotide hairpins with GCAA and GAAA loops and models have been proposed for the interaction of GNRA tetraloops with base pairs in the minor groove of A-form RNA. Here we describe the crystal structure of an intermolecular complex between a GAAA tetraloop and an RNA helix. The interactions we observe correlate with the specificity of GNRA tetraloops inferred from phylogenetic studies, suggesting that this complex is a legitimate model for intramolecular tertiary interactions mediated by GNRA tetraloops in large structured RNAs.

RNA processing: pocket guides to ribosomal RNA.

PubMed

Peculis, B

1997-08-01

The functional role of a recently identified class of small nucleolar (sno) RNAs has been elucidated: the 'box H/ACA' snoRNAs act as guide RNAs, specifying the position of evolutionarily conserved pseudouridines in ribosomal (r)RNA via an rRNA-snoRNA base-pairing interaction that forms a 'pseudouridine pocket'.

Two Interpretive Systems for Natural Language?

ERIC Educational Resources Information Center

Frazier, Lyn

2015-01-01

It is proposed that humans have available to them two systems for interpreting natural language. One system is familiar from formal semantics. It is a type based system that pairs a syntactic form with its interpretation using grammatical rules of composition. This system delivers both plausible and implausible meanings. The other proposed system…

Functional base-pairing interaction between highly conserved elements of U3 small nucleolar RNA and the small ribosomal subunit RNA.

PubMed

Hughes, J M

1996-06-21

The U3 nucleolar RNA has a remarkably wide phyletic distribution extending from the Eukarya to the Archaea. It functions in maturation of the small subunit (SSU) rRNA through a mechanism which is as yet unknown but which involves base-pairing with pre-rRNA. The most conserved part of U3 is within 30 nucleotides of the 5' end, but as yet no function for this domain has been proposed. Elements within this domain are complementary to highly conserved sequences in the SSU rRNA which, in the mature form, fold into a universally conserved pseudoknot. The nature of the complementarity suggests a novel mechanism for U3 function whereby U3 facilitates correct folding of the pseudoknot. Wide phylogenetic comparison provides compelling evidence in support of the interaction in that significant complementary changes have taken place, particularly in the archaeon Sulfolobus, which maintain the base-pairing. Base-substitution mutations in yeast U3 designed to disrupt the base-pairing indicate that the interaction is probably essential. These include cold-sensitivity mutations which exhibit phenotypes similar to U3-depletion, but without impairment of the AO processing step, which occurs within the 5' ETS. These phenotypes are consistent with the destabilization of SSU precursors and partial impairment of the processing steps A1, at the 5' ETS/18 S boundary, and A2, within the ITS1.

Hepatozoon parasites (Apicomplexa: Adeleorina) in bats.

PubMed

Pinto, C Miguel; Helgen, Kristofer M; Fleischer, Robert C; Perkins, Susan L

2013-08-01

We provide the first evidence of Hepatozoon parasites infecting bats. We sequenced a short fragment of the 18S rRNA gene (~600 base pairs) of Hepatozoon parasites from 3 Hipposideros cervinus bats from Borneo. Phylogenies inferred by model-based methods place these Hepatozoon within a clade formed by parasites of reptiles, rodents, and marsupials. We discuss the scenario that bats might be common hosts of Hepatozoon.

Benzophenone as a photoprobe of polymer films

NASA Astrophysics Data System (ADS)

Levin, Peter P.; Efremkin, Alexei F.; Khudyakov, Igor V.

2017-09-01

The review article is devoted to kinetics of fast reactions following photoexcitation of benzophenone in polymer films. We observed three processes by ns laser flash photolysis in elastomers: (i) decay of a triple state of benzophenone with hydrogen abstraction from polymer matrix, (ii) formation and decay of geminate radical pairs, (iii) cross-termination of the formed radicals in the polymer bulk. Application of external magnetic field (MF) of B = 0.2 T essentially affects recombination of geminate (G-) and a bimolecular recombination of free radicals, which escaped polymer cage (F-pairs). Theoretical calculation of MF effects on G- and F-pairs is in agreement with corresponding experimental data. Elongation of elastomer leads to an unexpected observation: recombination in the bulk becomes slower. An explanation of this phenomenon based on elastomer free volume Vf approach was suggested.

Capturing RNA Folding Free Energy with Coarse-Grained Molecular Dynamics Simulations

PubMed Central

Bell, David R.; Cheng, Sara Y.; Salazar, Heber; Ren, Pengyu

2017-01-01

We introduce a coarse-grained RNA model for molecular dynamics simulations, RACER (RnA CoarsE-gRained). RACER achieves accurate native structure prediction for a number of RNAs (average RMSD of 2.93 Å) and the sequence-specific variation of free energy is in excellent agreement with experimentally measured stabilities (R2 = 0.93). Using RACER, we identified hydrogen-bonding (or base pairing), base stacking, and electrostatic interactions as essential driving forces for RNA folding. Also, we found that separating pairing vs. stacking interactions allowed RACER to distinguish folded vs. unfolded states. In RACER, base pairing and stacking interactions each provide an approximate stability of 3–4 kcal/mol for an A-form helix. RACER was developed based on PDB structural statistics and experimental thermodynamic data. In contrast with previous work, RACER implements a novel effective vdW potential energy function, which led us to re-parameterize hydrogen bond and electrostatic potential energy functions. Further, RACER is validated and optimized using a simulated annealing protocol to generate potential energy vs. RMSD landscapes. Finally, RACER is tested using extensive equilibrium pulling simulations (0.86 ms total) on eleven RNA sequences (hairpins and duplexes). PMID:28393861

Aggregation and folding phase transitions of RNA molecules

NASA Astrophysics Data System (ADS)

Bundschuh, Ralf

2007-03-01

RNA is a biomolecule that is involved in nearly all aspects of cellular functions. In order to perform many of these functions, RNA molecules have to fold into specific secondary structures. This folding is driven by the tendency of the bases to form Watson-Crick base pairs. Beyond the biological importance of RNA, the relatively simple rules for structure formation of RNA make it a very interesting system from the statistical physics point of view. We will present examples of phase transitions in RNA secondary structure formation that are amenable to analytical descriptions. A special focus will be on aggregation between several RNA molecules which is important for some regulatory circuits based on RNA structure, triplet repeat diseases like Huntington's, and as a model for prion diseases. We show that depending on the relative strength of the intramolecular and the intermolecular base pairing, RNA molecules undergo a transition into an aggregated phase and quantitatively characterize this transition.

Modified Amber Force Field Correctly Models the Conformational Preference for Tandem GA pairs in RNA

PubMed Central

2015-01-01

Molecular mechanics with all-atom models was used to understand the conformational preference of tandem guanine-adenine (GA) noncanonical pairs in RNA. These tandem GA pairs play important roles in determining stability, flexibility, and structural dynamics of RNA tertiary structures. Previous solution structures showed that these tandem GA pairs adopt either imino (cis Watson–Crick/Watson–Crick A-G) or sheared (trans Hoogsteen/sugar edge A-G) conformations depending on the sequence and orientation of the adjacent closing base pairs. The solution structures (GCGGACGC)2 [Biochemistry, 1996, 35, 9677–9689] and (GCGGAUGC)2 [Biochemistry, 2007, 46, 1511–1522] demonstrate imino and sheared conformations for the two central GA pairs, respectively. These systems were studied using molecular dynamics and free energy change calculations for conformational changes, using umbrella sampling. For the structures to maintain their native conformations during molecular dynamics simulations, a modification to the standard Amber ff10 force field was required, which allowed the amino group of guanine to leave the plane of the base [J. Chem. Theory Comput., 2009, 5, 2088–2100] and form out-of-plane hydrogen bonds with a cross-strand cytosine or uracil. The requirement for this modification suggests the importance of out-of-plane hydrogen bonds in stabilizing the native structures. Free energy change calculations for each sequence demonstrated the correct conformational preference when the force field modification was used, but the extent of the preference is underestimated. PMID:24803859

Nonmagnetic impurity resonances as a signature of sign-reversal pairing in FeAs-based superconductors.

PubMed

Zhang, Degang

2009-10-30

The energy band structure of FeAs-based superconductors is fitted by a tight-binding model with two Fe ions per unit cell and two degenerate orbitals per Fe ion. Based on this, superconductivity with extended s-wave pairing symmetry of the form cosk(x)+cosk(y) is examined. The local density of states near an impurity is also investigated by using the T-matrix approach. For the nonmagnetic scattering potential, we found that there exist two major resonances inside the gap. The height of the resonance peaks depends on the strength of the impurity potential. These in-gap resonances are originated in the Andreev's bound states due to the quasiparticle scattering between the hole Fermi surfaces around Gamma point with positive order parameter and the electron Fermi surfaces around M point with negative order parameter.

[DNA structure from A to Z--biological implications of structural diversity of DNA].

PubMed

Bukowiecka-Matusiak, Małgorzata; Woźniak, Lucyna A

2006-01-01

Deoxyribonucleic acid (DNA) is a biopolymer of nucleotides, usually adopting a double-stranded helical form in cells, with complementary base pairing holding the two strands together. The most stable is B-DNA conformation, although numerous other double helical structures can occur under specific conditions (A-DNA, Z-DNA, P-DNA). The existence of multiple-stranded (triplex, tetraplex) forms in vivo and their biological function in cells are subject of intensive studies.

Separation of amaranthine-type betacyanins by ion-pair high-speed countercurrent chromatography.

PubMed

Jerz, Gerold; Gebers, Nadine; Szot, Dominika; Szaleniec, Maciej; Winterhalter, Peter; Wybraniec, Slawomir

2014-05-30

Betacyanins, red-violet plant pigments, were fractionated by ion-pair high-speed countercurrent chromatography (IP-HSCCC) from leaves extract of Iresine lindenii Van Houtte, an ornamental plant of the family Amaranthaceae. An HSCCC solvent system consisting of TBME-1-BuOH-ACN-H2O (1:3:1:5, v/v/v/v) was applied using ion-pair forming heptafluorobutyric acid (HFBA). Significantly different elution profiles of betacyanin diastereomeric pairs (derivatives based on betanidin and isobetanidin) observed in the HSCCC in comparison to HPLC systems indicate a complementarity of both techniques' fractionation capabilities. The numerous diastereomeric pairs can be selectively separated from each other using the HSCCC system simplifying the pigment purification process. Apart from the three well known highly abundant pigments (amaranthine, betanin and iresinin I) together with their isoforms, three new acylated (feruloylated and sinapoylated) betacyanins as well as known pigment hylocerenin (previously isolated from cacti fruits) were characterized in the plant for the first time and they are new for the whole Amaranthaceae family. Copyright © 2014 Elsevier B.V. All rights reserved.

Solid-state supramolecular architectures formed by co-crystallization of melamine and 2-, 3- and 4-fluorophenylacetic acids

NASA Astrophysics Data System (ADS)

Perpétuo, Genivaldo Julio; Janczak, Jan

2018-01-01

A family of supramolecular complexes of melamine with fluorophenylacetic acid isomers using solvent-assisted and evaporation-based techniques has been prepared. Crystallization of melamine with 2-fluorophenylacetic acid yield hydrated ionic supramolecular complex (1), whereas crystallization of melamine with 3- and 4-fluorophenylacetic acids leads to formation of neutral supramolecular complexes (2, 3), all with base to acid ratio of 1:2. The supramolecular assembly is driven by the noncovalent interactions, most commonly by the hydrogen bonds. The components of the crystal 1 interact via Nsbnd H⋯O and Osbnd H⋯N hydrogen bonds with R22(8) and R32(10) graphs forming ionic supramolecular complex, whereas the components in the crystals 2 and 3 interact with a graph of R22(8) forming neutral supramolecular complexes. The singly protonated melamin-1-ium residues in 1 interact each other via a pair of Nsbnd H⋯N hydrogen bonds forming one dimensional chains along [-110] that interact via Nsbnd H⋯O with deprotonated and neutral 2-fluorophenylacetic acid units and water molecules forming ribbon. In 2 and 3 co-crystals the melamine interacts with 3- and 4-fluorophenylacetic acids via a pair of Nsbnd H⋯O hydrogen bonds forming pseudo one-dimensional supramolecular chains along [010] direction. Hirshfeld surface and analysis of 2D fingerprint plots have been analysed both quantitatively and qualitatively interactions that governing the supramolecular organisation. The IR and Raman vibrational characterization of the supramolecular complexes 1-3 was supported by the spectra of their deuterated analogues.

Structure of an anti-HIV-1 hammerhead ribozyme complex with a 17-mer DNA substrate analog of HIV-1 gag RNA and a mechanism for the cleavage reaction: 750 MHz NMR and computer experiments

NASA Technical Reports Server (NTRS)

Ojha, R. P.; Dhingra, M. M.; Sarma, M. H.; Myer, Y. P.; Setlik, R. F.; Shibata, M.; Kazim, A. L.; Ornstein, R. L.; Rein, R.; Turner, C. J.;

Parietal lesion effects on cued recall following pair associate learning.

PubMed

Ben-Zvi, Shir; Soroker, Nachum; Levy, Daniel A

2015-07-01

We investigated the involvement of the posterior parietal cortex in episodic memory in a lesion-effects study of cued recall following pair-associate learning. Groups of patients who had experienced first-incident stroke, generally in middle cerebral artery territory, and exhibited damage that included lateral posterior parietal regions, were tested within an early post-stroke time window. In three experiments, patients and matched healthy comparison groups executed repeated study and cued recall test blocks of pairs of words (Experiment 1), pairs of object pictures (Experiment 2), or pairs of object pictures and environmental sounds (Experiment 3). Patients' brain CT scans were subjected to quantitative analysis of lesion volumes. Behavioral and lesion data were used to compute correlations between area lesion extent and memory deficits, and to conduct voxel-based lesion-symptom mapping. These analyses implicated lateral ventral parietal cortex, especially the angular gyrus, in cued recall deficits, most pronouncedly in the cross-modal picture-sound pairs task, though significant parietal lesion effects were also found in the unimodal word pairs and picture pairs tasks. In contrast to an earlier study in which comparable parietal lesions did not cause deficits in item recognition, these results indicate that lateral posterior parietal areas make a substantive contribution to demanding forms of recollective retrieval as represented by cued recall, especially for complex associative representations. Copyright © 2015 Elsevier Ltd. All rights reserved.

Electron pairing without superconductivity

NASA Astrophysics Data System (ADS)

Levy, Jeremy

Strontium titanate (SrTiO3) is the first and best known superconducting semiconductor. It exhibits an extremely low carrier density threshold for superconductivity, and possesses a phase diagram similar to that of high-temperature superconductors--two factors that suggest an unconventional pairing mechanism. Despite sustained interest for 50 years, direct experimental insight into the nature of electron pairing in SrTiO3 has remained elusive. Here we perform transport experiments with nanowire-based single-electron transistors at the interface between SrTiO3 and a thin layer of lanthanum aluminate, LaAlO3. Electrostatic gating reveals a series of two-electron conductance resonances--paired electron states--that bifurcate above a critical pairing field Bp of about 1-4 tesla, an order of magnitude larger than the superconducting critical magnetic field. For magnetic fields below Bp, these resonances are insensitive to the applied magnetic field; for fields in excess of Bp, the resonances exhibit a linear Zeeman-like energy splitting. Electron pairing is stable at temperatures as high as 900 millikelvin, well above the superconducting transition temperature (about 300 millikelvin). These experiments demonstrate the existence of a robust electronic phase in which electrons pair without forming a superconducting state. Key experimental signatures are captured by a model involving an attractive Hubbard interaction that describes real-space electron pairing as a precursor to superconductivity. Support from AFOSR, ONR, ARO, NSF, DOE and NSSEFF is gratefully acknowledged.

The coevolution of long-term pair bonds and cooperation.

PubMed

Song, Z; Feldman, M W

2013-05-01

The evolution of social traits may not only depend on but also change the social structure of the population. In particular, the evolution of pairwise cooperation, such as biparental care, depends on the pair-matching distribution of the population, and the latter often emerges as a collective outcome of individual pair-bonding traits, which are also under selection. Here, we develop an analytical model and individual-based simulations to study the coevolution of long-term pair bonds and cooperation in parental care, where partners play a Snowdrift game in each breeding season. We illustrate that long-term pair bonds may coevolve with cooperation when bonding cost is below a threshold. As long-term pair bonds lead to assortative interactions through pair-matching dynamics, they may promote the prevalence of cooperation. In addition to the pay-off matrix of a single game, the evolutionarily stable equilibrium also depends on bonding cost and accidental divorce rate, and it is determined by a form of balancing selection because the benefit from pair-bond maintenance diminishes as the frequency of cooperators increases. Our findings highlight the importance of ecological factors affecting social bonding cost and stability in understanding the coevolution of social behaviour and social structures, which may lead to the diversity of biological social systems. © 2013 The Authors. Journal of Evolutionary Biology © 2013 European Society For Evolutionary Biology.

Optical CO2 sensing with ionic liquid doped electrospun nanofibers.

PubMed

Aydogdu, Sibel; Ertekin, Kadriye; Suslu, Aslihan; Ozdemir, Mehtap; Celik, Erdal; Cocen, Umit

2011-03-01

The first use of electrospun nanofibrous materials as highly responsive fluorescence quenching-based optical CO(2) sensors is reported. Poly(methyl methacrylate) and ethyl cellulose were used as polymeric materials. Sensing slides were fabricated by electrospinning technique. A fiber-optic bundle was used for the gas detection. CO(2) sensors based on the change in the fluorescence signal intensity of ion pair form of 8-hydroxypyrene-1,3,6-trisulfonic acid (HPTS). The sensor slides showed high sensitivities due to the high surface area-to-volume ratio of the nanofibrous membrane structures. The preliminary results of Stern-Volmer analysis show that the sensitivities of electrospun nanofibrous membranes to detect CO(2) are 24 to 120 fold higher than those of the thin film based sensors. The response times of the sensing reagents were short and the signal changes were fully reversible. The stability of ion pair form of HPTS in the employed matrix materials was excellent and when stored in the ambient air of the laboratory there was no significant drift in signal intensity after 7 months. Our stability tests are still in progress. © Springer Science+Business Media, LLC 2010

Knowledge Acquisition from Structural Descriptions.

ERIC Educational Resources Information Center

Hayes-Roth, Frederick; McDermott, John

The learning machine described in this paper acquires concepts representable as conjunctive forms of the predicate calculus and behaviors representable as productions (antecedent-consequent pairs of such conjunctive forms): these concepts and behavior rules are inferred from sequentially presented pairs of examples by an algorithm that is probably…

Synergistic binding of bHLH transcription factors to the promoter of the maize NADP-ME gene used in C4 photosynthesis is based on an ancient code found in the ancestral C3 state.

PubMed

Borba, Ana Rita; Serra, Tânia S; Górska, Alicja; Gouveia, Paulo; Cordeiro, André M; Reyna-Llorens, Ivan; Knerová, Jana; Barros, Pedro M; Abreu, Isabel A; Oliveira, M Margarida; Hibberd, Julian M; Saibo, Nelson J M

2018-04-05

C4 photosynthesis has evolved repeatedly from the ancestral C3 state to generate a carbon concentrating mechanism that increases photosynthetic efficiency. This specialised form of photosynthesis is particularly common in the PACMAD clade of grasses, and is used by many of the world's most productive crops. The C4 cycle is accomplished through cell-type specific accumulation of enzymes but cis-elements and transcription factors controlling C4 photosynthesis remain largely unknown. Using the NADP-Malic Enzyme (NADP-ME) gene as a model we tested whether mechanisms impacting on transcription in C4 plants evolved from ancestral components found in C3 species. Two basic Helix-Loop-Helix (bHLH) transcription factors, ZmbHLH128 and ZmbHLH129, were shown to bind the C4NADP-ME promoter from maize. These proteins form heterodimers and ZmbHLH129 impairs trans-activation by ZmbHLH128. Electrophoretic mobility shift assays indicate that a pair of cis-elements separated by a seven base pair spacer synergistically bind either ZmbHLH128 or ZmbHLH129. This pair of cis-elements is found in both C3 and C4 Panicoid grass species of the PACMAD clade. Our analysis is consistent with this cis-element pair originating from a single motif present in the ancestral C3 state. We conclude that C4 photosynthesis has co-opted an ancient C3 regulatory code built on G-box recognition by bHLH to regulate the NADP-ME gene. More broadly, our findings also contribute to the understanding of gene regulatory networks controlling C4 photosynthesis.

Characterization of Surface and Bulk Nitrates of γ-Al2O3-Supported Alkaline Earth Oxides using Density Functional Theory

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mei, Donghai; Ge, Qingfeng; Kwak, Ja Hun

2009-05-14

“Surface" and "bulk" nitrates formed on a series of alkaline earth oxides (AEOs), AE(NO3)2, were investigated using first-principles density functional theory calculations. The formation of these surface and bulk nitrates was modeled by the adsorption of NO2+NO3 pairs on gamma-Al2O3-supported monomeric AEOs (MgO, CaO, SrO, and BaO) and on the extended AEO(001) surfaces, respectively. The calculated vibrational frequencies of the surface and bulk nitrates based on our proposed models are in good agreement with experimental measurements of AEO/gamma-Al2O3 materials after prolonged NO2 exposure. This indicates that experimentally observed "surface" nitrates are most likely formed with isolated two dimensional (including monomeric)more » AEO clusters on the gamma-Al2O3 substrate, while the "bulk" nitrates are formed on exposed (including (001)) surfaces (and likely in the bulk as well) of large three dimensional AEO particles supported on the gamma-Al2O3 substrate. Also in line with the experiments, our calculations show that the low and high frequency components of the vibrations for both surface and bulk nitrates are systematically red shifted with the increasing basicity and cationic size of the AEOs. The adsorption strengths of NO2+NO3 pairs are nearly the same for the series of alumina-supported monomeric AEOs, while the adsorption strengths of NO2+NO3 pairs on the AEO surfaces increase in the order of MgO < CaO < SrO ~ BaO. Compared to the NO2+NO3 pair that only interacts with monomeric AEOs, the stability of NO2+NO3 pairs that interact with both the monomeric AEO and the gamma-Al2O3 substrate is enhanced by about 0.5 eV. Pacific Northwest National Laboratory is operated by Battelle for the US Department of Energy.« less

Alignment of RNA molecules: Binding energy and statistical properties of random sequences

DOE Office of Scientific and Technical Information (OSTI.GOV)

Valba, O. V., E-mail: valbaolga@gmail.com; Nechaev, S. K., E-mail: sergei.nechaev@gmail.com; Tamm, M. V., E-mail: thumm.m@gmail.com

2012-02-15

A new statistical approach to the problem of pairwise alignment of RNA sequences is proposed. The problem is analyzed for a pair of interacting polymers forming an RNA-like hierarchical cloverleaf structures. An alignment is characterized by the numbers of matches, mismatches, and gaps. A weight function is assigned to each alignment; this function is interpreted as a free energy taking into account both direct monomer-monomer interactions and a combinatorial contribution due to formation of various cloverleaf secondary structures. The binding free energy is determined for a pair of RNA molecules. Statistical properties are discussed, including fluctuations of the binding energymore » between a pair of RNA molecules and loop length distribution in a complex. Based on an analysis of the free energy per nucleotide pair complexes of random RNAs as a function of the number of nucleotide types c, a hypothesis is put forward about the exclusivity of the alphabet c = 4 used by nature.« less

A curved RNA helix incorporating an internal loop with G·A and A·A non-Watson–Crick base pairing

PubMed Central

Baeyens, Katrien J.; De Bondt, Hendrik L.; Pardi, Arthur; Holbrook, Stephen R.

1996-01-01

The crystal structure of the RNA dodecamer 5′-GGCC(GAAA)GGCC-3′ has been determined from x-ray diffraction data to 2.3-Å resolution. In the crystal, these oligomers form double helices around twofold symmetry axes. Four consecutive non-Watson–Crick base pairs make up an internal loop in the middle of the duplex, including sheared G·A pairs and novel asymmetric A·A pairs. This internal loop sequence produces a significant curvature and narrowing of the double helix. The helix is curved by 34° from end to end and the diameter is narrowed by 24% in the internal loop. A Mn2+ ion is bound directly to the N7 of the first guanine in the Watson–Crick region following the internal loop and the phosphate of the preceding residue. This Mn2+ location corresponds to a metal binding site observed in the hammerhead catalytic RNA. PMID:8917508

Swelling Mechanisms of UO2 Lattices with Defect Ingrowths

PubMed Central

Günay, Seçkin D.

2015-01-01

The swelling that occurs in uranium dioxide as a result of radiation-induced defect ingrowth is not fully understood. Experimental and theoretical groups have attempted to explain this phenomenon with various complex theories. In this study, experimental lattice expansion and lattice super saturation were accurately reproduced using a molecular dynamics simulation method. Based on their resemblance to experimental data, the simulation results presented here show that fission induces only oxygen Frenkel pairs while alpha particle irradiation results in both oxygen and uranium Frenkel pair defects. Moreover, in this work, defects are divided into two sub-groups, obstruction type defects and distortion type defects. It is shown that obstruction type Frenkel pairs are responsible for both fission- and alpha-particle-induced lattice swelling. Relative lattice expansion was found to vary linearly with the number of obstruction type uranium Frenkel defects. Additionally, at high concentrations, some of the obstruction type uranium Frenkel pairs formed diatomic and triatomic structures with oxygen ions in their octahedral cages, increasing the slope of the linear dependence. PMID:26244777

Pearson's chi-square test and rank correlation inferences for clustered data.

PubMed

Shih, Joanna H; Fay, Michael P

2017-09-01

Pearson's chi-square test has been widely used in testing for association between two categorical responses. Spearman rank correlation and Kendall's tau are often used for measuring and testing association between two continuous or ordered categorical responses. However, the established statistical properties of these tests are only valid when each pair of responses are independent, where each sampling unit has only one pair of responses. When each sampling unit consists of a cluster of paired responses, the assumption of independent pairs is violated. In this article, we apply the within-cluster resampling technique to U-statistics to form new tests and rank-based correlation estimators for possibly tied clustered data. We develop large sample properties of the new proposed tests and estimators and evaluate their performance by simulations. The proposed methods are applied to a data set collected from a PET/CT imaging study for illustration. Published 2017. This article is a U.S. Government work and is in the public domain in the USA.

Structure-based approach to the prediction of disulfide bonds in proteins.

PubMed

Salam, Noeris K; Adzhigirey, Matvey; Sherman, Woody; Pearlman, David A

2014-10-01

Protein engineering remains an area of growing importance in pharmaceutical and biotechnology research. Stabilization of a folded protein conformation is a frequent goal in projects that deal with affinity optimization, enzyme design, protein construct design, and reducing the size of functional proteins. Indeed, it can be desirable to assess and improve protein stability in order to avoid liabilities such as aggregation, degradation, and immunogenic response that may arise during development. One way to stabilize a protein is through the introduction of disulfide bonds. Here, we describe a method to predict pairs of protein residues that can be mutated to form a disulfide bond. We combine a physics-based approach that incorporates implicit solvent molecular mechanics with a knowledge-based approach. We first assign relative weights to the terms that comprise our scoring function using a genetic algorithm applied to a set of 75 wild-type structures that each contains a disulfide bond. The method is then tested on a separate set of 13 engineered proteins comprising 15 artificial stabilizing disulfides introduced via site-directed mutagenesis. We find that the native disulfide in the wild-type proteins is scored well, on average (within the top 6% of the reasonable pairs of residues that could form a disulfide bond) while 6 out of the 15 artificial stabilizing disulfides scored within the top 13% of ranked predictions. Overall, this suggests that the physics-based approach presented here can be useful for triaging possible pairs of mutations for disulfide bond formation to improve protein stability. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Modeling DNA bubble formation at the atomic scale

DOE Office of Scientific and Technical Information (OSTI.GOV)

Beleva, V; Rasmussen, K. O.; Garcia, A. E.

We describe the fluctuations of double stranded DNA molecules using a minimalist Go model over a wide range of temperatures. Minimalist models allow us to describe, at the atomic level, the opening and formation of bubbles in DNA double helices. This model includes all the geometrical constraints in helix melting imposed by the 3D structure of the molecule. The DNA forms melted bubbles within double helices. These bubbles form and break as a function of time. The equilibrium average number of broken base pairs shows a sharp change as a function of T. We observe a temperature profile of sequencemore » dependent bubble formation similar to those measured by Zeng et al. Long nuclei acid molecules melt partially through the formations of bubbles. It is known that CG rich sequences melt at higher temperatures than AT rich sequences. The melting temperature, however, is not solely determined by the CG content, but by the sequence through base stacking and solvent interactions. Recently, models that incorporate the sequence and nonlinear dynamics of DNA double strands have shown that DNA exhibits a very rich dynamics. Recent extensions of the Bishop-Peyrard model show that fluctuations in the DNA structure lead to opening in localized regions, and that these regions in the DNA are associated with transcription initiation sites. 1D and 2D models of DNA may contain enough information about stacking and base pairing interactions, but lack the coupling between twisting, bending and base pair opening imposed by the double helical structure of DNA that all atom models easily describe. However, the complexity of the energy function used in all atom simulations (including solvent, ions, etc) does not allow for the description of DNA folding/unfolding events that occur in the microsecond time scale.« less

Two-Dimensional Nanoporous Networks Formed by Liquid-to-Solid Transfer of Hydrogen-Bonded Macrocycles Built from DNA Bases.

PubMed

Bilbao, Nerea; Destoop, Iris; De Feyter, Steven; González-Rodríguez, David

2016-01-11

We present an approach that makes use of DNA base pairing to produce hydrogen-bonded macrocycles whose supramolecular structure can be transferred from solution to a solid substrate. A hierarchical assembly process ultimately leads to two-dimensional nanostructured porous networks that are able to host size-complementary guests. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

On the Form of Bilingual Grammars: The Phonological Component.

ERIC Educational Resources Information Center

Elerick, Charles

This research is based on the assumption that a Spanish/English bilingual is aware of the phonological and semantic relatedness of the many hundreds of pairs of transparently cognate items in the two languages. This awareness is linguistically significant in that it is reflected in the internalized grammar of the bilingual. The bilingual speaker…

From SHAPE Signatures to 3-D Structures | Center for Cancer Research

Cancer.gov

RNAs undergo extensive folding to form sophisticated based-paired secondary structures that are, in part, indicators of more complex three-dimensional structures.  These 3-D shapes are an integral part of the cellular gene-expression machinery. Deconstructing these structures is no small matter, yet it is critical to understanding their function.

Staufen-mediated mRNA decay

PubMed Central

Park, Eonyoung; Maquat, Lynne E.

2013-01-01

Staufen1 (STAU1)-mediated mRNA decay (SMD) is an mRNA degradation process in mammalian cells that is mediated by the binding of STAU1 to a STAU1-binding site (SBS) within the 3'-untranslated region (3'UTR) of target mRNAs. During SMD, STAU1, a double-stranded (ds) RNA-binding protein, recognizes dsRNA structures formed either by intramolecular base-pairing of 3'UTR sequences or by intermolecular base-pairing of 3'UTR sequences with a long noncoding RNA (lncRNA) via partially complementary Alu elements. Recently, STAU2, a paralog of STAU1, has also been reported to mediate SMD. Both STAU1 and STAU2 interact directly with the ATP-dependent RNA helicase UPF1, a key SMD factor, enhancing its helicase activity to promote effective SMD. Moreover, STAU1 and STAU2 form homodimeric and heterodimeric interactions via domain-swapping. Since both SMD and the mechanistically related nonsense-mediated mRNA decay (NMD) employ UPF1, SMD and NMD are competitive pathways. Competition contributes to cellular differentiation processes, such as myogenesis and adipogenesis, placing SMD at the heart of various physiologically important mechanisms. PMID:23681777

Rhesus macaques form preferences for brand logos through sex and social status based advertising

PubMed Central

Watson, Karli K.; Fitzsimons, Gavan J.; Platt, Michael L.

2018-01-01

Like humans, monkeys value information about sex and status, inviting the hypothesis that our susceptibility to these factors in advertising arises from shared, ancestral biological mechanisms that prioritize social information. To test this idea, we asked whether rhesus macaques (Macaca mulatta) show choice behavior that is similar to humans in response to sex and social status in advertising. Our results show that monkeys form preferences for brand logos repeatedly paired with images of macaque genitals and high status monkeys. Moreover, monkeys sustain preferences for these brand logos even though choosing them provided no tangible rewards, a finding that cannot be explained by a decision mechanism operating solely on material outcomes. Together, our results endorse the hypothesis that the power of sex and status in advertising emerges from the spontaneous engagement of shared, ancestral neural circuits that prioritize information useful for navigating the social environment. Finally, our results show that simple associative conditioning is sufficient to explain the formation of preferences for brand logos paired with sexual or status-based images. PMID:29462189

Rhesus macaques form preferences for brand logos through sex and social status based advertising.

PubMed

Acikalin, M Yavuz; Watson, Karli K; Fitzsimons, Gavan J; Platt, Michael L

2018-01-01

Like humans, monkeys value information about sex and status, inviting the hypothesis that our susceptibility to these factors in advertising arises from shared, ancestral biological mechanisms that prioritize social information. To test this idea, we asked whether rhesus macaques (Macaca mulatta) show choice behavior that is similar to humans in response to sex and social status in advertising. Our results show that monkeys form preferences for brand logos repeatedly paired with images of macaque genitals and high status monkeys. Moreover, monkeys sustain preferences for these brand logos even though choosing them provided no tangible rewards, a finding that cannot be explained by a decision mechanism operating solely on material outcomes. Together, our results endorse the hypothesis that the power of sex and status in advertising emerges from the spontaneous engagement of shared, ancestral neural circuits that prioritize information useful for navigating the social environment. Finally, our results show that simple associative conditioning is sufficient to explain the formation of preferences for brand logos paired with sexual or status-based images.

Base-unpaired regions in supercoiled replicative form DNA of coliphage M13

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dasgupta, S.; Allison, D.P.; Snyder, C.E.

Superhelical covalently closed circular replicative form DNA (RF I) of coliphage M13 appears as a relaxed molecule that has a base-unpaired region in the form of a bubble (100 to 200 base pairs long) seen in electron micrographs when spread in the presence of formaldehyde and formamide or after pretreatment with glyoxal. S1 endonuclease, specific for single-stranded DNA, converts superhelical M13 RF I DNA, but not nonsuperhelical M13 RF I to a significant extent, into unit-length linear molecules by sequential nicking of two strands. The locations of S1 nuclease-susceptible sites and glyoxal-fixed base-unpaired regions were both related to the fivemore » A-T-rich regions in M13 RF DNA. While S1 nuclease does not show preference for any of these sites, glyoxal-fixed bubbles occur predominantly at the major A-T-rich region in M13 RF DNA.« less

Sensitive and Selective Spectrophotometric Determination of Gabapentin in Capsules Using Two Nitrophenols as Chromogenic Agents

PubMed Central

Abdulrahman, Sameer A. M.; Basavaiah, Kanakapura

2011-01-01

Two simple and selective spectrophotometric methods have been proposed for the determination of gabapentin (GBP) in pure form and in capsules. Both methods are based on the proton transfer from the Lewis acid such as 2,4,6-trinitrophenol (picric acid; PA) or 2,4-dinitrophenol (2,4-DNP) to the primary amino group of GBP which works as Lewis base and formation of yellow ion-pair complexes. The ion-pair complexes formed show absorption maximum at 415 and 420 nm for PA and 2,4-DNP, respectively. Under the optimized experimental conditions, Beer's law is obeyed over the concentration ranges of 1.25–15.0 and 2.0–18.0 μg mL−1 GBP for PA and 2,4-DNP methods, respectively. The molar absorptivity, Sandell's sensitivity, detection and, quantification limits for both methods are also reported. The proposed methods were applied successfully to the determination of GBP in pure form and commercial capsules. Statistical comparison of the results was performed using Student's t-test and F-ratio at 95% confidence level, and there was no significant difference between the reference and proposed methods with regard to accuracy and precision. Further, the validity of the proposed methods was confirmed by recovery studies via standard addition technique. PMID:21760787

DOE Office of Scientific and Technical Information (OSTI.GOV)

Devadoss, C.; Fessenden, R.W.

The transient that is produced in the quenching of triplet benzophenone by 1,4-diazabicyclo(2.2.2)octane (DABCO) has been examined by use of nano- and picosecond laser photolysis. The initial step in all solvents, both polar and nonpolar, is electron transfer to form a triplet contact ion pair. In nonpolar solvents, the ion pair remains in this form until it decays. For polar solvents, the spectra change somewhat over the first 100 ps showing that the solvation changes and the ion pair becomes solvent separated. The lifetime of the ion pair varies greatly with the solvent. In saturated hydrocarbons it is about 80more » ps. Nonpolar solvents with either {pi} electrons or a lone pair of electrons stabilize the ion pair on the nanosecond to microsecond time scale. A small amount of alcohol in benzene also stabilizes the ion pair by hydrogen bonding. A shift in the peak position with time toward the blue accompanies the formation of hydrogen bonds in this case.« less

Derivatization of DNAs with Selenium at 6-Position of Guanine for Function and Crystal Structure Studies

DOE Office of Scientific and Technical Information (OSTI.GOV)

Salon, J.; Jiang, J; Sheng, J

2008-01-01

To investigate nucleic acid base pairing and stacking via atom-specific mutagenesis and crystallography, we have synthesized for the first time the 6-Se-deoxyguanosine phosphoramidite and incorporated it into DNAs via solid-phase synthesis with a coupling yield over 97%. We found that the UV absorption of the Se-DNAs red-shifts over 100 nm to 360 nm ({Epsilon} = 2.3 x 10{sup 4} M{sup -1} cm{sup -1}), the Se-DNAs are yellow colored, and this Se modification is relatively stable in water and at elevated temperature. Moreover, we successfully crystallized a ternary complex of the Se-G-DNA, RNA and RNase H. The crystal structure determination andmore » analysis reveal that the overall structures of the native and Se-modified nucleic acid duplexes are very similar, the selenium atom participates in a Se-mediated hydrogen bond (Se H-N), and the {sup Se}G and C form a base pair similar to the natural G-C pair though the Se-modification causes the base-pair to shift (approximately 0.3 {angstrom}). Our biophysical and structural studies provide new insights into the nucleic acid flexibility, duplex recognition and stability. Furthermore, this novel selenium modification of nucleic acids can be used to investigate chemogenetics and structure of nucleic acids and their protein complexes.« less

Evolutionary transitions towards eusociality in snapping shrimps.

PubMed

Chak, Solomon Tin Chi; Duffy, J Emmett; Hultgren, Kristin M; Rubenstein, Dustin R

2017-03-20

Animal social organization varies from complex societies where reproduction is dominated by a single individual (eusociality) to those where reproduction is more evenly distributed among group members (communal breeding). Yet, how simple groups transition evolutionarily to more complex societies remains unclear. Competing hypotheses suggest that eusociality and communal breeding are alternative evolutionary endpoints, or that communal breeding is an intermediate stage in the transition towards eusociality. We tested these alternative hypotheses in sponge-dwelling shrimps, Synalpheus spp. Although species varied continuously in reproductive skew, they clustered into pair-forming, communal and eusocial categories based on several demographic traits. Evolutionary transition models suggested that eusocial and communal species are discrete evolutionary endpoints that evolved independently from pair-forming ancestors along alternative paths. This 'family-centred' origin of eusociality parallels observations in insects and vertebrates, reinforcing the role of kin selection in the evolution of eusociality and suggesting a general model of animal social evolution.

Visualization of drug-nucleic acid interactions at atomic resolution v. structure of two aminoacridine/dinucleoside monophosphate crystalline complexes, proflavine: 5-iodocytidylyl(3'-5') guanosine and acridine orange: 5-iodocytidylyl(3'-5') guanosine

DOE Office of Scientific and Technical Information (OSTI.GOV)

Reddy, B.S.; Seshadri, T.P.; Sakore, T.D.

1979-01-01

Acridine orange and proflavine form complexes with the dinucleoside monophosphate, 5-iodocytidylyl(3'-5') guanosine (iodoCpG). The acridine orange-iodoCpG crystals are monoclinic, space group P2/sub 1/, with unit cell dimensions a = 14.36 A, b = 19.64 A, c = 20.67 A, ..beta.. = 102.5. The proflavine-iodoCpG crystals are monoclinic, space group C2, with unit cell dimensions a = 32.14 A, b = 22.23 A, c = 18.42 A, ..beta.. = 123.3. Both structures have been solved to atomic resolution by Patterson and Fourier methods, and refined by full matrix least squares. Acridine orange forms an intercalative structure with iodoCpG but the acridinemore » nucleus lies asymmetrically in the intercalation site. This asymmetric intercalation is accompanied by a sliding of base-pairs upon the acridine nucleus. Base-pairs above and below the drug are separated by about 6.8 A and are twisted about 10/sup 0/. Proflavine demonstrates symmetric intercalation with iodoCpG. Hydrogen bonds connect amino- groups on proflavine with phosphate oxygen atoms on the dinucleotide. Base-pairs above and below the intercalative proflavine molecule are twisted about 36/sup 0/. The altered magnitude of this angular twist reflects the sugar puckering pattern that is observed. We propose a proflavine-DNA and an acridine orange-DNA binding model. We will describe these models in detail in this paper.« less

Ab initio Study of Naptho-Homologated DNA Bases

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sumpter, Bobby G; Vazquez-Mayagoitia, Alvaro; Huertas, Oscar

2008-01-01

Naptho-homologated DNA bases have been recently used to build a new type of size expanded DNA known as yyDNA. We have used theoretical techniques to investigate the structure, tautomeric preferences, base-pairing ability, stacking interactions, and HOMO-LUMO gaps of the naptho-bases. The structure of these bases is found to be similar to that of the benzo-fused predecessors (y-bases) with respect to the planarity of the aromatic rings and amino groups. Tautomeric studies reveal that the canonical-like form of naptho-thymine (yyT) and naptho-adenine (yyA) are the most stable tautomers, leading to hydrogen-bonded dimers with the corresponding natural nucleobases that mimic the Watson-Crickmore » pairing. However, the canonical-like species of naptho-guanine (yyG) and naptho-cytosine (yyC) are not the most stable tautomers, and the most favorable hydrogen-bonded dimers involve wobble-like pairings. The expanded size of the naphto-bases leads to stacking interactions notably larger than those found for the natural bases, and they should presumably play a dominant contribution in modulating the structure of yyDNA duplexes. Finally, the HOMO-LUMO gap of the naptho-bases is smaller than that of their benzo-base counterparts, indicating that size-expansion of DNA bases is an efficient way of reducing their HOMO-LUMO gap. These results are examined in light of the available experimental evidence reported for yyT and yyC.« less

ComplexContact: a web server for inter-protein contact prediction using deep learning.

PubMed

Zeng, Hong; Wang, Sheng; Zhou, Tianming; Zhao, Feifeng; Li, Xiufeng; Wu, Qing; Xu, Jinbo

2018-05-22

ComplexContact (http://raptorx2.uchicago.edu/ComplexContact/) is a web server for sequence-based interfacial residue-residue contact prediction of a putative protein complex. Interfacial residue-residue contacts are critical for understanding how proteins form complex and interact at residue level. When receiving a pair of protein sequences, ComplexContact first searches for their sequence homologs and builds two paired multiple sequence alignments (MSA), then it applies co-evolution analysis and a CASP-winning deep learning (DL) method to predict interfacial contacts from paired MSAs and visualizes the prediction as an image. The DL method was originally developed for intra-protein contact prediction and performed the best in CASP12. Our large-scale experimental test further shows that ComplexContact greatly outperforms pure co-evolution methods for inter-protein contact prediction, regardless of the species.

Antimatter Production at a Potential Boundary

NASA Technical Reports Server (NTRS)

LaPointe, Michael R.; Reddy, Dhanireddy (Technical Monitor)

2001-01-01

Current antiproton production techniques rely on high-energy collisions between beam particles and target nuclei to produce particle and antiparticle pairs, but inherently low production and capture efficiencies render these techniques impractical for the cost-effective production of antimatter for space propulsion and other commercial applications. Based on Dirac's theory of the vacuum field, a new antimatter production concept is proposed in which particle-antiparticle pairs are created at the boundary of a steep potential step formed by the suppression of the local vacuum fields. Current antimatter production techniques are reviewed, followed by a description of Dirac's relativistic quantum theory of the vacuum state and corresponding solutions for particle tunneling and reflection from a potential barrier. The use of the Casimir effect to suppress local vacuum fields is presented as a possible technique for generating the sharp potential gradients required for particle-antiparticle pair creation.

Crossed beam roof target for motion tracking

NASA Technical Reports Server (NTRS)

Olczak, Eugene (Inventor)

2009-01-01

A system for detecting motion between a first body and a second body includes first and second detector-emitter pairs, disposed on the first body, and configured to transmit and receive first and second optical beams, respectively. At least a first optical rotator is disposed on the second body and configured to receive and reflect at least one of the first and second optical beams. First and second detectors of the detector-emitter pairs are configured to detect the first and second optical beams, respectively. Each of the first and second detectors is configured to detect motion between the first and second bodies in multiple degrees of freedom (DOFs). The first optical rotator includes a V-notch oriented to form an apex of an isosceles triangle with respect to a base of the isosceles triangle formed by the first and second detector-emitter pairs. The V-notch is configured to receive the first optical beam and reflect the first optical beam to both the first and second detectors. The V-notch is also configured to receive the second optical beam and reflect the second optical beam to both the first and second detectors.

Unusual target site disruption by the rare-cutting HNH restriction endonuclease PacI

PubMed Central

Shen, Betty; Heiter, Daniel F.; Chan, Siu-Hong; Wang, Hua; Xu, Shuang-Yong; Morgan, Richard D.; Wilson, Geoffrey G.; Stoddard, Barry L.

2010-01-01

The crystal structure of the rare-cutting HNH restriction endonuclease PacI in complex with its eight base pair target recognition sequence 5'-TTAATTAA-3' has been determined to 1.9 Å resolution. The enzyme forms an extended homodimer, with each subunit containing two zinc-bound motifs surrounding a ββα-metal catalytic site. The latter is unusual in that a tyrosine residue likely initiates strand-cleavage. PacI dramatically distorts its target sequence from Watson-Crick duplex DNA basepairing, with every base separated from its original partner. Two bases on each strand are unpaired, four are engaged in non-canonical A:A and T:T base pairs, and the remaining two bases are matched with new Watson-Crick partners. This represents a highly unusual DNA binding mechanism for a restriction endonuclease, and implies that initial recognition of the target site might involve significantly different contacts from those visualized in the DNA-bound cocrystal structures. PMID:20541511

Evaluation of the pair-culture effect in Ophryotrocha puerilis (Polychaeta: Dorvilleidae). I. Pair-culture effect and sex ratio

NASA Astrophysics Data System (ADS)

Kegel, B.; Pfannenstiel, H.-D.

1983-06-01

Pairs and larger groups of female Ophryotrocha puerilis puerilis were formed from formerly isolated specimens. Neither the diameter of the oocytes present in the coelomic fluid nor the number of setigerous segments (ss) of the partners of a newly formed pair allow us to predict which one of the two animals will exhibit sex reversal. Amputation of the palps showed that these ventrolateral appendages of the prostomium are not responsible for the transmission of the mutual influence which is exerted during the pair-culture effect. Isolated females do not produce egg masses but keep their oocytes in the body cavity until they are eventually resorbed. The shedding of oocytes in one of the females of a newly formed pair was formerly considered to be the first step in the pair-culture effect. The present results demonstrate that egg laying in these cases is unspecific and due rather to the end of isolation than to specific interactions with the partner. In groups consisting of up to 50 animals the sex ratio oscillates around 1:1. The presence of primary males does not influence the sex ratio of adult specimens, although these males are capable of fertilizing egg masses produced by adult females. As a result, a high percentage of both young and old males are found in densely populated bowls. The significance of the pair-culture effect in natural populations is discussed in the light of these findings.

Paired β-sheet structure of an Aβ(1-40) amyloid fibril revealed by electron microscopy

PubMed Central

Sachse, Carsten; Fändrich, Marcus; Grigorieff, Nikolaus

2008-01-01

Alzheimer's disease is a neurodegenerative disorder that is characterized by the cerebral deposition of amyloid fibrils formed by Aβ peptide. Despite their prevalence in Alzheimer's and other neurodegenerative diseases, important details of the structure of amyloid fibrils remain unknown. Here, we present a three-dimensional structure of a mature amyloid fibril formed by Aβ(1-40) peptide, determined by electron cryomicroscopy at ≈8-Å resolution. The fibril consists of two protofilaments, each containing ≈5-nm-long regions of β-sheet structure. A local twofold symmetry within each region suggests that pairs of β-sheets are formed from equivalent parts of two Aβ(1-40) peptides contained in each protofilament. The pairing occurs via tightly packed interfaces, reminiscent of recently reported steric zipper structures. However, unlike these previous structures, the β-sheet pairing is observed within an amyloid fibril and includes significantly longer amino acid sequences. PMID:18483195

Dynamic DNA devices and assemblies formed by shape-complementary, non-base pairing 3D components

NASA Astrophysics Data System (ADS)

Gerling, Thomas; Wagenbauer, Klaus F.; Neuner, Andrea M.; Dietz, Hendrik

2015-03-01

We demonstrate that discrete three-dimensional (3D) DNA components can specifically self-assemble in solution on the basis of shape-complementarity and without base pairing. Using this principle, we produced homo- and heteromultimeric objects, including micrometer-scale one- and two-stranded filaments and lattices, as well as reconfigurable devices, including an actuator, a switchable gear, an unfoldable nanobook, and a nanorobot. These multidomain assemblies were stabilized via short-ranged nucleobase stacking bonds that compete against electrostatic repulsion between the components’ interfaces. Using imaging by electron microscopy, ensemble and single-molecule fluorescence resonance energy transfer spectroscopy, and electrophoretic mobility analysis, we show that the balance between attractive and repulsive interactions, and thus the conformation of the assemblies, may be finely controlled by global parameters such as cation concentration or temperature and by an allosteric mechanism based on strand-displacement reactions.

Dynamic Inefficiencies in an Employment-Based Health Insurance System: Theory and Evidence.

PubMed

Fang, Hanming; Gavazza, Alessandro

2011-12-01

We investigate the effects of the institutional settings of the US health care system on individuals' life-cycle medical expenditures. Health is a form of general human capital; labor turnover and labor-market frictions prevent an employer-employee pair from capturing the entire surplus from investment in an employee’s health. Thus, the pair underinvests in health during working years, thereby increasing medical expenditures during retirement. We provide empirical evidence consistent with the comparative statics predictions of our model using the Medical Expenditure Panel Survey (MEPS) and the Health and Retirement Study (HRS). Our estimates suggest significant inefficiencies in health investment in the United States.

Processing of ICARTT Data Files Using Fuzzy Matching and Parser Combinators

NASA Technical Reports Server (NTRS)

Rutherford, Matthew T.; Typanski, Nathan D.; Wang, Dali; Chen, Gao

2014-01-01

In this paper, the task of parsing and matching inconsistent, poorly formed text data through the use of parser combinators and fuzzy matching is discussed. An object-oriented implementation of the parser combinator technique is used to allow for a relatively simple interface for adapting base parsers. For matching tasks, a fuzzy matching algorithm with Levenshtein distance calculations is implemented to match string pair, which are otherwise difficult to match due to the aforementioned irregularities and errors in one or both pair members. Used in concert, the two techniques allow parsing and matching operations to be performed which had previously only been done manually.

Molecular flip–flops formed by overlapping Fis sites

PubMed Central

Hengen, Paul N.; Lyakhov, Ilya G.; Stewart, Lisa E.; Schneider, Thomas D.

2003-01-01

The DNA-binding protein Fis frequently uses pairs of sites 7 or 11 base pairs (bp) apart. Two overlapping Fis sites separated by 11 bp are found in the Escherichia coli origin of chromosomal replication. Only one of these sites is bound by Fis at a time, so the structure is a molecular flip–flop that could direct alternative firing of replication complexes in opposite directions. Alternatively, the flip–flop could represent part of an on–off switch for replication. Because they can be used to create precise switched states, molecular flip–flops could be used as the basis of a novel molecular computer. PMID:14602927

Molecular flip-flops formed by overlapping Fis sites.

PubMed

Hengen, Paul N; Lyakhov, Ilya G; Stewart, Lisa E; Schneider, Thomas D

2003-11-15

The DNA-binding protein Fis frequently uses pairs of sites 7 or 11 base pairs (bp) apart. Two overlapping Fis sites separated by 11 bp are found in the Escherichia coli origin of chromosomal replication. Only one of these sites is bound by Fis at a time, so the structure is a molecular flip-flop that could direct alternative firing of replication complexes in opposite directions. Alternatively, the flip-flop could represent part of an on-off switch for replication. Because they can be used to create precise switched states, molecular flip-flops could be used as the basis of a novel molecular computer.

Conformations of stereoisomeric base adducts to 4-hydroxyequilenin.

PubMed

Ding, Shuang; Shapiro, Robert; Geacintov, Nicholas E; Broyde, Suse

2003-06-01

Exposure to estrogen through estrogen replacement therapy increases the risk of women developing cancer in hormone sensitive tissues. Premarin (Wyeth), which has been the most frequent choice for estrogen replacement therapy in the United States, contains the equine estrogens equilin and equilenin as major components. 4-Hydroxyequilenin (4-OHEN) is a phase I metabolite of both of these substances. This catechol estrogen autoxidizes to potent cytotoxic quinoids that can react with dG, dA, and dC to form unusual stereoisomeric cyclic adducts (Bolton, J. L., et al. (1998) Chem. Res. Toxicol. 11, 1113-1127). Like other bulky DNA adducts, these lesions may exhibit different susceptibilities to DNA repair and mutagenic potential, if not repaired in a structure-dependent manner. To ultimately gain insights into structure-function relationships, we computed conformations of stereoisomeric guanine, adenine, and cytosine base adducts using density functional theory. We find near mirror image conformations in stereoisomer adduct pairs for each modified base, suggesting opposite orientations with respect to the 5' --> 3' direction of the modified strand when the stereoisomer pairs are incorporated into duplex DNA. Such opposite orientations could cause stereoisomer pairs of lesions to respond differently to DNA replication and repair enzymes.

Multi-image CAD employing features derived from ipsilateral mammographic views

NASA Astrophysics Data System (ADS)

Good, Walter F.; Zheng, Bin; Chang, Yuan-Hsiang; Wang, Xiao Hui; Maitz, Glenn S.; Gur, David

1999-05-01

On mammograms, certain kinds of features related to masses (e.g., location, texture, degree of spiculation, and integrated density difference) tend to be relatively invariant, or at last predictable, with respect to breast compression. Thus, ipsilateral pairs of mammograms may contain information not available from analyzing single views separately. To demonstrate the feasibility of incorporating multi-view features into CAD algorithm, `single-image' CAD was applied to each individual image in a set of 60 ipsilateral studies, after which all possible pairs of suspicious regions, consisting of one from each view, were formed. For these 402 pairs we defined and evaluated `multi-view' features such as: (1) relative position of centers of regions; (2) ratio of lengths of region projections parallel to nipple axis lines; (3) ratio of integrated contrast difference; (4) ratio of the sizes of the suspicious regions; and (5) measure of relative complexity of region boundaries. Each pair was identified as either a `true positive/true positive' (T) pair (i.e., two regions which are projections of the same actual mass), or as a falsely associated pair (F). Distributions for each feature were calculated. A Bayesian network was trained and tested to classify pairs of suspicious regions based exclusively on the multi-view features described above. Distributions for all features were significantly difference for T versus F pairs as indicated by likelihood ratios. Performance of the Bayesian network, which was measured by ROC analysis, indicates a significant ability to distinguish between T pairs and F pairs (Az equals 0.82 +/- 0.03), using information that is attributed to the multi-view content. This study is the first demonstration that there is a significant amount of spatial information that can be derived from ipsilateral pairs of mammograms.

Base pairing and structural insights into the 5-formylcytosine in RNA duplex

PubMed Central

Wang, Rui; Luo, Zhipu; He, Kaizhang; Delaney, Michael O.; Chen, Doris; Sheng, Jia

2016-01-01

Abstract 5-Formylcytidine (f5C), a previously discovered natural nucleotide in the mitochondrial tRNA of many species including human, has been recently detected as the oxidative product of 5-methylcytidine (m5C) through 5-hydroxymethylcytidine (hm5C) in total RNA of mammalian cells. The discovery indicated that these cytosine derivatives in RNA might also play important epigenetic roles similar as in DNA, which has been intensively investigated in the past few years. In this paper, we studied the base pairing specificity of f5C in different RNA duplex contexts. We found that the 5-formyl group could increase duplex thermal stability and enhance base pairing specificity. We present three high-resolution crystal structures of an octamer RNA duplex [5′-GUA(f5C)GUAC-3′]2 that have been solved under three crystallization conditions with different buffers and pH values. Our results showed that the 5-formyl group is located in the same plane as the cytosine base and forms an intra-residue hydrogen bond with the amino group in the N4 position. In addition, this modification increases the base stacking between the f5C and the neighboring bases while not causing significant global and local structure perturbations. This work provides insights into the effects of 5-formylcytosine on RNA duplex. PMID:27079978

Hyper-Binding across Time: Age Differences in the Effect of Temporal Proximity on Paired-Associate Learning

ERIC Educational Resources Information Center

Campbell, Karen L.; Trelle, Alexandra; Hasher, Lynn

2014-01-01

Older adults show hyper- (or excessive) binding effects for simultaneously and sequentially presented distraction. Here, we addressed the potential role of hyper-binding in paired-associate learning. Older and younger adults learned a list of word pairs and then received an associative recognition task in which rearranged pairs were formed from…

Effective theory of exotic superconductivity in LaAlO3/SrTiO3 interfaces

NASA Astrophysics Data System (ADS)

Esmailzadeh, Haniyeh; Moghaddam, Ali G.

2018-05-01

Motivated by experimental and theoretical works about superconductivity at the oxide interfaces, we provide a simple model for possible unconventional pairings inside the exotic two-dimensional electron gas formed in heterostructures of SrTiO3 and LaAlO3. At the low energy limit, the electron gas at the interfaces is usually modeled with an effective three band model considering of 3d t2g orbitals which are slightly coupled by atomic spin-orbit couplings (SOC). Considering direct superconducting pairing in two higher delocalized bands and by exploiting a perturbative scheme based on canonical transformation, we derive the effective pairing amplitudes with possibly exotic nature inside the localized dxy band as well as various inter-band pairing components. In particular we show that equal-spin triplet pairings are possible between the band dxy and any of other dxz and dyz bands. In addition weaker effective pairings take place inside the localized band itself and between delocalized dxz and dyz bands with singlet and opposite-spin triplet characters. These unconventional effective pairings are indeed mediated by SOC-induced higher order virtual transitions between the bands and particularly into the localized band. Our model suggest that unconventional effective superconductivity is possible at oxide interfaces, simply, due to the special band structure and important role of atomic SOC and perhaps other magnetic effects present at these heterostructures.

Characterization of a Chlamydomonas Insertional Mutant that Disrupts Flagellar Central Pair Microtubule-associated Structures

PubMed Central

Mitchell, David R.; Sale, Winfield S.

1999-01-01

Two alleles at a new locus, central pair–associated complex 1 (CPC1), were selected in a screen for Chlamydomonas flagellar motility mutations. These mutations disrupt structures associated with central pair microtubules and reduce flagellar beat frequency, but do not prevent changes in flagellar activity associated with either photophobic responses or phototactic accumulation of live cells. Comparison of cpc1 and pf6 axonemes shows that cpc1 affects a row of projections along C1 microtubules distinct from those missing in pf6, and a row of thin fibers that form an arc between the two central pair microtubules. Electron microscopic images of the central pair in axonemes from radial spoke–defective strains reveal previously undescribed central pair structures, including projections extending laterally toward radial spoke heads, and a diagonal link between the C2 microtubule and the cpc1 projection. By SDS-PAGE, cpc1 axonemes show reductions of 350-, 265-, and 79-kD proteins. When extracted from wild-type axonemes, these three proteins cosediment on sucrose gradients with three other central pair proteins (135, 125, and 56 kD) in a 16S complex. Characterization of cpc1 provides new insights into the structure and biochemistry of the central pair apparatus, and into its function as a regulator of dynein-based motility. PMID:9922455

Widespread Transient Hoogsteen Base-Pairs in Canonical Duplex DNA with Variable Energetics

PubMed Central

Alvey, Heidi S.; Gottardo, Federico L.; Nikolova, Evgenia N.; Al-Hashimi, Hashim M.

2015-01-01

Hoogsteen base-pairing involves a 180 degree rotation of the purine base relative to Watson-Crick base-pairing within DNA duplexes, creating alternative DNA conformations that can play roles in recognition, damage induction, and replication. Here, using Nuclear Magnetic Resonance R1ρ relaxation dispersion, we show that transient Hoogsteen base-pairs occur across more diverse sequence and positional contexts than previously anticipated. We observe sequence-specific variations in Hoogsteen base-pair energetic stabilities that are comparable to variations in Watson-Crick base-pair stability, with Hoogsteen base-pairs being more abundant for energetically less favorable Watson-Crick base-pairs. Our results suggest that the variations in Hoogsteen stabilities and rates of formation are dominated by variations in Watson-Crick base pair stability, suggesting a late transition state for the Watson-Crick to Hoogsteen conformational switch. The occurrence of sequence and position-dependent Hoogsteen base-pairs provide a new potential mechanism for achieving sequence-dependent DNA transactions. PMID:25185517

Hydration sites of unpaired RNA bases: a statistical analysis of the PDB structures.

PubMed

Kirillova, Svetlana; Carugo, Oliviero

2011-10-19

Hydration is crucial for RNA structure and function. X-ray crystallography is the most commonly used method to determine RNA structures and hydration and, therefore, statistical surveys are based on crystallographic results, the number of which is quickly increasing. A statistical analysis of the water molecule distribution in high-resolution X-ray structures of unpaired RNA nucleotides showed that: different bases have the same penchant to be surrounded by water molecules; clusters of water molecules indicate possible hydration sites, which, in some cases, match those of the major and minor grooves of RNA and DNA double helices; complex hydrogen bond networks characterize the solvation of the nucleotides, resulting in a significant rigidity of the base and its surrounding water molecules. Interestingly, the hydration sites around unpaired RNA bases do not match, in general, the positions that are occupied by the second nucleotide when the base-pair is formed. The hydration sites around unpaired RNA bases were found. They do not replicate the atom positions of complementary bases in the Watson-Crick pairs.

Hydration sites of unpaired RNA bases: a statistical analysis of the PDB structures

PubMed Central

2011-01-01

Background Hydration is crucial for RNA structure and function. X-ray crystallography is the most commonly used method to determine RNA structures and hydration and, therefore, statistical surveys are based on crystallographic results, the number of which is quickly increasing. Results A statistical analysis of the water molecule distribution in high-resolution X-ray structures of unpaired RNA nucleotides showed that: different bases have the same penchant to be surrounded by water molecules; clusters of water molecules indicate possible hydration sites, which, in some cases, match those of the major and minor grooves of RNA and DNA double helices; complex hydrogen bond networks characterize the solvation of the nucleotides, resulting in a significant rigidity of the base and its surrounding water molecules. Interestingly, the hydration sites around unpaired RNA bases do not match, in general, the positions that are occupied by the second nucleotide when the base-pair is formed. Conclusions The hydration sites around unpaired RNA bases were found. They do not replicate the atom positions of complementary bases in the Watson-Crick pairs. PMID:22011380

Spin-correlated doublet pairs as intermediate states in charge separation processes

NASA Astrophysics Data System (ADS)

Kraffert, Felix; Behrends, Jan

2017-10-01

Spin-correlated charge-carrier pairs play a crucial role as intermediate states in charge separation both in natural photosynthesis as well as in solar cells. Using transient electron paramagnetic resonance (trEPR) spectroscopy in combination with spectral simulations, we study spin-correlated polaron pairs in polymer:fullerene blends as organic solar cells materials. The semi-analytical simulations presented here are based on the well-established theoretical description of spin-correlated radical pairs in biological systems, however, explicitly considering the disordered nature of polymer:fullerene blends. The large degree of disorder leads to the fact that many different relative orientations between both polarons forming the spin-correlated pairs have to be taken into account. This has important implications for the spectra, which differ significantly from those of spin-correlated radical pairs with a fixed relative orientation. We systematically study the influence of exchange and dipolar couplings on the trEPR spectra and compare the simulation results to measured X- and Q-band trEPR spectra. Our results demonstrate that assuming dipolar couplings alone does not allow us to reproduce the experimental spectra. Due to the rather delocalised nature of polarons in conjugated organic semiconductors, a significant isotropic exchange coupling needs to be included to achieve good agreement between experiments and simulations.

Selective photooxidation of hydrocarbons in zeolites by oxygen

DOEpatents

Frei, Heinz; Blatter, Fritz; Sun, Hai

1998-01-01

A selective photooxidation process for the conversion of hydrocarbon molecules to partially oxygenated derivatives, which comprises the steps of adsorbing a hydrocarbon and oxygen onto a dehydrated zeolite support matrix to form a hydrocarbon-oxygen contact pair, and subsequently exposing the hydrocarbon-oxygen contact pair to visible light, thereby forming a partially oxygenated derivative.

Mining protein phosphorylation information from biomedical literature using NLP parsing and Support Vector Machines.

PubMed

Raja, Kalpana; Natarajan, Jeyakumar

2018-07-01

Extraction of protein phosphorylation information from biomedical literature has gained much attention because of the importance in numerous biological processes. In this study, we propose a text mining methodology which consists of two phases, NLP parsing and SVM classification to extract phosphorylation information from literature. First, using NLP parsing we divide the data into three base-forms depending on the biomedical entities related to phosphorylation and further classify into ten sub-forms based on their distribution with phosphorylation keyword. Next, we extract the phosphorylation entity singles/pairs/triplets and apply SVM to classify the extracted singles/pairs/triplets using a set of features applicable to each sub-form. The performance of our methodology was evaluated on three corpora namely PLC, iProLink and hPP corpus. We obtained promising results of >85% F-score on ten sub-forms of training datasets on cross validation test. Our system achieved overall F-score of 93.0% on iProLink and 96.3% on hPP corpus test datasets. Furthermore, our proposed system achieved best performance on cross corpus evaluation and outperformed the existing system with recall of 90.1%. The performance analysis of our unique system on three corpora reveals that it extracts protein phosphorylation information efficiently in both non-organism specific general datasets such as PLC and iProLink, and human specific dataset such as hPP corpus. Copyright © 2018 Elsevier B.V. All rights reserved.

Ceramic blade attachment system

DOEpatents

Shaffer, J.E.

1995-07-11

A turbine blade having a preestablished rate of thermal expansion is attached to a turbine disc having a preestablished rate of thermal expansion being greater than the preestablished rate of thermal expansion of the turbine blade and forms a turbine assembly. The turbine blade has a root portion defining a pair of sides having a pair of grooves therein. The turbine assembly includes a pair of flanges between which the turbine blades are positioned. Each of the pair of flanges has a plurality of grooves defined therein. The grooves within the pair of flanges are aligned with the grooves in the blades and have a space formed therebetween. A plurality of spherical balls are positioned within the space. The plurality of spherical balls has a preestablished rate of thermal expansion being equal to the preestablished rate of thermal expansion of the turbine blade. 4 figs.

Ceramic blade attachment system

DOEpatents

Shaffer, James E.

1995-01-01

A turbine blade having a preestablished rate of thermal expansion is attached to a turbine disc having a preestablished rate of thermal expansion being greater than the preestablished rate of thermal expansion of the turbine blade and forms a turbine assembly. The turbine blade has a root portion defining a pair of sides having a pair of grooves therein. The turbine assembly includes a pair of flanges between which the turbine blades are positioned. Each of the pair of flanges has a plurality of grooves defined therein. The grooves within the pair of flanges are aligned with the grooves in the blades and have a space formed therebetween. A plurality of spherical balls are positioned within the space. The plurality of spherical balls has a preestablished rate of thermal expansion being equal to the preestablished rate of thermal expansion of the turbine blade.

Microoptoelectromechanical system (MOEMS) based laser

DOEpatents

Hutchinson, Donald P.

2003-11-04

A method for forming a folded laser and associated laser device includes providing a waveguide substrate, micromachining the waveguide substrate to form a folded waveguide structure including a plurality of intersecting folded waveguide paths, forming a single fold mirror having a plurality of facets which bound all ends of said waveguide paths except those reserved for resonator mirrors, and disposing a pair of resonator mirrors on opposite sides of the waveguide to form a lasing cavity. A lasing material is provided in the lasing cavity. The laser can be sealed by disposing a top on the waveguide substrate. The laser can include a re-entrant cavity, where the waveguide substrate is disposed therein, the re-entrant cavity including the single fold mirror.

Personalizing Chinese medicine by integrating molecular features of diseases and herb ingredient information: application to acute myeloid leukemia

PubMed Central

Xie, Duoli; Shi, Tieliu; Wen, Chengping

2017-01-01

Traditional Chinese Medicine (TCM) has been widely used as a complementary medicine in Acute Myeloid Leukemia (AML) treatment. In this study, we proposed a new classification of Chinese Medicines (CMs) by integrating the latest discoveries in disease molecular mechanisms and traditional medicine theory. We screened out a set of chemical compounds on basis of AML differential expression genes and chemical-protein interactions and then mapped them to Traditional Chinese Medicine Integrated Database. 415 CMs contain those compounds and they were categorized into 8 groups according to the Traditional Chinese Pharmacology. Pathway analysis and synthetic lethality gene pairs were applied to analyze the dissimilarity, generality and intergroup relations of different groups. We defined hub CM pairs and alternative CM groups based on the analysis result and finally proposed a formula to form an effective anti-AML prescription which combined the hub CM pairs with alternative CMs according to patients’ molecular features. Our method of formulating CMs based on patients’ stratification provides novel insights into the new usage of conventional CMs and will promote TCM modernization. PMID:28454110

Personalizing Chinese medicine by integrating molecular features of diseases and herb ingredient information: application to acute myeloid leukemia.

PubMed

Huang, Lin; Li, Haichang; Xie, Duoli; Shi, Tieliu; Wen, Chengping

2017-06-27

Traditional Chinese Medicine (TCM) has been widely used as a complementary medicine in Acute Myeloid Leukemia (AML) treatment. In this study, we proposed a new classification of Chinese Medicines (CMs) by integrating the latest discoveries in disease molecular mechanisms and traditional medicine theory. We screened out a set of chemical compounds on basis of AML differential expression genes and chemical-protein interactions and then mapped them to Traditional Chinese Medicine Integrated Database. 415 CMs contain those compounds and they were categorized into 8 groups according to the Traditional Chinese Pharmacology. Pathway analysis and synthetic lethality gene pairs were applied to analyze the dissimilarity, generality and intergroup relations of different groups. We defined hub CM pairs and alternative CM groups based on the analysis result and finally proposed a formula to form an effective anti-AML prescription which combined the hub CM pairs with alternative CMs according to patients' molecular features. Our method of formulating CMs based on patients' stratification provides novel insights into the new usage of conventional CMs and will promote TCM modernization.

Two cloud-based cues for estimating scene structure and camera calibration.

PubMed

Jacobs, Nathan; Abrams, Austin; Pless, Robert

2013-10-01

We describe algorithms that use cloud shadows as a form of stochastically structured light to support 3D scene geometry estimation. Taking video captured from a static outdoor camera as input, we use the relationship of the time series of intensity values between pairs of pixels as the primary input to our algorithms. We describe two cues that relate the 3D distance between a pair of points to the pair of intensity time series. The first cue results from the fact that two pixels that are nearby in the world are more likely to be under a cloud at the same time than two distant points. We describe methods for using this cue to estimate focal length and scene structure. The second cue is based on the motion of cloud shadows across the scene; this cue results in a set of linear constraints on scene structure. These constraints have an inherent ambiguity, which we show how to overcome by combining the cloud motion cue with the spatial cue. We evaluate our method on several time lapses of real outdoor scenes.

Structural studies on choline-carboxylate bio-ionic liquids by x-ray scattering and molecular dynamics.

PubMed

Tanzi, Luana; Ramondo, Fabio; Caminiti, Ruggero; Campetella, Marco; Di Luca, Andrea; Gontrani, Lorenzo

2015-09-21

We report a X-ray diffraction and molecular dynamics study on three choline-based bio-ionic liquids, choline formate, [Ch] [For], choline propanoate, [Ch][Pro], and choline butanoate, [Ch][But]. For the first time, this class of ionic liquids has been investigated by X-ray diffraction. Experimental and theoretical structure factors have been compared for each term of the series. Local structural organization has been obtained from ab initio calculations through static models of isolated ion pairs and dynamic simulations of small portions of liquids through twelve, ten, and nine ion pairs for [Ch][For], [Ch][Pro], and [Ch][But], respectively. All the theoretical models indicate that cations and anions are connected by strong hydrogen bonding and form stable ion pairs in the liquid that are reminiscent of the static ab initio ion pairs. Different structural aspects may affect the radial distribution function, like the local structure of ion pairs and the conformation of choline. When small portions of liquids have been simulated by dynamic quantum chemical methods, some key structural features of the X-ray radial distribution function were well reproduced whereas the classical force fields here applied did not entirely reproduce all the observed structural features.

Structural studies on choline-carboxylate bio-ionic liquids by x-ray scattering and molecular dynamics

NASA Astrophysics Data System (ADS)

Tanzi, Luana; Ramondo, Fabio; Caminiti, Ruggero; Campetella, Marco; Di Luca, Andrea; Gontrani, Lorenzo

2015-09-01

We report a X-ray diffraction and molecular dynamics study on three choline-based bio-ionic liquids, choline formate, [Ch] [For], choline propanoate, [Ch][Pro], and choline butanoate, [Ch][But]. For the first time, this class of ionic liquids has been investigated by X-ray diffraction. Experimental and theoretical structure factors have been compared for each term of the series. Local structural organization has been obtained from ab initio calculations through static models of isolated ion pairs and dynamic simulations of small portions of liquids through twelve, ten, and nine ion pairs for [Ch][For], [Ch][Pro], and [Ch][But], respectively. All the theoretical models indicate that cations and anions are connected by strong hydrogen bonding and form stable ion pairs in the liquid that are reminiscent of the static ab initio ion pairs. Different structural aspects may affect the radial distribution function, like the local structure of ion pairs and the conformation of choline. When small portions of liquids have been simulated by dynamic quantum chemical methods, some key structural features of the X-ray radial distribution function were well reproduced whereas the classical force fields here applied did not entirely reproduce all the observed structural features.

Quantitative Metabolome Analysis Based on Chromatographic Peak Reconstruction in Chemical Isotope Labeling Liquid Chromatography Mass Spectrometry.

PubMed

Huan, Tao; Li, Liang

2015-07-21

Generating precise and accurate quantitative information on metabolomic changes in comparative samples is important for metabolomics research where technical variations in the metabolomic data should be minimized in order to reveal biological changes. We report a method and software program, IsoMS-Quant, for extracting quantitative information from a metabolomic data set generated by chemical isotope labeling (CIL) liquid chromatography mass spectrometry (LC-MS). Unlike previous work of relying on mass spectral peak ratio of the highest intensity peak pair to measure relative quantity difference of a differentially labeled metabolite, this new program reconstructs the chromatographic peaks of the light- and heavy-labeled metabolite pair and then calculates the ratio of their peak areas to represent the relative concentration difference in two comparative samples. Using chromatographic peaks to perform relative quantification is shown to be more precise and accurate. IsoMS-Quant is integrated with IsoMS for picking peak pairs and Zero-fill for retrieving missing peak pairs in the initial peak pairs table generated by IsoMS to form a complete tool for processing CIL LC-MS data. This program can be freely downloaded from the www.MyCompoundID.org web site for noncommercial use.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ichinose, G. A.; Myers, S. C.; Ford, S. R.

Here, we performed relative locations of six event pairs based on surface wave (SW) and body wave (BW) differential traveltimes of the 9 September 2016, 6 January 2016, 12 February 2013, and 25 May 2009 announced North Korea nuclear explosions. The SW relative locations for the 25 May 2009 and 12 February 2013 events were inconsistent with the BWs when paired with other events, and only the 6 January 2016/9 September 2016 pair was consistent. Apparent SW phase shift is investigated with respect to the BW relative locations. The pairs formed with the 25 May 2009 and 12 February 2013more » events, beneath the southeast slope of Mount Mant'ap, have the largest phase shifts and amplitude ratio deviations, whereas the least deviation was from the 6 January 2016 and 9 September 2016 event pair beneath the mountain peak. Regional moment tensors (MTs) predict the amplitude ratios but do not resolve the relative phase. We find that MTs with 10% difference in isotropic and rotated +CLVD can fit both relative phase and amplitude ratios. SW relative locations of highly isotropic and correlated explosion clusters can be affected by topography and small differences in MT.« less

Ion pair reinforced semi-interpenetrating polymer network for direct methanol fuel cell applications.

PubMed

Fang, Chunliu; Julius, David; Tay, Siok Wei; Hong, Liang; Lee, Jim Yang

2012-06-07

This paper describes the synthesis of ion-pair-reinforced semi-interpenetrating polymer networks (SIPNs) as proton exchange membranes (PEMs) for the direct methanol fuel cells (DMFCs). Specifically, sulfonated poly(2,6-dimethyl-1,4-phenylene oxide) (SPPO), a linear polymer proton source, was immobilized in a brominated PPO (BPPO) network covalently cross-linked by ethylenediamine (EDA). The immobilization of SPPO in the SIPN network was accomplished not only by the usual means of mechanical interlocking but also by ion pair formation between the sulfonic acid groups of SPPO and the amine moieties formed during the cross-linking reaction of BPPO with EDA. Through the ion pair interactions, the immobilization of SPPO polymer in the BPPO network was made more effective, resulting in a greater uniformity of sulfonic acid cluster distribution in the membrane. The hydrophilic amine-containing cross-links also compensated for some of the decrease in proton conductivity caused by ion pair formation. The SIPN membranes prepared as such showed good proton conductivity, low methanol permeability, good mechanical properties, and dimensional stability. Consequently, the PPO based SIPN membranes were able to deliver a higher maximum power density than Nafion, demonstrating the potential of the SIPN structure for PEM designs.

Synthesis and triplex forming properties of pyrimidine derivative containing extended functionality.

PubMed

Gianolio, D A; McLaughlin, L W

1999-08-01

Two pyrimidine nucleosides have been synthesized containing extended hydrogen bonding functionality. In one case the side chain is based upon semicarbazide and in the second monoacetylated carbohydrazide was employed. DNA sequences could be prepared using both analogue nucleosides in a reverse coupling protocol, and provided that the normal capping step was eliminated and that the iodine-based oxidizing solution was replaced with one based upon 10-camphorsulfonyl oxaziridine. Both derivatives exhibited moderate effects in targeting selectively C-G base pairs embedded within a polypurine target sequence.

Atomistic model of the spider silk nanostructure

NASA Astrophysics Data System (ADS)

Keten, Sinan; Buehler, Markus J.

2010-04-01

Spider silk is an ultrastrong and extensible self-assembling biopolymer that outperforms the mechanical characteristics of many synthetic materials including steel. Here we report atomic-level structures that represent aggregates of MaSp1 proteins from the N. Clavipes silk sequence based on a bottom-up computational approach using replica exchange molecular dynamics. We discover that poly-alanine regions predominantly form distinct and orderly beta-sheet crystal domains while disorderly structures are formed by poly-glycine repeats, resembling 31-helices. These could be the molecular source of the large semicrystalline fraction observed in silks, and also form the basis of the so-called "prestretched" molecular configuration. Our structures are validated against experimental data based on dihedral angle pair calculations presented in Ramachandran plots, alpha-carbon atomic distances, as well as secondary structure content.

Evolution of finite-amplitude localized vortices in planar homogeneous shear flows

NASA Astrophysics Data System (ADS)

Karp, Michael; Shukhman, Ilia G.; Cohen, Jacob

2017-02-01

An analytical-based method is utilized to follow the evolution of localized initially Gaussian disturbances in flows with homogeneous shear, in which the base velocity components are at most linear functions of the coordinates, including hyperbolic, elliptic, and simple shear. Coherent structures, including counterrotating vortex pairs (CVPs) and hairpin vortices, are formed for the cases where the streamlines of the base flow are open (hyperbolic and simple shear). For hyperbolic base flows, the dominance of shear over rotation leads to elongation of the localized disturbance along the outlet asymptote and formation of CVPs. For simple shear CVPs are formed from linear and nonlinear disturbances, whereas hairpins are observed only for highly nonlinear disturbances. For elliptic base flows CVPs, hairpins and vortex loops form initially, however they do not last and break into various vortical structures that spread in the spanwise direction. The effect of the disturbance's initial amplitude and orientation is examined and the optimal orientation achieving maximal growth is identified.

Nucleic acid duplexes incorporating a dissociable covalent base pair

NASA Technical Reports Server (NTRS)

Gao, K.; Orgel, L. E.; Bada, J. L. (Principal Investigator)

1999-01-01

We have used molecular modeling techniques to design a dissociable covalently bonded base pair that can replace a Watson-Crick base pair in a nucleic acid with minimal distortion of the structure of the double helix. We introduced this base pair into a potential precursor of a nucleic acid double helix by chemical synthesis and have demonstrated efficient nonenzymatic template-directed ligation of the free hydroxyl groups of the base pair with appropriate short oligonucleotides. The nonenzymatic ligation reactions, which are characteristic of base paired nucleic acid structures, are abolished when the covalent base pair is reduced and becomes noncoplanar. This suggests that the covalent base pair linking the two strands in the duplex is compatible with a minimally distorted nucleic acid double-helical structure.

Sequence Effect on the Formation of DNA Minidumbbells.

PubMed

Liu, Yuan; Lam, Sik Lok

2017-11-16

The DNA minidumbbell (MDB) is a recently identified non-B structure. The reported MDBs contain two TTTA, CCTG, or CTTG type II loops. At present, the knowledge and understanding of the sequence criteria for MDB formation are still limited. In this study, we performed a systematic high-resolution nuclear magnetic resonance (NMR) and native gel study to investigate the effect of sequence variations in tandem repeats on the formation of MDBs. Our NMR results reveal the importance of hydrogen bonds, base-base stacking, and hydrophobic interactions from each of the participating residues. We conclude that in the MDBs formed by tandem repeats, C-G loop-closing base pairs are more stabilizing than T-A loop-closing base pairs, and thymine residues in both the second and third loop positions are more stabilizing than cytosine residues. The results from this study enrich our knowledge on the sequence criteria for the formation of MDBs, paving a path for better exploring their potential roles in biological systems and DNA nanotechnology.

M&A For Lithography Of Sparse Arrays Of Sub-Micrometer Features

DOEpatents

Brueck, Steven R.J.; Chen, Xiaolan; Zaidi, Saleem; Devine, Daniel J.

1998-06-02

Methods and apparatuses are disclosed for the exposure of sparse hole and/or mesa arrays with line:space ratios of 1:3 or greater and sub-micrometer hole and/or mesa diameters in a layer of photosensitive material atop a layered material. Methods disclosed include: double exposure interferometric lithography pairs in which only those areas near the overlapping maxima of each single-period exposure pair receive a clearing exposure dose; double interferometric lithography exposure pairs with additional processing steps to transfer the array from a first single-period interferometric lithography exposure pair into an intermediate mask layer and a second single-period interferometric lithography exposure to further select a subset of the first array of holes; a double exposure of a single period interferometric lithography exposure pair to define a dense array of sub-micrometer holes and an optical lithography exposure in which only those holes near maxima of both exposures receive a clearing exposure dose; combination of a single-period interferometric exposure pair, processing to transfer resulting dense array of sub-micrometer holes into an intermediate etch mask, and an optical lithography exposure to select a subset of initial array to form a sparse array; combination of an optical exposure, transfer of exposure pattern into an intermediate mask layer, and a single-period interferometric lithography exposure pair; three-beam interferometric exposure pairs to form sparse arrays of sub-micrometer holes; five- and four-beam interferometric exposures to form a sparse array of sub-micrometer holes in a single exposure. Apparatuses disclosed include arrangements for the three-beam, five-beam and four-beam interferometric exposures.

Effects of ligand electronegativity on recoupled pair bonds with application to sulfurane precursors.

PubMed

Lindquist, Beth A; Woon, David E; Dunning, Thom H

2014-07-31

Recoupled pair bonds (RPBs) are conditional bonds-they only form for selected central atoms and ligands. A complete theoretical description of RPBs requires an understanding of the properties of the central atom and ligands that enable such bonds to be formed. In this work, we show that ligand electronegativity is positively correlated with recoupled pair bond strength for a variety of ligands interacting with the 3p(2) pair of sulfur. We also describe substituent (X) effects on the SF(a(4)Σ(-)) state by investigating X2SF species. These effects generally mirror those observed for covalently bound analogues, but we found that recoupled pair bonding can lead to breakdowns in the expected relationships among bond length, strength, and force constant for some of these species. Finally, we compare the properties of two molecules of practical interest that are bound by recoupled pair bonds: the dimethyl sulfur fluoride and hydroxide radicals (DMS-F and DMS-OH).

An unusual mode of DNA duplex association: Watson-Crick interaction of all-purine deoxyribonucleic acids.

PubMed

Battersby, Thomas R; Albalos, Maria; Friesenhahn, Michel J

2007-05-01

Nucleic acid duplexes associating through purine-purine base pairing have been constructed and characterized in a remarkable demonstration of nucleic acids with mixed sequence and a natural backbone in an alternative duplex structure. The antiparallel deoxyribose all-purine duplexes associate specifically through Watson-Crick pairing, violating the nucleobase size-complementarity pairing convention found in Nature. Sequence-specific recognition displayed by these structures makes the duplexes suitable, in principle, for information storage and replication fundamental to molecular evolution in all living organisms. All-purine duplexes can be formed through association of purines found in natural ribonucleosides. Key to the formation of these duplexes is the N(3)-H tautomer of isoguanine, preferred in the duplex, but not in aqueous solution. The duplexes have relevance to evolution of the modern genetic code and can be used for molecular recognition of natural nucleic acids.

Density functional theory study on the ionic liquid pyridinium hydrogen sulfate

NASA Astrophysics Data System (ADS)

Tankov, Ivaylo; Yankova, Rumyana; Genieva, Svetlana; Mitkova, Magdalena; Stratiev, Dicho

2017-07-01

The geometry, electronic structure and chemical reactivity of a pyridinium-based ionic liquid, pyridinium hydrogen sulfate ([H-Pyr]+[HSO4]-), have been discussed on the basis of quantum chemical density functional theory calculations using B3LYP/6-311+G(d,p) and B3LYP/6-311++G(2d,2p) approaches. The calculations indicated that [H-Pyr]+[HSO4]- exists in the form of an ion pair. A large electropositive potential was found on the pyridinium ring, while the regions of a negative electrostatic potential is linked with the lone pair of electronegative oxygen atoms in hydrogen sulfate anion ([HSO4]-). Electron transfer both within the anion, and between the anion and cation of an ion pair were described using natural bond orbital theory. The energy values of -7.1375 and -2.8801 eV were related to HOMO and LUMO orbitals, respectively.

Integrable aspects and rogue wave solution of Sasa-Satsuma equation with variable coefficients in the inhomogeneous fiber

NASA Astrophysics Data System (ADS)

Zhang, Yu-Ping; Yu, Lan; Wei, Guang-Mei

2018-02-01

Under investigation with symbolic computation in this paper, is a variable-coefficient Sasa-Satsuma equation (SSE) which can describe the ultra short pulses in optical fiber communications and propagation of deep ocean waves. By virtue of the extended Ablowitz-Kaup-Newell-Segur system, Lax pair for the model is directly constructed. Based on the obtained Lax pair, an auto-Bäcklund transformation is provided, then the explicit one-soliton solution is obtained. Meanwhile, an infinite number of conservation laws in explicit recursion forms are derived to indicate its integrability in the Liouville sense. Furthermore, exact explicit rogue wave (RW) solution is presented by use of a Darboux transformation. In addition to the double-peak structure and an analog of the Peregrine soliton, the RW can exhibit graphically an intriguing twisted rogue-wave (TRW) pair that involve four well-defined zero-amplitude points.

Pairs of Asteroids Probably of a Common Origin

NASA Astrophysics Data System (ADS)

Vokrouhlický, David; Nesvorný, David

2008-07-01

We report the first observational evidence for pairs of main-belt asteroids with bodies in each pair having nearly identical orbits. The existence of ~60 pairs identified here cannot be reconciled with random fluctuations of the asteroid orbit density and rather suggests a common origin of the paired objects. We propose that the identified pairs formed by (i) collisional disruptions of km-sized and larger parent asteroids, (ii) Yarkovsky-O'Keefe-Radzievski-Paddack (YORP)-induced spin-up and rotational fission of fast-rotating objects, and/or (iii) splitting of unstable asteroid binaries. In case (i), the pairs would be parts of compact collisional families with many km- and sub-km-size members that should be found by future asteroid surveys. Our dynamical analysis suggests that most identified pairs formed within the past lsim1 Myr, in several cases even much more recently. For example, paired asteroids (6070) Rheinland and (54827) 2001 NQ8 probably separated from their common ancestor only 16.5-19 kyr ago. Given their putatively very recent formation, the identified objects are prime candidates for astronomical observations. The title paraphrases that of Hirayama's 1918 paper "Groups of asteroids probably of a common origin," where the first evidence was given for groups of asteroid fragments produced by disruptive collisions.

Magnetic properties and pairing tendencies of the iron-based superconducting ladder BaFe 2 S 3 : Combined ab initio and density matrix renormalization group study

DOE PAGES

Patel, Niravkumar D.; Nocera, Alberto; Alvarez, Gonzalo; ...

2016-08-10

The recent discovery of superconductivity under high pressure in the two-leg ladder compound BaFe 2S 3 [H. Takahashi et al., Nat. Mater. 14, 1008 (2015)] opens a broad avenue of research, because it represents the first report of pairing tendencies in a quasi-one-dimensional iron-based high-critical-temperature superconductor. Similarly, as in the case of the cuprates, ladders and chains can be far more accurately studied using many-body techniques and model Hamiltonians than their layered counterparts, particularly if several orbitals are active. In this publication, we derive a two-orbital Hubbard model from first principles that describes individual ladders of BaFe 2S 3. Themore » model is studied with the density matrix renormalization group. These first reported results are exciting for two reasons: (i) at half-filling, ferromagnetic order emerges as the dominant magnetic pattern along the rungs of the ladder, and antiferromagnetic order along the legs, in excellent agreement with neutron experiments; and (ii) with hole doping, pairs form in the strong coupling regime, as found by studying the binding energy of two holes doped on the half-filled system. In addition, orbital selective Mott phase characteristics develop with doping, with only oneWannier orbital receiving the hole carriers while the other remains half-filled. Lastly, these results suggest that the analysis of models for iron-based two-leg ladders could clarify the origin of pairing tendencies and other exotic properties of iron-based high-critical-temperature superconductors in general.« less

Working the kinks out of nucleosomal DNA

PubMed Central

Olson, Wilma K.; Zhurkin, Victor B.

2011-01-01

Condensation of DNA in the nucleosome takes advantage of its double-helical architecture. The DNA deforms at sites where the base pairs face the histone octamer. The largest so-called kink-and-slide deformations occur in the vicinity of arginines that penetrate the minor groove. Nucleosome structures formed from the 601 positioning sequence differ subtly from those incorporating an AT-rich human α-satellite DNA. Restraints imposed by the histone arginines on the displacement of base pairs can modulate the sequence-dependent deformability of DNA and potentially contribute to the unique features of the different nucleosomes. Steric barriers mimicking constraints found in the nucleosome induce the simulated large-scale rearrangement of canonical B-DNA to kink-and-slide states. The pathway to these states shows non-harmonic behavior consistent with bending profiles inferred from AFM measurements. PMID:21482100

Two-particle correlation function and dihadron correlation approach

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vechernin, V. V., E-mail: v.vechernin@spbu.ru; Ivanov, K. O.; Neverov, D. I.

It is shown that, in the case of asymmetric nuclear interactions, the application of the traditional dihadron correlation approach to determining a two-particle correlation function C may lead to a form distorted in relation to the canonical pair correlation function {sub C}{sup 2}. This result was obtained both by means of exact analytic calculations of correlation functions within a simple string model for proton–nucleus and deuteron–nucleus collisions and by means of Monte Carlo simulations based on employing the HIJING event generator. It is also shown that the method based on studying multiplicity correlations in two narrow observation windows separated inmore » rapidity makes it possible to determine correctly the canonical pair correlation function C{sub 2} for all cases, including the case where the rapidity distribution of product particles is not uniform.« less

The nearest neighbor and next nearest neighbor effects on the thermodynamic and kinetic properties of RNA base pair

NASA Astrophysics Data System (ADS)

Wang, Yujie; Wang, Zhen; Wang, Yanli; Liu, Taigang; Zhang, Wenbing

2018-01-01

The thermodynamic and kinetic parameters of an RNA base pair with different nearest and next nearest neighbors were obtained through long-time molecular dynamics simulation of the opening-closing switch process of the base pair near its melting temperature. The results indicate that thermodynamic parameters of GC base pair are dependent on the nearest neighbor base pair, and the next nearest neighbor base pair has little effect, which validated the nearest-neighbor model. The closing and opening rates of the GC base pair also showed nearest neighbor dependences. At certain temperature, the closing and opening rates of the GC pair with nearest neighbor AU is larger than that with the nearest neighbor GC, and the next nearest neighbor plays little role. The free energy landscape of the GC base pair with the nearest neighbor GC is rougher than that with nearest neighbor AU.

A long baseline global stereo matching based upon short baseline estimation

NASA Astrophysics Data System (ADS)

Li, Jing; Zhao, Hong; Li, Zigang; Gu, Feifei; Zhao, Zixin; Ma, Yueyang; Fang, Meiqi

2018-05-01

In global stereo vision, balancing the matching efficiency and computing accuracy seems to be impossible because they contradict each other. In the case of a long baseline, this contradiction becomes more prominent. In order to solve this difficult problem, this paper proposes a novel idea to improve both the efficiency and accuracy in global stereo matching for a long baseline. In this way, the reference images located between the long baseline image pairs are firstly chosen to form the new image pairs with short baselines. The relationship between the disparities of pixels in the image pairs with different baselines is revealed by considering the quantized error so that the disparity search range under the long baseline can be reduced by guidance of the short baseline to gain matching efficiency. Then, the novel idea is integrated into the graph cuts (GCs) to form a multi-step GC algorithm based on the short baseline estimation, by which the disparity map under the long baseline can be calculated iteratively on the basis of the previous matching. Furthermore, the image information from the pixels that are non-occluded under the short baseline but are occluded for the long baseline can be employed to improve the matching accuracy. Although the time complexity of the proposed method depends on the locations of the chosen reference images, it is usually much lower for a long baseline stereo matching than when using the traditional GC algorithm. Finally, the validity of the proposed method is examined by experiments based on benchmark datasets. The results show that the proposed method is superior to the traditional GC method in terms of efficiency and accuracy, and thus it is suitable for long baseline stereo matching.

Nucleic acid duplexes incorporating a dissociable covalent base pair

PubMed Central

Gao, Kui; Orgel, Leslie E.

1999-01-01

We have used molecular modeling techniques to design a dissociable covalently bonded base pair that can replace a Watson-Crick base pair in a nucleic acid with minimal distortion of the structure of the double helix. We introduced this base pair into a potential precursor of a nucleic acid double helix by chemical synthesis and have demonstrated efficient nonenzymatic template-directed ligation of the free hydroxyl groups of the base pair with appropriate short oligonucleotides. The nonenzymatic ligation reactions, which are characteristic of base paired nucleic acid structures, are abolished when the covalent base pair is reduced and becomes noncoplanar. This suggests that the covalent base pair linking the two strands in the duplex is compatible with a minimally distorted nucleic acid double-helical structure. PMID:10611299

The phi-meson and Chiral-mass-meson production in heavy-ion collisions as potential probes of quark-gluon-plasma and Chiral symmetry transitions

NASA Technical Reports Server (NTRS)

Takahashi, Y.; Eby, P. B.

1985-01-01

Possibilities of observing abundances of phi mesons and narrow hadronic pairs, as results of QGP and Chiral transitions, are considered for nucleus-nucleus interactions. Kinematical requirements in forming close pairs are satisfied in K+K decays of S(975) and delta (980) mesons with small phi, and phi (91020) mesons with large PT, and in pi-pi decays of familiar resonance mesons only in a partially restored chiral symmetry. Gluon-gluon dominance in QGP can enhance phi meson production. High hadronization rates of primordial resonance mesons which form narrow hadronic pairs are not implausible. Past cosmic ray evidences of anomalous phi production and narrow pair abundances are considered.

Does Gender-Fair Language Pay Off? The Social Perception of Professions from a Cross-Linguistic Perspective.

PubMed

Horvath, Lisa K; Merkel, Elisa F; Maass, Anne; Sczesny, Sabine

2015-01-01

In many languages, masculine forms (e.g., German Lehrer, "teachers, masc.") have traditionally been used to refer to both women and men, although feminine forms are available, too. Feminine-masculine word pairs (e.g., German Lehrerinnen und Lehrer, "teachers, fem. and teachers, masc.") are recommended as gender-fair alternatives. A large body of empirical research documents that the use of gender-fair forms instead of masculine forms has a substantial impact on mental representations. Masculine forms activate more male representations even when used in a generic sense, whereas word pairs (e.g., German Lehrerinnen und Lehrer, "teachers, fem. and teachers, masc.") lead to a higher cognitive inclusion of women (i.e., visibility of women). Some recent studies, however, have also shown that in a professional context word pairs may be associated with lesser status. The present research is the first to investigate both effects within a single paradigm. A cross-linguistic (Italian and German) study with 391 participants shows that word pairs help to avoid a male bias in the gender-typing of professions and increase women's visibility; at the same time, they decrease the estimated salaries of typically feminine professions (but do not affect perceived social status or competence). This potential payoff has implications for language policies aiming at gender-fairness.

``Glue" approximation for the pairing interaction in the Hubbard model with next nearest neighbor hopping

NASA Astrophysics Data System (ADS)

Khatami, Ehsan; Macridin, Alexandru; Jarrell, Mark

2008-03-01

Recently, several authors have employed the ``glue" approximation for the Cuprates in which the full pairing vertex is approximated by the spin susceptibility. We study this approximation using Quantum Monte Carlo Dynamical Cluster Approximation methods on a 2D Hubbard model. By considering a reasonable finite value for the next nearest neighbor hopping, we find that this ``glue" approximation, in the current form, does not capture the correct pairing symmetry. Here, d-wave is not the leading pairing symmetry while it is the dominant symmetry using the ``exact" QMC results. We argue that the sensitivity of this approximation to the band structure changes leads to this inconsistency and that this form of interaction may not be the appropriate description of the pairing mechanism in Cuprates. We suggest improvements to this approximation which help to capture the the essential features of the QMC data.

Stabilised DNA secondary structures with increasing transcription localise hypermutable bases for somatic hypermutation in IGHV3-23.

PubMed

Duvvuri, Bhargavi; Duvvuri, Venkata R; Wu, Jianhong; Wu, Gillian E

2012-07-01

Somatic hypermutation (SHM) mediated by activation-induced cytidine deaminase (AID) is a transcription-coupled mechanism most responsible for generating high affinity antibodies. An issue remaining enigmatic in SHM is how AID is preferentially targeted during transcription to hypermutable bases in its substrates (WRC motifs) on both DNA strands. AID targets only single stranded DNA. By modelling the dynamical behaviour of IGHV3-23 DNA, a commonly used human variable gene segment, we observed that hypermutable bases on the non-transcribed strand are paired whereas those on transcribed strand are mostly unpaired. Hypermutable bases (both paired and unpaired) are made accessible to AID in stabilised secondary structures formed with increasing transcription levels. This observation provides a rationale for the hypermutable bases on both the strands of DNA being targeted to a similar extent despite having differences in unpairedness. We propose that increasing transcription and RNAP II stalling resulting in the formation and stabilisation of stem-loop structures with AID hotspots in negatively supercoiled region can localise the hypermutable bases of both strands of DNA, to AID-mediated SHM.

Cytological diploidization of paleopolyploid genus Zea: Divergence between homoeologous chromosomes or activity of pairing regulator genes?

PubMed Central

2018-01-01

Cytological diploidization process is different in autopolyploid and allopolyploid species. Colchicine applied at the onset of meiosis suppresses the effect of pairing regulator genes resulting multivalents formation in bivalent-forming species. Colchicine treated maizes (4x = 2n = 20, AmAmBmBm) showed up to 5IV, suggesting pairing between chromosomes from genomes homoeologous Am and Bm. In untreated individuals of the alloautooctoploid Zea perennis (8x = 2n = 40, ApApAp´Ap´Bp1Bp1Bp2Bp2) the most frequent configuration was 5IV+10II (formed by A and B genomes, respectively). The colchicine treated Z. perennis show up to 10IV revealing higher affinity within genomes A and B, but any homology among them. These results suggest the presence of a paring regulator locus (PrZ) in maize and Z. perennis, whose expression is suppressed by colchicine. It could be postulated that in Z. perennis, PrZ would affect independently the genomes A and B, being relevant the threshold of homology, the fidelity of pairing in each genomes and the ploidy level. Cytological analysis of the treated hexaploid hybrids (6x = 2n = 30), with Z. perennis as a parental, strongly suggests that PrZ is less effective in only one doses. This conclusion was reinforced by the homoeologous pairing observed in untreated dihaploid maizes, which showed up to 5II. Meiotic behaviour of individuals treated with different doses of colchicine allowed to postulate that PrZ affect the homoeologous association by controlling entire genomes (Am or Bm) rather than individual chromosomes. Based on cytological and statistical results it is possible to propose that the cytological diploidization in Zea species occurs by restriction of pairing between homoeologous chromosomes or by genetical divergence of the homoeologous chromosomes, as was observed in untreated Z. mays ssp. parviglumis. These are independent but complementary systems and could be acting jointly in the same nucleus. PMID:29293518

Cytological diploidization of paleopolyploid genus Zea: Divergence between homoeologous chromosomes or activity of pairing regulator genes?

PubMed

Poggio, Lidia; González, Graciela Esther

2018-01-01

Cytological diploidization process is different in autopolyploid and allopolyploid species. Colchicine applied at the onset of meiosis suppresses the effect of pairing regulator genes resulting multivalents formation in bivalent-forming species. Colchicine treated maizes (4x = 2n = 20, AmAmBmBm) showed up to 5IV, suggesting pairing between chromosomes from genomes homoeologous Am and Bm. In untreated individuals of the alloautooctoploid Zea perennis (8x = 2n = 40, ApApAp´Ap´Bp1Bp1Bp2Bp2) the most frequent configuration was 5IV+10II (formed by A and B genomes, respectively). The colchicine treated Z. perennis show up to 10IV revealing higher affinity within genomes A and B, but any homology among them. These results suggest the presence of a paring regulator locus (PrZ) in maize and Z. perennis, whose expression is suppressed by colchicine. It could be postulated that in Z. perennis, PrZ would affect independently the genomes A and B, being relevant the threshold of homology, the fidelity of pairing in each genomes and the ploidy level. Cytological analysis of the treated hexaploid hybrids (6x = 2n = 30), with Z. perennis as a parental, strongly suggests that PrZ is less effective in only one doses. This conclusion was reinforced by the homoeologous pairing observed in untreated dihaploid maizes, which showed up to 5II. Meiotic behaviour of individuals treated with different doses of colchicine allowed to postulate that PrZ affect the homoeologous association by controlling entire genomes (Am or Bm) rather than individual chromosomes. Based on cytological and statistical results it is possible to propose that the cytological diploidization in Zea species occurs by restriction of pairing between homoeologous chromosomes or by genetical divergence of the homoeologous chromosomes, as was observed in untreated Z. mays ssp. parviglumis. These are independent but complementary systems and could be acting jointly in the same nucleus.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Andrianov, S N; Moiseev, S A

We propose a scheme of a quantum computer based on nanophotonic elements: two buses in the form of nanowaveguide resonators, two nanosized units of multiatom multiqubit quantum memory and a set of nanoprocessors in the form of photonic quantum transistors, each containing a pair of nanowaveguide ring resonators coupled via a quantum dot. The operation modes of nanoprocessor photonic quantum transistors are theoretically studied and the execution of main logical operations by means of them is demonstrated. We also discuss the prospects of the proposed nanophotonic quantum computer for operating in high-speed optical fibre networks. (quantum computations)

Synthesis of peptide nucleic acids containing pyridazine derivatives as cytosine and thymine analogs, and their duplexes with complementary oligodeoxynucleotides.

PubMed

Tomori, Takahito; Miyatake, Yuya; Sato, Yuta; Kanamori, Takashi; Masaki, Yoshiaki; Ohkubo, Akihiro; Sekine, Mitsuo; Seio, Kohji

2015-03-20

Synthesis of peptide nucleic acids (PNAs) is reported with new pyridazine-type nucleobases: 3-aminopyridazine (aPz) and 1-aminophthalazine (aPh) as cytosine analogs, and pyridazin-3-one (Pz(O)) and phthalazin-1-one (Ph(O)) as thymine analogs. The PNAs having an aPz or a Pz(O) formed duplexes with each complementary oligodeoxynucleotide forming a base pair with G or A, respectively, as evaluated by using UV melting analyses and circular dichroism (CD) spectra.

Analysis of Structural Flexibility of Damaged DNA Using Thiol-Tethered Oligonucleotide Duplexes

PubMed Central

Fujita, Masashi; Watanabe, Shun; Yoshizawa, Mariko; Yamamoto, Junpei; Iwai, Shigenori

2015-01-01

Bent structures are formed in DNA by the binding of small molecules or proteins. We developed a chemical method to detect bent DNA structures. Oligonucleotide duplexes in which two mercaptoalkyl groups were attached to the positions facing each other across the major groove were prepared. When the duplex contained the cisplatin adduct, which was proved to induce static helix bending, interstrand disulfide bond formation under an oxygen atmosphere was detected by HPLC analyses, but not in the non-adducted duplex, when the two thiol-tethered nucleosides were separated by six base pairs. When the insert was five and seven base pairs, the disulfide bond was formed and was not formed, respectively, regardless of the cisplatin adduct formation. The same reaction was observed in the duplexes containing an abasic site analog and the (6–4) photoproduct. Compared with the cisplatin case, the disulfide bond formation was slower in these duplexes, but the reaction rate was nearly independent of the linker length. These results indicate that dynamic structural changes of the abasic site- and (6–4) photoproduct-containing duplexes could be detected by our method. It is strongly suggested that the UV-damaged DNA-binding protein, which specifically binds these duplexes and functions at the first step of global-genome nucleotide excision repair, recognizes the easily bendable nature of damaged DNA. PMID:25679955

Generation of strip-format fibrin-based engineered heart tissue (EHT).

PubMed

Schaaf, Sebastian; Eder, Alexandra; Vollert, Ingra; Stöhr, Andrea; Hansen, Arne; Eschenhagen, Thomas

2014-01-01

This protocol describes a method for casting fibrin-based engineered heart tissue (EHT) in standard 24-well culture dishes. In principle, a hydrogel tissue engineering method requires cardiomyocytes, a liquid matrix that forms a gel, a casting mold, and a device that keeps the developing tissue in place. This protocol refers to neonatal rat heart cells as the cell source; the matrix of choice is fibrin, and the tissues are generated in rectangular agarose-casting molds (12 × 3 × 3 mm) prepared in standard 24-well cell culture dishes, in which a pair of flexible silicone posts is suspended from above. A master mix of freshly isolated cells, medium, fibrinogen, and thrombin is pipetted into the casting mold and, over a period of 2 h, polymerizes and forms a fibrin cell block around two silicone posts. Silicone racks holding four pairs of silicone posts each are used to transfer the fresh fibrin cell blocks into new 24-well dishes with culture medium. Without further handling, the cells start to remodel the fibrin gel, form contacts with each other, elongate, and condense the gel to approximately ¼ of the initial volume. Spontaneous and rhythmic contractions start after 1 week. EHTs are viable and relatively stable for several weeks in this format and can be subjected to repeated measurements of contractile function and final morphological and molecular analyses.

Bistable microelectromechanical actuator

DOEpatents

Fleming, James G.

1999-01-01

A bistable microelectromechanical (MEM) actuator is formed on a substrate and includes a stressed membrane of generally rectangular shape that upon release assumes a curvilinear cross-sectional shape due to attachment at a midpoint to a resilient member and at opposing edges to a pair of elongate supports. The stressed membrane can be electrostatically switched between a pair of mechanical states having mirror-image symmetry, with the MEM actuator remaining in a quiescent state after a programming voltage is removed. The bistable MEM actuator according to various embodiments of the present invention can be used to form a nonvolatile memory element, an optical modulator (with a pair of mirrors supported above the membrane and moving in synchronism as the membrane is switched), a switchable mirror (with a single mirror supported above the membrane at the midpoint thereof) and a latching relay (with a pair of contacts that open and close as the membrane is switched). Arrays of bistable MEM actuators can be formed for applications including nonvolatile memories, optical displays and optical computing.

Bistable microelectromechanical actuator

DOEpatents

Fleming, J.G.

1999-02-02

A bistable microelectromechanical (MEM) actuator is formed on a substrate and includes a stressed membrane of generally rectangular shape that upon release assumes a curvilinear cross-sectional shape due to attachment at a midpoint to a resilient member and at opposing edges to a pair of elongate supports. The stressed membrane can be electrostatically switched between a pair of mechanical states having mirror-image symmetry, with the MEM actuator remaining in a quiescent state after a programming voltage is removed. The bistable MEM actuator according to various embodiments of the present invention can be used to form a nonvolatile memory element, an optical modulator (with a pair of mirrors supported above the membrane and moving in synchronism as the membrane is switched), a switchable mirror (with a single mirror supported above the membrane at the midpoint thereof) and a latching relay (with a pair of contacts that open and close as the membrane is switched). Arrays of bistable MEM actuators can be formed for applications including nonvolatile memories, optical displays and optical computing. 49 figs.

Classification of AB O 3 perovskite solids: a machine learning study

DOE PAGES

Pilania, G.; Balachandran, P. V.; Gubernatis, J. E.; ...

2015-07-23

Here we explored the use of machine learning methods for classifying whether a particularABO 3chemistry forms a perovskite or non-perovskite structured solid. Starting with three sets of feature pairs (the tolerance and octahedral factors, theAandBionic radii relative to the radius of O, and the bond valence distances between theAandBions from the O atoms), we used machine learning to create a hyper-dimensional partial dependency structure plot using all three feature pairs or any two of them. Doing so increased the accuracy of our predictions by 2–3 percentage points over using any one pair. We also included the Mendeleev numbers of theAandBatomsmore » to this set of feature pairs. Moreover, doing this and using the capabilities of our machine learning algorithm, the gradient tree boosting classifier, enabled us to generate a new type of structure plot that has the simplicity of one based on using just the Mendeleev numbers, but with the added advantages of having a higher accuracy and providing a measure of likelihood of the predicted structure.« less

NMR solution structure of an N2-guanine DNA adduct derived from the potent tumorigen dibenzo[a,l]pyrene: Intercalation from the minor groove with ruptured Watson-Crick base pairing

PubMed Central

Tang, Yijin; Liu, Zhi; Ding, Shuang; Lin, Chin H.; Cai, Yuqin; Rodriguez, Fabian A.; Sayer, Jane M.; Jerina, Donald M.; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E.

2012-01-01

The most potent tumorigen identified among the polycyclic aromatic hydrocarbons (PAH) is the non-planar fjord region dibenzo[a,l]pyrene (DB[a,l]P). It is metabolically activated in vivo through the widely-studied diol epoxide (DE) pathway to form covalent adducts with DNA bases, predominantly guanine and adenine. The (+)-11S,12R,13R,14S DE enantiomer forms adducts via its C14-position with the exocyclic amino group of guanine. Here, we present the first NMR solution structure of a DB[a,l]P-derived adduct, the 14R (+)-trans-anti-DB[a,l]P–N2-dG (DB[a,l]P-dG) lesion in double-stranded DNA. In contrast to the stereochemically identical benzo[a]pyrene-derived N2-dG adduct (B[a]P-dG) in which the B[a]P rings reside in the B-DNA minor groove on the 3’-side of the modifed deoxyguanosine, in the DB[a,l]P-derived adduct the DB[a,l]P rings intercalate into the duplex on the 3’-side of the modified base from the sterically crowded minor groove. Watson-Crick base pairing of the modified guanine with the partner cytosine is broken, but these bases retain some stacking with the bulky DB[a,l]P ring system. This new theme in PAH DE - DNA adduct conformation differs from: (1) the classical intercalation motif where Watson-Crick base-pairing is intact at the lesion site, and (2) the base-displaced intercalation motif in which the damaged base and its partner are extruded from the helix . The structural considerations that lead to the intercalated conformation of the DB[a,l]P-dG lesion in contrast to the minor groove alignment of the B[a]P-dG adduct, and the implications of the DB[a,l]P-dG conformational motif for the recognition of such DNA lesions by the human nucleotide excision repair apparatus, are discussed. PMID:23121427

Nuclear magnetic resonance solution structure of an N(2)-guanine DNA adduct derived from the potent tumorigen dibenzo[a,l]pyrene: intercalation from the minor groove with ruptured Watson-Crick base pairing.

PubMed

Tang, Yijin; Liu, Zhi; Ding, Shuang; Lin, Chin H; Cai, Yuqin; Rodriguez, Fabian A; Sayer, Jane M; Jerina, Donald M; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E

2012-12-04

The most potent tumorigen identified among the polycyclic aromatic hydrocarbons (PAH) is the nonplanar fjord region dibenzo[a,l]pyrene (DB[a,l]P). It is metabolically activated in vivo through the widely studied diol epoxide (DE) pathway to form covalent adducts with DNA bases, predominantly guanine and adenine. The (+)-11S,12R,13R,14S DE enantiomer forms adducts via its C14 position with the exocyclic amino group of guanine. Here, we present the first nuclear magnetic resonance solution structure of a DB[a,l]P-derived adduct, the 14R-(+)-trans-anti-DB[a,l]P-N(2)-dG (DB[a,l]P-dG) lesion in double-stranded DNA. In contrast to the stereochemically identical benzo[a]pyrene-derived N(2)-dG adduct (B[a]P-dG) in which the B[a]P rings reside in the B-DNA minor groove on the 3'-side of the modifed deoxyguanosine, in the DB[a,l]P-derived adduct the DB[a,l]P rings intercalate into the duplex on the 3'-side of the modified base from the sterically crowded minor groove. Watson-Crick base pairing of the modified guanine with the partner cytosine is broken, but these bases retain some stacking with the bulky DB[a,l]P ring system. This new theme in PAH DE-DNA adduct conformation differs from (1) the classical intercalation motif in which Watson-Crick base pairing is intact at the lesion site and (2) the base-displaced intercalation motif in which the damaged base and its partner are extruded from the helix. The structural considerations that lead to the intercalated conformation of the DB[a,l]P-dG lesion in contrast to the minor groove alignment of the B[a]P-dG adduct, and the implications of the DB[a,l]P-dG conformational motif for the recognition of such DNA lesions by the human nucleotide excision repair apparatus, are discussed.

The Nature of Negotiations in Face-to-Face versus Computer-Mediated Communication in Pair Interactions

ERIC Educational Resources Information Center

Rouhshad, Amir; Wigglesworth, Gillian; Storch, Neomy

2016-01-01

The Interaction Approach argues that negotiation for meaning and form is conducive to second language development. To date, most of the research on negotiations has been either in face-to-face (FTF) or text-based synchronous computer-mediated communication (SCMC) modes. Very few studies have compared the nature of negotiations across the modes.…

High-School Students' Approaches to Solving Algebra Problems that Are Posed Symbolically: Results from an Interview Study

ERIC Educational Resources Information Center

Huntley, Mary Ann; Davis, Jon D.

2008-01-01

A cross-curricular structured-probe task-based clinical interview study with 44 pairs of third year high-school mathematics students, most of whom were high achieving, was conducted to investigate their approaches to a variety of algebra problems. This paper presents results from three problems that were posed in symbolic form. Two problems are…

A Gamma-Ray Burst Model Via Compressional Heating of Binary Neutron Stars

NASA Astrophysics Data System (ADS)

Salmonson, J. D.; Wilson, J. R.; Mathews, G. J.

1998-12-01

We present a model for gamma-ray bursts based on the compression of neutron stars in close binary systems. General relativistic (GR) simulations of close neutron star binaries have found compression of the neutron stars estimated to produce 1053 ergs of thermal neutrinos on a timescale of seconds. The hot neutron stars will emit neutrino pairs which will partially recombine to form 1051 to 1052 ergs of electron-positron (e^-e^+) pair plasma. GR hydrodynamic computational modeling of the e^-e^+ plasma flow and recombination yield a gamma-ray burst in good agreement with general characteristics (duration ~10 seconds, spectrum peak energy ~100 keV, total energy ~1051 ergs) of many observed gamma-ray bursts.

Staufen-mediated mRNA decay.

PubMed

Park, Eonyoung; Maquat, Lynne E

2013-01-01

Staufen1 (STAU1)-mediated mRNA decay (SMD) is an mRNA degradation process in mammalian cells that is mediated by the binding of STAU1 to a STAU1-binding site (SBS) within the 3'-untranslated region (3'-UTR) of target mRNAs. During SMD, STAU1, a double-stranded (ds) RNA-binding protein, recognizes dsRNA structures formed either by intramolecular base pairing of 3'-UTR sequences or by intermolecular base pairing of 3'-UTR sequences with a long-noncoding RNA (lncRNA) via partially complementary Alu elements. Recently, STAU2, a paralog of STAU1, has also been reported to mediate SMD. Both STAU1 and STAU2 interact directly with the ATP-dependent RNA helicase UPF1, a key SMD factor, enhancing its helicase activity to promote effective SMD. Moreover, STAU1 and STAU2 form homodimeric and heterodimeric interactions via domain-swapping. Because both SMD and the mechanistically related nonsense-mediated mRNA decay (NMD) employ UPF1; SMD and NMD are competitive pathways. Competition contributes to cellular differentiation processes, such as myogenesis and adipogenesis, placing SMD at the heart of various physiologically important mechanisms. Copyright © 2013 John Wiley & Sons, Ltd.

Homology between DNA polymerases of poxviruses, herpesviruses, and adenoviruses: nucleotide sequence of the vaccinia virus DNA polymerase gene.

PubMed Central

Earl, P L; Jones, E V; Moss, B

1986-01-01

A 5400-base-pair segment of the vaccinia virus genome was sequenced and an open reading frame of 938 codons was found precisely where the DNA polymerase had been mapped by transfer of a phosphonoacetate-resistance marker. A single nucleotide substitution changing glycine at position 347 to aspartic acid accounts for the drug resistance of the mutant vaccinia virus. The 5' end of the DNA polymerase mRNA was located 80 base pairs before the methionine codon initiating the open reading frame. Correspondence between the predicted Mr 108,577 polypeptide and the 110,000 purified enzyme indicates that little or no proteolytic processing occurs. Extensive homology, extending over 435 amino acids, was found upon comparing the DNA polymerase of vaccinia virus and DNA polymerase of Epstein-Barr virus. A highly conserved sequence of 14 amino acids in the carboxyl-terminal regions of the above DNA polymerases is also present at a similar location in adenovirus DNA polymerase. This structure, which is predicted to form a turn flanked by beta-pleated sheets, may form part of an essential binding or catalytic site that accounts for its presence in DNA polymerases of poxviruses, herpesviruses, and adenoviruses. Images PMID:3012524

Molecular recognition of DNA base pairs by the formamido/pyrrole and formamido/imidazole pairings in stacked polyamides.

PubMed

Buchmueller, Karen L; Staples, Andrew M; Uthe, Peter B; Howard, Cameron M; Pacheco, Kimberly A O; Cox, Kari K; Henry, James A; Bailey, Suzanna L; Horick, Sarah M; Nguyen, Binh; Wilson, W David; Lee, Moses

2005-01-01

Polyamides containing an N-terminal formamido (f) group bind to the minor groove of DNA as staggered, antiparallel dimers in a sequence-specific manner. The formamido group increases the affinity and binding site size, and it promotes the molecules to stack in a staggered fashion thereby pairing itself with either a pyrrole (Py) or an imidazole (Im). There has not been a systematic study on the DNA recognition properties of the f/Py and f/Im terminal pairings. These pairings were analyzed here in the context of f-ImPyPy, f-ImPyIm, f-PyPyPy and f-PyPyIm, which contain the central pairing modes, -ImPy- and -PyPy-. The specificity of these triamides towards symmetrical recognition sites allowed for the f/Py and f/Im terminal pairings to be directly compared by SPR, CD and DeltaT (M) experiments. The f/Py pairing, when placed next to the -ImPy- or -PyPy- central pairings, prefers A/T and T/A base pairs to G/C base pairs, suggesting that f/Py has similar DNA recognition specificity to Py/Py. With -ImPy- central pairings, f/Im prefers C/G base pairs (>10 times) to the other Watson-Crick base pairs; therefore, f/Im behaves like the Py/Im pair. However, the f/Im pairing is not selective for the C/G base pair when placed next to the -PyPy- central pairings.

Prediction of RNA secondary structures: from theory to models and real molecules

NASA Astrophysics Data System (ADS)

Schuster, Peter

2006-05-01

RNA secondary structures are derived from RNA sequences, which are strings built form the natural four letter nucleotide alphabet, {AUGC}. These coarse-grained structures, in turn, are tantamount to constrained strings over a three letter alphabet. Hence, the secondary structures are discrete objects and the number of sequences always exceeds the number of structures. The sequences built from two letter alphabets form perfect structures when the nucleotides can form a base pair, as is the case with {GC} or {AU}, but the relation between the sequences and structures differs strongly from the four letter alphabet. A comprehensive theory of RNA structure is presented, which is based on the concepts of sequence space and shape space, being a space of structures. It sets the stage for modelling processes in ensembles of RNA molecules like evolutionary optimization or kinetic folding as dynamical phenomena guided by mappings between the two spaces. The number of minimum free energy (mfe) structures is always smaller than the number of sequences, even for two letter alphabets. Folding of RNA molecules into mfe energy structures constitutes a non-invertible mapping from sequence space onto shape space. The preimage of a structure in sequence space is defined as its neutral network. Similarly the set of suboptimal structures is the preimage of a sequence in shape space. This set represents the conformation space of a given sequence. The evolutionary optimization of structures in populations is a process taking place in sequence space, whereas kinetic folding occurs in molecular ensembles that optimize free energy in conformation space. Efficient folding algorithms based on dynamic programming are available for the prediction of secondary structures for given sequences. The inverse problem, the computation of sequences for predefined structures, is an important tool for the design of RNA molecules with tailored properties. Simultaneous folding or cofolding of two or more RNA molecules can be modelled readily at the secondary structure level and allows prediction of the most stable (mfe) conformations of complexes together with suboptimal states. Cofolding algorithms are important tools for efficient and highly specific primer design in the polymerase chain reaction (PCR) and help to explain the mechanisms of small interference RNA (si-RNA) molecules in gene regulation. The evolutionary optimization of RNA structures is illustrated by the search for a target structure and mimics aptamer selection in evolutionary biotechnology. It occurs typically in steps consisting of short adaptive phases interrupted by long epochs of little or no obvious progress in optimization. During these quasi-stationary epochs the populations are essentially confined to neutral networks where they search for sequences that allow a continuation of the adaptive process. Modelling RNA evolution as a simultaneous process in sequence and shape space provides answers to questions of the optimal population size and mutation rates. Kinetic folding is a stochastic process in conformation space. Exact solutions are derived by direct simulation in the form of trajectory sampling or by solving the master equation. The exact solutions can be approximated straightforwardly by Arrhenius kinetics on barrier trees, which represent simplified versions of conformational energy landscapes. The existence of at least one sequence forming any arbitrarily chosen pair of structures is granted by the intersection theorem. Folding kinetics is the key to understanding and designing multistable RNA molecules or RNA switches. These RNAs form two or more long lived conformations, and conformational changes occur either spontaneously or are induced through binding of small molecules or other biopolymers. RNA switches are found in nature where they act as elements in genetic and metabolic regulation. The reliability of RNA secondary structure prediction is limited by the accuracy with which the empirical parameters can be determined and by principal deficiencies, for example by the lack of energy contributions resulting from tertiary interactions. In addition, native structures may be determined by folding kinetics rather than by thermodynamics. We address the first problem by considering base pair probabilities or base pairing entropies, which are derived from the partition function of conformations. A high base pair probability corresponding to a low pairing entropy is taken as an indicator of a high reliability of prediction. Pseudoknots are discussed as an example of a tertiary interaction that is highly important for RNA function. Moreover, pseudoknot formation is readily incorporated into structure prediction algorithms. Some examples of experimental data on RNA secondary structures that are readily explained using the landscape concept are presented. They deal with (i) properties of RNA molecules with random sequences, (ii) RNA molecules from restricted alphabets, (iii) existence of neutral networks, (iv) shape space covering, (v) riboswitches and (vi) evolution of non-coding RNAs as an example of evolution restricted to neutral networks.

Physicochemical and crystal structure analyses of the antidiabetic agent troglitazone.

PubMed

Kobayashi, Katsuhiro; Fukuhara, Hiroshi; Hata, Tadashi; Sekine, Akiko; Uekusa, Hidehiro; Ohashi, Yuji

2003-07-01

The antidiabetic agent troglitazone has two asymmetric carbons located at the chroman ring and the thiazolidine ring and is produced as a mixture of equal amounts of four optical isomers, 2R-5S, 2S-5R, 2R-5R, and 2S-5S. The crystalline powdered drug substance consists of two diastereomer pairs, 2R-5R/2S-5S and 2R-5S/2S-5R. There are many types of crystals obtained from various crystallization conditions. The X-ray structure analysis and the physicochemical analyses of troglitazone were performed. The solvated crystals of the 2R-5R/2S-5S pair were crystallized from several solutions: methanol, ethanol, acetonitrile, and dichloromethane. The ratio of solvent and troglitazone was 1 : 2 (L1/2-form). The monohydrate crystals were obtained from aqueous acetone solution (L1-form). On the other hand, only an anhydrate crystal of the 2R-5S/2S-5R pair was crystallized from various solutions (H0-form). The dihydrous mixed crystal (MA2-form) was obtained from a mixture of the two diastereomer pairs of 2R-5R/2S-5S and 2R-5S/2S-5R in equal amounts by the slow evaporation of aqueous acetone solution. The crystal structure of the MA2-form is similar to the H0-form. When the MA2 crystal was kept under low humidity, it was converted into the dehydrated form (MA0-form) with retention of the single crystal form. The structure of the MA0-form is isomorphous to the H0-form. The MA2-form was converted into the MA0-form and vice versa with retention of the single crystal under low and high humidity, respectively. The crystallization and storage conditions of the drug substances were successfully analyzed.

Nucleotide sequence analysis establishes the role of endogenous murine leukemia virus DNA segments in formation of recombinant mink cell focus-forming murine leukemia viruses.

PubMed Central

Khan, A S

1984-01-01

The sequence of 363 nucleotides near the 3' end of the pol gene and 564 nucleotides from the 5' terminus of the env gene in an endogenous murine leukemia viral (MuLV) DNA segment, cloned from AKR/J mouse DNA and designated as A-12, was obtained. For comparison, the nucleotide sequence in an analogous portion of AKR mink cell focus-forming (MCF) 247 MuLV provirus was also determined. Sequence features unique to MCF247 MuLV DNA in the 3' pol and 5' env regions were identified by comparison with nucleotide sequences in analogous regions of NFS -Th-1 xenotropic and AKR ecotropic MuLV proviruses. These included (i) an insertion of 12 base pairs encoding four amino acids located 60 base pairs from the 3' terminus of the pol gene and immediately preceding the env gene, (ii) the deletion of 12 base pairs (encoding four amino acids) and the insertion of 3 base pairs (encoding one amino acid) in the 5' portion of the env gene, and (iii) single base substitutions resulting in 2 MCF247 -specific amino acids in the 3' pol and 23 in the 5' env regions. Nucleotide sequence comparison involving the 3' pol and 5' env regions of AKR MCF247 , NFS xenotropic, and AKR ecotropic MuLV proviruses with the cloned endogenous MuLV DNA indicated that MCF247 proviral DNA sequences were conserved in the cloned endogenous MuLV proviral segment. In fact, total nucleotide sequence identity existed between the endogenous MuLV DNA and the MCF247 MuLV provirus in the 3' portion of the pol gene. In the 5' env region, only 4 of 564 nucleotides were different, resulting in three amino acid changes between AKR MCF247 MuLV DNA and the endogenous MuLV DNA present in clone A-12. In addition, nucleotide sequence comparison indicated that Moloney-and Friend-MCF MuLVs were also highly related in the 3' pol and 5' env regions to the cloned endogenous MuLV DNA. These results establish the role of endogenous MuLV DNA segments in generation of recombinant MCF viruses. PMID:6328017

Preliminary Analysis of a Breadth-First Parsing Algorithm: Theoretical and Experimental Results.

DTIC Science & Technology

1981-06-01

present discussion we will assume that phrases have one or two daughters, or more formally, that the grammar is in Chomsky Normal Form [1].) This... grammar point of view, these pairs contrast Chomsky Normal Form [1] with Categorial Grammars [2], and from a representational point of view, these pairs...chart(i, k) * chart(k, j) bottom-up ( Chomsky Normal Form) (9) chart(k, j) = chart(i, ) top-down (Categorial Grammars )chart(i, k) Earley’s Algorithm [8

Pair bond characteristics and maintenance in free-flying jackdaws Corvus monedula: effects of social context and season

PubMed Central

Kubitza, Robin J.; Bugnyar, Thomas; Schwab, Christine

2015-01-01

Most birds rely on cooperation between pair partners for breeding. In long-term monogamous species, pair bonds are considered the basic units of social organization, albeit these birds often form foraging, roosting or breeding groups in which they repeatedly interact with numerous conspecifics. Focusing on jackdaws Corvus monedula, we here investigated 1) the interplay between pair bond and group dynamics in several social contexts and 2) how pair partners differ in individual effort of pair bond maintenance. Based on long-term data on free-flying birds, we quantified social interactions between group members within three positive contexts (spatial proximity, feeding and sociopositive interactions) for different periods of the year (non-breeding, pre-breeding, parental care). On the group level, we found that the number of interaction partners was highest in the spatial proximity context while in the feeding and sociopositive contexts the number of interaction partners was low and moderately low, respectively. Interactions were reciprocated within almost all contexts and periods. Investigating subgrouping within the flock, results showed that interactions were preferentially directed towards the respective pair partner compared to unmated adults. When determining pair partner effort, both sexes similarly invested most into mutual proximity during late winter, thereby refreshing their bond before the onset of breeding. Paired males fed their mates over the entire year at similar rates while paired females hardly fed their mates at all but engaged in sociopositive behaviors instead. We conclude that jackdaws actively seek out positive social ties to flock members (close proximity, sociopositive behavior), at certain times of the year. Thus, the group functions as a dynamic social unit, nested within are highly cooperative pair bonds. Both sexes invested into the bond with different social behaviors and different levels of effort, yet these are likely male and female proximate mechanisms aimed at maintaining and perpetuating the pair bond. PMID:25892848

Unique Thermal Stability of Unnatural Hydrophobic Ds Bases in Double-Stranded DNAs.

PubMed

Kimoto, Michiko; Hirao, Ichiro

2017-10-20

Genetic alphabet expansion technology, the introduction of unnatural bases or base pairs into replicable DNA, has rapidly advanced as a new synthetic biology area. A hydrophobic unnatural base pair between 7-(2-thienyl)imidazo[4,5-b]pyridine (Ds) and 2-nitro-4-propynylpyrrole (Px) exhibited high fidelity as a third base pair in PCR. SELEX methods using the Ds-Px pair enabled high-affinity DNA aptamer generation, and introducing a few Ds bases into DNA aptamers extremely augmented their affinities and selectivities to target proteins. Here, to further scrutinize the functions of this highly hydrophobic Ds base, the thermal stabilities of double-stranded DNAs (dsDNA) containing a noncognate Ds-Ds or G-Ds pair were examined. The thermal stability of the Ds-Ds self-pair was as high as that of the natural G-C pair, and apart from the generally higher stability of the G-C pair than that of the A-T pair, most of the 5'-pyrimidine-Ds-purine-3' sequences, such as CDsA and TDsA, exhibited higher stability than the 5'-purine-Ds-pyrimidine-3' sequences, such as GDsC and ADsC, in dsDNAs. This trait enabled the GC-content-independent control of the thermal stability of the designed dsDNA fragments. The melting temperatures of dsDNA fragments containing the Ds-Ds pair can be predicted from the nearest-neighbor parameters including the Ds base. In addition, the noncognate G-Ds pair can efficiently distinguish its neighboring cognate natural base pairs from noncognate pairs. We demonstrated that real-time PCR using primers containing Ds accurately detected a single-nucleotide mismatch in target DNAs. These unique properties of the Ds base that affect the stabilities of the neighboring base pairs could impart new functions to DNA molecules and technologies.

Helix-length compensation studies reveal the adaptability of the VS ribozyme architecture.

PubMed

Lacroix-Labonté, Julie; Girard, Nicolas; Lemieux, Sébastien; Legault, Pascale

2012-03-01

Compensatory mutations in RNA are generally regarded as those that maintain base pairing, and their identification forms the basis of phylogenetic predictions of RNA secondary structure. However, other types of compensatory mutations can provide higher-order structural and evolutionary information. Here, we present a helix-length compensation study for investigating structure-function relationships in RNA. The approach is demonstrated for stem-loop I and stem-loop V of the Neurospora VS ribozyme, which form a kissing-loop interaction important for substrate recognition. To rapidly characterize the substrate specificity (k(cat)/K(M)) of several substrate/ribozyme pairs, a procedure was established for simultaneous kinetic characterization of multiple substrates. Several active substrate/ribozyme pairs were identified, indicating the presence of limited substrate promiscuity for stem Ib variants and helix-length compensation between stems Ib and V. 3D models of the I/V interaction were generated that are compatible with the kinetic data. These models further illustrate the adaptability of the VS ribozyme architecture for substrate cleavage and provide global structural information on the I/V kissing-loop interaction. By exploring higher-order compensatory mutations in RNA our approach brings a deeper understanding of the adaptability of RNA structure, while opening new avenues for RNA research.

Orthography-Induced Length Contrasts in the Second Language Phonological Systems of L2 Speakers of English: Evidence from Minimal Pairs.

PubMed

Bassetti, Bene; Sokolović-Perović, Mirjana; Mairano, Paolo; Cerni, Tania

2018-06-01

Research shows that the orthographic forms ("spellings") of second language (L2) words affect speech production in L2 speakers. This study investigated whether English orthographic forms lead L2 speakers to produce English homophonic word pairs as phonological minimal pairs. Targets were 33 orthographic minimal pairs, that is to say homophonic words that would be pronounced as phonological minimal pairs if orthography affects pronunciation. Word pairs contained the same target sound spelled with one letter or two, such as the /n/ in finish and Finnish (both /'fɪnɪʃ/ in Standard British English). To test for effects of length and type of L2 exposure, we compared Italian instructed learners of English, Italian-English late bilinguals with lengthy naturalistic exposure, and English natives. A reading-aloud task revealed that Italian speakers of English L2 produce two English homophonic words as a minimal pair distinguished by different consonant or vowel length, for instance producing the target /'fɪnɪʃ/ with a short [n] or a long [nː] to reflect the number of consonant letters in the spelling of the words finish and Finnish. Similar effects were found on the pronunciation of vowels, for instance in the orthographic pair scene-seen (both /siːn/). Naturalistic exposure did not reduce orthographic effects, as effects were found both in learners and in late bilinguals living in an English-speaking environment. It appears that the orthographic form of L2 words can result in the establishment of a phonological contrast that does not exist in the target language. Results have implications for models of L2 phonological development.

Detection of a Cooper-pair density wave in Bi 2Sr 2CaCu 2O 8+x

DOE PAGES

Hamidian, M. H.; Edkins, S. D.; Joo, Sang Hyun; ...

2016-04-13

The quantum condensate of Cooper pairs forming a superconductor was originally conceived as being translationally invariant. In theory, however, pairs can exist with finite momentum Q, thus generating a state with a spatially modulated Cooper-pair density. Such a state has been created in ultracold 6Li gas but never observed directly in any superconductor. It is now widely hypothesized that the pseudogap phase of the copper oxide superconductors contains such a ‘pair density wave’ state. In this paper we report the use of nanometre-resolution scanned Josephson tunnelling microscopy to image Cooper pair tunnelling from a d-wave superconducting microscope tip to themore » condensate of the superconductor Bi 2Sr 2CaCu 2O 8+x. We demonstrate condensate visualization capabilities directly by using the Cooper-pair density variations surrounding zinc impurity atoms and at the Bi 2Sr 2CaCu 2O 8+x crystal supermodulation. Then, by using Fourier analysis of scanned Josephson tunnelling images, we discover the direct signature of a Cooper-pair density modulation at wavevectors Q P ≈ (0.25, 0)2π/a 0 and (0, 0.25)2π/a 0 in Bi 2Sr 2CaCu 2O 8+x. The amplitude of these modulations is about five per cent of the background condensate density and their form factor exhibits primarily s or s' symmetry. Finally, this phenomenology is consistent with Ginzburg–Landau theory when a charge density wave with d-symmetry form factor and wavevector Q C = Q P coexists with a d-symmetry superconductor; it is also predicted by several contemporary microscopic theories for the pseudogap phase.« less

Ex vivo mammalian prions are formed of paired double helical prion protein fibrils.

PubMed

Terry, Cassandra; Wenborn, Adam; Gros, Nathalie; Sells, Jessica; Joiner, Susan; Hosszu, Laszlo L P; Tattum, M Howard; Panico, Silvia; Clare, Daniel K; Collinge, John; Saibil, Helen R; Wadsworth, Jonathan D F

2016-05-01

Mammalian prions are hypothesized to be fibrillar or amyloid forms of prion protein (PrP), but structures observed to date have not been definitively correlated with infectivity and the three-dimensional structure of infectious prions has remained obscure. Recently, we developed novel methods to obtain exceptionally pure preparations of prions from mouse brain and showed that pathogenic PrP in these high-titre preparations is assembled into rod-like assemblies. Here, we have used precise cell culture-based prion infectivity assays to define the physical relationship between the PrP rods and prion infectivity and have used electron tomography to define their architecture. We show that infectious PrP rods isolated from multiple prion strains have a common hierarchical assembly comprising twisted pairs of short fibres with repeating substructure. The architecture of the PrP rods provides a new structural basis for understanding prion infectivity and can explain the inability to systematically generate high-titre synthetic prions from recombinant PrP. © 2016 The Authors.

Dark-bright soliton pairs in nonlocal nonlinear media.

PubMed

Lin, Yuan Yao; Lee, Ray-Kuang

2007-07-09

We study the formation of dark-bright vector soliton pairs in nonlocal Kerr-type nonlinear medium. We show, by analytical analysis and direct numerical calculation, that in addition to stabilize of vector soliton pairs nonlocal nonlinearity also helps to reduce the threshold power for forming a guided bright soliton. With help of the nonlocality, it is expected that the observation of dark-bright vector soliton pairs in experiments becomes more workable.

Description of three new species of Hepatozoon (Apicomplexa, Hepatozoidae) from Rattlesnakes (Crotalus durissus terrificus) based on molecular, morphometric and morphologic characters.

PubMed

O'Dwyer, Lucia Helena; Moço, Tatiana Cristina; Paduan, Karina dos Santos; Spenassatto, Carine; da Silva, Reinaldo José; Ribolla, Paulo Eduardo Martins

2013-10-01

Hepatozoon spp. are commonly found infecting snakes. Since the latter are parasitized by diverse forms and data in the literature show divergence, we studied Hepatozoon spp. diversity on Crotalus durissus terrificus snakes using both molecular and morphological approaches. Naturally infected animals were employed. Blood was collected, blood smears were prepared and an aliquot was stored at -20°C for DNA extraction. Five specimens of C. durissus terrificus were selected, each of them infected with one gamont type. Morphological and morphometric analyses of the found gamonts led to their grouping into three populations. For molecular characterization, seven oligonucleotide pairs that amplify distinct regions of rDNA gene were tested by adopting the PCR technique. Only the oligonucleotide pairs HepF300/Hep900 and HEMO1/HEMO2 were efficient in amplifying and distinguishing different isolates of Hepatozoon spp. from snakes. The better results were obtained when both oligonucleotide pairs were used in association. Based on the molecular and morphologic differences, three new species were proposed: Hepatozoon cuestensis sp. nov.; Hepatozoon cevapii sp. nov. and Hepatozoon massardii sp. nov. This is the first description of new Hepatozoon species from snakes, based on molecular characterization and morphological data, in South America. Copyright © 2013 Elsevier Inc. All rights reserved.

An Algorithm for Finding Candidate Synaptic Sites in Computer Generated Networks of Neurons with Realistic Morphologies

PubMed Central

van Pelt, Jaap; Carnell, Andrew; de Ridder, Sander; Mansvelder, Huibert D.; van Ooyen, Arjen

2010-01-01

Neurons make synaptic connections at locations where axons and dendrites are sufficiently close in space. Typically the required proximity is based on the dimensions of dendritic spines and axonal boutons. Based on this principle one can search those locations in networks formed by reconstructed neurons or computer generated neurons. Candidate synapses are then located where axons and dendrites are within a given criterion distance from each other. Both experimentally reconstructed and model generated neurons are usually represented morphologically by piecewise-linear structures (line pieces or cylinders). Proximity tests are then performed on all pairs of line pieces from both axonal and dendritic branches. Applying just a test on the distance between line pieces may result in local clusters of synaptic sites when more than one pair of nearby line pieces from axonal and dendritic branches is sufficient close, and may introduce a dependency on the length scale of the individual line pieces. The present paper describes a new algorithm for defining locations of candidate synapses which is based on the crossing requirement of a line piece pair, while the length of the orthogonal distance between the line pieces is subjected to the distance criterion for testing 3D proximity. PMID:21160548

Thermodynamic properties of water molecules in the presence of cosolute depend on DNA structure: a study using grid inhomogeneous solvation theory

PubMed Central

Nakano, Miki; Tateishi-Karimata, Hisae; Tanaka, Shigenori; Tama, Florence; Miyashita, Osamu; Nakano, Shu-ichi; Sugimoto, Naoki

2015-01-01

In conditions that mimic those of the living cell, where various biomolecules and other components are present, DNA strands can adopt many structures in addition to the canonical B-form duplex. Previous studies in the presence of cosolutes that induce molecular crowding showed that thermal stabilities of DNA structures are associated with the properties of the water molecules around the DNAs. To understand how cosolutes, such as ethylene glycol, affect the thermal stability of DNA structures, we investigated the thermodynamic properties of water molecules around a hairpin duplex and a G-quadruplex using grid inhomogeneous solvation theory (GIST) with or without cosolutes. Our analysis indicated that (i) cosolutes increased the free energy of water molecules around DNA by disrupting water–water interactions, (ii) ethylene glycol more effectively disrupted water–water interactions around Watson–Crick base pairs than those around G-quartets or non-paired bases, (iii) due to the negative electrostatic potential there was a thicker hydration shell around G-quartets than around Watson–Crick-paired bases. Our findings suggest that the thermal stability of the hydration shell around DNAs is one factor that affects the thermal stabilities of DNA structures under the crowding conditions. PMID:26538600

Minor groove RNA triplex in the crystal structure of a ribosomal frameshifting viral pseudoknot

NASA Technical Reports Server (NTRS)

Su, L.; Chen, L.; Egli, M.; Berger, J. M.; Rich, A.

1999-01-01

Many viruses regulate translation of polycistronic mRNA using a -1 ribosomal frameshift induced by an RNA pseudoknot. A pseudoknot has two stems that form a quasi-continuous helix and two connecting loops. A 1.6 A crystal structure of the beet western yellow virus (BWYV) pseudoknot reveals rotation and a bend at the junction of the two stems. A loop base is inserted in the major groove of one stem with quadruple-base interactions. The second loop forms a new minor-groove triplex motif with the other stem, involving 2'-OH and triple-base interactions, as well as sodium ion coordination. Overall, the number of hydrogen bonds stabilizing the tertiary interactions exceeds the number involved in Watson-Crick base pairs. This structure will aid mechanistic analyses of ribosomal frameshifting.

Molecular recognition of DNA base pairs by the formamido/pyrrole and formamido/imidazole pairings in stacked polyamides

PubMed Central

Buchmueller, Karen L.; Staples, Andrew M.; Uthe, Peter B.; Howard, Cameron M.; Pacheco, Kimberly A. O.; Cox, Kari K.; Henry, James A.; Bailey, Suzanna L.; Horick, Sarah M.; Nguyen, Binh; Wilson, W. David; Lee, Moses

2005-01-01

Polyamides containing an N-terminal formamido (f) group bind to the minor groove of DNA as staggered, antiparallel dimers in a sequence-specific manner. The formamido group increases the affinity and binding site size, and it promotes the molecules to stack in a staggered fashion thereby pairing itself with either a pyrrole (Py) or an imidazole (Im). There has not been a systematic study on the DNA recognition properties of the f/Py and f/Im terminal pairings. These pairings were analyzed here in the context of f-ImPyPy, f-ImPyIm, f-PyPyPy and f-PyPyIm, which contain the central pairing modes, –ImPy– and –PyPy–. The specificity of these triamides towards symmetrical recognition sites allowed for the f/Py and f/Im terminal pairings to be directly compared by SPR, CD and ΔTM experiments. The f/Py pairing, when placed next to the –ImPy– or –PyPy– central pairings, prefers A/T and T/A base pairs to G/C base pairs, suggesting that f/Py has similar DNA recognition specificity to Py/Py. With –ImPy– central pairings, f/Im prefers C/G base pairs (>10 times) to the other Watson–Crick base pairs; therefore, f/Im behaves like the Py/Im pair. However, the f/Im pairing is not selective for the C/G base pair when placed next to the –PyPy– central pairings. PMID:15703305

Optical NAND gate

DOEpatents

Skogen, Erik J [Albuquerque, NM; Raring, James [Goleta, CA; Tauke-Pedretti, Anna [Albuquerque, NM

2011-08-09

An optical NAND gate is formed from two pair of optical waveguide devices on a substrate, with each pair of the optical waveguide devices consisting of an electroabsorption modulator and a photodetector. One pair of the optical waveguide devices is electrically connected in parallel to operate as an optical AND gate; and the other pair of the optical waveguide devices is connected in series to operate as an optical NOT gate (i.e. an optical inverter). The optical NAND gate utilizes two digital optical inputs and a continuous light input to provide a NAND function output. The optical NAND gate can be formed from III-V compound semiconductor layers which are epitaxially deposited on a III-V compound semiconductor substrate, and operates at a wavelength in the range of 0.8-2.0 .mu.m.

Base-Pairing Energies of Protonated Nucleoside Base Pairs of dCyd and m5dCyd: Implications for the Stability of DNA i-Motif Conformations

NASA Astrophysics Data System (ADS)

Yang, Bo; Rodgers, M. T.

2015-08-01

Hypermethylation of cytosine in expanded (CCG)n•(CGG)n trinucleotide repeats results in Fragile X syndrome, the most common cause of inherited mental retardation. The (CCG)n•(CGG)n repeats adopt i-motif conformations that are preferentially stabilized by base-pairing interactions of protonated base pairs of cytosine. Here we investigate the effects of 5-methylation and the sugar moiety on the base-pairing energies (BPEs) of protonated cytosine base pairs by examining protonated nucleoside base pairs of 2'-deoxycytidine (dCyd) and 5-methyl-2'-deoxycytidine (m5dCyd) using threshold collision-induced dissociation techniques. 5-Methylation of a single or both cytosine residues leads to very small change in the BPE. However, the accumulated effect may be dramatic in diseased state trinucleotide repeats where many methylated base pairs may be present. The BPEs of the protonated nucleoside base pairs examined here significantly exceed those of Watson-Crick dGuo•dCyd and neutral dCyd•dCyd base pairs, such that these base-pairing interactions provide the major forces responsible for stabilization of DNA i-motif conformations. Compared with isolated protonated nucleobase pairs of cytosine and 1-methylcytosine, the 2'-deoxyribose sugar produces an effect similar to the 1-methyl substituent, and leads to a slight decrease in the BPE. These results suggest that the base-pairing interactions may be slightly weaker in nucleic acids, but that the extended backbone is likely to exert a relatively small effect on the total BPE. The proton affinity (PA) of m5dCyd is also determined by competitive analysis of the primary dissociation pathways that occur in parallel for the protonated (m5dCyd)H+(dCyd) nucleoside base pair and the absolute PA of dCyd previously reported.

Balancing act: Evidence for a strong subdominant d -wave pairing channel in Ba 0.6 K 0.4 Fe 2 As 2

DOE PAGES

Böhm, T.; Kemper, A. F.; Moritz, B.; ...

2014-12-18

We present detailed measurements of the temperature-dependent Raman spectra of optimally doped Ba 0.6K 0.4Fe 2As 2 and analyze the low-temperature spectra based on local-density-approximation band-structure calculations and the subsequent estimation of effective Raman vertices. Experimentally, a narrow, emergent mode appears in the B 1g (d x2-y2) Raman spectra only below T c, well into the superconducting state and at an energy below twice the energy gap on the electron Fermi-surface sheets. The Raman spectra can be reproduced quantitatively with estimates for the magnitude and momentum-space structure of an A 1g (s-wave) pairing gap on different Fermi-surface sheets, as wellmore » as the identification of the emergent sharp feature as a Bardasis-Schrieffer exciton. Formed as a Cooper-pair bound state in a subdominant d x2-y2 channel, the binding energy of the exciton relative to the gap edge shows that the coupling strength in the subdominant channel is as strong as 60% of that in the dominant s-wave channel. This result suggests that d x2-y2 may be the dominant pairing symmetry in Fe-based superconductors that lack central hole bands.« less

Theoretical determination of one-electron redox potentials for DNA bases, base pairs, and stacks.

PubMed

Paukku, Y; Hill, G

2011-05-12

Electron affinities, ionization potentials, and redox potentials for DNA bases, base pairs, and N-methylated derivatives are computed at the DFT/M06-2X/6-31++G(d,p) level of theory. Redox properties of a guanine-guanine stack model are explored as well. Reduction and oxidation potentials are in good agreement with the experimental ones. Electron affinities of base pairs were found to be negative. Methylation of canonical bases affects the ionization potentials the most. Base pair formation and base stacking lower ionization potentials by 0.3 eV. Pairing of guanine with the 5-methylcytosine does not seem to influence the redox properties of this base pair much.

Construction typification as the tool for optimizing the functioning of a robotized manufacturing system

NASA Astrophysics Data System (ADS)

Gwiazda, A.; Banas, W.; Sekala, A.; Foit, K.; Hryniewicz, P.; Kost, G.

2015-11-01

Process of workcell designing is limited by different constructional requirements. They are related to technological parameters of manufactured element, to specifications of purchased elements of a workcell and to technical characteristics of a workcell scene. This shows the complexity of the design-constructional process itself. The results of such approach are individually designed workcell suitable to the specific location and specific production cycle. Changing this parameters one must rebuild the whole configuration of a workcell. Taking into consideration this it is important to elaborate the base of typical elements of a robot kinematic chain that could be used as the tool for building Virtual modelling of kinematic chains of industrial robots requires several preparatory phase. Firstly, it is important to create a database element, which will be models of industrial robot arms. These models could be described as functional primitives that represent elements between components of the kinematic pairs and structural members of industrial robots. A database with following elements is created: the base kinematic pairs, the base robot structural elements, the base of the robot work scenes. The first of these databases includes kinematic pairs being the key component of the manipulator actuator modules. Accordingly, as mentioned previously, it includes the first stage rotary pair of fifth stage. This type of kinematic pairs was chosen due to the fact that it occurs most frequently in the structures of industrial robots. Second base consists of structural robot elements therefore it allows for the conversion of schematic structures of kinematic chains in the structural elements of the arm of industrial robots. It contains, inter alia, the structural elements such as base, stiff members - simple or angular units. They allow converting recorded schematic three-dimensional elements. Last database is a database of scenes. It includes elements of both simple and complex: simple models of technological equipment, conveyors models, models of the obstacles and like that. Using these elements it could be formed various production spaces (robotized workcells), in which it is possible to virtually track the operation of an industrial robot arm modelled in the system.

Paired-Associate Learning Ability Accounts for Unique Variance in Orthographic Learning

ERIC Educational Resources Information Center

Wang, Hua-Chen; Wass, Malin; Castles, Anne

2017-01-01

Paired-associate learning is a dynamic measure of the ability to form new links between two items. This study aimed to investigate whether paired-associate learning ability is associated with success in orthographic learning, and if so, whether it accounts for unique variance beyond phonological decoding ability and orthographic knowledge. A group…

Two sides of gender: ERP evidence for the presence of two routes during gender agreement processing.

PubMed

Caffarra, Sendy; Janssen, Niels; Barber, Horacio A

2014-10-01

The present ERP study aimed at providing evidence for the existence of two routes in the brain for the processing of morphosyntactic features during language comprehension; a lexical route which retrieves grammatical properties stored in the lexicon without reliance on formal cues, and a form-based route that takes advantage of sub-lexical units strongly related to a specific grammatical class. In the experiment, we investigated grammatical gender agreement processing in Spanish article-noun word pairs using a grammaticality judgment task. Article-noun pairs either agreed or did not agree in gender. Noun transparency was manipulated such that the ending could be strongly associated with a specific gender class (i.e., transparent nouns) or not (i.e., opaque nouns). A visual half-field method was employed and ERPs were recorded in response to the target nouns in order to disentangle the initial hemisphere-specific computations of gender processing. ERP results showed that, while both hemispheres compute agreement dependencies, the left hemisphere is sensitive to the presence of formal gender cues at an early stage (i.e., 350-500 ms) indicating the presence of a form-based route. The right hemisphere showed an ERP effect of transparency, but later than the left hemisphere (i.e., 500-750 ms). These findings confirm the presence of two routes to gender, which can be differently used depending on the availability of transparent endings. In addition, the results showed hemispheric differences in the time course of the form-based route. Copyright © 2014 Elsevier Ltd. All rights reserved.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mazurkiewicz, Kamil; Haranczyk, Maciej; Gutowski, Maciej S.

The electron affinity and the propensity to electron-induced proton transfer (PT) of hydrogen-bonded complexes between the Watson–Crick adenine–thymine pair (AT) and simple organic acid (HX), attached to adenine in the Hoogsteen-type configuration, were studied at the B3LYP/6-31+G** level. Although the carboxyl group is deprotonated at physiological pH, its neutral form, COOH, resembles the peptide bond or the amide fragment in the side chain of asparagine (Asn) or glutamine (Gln). Thus, these complexes mimic the interaction between the DNA environment (e.g., proteins) and nucleobase pairs incorporated in the biopolymer. Electron attachment is thermodynamically feasible and adiabatic electron affinities range from 0.41more » to 1.28 eV, while the vertical detachment energies of the resulting anions span the range of 0.39 –2.88 eV. Low-energy activation barriers separate the anionic minima: aHX(AT) from the more stable single-PT anionic geometry, aHX(AT)-SPT, and aHX(AT)-SPT from the double-PT anionic geometry, aHX(AT)-DPT. Interaction between the adenine of the Watson–Crick AT base pair with an acidic proton donor probably counterbalances the larger EA of isolated thymine, as SOMO is almost evenly delocalized over both types of nucleic bases in the aHX(AT) anions. Moreover, as a result of PT the excess electron localizes entirely on adenine. Thus, in DNA interacting with its physiological environment, damage induced by low-energy electrons could begin, contrary to the current view, with the formation of purine anions, which are not formed in isolated DNA because of the greater stability of anionic pyrimidines.« less

Use of two sulfonthalein dyes in the extraction-free spectrophotometric assay of tramadol in dosage forms and in spiked human urine based on ion-pair reaction.

PubMed

Vinay, Kanakapura B; Revannasiddappa, Hosakere D; Rajendraprasad, Nagaraju; Ramesh, Pavagada J; Xavier, Cijo M; Basavaiah, Kanakapura

2012-02-01

Tramadol is a centrally acting analgesic used in the prevention and treatment of moderate to severe pain. Two sensitive, selective, and rapid spectrophotometric methods are described for the determination of tramadol in its dosage forms and in spiked human urine. The methods are based on formation of yellow ion-pairs between tramadol and two sulfonthalein dyes; bromocresol purple (BCP) and bromocresol green (BCG) in dichloromethane medium followed by absorbance measurement at 400 and 410 nm, respectively. Under the optimum conditions, tramadol could be assayed in the concentration ranges, 1-15 and 1-16 µg ml(-1) with correlation coefficient greater than 0.999 in both cases. The molar absorptivity values are calculated to be 1.84 × 10(4) and 1.97 × 10(4) l mol(-1) cm(-1) for BCP and BCG methods, respectively; and the corresponding Sandell sensitivity values are 0.0143 and 0.0134 µg cm(-2). The limits of detection (LOD) and quantification (LOQ) have also been reported. The stoichiometry of the reaction was found to be 1:1 in both cases and the conditional stability constant (K(f)) values of the ion pairs have been calculated. The within-day and between-day RSD were 0.9-1.96% and 1.56-3.21%, respectively. The methods were successfully applied to the determination of tramadol in tablets and injections and also in spiked human urine with good recoveries. The procedures are simple, accurate, and suitable for quality control application. Copyright © 2011 John Wiley & Sons, Ltd.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vostokov, S V

A new method for calculating an explicit form of the Hilbert pairing is proposed. It is used to calculate the Hilbert pairing in a classical local field and in a complete higher-dimensional field. Bibliography: 25 titles.

A preference to bond? Male prairie voles form pair bonds even in the presence of multiple receptive females

PubMed Central

Blocker, Tomica D.; Ophir, Alexander G.

2016-01-01

Pair bonds are the cornerstone of a monogamous relationship. When individuals of the same species engage in monogamy and promiscuity (i.e. alternative reproductive tactics) it can be difficult to determine which tactic confers greater fitness, as measures of fitness can be difficult to ascertain. However, in these circumstances, whether animals preferentially establish pair bonds can reveal decisions that presumably reflect the animals’ assessment of how to best maximize reproductive success. In nature, the majority of prairie voles, Microtus ochrogaster, establishes pair bonds and engages in social monogamy while a minority of individuals remains single and presumably mates promiscuously. The existence of these two tactics raises the interesting question: do bonded male prairie voles choose to ‘settle’ (for just one partner) or are they preferentially ‘settling down’? To determine which of these two tactics is preferred, we provided single male prairie voles simultaneous access to two sexually receptive females for 24 h and then subsequently tested males in ‘partner preference tests’ with each female independently contrasted with a novel female. We aimed to determine whether males would form a pair bond with one, both or none of the original females. We found that males formed pair bonds with one of the two females. We also investigated male- and female-initiated aggression and found that during the bonding process males were more aggressive with females that they did not ultimately form a bond with. In the partner preference tests, males showed more aggression towards unfamiliar females than towards familiar females. Mismatches in male- and female-initiated aggression suggest that aggressive interactions may be perpetuated more by males than by females. Taken together, our results demonstrate that under conditions that are ideal for forgoing bonding and engaging in multiple matings, males choose to establish a pair bond, suggesting that selective pressures may have facilitated bonding by males. PMID:28579618

Synthesis and monitored selection of nucleotide surrogates for binding T:A base pairs in homopurine-homopyrimidine DNA triple helices.

PubMed

Mokhir, A A; Connors, W H; Richert, C

2001-09-01

A total of 16 oligodeoxyribonucleotides of general sequence 5'-TCTTCTZTCTTTCT-3', where Z denotes an N-acyl-N-(2-hydroxyethyl)glycine residue, were prepared via solid phase synthesis. The ability of these oligonucleotides to form triplexes with the duplex 5'-AGAAGATAGAAAGA-HEG-TCTTTCTATCTTCT-3', where HEG is a hexaethylene glycol linker, was tested. In these triplexes, an 'interrupting' T:A base pair faces the Z residue in the third strand. Among the acyl moieties of Z tested, an anthraquinone carboxylic acid residue linked via a glycinyl group gave the most stable triplex, whose UV melting point was 8.4 degrees C higher than that of the triplex with 5'-TCTTCTGTCTTTCT-3' as the third strand. The results from exploratory nuclease selection experiments suggest that a combinatorial search for strands capable of recognizing mixed sequences by triple helix formation is feasible.

Spectroscopy of Isolated Prebiotic Nucleobases

NASA Technical Reports Server (NTRS)

Svadlenak, Nathan; Callahan, Michael P.; Ligare, Marshall; Gulian, Lisa; Gengeliczki, Zsolt; Nachtigallova, Dana; Hobza, Pavel; deVries, Mattanjah

2011-01-01

We use multiphoton ionization and double resonance spectroscopy to study the excited state dynamics of biologically relevant molecules as well as prebiotic nucleobases, isolated in the gas phase. Molecules that are biologically relevant to life today tend to exhibit short excited state lifetimes compared to similar but non-biologically relevant analogs. The mechanism is internal conversion, which may help protect the biologically active molecules from UV damage. This process is governed by conical intersections that depend very strongly on molecular structure. Therefore we have studied purines and pyrimidines with systematic variations of structure, including substitutions, tautomeric forms, and cluster structures that represent different base pair binding motifs. These structural variations also include possible alternate base pairs that may shed light on prebiotic chemistry. With this in mind we have begun to probe the ultrafast dynamics of molecules that exhibit very short excited states and search for evidence of internal conversions.

Hydrolysis of N3-methyl-2'-deoxycytidine: model compound for reactivity of protonated cytosine residues in DNA.

PubMed

Sowers, L C; Sedwick, W D; Shaw, B R

1989-11-01

Protonation of cytosine residues at physiological pH may occur in DNA as a consequence of both alkylation and aberrant base-pair formation. When cytosine derivatives are protonated, they undergo hydrolysis reactions at elevated rates and can either deaminate to form the corresponding uracil derivatives or depyrimidinate generating abasic sites. The kinetic parameters for reaction of protonated cytosine are derived by studying the hydrolysis of N3-methyl-2'-deoxycytidine (m3dC), a cytosine analogue which is predominantly protonated at physiological pH. Both deamination and depyrimidimation reaction rates are shown to be linearly dependent upon the fraction of protonated molecules. We present here thermodynamic parameters which allow determination of hydrolysis rates of m3dC as functions of pH and temperature. Protonation of cytosine residues in DNA, as induced by aberrant base-pair formation or base modification, may accelerate the rate of both deamination and depyrimidation up to several thousand-fold under physiological conditions.

Ionomers for Ion-Conducting Energy Materials

NASA Astrophysics Data System (ADS)

Colby, Ralph

For ionic actuators and battery separators, it is vital to utilize single-ion conducting ionomers that avoid the detrimental polarization of other ions. Single-ion conducting ionomers are synthesized based on DFT calculations, with low glass transition temperatures (facile dynamics) to prepare ion-conducting membranes for battery separators that conduct Li+ or Na+. Characterization by X-ray scattering, dielectric spectroscopy, FTIR, NMR and linear viscoelasticity collectively develop a coherent picture of ionic aggregation and both counterion and polymer dynamics. 7Li NMR diffusion measurements find that diffusion is faster than expected by conductivity using the Nernst-Einstein equation, which means that the majority of Li diffusion occurs by ion pairs moving with the polymer segmental motion. Segmental motion only contributes to ionic conduction in the rare event that one of these ion pairs has an extra Li (a positive triple ion). This leads us to a new metric for ion-conducting soft materials, the product of the cation number density p0 and their diffusion coefficient D; p0D is the diffusive flux of lithium ions. This new metric has a maximum at intermediate ion content that corresponds to the overlap of ion pair polarizability volumes. At higher ion contents, the ion pairs interact strongly and form larger aggregation states that retard segmental motion of both mobile ion pairs and triple ions.

Relative surface wave amplitude and phase anomalies from the Democratic People's Republic of Korea announced nuclear tests

DOE PAGES

Ichinose, G. A.; Myers, S. C.; Ford, S. R.; ...

2017-08-29

Here, we performed relative locations of six event pairs based on surface wave (SW) and body wave (BW) differential traveltimes of the 9 September 2016, 6 January 2016, 12 February 2013, and 25 May 2009 announced North Korea nuclear explosions. The SW relative locations for the 25 May 2009 and 12 February 2013 events were inconsistent with the BWs when paired with other events, and only the 6 January 2016/9 September 2016 pair was consistent. Apparent SW phase shift is investigated with respect to the BW relative locations. The pairs formed with the 25 May 2009 and 12 February 2013more » events, beneath the southeast slope of Mount Mant'ap, have the largest phase shifts and amplitude ratio deviations, whereas the least deviation was from the 6 January 2016 and 9 September 2016 event pair beneath the mountain peak. Regional moment tensors (MTs) predict the amplitude ratios but do not resolve the relative phase. We find that MTs with 10% difference in isotropic and rotated +CLVD can fit both relative phase and amplitude ratios. SW relative locations of highly isotropic and correlated explosion clusters can be affected by topography and small differences in MT.« less

Structural studies on choline-carboxylate bio-ionic liquids by x-ray scattering and molecular dynamics

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tanzi, Luana; Ramondo, Fabio, E-mail: fabio.ramondo@univaq.it; Caminiti, Ruggero

2015-09-21

We report a X-ray diffraction and molecular dynamics study on three choline-based bio-ionic liquids, choline formate, [Ch] [For], choline propanoate, [Ch][Pro], and choline butanoate, [Ch][But]. For the first time, this class of ionic liquids has been investigated by X-ray diffraction. Experimental and theoretical structure factors have been compared for each term of the series. Local structural organization has been obtained from ab initio calculations through static models of isolated ion pairs and dynamic simulations of small portions of liquids through twelve, ten, and nine ion pairs for [Ch][For], [Ch][Pro], and [Ch][But], respectively. All the theoretical models indicate that cations andmore » anions are connected by strong hydrogen bonding and form stable ion pairs in the liquid that are reminiscent of the static ab initio ion pairs. Different structural aspects may affect the radial distribution function, like the local structure of ion pairs and the conformation of choline. When small portions of liquids have been simulated by dynamic quantum chemical methods, some key structural features of the X-ray radial distribution function were well reproduced whereas the classical force fields here applied did not entirely reproduce all the observed structural features.« less

Experimental and computational studies on the DNA translocation mechanism of the T4 viral packaging motor

NASA Astrophysics Data System (ADS)

Migliori, Amy; Arya, Gaurav; Smith, Douglas E.

2012-10-01

Bacteriophage T4 is a double stranded DNA virus that infects E.coli by injecting the viral genome through the cellular wall of a host cell. The T4 genome must be ejected from the viral capsid with sufficient force to ensure infection. To generate high ejection forces, the genome is packaged to high density within the viral capsid. A DNA translocation motor, in which the protein gp17 hydrolyzes ATP and binds to the DNA, is responsible for translocating the genome into the capsid during viral maturation of T4. This motor generates forces in excess of 60 pN and packages DNA at rates exceeding 2000 base pairs/second (bp/s)1. Understanding these small yet powerful motors is important, as they have many potential applications. Though much is known about the activity of these motors from bulk and single molecule biophysical techniques, little is known about their detailed molecular mechanism. Recently, two structures of gp17 have been obtained: a high-resolution X-ray crystallographic structure showing a monomeric compacted form of the enzyme, and a cryo-electron microscopic structure of the extended form of gp17 in complex with actively packaging prohead complexes. Comparison of these two structures indicates several key differences, and a model has been proposed to explain the translocation action of the motor2. Key to this model are a set of residues forming ion pairs across two domains of the gp17 molecule that are proposed to be involved in force generation by causing the collapse of the extended form of gp17. Using a dual optical trap to measure the rates of DNA packaging and the generated forces, we present preliminary mutational data showing that these several of these ion pairs are important to motor function. We have also performed preliminary free energy calculations on the extended and collapsed state of gp17, to confirm that these interdomain ion pairs have large contributions to the change in free energy that occurs upon the collapse of gp17 during the proposed ratcheting mechanism.

Structural basis for proficient incorporation of dTTP opposite O6-methylguanine by human DNA polymerase iota.

PubMed

Pence, Matthew G; Choi, Jeong-Yun; Egli, Martin; Guengerich, F Peter

2010-12-24

O(6)-methylguanine (O(6)-methylG) is highly mutagenic and is commonly found in DNA exposed to methylating agents, even physiological ones (e.g. S-adenosylmethionine). The efficiency of a truncated, catalytic DNA polymerase ι core enzyme was determined for nucleoside triphosphate incorporation opposite O(6)-methylG, using steady-state kinetic analyses. The results presented here corroborate previous work from this laboratory using full-length pol ι, which showed that dTTP incorporation occurs with high efficiency opposite O(6)-methylG. Misincorporation of dTTP opposite O(6)-methylG occurred with ∼6-fold higher efficiency than incorporation of dCTP. Crystal structures of the truncated form of pol ι with O(6)-methylG as the template base and incoming dCTP or dTTP were solved and showed that O(6)-methylG is rotated into the syn conformation in the pol ι active site and that dTTP misincorporation by pol ι is the result of Hoogsteen base pairing with the adduct. Both dCTP and dTTP base paired with the Hoogsteen edge of O(6)-methylG. A single, short hydrogen bond formed between the N3 atom of dTTP and the N7 atom of O(6)-methylG. Protonation of the N3 atom of dCTP and bifurcation of the N3 hydrogen between the N7 and O(6) atoms of O(6)-methylG allow base pairing of the lesion with dCTP. We conclude that differences in the Hoogsteen hydrogen bonding between nucleotides is the main factor in the preferential selectivity of dTTP opposite O(6)-methylG by human pol ι, in contrast to the mispairing modes observed previously for O(6)-methylG in the structures of the model DNA polymerases Sulfolobus solfataricus Dpo4 and Bacillus stearothermophilus DNA polymerase I.

Does Gender-Fair Language Pay Off? The Social Perception of Professions from a Cross-Linguistic Perspective

PubMed Central

Horvath, Lisa K.; Merkel, Elisa F.; Maass, Anne; Sczesny, Sabine

2016-01-01

In many languages, masculine forms (e.g., German Lehrer, “teachers, masc.”) have traditionally been used to refer to both women and men, although feminine forms are available, too. Feminine-masculine word pairs (e.g., German Lehrerinnen und Lehrer, “teachers, fem. and teachers, masc.”) are recommended as gender-fair alternatives. A large body of empirical research documents that the use of gender-fair forms instead of masculine forms has a substantial impact on mental representations. Masculine forms activate more male representations even when used in a generic sense, whereas word pairs (e.g., German Lehrerinnen und Lehrer, “teachers, fem. and teachers, masc.”) lead to a higher cognitive inclusion of women (i.e., visibility of women). Some recent studies, however, have also shown that in a professional context word pairs may be associated with lesser status. The present research is the first to investigate both effects within a single paradigm. A cross-linguistic (Italian and German) study with 391 participants shows that word pairs help to avoid a male bias in the gender-typing of professions and increase women's visibility; at the same time, they decrease the estimated salaries of typically feminine professions (but do not affect perceived social status or competence). This potential payoff has implications for language policies aiming at gender-fairness. PMID:26834662

Preferential solvation, ion pairing, and dynamics of concentrated aqueous solutions of divalent metal nitrate salts

NASA Astrophysics Data System (ADS)

Yadav, Sushma; Chandra, Amalendu

2017-12-01

We have investigated the characteristics of preferential solvation of ions, structure of solvation shells, ion pairing, and dynamics of aqueous solutions of divalent alkaline-earth metal nitrate salts at varying concentration by means of molecular dynamics simulations. Hydration shell structures and the extent of preferential solvation of the metal and nitrate ions in the solutions are investigated through calculations of radial distribution functions, tetrahedral ordering, and also spatial distribution functions. The Mg2+ ions are found to form solvent separated ion-pairs while the Ca2+ and Sr2+ ions form contact ion pairs with the nitrate ions. These findings are further corroborated by excess coordination numbers calculated through Kirkwood-Buff G factors for different ion-ion and ion-water pairs. The ion-pairing propensity is found to be in the order of Mg(NO3) 2 < C a (NO3) 2 < S r (NO3) 2, and it follows the trend given by experimental activity coefficients. It is found that proper modeling of these solutions requires the inclusion of electronic polarization of the ions which is achieved in the current study through electronic continuum correction force fields. A detailed analysis of the effects of ion-pairs on the structure and dynamics of water around the hydrated ions is done through classification of water into different subspecies based on their locations around the cations or anions only or bridged between them. We have looked at the diffusion coefficients, relaxation of orientational correlation functions, and also the residence times of different subspecies of water to explore the dynamics of water in different structural environments in the solutions. The current results show that the water molecules are incorporated into fairly well-structured hydration shells of the ions, thus decreasing the single-particle diffusivities and increasing the orientational relaxation times of water with an increase in salt concentration. The different structural motifs also lead to the presence of substantial dynamical heterogeneity in these solutions of strongly interacting ions. The current study helps us to understand the molecular details of hydration structure, ion pairing, and dynamics of water in the solvation shells and also of ion diffusion in aqueous solutions of divalent metal nitrate salts.

Base-Pairing Energies of Proton-Bound Dimers and Proton Affinities of 1-Methyl-5-Halocytosines: Implications for the Effects of Halogenation on the Stability of the DNA i-Motif

NASA Astrophysics Data System (ADS)

Yang, Bo; Wu, R. R.; Rodgers, M. T.

2015-09-01

(CCG)n•(CGG)n trinucleotide repeats have been found to be associated with fragile X syndrome, the most widespread inherited cause of mental retardation in humans. The (CCG)n•(CGG)n repeats adopt i-motif conformations that are preferentially stabilized by base-pairing interactions of noncanonical proton-bound dimers of cytosine (C+•C). Halogenated cytosine residues are one form of DNA damage that may be important in altering the structure and stability of DNA or DNA-protein interactions and, hence, regulate gene expression. Previously, we investigated the effects of 5-halogenation and 1-methylation of cytosine on the base-pairing energies (BPEs) using threshold collision-induced dissociation (TCID) techniques. In the present study, we extend our work to include proton-bound homo- and heterodimers of cytosine, 1-methyl-5-fluorocytosine, and 1-methyl-5-bromocytosine. All modifications examined here are found to produce a decrease in the BPEs. However, the BPEs of all of the proton-bound dimers examined significantly exceed those of Watson-Crick G•C, neutral C•C base pairs, and various methylated variants such that DNA i-motif conformations should still be preserved in the presence of these modifications. The proton affinities (PAs) of the halogenated cytosines are also obtained from the experimental data by competitive analysis of the primary dissociation pathways that occur in parallel for the proton-bound heterodimers. 5-Halogenation leads to a decrease in the N3 PA of cytosine, whereas 1-methylation leads to an increase in the N3 PA. Thus, the 1-methyl-5-halocytosines exhibit PAs that are intermediate.

A two-dimensional 1H-NMR study of the dam methylase site: comparison between the hemimethylated GATC sequence, its unmethylated analogue and a hemimethylated CATG sequence. The sequence dependence of methylation upon base-pair lifetimes.

PubMed

Fazakerley, G V; Quignard, E; Teoule, R; Guy, A; Guschlbauer, W

1987-09-15

We report two-dimensional NOE (NOESY) spectra on the sequence d(GCGATCATGG).d(CCATGATCGC) which contains the unmethylated dam site. As expected the DNA adopts a B-form conformation but appears to be distorted at the TG step of the second strand. This distorsion, probably bending, is not seen on the opposite strand. When the first strand is methylated on adenine in the GATC or CATG sequence the NOESY spectra indicate little or no change in the conformation. However the single strand-duplex exchange is slowed down to the slow-exchange region on a proton NMR time scale. We have assigned the exchangeable imino and cytidine amino resonances of the three duplexes. From the imino linewidths as a function of temperature, we observe that the unmethylated and the hemimethylated Gm6ATC duplexes melt normally from the ends. However, this is not so for the hemimethylated Cm6ATG duplex which, apart from the terminal base pairs, melts cooperatively and at higher temperature. In spectra recorded in H2O a second duplex is observed, for the Gm6ATC sequence, which we have not been able to identify. It is however unlikely to be a hairpin structure. Ultraviolet-melting curves also indicate the presence of two transitions for this duplex. The effect of methylation upon base-pair lifetimes has been studied by comparing the above three duplexes. Little effect is observed upon methylation in the GATC sequence but a drastic increase in the lifetimes of all base pairs is observed upon methylation in the CATG sequence.

Structural landscape of base pairs containing post-transcriptional modifications in RNA

PubMed Central

Seelam, Preethi P.; Sharma, Purshotam

2017-01-01

Base pairs involving post-transcriptionally modified nucleobases are believed to play important roles in a wide variety of functional RNAs. Here we present our attempts toward understanding the structural and functional role of naturally occurring modified base pairs using a combination of X-ray crystal structure database analysis, sequence analysis, and advanced quantum chemical methods. Our bioinformatics analysis reveals that despite their presence in all major secondary structural elements, modified base pairs are most prevalent in tRNA crystal structures and most commonly involve guanine or uridine modifications. Further, analysis of tRNA sequences reveals additional examples of modified base pairs at structurally conserved tRNA regions and highlights the conservation patterns of these base pairs in three domains of life. Comparison of structures and binding energies of modified base pairs with their unmodified counterparts, using quantum chemical methods, allowed us to classify the base modifications in terms of the nature of their electronic structure effects on base-pairing. Analysis of specific structural contexts of modified base pairs in RNA crystal structures revealed several interesting scenarios, including those at the tRNA:rRNA interface, antibiotic-binding sites on the ribosome, and the three-way junctions within tRNA. These scenarios, when analyzed in the context of available experimental data, allowed us to correlate the occurrence and strength of modified base pairs with their specific functional roles. Overall, our study highlights the structural importance of modified base pairs in RNA and points toward the need for greater appreciation of the role of modified bases and their interactions, in the context of many biological processes involving RNA. PMID:28341704

Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides.

PubMed

Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu

2004-03-01

A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non-Watson-Crick base pair in SECIS element plays an important role in the selenocysteine expression by UGA codon.

Glacial geology of the Shingobee River headwaters area, north-central Minnesota

USGS Publications Warehouse

Melchior, Robert C.

2014-01-01

During middle and late Wisconsin time in the Shingobee River headwaters area, the Laurentide Wadena lobe, Hewitt and Itasca phases, produced terminal and ground moraine along with a variety of associated glacial features. The stratigraphic record is accessible and provides details of depositional mode as well as principal glacial events during the advance and retreat of middle and late Wisconsin ice tongues. Geomorphic features such as tunnel valleys, stream terraces, and postglacial stream cuts formed by erosional events persist to the present day. Middle Wisconsin Hewitt phase deposits are the oldest and include drumlins, ground moraine, boulder pavements, and outwash. Together, these deposits suggest a wet-based, periodically surging glacier in a subpolar thermal state. Regional permafrost and deposition from retreating ice are inferred between the end of the Hewitt phase and the advance of late Wisconsin Itasca phase ice. Itasca phase glaciation occurred as a contemporaneous pair of adjacent ice tongues whose contrasting moraine styles suggest independent flow modes. The western (Shingobee) portion of the Itasca moraine contains composite ridges, permafrost phenomena, hill-hole pairs, and debris flows. By contrast, eastern (Onigum) moraine deposits generally lack glaciotectonic features and consist almost exclusively of mud and debris flows. Near the end of the Itasca phase, large-scale hill-hole pairs developed in the Shingobee division, and debris flows from the Onigum division blocked the preexisting Shingobee tunnel valley to form glacial lake Willobee. Postglacial streams formed deep valleys as glacial lake Willobee catastrophically drained. Dates based on temperature trends in Greenland ice cores are proposed for prominent glacial events in the Shingobee area. This report proposes that Hewitt phase glaciation occurred between 27.2 and 23.6 kiloannum and Itasca phase glaciation between 22.8 and 14.7 kiloannum. Des Moines lobe (Younger Dryas) glaciation, which had only secondary effects on the Shingobee headwaters area, occurred between 13.5 and 11.6 kiloannum.

Mechanism of error-free DNA synthesis across N1-methyl-deoxyadenosine by human DNA polymerase-ι

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jain, Rinku; Choudhury, Jayati Roy; Buku, Angeliki

N1-methyl-deoxyadenosine (1-MeA) is formed by methylation of deoxyadenosine at the N1 atom. 1-MeA presents a block to replicative DNA polymerases due to its inability to participate in Watson-Crick (W-C) base pairing. Here we determine how human DNA polymerase-ι (Polι) promotes error-free replication across 1-MeA. Steady state kinetic analyses indicate that Polι is ~100 fold more efficient in incorporating the correct nucleotide T versus the incorrect nucleotide C opposite 1-MeA. To understand the basis of this selectivity, we determined ternary structures of Polι bound to template 1-MeA and incoming dTTP or dCTP. In both structures, template 1-MeA rotates to the synmore » conformation but pairs differently with dTTP versus dCTP. Thus, whereas dTTP partakes in stable Hoogsteen base pairing with 1-MeA, dCTP fails to gain a “foothold” and is largely disordered. Together, our kinetic and structural studies show how Polι maintains discrimination between correct and incorrect incoming nucleotide opposite 1-MeA in preserving genome integrity.« less

Roles of the Lewis acid and base in the chemical reduction of CO2 catalyzed by frustrated Lewis pairs.

PubMed

Lim, Chern-Hooi; Holder, Aaron M; Hynes, James T; Musgrave, Charles B

2013-09-03

We employ quantum chemical calculations to discover how frustrated Lewis pairs (FLP) catalyze the reduction of CO2 by ammonia borane (AB); specifically, we examine how the Lewis acid (LA) and Lewis base (LB) of an FLP activate CO2 for reduction. We find that the LA (trichloroaluminum, AlCl3) alone catalyzes hydride transfer (HT) to CO2 while the LB (trimesitylenephosphine, PMes3) actually hinders HT; inclusion of the LB increases the HT barrier by ∼8 kcal/mol relative to the reaction catalyzed by LAs only. The LB hinders HT by donating its lone pair to the LUMO of CO2, increasing the electron density on the C atom and thus lowering its hydride affinity. Although the LB hinders HT, it nonetheless plays a crucial role by stabilizing the active FLP·CO2 complex relative to the LA dimer, free CO2, and free LB. This greatly increases the concentration of the reactive complex in the form FLP·CO2 and thus increases the rate of reaction. We expect that the principles we describe will aid in understanding other catalytic CO2 reductions.

Thermodynamics of triple helix formation: spectrophotometric studies on the d(A)10.2d(T)10 and d(C+3T4C+3).d(G3A4G3).d(C3T4C3) triple helices.

PubMed Central

Pilch, D S; Brousseau, R; Shafer, R H

1990-01-01

We have stabilized the d(A)10.2d(T)10 and d(C+LT4C+3).d(G3A4G3).d(C3T4C3) triple helices with either NaCl or MgCl2 at pH 5.5. UV mixing curves demonstrate a 1:2 stoichiometry of purine to pyrimidine strands under the appropriate conditions of pH and ionic strength. Circular dichroic titrations suggest a possible sequence-independent spectral signature for triplex formation. Thermal denaturation profiles indicate the initial loss of the third strand followed by dissociation of the underlying duplex with increasing temperature. Depending on the base sequence and ionic conditions, the binding affinity of the third strand for the duplex at 25 degrees C is two to five orders of magnitude lower than that of the two strands forming the duplex. Thermodynamic parameters for triplex formation were determined for both sequences in the presence of 50 mM MgCl2 and/or 2.0 M NaCl. Hoogsteen base pairs are 0.22-0.64 kcal/mole less stable than Watson-Crick base pairs, depending on ionic conditions and base composition. C+.G and T.A Hoogsteen base pairs appear to have similar stability in the presence of Mg2+ ions at low pH. PMID:2216768

Transitive inference in adults with autism spectrum disorders

PubMed Central

Solomon, Marjorie; Frank, Michael J.; Smith, Anne C.; Ly, Stanford; Carter, Cameron S.

2012-01-01

Individuals with autism spectrum disorders (ASDs) exhibit intact rote learning with impaired generalization. A transitive inference paradigm, involving training on four sequentially presented stimulus pairs containing overlapping items, with subsequent testing on two novel pairs, was used to investigate this pattern of learning in 27 young adults with ASDs and 31 matched neurotypical individuals (TYPs). On the basis of findings about memory and neuropathology, we hypothesized that individuals with ASDs would use a relational flexibility/conjunctive strategy reliant on an intact hippocampus, versus an associative strength/value transfer strategy requiring intact interactions between the prefrontal cortex and the striatum. Hypotheses were largely confirmed. ASDs demonstrated reduced interference from intervening pairs in early training; only TYPs formed a serial position curve by test; and ASDs exhibited impairments on the novel test pair consisting of end items with intact performance on the inner test pair. However, comparable serial position curves formed for both groups by the end of the first block. PMID:21656344

Bulge formed cooling channels with a variable lead helix on a hollow body of revolution

NASA Technical Reports Server (NTRS)

McAninch, Michael D. (Inventor); Holbrook, Richard L. (Inventor); Lacount, Dale F. (Inventor); Kawashige, Chester M. (Inventor); Crapuchettes, John M. (Inventor); Scala, James (Inventor)

1993-01-01

A method of constructing a nozzle having cooling channels comprises a shell and a liner which are formed into a body of revolution having an axis of revolution. Helical welds are formed to hold the liner and shell to each other with a channel position being defined between each pair of helical welds. Pressurized fluid which may be a gas or a liquid, is introduced between the weld pairs to outwardly bulge the material of at least one of the liner and shell to define the channels.

pKa shifting in double-stranded RNA is highly dependent upon nearest neighbors and bulge positioning.

PubMed

Wilcox, Jennifer L; Bevilacqua, Philip C

2013-10-22

Shifting of pKa's in RNA is important for many biological processes; however, the driving forces responsible for shifting are not well understood. Herein, we determine how structural environments surrounding protonated bases affect pKa shifting in double-stranded RNA (dsRNA). Using (31)P NMR, we determined the pKa of the adenine in an A(+)·C base pair in various sequence and structural environments. We found a significant dependence of pKa on the base pairing strength of nearest neighbors and the location of a nearby bulge. Increasing nearest neighbor base pairing strength shifted the pKa of the adenine in an A(+)·C base pair higher by an additional 1.6 pKa units, from 6.5 to 8.1, which is well above neutrality. The addition of a bulge two base pairs away from a protonated A(+)·C base pair shifted the pKa by only ~0.5 units less than a perfectly base paired hairpin; however, positioning the bulge just one base pair away from the A(+)·C base pair prohibited formation of the protonated base pair as well as several flanking base pairs. Comparison of data collected at 25 °C and 100 mM KCl to biological temperature and Mg(2+) concentration revealed only slight pKa changes, suggesting that similar sequence contexts in biological systems have the potential to be protonated at biological pH. We present a general model to aid in the determination of the roles protonated bases may play in various dsRNA-mediated processes including ADAR editing, miRNA processing, programmed ribosomal frameshifting, and general acid-base catalysis in ribozymes.

Database of non-canonical base pairs found in known RNA structures

NASA Technical Reports Server (NTRS)

Nagaswamy, U.; Voss, N.; Zhang, Z.; Fox, G. E.

2000-01-01

Atomic resolution RNA structures are being published at an increasing rate. It is common to find a modest number of non-canonical base pairs in these structures in addition to the usual Watson-Crick pairs. This database summarizes the occurrence of these rare base pairs in accordance with standard nomenclature. The database, http://prion.bchs.uh.edu/, contains information such as sequence context, sugar pucker conformation, anti / syn base conformations, chemical shift, p K (a)values, melting temperature and free energy. Of the 29 anticipated pairs with two or more hydrogen bonds, 20 have been encountered to date. In addition, four unexpected pairs with two hydrogen bonds have been reported bringing the total to 24. Single hydrogen bond versions of five of the expected geometries have been encountered among the single hydrogen bond interactions. In addition, 18 different types of base triplets have been encountered, each of which involves three to six hydrogen bonds. The vast majority of the rare base pairs are antiparallel with the bases in the anti configuration relative to the ribose. The most common are the GU wobble, the Sheared GA pair, the Reverse Hoogsteen pair and the GA imino pair.

Controlled-force end seal arrangement for an air press of a papermaking machine

DOEpatents

Beck, David A.

2003-07-08

An air press for pressing a fiber web includes a plurality of rolls and a pair of end seal arrangements. Of the plurality of rolls, each pair of adjacent rolls forms a nip therebetween. Further, each roll has a pair of roll ends, the plurality of rolls together forming two sets of roll ends. Each end seal arrangement coacts with one set of roll ends, the plurality of rolls and the pair of end seal arrangements together defining an air press chamber having an air chamber pressure. Each end seal arrangement is composed of at least one roll seal, including a first roll seal, and an adjustable bias mechanism. Each roll seal forms a seal with at least one roll end, and one side of the first roll seal being exposed to the air chamber pressure. The adjustable bias mechanism is configured for controlling a position of each roll seal relative to a respective at least one roll end and for adjusting a seal force between the roll seal and the respective at least one roll end.

Rank-Order and Paired Comparisons as the Basis for Measurement.

ERIC Educational Resources Information Center

Linacre, John M.

Three case studies are presented demonstrating the application of straight-forward Rasch techniques to rank order data. Paired comparisons are the simplest form of rank ordering. A consumer preference test with 56 pairs of cups of coffee tasted by each of 26 consumers illustrates analysis of these rankings. When subjects are allowed the option of…

Wire stripper

NASA Technical Reports Server (NTRS)

Economu, M. A. (Inventor)

1978-01-01

An insulation stripper is described which is especially useful for shielded wire, the stripper including a first pair of jaws with blades extending substantially perpendicular to the axis of the wire, and a second pair of jaws with blades extending substantially parallel to the axis of the wire. The first pair of jaws is pressed against the wire so the blades cut into the insulation, and the device is turned to form circumferential cuts in the insulation. Then the second pair of jaws is pressed against the wire so the blades cut into the insulation, and the wire is moved through the device to form longitudinal cuts that permit easy removal of the insulation. Each of the blades is located within the concave face of a V-block, to center the blades on the wire and to limit the depth of blade penetration.

Dancing to CHANGA: a self-consistent prediction for close SMBH pair formation time-scales following galaxy mergers

NASA Astrophysics Data System (ADS)

Tremmel, M.; Governato, F.; Volonteri, M.; Quinn, T. R.; Pontzen, A.

2018-04-01

We present the first self-consistent prediction for the distribution of formation time-scales for close supermassive black hole (SMBH) pairs following galaxy mergers. Using ROMULUS25, the first large-scale cosmological simulation to accurately track the orbital evolution of SMBHs within their host galaxies down to sub-kpc scales, we predict an average formation rate density of close SMBH pairs of 0.013 cMpc-3 Gyr-1. We find that it is relatively rare for galaxy mergers to result in the formation of close SMBH pairs with sub-kpc separation and those that do form are often the result of Gyr of orbital evolution following the galaxy merger. The likelihood and time-scale to form a close SMBH pair depends strongly on the mass ratio of the merging galaxies, as well as the presence of dense stellar cores. Low stellar mass ratio mergers with galaxies that lack a dense stellar core are more likely to become tidally disrupted and deposit their SMBH at large radii without any stellar core to aid in their orbital decay, resulting in a population of long-lived `wandering' SMBHs. Conversely, SMBHs in galaxies that remain embedded within a stellar core form close pairs in much shorter time-scales on average. This time-scale is a crucial, though often ignored or very simplified, ingredient to models predicting SMBH mergers rates and the connection between SMBH and star formation activity.

Biochemical behavior of N-oxidized cytosine and adenine bases in DNA polymerase-mediated primer extension reactions

PubMed Central

Tsunoda, Hirosuke; Kudo, Tomomi; Masaki, Yoshiaki; Ohkubo, Akihiro; Seio, Kohji; Sekine, Mitsuo

2011-01-01

To clarify the biochemical behavior of 2′-deoxyribonucleoside 5′-triphosphates and oligodeoxyribonucleotides (ODNs) containing cytosine N-oxide (Co) and adenine N-oxide (Ao), we examined their base recognition ability in DNA duplex formation using melting temperature (Tm) experiments and their substrate specificity in DNA polymerase-mediated replication. As the result, it was found that the Tm values of modified DNA–DNA duplexes incorporating 2′-deoxyribonucleoside N-oxide derivatives significantly decreased compared with those of the unmodified duplexes. However, single insertion reactions by DNA polymerases of Klenow fragment (KF) (exo−) and Vent (exo−) suggested that Co and Ao selectively recognized G and T, respectively. Meanwhile, the kinetic study showed that the incorporation efficiencies of the modified bases were lower than those of natural bases. Ab initio calculations suggest that these modified bases can form the stable base pairs with the original complementary bases. These results indicate that the modified bases usually recognize the original bases as partners for base pairing, except for misrecognition of dATP by the action of KF (exo−) toward Ao on the template, and the primers could be extended on the template DNA. When they misrecognized wrong bases, the chain could not be elongated so that the modified base served as the chain terminator. PMID:21300642

Biochemical behavior of N-oxidized cytosine and adenine bases in DNA polymerase-mediated primer extension reactions.

PubMed

Tsunoda, Hirosuke; Kudo, Tomomi; Masaki, Yoshiaki; Ohkubo, Akihiro; Seio, Kohji; Sekine, Mitsuo

2011-04-01

To clarify the biochemical behavior of 2'-deoxyribonucleoside 5'-triphosphates and oligodeoxyribonucleotides (ODNs) containing cytosine N-oxide (C(o)) and adenine N-oxide (A(o)), we examined their base recognition ability in DNA duplex formation using melting temperature (T(m)) experiments and their substrate specificity in DNA polymerase-mediated replication. As the result, it was found that the T(m) values of modified DNA-DNA duplexes incorporating 2'-deoxyribonucleoside N-oxide derivatives significantly decreased compared with those of the unmodified duplexes. However, single insertion reactions by DNA polymerases of Klenow fragment (KF) (exo(-)) and Vent (exo(-)) suggested that C(o) and A(o) selectively recognized G and T, respectively. Meanwhile, the kinetic study showed that the incorporation efficiencies of the modified bases were lower than those of natural bases. Ab initio calculations suggest that these modified bases can form the stable base pairs with the original complementary bases. These results indicate that the modified bases usually recognize the original bases as partners for base pairing, except for misrecognition of dATP by the action of KF (exo(-)) toward A(o) on the template, and the primers could be extended on the template DNA. When they misrecognized wrong bases, the chain could not be elongated so that the modified base served as the chain terminator.

Efficacy of an Attachment-Based Intervention Model on Health Indices in Children with Chronic Disease and Their Mothers.

PubMed

Dehghani-Arani, Fateme; Besharat, Mohammad Ali; Fitton, Victoria A; Aghamohammadi, Asghar

2018-05-07

Studies have shown significant relationship between health conditions and attachment. This study aimed to examine an attachment-based intervention model named mother-child-disease triangle (MCDT) on health indices in children with chronic disease and their mothers. This randomized trial study included 22 volunteer children aged 12-18 years undergoing medical treatment for a chronic disease and their mothers. After evaluation by 28-form General Health Questionnaire (GHQ-28), inventory of parent and peer attachment (IPPA), 28-form Child Health Questionnaire (CHQ-28) and Illness Perception Questionnaire (IPQ), the mother-child dyads were paired on the basis of IPPA scores. These pairs were then randomly assigned to an experimental or control group. The experimental group received ten 90-min sessions of MCDT over a 7-week period. Meanwhile, the control group received ten simple conversational sessions as a dummy intervention. In accordance with this study's pre-test/post-test design, both groups were evaluated once again after completing their respective treatment. Multivariate analysis of covariance (MANCOVA) showed members of the experimental group to have significantly stronger attachment and better physiological and psychosocial health than those in the control group. These findings suggest that attachment-based interventions can be used to improve the effectiveness of treatment among children with chronic disease and their mothers.

Base pair probability estimates improve the prediction accuracy of RNA non-canonical base pairs

PubMed Central

2017-01-01

Prediction of RNA tertiary structure from sequence is an important problem, but generating accurate structure models for even short sequences remains difficult. Predictions of RNA tertiary structure tend to be least accurate in loop regions, where non-canonical pairs are important for determining the details of structure. Non-canonical pairs can be predicted using a knowledge-based model of structure that scores nucleotide cyclic motifs, or NCMs. In this work, a partition function algorithm is introduced that allows the estimation of base pairing probabilities for both canonical and non-canonical interactions. Pairs that are predicted to be probable are more likely to be found in the true structure than pairs of lower probability. Pair probability estimates can be further improved by predicting the structure conserved across multiple homologous sequences using the TurboFold algorithm. These pairing probabilities, used in concert with prior knowledge of the canonical secondary structure, allow accurate inference of non-canonical pairs, an important step towards accurate prediction of the full tertiary structure. Software to predict non-canonical base pairs and pairing probabilities is now provided as part of the RNAstructure software package. PMID:29107980

Mechanics of wafer bonding: Effect of clamping

NASA Astrophysics Data System (ADS)

Turner, K. T.; Thouless, M. D.; Spearing, S. M.

2004-01-01

A mechanics-based model is developed to examine the effects of clamping during wafer bonding processes. The model provides closed-form expressions that relate the initial geometry and elastic properties of the wafers to the final shape of the bonded pair and the strain energy release rate at the interface for two different clamping configurations. The results demonstrate that the curvature of bonded pairs may be controlled through the use of specific clamping arrangements during the bonding process. Furthermore, it is demonstrated that the strain energy release rate depends on the clamping configuration and that using applied loads usually leads to an undesirable increase in the strain energy release rate. The results are discussed in detail and implications for process development and bonding tool design are highlighted.

Capacitive proximity sensor

DOEpatents

Kronberg, James W.

1994-01-01

A proximity sensor based on a closed field circuit. The circuit comprises a ring oscillator using a symmetrical array of plates that creates an oscillating displacement current. The displacement current varies as a function of the proximity of objects to the plate array. Preferably the plates are in the form of a group of three pair of symmetric plates having a common center, arranged in a hexagonal pattern with opposing plates linked as a pair. The sensor produces logic level pulses suitable for interfacing with a computer or process controller. The proximity sensor can be incorporated into a load cell, a differential pressure gauge, or a device for measuring the consistency of a characteristic of a material where a variation in the consistency causes the dielectric constant of the material to change.

Ion Pairs or Neutral Molecule Adducts? Cooperativity in Hydrogen Bonding

ERIC Educational Resources Information Center

DeKock, Roger L.; Schipper, Laura A.; Dykhouse, Stephanie C.; Heeringa, Lee P.; Brandsen, Benjamin M.

2009-01-01

We performed theoretical studies on the systems NH[subscript 3] times HF times mH[subscript 2]O, NH[subscript 3] times HCl times mH[subscript 2]O, with m = 0, 1, 2, and 6. The molecules with m = 0 form hydrogen-bonded adducts with little tendency to form an ion-pair structure. The molecule NH[subscript 3] times HCl times H[subscript 2]O cannot be…

DNA base dimers are stabilized by hydrogen-bonding interactions including non-Watson-Crick pairing near graphite surfaces.

PubMed

Shankar, Akshaya; Jagota, Anand; Mittal, Jeetain

2012-10-11

Single- and double-stranded DNA are increasingly being paired with surfaces and nanoparticles for numerous applications, such as sensing, imaging, and drug delivery. Unlike the majority of DNA structures in bulk that are stabilized by canonical Watson-Crick pairing between Ade-Thy and Gua-Cyt, those adsorbed on surfaces are often stabilized by noncanonical base pairing, quartet formation, and base-surface stacking. Not much is known about these kinds of interactions. To build an understanding of the role of non-Watson-Crick pairing on DNA behavior near surfaces, one requires basic information on DNA base pair stacking and hydrogen-bonding interactions. All-atom molecular simulations of DNA bases in two cases--in bulk water and strongly adsorbed on a graphite surface--are conducted to study the relative strengths of stacking and hydrogen bond interactions for each of the 10 possible combinations of base pairs. The key information obtained from these simulations is the free energy as a function of distance between two bases in a pair. We find that stacking interactions exert the dominant influence on the stability of DNA base pairs in bulk water as expected. The strength of stability for these stacking interactions is found to decrease in the order Gua-Gua > Ade-Gua > Ade-Ade > Gua-Thy > Gua-Cyt > Ade-Thy > Ade-Cyt > Thy-Thy > Cyt-Thy > Cyt-Cyt. On the other hand, mutual interactions of surface-adsorbed base pairs are stabilized mostly by hydrogen-bonding interactions in the order Gua-Cyt > Ade-Gua > Ade-Thy > Ade-Ade > Cyt-Thy > Gua-Gua > Cyt-Cyt > Ade-Cyt > Thy-Thy > Gua-Thy. Interestingly, several non-Watson-Crick base pairings, which are commonly ignored, have similar stabilization free energies due to interbase hydrogen bonding as Watson-Crick pairs. This clearly highlights the importance of non-Watson-Crick base pairing in the development of secondary structures of oligonucleotides near surfaces.

Demographic mechanisms of inbreeding adjustment through extra-pair reproduction.

PubMed

Reid, Jane M; Duthie, A Bradley; Wolak, Matthew E; Arcese, Peter

2015-07-01

One hypothesis explaining extra-pair reproduction is that socially monogamous females mate with extra-pair males to adjust the coefficient of inbreeding (f) of extra-pair offspring (EPO) relative to that of within-pair offspring (WPO) they would produce with their socially paired male. Such adjustment of offspring f requires non-random extra-pair reproduction with respect to relatedness, which is in turn often assumed to require some mechanism of explicit pre-copulatory or post-copulatory kin discrimination. We propose three demographic processes that could potentially cause mean f to differ between individual females' EPO and WPO given random extra-pair reproduction with available males without necessarily requiring explicit kin discrimination. Specifically, such a difference could arise if social pairings formed non-randomly with respect to relatedness or persisted non-randomly with respect to relatedness, or if the distribution of relatedness between females and their sets of potential mates changed during the period through which social pairings persisted. We used comprehensive pedigree and pairing data from free-living song sparrows (Melospiza melodia) to quantify these three processes and hence investigate how individual females could adjust mean offspring f through instantaneously random extra-pair reproduction. Female song sparrows tended to form social pairings with unrelated or distantly related males slightly less frequently than expected given random pairing within the defined set of available males. Furthermore, social pairings between more closely related mates tended to be more likely to persist across years than social pairings between less closely related mates. However, these effects were small and the mean relatedness between females and their sets of potential extra-pair males did not change substantially across the years through which social pairings persisted. Our framework and analyses illustrate how demographic and social structuring within populations might allow females to adjust mean f of offspring through random extra-pair reproduction without necessarily requiring explicit kin discrimination, implying that adjustment of offspring f might be an inevitable consequence of extra-pair reproduction. New theoretical and empirical studies are required to explore the general magnitude of such effects and quantify the degree to which they could facilitate or constrain long-term evolution of extra-pair reproduction. © 2015 The Authors. Journal of Animal Ecology published by John Wiley & Sons Ltd on behalf of British Ecological Society.

Dynamics of Cancer Cell near Collagen Fiber Chain

NASA Astrophysics Data System (ADS)

Kim, Jihan; Sun, Bo

Cell migration is an integrated process that is important in life. Migration is essential for embryonic development as well as homeostatic processes such as wound healing and immune responses. When cell migrates through connective extracellular matrix (ECM), it applies cellular traction force to ECM and senses the rigidity of their local environment. We used human breast cancer cell (MDA-MB-231) which is highly invasive and applies strong traction force to ECM. As cancer cell applies traction force to type I collage-based ECM, it deforms collagen fibers near the surface. Patterns of deforming collagen fibers are significantly different with pairs of cancer cells compared to a single cancer cell. While a pair of cancer cells within 60 um creates aligned collagen fiber chains between them permanently, a single cancer cell does not form any fiber chains. In this experiment we measured a cellular response and an interaction between a pair of cells through the chain. Finally, we analyzed correlation of directions between cancer cell migration and the collagen chain alignment.

Benchmark studies on the building blocks of DNA. 3. Watson-Crick and stacked base pairs.

PubMed

Szalay, Péter G; Watson, Thomas; Perera, Ajith; Lotrich, Victor; Bartlett, Rodney J

2013-04-18

Excited states of stacked adenine-thymine and guanine-cytosine pairs as well as the Watson-Crick pair of guanine-thymine have been investigated using the equation of motion coupled-cluster (EOM-CC) method with single and double as well as approximate triple excitations. Transitions have been assigned, and the form of the excitations has been analyzed. The majority of the excitations could be classified as localized on the nucleobases, but for all three studied systems, charge-transfer (CT) transitions could also be identified. The main aim of this study was to compare the performance of lower-level methods (ADC(2) and TDDFT) to the high-level EOM-CC ones. It was shown that both ADC(2) and TDDFT with long-range correction have nonsystematic error in excitation energies, causing alternation of the energetic ordering of the excitations. Considering the high costs of the EOM-CC calculations, there is a need for reliable new approximate methods.

Long-range coupling of electron-hole pairs in spatially separated organic donor-acceptor layers

PubMed Central

Nakanotani, Hajime; Furukawa, Taro; Morimoto, Kei; Adachi, Chihaya

2016-01-01

Understanding exciton behavior in organic semiconductor molecules is crucial for the development of organic semiconductor-based excitonic devices such as organic light-emitting diodes and organic solar cells, and the tightly bound electron-hole pair forming an exciton is normally assumed to be localized on an organic semiconducting molecule. We report the observation of long-range coupling of electron-hole pairs in spatially separated electron-donating and electron-accepting molecules across a 10-nanometers-thick spacer layer. We found that the exciton energy can be tuned over 100 megaelectron volts and the fraction of delayed fluorescence can be increased by adjusting the spacer-layer thickness. Furthermore, increasing the spacer-layer thickness produced an organic light-emitting diode with an electroluminescence efficiency nearly eight times higher than that of a device without a spacer layer. Our results demonstrate the first example of a long-range coupled charge-transfer state between electron-donating and electron-accepting molecules in a working device. PMID:26933691

Evaluation of suitable DNA regions for molecular identification of high value medicinal plants in genus Kaempferia.

PubMed

Osathanunkul, Maslin; Dheeranupattana, Srisulak; Rotarayanont, Siriphron; Sookkhee, Siriwoot; Osathanunkul, Khukrit; Madesis, Panagiotis

2017-12-02

DNA barcoding coupled high resolution melting (Bar-HRM) is an emerging method for species discrimination based on DNA dissociation kinetics. The aim of this work was to evaluate the suitability of different primer sets, derived from selected DNA regions, for Bar-HRM analysis of species in Kaempferia (Zingiberaceae). Four primer pairs were evaluated (rbcL, rpoC, trnL and ITS1). It was observed that the ITS1 barcode was the most useful DNA barcoding region overall for species discrimination out of all of the regions and primers assessed. Thus, the primer pair derived from the ITS1 region was the single most effective region for the identification of the tested species, whereas the rbcL primer pair gave the lowest resolution. Our Bar-HRM developed here would not only be useful for identification of Kaempferia plant specimens lacking essential parts for morphological identification but will be useful for authenticating products in powdered form of a high value medicinal species Kaempferia parviflora, in particular.

I Know My Neighbour: Individual Recognition in Octopus vulgaris

PubMed Central

Tricarico, Elena; Borrelli, Luciana; Gherardi, Francesca; Fiorito, Graziano

2011-01-01

Background Little is known about individual recognition (IR) in octopuses, although they have been abundantly studied for their sophisticated behaviour and learning capacities. Indeed, the ability of octopuses to recognise conspecifics is suggested by a number of clues emerging from both laboratory studies (where they appear to form and maintain dominance hierarchies) and field observations (octopuses of neighbouring dens display little agonism between each other). To fill this gap in knowledge, we investigated the behaviour of 24 size-matched pairs of Octopus vulgaris in laboratory conditions. Methodology/Principal Findings The experimental design was composed of 3 phases: Phase 1 (acclimatization): 12 “sight-allowed” (and 12 “isolated”) pairs were maintained for 3 days in contiguous tanks separated by a transparent (and opaque) partition to allow (and block) the vision of the conspecific; Phase 2 (cohabitation): members of each pair (both sight-allowed and isolated) were transferred into an experimental tank and were allowed to interact for 15 min every day for 3 consecutive days; Phase 3 (test): each pair (both sight-allowed and isolated) was subject to a switch of an octopus to form pairs composed of either familiar (“sham switches”) or unfamiliar conspecifics (“real switches”). Longer latencies (i.e. the time elapsed from the first interaction) and fewer physical contacts in the familiar pairs as opposed to the unfamiliar pairs were used as proxies for recognition. Conclusions Octopuses appear able to recognise conspecifics and to remember the individual previously met for at least one day. To the best of our knowledge, this is the first experimental study showing the occurrence of a form of IR in cephalopods. Future studies should clarify whether this is a “true” IR. PMID:21533257

Incorporating a guanidine-modified cytosine base into triplex-forming PNAs for the recognition of a C-G pyrimidine–purine inversion site of an RNA duplex

PubMed Central

Toh, Desiree-Faye Kaixin; Devi, Gitali; Patil, Kiran M.; Qu, Qiuyu; Maraswami, Manikantha; Xiao, Yunyun; Loh, Teck Peng; Zhao, Yanli; Chen, Gang

2016-01-01

RNA duplex regions are often involved in tertiary interactions and protein binding and thus there is great potential in developing ligands that sequence-specifically bind to RNA duplexes. We have developed a convenient synthesis method for a modified peptide nucleic acid (PNA) monomer with a guanidine-modified 5-methyl cytosine base. We demonstrated by gel electrophoresis, fluorescence and thermal melting experiments that short PNAs incorporating the modified residue show high binding affinity and sequence specificity in the recognition of an RNA duplex containing an internal inverted Watson-Crick C-G base pair. Remarkably, the relatively short PNAs show no appreciable binding to DNA duplexes or single-stranded RNAs. The attached guanidine group stabilizes the base triple through hydrogen bonding with the G base in a C-G pair. Selective binding towards an RNA duplex over a single-stranded RNA can be rationalized by the fact that alkylation of the amine of a 5-methyl C base blocks the Watson–Crick edge. PNAs incorporating multiple guanidine-modified cytosine residues are able to enter HeLa cells without any transfection agent. PMID:27596599

Visual form predictions facilitate auditory processing at the N1.

PubMed

Paris, Tim; Kim, Jeesun; Davis, Chris

2017-02-20

Auditory-visual (AV) events often involve a leading visual cue (e.g. auditory-visual speech) that allows the perceiver to generate predictions about the upcoming auditory event. Electrophysiological evidence suggests that when an auditory event is predicted, processing is sped up, i.e., the N1 component of the ERP occurs earlier (N1 facilitation). However, it is not clear (1) whether N1 facilitation is based specifically on predictive rather than multisensory integration and (2) which particular properties of the visual cue it is based on. The current experiment used artificial AV stimuli in which visual cues predicted but did not co-occur with auditory cues. Visual form cues (high and low salience) and the auditory-visual pairing were manipulated so that auditory predictions could be based on form and timing or on timing only. The results showed that N1 facilitation occurred only for combined form and temporal predictions. These results suggest that faster auditory processing (as indicated by N1 facilitation) is based on predictive processing generated by a visual cue that clearly predicts both what and when the auditory stimulus will occur. Copyright © 2016. Published by Elsevier Ltd.

Initiation of Long-Wave Instability of Vortex Pairs at Cruise Altitudes

NASA Technical Reports Server (NTRS)

Rossow, Vernon J.

2011-01-01

Previous studies have usually attributed the initiation of the long-wave instability of a vortex pair to turbulence in the atmosphere or in the wake of the aircraft. The purpose here is to show by use of observations and photographs of condensation trails shed by aircraft at cruise altitudes that another initiating mechanism is not only possible but is usually the mechanism that initiates the long-wave instability at cruise altitudes. The alternate initiating mechanism comes about when engine thrust is robust enough to form an array of circumferential vortices around each jet-engine-exhaust stream. In those cases, initiation begins when the vortex sheet shed by the wing has rolled up into a vortex pair and descended to the vicinity of the inside bottom of the combined shear-layer vortex arrays. It is the in-and-out (up and down) velocity field between sequential circumferential vortices near the bottom of the array that then impresses disturbance waves on the lift-generated vortex pair that initiate the long-wave instability. A time adjustment to the Crow and Bate estimate for vortex linking is then derived for cases when thrust-based linking occurs.

Larval spicules, cilia, and symmetry as remnants of indirect development in the direct developing sea urchin Heliocidaris erythrogramma.

PubMed

Emlet, R B

1995-02-01

Nonfeeding larvae of the echinoid Heliocidaris erythrogramma were raised in culture and examined for expression of a larval skeleton and for the arrangement of the ciliated band. Opaque larvae were fixed, cleared, and examined under polarized light for evidence of calcification. By 35 hr after fertilization (at 22 degrees C), a pair of triradiate spicules was present at the posterior end of the larvae. Each member of this pair formed a fenestrated spicule as it grew laterally. This pair and another pair which formed subsequently, were arranged across a plane of bilateral symmetry orthagonal to the juvenile oral aboral axis. These paired larval spicules can be identified as reduced expressions of postoral and posterodorsal rods found in plutei, and their expression indicates that the juvenile rudiment of H. erythrogramma forms on the left side and that larval body axes are conserved in this modified larva. By 44 hr the ciliated band formed as an incomplete transverse loop of three segments at the posterior end and on the dorsal surface of the ovoid larva. Cilia in these segments grew to lengths of 45-50 microns, longer than other swimming and feeding cilia reported for echinoderm larvae. Band segments are interpreted as expressions of epaulettes (specialized swimming bands) rather than the feeding ciliated band of the pluteus. The ciliated band segments and the larval spicules are both bilaterally symmetrical with respect to the same plane and indicate conserved larval bilateral symmetry despite the major asymmetry of the fates of cells on either side of this plane in their contribution to juvenile development.

Peculiarities of Clutch Forming Rails and Wheel Block Construction

NASA Astrophysics Data System (ADS)

Shiler, V. V.; Galiev, I. I.; Shiler, A. V.

2018-03-01

The clutch of the wheel and rail is significantly influenced by the design features of the standard wheel pair, which are manifested in the presence of "parasitic" slipping of the wheels along the rails during its movement. The purpose of the presented work is to evaluate new design solutions for wheel sets. The research was carried out using methods of comparative simulation modelling and physical prototyping. A new design of the wheel pair (block wheel pair) is proposed, which features an independent rotation of all surfaces of the wheels in contact with the rails. The block construction of the wheel pair forms open mechanical contours with the track gauge, which completely eliminates the "parasitic" slippage. As a result, in the process of implementing traction or braking forces, the coupling coefficient of the block construction of the wheel pair is significantly higher than that of existing structures. In addition, in the run-out mode, the resistance to movement of the block wheel pair is half as much. All this will allow one to significantly reduce the energy consumption for traction of trains, wear of track elements and crew, and to increase the speed and safety of train traffic.

Searching for globally optimal functional forms for interatomic potentials using genetic programming with parallel tempering.

PubMed

Slepoy, A; Peters, M D; Thompson, A P

2007-11-30

Molecular dynamics and other molecular simulation methods rely on a potential energy function, based only on the relative coordinates of the atomic nuclei. Such a function, called a force field, approximately represents the electronic structure interactions of a condensed matter system. Developing such approximate functions and fitting their parameters remains an arduous, time-consuming process, relying on expert physical intuition. To address this problem, a functional programming methodology was developed that may enable automated discovery of entirely new force-field functional forms, while simultaneously fitting parameter values. The method uses a combination of genetic programming, Metropolis Monte Carlo importance sampling and parallel tempering, to efficiently search a large space of candidate functional forms and parameters. The methodology was tested using a nontrivial problem with a well-defined globally optimal solution: a small set of atomic configurations was generated and the energy of each configuration was calculated using the Lennard-Jones pair potential. Starting with a population of random functions, our fully automated, massively parallel implementation of the method reproducibly discovered the original Lennard-Jones pair potential by searching for several hours on 100 processors, sampling only a minuscule portion of the total search space. This result indicates that, with further improvement, the method may be suitable for unsupervised development of more accurate force fields with completely new functional forms. Copyright (c) 2007 Wiley Periodicals, Inc.

Captive-housed male cheetahs (Acinonyx jubatus soemmeringii) form naturalistic coalitions: measuring associations and calculating chance encounters.

PubMed

Chadwick, Carly L; Rees, Paul A; Stevens-Wood, Barry

2013-01-01

Cheetahs are known to reproduce poorly in captivity and research suggests that the reasons for this are behavioral, rather than physiological. In the wild, male cheetahs remain in stable groups, or coalitions, throughout their lifetime. Appropriate social group housing is important in enhancing welfare and reproductive success in captivity and this study examined the effect of changes in social group composition on the behavior of four male cheetahs: two siblings and two half siblings. During the study, the cheetahs were housed both in pairs and as a group of four, before one male was relocated. The remaining cheetahs were then housed in a trio. Affiliative behaviors were frequently shown within pairs and overt aggression was seldom observed. Association indices were calculated for each cheetah pair and corrected for chance encounters based on data generated from a Monte Carlo simulation. The indices showed that two coalitions existed before the relocated male departed. Following the relocation of one of the half siblings, the remaining cheetahs appeared to form a coalition of three, as the indices of association between the unrelated male and the siblings increased and allogrooming between unrelated individuals was observed. The findings of this study indicate that natural social groupings of male cheetahs can be successfully replicated in captivity, which could potentially improve the chances of reproductive success when they are introduced to female cheetahs. © 2013 Wiley Periodicals, Inc.

[Karyological studies of two populations of Juniperus communis L. in west Siberia].

PubMed

Mikheeva, N A; Muratova, E N

2005-01-01

Results of a karyological study of Juniperus communis L. populations under swamp and dry conditions are presented. The chromosome number of J. communis are 2n = 22. Analysis of morphological chromosome parameters showed a similarity between karyotypes of both populations. It is possible to identify one pair of asymmetric chromosomes (VIII pair); this chromosome pair is close to submetacentric type. Three pairs of chromosomes (I, VII, VIII) have secondary constrictions. Other metacentric chromosomes form groups of five long (II--VI) and three short (IX-XI) pairs. Differences between two populations in absolute chromosomal length are observed.

Personalized Medicine in Veterans with Traumatic Brain Injuries

DTIC Science & Technology

2014-07-01

9 control cases are subjected to unsupervised hierarchical clustering analysis using the UPGMA algorithm with cosine correlation as the similarity...in unsu- pervised hierarchical clustering by the Un- weighted Pair-Group Method using Arithmetic averages ( UPGMA ) based on cosine correlation of row...of log2 trans- formed MAS5.0 signal values; probe set cluster- ing was performed by the UPGMA method using Cosine correlation as the similarity

Fluid-Dynamics of Underwater Flight in Sea Butterflies: Analysis using Tomographic PIV

NASA Astrophysics Data System (ADS)

Adhikari, D.; Murphy, D. W.; Webster, D. R.; Yen, J.

2014-11-01

Sea butterflies, Limacina helicina, swim in sea water with a pair of gelatinous ``wings'' (or parapodia). Their unique propulsion mechanism has been hypothesized to consist of a combination of drag-based propulsion (rowing) and lift-based propulsion (flapping). Drag-based propulsion utilizes maximum drag on the wings during power stroke, followed by minimum drag during recovery stroke. Lift-based propulsion, in contrast, utilizes a pressure difference between the top and bottom of the wings. We present the 3D kinematics of a free-swimming sea butterfly and its induced volumetric velocity field using tomographic PIV. Both upstroke and downstroke motions propel the animal (1 - 3 mm) upward in a sawtooth-like trajectory with average speed of 5 - 15 mm/s (Re = 5 - 45) and roll the calcareous shell forwards-and-backwards at 4 - 5 Hz. The rolling motion effectively positions the wings such that they stroke downward during both the power and recovery strokes, hence inducing upward motion during both phases. A clap-and-fling mechanism is observed at the beginning of the flapping cycle. As the wings come into contact, the velocity of the organism is 2 mm/s. During fling motion, high (unsteady) lift causes the organism velocity to reach 35 mm/s. Separation vortices are observed during the fling motion, and vortices with an opposite sense of rotation form closer to the base of the wing due to the upward translation of the organism. The separation vortices shed into the wake, as the organism translates upward, in the form of separate vortex pairs.

Multispectroscopic and Theoretical Exploration of the Comparative Binding Aspects of Bioflavonoid Fisetin with Triple- and Double-Helical Forms of RNA.

PubMed

Bhuiya, Sutanwi; Haque, Lucy; Goswami, Rapti; Das, Suman

2017-12-14

The interactions of RNA triplex (U.A*U) and duplex (A.U) with naturally occurring flavonoid fisetin (FTN) have been examined at pH 7.0 using various spectroscopic, viscometric, and theoretical studies. Experimental observations showed that the ligand binds with both double- and triple-helical forms of RNA, although the binding affinity is greater for the triplex structure (5.94 × 10 6 M -1 ) compared to that for the duplex counterpart (1.0 × 10 5 M -1 ). Thermal melting experiments revealed that the Hoogsteen base-paired third strand of triplex was stabilized to a greater extent (∼14 °C) compared with the Watson-Crick base-paired second strand (∼4 °C) in the presence of FTN. From fluorimetric study, we observed that U.A*U and A.U primarily bind to the photoproduced tautomer of FTN in the excited state. Steady-state and time-resolved anisotropy measurements illustrate considerable modulations of the spectroscopic properties of the tautomeric FTN within the RNA environment. Viscometric, fluorescence quenching, and thermal melting studies all together support the mode of binding to be intercalation. Theoretical study explains the experimental absorption and emission (dual fluorescence) behavior of FTN along with the excited-state intramolecular proton transfer process.

Determination of Actual Friction Factors in Metal Forming under Heavy Loaded Regimes Combining Experimental and Numerical Analysis.

PubMed

Camacho, Ana María; Veganzones, Mariano; Claver, Juan; Martín, Francisco; Sevilla, Lorenzo; Sebastián, Miguel Ángel

2016-09-01

Tribological conditions can change drastically during heavy loaded regimes as experienced in metal forming; this is especially critical when lubrication can only be applied at the early stage of the process because the homogeneous lubricant layer can break along the die-workpiece interface. In these cases, adopting a constant friction factor for the lubricant-surface pair may not be a valid assumption. This paper presents a procedure based on the use of dual friction factor maps to determine friction factors employed in heavy loaded regimes. A finite element (FE) simulation is used to obtain the friction factor map for the alloy UNS A96082. Experiments were conducted using four lubricants (aluminum anti-size, MoS₂ grease, silicone oil, and copper paste) to determine the actual friction curves. The experimental procedure is based on the application of lubricant only at the beginning of the first stage of ring compression, and not at intermediate stages as is usual in typical ring compression tests (RCTs). The results show that for small reductions ( r h < 20%), the conventional RCT can be applied because the tribological conditions remain similar. For large reductions ( r h > 20%), it is recommended to obtain an average value of the friction factor for every lubricant-surface pair in the range of deformation considered.

Determination of Actual Friction Factors in Metal Forming under Heavy Loaded Regimes Combining Experimental and Numerical Analysis

PubMed Central

Camacho, Ana María; Veganzones, Mariano; Claver, Juan; Martín, Francisco; Sevilla, Lorenzo; Sebastián, Miguel Ángel

2016-01-01

Tribological conditions can change drastically during heavy loaded regimes as experienced in metal forming; this is especially critical when lubrication can only be applied at the early stage of the process because the homogeneous lubricant layer can break along the die-workpiece interface. In these cases, adopting a constant friction factor for the lubricant-surface pair may not be a valid assumption. This paper presents a procedure based on the use of dual friction factor maps to determine friction factors employed in heavy loaded regimes. A finite element (FE) simulation is used to obtain the friction factor map for the alloy UNS A96082. Experiments were conducted using four lubricants (aluminum anti-size, MoS2 grease, silicone oil, and copper paste) to determine the actual friction curves. The experimental procedure is based on the application of lubricant only at the beginning of the first stage of ring compression, and not at intermediate stages as is usual in typical ring compression tests (RCTs). The results show that for small reductions (rh < 20%), the conventional RCT can be applied because the tribological conditions remain similar. For large reductions (rh > 20%), it is recommended to obtain an average value of the friction factor for every lubricant-surface pair in the range of deformation considered. PMID:28773868

An Empirical Comparison of Methods for Equating with Randomly Equivalent Groups of 50 to 400 Test Takers. Research Report. ETS RR-10-05

ERIC Educational Resources Information Center

Livingston, Samuel A.; Kim, Sooyeon

2010-01-01

A series of resampling studies investigated the accuracy of equating by four different methods in a random groups equating design with samples of 400, 200, 100, and 50 test takers taking each form. Six pairs of forms were constructed. Each pair was constructed by assigning items from an existing test taken by 9,000 or more test takers. The…

Cross-contact chain

NASA Technical Reports Server (NTRS)

Lieneweg, Udo (Inventor)

1988-01-01

A system is provided for use with wafers that include multiple integrated circuits that include two conductive layers in contact at multiple interfaces. Contact chains are formed beside the integrated circuits, each contact chain formed of the same two layers as the circuits, in the form of conductive segments alternating between the upper and lower layers and with the ends of the segments connected in series through interfaces. A current source passes a current through the series-connected segments, by way of a pair of current tabs connected to opposite ends of the series of segments. While the current flows, voltage measurements are taken between each of a plurality of pairs of voltage tabs, the two tabs of each pair connected to opposite ends of an interface that lies along the series-connected segments. A plot of interface conductances on a normal probability chart, enables prediction of the yield of good integrated circuits from the wafer.

Cross-contact chain

NASA Technical Reports Server (NTRS)

Lieneweg, U. (Inventor)

1986-01-01

A system is provided for use with wafers that include multiple integrated circuits that include two conductive layers in contact at multiple interfaces. Contact chains are formed beside the integrated circuits, each contact chain formed of the same two layers as the circuits, in the form of conductive segments alternating between the upper and lower layers and with the ends of the segments connected in series through interfaces. A current source passes a current through the series-connected segments, by way of a pair of current tabs connected to opposite ends of the series of segments. While the current flows, voltage measurements are taken between each of a plurality of pairs of voltage tabs, the two tabs of each pair connected to opposite ends of an interface that lies along the series-connected segments. A plot of interface conductances on normal probability chart enables prediction of the yield of good integrated circuits from the wafer.

Cation specific binding with protein surface charges

PubMed Central

Hess, Berk; van der Vegt, Nico F. A.

2009-01-01

Biological organization depends on a sensitive balance of noncovalent interactions, in particular also those involving interactions between ions. Ion-pairing is qualitatively described by the law of “matching water affinities.” This law predicts that cations and anions (with equal valence) form stable contact ion pairs if their sizes match. We show that this simple physical model fails to describe the interaction of cations with (molecular) anions of weak carboxylic acids, which are present on the surfaces of many intra- and extracellular proteins. We performed molecular simulations with quantitatively accurate models and observed that the order K+ < Na+ < Li+ of increasing binding affinity with carboxylate ions is caused by a stronger preference for forming weak solvent-shared ion pairs. The relative insignificance of contact pair interactions with protein surfaces indicates that thermodynamic stability and interactions between proteins in alkali salt solutions is governed by interactions mediated through hydration water molecules. PMID:19666545

Rotational-translational fourier imaging system

NASA Technical Reports Server (NTRS)

Campbell, Jonathan W. (Inventor)

2004-01-01

This invention has the ability to create Fourier-based images with only two grid pairs. The two grid pairs are manipulated in a manner that allows (1) a first grid pair to provide multiple real components of the Fourier-based image and (2) a second grid pair to provide multiple imaginary components of the Fourier-based image. The novelty of this invention resides in the use of only two grid pairs to provide the same imaging information that has been traditionally collected with multiple grid pairs.

Interacting star clusters in the Large Magellanic Cloud. Overmerging problem solved by cluster group formation

NASA Astrophysics Data System (ADS)

Leon, Stéphane; Bergond, Gilles; Vallenari, Antonella

1999-04-01

We present the tidal tail distributions of a sample of candidate binary clusters located in the bar of the Large Magellanic Cloud (LMC). One isolated cluster, SL 268, is presented in order to study the effect of the LMC tidal field. All the candidate binary clusters show tidal tails, confirming that the pairs are formed by physically linked objects. The stellar mass in the tails covers a large range, from 1.8x 10(3) to 3x 10(4) \\msun. We derive a total mass estimate for SL 268 and SL 356. At large radii, the projected density profiles of SL 268 and SL 356 fall off as r(-gamma ) , with gamma = 2.27 and gamma =3.44, respectively. Out of 4 pairs or multiple systems, 2 are older than the theoretical survival time of binary clusters (going from a few 10(6) years to 10(8) years). A pair shows too large age difference between the components to be consistent with classical theoretical models of binary cluster formation (Fujimoto & Kumai \\cite{fujimoto97}). We refer to this as the ``overmerging'' problem. A different scenario is proposed: the formation proceeds in large molecular complexes giving birth to groups of clusters over a few 10(7) years. In these groups the expected cluster encounter rate is larger, and tidal capture has higher probability. Cluster pairs are not born together through the splitting of the parent cloud, but formed later by tidal capture. For 3 pairs, we tentatively identify the star cluster group (SCG) memberships. The SCG formation, through the recent cluster starburst triggered by the LMC-SMC encounter, in contrast with the quiescent open cluster formation in the Milky Way can be an explanation to the paucity of binary clusters observed in our Galaxy. Based on observations collected at the European Southern Observatory, La Silla, Chile}

Thermodynamic stability of Hoogsteen and Watson-Crick base pairs in the presence of histone H3-mimicking peptide.

PubMed

Pramanik, Smritimoy; Nakamura, Kaori; Usui, Kenji; Nakano, Shu-ichi; Saxena, Sarika; Matsui, Jun; Miyoshi, Daisuke; Sugimoto, Naoki

2011-03-14

We found that Hoogsteen base pairs were stabilized by molecular crowding and a histone H3-mimicking peptide, which was not observed for Watson-Crick base pairs. Our findings demonstrate that the type of DNA base pair is critical for the interaction between DNA and histones.

Evaluative stimulus (in)congruency impacts performance in an unrelated task: evidence for a resource-based account of evaluative priming.

PubMed

Gast, Anne; Werner, Benedikt; Heitmann, Christina; Spruyt, Adriaan; Rothermund, Klaus

2014-01-01

In two experiments, we assessed evaluative priming effects in a task that was unrelated to the congruent or incongruent stimulus pairs. In each trial, participants saw two valent (positive or negative) pictures that formed evaluatively congruent or incongruent stimulus pairs and a letter that was superimposed on the second picture. Different from typical evaluative priming studies, participants were not required to respond to the second of the valent stimuli, but asked to categorize the letter that was superimposed on the second picture. We assessed the impact of the evaluative (in)congruency of the two pictures on the performance in responding to the letter. In addition, we manipulated attention to the evaluative dimension by asking participants in one experimental group to respond to the valence of the pictures on a subset of trials (evaluative task condition). In both experiments, we found evaluative priming effects in letter categorization responses: Participants categorized the letter faster (and sometimes more correctly) in trials with congruent picture-pairs. These effects were present only in the evaluative task condition. These findings can be explained with different resource-based accounts of evaluative priming and the additional assumption that attention to valence is necessary for evaluative congruency to affect processing resources. According to resource-based accounts valence-incongruent trials require more cognitive resources than valence-congruent trials (e.g., Hermans, Van den Broeck, & Eelen, 1998).

Thermodynamic properties of water molecules in the presence of cosolute depend on DNA structure: a study using grid inhomogeneous solvation theory.

PubMed

Nakano, Miki; Tateishi-Karimata, Hisae; Tanaka, Shigenori; Tama, Florence; Miyashita, Osamu; Nakano, Shu-Ichi; Sugimoto, Naoki

2015-12-02

In conditions that mimic those of the living cell, where various biomolecules and other components are present, DNA strands can adopt many structures in addition to the canonical B-form duplex. Previous studies in the presence of cosolutes that induce molecular crowding showed that thermal stabilities of DNA structures are associated with the properties of the water molecules around the DNAs. To understand how cosolutes, such as ethylene glycol, affect the thermal stability of DNA structures, we investigated the thermodynamic properties of water molecules around a hairpin duplex and a G-quadruplex using grid inhomogeneous solvation theory (GIST) with or without cosolutes. Our analysis indicated that (i) cosolutes increased the free energy of water molecules around DNA by disrupting water-water interactions, (ii) ethylene glycol more effectively disrupted water-water interactions around Watson-Crick base pairs than those around G-quartets or non-paired bases, (iii) due to the negative electrostatic potential there was a thicker hydration shell around G-quartets than around Watson-Crick-paired bases. Our findings suggest that the thermal stability of the hydration shell around DNAs is one factor that affects the thermal stabilities of DNA structures under the crowding conditions. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Twofold spin-triplet pairing states and tunneling conductance in ferromagnet/ferromagnet/iron pnictide superconductor heterojunctions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yang, X.; Tao, Y.C., E-mail: yctao88@163.com; Dong, Z.C.

By applying an extended eight-component Bogoliubov–de Gennes equation, we study theoretically the tunneling conductance in clean ferromagnet/ferromagnet/iron pnictide superconductor (FM/FM/iron-based SC) heterojunctions. Under the condition of noncollinear magnetizations, twofold novel Andreev reflections exist due to the existence of two bands in the SC, in which the incident electron and the two Andreev-reflected holes, belonging to the same spin subband, form twofold spin-triplet pairing states near the FM/iron-based SC interface. It is shown that the conversions of the conductance not only between the zero-bias peak and valley at zero energy but also between the peaks and dips at two gap energiesmore » are strongly dependent on both the interband coupling strength in the SC and the spin polarization in the FM. The qualitative differences from tunneling into a conventional s-wave SC are also presented, which may help with experimentally probing and identifying the antiphase s-wave pairing symmetry in the iron-based SC. -- Highlights: •An eight-component Bogoliubov–de Gennes (BDG) equation. •Twofold novel ARs and twofold usual ARs. •Conversions of conductance between the zero-bias peak and valley at zero energy. •Conversions of conductance between peaks and dips at two gap energies. •The importance of the interband coupling strength in the SC.« less

A water market simulator considering pair-wise trades between agents

NASA Astrophysics Data System (ADS)

Huskova, I.; Erfani, T.; Harou, J. J.

2012-04-01

In many basins in England no further water abstraction licences are available. Trading water between water rights holders has been recognized as a potentially effective and economically efficient strategy to mitigate increasing scarcity. A screening tool that could assess the potential for trade through realistic simulation of individual water rights holders would help assess the solution's potential contribution to local water management. We propose an optimisation-driven water market simulator that predicts pair-wise trade in a catchment and represents its interaction with natural hydrology and engineered infrastructure. A model is used to emulate licence-holders' willingness to engage in short-term trade transactions. In their simplest form agents are represented using an economic benefit function. The working hypothesis is that trading behaviour can be partially predicted based on differences in marginal values of water over space and time and estimates of transaction costs on pair-wise trades. We discuss the further possibility of embedding rules, norms and preferences of the different water user sectors to more realistically represent the behaviours, motives and constraints of individual licence holders. The potential benefits and limitations of such a social simulation (agent-based) approach is contrasted with our simulator where agents are driven by economic optimization. A case study based on the Dove River Basin (UK) demonstrates model inputs and outputs. The ability of the model to suggest impacts of water rights policy reforms on trading is discussed.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Straatman, Caroline M. S.; Labbé, Ivo; Van Houdt, Josha

The FourStar galaxy evolution survey (ZFOURGE) is a 45 night legacy program with the FourStar near-infrared camera on Magellan and one of the most sensitive surveys to date. ZFOURGE covers a total of 400 arcmin{sup 2} in cosmic fields CDFS, COSMOS and UDS, overlapping CANDELS. We present photometric catalogs comprising >70,000 galaxies, selected from ultradeep K {sub s} -band detection images (25.5–26.5 AB mag, 5 σ , total), and >80% complete to K {sub s} < 25.3–25.9 AB. We use 5 near-IR medium-bandwidth filters ( J {sub 1}, J {sub 2}, J {sub 3}, H {sub s} , H {submore » l} ) as well as broad-band K {sub s} at 1.05–2.16 μ m to 25–26 AB at a seeing of ∼0.″5. Each field has ancillary imaging in 26–40 filters at 0.3–8 μ m. We derive photometric redshifts and stellar population properties. Comparing with spectroscopic redshifts indicates a photometric redshift uncertainty σ {sub z} = 0.010, 0.009, and 0.011 in CDFS, COSMOS, and UDS. As spectroscopic samples are often biased toward bright and blue sources, we also inspect the photometric redshift differences between close pairs of galaxies, finding σ {sub z} {sub ,pairs} = 0.01–0.02 at 1 < z < 2.5. We quantify how σ {sub z} {sub ,pairs} depends on redshift, magnitude, spectral energy distribution type, and the inclusion of FourStar medium bands. σ {sub z} {sub ,pairs} is smallest for bright, blue star-forming samples, while red star-forming galaxies have the worst σ {sub z} {sub ,pairs}. Including FourStar medium bands reduces σ {sub z} {sub ,pairs} by 50% at 1.5 < z < 2.5. We calculate star formation rates (SFRs) based on ultraviolet and ultradeep far-IR Spitzer /MIPS and Herschel /PACS data. We derive rest-frame U − V and V − J colors, and illustrate how these correlate with specific SFR and dust emission to z = 3.5. We confirm the existence of quiescent galaxies at z ∼ 3, demonstrating their SFRs are suppressed by > ×15.« less

KIC 4150611: a rare multi-eclipsing quintuple with a hybrid pulsator

NASA Astrophysics Data System (ADS)

Hełminiak, K. G.; Ukita, N.; Kambe, E.; Kozłowski, S. K.; Pawłaszek, R.; Maehara, H.; Baranec, C.; Konacki, M.

2017-06-01

Aims: We aim to analyse KIC 4150611 (HD 181469) - an interesting, bright quintuple system that includes a hybrid δ Sct/γ Dor pulsator. Four periods of eclipses - 94.2, 8.65, 1.52 and 1.43 d - have been observed by the Kepler satellite, and three point sources (A, B, and C) are seen in high angular resolution images. Methods: From spectroscopic observations made with the HIDES spectrograph attached to the 1.88-m telescope of the Okayama Astrophysical Observatory (OAO), we have calculated for the first time radial velocities (RVs) of the component B - a pair of G-type stars - and combined them with Kepler photometry in order to obtain absolute physical parameters of this pair. We also managed to directly measure RVs of the pulsator, for the first time. Additionally, we modelled the light curves of the 1.52 and 1.43-day pairs, and measured their eclipse timing variations (ETVs). We also performed relative astrometry and photometry of three sources seen on the images taken with the NIRC2 camera of the Keck II telescope. Finally, we compared our results with theoretical isochrones. Results: The brightest component Aa is the hybrid pulsator, transited every 94.2 days by a pair of K/M-type stars (Ab1+Ab2), which themselves form a 1.52-day eclipsing binary. The components Ba and Bb are late G-type stars, forming another eclipsing pair with a 8.65 day period. Their masses and radii are MBa = 0.894 ± 0.010 M⊙, RBa = 0.802 ± 0.044 R⊙ for the primary, and MBb = 0.888 ± 0.010 M⊙, RBb = 0.856 ± 0.038 R⊙ for the secondary. The remaining period of 1.43 days is possibly related to a faint third star C, which itself is most likely a background object. The system's properties are well-represented by a 35 Myr isochrone, basing on which the masses of the pulsator and the 1.52-day pair are MAa = 1.64(6) M⊙, and MAb,tot = 0.90(13) M⊙, respectively. There are also suggestions of additional bodies in the system.

Innexin-3 forms connexin-like intercellular channels.

PubMed

Landesman, Y; White, T W; Starich, T A; Shaw, J E; Goodenough, D A; Paul, D L

1999-07-01

Innexins comprise a large family of genes that are believed to encode invertebrate gap junction channel-forming proteins. However, only two Drosophila innexins have been directly tested for the ability to form intercellular channels and only one of those was active. Here we tested the ability of Caenorhabditis elegans family members INX-3 and EAT-5 to form intercellular channels between paired Xenopus oocytes. We show that expression of INX-3 but not EAT-5, induces electrical coupling between the oocyte pairs. In addition, analysis of INX-3 voltage and pH gating reveals a striking degree of conservation in the functional properties of connexin and innnexin channels. These data strongly support the idea that innexin genes encode intercellular channels.

Lewis pair polymerization by classical and frustrated Lewis pairs: acid, base and monomer scope and polymerization mechanism.

PubMed

Zhang, Yuetao; Miyake, Garret M; John, Mallory G; Falivene, Laura; Caporaso, Lucia; Cavallo, Luigi; Chen, Eugene Y-X

2012-08-14

Classical and frustrated Lewis pairs (LPs) of the strong Lewis acid (LA) Al(C(6)F(5))(3) with several Lewis base (LB) classes have been found to exhibit exceptional activity in the Lewis pair polymerization (LPP) of conjugated polar alkenes such as methyl methacrylate (MMA) as well as renewable α-methylene-γ-butyrolactone (MBL) and γ-methyl-α-methylene-γ-butyrolactone (γ-MMBL), leading to high molecular weight polymers, often with narrow molecular weight distributions. This study has investigated a large number of LPs, consisting of 11 LAs as well as 10 achiral and 4 chiral LBs, for LPP of 12 monomers of several different types. Although some more common LAs can also be utilized for LPP, Al(C(6)F(5))(3)-based LPs are far more active and effective than other LA-based LPs. On the other hand, several classes of LBs, when paired with Al(C(6)F(5))(3), can render highly active and effective LPP of MMA and γ-MMBL; such LBs include phosphines (e.g., P(t)Bu(3)), chiral chelating diphosphines, N-heterocyclic carbenes (NHCs), and phosphazene superbases (e.g., P(4)-(t)Bu). The P(4)-(t)Bu/Al(C(6)F(5))(3) pair exhibits the highest activity of the LP series, with a remarkably high turn-over frequency of 9.6 × 10(4) h(-1) (0.125 mol% catalyst, 100% MMA conversion in 30 s, M(n) = 2.12 × 10(5) g mol(-1), PDI = 1.34). The polymers produced by LPs at RT are typically atactic (P(γ)MMBL with ∼47% mr) or syndio-rich (PMMA with ∼70-75% rr), but highly syndiotactic PMMA with rr ∼91% can be produced by chiral or achiral LPs at -78 °C. Mechanistic studies have identified and structurally characterized zwitterionic phosphonium and imidazolium enolaluminates as the active species of the current LPP system, which are formed by the reaction of the monomer·Al(C(6)F(5))(3) adduct with P(t)Bu(3) and NHC bases, respectively. Kinetic studies have revealed that the MMA polymerization by the (t)Bu(3)P/Al(C(6)F(5))(3) pair is zero-order in monomer concentration after an initial induction period, and the polymerization is significantly catalyzed by the LA, thus pointing to a bimetallic, activated monomer propagation mechanism. Computational study on the active species formation as well as the chain initiation and propagation events involved in the LPP of MMA with some of the most representative LPs has added our understanding of fundamental steps of LPP. The main difference between NHC and PR(3) bases is in the energetics of zwitterion formation, with the NHC-based zwitterions being remarkably more stable than the PR(3)-based zwitterions. Comparison of the monometallic and bimetallic mechanisms for MMA addition shows a clear preference for the bimetallic mechanism.

Morphological and molecular genetic diversity of Strongyluris calotis (Nematoda: Ascaridida: Heterakidae) in South East and East Asian lizards.

PubMed

Tran, Binh Thi; Ong, An Vinh; Luc, Pham Van; Sato, Hiroshi

2016-07-01

Strongyluris calotis is a heterakid nematode in the large intestine of agamid lizards (Reptilia: Sauria: Agamidae) from the Oriental Region. The standard light microscopic definition of the species counts the "caudal papillae" as 10 pairs on male worms. However, previous work from our group using scanning electron microscopy (SEM) on the heterakid from agamid lizards in Japan, Taiwan, and Singapore revealed that this counting contained a pair of phasmids and that two pairs of postcloacal papillae were completely fused to form a pair of united papillae, thus resulting in "10 pairs." In the present study, we examined S. calotis specimens from the Emma Gray's forest lizard, Calotes emma (Agamidae), living in the plain forest at low altitude, and the Vietnam false bloodsucker, Pseudocalotes brevipes (Agamidae), living in the mountainous forest at high altitude in the northern part of Vietnam. Using SEM, the arrangement of caudal papillae in male worms from an Emma Gray's forest lizard was found to be comparable to classical S. calotis specimens from agamid lizards collected in Japan, Taiwan, and Singapore. However, male worms from Vietnam false bloodsuckers did not have a pair of united papillae but had 10 pairs of independent caudal papillae with a pair of phasmids. Molecular genetic analyses of the ribosomal RNA gene (rDNA) of worms of the classical S. calotis morphotype from Japan and Singapore and two S. calotis morphotypes from Vietnam demonstrated absolutely identical nucleotide sequences of partial 18S rDNA (at least 1764 base pairs (bp)) and 5.8S rDNA (158 bp). However, intraspecific differences were detected in other regions of the rDNA, related to the geographical distribution of hosts regardless of morphotype: 97.8-98.5 % identity (443-446 bp/453 bp) in the internal transcribed spacer (ITS)-1 region, 96.6-98.0 % identity (425-431 bp/440 bp) in the ITS-2 region, and 99.6-99.7 % identity (1149-1151 bp/1154 bp) in the 28S rDNA. Thus, in the future, taxonomic relationships of S. calotis distributed widely in the Oriental Region as well as other nominal Oriental Strongyluris spp., currently six in number, need to be extensively explored based on molecular genetic analyses in addition to intensive morphological characterization.

Synthesis and binding properties of new selective ligands for the nucleobase opposite the AP site.

PubMed

Abe, Yukiko; Nakagawa, Osamu; Yamaguchi, Rie; Sasaki, Shigeki

2012-06-01

DNA is continuously damaged by endogenous and exogenous factors such as oxidative stress or DNA alkylating agents. These damaged nucleobases are removed by DNA N-glycosylase and form apurinic/apyrimidinic sites (AP sites) as intermediates in the base excision repair (BER) pathway. AP sites are also representative DNA damages formed by spontaneous hydrolysis. The AP sites block DNA polymerase and a mismatch nucleobase is inserted opposite the AP sites by polymerization to cause acute toxicities and mutations. Thus, AP site specific compounds have attracted much attention for therapeutic and diagnostic purposes. In this study, we have developed nucleobase-polyamine conjugates as the AP site binding ligand by expecting that the nucleobase part would play a role in the specific recognition of the nucleobase opposite the AP site by the Watson-Crick base pair formation and that the polyamine part should contribute to the access of the ligand to the AP site by a non-specific interaction to the DNA phosphate backbone. The nucleobase conjugated with 3,3'-diaminodipropylamine (A-ligand, G-ligand, C-ligand, T-ligand and U-ligand) showed a specific stabilization of the duplex containing the AP site depending on the complementary combination with the nucleobase opposite the AP site; that is A-ligand to T, G-ligand to C, C-ligand to G, T- and U-ligand to A. The thermodynamic binding parameters clearly indicated that the specific stabilization is due to specific binding of the ligands to the complementary AP site. These results have suggested that the complementary base pairs of the Watson-Crick type are formed at the AP site. Copyright © 2012 Elsevier Ltd. All rights reserved.

Kinetic mechanism and fidelity of nick sealing by Escherichia coli NAD+-dependent DNA ligase (LigA)

PubMed Central

Chauleau, Mathieu; Shuman, Stewart

2016-01-01

Escherichia coli DNA ligase (EcoLigA) repairs 3′-OH/5′-PO4 nicks in duplex DNA via reaction of LigA with NAD+ to form a covalent LigA-(lysyl-Nζ)–AMP intermediate (step 1); transfer of AMP to the nick 5′-PO4 to form an AppDNA intermediate (step 2); and attack of the nick 3′-OH on AppDNA to form a 3′-5′ phosphodiester (step 3). A distinctive feature of EcoLigA is its stimulation by ammonium ion. Here we used rapid mix-quench methods to analyze the kinetic mechanism of single-turnover nick sealing by EcoLigA–AMP. For substrates with correctly base-paired 3′-OH/5′-PO4 nicks, kstep2 was fast (6.8–27 s−1) and similar to kstep3 (8.3–42 s−1). Absent ammonium, kstep2 and kstep3 were 48-fold and 16-fold slower, respectively. EcoLigA was exquisitely sensitive to 3′-OH base mispairs and 3′ N:abasic lesions, which elicited 1000- to >20000-fold decrements in kstep2. The exception was the non-canonical 3′ A:oxoG configuration, which EcoLigA accepted as correctly paired for rapid sealing. These results underscore: (i) how EcoLigA requires proper positioning of the nick 3′ nucleoside for catalysis of 5′ adenylylation; and (ii) EcoLigA's potential to embed mutations during the repair of oxidative damage. EcoLigA was relatively tolerant of 5′-phosphate base mispairs and 5′ N:abasic lesions. PMID:26857547

Transition-state destabilization reveals how human DNA polymerase β proceeds across the chemically unstable lesion N7-methylguanine

PubMed Central

Ouzon-Shubeita, Hala; Lee, Seongmin

2014-01-01

N7-Methyl-2′-deoxyguanosine (m7dG) is the predominant lesion formed by methylating agents. A systematic investigation on the effect of m7dG on DNA replication has been difficult due to the chemical instability of m7dG. To gain insights into the m7dG effect, we employed a 2′-fluorine-mediated transition-state destabilzation strategy. Specifically, we determined kinetic parameters for dCTP insertion opposite a chemically stable m7dG analogue, 2′-fluoro-m7dG (Fm7dG), by human DNA polymerase β (polβ) and solved three X-ray structures of polβ in complex with the templating Fm7dG paired with incoming dCTP or dTTP analogues. The kinetic studies reveal that the templating Fm7dG slows polβ catalysis ∼300-fold, suggesting that m7dG in genomic DNA may impede replication by some DNA polymerases. The structural analysis reveals that Fm7dG forms a canonical Watson–Crick base pair with dCTP, but metal ion coordination is suboptimal for catalysis in the polβ-Fm7dG:dCTP complex, which partially explains the slow insertion of dCTP opposite Fm7dG by polβ. In addition, the polβ-Fm7dG:dTTP structure shows open protein conformations and staggered base pair conformations, indicating that N7-methylation of dG does not promote a promutagenic replication. Overall, the first systematic studies on the effect of m7dG on DNA replication reveal that polβ catalysis across m7dG is slow, yet highly accurate. PMID:24966350

A small modified hammerhead ribozyme and its conformational characteristics determined by mutagenesis and lattice calculation.

PubMed Central

Lustig, B; Lin, N H; Smith, S M; Jernigan, R L; Jeang, K T

1995-01-01

A prototypic hammerhead ribozyme has three helices that surround an asymmetrical central core loop. We have mutagenized a hammerhead type ribozyme. In agreement with previous studies, progressive removal of stem-loop II from a three stemmed ribozyme showed that this region is not absolutely critical for catalysis. However, complete elimination of stem II and its loop did reduce, but did not eliminate, function. In a stem-loop II-deleted ribozyme, activity was best preserved when a purine, preferably a G, was present at position 10.1. This G contributed to catalysis irregardless of its role as either one part of a canonical pair with a C residue at 11.1 or a lone nucleotide with C (11.1) deleted. Computational methods using lattices generated 87 million three-dimensional chain forms for a stem-loop II-deleted RNA complex that preserved one potential G.C base pair at positions 10.1 and 11.1. This exhaustive set of chain forms included one major class of structures with G(10.1) being spatially proximal to the GUCX cleavage site of the substrate strand. Strong correlations were observed between colinear arrangement of stems I and III, constraints of base-pairing in the central core loop, and one particular placement of G(10.1) relative to the cleavage site. Our calculations of a stem-loop II-deleted ribozyme indicate that without needing to invoke any other constraints, the inherent asymmetry in the lengths of the two loop strands (3 nt in one and 7 nt in the other) that compose the core and flank G10.1-C11.1 stipulated strongly this particular G placement. This suggests that the hammerhead ribozyme maintains an asymmetry in its internal loop for a necessary structure/function reason. Images PMID:7567466

Efficient Implementation of the Pairing on Mobilephones Using BREW

NASA Astrophysics Data System (ADS)

Yoshitomi, Motoi; Takagi, Tsuyoshi; Kiyomoto, Shinsaku; Tanaka, Toshiaki

Pairing based cryptosystems can accomplish novel security applications such as ID-based cryptosystems, which have not been constructed efficiently without the pairing. The processing speed of the pairing based cryptosystems is relatively slow compared with the other conventional public key cryptosystems. However, several efficient algorithms for computing the pairing have been proposed, namely Duursma-Lee algorithm and its variant ηT pairing. In this paper, we present an efficient implementation of the pairing over some mobilephones. Moreover, we compare the processing speed of the pairing with that of the other standard public key cryptosystems, i. e. RSA cryptosystem and elliptic curve cryptosystem. Indeed the processing speed of our implementation in ARM9 processors on BREW achieves under 100 milliseconds using the supersingular curve over F397. In addition, the pairing is more efficient than the other public key cryptosystems, and the pairing can be achieved enough also on BREW mobilephones. It has become efficient enough to implement security applications, such as short signature, ID-based cryptosystems or broadcast encryption, using the pairing on BREW mobilephones.

Recursive Directional Ligation Approach for Cloning Recombinant Spider Silks.

PubMed

Dinjaski, Nina; Huang, Wenwen; Kaplan, David L

2018-01-01

Recent advances in genetic engineering have provided a route to produce various types of recombinant spider silks. Different cloning strategies have been applied to achieve this goal (e.g., concatemerization, step-by-step ligation, recursive directional ligation). Here we describe recursive directional ligation as an approach that allows for facile modularity and control over the size of the genetic cassettes. This approach is based on sequential ligation of genetic cassettes (monomers) where the junctions between them are formed without interrupting key gene sequences with additional base pairs.

An ensemble of SVM classifiers based on gene pairs.

PubMed

Tong, Muchenxuan; Liu, Kun-Hong; Xu, Chungui; Ju, Wenbin

2013-07-01

In this paper, a genetic algorithm (GA) based ensemble support vector machine (SVM) classifier built on gene pairs (GA-ESP) is proposed. The SVMs (base classifiers of the ensemble system) are trained on different informative gene pairs. These gene pairs are selected by the top scoring pair (TSP) criterion. Each of these pairs projects the original microarray expression onto a 2-D space. Extensive permutation of gene pairs may reveal more useful information and potentially lead to an ensemble classifier with satisfactory accuracy and interpretability. GA is further applied to select an optimized combination of base classifiers. The effectiveness of the GA-ESP classifier is evaluated on both binary-class and multi-class datasets. Copyright © 2013 Elsevier Ltd. All rights reserved.

Amino acid fermentation at the origin of the genetic code.

PubMed

de Vladar, Harold P

2012-02-10

There is evidence that the genetic code was established prior to the existence of proteins, when metabolism was powered by ribozymes. Also, early proto-organisms had to rely on simple anaerobic bioenergetic processes. In this work I propose that amino acid fermentation powered metabolism in the RNA world, and that this was facilitated by proto-adapters, the precursors of the tRNAs. Amino acids were used as carbon sources rather than as catalytic or structural elements. In modern bacteria, amino acid fermentation is known as the Stickland reaction. This pathway involves two amino acids: the first undergoes oxidative deamination, and the second acts as an electron acceptor through reductive deamination. This redox reaction results in two keto acids that are employed to synthesise ATP via substrate-level phosphorylation. The Stickland reaction is the basic bioenergetic pathway of some bacteria of the genus Clostridium. Two other facts support Stickland fermentation in the RNA world. First, several Stickland amino acid pairs are synthesised in abiotic amino acid synthesis. This suggests that amino acids that could be used as an energy substrate were freely available. Second, anticodons that have complementary sequences often correspond to amino acids that form Stickland pairs. The main hypothesis of this paper is that pairs of complementary proto-adapters were assigned to Stickland amino acids pairs. There are signatures of this hypothesis in the genetic code. Furthermore, it is argued that the proto-adapters formed double strands that brought amino acid pairs into proximity to facilitate their mutual redox reaction, structurally constraining the anticodon pairs that are assigned to these amino acid pairs. Significance tests which randomise the code are performed to study the extent of the variability of the energetic (ATP) yield. Random assignments can lead to a substantial yield of ATP and maintain enough variability, thus selection can act and refine the assignments into a proto-code that optimises the energetic yield. Monte Carlo simulations are performed to evaluate the establishment of these simple proto-codes, based on amino acid substitutions and codon swapping. In all cases, donor amino acids are assigned to anticodons composed of U+G, and have low redundancy (1-2 codons), whereas acceptor amino acids are assigned to the the remaining codons. These bioenergetic and structural constraints allow for a metabolic role for amino acids before their co-option as catalyst cofactors.

Envisaging quantum transport phenomenon in a muddled base pair of DNA

NASA Astrophysics Data System (ADS)

Vohra, Rajan; Sawhney, Ravinder Singh

2018-05-01

The effect of muddled base pair on electron transfer through a deoxyribonucleic acid (DNA) molecule connected to the gold electrodes has been elucidated using tight binding model. The effect of hydrogen and nitrogen bonds on the resistance of the base pair has been minutely observed. Using the semiempirical extended Huckel approach within NEGF regime, we have determined the current and conductance vs. bias voltage for disordered base pairs of DNA made of thymine (T) and adenine (A). The asymmetrical behaviour amid five times depreciation in the current characteristics has been observed for deviated Au-AT base pair-Au devices. An interesting revelation is that the conductance of the intrinsic AT base pair configuration attains dramatically high values with the symmetrical zig-zag pattern of current, which clearly indicates the transformation of the bond length within the strands of base pair when compared with other samples. A thorough investigation of the transmission coefficients T( E) and HOMO-LUMO gap reveals the misalignment of the strands in base pairs of DNA. The observed results present an insight to extend this work to build biosensing devices to predict the abnormality with the DNA.

Higher order structural effects stabilizing the reverse Watson–Crick Guanine-Cytosine base pair in functional RNAs

PubMed Central

Chawla, Mohit; Abdel-Azeim, Safwat; Oliva, Romina; Cavallo, Luigi

2014-01-01

The G:C reverse Watson–Crick (W:W trans) base pair, also known as Levitt base pair in the context of tRNAs, is a structurally and functionally important base pair that contributes to tertiary interactions joining distant domains in functional RNA molecules and also participates in metabolite binding in riboswitches. We previously indicated that the isolated G:C W:W trans base pair is a rather unstable geometry, and that dicationic metal binding to the Guanine base or posttranscriptional modification of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G:C trans base pairs. Interestingly, 66% of the G:C trans base pairs in the PDB are engaged in additional H-bonding interactions with other bases, the RNA backbone or structured water molecules. High level quantum mechanical calculations on a data set of representative crystal structures were performed to shed light on the structural stability and energetics of the various crystallographic motifs. This analysis was extended to the binding of the preQ1 metabolite to a preQ1-II riboswitch. PMID:24121683

Conformation of the Phosphate D-alanine Zwitterion in Bacterial Teichoic Acid from Nuclear Magnetic Resonance Spectroscopy

PubMed Central

Garimella, Ravindranath; Halye, Jeffrey L.; Harrison, William; Klebba, Phillip E.; Rice, Charles V.

2009-01-01

The conformation of D-alanine (D-Ala) groups of bacterial teichoic acid is a central, yet untested, paradigm of microbiology. The D-Ala binds via the C-terminus, thereby allowing the amine to exist as a free cationic NH3+ group with the ability to form a contact-ion-pair with the nearby anionic phosphate group. This conformation hinders metal chelation by the phosphate because the zwitterion pair is charge neutral. To the contrary, the repulsion of cationic antimicrobial peptides (CAMPs) is attributed to the presence of the D-Ala cation; thus the ion-pair does not form in this model. Solid-state nuclear magnetic resonance (NMR) spectroscopy has been used to measure the distance between amine and phosphate groups within cell wall fragments of Bacillus subtilis. The bacteria were grown on media containing 15N D-Ala and β-chloroalanine racemase inhibitor. The rotational-echo double-resonance (REDOR) pulse sequence was used to measure the internuclear dipolar coupling and the results demonstrate: 1) the metal-free amine-to-phosphate distance is 4.4 Å and 2) the amine-to-phosphate distance increases to 5.4 Å in the presence of Mg2+ ions. As a result, the zwitterion exists in a nitrogen-oxygen ion-pair configuration providing teichoic acid with a positive charge to repel CAMPs. Additionally, the amine of D-Ala does not prevent magnesium chelation in contradiction to the prevailing view of teichoic acids in metal binding. Thus, the NMR-based description of teichoic acid structure resolves the contradictory models, advances the basic understanding of cell wall biochemistry, and provides possible insight into the creation of new antibiotic therapies. PMID:19746945

MOLECULAR VACUUM PUMP

DOEpatents

Eckberg, E.E.

1960-09-27

A multiple molecular vacuum pump capable of producing a vacuum of the order of 10/sup -9/ mm Hg is described. The pump comprises a casing of an aggregate of paired and matched cylindrical plates, a recessed portion on one face of each plate concentrically positioned formed by a radially extending wall and matching the similarly recessed portion of its twin plate of that pair of plates and for all paired and matched plates; a plurality of grooves formed in the radially extending walls of each and all recesses progressing in a spiral manner from their respective starting points out at the periphery of the recess inwardly to the central area; a plurality of rotors rotatably mounted to closely occupy the spaces as presented by the paired and matched recesses between all paired plates; a hollowed drive-shaft perforated at points adjacent to the termini of all spiral grooves; inlet ports at the starting points of all grooves and through all plates at common points to each respectively; and a common outlet passage presented by the hollow portion of the perforated hollowed drive-shaft of the molecular pump. (AEC)

Odd-frequency superconductivity induced in topological insulators with and without hexagonal warping.

PubMed

Vasenko, A S; Golubov, A A; Silkin, V M; Chulkov, E V

2017-07-26

We study the effect of the Fermi surface anisotropy on the odd-frequency spin-triplet pairing component of the induced pair potential. We consider a superconductor/ ferromagnetic insulator (S/FI) hybrid structure formed on the 3D topological insulator (TI) surface. In this case three ingredients ensure the possibility of the odd-frequency pairing: (1) the topological surface states, (2) the induced pair potential, and (3) the magnetic moment of a nearby ferromagnetic insulator. We take into account the strong anisotropy of the Dirac point in topological insulators when the chemical potential lies well above the Dirac cone and its constant energy contour has a snowflake shape. Within this model, we propose that the S/FI boundary should be properly aligned with respect to the snowflake constant energy contour to have an odd-frequency symmetry of the corresponding pairing component and to insure the Majorana bound state at the S/FI boundary. For arbitrary orientation of the boundary, the Majorana bound state is absent. This provides a selection rule to the realization of Majorana modes in S/FI hybrid structures, formed on the topological insulator surface.

Molecular switching behavior in isosteric DNA base pairs.

PubMed

Jissy, A K; Konar, Sukanya; Datta, Ayan

2013-04-15

The structures and proton-coupled behavior of adenine-thymine (A-T) and a modified base pair containing a thymine isostere, adenine-difluorotoluene (A-F), are studied in different solvents by dispersion-corrected density functional theory. The stability of the canonical Watson-Crick base pair and the mismatched pair in various solvents with low and high dielectric constants is analyzed. It is demonstrated that A-F base pairing is favored in solvents with low dielectric constant. The stabilization and conformational changes induced by protonation are also analyzed for the natural as well as the mismatched base pair. DNA sequences capable of changing their sequence conformation on protonation are used in the construction of pH-based molecular switches. An acidic medium has a profound influence in stabilizing the isostere base pair. Such a large gain in stability on protonation leads to an interesting pH-controlled molecular switch, which can be incorporated in a natural DNA tract. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Allen, James J.

A microelectromechanical (MEM) optical switching apparatus is disclosed that is based on an erectable mirror which is formed on a rotatable stage using surface micromachining. An electrostatic actuator is also formed on the substrate to rotate the stage and mirror with a high angular precision. The mirror can be erected manually after fabrication of the device and used to redirect an incident light beam at an arbitrary angel and to maintain this state in the absence of any applied electrical power. A 1.times.N optical switch can be formed using a single rotatable mirror. In some embodiments of the present invention,more » a plurality of rotatable mirrors can be configured so that the stages and mirrors rotate in unison when driven by a single micromotor thereby forming a 2.times.2 optical switch which can be used to switch a pair of incident light beams, or as a building block to form a higher-order optical switch.« less

A study of N-methylacetamide in water clusters: based on atom-bond electronegativity equalization method fused into molecular mechanics.

PubMed

Yang, Zhong-Zhi; Qian, Ping

2006-08-14

N-methylacetamide (NMA) is a very interesting compound and often serves as a model of the peptide bond. The interaction between NMA and water provides a convenient prototype for the solvation of the peptides in aqueous solutions. Here we present NMA-water potential model based on atom-bond electronegativity equalization method fused into molecular mechanics (ABEEM/MM) that is to take ABEEM charges of all atoms, bonds, and lone-pair electrons of NMA and water molecules into the electrostatic interaction term in molecular mechanics. The model has the following characters: (1)it allows the charges in system to fluctuate responding to the ambient environment; (2) for two major types of intermolecular hydrogen bonds, which are the hydrogen bond forming between the lone-pair electron on amide oxygen and the water hydrogen, and the one forming between the lone-pair electron on water oxygen and the amide hydrogen, we take special treatments in describing the electrostatic interaction by the use of the parameters k(lpO=, H) and k(lpO(-), HN(-)), respectively. The newly constructed potential model based on ABEEM/MM is first applied to amide-water clusters and reproduces gas-phase state properties of NMA(H(2)O)(n) (n=1-3) including optimal structures, dipole moments, ABEEM charge distributions, energy difference of the isolated trans- and cis-NMA, interaction energies, hydrogen bonding cooperative effects, and so on, whose results show the good agreement with those measured by available experiments and calculated by ab initio methods. In order to further test the reasonableness of this model and the correctness and transferability of the parameters, many static properties of the larger NMA-water complexes NMA(H(2)O)(n) (n=4-6) are also studied including optimal structures and interaction energies. The results also show fair consistency with those of our quantum chemistry calculations.

Mechanistic Basis for the Bypass of a Bulky DNA Adduct Catalyzed by a Y-Family DNA Polymerase

PubMed Central

Vyas, Rajan; Efthimiopoulos, Georgia; Tokarsky, E. John; Malik, Chanchal K.; Basu, Ashis K.; Suo, Zucai

2015-01-01

1-Nitropyrene (1-NP), an environmental pollutant, induces DNA damage in vivo and is considered to be carcinogenic. The DNA adducts formed by the 1-NP metabolites stall replicative DNA polymerases but are presumably bypassed by error-prone Y-family DNA polymerases at the expense of replication fidelity and efficiency in vivo. Our running start assays confirmed that a site-specifically placed 8-(deoxyguanosin-N2-yl)-1-aminopyrene (dG1,8), one of the DNA adducts derived from 1-NP, can be bypassed by Sulfolobus solfataricus DNA polymerase IV (Dpo4), although this representative Y-family enzyme was paused strongly by the lesion. Pre-steady-state kinetic assays were employed to determine the low nucleotide incorporation fidelity and establish a minimal kinetic mechanism for the dG1,8 bypass by Dpo4. To reveal a structural basis for dCTP incorporation opposite dG1,8, we solved the crystal structures of the complexes of Dpo4 and DNA containing a templating dG1,8 lesion in the absence or presence of dCTP. The Dpo4·DNA-dG1,8 binary structure shows that the aminopyrene moiety of the lesion stacks against the primer/template junction pair, while its dG moiety projected into the cleft between the Finger and Little Finger domains of Dpo4. In the Dpo4·DNA-dG1,8·dCTP ternary structure, the aminopyrene moiety of the dG1,8 lesion, is sandwiched between the nascent and junction base pairs, while its base is present in the major groove. Moreover, dCTP forms a Watson–Crick base pair with dG, two nucleotides upstream from the dG1,8 site, creating a complex for “-2” frameshift mutation. Mechanistically, these crystal structures provide additional insight into the aforementioned minimal kinetic mechanism. PMID:26327169

Novel base-pairing interactions at the tRNA wobble position crucial for accurate reading of the genetic code

PubMed Central

Rozov, Alexey; Demeshkina, Natalia; Khusainov, Iskander; Westhof, Eric; Yusupov, Marat; Yusupova, Gulnara

2016-01-01

Posttranscriptional modifications at the wobble position of transfer RNAs play a substantial role in deciphering the degenerate genetic code on the ribosome. The number and variety of modifications suggest different mechanisms of action during messenger RNA decoding, of which only a few were described so far. Here, on the basis of several 70S ribosome complex X-ray structures, we demonstrate how Escherichia coli tRNALysUUU with hypermodified 5-methylaminomethyl-2-thiouridine (mnm5s2U) at the wobble position discriminates between cognate codons AAA and AAG, and near-cognate stop codon UAA or isoleucine codon AUA, with which it forms pyrimidine–pyrimidine mismatches. We show that mnm5s2U forms an unusual pair with guanosine at the wobble position that expands general knowledge on the degeneracy of the genetic code and specifies a powerful role of tRNA modifications in translation. Our models consolidate the translational fidelity mechanism proposed previously where the steric complementarity and shape acceptance dominate the decoding mechanism. PMID:26791911

[Network of plastic neurons capable of forming conditioned reflexes ("membrane" model of learning)].

PubMed

Litvinov, E G; Frolov, A A

1978-01-01

Simple net neuronal model was suggested which was able to form the conditioning due to changes of the neuron excitability. The model was based on the following main concepts: (a) the conditioning formation should result in reduction of the firing threshold in the same neurons where the conditioning and reinforcement stimuli were converged, (b) neuron threshold may have only two possible states: initial and final ones, these were identical for all cells, the threshold may be changed only once from the initial value to the final one, (c) isomorphous relation may be introduced between some pair of arbitrary stimuli and some subset of the net neurons; any two pairs differing at least in one stimulus have unlike subsets of the convergent neurons. Stochastically organized neuronal net was used for analysis of the model. Considerable information capacity of the net gives the opportunity to consider that the conditioning formation is possible on the basis of the nervous cells. The efficienty of the model turn out to be comparable with the well known models where the conditioning formation was due to the modification of the synapses.

Novel base-pairing interactions at the tRNA wobble position crucial for accurate reading of the genetic code.

PubMed

Rozov, Alexey; Demeshkina, Natalia; Khusainov, Iskander; Westhof, Eric; Yusupov, Marat; Yusupova, Gulnara

2016-01-21

Posttranscriptional modifications at the wobble position of transfer RNAs play a substantial role in deciphering the degenerate genetic code on the ribosome. The number and variety of modifications suggest different mechanisms of action during messenger RNA decoding, of which only a few were described so far. Here, on the basis of several 70S ribosome complex X-ray structures, we demonstrate how Escherichia coli tRNA(Lys)(UUU) with hypermodified 5-methylaminomethyl-2-thiouridine (mnm(5)s(2)U) at the wobble position discriminates between cognate codons AAA and AAG, and near-cognate stop codon UAA or isoleucine codon AUA, with which it forms pyrimidine-pyrimidine mismatches. We show that mnm(5)s(2)U forms an unusual pair with guanosine at the wobble position that expands general knowledge on the degeneracy of the genetic code and specifies a powerful role of tRNA modifications in translation. Our models consolidate the translational fidelity mechanism proposed previously where the steric complementarity and shape acceptance dominate the decoding mechanism.

Novel base-pairing interactions at the tRNA wobble position crucial for accurate reading of the genetic code

NASA Astrophysics Data System (ADS)

Rozov, Alexey; Demeshkina, Natalia; Khusainov, Iskander; Westhof, Eric; Yusupov, Marat; Yusupova, Gulnara

2016-01-01

Posttranscriptional modifications at the wobble position of transfer RNAs play a substantial role in deciphering the degenerate genetic code on the ribosome. The number and variety of modifications suggest different mechanisms of action during messenger RNA decoding, of which only a few were described so far. Here, on the basis of several 70S ribosome complex X-ray structures, we demonstrate how Escherichia coli tRNALysUUU with hypermodified 5-methylaminomethyl-2-thiouridine (mnm5s2U) at the wobble position discriminates between cognate codons AAA and AAG, and near-cognate stop codon UAA or isoleucine codon AUA, with which it forms pyrimidine-pyrimidine mismatches. We show that mnm5s2U forms an unusual pair with guanosine at the wobble position that expands general knowledge on the degeneracy of the genetic code and specifies a powerful role of tRNA modifications in translation. Our models consolidate the translational fidelity mechanism proposed previously where the steric complementarity and shape acceptance dominate the decoding mechanism.

A gp41-based heteroduplex mobility assay provides rapid and accurate assessment of intrasubtype epidemiological linkage in HIV type 1 heterosexual transmission Pairs.

PubMed

Manigart, Olivier; Boeras, Debrah I; Karita, Etienne; Hawkins, Paulina A; Vwalika, Cheswa; Makombe, Nathan; Mulenga, Joseph; Derdeyn, Cynthia A; Allen, Susan; Hunter, Eric

2012-12-01

A critical step in HIV-1 transmission studies is the rapid and accurate identification of epidemiologically linked transmission pairs. To date, this has been accomplished by comparison of polymerase chain reaction (PCR)-amplified nucleotide sequences from potential transmission pairs, which can be cost-prohibitive for use in resource-limited settings. Here we describe a rapid, cost-effective approach to determine transmission linkage based on the heteroduplex mobility assay (HMA), and validate this approach by comparison to nucleotide sequencing. A total of 102 HIV-1-infected Zambian and Rwandan couples, with known linkage, were analyzed by gp41-HMA. A 400-base pair fragment within the envelope gp41 region of the HIV proviral genome was PCR amplified and HMA was applied to both partners' amplicons separately (autologous) and as a mixture (heterologous). If the diversity between gp41 sequences was low (<5%), a homoduplex was observed upon gel electrophoresis and the transmission was characterized as having occurred between partners (linked). If a new heteroduplex formed, within the heterologous migration, the transmission was determined to be unlinked. Initial blind validation of gp-41 HMA demonstrated 90% concordance between HMA and sequencing with 100% concordance in the case of linked transmissions. Following validation, 25 newly infected partners in Kigali and 12 in Lusaka were evaluated prospectively using both HMA and nucleotide sequences. Concordant results were obtained in all but one case (97.3%). The gp41-HMA technique is a reliable and feasible tool to detect linked transmissions in the field. All identified unlinked results should be confirmed by sequence analyses.

Early diagnosis of a Mexican variant of Papaya meleira virus (PMeV-Mx) by RT-PCR.

PubMed

Zamudio-Moreno, E; Ramirez-Prado, J H; Moreno-Valenzuela, O A; Lopez-Ochoa, L A

2015-02-06

Papaya meleira disease was identified in Brazil in the 1980s. The disease is caused by a double-stranded RNA virus known as Papaya meleira virus (PMeV), which has also been recently reported in Mexico. However, previously reported PMeV primers failed to diagnose the Mexican form of the disease. A genomic approach was used to identify sequences of the Mexican virus isolate, referred here to as PMeV-Mx, to develop a diagnostic method. A mini cDNA library was generated using total RNA from the latex of fruits; this RNA was also sequenced using the Illumina platform. Sequences corresponding to the previously reported 669-base pair sequence for PMeV from Brazil (PMeV-Br) were identified within the PMeV-Mx genome, exhibiting 79-92% identity with PMeV-Br. In addition, a new sequence of 1154-base pairs encoding a putative RNA-dependent RNA polymerase was identified in PMeV-Mx. Primers designed against this sequence detected both virus isolates, 2 amplicons of 173 and 491 base pairs from PMeV-Br and PMeV-Mx, and shared 100 and 98% identity, respectively. PMeV-Mx was found in the latex of fruits, in seedlings, and in the leaves, flowers, petioles, and seeds of mature plants. PMeV-Mx was more abundant in the latex of fruits than in the leaves. The limit of detection of the CB38/CB39 primer pair was 1 fg and 1 pg using total RNA extracted from the latex of fruits and from seedlings, respectively. A sensitive and early diagnosis protocol was developed; this method will enable the certification of seeds and seedlings prior to transplantation to the field.

Compact ion chamber based neutron detector

DOEpatents

Derzon, Mark S.; Galambos, Paul C.; Renzi, Ronald F.

2015-10-27

A directional neutron detector has an ion chamber formed in a dielectric material; a signal electrode and a ground electrode formed in the ion chamber; a neutron absorbing material filling the ion chamber; readout circuitry which is electrically coupled to the signal and ground electrodes; and a signal processor electrically coupled to the readout circuitry. The ion chamber has a pair of substantially planar electrode surfaces. The chamber pressure of the neutron absorbing material is selected such that the reaction particle ion trail length for neutrons absorbed by the neutron absorbing material is equal to or less than the distance between the electrode surfaces. The signal processor is adapted to determine a path angle for each absorbed neutron based on the rise time of the corresponding pulse in a time-varying detector signal.

Dark-bright quadratic solitons with a focusing effective Kerr nonlinearity

NASA Astrophysics Data System (ADS)

Chen, Manna; Ping, Xiaorou; Liang, Guo; Guo, Qi; Lu, Daquan; Hu, Wei

2018-01-01

Dark solitons are traditionally considered to exist in defocusing Kerr nonlinearity media. We investigate dark quadratic solitons with a focusing effective Kerr nonlinearity and a sine-oscillatory nonlocal response. A nonlinear refractive index with a focusing sine-oscillatory response leads to a defocusing effect with a strong degree of nonlocality, which causes the formation of dark solitons. By analyzing the modulational instability, we determine the parameter domain for dark quadratic solitons with a stable background and numerically obtain dark-bright soliton solutions in the form of pairs, which avoid radiative phenomena. Based on a numerical simulation, we find that all dark-bright soliton pairs are unstable after a relatively long propagation distance, and their stabilities are affected by the soliton interval and the degree of nonlocality.

Capacitive proximity sensor

DOEpatents

Kronberg, J.W.

1994-05-31

A proximity sensor based on a closed field circuit is disclosed. The circuit comprises a ring oscillator using a symmetrical array of plates that creates an oscillating displacement current. The displacement current varies as a function of the proximity of objects to the plate array. Preferably the plates are in the form of a group of three pair of symmetric plates having a common center, arranged in a hexagonal pattern with opposing plates linked as a pair. The sensor produces logic level pulses suitable for interfacing with a computer or process controller. The proximity sensor can be incorporated into a load cell, a differential pressure gauge, or a device for measuring the consistency of a characteristic of a material where a variation in the consistency causes the dielectric constant of the material to change. 14 figs.

Galaxy bachelors, couples, spouses: Star formation in interacting galaxies

NASA Astrophysics Data System (ADS)

Sun, Jing; Barger, Kathleen; Richstein, Hannah; SDSS-IV/MaNGA

2017-01-01

We investigate the star formation activity in three galaxy systems in different stages of interaction to determine how the environment of galaxies affects their star forming ability and potential. These systems include an isolated galaxy, a pair of interacting galaxies, and a pair of merging galaxies. All of the target galaxies in these systems have similar stellar masses and similar radii and are at similar redshifts. We trace the star formation activity over the past 1-2 Gyr using spatially and kinematically resolved H-alpha emission, H-alpha equivalent width, and 4000-Angstrom break maps. This work is based on data from the fourth-generation Sloan Digital Sky Survey (SDSS-IV)/Mapping Nearby Galaxies at Apache Point Observatory (MaNGA), and is part of the Project No.0285 in SDSS-IV.

Magnetic field effect on the optoelectronic response of amorphous hydrogenated silicon

NASA Astrophysics Data System (ADS)

McLaughlin, Ryan; Sun, Dali; Zhang, Chuang; Ehrenfreund, Eitan; Vardeny, Zeev Valy

We have studied the magneto-photoluminescence and magneto photoconductivity in amorphous hydrogenated silicon (a-Si:H) thin films and devices as a function of temperature up to field of 5 Tesla. The magnetic field effects (MFE) are interpreted as spin mixing between spin-singlet and spin-triplet charge pairs due to the ''delta- g'' mechanism that is based on the g-value difference between the paired electron and hole, which directly affects the rate of radiative recombination and charge carrier separation, respectively. We found that the MFE(B) response does not form a Lorentzian (that is expected from the ''delta- g'' mechanism) due to disorder in the film that results in a broad distribution of e-h recombination rates, which could be extracted directly by time-resolved photoluminescence.

Evaluation of antioxidant activity and electronic structure of aspirin and paracetamol

NASA Astrophysics Data System (ADS)

Motozaki, W.; Nagatani, Y.; Kimura, Y.; Endo, K.; Takemura, T.; Kurmaev, E. Z.; Moewes, A.

2011-01-01

We present a study of electronic structure, chemical bonding, and antioxidant activity of phenolic antioxidants (aspirin and paracetamol). X-ray photoelectron and emission spectra of the antioxidants have been simulated by deMon density functional theory (DFT) calculations of the molecules. The chemical bonding of aspirin is characterized by the formation of oxygen 'lone-pair' π-orbitals which can neutralize free radicals and thus be related to antioxidant properties of the drug. In the case of paracetamol the additional nitrogen 'lone pair' is formed which can explain toxicity of the drug. We propose an evaluation method of antioxidant activity based on the relationship between experimental half-wave oxidation potential ( Ep/2 ) and calculated ionization potentials ( IP) by the DFT calculations, and can conclude that paracetamol has the higher antioxidant activity than aspirin.

The effect of ionic environment and mercury(II) binding on the alternative structures of DNA. An infrared spectroscopic study

NASA Astrophysics Data System (ADS)

Keller, P. B.; Hartman, K. A.

Infrared spectroscopy was used to measure the effects of NaCl, NaNO 3 and HgCl 2 on the structure and structural transitions of DNA in hydrated films. The following conclusions are supported by the data. (1) The transition from the B- to the A-structural form in films of salt-free, calf-thymus DNA occurs between 86 and 75% r.h. Previous failures to obtain this transition in salt-free films and the finding that ca 4% (w/w) NaCl is needed to observe the B to A transition in films of DNA appear to be anomalies produced by the very slow kinetics for this transition. (2) The addition of NaCl to DNA increases the quantity of water absorbed at a given r.h. value and shifts the B to A transition to lower r.h. values. (3) Highly hydrated DNA (100% r.h.) with or without added NaCl exists in the B-helical structure for all samples examined. (4) DNA films containing one NaNO 3 per 6.7 nucleotide residues remained in the B-helical form to very low values of hydration. (5) The interaction of HgCl 2 with DNA to form the type I complex prevents the transition of DNA from the B- to the A-helical form but a conformational variation within the B family of structures was observed to occur between 94 and 75% r.h. (6) The primary sites of binding of Hg 2+ in the type-1 complex with the DNA are the AT base pairs. Hg 2+ binds to the N3 atom of thymine. Binding of Hg 2+ to AT pairs perturbs the CG pairs but has only a minor effect on the sugar—phosphate conformation.

Protonation-dependent base flipping in the catalytic triad of a small RNA

NASA Astrophysics Data System (ADS)

Sun, Zhaoxi; Wang, Xiaohui; Zhang, John Z. H.

2017-09-01

Protonation dependent base flipping in RNA has never been studied theoretically. In this work we studied protonation-dependent behavior of the base flipping in the catalytic triad of a single-stranded RNA which was previously characterized by NMR experiment. Molecular dynamics simulation reveals that the GA mismatch in this region accounts for this behavior. Free energy profiles show that the stable point for flipping dihedral shifts about 35° and the free energy barrier along the flipping pathway is elevated upon protonation. The orientation of Guanine from syn to anti conformation is coupled with protonation-dependent base flipping and G-HA+ base pair is formed under acidic condition.

Comparison of Heavy-Duty Scuffing Behavior between Chromium-Based Ceramic Composite and Nickel-Chromium-Molybdenum-Coated Ring Sliding against Cast Iron Liner under Starvation

PubMed Central

Shen, Yan; Yu, Baihong; Lv, Yutao; Li, Bin

2017-01-01

A running-in and starved lubrication experiment is designed to investigate the heavy-duty scuffing behavior of piston ring coatings against cast iron (Fe) cylinder liner using the piston ring reciprocating liner test rig. The scuffing resistance of the piston ring with the chromium-based ceramic composite coating (CKS), and that with the thermally sprayed nickel-chromium-molybdenum coating (NCM) is compared at different nominal pressures (40~100 MPa) and temperatures (180~250 °C). With the failure time as a criterion, the rank order is as follows: NCM/Fe > CKS/Fe. Before the scoring occurs at the interface of the piston ring and cylinder liner (PRCL), the cast iron liner enters into a “polish wear” stage, and iron-based adhesive materials begin to form on the piston ring surface. With the macroscopic adhesion formation, the plastic shearing cycle causes surface damages mainly due to abrasive effects for the CKS/Fe pairs and adhesive effects for the NCM/Fe pairs. PMID:29036911

Monte Carlo approach in assessing damage in higher order structures of DNA

NASA Technical Reports Server (NTRS)

Chatterjee, A.; Schmidt, J. B.; Holley, W. R.

1994-01-01

We have developed a computer monitor of nuclear DNA in the form of chromatin fibre. The fibres are modeled as a ideal solenoid consisting of twenty helical turns with six nucleosomes per turn. The chromatin model, in combination with are Monte Carlo theory of radiation damage induces by charged particles, based on general features of tack structure and stopping power theory, has been used to evaluate the influence of DNA structure on initial damage. An interesting has emerged from our calculations. Our calculated results predict the existence of strong spatial correlations in damage sites associated with the symmetries in the solenoidal model. We have calculated spectra of short fragments of double stranded DNA produced by multiple double strand breaks induced by both high and low LET radiation. The spectra exhibit peaks at multiples of approximately 85 base pairs (the nucleosome periodicity), and approximately 1000 base pairs (solenoid periodicity). Preliminary experiments to investigate the fragment distributions from irradiated DNA, made by B. Rydberg at Lawrence Berkeley Laboratory, confirm the existence of short DNA fragments and are in substantial agreement with the predictions of our theory.

Zn2+ selectively stabilizes FdU-substituted DNA through a unique major groove binding motif

PubMed Central

Ghosh, Supratim; Salsbury, Freddie R.; Horita, David A.; Gmeiner, William H.

2011-01-01

We report, based on semi-empirical calculations, that Zn2+ binds duplex DNA containing consecutive FdU–dA base pairs in the major groove with distorted trigonal bipyramidal geometry. In this previously uncharacterized binding motif, O4 and F5 on consecutive FdU are axial ligands while three water molecules complete the coordination sphere. NMR spectroscopy confirmed Zn2+ complexation occurred with maintenance of base pairing while a slight hypsochromic shift in circular dichroism (CD) spectra indicated moderate structural distortion relative to B-form DNA. Zn2+ complexation inhibited ethidium bromide (EtBr) intercalation and stabilized FdU-substituted duplex DNA (ΔTm > 15°C). Mg2+ neither inhibited EtBr complexation nor had as strong of a stabilizing effect. DNA sequences that did not contain consecutive FdU were not stabilized by Zn2+. A lipofectamine preparation of the Zn2+–DNA complex displayed enhanced cytotoxicity toward prostate cancer cells relative to the individual components prepared as lipofectamine complexes indicating the potential utility of Zn2+–DNA complexes for cancer treatment. PMID:21296761

Thermodynamic Signature of DNA Damage: Characterization of DNA with a 5-Hydroxy-2'-deoxycytidine•2'-Deoxyguanosine Base Pair

PubMed Central

Ganguly, Manjori; Szulik, Marta W.; Donahue, Patrick S.; Clancy, Kate; Stone, Michael P.; Gold, Barry

2012-01-01

Oxidation of DNA due to exposure to reactive oxygen species is a major source of DNA damage. One of the oxidation lesions formed, 5-hydroxy-2'-deoxycytidine, has been shown to miscode by some replicative DNA polymerases but not by error prone polymerases capable of translesion synthesis. The 5-hydroxy-2'-deoxycytidine lesion is repaired by DNA glycosylases that require the 5-hydroxycytidine base to be extrahelical so it can enter into the enzyme's active site where it is excised off the DNA backbone to afford an abasic site. The thermodynamic and NMR results presented herein, describe the effect of a 5-hydroxy-2'-deoxycytidine•2'-deoxyguanosine base pair on the stability of two different DNA duplexes. The results demonstrate that the lesion is highly destabilizing and that the energy barrier for the unstacking of 5-hydroxy-2'-deoxycytidine from the DNA duplex may be low. This could provide a thermodynamic mode of adduct identification by DNA glycosylases that require the lesion to be extrahelical. PMID:22332945

Microelectromechanical mirrors and electrically-programmable diffraction gratings based on two-stage actuation

DOEpatents

Allen, James J.; Sinclair, Michael B.; Dohner, Jeffrey L.

2005-11-22

A microelectromechanical (MEM) device for redirecting incident light is disclosed. The MEM device utilizes a pair of electrostatic actuators formed one above the other from different stacked and interconnected layers of polysilicon to move or tilt an overlying light-reflective plate (i.e. a mirror) to provide a reflected component of the incident light which can be shifted in phase or propagation angle. The MEM device, which utilizes leveraged bending to provide a relatively-large vertical displacement up to several microns for the light-reflective plate, has applications for forming an electrically-programmable diffraction grating (i.e. a polychromator) or a micromirror array.

Charge transfer mediator based systems for electrocatalytic oxygen reduction

DOEpatents

Stahl, Shannon S.; Gerken, James B.; Anson, Colin W.

2017-11-07

Disclosed are systems for the electrocatalytic reduction of oxygen, having redox mediator/redox catalyst pairs and an electrolyte solution in contact with an electrode. The redox mediator is included in the electrolyte solution, and the redox catalyst may be included in the electrolyte solution, or alternatively, may be in contact with the electrolyte solution. In one form a cobalt redox catalyst is used with a quinone redox mediator. In another form a nitrogen oxide redox catalyst is used with a nitroxyl type redox mediator. The systems can be used in electrochemical cells wherein neither the anode nor the cathode comprise an expensive metal such as platinum.

Charge transfer mediator based systems for electrocatalytic oxygen reduction

DOEpatents

Stahl, Shannon S.; Gerken, James B.; Anson, Colin W.

2017-07-18

Disclosed are systems for the electrocatalytic reduction of oxygen, having redox mediator/redox catalyst pairs and an electrolyte solution in contact with an electrode. The redox mediator is included in the electrolyte solution, and the redox catalyst may be included in the electrolyte solution, or alternatively, may be in contact with the electrolyte solution. In one form a cobalt redox catalyst is used with a quinone redox mediator. In another form a nitrogen oxide redox catalyst is used with a nitroxyl type redox mediator. The systems can be used in electrochemical cells wherein neither the anode nor the cathode comprise an expensive metal such as platinum.

Hybridization and sequencing of nucleic acids using base pair mismatches

DOEpatents

Fodor, Stephen P. A.; Lipshutz, Robert J.; Huang, Xiaohua

2001-01-01

Devices and techniques for hybridization of nucleic acids and for determining the sequence of nucleic acids. Arrays of nucleic acids are formed by techniques, preferably high resolution, light-directed techniques. Positions of hybridization of a target nucleic acid are determined by, e.g., epifluorescence microscopy. Devices and techniques are proposed to determine the sequence of a target nucleic acid more efficiently and more quickly through such synthesis and detection techniques.

MSeq-CNV: accurate detection of Copy Number Variation from Sequencing of Multiple samples.

PubMed

Malekpour, Seyed Amir; Pezeshk, Hamid; Sadeghi, Mehdi

2018-03-05

Currently a few tools are capable of detecting genome-wide Copy Number Variations (CNVs) based on sequencing of multiple samples. Although aberrations in mate pair insertion sizes provide additional hints for the CNV detection based on multiple samples, the majority of the current tools rely only on the depth of coverage. Here, we propose a new algorithm (MSeq-CNV) which allows detecting common CNVs across multiple samples. MSeq-CNV applies a mixture density for modeling aberrations in depth of coverage and abnormalities in the mate pair insertion sizes. Each component in this mixture density applies a Binomial distribution for modeling the number of mate pairs with aberration in the insertion size and also a Poisson distribution for emitting the read counts, in each genomic position. MSeq-CNV is applied on simulated data and also on real data of six HapMap individuals with high-coverage sequencing, in 1000 Genomes Project. These individuals include a CEU trio of European ancestry and a YRI trio of Nigerian ethnicity. Ancestry of these individuals is studied by clustering the identified CNVs. MSeq-CNV is also applied for detecting CNVs in two samples with low-coverage sequencing in 1000 Genomes Project and six samples form the Simons Genome Diversity Project.

FT-IR and FT-Raman spectra of 5-chlorocytosine: Solid state simulation and tautomerism. Effect of the chlorine substitution in the Watson-Crick base pair 5-chlorodeoxycytidine-deoxyguanosine

NASA Astrophysics Data System (ADS)

Alcolea Palafox, M.; Rastogi, V. K.; Singh, S. P.

2018-01-01

The laser Raman and IR spectra of 5-chlorocytosine have been recorded and accurately assigned in the solid state using Density functional calculations (DFT) together with the linear scaling equation procedure (LSE) and the solid state simulation of the crystal unit cell through a tetramer form. These results remarkably improve those reported previously by other authors. Several new scaling equations were proposed to be used in related molecules. The six main tautomers of the biomolecule 5-chlorocytosine were determined and optimized at the MP2 and CCSD levels, using different basis sets. The relative stabilities were compared with those obtained in cytosine and their 5-halo derivatives. Several relationships between energies, geometric parameters and NBO atomic charges were established. The effect of the chlorine substitution in the fifth position was evaluated through the stability of the Watson-Crick (WC) base pair of 5-chlorodeoxycytidine with deoxyguanosine, and through their vibrational spectra.

Trans-activation of the Tetrahymena group I intron ribozyme via a non-native RNA-RNA interaction.

PubMed Central

Ikawa, Y; Shiraishi, H; Inoue, T

1999-01-01

The peripheral P2.1 domain of the Tetrahymena group I intron ribozyme has been shown to be non-essential for splicing. We found, however, that separately prepared P2.1 RNA efficiently accelerates the 3' splice-site-specific hydrolysis reaction of a mutant ribozyme lacking both P2.1 and its upstream region in trans. We report here the unusual properties of this trans-activation. Compensatory mutational analysis revealed that non-native long-range base-pairings between the loop region of P2.1 RNA and L5c region of the mutant ribozyme are needed for the activation in spite of the fact that P2.1 forms base-pairings with P9.1 in the Tetrahymena ribozyme. The trans -activation depends on the non-native RNA-RNA interaction together with the higher order structure of P2.1 RNA. This activation is unique among the known trans-activations that utilize native tertiary interactions or RNA chaperons. PMID:10075996

Control of myogenesis by rodent SINE-containing lncRNAs

PubMed Central

Wang, Jiashi; Gong, Chenguang; Maquat, Lynne E.

2013-01-01

Staufen1-mediated mRNA decay (SMD) degrades mRNAs that harbor a Staufen1-binding site (SBS) in their 3′ untranslated regions (UTRs). Human SBSs can form by intermolecular base-pairing between a 3′ UTR Alu element and an Alu element within a long noncoding RNA (lncRNA) called a ½-sbsRNA. Since Alu elements are confined to primates, it was unclear how SMD occurs in rodents. Here we identify mouse mRNA 3′ UTRs and lncRNAs that contain a B1, B2, B4, or identifier (ID) element. We show that SMD occurs in mouse cells via mRNA–lncRNA base-pairing of partially complementary elements and that mouse ½-sbsRNA (m½-sbsRNA)-triggered SMD regulates C2C12 cell myogenesis. Our findings define new roles for lncRNAs as well as B and ID short interspersed elements (SINEs) in mice that undoubtedly influence many developmental and homeostatic pathways. PMID:23558772

Sign reversal of the order parameter in (Li1-xFex)OHFe1-yZnySe

NASA Astrophysics Data System (ADS)

Du, Zengyi; Yang, Xiong; Altenfeld, Dustin; Gu, Qiangqiang; Yang, Huan; Eremin, Ilya; Hirschfeld, Peter J.; Mazin, Igor I.; Lin, Hai; Zhu, Xiyu; Wen, Hai-Hu

2018-02-01

Iron pnictides are the only known family of unconventional high-temperature superconductors besides cuprates. Until recently, it was widely accepted that superconductivity is driven by spin fluctuations and intimately related to the fermiology, specifically, hole and electron pockets separated by the same wavevector that characterizes the dominant spin fluctuations, and supporting order parameters (OP) of opposite signs. This picture was questioned after the discovery of intercalated or monolayer form of FeSe-based systems without hole pockets, which seemingly undermines the basis for spin-fluctuation theory and the idea of a sign-changing OP. Using the recently proposed phase-sensitive quasiparticle interference technique, here we show that in LiOH-intercalated FeSe compound the OP does change sign, albeit within the electronic pockets. This result unifies the pairing mechanism of iron-based superconductors with or without the hole Fermi pockets and supports the conclusion that spin fluctuations play the key role in electron pairing.

Computational Approaches to Nucleic Acid Origami.

PubMed

Jabbari, Hosna; Aminpour, Maral; Montemagno, Carlo

2015-10-12

Recent advances in experimental DNA origami have dramatically expanded the horizon of DNA nanotechnology. Complex 3D suprastructures have been designed and developed using DNA origami with applications in biomaterial science, nanomedicine, nanorobotics, and molecular computation. Ribonucleic acid (RNA) origami has recently been realized as a new approach. Similar to DNA, RNA molecules can be designed to form complex 3D structures through complementary base pairings. RNA origami structures are, however, more compact and more thermodynamically stable due to RNA's non-canonical base pairing and tertiary interactions. With all these advantages, the development of RNA origami lags behind DNA origami by a large gap. Furthermore, although computational methods have proven to be effective in designing DNA and RNA origami structures and in their evaluation, advances in computational nucleic acid origami is even more limited. In this paper, we review major milestones in experimental and computational DNA and RNA origami and present current challenges in these fields. We believe collaboration between experimental nanotechnologists and computer scientists are critical for advancing these new research paradigms.

The constitutional t(11;22): implications for a novel mechanism responsible for gross chromosomal rearrangements

PubMed Central

Kurahashi, H; Inagaki, H; Ohye, T; Kogo, H; Tsutsumi, M; Kato, T; Tong, M; Emanuel, BS

2012-01-01

The constitutional t(11;22)(q23;q11) is the most common recurrent non-Robertsonian translocation in humans. The breakpoint sequences of both chromosomes are characterized by several hundred base pairs of palindromic AT-rich repeats (PATRRs). Similar PATRRs have also been identified at the breakpoints of other nonrecurrent translocations, suggesting that PATRR-mediated chromosomal translocation represents one of the universal pathways for gross chromosomal rearrangement in the human genome. We propose that PATRRs have the potential to form cruciform structures through intrastrand-base pairing in single-stranded DNA, creating a source of genomic instability and leading to translocations. Indeed, de novo examples of the t(11;22) are detected at a high frequency in sperm from normal healthy males. This review synthesizes recent data illustrating a novel paradigm for an apparent spermatogenesis-specific translocation mechanism. This observation has important implications pertaining to the predominantly paternal origin of de novo gross chromosomal rearrangements in humans. PMID:20507342

Comparison of clinical knowledge bases for summarization of electronic health records.

PubMed

McCoy, Allison B; Sittig, Dean F; Wright, Adam

2013-01-01

Automated summarization tools that create condition-specific displays may improve clinician efficiency. These tools require new kinds of knowledge that is difficult to obtain. We compared five problem-medication pair knowledge bases generated using four previously described knowledge base development approaches. The number of pairs in the resulting mapped knowledge bases varied widely due to differing mapping techniques from the source terminologies, ranging from 2,873 to 63,977,738 pairs. The number of overlapping pairs across knowledge bases was low, with one knowledge base having half of the pairs overlapping with another knowledge base, and most having less than a third overlapping. Further research is necessary to better evaluate the knowledge bases independently in additional settings, and to identify methods to integrate the knowledge bases.

G-quadruplexes Significantly Stimulate Pif1 Helicase-catalyzed Duplex DNA Unwinding*

PubMed Central

Duan, Xiao-Lei; Liu, Na-Nv; Yang, Yan-Tao; Li, Hai-Hong; Li, Ming; Dou, Shuo-Xing; Xi, Xu-Guang

2015-01-01

The evolutionarily conserved G-quadruplexes (G4s) are faithfully inherited and serve a variety of cellular functions such as telomere maintenance, gene regulation, DNA replication initiation, and epigenetic regulation. Different from the Watson-Crick base-pairing found in duplex DNA, G4s are formed via Hoogsteen base pairing and are very stable and compact DNA structures. Failure of untangling them in the cell impedes DNA-based transactions and leads to genome instability. Cells have evolved highly specific helicases to resolve G4 structures. We used a recombinant nuclear form of Saccharomyces cerevisiae Pif1 to characterize Pif1-mediated DNA unwinding with a substrate mimicking an ongoing lagging strand synthesis stalled by G4s, which resembles a replication origin and a G4-structured flap in Okazaki fragment maturation. We find that the presence of G4 may greatly stimulate the Pif1 helicase to unwind duplex DNA. Further studies reveal that this stimulation results from G4-enhanced Pif1 dimerization, which is required for duplex DNA unwinding. This finding provides new insights into the properties and functions of G4s. We discuss the observed activation phenomenon in relation to the possible regulatory role of G4s in the rapid rescue of the stalled lagging strand synthesis by helping the replicator recognize and activate the replication origin as well as by quickly removing the G4-structured flap during Okazaki fragment maturation. PMID:25627683

DOE Office of Scientific and Technical Information (OSTI.GOV)

Okutsu, N.; Shimamura, K.; Shimizu, E.

To elucidate the effect of radicals on DNA base pairs, we investigated the attacking mechanism of OH and H radicals to the G-C and A-T base pairs, using the density functional theory (DFT) calculations in water approximated by the continuum solvation model. The DFT calculations revealed that the OH radical abstracts the hydrogen atom of a NH{sub 2} group of G or A base and induces a tautomeric reaction for an A-T base pair more significantly than for a G-C base pair. On the other hand, the H radical prefers to bind to the Cytosine NH{sub 2} group of G-Cmore » base pair and induce a tautomeric reaction from G-C to G*-C*, whose activation free energy is considerably small (−0.1 kcal/mol) in comparison with that (42.9 kcal/mol) for the reaction of an A-T base pair. Accordingly, our DFT calculations elucidated that OH and H radicals have a significant effect on A-T and G-C base pairs, respectively. This finding will be useful for predicting the effect of radiation on the genetic information recorded in the base sequences of DNA duplexes.« less

Bridging the gap: functional healing of embryonic small intestine ex vivo

PubMed Central

Coletta, Riccardo; Roberts, Neil A.; Oltrabella, Francesca; Khalil, Basem A.; Morabito, Antonino

2015-01-01

Abstract The ability to grow embryonic organs ex vivo provides an opportunity to follow their differentiation in a controlled environment, with resulting insights into normal development. Additionally, similar strategies can be used to assess effects on organogenesis of physical and chemical manipulations. This study aimed to create an organ culture model with which to test physical manipulations to enhance healing of gut segments, thus generating a single functional organ. Embryonic mouse jejunum was isolated and cut into 2–3 mm tubes, which were placed in pairs, separated by a small gap, on semi‐permeable supports. Each pair was linked by a nylon suture threaded through their lumens. After 3 days in organ culture fed by defined serum‐free media, the rudiments differentiated to form tubes of smooth muscle surrounding a core of rudimentary villi. Of 34 such pairs, 74% had touching and well aligned proximate ends. Of these joined structures, 80% (59% of the total pairs) had a continuous lumen, as assessed by observing the trajectories of fluorescent dextrans injected into their distal ends. Fused organ pairs formed a single functional unit, as assessed by spontaneous contraction waves propagated along their lengths. In these healed intestines, peripherin+ neurons formed a nexus in the zone of fusion, linking the rudiment pairs. In future, this system could be used to test whether growth factors enhance fusion. Such results should in turn inform the design of novel treatments for short bowel syndrome, a potentially fatal condition with a currently limited and imperfect range of therapies. ©2015. The Authors Journal of Tissue Engineering and Regenerative Medicine Published by John Wiley & Sons, Ltd PMID:26234729

Apparatus for diffusion controlled dialysis under microgravity conditions

NASA Technical Reports Server (NTRS)

Carter, Daniel C. (Inventor)

1995-01-01

Apparatus for implementing crystal growth by allowing mixing of solutions under microgravity conditions includes a housing within which a number of pairs of chambers are formed. The chambers of each pair are aligned and a rotary valve is positioned between the chambers of each pair. When the valve is in a first position one chamber of each pair may communicate with the other chamber. A separate valve is provided for each pair of chambers so that each pair of chambers may be activated independently of the others and sequentially at selected intervals. Protein solution may be located within a small cavity in a cap which closes one of the chambers of a pair, and the cavity in the cap is closed by a dialysis membrane. The length of certain pairs of chambers may differ from the length of other pairs of chambers to optimize conditions for various dialysis productions, and wicking material may be incorporated into selected chambers for controlling the critical approach to supersaturation.