An in vitro biomechanical comparison of equine proximal interphalangeal joint arthrodesis techniques: an axial positioned dynamic compression plate and two abaxial transarticular cortical screws inserted in lag fashion versus three parallel transarticular cortical screws inserted in lag fashion.

PubMed

Sod, Gary A; Riggs, Laura M; Mitchell, Colin F; Hubert, Jeremy D; Martin, George S

2010-01-01

To compare in vitro monotonic biomechanical properties of an axial 3-hole, 4.5 mm narrow dynamic compression plate (DCP) using 5.5 mm cortical screws in conjunction with 2 abaxial transarticular 5.5 mm cortical screws inserted in lag fashion (DCP-TLS) with 3 parallel transarticular 5.5 mm cortical screws inserted in lag fashion (3-TLS) for the equine proximal interphalangeal (PIP) joint arthrodesis. Paired in vitro biomechanical testing of 2 methods of stabilizing cadaveric adult equine forelimb PIP joints. Cadaveric adult equine forelimbs (n=15 pairs). For each forelimb pair, 1 PIP joint was stabilized with an axial 3-hole narrow DCP (4.5 mm) using 5.5 mm cortical screws in conjunction with 2 abaxial transarticular 5.5 mm cortical screws inserted in lag fashion and 1 with 3 parallel transarticular 5.5 mm cortical screws inserted in lag fashion. Five matching pairs of constructs were tested in single cycle to failure under axial compression, 5 construct pairs were tested for cyclic fatigue under axial compression, and 5 construct pairs were tested in single cycle to failure under torsional loading. Mean values for each fixation method were compared using a paired t-test within each group with statistical significance set at P<.05. Mean yield load, yield stiffness, and failure load under axial compression and torsion, single cycle to failure, of the DCP-TLS fixation were significantly greater than those of the 3-TLS fixation. Mean cycles to failure in axial compression of the DCP-TLS fixation was significantly greater than that of the 3-TLS fixation. The DCP-TLS was superior to the 3-TLS in resisting the static overload forces and in resisting cyclic fatigue. The results of this in vitro study may provide information to aid in the selection of a treatment modality for arthrodesis of the equine PIP joint.

Weak nanoscale chaos and anomalous relaxation in DNA

NASA Astrophysics Data System (ADS)

Mazur, Alexey K.

2017-06-01

Anomalous nonexponential relaxation in hydrated biomolecules is commonly attributed to the complexity of the free-energy landscapes, similarly to polymers and glasses. It was found recently that the hydrogen-bond breathing of terminal DNA base pairs exhibits a slow power-law relaxation attributable to weak Hamiltonian chaos, with parameters similar to experimental data. Here, the relationship is studied between this motion and spectroscopic signals measured in DNA with a small molecular photoprobe inserted into the base-pair stack. To this end, the earlier computational approach in combination with an analytical theory is applied to the experimental DNA fragment. It is found that the intensity of breathing dynamics is strongly increased in the internal base pairs that flank the photoprobe, with anomalous relaxation quantitatively close to that in terminal base pairs. A physical mechanism is proposed to explain the coupling between the relaxation of base-pair breathing and the experimental response signal. It is concluded that the algebraic relaxation observed experimentally is very likely a manifestation of weakly chaotic dynamics of hydrogen-bond breathing in the base pairs stacked to the photoprobe and that the weak nanoscale chaos can represent an ubiquitous hidden source of nonexponential relaxation in ultrafast spectroscopy.

Weak nanoscale chaos and anomalous relaxation in DNA.

PubMed

Mazur, Alexey K

2017-06-01

Anomalous nonexponential relaxation in hydrated biomolecules is commonly attributed to the complexity of the free-energy landscapes, similarly to polymers and glasses. It was found recently that the hydrogen-bond breathing of terminal DNA base pairs exhibits a slow power-law relaxation attributable to weak Hamiltonian chaos, with parameters similar to experimental data. Here, the relationship is studied between this motion and spectroscopic signals measured in DNA with a small molecular photoprobe inserted into the base-pair stack. To this end, the earlier computational approach in combination with an analytical theory is applied to the experimental DNA fragment. It is found that the intensity of breathing dynamics is strongly increased in the internal base pairs that flank the photoprobe, with anomalous relaxation quantitatively close to that in terminal base pairs. A physical mechanism is proposed to explain the coupling between the relaxation of base-pair breathing and the experimental response signal. It is concluded that the algebraic relaxation observed experimentally is very likely a manifestation of weakly chaotic dynamics of hydrogen-bond breathing in the base pairs stacked to the photoprobe and that the weak nanoscale chaos can represent an ubiquitous hidden source of nonexponential relaxation in ultrafast spectroscopy.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Banerjee, Surajit; Christov, Plamen P.; Kozekova, Albena

trans-4-Hydroxynonenal (HNE) is the major peroxidation product of {omega}-6 polyunsaturated fatty acids in vivo. Michael addition of the N{sub 2}-amino group of dGuo to HNE followed by ring closure of N1 onto the aldehyde results in four diastereomeric 1,N{sub 2}-dGuo (1,N{sub 2}-HNE-dGuo) adducts. The (6S,8R,11S)-HNE-1,N{sub 2}-dGuo adduct was incorporated into the 18-mer templates 5'-d(TCATXGAATCCTTCCCCC)-3' and d(TCACXGAATCCTTCCCCC)-3', where X = (6S,8R,11S)-HNE-1,N{sub 2}-dGuo adduct. These differed in the identity of the template 5'-neighbor base, which was either Thy or Cyt, respectively. Each of these templates was annealed with either a 13-mer primer 5'-d(GGGGGAAGGATTC)-3' or a 14-mer primer 5'-d(GGGGGAAGGATTCC)-3'. The addition of dNTPsmore » to the 13-mer primer allowed analysis of dNTP insertion opposite to the (6S,8R,11S)-HNE-1,N{sub 2}-dGuo adduct, whereas the 14-mer primer allowed analysis of dNTP extension past a primed (6S,8R,11S)-HNE-1,N{sub 2}-dGuo:dCyd pair. The Sulfolobus solfataricus P2 DNA polymerase IV (Dpo4) belongs to the Y-family of error-prone polymerases. Replication bypass studies in vitro reveal that this polymerase inserted dNTPs opposite the (6S,8R,11S)-HNE-1,N{sub 2}-dGuo adduct in a sequence-specific manner. If the template 5'-neighbor base was dCyt, the polymerase inserted primarily dGTP, whereas if the template 5'-neighbor base was dThy, the polymerase inserted primarily dATP. The latter event would predict low levels of Gua {yields} Thy mutations during replication bypass when the template 5'-neighbor base is dThy. When presented with a primed (6S,8R,11S)-HNE-1,N{sub 2}-dGuo:dCyd pair, the polymerase conducted full-length primer extension. Structures for ternary (Dpo4-DNA-dNTP) complexes with all four template-primers were obtained. For the 18-mer:13-mer template-primers in which the polymerase was confronted with the (6S,8R,11S)-HNE-1,N{sub 2}-dGuo adduct, the (6S,8R,11S)-1,N{sub 2}-dGuo lesion remained in the ring-closed conformation at the active site. The incoming dNTP, either dGTP or dATP, was positioned with Watson-Crick pairing opposite the template 5'-neighbor base, dCyt or dThy, respectively. In contrast, for the 18-mer:14-mer template-primers with a primed (6S,8R,11S)-HNE-1,N{sub 2}-dGuo:dCyd pair, ring opening of the adduct to the corresponding N{sub 2}-dGuo aldehyde species occurred. This allowed Watson-Crick base pairing at the (6S,8R,11S)-HNE-1,N{sub 2}-dGuo:dCyd pair.« less

Mechanisms of Insertion of dCTP and dTTP Opposite the DNA Lesion O6-Methyl-2'-deoxyguanosine by Human DNA Polymerase η.

PubMed

Patra, Amitraj; Zhang, Qianqian; Guengerich, F Peter; Egli, Martin

2016-11-11

O 6 -Methyl-2'-deoxyguanosine (O 6 -MeG) is a ubiquitous DNA lesion, formed not only by xenobiotic carcinogens but also by the endogenous methylating agent S-adenosylmethionine. It can introduce mutations during DNA replication, with different DNA polymerases displaying different ratios of correct or incorrect incorporation opposite this nucleoside. Of the "translesion" Y-family human DNA polymerases (hpols), hpol η is most efficient in incorporating equal numbers of correct and incorrect C and T bases. However, the mechanistic basis for this specific yet indiscriminate activity is not known. To explore this question, we report biochemical and structural analysis of the catalytic core of hpol η. Activity assays showed the truncated form displayed similar misincorporation properties as the full-length enzyme, incorporating C and T equally and extending from both. X-ray crystal structures of both dC and dT paired with O 6 -MeG were solved in both insertion and extension modes. The structures revealed a Watson-Crick-like pairing between O 6 -MeG and 2"-deoxythymidine-5"-[(α, β)-imido]triphosphate (approximating dT) at both the insertion and extension stages with formation of two H-bonds. Conversely, both the structures with O 6 - MeG opposite dCTP and dC display sheared configuration of base pairs but to different degrees, with formation of two bifurcated H-bonds and two single H-bonds in the structures trapped in the insertion and extension states, respectively. The structural data are consistent with the observed tendency of hpol η to insert both dC and dT opposite the O 6 -MeG lesion with similar efficiencies. Comparison of the hpol η active site configurations with either O 6 -MeG:dC or O 6 -MeG:dT bound compared with the corresponding situations in structures of complexes of Sulfolobus solfataricus Dpo4, a bypass pol that favors C relative to T by a factor of ∼4, helps rationalize the more error-prone synthesis opposite the lesion by hpol η. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Mechanisms of Insertion of dCTP and dTTP Opposite the DNA Lesion O6-Methyl-2′-deoxyguanosine by Human DNA Polymerase η*

PubMed Central

Patra, Amitraj; Zhang, Qianqian; Guengerich, F. Peter; Egli, Martin

2016-01-01

O6-Methyl-2′-deoxyguanosine (O6-MeG) is a ubiquitous DNA lesion, formed not only by xenobiotic carcinogens but also by the endogenous methylating agent S-adenosylmethionine. It can introduce mutations during DNA replication, with different DNA polymerases displaying different ratios of correct or incorrect incorporation opposite this nucleoside. Of the “translesion” Y-family human DNA polymerases (hpols), hpol η is most efficient in incorporating equal numbers of correct and incorrect C and T bases. However, the mechanistic basis for this specific yet indiscriminate activity is not known. To explore this question, we report biochemical and structural analysis of the catalytic core of hpol η. Activity assays showed the truncated form displayed similar misincorporation properties as the full-length enzyme, incorporating C and T equally and extending from both. X-ray crystal structures of both dC and dT paired with O6-MeG were solved in both insertion and extension modes. The structures revealed a Watson-Crick-like pairing between O6-MeG and 2"-deoxythymidine-5"-[(α, β)-imido]triphosphate (approximating dT) at both the insertion and extension stages with formation of two H-bonds. Conversely, both the structures with O6- MeG opposite dCTP and dC display sheared configuration of base pairs but to different degrees, with formation of two bifurcated H-bonds and two single H-bonds in the structures trapped in the insertion and extension states, respectively. The structural data are consistent with the observed tendency of hpol η to insert both dC and dT opposite the O6-MeG lesion with similar efficiencies. Comparison of the hpol η active site configurations with either O6-MeG:dC or O6-MeG:dT bound compared with the corresponding situations in structures of complexes of Sulfolobus solfataricus Dpo4, a bypass pol that favors C relative to T by a factor of ∼4, helps rationalize the more error-prone synthesis opposite the lesion by hpol η. PMID:27694439

Turbine vane segment and impingement insert configuration for fail-safe impingement insert retention

DOEpatents

Burdgick, Steven Sebastian; Kellock, Iain Robertson

2003-05-13

An impingement insert sleeve is provided that is adapted to be disposed in a coolant cavity defined through a stator vane. The insert has a generally open inlet end and first and second pairs of diametrically opposed side walls, and at least one fail-safe tab defined at a longitudinal end of the insert for limiting radial displacement of the insert with respect to the stator vane.

The Effect of Suture Anchor Insertion Angle on Calcaneus Pullout Strength: Challenging the Deadman's Angle.

PubMed

Weiss, William M; Saucedo, Ramon P; Robinson, John D; Lo, Chung-Chieh Jason; Morris, Randal P; Panchbhavi, Vinod K

2017-10-01

Refractory cases of Achilles tendinopathy amenable to surgery may include reattachment of the tendon using suture anchors. However, there is paucity of information describing the optimal insertion angle to maximize the tendon footprint and anchor stability in the calcaneus. The purpose of this investigation is to compare the fixation strength of suture anchors inserted at 90° and 45° (the Deadman's angle) relative to the primary compressive trabeculae of the calcaneus. A total of 12 matched pairs of adult cadaveric calcanei were excised and potted to approximate their alignment in vivo. Each pair was implanted with 5.5-mm bioabsorbable suture anchors placed either perpendicular (90°) or oblique (45°) to the primary compressive trabeculae. A tensile load was applied until failure of anchor fixation. Differences in failure load and stiffness between anchor fixation angles were determined by paired t-tests. No significant differences were detected between perpendicular and oblique suture anchor insertion relative to primary compressive trabeculae in terms of load to failure or stiffness. This investigation suggests that the fixation strength of suture anchors inserted perpendicular to the primary compression trabeculae and at the Deadman's angle are possibly comparable. Biomechanical comparison study.

Two novel mutations in the Norrie disease gene associated with the classical ocular phenotype.

PubMed

Caballero, M; Veske, A; Rodriguez, J J; Lugo, N; Schroeder, B; Hesse, L; Gal, A

1996-12-01

Norrie disease (ND) is a rare X-linked recessive disorder characterized by congenital blindness due to a degenerative and proliferative dysplasia of the neuroretina and, occasionally, by deafness and mental handicap. Here, we report two novel mutations detected in patients with the classical eye features of ND. Both the one-base pair insertion in exon II (544/545 insA) and the two-base pair deletion in the start codon (418delTG) of the ND gene predict a functional 'null allele', i.e. the complete absence of the corresponding gene product.

Mispairs with Watson-Crick base-pair geometry observed in ternary complexes of an RB69 DNA polymerase variant.

PubMed

Xia, Shuangluo; Konigsberg, William H

2014-04-01

Recent structures of DNA polymerase complexes with dGMPCPP/dT and dCTP/dA mispairs at the insertion site have shown that they adopt Watson-Crick geometry in the presence of Mn(2+) indicating that the tautomeric or ionization state of the base has changed. To see whether the tautomeric or ionization state of base-pair could be affected by its microenvironment, we determined 10 structures of an RB69 DNA polymerase quadruple mutant with dG/dT or dT/dG mispairs at position n-1 to n-5 of the Primer/Template duplex. Different shapes of the mispairs, including Watson-Crick geometry, have been observed, strongly suggesting that the local environment of base-pairs plays an important role in their tautomeric or ionization states. © 2014 The Protein Society.

Conformational Dynamics inside Amino-Terminal Disease Hotspot of Ryanodine Receptor

PubMed Central

Zhong, Xiaowei; Liu, Ying; Zhu, Li; Meng, Xing; Wang, Ruiwu; Van Petegem, Filip; Wagenknecht, Terence; Wayne Chen, S. R.; Liu, Zheng

2013-01-01

Summary The N-terminal region of both skeletal and cardiac ryanodine receptor is a disease mutation hotspot. Recently, a crystal structure of the RyR1 fragment (residues 1-559) was solved. This N-terminal structure contains three separate domains, A, B, and C, and was docked into a central vestibule in a full-length RyR1 cryo-EM map. Here we reconstructed 3D cryo-EM structures of two GFP-tagged RyR2s with GFP inserted after residue Glu-310 and Ser-437, respectively. The structures of RyR2E310-GFP and RyR2S437-GFP displayed an extra mass on domain B and C, directly validating the predicted docking model. Next, we revealed domain movements in molecular dynamics flexible fitting models in both the closed and open state cryo-EM maps. To further probe the conformational changes, we generated FRET pairs by inserting CFP or YFP in two selected domains, FRET studies of three dual-insertion pairs and three co-expressed single-insertion pairs showed the dynamic structural changes within the N-terminal domains. PMID:24139989

Alu repeat discovery and characterization within human genomes

PubMed Central

Hormozdiari, Fereydoun; Alkan, Can; Ventura, Mario; Hajirasouliha, Iman; Malig, Maika; Hach, Faraz; Yorukoglu, Deniz; Dao, Phuong; Bakhshi, Marzieh; Sahinalp, S. Cenk; Eichler, Evan E.

2011-01-01

Human genomes are now being rapidly sequenced, but not all forms of genetic variation are routinely characterized. In this study, we focus on Alu retrotransposition events and seek to characterize differences in the pattern of mobile insertion between individuals based on the analysis of eight human genomes sequenced using next-generation sequencing. Applying a rapid read-pair analysis algorithm, we discover 4342 Alu insertions not found in the human reference genome and show that 98% of a selected subset (63/64) experimentally validate. Of these new insertions, 89% correspond to AluY elements, suggesting that they arose by retrotransposition. Eighty percent of the Alu insertions have not been previously reported and more novel events were detected in Africans when compared with non-African samples (76% vs. 69%). Using these data, we develop an experimental and computational screen to identify ancestry informative Alu retrotransposition events among different human populations. PMID:21131385

Entropy Beacon: A Hairpin-Free DNA Amplification Strategy for Efficient Detection of Nucleic Acids

PubMed Central

2015-01-01

Here, we propose an efficient strategy for enzyme- and hairpin-free nucleic acid detection called an entropy beacon (abbreviated as Ebeacon). Different from previously reported DNA hybridization/displacement-based strategies, Ebeacon is driven forward by increases in the entropy of the system, instead of free energy released from new base-pair formation. Ebeacon shows high sensitivity, with a detection limit of 5 pM target DNA in buffer and 50 pM in cellular homogenate. Ebeacon also benefits from the hairpin-free amplification strategy and zero-background, excellent thermostability from 20 °C to 50 °C, as well as good resistance to complex environments. In particular, based on the huge difference between the breathing rate of a single base pair and two adjacent base pairs, Ebeacon also shows high selectivity toward base mutations, such as substitution, insertion, and deletion and, therefore, is an efficient nucleic acid detection method, comparable to most reported enzyme-free strategies. PMID:26505212

Selfish DNA in protein-coding genes of Rickettsia.

PubMed

Ogata, H; Audic, S; Barbe, V; Artiguenave, F; Fournier, P E; Raoult, D; Claverie, J M

2000-10-13

Rickettsia conorii, the aetiological agent of Mediterranean spotted fever, is an intracellular bacterium transmitted by ticks. Preliminary analyses of the nearly complete genome sequence of R. conorii have revealed 44 occurrences of a previously undescribed palindromic repeat (150 base pairs long) throughout the genome. Unexpectedly, this repeat was found inserted in-frame within 19 different R. conorii open reading frames likely to encode functional proteins. We found the same repeat in proteins of other Rickettsia species. The finding of a mobile element inserted in many unrelated genes suggests the potential role of selfish DNA in the creation of new protein sequences.

High temperature penetrator assembly with bayonet plug and ramp-activated lock

NASA Technical Reports Server (NTRS)

Wood, K. E. (Inventor)

1982-01-01

A penetration apparatus, for very high temperature applications in which a base plug is inserted into an opening through a bulkhead is described. The base plug has a head shape and is seated against the highest temperature surface of the bulkhead, which may be the skin of the nose cone or other part of a space vehicle intended for nondestructive atmospheric reentry. From the second side of the bulkhead at which the less severe environment is extant, a bayonet plug is inserted into the base plug and engages an internal shoulder at about 90 deg rotation. The bayonet plug has an integral flanged portion and a pair of ramping washers which are located between the flange and the second bulkhead surface with a spacing washer as necessary.

Effect of therapeutic footwear on foot reulceration in patients with diabetes: a randomized controlled trial.

PubMed

Reiber, Gayle E; Smith, Douglas G; Wallace, Carolyn; Sullivan, Katrina; Hayes, Shane; Vath, Christy; Maciejewski, Matthew L; Yu, Onchee; Heagerty, Patrick J; LeMaster, Joseph

2002-05-15

Many people with diabetes experience lower-limb ulcers. Footwear has been implicated as a primary cause of foot ulcers, yet research is limited on the efficacy of shoe and insert combinations to prevent reulceration. To determine whether extra-depth and -width therapeutic shoes used with 2 types of inserts reduce reulceration in diabetic individuals with a history of foot ulcer. Randomized clinical trial of 400 diabetes patients with history of foot ulcer in 2 Washington State health care organizations who did not require custom shoes for foot deformity and were enrolled between August 1997 and December 1998 and followed up for 2 years. Data collected at regular intervals documented physical, foot, and diabetes characteristics; footwear use; foot lesions; and ulcers. Participants were randomly assigned to receive 3 pairs of therapeutic shoes and 3 pairs of customized medium-density cork inserts with a neoprene closed-cell cover (n = 121); to receive 3 pairs of therapeutic shoes and 3 pairs of prefabricated, tapered polyurethane inserts with a brushed nylon cover (n = 119); or to wear their usual footwear (controls; n = 160). Foot reulceration, compared among the 3 groups. Two-year cumulative reulceration incidence across the 3 groups was low: 15% in the cork-insert group, 14% in the prefabricated-insert group, and 17% in controls. In the intent-to-treat analysis, patients assigned to therapeutic shoes did not have a significantly lower risk of reulceration compared with controls (risk ratio [RR] for the cork-insert group, 0.88; 95% confidence interval [CI], 0.51-1.52 and RR the for prefabricated-insert group, 0.85; 95% CI, 0.48-1.48). All ulcer episodes in patients assigned to therapeutic shoes and 88% wearing nonstudy shoes occurred in patients with foot insensitivity. This study of persons without severe foot deformity does not provide evidence to support widespread dispensing of therapeutic shoes and inserts to diabetic patients with a history of foot ulcer. Study shoes and custom cork or preformed polyurethane inserts conferred no significant ulcer reduction compared with control footwear. This study suggests that careful attention to foot care by health care professionals may be more important than therapeutic footwear but does not negate the possibility that special footwear is beneficial in persons with diabetes who do not receive such close attention to foot care by their health care providers or in individuals with severe foot deformities.

Effects of the adenovirus 2 late promoter on simian virus 40 transcription and replication.

PubMed Central

Grass, D S; Manley, J L

1986-01-01

A 100-base-pair fragment of adenovirus 2 (Ad2) DNA encompassing the major late transcriptional promoter was inserted into the simian virus 40 (SV40) late promoter region at SV40 nucleotide 294 to study the effects of a strong TATA box-containing promoter on SV40 late transcription. pSVAdE contains the insert in an orientation such that it would promote transcription towards the origin and early region of SV40, while the insert is in the opposite orientation in pSVAdL. Nuclease S1 analysis with 5'-end-labeled probes showed that in cells transfected with pSVAdE, the late mRNA initiation sites are essentially the same as in wild type, demonstrating that an insert of 100 base pairs can have no effect on utilization of the SV40 late start sites. In pSVAdL-transfected cells, however, the major late viral initiation site is now in the insert at +1 with respect to the Ad2 major late cap site. However, all of the SV40 initiation sites are still utilized and with the same efficiency relative to each other as in wild type. Thus, it appears that the Ad2 late promoter and the SV40 late promoter can function independently on the same DNA molecule, even when one promoter is embedded within the other. By using cytosine arabinoside to block DNA replication and thereby inhibit the onset of late expression, it has been shown that both the Ad2 late promoter and the SV40 late promoter have similar requirement for DNA replication in this context. In addition, pSVAdL showed dramatically diminished virus viability and VPI expression compared with both wildtype and pSVAdE. Possible explanations for this unexpected finding are discussed. Images PMID:3001338

Genetic Control of Replication through N1-methyladenine in Human Cells*

PubMed Central

Conde, Juan; Yoon, Jung-Hoon; Roy Choudhury, Jayati; Prakash, Louise; Prakash, Satya

2015-01-01

N1-methyl adenine (1-MeA) is formed in DNA by reaction with alkylating agents and naturally occurring methyl halides. The 1-MeA lesion impairs Watson-Crick base pairing and blocks normal DNA replication. Here we identify the translesion synthesis (TLS) DNA polymerases (Pols) required for replicating through 1-MeA in human cells and show that TLS through this lesion is mediated via three different pathways in which Pols ι and θ function in one pathway and Pols η and ζ, respectively, function in the other two pathways. Our biochemical studies indicate that in the Polι/Polθ pathway, Polι would carry out nucleotide insertion opposite 1-MeA from which Polθ would extend synthesis. In the Polη pathway, this Pol alone would function at both the nucleotide insertion and extension steps of TLS, and in the third pathway, Polζ would extend from the nucleotide inserted opposite 1-MeA by an as yet unidentified Pol. Whereas by pushing 1-MeA into the syn conformation and by forming Hoogsteen base pair with the T residue, Polι would carry out TLS opposite 1-MeA, the ability of Polη to replicate through 1-MeA suggests that despite its need for Watson-Crick hydrogen bonding, Polη can stabilize the adduct in its active site. Remarkably, even though Pols η and ι are quite error-prone at inserting nucleotides opposite 1-MeA, TLS opposite this lesion in human cells occurs in a highly error-free fashion. This suggests that the in vivo fidelity of TLS Pols is regulated by factors such as post-translational modifications, protein-protein interactions, and possibly others. PMID:26491020

Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides.

PubMed

Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu

2004-03-01

A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non-Watson-Crick base pair in SECIS element plays an important role in the selenocysteine expression by UGA codon.

Child Development and Structural Variation in the Human Genome

ERIC Educational Resources Information Center

Zhang, Ying; Haraksingh, Rajini; Grubert, Fabian; Abyzov, Alexej; Gerstein, Mark; Weissman, Sherman; Urban, Alexander E.

2013-01-01

Structural variation of the human genome sequence is the insertion, deletion, or rearrangement of stretches of DNA sequence sized from around 1,000 to millions of base pairs. Over the past few years, structural variation has been shown to be far more common in human genomes than previously thought. Very little is currently known about the effects…

Cloning of a promoter-like soybean DNA sequence responding to IAA induction in Escherichia coli K12.

PubMed

Kline, E L; Chiang, S J; Lattora, D; Chaung, W

1992-02-01

We have constructed a soybean genomic DNA library in Escherichia coli K12 strain KC13 using plasmid pPV33, which consists of a promoter-less tetracycline resistance (Tcr) gene. A recombinant clone, KC13(pAU-SB1)+, was obtained by selecting for resistance to tetracycline in the presence of indole-3-acetic acid (IAA). Restriction enzyme cleavage and Southern hybridization analysis revealed that the pAU-SB1 plasmid has a 250 bp soybean DNA insert fused with the Tcr gene. In the presence of a selected group of auxins, induction of the Tcr phenotype and mRNA synthesis of the Tcr gene are observed only in KC13(pAU-SB1)+ cultures. On the other hand, induction of the Tcr phenotype and mRNA synthesis of the Tcr gene are absent in cells harboring the cloning vector pPV33 or a recombinant plasmid containing the 250 bp insert in the reverse orientation, pAU-SB1ro. This demonstrated a need for the insertion of the 250 bp soybean DNA and the specificity of its orientation in response to IAA induction. The start point of mRNA transcription in response to IAA, IBA, IPA, 2,4,5-T, and a-NAP is at base pair -96 or -95 upstream of the translational start site of the Tcr gene and base pair -98 with 2,4-D.

Structure of yeast Argonaute with guide RNA

PubMed Central

Nakanishi, Kotaro; Weinberg, David E.; Bartel, David P.; Patel, Dinshaw J.

2012-01-01

The RNA-induced silencing complex, comprising Argonaute and guide RNA, mediates RNA interference. Here we report the 3.2 Å crystal structure of Kluyveromyces Argonaute (KpAGO) fortuitously complexed with guide RNA originating from small-RNA duplexes autonomously loaded and processed by recombinant KpAGO. Despite their diverse sequences, guide-RNA nucleotides 1–8 are positioned similarly, with sequence-independent contacts to bases, phosphates and 2′-hydroxyl groups pre-organizing the backbone of nucleotides 2–8 in a near–A-form conformation. Compared with prokaryotic Argonautes, KpAGO has numerous surface-exposed insertion segments, with a cluster of conserved insertions repositioning the N domain to enable full propagation of guide–target pairing. Compared with Argonautes in inactive conformations, KpAGO has a hydrogen-bond network that stabilizes an expanded and repositioned loop, which inserts an invariant glutamate into the catalytic pocket. Mutation analyses and analogies to Ribonuclease H indicate that insertion of this glutamate finger completes a universally conserved catalytic tetrad, thereby activating Argonaute for RNA cleavage. PMID:22722195

NDI and DAN DNA: nucleic acid-directed assembly of NDI and DAN.

PubMed

Ikkanda, Brian A; Samuel, Stevan A; Iverson, Brent L

2014-03-07

Two novel DNA base surrogate phosphoramidites 1 and 2, based upon relatively electron-rich 1,5-dialkoxynaphthalene (DAN) and relatively electron-deficient 1,4,5,8-naphthalenetetracarboxylic diimide (NDI), respectively, were designed, synthesized, and incorporated into DNA oligonucleotide strands. The DAN and NDI artificial DNA bases were inserted within a three-base-pair region within the interior of a 12-mer oligonucleotide duplex in various sequential arrangements and investigated with CD spectroscopy and UV melting curve analysis. The CD spectra of the modified duplexes indicated B-form DNA topology. Melting curve analyses revealed trends in DNA duplex stability that correlate with the known association of DAN and NDI moieties in aqueous solution as well as the known favorable interactions between NDI and natural DNA base pairs. This demonstrates that DNA duplex stability and specificity can be driven by the electrostatic complementarity between DAN and NDI. In the most favorable case, an NDI-DAN-NDI arrangement in the middle of the DNA duplex was found to be approximately as stabilizing as three A-T base pairs.

Structural and Kinetic Analysis of Nucleoside Triphosphate Incorporation Opposite an Abasic Site by Human Translesion DNA Polymerase η

DOE Office of Scientific and Technical Information (OSTI.GOV)

Patra, Amritaj; Zhang, Qianqian; Lei, Li

2015-02-09

The most prevalent lesion in DNA is an abasic site resulting from glycolytic cleavage of a base. In a number of cellular studies, abasic sites preferentially code for dATP insertion (the “A rule”). In some cases frameshifts are also common. X-ray structures with abasic sites in oligonucleotides have been reported for several microbial and human DNA polymerases (pols), e.g. Dpo4, RB69, KlenTaq, yeast pol ι, human (h) pol ι, and human pol β. We reported previously that hpol η is a major pol involved in abasic site bypass (Choi, J.-Y., Lim, S., Kim, E. J., Jo, A., and Guengerich, F.more » P. (2010 J. Mol. Biol. 404, 34–44). hpol η inserted all four dNTPs in steady-state and pre-steady-state assays, preferentially inserting A and G. In LC-MS analysis of primer-template pairs, A and G were inserted but little C or T was inserted. Frameshifts were observed when an appropriate pyrimidine was positioned 5' to the abasic site in the template. In x-ray structures of hpol η with a non-hydrolyzable analog of dATP or dGTP opposite an abasic site, H-bonding was observed between the phosphate 5' to the abasic site and water H-bonded to N1 and N6 of A and N1 and O6 of G nucleoside triphosphate analogs, offering an explanation for what appears to be a “purine rule.” A structure was also obtained for an A inserted and bonded in the primer opposite the abasic site, but it did not pair with a 5' T in the template. Finally, we conclude that hpol η, a major copying enzyme with abasic sites, follows a purine rule, which can also lead to frameshifts. The phenomenon can be explained with H-bonds.« less

Misalignment Accommodating Connector Assembly

NASA Technical Reports Server (NTRS)

Stemper, Jack S. (Inventor)

1998-01-01

Misalignment accommodating connector assembly for removably connecting first and second objects which may comprise: a first connector subassembly having an arm member extending therefrom transversely through which is provided a tubular member; a second connector subassembly having a pair of spaced apart arm members each of which is provided with a transversely disposed coaxially aligned semi-cylindrical recess for receiving opposite ends of the first connector tubular member upon lateral insertion of the first connector arm member into the space between the second connector pair of arm members. An axially extendable and contractible fastener subassembly carried by the first connector tubular member is extendable to allow insertion or removal of the first connector arm member into or from the space between the second connector pair of arm members and contractible when the opposite ends of the tubular member are substantially received by the semi-cylindrical recesses of the pair of spaced apart arm members to lock the first and second connector subassemblies together.

Replication infidelity via a mismatch with Watson-Crick geometry.

PubMed

Bebenek, Katarzyna; Pedersen, Lars C; Kunkel, Thomas A

2011-02-01

In describing the DNA double helix, Watson and Crick suggested that "spontaneous mutation may be due to a base occasionally occurring in one of its less likely tautomeric forms." Indeed, among many mispairing possibilities, either tautomerization or ionization of bases might allow a DNA polymerase to insert a mismatch with correct Watson-Crick geometry. However, despite substantial progress in understanding the structural basis of error prevention during polymerization, no DNA polymerase has yet been shown to form a natural base-base mismatch with Watson-Crick-like geometry. Here we provide such evidence, in the form of a crystal structure of a human DNA polymerase λ variant poised to misinsert dGTP opposite a template T. All atoms needed for catalysis are present at the active site and in positions that overlay with those for a correct base pair. The mismatch has Watson-Crick geometry consistent with a tautomeric or ionized base pair, with the pH dependence of misinsertion consistent with the latter. The results support the original idea that a base substitution can originate from a mismatch having Watson-Crick geometry, and they suggest a common catalytic mechanism for inserting a correct and an incorrect nucleotide. A second structure indicates that after misinsertion, the now primer-terminal G • T mismatch is also poised for catalysis but in the wobble conformation seen in other studies, indicating the dynamic nature of the pathway required to create a mismatch in fully duplex DNA.

Gene replacements and insertions in rice by intron targeting using CRISPR-Cas9.

PubMed

Li, Jun; Meng, Xiangbing; Zong, Yuan; Chen, Kunling; Zhang, Huawei; Liu, Jinxing; Li, Jiayang; Gao, Caixia

2016-09-12

Sequence-specific nucleases have been exploited to create targeted gene knockouts in various plants(1), but replacing a fragment and even obtaining gene insertions at specific loci in plant genomes remain a serious challenge. Here, we report efficient intron-mediated site-specific gene replacement and insertion approaches that generate mutations using the non-homologous end joining (NHEJ) pathway using the clustered regularly interspaced short palindromic repeats (CRISPR)-CRISPR-associated protein 9 (Cas9) system. Using a pair of single guide RNAs (sgRNAs) targeting adjacent introns and a donor DNA template including the same pair of sgRNA sites, we achieved gene replacements in the rice endogenous gene 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) at a frequency of 2.0%. We also obtained targeted gene insertions at a frequency of 2.2% using a sgRNA targeting one intron and a donor DNA template including the same sgRNA site. Rice plants harbouring the OsEPSPS gene with the intended substitutions were glyphosate-resistant. Furthermore, the site-specific gene replacements and insertions were faithfully transmitted to the next generation. These newly developed approaches can be generally used to replace targeted gene fragments and to insert exogenous DNA sequences into specific genomic sites in rice and other plants.

Replication infidelity via a mismatch with Watson–Crick geometry

PubMed Central

Bebenek, Katarzyna; Pedersen, Lars C.; Kunkel, Thomas A.

2011-01-01

In describing the DNA double helix, Watson and Crick suggested that “spontaneous mutation may be due to a base occasionally occurring in one of its less likely tautomeric forms.” Indeed, among many mispairing possibilities, either tautomerization or ionization of bases might allow a DNA polymerase to insert a mismatch with correct Watson–Crick geometry. However, despite substantial progress in understanding the structural basis of error prevention during polymerization, no DNA polymerase has yet been shown to form a natural base–base mismatch with Watson–Crick-like geometry. Here we provide such evidence, in the form of a crystal structure of a human DNA polymerase λ variant poised to misinsert dGTP opposite a template T. All atoms needed for catalysis are present at the active site and in positions that overlay with those for a correct base pair. The mismatch has Watson–Crick geometry consistent with a tautomeric or ionized base pair, with the pH dependence of misinsertion consistent with the latter. The results support the original idea that a base substitution can originate from a mismatch having Watson–Crick geometry, and they suggest a common catalytic mechanism for inserting a correct and an incorrect nucleotide. A second structure indicates that after misinsertion, the now primer-terminal G•T mismatch is also poised for catalysis but in the wobble conformation seen in other studies, indicating the dynamic nature of the pathway required to create a mismatch in fully duplex DNA. PMID:21233421

Evaluation of dual-tip micromanometers during 21-day implantation in goats

NASA Technical Reports Server (NTRS)

Reister, C. A.; Koenig, S. C.; Schaub, J. D.; Ewert, D. L.; Swope, R. D.; Latham, R. D.; Fanton, J. W.; Convertino, V. A. (Principal Investigator)

1998-01-01

Investigative research efforts using a cardiovascular model required the determination of central circulatory haemodynamic and arterial system parameters for the evaluation of cardiovascular performance. These calculations required continuous beat-to-beat measurement of pressure within the four chambers of the heart and great vessels. Sensitivity and offset drift, longevity, and sources of error for eight 3F dual-tipped micromanometers were determined during 21 days of implantation in goats. Subjects were instrumented with pairs of chronically implanted fluid-filled access catheters in the left and right ventricles, through which dual-tipped (test) micromanometers were chronically inserted and single-tip (standard) micromanometers were acutely inserted. Acutely inserted sensors were calibrated daily and measured pressures were compared in vivo to the chronically inserted sensors. Comparison of the pre- and post-gain calibration of the chronically inserted sensors showed a mean sensitivity drift of 1.0 +/- 0.4% (99% confidence, n = 9 sensors) and mean offset drift of 5.0 +/- 1.5 mmHg (99% confidence, n = 9 sensors). Potential sources of error for these drifts were identified, and included measurement system inaccuracies, temperature drift, hydrostatic column gradients, and dynamic pressure changes. Based upon these findings, we determined that these micromanometers may be chronically inserted in high-pressure chambers for up to 17 days with an acceptable error, but should be limited to acute (hours) insertions in low-pressure applications.

New t-gap insertion-deletion-like metrics for DNA hybridization thermodynamic modeling.

PubMed

D'yachkov, Arkadii G; Macula, Anthony J; Pogozelski, Wendy K; Renz, Thomas E; Rykov, Vyacheslav V; Torney, David C

2006-05-01

We discuss the concept of t-gap block isomorphic subsequences and use it to describe new abstract string metrics that are similar to the Levenshtein insertion-deletion metric. Some of the metrics that we define can be used to model a thermodynamic distance function on single-stranded DNA sequences. Our model captures a key aspect of the nearest neighbor thermodynamic model for hybridized DNA duplexes. One version of our metric gives the maximum number of stacked pairs of hydrogen bonded nucleotide base pairs that can be present in any secondary structure in a hybridized DNA duplex without pseudoknots. Thermodynamic distance functions are important components in the construction of DNA codes, and DNA codes are important components in biomolecular computing, nanotechnology, and other biotechnical applications that employ DNA hybridization assays. We show how our new distances can be calculated by using a dynamic programming method, and we derive a Varshamov-Gilbert-like lower bound on the size of some of codes using these distance functions as constraints. We also discuss software implementation of our DNA code design methods.

Use of low-coverage, large-insert, short-read data for rapid and accurate generation of enhanced-quality draft Pseudomonas genome sequences.

PubMed

O'Brien, Heath E; Gong, Yunchen; Fung, Pauline; Wang, Pauline W; Guttman, David S

2011-01-01

Next-generation genomic technology has both greatly accelerated the pace of genome research as well as increased our reliance on draft genome sequences. While groups such as the Genomics Standards Consortium have made strong efforts to promote genome standards there is a still a general lack of uniformity among published draft genomes, leading to challenges for downstream comparative analyses. This lack of uniformity is a particular problem when using standard draft genomes that frequently have large numbers of low-quality sequencing tracts. Here we present a proposal for an "enhanced-quality draft" genome that identifies at least 95% of the coding sequences, thereby effectively providing a full accounting of the genic component of the genome. Enhanced-quality draft genomes are easily attainable through a combination of small- and large-insert next-generation, paired-end sequencing. We illustrate the generation of an enhanced-quality draft genome by re-sequencing the plant pathogenic bacterium Pseudomonas syringae pv. phaseolicola 1448A (Pph 1448A), which has a published, closed genome sequence of 5.93 Mbp. We use a combination of Illumina paired-end and mate-pair sequencing, and surprisingly find that de novo assemblies with 100x paired-end coverage and mate-pair sequencing with as low as low as 2-5x coverage are substantially better than assemblies based on higher coverage. The rapid and low-cost generation of large numbers of enhanced-quality draft genome sequences will be of particular value for microbial diagnostics and biosecurity, which rely on precise discrimination of potentially dangerous clones from closely related benign strains.

Gas turbine nozzle vane insert and methods of installation

DOEpatents

Miller, William John; Predmore, Daniel Ross; Placko, James Michael

2002-01-01

A pair of hollow elongated insert bodies are disposed in one or more of the nozzle vane cavities of a nozzle stage of a gas turbine. Each insert body has an outer wall portion with apertures for impingement-cooling of nozzle wall portions in registration with the outer wall portion. The insert bodies are installed into the cavity separately and spreaders flex the bodies toward and to engage standoffs against wall portions of the nozzle whereby the designed impingement gap between the outer wall portions of the insert bodies and the nozzle wall portions is achieved. The spreaders are secured to the inner wall portions of the insert bodies and the bodies are secured to one another and to the nozzle vane by welding or brazing.

A nucleotide-analogue-induced gain of function corrects the error-prone nature of human DNA polymerase iota.

PubMed

Ketkar, Amit; Zafar, Maroof K; Banerjee, Surajit; Marquez, Victor E; Egli, Martin; Eoff, Robert L

2012-06-27

Y-family DNA polymerases participate in replication stress and DNA damage tolerance mechanisms. The properties that allow these enzymes to copy past bulky adducts or distorted template DNA can result in a greater propensity for them to make mistakes. Of the four human Y-family members, human DNA polymerase iota (hpol ι) is the most error-prone. In the current study, we elucidate the molecular basis for improving the fidelity of hpol ι through use of the fixed-conformation nucleotide North-methanocarba-2'-deoxyadenosine triphosphate (N-MC-dATP). Three crystal structures were solved of hpol ι in complex with DNA containing a template 2'-deoxythymidine (dT) paired with an incoming dNTP or modified nucleotide triphosphate. The ternary complex of hpol ι inserting N-MC-dATP opposite dT reveals that the adenine ring is stabilized in the anti orientation about the pseudo-glycosyl torsion angle, which mimics precisely the mutagenic arrangement of dGTP:dT normally preferred by hpol ι. The stabilized anti conformation occurs without notable contacts from the protein but likely results from constraints imposed by the bicyclo[3.1.0]hexane scaffold of the modified nucleotide. Unmodified dATP and South-MC-dATP each adopt syn glycosyl orientations to form Hoogsteen base pairs with dT. The Hoogsteen orientation exhibits weaker base-stacking interactions and is less catalytically favorable than anti N-MC-dATP. Thus, N-MC-dATP corrects the error-prone nature of hpol ι by preventing the Hoogsteen base-pairing mode normally observed for hpol ι-catalyzed insertion of dATP opposite dT. These results provide a previously unrecognized means of altering the efficiency and the fidelity of a human translesion DNA polymerase.

A nucleotide analogue induced gain of function corrects the error-prone nature of human DNA polymerase iota

PubMed Central

Ketkar, Amit; Zafar, Maroof K.; Banerjee, Surajit; Marquez, Victor E.; Egli, Martin; Eoff, Robert L

2012-01-01

Y-family DNA polymerases participate in replication stress and DNA damage tolerance mechanisms. The properties that allow these enzymes to copy past bulky adducts or distorted template DNA can result in a greater propensity for them to make mistakes. Of the four human Y-family members, human DNA polymerase iota (hpol ι) is the most error-prone. In the current study, we elucidate the molecular basis for improving the fidelity of hpol ι through use of the fixed-conformation nucleotide North-methanocarba-2′-deoxyadenosine triphosphate (N-MC-dATP). Three crystal structures were solved of hpol ι in complex with DNA containing a template 2′-deoxythymidine (dT) paired with an incoming dNTP or modified nucleotide triphosphate. The ternary complex of hpol ι inserting N-MC-dATP opposite dT reveals that the adenine ring is stabilized in the anti orientation about the pseudo-glycosyl torsion angle (χ), which mimics precisely the mutagenic arrangement of dGTP:dT normally preferred by hpol ι. The stabilized anti conformation occurs without notable contacts from the protein but likely results from constraints imposed by the bicyclo[3.1.0]hexane scaffold of the modified nucleotide. Unmodified dATP and South-MC-dATP each adopt syn glycosyl orientations to form Hoogsteen base pairs with dT. The Hoogsteen orientation exhibits weaker base stacking interactions and is less catalytically favorable than anti N-MC-dATP. Thus, N-MC-dATP corrects the error-prone nature of hpol ι by preventing the Hoogsteen base-pairing mode normally observed for hpol ι-catalyzed insertion of dATP opposite dT. These results provide a previously unrecognized means of altering the efficiency and the fidelity of a human translesion DNA polymerase. PMID:22632140

Characterization of a highly polymorphic region 5′ to JH in the human immunoglobulin heavy chain

PubMed Central

Silva, Alcino J.; Johnson, John P.; White, Raymond L.

1987-01-01

A cloned DNA segment 1.25 kilobases (kb) upstream from the joining segments of the human heavy chain immunoglobulin gene revealed extensive polymorphic variation at this locus, and the polymorphic pattern was stably transmitted to the next generation. Genomic restriction analysis showed that the polymorphism was caused by insertions/deletions within an MspI/BamHI fragment. Sequencing of one allele, 848 base pairs (bp) long, revealed eleven 50-base-pair tandem repeats. A second allele, 648 bp long, was cloned from a human genomic cosmid library, sequenced, and found to contain four fewer repeats than the first allele. A survey of 186 chromosomes from unrelated individuals of primarily northern European descent revealed at least six alleles. Images PMID:2884636

Mitochondrial Enzyme Plays Critical Role in Chemotherapy-Induced Heart Damage | Center for Cancer Research

Cancer.gov

Doxorubicin (DOX) is an effective drug for treating cancers ranging from leukemia and lymphoma to solid tumors, such as breast cancer. DOX kills dividing cells in two ways: inserting between the base pairs of DNA and trapping a complex of DNA and an enzyme that cuts DNA, topoisomerase 2α, preventing DNA repair. However, DOX also causes congestive heart failure in about 30

Protective effects of biodegradable collagen implants on thinned sclera after strabismus surgery: a paired-eye study.

PubMed

Yoo, Tae Keun; Han, Sueng-Han; Han, Jinu

2017-12-01

To determine the efficacy of a biodegradable Ologen (Aeon Astron Europe BV, Leiden, The Netherlands) collagen matrix in reducing the blue color change due to exposed thinned sclera after strabismus surgery. Fourteen patients with intermittent exotropia undergoing symmetric bilateral lateral rectus recession surgery were included in this prospective, randomized, paired-eye controlled study. In each patient, Ologen was implanted at the original rectus insertion site in one randomly selected eye; the other eye underwent conventional surgery. Ologen was inserted under the conjunctiva without suturing, covering the muscle insertion site. Conjunctival color change was analyzed using computer-based image analysis immediately and 1 week, 1 month, and 3 months postoperatively. Slit-lamp photographs of each eye were evaluated using contrast limited adaptive histogram equalization (CLAHE), Canny edge, and the RGB (red-green-blue) model. Secondary outcomes were conjunctival and sclera thickness 3 months postoperatively determined by anterior segment optical coherence tomography. Immediately and 1 week postoperatively all color models showed no significant differences between Ologen-implanted and control eyes. Three months postoperatively, Ologen-implanted eyes exhibited significantly lower CLAHE (P = 0.041) and RGB model blue color (P = 0.008) values than control eyes. Canny edge (P = 0.061) and RGB model red color (P = 0.152) values did not differ between eyes. Conjunctival stroma and episcleral complex thickness was greater in Ologen-implanted eyes than in controls (P = 0.001). Blue color change was significantly less noticeable in Ologen-implanted eyes than in controls. Thus, Ologen implantation helps prevent visible blue sclera at the original rectus insertion site after lateral rectus recession. Copyright © 2017 American Association for Pediatric Ophthalmology and Strabismus. Published by Elsevier Inc. All rights reserved.

The crystal structure of an oligo(U):pre-mRNA duplex from a trypanosome RNA editing substrate

PubMed Central

Mooers, Blaine H.M.; Singh, Amritanshu

2011-01-01

Guide RNAs bind antiparallel to their target pre-mRNAs to form editing substrates in reaction cycles that insert or delete uridylates (Us) in most mitochondrial transcripts of trypanosomes. The 5′ end of each guide RNA has an anchor sequence that binds to the pre-mRNA by base-pair complementarity. The template sequence in the middle of the guide RNA directs the editing reactions. The 3′ ends of most guide RNAs have ∼15 contiguous Us that bind to the purine-rich unedited pre-mRNA upstream of the editing site. The resulting U-helix is rich in G·U wobble base pairs. To gain insights into the structure of the U-helix, we crystallized 8 bp of the U-helix in one editing substrate for the A6 mRNA of Trypanosoma brucei. The fragment provides three samples of the 5′-AGA-3′/5′-UUU-3′ base-pair triple. The fusion of two identical U-helices head-to-head promoted crystallization. We obtained X-ray diffraction data with a resolution limit of 1.37 Å. The U-helix had low and high twist angles before and after each G·U wobble base pair; this variation was partly due to shearing of the wobble base pairs as revealed in comparisons with a crystal structure of a 16-nt RNA with all Watson–Crick base pairs. Both crystal structures had wider major grooves at the junction between the poly(U) and polypurine tracts. This junction mimics the junction between the template helix and the U-helix in RNA-editing substrates and may be a site of major groove invasion by RNA editing proteins. PMID:21878548

High-Throughput Analysis of T-DNA Location and Structure Using Sequence Capture.

PubMed

Inagaki, Soichi; Henry, Isabelle M; Lieberman, Meric C; Comai, Luca

2015-01-01

Agrobacterium-mediated transformation of plants with T-DNA is used both to introduce transgenes and for mutagenesis. Conventional approaches used to identify the genomic location and the structure of the inserted T-DNA are laborious and high-throughput methods using next-generation sequencing are being developed to address these problems. Here, we present a cost-effective approach that uses sequence capture targeted to the T-DNA borders to select genomic DNA fragments containing T-DNA-genome junctions, followed by Illumina sequencing to determine the location and junction structure of T-DNA insertions. Multiple probes can be mixed so that transgenic lines transformed with different T-DNA types can be processed simultaneously, using a simple, index-based pooling approach. We also developed a simple bioinformatic tool to find sequence read pairs that span the junction between the genome and T-DNA or any foreign DNA. We analyzed 29 transgenic lines of Arabidopsis thaliana, each containing inserts from 4 different T-DNA vectors. We determined the location of T-DNA insertions in 22 lines, 4 of which carried multiple insertion sites. Additionally, our analysis uncovered a high frequency of unconventional and complex T-DNA insertions, highlighting the needs for high-throughput methods for T-DNA localization and structural characterization. Transgene insertion events have to be fully characterized prior to use as commercial products. Our method greatly facilitates the first step of this characterization of transgenic plants by providing an efficient screen for the selection of promising lines.

DOE Office of Scientific and Technical Information (OSTI.GOV)

R Vasquez-Del Carpio; T Silverstein; S Lone

Exposure of DNA to UV radiation causes covalent linkages between adjacent pyrimidines. The most common lesion found in DNA from these UV-induced linkages is the cis-syn cyclobutane pyrimidine dimer. Human DNA polymerase {Kappa} (Pol{Kappa}), a member of the Y-family of DNA polymerases, is unable to insert nucleotides opposite the 3'T of a cis-syn T-T dimer, but it can efficiently extend from a nucleotide inserted opposite the 3'T of the dimer by another DNA polymerase. We present here the structure of human Pol{Kappa} in the act of inserting a nucleotide opposite the 5'T of the cis-syn T-T dimer. The structure revealsmore » a constrained active-site cleft that is unable to accommodate the 3'T of a cis-syn T-T dimer but is remarkably well adapted to accommodate the 5'T via Watson-Crick base pairing, in accord with a proposed role for Pol{Kappa} in the extension reaction opposite from cyclobutane pyrimidine dimers in vivo.« less

Effective oligonucleotide-mediated gene disruption in ES cells lacking the mismatch repair protein MSH3.

PubMed

Dekker, M; Brouwers, C; Aarts, M; van der Torre, J; de Vries, S; van de Vrugt, H; te Riele, H

2006-04-01

We have previously demonstrated that site-specific insertion, deletion or substitution of one or two nucleotides in mouse embryonic stem cells (ES cells) by single-stranded deoxyribo-oligonucleotides is several hundred-fold suppressed by DNA mismatch repair (MMR) activity. Here, we have investigated whether compound mismatches and larger insertions escape detection by the MMR machinery and can be effectively introduced in MMR-proficient cells. We identified several compound mismatches that escaped detection by the MMR machinery to some extent, but could not define general rules predicting the efficacy of complex base-pair substitutions. In contrast, we found that four-nucleotide insertions were largely subject to suppression by the MSH2/MSH3 branch of MMR and could be effectively introduced in Msh3-deficient cells. As these cells have no overt mutator phenotype and Msh3-deficient mice do not develop cancer, Msh3-deficient ES cells can be used for oligonucleotide-mediated gene disruption. As an example, we present disruption of the Fanconi anemia gene Fancf.

SU-F-J-205: Effect of Cone Beam Factor On Cone Beam CT Number Accuracy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yao, W; Hua, C; Farr, J

Purpose: To examine the suitability of a Catphan™ 700 phantom for image quality QA of a cone beam computed tomography (CBCT) system deployed for proton therapy. Methods: Catphan phantoms, particularly Catphan™ 504, are commonly used in image quality QA for CBCT. As a newer product, Catphan™ 700 offers more tissue equivalent inserts which may be useful for generating the electron density – CT number curve for CBCT based treatment planning. The sensitometry-and-geometry module used in Catphan™ 700 is located at the end of the phantom and after the resolution line pair module. In Catphan™ 504 the line pair module ismore » located at the end of the phantom and after the sensitometry-and-geometry module. To investigate the effect of difference in location on CT number accuracy due to the cone beam factor, we scanned the Catphan™ 700 with the central plane of CBCT at the center of the phantom, line pair and sensitometry-andgeometry modules of the phantom, respectively. The protocol head and thorax scan modes were used. For each position, scans were repeated 4 times. Results: For the head scan mode, the standard deviation (SD) of the CT numbers of each insert under 4 repeated scans was up to 20 HU, 11 HU, and 11 HU, respectively, for the central plane of CBCT located at the center of the phantom, line pair, and sensitometry-and-geometry modules of the phantom. The mean of the SD was 9.9 HU, 5.7 HU, and 5.9 HU, respectively. For the thorax mode, the mean of the SD was 4.5 HU, 4.4 HU, and 4.4 HU, respectively. The assessment of image quality based on resolution and spatial linearity was not affected by imaging location changes. Conclusion: When the Catphan™ 700 was aligned to the center of imaging region, the CT number accuracy test may not meet expectations. We recommend reconfiguration of the modules.« less

The Influence of Tactile Perception on Classification of Bone Tissue at Dental Implant Insertion.

PubMed

Linck, Gláucia Kelly Silva Barbosa; Ferreira, Geovane Miranda; De Oliveira, Rubelisa Cândido Gomes; Lindh, Christina; Leles, Cláudio Rodrigues; Ribeiro-Rotta, Rejane Faria

2016-06-01

Various ways of using the Lekholm and Zarb (L&Z) classification have added to the lack of scientific evidence of the effectiveness of this clinical method in the evaluation of implant treatment. The study aims to assess subjective jawbone classifications in patients referred for implant treatment, using L&Z classification with and without surgeon's hand perception at implant insertion. The association between bone type classifications and quantitative parameters of primary implant stability was also assessed. One hundred thirty-five implants were inserted using conventional loading protocol. Three surgeons classified bone quality at implant sites using two methods: one based on periapical and panoramic images (modified L&Z) and one based on the same images associated with the surgeon's tactile perception during drilling (original L&Z). Peak insertion torque and implant stability quotient (ISQ) were recorded. The modified and original L&Z were strongly correlated (rho = 0.79; p < .001); Wilcoxon signed-rank test showed no significant difference in the distribution of bone type classification between pairs using the two methods (p = .538). Spearman correlation tested the association between primary stability parameters and bone type classifications (-0.34 to -0.57 [p < .001]). Tactile surgical perception has a minor influence on rating of subjective bone type for dental implant treatment using the L&Z classification. © 2015 Wiley Periodicals, Inc.

Novel insertion mutation of ABCB1 gene in an ivermectin-sensitive Border Collie.

PubMed

Han, Jae-Ik; Son, Hyoung-Won; Park, Seung-Cheol; Na, Ki-Jeong

2010-12-01

P-glycoprotein (P-gp) is encoded by the ABCB1 gene and acts as an efflux pump for xenobiotics. In the Border Collie, a nonsense mutation caused by a 4-base pair deletion in the ABCB1 gene is associated with a premature stop to P-gp synthesis. In this study, we examined the full-length coding sequence of the ABCB1 gene in an ivermectin-sensitive Border Collie that lacked the aforementioned deletion mutation. The sequence was compared to the corresponding sequences of a wild-type Beagle and seven ivermectin-tolerant family members of the Border Collie. When compared to the wild-type Beagle sequence, that of the ivermectin-sensitive Border Collie was found to have one insertion mutation and eight single nucleotide polymorphisms (SNPs) in the coding sequence of the ABCB1 gene. While the eight SNPs were also found in the family members' sequences, the insertion mutation was found only in the ivermectin-sensitive dog. These results suggest the possibility that the SNPs are species-specific features of the ABCB1 gene in Border Collies, and that the insertion mutation may be related to ivermectin intolerance.

Novel insertion mutation of ABCB1 gene in an ivermectin-sensitive Border Collie

PubMed Central

Han, Jae-Ik; Son, Hyoung-Won; Park, Seung-Cheol

2010-01-01

P-glycoprotein (P-gp) is encoded by the ABCB1 gene and acts as an efflux pump for xenobiotics. In the Border Collie, a nonsense mutation caused by a 4-base pair deletion in the ABCB1 gene is associated with a premature stop to P-gp synthesis. In this study, we examined the full-length coding sequence of the ABCB1 gene in an ivermectin-sensitive Border Collie that lacked the aforementioned deletion mutation. The sequence was compared to the corresponding sequences of a wild-type Beagle and seven ivermectin-tolerant family members of the Border Collie. When compared to the wild-type Beagle sequence, that of the ivermectin-sensitive Border Collie was found to have one insertion mutation and eight single nucleotide polymorphisms (SNPs) in the coding sequence of the ABCB1 gene. While the eight SNPs were also found in the family members' sequences, the insertion mutation was found only in the ivermectin-sensitive dog. These results suggest the possibility that the SNPs are species-specific features of the ABCB1 gene in Border Collies, and that the insertion mutation may be related to ivermectin intolerance. PMID:21113104

Transition-state destabilization reveals how human DNA polymerase β proceeds across the chemically unstable lesion N7-methylguanine

PubMed Central

Ouzon-Shubeita, Hala; Lee, Seongmin

2014-01-01

N7-Methyl-2′-deoxyguanosine (m7dG) is the predominant lesion formed by methylating agents. A systematic investigation on the effect of m7dG on DNA replication has been difficult due to the chemical instability of m7dG. To gain insights into the m7dG effect, we employed a 2′-fluorine-mediated transition-state destabilzation strategy. Specifically, we determined kinetic parameters for dCTP insertion opposite a chemically stable m7dG analogue, 2′-fluoro-m7dG (Fm7dG), by human DNA polymerase β (polβ) and solved three X-ray structures of polβ in complex with the templating Fm7dG paired with incoming dCTP or dTTP analogues. The kinetic studies reveal that the templating Fm7dG slows polβ catalysis ∼300-fold, suggesting that m7dG in genomic DNA may impede replication by some DNA polymerases. The structural analysis reveals that Fm7dG forms a canonical Watson–Crick base pair with dCTP, but metal ion coordination is suboptimal for catalysis in the polβ-Fm7dG:dCTP complex, which partially explains the slow insertion of dCTP opposite Fm7dG by polβ. In addition, the polβ-Fm7dG:dTTP structure shows open protein conformations and staggered base pair conformations, indicating that N7-methylation of dG does not promote a promutagenic replication. Overall, the first systematic studies on the effect of m7dG on DNA replication reveal that polβ catalysis across m7dG is slow, yet highly accurate. PMID:24966350

In vitro optimization of truncated stem-loop II variants of the hammerhead ribozyme for cleavage in low concentrations of magnesium under non-turnover conditions.

PubMed Central

Zillmann, M; Limauro, S E; Goodchild, J

1997-01-01

By truncating helix II to two base pairs in a hammerhead ribozyme having long flanking sequences (greater than 30 bases), the rate of cleavage in 1 mM magnesium can be increased roughly 100-fold. Replacing most of the nucleotides in a typical stem-loop II with 1-4 randomized nucleotides gave an RNA library that, even before selection, was more active in 1 mM magnesium than the parent ribozyme, but considerably less active than the truncated stem-loop II ribozyme. A novel, multiround selection for intermolecular cleavage was exploited to optimize this library for cleavage in low concentrations of magnesium. After three rounds of selection at sequentially lower concentrations of magnesium, the library cleaved substrate RNA 20-fold faster than the initial pool and was cloned. This pool was heavily enriched for one particular sequence (5'-CGUG-3') that represented 16 of 52 isolates (the next most common sequence was represented only six times). This sequence also represented the most active sequence, exceeding the activity of the short helix II variant under the conditions of the selection, thereby demonstrating the effectiveness of the selection technique. Analysis of the cleavage rates of RNAs made from eight isolates having different four-base insert sequences allowed assignment of highly preferred bases at each position in the insert. Analysis of pool clones having insert of differing lengths showed that, in general, activity decreased as the length of the insert decreased from 4 to 1. This supports the suggested role of stem-loop II in stabilizing the non-Watson-Crick interactions between the conserved bases of the catalytic core. PMID:9214657

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rechkoblit, Olga; Delaney, James C.; Essigmann, John M.

DNA is susceptible to alkylation damage by a number of environmental agents that modify the Watson-Crick edge of the bases. Such lesions, if not repaired, may be bypassed by Y-family DNA polymerases. The bypass polymerase Dpo4 is strongly inhibited by 1-methylguanine (m1G) and 3-methylcytosine (m3C), with nucleotide incorporation opposite these lesions being predominantly mutagenic. Further, extension after insertion of both correct and incorrect bases, introduces additional base substitution and deletion errors. Crystal structures of the Dpo4 ternary extension complexes with correct and mismatched 3'-terminal primer bases opposite the lesions reveal that both m1G and m3C remain positioned within the DNAmore » template/primer helix. However, both correct and incorrect pairing partners exhibit pronounced primer terminal nucleotide distortion, being primarily evicted from the DNA helix when opposite m1G or misaligned when pairing with m3C. Our studies provide insights into mechanisms related to hindered and mutagenic bypass of methylated lesions and models associated with damage recognition by repair demethylases.« less

High-throughput analysis of T-DNA location and structure using sequence capture

DOE Office of Scientific and Technical Information (OSTI.GOV)

Inagaki, Soichi; Henry, Isabelle M.; Lieberman, Meric C.

Agrobacterium-mediated transformation of plants with T-DNA is used both to introduce transgenes and for mutagenesis. Conventional approaches used to identify the genomic location and the structure of the inserted T-DNA are laborious and high-throughput methods using next-generation sequencing are being developed to address these problems. Here, we present a cost-effective approach that uses sequence capture targeted to the T-DNA borders to select genomic DNA fragments containing T-DNA—genome junctions, followed by Illumina sequencing to determine the location and junction structure of T-DNA insertions. Multiple probes can be mixed so that transgenic lines transformed with different T-DNA types can be processed simultaneously,more » using a simple, index-based pooling approach. We also developed a simple bioinformatic tool to find sequence read pairs that span the junction between the genome and T-DNA or any foreign DNA. We analyzed 29 transgenic lines of Arabidopsis thaliana, each containing inserts from 4 different T-DNA vectors. We determined the location of T-DNA insertions in 22 lines, 4 of which carried multiple insertion sites. Additionally, our analysis uncovered a high frequency of unconventional and complex T-DNA insertions, highlighting the needs for high-throughput methods for T-DNA localization and structural characterization. Transgene insertion events have to be fully characterized prior to use as commercial products. As a result, our method greatly facilitates the first step of this characterization of transgenic plants by providing an efficient screen for the selection of promising lines.« less

High-throughput analysis of T-DNA location and structure using sequence capture

DOE PAGES

Inagaki, Soichi; Henry, Isabelle M.; Lieberman, Meric C.; ...

2015-10-07

Agrobacterium-mediated transformation of plants with T-DNA is used both to introduce transgenes and for mutagenesis. Conventional approaches used to identify the genomic location and the structure of the inserted T-DNA are laborious and high-throughput methods using next-generation sequencing are being developed to address these problems. Here, we present a cost-effective approach that uses sequence capture targeted to the T-DNA borders to select genomic DNA fragments containing T-DNA—genome junctions, followed by Illumina sequencing to determine the location and junction structure of T-DNA insertions. Multiple probes can be mixed so that transgenic lines transformed with different T-DNA types can be processed simultaneously,more » using a simple, index-based pooling approach. We also developed a simple bioinformatic tool to find sequence read pairs that span the junction between the genome and T-DNA or any foreign DNA. We analyzed 29 transgenic lines of Arabidopsis thaliana, each containing inserts from 4 different T-DNA vectors. We determined the location of T-DNA insertions in 22 lines, 4 of which carried multiple insertion sites. Additionally, our analysis uncovered a high frequency of unconventional and complex T-DNA insertions, highlighting the needs for high-throughput methods for T-DNA localization and structural characterization. Transgene insertion events have to be fully characterized prior to use as commercial products. As a result, our method greatly facilitates the first step of this characterization of transgenic plants by providing an efficient screen for the selection of promising lines.« less

Detection of restriction fragment length polymorphisms in clinical isolates and serially passaged Pseudomonas aeruginosa strains.

PubMed Central

Hjelm, L N; Branstrom, A A; Warren, R L

1990-01-01

An 800-base-pair HindIII-PstI fragment that flanks a hot spot for Tn7 insertion was isolated from the chromosome of Pseudomonas aeruginosa and cloned into pUC12. The fragment was used to probe XhoI digests of genomic DNA from 18 P. aeruginosa isolates collected from sputum samples of seven cystic fibrosis patients. Only two XhoI restriction fragment length polymorphisms (RFLPs), of 3.7 and 7.7 kilobases (kb), were detected. Isolate WSU3531-1 (3.7-kb XhoI fragment) and WSU3860 (7.7-kb XhoI fragment), while isolated from the same patient, showed different RFLPs. Serial passages of isolate WSU3531-1 demonstrated that this strain was phenotypically stable. In contrast, colony and pigment variants were readily isolated at a frequency of 1% from serial passages of isolate WSU3860. When XhoI-digested genomic DNA from phenotypic variants of serially passaged WSU3860 were probed with the 800-base-pair HindIII-PstI fragment, the probe hybridized to a 10.4-kb XhoI fragment from three isolates. Restriction analysis of the genomic DNA digested with a variety of restriction enzymes showed that a 2.7-kb insertion occurred in the same region for all three isolates. There appeared to be no correlation between changes in the RFLP and changes in colony morphology. Images PMID:1977762

Nucleotide sequence analysis establishes the role of endogenous murine leukemia virus DNA segments in formation of recombinant mink cell focus-forming murine leukemia viruses.

PubMed Central

Khan, A S

1984-01-01

The sequence of 363 nucleotides near the 3' end of the pol gene and 564 nucleotides from the 5' terminus of the env gene in an endogenous murine leukemia viral (MuLV) DNA segment, cloned from AKR/J mouse DNA and designated as A-12, was obtained. For comparison, the nucleotide sequence in an analogous portion of AKR mink cell focus-forming (MCF) 247 MuLV provirus was also determined. Sequence features unique to MCF247 MuLV DNA in the 3' pol and 5' env regions were identified by comparison with nucleotide sequences in analogous regions of NFS -Th-1 xenotropic and AKR ecotropic MuLV proviruses. These included (i) an insertion of 12 base pairs encoding four amino acids located 60 base pairs from the 3' terminus of the pol gene and immediately preceding the env gene, (ii) the deletion of 12 base pairs (encoding four amino acids) and the insertion of 3 base pairs (encoding one amino acid) in the 5' portion of the env gene, and (iii) single base substitutions resulting in 2 MCF247 -specific amino acids in the 3' pol and 23 in the 5' env regions. Nucleotide sequence comparison involving the 3' pol and 5' env regions of AKR MCF247 , NFS xenotropic, and AKR ecotropic MuLV proviruses with the cloned endogenous MuLV DNA indicated that MCF247 proviral DNA sequences were conserved in the cloned endogenous MuLV proviral segment. In fact, total nucleotide sequence identity existed between the endogenous MuLV DNA and the MCF247 MuLV provirus in the 3' portion of the pol gene. In the 5' env region, only 4 of 564 nucleotides were different, resulting in three amino acid changes between AKR MCF247 MuLV DNA and the endogenous MuLV DNA present in clone A-12. In addition, nucleotide sequence comparison indicated that Moloney-and Friend-MCF MuLVs were also highly related in the 3' pol and 5' env regions to the cloned endogenous MuLV DNA. These results establish the role of endogenous MuLV DNA segments in generation of recombinant MCF viruses. PMID:6328017

Insertion and deletion mutagenesis of the human cytomegalovirus genome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Spaete, R.R.; Mocarski, E.S.

1987-10-01

Studies on human cytomegalovirus (CMV) have been limited by a paucity of molecular genetic techniques available for manipulating the viral genome. The authors have developed methods for site-specific insertion and deletion mutagenesis of CMV utilizing a modified Escherichia coli lacZ gene as a genetic marker. The lacZ gene was placed under the control of the major ..beta.. gene regulatory signals and inserted into the viral genome by homologous recombination, disrupting one of two copies of this ..beta.. gene within the L-component repeats of CMV DNA. They observed high-level expression of ..beta..-galactosidase by the recombinant in a temporally authentic manner, withmore » levels of this enzyme approaching 1% of total protein in infected cells. Thus, CMV is an efficient vector for high-level expression of foreign gene products in human cells. Using back selection of lacZ-deficient virus in the presence of the chromogenic substrate 5-bromo-4-chloro-3-indolyl ..beta..-D-galactoside, they generated random endpoint deletion mutants. Analysis of these mutant revealed that CMV DNA sequences flanking the insert had been removed, thereby establishing this approach as a means of determining whether sequences flanking a lacZ insertion are dispensable for viral growth. In an initial test of the methods, they have shown that 7800 base pairs of one copy of L-component repeat sequences can be deleted without affecting viral growth in human fibroblasts.« less

High-fidelity in vivo replication of DNA base shape mimics without Watson–Crick hydrogen bonds

PubMed Central

Delaney, James C.; Henderson, Paul T.; Helquist, Sandra A.; Morales, Juan C.; Essigmann, John M.; Kool, Eric T.

2003-01-01

We report studies testing the importance of Watson–Crick hydrogen bonding, base-pair geometry, and steric effects during DNA replication in living bacterial cells. Nonpolar DNA base shape mimics of thymine and adenine (abbreviated F and Q, respectively) were introduced into Escherichia coli by insertion into a phage genome followed by transfection of the vector into bacteria. Genetic assays showed that these two base mimics were bypassed with moderate to high efficiency in the cells and with very high efficiency under damage-response (SOS induction) conditions. Under both sets of conditions, the T-shape mimic (F) encoded genetic information in the bacteria as if it were thymine, directing incorporation of adenine opposite it with high fidelity. Similarly, the A mimic (Q) directed incorporation of thymine opposite itself with high fidelity. The data establish that Watson–Crick hydrogen bonding is not necessary for high-fidelity replication of a base pair in vivo. The results suggest that recognition of DNA base shape alone serves as the most powerful determinant of fidelity during transfer of genetic information in a living organism. PMID:12676985

Norrie-Warburg syndrome: two novel mutations in patients with classical clinical phenotype.

PubMed

Gal, A; Veske, A; Jojart, G; Grammatico, B; Huber, B; Gu, S; del Porto, G; Senyi, K

1996-01-01

Norrie-Warburg syndrome (NWS) is a rare X-linked disorder characterized by blindness, which is invariable, deafness and mental disturbances, which are present occasionally. We describe here two novel mutations, a missense mutation (C126S) and a 1-base pair insertion (insT466/T467), together with a recurrent mutation (M1V), found in patients presenting with the classical clinical phenotype of NWS. All three mutations are likely to result in prominent structural changes of the norrin protein.

Fiber-optic coupling based on nonimaging expanded-beam optics.

PubMed

Moslehi, B; Ng, J; Kasimoff, I; Jannson, T

1989-12-01

We have fabricated and experimentally tested low-cost and mass-producible multimode fiber-optic couplers and connectors based on nonimaging beam-expanding optics and Liouville's theorem. Analysis indicates that a pair coupling loss of -0.25 dB can be achieved. Experimentally, we measured insertion losses as low as -0.38 dB. The beam expanders can be mass produced owing to the use of plastic injection-molding fabrication techniques and packaged in standard connector housings. This design is compatible with the fiber geometry and can yield highly stable coupling owing to its high tolerance for misalignments.

Memristive Ion Channel-Doped Biomembranes as Synaptic Mimics.

PubMed

Najem, Joseph S; Taylor, Graham J; Weiss, Ryan J; Hasan, Md Sakib; Rose, Garrett; Schuman, Catherine D; Belianinov, Alex; Collier, C Patrick; Sarles, Stephen A

2018-05-22

Solid-state neuromorphic systems based on transistors or memristors have yet to achieve the interconnectivity, performance, and energy efficiency of the brain due to excessive noise, undesirable material properties, and nonbiological switching mechanisms. Here we demonstrate that an alamethicin-doped, synthetic biomembrane exhibits memristive behavior, emulates key synaptic functions including paired-pulse facilitation and depression, and enables learning and computing. Unlike state-of-the-art devices, our two-terminal, biomolecular memristor features similar structure (biomembrane), switching mechanism (ion channels), and ionic transport modality as biological synapses while operating at considerably lower power. The reversible and volatile voltage-driven insertion of alamethicin peptides into an insulating lipid bilayer creates conductive pathways that exhibit pinched current-voltage hysteresis at potentials above their insertion threshold. Moreover, the synapse-like dynamic properties of the biomolecular memristor allow for simplified learning circuit implementations. Low-power memristive devices based on stimuli-responsive biomolecules represent a major advance toward implementation of full synaptic functionality in neuromorphic hardware.

MinION Analysis and Reference Consortium: Phase 2 data release and analysis of R9.0 chemistry.

PubMed

Jain, Miten; Tyson, John R; Loose, Matthew; Ip, Camilla L C; Eccles, David A; O'Grady, Justin; Malla, Sunir; Leggett, Richard M; Wallerman, Ola; Jansen, Hans J; Zalunin, Vadim; Birney, Ewan; Brown, Bonnie L; Snutch, Terrance P; Olsen, Hugh E

2017-01-01

Long-read sequencing is rapidly evolving and reshaping the suite of opportunities for genomic analysis. For the MinION in particular, as both the platform and chemistry develop, the user community requires reference data to set performance expectations and maximally exploit third-generation sequencing. We performed an analysis of MinION data derived from whole genome sequencing of Escherichia coli K-12 using the R9.0 chemistry, comparing the results with the older R7.3 chemistry. We computed the error-rate estimates for insertions, deletions, and mismatches in MinION reads. Run-time characteristics of the flow cell and run scripts for R9.0 were similar to those observed for R7.3 chemistry, but with an 8-fold increase in bases per second (from 30 bps in R7.3 and SQK-MAP005 library preparation, to 250 bps in R9.0) processed by individual nanopores, and less drop-off in yield over time. The 2-dimensional ("2D") N50 read length was unchanged from the prior chemistry. Using the proportion of alignable reads as a measure of base-call accuracy, 99.9% of "pass" template reads from 1-dimensional ("1D")  experiments were mappable and ~97% from 2D experiments. The median identity of reads was ~89% for 1D and ~94% for 2D experiments. The total error rate (miscall + insertion + deletion ) decreased for 2D "pass" reads from 9.1% in R7.3 to 7.5% in R9.0 and for template "pass" reads from 26.7% in R7.3 to 14.5% in R9.0. These Phase 2 MinION experiments serve as a baseline by providing estimates for read quality, throughput, and mappability. The datasets further enable the development of bioinformatic tools tailored to the new R9.0 chemistry and the design of novel biological applications for this technology. K: thousand, Kb: kilobase (one thousand base pairs), M: million, Mb: megabase (one million base pairs), Gb: gigabase (one billion base pairs).

[cDNA library construction from panicle meristem of finger millet].

PubMed

Radchuk, V; Pirko, Ia V; Isaenkov, S V; Emets, A I; Blium, Ia B

2014-01-01

The protocol for production of full-size cDNA using SuperScript Full-Length cDNA Library Construction Kit II (Invitrogen) was tested and high quality cDNA library from meristematic tissue of finger millet panicle (Eleusine coracana (L.) Gaertn) was created. The titer of obtained cDNA library comprised 3.01 x 10(5) CFU/ml in avarage. In average the length of cDNA insertion consisted about 1070 base pairs, the effectivity of cDNA fragment insertions--99.5%. The selective sequencing of cDNA clones from created library was performed. The sequences of cDNA clones were identified with usage of BLAST-search. The results of cDNA library analysis and selective sequencing represents prove good functionality and full length character of inserted cDNA clones. Obtained cDNA library from meristematic tissue of finger millet panicle represents good and valuable source for isolation and identification of key genes regulating metabolism and meristematic development and for mining of new molecular markers to conduct out high quality genetic investigations and molecular breeding as well.

Thermal stability of G-rich anti-parallel DNA triplexes upon insertion of LNA and α-L-LNA.

PubMed

Kosbar, Tamer R; Sofan, Mamdouh A; Abou-Zeid, Laila; Pedersen, Erik B

2015-05-14

G-rich anti-parallel DNA triplexes were modified with LNA or α-L-LNA in their Watson-Crick and TFO strands. The triplexes were formed by targeting a pyrimidine strand to a putative hairpin formed by Hoogsteen base pairing in order to use the UV melting method to evaluate the stability of the triplexes. Their thermal stability was reduced when the TFO strand was modified with LNA or α-L-LNA. The same trend was observed when the TFO strand and the purine Watson-Crick strand both were modified with LNA. When all triad components were modified with α-L-LNA and LNA in the middle of the triplex, the thermal melting was increased. When the pyrimidine sequence was modified with a single insertion of LNA or α-L-LNA the ΔTm increased. Moreover, increasing the number of α-L-LNA in the pyrimidine target sequence to six insertions, leads to a high increase in the thermal stability. The conformational S-type structure of α-L-LNA in anti-parallel triplexes is preferable for triplex stability.

The effect of screw taper on interference fit during load to failure at the soft tissue/bone interface.

PubMed

Mann, Charles J; Costi, John J; Stanley, Richard M; Dobson, Peter J

2005-10-01

The effect of screw geometry on the pullout strength of an anterior cruciate ligament reconstruction is well documented. The effect of a truly tapered screw has not been previously investigated. Thirty bovine knees in right and left knee pairs were collected. Superficial digital flexors from the hind legs of sheep were harvested to form a quadruple tendon graft. For each knee pair, one tendon graft was fixed using a tapered screw (n=15) and the other with a non-tapered screw (n=15). Interference screws were manufactured from stainless steel, and apart from the tapered or non-tapered profile were identical. The screws were inserted into a tibial tunnel already containing the tendon graft. The interference fit was tested by extensile load to failure tests. The insertion torque of the screws and first sign of load to failure (by pullout) of the interference fit were recorded. Results were analysed using paired t-tests. The results indicated that tapered screws have significantly higher resistance to interference failure (p=0.007) and insertion torque (p<0.001) than non-tapered screws. The improved biomechanical performance of tapered screws demonstrated in this study may translate into superior clinical results, particularly at the tibial attachment of hamstring anterior cruciate ligament reconstruction, and also of hamstring fixation to the medial femoral condyle for patella instability.

Characterization of a Chlamydomonas Insertional Mutant that Disrupts Flagellar Central Pair Microtubule-associated Structures

PubMed Central

Mitchell, David R.; Sale, Winfield S.

1999-01-01

Two alleles at a new locus, central pair–associated complex 1 (CPC1), were selected in a screen for Chlamydomonas flagellar motility mutations. These mutations disrupt structures associated with central pair microtubules and reduce flagellar beat frequency, but do not prevent changes in flagellar activity associated with either photophobic responses or phototactic accumulation of live cells. Comparison of cpc1 and pf6 axonemes shows that cpc1 affects a row of projections along C1 microtubules distinct from those missing in pf6, and a row of thin fibers that form an arc between the two central pair microtubules. Electron microscopic images of the central pair in axonemes from radial spoke–defective strains reveal previously undescribed central pair structures, including projections extending laterally toward radial spoke heads, and a diagonal link between the C2 microtubule and the cpc1 projection. By SDS-PAGE, cpc1 axonemes show reductions of 350-, 265-, and 79-kD proteins. When extracted from wild-type axonemes, these three proteins cosediment on sucrose gradients with three other central pair proteins (135, 125, and 56 kD) in a 16S complex. Characterization of cpc1 provides new insights into the structure and biochemistry of the central pair apparatus, and into its function as a regulator of dynein-based motility. PMID:9922455

Prediction of retrotransposons and assessment of genetic variability based on developed retrotransposon-based insertion polymorphism (RBIP) markers in Pyrus L.

PubMed

Jiang, Shuang; Zong, Yu; Yue, Xiaoyan; Postman, Joseph; Teng, Yuanwen; Cai, Danying

2015-02-01

Interspecific hybridization has been considered the major mode of evolution in Pyrus (pear), and thus, the genetic relationships within this genus have not been well documented. Retrotransposons are ubiquitous components of plant genomes and 42.4 % of the pear genome was reported to be long terminal repeat (LTR) retrotransposons, implying that retrotransposons might be significant in the evolution of Pyrus. In this study, 1,836 putative full-length LTR retrotransposons were isolated and 196 retrotransposon-based insertion polymorphism (RBIP) primers were developed, of which 24 pairs to the Ppcr1 subfamily of copia retrotransposons were used to analyze genetic diversity among 110 Pyrus accessions from Eurasia. Our results showed that Ppcr1 replicated many times in the development of cultivated Asian pears. The genetic structure analysis and the unweighted pair group method with arithmetic mean (UPGMA) dendrogram indicated that all accessions could be divided into Oriental and Occidental groups. In Oriental pears, wild pea pears clustered separately into independent groups in accordance with their morphological classifications. Cultivars of P. ussuriensis Maxim, P. pyrifolia Nakai, and P. pyrifolia Chinese white pear were mingled together, which inferred that hybridization events occurred during the development of the cultivated Asian pears. In Occidental pears, two clades were obtained in the UPGMA dendrogram in accordance with their geographical distribution; one contained the European species and the other included species from North Africa and West Asia. New findings in this study will be important to further understand the phylogeny of Pyrus and origins of cultivated pears.

Automated detection of a prostate Ni-Ti stent in electronic portal images.

PubMed

Carl, Jesper; Nielsen, Henning; Nielsen, Jane; Lund, Bente; Larsen, Erik Hoejkjaer

2006-12-01

Planning target volumes (PTV) in fractionated radiotherapy still have to be outlined with wide margins to the clinical target volume due to uncertainties arising from daily shift of the prostate position. A recently proposed new method of visualization of the prostate is based on insertion of a thermo-expandable Ni-Ti stent. The current study proposes a new detection algorithm for automated detection of the Ni-Ti stent in electronic portal images. The algorithm is based on the Ni-Ti stent having a cylindrical shape with a fixed diameter, which was used as the basis for an automated detection algorithm. The automated method uses enhancement of lines combined with a grayscale morphology operation that looks for enhanced pixels separated with a distance similar to the diameter of the stent. The images in this study are all from prostate cancer patients treated with radiotherapy in a previous study. Images of a stent inserted in a humanoid phantom demonstrated a localization accuracy of 0.4-0.7 mm which equals the pixel size in the image. The automated detection of the stent was compared to manual detection in 71 pairs of orthogonal images taken in nine patients. The algorithm was successful in 67 of 71 pairs of images. The method is fast, has a high success rate, good accuracy, and has a potential for unsupervised localization of the prostate before radiotherapy, which would enable automated repositioning before treatment and allow for the use of very tight PTV margins.

Sequence analysis of laci mutations obtained from lung cells of radon-exposed big blue{trademark} transgenic mice

DOE Office of Scientific and Technical Information (OSTI.GOV)

Layton, A.D.; Cross, F.T.; Steigler, G.L.

1994-12-31

We have exposed Big Blue{trademark} transgenic mice by inhalation to 320, 640 and 960 Working Level Months (WLM) of radon progeny. Mice were sacrificed after 3, 6 and 9 days; the time periods required to obtain the exposures. Control mice were also sacrificed at each time interval. In each case all tissues were excised, flash frozen in liquid nitrogen, and stored at -80{degrees}C for further analysis. Twelve lacI mutations have been isolated from the lung tissue of a mouse from the 960-WLM exposure group; the lacI genes from these mutants have been sequenced. Sequence data indicate that three of themore » mutants have a C;G deletion at BP 978 and are possibly clonal in origin. Two mutants have multiple events within the gene: one has a an A:T to C:G transversion and a C:G insertion separated by 291 BPs; the second has a G:C to A:T transition as well as an A:T deletion followed by 6 base pairs downstream by a T:A insertion. Other mutations include a single G:C to A:T transition, a two base pair deletion, and a C:G to T:A transition. Mutant plaques are being evaluated from individual mice at other dose levels. Time course experiments are also planned. These studies will help define the molecular fine structure of mutations induced by high-LET radiation exposure.« less

High-energy X-ray powder diffraction and atomic-pair distribution-function studies of charged/discharged structures in carbon-hybridized Li2MnSiO4 nanoparticles as a cathode material for lithium-ion batteries

NASA Astrophysics Data System (ADS)

Moriya, Maki; Miyahara, Masahiko; Hokazono, Mana; Sasaki, Hirokazu; Nemoto, Atsushi; Katayama, Shingo; Akimoto, Yuji; Hirano, Shin-ichi; Ren, Yang

2014-10-01

The stable cycling performance with a high discharge capacity of ∼190 mAh g-1 in a carbon-hybridized Li2MnSiO4 nanostructured powder has prompted an experimental investigation of the charged/discharged structures using synchrotron-based and laboratory-based X-rays and atomic-pair distribution-function (PDF) analyses. A novel method of in-situ spray pyrolysis of a precursor solution with glucose as a carbon source enabled the successful synthesis of the carbon-hybridized Li2MnSiO4 nanoparticles. The XRD patters of the discharged (lithiated) samples exhibit a long-range ordered structure characteristic of the (β) Li2MnSiO4 crystalline phase (space group Pmn21) which dissipates in the charged (delithiated) samples. However, upon discharging the long-range ordered structure recovers in each cycle. The disordered structure, according to the PDF analysis, is mainly due to local distortions of the MnO4 tetrahedra which show a mean Mn-O nearest neighbor distance shorter than that of the long-range ordered phase. These results corroborate the notion of the smaller Mn3+/Mn4+ ionic radii in the Li extracted phase versus the larger Mn2+ ionic radius in Li inserted phase. Thus Li extraction/insertion drives the fluctuation between the disordered and the long-range ordered structures.

Identifying transposon insertions and their effects from RNA-sequencing data.

PubMed

de Ruiter, Julian R; Kas, Sjors M; Schut, Eva; Adams, David J; Koudijs, Marco J; Wessels, Lodewyk F A; Jonkers, Jos

2017-07-07

Insertional mutagenesis using engineered transposons is a potent forward genetic screening technique used to identify cancer genes in mouse model systems. In the analysis of these screens, transposon insertion sites are typically identified by targeted DNA-sequencing and subsequently assigned to predicted target genes using heuristics. As such, these approaches provide no direct evidence that insertions actually affect their predicted targets or how transcripts of these genes are affected. To address this, we developed IM-Fusion, an approach that identifies insertion sites from gene-transposon fusions in standard single- and paired-end RNA-sequencing data. We demonstrate IM-Fusion on two separate transposon screens of 123 mammary tumors and 20 B-cell acute lymphoblastic leukemias, respectively. We show that IM-Fusion accurately identifies transposon insertions and their true target genes. Furthermore, by combining the identified insertion sites with expression quantification, we show that we can determine the effect of a transposon insertion on its target gene(s) and prioritize insertions that have a significant effect on expression. We expect that IM-Fusion will significantly enhance the accuracy of cancer gene discovery in forward genetic screens and provide initial insight into the biological effects of insertions on candidate cancer genes. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Diamond-anvil high-pressure cell with improved x-ray collimation system

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schiferl, D.; Olinger, B.W.; Livingston, R.W.

1986-07-22

This patent describes a diamond-anvil high-pressure cell having a tubular piston and a cylinder in which the piston is slidable to effect compression of a pair of opposed diamonds located between the piston and the cylinder. The piston includes a central bore opening on one end, an adjustable X-ray collimation system comprising a tubular insert engageable in the bore of the piston, the insert including a central bore and having first and second ends, with the first end of the insert being closest to the opposed diamonds and the second end of the insert extending out of the open endmore » of the piston, a collimator insertable in the bore of the tubular insert. The collimator has a central bore and having first and second ends corresponding respectively with the first and second ends of the insert, elastomeric pivot means mounted in the bore of the insert at the first end of the insert for flexibly retaining the first end of the collimator while allowing the collimator to pivot within the pivot means, and adjustable locking means located at the second end of the insert for adjusting and securing the second end of the collimator so as to be in alignment with the opposed diamonds.« less

A pair of new BAC and BIBAC vectors that facilitate BAC/BIBAC library construction and intact large genomic DNA insert exchange.

PubMed

Shi, Xue; Zeng, Haiyang; Xue, Yadong; Luo, Meizhong

2011-10-11

Large-insert BAC and BIBAC libraries are important tools for structural and functional genomics studies of eukaryotic genomes. To facilitate the construction of BAC and BIBAC libraries and the transfer of complete large BAC inserts into BIBAC vectors, which is desired in positional cloning, we developed a pair of new BAC and BIBAC vectors. The new BAC vector pIndigoBAC536-S and the new BIBAC vector BIBAC-S have the following features: 1) both contain two 18-bp non-palindromic I-SceI sites in an inverted orientation at positions that flank an identical DNA fragment containing the lacZ selection marker and the cloning site. Large DNA inserts can be excised from the vectors as single fragments by cutting with I-SceI, allowing the inserts to be easily sized. More importantly, because the two vectors contain different antibiotic resistance genes for transformant selection and produce the same non-complementary 3' protruding ATAA ends by I-SceI that suppress self- and inter-ligations, the exchange of intact large genomic DNA inserts between the BAC and BIBAC vectors is straightforward; 2) both were constructed as high-copy composite vectors. Reliable linearized and dephosphorylated original low-copy pIndigoBAC536-S and BIBAC-S vectors that are ready for library construction can be prepared from the high-copy composite vectors pHZAUBAC1 and pHZAUBIBAC1, respectively, without the need for additional preparation steps or special reagents, thus simplifying the construction of BAC and BIBAC libraries. BIBAC clones constructed with the new BIBAC-S vector are stable in both E. coli and Agrobacterium. The vectors can be accessed through our website http://GResource.hzau.edu.cn. The two new vectors and their respective high-copy composite vectors can largely facilitate the construction and characterization of BAC and BIBAC libraries. The transfer of complete large genomic DNA inserts from one vector to the other is made straightforward.

Interactions of anions and cations in carbon nanotubes.

PubMed

Mohammadzadeh, L; Quaino, P; Schmickler, W

2016-12-12

We consider the insertion of alkali-halide ion pairs into a narrow (5,5) carbon nanotube. In all cases considered, the insertion of a dimer is only slightly exothermic. While the image charge induced on the surface of the tube favors insertion, it simultaneously weakens the Coulomb attraction between the two ions. In addition, the anion experiences a sizable Pauli repulsion. For a one dimensional chain of NaCl embedded in the tube the most favorable position for the anion is at the center, and for the cation near the wall. The phonon spectrum of such chains shows both an acoustic and an optical branch.

BACCardI--a tool for the validation of genomic assemblies, assisting genome finishing and intergenome comparison.

PubMed

Bartels, Daniela; Kespohl, Sebastian; Albaum, Stefan; Drüke, Tanja; Goesmann, Alexander; Herold, Julia; Kaiser, Olaf; Pühler, Alfred; Pfeiffer, Friedhelm; Raddatz, Günter; Stoye, Jens; Meyer, Folker; Schuster, Stephan C

2005-04-01

We provide the graphical tool BACCardI for the construction of virtual clone maps from standard assembler output files or BLAST based sequence comparisons. This new tool has been applied to numerous genome projects to solve various problems including (a) validation of whole genome shotgun assemblies, (b) support for contig ordering in the finishing phase of a genome project, and (c) intergenome comparison between related strains when only one of the strains has been sequenced and a large insert library is available for the other. The BACCardI software can seamlessly interact with various sequence assembly packages. Genomic assemblies generated from sequence information need to be validated by independent methods such as physical maps. The time-consuming task of building physical maps can be circumvented by virtual clone maps derived from read pair information of large insert libraries.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wu, Hong; Zeng, Hong; Lam, Robert

Mismatch repair prevents the accumulation of erroneous insertions/deletions and non-Watson–Crick base pairs in the genome. Pathogenic mutations in theMLH1gene are associated with a predisposition to Lynch and Turcot's syndromes. Although genetic testing for these mutations is available, robust classification of variants requires strong clinical and functional support. Here, the first structure of the N-terminus of human MLH1, determined by X-ray crystallography, is described. Lastly, the structure shares a high degree of similarity with previously determined prokaryoticMLH1homologs; however, this structure affords a more accurate platform for the classification ofMLH1variants.

Unlocking Short Read Sequencing for Metagenomics

DOE PAGES

Rodrigue, Sébastien; Materna, Arne C.; Timberlake, Sonia C.; ...

2010-07-28

We describe an experimental and computational pipeline yielding millions of reads that can exceed 200 bp with quality scores approaching that of traditional Sanger sequencing. The method combines an automatable gel-less library construction step with paired-end sequencing on a short-read instrument. With appropriately sized library inserts, mate-pair sequences can overlap, and we describe the SHERA software package that joins them to form a longer composite read.

Detection of figure and caption pairs based on disorder measurements

NASA Astrophysics Data System (ADS)

Faure, Claudie; Vincent, Nicole

2010-01-01

Figures inserted in documents mediate a kind of information for which the visual modality is more appropriate than the text. A complete understanding of a figure often necessitates the reading of its caption or to establish a relationship with the main text using a numbered figure identifier which is replicated in the caption and in the main text. A figure and its caption are closely related; they constitute single multimodal components (FC-pair) that Document Image Analysis cannot extract with text and graphics segmentation. We propose a method to go further than the graphics and text segmentation in order to extract FC-pairs without performing a full labelling of the page components. Horizontal and vertical text lines are detected in the pages. The graphics are associated with selected text lines to initiate the detector of FC-pairs. Spatial and visual disorders are introduced to define a layout model in terms of properties. It enables to cope with most of the numerous spatial arrangements of graphics and text lines. The detector of FC-pairs performs operations in order to eliminate the layout disorder and assigns a quality value to each FC-pair. The processed documents were collected in medic@, the digital historical collection of the BIUM (Bibliothèque InterUniversitaire Médicale). A first set of 98 pages constitutes the design set. Then 298 pages were collected to evaluate the system. The performances are the result of a full process, from the binarisation of the digital images to the detection of FC-pairs.

Biochemical behavior of N-oxidized cytosine and adenine bases in DNA polymerase-mediated primer extension reactions

PubMed Central

Tsunoda, Hirosuke; Kudo, Tomomi; Masaki, Yoshiaki; Ohkubo, Akihiro; Seio, Kohji; Sekine, Mitsuo

2011-01-01

To clarify the biochemical behavior of 2′-deoxyribonucleoside 5′-triphosphates and oligodeoxyribonucleotides (ODNs) containing cytosine N-oxide (Co) and adenine N-oxide (Ao), we examined their base recognition ability in DNA duplex formation using melting temperature (Tm) experiments and their substrate specificity in DNA polymerase-mediated replication. As the result, it was found that the Tm values of modified DNA–DNA duplexes incorporating 2′-deoxyribonucleoside N-oxide derivatives significantly decreased compared with those of the unmodified duplexes. However, single insertion reactions by DNA polymerases of Klenow fragment (KF) (exo−) and Vent (exo−) suggested that Co and Ao selectively recognized G and T, respectively. Meanwhile, the kinetic study showed that the incorporation efficiencies of the modified bases were lower than those of natural bases. Ab initio calculations suggest that these modified bases can form the stable base pairs with the original complementary bases. These results indicate that the modified bases usually recognize the original bases as partners for base pairing, except for misrecognition of dATP by the action of KF (exo−) toward Ao on the template, and the primers could be extended on the template DNA. When they misrecognized wrong bases, the chain could not be elongated so that the modified base served as the chain terminator. PMID:21300642

Biochemical behavior of N-oxidized cytosine and adenine bases in DNA polymerase-mediated primer extension reactions.

PubMed

Tsunoda, Hirosuke; Kudo, Tomomi; Masaki, Yoshiaki; Ohkubo, Akihiro; Seio, Kohji; Sekine, Mitsuo

2011-04-01

To clarify the biochemical behavior of 2'-deoxyribonucleoside 5'-triphosphates and oligodeoxyribonucleotides (ODNs) containing cytosine N-oxide (C(o)) and adenine N-oxide (A(o)), we examined their base recognition ability in DNA duplex formation using melting temperature (T(m)) experiments and their substrate specificity in DNA polymerase-mediated replication. As the result, it was found that the T(m) values of modified DNA-DNA duplexes incorporating 2'-deoxyribonucleoside N-oxide derivatives significantly decreased compared with those of the unmodified duplexes. However, single insertion reactions by DNA polymerases of Klenow fragment (KF) (exo(-)) and Vent (exo(-)) suggested that C(o) and A(o) selectively recognized G and T, respectively. Meanwhile, the kinetic study showed that the incorporation efficiencies of the modified bases were lower than those of natural bases. Ab initio calculations suggest that these modified bases can form the stable base pairs with the original complementary bases. These results indicate that the modified bases usually recognize the original bases as partners for base pairing, except for misrecognition of dATP by the action of KF (exo(-)) toward A(o) on the template, and the primers could be extended on the template DNA. When they misrecognized wrong bases, the chain could not be elongated so that the modified base served as the chain terminator.

In vitro biomechanical comparison of equine proximal interphalangeal joint arthrodesis techniques: prototype equine spoon plate versus axially positioned dynamic compression plate and two abaxial transarticular cortical screws inserted in lag fashion.

PubMed

Sod, Gary A; Mitchell, Colin F; Hubert, Jeremy D; Martin, George S; Gill, Marjorie S

2007-12-01

To compare in vitro monotonic biomechanical properties of an equine spoon plate (ESP) with an axial 3-hole, 4.5 mm narrow dynamic compression plate (DCP) using 5.5 mm cortical screws in conjunction with 2 abaxial transarticular 5.5 mm cortical screws (DCP-TLS) inserted in lag fashion for equine proximal interphalangeal (PIP) joint arthrodesis. Paired in vitro biomechanical testing of 2 methods of stabilizing cadaveric adult equine forelimb PIP joints. Cadaveric adult equine forelimbs (n=18 pairs). For each forelimb pair, 1 PIP joint was stabilized with an ESP (8 hole, 4.5 mm) and 1 with an axial 3-hole narrow DCP (4.5 mm) using 5.5 mm cortical screws in conjunction with 2 abaxial transarticular 5.5 mm cortical screws inserted in lag fashion. Six matching pairs of constructs were tested in single cycle to failure under axial compression with load applied under displacement control at a constant rate of 5 cm/s. Six construct pairs were tested for cyclic fatigue under axial compression with cyclic load (0-7.5 kN) applied at 6 Hz; cycles to failure were recorded. Six construct pairs were tested in single cycle to failure under torsional loading applied at a constant displacement rate (0.17 radians/s) until rotation of 0.87 radians occurred. Mean values for each fixation method were compared using a paired t-test within each group with statistical significance set at P<.05. Mean yield load, yield stiffness, and failure load for ESP fixation were significantly greater (for axial compression and torsion) than for DCP-TLS fixation. Mean (+/- SD) values for the ESP and DCP-TLS fixation techniques, respectively, in single cycle to failure under axial compression were: yield load 123.9 +/- 8.96 and 28.5 +/- 3.32 kN; stiffness, 13.11 +/- 0.242 and 2.60 +/- 0.17 kN/cm; and failure load, 144.4 +/- 13.6 and 31.4 +/- 3.8 kN. In single cycle to failure under torsion, mean (+/- SD) values for ESP and DCP-TLS, respectively, were: stiffness 2,022 +/- 26.2 and 107.9 +/- 11.1 N m/rad; and failure load: 256.4 +/- 39.2 and 87.1 +/- 11.5 N m. Mean cycles to failure in axial compression of ESP fixation (622,529 +/- 65,468) was significantly greater than DCP-TLS (95,418 +/- 11,037). ESP was superior to an axial 3-hole narrow DCP with 2 abaxial transarticular screws inserted in lag fashion in resisting static overload forces and cyclic fatigue. In vitro results support further evaluation of ESP for PIP joint arthrodesis in horses. Its specific design may provide increased stability without need for external coaptation support.

Evaluation of Anti-HIV-1 Mutagenic Nucleoside Analogues*

PubMed Central

Vivet-Boudou, Valérie; Isel, Catherine; El Safadi, Yazan; Smyth, Redmond P.; Laumond, Géraldine; Moog, Christiane; Paillart, Jean-Christophe; Marquet, Roland

2015-01-01

Because of their high mutation rates, RNA viruses and retroviruses replicate close to the threshold of viability. Their existence as quasi-species has pioneered the concept of “lethal mutagenesis” that prompted us to synthesize pyrimidine nucleoside analogues with antiviral activity in cell culture consistent with an accumulation of deleterious mutations in the HIV-1 genome. However, testing all potentially mutagenic compounds in cell-based assays is tedious and costly. Here, we describe two simple in vitro biophysical/biochemical assays that allow prediction of the mutagenic potential of deoxyribonucleoside analogues. The first assay compares the thermal stabilities of matched and mismatched base pairs in DNA duplexes containing or not the nucleoside analogues as follows. A promising candidate should display a small destabilization of the matched base pair compared with the natural nucleoside and the smallest gap possible between the stabilities of the matched and mismatched base pairs. From this assay, we predicted that two of our compounds, 5-hydroxymethyl-2′-deoxyuridine and 5-hydroxymethyl-2′-deoxycytidine, should be mutagenic. The second in vitro reverse transcription assay assesses DNA synthesis opposite nucleoside analogues inserted into a template strand and subsequent extension of the newly synthesized base pairs. Once again, only 5-hydroxymethyl-2′-deoxyuridine and 5-hydroxymethyl-2′-deoxycytidine are predicted to be efficient mutagens. The predictive potential of our fast and easy first line screens was confirmed by detailed analysis of the mutation spectrum induced by the compounds in cell culture because only compounds 5-hydroxymethyl-2′-deoxyuridine and 5-hydroxymethyl-2′-deoxycytidine were found to increase the mutation frequency by 3.1- and 3.4-fold, respectively. PMID:25398876

Evaluation of anti-HIV-1 mutagenic nucleoside analogues.

PubMed

Vivet-Boudou, Valérie; Isel, Catherine; El Safadi, Yazan; Smyth, Redmond P; Laumond, Géraldine; Moog, Christiane; Paillart, Jean-Christophe; Marquet, Roland

2015-01-02

Because of their high mutation rates, RNA viruses and retroviruses replicate close to the threshold of viability. Their existence as quasi-species has pioneered the concept of "lethal mutagenesis" that prompted us to synthesize pyrimidine nucleoside analogues with antiviral activity in cell culture consistent with an accumulation of deleterious mutations in the HIV-1 genome. However, testing all potentially mutagenic compounds in cell-based assays is tedious and costly. Here, we describe two simple in vitro biophysical/biochemical assays that allow prediction of the mutagenic potential of deoxyribonucleoside analogues. The first assay compares the thermal stabilities of matched and mismatched base pairs in DNA duplexes containing or not the nucleoside analogues as follows. A promising candidate should display a small destabilization of the matched base pair compared with the natural nucleoside and the smallest gap possible between the stabilities of the matched and mismatched base pairs. From this assay, we predicted that two of our compounds, 5-hydroxymethyl-2'-deoxyuridine and 5-hydroxymethyl-2'-deoxycytidine, should be mutagenic. The second in vitro reverse transcription assay assesses DNA synthesis opposite nucleoside analogues inserted into a template strand and subsequent extension of the newly synthesized base pairs. Once again, only 5-hydroxymethyl-2'-deoxyuridine and 5-hydroxymethyl-2'-deoxycytidine are predicted to be efficient mutagens. The predictive potential of our fast and easy first line screens was confirmed by detailed analysis of the mutation spectrum induced by the compounds in cell culture because only compounds 5-hydroxymethyl-2'-deoxyuridine and 5-hydroxymethyl-2'-deoxycytidine were found to increase the mutation frequency by 3.1- and 3.4-fold, respectively. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

A genome-wide inducible phenotypic screen identifies antisense RNA constructs silencing Escherichia coli essential genes

PubMed Central

Meng, Jia; Kanzaki, Gregory; Meas, Diane; Lam, Christopher K.; Crummer, Heather; Tain, Justina; Xu, H. Howard

2013-01-01

Regulated antisense RNA (asRNA) expression has been employed successfully in Gram-positive bacteria for genome-wide essential gene identification and drug target determination. However, there have been no published reports describing the application of asRNA gene silencing for comprehensive analyses of essential genes in Gram-negative bacteria. In this study, we report the first genome-wide identification of asRNA constructs for essential genes in Escherichia coli. We screened 250,000 library transformants for conditional growth-inhibitory recombinant clones from two shot-gun genomic libraries of E. coli using a paired-termini expression vector (pHN678). After sequencing plasmid inserts of 675 confirmed inducer-sensitive cell clones, we identified 152 separate asRNA constructs of which 134 inserts came from essential genes while 18 originated from non-essential genes (but share operons with essential genes). Among the 79 individual essential genes silenced by these asRNA constructs, 61 genes (77%) engage in processes related to protein synthesis. The cell-based assays of an asRNA clone targeting fusA (encoding elongation factor G) showed that the induced cells were sensitized 12 fold to fusidic acid, a known specific inhibitor. Our results demonstrate the utility of the paired-termini expression vector and feasibility of large-scale gene silencing in E. coli using regulated asRNA expression. PMID:22268863

A quantitative study of copulatory behaviour of large Felidae.

PubMed

Lanier, D L; Dewsbury, D A

1976-12-01

A total of 109 copulations was observed in six male-female pairs from four species of large Felidae. The mean intromission durations were 3.0 sec for Asian leopards (Panthera pardus), 3.3 sec for African leopards (Panthera pardus), 12.9 sec for snow leopards (Uncia uncia), 2.3 sec for spotted jaguars (Panthera onca), 3.3 sec for black jaguars (Panthera onca), and 12.4 sec for Siberian tigers (Panthera tigris). Behavioural patterns were qualitatively similar across species; all displayed a copulatory pattern with no lock, no intra-vaginal thrusting, ejaculation on a single insertion, and multiple ejaculations. Whereas domestic cats are reported to assume a neck grip and to tread prior to insertion, these larger Felidae generally did so after intromission had been achieved. After copulation, females of some pairs swiped at the male and displayed a rolling after-reaction. Copyright © 1976. Published by Elsevier B.V.

Structures of (5′S)-8,5′-Cyclo-2′-deoxyguanosine Mismatched with dA or dT

PubMed Central

2012-01-01

Diastereomeric 8,5′-cyclopurine 2′-deoxynucleosides, containing a covalent bond between the deoxyribose and the purine base, are induced in DNA by ionizing radiation. They are suspected to play a role in the etiology of neurodegeneration in xeroderma pigmentosum patients. If not repaired, the S-8,5′-cyclo-2′-deoxyguanosine lesion (S-cdG) induces Pol V-dependent mutations at a frequency of 34% in Escherichia coli. Most are S-cdG → A transitions, suggesting mis-incorporation of dTTP opposite the lesion during replication bypass, although low levels of S-cdG → T transversions, arising from mis-incorporation of dATP, are also observed. We report the structures of 5′-d(GTGCXTGTTTGT)-3′·5′-d(ACAAACAYGCAC)-3′, where X denotes S-cdG and Y denotes either dA or dT, corresponding to the situation following mis-insertion of either dTTP or dATP opposite the S-cdG lesion. The S-cdG·dT mismatch pair adopts a wobble base pairing. This provides a plausible rationale for the S-cdG → A transitions. The S-cdG·dA mismatch pair differs in conformation from the dG·dA mismatch pair. For the S-cdG·dA mismatch pair, both S-cdG and dA intercalate, but no hydrogen bonding is observed between S-cdG and dA. This is consistent with the lower levels of S-cdG → T transitions in E. coli. PMID:22309170

Trypanosoma brucei RNA Editing Complex

PubMed Central

O'Hearn, Sean F.; Huang, Catherine E.; Hemann, Mike; Zhelonkina, Alevtina; Sollner-Webb, Barbara

2003-01-01

Maturation of Trypanosoma brucei mitochondrial mRNA involves massive posttranscriptional insertion and deletion of uridine residues. This RNA editing utilizes an enzymatic complex with seven major proteins, band I through band VII. We here use RNA interference (RNAi) to examine the band II and band V proteins. Band II is found essential for viability; it is needed to maintain the normal structure of the editing complex and to retain the band V ligase protein. Previously, band III was found essential for certain activities, including maintenance of the editing complex and retention of the band IV ligase protein. Thus, band II and band V form a protein pair with features analogous to the band III/band IV ligase pair. Since band V is specific for U insertion and since band IV is needed for U deletion, their parallel organization suggests that the editing complex has a pseudosymmetry. However, unlike the essential band IV ligase, RNAi to band V has only a morphological but no growth rate effect, suggesting that it is stimulatory but nonessential. Indeed, in vitro analysis of band V RNAi cell extract demonstrates that band IV can seal U insertion when band V is lacking. Thus, band IV ligase is the first activity of the basic editing complex shown able to serve in both forms of editing. Our studies also indicate that the U insertional portion may be less central in the editing complex than the corresponding U deletional portion. PMID:14560033

Proof-of-principle experiment of measurement-device-independent quantum key distribution with vector vortex beams

NASA Astrophysics Data System (ADS)

Dong, Chen; Zhao, Shang-Hong; Li, Wei; Yang, Jian

2018-03-01

In this paper, by combining measurement-device-independent quantum key distribution (MDI-QKD) scheme with entangled photon sources, we present a modified MDI-QKD scheme with pairs of vector vortex(VV) beams, which shows a structure of hybrid entangled entanglement corresponding to intrasystem entanglement and intersystem entanglement. The former entanglement, which is entangled between polarization and orbit angular momentum within each VV beam, is adopted to overcome the polarization misalignment associated with random rotations in quantum key distribution. The latter entanglement, which is entangled between the two VV beams, is used to perform entangled-based MDI-QKD protocol with pair of VV beams to inherit the merit of long distance. The numerical simulations show that our modified scheme can tolerate 97dB with practical detectors. Furthermore, our modified protocol only needs to insert q-plates in practical experiment.

Properties of promoters cloned randomly from the Saccharomyces cerevisiae genome.

PubMed Central

Santangelo, G M; Tornow, J; McLaughlin, C S; Moldave, K

1988-01-01

Promoters were isolated at random from the genome of Saccharomyces cerevisiae by using a plasmid that contains a divergently arrayed pair of promoterless reporter genes. A comprehensive library was constructed by inserting random (DNase I-generated) fragments into the intergenic region upstream from the reporter genes. Simple in vivo assays for either reporter gene product (alcohol dehydrogenase or beta-galactosidase) allowed the rapid identification of promoters from among these random fragments. Poly(dA-dT) homopolymer tracts were present in three of five randomly cloned promoters. With two exceptions, each RNA start site detected was 40 to 100 base pairs downstream from a TATA element. All of the randomly cloned promoters were capable of activating reporter gene transcription bidirectionally. Interestingly, one of the promoter fragments originated in a region of the S. cerevisiae rDNA spacer; regulated divergent transcription (presumably by RNA polymerase II) initiated in the same region. Images PMID:2847031

Development of a reliable method to assess footwear comfort during running.

PubMed

Mündermann, Anne; Nigg, Benno M; Stefanyshyn, Darren J; Humble, R Neil

2002-08-01

The purposes of this study were: (a) to determine whether subjects are able to distinguish between differences in footwear with respect to footwear comfort; and (b) to determine how reliably footwear comfort can be assessed using a visual analogue scale (VAS) and a protocol including a control condition during running. Intraclass correlation coefficients (ICCs) between comfort ratings for repeated conditions were high (ICC = 0.799). Differences in comfort ratings between the insert conditions were significant. A paired t-test revealed a significant difference in overall comfort ratings for the control insert when tested after the soft insert compared to when tested after the hard insert (P = 0.008). The results of this study showed that VASs provide a reliable measure to assess footwear comfort during running under the conditions that: (a) a control condition is included; and (b) the average comfort rating of sessions 4-6 is used. Copyright 2002 Elsevier Science B.V.

Peripherally inserted central catheter - flushing

MedlinePlus

... on a pair of sterile gloves. Remove the cap on the saline syringe and set the cap down on the paper towel. DO NOT let ... It is a good idea to change the caps at the end of your catheter (called the " ...

Saccharomyces cerevisiae Msh2-Msh3 acts in repair of base-base mispairs.

PubMed

Harrington, Jill M; Kolodner, Richard D

2007-09-01

DNA mismatch repair is thought to act through two subpathways involving the recognition of base-base and insertion/deletion mispairs by the Msh2-Msh6 heterodimer and the recognition of insertion/deletion mispairs by the Msh2-Msh3 heterodimer. Here, through genetic and biochemical approaches, we describe a previously unidentified role of the Msh2-Msh3 heterodimer in the recognition of base-base mispairs and the suppression of homology-mediated duplication and deletion mutations. Saccharomyces cerevisiae msh3 mutants did not show an increase in the rate of base substitution mutations by the CAN1 forward mutation assay compared to the rate for the wild type but did show an altered spectrum of base substitution mutations, including an increased accumulation of base pair changes from GC to CG and from AT to TA; msh3 mutants also accumulated homology-mediated duplication and deletion mutations. The mutation spectrum of mlh3 mutants paralleled that of msh3 mutants, suggesting that the Mlh1-Mlh3 heterodimer may also play a role in the repair of base-base mispairs and in the suppression of homology-mediated duplication and deletion mutations. Mispair binding analysis with purified Msh2-Msh3 and DNA substrates derived from CAN1 sequences found to be mutated in vivo demonstrated that Msh2-Msh3 exhibited robust binding to specific base-base mispairs that was consistent with functional mispair binding.

Saccharomyces cerevisiae Msh2-Msh3 Acts in Repair of Base-Base Mispairs▿ †

PubMed Central

Harrington, Jill M.; Kolodner, Richard D.

2007-01-01

DNA mismatch repair is thought to act through two subpathways involving the recognition of base-base and insertion/deletion mispairs by the Msh2-Msh6 heterodimer and the recognition of insertion/deletion mispairs by the Msh2-Msh3 heterodimer. Here, through genetic and biochemical approaches, we describe a previously unidentified role of the Msh2-Msh3 heterodimer in the recognition of base-base mispairs and the suppression of homology-mediated duplication and deletion mutations. Saccharomyces cerevisiae msh3 mutants did not show an increase in the rate of base substitution mutations by the CAN1 forward mutation assay compared to the rate for the wild type but did show an altered spectrum of base substitution mutations, including an increased accumulation of base pair changes from GC to CG and from AT to TA; msh3 mutants also accumulated homology-mediated duplication and deletion mutations. The mutation spectrum of mlh3 mutants paralleled that of msh3 mutants, suggesting that the Mlh1-Mlh3 heterodimer may also play a role in the repair of base-base mispairs and in the suppression of homology-mediated duplication and deletion mutations. Mispair binding analysis with purified Msh2-Msh3 and DNA substrates derived from CAN1 sequences found to be mutated in vivo demonstrated that Msh2-Msh3 exhibited robust binding to specific base-base mispairs that was consistent with functional mispair binding. PMID:17636021

Simulation-based medical education training improves short and long-term competency in, and knowledge of central venous catheter insertion: A before and after intervention study.

PubMed

Cartier, Vanessa; Inan, Cigdem; Zingg, Walter; Delhumeau, Cecile; Walder, Bernard; Savoldelli, Georges L

2016-08-01

Multimodal educational interventions have been shown to improve short-term competency in, and knowledge of central venous catheter (CVC) insertion. To evaluate the effectiveness of simulation-based medical education training in improving short and long-term competency in, and knowledge of CVC insertion. Before and after intervention study. University Geneva Hospital, Geneva, Switzerland, between May 2008 and January 2012. Residents in anaesthesiology aware of the Seldinger technique for vascular puncture. Participants attended a half-day course on CVC insertion. Learning objectives included work organization, aseptic technique and prevention of CVC complications. CVC insertion competency was tested pretraining, posttraining and then more than 2 years after training (sustainability phase). The primary study outcome was competency as measured by a global rating scale of technical skills, a hand hygiene compliance score and a checklist compliance score. Secondary outcome was knowledge as measured by a standardised pretraining and posttraining multiple-choice questionnaire. Statistical analyses were performed using paired Student's t test or Wilcoxon signed-rank test. Thirty-seven residents were included; 18 were tested in the sustainability phase (on average 34 months after training). The average global rating of skills was 23.4 points (±SD 4.08) before training, 32.2 (±4.51) after training (P < 0.001 for comparison with pretraining scores) and 26.5 (±5.34) in the sustainability phase (P = 0.040 for comparison with pretraining scores). The average hand hygiene compliance score was 2.8 (±1.0) points before training, 5.0 (±1.04) after training (P < 0.001 for comparison with pretraining scores) and 3.7 (±1.75) in the sustainability phase (P = 0.038 for comparison with pretraining scores). The average checklist compliance was 14.9 points (±2.3) before training, 19.9 (±1.06) after training (P < 0.001 for comparison with pretraining scores) and 17.4 (±1.41) (P = 0.002 for comparison with pretraining scores). The percentage of correct answers in the multiple-choice questionnaire increased from 76.0% (±7.9) before training to 87.7% (±4.4) after training (P < 0.001). Simulation-based medical education training was effective in improving short and long-term competency in, and knowledge of CVC insertion.

Basis of Miscoding of the DNA Adduct N2,3-Ethenoguanine by Human Y-family DNA Polymerases*

PubMed Central

Zhao, Linlin; Pence, Matthew G.; Christov, Plamen P.; Wawrzak, Zdzislaw; Choi, Jeong-Yun; Rizzo, Carmelo J.; Egli, Martin; Guengerich, F. Peter

2012-01-01

N2,3-Ethenoguanine (N2,3-ϵG) is one of the exocyclic DNA adducts produced by endogenous processes (e.g. lipid peroxidation) and exposure to bioactivated vinyl monomers such as vinyl chloride, which is a known human carcinogen. Existing studies exploring the miscoding potential of this lesion are quite indirect because of the lability of the glycosidic bond. We utilized a 2′-fluoro isostere approach to stabilize this lesion and synthesized oligonucleotides containing 2′-fluoro-N2,3-ϵ-2′-deoxyarabinoguanosine to investigate the miscoding potential of N2,3-ϵG by Y-family human DNA polymerases (pols). In primer extension assays, pol η and pol κ replicated through N2,3-ϵG, whereas pol ι and REV1 yielded only 1-base incorporation. Steady-state kinetics revealed that dCTP incorporation is preferred opposite N2,3-ϵG with relative efficiencies in the order of pol κ > REV1 > pol η ≈ pol ι, and dTTP misincorporation is the major miscoding event by all four Y-family human DNA pols. Pol ι had the highest dTTP misincorporation frequency (0.71) followed by pol η (0.63). REV1 misincorporated dTTP and dGTP with much lower frequencies. Crystal structures of pol ι with N2,3-ϵG paired to dCTP and dTTP revealed Hoogsteen-like base pairing mechanisms. Two hydrogen bonds were observed in the N2,3-ϵG:dCTP base pair, whereas only one appears to be present in the case of the N2,3-ϵG:dTTP pair. Base pairing mechanisms derived from the crystal structures explain the slightly favored dCTP insertion for pol ι in steady-state kinetic analysis. Taken together, these results provide a basis for the mutagenic potential of N2,3-ϵG. PMID:22910910

Reshaping and linking of molecules in ion-pair traps

NASA Astrophysics Data System (ADS)

Cochrane, Bryce; Naumkin, Fedor Y.

2016-01-01

A series of insertion complexes of small molecules trapped between alkali-halide counter-ions are investigated ab initio. The molecular shape is altered inside the complexes and varies in corresponding anions. Stabilities and charge distributions are investigated. Strong charge-transfer in the alkali-halide component effectively through the almost neutral molecule results in very large dipole moments. The most stable species is used to construct a dimer significantly bound via dipole-dipole interaction. Another complex with two alkali-halide diatoms trapping the molecule represents a unit of corresponding longer oligomer. This completes the array of systems with the molecule effectively in ion-pair, ion-dipole, dipole-pair electric fields.

Visualization of chromatin domains created by the gypsy insulator of Drosophila.

PubMed

Byrd, Keith; Corces, Victor G

2003-08-18

Insulators might regulate gene expression by establishing and maintaining the organization of the chromatin fiber within the nucleus. Biochemical fractionation and in situ high salt extraction of lysed cells show that two known protein components of the gypsy insulator are present in the nuclear matrix. Using FISH with DNA probes located between two endogenous Su(Hw) binding sites, we show that the intervening DNA is arranged in a loop, with the two insulators located at the base. Mutations in insulator proteins, subjecting the cells to a brief heat shock, or destruction of the nuclear matrix lead to disruption of the loop. Insertion of an additional gypsy insulator in the center of the loop results in the formation of paired loops through the attachment of the inserted sequences to the nuclear matrix. These results suggest that the gypsy insulator might establish higher-order domains of chromatin structure and regulate nuclear organization by tethering the DNA to the nuclear matrix and creating chromatin loops.

Retroviral DNA Integration Directed by HIV Integration Protein in Vitro

NASA Astrophysics Data System (ADS)

Bushman, Frederic D.; Fujiwara, Tamio; Craigie, Robert

1990-09-01

Efficient retroviral growth requires integration of a DNA copy of the viral RNA genome into a chromosome of the host. As a first step in analyzing the mechanism of integration of human immunodeficiency virus (HIV) DNA, a cell-free system was established that models the integration reaction. The in vitro system depends on the HIV integration (IN) protein, which was partially purified from insect cells engineered to express IN protein in large quantities. Integration was detected in a biological assay that scores the insertion of a linear DNA containing HIV terminal sequences into a λ DNA target. Some integration products generated in this assay contained five-base pair duplications of the target DNA at the recombination junctions, a characteristic of HIV integration in vivo; the remaining products contained aberrant junctional sequences that may have been produced in a variation of the normal reaction. These results indicate that HIV IN protein is the only viral protein required to insert model HIV DNA sequences into a target DNA in vitro.

Transcriptome-wide effects of inverted SINEs on gene expression and their impact on RNA polymerase II activity.

PubMed

Tajaddod, Mansoureh; Tanzer, Andrea; Licht, Konstantin; Wolfinger, Michael T; Badelt, Stefan; Huber, Florian; Pusch, Oliver; Schopoff, Sandy; Janisiw, Michael; Hofacker, Ivo; Jantsch, Michael F

2016-10-25

Short interspersed elements (SINEs) represent the most abundant group of non-long-terminal repeat transposable elements in mammalian genomes. In primates, Alu elements are the most prominent and homogenous representatives of SINEs. Due to their frequent insertion within or close to coding regions, SINEs have been suggested to play a crucial role during genome evolution. Moreover, Alu elements within mRNAs have also been reported to control gene expression at different levels. Here, we undertake a genome-wide analysis of insertion patterns of human Alus within transcribed portions of the genome. Multiple, nearby insertions of SINEs within one transcript are more abundant in tandem orientation than in inverted orientation. Indeed, analysis of transcriptome-wide expression levels of 15 ENCODE cell lines suggests a cis-repressive effect of inverted Alu elements on gene expression. Using reporter assays, we show that the negative effect of inverted SINEs on gene expression is independent of known sensors of double-stranded RNAs. Instead, transcriptional elongation seems impaired, leading to reduced mRNA levels. Our study suggests that there is a bias against multiple SINE insertions that can promote intramolecular base pairing within a transcript. Moreover, at a genome-wide level, mRNAs harboring inverted SINEs are less expressed than mRNAs harboring single or tandemly arranged SINEs. Finally, we demonstrate a novel mechanism by which inverted SINEs can impact on gene expression by interfering with RNA polymerase II.

Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

PubMed

Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing

2016-01-01

In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

Basic Trends of Frictional Interaction and Tribodiagnostics

DTIC Science & Technology

1996-04-01

control of cutting tool and different type of the .5 bearing are often described as well. There was also a large variety of technical objects studied...in the form of thin flat insert are manufactured from the same steel as objects under control with addition of cobalt (1-2%). Their activation by...additives in oils or greases, as well as if one of the elements of the rubbing pairs is made of a copper-containing alloy, for example steel -bronze pairs

Mutagenesis of the lac promoter region in M13 mp10 phage DNA by 4'-hydroxymethyl-4,5',8-trimethylpsoralen

DOE Office of Scientific and Technical Information (OSTI.GOV)

Piette, J.; Decuyper-Debergh, D.; Gamper, H.

Double-stranded M13 phage DNA (M13 mp10 replicative form) was photoreacted with 4'-hydroxymethyl-4,5',8-trimethylpsoralen, using light of wavelength greater than 320 nm or greater than 390 nm to generate predominantly crosslinks or monoadducts, respectively. The damaged DNAs were scored for inactivation and mutagenesis after transfection into Escherichia coli. The appearance of light-blue or colorless plaques on indicator medium showed that mutation had occurred in the lac insert of the viral DNA. A comparison of the consequences of the two phototreatments with psoralen supports the idea that crosslinks are both more lethal and more mutagenic than monoadducts. Numerous mutant clones partially or totallymore » deficient in beta-galactosidase were plaque-purified and amplified. The viral DNA of each clone was sequenced by the dideoxy chain-terminating procedure. All of the observed base-pair changes were mapped to the lac promoter region and consisted of 3 transition, 14 transversion, and 6 single base-pair frame-shift mutations. The predominant mutation was a T.A----G.C transversion.« less

Kinetics of initiation, propagation, and termination for the [rac-(C(2)H(4)(1-indenyl)(2))ZrMe][MeB(C(6)F(5))(3)]-catalyzed polymerization of 1-hexene.

PubMed

Liu, Z; Somsook, E; White, C B; Rosaaen, K A; Landis, C R

2001-11-14

Metallocene-catalyzed polymerization of 1-alkenes offers fine control of critical polymer attributes such as molecular weight, polydispersity, tacticity, and comonomer incorporation. Enormous effort has been expended on the synthesis and discovery of new catalysts and activators, but elementary aspects of the catalytic processes remain unclear. For example, it is unclear how the catalyst is distributed among active and dormant sites and how this distribution influences the order in monomer for the propagation rates, for which widely varying values are reported. Similarly, although empirical relationships between average molecular weights and monomer have been established for many systems, the underlying mechanisms of chain termination are unclear. Another area of intense interest concerns the role of ion-pairing in controlling the activity and termination mechanisms of metallocene-catalyzed polymerizations. Herein we report the application of quenched-flow kinetics, active site counting, polymer microstructure analysis, and molecular weight distribution analysis to the determination of fundamental rate laws for initiation, propagation, and termination for the polymerization of 1-hexene in toluene solution as catalyzed by the contact ion-pair, [rac-(C(2)H(4)(1-indenyl)(2))ZrMe][MeB(C(6)F(5))(3)] (1) over the temperature range of -10 to 50 degrees C. Highly isotactic (>99% mmmm) poly-1-hexene is produced with no apparent enchained regioerrors. Initiation and propagation processes are first order in the concentrations of 1-hexene and 1 but independent of excess borane or the addition of the contact ion-pair [PhNMe(3)][MeB(C(6)F(5))(3)]. Active site counting and the reaction kinetics provide no evidence of catalyst accumulation in dormant or inactive sites. Initiation is slower than propagation by a factor of 70. The principal termination process is the formation of unsaturates of two types: vinylidene end groups that arise from termination after a 1,2 insertion and vinylene end groups that follow 2,1 insertions. The rate law for the former termination process is independent of the 1-hexene concentration, whereas the latter is first order. Analysis of (13)C-labeled polymer provides support for a mechanism of vinylene end group formation that is not chain transfer to monomer. Deterministic modeling of the molecular weight distributions using the fundamental rate laws and kinetic constants demonstrates the robustness of the kinetic analysis. Comparisons of insertion frequencies with estimated limits on the rates of ion-pair symmetrization obtained by NMR suggest that ion-pair separation prior to insertion is not required, but the analysis requires assumptions that cannot be validated.

Solution structure of a DNA decamer duplex containing the stable 3′ T⋅G base pair of the pyrimidine(6–4)pyrimidone photoproduct [(6–4) adduct]: Implications for the highly specific 3′ T → C transition of the (6–4) adduct

PubMed Central

Lee, Joon-Hwa; Hwang, Geum-Sook; Choi, Byong-Seok

1999-01-01

The pyrimidine(6–4)pyrimidone photoproduct [(6–4) adduct] is one of the major photoproducts induced by UV irradiation of DNA and occurs at TpT sites. The (6–4) adduct is highly mutagenic and leads most often to a 3′ T → C transition with 85% replicating error frequency [LeClerc, J. E., Borden, A. & Lawrence, C. W. (1991) Proc. Natl. Acad. Sci. USA 88, 9685–9689]. To determine the origin of the specific 3′ T → C transition of the (6–4) adduct, we have used experimental NMR restraints and molecular dynamics to determine the solution structure of a (6–4)-lesion DNA decamer duplex that contains a mismatched base pair between the 3′ T residue and an opposed G residue. Normal Watson–Crick-type hydrogen bonding is retained at the 5′ T of the lesion site. The O2 carbonyl of the 3′ T residue forms hydrogen bonds with the imino and amino protons of the opposed G residue. This potential hydrogen bonding stabilizes the overall helix and restores the highly distorted conformation of the (6–4) adduct to the typical B-form-like DNA structure. This structural feature can explain the marked preference for the insertion of an A residue opposite the 5′ T and a G residue opposite the 3′ T of the (6–4) lesion during trans-lesion synthesis. Thus these insertions yield the predominant 3′ T → C transition. PMID:10359763

A Bulky Rhodium Complex Bound to an Adenosine-Adenosine DNA Mismatch: General Architecture of the Metalloinsertion Binding Mode†

PubMed Central

Zeglis, Brian M.; Pierre, Valérie C.; Kaiser, Jens T.; Barton, Jacqueline K.

2009-01-01

Two crystal structures are determined for Δ-Rh(bpy)2(chrysi)3+ (chrysi = 5,6-chrysenequinone diimine) bound to the oligonucleotide duplex 5′-CGGAAATTACCG-3′ containing two adenosine-adenosine mismatches (italics) through metalloinsertion. Diffraction quality crystals with two different space groups (P3221 and P43212) were obtained under very similar crystallization conditions. In both structures, the bulky rhodium complex inserts into the two mismatched sites from the minor groove side, ejecting the mismatched bases into the major groove. The conformational changes are localized to the mismatched site; the metal complex replaces the mismatched base pair without an increase in base pair rise. The expansive metal complex is accommodated in the duplex by a slight opening in the phosphodiester backbone; all sugars retain a C2′-endo puckering, and flanking base pairs neither stretch nor shear. The structures differ, however, in that in one of the structures, an additional metal complex is bound by intercalation from the major groove at the central 5′-AT-3′ step. We conclude that this additional metal complex is intercalated into this central step because of crystal packing forces. The structures described here of Δ-Rh(bpy)2(chrysi)3+ bound to thermodynamically destabilized AA mismatches share critical features with binding by metalloinsertion in two other oligonucleotides containing different single base mismatches. These results underscore the generality of the metalloinsertion as a new mode of non-covalent binding by small molecules with a DNA duplex. PMID:19374348

Quantification of cancellous bone-compaction due to DHS Blade insertion and influence upon cut-out resistance.

PubMed

Windolf, Markus; Muths, Raphael; Braunstein, Volker; Gueorguiev, Boyko; Hänni, Markus; Schwieger, Karsten

2009-01-01

Compaction of cancellous bone is believed to prevent cut-out. This in vitro study quantified the compaction in the femoral head due to insertion of a dynamic hip screw-blade with and without predrilling and investigated the resulting implant anchorage under cyclic loading. Eight pairs of human cadaveric femoral heads were instrumented with a dynamic hip screw-blade made of Polyetheretherketon. Pairwise instrumentation was performed either with or without predrilling the specimens. CT scanning was performed before and after implantation, to measure bone-compaction. Subsequently the implant was removed and a third scan was performed to analyze the relaxation of the bone structure. Commercial implants were reinserted and the specimens were cyclically loaded until onset of cut-out occurred. The bone-implant interface was monitored by means of fluoroscopic imaging throughout the experiment. Paired t-tests were performed to identify differences regarding compaction, relaxation and cycles to failure. Bone density in the surrounding of the implant increased about 30% for the non-predrilled and 20% for the predrilled group when inserting the implant. After implant removal the predrilled specimens fully relaxed; the non-predrilled group showed about 10% plastic deformation. No differences were found regarding cycles to failure (P=0.32). Significant bone-compaction due to blade insertion was verified. Even though compaction was lower when predrilling the specimens, mainly elastic deformation was present, which is believed to primarily enhance the implant anchorage. Cyclic loading tests confirmed this thesis. The importance of the implantation technique with regard to predrilling is therefore decreased.

Incremental Multi-view 3D Reconstruction Starting from Two Images Taken by a Stereo Pair of Cameras

NASA Astrophysics Data System (ADS)

El hazzat, Soulaiman; Saaidi, Abderrahim; Karam, Antoine; Satori, Khalid

2015-03-01

In this paper, we present a new method for multi-view 3D reconstruction based on the use of a binocular stereo vision system constituted of two unattached cameras to initialize the reconstruction process. Afterwards , the second camera of stereo vision system (characterized by varying parameters) moves to capture more images at different times which are used to obtain an almost complete 3D reconstruction. The first two projection matrices are estimated by using a 3D pattern with known properties. After that, 3D scene points are recovered by triangulation of the matched interest points between these two images. The proposed approach is incremental. At each insertion of a new image, the camera projection matrix is estimated using the 3D information already calculated and new 3D points are recovered by triangulation from the result of the matching of interest points between the inserted image and the previous image. For the refinement of the new projection matrix and the new 3D points, a local bundle adjustment is performed. At first, all projection matrices are estimated, the matches between consecutive images are detected and Euclidean sparse 3D reconstruction is obtained. So, to increase the number of matches and have a more dense reconstruction, the Match propagation algorithm, more suitable for interesting movement of the camera, was applied on the pairs of consecutive images. The experimental results show the power and robustness of the proposed approach.

A genome-wide inducible phenotypic screen identifies antisense RNA constructs silencing Escherichia coli essential genes.

PubMed

Meng, Jia; Kanzaki, Gregory; Meas, Diane; Lam, Christopher K; Crummer, Heather; Tain, Justina; Xu, H Howard

2012-04-01

Regulated antisense RNA (asRNA) expression has been employed successfully in Gram-positive bacteria for genome-wide essential gene identification and drug target determination. However, there have been no published reports describing the application of asRNA gene silencing for comprehensive analyses of essential genes in Gram-negative bacteria. In this study, we report the first genome-wide identification of asRNA constructs for essential genes in Escherichia coli. We screened 250 000 library transformants for conditional growth inhibitory recombinant clones from two shotgun genomic libraries of E. coli using a paired-termini expression vector (pHN678). After sequencing plasmid inserts of 675 confirmed inducer sensitive cell clones, we identified 152 separate asRNA constructs of which 134 inserts came from essential genes, while 18 originated from nonessential genes (but share operons with essential genes). Among the 79 individual essential genes silenced by these asRNA constructs, 61 genes (77%) engage in processes related to protein synthesis. The cell-based assays of an asRNA clone targeting fusA (encoding elongation factor G) showed that the induced cells were sensitized 12-fold to fusidic acid, a known specific inhibitor. Our results demonstrate the utility of the paired-termini expression vector and feasibility of large-scale gene silencing in E. coli using regulated asRNA expression. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

Understanding the differences between genome sequences of Escherichia coli B strains REL606 and BL21(DE3), and comparison of the closely related E. coli B and K-12 genomes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Studier, F.W.; Daegelen, P.; Lenski, R. E.

2009-12-01

Each difference between the genome sequences of Escherichia coli B strains REL606 and BL21(DE3) can be interpreted in light of known laboratory manipulations plus a gene conversion between ribosomal RNA operons. Two treatments with 1-methyl-3-nitro-1-nitrosoguanidine in the REL606 lineage produced at least 93 single-base-pair mutations ({approx} 90% GC-to-AT transitions) and 3 single-base-pair GC deletions. Two UV treatments in the BL21(DE3) lineage produced only 4 single-base-pair mutations but 16 large deletions. P1 transductions from K-12 into the two B lineages produced 317 single-base-pair differences and 9 insertions or deletions, reflecting differences between B DNA in BL21(DE3) and integrated restriction fragments ofmore » K-12 DNA inherited by REL606. Two sites showed selective enrichment of spontaneous mutations. No unselected spontaneous single-base-pair mutations were evident. The genome sequences revealed that a progenitor of REL606 had been misidentified, explaining initially perplexing differences. Limited sequencing of other B strains defined characteristic properties of B and allowed assembly of the inferred genome of the ancestral B of Delbrueck and Luria. Comparison of the B and K-12 genomes shows that more than half of the 3793 proteins of their basic genomes are predicted to be identical, although {approx} 310 appear to be functional in either B or K-12 but not in both. The ancestral basic genome appears to have had {approx} 4039 coding sequences occupying {approx} 4.0 Mbp. Repeated horizontal transfer from diverged Escherichia coli genomes and homologous recombination may explain the observed variable distribution of single-base-pair differences. Fifteen sites are occupied by phage-related elements, but only six by comparable elements at the same site. More than 50 sites are occupied by IS elements in both B and K, 16 in common, and likely founding IS elements are identified. A signature of widespread cryptic phage P4-type mobile elements was identified. Complex deletions (dense clusters of small deletions and substitutions) apparently removed nonessential genes from {approx} 30 sites in the basic genomes.« less

Efficient pairwise RNA structure prediction using probabilistic alignment constraints in Dynalign

PubMed Central

2007-01-01

Background Joint alignment and secondary structure prediction of two RNA sequences can significantly improve the accuracy of the structural predictions. Methods addressing this problem, however, are forced to employ constraints that reduce computation by restricting the alignments and/or structures (i.e. folds) that are permissible. In this paper, a new methodology is presented for the purpose of establishing alignment constraints based on nucleotide alignment and insertion posterior probabilities. Using a hidden Markov model, posterior probabilities of alignment and insertion are computed for all possible pairings of nucleotide positions from the two sequences. These alignment and insertion posterior probabilities are additively combined to obtain probabilities of co-incidence for nucleotide position pairs. A suitable alignment constraint is obtained by thresholding the co-incidence probabilities. The constraint is integrated with Dynalign, a free energy minimization algorithm for joint alignment and secondary structure prediction. The resulting method is benchmarked against the previous version of Dynalign and against other programs for pairwise RNA structure prediction. Results The proposed technique eliminates manual parameter selection in Dynalign and provides significant computational time savings in comparison to prior constraints in Dynalign while simultaneously providing a small improvement in the structural prediction accuracy. Savings are also realized in memory. In experiments over a 5S RNA dataset with average sequence length of approximately 120 nucleotides, the method reduces computation by a factor of 2. The method performs favorably in comparison to other programs for pairwise RNA structure prediction: yielding better accuracy, on average, and requiring significantly lesser computational resources. Conclusion Probabilistic analysis can be utilized in order to automate the determination of alignment constraints for pairwise RNA structure prediction methods in a principled fashion. These constraints can reduce the computational and memory requirements of these methods while maintaining or improving their accuracy of structural prediction. This extends the practical reach of these methods to longer length sequences. The revised Dynalign code is freely available for download. PMID:17445273

Minor groove RNA triplex in the crystal structure of a ribosomal frameshifting viral pseudoknot

NASA Technical Reports Server (NTRS)

Su, L.; Chen, L.; Egli, M.; Berger, J. M.; Rich, A.

1999-01-01

Many viruses regulate translation of polycistronic mRNA using a -1 ribosomal frameshift induced by an RNA pseudoknot. A pseudoknot has two stems that form a quasi-continuous helix and two connecting loops. A 1.6 A crystal structure of the beet western yellow virus (BWYV) pseudoknot reveals rotation and a bend at the junction of the two stems. A loop base is inserted in the major groove of one stem with quadruple-base interactions. The second loop forms a new minor-groove triplex motif with the other stem, involving 2'-OH and triple-base interactions, as well as sodium ion coordination. Overall, the number of hydrogen bonds stabilizing the tertiary interactions exceeds the number involved in Watson-Crick base pairs. This structure will aid mechanistic analyses of ribosomal frameshifting.

“Gate-keeper” Residues and Active-Site Rearrangements in DNA Polymerase μ Help Discriminate Non-cognate Nucleotides

PubMed Central

Li, Yunlang; Schlick, Tamar

2013-01-01

Incorporating the cognate instead of non-cognate substrates is crucial for DNA polymerase function. Here we analyze molecular dynamics simulations of DNA polymerase μ (pol μ) bound to different non-cognate incoming nucleotides including A:dCTP, A:dGTP, A(syn):dGTP, A:dATP, A(syn):dATP, T:dCTP, and T:dGTP to study the structure-function relationships involved with aberrant base pairs in the conformational pathway; while a pol μ complex with the A:dTTP base pair is available, no solved non-cognate structures are available. We observe distinct differences of the non-cognate systems compared to the cognate system. Specifically, the motions of active-site residue His329 and Asp330 distort the active site, and Trp436, Gln440, Glu443 and Arg444 tend to tighten the nucleotide-binding pocket when non-cognate nucleotides are bound; the latter effect may further lead to an altered electrostatic potential within the active site. That most of these “gate-keeper” residues are located farther apart from the upstream primer in pol μ, compared to other X family members, also suggests an interesting relation to pol μ's ability to incorporate nucleotides when the upstream primer is not paired. By examining the correlated motions within pol μ complexes, we also observe different patterns of correlations between non-cognate systems and the cognate system, especially decreased interactions between the incoming nucleotides and the nucleotide-binding pocket. Altered correlated motions in non-cognate systems agree with our recently proposed hybrid conformational selection/induced-fit models. Taken together, our studies propose the following order for difficulty of non-cognate system insertions by pol μ: T:dGTP

Delineating the contribution of long-term associations to immediate recall.

PubMed

Saint-Aubin, Jean; Guérard, Katherine; Chamberland, Cindy; Malenfant, Amélie

2014-01-01

In the present study we examined the contribution of semantic associative links to short-term recall performance by using the separation effect first introduced in free recall studies (Glanzer, 1969). Pairs of associated words were inserted in the to-be-remembered lists. In two experiments associated words were better recalled than non-associated words, and were better recalled when they were adjacent in the list than when they were separated by one non-associated item. In addition results showed that forward associative links among pair members were as beneficial to immediate serial recall as backward associative links. Finally the benefit of associative links among pair members was observed with both forward and backward recall.

Stepwise Loop Insertion Strategy for Active Site Remodeling to Generate Novel Enzyme Functions.

PubMed

Hoque, Md Anarul; Zhang, Yong; Chen, Liuqing; Yang, Guangyu; Khatun, Mst Afroza; Chen, Haifeng; Hao, Liu; Feng, Yan

2017-05-19

The remodeling of active sites to generate novel biocatalysts is an attractive and challenging task. We developed a stepwise loop insertion strategy (StLois), in which randomized residue pairs are inserted into active site loops. The phosphotriesterase-like lactonase from Geobacillus kaustophilus (GkaP-PLL) was used to investigate StLois's potential for changing enzyme function. By inserting six residues into active site loop 7, the best variant ML7-B6 demonstrated a 16-fold further increase in catalytic efficiency toward ethyl-paraoxon compared with its initial template, that is a 609-fold higher, >10 7 fold substrate specificity shift relative to that of wild-type lactonase. The remodeled variants displayed 760-fold greater organophosphate hydrolysis activity toward the organophosphates parathion, diazinon, and chlorpyrifos. Structure and docking computations support the source of notably inverted enzyme specificity. Considering the fundamental importance of active site loops, the strategy has potential for the rapid generation of novel enzyme functions by loop remodeling.

Surgical management of insertional calcific achilles tendinosis with a central tendon splitting approach.

PubMed

Johnson, Keith W; Zalavras, Charalampos; Thordarson, David B

2006-04-01

Insertional calcific Achilles tendinosis is a painful, frequently disabling condition. Numerous operative approaches for this problem have been described. This study evaluated the outcome of a central tendon splitting approach. Twenty-two patients were evaluated after a central tendon splitting approach for persistent insertional calcific Achilles tendinosis. Followup averaged 34 (11 to 64) months. Suture anchors were routinely used to augment the tendon insertion after debridement. An American Orthopaedic Foot and Ankle Society (AOFAS) hindfoot score, shoewear comfort, and return to work were evaluated. A paired t-test was used to evaluate the results. Pain significantly improved from 7 points preoperatively to 33 points postoperatively (p < 0.001). Function improved significantly from 36 points to 46 points (p < 0.001). The ankle-hindfoot score improved from 53 points to 89 points (p < 0.001). Age older or younger than 50 years did not affect outcome. A central tendon splitting approach yielded good relief of pain with improved function, shoewear, and ability to work without painful postoperative scars.

Structure of the human MLH1 N-terminus: implications for predisposition to Lynch syndrome

DOE PAGES

Wu, Hong; Zeng, Hong; Lam, Robert; ...

2015-08-01

Mismatch repair prevents the accumulation of erroneous insertions/deletions and non-Watson–Crick base pairs in the genome. Pathogenic mutations in theMLH1gene are associated with a predisposition to Lynch and Turcot's syndromes. Although genetic testing for these mutations is available, robust classification of variants requires strong clinical and functional support. Here, the first structure of the N-terminus of human MLH1, determined by X-ray crystallography, is described. Lastly, the structure shares a high degree of similarity with previously determined prokaryoticMLH1homologs; however, this structure affords a more accurate platform for the classification ofMLH1variants.

Designing deep sequencing experiments: detecting structural variation and estimating transcript abundance.

PubMed

Bashir, Ali; Bansal, Vikas; Bafna, Vineet

2010-06-18

Massively parallel DNA sequencing technologies have enabled the sequencing of several individual human genomes. These technologies are also being used in novel ways for mRNA expression profiling, genome-wide discovery of transcription-factor binding sites, small RNA discovery, etc. The multitude of sequencing platforms, each with their unique characteristics, pose a number of design challenges, regarding the technology to be used and the depth of sequencing required for a particular sequencing application. Here we describe a number of analytical and empirical results to address design questions for two applications: detection of structural variations from paired-end sequencing and estimating mRNA transcript abundance. For structural variation, our results provide explicit trade-offs between the detection and resolution of rearrangement breakpoints, and the optimal mix of paired-read insert lengths. Specifically, we prove that optimal detection and resolution of breakpoints is achieved using a mix of exactly two insert library lengths. Furthermore, we derive explicit formulae to determine these insert length combinations, enabling a 15% improvement in breakpoint detection at the same experimental cost. On empirical short read data, these predictions show good concordance with Illumina 200 bp and 2 Kbp insert length libraries. For transcriptome sequencing, we determine the sequencing depth needed to detect rare transcripts from a small pilot study. With only 1 Million reads, we derive corrections that enable almost perfect prediction of the underlying expression probability distribution, and use this to predict the sequencing depth required to detect low expressed genes with greater than 95% probability. Together, our results form a generic framework for many design considerations related to high-throughput sequencing. We provide software tools http://bix.ucsd.edu/projects/NGS-DesignTools to derive platform independent guidelines for designing sequencing experiments (amount of sequencing, choice of insert length, mix of libraries) for novel applications of next generation sequencing.

Mechanisms of splicing-dependent trans-synaptic adhesion by PTPδ-IL1RAPL1/IL-1RAcP for synaptic differentiation

NASA Astrophysics Data System (ADS)

Yamagata, Atsushi; Yoshida, Tomoyuki; Sato, Yusuke; Goto-Ito, Sakurako; Uemura, Takeshi; Maeda, Asami; Shiroshima, Tomoko; Iwasawa-Okamoto, Shiho; Mori, Hisashi; Mishina, Masayoshi; Fukai, Shuya

2015-04-01

Synapse formation is triggered through trans-synaptic interaction between pairs of pre- and postsynaptic adhesion molecules, the specificity of which depends on splice inserts known as `splice-insert signaling codes'. Receptor protein tyrosine phosphatase δ (PTPδ) can bidirectionally induce pre- and postsynaptic differentiation of neurons by trans-synaptically binding to interleukin-1 receptor accessory protein (IL-1RAcP) and IL-1RAcP-like-1 (IL1RAPL1) in a splicing-dependent manner. Here, we report crystal structures of PTPδ in complex with IL1RAPL1 and IL-1RAcP. The first immunoglobulin-like (Ig) domain of IL1RAPL1 directly recognizes the first splice insert, which is critical for binding to IL1RAPL1. The second splice insert functions as an adjustable linker that positions the Ig2 and Ig3 domains of PTPδ for simultaneously interacting with the Ig1 domain of IL1RAPL1 or IL-1RAcP. We further identified the IL1RAPL1-specific interaction, which appears coupled to the first-splice-insert-mediated interaction. Our results thus reveal the decoding mechanism of splice-insert signaling codes for synaptic differentiation induced by trans-synaptic adhesion between PTPδ and IL1RAPL1/IL-1RAcP.

Concurrency Control in Distributed Systems with Applications to Long-Lived Transactions and Partitioned Networks.

DTIC Science & Technology

1983-06-01

i in partition Is ana transaction 󈧐 writes oata ooject a in partition 1I, then the conflict pair "TiTi : a" must ue Includea in tne glocal relation...It botn transactions naa written aatd ob]ect a tnen each control site woulu insert a conflict pair in the glocal relation. "TIT2 : a" and ൔii : a...DATA STUULTUhES 1. Transactions Transactions are implemented in the simulation design as a linked list structure pointed to oy a glocal variaole (TIA

SDM-Assist software to design site-directed mutagenesis primers introducing “silent” restriction sites

PubMed Central

2013-01-01

Background Over the past decades site-directed mutagenesis (SDM) has become an indispensable tool for biological structure-function studies. In principle, SDM uses modified primer pairs in a PCR reaction to introduce a mutation in a cDNA insert. DpnI digestion of the reaction mixture is used to eliminate template copies before amplification in E. coli; however, this process is inefficient resulting in un-mutated clones which can only be distinguished from mutant clones by sequencing. Results We have developed a program – ‘SDM-Assist’ which creates SDM primers adding a specific identifier: through additional silent mutations a restriction site is included or a previous one removed which allows for highly efficient identification of ‘mutated clones’ by a simple restriction digest. Conclusions The direct identification of SDM clones will save time and money for researchers. SDM-Assist also scores the primers based on factors such as Tm, GC content and secondary structure allowing for simplified selection of optimal primer pairs. PMID:23522286

Comparative ruminant genomics highlights segmental duplication and mobile element insertion diversity

USDA-ARS?s Scientific Manuscript database

We have expanded upon a previously reported comparative genomics approach using a read-depth (JaRMs) and a hybrid read-pair, split-read (RAPTR-SV) copy number variation (CNV) detection method that uses read alignments to the cattle reference genome in order to identify species-specific genomic rearr...

Unusual Properties of Regulatory DNA from the Drosophila Engrailed Gene: Three ``pairing-Sensitive'' Sites within a 1.6-Kb Region

PubMed Central

Kassis, J. A.

1994-01-01

We have previously shown that a 2-kb fragment of engrailed DNA can suppress expression of a linked marker gene, white, in the P element vector CaSpeR. This suppression is dependent on the presence of two copies of engrailed DNA-containing P elements (P[en]) in proximity in the Drosophila genome (either in cis or in trans). In this study, the 2-kb fragment was dissected and found to contain three fragments of DNA which could mediate white suppression [called ``pairing-sensitive sites'' (PS)]. A PS site was also identified in regulatory DNA from the Drosophila escargot gene. The eye colors of six different P[en] insertions in the escargot gene suggest an interaction between P[en]-encoded and genome-encoded PS sites. I hypothesize that white gene expression from P[en] is repressed by the formation of a protein complex which is initiated at the engrailed PS sites and also requires interactions with flanking genomic DNA. Genes were sought which influence the function of PS sites. Mutations in some Polycomb and trithorax group genes were found to affect the eye color from some P[en] insertion sites. However, different mutations affected expression from different P[en] insertion sites and no one mutation was found to affect expression from all P[en] insertion sites examined. These results suggest that white expression from P[en] is not directly regulated by members of the Polycomb and trithorax group genes, but in some cases can be influenced by them. I propose that engrailed PS sites normally act to promote interactions between distantly located engrailed regulatory sites and the engrailed promoter. PMID:8005412

The Werner syndrome protein limits the error-prone 8-oxo-dG lesion bypass activity of human DNA polymerase kappa

PubMed Central

Maddukuri, Leena; Ketkar, Amit; Eddy, Sarah; Zafar, Maroof K.; Eoff, Robert L.

2014-01-01

Human DNA polymerase kappa (hpol κ) is the only Y-family member to preferentially insert dAMP opposite 7,8-dihydro-8-oxo-2′-deoxyguanosine (8-oxo-dG) during translesion DNA synthesis. We have studied the mechanism of action by which hpol κ activity is modulated by the Werner syndrome protein (WRN), a RecQ helicase known to influence repair of 8-oxo-dG. Here we show that WRN stimulates the 8-oxo-dG bypass activity of hpol κ in vitro by enhancing the correct base insertion opposite the lesion, as well as extension from dC:8-oxo-dG base pairs. Steady-state kinetic analysis reveals that WRN improves hpol κ-catalyzed dCMP insertion opposite 8-oxo-dG ∼10-fold and extension from dC:8-oxo-dG by 2.4-fold. Stimulation is primarily due to an increase in the rate constant for polymerization (kpol), as assessed by pre-steady-state kinetics, and it requires the RecQ C-terminal (RQC) domain. In support of the functional data, recombinant WRN and hpol κ were found to physically interact through the exo and RQC domains of WRN, and co-localization of WRN and hpol κ was observed in human cells treated with hydrogen peroxide. Thus, WRN limits the error-prone bypass of 8-oxo-dG by hpol κ, which could influence the sensitivity to oxidative damage that has previously been observed for Werner's syndrome cells. PMID:25294835

LookSeq: a browser-based viewer for deep sequencing data.

PubMed

Manske, Heinrich Magnus; Kwiatkowski, Dominic P

2009-11-01

Sequencing a genome to great depth can be highly informative about heterogeneity within an individual or a population. Here we address the problem of how to visualize the multiple layers of information contained in deep sequencing data. We propose an interactive AJAX-based web viewer for browsing large data sets of aligned sequence reads. By enabling seamless browsing and fast zooming, the LookSeq program assists the user to assimilate information at different levels of resolution, from an overview of a genomic region to fine details such as heterogeneity within the sample. A specific problem, particularly if the sample is heterogeneous, is how to depict information about structural variation. LookSeq provides a simple graphical representation of paired sequence reads that is more revealing about potential insertions and deletions than are conventional methods.

Effect of the Molecular Nature of Mutation on the Efficiency of Intrachromosomal Gene Conversion in Mouse Cells

PubMed Central

Letsou, Anthea; Liskay, R. Michael

1987-01-01

With the intent of further exploring the nature of gene conversion in mammalian cells, we systematically addressed the effects of the molecular nature of mutation on the efficiency of intrachromosomal gene conversion in cultured mouse cells. Comparison of conversion rates revealed that all mutations studied were suitable substrates for gene conversion; however, we observed that the rates at which different mutations converted to wild-type could differ by two orders of magnitude. Differences in conversion rates were correlated with the molecular nature of the mutations. In general, rates of conversion decreased with increasing size of the molecular lesions. In comparisons of conversion rates for single base pair insertions and deletions we detected a genotype-directed path for conversion, by which an insertion was converted to wild-type three to four times more efficiently than was a deletion which maps to the same site. The data are discussed in relation to current theories of gene conversion, and are consistent with the idea that gene conversion in mammalian cells can result from repair of heteroduplex DNA (hDNA) intermediates. PMID:2828159

Precision-engineering the Pseudomonas aeruginosa genome with two-step allelic exchange

PubMed Central

Hmelo, Laura R.; Borlee, Bradley R.; Almblad, Henrik; Love, Michelle E.; Randall, Trevor E.; Tseng, Boo Shan; Lin, Chuyang; Irie, Yasuhiko; Storek, Kelly M.; Yang, Jaeun Jane; Siehnel, Richard J.; Howell, P. Lynne; Singh, Pradeep K.; Tolker-Nielsen, Tim; Parsek, Matthew R.; Schweizer, Herbert P.; Harrison, Joe J.

2016-01-01

Allelic exchange is an efficient method of bacterial genome engineering. This protocol describes the use of this technique to make gene knockouts and knockins, as well as single nucleotide insertions, deletions and substitutions in Pseudomonas aeruginosa. Unlike other approaches to allelic exchange, this protocol does not require heterologous recombinases to insert or excise selective markers from the target chromosome. Rather, positive and negative selection are enabled solely by suicide vector-encoded functions and host cell proteins. Here, mutant alleles, which are flanked by regions of homology to the recipient chromosome, are synthesized in vitro and then cloned into allelic exchange vectors using standard procedures. These suicide vectors are then introduced into recipient cells by conjugation. Homologous recombination then results in antibiotic resistant single-crossover mutants in which the plasmid has integrated site-specifically into the chromosome. Subsequently, unmarked double-crossover mutants are isolated directly using sucrose-mediated counter-selection. This two-step process yields seamless mutations that are precise to a single base pair of DNA. The entire procedure requires ~2 weeks. PMID:26492139

Desktop-based computer-assisted orthopedic training system for spinal surgery.

PubMed

Rambani, Rohit; Ward, James; Viant, Warren

2014-01-01

Simulation and surgical training has moved on since its inception during the end of the last century. The trainees are getting more exposed to computers and laboratory training in different subspecialties. More needs to be done in orthopedic simulation in spinal surgery. To develop a training system for pedicle screw fixation and validate its effectiveness in a cohort of junior orthopedic trainees. Fully simulated computer-navigated training system is used to train junior orthopedic trainees perform pedicle screw insertion in the lumbar spine. Real patient computed tomography scans are used to produce the real-time fluoroscopic images of the lumbar spine. The training system was developed to simulate pedicle screw insertion in the lumbar spine. A total of 12 orthopedic senior house officers performed pedicle screw insertion in the lumbar spine before and after the training on training system. The results were assessed based on the scoring system, which included the amount of time taken, accuracy of pedicle screw insertion, and the number of exposures requested to complete the procedure. The result shows a significant improvement in amount of time taken, accuracy of fixation, and the number of exposures after the training on simulator system. This was statistically significant using paired Student t test (p < 0.05). Fully simulated computer-navigated training system is an efficient training tool for young orthopedic trainees. This system can be used to augment training in the operating room, and trainees acquire their skills in the comfort of their study room or in the training room in the hospital. The system has the potential to be used in various other orthopedic procedures for learning of technical skills in a manner aimed at ensuring a smooth escalation in task complexity leading to the better performance of procedures in the operating theater. Copyright © 2014 Association of Program Directors in Surgery. Published by Elsevier Inc. All rights reserved.

Formation and Repair of Mismatches Containing Ribonucleotides and Oxidized Bases at Repeated DNA Sequences*

PubMed Central

Cilli, Piera; Minoprio, Anna; Bossa, Cecilia; Bignami, Margherita; Mazzei, Filomena

2015-01-01

The cellular pool of ribonucleotide triphosphates (rNTPs) is higher than that of deoxyribonucleotide triphosphates. To ensure genome stability, DNA polymerases must discriminate against rNTPs and incorporated ribonucleotides must be removed by ribonucleotide excision repair (RER). We investigated DNA polymerase β (POL β) capacity to incorporate ribonucleotides into trinucleotide repeated DNA sequences and the efficiency of base excision repair (BER) and RER enzymes (OGG1, MUTYH, and RNase H2) when presented with an incorrect sugar and an oxidized base. POL β incorporated rAMP and rCMP opposite 7,8-dihydro-8-oxoguanine (8-oxodG) and extended both mispairs. In addition, POL β was able to insert and elongate an oxidized rGMP when paired with dA. We show that RNase H2 always preserves the capacity to remove a single ribonucleotide when paired to an oxidized base or to incise an oxidized ribonucleotide in a DNA duplex. In contrast, BER activity is affected by the presence of a ribonucleotide opposite an 8-oxodG. In particular, MUTYH activity on 8-oxodG:rA mispairs is fully inhibited, although its binding capacity is retained. This results in the reduction of RNase H2 incision capability of this substrate. Thus complex mispairs formed by an oxidized base and a ribonucleotide can compromise BER and RER in repeated sequences. PMID:26338705

Efficient CRISPR/Cas9-Mediated Versatile, Predictable, and Donor-Free Gene Knockout in Human Pluripotent Stem Cells.

PubMed

Liu, Zhongliang; Hui, Yi; Shi, Lei; Chen, Zhenyu; Xu, Xiangjie; Chi, Liankai; Fan, Beibei; Fang, Yujiang; Liu, Yang; Ma, Lin; Wang, Yiran; Xiao, Lei; Zhang, Quanbin; Jin, Guohua; Liu, Ling; Zhang, Xiaoqing

2016-09-13

Loss-of-function studies in human pluripotent stem cells (hPSCs) require efficient methodologies for lesion of genes of interest. Here, we introduce a donor-free paired gRNA-guided CRISPR/Cas9 knockout strategy (paired-KO) for efficient and rapid gene ablation in hPSCs. Through paired-KO, we succeeded in targeting all genes of interest with high biallelic targeting efficiencies. More importantly, during paired-KO, the cleaved DNA was repaired mostly through direct end joining without insertions/deletions (precise ligation), and thus makes the lesion product predictable. The paired-KO remained highly efficient for one-step targeting of multiple genes and was also efficient for targeting of microRNA, while for long non-coding RNA over 8 kb, cleavage of a short fragment of the core promoter region was sufficient to eradicate downstream gene transcription. This work suggests that the paired-KO strategy is a simple and robust system for loss-of-function studies for both coding and non-coding genes in hPSCs. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.

Upregulation of the Nr2f1-A830082K12Rik gene pair in murine neural crest cells results in a complex phenotype reminiscent of Waardenburg syndrome type 4

PubMed Central

Bergeron, Karl-F.; Nguyen, Chloé M. A.; Cardinal, Tatiana; Charrier, Baptiste; Silversides, David W.

2016-01-01

ABSTRACT Waardenburg syndrome is a neurocristopathy characterized by a combination of skin and hair depigmentation, and inner ear defects. In the type 4 form, these defects show comorbidity with Hirschsprung disease, a disorder marked by an absence of neural ganglia in the distal colon, triggering functional intestinal obstruction. Here, we report that the Spot mouse line – obtained through an insertional mutagenesis screen for genes involved in neural crest cell (NCC) development – is a model for Waardenburg syndrome type 4. We found that the Spot insertional mutation causes overexpression of an overlapping gene pair composed of the transcription-factor-encoding Nr2f1 and the antisense long non-coding RNA A830082K12Rik in NCCs through a mechanism involving relief of repression of these genes. Consistent with the previously described role of Nr2f1 in promoting gliogenesis in the central nervous system, we further found that NCC-derived progenitors of the enteric nervous system fail to fully colonize Spot embryonic guts owing to their premature differentiation in glial cells. Taken together, our data thus identify silencer elements of the Nr2f1-A830082K12Rik gene pair as new candidate loci for Waardenburg syndrome type 4. PMID:27585883

Upregulation of the Nr2f1-A830082K12Rik gene pair in murine neural crest cells results in a complex phenotype reminiscent of Waardenburg syndrome type 4.

PubMed

Bergeron, Karl-F; Nguyen, Chloé M A; Cardinal, Tatiana; Charrier, Baptiste; Silversides, David W; Pilon, Nicolas

2016-11-01

Waardenburg syndrome is a neurocristopathy characterized by a combination of skin and hair depigmentation, and inner ear defects. In the type 4 form, these defects show comorbidity with Hirschsprung disease, a disorder marked by an absence of neural ganglia in the distal colon, triggering functional intestinal obstruction. Here, we report that the Spot mouse line - obtained through an insertional mutagenesis screen for genes involved in neural crest cell (NCC) development - is a model for Waardenburg syndrome type 4. We found that the Spot insertional mutation causes overexpression of an overlapping gene pair composed of the transcription-factor-encoding Nr2f1 and the antisense long non-coding RNA A830082K12Rik in NCCs through a mechanism involving relief of repression of these genes. Consistent with the previously described role of Nr2f1 in promoting gliogenesis in the central nervous system, we further found that NCC-derived progenitors of the enteric nervous system fail to fully colonize Spot embryonic guts owing to their premature differentiation in glial cells. Taken together, our data thus identify silencer elements of the Nr2f1-A830082K12Rik gene pair as new candidate loci for Waardenburg syndrome type 4. © 2016. Published by The Company of Biologists Ltd.

Recovery of Pavlovian sign-tracking (autoshaping) following the discontinuation of inter-trial interval food in rats.

PubMed

Kearns, David N; Weiss, Stanley J

2007-07-01

In pigeons, Pavlovian autoshaped keypecking produced by keylight-food pairings has been eliminated by introducing food during periods between CS presentations (i.e., during the inter-trial intervals). Keypecking eliminated in this manner reappears when the inter-trial USs are discontinued even though the CS is no longer paired with US. The present experiment investigated whether this recovery of responding produced by discontinuing unpaired inter-trial US presentations could be extended to another species, rats, within a Pavlovian sign-tracking paradigm. Rats were initially trained on a procedure where insertion of one retractable lever (CS(+)) was followed, response independently, with food, while insertion of another lever (CS(-)) was not paired with food. Rats quickly came to contact the CS(+) lever at high rates, but contacted the CS(-) lever infrequently. In the next phase, CS(+) was no longer followed by food. Explicitly unpaired food was presented only during the inter-trial intervals when both levers were absent. This treatment essentially eliminated the sign-tracking response. In the final phase, the unpaired inter-trial food presentations were discontinued while both CSs continued to be presented without food. This produced a significant recovery of the sign-tracking elicited by the CS(+) lever, extending the species generality of the Pavlovian resurgence phenomenon that has previously only been reported in pigeons, to rats.

System and method for smoothing a salient rotor in electrical machines

DOEpatents

Raminosoa, Tsarafidy; Alexander, James Pellegrino; El-Refaie, Ayman Mohamed Fawzi; Torrey, David A.

2016-12-13

An electrical machine exhibiting reduced friction and windage losses is disclosed. The electrical machine includes a stator and a rotor assembly configured to rotate relative to the stator, wherein the rotor assembly comprises a rotor core including a plurality of salient rotor poles that are spaced apart from one another around an inner hub such that an interpolar gap is formed between each adjacent pair of salient rotor poles, with an opening being defined by the rotor core in each interpolar gap. Electrically non-conductive and non-magnetic inserts are positioned in the gaps formed between the salient rotor poles, with each of the inserts including a mating feature formed an axially inner edge thereof that is configured to mate with a respective opening being defined by the rotor core, so as to secure the insert to the rotor core against centrifugal force experienced during rotation of the rotor assembly.

In Vivo Wear Performance of Cobalt-Chromium Versus Oxidized Zirconium Femoral Total Knee Replacements.

PubMed

Gascoyne, Trevor C; Teeter, Matthew G; Guenther, Leah E; Burnell, Colin D; Bohm, Eric R; Naudie, Douglas R

2016-01-01

This study examines the damage and wear on the polyethylene (PE) inserts from 52 retrieved Genesis II total knee replacements to identify differences in tribological performance between matched pairs of cobalt-chromium (CoCr) and oxidized zirconium (OxZr) femoral components. Observer damage scoring and microcomputed tomography were used to quantify PE damage and wear, respectively. No significant differences were found between CoCr and OxZr groups in terms of PE insert damage, surface penetration, or wear. No severe damage such as cracking or delamination was noted on any of the 52 PE inserts. Observer damage scoring did not correlate with penetrative or volumetric PE wear. The more costly OxZr femoral component does not demonstrate clear tribological benefit over the standard CoCr component in the short term with this total knee replacement design. Copyright © 2016 Elsevier Inc. All rights reserved.

[Analysis of the primary and secondary structure of the mitochondrial serine transfer RNA in seven species of Lutzomyia].

PubMed

Vivero, Rafael José; Contreras-Gutiérrez, Maria Angélica; Bejarano, Eduar Elías

2007-09-01

Lutzomyia sand flies are involved in the transmission of the parasite Leishmania spp. in America. The taxonomy of these vectors is traditionally based on morphological features of the adult stage, particularly the paired structures of the head and genitalia. Although these characters are useful to distinguish most species of Lutzomyia, morphological identification may be complicated by the similarities within subgenera and species group. To evaluate the utility of mitochondrial serine transfer RNA tRNA Ser for taxonomic identification of Lutzomyia. Seven sand fly species, each representing one of the 27 taxonomic subdivisions in genus Lutzomyia, were analyzed including L. trinidadensis (Oswaldoi group), L. (Psychodopygus) panamensis, L.(Micropygomyia) cayennensis cayennensis, L. dubitans (Migonei group), L. (Lutzomyia) gomezi, L. rangeliana (ungrouped) and L. evansi (Verrucarum group). The mitochondrial tRNA Ser gene, flanked by the cytochrome b and NAD dehydrogenase subunit one genes, was extracted, amplified and sequenced from each specimen. Secondary structure of the tRNA Ser was predicted by comparisons with previously described homologous structures from other dipteran species. The tRNA Ser gene ranged in size from 66 base pairs in L. gomezi to 69 base pairs in L. trinidadensis. Fourteen polymorphic sites, including four insertion-deletion events, were observed in the aligned 70 nucleotide positions. The majority of the substitutions were located in the dihydrouridine, ribothymidine-pseudouridine-cytosine and variable loops, as well as in the basal extreme of the anticodon arm. Changes of primary sequence of the tRNASer provided useful molecular characters for taxonomic identification of the sand fly species under consideration.

Study of low insertion loss and miniaturization wavelet transform and inverse transform processor using SAW devices.

PubMed

Jiang, Hua; Lu, Wenke; Zhang, Guoan

2013-07-01

In this paper, we propose a low insertion loss and miniaturization wavelet transform and inverse transform processor using surface acoustic wave (SAW) devices. The new SAW wavelet transform devices (WTDs) use the structure with two electrode-widths-controlled (EWC) single phase unidirectional transducers (SPUDT-SPUDT). This structure consists of the input withdrawal weighting interdigital transducer (IDT) and the output overlap weighting IDT. Three experimental devices for different scales 2(-1), 2(-2), and 2(-3) are designed and measured. The minimum insertion loss of the three devices reaches 5.49dB, 4.81dB, and 5.38dB respectively which are lower than the early results. Both the electrode width and the number of electrode pairs are reduced, thus making the three devices much smaller than the early devices. Therefore, the method described in this paper is suitable for implementing an arbitrary multi-scale low insertion loss and miniaturization wavelet transform and inverse transform processor using SAW devices. Copyright © 2013 Elsevier B.V. All rights reserved.

First description of a musculoskeletal linkage in an adipose fin: innovations for active control in a primitively passive appendage

PubMed Central

Stewart, Thomas A.; Hale, Melina E.

2013-01-01

Adipose fins are enigmatic appendages found between the dorsal and caudal fins of some teleostean fishes. Long thought to be vestigial, degenerate second dorsal fins, remnants of the primitive gnathostome condition, adipose fins have since been recognized as novel morphologies. Unique among the fins of extant fishes, adipose fins have uniformly been described as passive structures, with no associated musculature. Here we provide the first description of a musculoskeletal linkage in an adipose fin, identified in the sun catfish Horabagrus brachysoma. Modified supracarinalis posterior muscles insert from the dorsal midline anterior to the adipose fin by tendons onto the fin base. An additional pair of posterior adipose-fin muscles also inserts upon the fin base and lay posterolateral to the fin, superficial to the axial muscle. This musculoskeletal linkage is an evolutionary innovation, a novel mechanism for controlling adipose-fin movement. These muscles appear to exemplify two approaches by which fins evolve to be actively controlled. We hypothesize that the anterior muscles arose through co-option of an existing fin linkage, while the posterior muscles originated as de novo fin muscles. These findings present adipose fins as a rich system within which to explore the evolution of novel vertebrate appendages. PMID:23135670

Ultracompact and broadband polarization beam splitter based on polarization-dependent critical guiding condition.

PubMed

Ying, Zhoufeng; Wang, Guanghui; Zhang, Xuping; Ho, Ho-pui; Huang, Ying

2015-05-01

An ultracompact and broadband polarization beam splitter (PBS) based on the polarization-dependent critical guiding condition of an asymmetrical directional coupler is proposed. The device consists of a pair of silicon waveguides with different height and width. Due to the different cutoff conditions for the TE and TM polarization modes, it is possible to have the TM mode guided in one waveguide while the TE mode is supported in both. Therefore, only the phase-matching condition for the cross-coupling of the TE mode needs to be considered. This approach not only simplifies the design procedures but also significantly improves device performance with smaller total length and larger bandwidth. Finally, regardless of the contribution of S-bend waveguides, our proposed PBS has a coupling region as short as 0.2 μm, which is the shortest reported until now. The simulation result shows that the extinction ratios for the TE and TM polarization are 13.5 and 16.6 dB at their respective output ports, and their insertion losses are 0.29 and 0.13 dB, respectively. Numerical simulations also show that the device offers a very large bandwidth (∼140  nm) with large extinction ratio (>10  dB) and low insertion loss (<1  dB).

Complete Genome Sequence of ER2796, a DNA Methyltransferase-Deficient Strain of Escherichia coli K-12.

PubMed

Anton, Brian P; Mongodin, Emmanuel F; Agrawal, Sonia; Fomenkov, Alexey; Byrd, Devon R; Roberts, Richard J; Raleigh, Elisabeth A

2015-01-01

We report the complete sequence of ER2796, a laboratory strain of Escherichia coli K-12 that is completely defective in DNA methylation. Because of its lack of any native methylation, it is extremely useful as a host into which heterologous DNA methyltransferase genes can be cloned and the recognition sequences of their products deduced by Pacific Biosciences Single-Molecule Real Time (SMRT) sequencing. The genome was itself sequenced from a long-insert library using the SMRT platform, resulting in a single closed contig devoid of methylated bases. Comparison with K-12 MG1655, the first E. coli K-12 strain to be sequenced, shows an essentially co-linear relationship with no major rearrangements despite many generations of laboratory manipulation. The comparison revealed a total of 41 insertions and deletions, and 228 single base pair substitutions. In addition, the long-read approach facilitated the surprising discovery of four gene conversion events, three involving rRNA operons and one between two cryptic prophages. Such events thus contribute both to genomic homogenization and to bacteriophage diversification. As one of relatively few laboratory strains of E. coli to be sequenced, the genome also reveals the sequence changes underlying a number of classical mutant alleles including those affecting the various native DNA methylation systems.

Complete Genome Sequence of ER2796, a DNA Methyltransferase-Deficient Strain of Escherichia coli K-12

PubMed Central

Anton, Brian P.; Mongodin, Emmanuel F.; Agrawal, Sonia; Fomenkov, Alexey; Byrd, Devon R.; Roberts, Richard J.; Raleigh, Elisabeth A.

2015-01-01

We report the complete sequence of ER2796, a laboratory strain of Escherichia coli K-12 that is completely defective in DNA methylation. Because of its lack of any native methylation, it is extremely useful as a host into which heterologous DNA methyltransferase genes can be cloned and the recognition sequences of their products deduced by Pacific Biosciences Single-Molecule Real Time (SMRT) sequencing. The genome was itself sequenced from a long-insert library using the SMRT platform, resulting in a single closed contig devoid of methylated bases. Comparison with K-12 MG1655, the first E. coli K-12 strain to be sequenced, shows an essentially co-linear relationship with no major rearrangements despite many generations of laboratory manipulation. The comparison revealed a total of 41 insertions and deletions, and 228 single base pair substitutions. In addition, the long-read approach facilitated the surprising discovery of four gene conversion events, three involving rRNA operons and one between two cryptic prophages. Such events thus contribute both to genomic homogenization and to bacteriophage diversification. As one of relatively few laboratory strains of E. coli to be sequenced, the genome also reveals the sequence changes underlying a number of classical mutant alleles including those affecting the various native DNA methylation systems. PMID:26010885

Radial wedge flange clamp

DOEpatents

Smith, Karl H.

2002-01-01

A radial wedge flange clamp comprising a pair of flanges each comprising a plurality of peripheral flat wedge facets having flat wedge surfaces and opposed and mating flat surfaces attached to or otherwise engaged with two elements to be joined and including a series of generally U-shaped wedge clamps each having flat wedge interior surfaces and engaging one pair of said peripheral flat wedge facets. Each of said generally U-shaped wedge clamps has in its opposing extremities apertures for the tangential insertion of bolts to apply uniform radial force to said wedge clamps when assembled about said wedge segments.

Development and evaluation of a LOR-based image reconstruction with 3D system response modeling for a PET insert with dual-layer offset crystal design.

PubMed

Zhang, Xuezhu; Stortz, Greg; Sossi, Vesna; Thompson, Christopher J; Retière, Fabrice; Kozlowski, Piotr; Thiessen, Jonathan D; Goertzen, Andrew L

2013-12-07

In this study we present a method of 3D system response calculation for analytical computer simulation and statistical image reconstruction for a magnetic resonance imaging (MRI) compatible positron emission tomography (PET) insert system that uses a dual-layer offset (DLO) crystal design. The general analytical system response functions (SRFs) for detector geometric and inter-crystal penetration of coincident crystal pairs are derived first. We implemented a 3D ray-tracing algorithm with 4π sampling for calculating the SRFs of coincident pairs of individual DLO crystals. The determination of which detector blocks are intersected by a gamma ray is made by calculating the intersection of the ray with virtual cylinders with radii just inside the inner surface and just outside the outer-edge of each crystal layer of the detector ring. For efficient ray-tracing computation, the detector block and ray to be traced are then rotated so that the crystals are aligned along the X-axis, facilitating calculation of ray/crystal boundary intersection points. This algorithm can be applied to any system geometry using either single-layer (SL) or multi-layer array design with or without offset crystals. For effective data organization, a direct lines of response (LOR)-based indexed histogram-mode method is also presented in this work. SRF calculation is performed on-the-fly in both forward and back projection procedures during each iteration of image reconstruction, with acceleration through use of eight-fold geometric symmetry and multi-threaded parallel computation. To validate the proposed methods, we performed a series of analytical and Monte Carlo computer simulations for different system geometry and detector designs. The full-width-at-half-maximum of the numerical SRFs in both radial and tangential directions are calculated and compared for various system designs. By inspecting the sinograms obtained for different detector geometries, it can be seen that the DLO crystal design can provide better sampling density than SL or dual-layer no-offset system designs with the same total crystal length. The results of the image reconstruction with SRFs modeling for phantom studies exhibit promising image recovery capability for crystal widths of 1.27-1.43 mm and top/bottom layer lengths of 4/6 mm. In conclusion, we have developed efficient algorithms for system response modeling of our proposed PET insert with DLO crystal arrays. This provides an effective method for both 3D computer simulation and quantitative image reconstruction, and will aid in the optimization of our PET insert system with various crystal designs.

Influence of a removable prosthesis on oral health-related quality of life and mastication in elders with Parkinson disease.

PubMed

Ribeiro, Giselle R; Campos, Camila H; Rodrigues Garcia, Renata Cunha Matheus

2017-11-01

Parkinson disease (PD) symptoms, such as muscle rigidity, tremors in the lips and tongue, and involuntary mandibular movements, may cause oral health-related problems, mastication difficulties, and denture discomfort because of the difficulty in controlling a prosthesis with the oral musculature. The purpose of this observational clinical study was to evaluate the influence of oral rehabilitation with a removable prosthesis on oral health-related quality of life (OHRQoL) and masticatory efficiency (ME) in elders with PD. Thirty-four elders with PD (n=17, mean age 69.4 ±4.7 years) or without PD (n=17, mean age 70.7 ±4.7 years) were recruited. All participants first underwent OHRQoL and ME evaluations. Two months after the insertion of new removable prostheses, the participants were reassessed. The OHRQoL was measured with the Oral Health Impact Profile (OHIP-49). ME was evaluated by determining the percentage weight of the comminuted silicone-based artificial material that passed through a 2.8 mm sieve. For each group, data were compared between baseline and after insertion of new removable prostheses by paired t test or Wilcoxon sign test/signed-rank test. Group differences were assessed at each time point by t test (α=.05). After the insertion of removable prostheses, elders with PD showed improved OHRQoL and ME. Controls also showed improvements on both measures after insertion of removable prostheses. At baseline, elders with PD had lower OHRQoL and ME compared with the controls (P<.05). After removable prosthesis insertion, the elders with PD continued to show lower ME values than the controls, but their OHRQoL was similar. Oral rehabilitation with new removable dental prostheses improved the OHRQoL and ME in elders with and without PD, although ME did not reach control levels in elders with PD. Copyright © 2017 Editorial Council for the Journal of Prosthetic Dentistry. Published by Elsevier Inc. All rights reserved.

Axial load-bearing capacity of an osteochondral autograft stabilized with a resorbable osteoconductive bone cement compared with a press-fit graft in a bovine model.

PubMed

Kiss, Marc-Olivier; Levasseur, Annie; Petit, Yvan; Lavigne, Patrick

2012-05-01

Osteochondral autografts in mosaicplasty are inserted in a press-fit fashion, and hence, patients are kept nonweightbearing for up to 2 months after surgery to allow bone healing and prevent complications. Very little has been published regarding alternative fixation techniques of those grafts. Osteochondral autografts stabilized with a resorbable osteoconductive bone cement would have a greater load-bearing capacity than standard press-fit grafts. Controlled laboratory study. Biomechanical testing was conducted on 8 pairs of cadaveric bovine distal femurs. For the first 4 pairs, 6 single osteochondral autografts were inserted in a press-fit fashion on one femur. On the contralateral femur, 6 grafts were stabilized with a calcium triglyceride osteoconductive bone cement. For the 4 remaining pairs of femurs, 4 groups of 3 adjacent press-fit grafts were inserted on one femur, whereas on the contralateral femur, grafts were cemented. After a maturation period of 48 hours, axial loading was applied on all single grafts and on the middle graft of each 3-in-a-row series. For the single-graft configuration, median loads required to sink the press-fit and cemented grafts by 2 and 3 mm were 281.87 N versus 345.56 N (P = .015) and 336.29 N versus 454.08 N (P = .018), respectively. For the 3-in-a-row configuration, median loads required to sink the press-fit and cemented grafts by 2 and 3 mm were 260.31 N versus 353.47 N (P = .035) and 384.83 N versus 455.68 N (P = .029), respectively. Fixation of osteochondral grafts using bone cement appears to improve immediate stability over the original mosaicplasty technique for both single- and multiple-graft configurations. Achieving greater primary stability of osteochondral grafts could potentially accelerate postoperative recovery, allowing early weightbearing and physical therapy.

Role of blood ribosomal protein S19 in coagulum resorption: a study using Gln137Glu-ribosomal protein S19 gene knock-in mouse.

PubMed

Chen, Jun; Fujino, Rika; Zhao, Rui; Semba, Umeko; Araki, Kimi; Yamamoto, Tetsuro

2014-11-01

Sera of human, guinea pig or mouse contain a strong monocyte chemoattractant capacity that is attributed to the ribosomal protein S19 (RP S19) oligomers generated during blood coagulation. In contrast, sera prepared from Gln137Glu-RP S19 gene knock-in mice contained negligible chemoattractant capacity. When coagula that had been pre-formed from the blood of both the wild type and knock-in mice were intraperitoneally inserted into host mice, after 3 days of recovery, the knock-in mouse coagula remained larger than the wild type mouse coagula. The wild type mouse coagula were covered by multiple macrophage layers at the surface and were infiltrated inside by macrophages. Knock-in mouse coagula exhibited less macrophage involvement. When coagula of knock-in mice and coagula of knock-in mice containing C5a/RP S19, an artificial substitute of the RP S19 oligomers, were intraperitoneally inserted as pairs, the C5a/RP S19 containing coagulum was more rapidly absorbed, concomitant with increased macrophage involvement. Finally, when the knock-in mouse and wild type mouse coagula pairs were inserted into mice in which macrophages had been depleted using clodronate liposome, the size difference of recovered coagula was reversed. These results indicate the importance of the RP S19 oligomer-induced macrophage recruitment in coagulum resorption. © 2014 Japanese Society of Pathology and Wiley Publishing Asia Pty Ltd.

Replication of a carcinogenic nitropyrene DNA lesion by human Y-family DNA polymerase

PubMed Central

Kirouac, Kevin N.; Basu, Ashis K.; Ling, Hong

2013-01-01

Nitrated polycyclic aromatic hydrocarbons are common environmental pollutants, of which many are mutagenic and carcinogenic. 1-Nitropyrene is the most abundant nitrated polycyclic aromatic hydrocarbon, which causes DNA damage and is carcinogenic in experimental animals. Error-prone translesion synthesis of 1-nitropyrene–derived DNA lesions generates mutations that likely play a role in the etiology of cancer. Here, we report two crystal structures of the human Y-family DNA polymerase iota complexed with the major 1-nitropyrene DNA lesion at the insertion stage, incorporating either dCTP or dATP nucleotide opposite the lesion. Polι maintains the adduct in its active site in two distinct conformations. dCTP forms a Watson–Crick base pair with the adducted guanine and excludes the pyrene ring from the helical DNA, which inhibits replication beyond the lesion. By contrast, the mismatched dATP stacks above the pyrene ring that is intercalated in the helix and achieves a productive conformation for misincorporation. The intra-helical bulky pyrene mimics a base pair in the active site and facilitates adenine misincorporation. By structure-based mutagenesis, we show that the restrictive active site of human polη prevents the intra-helical conformation and A-base misinsertions. This work provides one of the molecular mechanisms for G to T transversions, a signature mutation in human lung cancer. PMID:23268450

Diamond-anvil high-pressure cell with improved X-ray collimation system

DOEpatents

Schiferl, David; Olinger, Barton W.; Livingston, Robert W.

1986-01-01

An adjustable X-ray collimation system for a diamond-anvil high-pressure cell of the type including a cooperable piston and cylinder and a pair of opposing diamonds located between the head of the piston and the head of the cylinder. The X-ray collimation system includes a tubular insert which contains an X-ray collimator. The insert is engageable in the bore of the piston. The collimator is mounted within the insert by means of an elastomeric O-ring at the end closest the opposed diamonds, and by means of a set of adjustable set screws at the opposite end. By adjustment of the set screws the collimator can be pivoted about the O-ring and brought into alignment with the opposed diamonds and the sample contained therein. In the preferred embodiment there is further provided a set of plugs which are insertable in the bore of the collimator. The plugs have bores of different diameters. By successively inserting plugs of progressively smaller bore diameters and adjusting the alignment of the collimator with each plug, the collimator can be quickly brought into accurate alignment with the diamonds. The collimation system allows alignment of the collimator either before or after the cell has been loaded and pressurized.

Diamond-anvil high-pressure cell with improved x-ray collimation system

DOEpatents

Schiferl, D.; Olinger, B.W.; Livingston, R.W.

1984-03-30

An adjustable x-ray collimation system for a diamond-anvil high-pressure cell of the type including a cooperable piston and cylinder and a pair of opposing diamonds located between the head of the piston and the head of the cylinder. The x-ray collimation system includes a tubular insert which contains an x-ray collimator. The insert is engageable in the bore of the piston. The collimator is mounted within the insert by means of an elastomeric o-ring at the end closest the opposed diamonds, and by means of a set of adjustable set screws at the opposite end. By adjustment of the set screws the collimator can be pivoted about the o-ring and brought into alignment with the opposed diamonds and the sample contained therein. In the preferred embodiment there is further provided a set of plugs which are insertable in the bore of the collimator. The plugs have bores of different diameters. By successively inserting plugs of progressively smaller bore diameters and adjusting the alignment of the collimator with each plug, the collimator can be quickly brought into accurate alignment with the diamonds. The collimation system allows alignment of the collimator either before or after the cell has been loaded and pressurized.

Investigation report: H Reactor mischarging incident

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vinther, A.P.

1964-05-01

All cold reactor start-up procedures require the vertical safety rods (VSR) to be withdrawn in pairs with specific waiting periods between each pair withdrawal. This rod withdrawal procedure will assure an early and safe detection of reactor criticality should reactor reactivity conditions be different than predicted so that proper corrective actions can be taken. During the paired VSR removal of H reactor on April 17, 1964, while preparing for reactor start-up, an extremely low level rising period was detected with six VSR's still in the reactor. The withdrawn VSR's were promptly re-inserted. During the next several days other process difficultiesmore » were encountered. H Processing personnel began investigating the possibility that a number of process tubes might have been mischarged; one shift's charging effort appeared to be suspect as longitudinal peaking appeared nearly twice as severe as normal in the distorted region. Following verification of a charging error in the suspect group of 171 tubes, that group of tubes was discharged and recharged with the proper charge make-up. On April 24, during VSR removal for start-up, low level criticality was detected with three VSR's still in the unit. The VSR's were re-inserted and Operational Physics analysis requested. Following installation of additional poisoning, the Operational Physics analysis uncovered a reactivity prediction error related to the prior operation with the skewed flux distribution. However, in this case, as on April 17, the procedural paired VSR withdrawal provided safe detection of the criticality condition in adequate time to take prompt corrective action. A successful reactor start-up was then achieved later on April 24, and reactor operation has been normal since that time. 4 figs.« less

Mucoadhesive ocular insert based on thiolated poly(acrylic acid): development and in vivo evaluation in humans.

PubMed

Hornof, Margit; Weyenberg, Wim; Ludwig, Annick; Bernkop-Schnürch, Andreas

2003-05-20

The aim of the study was to develop a mucoadhesive ocular insert for the controlled delivery of ophthalmic drugs and to evaluate its efficacy in vivo. The inserts tested were based either on unmodified or thiolated poly(acrylic acid). Water uptake and swelling behavior of the inserts as well as the drug release rates of the model drugs fluorescein and two diclofenac salts with different solubility properties were evaluated in vitro. Fluorescein was used as fluorescent tracer to study the drug release from the insert in humans. The mean fluorescein concentration in the cornea/tearfilm compartment as a function of time was determined after application of aqueous eye drops and inserts composed of unmodified and of thiolated poly(acrylic acid). The acceptability of the inserts by the volunteers was also evaluated. Inserts based on thiolated poly(acrylic acid) were not soluble and had good cohesive properties. A controlled release was achieved for the incorporated model drugs. The in vivo study showed that inserts based on thiolated poly(acrylic acid) provide a fluorescein concentration on the eye surface for more than 8 h, whereas the fluorescein concentration rapidly decreased after application of aqueous eye drops or inserts based on unmodified poly(acrylic acid). Moreover, these inserts were well accepted by the volunteers. The present study indicates that ocular inserts based on thiolated poly(acrylic acid) are promising new solid devices for ocular drug delivery.

Molecular Population Genetics of the Alcohol Dehydrogenase Gene Region of DROSOPHILA MELANOGASTER

PubMed Central

Aquadro, Charles F.; Desse, Susan F.; Bland, Molly M.; Langley, Charles H.; Laurie-Ahlberg, Cathy C.

1986-01-01

Variation in the DNA restriction map of a 13-kb region of chromosome II including the alcohol dehydrogenase structural gene (Adh) was examined in Drosophila melanogaster from natural populations. Detailed analysis of 48 D. melanogaster lines representing four eastern United States populations revealed extensive DNA sequence variation due to base substitutions, insertions and deletions. Cloning of this region from several lines allowed characterization of length variation as due to unique sequence insertions or deletions [nine sizes; 21–200 base pairs (bp)] or transposable element insertions (several sizes, 340 bp to 10.2 kb, representing four different elements). Despite this extensive variation in sequences flanking the Adh gene, only one length polymorphism is clearly associated with altered Adh expression (a copia element approximately 250 bp 5' to the distal transcript start site). Nonetheless, the frequency spectra of transposable elements within and between Drosophila species suggests they are slightly deleterious. Strong nonrandom associations are observed among Adh region sequence variants, ADH allozyme (Fast vs. Slow), ADH enzyme activity and the chromosome inversion ln(2L) t. Phylogenetic analysis of restriction map haplotypes suggest that the major twofold component of ADH activity variation (high vs. low, typical of Fast and Slow allozymes, respectively) is due to sequence variation tightly linked to and possibly distinct from that underlying the allozyme difference. The patterns of nucleotide and haplotype variation for Fast and Slow allozyme lines are consistent with the recent increase in frequency and spread of the Fast haplotype associated with high ADH activity. These data emphasize the important role of evolutionary history and strong nonrandom associations among tightly linked sequence variation as determinants of the patterns of variation observed in natural populations. PMID:3026893

Time-resolved fluorescent properties of 8-vinyl-deoxyadenosine and 2-amino-deoxyribosylpurine exhibit different sensitivity to their opposite base in duplexes.

PubMed

Kenfack, Cyril A; Piémont, Etienne; Ben Gaied, Nouha; Burger, Alain; Mély, Yves

2008-08-14

8-Vinyl-deoxyadenosine (8VA) has been recently introduced as a fluorescent analogue of adenosine that is less perturbing and less quenched than the well-established 2-amino-deoxyribosylpurine (2AP) probe when inserted in oligonucleotides. To further validate 8VA as a fluorescent substitute of A, we compared the ability of 8VA and 2AP in sequences of the type d(CGT TTT XNX TTT TGC) (with N=8VA or 2AP and X=T and C) to discriminate the nature of the opposite base (Y) in duplexes. For both probes, systematic variations in the amplitudes of the short- and long-lived lifetimes of the fluorescence intensity decays as well as in the amplitude of the fast rotational correlation time of the fluorescence anisotropy decays were observed as a function of the nature of Y. From these parameters, we inferred a stability order 8VA-T > 8VA-G > 8VA-A > 8VA-C, similar to the stability order with the native A base, but different from the stability order with 2AP. Using a combination of molecular mechanics and ab initio calculations, we found that the time-resolved parameters of 8VA, but not the 2AP ones, correlate well with the geometry and the strength of the A-Y base-pairing interaction. This may be rationalized by the smaller structural and electronic perturbations induced by the vinyl group in position 8 as compared to the amino group at position 2. As a consequence, substitution of A by 8VA in a base pair was found to only minimally modify the structure and interaction energy of the base pair. Thus, 8VA can be used as a fluorescent substitute of the natural A, to straightforwardly discriminate the nature of the opposite base. This may find interesting applications notably in the elucidation of the mechanisms and dynamics of the DNA mismatch repair system.

Structural and functional differences in the dio1 gene in mice with inherited type 1 deiodinase deficiency.

PubMed

Maia, A L; Berry, M J; Sabbag, R; Harney, J W; Larsen, P R

1995-08-01

The type 1 deiodinase (D1) provides the major portion of the circulating T3 in vertebrates. In C3H and certain other inbred mice, liver and kidney D1 activity is 5- to 10-fold lower than in the common phenotype, C57. The lower D1 levels are paralleled by a decreased normal-sized dio1 mRNA and hyperthyroxinemia. Low activity cosegregates with a restriction fragment length variant (RFLV) in both inbred and recombinant strains, indicating it is due to differences in the dio1 gene. The exonic structure and the deduced amino acid sequences are identical for both strains and highly homologous to that of the rat. The RFLV is due to an approximately 150-base pair expansion of repetitive sequences in the second intron of the C3H gene, but this segment does not differentially affect the transient expression of a human GH gene. The promoter and 5'-flanking regions of the C3H and C57 dio1 genes are very similar and are GC rich without TATA or CCAAT boxes. However, functional assays of 1.5-kilobase 5'-flanking dio1-CAT constructs showed 2- to 3-fold higher activity of the C57-CAT constructs. Deletion mutants showed that sequences between -705 and -162 were the cause of this. In this region, the only major difference between the two genes is a 21-base pair insert containing five CTG repeats in the C3H promoter. This difference also cosegregates with low D1 activity and the intron RFLV in four other mouse strains. The correlation of the CTG repeat insert with both in vitro and in vivo expression and the absence of other significant sequence differences in the 5'-flanking region argue that this is the major explanation for the impaired expression of the dio1 gene and the resulting hyperthyroxinemia of the C3H mouse.

HER2 Amplification and HER2 Mutation Are Distinct Molecular Targets in Lung Cancers.

PubMed

Li, Bob T; Ross, Dara S; Aisner, Dara L; Chaft, Jamie E; Hsu, Meier; Kako, Severine L; Kris, Mark G; Varella-Garcia, Marileila; Arcila, Maria E

2016-03-01

Human epidermal growth factor receptor 2 gene (HER2 [also known as ERBB2]) alterations have been identified as oncogenic drivers and potential therapeutic targets in lung cancers. The molecular associations of HER2 gene amplification, mutation, and HER2 protein overexpression in lung cancers have not been distinctly defined. To explore these associations, Memorial Sloan Kettering Cancer Center and the University of Colorado combined their data on HER2 alterations in lung cancers. Tumor specimens from 175 patients with lung adenocarcinomas and no prior targeted therapy were evaluated for the presence of HER2 amplification and mutation and HER2 protein overexpression. Amplification was assessed by fluorescence in situ hybridization (FISH) and defined as an HER2-to-chromosome enumeration probe 17 ratio of at least 2.0. Mutation was assessed by fragment analysis, mass spectrometry genotyping, and Sanger sequencing. Overexpression was assessed by immunohistochemical (IHC) staining. The frequencies of HER2 amplification and mutation and HER2 overexpression were calculated and their overlap examined. HER2 amplification was detected by FISH in 5 of 175 cases (3%). HER2 mutation was detected in 4 of 148 specimens (3%), including three identical 12-base pair insertions (p.A775_G776insYVMA) and a 9-base pair insertion, all in exon 20. None of the HER2-mutant cases was amplified. HER2 overexpression (2+ or 3+) on IHC staining was not detected in the 25 specimens available for testing, and negative IHC staining correlated with the negative results according to FISH. HER2 mutations are not associated with HER2 amplification, thus suggesting a distinct entity and therapeutic target. HER2-positive lung cancer may not be an adequate term, and patient cohorts for the study of HER2-targeted agents should be defined by the specific HER2 alteration present. Copyright © 2015 International Association for the Study of Lung Cancer. Published by Elsevier Inc. All rights reserved.

A novel, non-functional, COL1A1 polymorphism is not associated with lumbar disk disease in young male Greek subjects unlike that of the Sp1 site

PubMed Central

Bei, Thalia; Tilkeridis, Constantinos; Garantziotis, Stavros; Boikos, Sosipatros A.; Kazakos, Konstantinos; Simopoulos, Constantinos; Stratakis, Constantine A.

2011-01-01

OBJECTIVE We recently reported the association of the Sp1 site polymorphism of the COL1A1 gene with lumbar disk disease (LDD). In the present study we searched for a different polymorphism of the COL1A1 gene (which is usually not in linkage disequilibrium with the Sp1 site) in subjects with LDD. DESIGN Blood was collected from 24 Greek army recruits, aged 29±7.6 years, with LDD, and 66 healthy men, aged 26±4.38 years, matched for body mass index (BMI) and age, with normal BMD and with no history of trauma or fractures, who served as controls. DNA was extracted and the COL1A1 gene was sequenced. Of the control subjects, 12 were army recruits and 54 were selected from the general population. RESULTS The four base-pair insertion polymorphism in the COL1A1 gene analyzed by polymerase chain reaction amplification of DNA produces two different fragments (alleles A1 and A2): 14 patients (58.3%) were homozygous for A2A2, versus 35 controls (53%), while 3 patients (12.5%) were A1A1, and 8 of the control subjects (12%) had this genotype. There were no statistically significant differences in the presence of the two alleles of this polymorphism between patients with LDD and control subjects. CONCLUSIONS A four base-pair insertion polymorphism of the COL1A1 gene is not associated with the presence of LDD in young males, unlike the Sp1 site polymorphism of the same gene. These data reinforce the association between LDD and the functional polymorphisms of the Sp1 site by showing that other polymorphic sites of the of the COL1A1 gene in the same population of patients are not linked to the disease. PMID:18694864

Zinc-finger nuclease-mediated targeted insertion of reporter genes for quantitative imaging of gene expression in sea urchin embryos

PubMed Central

Ochiai, Hiroshi; Sakamoto, Naoaki; Fujita, Kazumasa; Nishikawa, Masatoshi; Suzuki, Ken-ichi; Matsuura, Shinya; Miyamoto, Tatsuo; Sakuma, Tetsushi; Shibata, Tatsuo; Yamamoto, Takashi

2012-01-01

To understand complex biological systems, such as the development of multicellular organisms, it is important to characterize the gene expression dynamics. However, there is currently no universal technique for targeted insertion of reporter genes and quantitative imaging in multicellular model systems. Recently, genome editing using zinc-finger nucleases (ZFNs) has been reported in several models. ZFNs consist of a zinc-finger DNA-binding array with the nuclease domain of the restriction enzyme FokI and facilitate targeted transgene insertion. In this study, we successfully inserted a GFP reporter cassette into the HpEts1 gene locus of the sea urchin, Hemicentrotus pulcherrimus. We achieved this insertion by injecting eggs with a pair of ZFNs for HpEts1 with a targeting donor construct that contained ∼1-kb homology arms and a 2A-histone H2B–GFP cassette. We increased the efficiency of the ZFN-mediated targeted transgene insertion by in situ linearization of the targeting donor construct and cointroduction of an mRNA for a dominant-negative form of HpLig4, which encodes the H. pulcherrimus homolog of DNA ligase IV required for error-prone nonhomologous end joining. We measured the fluorescence intensity of GFP at the single-cell level in living embryos during development and found that there was variation in HpEts1 expression among the primary mesenchyme cells. These findings demonstrate the feasibility of ZFN-mediated targeted transgene insertion to enable quantification of the expression levels of endogenous genes during development in living sea urchin embryos. PMID:22711830

Comprehensive Genomic Profiling Aids in Distinguishing Metastatic Recurrence from Second Primary Cancers

PubMed Central

Weinberg, Benjamin A.; Gowen, Kyle; Lee, Thomas K.; Ou, Sai‐Hong Ignatius; Bristow, Robert; Krill, Lauren; Almira‐Suarez, M. Isabel; Ali, Siraj M.; Miller, Vincent A.; Liu, Stephen V.

2017-01-01

Abstract Background. Metastatic recurrence after treatment for locoregional cancer is a major cause of morbidity and cancer‐specific mortality. Distinguishing metastatic recurrence from the development of a second primary cancer has important prognostic and therapeutic value and represents a difficult clinical scenario. Advances beyond histopathological comparison are needed. We sought to interrogate the ability of comprehensive genomic profiling (CGP) to aid in distinguishing between these clinical scenarios. Materials and Methods. We identified three prospective cases of recurrent tumors in patients previously treated for localized cancers in which histologic analyses suggested subsequent development of a distinct second primary. Paired samples from the original primary and recurrent tumor were subjected to hybrid capture next‐generation sequencing‐based CGP to identify base pair substitutions, insertions, deletions, copy number alterations (CNA), and chromosomal rearrangements. Genomic profiles between paired samples were compared using previously established statistical clonality assessment software to gauge relatedness beyond global CGP similarities. Results. A high degree of similarity was observed among genomic profiles from morphologically distinct primary and recurrent tumors. Genomic information suggested reclassification as recurrent metastatic disease, and patients received therapy for metastatic disease based on the molecular determination. Conclusions. Our cases demonstrate an important adjunct role for CGP technologies in separating metastatic recurrence from development of a second primary cancer. Larger series are needed to confirm our observations, but comparative CGP may be considered in patients for whom distinguishing metastatic recurrence from a second primary would alter the therapeutic approach. Implications for Practice. Distinguishing a metastatic recurrence from a second primary cancer can represent a difficult clinicopathologic problem but has important prognostic and therapeutic implications. Approaches to aid histologic analysis may improve clinician and pathologist confidence in this increasingly common clinical scenario. Our series provides early support for incorporating paired comprehensive genomic profiling in clinical situations in which determination of metastatic recurrence versus a distinct second primary cancer would influence patient management. PMID:28193735

Systematic Characteristic Exploration of the Chimeras Generated in Multiple Displacement Amplification through Next Generation Sequencing Data Reanalysis

PubMed Central

Gao, Shen; Yao, Bei; Lu, Zuhong

2015-01-01

Background The chimeric sequences produced by phi29 DNA polymerase, which are named as chimeras, influence the performance of the multiple displacement amplification (MDA) and also increase the difficulty of sequence data process. Despite several articles have reported the existence of chimeric sequence, there was only one research focusing on the structure and generation mechanism of chimeras, and it was merely based on hundreds of chimeras found in the sequence data of E. coli genome. Method We finished data mining towards a series of Next Generation Sequencing (NGS) reads which were used for whole genome haplotype assembling in a primary study. We established a bioinformatics pipeline based on subsection alignment strategy to discover all the chimeras inside and achieve their structural visualization. Then, we artificially defined two statistical indexes (the chimeric distance and the overlap length), and their regular abundance distribution helped illustrate of the structural characteristics of the chimeras. Finally we analyzed the relationship between the chimera type and the average insertion size, so that illustrate a method to decrease the proportion of wasted data in the procedure of DNA library construction. Results/Conclusion 131.4 Gb pair-end (PE) sequence data was reanalyzed for the chimeras. Totally, 40,259,438 read pairs (6.19%) with chimerism were discovered among 650,430,811 read pairs. The chimeric sequences are consisted of two or more parts which locate inconsecutively but adjacently on the chromosome. The chimeric distance between the locations of adjacent parts on the chromosome followed an approximate bimodal distribution ranging from 0 to over 5,000 nt, whose peak was at about 250 to 300 nt. The overlap length of adjacent parts followed an approximate Poisson distribution and revealed a peak at 6 nt. Moreover, unmapped chimeras, which were classified as the wasted data, could be reduced by properly increasing the length of the insertion segment size through a linear correlation analysis. Significance This study exhibited the profile of the phi29MDA chimeras by tens of millions of chimeric sequences, and helped understand the amplification mechanism of the phi29 DNA polymerase. Our work also illustrated the importance of NGS data reanalysis, not only for the improvement of data utilization efficiency, but also for more potential genomic information. PMID:26440104

A circular polarization converter based on in-linked loop antenna frequency selective surface

NASA Astrophysics Data System (ADS)

Wang, Shen-Yun; Liu, Wei; Geyi, Wen

2018-06-01

In this paper, we report the design, fabrication and measurement of a circular polarization converter based on an in-linked loop-antenna frequency selective surface. The building unit cell is the in-linked loop-antenna module, which consists of same front and back planar loop antennas in-linked by a pair of through-via holes passing through a sandwiched perforated metal ground plane. The proposed device can achieve transmission polarization conversions from right- or left-handed circularly polarized waves to left- or right-handed ones, respectively, or vice versa. Simulation and experimental results show that it has relative conversion ratio of near unity at resonant frequency and very low Joule insertion loss in the operating frequency band. The proposed circular polarization converter may be applied to wireless systems where circular polarization diversity is needed.

Sliding over the Blocks in Enzyme-Free RNA Copying – One-Pot Primer Extension in Ice

PubMed Central

Löffler, Philipp M. G.; Groen, Joost; Dörr, Mark; Monnard, Pierre-Alain

2013-01-01

Template-directed polymerization of RNA in the absence of enzymes is the basis for an information transfer in the ‘RNA-world’ hypothesis and in novel nucleic acid based technology. Previous investigations established that only cytidine rich strands are efficient templates in bulk aqueous solutions while a few specific sequences completely block the extension of hybridized primers. We show that a eutectic water/ice system can support Pb2+/Mg2+-ion catalyzed extension of a primer across such sequences, i.e. AA, AU and AG, in a one-pot synthesis. Using mixtures of imidazole activated nucleotide 5′-monophosphates, the two first “blocking” residues could be passed during template-directed polymerization, i.e., formation of triply extended products containing a high fraction of faithful copies was demonstrated. Across the AG sequence, a mismatch sequence was formed in similar amounts to the correct product due to U·G wobble pairing. Thus, the template-directed extension occurs both across pyrimidine and purine rich sequences and insertions of pyrimidines did not inhibit the subsequent insertions. Products were mainly formed with 2′-5′-phosphodiester linkages, however, the abundance of 3′–5′-linkages was higher than previously reported for pyrimidine insertions. When enzyme-free, template-directed RNA polymerization is performed in a eutectic water ice environment, various intrinsic reaction limitations observed in bulk solution can then be overcome. PMID:24058695

Method and apparatus for assembling solid oxide fuel cells

DOEpatents

Szreders, Bernard E.; Campanella, Nicholas

1989-01-01

A plurality of jet air tubes are supported and maintained in a spaced matrix array by a positioning/insertion assembly for insertion in respective tubes of a solid oxide fuel cell (SOFC) in the assembly of an SOFC module. The positioning/insertion assembly includes a plurality of generally planar, elongated, linear vanes which are pivotally mounted at each end thereof to a support frame. The vanes, which each include a plurality of spaced slots along the facing edges thereof, may be pivotally displaced from a generally vertical orientation, wherein each jet air tube is positioned within and engaged by the aligned slots of a plurality of paired upper and lower vanes to facilitate their insertion in respective aligned SOFC tubes arranged in a matrix array, to an inclined orientation, wherein the jet air tubes may be removed from the positioning/insertion assembly after being inserted in the SOFC tubes. A rectangular compression assembly of adjustable size is adapted to receive and squeeze a matrix of SOFC tubes so as to compress the inter-tube nickel felt conductive pads which provide series/parallel electrical connection between adjacent SOFCs, with a series of increasingly larger retainer frames used to maintain larger matrices of SOFC tubes in position. Expansion of the SOFC module housing at the high operating temperatures of the SOFC is accommodated by conductive, flexible, resilient expansion, connector bars which provide support and electrical coupling at the top and bottom of the SOFC module housing.

Formation and Repair of Mismatches Containing Ribonucleotides and Oxidized Bases at Repeated DNA Sequences.

PubMed

Cilli, Piera; Minoprio, Anna; Bossa, Cecilia; Bignami, Margherita; Mazzei, Filomena

2015-10-23

The cellular pool of ribonucleotide triphosphates (rNTPs) is higher than that of deoxyribonucleotide triphosphates. To ensure genome stability, DNA polymerases must discriminate against rNTPs and incorporated ribonucleotides must be removed by ribonucleotide excision repair (RER). We investigated DNA polymerase β (POL β) capacity to incorporate ribonucleotides into trinucleotide repeated DNA sequences and the efficiency of base excision repair (BER) and RER enzymes (OGG1, MUTYH, and RNase H2) when presented with an incorrect sugar and an oxidized base. POL β incorporated rAMP and rCMP opposite 7,8-dihydro-8-oxoguanine (8-oxodG) and extended both mispairs. In addition, POL β was able to insert and elongate an oxidized rGMP when paired with dA. We show that RNase H2 always preserves the capacity to remove a single ribonucleotide when paired to an oxidized base or to incise an oxidized ribonucleotide in a DNA duplex. In contrast, BER activity is affected by the presence of a ribonucleotide opposite an 8-oxodG. In particular, MUTYH activity on 8-oxodG:rA mispairs is fully inhibited, although its binding capacity is retained. This results in the reduction of RNase H2 incision capability of this substrate. Thus complex mispairs formed by an oxidized base and a ribonucleotide can compromise BER and RER in repeated sequences. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

A comparison of Lewis and Fischer rat strains on autoshaping (sign-tracking), discrimination reversal learning and negative auto-maintenance.

PubMed

Kearns, David N; Gomez-Serrano, Maria A; Weiss, Stanley J; Riley, Anthony L

2006-05-15

Lewis (LEW) and Fischer (F344) rat strains differ on a number of physiological characteristics, such as hypothalamic-pituitary-adrenal (HPA) axis activity, as well as on behavioral tasks, including those that measure impulsivity and drug reward. Since autoshaping, the phenomenon where animals approach and contact reward-paired conditioned stimuli, has been linked to HPA axis functioning, impulsivity and drug taking, the present study compared LEW and F344 rats on the rate of acquisition and performance of the autoshaping response. Rats were trained on an autoshaping procedure where insertions of one retractable lever (CS(+)) were paired response-independently with food, while insertions of another lever (CS(-)) were not paired with food. LEW rats acquired the autoshaping response more rapidly and also performed the autoshaping response at a higher rate than F344 rats. No differences between the strains were observed when rats were trained on a discrimination reversal where the CS(+) and CS(-) levers were reversed or during a negative auto-maintenance phase where CS(+) lever contacts cancelled food delivery. Potential physiological mechanisms that might mediate the present results, including strain differences in HPA axis and monoamine neurotransmitter activity, are discussed. The finding that LEW (as compared to F344 rats) more readily acquire autoshaping and perform more responses is consistent with research indicating that LEW rats behave more impulsively and more readily self-administer drugs of abuse.

Technique for converting non-conforming hexahedral-to-hexahedral interfaces into conforming interfaces

DOEpatents

Staten, Matthew L.; Shepherd, Jason F.; Ledoux, Frank; Shimada, Kenji; Merkley, Karl G.; Carbonera, Carlos

2013-03-05

A technique for conforming an interface between a first mesh and a second mesh is disclosed. A first interface surface in the first mesh and a second interface surface in the second mesh residing along the interface are identified. The first and second interface surfaces are initially non-conforming along the interface. Chords within the first and second interface surfaces that fall within a threshold separation distance of each other are paired. Sheets having chords that reside within the first or second interface surfaces are recursively inserted into or extracted from one or both of the first and second meshes until all remaining chords within the first interface surface are paired with corresponding chords in the second interface surface and all remaining chords within the second interface surface are paired with corresponding chords in the first interface surface.

Multispectroscopic methods reveal different modes of interaction of anti cancer drug mitoxantrone with Poly(dG-dC).Poly(dG-dC) and Poly(dA-dT).Poly(dA-dT).

PubMed

Awasthi, Pamita; Dogra, Shilpa; Barthwal, Ritu

2013-10-05

The interaction of mitoxantrone with alternating Poly(dG-dC).Poly(dG-dC) and Poly(dA-dT).Poly(dA-dT) duplex has been studied by absorption, fluorescence and Circular Dichroism (CD) spectroscopy at Drug to Phosphate base pair ratios D/P=20.0-0.04. Binding to GC polymer occurs in two distinct modes: partial stacking characterized by red shifts of 18-23nm at D/P=0.2-0.8 and external binding at D/P=1.0-20.0 whereas that to AT polymer occurs externally in the entire range of D/P. The binding constant and number of binding sites is 3.7×10(5)M(-1), 0.3 and 1.3× 10(4)M(-1), 1.5 in GC and AT polymers, respectively at low D/P ratios. CD binding isotherms show breakpoints at D/P=0.1, 0.5 and 0.25, 0.5 in GC and AT polymers, respectively. The intrinsic CD bands indicate that the distortions in GC polymer are significantly higher than that in AT polymer. Docking studies show partial insertion of mitoxantrone rings between to GC base pairs in alternating GC polymer. Side chains of mitoxantrone interact specifically with base pairs and DNA backbone. The studies are relevant to the understanding of suppression or inhibition of DNA cleavage on formation of ternary complex with topoisomerase-II enzyme and hence the anti cancer action. Copyright © 2013 Elsevier B.V. All rights reserved.

Net Fluorescein Flux Across Corneal Endothelium Strongly Suggests Fluid Transport is due to Electro-osmosis.

PubMed

Sanchez, J M; Cacace, V; Kusnier, C F; Nelson, R; Rubashkin, A A; Iserovich, P; Fischbarg, J

2016-08-01

We have presented prior evidence suggesting that fluid transport results from electro-osmosis at the intercellular junctions of the corneal endothelium. Such phenomenon ought to drag other extracellular solutes. We have investigated this using fluorescein-Na2 as an extracellular marker. We measured unidirectional fluxes across layers of cultured human corneal endothelial (HCE) cells. SV-40-transformed HCE layers were grown to confluence on permeable membrane inserts. The medium was DMEM with high glucose and no phenol red. Fluorescein-labeled medium was placed either on the basolateral or the apical side of the inserts; the other side carried unlabeled medium. The inserts were held in a CO2 incubator for 1 h (at 37 °C), after which the entire volume of the unlabeled side was collected. After that, label was placed on the opposite side, and the corresponding paired sample was collected after another hour. Fluorescein counts were determined with a (Photon Technology) DeltaScan fluorometer (excitation 380 nm; emission 550 nm; 2 nm bwth). Samples were read for 60 s. The cells utilized are known to transport fluid from the basolateral to the apical side, just as they do in vivo in several species. We used 4 inserts for influx and efflux (total: 20 1-h periods). We found a net flux of fluorescein from the basolateral to the apical side. The flux ratio was 1.104 ± 0.056. That difference was statistically significant (p = 0.00006, t test, paired samples). The endothelium has a definite restriction at the junctions. Hence, an asymmetry in unidirectional fluxes cannot arise from osmosis, and can only point instead to paracellular solvent drag. We suggest, once more, that such drag is due to electro-osmotic coupling at the paracellular junctions.

A physical map of a BAC clone contig covering the entire autosome insertion between ovine MHC Class IIa and IIb

PubMed Central

2012-01-01

Background The ovine Major Histocompatibility Complex (MHC) harbors genes involved in overall resistance/susceptibility of the host to infectious diseases. Compared to human and mouse, the ovine MHC is interrupted by a large piece of autosome insertion via a hypothetical chromosome inversion that constitutes ~25% of ovine chromosome 20. The evolutionary consequence of such an inversion and an insertion (inversion/insertion) in relation to MHC function remains unknown. We previously constructed a BAC clone physical map for the ovine MHC exclusive of the insertion region. Here we report the construction of a high-density physical map covering the autosome insertion in order to address the question of what the inversion/insertion had to do with ruminants during the MHC evolution. Results A total of 119 pairs of comparative bovine oligo primers were utilized to screen an ovine BAC library for positive clones and the orders and overlapping relationships of the identified clones were determined by DNA fingerprinting, BAC-end sequencing, and sequence-specific PCR. A total of 368 positive BAC clones were identified and 108 of the effective clones were ordered into an overlapping BAC contig to cover the consensus region between ovine MHC class IIa and IIb. Therefore, a continuous physical map covering the entire ovine autosome inversion/insertion region was successfully constructed. The map confirmed the bovine sequence assembly for the same homologous region. The DNA sequences of 185 BAC-ends have been deposited into NCBI database with the access numbers HR309252 through HR309068, corresponding to dbGSS ID 30164010 through 30163826. Conclusions We have constructed a high-density BAC clone physical map for the ovine autosome inversion/insertion between the MHC class IIa and IIb. The entire ovine MHC region is now fully covered by a continuous BAC clone contig. The physical map we generated will facilitate MHC functional studies in the ovine, as well as the comparative MHC evolution in ruminants. PMID:22897909

FH Tulsa-1 and -2: Two unique alleles for familial hypercholesterolemia presenting in an affected two-year-old African-American male

DOE Office of Scientific and Technical Information (OSTI.GOV)

Blackett, P.R.; Altmiller, D.H.; Jelley, D.

1995-11-20

A two-year-old African American boy presented with cutaneous xanthomata and extreme hypercholesterolemia. Subsequent studies revealed that the LDL-cholesterol was 1,001 mg/dl and apoB 507 mg/dl. LDL-receptor activity was almost undetectable, which is compatible with the finding of two newly described defective alleles on exon 4 of the LDL-receptor gene coding for part of the ligand-binding domain. One allele contained a 21 base-pair insertion from codon 200 to 207 whereas the other had a point mutation at codon 207. The rarity of genes for FH reported in individuals of African ancestry is discussed. 16 refs., 2 figs., 2 tabs.

Stable zymomonas mobilis xylose and arabinose fermenting strains

DOEpatents

Zhang, Min [Lakewood, CO; Chou, Yat-Chen [Taipei, TW

2008-04-08

The present invention briefly includes a transposon for stable insertion of foreign genes into a bacterial genome, comprising at least one operon having structural genes encoding enzymes selected from the group consisting of xylAxylB, araBAD and tal/tkt, and at least one promoter for expression of the structural genes in the bacterium, a pair of inverted insertion sequences, the operons contained inside the insertion sequences, and a transposase gene located outside of the insertion sequences. A plasmid shuttle vector for transformation of foreign genes into a bacterial genome, comprising at least one operon having structural genes encoding enzymes selected from the group consisting of xylAxylB, araBAD and tal/tkt, at least one promoter for expression of the structural genes in the bacterium, and at least two DNA fragments having homology with a gene in the bacterial genome to be transformed, is also provided.The transposon and shuttle vectors are useful in constructing significantly different Zymomonas mobilis strains, according to the present invention, which are useful in the conversion of the cellulose derived pentose sugars into fuels and chemicals, using traditional fermentation technology, because they are stable for expression in a non-selection medium.

Interchromosomal recombination in Zea mays.

PubMed Central

Hu, W; Timmermans, M C; Messing, J

1998-01-01

A new allele of the 27-kD zein locus in maize has been generated by interchromosomal recombination between chromosomes of two different inbred lines. A continuous patch of at least 11,817 bp of inbred W64A, containing the previously characterized Ra allele of the 27-kD zein gene, has been inserted into the genome of A188 by a single crossover. While both junction sequences are conserved, sequences of the two homologs between these junctions differ considerably. W64A contains the 7313-bp-long retrotransposon, Zeon-1. A188 contains a second copy of the 27-kD zein gene and a 2-kb repetitive element. Therefore, recombination results in a 7.3-kb insertion and a 14-kb deletion compared to the original S+A188 allele. If nonpairing sequences are looped out, 206 single base changes, frequently clustered, are present. The structure of this allele may explain how a recently discovered example of somatic recombination occurred in an A188/W64A hybrid. This would indicate that despite these sequence differences, pairing between these alleles could occur early during plant development. Therefore, such a somatically derived chimeric chromosome can also be heritable and give rise to new alleles. PMID:9799274

Primers-4-Yeast: a comprehensive web tool for planning primers for Saccharomyces cerevisiae.

PubMed

Yofe, Ido; Schuldiner, Maya

2014-02-01

The budding yeast Saccharomyces cerevisiae is a key model organism of functional genomics, due to its ease and speed of genetic manipulations. In fact, in this yeast, the requirement for homologous sequences for recombination purposes is so small that 40 base pairs (bp) are sufficient. Hence, an enormous variety of genetic manipulations can be performed by simply planning primers with the correct homology, using a defined set of transformation plasmids. Although designing primers for yeast transformations and for the verification of their correct insertion is a common task in all yeast laboratories, primer planning is usually done manually and a tool that would enable easy, automated primer planning for the yeast research community is still lacking. Here we introduce Primers-4-Yeast, a web tool that allows primers to be designed in batches for S. cerevisiae gene-targeting transformations, and for the validation of correct insertions. This novel tool enables fast, automated, accurate primer planning for large sets of genes, introduces consistency in primer planning and is therefore suggested to serve as a standard in yeast research. Primers-4-Yeast is available at: http://www.weizmann.ac.il/Primers-4-Yeast Copyright © 2013 John Wiley & Sons, Ltd.

Design and evaluation of corn starch-bonded Rhizophora spp. particleboard phantoms for SPECT/CT imaging

NASA Astrophysics Data System (ADS)

Hamid, Puteri Nor Khatijah Abd; Yusof, Mohd Fahmi Mohd; Aziz Tajuddin, Abd; Hashim, Rokiah; Zainon, Rafidah

2018-01-01

The aim of this study was to design and evaluate of corn starch-bonded Rhizophora spp. particleboards as phantom for SPECT/CT imaging. The phantom was designed according to the Jaszczak phantom commonly used in SPECT imaging with dimension of 22 cm diameter and 18 cm length. Six inserts with different diameter were made for insertion of vials filled with 1.6 µCi/ml of 99mTc unsealed source. The particleboard phantom was scanned using SPECT/CT imaging protocol. The contrast of each vial for particleboards phantom were calculated based on the ratio of counts in radionuclide volume and phantom background and compared to Perspex® and water phantom. The results showed that contrast values for each vial in particleboard phantomis near to 1.0 and in good agreement with Perspex® and water phantoms as common phantom materials for SPECT/CT. The paired sample t-test result showed no significant difference of contrast values between images in particleboard phantoms and that in water. The overall results showed the potential of corn starch-bonded Rhizophora spp. as phantom for quality control and dosimetry works in SPECT/CT imaging.

Development of Genic and Genomic SSR Markers of Robusta Coffee (Coffea canephora Pierre Ex A. Froehner)

PubMed Central

Hendre, Prasad S.; Aggarwal, Ramesh K.

2014-01-01

Coffee breeding and improvement efforts can be greatly facilitated by availability of a large repository of simple sequence repeats (SSRs) based microsatellite markers, which provides efficiency and high-resolution in genetic analyses. This study was aimed to improve SSR availability in coffee by developing new genic−/genomic-SSR markers using in-silico bioinformatics and streptavidin-biotin based enrichment approach, respectively. The expressed sequence tag (EST) based genic microsatellite markers (EST-SSRs) were developed using the publicly available dataset of 13,175 unigene ESTs, which showed a distribution of 1 SSR/3.4 kb of coffee transcriptome. Genomic SSRs, on the other hand, were developed from an SSR-enriched small-insert partial genomic library of robusta coffee. In total, 69 new SSRs (44 EST-SSRs and 25 genomic SSRs) were developed and validated as suitable genetic markers. Diversity analysis of selected coffee genotypes revealed these to be highly informative in terms of allelic diversity and PIC values, and eighteen of these markers (∼27%) could be mapped on a robusta linkage map. Notably, the markers described here also revealed a very high cross-species transferability. In addition to the validated markers, we have also designed primer pairs for 270 putative EST-SSRs, which are expected to provide another ca. 200 useful genetic markers considering the high success rate (88%) of marker conversion of similar pairs tested/validated in this study. PMID:25461752

Foldback intercoil DNA and the mechanism of DNA transposition.

PubMed

Kim, Byung-Dong

2014-09-01

Foldback intercoil (FBI) DNA is formed by the folding back at one point of a non-helical parallel track of double-stranded DNA at as sharp as 180° and the intertwining of two double helixes within each other's major groove to form an intercoil with a diameter of 2.2 nm. FBI DNA has been suggested to mediate intra-molecular homologous recombination of a deletion and inversion. Inter-molecular homologous recombination, known as site-specific insertion, on the other hand, is mediated by the direct perpendicular approach of the FBI DNA tip, as the attP site, onto the target DNA, as the attB site. Transposition of DNA transposons involves the pairing of terminal inverted repeats and 5-7-bp tandem target duplication. FBI DNA configuration effectively explains simple as well as replicative transposition, along with the involvement of an enhancer element. The majority of diverse retrotransposable elements that employ a target site duplication mechanism is also suggested to follow the FBI DNA-mediated perpendicular insertion of the paired intercoil ends by non-homologous end-joining, together with gap filling. A genome-wide perspective of transposable elements in light of FBI DNA is discussed.

Production of Mutated Porcine Embryos Using Zinc Finger Nucleases and a Reporter-based Cell Enrichment System.

PubMed

Koo, Ok Jae; Park, Sol Ji; Lee, Choongil; Kang, Jung Taek; Kim, Sujin; Moon, Joon Ho; Choi, Ji Yei; Kim, Hyojin; Jang, Goo; Kim, Jin-Soo; Kim, Seokjoong; Lee, Byeong-Chun

2014-03-01

To facilitate the construction of genetically-modified pigs, we produced cloned embryos derived from porcine fibroblasts transfected with a pair of engineered zinc finger nuclease (ZFN) plasmids to create targeted mutations and enriched using a reporter plasmid system. The reporter expresses RFP and eGFP simultaneously when ZFN-mediated site-specific mutations occur. Thus, double positive cells (RFP(+)/eGFP(+)) were selected and used for somatic cell nuclear transfer. Two types of reporter based enrichment systems were used in this study; the cloned embryos derived from cells enriched using a magnetic sorting-based system showed better developmental competence than did those derived from cells enriched by flow cytometry. Mutated sequences, such as insertions, deletions, or substitutions, together with the wild-type sequence, were found in the cloned porcine blastocysts. Therefore, genetic mutations can be achieved in cloned porcine embryos reconstructed with ZFN-treated cells that were enriched by a reporter-based system.

SEQUOIA: significance enhanced network querying through context-sensitive random walk and minimization of network conductance.

PubMed

Jeong, Hyundoo; Yoon, Byung-Jun

2017-03-14

Network querying algorithms provide computational means to identify conserved network modules in large-scale biological networks that are similar to known functional modules, such as pathways or molecular complexes. Two main challenges for network querying algorithms are the high computational complexity of detecting potential isomorphism between the query and the target graphs and ensuring the biological significance of the query results. In this paper, we propose SEQUOIA, a novel network querying algorithm that effectively addresses these issues by utilizing a context-sensitive random walk (CSRW) model for network comparison and minimizing the network conductance of potential matches in the target network. The CSRW model, inspired by the pair hidden Markov model (pair-HMM) that has been widely used for sequence comparison and alignment, can accurately assess the node-to-node correspondence between different graphs by accounting for node insertions and deletions. The proposed algorithm identifies high-scoring network regions based on the CSRW scores, which are subsequently extended by maximally reducing the network conductance of the identified subnetworks. Performance assessment based on real PPI networks and known molecular complexes show that SEQUOIA outperforms existing methods and clearly enhances the biological significance of the query results. The source code and datasets can be downloaded from http://www.ece.tamu.edu/~bjyoon/SEQUOIA .

Statistical alignment: computational properties, homology testing and goodness-of-fit.

PubMed

Hein, J; Wiuf, C; Knudsen, B; Møller, M B; Wibling, G

2000-09-08

The model of insertions and deletions in biological sequences, first formulated by Thorne, Kishino, and Felsenstein in 1991 (the TKF91 model), provides a basis for performing alignment within a statistical framework. Here we investigate this model.Firstly, we show how to accelerate the statistical alignment algorithms several orders of magnitude. The main innovations are to confine likelihood calculations to a band close to the similarity based alignment, to get good initial guesses of the evolutionary parameters and to apply an efficient numerical optimisation algorithm for finding the maximum likelihood estimate. In addition, the recursions originally presented by Thorne, Kishino and Felsenstein can be simplified. Two proteins, about 1500 amino acids long, can be analysed with this method in less than five seconds on a fast desktop computer, which makes this method practical for actual data analysis.Secondly, we propose a new homology test based on this model, where homology means that an ancestor to a sequence pair can be found finitely far back in time. This test has statistical advantages relative to the traditional shuffle test for proteins.Finally, we describe a goodness-of-fit test, that allows testing the proposed insertion-deletion (indel) process inherent to this model and find that real sequences (here globins) probably experience indels longer than one, contrary to what is assumed by the model. Copyright 2000 Academic Press.

Basic Study for Ultrasound-Based Navigation for Pedicle Screw Insertion Using Transmission and Backscattered Methods

PubMed Central

Chen, Ziqiang; Wu, Bing; Zhai, Xiao; Bai, Yushu; Zhu, Xiaodong; Luo, Beier; Chen, Xiao; Li, Chao; Yang, Mingyuan; Xu, Kailiang; Liu, Chengcheng; Wang, Chuanfeng; Zhao, Yingchuan; Wei, Xianzhao; Chen, Kai; Yang, Wu; Ta, Dean; Li, Ming

2015-01-01

The purpose of this study was to understand the acoustic properties of human vertebral cancellous bone and to study the feasibility of ultrasound-based navigation for posterior pedicle screw fixation in spinal fusion surgery. Fourteen human vertebral specimens were disarticulated from seven un-embalmed cadavers (four males, three females, 73.14 ± 9.87 years, two specimens from each cadaver). Seven specimens were used to measure the transmission, including tests of attenuation and phase velocity, while the other seven specimens were used for backscattered measurements to inspect the depth of penetration and A-Mode signals. Five pairs of unfocused broadband ultrasonic transducers were used for the detection, with center frequencies of 0.5 MHz, 1 MHz, 1.5 MHz, 2.25 MHz, and 3.5 MHz. As a result, good and stable results were documented. With increased frequency, the attenuation increased (P<0.05), stability of the speed of sound improved (P<0.05), and penetration distance decreased (P>0.05). At about 0.6 cm away from the cortical bone, warning signals were easily observed from the backscattered measurements. In conclusion, the ultrasonic system proved to be an effective, moveable, and real-time imaging navigation system. However, how ultrasonic navigation will benefit pedicle screw insertion in spinal surgery needs to be determined. Therefore, ultrasound-guided pedicle screw implantation is theoretically effective and promising. PMID:25861053

High Precision Grids for Neutron, Hard X-Ray, and Gamma-Ray Imaging Systems

NASA Technical Reports Server (NTRS)

Campbell, Jonathan W. (Inventor)

2002-01-01

Fourier telescopes permit observations over a very broad band of energy. They generally include synthetic spatial filtering structures, known as multilayer grids or grid pairs consisting of alternate layers of absorbing and transparent materials depending on whether neutrons or photons are being imaged. For hard x-rays and gamma rays high (absorbing) and low (transparent) atomic number elements, termed high-Z and low-Z materials may be used. Fabrication of these multilayer grid structures is not without its difficulties. Herein the alternate layers of the higher material and the lower material are inserted in a polyhedron, transparent to photons of interest, through an open face of the polyhedron. The inserted layers are then uniformly compressed to form a multilayer grid.

Hands-on work fine-tunes X-band PIN-diode duplexer

NASA Astrophysics Data System (ADS)

Schneider, P.

1985-06-01

Computer-aided design (CAD) programs for fabricating PIN-diode duplexers are useful in avoiding time-consuming cut-and-try techniques. Nevertheless, to attain minimum insertion loss, only experimentation yields the optimum microstrip circuitry. A PIN-diode duplexer, consisting of two SPST PIN-diode switches and a pair of 3-dB Lange microstrip couplers, designed for an X-band transmit/receive module exemplifies what is possible when computer-derived designs and experimentation are used together. Differences between the measured and computer-generated figures for insertion loss can be attributed to several factors not included in the CAD program - for example, radiation and connector losses. Mechanical tolerances of the microstrip PC board and variations in the SMA connector-to-microstrip transition contribute to the discrepancy.

Low loss millimeter-wave switches based on the Vanadium Dioxide Metal - Insulator - Transition

NASA Astrophysics Data System (ADS)

Field, Mark; Hillman, Christopher; Stupar, Philip; Griffith, Zachary; Rodwell, Mark

2014-03-01

A new ultra-low-loss and broad band millimeter wave switch technology based on the reversible metal / insulator phase transition of vanadium dioxide has been developed. We report having fabricated series configured, single-pole single-throw (SPST) switches having measured S-parameters from DC to 110 GHz. The on-state insertion loss is 0.2 dB and off-state isolation is 21 dB at 50 GHz. The resulting impedance contrast ratio, ZOFF / ZON, is greater than 500:1 at 50 GHz (i.e. cut-off frequency fc ~ 40 THz). As a demonstration of the technology's utility, we also present the results of a 2-bit real time delay phase shifter incorporating a pair of VO2 SP4T switches. This switch technology's high impedance contrast ratio combined with its compactness, ease of integration, and low voltage operation make it an enabler of previously unachievable high-performance millimeter wave FPGAs.

Insights into finding a mismatch through the structure of a mispaired DNA bound by a rhodium intercalator

PubMed Central

Pierre, Valérie C.; Kaiser, Jens T.; Barton, Jacqueline K.

2007-01-01

We report the 1.1-Å resolution crystal structure of a bulky rhodium complex bound to two different DNA sites, mismatched and matched in the oligonucleotide 5′-(dCGGAAATTCCCG)2-3′. At the AC mismatch site, the structure reveals ligand insertion from the minor groove with ejection of both mismatched bases and elucidates how destabilized mispairs in DNA may be recognized. This unique binding mode contrasts with major groove intercalation, observed at a matched site, where doubling of the base pair rise accommodates stacking of the intercalator. Mass spectral analysis reveals different photocleavage products associated with the two binding modes in the crystal, with only products characteristic of mismatch binding in solution. This structure, illustrating two clearly distinct binding modes for a molecule with DNA, provides a rationale for the interrogation and detection of mismatches. PMID:17194756

Breakpoint Features of Genomic Rearrangements in Neuroblastoma with Unbalanced Translocations and Chromothripsis

PubMed Central

Daveau, Romain; Combaret, Valérie; Pierre-Eugène, Cécile; Cazes, Alex; Louis-Brennetot, Caroline; Schleiermacher, Gudrun; Ferrand, Sandrine; Pierron, Gaëlle; Lermine, Alban; Frio, Thomas Rio; Raynal, Virginie; Vassal, Gilles; Barillot, Emmanuel; Delattre, Olivier; Janoueix-Lerosey, Isabelle

2013-01-01

Neuroblastoma is a pediatric cancer of the peripheral nervous system in which structural chromosome aberrations are emblematic of aggressive tumors. In this study, we performed an in-depth analysis of somatic rearrangements in two neuroblastoma cell lines and two primary tumors using paired-end sequencing of mate-pair libraries and RNA-seq. The cell lines presented with typical genetic alterations of neuroblastoma and the two tumors belong to the group of neuroblastoma exhibiting a profile of chromothripsis. Inter and intra-chromosomal rearrangements were identified in the four samples, allowing in particular characterization of unbalanced translocations at high resolution. Using complementary experiments, we further characterized 51 rearrangements at the base pair resolution that revealed 59 DNA junctions. In a subset of cases, complex rearrangements were observed with templated insertion of fragments of nearby sequences. Although we did not identify known particular motifs in the local environment of the breakpoints, we documented frequent microhomologies at the junctions in both chromothripsis and non-chromothripsis associated breakpoints. RNA-seq experiments confirmed expression of several predicted chimeric genes and genes with disrupted exon structure including ALK, NBAS, FHIT, PTPRD and ODZ4. Our study therefore indicates that both non-homologous end joining-mediated repair and replicative processes may account for genomic rearrangements in neuroblastoma. RNA-seq analysis allows the identification of the subset of abnormal transcripts expressed from genomic rearrangements that may be involved in neuroblastoma oncogenesis. PMID:23991058

Measurement of hyperpolarized gas diffusion at very short time scales

PubMed Central

Carl, Michael; Wilson Miller, G.; Mugler, John P.; Rohrbaugh, Scott; Tobias, William A.; Cates, Gordon D.

2007-01-01

We present a new pulse sequence for measuring very-short-time-scale restricted diffusion of hyperpolarized noble gases. The pulse sequence is based on concatenating a large number of bipolar diffusion-sensitizing gradients to increase the diffusion attenuation of the MR signal while maintaining a fundamentally short diffusion time. However, it differs in several respects from existing methods that use oscillating diffusion gradients for this purpose. First, a wait time is inserted between neighboring pairs of gradient pulses; second, consecutive pulse pairs may be applied along orthogonal axes; and finally, the diffusion-attenuated signal is not simply read out at the end of the gradient train but is periodically sampled during the wait times between neighboring pulse pairs. The first two features minimize systematic differences between the measured (apparent) diffusion coefficient and the actual time-dependent diffusivity, while the third feature optimizes the use of the available MR signal to improve the precision of the diffusivity measurement in the face of noise. The benefits of this technique are demonstrated using theoretical calculations, Monte-Carlo simulations of gas diffusion in simple geometries, and experimental phantom measurements in a glass sphere containing hyperpolarized 3He gas. The advantages over the conventional single-bipolar approach were found to increase with decreasing diffusion time, and thus represent a significant step toward making accurate surface-to-volume measurements in the lung airspaces. PMID:17936048

Trans-Metal-Trapping Meets Frustrated-Lewis-Pair Chemistry: Ga(CH2SiMe3)3-Induced C–H Functionalizations

PubMed Central

2017-01-01

Merging two topical themes in main-group chemistry, namely, cooperative bimetallics and frustrated-Lewis-pair (FLP) activity, this Forum Article focuses on the cooperativity-induced outcomes observed when the tris(alkyl)gallium compound GaR3 (R = CH2SiMe3) is paired with the lithium amide LiTMP (TMP = 2,2,6,6-tetramethylpiperidide) or the sterically hindered N-heterocyclic carbene (NHC) 1,3-bis(tert-butyl)imidazol-2-ylidene (ItBu). When some previously published work are drawn together with new results, unique tandem reactivities are presented that are driven by the steric mismatch between the individual reagents of these multicomponent reagents. Thus, the LiTMP/GaR3 combination, which on its own fails to form a cocomplex, functions as a highly regioselective base (LiTMP)/trap (GaR3) partnership for the metalation of N-heterocycles such as diazines, 1,3-benzoazoles, and 2-picolines in a trans-metal-trapping (TMT) process that stabilizes the emerging sensitive carbanions. Taking advantage of related steric incompatibility, a novel monometallic FLP system pairing GaR3 with ItBu has been developed for the activation of carbonyl compounds (via C=O insertion) and other molecules with acidic hydrogen atoms such as phenol and phenylacetylene. Shedding new light on how these non-cocomplexing partnerships operate and showcasing the potential of gallium reagents to engage in metalation reactions or FLP activations, areas where the use of this group 13 metal is scant, this Forum Article aims to stimulate more interest and activity toward the advancement of organogallium chemistry. PMID:28485929

Long-Term In Vivo Electromechanical Reshaping for Auricular Reconstruction in the New Zealand White Rabbit Model

PubMed Central

Badran, Karam W.; Manuel, Cyrus T.; Loy, Anthony Chin; Conderman, Christian; Yau, Yuk Yee; Lin, Jennifer; Tjoa, Tjoson; Su, Erica; Protsenko, Dmitriy; Wong, Brian J. F.

2016-01-01

Objectives/Hypothesis To demonstrate the dosimetry effect of electromechanical reshaping (EMR) on cartilage shape change, structural integrity, cellular viability, and remodeling of grafts in an in vivo long-term animal model. Study Design Animal study. Methods A subperichondrial cartilaginous defect was created within the base of the pinna of 31 New Zealand white rabbits. Autologous costal cartilage grafts were electromechanically reshaped to resemble the rabbit auricular base framework and mechanically secured into the pinna base defect. Forty-nine costal cartilage specimens (four control and 45 experimental) successfully underwent EMR using a paired set of voltage-time combinations and survived for 6 or 12 weeks. Shape change was measured, and specimens were analyzed using digital imaging, tissue histology, and confocal microscopy with LIVE-DEAD viability assays. Results Shape change was proportional to charge transfer in all experimental specimens (P <.01) and increased with voltage. All experimental specimens contoured to the auricular base. Focal cartilage degeneration and fibrosis was observed where needle electrodes were inserted, ranging from 2.2 to 3.9 mm. The response to injury increased with increasing charge transfer and survival duration. Conclusions EMR results in appropriate shape change in cartilage grafts with chondrocyte injury highly localized. These studies suggest that elements of auricular reconstruction may be feasible using EMR. Extended survival periods and further optimization of voltage-time pairs are necessary to evaluate the long-term effects and shape-change potential of EMR. PMID:25779479

Reduction of Endotracheal Tube Connector Dead Space Improves Ventilation: A Bench Test on a Model Lung Simulating an Extremely Low Birth Weight Neonate.

PubMed

Ivanov, Vadim A

2016-02-01

The reduction of instrumental dead space is a recognized approach to preventing ventilation-induced lung injury in premature infants. However, there are no published data regarding the effectiveness of instrumental dead-space reduction in endotracheal tube (ETT) connectors. We tested the impact of the Y-piece/ETT connector pairs with reduced instrumental dead space on CO2 elimination in a model of the premature neonate lung. The standard ETT connector was compared with a low-dead-space ETT connector and with a standard connector equipped with an insert. We compared the setups by measuring the CO2 elimination rate in an artificial lung ventilated via the connectors. The lung was connected to a ventilator via a standard circuit, a 2.5-mm ETT, and one of the connectors under investigation. The ventilator was run in volume-controlled continuous mandatory ventilation mode. The low-dead-space ETT connector/Y-piece and insert-equipped standard connector/Y-piece pairs had instrumental dead space reduced by 36 and 67%, respectively. With set tidal volumes (VT) of 2.5, 5, and 10 mL, in comparison with the standard ETT connector, the low-dead-space connector reduced CO2 elimination time by 4.5% (P < .05), 4.4% (P < .01), and 7.1% (not significant), respectively. The insert-equipped standard connector reduced CO2 elimination time by 13.5, 25.1, and 16.1% (all P < .01). The low-dead-space connector increased inspiratory resistance by 17.8% (P < .01), 9.6% (P < .05), and 5.0% (not significant); the insert-equipped standard connector increased inspiratory resistance by 9.1, 8.4, and 5.9% (all not significant). The low-dead-space connector decreased expiratory resistance by 6.8% (P < .01) and 1.8% (not significant) and increased it by 1.4% (not significant); the insert-equipped standard connector decreased expiratory resistance by 1.5 and 1% and increased it by 1% (all not significant). The low-dead-space connector increased work of breathing by 4.7% (P < .01), 3.8% (P < .01), and 2.5% (not significant); the insert-equipped standard connector increased it by 0.8% (not significant), 2.5% (P < .01), and 2.8% (P < .01). Both methods of instrumental dead-space reduction led to improvements in artificial lung ventilation. Negative effects on resistance and work of breathing appeared minimal. Further testing in vivo should be performed to confirm the lung model results and, if successful, translated into clinical practice. Copyright © 2016 by Daedalus Enterprises.

Blade retainer assembly

NASA Technical Reports Server (NTRS)

Luebering, G. W. (Inventor)

1977-01-01

A retaining assembly is provided for locking radially extending blades in a rotor disc associated with a gas turbine engine. The assembly includes a pair of spaced apart lugs axially extending from one side of the disc to form an access gap for insertion of a blade tang into a dovetail slot in the rotor disc. A pair of axially aligned inwardly facing recesses are disposed in the lugs. A retaining member resides in the recesses and extends across the gap to preclude egress of the blade tang from the dovetail slot. The retaining member includes at least one axially extending protrusion adapted to radially overlap and abuttingly engage a radially inwardly facing abutment surface on the lugs.

Post clamp

NASA Technical Reports Server (NTRS)

Ramsey, John K. (Inventor); Meyn, Erwin H. (Inventor)

1990-01-01

A pair of spaced collars are mounted at right angles on a clamp body by retaining rings which enable the collars to rotate with respect to the clamp body. Mounting posts extend through aligned holes in the collars and clamp body. Each collar can be clamped onto the inserted post while the clamp body remains free to rotate about the post and collar. The clamp body is selectively clamped onto each post.

Ab initio study of Fe(+)-benzyne

NASA Technical Reports Server (NTRS)

Bauschlicher, Charles W., Jr.

1993-01-01

The interaction of Fe(+) with benzyne is studied using the self-consistent-field (SCF), complete active space SCF, and modified-coupled-pair functional levels of theory. The most stable structure is planar, where the Fe(+) has inserted into the in-plane pi bond, although the C-C bond distance suggests that some in-plane pi bonding remains. This system is compared with Sc(+) bonding to benzyne and other ligands.

Bypass of Aflatoxin B[subscript 1] Adducts by the Sulfolobus solfataricus DNA Polymerase IV

DOE Office of Scientific and Technical Information (OSTI.GOV)

Banerjee, Surajit; Brown, Kyle L.; Egli, Martin

Aflatoxin B{sub 1} (AFB{sub 1}) is oxidized to an epoxide in vivo, which forms an N7-dG DNA adduct (AFB{sub 1}-N7-dG). The AFB{sub 1}-N7-dG can rearrange to a formamidopyrimidine (AFB{sub 1}-FAPY) derivative. Both AFB{sub 1}-N7-dG and the {beta}-anomer of the AFB{sub 1}-FAPY adduct yield G {yields} T transversions in Escherichia coli, but the latter is more mutagenic. We show that the Sulfolobus solfataricus P2 DNA polymerase IV (Dpo4) bypasses AFB{sub 1}-N7-dG in an error-free manner but conducts error-prone replication past the AFB{sub 1}-FAPY adduct, including misinsertion of dATP, consistent with the G {yields} T mutations observed in E. coli. Three ternarymore » (Dpo4-DNA-dNTP) structures with AFB{sub 1}-N7-dG adducted template:primers have been solved. These demonstrate insertion of dCTP opposite the AFB{sub 1}-N7-dG adduct, and correct vs incorrect insertion of dATP vs dTTP opposite the 5'-template neighbor dT from a primed AFB{sub 1}-N7-dG:dC pair. The insertion of dTTP reveals hydrogen bonding between the template N3 imino proton and the O{sup 2} oxygen of dTTP, and between the template T O{sup 4} oxygen and the N3 imino proton of dTTP, perhaps explaining why this polymerase does not efficiently catalyze phosphodiester bond formation from this mispair. The AFB{sub 1}-N7-dG maintains the 5'-intercalation of the AFB{sub 1} moiety observed in DNA. The bond between N7-dG and C8 of the AFB{sub 1} moiety remains in plane with the alkylated guanine, creating a 16{sup o} inclination of the AFB{sub 1} moiety with respect to the guanine. A binary (Dpo4-DNA) structure with an AFB{sub 1}-FAPY adducted template:primer also maintains 5'-intercalation of the AFB{sub 1} moiety. The {beta}-deoxyribose anomer is observed. Rotation about the FAPY C5-N{sup 5} bond orients the bond between N{sup 5} and C8 of the AFB{sub 1} moiety out of plane in the 5'-direction, with respect to the FAPY base. The formamide group extends in the 3'-direction. This improves stacking of the AFB{sub 1} moiety above the 5'-face of the FAPY base, as compared to the AFB{sub 1}-N7-dG adduct. Ternary structures with AFB{sub 1}-{beta}-FAPY adducted template:primers show correct vs incorrect insertion of dATP vs dTTP opposite the 5'-template neighbor dT from a primed AFB{sub 1}-{beta}-FAPY:dC pair. For dATP, the oxygen atom of the FAPY formamide group participates in a water-mediated hydrogen bond with Arg332. The insertion of dTTP yields a structure similar to that observed for the AFB{sub 1}-N7-dG adduct. The differential accommodation of these AFB{sub 1} adducts within the active site may, in part, modulate lesion bypass.« less

Mo99 Production Plant Layout

DOE Office of Scientific and Technical Information (OSTI.GOV)

Woloshun, Keith Albert; Dale, Gregory E.; Naranjo, Angela Carol

The NorthStar Medical Technologies 99Mo production facility configuration is envisioned to be 8 accelerator pairs irradiating 7 100Mo targets (one spare accelerator pair undergoing maintenance while the other 7 pairs are irradiating targets). The required shielding in every direction for the accelerators is initially estimated to be 10 feet of concrete. With the accelerator pairs on one (ground) level and spaced with the required shielding between adjacent pairs, the only practical path for target insertion and removal while minimizing floor space is vertical. The current scheme then requires a target vertical lift of nominally 10 feet through a shield stack.more » It is envisioned that the lift will be directly into a hot cell where an activated target can be removed from its holder and a new target attached and lowered. The hot cell is on a rail system so that a single hot cell can service all active target locations, as well as deliver the ready targets to the separations lab. On this rail system, coupled to the hot cell, will be a helium recovery and clean-up system. All helium coolant equipment is located on the upper level near to the target removal point.« less

Biomedical gait evaluation of the immediate effect of orthotic treatment for flexible flat foot.

PubMed

Leung, A K; Mak, A F; Evans, J H

1998-04-01

Flexible flat foot subjects attending the prosthetics and orthotics units come with prescriptions from orthopaedic surgeons for arch supports. Usually a pair of thermoformed plastic inserts are fabricated and fitted to treat the patients. However the effect of the orthotic treatment is not yet clear. A motion analysis system with two video cameras placed on the lateral and rear sides of the subject together with one force platform was used to investigate the immediate effects of the orthotic treatment. The force platform collected force data and the two cameras captured two-dimensional displacement data of the lower limb. Eight subjects, all having an arch index (AI) larger than 3.0 participated in the study. For each subject, three successful steps on the force platform were videotaped for both the shod (with shoe only) and the orthotic (with shoe and orthosis) conditions. The kinetic variables were normalized to individual body weight and averaged for each subject. A Paired t-test was conducted to analyse sample means of matched pairs between the shod and the orthotic conditions. The results showed changes in displacement data with relatively little change in the collected force data. The modified UCBL shoe insert evaluated significantly affected the orientation and movements of the subtalar joint, ankle joint and knee joint. These immediate effects reduced the degree and duration of abnormal pronation during the stance phase and thus had the potential for decreasing strain in the plantar ligaments and reducing abnormal tibial rotation which may be therapeutic for the foot.

Tibiotalocalcaneal arthrodesis with a retrograde intramedullary nail: a biomechanical analysis of the effect of nail length.

PubMed

Noonan, Timothy; Pinzur, Michael; Paxinos, Odysseas; Havey, Robert; Patwardhin, Avinash

2005-04-01

Fatigue fractures of the tibia have been observed at the level of the proximal end of the nail after successful tibiocalcaneal arthrodesis with a retrograde intramedullary device. To study the effect of nail length, five matched pairs of cadaver tibiae were instrumented with strain gauges and potted in methylmethacrylate from a level 3 cm proximal to the distal medial malleolus to simulate a successful tibiocalcaneal arthrodesis. A standard length (15 cm) ankle arthrodesis nail and an identical longer device terminating in the proximal tibial metaphysis were inserted in each paired tibia using appropriate technique. The strain of the posterior cortex of the tibia was recorded under bending moments of up to 50 Nm for each intact specimen after nail insertion and after proximal locking of the nail. The nails were then exchanged between the specimens of the same pairs and the experiment was repeated to insure uniformity. The standard length locked nail increased the principal strain of the posterior cortex of the tibia at the level of the proximal screw holes 5.3 times more than the locked long nail (353 and 67 microstrains), respectively. This stress concentration was not observed when the proximal extent of the nail terminated within the proximal tibial metaphysis. A successful tibiocalcaneal arthrodesis with a standard length locked intramedullary nail creates stress concentration around the proximal screw holes that may be responsible for the fractures observed clinically. This study supports the use of a "long" retrograde locked intramedullary nail for tibiocalcaneal arthrodesis in patients with systemic or localized osteopenia.

Prophylactic augmentation of the proximal femur: an investigation of two techniques.

PubMed

Raas, Christoph; Hofmann-Fliri, Ladina; Hörmann, Romed; Schmoelz, Werner

2016-03-01

Osteoporotic hip fractures are an increasing problem in an ageing population. They result in high morbidity, mortality and high socioeconomic costs. For patients with poor bone quality, prophylactic augmentation of the proximal femur might be an option for fracture prevention. In two groups of paired human femora the potential of limited polymethyl-methacrylate (PMMA) augmentation (11-15 ml) in a V-shape pattern and the insertion of a proximal femur nail antirotation (PFNA) blade were investigated. The testing was carried out pair wise simulating the single leg stand. The untreated femur in each pair served as control. An axial load was applied until failure. Load displacement parameters and temperature increase during the augmentation process were recorded. In the PMMA group no significant difference was found between the augmented and non-augmented specimen concerning load to failure (p = 0.35) and energy to failure (p = 0.9). A median temperature increase of 9.5 °C was observed in the augmented specimen. A significant correlation was found between the amount of applied PMMA and the temperature increase (Cor. Coef. = 0.82, p = 0.042). In the PFNA group, a significant decrease of load to failure and a non-significant decrease of energy to failure were observed (p = 0.037 and p = 0.075). Limited V-shaped PMMA augmentation and PFNA blade insertion did not show any improvement in failure load or energy to failure. Volumes of up to 15 ml PMMA did not cause a critical surface temperature increase.

Innovative Sensory Methods to Access Acceptability of Mixed Polymer Semisoft Ovules for Microbicide Applications

PubMed Central

Zaveri, Toral; Running, Cordelia A; Surapaneni, Lahari; Ziegler, Gregory R; Hayes, John E

2016-01-01

Vaginal microbicides are a promising means to prevent the transmission of HIV, empowering women by putting protection under their control. We have been using gel technology to develop microbicides in the intermediate texture space to overcome shortcomings of current solid and liquid forms. We recently formulated semisoft ovules from mixed polymer combinations of carrageenan and Carbopol 940P to overcome some of the flaws with our previous generation of formulations based solely on carrageenan. To determine the user acceptability of the reformulated gels, women first evaluated intact semisoft ovules before evaluating ovules that had been subjected to mechanical crushing to simulate samples that represent post-use discharge. Women then evaluated combinations of intact and discharge samples to understand how ovule textures correlated with texture of the resulting discharge samples. Carbopol concentration directly and inversely correlated with willingness to try for discharge samples and intact samples respectively. When evaluating intact samples, women focused on the ease of inserting the product and preferred firmer samples; conversely, when evaluating discharge samples, softer samples that resulted in a smooth paste were preferred. Significant differences between samples were lost when evaluating pairs as women made varying tradeoffs between their preference for ease of inserting intact ovules and acceptability of discharge appearance. Evaluating samples that represent different stages of the use cycle reveals a more holistic measure of product acceptability. Studying sensory acceptability in parallel with biophysical performance enables an iterative design process that considers what women prefer in terms of insertion as well as possibility of leakage. PMID:27357703

Innovative sensory methods to access acceptability of mixed polymer semisoft ovules for microbicide applications.

PubMed

Zaveri, Toral; Running, Cordelia A; Surapaneni, Lahari; Ziegler, Gregory R; Hayes, John E

2016-10-01

Vaginal microbicides are a promising means to prevent the transmission of HIV, empowering women by putting protection under their control. We have been using gel technology to develop microbicides in the intermediate texture space to overcome shortcomings of current solid and liquid forms. We recently formulated semisoft ovules from mixed polymer combinations of carrageenan and Carbopol 940P to overcome some of the flaws with our previous generation of formulations based solely on carrageenan. To determine the user acceptability of the reformulated gels, women first evaluated intact semisoft ovules before evaluating ovules that had been subjected to mechanical crushing to simulate samples that represent post-use discharge. Women then evaluated combinations of intact and discharge samples to understand how ovule textures correlated with texture of the resulting discharge samples. Carbopol concentration directly and inversely correlated with willingness to try for discharge samples and intact samples, respectively. When evaluating intact samples, women focused on the ease of inserting the product and preferred firmer samples; conversely, when evaluating discharge samples, softer samples that resulted in a smooth paste were preferred. Significant differences between samples were lost when evaluating pairs as women made varying trade-offs between their preference for ease of inserting intact ovules and acceptability of discharge appearance. Evaluating samples that represent different stages of the use cycle reveals a more holistic measure of product acceptability. Studying sensory acceptability in parallel with biophysical performance enables an iterative design process that considers what women prefer in terms of insertion as well as possibility of leakage.

A Bridging Water Anchors the Tethered 5-(3-Aminopropyl)-2′-deoxyuridine Amine in the DNA Major Groove Proximate to the N+2 C·G Base Pair: Implications for Formation of Interstrand 5′-GNC-3′ Cross-Links by Nitrogen Mustards‡

PubMed Central

Wang, Feng; Li, Feng; Ganguly, Manjori; Marky, Luis A.; Gold, Barry; Egli, Martin; Stone, Michael P.

2009-01-01

Site-specific insertion of 5-(3-aminopropyl)-2′-deoxyuridine (Z3dU) and 7-deaza-dG into the Dickerson-Drew dodecamers 5′-d(C1G2C3G4A5A6T7T8C9Z10C11G12)-3′ · 5′-d(C13G14C15G16A17A18T19T20-C21Z22C23G24)-3′ (named DDDZ10) and 5′-d(C1G2C3G4A5A6T7X8C9Z10C11G12)-3′ · 5′-d(C13G14C15G16A17A18-T19X20C21Z22C23G24)-3′ (named DDD2+Z10)(X = Z3dU; Z = 7-deaza-dG) suggests a mechanism underlying the formation of interstrand N+2 DNA cross-links by nitrogen mustards, e.g., melphalan and mechlorethamine. Analysis of the DDD2+Z10 duplex reveals that the tethered cations at base pairs A5 · X20 and X8 · A17 extend within the major groove in the 3′-direction, toward conserved Mg2+ binding sites located adjacent to N+2 base pairs C3 · Z22 and Z10 · C15. Bridging waters located between the tethered amines and either Z10 or Z22 O6 stabilize the tethered cations and allow interactions with the N + 2 base pairs without DNA bending. Incorporation of 7-deaza-dG into the DDD2+Z10 duplex weakens but does not eliminate electrostatic interactions between tethered amines and Z10 O6 and Z22 O6. The results suggest a mechanism by which tethered N7-dG aziridinium ions, the active species involved in formation of interstrand 5′-GNC-3′ cross-links by nitrogen mustards, modify the electrostatics of the major groove and position the aziridinium ions proximate to the major groove edge of the N+2 C · G base pair, facilitating interstrand cross-linking. PMID:18549246

Genome engineering in human cells.

PubMed

Song, Minjung; Kim, Young-Hoon; Kim, Jin-Soo; Kim, Hyongbum

2014-01-01

Genome editing in human cells is of great value in research, medicine, and biotechnology. Programmable nucleases including zinc-finger nucleases, transcription activator-like effector nucleases, and RNA-guided engineered nucleases recognize a specific target sequence and make a double-strand break at that site, which can result in gene disruption, gene insertion, gene correction, or chromosomal rearrangements. The target sequence complexities of these programmable nucleases are higher than 3.2 mega base pairs, the size of the haploid human genome. Here, we briefly introduce the structure of the human genome and the characteristics of each programmable nuclease, and review their applications in human cells including pluripotent stem cells. In addition, we discuss various delivery methods for nucleases, programmable nickases, and enrichment of gene-edited human cells, all of which facilitate efficient and precise genome editing in human cells.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wu, Hong; Zeng, Hong; Lam, Robert

The crystal structure of the human MLH1 N-terminus is reported at 2.30 Å resolution. The overall structure is described along with an analysis of two clinically important mutations. Mismatch repair prevents the accumulation of erroneous insertions/deletions and non-Watson–Crick base pairs in the genome. Pathogenic mutations in the MLH1 gene are associated with a predisposition to Lynch and Turcot’s syndromes. Although genetic testing for these mutations is available, robust classification of variants requires strong clinical and functional support. Here, the first structure of the N-terminus of human MLH1, determined by X-ray crystallography, is described. The structure shares a high degree ofmore » similarity with previously determined prokaryotic MLH1 homologs; however, this structure affords a more accurate platform for the classification of MLH1 variants.« less

A Binary Array Asynchronous Sorting Algorithm with Using Petri Nets

NASA Astrophysics Data System (ADS)

Voevoda, A. A.; Romannikov, D. O.

2017-01-01

Nowadays the tasks of computations speed-up and/or their optimization are actual. Among the approaches on how to solve these tasks, a method applying approaches of parallelization and asynchronization to a sorting algorithm is considered in the paper. The sorting methods are ones of elementary methods and they are used in a huge amount of different applications. In the paper, we offer a method of an array sorting that based on a division into a set of independent adjacent pairs of numbers and their parallel and asynchronous comparison. And this one distinguishes the offered method from the traditional sorting algorithms (like quick sorting, merge sorting, insertion sorting and others). The algorithm is implemented with the use of Petri nets, like the most suitable tool for an asynchronous systems description.

Spin dependent transport properties of Mn-Ga/MgO/Mn-Ga magnetic tunnel junctions with metal(Mg, Co, Cr) insertion layer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liang, S. H.; Tao, L. L.; Liu, D. P., E-mail: dpliu@iphy.ac.cn

We report a first principles theoretical investigation of spin polarized quantum transport in Mn{sub 2}Ga/MgO/Mn{sub 2}Ga and Mn{sub 3}Ga/MgO/Mn{sub 3}Ga magnetic tunneling junctions (MTJs) with the consideration of metal(Mg, Co, Cr) insertion layer effect. By changing the concentration of Mn, our calculation shows a considerable disparity in transport properties: A tunneling magnetoresistance (TMR) ratio of 852% was obtained for Mn{sub 2}Ga-based MTJs, however, only a 5% TMR ratio for Mn{sub 3}Ga-based MTJs. In addition, the influence of insertion layer has been considered in our calculation. We found the Co insertion layer can increase the TMR of Mn{sub 2}Ga-based MTJ tomore » 904%; however, the Cr insertion layer can decrease the TMR by 668%; A negative TMR ratio can be obtained with Mg insertion layer. Our work gives a comprehensive understanding of the influence of different insertion layer in Mn-Ga based MTJs. It is proved that, due to the transmission can be modulated by the interfacial electronic structure of insertion, the magnetoresistance ratio of Mn{sub 2}Ga/MgO/Mn{sub 2}Ga MTJ can be improved by inserting Co layer.« less

Identification of genomic indels and structural variations using split reads

PubMed Central

2011-01-01

Background Recent studies have demonstrated the genetic significance of insertions, deletions, and other more complex structural variants (SVs) in the human population. With the development of the next-generation sequencing technologies, high-throughput surveys of SVs on the whole-genome level have become possible. Here we present split-read identification, calibrated (SRiC), a sequence-based method for SV detection. Results We start by mapping each read to the reference genome in standard fashion using gapped alignment. Then to identify SVs, we score each of the many initial mappings with an assessment strategy designed to take into account both sequencing and alignment errors (e.g. scoring more highly events gapped in the center of a read). All current SV calling methods have multilevel biases in their identifications due to both experimental and computational limitations (e.g. calling more deletions than insertions). A key aspect of our approach is that we calibrate all our calls against synthetic data sets generated from simulations of high-throughput sequencing (with realistic error models). This allows us to calculate sensitivity and the positive predictive value under different parameter-value scenarios and for different classes of events (e.g. long deletions vs. short insertions). We run our calculations on representative data from the 1000 Genomes Project. Coupling the observed numbers of events on chromosome 1 with the calibrations gleaned from the simulations (for different length events) allows us to construct a relatively unbiased estimate for the total number of SVs in the human genome across a wide range of length scales. We estimate in particular that an individual genome contains ~670,000 indels/SVs. Conclusions Compared with the existing read-depth and read-pair approaches for SV identification, our method can pinpoint the exact breakpoints of SV events, reveal the actual sequence content of insertions, and cover the whole size spectrum for deletions. Moreover, with the advent of the third-generation sequencing technologies that produce longer reads, we expect our method to be even more useful. PMID:21787423

The effect of gait training with shoe inserts on the improvement of pain and gait in sacroiliac joint patients.

PubMed

Cho, Byung-Yun; Yoon, Jung-Gyu

2015-08-01

[Purpose] The purpose of the current research was to identify how gait training with shoe inserts affects the pain and gait of sacroiliac joint dysfunction patients. [Subjects and Methods] Thirty subjects were randomly selected and assigned to be either the experimental group (gait training with shoe insert group) or control group. Each group consisted of 15 patients. Pain was measured by Visual Analogue Scale, and foot pressure in a standing position and during gait was measured with a Gateview AFA-50 system (Alpus, Seoul, Republic of Korea). A paired sample t-test was used to compare the pain and gait of the sacroiliac joint before and after the intervention. Correlation between pain and walking after gait training with shoe inserts was examined by Pearson test. The level of significance was set at α=0.05. [Results] It was found that application of the intervention to the experimental group resulted in a significant decrease in sacroiliac joint pain. It was also found that there was a significant correlation between Visual Analogue Scale score and dynamic asymmetric index (r= 0.796) and that there was a negative correlation between Visual Analogue Scale score and forefoot/rear foot peak pressure ratio (r=-0.728). [Conclusion] The results of our analysis lead us to conclude that the intervention with shoe inserts had a significant influence on the pain and gait of sacroiliac joint patients.

The effect of gait training with shoe inserts on the improvement of pain and gait in sacroiliac joint patients

PubMed Central

Cho, Byung-Yun; Yoon, Jung-Gyu

2015-01-01

[Purpose] The purpose of the current research was to identify how gait training with shoe inserts affects the pain and gait of sacroiliac joint dysfunction patients. [Subjects and Methods] Thirty subjects were randomly selected and assigned to be either the experimental group (gait training with shoe insert group) or control group. Each group consisted of 15 patients. Pain was measured by Visual Analogue Scale, and foot pressure in a standing position and during gait was measured with a Gateview AFA-50 system (Alpus, Seoul, Republic of Korea). A paired sample t-test was used to compare the pain and gait of the sacroiliac joint before and after the intervention. Correlation between pain and walking after gait training with shoe inserts was examined by Pearson test. The level of significance was set at α=0.05. [Results] It was found that application of the intervention to the experimental group resulted in a significant decrease in sacroiliac joint pain. It was also found that there was a significant correlation between Visual Analogue Scale score and dynamic asymmetric index (r= 0.796) and that there was a negative correlation between Visual Analogue Scale score and forefoot/rear foot peak pressure ratio (r=-0.728). [Conclusion] The results of our analysis lead us to conclude that the intervention with shoe inserts had a significant influence on the pain and gait of sacroiliac joint patients. PMID:26357428

Impact of Discrete Corrections in a Modular Approach for Trajectory Generation in Quadruped Robots

NASA Astrophysics Data System (ADS)

Pinto, Carla M. A.; Santos, Cristina P.; Rocha, Diana; Matos, Vítor

2011-09-01

Online generation of trajectories in robots is a very complex task that involves the combination of different types of movements, i.e., distinct motor primitives. The later are used to model complex behaviors in robots, such as locomotion in irregular terrain and obstacle avoidance. In this paper, we consider two motor primitives: rhythmic and discrete. We study the effect on the robots' gaits of superimposing the two motor primitives, considering two distinct types of coupling. Additionally, we simulate two scenarios, where the discrete primitive is inserted in all of the four limbs, or is inserted in ipsilateral pairs of limbs. Numerical results show that amplitude and frequency of the periodic solutions, corresponding to the gaits trot and pace, are almost constant for diffusive and synaptic couplings.

Accuracy of pedicle screw insertion by AIRO® intraoperative CT in complex spinal deformity assessed by a new classification based on technical complexity of screw insertion.

PubMed

Rajasekaran, S; Bhushan, Manindra; Aiyer, Siddharth; Kanna, Rishi; Shetty, Ajoy Prasad

2018-01-09

To develop a classification based on the technical complexity encountered during pedicle screw insertion and to evaluate the performance of AIRO ® CT navigation system based on this classification, in the clinical scenario of complex spinal deformity. 31 complex spinal deformity correction surgeries were prospectively analyzed for performance of AIRO ® mobile CT-based navigation system. Pedicles were classified according to complexity of insertion into five types. Analysis was performed to estimate the accuracy of screw placement and time for screw insertion. Breach greater than 2 mm was considered for analysis. 452 pedicle screws were inserted (T1-T6: 116; T7-T12: 171; L1-S1: 165). The average Cobb angle was 68.3° (range 60°-104°). We had 242 grade 2 pedicles, 133 grade 3, and 77 grade 4, and 44 pedicles were unfit for pedicle screw insertion. We noted 27 pedicle screw breach (medial: 10; lateral: 16; anterior: 1). Among lateral breach (n = 16), ten screws were planned for in-out-in pedicle screw insertion. Among lateral breach (n = 16), ten screws were planned for in-out-in pedicle screw insertion. Average screw insertion time was 1.76 ± 0.89 min. After accounting for planned breach, the effective breach rate was 3.8% resulting in 96.2% accuracy for pedicle screw placement. This classification helps compare the accuracy of screw insertion in range of conditions by considering the complexity of screw insertion. Considering the clinical scenario of complex pedicle anatomy in spinal deformity AIRO ® navigation showed an excellent accuracy rate of 96.2%.

Frequency response improvement of a two-port surface acoustic wave device based on epitaxial AlN thin film

NASA Astrophysics Data System (ADS)

Gao, Junning; Hao, Zhibiao; Luo, Yi; Li, Guoqiang

2018-01-01

This paper presents an exploration on improving the frequency response of the symmetrical two-port AlN surface acoustic wave (SAW) device, using epitaxial AlN thin film on (0001) sapphire as the piezoelectric substrate. The devices were fabricated by lift-off processes with Ti/Al composite electrodes as interleaved digital transducers (IDT). The impact of DL and the number of the IDT finger pairs on the frequency response was carefully investigated. The overall properties of the device are found to be greatly improved with DL elongation, indicated by the reduced pass band ripple and increased stop band rejection ratio. The rejection increases by 8.3 dB when DL elongates from 15.5λ to 55.5λ and 4.4 dB further accompanying another 50λ elongation. This is because larger DL repels the stray acoustic energy out of the propagation path and provides a cleaner traveling channel for functional SAW, and at the same time restrains electromagnetic feedthrough. It is also found that proper addition of the IDT finger pairs is beneficial for the device response, indicated by the ripple reduction and the insertion loss drop.

New application of superconductors: High sensitivity cryogenic light detectors

NASA Astrophysics Data System (ADS)

Cardani, L.; Bellini, F.; Casali, N.; Castellano, M. G.; Colantoni, I.; Coppolecchia, A.; Cosmelli, C.; Cruciani, A.; D'Addabbo, A.; Di Domizio, S.; Martinez, M.; Tomei, C.; Vignati, M.

2017-02-01

In this paper we describe the current status of the CALDER project, which is developing ultra-sensitive light detectors based on superconductors for cryogenic applications. When we apply an AC current to a superconductor, the Cooper pairs oscillate and acquire kinetic inductance, that can be measured by inserting the superconductor in a LC circuit with high merit factor. Interactions in the superconductor can break the Cooper pairs, causing sizable variations in the kinetic inductance and, thus, in the response of the LC circuit. The continuous monitoring of the amplitude and frequency modulation allows to reconstruct the incident energy with excellent sensitivity. This concept is at the basis of Kinetic Inductance Detectors (KIDs) that are characterized by natural aptitude to multiplexed read-out (several sensors can be tuned to different resonant frequencies and coupled to the same line), resolution of few eV, stable behavior over a wide temperature range, and ease in fabrication. We present the results obtained by the CALDER collaboration with 2×2 cm2 substrates sampled by 1 or 4 Aluminum KIDs. We show that the performances of the first prototypes are already competitive with those of other commonly used light detectors, and we discuss the strategies for a further improvement.

System for injecting fuel in a gas turbine combustor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Berry, Jonathan Dwight

A combustion system uses a fuel nozzle with an inner wall having a fuel inlet in fluid communication with a fuel outlet in a fuel cartridge. The inner wall defines a mounting location for inserting the fuel cartridge. A pair of annular lip seals around the cartridge outer wall on both sides of the fuel outlet seals the fuel passage between the fuel inlet and the fuel outlet.

Method of making dished ion thruster grids

NASA Technical Reports Server (NTRS)

Banks, B. A. (Inventor)

1975-01-01

A pair of flat grid blanks are clamped together at their edges with an impervious metal sheet on top. All of the blanks and sheets are dished simultaneously by forcing fluid to inflate an elastic sheet which contacts the bottom grid blank. A second impervious metal sheet is inserted between the two grid blanks if the grids have high percentage open areas. The dished grids are stress relieved simultaneously.

Teleoperated master-slave needle insertion.

PubMed

Abolhassani, Niki; Patel, Rajni V

2009-12-01

Accuracy of needle tip placement and needle tracking in soft tissue are of particular importance in many medical procedures. In recent years, developing autonomous and teleoperated systems for needle insertion has become an active area of research. In this study, needle insertion was performed using a master-slave set-up with multi-degrees of freedom. The effect of force feedback on the accuracy of needle insertion was investigated. In addition, this study compared autonomous, teleoperated and semi-autonomous needle insertion. The results of this study show that incorporation of force feedback can improve teleoperated needle insertion. However, autonomous and semi-autonomous needle insertions, which use feedback from a deflection model, provide significantly better performance. Development of a haptic master-slave needle insertion system, which is capable of performing some autonomous tasks based on feedback from tissue deformation and needle deflection models, can improve the performance of autonomous robotics-based insertions as well as non-autonomous teleoperated manual insertions. Copyright (c) 2009 John Wiley & Sons, Ltd.

Haplotype estimation using sequencing reads.

PubMed

Delaneau, Olivier; Howie, Bryan; Cox, Anthony J; Zagury, Jean-François; Marchini, Jonathan

2013-10-03

High-throughput sequencing technologies produce short sequence reads that can contain phase information if they span two or more heterozygote genotypes. This information is not routinely used by current methods that infer haplotypes from genotype data. We have extended the SHAPEIT2 method to use phase-informative sequencing reads to improve phasing accuracy. Our model incorporates the read information in a probabilistic model through base quality scores within each read. The method is primarily designed for high-coverage sequence data or data sets that already have genotypes called. One important application is phasing of single samples sequenced at high coverage for use in medical sequencing and studies of rare diseases. Our method can also use existing panels of reference haplotypes. We tested the method by using a mother-father-child trio sequenced at high-coverage by Illumina together with the low-coverage sequence data from the 1000 Genomes Project (1000GP). We found that use of phase-informative reads increases the mean distance between switch errors by 22% from 274.4 kb to 328.6 kb. We also used male chromosome X haplotypes from the 1000GP samples to simulate sequencing reads with varying insert size, read length, and base error rate. When using short 100 bp paired-end reads, we found that using mixtures of insert sizes produced the best results. When using longer reads with high error rates (5-20 kb read with 4%-15% error per base), phasing performance was substantially improved. Copyright © 2013 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

A naturally-occurring new lead-based halocuprate(I)

NASA Astrophysics Data System (ADS)

Welch, Mark D.; Rumsey, Michael S.; Kleppe, Annette K.

2016-06-01

Pb2Cu(OH)2I3 is a new type of halocuprate(I) that is a framework of alternating [Pb4(OH)4]4+ and [Cu2I6]4- units. The structure has been determined in orthorhombic space group Fddd to R1=0.037, wR2=0.057, GoF=1.016. Unit cell parameters are a=16.7082(9) Å, b=20.8465(15) Å, c=21.0159(14) Å, V=7320.0(8) Å3 (Z=32). There is no synthetic counterpart. The structure is based upon a cubane-like Pb4(OH)4 nucleus that is coordinated to sixteen iodide ions. Cu+ ions are inserted into pairs of adjacent edge-sharing tetrahedral sites in the iodide motif to form [Cu2I6]4- groups. The Raman spectrum of Pb2Cu(OH)2I3 has two O-H stretching modes and as such is consistent with space group Fddd, with two non-equivalent OH groups, rather than the related space group I41/acd which has only one non-equivalent OH group. Consideration of the 18-electron rule implies that there is a Cu=Cu double bond, which may be consistent with the short Cu…Cu distance of 2.78 Å, although the dearth of published data on the interpretation of Cu…Cu distances in halocuprate(I) compounds does not allow a clear-cut interpretation of this interatomic distance. The orthorhombic structure is compared with that of the synthetic halocuprate(I) compound Pb2Cu(OH)2BrI2 with space group I41/acd and having chains of corner-linked CuI4 tetrahedra rather than isolated Cu2I6 pairs. The paired motif found in Pb2Cu(OH)2I3 cannot be achieved in space group I41/acd and, conversely, the chain motif cannot be achieved in space group Fddd. As such, the space group defines either a chain or an isolated-pair motif. The existence of Pb2Cu(OH)2I3 suggests a new class of inorganic halocuprate(I)s based upon the Pb4(OH)4 group.

PDF Lecture Materials for Online and ``Flipped'' Format Astronomy Courses

NASA Astrophysics Data System (ADS)

Kary, D. M.; Eisberg, J.

2013-04-01

Online astronomy courses typically rely on students reading the textbook and/or a set of text-based lecture notes to replace the “lecture” material. However, many of our students report that this is much less engaging than in-person lectures, especially given the amount of interactive work such as “think-pair-share” problems done in many astronomy classes. Students have similarly criticized direct lecture-capture. To address this, we have developed a set of PowerPoint-style presentations with embedded lecture audio combined with prompts for student interaction including think-pair-share questions. These are formatted PDF packages that can be used on a range of different computers using free software. The presentations are first developed using Microsoft PowerPoint software. Audio recordings of scripted lectures are then synchronized with the presentations and the entire package is converted to PDF using Adobe Presenter. This approach combines the ease of editing that PowerPoint provides along with the platform-independence of PDF. It's easy to add, remove, or edit individual slides as needed, and PowerPoint supports internal links so that think-pair-share questions can be inserted with links to feedback based on the answers selected. Modern PDF files support animated visuals with synchronized audio and they can be read using widely available free software. Using these files students in an online course can get many of the benefits of seeing and hearing the course material presented in an in-person lecture format. Students needing extra help in traditional lecture classes can use these presentations to help review the materials covered in lecture. Finally, the presentations can be used in a “flipped” format in which students work through the presentations outside of class time while spending the “lecture” time on in-class interaction.

In vivo blunt-end cloning through CRISPR/Cas9-facilitated non-homologous end-joining

PubMed Central

Geisinger, Jonathan M.; Turan, Sören; Hernandez, Sophia; Spector, Laura P.; Calos, Michele P.

2016-01-01

The CRISPR/Cas9 system facilitates precise DNA modifications by generating RNA-guided blunt-ended double-strand breaks. We demonstrate that guide RNA pairs generate deletions that are repaired with a high level of precision by non-homologous end-joining in mammalian cells. We present a method called knock-in blunt ligation for exploiting these breaks to insert exogenous PCR-generated sequences in a homology-independent manner without loss of additional nucleotides. This method is useful for making precise additions to the genome such as insertions of marker gene cassettes or functional elements, without the need for homology arms. We successfully utilized this method in human and mouse cells to insert fluorescent protein cassettes into various loci, with efficiencies up to 36% in HEK293 cells without selection. We also created versions of Cas9 fused to the FKBP12-L106P destabilization domain in an effort to improve Cas9 performance. Our in vivo blunt-end cloning method and destabilization-domain-fused Cas9 variant increase the repertoire of precision genome engineering approaches. PMID:26762978

Whole genome sequencing of cytogenetically balanced chromosome translocations identifies potentially pathological gene disruptions and highlights the importance of microhomology in the mechanism of formation

PubMed Central

Gustavsson, Peter; Förster, Alisa; Hofmeister, Wolfgang; Wincent, Josephine; Zachariadis, Vasilios; Anderlid, Britt-Marie; Nordgren, Ann; Mäkitie, Outi; Wirta, Valtteri; Käller, Max; Vezzi, Francesco; Lupski, James R; Nordenskjöld, Magnus; Lundberg, Elisabeth Syk; Carvalho, Claudia M. B.; Lindstrand, Anna

2016-01-01

Most balanced translocations are thought to result mechanistically from non-homologous endjoining (NHEJ) or, in rare cases of recurrent events, by nonallelic homologous recombination (NAHR). Here, we use low coverage mate pair whole genome sequencing to fine map rearrangement breakpoint junctions in both phenotypically normal and affected translocation carriers. In total, 46 junctions from 22 carriers of balanced translocations were characterized. Genes were disrupted in 48% of the breakpoints; recessive genes in four normal carriers and known dominant intellectual disability genes in three affected carriers. Finally, seven candidate disease genes were disrupted in five carriers with neurocognitive disabilities (SVOPL, SUSD1, TOX, NCALD, SLC4A10) and one XX-male carrier with Tourette syndrome (LYPD6, GPC5). Breakpoint junction analyses revealed microhomology and small templated insertions in a substantive fraction of the analyzed translocations (17.4%; n=4); an observation that was substantiated by reanalysis of 37 previously published translocation junctions. Microhomology associated with templated-insertions is a characteristic seen in the breakpoint junctions of rearrangements mediated by the error prone replication-based repair mechanisms (RBMs). Our data implicate that a mechanism involving template switching might contribute to the formation of at least 15% of the interchromosomal translocation events. PMID:27862604

Applications of CRISPR/Cas9 technology for targeted mutagenesis, gene replacement and stacking of genes in higher plants.

PubMed

Luo, Ming; Gilbert, Brian; Ayliffe, Michael

2016-07-01

Mutagenesis continues to play an essential role for understanding plant gene function and, in some instances, provides an opportunity for plant improvement. The development of gene editing technologies such as TALENs and zinc fingers has revolutionised the targeted mutation specificity that can now be achieved. The CRISPR/Cas9 system is the most recent addition to gene editing technologies and arguably the simplest requiring only two components; a small guide RNA molecule (sgRNA) and Cas9 endonuclease protein which complex to recognise and cleave a specific 20 bp target site present in a genome. Target specificity is determined by complementary base pairing between the sgRNA and target site sequence enabling highly specific, targeted mutation to be readily engineered. Upon target site cleavage, error-prone endogenous repair mechanisms produce small insertion/deletions at the target site usually resulting in loss of gene function. CRISPR/Cas9 gene editing has been rapidly adopted in plants and successfully undertaken in numerous species including major crop species. Its applications are not restricted to mutagenesis and target site cleavage can be exploited to promote sequence insertion or replacement by recombination. The multiple applications of this technology in plants are described.

Alternative Splicing of a Novel Inducible Exon Diversifies the CASK Guanylate Kinase Domain

PubMed Central

Dembowski, Jill A.; An, Ping; Scoulos-Hanson, Maritsa; Yeo, Gene; Han, Joonhee; Fu, Xiang-Dong; Grabowski, Paula J.

2012-01-01

Alternative pre-mRNA splicing has a major impact on cellular functions and development with the potential to fine-tune cellular localization, posttranslational modification, interaction properties, and expression levels of cognate proteins. The plasticity of regulation sets the stage for cells to adjust the relative levels of spliced mRNA isoforms in response to stress or stimulation. As part of an exon profiling analysis of mouse cortical neurons stimulated with high KCl to induce membrane depolarization, we detected a previously unrecognized exon (E24a) of the CASK gene, which encodes for a conserved peptide insertion in the guanylate kinase interaction domain. Comparative sequence analysis shows that E24a appeared selectively in mammalian CASK genes as part of a >3,000 base pair intron insertion. We demonstrate that a combination of a naturally defective 5′ splice site and negative regulation by several splicing factors, including SC35 (SRSF2) and ASF/SF2 (SRSF1), drives E24a skipping in most cell types. However, this negative regulation is countered with an observed increase in E24a inclusion after neuronal stimulation and NMDA receptor signaling. Taken together, E24a is typically a skipped exon, which awakens during neuronal stimulation with the potential to diversify the protein interaction properties of the CASK polypeptide. PMID:23008758

Analysis of Structural Flexibility of Damaged DNA Using Thiol-Tethered Oligonucleotide Duplexes

PubMed Central

Fujita, Masashi; Watanabe, Shun; Yoshizawa, Mariko; Yamamoto, Junpei; Iwai, Shigenori

2015-01-01

Bent structures are formed in DNA by the binding of small molecules or proteins. We developed a chemical method to detect bent DNA structures. Oligonucleotide duplexes in which two mercaptoalkyl groups were attached to the positions facing each other across the major groove were prepared. When the duplex contained the cisplatin adduct, which was proved to induce static helix bending, interstrand disulfide bond formation under an oxygen atmosphere was detected by HPLC analyses, but not in the non-adducted duplex, when the two thiol-tethered nucleosides were separated by six base pairs. When the insert was five and seven base pairs, the disulfide bond was formed and was not formed, respectively, regardless of the cisplatin adduct formation. The same reaction was observed in the duplexes containing an abasic site analog and the (6–4) photoproduct. Compared with the cisplatin case, the disulfide bond formation was slower in these duplexes, but the reaction rate was nearly independent of the linker length. These results indicate that dynamic structural changes of the abasic site- and (6–4) photoproduct-containing duplexes could be detected by our method. It is strongly suggested that the UV-damaged DNA-binding protein, which specifically binds these duplexes and functions at the first step of global-genome nucleotide excision repair, recognizes the easily bendable nature of damaged DNA. PMID:25679955

Accurate indel prediction using paired-end short reads

PubMed Central

2013-01-01

Background One of the major open challenges in next generation sequencing (NGS) is the accurate identification of structural variants such as insertions and deletions (indels). Current methods for indel calling assign scores to different types of evidence or counter-evidence for the presence of an indel, such as the number of split read alignments spanning the boundaries of a deletion candidate or reads that map within a putative deletion. Candidates with a score above a manually defined threshold are then predicted to be true indels. As a consequence, structural variants detected in this manner contain many false positives. Results Here, we present a machine learning based method which is able to discover and distinguish true from false indel candidates in order to reduce the false positive rate. Our method identifies indel candidates using a discriminative classifier based on features of split read alignment profiles and trained on true and false indel candidates that were validated by Sanger sequencing. We demonstrate the usefulness of our method with paired-end Illumina reads from 80 genomes of the first phase of the 1001 Genomes Project ( http://www.1001genomes.org) in Arabidopsis thaliana. Conclusion In this work we show that indel classification is a necessary step to reduce the number of false positive candidates. We demonstrate that missing classification may lead to spurious biological interpretations. The software is available at: http://agkb.is.tuebingen.mpg.de/Forschung/SV-M/. PMID:23442375

Biotechnological applications of mobile group II introns and their reverse transcriptases: gene targeting, RNA-seq, and non-coding RNA analysis.

PubMed

Enyeart, Peter J; Mohr, Georg; Ellington, Andrew D; Lambowitz, Alan M

2014-01-13

Mobile group II introns are bacterial retrotransposons that combine the activities of an autocatalytic intron RNA (a ribozyme) and an intron-encoded reverse transcriptase to insert site-specifically into DNA. They recognize DNA target sites largely by base pairing of sequences within the intron RNA and achieve high DNA target specificity by using the ribozyme active site to couple correct base pairing to RNA-catalyzed intron integration. Algorithms have been developed to program the DNA target site specificity of several mobile group II introns, allowing them to be made into 'targetrons.' Targetrons function for gene targeting in a wide variety of bacteria and typically integrate at efficiencies high enough to be screened easily by colony PCR, without the need for selectable markers. Targetrons have found wide application in microbiological research, enabling gene targeting and genetic engineering of bacteria that had been intractable to other methods. Recently, a thermostable targetron has been developed for use in bacterial thermophiles, and new methods have been developed for using targetrons to position recombinase recognition sites, enabling large-scale genome-editing operations, such as deletions, inversions, insertions, and 'cut-and-pastes' (that is, translocation of large DNA segments), in a wide range of bacteria at high efficiency. Using targetrons in eukaryotes presents challenges due to the difficulties of nuclear localization and sub-optimal magnesium concentrations, although supplementation with magnesium can increase integration efficiency, and directed evolution is being employed to overcome these barriers. Finally, spurred by new methods for expressing group II intron reverse transcriptases that yield large amounts of highly active protein, thermostable group II intron reverse transcriptases from bacterial thermophiles are being used as research tools for a variety of applications, including qRT-PCR and next-generation RNA sequencing (RNA-seq). The high processivity and fidelity of group II intron reverse transcriptases along with their novel template-switching activity, which can directly link RNA-seq adaptor sequences to cDNAs during reverse transcription, open new approaches for RNA-seq and the identification and profiling of non-coding RNAs, with potentially wide applications in research and biotechnology.

Population-wide sampling of retrotransposon insertion polymorphisms using deep sequencing and efficient detection.

PubMed

Yu, Qichao; Zhang, Wei; Zhang, Xiaolong; Zeng, Yongli; Wang, Yeming; Wang, Yanhui; Xu, Liqin; Huang, Xiaoyun; Li, Nannan; Zhou, Xinlan; Lu, Jie; Guo, Xiaosen; Li, Guibo; Hou, Yong; Liu, Shiping; Li, Bo

2017-09-01

Active retrotransposons play important roles during evolution and continue to shape our genomes today, especially in genetic polymorphisms underlying a diverse set of diseases. However, studies of human retrotransposon insertion polymorphisms (RIPs) based on whole-genome deep sequencing at the population level have not been sufficiently undertaken, despite the obvious need for a thorough characterization of RIPs in the general population. Herein, we present a novel and efficient computational tool called Specific Insertions Detector (SID) for the detection of non-reference RIPs. We demonstrate that SID is suitable for high-depth whole-genome sequencing data using paired-end reads obtained from simulated and real datasets. We construct a comprehensive RIP database using a large population of 90 Han Chinese individuals with a mean ×68 depth per individual. In total, we identify 9342 recent RIPs, and 8433 of these RIPs are novel compared with dbRIP, including 5826 Alu, 2169 long interspersed nuclear element 1 (L1), 383 SVA, and 55 long terminal repeats. Among the 9342 RIPs, 4828 were located in gene regions and 5 were located in protein-coding regions. We demonstrate that RIPs can, in principle, be an informative resource to perform population evolution and phylogenetic analyses. Taking the demographic effects into account, we identify a weak negative selection on SVA and L1 but an approximately neutral selection for Alu elements based on the frequency spectrum of RIPs. SID is a powerful open-source program for the detection of non-reference RIPs. We built a non-reference RIP dataset that greatly enhanced the diversity of RIPs detected in the general population, and it should be invaluable to researchers interested in many aspects of human evolution, genetics, and disease. As a proof of concept, we demonstrate that the RIPs can be used as biomarkers in a similar way as single nucleotide polymorphisms. © The Authors 2017. Published by Oxford University Press.

Morphological and molecular evidence supporting an arbutoid mycorrhizal relationship in the Costa Rican páramo.

PubMed

Osmundson, Todd W; Halling, Roy E; den Bakker, Henk C

2007-05-01

This study examines evidence for a particular arbutoid mycorrhizal interaction in páramo, a high-altitude neotropical ecosystem important in hydrological regulation but poorly known in terms of its fungal communities. Comarostaphylis arbutoides Lindley (Ericaceae) often forms dense thickets in Central American páramo habitats. Based on phylogenetic classification, it has been suggested that C. arbutoides forms arbutoid mycorrhizae with diverse Basidiomycetes and Ascomycetes; however, this assumption has not previously been confirmed. Based on field data, we hypothesized an arbutoid mycorrhizal association between C. arbutoides and the recently described bolete Leccinum monticola Halling & G.M. Mueller; in this study, we applied a rigorous approach using anatomical and molecular data to examine evidence for such an association. We examined root samples collected beneath L. monticola basidiomes for mycorrhizal structures, and we also compared rDNA internal transcribed spacer (ITS) sequences between mycorrhizal root tips and leaf or basidiome material of the suspected symbionts. Root cross sections showed a thin hyphal sheath and intracellular hyphal coils typical of arbutoid mycorrhizae. DNA sequence comparisons confirmed the identity of C. arbutoides and L. monticola as the mycorrhizal symbionts. In addition, this paper provides additional evidence for the widespread presence of minisatellite-like inserts in the ITS1 spacer in Leccinum species (including a characterization of the insert in L. monticola) and reports the use of an angiosperm-specific ITS primer pair useful for amplifying plant DNA from mycorrhizal roots without co-amplifying fungal DNA.

Feasibility study using a Ni-Ti stent and electronic portal imaging to localize the prostate during radiotherapy.

PubMed

Carl, Jesper; Lund, Bente; Larsen, Erik Hoejkjaer; Nielsen, Jane

2006-02-01

A new method for localization of the prostate during external beam radiotherapy is presented. The method is based on insertion of a thermo-expandable Ni-Ti stent. The stent is originally developed for treatment of bladder outlet obstruction caused by benign hyperplasia. The radiological properties of the stent are used for precise prostate localization during treatment using electronic portal images. Patients referred for intended curative radiotherapy and having a length of their prostatic urethra in the range from 25 to 65 mm were included. Pairs of isocentric orthogonal portal images were used to determine the 3D position at eight different treatment sessions for each patient. Fourteen patients were enrolled in the study. The data obtained demonstrated that the stent position was representative of the prostate location. The stent may also improve delineation of the prostate GTV, and prevent obstruction of bladder outlet during treatment. Precision in localization of the stent was less than 1 mm. Random errors in stent position were left-right 1.6 mm, cranial-caudal 2.2 mm and anterior-posterior 3.2 mm. In four of 14 patients a dislocation of the stent to the bladder occurred. Dislocation only occurred in patients with length of prostatic urethra less than 40 mm. A new method for radiological high precision localization of the prostate during radiotherapy is presented. The method is based on insertion of a standard Ni-Ti thermo-expandable stent, designed for treatment of benign prostate hyperplasia.

Strategies to prepare and use functionalized organometallic reagents.

PubMed

Klatt, Thomas; Markiewicz, John T; Sämann, Christoph; Knochel, Paul

2014-05-16

Polyfunctional zinc and magnesium organometallic reagents occupy a central position in organic synthesis. Most organic functional groups are tolerated by zinc organometallic reagents, and Csp(2)-centered magnesium organometallic reagents are compatible with important functional groups, such as the ester, aryl ketone, nitro, cyano, and amide functions. This excellent chemoselectivity gives zinc- and magnesium-organometallic reagents a central position in modern organic synthesis. Efficient and general preparations of these organometallic reagents, as well as their most practical and useful reactions, are presented in this Perspective. As starting materials, a broad range of organic halides (iodides, bromides, and also to some extent chlorides) can be used for the direct insertion of magnesium or zinc powder; the presence of LiCl very efficiently promotes such insertions. Alternatively, aromatic or heterocyclic bromides also undergo a smooth bromine-magnesium exchange when treated with i-PrMgCl·LiCl. Alternative precursors of zinc and magnesium reagents are polyfunctionalized aryl and heteroaryl molecules, which undergo directed metalations with sterically hindered TMP bases (TMP = 2,2,6,6-tetramethylpiperide) of magnesium and zinc. This powerful C-H functionalization method gives access to polyfunctional heterocyclic zinc and magnesium reagents, which undergo efficient reactions with numerous electrophiles. The compatibility of the strong TMP-bases with BF3·OEt2 (formation of frustrated Lewis pairs) dramatically increases the scope of these metalations, giving for example, a practical access to magnesiated pyridines and pyrazines, which can be used as convenient building blocks for the preparation of biologically active molecules.

Use of simulation-based education to reduce catheter-related bloodstream infections.

PubMed

Barsuk, Jeffrey H; Cohen, Elaine R; Feinglass, Joe; McGaghie, William C; Wayne, Diane B

2009-08-10

Simulation-based education improves procedural competence in central venous catheter (CVC) insertion. The effect of simulation-based education in CVC insertion on the incidence of catheter-related bloodstream infection (CRBSI) is unknown. The aim of this study was to determine if simulation-based training in CVC insertion reduces CRBSI. This was an observational education cohort study set in an adult intensive care unit (ICU) in an urban teaching hospital. Ninety-two internal medicine and emergency medicine residents completed a simulation-based mastery learning program in CVC insertion skills. Rates of CRBSI from CVCs inserted by residents in the ICU before and after the simulation-based educational intervention were compared over a 32-month period. There were fewer CRBSIs after the simulator-trained residents entered the intervention ICU (0.50 infections per 1000 catheter-days) compared with both the same unit prior to the intervention (3.20 per 1000 catheter-days) (P = .001) and with another ICU in the same hospital throughout the study period (5.03 per 1000 catheter-days) (P = .001). An educational intervention in CVC insertion significantly improved patient outcomes. Simulation-based education is a valuable adjunct in residency education.

Multi-function magnetic jack control drive mechanism

DOEpatents

Bollinger, L.R.; Crawford, D.C.

1983-10-06

A multi-function magnetic jack control drive mechanism for controlling a nuclear reactor is provided. The mechanism includes an elongate pressure housing in which a plurality of closely spaced drive rods are located. Each drive rod is connected to a rod which is insertable in the reactor core. An electromechanical stationary latch device is provided which is actuatable to hold each drive rod stationary with respect to the pressure housing. An electromechanical movable latch device is also provided for each one of the drive rods. Each movable latch device is provided with a base and is actuatable to hold a respective drive rod stationary with respect to the base. An electromechanical lift device is further provided for each base which is actuatable for moving a respective base longitudinally along the pressure housing. In this manner, one or more drive rods can be moved in the pressure housing by sequentially and repetitively operating the electromechanical devices. Preferably, each latch device includes a pair of opposed latches which grip teeth located on the respective drive rod. Two, three, or four drive rods can be located symmetrically about the longitudinal axis of the pressure housing.

Multi-function magnetic jack control drive mechanism

DOEpatents

Bollinger, Lawrence R.; Crawford, Donald C.

1986-01-01

A multi-function magnetic jack control drive mechanism for controlling a nuclear reactor is provided. The mechanism includes an elongate pressure housing in which a plurality of closely spaced drive rods are located. Each drive rod is connected to a rod which is insertable in the reactor core. An electromechanical stationary latch device is provided which is actuatable to hold each drive rod stationary with respect to the pressure housing. An electromechanical movable latch device is also provided for each one of the drive rods. Each movable latch device is provided with a base and is actuatable to hold a respective drive rod stationary with respect to the base. An electromechanical lift device is further provided for each base which is actuatable for moving a respective base longitudinally along the pressure housing. In this manner, one or more drive rods can be moved in the pressure housing by sequentially and repetitively operating the electromechanical devices. Preferably, each latch device includes a pair of opposed latches which grip teeth located on the respective drive rod. Two, three, or four drive rods can be located symmetrically about the longitudinal axis of the pressure housing.

How Y-Family DNA polymerase IV is more accurate than Dpo4 at dCTP insertion opposite an N2-dG adduct of benzo[a]pyrene.

PubMed

Sholder, Gabriel; Creech, Amanda; Loechler, Edward L

2015-11-01

To bypass DNA damage, cells have Y-Family DNA polymerases (DNAPs). One Y-Family-class includes DNAP κ and DNAP IV, which accurately insert dCTP opposite N(2)-dG adducts, including from the carcinogen benzo[a]pyrene (BP). Another class includes DNAP η and DNAP V, which insert accurately opposite UV-damage, but inaccurately opposite BP-N(2)-dG. To investigate structural differences between Y-Family-classes, regions are swapped between DNAP IV (a κ/IV-class-member) and Dpo4 (a η/V-class-member); the kinetic consequences are evaluated via primer-extension studies with a BP-N(2)-dG-containing template. Four key structural elements are revealed. (1) Y-Family DNAPs have discreet non-covalent contacts between their little finger-domain (LF-Domain) and their catalytic core-domain (CC-Domain), which we call "non-covalent bridges" (NCBs). Arg37 and Arg38 in DNAP IV's CC-Domain near the active site form a non-covalent bridge (AS-NCB) by interacting with Glu251 and Asp252, respectively, in DNAP IV's LF-Domain. Without these interactions dATP/dGTP/dTTP misinsertions increase. DNAP IV's AS-NCB suppresses misinsertions better than Dpo4's equivalent AS-NCB. (2) DNAP IV also suppresses dATP/dGTP/dTTP misinsertions via a second non-covalent bridge, which is ∼8Å from the active site (Distal-NCB). Dpo4 has no Distal-NCB, rendering it inferior at dATP/dGTP/dTTP suppression. (3) dCTP insertion is facilitated by the larger minor groove opening near the active site in DNAP IV versus Dpo4, which is sensible given that Watson/Crick-like [dCTP:BP-N(2)-dG] pairing requires the BP-moiety to be in the minor groove. (4) Compared to Dpo4, DNAP IV has a smaller major groove opening, which suppresses dGTP misinsertion, implying BP-N(2)-dG bulk in the major groove during Hoogsteen syn-adduct-dG:dGTP pairing. In summary, DNAP IV has a large minor groove opening to enhance dCTP insertion, a plugged major groove opening to suppress dGTP misinsertion, and two non-covalent bridges (near and distal to the active site) to suppress dATP/dGTP/dTTP misinsertions; collectively these four structural features enhance DNAP IV's dNTP insertion fidelity opposite a BP-N(2)-dG adduct compared to Dpo4. Copyright © 2015 Elsevier B.V. All rights reserved.

Regional pressure and temperature variations across the injured human brain: comparisons between paired intraparenchymal and ventricular measurements.

PubMed

Childs, Charmaine; Shen, Liang

2015-06-23

Intraparenchymal, multimodality sensors are commonly used in the management of patients with severe traumatic brain injury (TBI). The 'gold standard', based on accuracy, reliability and cost for intracranial pressure (ICP) monitoring is within the cerebral ventricle (external strain gauge). There are no standards yet for intracerebral temperature monitoring and little is known of temperature differences between brain tissue and ventricle. The aim of the study therefore was to determine pressure and temperature differences at intraparenchymal and ventricular sites during five days of continuous neuromonitoring. Patients with severe TBI requiring emergency surgery. patients who required ICP monitoring were eligible for recruitment. Two intracerebral probe types were used: a) intraventricular, dual parameter sensor (measuring pressure, temperature) with inbuilt catheter for CSF drainage: b) multiparameter intraparenchymal sensor measuring pressure, temperature and oxygen partial pressure. All sensors were inserted during surgery and under aseptic conditions. Seventeen patients, 12 undergoing neurosurgery (decompressive craniectomy n = 8, craniotomy n = 4) aged 21-78 years were studied. Agreement of measures for 9540 brain tissue-ventricular temperature 'pairs' and 10,291 brain tissue-ventricular pressure 'pairs' were determined using mixed model to compare mean temperature and pressure for longitudinal data. There was no significant overall difference for mean temperature (p = 0.92) or mean pressure readings (p = 0.379) between tissue and ventricular sites. With 95.8 % of paired temperature readings within 2SD (-0.4 to 0.4 °C) differences in temperature between brain tissue and ventricle were clinically insignificant. For pressure, 93.5 % of readings pairs fell within the 2SD range (-9.4756 to 7.8112 mmHg). However, for individual patients, agreement for mean tissue-ventricular pressure differences was poor on occasions. There is good overall agreement between paired temperature measurements obtained from deep white matter and brain ventricle in patients with and without early neurosurgery. For paired ICP measurements, 93.5 % of readings were within 2SD of mean difference. Whilst the majority of paired readings were comparable (within 10 mmHg) clinically relevant tissue-ventricular dissociations were noted. Further work is required to unravel the events responsible for short intervals of pressure dissociation before tissue pressure readings can be definitively accepted as a reliable surrogate for ventricular pressure.

A deficiency screen of the major autosomes identifies a gene (matrimony) that is haplo-insufficient for achiasmate segregation in Drosophila oocytes.

PubMed Central

Harris, David; Orme, Charisse; Kramer, Joseph; Namba, Luria; Champion, Mia; Palladino, Michael J; Natzle, Jeanette; Hawley, R Scott

2003-01-01

In Drosophila oocytes, euchromatic homolog-homolog associations are released at the end of pachytene, while heterochromatic pairings persist until metaphase I. A screen of 123 autosomal deficiencies for dominant effects on achiasmate chromosome segregation has identified a single gene that is haplo-insufficient for homologous achiasmate segregation and whose product may be required for the maintenance of such heterochromatic pairings. Of the deficiencies tested, only one exhibited a strong dominant effect on achiasmate segregation, inducing both X and fourth chromosome nondisjunction in FM7/X females. Five overlapping deficiencies showed a similar dominant effect on achiasmate chromosome disjunction and mapped the haplo-insufficient meiotic gene to a small interval within 66C7-12. A P-element insertion mutation in this interval exhibits a similar dominant effect on achiasmate segregation, inducing both high levels of X and fourth chromosome nondisjunction in FM7/X females and high levels of fourth chromosome nondisjunction in X/X females. The insertion site for this P element lies immediately upstream of CG18543, and germline expression of a UAS-CG18543 cDNA construct driven by nanos-GAL4 fully rescues the dominant meiotic defect. We conclude that CG18543 is the haplo-insufficient gene and have renamed this gene matrimony (mtrm). Cytological studies of prometaphase and metaphase I in mtrm hemizygotes demonstrate that achiasmate chromosomes are not properly positioned with respect to their homolog on the meiotic spindle. One possible, albeit speculative, interpretation of these data is that the presence of only a single copy of mtrm disrupts the function of whatever "glue" holds heterochromatically paired homologs together from the end of pachytene until metaphase I. PMID:14573476

NASA's What's Up Astronomy and Mission video series celebrates the Year of the Solar System: Fall 2010 - late summer 2012

NASA Astrophysics Data System (ADS)

Houston Jones, J.; Alice Wessen, Manager Of Solar System Eduction; Public Engagement

2010-12-01

NASA's What's Up video podcast supports the Year of the Solar System (YSS) October 2010 - August 2012. During YSS each podcast pairs a popular night sky viewing target (Moon, Comet, Planets, solar system features) with a mission event (launch, flyby, orbit insertion, landing). This product has proven popular with public, formal and informal audiences and will compliment and augment other programming material.

Cryogenic expansion machine

DOEpatents

Pallaver, Carl B.; Morgan, Michael W.

1978-01-01

A cryogenic expansion engine includes intake and exhaust poppet valves each controlled by a cam having adjustable dwell, the valve seats for the valves being threaded inserts in the valve block. Each cam includes a cam base and a ring-shaped cam insert disposed at an exterior corner of the cam base, the cam base and cam insert being generally circular but including an enlarged cam dwell, the circumferential configuration of the cam base and cam dwell being identical, the cam insert being rotatable with respect to the cam base. GI CONTRACTUAL ORIGIN OF THE INVENTION The invention described herein was made in the course of, or under, a contract with the UNITED STATES ENERGY RESEARCH AND DEVELOPMENT ADMINISTRATION.

Integrated electrical connector

DOEpatents

Benett, William J.; Ackler, Harold D.

2005-05-24

An electrical connector is formed from a sheet of electrically conductive material that lies in between the two layers of nonconducting material that comprise the casing of an electrical chip. The connector is electrically connected to an electrical element embedded within the chip. An opening in the sheet is concentrically aligned with a pair of larger holes respectively bored through the nonconducting layers. The opening is also smaller than the diameter of an electrically conductive contact pin. However, the sheet is composed flexible material so that the opening adapts to the diameter of the pin when the pin is inserted therethrough. The periphery of the opening applies force to the sides of the pin when the pin is inserted, and thus holds the pin within the opening and in contact with the sheet, by friction. The pin can be withdrawn from the connector by applying sufficient axial force.

Hydrodynamic optimality of balistiform and gymnotiform locomotion

NASA Astrophysics Data System (ADS)

Sprinkle, Brennan; Bale, Rahul; Bhalla, Amneet Pal Singh; MacIver, Malcolm A.; Patankar, Neelesh A.

2017-03-01

Some groups of fish have evolved to generate propulsion using undulatory elongated fins while maintaining a relatively rigid body. The fins run along the body axis and can be dorsal, ventral, dorsoventral pairs or left-right pairs. These fish are termed as median/paired fin (MPF) swimmers. The movement of these groups of fish was studied in an influential series of papers by Lighthill and Blake. In this work, we revisit this problem by performing direct numerical simulations. We interrogate two issues. First, we investigate and explain a key morphological feature, which is the diagonal fin insertion found in many MPF swimmers such as the knifefish. Not only are these results of biological relevance, but these are also useful in engineering to design bioinspired highly maneuverable underwater vehicles. Second, we investigate whether there is a mechanical advantage in the form of reduced cost of transport (COT) (energy spent per unit distance traveled) for not undulating the entire body. We find that a rigid body attached to an undulating fin leads to a reduced COT.

Biological activity of N(4)-boronated derivatives of 2'-deoxycytidine, potential agents for boron-neutron capture therapy.

PubMed

Nizioł, Joanna; Uram, Łukasz; Szuster, Magdalena; Sekuła, Justyna; Ruman, Tomasz

2015-10-01

Boron-neutron capture therapy (BNCT) is a binary anticancer therapy that requires boron compound for nuclear reaction during which high energy alpha particles and lithium nuclei are formed. Unnatural, boron-containing nucleoside with hydrophobic pinacol moiety was investigated as a potential BNCT boron delivery agent. Biological properties of this compound are presented for the first time and prove that boron nucleoside has low cytotoxicity and that observed apoptotic effects suggest alteration of important functions of cancer cells. Mass spectrometry analysis of DNA from cancer cells proved that boron nucleoside is inserted into nucleic acids as a functional nucleotide derivative. NMR studies present very high degree of similarity of natural dG-dC base pair with dG-boron nucleoside system. Copyright © 2015 Elsevier Ltd. All rights reserved.

Precise Maps of RNA Polymerase Reveal How Promoters Direct Initiation and Pausing

PubMed Central

Kwak, Hojoong; Fuda, Nicholas J.; Core, Leighton J.; Lis, John T.

2014-01-01

Transcription regulation occurs frequently through promoter-associated pausing of RNA polymerase II (Pol II). We developed a Precision nuclear Run-On and sequencing assay (PRO-seq) to map the genome-wide distribution of transcriptionally-engaged Pol II at base-pair resolution. Pol II accumulates immediately downstream of promoters, at intron-exon junctions that are efficiently used for splicing, and over 3' poly-adenylation sites. Focused analyses of promoters reveal that pausing is not fixed relative to initiation sites nor is it specified directly by the position of a particular core promoter element or the first nucleosome. Core promoter elements function beyond initiation, and when optimally positioned they act collectively to dictate the position and strength of pausing. We test this ‘Complex Interaction’ model with insertional mutagenesis of the Drosophila Hsp70 core promoter. PMID:23430654

Understanding the effect of locked nucleic acid and 2'-O-methyl modification on the hybridization thermodynamics of a miRNA-mRNA pair in the presence and absence of AfPiwi protein.

PubMed

Kumar, Santosh; Mapa, Koyeli; Maiti, Souvik

2014-03-18

miRNAs are some of the key epigenetic regulators of gene expression. They act through hybridization with their target mRNA and modulate the level of respective proteins via different mechanisms. Various cancer conditions are known to be associated with up- and downregulation of the oncogenic and tumor suppressor miRNAs, respectively. The levels of aberrantly expressed oncogenic miRNAs can be downregulated in different ways. Similarly, restoration of tumor suppressor miRNAs to their normal levels can be achieved using miRNA mimics. However, the use of miRNA mimics is limited by their reduced biostability and function. We have studied the hybridization thermodynamics of the miRNA 26a (11-mer, including the seed sequence) guide strand with the mRNA (11-mer) target strand in the absence and presence of AfPiwi protein. We have also inserted locked nucleic acids (LNAs) and 2'-O-methyl-modified nucleotides into the guide strand, in a walk-through manner, to assess their effect on the binding efficiency between guide and target RNA. Insertion of LNA and 2'-O-methyl-modified nucleotides into the guide strand helped to strengthen the binding affinity irrespective of the position of insertion. However, in the presence of AfPiwi protein, these modifications reduced the binding affinity to different extents depending on the position of insertion. Insertion of a modification leads to an increase in the enthalpic contribution with an increased unfavorable entropic contribution, which negatively compensates for the higher favorable enthalpy.

Using Comprehensive Video-Module Instruction as an Alternative Approach for Teaching IUD Insertion.

PubMed

Garcia-Rodriguez, Juan Antonio; Donnon, Tyrone

2016-01-01

Family medicine clinicians and residents have increasing educational and work demands that have made it difficult to provide and access training on specific procedures such as IUD insertion. The purpose of this study was to determine whether the use of video-module instruction could provide residents with the necessary knowledge and skills to perform an IUD insertion correctly when compared with the traditional form of instruction, which is a lecture-demonstration session provided by an academic gynecologist. Thirty-nine family medicine residents participated in the study during the induction period at the beginning of their residency program in July 2012 at the University of Calgary. A randomized, two group pretest/posttest experimental research design was used to compare the procedural knowledge and skills performance (posttest only) of residents trained using an alternative instructional intervention (video-module teaching) with the traditional lecture-demonstration approach to teaching IUD insertion. Both teaching methods were effective in providing procedural knowledge instruction, and the paired-samples t tests results were almost identical: t (37)=1.35. On the other hand, performance scores were significantly higher in the video-module group: t (37)=2.37, 95% CI (0.61, 8.00), with a mean difference in performance of 4.31. There were no significant differences in residents' satisfaction scores, and there was no correlation between the different scores and sex or age or between performance and level of satisfaction. This video-module instruction is an effective method to provide comprehensive IUD insertion training, and the psychomotor skills gain (performance component) was significantly higher than the traditional method of instruction.

Risk-based screening for Chlamydia trachomatis and Neisseria gonorrhoeae prior to intrauterine device insertion.

PubMed

Grentzer, Jaclyn M; Peipert, Jeffrey F; Zhao, Qiuhong; McNicholas, Colleen; Secura, Gina M; Madden, Tessa

2015-10-01

The objective was to compare three strategies for Chlamydia trachomatis and Neisseria gonorrhoeae screening prior to intrauterine device (IUD) insertion. This was a secondary analysis of the Contraceptive CHOICE Project. We measured the prevalence of C. trachomatis and/or N. gonorrhoeae at the time of IUD insertion. We then compared sensitivity, specificity, negative and positive predictive values, and likelihood ratios for three screening strategies for C. trachomatis and N. gonorrhoeae prior to IUD insertion: (a) "age-based" — age ≤25 years alone; (b) "age/partner-based" — age ≤25 and/or multiple sexual partners; and (c) "risk-based" — age ≤25, multiple sexual partners, inconsistent condom use and/or history of prior sexually transmitted infection (STI). Among 5087 IUD users, 140 (2.8%) tested positive for C. trachomatis, 16 (0.3%) tested positive for N. gonorrhoeae, and 6 (0.1%) were positive for both at the time of IUD insertion. The "risk-based" screening strategy had the highest sensitivity (99.3%) compared to "age-based" and "age/partner-based" screening (80.7% and 84.7%, respectively.) Only one (0.7%) woman with a chlamydia or gonorrhea infection would not have been screened using "risk-based" screening. A risk-based strategy to screen for C. trachomatis and N. gonorrhoeae prior to IUD insertion has higher sensitivity than screening based on age alone or age and multiple sexual partners. Using a risk-based screening strategy (age≤25, multiple sexual partners, inconsistent condom use and/or history of an STI) to determine who should be screened for C. trachomatis and N. gonorrhoeae prior to IUD insertion will miss very few cases of infection and obviates the need for universal screening. Copyright © 2015 Elsevier Inc. All rights reserved.

SU-G-IeP2-15: Virtual Insertion of Digital Kidney Stones Into Dual-Source, Dual- Energy CT Projection Data

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ferrero, A; Chen, B; Huang, A

Purpose: In order to investigate novel methods to more accurately estimate the mineral composition of kidney stones using dual energy CT, it is desirable to be able to combine digital stones of known composition with actual phantom and patient scan data. In this work, we developed and validated a method to insert digital kidney stones into projection data acquired on a dual-source, dual-energy CT system. Methods: Attenuation properties of stones of different mineral composition were computed using tabulated mass attenuation coefficients, the chemical formula for each stone type, and the effective beam energy at each evaluated tube potential. A previouslymore » developed method to insert lesions into x-ray CT projection data was extended to include simultaneous dual-energy CT projections acquired on a dual-source gantry (Siemens Somatom Flash). Digital stones were forward projected onto both detectors and the resulting projections added to the physically acquired sinogram data. To validate the accuracy of the technique, digital stones were inserted into different locations in the ACR CT accreditation phantom; low and high contrast resolution, CT number accuracy and noise properties were compared before and after stone insertion. The procedure was repeated for two dual-energy tube potential pairs in clinical use on the scanner, 80/Sn140 kV and 100/Sn140 kV, respectively. Results: The images reconstructed after the insertion of digital kidney stones were consistent with the images reconstructed from the scanner. The largest average CT number difference for the 4 insert in the CT number accuracy module of the phantom was 3 HU. Conclusion: A framework was developed and validated for the creation of digital kidney stones of known mineral composition, and their projection-domain insertion into commercial dual-source, dual-energy CT projection data. This will allow a systematic investigation of the impact of scan and reconstruction parameters on stone attenuation and dual-energy behavior under rigorously controlled conditions. Dr. McCollough receives research support from Siemens Healthcare.« less

Are insertion torque and early osseointegration proportional? A histologic evaluation.

PubMed

Campos, Felipe E B; Jimbo, Ryo; Bonfante, Estevam A; Barbosa, Darceny Z; Oliveira, Maiolino T F; Janal, Malvin N; Coelho, Paulo G

2015-11-01

The objective of this histologic study was to determine the effect of three drilling protocols (oversized, intermediate, and undersized) on biologic responses to a single implant type at early healing periods (2 weeks in vivo) in a beagle dog model. Ten beagle dogs were acquired and subjected to surgeries in the tibia 2 weeks before euthanasia. During surgery, each dog received three Unitite implants, 4 mm in diameter by 10 mm in length, in bone sites drilled to 3.5, 3.75, and 4.0 mm in final diameter. The insertion torque was recorded during surgery, and bone-to-implant contact (BIC), and bone area fraction occupied (BAFO) measured from the histology. Each outcome measure was compared between treatment conditions with the Wilcoxon signed-rank test. Bonferroni-corrected statistical significance was set to 95%. Insertion torque increased as an inverse function of drilling diameter, as indicated by significant differences in torque levels between each pair of conditions (P = 0.005). BIC and BAFO levels were highest and statistically similar in the recommended and undersized conditions and significantly reduced in the oversized condition (P < 0.01). Reduced drilling dimensions resulted in increased insertion torque (primary stability). While BIC and BAFO were maximized when drilling the recommended diameter hole, only the oversized hole resulted in evidence of statistically reduced integration. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Yanli; Juranek, Stefan; Li, Haitao

Here we report on a 3.0 {angstrom} crystal structure of a ternary complex of wild-type Thermus thermophilus argonaute bound to a 5'-phosphorylated 21-nucleotide guide DNA and a 20-nucleotide target RNA containing cleavage-preventing mismatches at the 10-11 step. The seed segment (positions 2 to 8) adopts an A-helical-like Watson-Crick paired duplex, with both ends of the guide strand anchored in the complex. An arginine, inserted between guide-strand bases 10 and 11 in the binary complex, locking it in an inactive conformation, is released on ternary complex formation. The nucleic-acid-binding channel between the PAZ- and PIWI-containing lobes of argonaute widens on formationmore » of a more open ternary complex. The relationship of structure to function was established by determining cleavage activity of ternary complexes containing position-dependent base mismatch, bulge and 2'-O-methyl modifications. Consistent with the geometry of the ternary complex, bulges residing in the seed segments of the target, but not the guide strand, were better accommodated and their complexes were catalytically active.« less

Evolution-based Virtual Content Insertion with Visually Virtual Interactions in Videos

NASA Astrophysics Data System (ADS)

Chang, Chia-Hu; Wu, Ja-Ling

With the development of content-based multimedia analysis, virtual content insertion has been widely used and studied for video enrichment and multimedia advertising. However, how to automatically insert a user-selected virtual content into personal videos in a less-intrusive manner, with an attractive representation, is a challenging problem. In this chapter, we present an evolution-based virtual content insertion system which can insert virtual contents into videos with evolved animations according to predefined behaviors emulating the characteristics of evolutionary biology. The videos are considered not only as carriers of message conveyed by the virtual content but also as the environment in which the lifelike virtual contents live. Thus, the inserted virtual content will be affected by the videos to trigger a series of artificial evolutions and evolve its appearances and behaviors while interacting with video contents. By inserting virtual contents into videos through the system, users can easily create entertaining storylines and turn their personal videos into visually appealing ones. In addition, it would bring a new opportunity to increase the advertising revenue for video assets of the media industry and online video-sharing websites.

First Blindness Cases of Horses Infected with Setaria Digitata (Nematoda: Filarioidea) in the Republic of Korea.

PubMed

Shin, Jihun; Ahn, Kyu-Sung; Suh, Guk-Hyun; Kim, Ha-Jung; Jeong, Hak-Sub; Kim, Byung-Su; Choi, Eunsang; Shin, Sung-Shik

2017-12-01

Ocular setariases of cattle were reported but those of equine hosts have never been reported in the Republic of Korea (Korea). We found motile worms in the aqueous humor of 15 horses (Equus spp.) from 12 localities in southern parts of Korea between January 2004 and November 2017. After the affected animals were properly restrained under sedation and local anesthesia, 10 ml disposable syringe with a 16-gauge needle was inserted into the anterior chamber of the affected eye to successfully remove the parasites. The male worm that was found in 7 of the cases showed a pair of lateral appendages near the posterior terminal end of the body. The papillar arrangement was 3 pairs of precloacal, a pair of adcloacal, and 3 pairs of postcloacal papillae, plus a central papilla just in front of the cloaca. The female worms found in the eyes of 8 horses were characterized by the tapering posterior terminal end of the body with a smooth knob. Worms were all identified as Setaria digitata (von Linstow, 1906) by the morphologic characteristics using light and electron microscopic observations. This is the first blindness cases of 15 horses infected with S. digitata (Nematoda: Filarioidea) in Korea.

Type 2 diabetes susceptibility genes on chromosome 1q21-24.

PubMed

Hasstedt, S J; Chu, W S; Das, S K; Wang, H; Elbein, S C

2008-03-01

Type 2 diabetes (T2D) has been linked to chromosome 1q21-24 in multiple samples, including a Utah family sample. Variants in 13 of the numerous candidate genes in the 1q region were tested for association with T2D in a Utah case-control sample. The most promising, 19 variants in 6 candidates, were genotyped on the Utah family sample. Herein, we tested the 19 variants individually and in pairs for an effect on T2D risk in family members using a logistic regression model that accounted for gender, age, and BMI and attributed residual genetic effects to a polygenic component. Seven variants increased risk significantly through 5 pairs of interactions. The significant variant pairs were apolipoprotein A-II (APOA2) rs6413453 interacting with calsequestrin 1 (CASQ1) rs617698, dual specificity phosphatase 12 (DUSP12) rs1503814, and retinoid X receptor gamma (RXRG) rs10918169, a poly-T insertion-deletion polymorphism in liver pyruvate kinase (PKLR) interacting with APOA2 rs12143180, and DUSP12 rs1027702 interacting with RXRG rs10918169. Genotypes of these 5 variant pairs accounted for 25.8% of the genetic variance in T2D in these pedigrees.

A Bridging Water Anchors the Tethered 5-(3-Aminopropyl)-2′-deoxyuridine Amine in the DNA Major Groove Proximate to the N+2 C·G Base Pair: Implications for Formation of Interstrand 5′-GNC-3′ Cross-Links by Nitrogen Mustards

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Feng; Li, Feng; Ganguly, Manjori

2008-11-14

Site-specific insertion of t-(3-aminopropyl)-2'-deoxyuridine (Z3dU) and 7-deaza-dG into the Dickerson-Drew dodecamers 5'-d(C{sup 1}G{sup 2}C{sup 3}G{sup 4}A{sup 5}A{sup 6}T{sup 7}T{sup 8}C{sup 9}{und Z}{sup 10}C{sup 11}G{sup 12})-3'{center_dot}5'-d (C{sup 13}G{sup 14}C{sup 15}G{sup 16}A{sup 17}A{sup 18}T{sup 19}T{sup 20}C{sup 21}{und Z}{sup 22}C{sup 23}G{sup 24})-3' (named DDD{sup Z10}) and 5'-d(C{sup 1}G{sup 2}C{sup 3}G{sup 4}A{sup 5}A{sup 6}T{sup 7}{und X}{sup 20}C{sup 21}{und Z}{sup 22}C{sup 23}G{sup 24})-3' (named DDD{sup 2+Z10}) (X = 73dU; Z = 7-deaza-dG) suggests a mechanism underlying the formation of interstrand N+2 DNA cross-links by nitrogen mustards, e.g., melphalan and mechlorethamine. Analysis of the DDD{sup 2+Z10} duplex reveals that the tethered cations at base pairs A{supmore » 5}{center_dot}X{sup 20} and X{sup 8}{center_dot}A{sup 17} extend within the major groove in the 3'-direction, toward conserved Mg{sup 2+} binding sites located adjacent to N+2 base pairs C{sup 3}{center_dot}Z{sup 22} and Z{sup 10}{center_dot}C{sup 15}. Bridging waters located between the tethered amines and either Z{sup 10} or Z{sup 22} O{sup 6} stabilize the tethered cations and allow interactions with the N + 2 base pairs without DNA bending. Incorporation of 7-deaza-dG into the DDD{sup 2+Z10} duplex weakens but does not eliminate electrostatic interactions between tethered amines and Z{sup 10} O{sup 6} and Z{sup 22} O{sup 6}. The results suggest a mechanism by which tethered N7-dG aziridinium ions, the active species involved in formation of interstrand 5'-GNC-3' cross-links by nitrogen mustards, modify the electrostatics of the major groove and position the aziridinium ions proximate to the major groove edge of the N+2 C{center_dot}G base pair, facilitating interstrand cross-linking.« less

A filtering method to generate high quality short reads using illumina paired-end technology.

PubMed

Eren, A Murat; Vineis, Joseph H; Morrison, Hilary G; Sogin, Mitchell L

2013-01-01

Consensus between independent reads improves the accuracy of genome and transcriptome analyses, however lack of consensus between very similar sequences in metagenomic studies can and often does represent natural variation of biological significance. The common use of machine-assigned quality scores on next generation platforms does not necessarily correlate with accuracy. Here, we describe using the overlap of paired-end, short sequence reads to identify error-prone reads in marker gene analyses and their contribution to spurious OTUs following clustering analysis using QIIME. Our approach can also reduce error in shotgun sequencing data generated from libraries with small, tightly constrained insert sizes. The open-source implementation of this algorithm in Python programming language with user instructions can be obtained from https://github.com/meren/illumina-utils.

Morphological size evaluation of the mid-substance insertion areas and the fan-like extension fibers in the femoral ACL footprint.

PubMed

Suruga, Makoto; Horaguchi, Takashi; Iriuchishima, Takanori; Yahagi, Yoshiyuki; Iwama, Genki; Tokuhashi, Yasuaki; Aizawa, Shin

2017-08-01

The purpose of this study was to evaluate the detailed anatomy of the femoral anterior cruciate ligament (ACL) insertion site, with special attention given to the morphology of the mid-substance insertion areas and the fan-like extension fibers. Twenty-three non-paired human cadaver knees were used (7 Males, 16 Females, median age 83, range 69-96). All soft tissues around the knee were resected except the ligaments. The ACL was divided into antero-medial (AM) and postero-lateral (PL) bundles according to the difference in macroscopic tension patterns. The ACL was carefully dissected and two outlines were made of the periphery of each bundle insertion site: those which included and those which excluded the fan-like extension fibers. An accurate lateral view of the femoral condyle was photographed with a digital camera, and the images were downloaded to a personal computer. The area of each bundle, including and excluding the fan-like extension fibers, was measured with Image J software (National Institution of Health). The width and length of the mid-substance insertion sites were also evaluated using same image. The femoral ACL footprint was divided into four regions (mid-substance insertion sites of the AM and PL bundles, and fan-like extensions of the AM and PL bundles). The measured areas of the mid-substance insertion sites of the AM and PL bundles were 35.5 ± 12.5, and 32.4 ± 13.8 mm 2 , respectively. Whole width and length of the mid-substance insertion sites were 5.3 ± 1.4, and 15.5 ± 2.9 mm, respectively. The measured areas of the fan-like extensions of the AM and PL bundles were 27 ± 11.5, and 29.5 ± 12.4 mm 2 , respectively. The femoral ACL footprint was divided into quarters of approximately equal size (mid-substance insertion sites of the AM and PL bundles, and fan-like extensions of the AM and PL bundles). For clinical relevance, to perform highly reproducible anatomical ACL reconstruction, the presence of the fan-like extension fibers should be taken into consideration.

Mixed Modeling of a SAW Delay Line Using VHDL-AMS

NASA Technical Reports Server (NTRS)

Wilson, William C.; Atkinson, Gary M.

2006-01-01

To aid in the development of SAW sensors for aerospace applications we have created a model of a SAW Delay line using VHDL. The model implements the Impulse Response method to calculate the frequency response, impedance, and insertion loss. The model includes optimization for the number of finger pairs in the IDTs and for the aperture height. This paper presents the model and the results from the model for a SAW delay line design.

Enabling Dynamic Security Management of Networked Systems via Device-Embedded Security (Self-Securing Devices)

DTIC Science & Technology

2007-01-15

it can detect specifically proscribed content changes to critical files (e.g., illegal shells inserted into /etc/ passwd ). Fourth, it can detect the...UNIX password management involves a pair of inter-related files (/etc/ passwd and /etc/shadow). The corresponding access patterns seen at the storage...content integrity verification is utilized. As a concrete example, consider a UNIX system password file (/etc/ passwd ), which consists of a set of well

Binding modes and pathway of RHPS4 to human telomeric G-quadruplex and duplex DNA probed by all-atom molecular dynamics simulations with explicit solvent.

PubMed

Mulholland, Kelly; Siddiquei, Farzana; Wu, Chun

2017-07-19

RHPS4, a potent binder to human telomeric DNA G-quadruplex, shows high efficacy in tumor cell growth inhibition. However, it's preferential binding to DNA G-quadruplex over DNA duplex (about 10 fold) remains to be improved toward its clinical application. A high resolution structure of the single-stranded telomeric DNA G-quadruplexes, or B-DNA duplex, in complex with RHPS4 is not available yet, and the binding nature of this ligand to these DNA forms remains to be elusive. In this study, we carried out 40 μs molecular dynamics binding simulations with a free ligand to decipher the binding pathway of RHPS4 to a DNA duplex and three G-quadruplex folders (parallel, antiparallel and hybrid) of the human telomeric DNA sequence. The most stable binding mode identified for the duplex, parallel, antiparallel and hybrid G-quadruplexes is an intercalation, bottom stacking, top intercalation and bottom intercalation mode, respectively. The intercalation mode with similar binding strength to both the duplex and the G-quadruplexes, explains the lack of binding selectivity of RHPS4 to the G-quadruplex form. Therefore, a ligand modification that destabilizes the duplex intercalation mode but stabilizes the G-quadruplex intercalation mode will improve the binding selectivity toward G-quadruplex. The intercalation mode of RHPS4 to both the duplex and the antiparallel and the hybrid G-quadruplex follows a base flipping-insertion mechanism rather than an open-insertion mechanism. The groove binding, the side binding and the intercalation with flipping out of base were observed to be intermediate states before the full intercalation state with paired bases.

Improvement of the insertion axis for cochlear implantation with a robot-based system.

PubMed

Torres, Renato; Kazmitcheff, Guillaume; De Seta, Daniele; Ferrary, Evelyne; Sterkers, Olivier; Nguyen, Yann

2017-02-01

It has previously reported that alignment of the insertion axis along the basal turn of the cochlea was depending on surgeon' experience. In this experimental study, we assessed technological assistances, such as navigation or a robot-based system, to improve the insertion axis during cochlear implantation. A preoperative cone beam CT and a mastoidectomy with a posterior tympanotomy were performed on four temporal bones. The optimal insertion axis was defined as the closest axis to the scala tympani centerline avoiding the facial nerve. A neuronavigation system, a robot assistance prototype, and software allowing a semi-automated alignment of the robot were used to align an insertion tool with an optimal insertion axis. Four procedures were performed and repeated three times in each temporal bone: manual, manual navigation-assisted, robot-based navigation-assisted, and robot-based semi-automated. The angle between the optimal and the insertion tool axis was measured in the four procedures. The error was 8.3° ± 2.82° for the manual procedure (n = 24), 8.6° ± 2.83° for the manual navigation-assisted procedure (n = 24), 5.4° ± 3.91° for the robot-based navigation-assisted procedure (n = 24), and 3.4° ± 1.56° for the robot-based semi-automated procedure (n = 12). A higher accuracy was observed with the semi-automated robot-based technique than manual and manual navigation-assisted (p < 0.01). Combination of a navigation system and a manual insertion does not improve the alignment accuracy due to the lack of friendly user interface. On the contrary, a semi-automated robot-based system reduces both the error and the variability of the alignment with a defined optimal axis.

Molecular and morphological differentiation between the crop and weedy types in velvetleaf (Abutilon theophrasti Medik.) using a chloroplast DNA marker: seed source of the present invasive velvetleaf in Japan.

PubMed

Kurokawa, S; Shibaike, H; Akiyama, H; Yoshimura, Y

2004-12-01

A comparison of chloroplast DNA (cpDNA) sequences was carried out between the crop and weed types of Abutilon theophrasti to clarify the seed source of the present weedy velvetleaf in Japan. A sequencing analysis of approx. 6% of the chloroplast genome (ca 10 kbp) detected three nucleotide substitutions, one six-base-pair insertion/deletion (indel) and one 30-base pair inversion, which distinguish two haplotypes of cpDNA. A PCR-based survey of the indel and the inversion revealed that the 93 accessions of velvetleaf collected from the world could be divided into two groups. A morphological marker (capsule color) could be used to discriminate the crop type and the weed type, and hence, along with cpDNA haplotype, to distinguish three genotypes (Type I, II, and III). All Japanese cultivars and crop accessions from other countries were Type I. Weed types were divided into Type II and III. All of the samples from the USA, and the samples taken from grain imports to Japan were Type III. Since most of the weedy types distributed in Japan were of Type III, it is argued that they were introduced as seeds in the imported grain. We also found that the Type II plants sporadically occurred in Japan. It is suggested that they originated as hybrids, with indigenous cultivars as the maternal ancestor. Such hybrids must have survived since the cessation of velvetleaf cultivation about a century ago.

OsDMC1 Is Not Required for Homologous Pairing in Rice Meiosis1[OPEN

PubMed Central

Tang, Ding; Liu, Xiaofei; Du, Guijie; Shen, Yi; Li, Yafei; Cheng, Zhukuan

2016-01-01

Meiotic homologous recombination is pivotal to sexual reproduction. DMC1, a conserved recombinase, is involved in directing single-end invasion between interhomologs during meiotic recombination. In this study, we identified OsDMC1A and OsDMC1B, two closely related proteins in rice (Oryza sativa) with high sequence similarity to DMC1 proteins from other species. Analysis of Osdmc1a and Osdmc1b Tos17 insertion mutants indicated that these genes are functionally redundant. Immunolocalization analysis revealed OsDMC1 foci occurred at leptotene, which disappeared from late pachytene chromosomes in wild-type meiocytes. According to cytological analyses, homologous pairing is accomplished in the Osdmc1a Osdmc1b double mutant, but synapsis is seriously disrupted. The reduced number of bivalents and abnormal OsHEI10 foci in Osdmc1a Osdmc1b establishes an essential role for OsDMC1 in crossover formation. In the absence of OsDMC1, early recombination events probably occur normally, leading to normal localization of γH2AX, PAIR3, OsMRE11, OsCOM1, and OsRAD51C. Moreover, OsDMC1 was not detected in pairing-defective mutants, such as pair2, pair3, Oscom1, and Osrad51c, while it was loaded onto meiotic chromosomes in zep1, Osmer3, Oszip4, and Oshei10. Taken together, these results suggest that during meiosis, OsDMC1 is dispensable for homologous pairing in rice, which is quite different from the DMC1 homologs identified so far in other organisms. PMID:26960731

Mechanism of mismatch recognition revealed by human MutS[beta] bound to unpaired DNA loops

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gupta, Shikha; Gellert, Martin; Yang, Wei

2012-04-17

DNA mismatch repair corrects replication errors, thus reducing mutation rates and microsatellite instability. Genetic defects in this pathway cause Lynch syndrome and various cancers in humans. Binding of a mispaired or unpaired base by bacterial MutS and eukaryotic MutS{alpha} is well characterized. We report here crystal structures of human MutS{beta} in complex with DNA containing insertion-deletion loops (IDL) of two, three, four or six unpaired nucleotides. In contrast to eukaryotic MutS{alpha} and bacterial MutS, which bind the base of a mismatched nucleotide, MutS{beta} binds three phosphates in an IDL. DNA is severely bent at the IDL; unpaired bases are flippedmore » out into the major groove and partially exposed to solvent. A normal downstream base pair can become unpaired; a single unpaired base can thereby be converted to an IDL of two nucleotides and recognized by MutS{beta}. The C-terminal dimerization domains form an integral part of the MutS structure and coordinate asymmetrical ATP hydrolysis by Msh2 and Msh3 with mismatch binding to signal for repair.« less

Disposable and removable nucleic acid extraction and purification cartridges for automated flow-through systems

DOEpatents

Regan, John Frederick

2014-09-09

Removable cartridges are used on automated flow-through systems for the purpose of extracting and purifying genetic material from complex matrices. Different types of cartridges are paired with specific automated protocols to concentrate, extract, and purifying pathogenic or human genetic material. Their flow-through nature allows large quantities sample to be processed. Matrices may be filtered using size exclusion and/or affinity filters to concentrate the pathogen of interest. Lysed material is ultimately passed through a filter to remove the insoluble material before the soluble genetic material is delivered past a silica-like membrane that binds the genetic material, where it is washed, dried, and eluted. Cartridges are inserted into the housing areas of flow-through automated instruments, which are equipped with sensors to ensure proper placement and usage of the cartridges. Properly inserted cartridges create fluid- and air-tight seals with the flow lines of an automated instrument.

Cooperative learning using simulation to achieve mastery of nasogastric tube insertion.

PubMed

Cason, Melanie Leigh; Gilbert, Gregory E; Schmoll, Heidi H; Dolinar, Susan M; Anderson, Jane; Nickles, Barbara Marshburn; Pufpaff, Laurie A; Henderson, Ruth; Lee, Frances Wickham; Schaefer, John J

2015-03-01

Traditionally, psychomotor skills training for nursing students involves didactic instruction followed by procedural review and practice with a task trainer, manikin, or classmates. This article describes a novel method of teaching psychomotor skills to associate degree and baccalaureate nursing students, Cooperative Learning Simulation Skills Training (CLSST), in the context of nasogastric tube insertion using a deliberate practice-to-mastery learning model. Student dyads served as operator and student learner. Automatic scoring was recorded in the debriefing log. Student pairs alternated roles until they achieved mastery, after which they were assessed individually. Median checklist scores of 100% were achieved by students in both programs after one practice session and through evaluation. Students and faculty provided positive feedback regarding this educational innovation. CLSST in a deliberate practice-to-mastery learning paradigm offers a novel way to teach psychomotor skills in nursing curricula and decreases the instructor-to-student ratio. Copyright 2015, SLACK Incorporated.

A Stem-Loop Structure in Potato Leafroll Virus Open Reading Frame 5 (ORF5) Is Essential for Readthrough Translation of the Coat Protein ORF Stop Codon 700 Bases Upstream.

PubMed

Xu, Yi; Ju, Ho-Jong; DeBlasio, Stacy; Carino, Elizabeth J; Johnson, Richard; MacCoss, Michael J; Heck, Michelle; Miller, W Allen; Gray, Stewart M

2018-06-01

Translational readthrough of the stop codon of the capsid protein (CP) open reading frame (ORF) is used by members of the Luteoviridae to produce their minor capsid protein as a readthrough protein (RTP). The elements regulating RTP expression are not well understood, but they involve long-distance interactions between RNA domains. Using high-resolution mass spectrometry, glutamine and tyrosine were identified as the primary amino acids inserted at the stop codon of Potato leafroll virus (PLRV) CP ORF. We characterized the contributions of a cytidine-rich domain immediately downstream and a branched stem-loop structure 600 to 700 nucleotides downstream of the CP stop codon. Mutations predicted to disrupt and restore the base of the distal stem-loop structure prevented and restored stop codon readthrough. Motifs in the downstream readthrough element (DRTE) are predicted to base pair to a site within 27 nucleotides (nt) of the CP ORF stop codon. Consistent with a requirement for this base pairing, the DRTE of Cereal yellow dwarf virus was not compatible with the stop codon-proximal element of PLRV in facilitating readthrough. Moreover, deletion of the complementary tract of bases from the stop codon-proximal region or the DRTE of PLRV prevented readthrough. In contrast, the distance and sequence composition between the two domains was flexible. Mutants deficient in RTP translation moved long distances in plants, but fewer infection foci developed in systemically infected leaves. Selective 2'-hydroxyl acylation and primer extension (SHAPE) probing to determine the secondary structure of the mutant DRTEs revealed that the functional mutants were more likely to have bases accessible for long-distance base pairing than the nonfunctional mutants. This study reveals a heretofore unknown combination of RNA structure and sequence that reduces stop codon efficiency, allowing translation of a key viral protein. IMPORTANCE Programmed stop codon readthrough is used by many animal and plant viruses to produce key viral proteins. Moreover, such "leaky" stop codons are used in host mRNAs or can arise from mutations that cause genetic disease. Thus, it is important to understand the mechanism(s) of stop codon readthrough. Here, we shed light on the mechanism of readthrough of the stop codon of the coat protein ORFs of viruses in the Luteoviridae by identifying the amino acids inserted at the stop codon and RNA structures that facilitate this "leakiness" of the stop codon. Members of the Luteoviridae encode a C-terminal extension to the capsid protein known as the readthrough protein (RTP). We characterized two RNA domains in Potato leafroll virus (PLRV), located 600 to 700 nucleotides apart, that are essential for efficient RTP translation. We further determined that the PLRV readthrough process involves both local structures and long-range RNA-RNA interactions. Genetic manipulation of the RNA structure altered the ability of PLRV to translate RTP and systemically infect the plant. This demonstrates that plant virus RNA contains multiple layers of information beyond the primary sequence and extends our understanding of stop codon readthrough. Strategic targets that can be exploited to disrupt the virus life cycle and reduce its ability to move within and between plant hosts were revealed. Copyright © 2018 American Society for Microbiology.

Smoking has no impact on survival and it is not associated with ACE gene I/D polymorphism in hemodialysis patients.

PubMed

Kiss, István; Kiss, Zoltán; Kerkovits, Lóránt; Paksy, András; Ambrus, Csaba

2017-01-01

The relationship between smoking and mortality in patients on hemodialysis is controversial. Earlier studies showed that the insertion/deletion (I/D) polymorphism of the ACE gene might have an effect on mortality. The aim of this study was to test the impact of smoking on survival and whether this association was influenced by ACE gene I/D polymorphism in patients on maintenance hemodialysis. In this prospective, multicenter cohort study we analyzed 709 prevalent patients on maintenance hemodialysis. Patients were allocated into groups based on their smoking habit. Outcome data were collected during the 144-month follow-up period. Outcomes of current smokers and lifelong non-smokers were compared. In order to control for interactions between predictor variables, we also identified 160 matched pairs for further sub-analysis. The vast majority of patients (67%) were non-smokers, followed by current smokers (22.2%) and ex-smokers (9.8%). Smoking had no impact on survival in the matched pair analysis ( p = 0.99). After adjustment for ACE I/D polymorphism and other co-variates, smoking had no effect on survival. Our data suggest that smoking has no impact on survival; neither is it associated with ACE gene I/D polymorphism in hemodialysis patients.

Chirped-Pulse and Cavity Based Fourier Transform Microwave Spectroscopy of the Methyl Lactate-Ammonia Adduct

NASA Astrophysics Data System (ADS)

Thomas, Javix; Sukhorukov, Oleksandr; Jaeger, Wolfgang; Xu, Yunjie

2012-06-01

The hydrogen bonded complex of ammonia with methyl lactate, a chiral alpha-hydroxyester, has been studied using rotational spectroscopy and high level ab initio calculations. Previous studies showed that methyl lactate can exist in a number of conformers. However, only the most stable one which has an intramolecular hydrogen bonded ring formed with its alcoholic hydroxyl and its carbonyl oxygen atom was detected experimentally An extensive ab initio search has been performed to locate all possible low energy conformers of the methyl lactate-ammonia contact pair. Five lowest energy conformers have been identified at the MP2/6-311++G(d,p) level. The lowest energy conformer favors an insertion arrangement, where ammonia is inserted into the existing intramolecular hydrogen bonded ring in the most stable methyl lactate conformer. Broadband scans for the rotational spectra of possible binary conformers have been carried out using a chirped-pulse Fourier transform microwave (FTMW) instrument. The most stable binary adduct was identified and assigned. The final frequency measurements have been done with a cavity based FTMW instrument. The spectrum observed shows complicated fine and hyperfine splitting patterns, likely due to the internal rotations of the methyl groups of methyl lactate and that of ammonia, as well as the 14N quadrupolar nucleus. The binary adduct with 15NH3 has also been studied to simplify the splitting pattern and to aid the assignments of the extensive splittings. The isotopic data and the fine and hyperfine structures will be discussed in terms of internal rotation dynamics and geometry of the hydrogen bonded adduct.

Mechanism of Ribonucleotide Incorporation by Human DNA Polymerase η*

PubMed Central

Su, Yan; Egli, Martin; Guengerich, F. Peter

2016-01-01

Ribonucleotides and 2′-deoxyribonucleotides are the basic units for RNA and DNA, respectively, and the only difference is the extra 2′-OH group on the ribonucleotide sugar. Cellular rNTP concentrations are much higher than those of dNTP. When copying DNA, DNA polymerases not only select the base of the incoming dNTP to form a Watson-Crick pair with the template base but also distinguish the sugar moiety. Some DNA polymerases use a steric gate residue to prevent rNTP incorporation by creating a clash with the 2′-OH group. Y-family human DNA polymerase η (hpol η) is of interest because of its spacious active site (especially in the major groove) and tolerance of DNA lesions. Here, we show that hpol η maintains base selectivity when incorporating rNTPs opposite undamaged DNA and the DNA lesions 7,8-dihydro-8-oxo-2′-deoxyguanosine and cyclobutane pyrimidine dimer but with rates that are 103-fold lower than for inserting the corresponding dNTPs. X-ray crystal structures show that the hpol η scaffolds the incoming rNTP to pair with the template base (dG) or 7,8-dihydro-8-oxo-2′-deoxyguanosine with a significant propeller twist. As a result, the 2′-OH group avoids a clash with the steric gate, Phe-18, but the distance between primer end and Pα of the incoming rNTP increases by 1 Å, elevating the energy barrier and slowing polymerization compared with dNTP. In addition, Tyr-92 was identified as a second line of defense to maintain the position of Phe-18. This is the first crystal structure of a DNA polymerase with an incoming rNTP opposite a DNA lesion. PMID:26740629

A framework for correcting brain retraction based on an eXtended Finite Element Method using a laser range scanner.

PubMed

Li, Ping; Wang, Weiwei; Song, Zhijian; An, Yong; Zhang, Chenxi

2014-07-01

Brain retraction causes great distortion that limits the accuracy of an image-guided neurosurgery system that uses preoperative images. Therefore, brain retraction correction is an important intraoperative clinical application. We used a linear elastic biomechanical model, which deforms based on the eXtended Finite Element Method (XFEM) within a framework for brain retraction correction. In particular, a laser range scanner was introduced to obtain a surface point cloud of the exposed surgical field including retractors inserted into the brain. A brain retraction surface tracking algorithm converted these point clouds into boundary conditions applied to XFEM modeling that drive brain deformation. To test the framework, we performed a brain phantom experiment involving the retraction of tissue. Pairs of the modified Hausdorff distance between Canny edges extracted from model-updated images, pre-retraction, and post-retraction CT images were compared to evaluate the morphological alignment of our framework. Furthermore, the measured displacements of beads embedded in the brain phantom and the predicted ones were compared to evaluate numerical performance. The modified Hausdorff distance of 19 pairs of images decreased from 1.10 to 0.76 mm. The forecast error of 23 stainless steel beads in the phantom was between 0 and 1.73 mm (mean 1.19 mm). The correction accuracy varied between 52.8 and 100 % (mean 81.4 %). The results demonstrate that the brain retraction compensation can be incorporated intraoperatively into the model-updating process in image-guided neurosurgery systems.

Identification of somatic mutations in cancer through Bayesian-based analysis of sequenced genome pairs

PubMed Central

2013-01-01

Background The field of cancer genomics has rapidly adopted next-generation sequencing (NGS) in order to study and characterize malignant tumors with unprecedented resolution. In particular for cancer, one is often trying to identify somatic mutations – changes specific to a tumor and not within an individual’s germline. However, false positive and false negative detections often result from lack of sufficient variant evidence, contamination of the biopsy by stromal tissue, sequencing errors, and the erroneous classification of germline variation as tumor-specific. Results We have developed a generalized Bayesian analysis framework for matched tumor/normal samples with the purpose of identifying tumor-specific alterations such as single nucleotide mutations, small insertions/deletions, and structural variation. We describe our methodology, and discuss its application to other types of paired-tissue analysis such as the detection of loss of heterozygosity as well as allelic imbalance. We also demonstrate the high level of sensitivity and specificity in discovering simulated somatic mutations, for various combinations of a) genomic coverage and b) emulated heterogeneity. Conclusion We present a Java-based implementation of our methods named Seurat, which is made available for free academic use. We have demonstrated and reported on the discovery of different types of somatic change by applying Seurat to an experimentally-derived cancer dataset using our methods; and have discussed considerations and practices regarding the accurate detection of somatic events in cancer genomes. Seurat is available at https://sites.google.com/site/seuratsomatic. PMID:23642077

Identification of somatic mutations in cancer through Bayesian-based analysis of sequenced genome pairs.

PubMed

Christoforides, Alexis; Carpten, John D; Weiss, Glen J; Demeure, Michael J; Von Hoff, Daniel D; Craig, David W

2013-05-04

The field of cancer genomics has rapidly adopted next-generation sequencing (NGS) in order to study and characterize malignant tumors with unprecedented resolution. In particular for cancer, one is often trying to identify somatic mutations--changes specific to a tumor and not within an individual's germline. However, false positive and false negative detections often result from lack of sufficient variant evidence, contamination of the biopsy by stromal tissue, sequencing errors, and the erroneous classification of germline variation as tumor-specific. We have developed a generalized Bayesian analysis framework for matched tumor/normal samples with the purpose of identifying tumor-specific alterations such as single nucleotide mutations, small insertions/deletions, and structural variation. We describe our methodology, and discuss its application to other types of paired-tissue analysis such as the detection of loss of heterozygosity as well as allelic imbalance. We also demonstrate the high level of sensitivity and specificity in discovering simulated somatic mutations, for various combinations of a) genomic coverage and b) emulated heterogeneity. We present a Java-based implementation of our methods named Seurat, which is made available for free academic use. We have demonstrated and reported on the discovery of different types of somatic change by applying Seurat to an experimentally-derived cancer dataset using our methods; and have discussed considerations and practices regarding the accurate detection of somatic events in cancer genomes. Seurat is available at https://sites.google.com/site/seuratsomatic.

Rectal suppository: commonsense and mode of insertion.

PubMed

Abd-el-Maeboud, K H; el-Naggar, T; el-Hawi, E M; Mahmoud, S A; Abd-el-Hay, S

1991-09-28

Rectal suppository is a well-known form of medication and its use is increasing. The commonest shape is one with an apex (pointed end) tapering to a base (blunt end). Because of a general lack of information about mode of insertion, we asked 360 lay subjects (Egyptians and non-Egyptians) and 260 medical personnel (physicians, pharmacists, and nurses) by questionnaire which end they inserted foremost. Apart from 2 individuals, all subjects suggested insertion with the apex foremost. Commonsense was the most frequent basis for this practice (86.9% of lay subjects and 84.6% of medical personnel) followed by information from a relative, a friend, or medical personnel, or from study at medical school. Suppository insertion with the base or apex foremost was compared in 100 subjects (60 adults, 40 infants and children). Retention with the former method was more easily achieved in 98% of the cases, with no need to introduce a finger in the anal canal (1% vs 83%), and lower expulsion rate (0% vs 3%). The designer of the "torpedo-shaped" suppository suggested its insertion with apex foremost. Our data suggest that a suppository is better inserted with the base foremost. Reversed vermicular contractions or pressure gradient of the anal canal might press it inwards.

Complete Chloroplast Genome of Pinus massoniana (Pinaceae): Gene Rearrangements, Loss of ndh Genes, and Short Inverted Repeats Contraction, Expansion.

PubMed

Ni, ZhouXian; Ye, YouJu; Bai, Tiandao; Xu, Meng; Xu, Li-An

2017-09-11

The chloroplast genome (CPG) of Pinus massoniana belonging to the genus Pinus (Pinaceae), which is a primary source of turpentine, was sequenced and analyzed in terms of gene rearrangements, ndh genes loss, and the contraction and expansion of short inverted repeats (IRs). P. massoniana CPG has a typical quadripartite structure that includes large single copy (LSC) (65,563 bp), small single copy (SSC) (53,230 bp) and two IRs (IRa and IRb, 485 bp). The 108 unique genes were identified, including 73 protein-coding genes, 31 tRNAs, and 4 rRNAs. Most of the 81 simple sequence repeats (SSRs) identified in CPG were mononucleotides motifs of A/T types and located in non-coding regions. Comparisons with related species revealed an inversion (21,556 bp) in the LSC region; P. massoniana CPG lacks all 11 intact ndh genes (four ndh genes lost completely; the five remained truncated as pseudogenes; and the other two ndh genes remain as pseudogenes because of short insertions or deletions). A pair of short IRs was found instead of large IRs, and size variations among pine species were observed, which resulted from short insertions or deletions and non-synchronized variations between "IRa" and "IRb". The results of phylogenetic analyses based on whole CPG sequences of 16 conifers indicated that the whole CPG sequences could be used as a powerful tool in phylogenetic analyses.

CAPRRESI: Chimera Assembly by Plasmid Recovery and Restriction Enzyme Site Insertion.

PubMed

Santillán, Orlando; Ramírez-Romero, Miguel A; Dávila, Guillermo

2017-06-25

Here, we present chimera assembly by plasmid recovery and restriction enzyme site insertion (CAPRRESI). CAPRRESI benefits from many strengths of the original plasmid recovery method and introduces restriction enzyme digestion to ease DNA ligation reactions (required for chimera assembly). For this protocol, users clone wildtype genes into the same plasmid (pUC18 or pUC19). After the in silico selection of amino acid sequence regions where chimeras should be assembled, users obtain all the synonym DNA sequences that encode them. Ad hoc Perl scripts enable users to determine all synonym DNA sequences. After this step, another Perl script searches for restriction enzyme sites on all synonym DNA sequences. This in silico analysis is also performed using the ampicillin resistance gene (ampR) found on pUC18/19 plasmids. Users design oligonucleotides inside synonym regions to disrupt wildtype and ampR genes by PCR. After obtaining and purifying complementary DNA fragments, restriction enzyme digestion is accomplished. Chimera assembly is achieved by ligating appropriate complementary DNA fragments. pUC18/19 vectors are selected for CAPRRESI because they offer technical advantages, such as small size (2,686 base pairs), high copy number, advantageous sequencing reaction features, and commercial availability. The usage of restriction enzymes for chimera assembly eliminates the need for DNA polymerases yielding blunt-ended products. CAPRRESI is a fast and low-cost method for fusing protein-coding genes.

Influence of implantoplasty on stress distribution of exposed implants at different bone insertion levels.

PubMed

Tribst, João Paulo Mendes; Dal Piva, Amanda Maria de Oliveira; Shibli, Jamil Awad; Borges, Alexandre Luiz Souto; Tango, Rubens Nisie

2017-12-07

This study evaluated the effect of implantoplasty on different bone insertion levels of exposed implants. A model of the Bone Level Tapered implant (Straumann Institute, Waldenburg, Switzerland) was created through the Rhinoceros software (version 5.0 SR8, McNeel North America, Seattle, WA, USA). The abutment was fixed to the implant through a retention screw and a monolithic crown was modeled over a cementation line. Six models were created with increasing portions of the implant threads exposed: C1 (1 mm), C2 (2 mm), C3 (3 mm), C4 (4 mm), C5 (5 mm) and C6 (6 mm). The models were made in duplicates and one of each pair was used to simulate implantoplasty, by removing the threads (I1, I2, I3, I4, I5 and I6). The final geometry was exported in STEP format to ANSYS (ANSYS 15.0, ANSYS Inc., Houston, USA) and all materials were considered homogeneous, isotropic and linearly elastic. To assess distribution of stress forces, an axial load (300 N) was applied on the cusp. For the periodontal insert, the strains increased in the peri-implant region according to the size of the exposed portion and independent of the threads' presence. The difference between groups with and without implantoplasty was less than 10%. Critical values were found when the inserted portion was smaller than the exposed portion. In the exposed implants, the stress generated on the implant and retention screw was higher in the models that received implantoplasty. For the bone tissue, exposure of the implant's thread was a damaging factor, independent of implantoplasty. Implantoplasty treatment can be safely used to control peri-implantitis if at least half of the implant is still inserted in bone.

A randomised controlled trial comparing ProSeal laryngeal mask airway, i-gel and Laryngeal Tube Suction-D under general anaesthesia for elective surgical patients requiring controlled ventilation.

PubMed

Das, Bikramjit; Varshney, Rahul; Mitra, Subhro

2017-12-01

The ProSeal™ laryngeal mask airway (PLMA), i-gel™ and Laryngeal Tube Suction-D (LTS-D™) have previously been evaluated alone or in pair-wise comparisons but differing study designs make it difficult to compare the results. The aim of this study was to compare the clinical performance of these three devices in terms of efficacy and safety in patients receiving mechanical ventilation during elective surgical procedures. This prospective, randomised, double-blind study was conducted on 150 American Society of Anesthesiologists physical status I-II patients, randomly allocated into 3 groups, undergoing elective surgical procedures under general anaesthesia. PLMA, i-gel™ or LTS-D™ appropriate for weight or/and height was inserted. Primary outcome measured was airway sealing pressure. Insertion time, ease of insertion, number of attempts, overall success rate and the incidence of airway trauma and complications were also recorded. Intergroup differences were compared using one-way analysis of variance with post hoc correction for continuous data and Chi-square test for categorical variables. Overall success rate was comparable between the three devices (i-gel™ 100%, LTS-D™ 94%, PLMA 96%). Airway sealing pressure was lower with i-gel™ (23.38 ± 2.06 cm H 2 O) compared to LTS-D™ (26.06 ± 2.11 cm H 2 O) and PLMA (28.5 ± 2.8 cm H 2 O; P < 0.0005). The mean insertion time was significantly more in PLMA (38.77 ± 3.2 s) compared to i-gel™ (27.9 ± 2.53 s) and LTS-D™ (21.66 ± 2.31 s; P < 0.0005). Airway sealing pressure and insertion time were significantly higher in PLMA compared to i-gel™ and LTS-D™.

Unsatisfactory clinical outcomes of second-generation mobile bearing floating platform total knee arthroplasty: comparing outcomes with fixed bearing after five years minimum.

PubMed

Yoon, Jung-Ro; Yang, Jae-Hyuk

2018-03-20

The purpose of this retrospective study was to analyze and compare the clinical and radiologic outcomes of fixed bearing ultracongruent (UC) insert total knee arthroplasty (TKA) and mobile bearing (MB) floating platform TKA using the navigation-assisted gap balancing technique with a minimum follow-up of five years. The study retrospectively enrolled 105 patients who received the UC type fixed bearing insert (group 1) and 95 patients who received the floating platform MB insert (group 2) during the period from August 2009 to June 2012. All surgery was performed using the navigation-assisted gap balancing technique. For strict assessment of gap measurements, the offset-type-force-controlled-spreader-system was used. Radiologic and clinical outcomes were assessed before operation and at the most recent follow-up using the Knee Society Score (KSS) and the Western Ontario and McMaster Universities Osteoarthritis Index (WOMAC) score. For statistical analysis, paired sample t tests were used. A p value less than 0.05 was considered significant. Although the radiologic alignments were satisfactory for both groups (99/105 [94%] cases were neutral for group 1 and 90/95 [94%] for group 2), the functional and total WOMAC scores were inferior in group 2 (p < 0.05). There were two cases of insert breakage in group 2 that required bearing exchange. The Kaplan-Meier survivorship rates for groups 1 and 2 at 77 months were 100.0 and 97.9%, respectively. Second-generation MB floating platform TKA cases did not have satisfactory outcomes. There were two cases of insert breakage, which required bearing exchange. Other patients who underwent surgery with second-generation MB floating platform were encouraged to avoid high knee flexion activities, resulting in lower clinical performance.

Self-diagnosis of damage in fibrous composites using electrical resistance measurements

NASA Astrophysics Data System (ADS)

Kang, Ji Ho; Paty, Spandana; Kim, Ran Y.; Tandon, G. P.

2006-03-01

The objective of this research was to develop a practical integrated approach using extracted features from electrical resistance measurements and coupled electromechanical models of damage, for in situ damage detection and sensing in carbon fiber reinforced plastic (CFRP) composite structures. To achieve this objective, we introduced specific known damage (in terms of type, size, and location) into CFRP laminates and established quantitative relationships with the electrical resistance measurements. For processing of numerous measurement data, an autonomous data acquisition system was devised. We also established a specimen preparation procedure and a method for electrode setup. Coupon and panel CFRP laminate specimens with several known damage were tested and post-processed with the measurement data. Coupon specimens with various sizes of artificial delaminations obtained by inserting Teflon film were manufactured and the resistance was measured. The measurement results showed that increase of delamination size led to increase of resistance implying that it is possible to sense the existence and size of delamination. Encouraged by the results of coupon specimens, we implemented the measurement system on panel specimens. Three different quasi-isotropic panels were designed and manufactured: a panel with artificial delamination by inserting Teflon film at the midplane, a panel with artificial delamination by inserting Teflon film between the second and third plies from the surface, and an undamaged panel. The first two panels were designed to determine the feasibility of detecting delamination using the developed measurement system. The third panel had no damage at first, and then three different sizes of holes were drilled at a chosen location. Panels were prepared using the established procedures with six electrode connections on each side making a total of twenty-four electrode connections for a panel. All possible pairs of electrodes were scanned and the resistance was measured for each pair. The measurement results showed the possibility of the established measurement system for an in-situ damage detection method for CFRP composite structures.

Prospective multicenter study of marginal bone level and soft tissue health of a one-piece implant after two years.

PubMed

Finne, Kaj; Rompen, Eric; Toljanic, Joseph

2007-06-01

A novel 1-piece implant purported to provide for stable tissue support, immediate function, and immediate placement in extraction sockets has been developed. Stabilization of the marginal bone level over time requires documentation. The aim of this study was to evaluate marginal bone level differences and soft tissue health between the 1- and 2-year follow-up of a 1-piece implant design. Eighty-two implants, restoring both single teeth and multiple edentulous situations, in 56 consecutively treated patients, were included. Marginal bone level was evaluated on radiographs made at implant insertion, 6-month follow-up, and annually thereafter. At 3-, 6-month, and 1-year follow-ups, presence of plaque and the soft tissue response were evaluated using plaque and bleeding on probing indexes. The papilla index was used to determine papilla size at implant insertion with the provisional restoration in place and at the insertion of the definitive restoration. The change over time in marginal bone level was analyzed with a 1-way analysis of variance (ANOVA) paired design with time as main effect (1 to 2 years) and subjects as block effect (alpha=.05). One implant failure occurred, resulting in a 98.8% cumulative survival rate (CSR) for the follow-up time of 2 years. The mean (SD) change in bone level between years 1 and 2 was 0.08 mm (1.19) (95% CI-0.30 to 0.46) (P=.68), demonstrating a stable marginal bone level. Normal implant mucosa was noted for approximately 90% of the sites at the 1-year follow-up. The mean (SD) papilla score at placement was 1.3 (0.66) and increased to 1.7 (0.67) at insertion of the definitive prosthesis. The stable marginal bone level and soft tissue health observed indicate that the 1-piece implant tested has the ability to preserve both hard and soft tissue. Based on the high implant survival rate and favorable tissue response, the 1-piece implant can be recommended for clinical use.

A Bioinformatics Approach for Detecting Repetitive Nested Motifs using Pattern Matching.

PubMed

Romero, José R; Carballido, Jessica A; Garbus, Ingrid; Echenique, Viviana C; Ponzoni, Ignacio

2016-01-01

The identification of nested motifs in genomic sequences is a complex computational problem. The detection of these patterns is important to allow the discovery of transposable element (TE) insertions, incomplete reverse transcripts, deletions, and/or mutations. In this study, a de novo strategy for detecting patterns that represent nested motifs was designed based on exhaustive searches for pairs of motifs and combinatorial pattern analysis. These patterns can be grouped into three categories, motifs within other motifs, motifs flanked by other motifs, and motifs of large size. The methodology used in this study, applied to genomic sequences from the plant species Aegilops tauschii and Oryza sativa , revealed that it is possible to identify putative nested TEs by detecting these three types of patterns. The results were validated through BLAST alignments, which revealed the efficacy and usefulness of the new method, which is called Mamushka.

Synthesis of amide isosteres of schweinfurthin-based stilbenes.

PubMed

Stockdale, David P; Beutler, John A; Wiemer, David F

2017-10-15

The schweinfurthins are plant-derived stilbenes with an intriguing profile of anti-cancer activity. To obtain analogues of the schweinfurthins that might preserve the biological activity but have greater water solubility, a formal replacement of the central olefin with an amide has been explored. Two pairs of amides have been prepared, each containing the same hexahydroxanthene "left half" joined through an amide linkage to two different "right halves." In each series, the amide has been inserted in both possible orientations, placing the carbonyl group on the tricyclic ABC ring system and the amine on the D-ring, or placing the amine on the hexahydroxanthene and the carbonyl group on the D-ring. The four new schweinfurthin analogues have been tested in the NCI 60 cell line screen, and in both cases the more active isomer carried the carbonyl group on the C-ring. Copyright © 2017 Elsevier Ltd. All rights reserved.

Indel Group in Genomes (IGG) Molecular Genetic Markers1[OPEN

PubMed Central

Burkart-Waco, Diana; Kuppu, Sundaram; Britt, Anne; Chetelat, Roger

2016-01-01

Genetic markers are essential when developing or working with genetically variable populations. Indel Group in Genomes (IGG) markers are primer pairs that amplify single-locus sequences that differ in size for two or more alleles. They are attractive for their ease of use for rapid genotyping and their codominant nature. Here, we describe a heuristic algorithm that uses a k-mer-based approach to search two or more genome sequences to locate polymorphic regions suitable for designing candidate IGG marker primers. As input to the IGG pipeline software, the user provides genome sequences and the desired amplicon sizes and size differences. Primer sequences flanking polymorphic insertions/deletions are produced as output. IGG marker files for three sets of genomes, Solanum lycopersicum/Solanum pennellii, Arabidopsis (Arabidopsis thaliana) Columbia-0/Landsberg erecta-0 accessions, and S. lycopersicum/S. pennellii/Solanum tuberosum (three-way polymorphic) are included. PMID:27436831

Mitochondrial Enzyme Plays Critical Role in Chemotherapy-Induced Heart Damage | Center for Cancer Research

Cancer.gov

Doxorubicin (DOX) is an effective drug for treating cancers ranging from leukemia and lymphoma to solid tumors, such as breast cancer. DOX kills dividing cells in two ways: inserting between the base pairs of DNA and trapping a complex of DNA and an enzyme that cuts DNA, topoisomerase 2α, preventing DNA repair. However, DOX also causes congestive heart failure in about 30 percent of adult cancer patients and delayed onset heart failure in a significant number of pediatric cancer patients. The mechanism of this DOX-mediated cardiotoxicity is not well understood since heart muscle cells neither divide nor express Top2α, and there are currently no genetic factors that identify patients who are susceptible to cardiac damage from DOX. However, a recent study showed that mice lacking another topoisomerase, Top2β, did not experience cardiac damage after treatment with DOX.

Association of 5-HTTLPR Polymorphism with the Nursing Diagnoses and the Achievement of Nursing Outcomes in Patients with Major Depression.

PubMed

Prokofieva, Margarita; Karadima, Georgia; Koukia, Evmorfia; Michou, Vassiliki; Kyprianidou, Chrysoula; Papageorgiou, Chrysovalantis V; Alexiadis, Evangelos; Constantoulakis, Pantelis; Dikeos, Dimitris

2017-10-01

The aim of this study is to investigate whether a 44-base-pair insertion/deletion polymorphism in the upstream regulatory region of the serotonin transporter gene (5-HTTLPR) is associated with the nursing diagnoses and the achievement of the desired nursing outcomes in inpatients with major depression. Thirty five patients were evaluated. The nursing diagnoses of risk for suicide and imbalanced nutrition are reported less often in homozygotes of the high-expressing gene (L A ). Carriers of the low-expressing genes (L G or S) have a worse response to interventions which aim to increase low self-esteem, indicating that they may need more intensive care in order to achieve the desired outcome. Genetics in psychiatric nursing could help refine personalized care, however further studies with large sample sizes and multiple gene evaluations are needed.

Power supply system for the superconducting outsert of the CHMFL hybrid magnet

NASA Astrophysics Data System (ADS)

Fang, Z.; Zhu, J.; Chen, W.; Jiang, D.; Huang, P.; Chen, Z.; Tan, Y.; Kuang, G.

2017-12-01

The construction of a new hybrid magnet, consisting of a 11 T superconducting outsert and a 34 T resistive insert magnet, has been finished at the Chinese High Magnetic Field Laboratory (CHMFL) in Hefei. With a room temperature bore of 800 mm in diameter, the hybrid magnet superconducting outsert is composed of four separate Nb3Sn-based Cable-in-Conduit Conductor (CICC) coils electrically connected in series and powered by a single power supply system. The power supply system for the superconducting outsert consists of a 16 kA DC power supply, a quench protection system, a pair of 16 kA High Temperature Superconducting (HTS) current leads, and two Low Temperature Superconducting bus-lines. The design and manufacturing of the power supply system have been completed at the CHMFL. This paper describes the design features of the power supply system as well as the current fabrication condition of its main components.

Continuous glucose monitoring system: dawn period calibration does not change accuracy of the method.

PubMed

Augusto, Gustavo A; Sousa, André G P; Perazo, Marcela N A; Correa-Giannella, Maria L C; Nery, Marcia; Melo, Karla F S de

2009-06-01

Continuous glucose monitoring system is a valuable instrument to measure glycemic control, which uses a retrospective calibration based upon 3 to 4 capillary glucose meter values inserted by the patient each day. We evaluated the interference of calibration during the dawn period in the system accuracy. The monitoring data were retrospectively divided into two groups: with (Group A) or without (Group B) the dawn period calibration (between 1:00 and 5:00 AM). Accuracy of the method was expressed by relative absolute difference. Thirty-four continuous glucose monitoring data were evaluated comprising a total of 112 nights. A total of 289 paired readings were analyzed - 195 in Group A and 94 in Group B. We did not find a difference in relative absolute difference (RAD%) in any analyzed period of day by adding dawn calibration. These data suggest that dawn calibration does not alter accuracy of method.

Synthesis of the missing oxide of xenon, XeO2, and its implications for Earth's missing xenon.

PubMed

Brock, David S; Schrobilgen, Gary J

2011-04-27

The missing Xe(IV) oxide, XeO(2), has been synthesized at 0 °C by hydrolysis of XeF(4) in water and 2.00 M H(2)SO(4(aq)). Raman spectroscopy and (16/18)O isotopic enrichment studies indicate that XeO(2) possesses an extended structure in which Xe(IV) is oxygen bridged to four neighboring oxygen atoms to give a local square-planar XeO(4) geometry based on an AX(4)E(2) valence shell electron pair repulsion (VSEPR) arrangement. The vibrational spectra of Xe(16)O(2) and Xe(18)O(2) amend prior vibrational assignments of xenon doped SiO(2) and are in accordance with prior speculation that xenon depletion from the Earth's atmosphere may occur by xenon insertion at high temperatures and high pressures into SiO(2) in the Earth's crust.

16 × 16 non-blocking silicon optical switch based on electro-optic Mach-Zehnder interferometers.

PubMed

Lu, Liangjun; Zhao, Shuoyi; Zhou, Linjie; Li, Dong; Li, Zuxiang; Wang, Minjuan; Li, Xinwan; Chen, Jianping

2016-05-02

We experimentally demonstrate a 16 × 16 non-blocking optical switch fabric with a footprint of 10.7 × 4.4 mm². The switch fabric is composed of 56 2 × 2 silicon Mach-Zehnder interferometers (MZIs), with each integrated with a pair of TiN resistive micro-heaters and a p-i-n diode. The average on-chip insertion loss at 1560 nm wavelength is ~6.7 dB and ~14 dB for the "all-cross" and "all-bar" states, respectively, with a loss variation of ± 1 dB over all routing paths. The measured rise/fall time of the switch upon electrical tuning is 3.2/2.5 ns. The switching functionality is verified by transmission of 20 Gb/s on-off keying (OOK) and 50 Gb/s quadrature phase-shift keying (QPSK) optical signals.

Technology Insertion-Engineering Services Process Characterization. Task Order No. 1. Volume 4. OO-ALC

DTIC Science & Technology

1989-12-15

Since no bridge crane exists in either the north or south plate areas, parts must be dismounted from one monorail /hoist and transferred to another...when the chemical operations involve more than one tank line. There are 19 tank lines in the shop with one monorail hoist for each pair of tank lines...except for tank line no. 19. The monorail system over line 19 does not connect with the rest of the interconnected serpentine monorail system. Solution

Does maximum torque mean optimal pullout strength of screws?

PubMed

Tankard, Sara E; Mears, Simon C; Marsland, Daniel; Langdale, Evan R; Belkoff, Stephen M

2013-04-01

To determine the relationship between insertion torque and pullout strength of 3.5-mm-diameter cortical screws in cadaveric humeri with different bone mineral densities (BMDs). Five pairs of human humeri from each of 3 BMD groups (normal, osteopenic, and osteoporotic) were used. Holes were drilled in each humerus, and maximum insertion torque (T(max)) was measured by tightening a screw until stripping occurred. In the remaining holes, screws were tightened to 50%, 70%, or 90% of the T(max). A servohydraulic testing machine pulled each screw out at 1 mm/s while resulting force and axial displacement were recorded at 10 Hz. The authors checked for an effect of insertion torque (percent T(max)) on pullout strength using a general linearized and latent mixed model (Stata10), controlling for cortical thickness and BMD (T-score). Pullout strength for normal and osteoporotic bone was greatest for screws inserted to 50% T(max) and was significantly greater than that at T(max) but not significantly different from that at 70% or 90% T(max). For osteopenic bone, pullout strength was greatest at 70% peak torque, but it was not significantly different from the pullout strength at the 50% or 90% T(max) levels. Tightening screws beyond 50% T(max) does not increase pullout strength of the screw and may place bone at risk for damage that might result in loss of fixation. Even after adjusting for bone thickness and density, there is no clear relationship between pullout strength and screw torque.

Does prone repositioning before posterior fixation produce greater lordosis in lateral lumbar interbody fusion (LLIF)?

PubMed

Yson, Sharon C; Sembrano, Jonathan N; Santos, Edward R G; Luna, Jeffrey T P; Polly, David W

2014-10-01

Retrospective comparative radiographic review. To determine if lateral to prone repositioning before posterior fixation confers additional operative level lordosis in lateral lumbar interbody fusion (LLIF) procedures. In a review of 56 consecutive patients who underwent LLIF, there was no statistically significant change in segmental lordosis from lateral to prone once a cage is in place. The greatest lordosis increase was observed after cage insertion. We reviewed 56 consecutive patients who underwent LLIF in the lateral position followed by posterior fixation in the prone position. Eighty-eight levels were fused. Disk space angle was measured on intraoperative C-arm images, and change in operative level segmental lordosis brought about by each of the following was determined: (1) cage insertion, (2) prone repositioning, and (3) posterior instrumentation. Paired t test was used to determine significance (α=0.05). Mean lordosis improvement brought about by cage insertion was 2.6 degrees (P=0.00005). There was a 0.1 degree mean lordosis change brought about by lateral to prone positioning (P=0.47). Mean lordosis improvement brought about by posterior fixation, including rod compression, was 1.0 degree (P=0.03). In LLIF procedures, the largest increase in operative level segmental lordosis is brought about by cage insertion. Further lordosis may be gained by placing posterior fixation, including compressive maneuvers. Prone repositioning after cage placement does not produce any incremental lordosis change. Therefore, posterior fixation may be performed in the lateral position without compromising operative level sagittal alignment.

The influence of a small insert, in the footbed of a shoe, upon plantar pressure distribution.

PubMed

Burgess, S; Jordan, C; Bartlett, RM

1997-04-01

INTRODUCTION:: A recent development in plantar pressure distribution research, has been the study of the effects of sensory input on pressure distribution. It has been suggested that proprioceptive and exteroceptive information received from the plantar surface of the foot plays an important role in adapting to high pressures in shoes. Robbins and Gouw (1991) suggested that surface irregularities should be added to the insoles of running shoes to gain correct sensory input. Hayda et al. (1994) found that placing a pad proximal to the metatarsal heads produced significant reductions in forefoot plantar pressures around the first and second metatarsal heads. A development by Villeneuve (1993), 'La Posteropodle', utilized a small insert to maintain postural equilibrium, by stimulating the mechanoreceptors in the plantar surface of the foot. The aim of this study was to measure changes in plantar pressure distribution using a small circular insert. METHODS:: Ten non-pathological male subjects were tested whilst walking, after one day of wearing a pair of oxfords (hard) and running shoes (soft), containing an insert of 4 mm in height placed on a 0.8 mm EVA insole. The foot was split into five sections: (1) midfoot, (2) first metatarsal head, (3) 2nd and 3rd metatarsal heads, (4) 4th and 5th metatarsal heads, (5) the phalanges. A PEDAR system (Novel GmbH) was used to collect in-shoe plantar pressure data, with data collections at the beginning and end of a working day. Subjects were tested under two conditions: (1) the insert 5 mm proximal to the metatarsal heads, between the 2nd and 3rd heads, (2) a control, with no insert. RESULTS:: Preliminary results indicate that whilst wearing a hard shoe the insert had the effect of shifting peak pressures from the first metatarsal head, to the area of the second and third metatarsal heads. Peak pressures were found to be lower with the insert present. This has not yet been tested for significance. With the running shoe there appeared to be no significant differences between conditions with and without the insert. There were also no differences between the beginning and end of the day, for both shoe types. DISCUSSION:: From the results it appears that the insert is successful in both shifting peak pressures from the medial to the lateral forefoot, whilst reducing peak pressures simultaneously. This was only evident in the hard shoe condition however, suggesting that the footbed of the running shoe was perhaps too soft to allow the insert to influence sensory input sufficiently. These findings indicate that there may be implications for the use of small orthotics. Further study is required, however, to fully substantiate this hypothesis.

Dynamic soft tissue deformation estimation based on energy analysis

NASA Astrophysics Data System (ADS)

Gao, Dedong; Lei, Yong; Yao, Bin

2016-10-01

The needle placement accuracy of millimeters is required in many needle-based surgeries. The tissue deformation, especially that occurring on the surface of organ tissue, affects the needle-targeting accuracy of both manual and robotic needle insertions. It is necessary to understand the mechanism of tissue deformation during needle insertion into soft tissue. In this paper, soft tissue surface deformation is investigated on the basis of continuum mechanics, where a geometry model is presented to quantitatively approximate the volume of tissue deformation. The energy-based method is presented to the dynamic process of needle insertion into soft tissue based on continuum mechanics, and the volume of the cone is exploited to quantitatively approximate the deformation on the surface of soft tissue. The external work is converted into potential, kinetic, dissipated, and strain energies during the dynamic rigid needle-tissue interactive process. The needle insertion experimental setup, consisting of a linear actuator, force sensor, needle, tissue container, and a light, is constructed while an image-based method for measuring the depth and radius of the soft tissue surface deformations is introduced to obtain the experimental data. The relationship between the changed volume of tissue deformation and the insertion parameters is created based on the law of conservation of energy, with the volume of tissue deformation having been obtained using image-based measurements. The experiments are performed on phantom specimens, and an energy-based analytical fitted model is presented to estimate the volume of tissue deformation. The experimental results show that the energy-based analytical fitted model can predict the volume of soft tissue deformation, and the root mean squared errors of the fitting model and experimental data are 0.61 and 0.25 at the velocities 2.50 mm/s and 5.00 mm/s. The estimating parameters of the soft tissue surface deformations are proven to be useful for compensating the needle-targeting error in the rigid needle insertion procedure, especially for percutaneous needle insertion into organs.

Descemet's Stripping Automated Endothelial Keratoplasty Tissue Insertion Devices

PubMed Central

Khan, Salman Nasir; Shiakolas, Panos S.; Mootha, Venkateswara Vinod

2015-01-01

This review study provides information regarding the construction, design, and use of six commercially available endothelial allograft insertion devices applied for Descemet's stripping automated endothelial keratoplasty (DSAEK). We also highlight issues being faced in DSAEK and discuss the methods through which medical devices such as corneal inserters may alleviate these issues. Inserter selection is of high importance in the DSAEK procedure since overcoming the learning curve associated with the use of an insertion device is a time and energy consuming process. In the present review, allograft insertion devices were compared in terms of design, construction material, insertion technique, dimensions, incision requirements and endothelial cell loss to show their relative merits and capabilities based on available data in the literature. Moreover, the advantages/disadvantages of various insertion devices used for allograft insertion in DSAEK are reviewed and compared. The information presented in this review can be utilized for better selection of an insertion device for DSAEK. PMID:27051492

Low X/Y divergence in four pairs of papaya sex-linked genes.

PubMed

Yu, Qingyi; Hou, Shaobin; Feltus, F Alex; Jones, Meghan R; Murray, Jan E; Veatch, Olivia; Lemke, Cornelia; Saw, Jimmy H; Moore, Richard C; Thimmapuram, Jyothi; Liu, Lei; Moore, Paul H; Alam, Maqsudul; Jiang, Jiming; Paterson, Andrew H; Ming, Ray

2008-01-01

Sex chromosomes in flowering plants, in contrast to those in animals, evolved relatively recently and only a few are heteromorphic. The homomorphic sex chromosomes of papaya show features of incipient sex chromosome evolution. We investigated the features of paired X- and Y-specific bacterial artificial chromosomes (BACs), and estimated the time of divergence in four pairs of sex-linked genes. We report the results of a comparative analysis of long contiguous genomic DNA sequences between the X and hermaphrodite Y (Y(h)) chromosomes. Numerous chromosomal rearrangements were detected in the male-specific region of the Y chromosome (MSY), including inversions, deletions, insertions, duplications and translocations, showing the dynamic evolutionary process on the MSY after recombination ceased. DNA sequence expansion was documented in the two regions of the MSY, demonstrating that the cytologically homomorphic sex chromosomes are heteromorphic at the molecular level. Analysis of sequence divergence between four X and Y(h) gene pairs resulted in a estimated age of divergence of between 0.5 and 2.2 million years, supporting a recent origin of the papaya sex chromosomes. Our findings indicate that sex chromosomes did not evolve at the family level in Caricaceae, and reinforce the theory that sex chromosomes evolve at the species level in some lineages.

Pressurized bellows flat contact heat exchanger interface

NASA Technical Reports Server (NTRS)

Voss, Fred E. (Inventor); Howell, Harold R. (Inventor); Winkler, Roger V. (Inventor)

1990-01-01

Disclosed is an interdigitated plate-type heat exchanger interface. The interface includes a modular interconnect to thermally connect a pair or pairs of plate-type heat exchangers to a second single or multiple plate-type heat exchanger. The modular interconnect comprises a series of parallel, plate-type heat exchangers arranged in pairs to form a slot therebetween. The plate-type heat exchangers of the second heat exchanger insert into the slots of the modular interconnect. Bellows are provided between the pairs of fins of the modular interconnect so that when the bellows are pressurized, they drive the plate-type heat exchangers of the modular interconnect toward one another, thus closing upon the second heat exchanger plates. Each end of the bellows has a part thereof a thin, membrane diaphragm which readily conforms to the contours of the heat exchanger plates of the modular interconnect when the bellows is pressurized. This ensures an even distribution of pressure on the heat exchangers of the modular interconnect thus creating substantially planar contact between the two heat exchangers. The effect of the interface of the present invention is to provide a dry connection between two heat exchangers whereby the rate of heat transfer can be varied by varying the pressure within the bellows.

Lineages of Streptococcus equi ssp. equi in the Irish equine industry.

PubMed

Moloney, Emma; Kavanagh, Kerrie S; Buckley, Tom C; Cooney, Jakki C

2013-01-01

Streptococcus equi ssp. equi is the causative agent of 'Strangles' in horses. This is a debilitating condition leading to economic loss, yard closures and cancellation of equestrian events. There are multiple genotypes of S. equi ssp. equi which can cause disease, but to date there has been no systematic study of strains which are prevalent in Ireland. This study identified and classified Streptococcus equi ssp. equi strains isolated from within the Irish equine industry. Two hundred veterinary isolates were subjected to SLST (single locus sequence typing) based on an internal sequence from the seM gene of Streptococcus equi ssp equi. Of the 171 samples which successfully gave an amplicon, 162 samples (137 Irish and 24 UK strains) gave robust DNA sequence information. Analysis of the sequences allowed division of the isolates into 19 groups, 13 of which contain at least 2 isolates and 6 groups containing single isolates. There were 19 positions where a DNA SNP (single nucleotide polymorphism) occurs, and one 3 bp insertion. All groups had multiple (2-8) SNPs. Of the SNPs 17 would result in an amino acid change in the encoded protein. Interestingly, the single isolate EI8, which has 6 SNPs, has the three base pair insertion which is not seen in any other isolate, this would result in the insertion of an Ile residue at position 62 in that protein sequence. Comparison of the relevant region in the determined sequences with the UK Streptococcus equi seM MLST database showed that Group B (15 isolates) and Group I (2 isolates), as well as the individual isolates EI3 and EI8, are unique to Ireland, and some groups are most likely of UK origin (Groups F and M), but many more probably passed back and forth between the two countries. The strains occurring in Ireland are not clonal and there is a considerable degree of sequence variation seen in the seM gene. There are two major clades causing infection in Ireland and these strains are also common in the UK.

SU-E-J-17: Evaluation of Metal Artifact Reduction in MVCTs Using a Model Based Image Reconstruction Method.

PubMed

Paudel, M; MacKenzie, M; Fallone, B; Rathee, S

2012-06-01

To evaluate the performance of a model based image reconstruction in reducing metal artifacts in MVCT systems, and to compare with filtered-back projection (FBP) technique. Iterative maximum likelihood polychromatic algorithm for CT (IMPACT) is used with pair/triplet production process and the energy dependent response of detectors. The beam spectra for in-house bench-top and TomotherapyTM MVCT are modelled for use in IMPACT. The energy dependent gain of detectors is calculated using a constrained optimization technique and measured attenuation produced by 0 - 24 cm thick solid water slabs. A cylindrical (19 cm diameter) plexiglass phantom containing various central cylindrical inserts (relative electron density of 0.28-1.69) between two steel rods (2 cm diameter) is scanned in the bench-top [the bremsstrahlung radiation from 6 MeV electron beam passed through 4 cm solid water on the Varian Clinac 2300C] and TomotherapyTM MVCTs. The FBP reconstructs images from raw signal normalised to air scan and corrected for beam hardening using a uniform plexi-glass cylinder (20 cm diameter). IMPACT starts with FBP reconstructed seed image and reconstructs final image at 1.25 MeV in 150 iterations. FBP produces a visible dark shading in the image between two steel rods that becomes darker with higher density central insert causing 5-8 % underestimation of electron density compared to the case without the steel rods. In the IMPACT image the dark shading connecting the steel rods is nearly removed and the uniform background restored. The average attenuation coefficients of the inserts and the background are very close to the corresponding theoretical values at 1.25 MeV. The dark shading metal artifact due to beam hardening can be removed in MVCT using the iterative reconstruction algorithm such as IMPACT. However, the accurate modelling of detectors' energy dependent response and physical processes are crucial for successful implementation. Funding support for the research is obtained from "Vanier Canada Graduate Scholarship" and "Canadian Institute of Health Research". © 2012 American Association of Physicists in Medicine.

Lineages of Streptococcus equi ssp. equi in the Irish equine industry

PubMed Central

2013-01-01

Background Streptococcus equi ssp. equi is the causative agent of ‘Strangles’ in horses. This is a debilitating condition leading to economic loss, yard closures and cancellation of equestrian events. There are multiple genotypes of S. equi ssp. equi which can cause disease, but to date there has been no systematic study of strains which are prevalent in Ireland. This study identified and classified Streptococcus equi ssp. equi strains isolated from within the Irish equine industry. Results Two hundred veterinary isolates were subjected to SLST (single locus sequence typing) based on an internal sequence from the seM gene of Streptococcus equi ssp equi. Of the 171 samples which successfully gave an amplicon, 162 samples (137 Irish and 24 UK strains) gave robust DNA sequence information. Analysis of the sequences allowed division of the isolates into 19 groups, 13 of which contain at least 2 isolates and 6 groups containing single isolates. There were 19 positions where a DNA SNP (single nucleotide polymorphism) occurs, and one 3 bp insertion. All groups had multiple (2–8) SNPs. Of the SNPs 17 would result in an amino acid change in the encoded protein. Interestingly, the single isolate EI8, which has 6 SNPs, has the three base pair insertion which is not seen in any other isolate, this would result in the insertion of an Ile residue at position 62 in that protein sequence. Comparison of the relevant region in the determined sequences with the UK Streptococcus equi seM MLST database showed that Group B (15 isolates) and Group I (2 isolates), as well as the individual isolates EI3 and EI8, are unique to Ireland, and some groups are most likely of UK origin (Groups F and M), but many more probably passed back and forth between the two countries. Conclusions The strains occurring in Ireland are not clonal and there is a considerable degree of sequence variation seen in the seM gene. There are two major clades causing infection in Ireland and these strains are also common in the UK. PMID:23731628

CE: Original Research: Does Certification in Vascular Access Matter? An Analysis of the PICC1 Survey.

PubMed

Chopra, Vineet; Kuhn, Latoya; Vaughn, Valerie; Ratz, David; Winter, Suzanne; Moureau, Nancy; Meyer, Britt; Krein, Sarah

2017-12-01

: Background: Although certification by an accredited agency is often a practice prerequisite in health care, it is not required of vascular access specialists who insert peripherally inserted central catheters (PICCs). Whether certification is associated with differences in practice among inserters is unknown. The purpose of this study was to gather information regarding whether certified and noncertified PICC inserters differ with respect to their practices and views about PICC use. We conducted a national survey of vascular access specialists, identifying certified PICC inserters as those who had received board certification from the Association for Vascular Access, the Infusion Nurses Society, or both. The 76-item survey asked about PICC policies and procedures at respondents' facilities, use of insertion technologies, device management, management of complications, perceptions about PICC use, and relationships with other health care providers. Additional data about respondents, including years in practice and primary practice settings, were also gathered. Bivariable comparisons were made using χ tests; two-sided α with P ≤ 0.05 was considered statistically significant. Of the 1,450 respondents in the final sample, 1,007 (69%) said they were certified inserters and 443 (31%) said they were not. Significantly higher percentages of certified than noncertified inserters reported having practiced for five or more years (78% versus 54%) and having placed 1,000 or more PICCs (58% versus 32%). Significantly more certified than noncertified inserters also reported being the vascular access lead for their facility (56% versus 44%). Reported practice patterns for insertion, care, and management of PICCs varied based on certification status. Some evidence-based practices (such as the use of ultrasound to measure catheter-to-vein ratios) were more often reported by certified inserters, while others (such as the use of maximal sterile barriers during PICC insertion) were not. Asked about their perceptions of PICC use at their institution, certified inserters reported higher percentages of inappropriate insertion and removal than noncertified inserters. Certified PICC inserters appear to be a distinct group of vascular access specialists. A better understanding of how and why practices differ between certified and noncertified inserters is necessary to ensuring safer, high-quality patient care.

The transport of extremely low-frequency electrical signals through an acupuncture meridian compared to nonmeridian tissue.

PubMed

Spaulding, Keith; Chamberlin, Kent

2011-02-01

This study investigated the manner in which extremely low-frequency (ELF) electrical energy is transported through biologic tissues, focusing on the differences between an acupuncture meridian and nonmeridian tissues. Using inserted needles as the electrodes, the energy transport properties of the Large Intestine (LI) meridian were compared to a control channel that had the same length as the meridian channel and comprised similar soft tissue. Twenty (20) participants were tested at the University of New Hampshire, Durham, with ages ranging from 22 to 60 years old. A Gaussian pulse with spectral energy extending into the kilohertz range was launched using a low-impedance amplifier at the distal point on either the LI meridian or a nearby control channel. The signal launched was measured at the proximal point using a high-impedance instrumentation amplifier. The ground reference for both the launch and receiver locations was a needle inserted in the lower leg. After taking the Fast Fourier Transform, power spectral measurements were calculated, giving a single value representing power density of the measured potential in the 2-100-Hz range. A paired, two-sided signed rank test was performed. For the data pairs in this study, p = 0.035, indicating that they are dissimilar with a statistical significance. The ELF electric energy is transported somewhat more efficiently through the LI meridian compared to a nonmeridian control. The results were not dramatic, with some participants giving greater values on the control channel, but they were statistically significant.

Acid-triggered membrane insertion of Pseudomonas exotoxin A involves an original mechanism based on pH-regulated tryptophan exposure.

PubMed

Méré, Jocelyn; Morlon-Guyot, Juliette; Bonhoure, Anne; Chiche, Laurent; Beaumelle, Bruno

2005-06-03

Exposure to low endosomal pH during internalization of Pseudomonas exotoxin A (PE) triggers membrane insertion of its translocation domain. This process is a prerequisite for PE translocation to the cytosol where it inactivates protein synthesis. Although hydrophobic helices enable membrane insertion of related bacterial toxins such as diphtheria toxin, the PE translocation domain is devoid of hydrophobic stretches and the structural features triggering acid-induced membrane insertion of PE are not known. Here we have identified a molecular device that enables PE membrane insertion. This process is promoted by exposure of a key tryptophan residue. At neutral pH, this Trp is buried in a hydrophobic pocket closed by the smallest alpha-helix of the translocation domain. Upon acidification, protonation of the Asp that is the N-cap residue of the helix leads to its destabilization, enabling Trp side chain insertion into the endosome membrane. This tryptophan-based membrane insertion system is surprisingly similar to the membrane-anchoring mechanism of human annexin-V and could be used by other proteins as well.

Predicting knee replacement damage in a simulator machine using a computational model with a consistent wear factor.

PubMed

Zhao, Dong; Sakoda, Hideyuki; Sawyer, W Gregory; Banks, Scott A; Fregly, Benjamin J

2008-02-01

Wear of ultrahigh molecular weight polyethylene remains a primary factor limiting the longevity of total knee replacements (TKRs). However, wear testing on a simulator machine is time consuming and expensive, making it impractical for iterative design purposes. The objectives of this paper were first, to evaluate whether a computational model using a wear factor consistent with the TKR material pair can predict accurate TKR damage measured in a simulator machine, and second, to investigate how choice of surface evolution method (fixed or variable step) and material model (linear or nonlinear) affect the prediction. An iterative computational damage model was constructed for a commercial knee implant in an AMTI simulator machine. The damage model combined a dynamic contact model with a surface evolution model to predict how wear plus creep progressively alter tibial insert geometry over multiple simulations. The computational framework was validated by predicting wear in a cylinder-on-plate system for which an analytical solution was derived. The implant damage model was evaluated for 5 million cycles of simulated gait using damage measurements made on the same implant in an AMTI machine. Using a pin-on-plate wear factor for the same material pair as the implant, the model predicted tibial insert wear volume to within 2% error and damage depths and areas to within 18% and 10% error, respectively. Choice of material model had little influence, while inclusion of surface evolution affected damage depth and area but not wear volume predictions. Surface evolution method was important only during the initial cycles, where variable step was needed to capture rapid geometry changes due to the creep. Overall, our results indicate that accurate TKR damage predictions can be made with a computational model using a constant wear factor obtained from pin-on-plate tests for the same material pair, and furthermore, that surface evolution method matters only during the initial "break in" period of the simulation.

[A study of PDE6B gene mutation and phenotype in Chinese cases with retinitis pigmentosa].

PubMed

Cui, Yun; Zhao, Kan-xing; Wang, Li; Wang, Qing; Zhang, Wei; Chen, Wei-ying; Wang, Li-ming

2003-01-01

To identify the mutation spectrum of phosphodiesterase beta subunit (PDE6B) gene, the incidence in Chinese patients with retinitis pigmentosa (RP) and their clinical phenotypic characteristics. Screening of mutations within PDE6B gene was performed using polymerase chain reaction-heteroduplex-single strand conformation polymorphism (PCR-SSCP) and DNA sequence in 35 autosomal recessive (AR) RP and 55 sporadic RP cases. The phenotypes of the patients with the gene mutation were examined and analyzed. Novel complex heterozygous variants of PDE6B gene in a sporadic case, a T to C transversion in codon 323 resulting in the substitution of Gly by Ser and 2 base pairs (bp: G and T) insert between the 27th-28th bp upstream of the 5'-end of exon 10 were both present in a same isolate RP. But they are not found in 100 unrelated healthy individuals. Ocular findings showed diffuse pigmentary retinal degeneration in the midperipheral and peripheral fundi, optic atrophy and vessel attenuation. Multi-focal ERG indicated that the rod function was more severely deteriorated. A mutation was found in a case with RP in a ARRP family, a G to A transversion at 19th base upstream 5'-end of exon 11 (within intron 10) of PDE6B gene. A sporadic RP carried a sequence variant of PDE6B gene, a G to C transition, at the 15th base adjacent to the 3'-end of exon l8. In another isolate case with RP was found 2 bp (GT) insert between 31st and 32nd base upstream 5'-end of exon 4 (in intron 3) of PDE6B gene. There are novel complex heterozygous mutations of PDE6B gene responsible for a sporadic RP patient in China. This gene mutation associated with rod deterioration and RP. Several DNA variants were found in introns of PDE6B gene in national population.

Composition and structure of porcine digital flexor tendon-bone insertion tissues.

PubMed

Chandrasekaran, Sandhya; Pankow, Mark; Peters, Kara; Huang, Hsiao-Ying Shadow

2017-11-01

Tendon-bone insertion is a functionally graded tissue, transitioning from 200 MPa tensile modulus at the tendon end to 20 GPa tensile modulus at the bone, across just a few hundred micrometers. In this study, we examine the porcine digital flexor tendon insertion tissue to provide a quantitative description of its collagen orientation and mineral concentration by using Fast Fourier Transform (FFT) based image analysis and mass spectrometry, respectively. Histological results revealed uniformity in global collagen orientation at all depths, indicative of mechanical anisotropy, although at mid-depth, the highest fiber density, least amount of dispersion, and least cellular circularity were evident. Collagen orientation distribution obtained through 2D FFT of histological imaging data from fluorescent microscopy agreed with past measurements based on polarized light microscopy. Results revealed global fiber orientation across the tendon-bone insertion to be preserved along direction of physiologic tension. Gradation in the fiber distribution orientation index across the insertion was reflective of a decrease in anisotropy from the tendon to the bone. We provided elemental maps across the fibrocartilage for its organic and inorganic constituents through time-of-flight secondary ion mass spectrometry (TOF-SIMS). The apatite intensity distribution from the tendon to bone was shown to follow a linear trend, supporting past results based on Raman microprobe analysis. The merit of this study lies in the image-based simplified approach to fiber distribution quantification and in the high spatial resolution of the compositional analysis. In conjunction with the mechanical properties of the insertion tissue, fiber, and mineral distribution results for the insertion from this may potentially be incorporated into the development of a structural constitutive approach toward computational modeling. Characterizing the properties of the native insertion tissue would provide the microstructural basis for developing biomimetic scaffolds to recreate the graded morphology of a fibrocartilaginous insertion. © 2017 Wiley Periodicals, Inc. J Biomed Mater Res Part A: 105A: 3050-3058, 2017. © 2017 Wiley Periodicals, Inc.

Effectiveness of the surgical torque limiter: a model comparing drill- and hand-based screw insertion into locking plates.

PubMed

Ioannou, Christopher; Knight, Matthew; Daniele, Luca; Flueckiger, Lee; Tan, Ezekiel S L

2016-10-17

The objective of this study is to analyse the effectiveness of the surgical torque limiter during operative use. The study also investigates the potential differences in torque between hand and drill-based screw insertion into locking plates using a standardised torque limiter. Torque for both hand and power screw insertion was measured through a load cell, registering 6.66 points per second. This was performed in a controlled environment using synthetic bone, a locking plate and locking screws to simulate plate fixation. Screws were inserted by hand and by drill with torque values measured. The surgical torque limiter (1.5 Nm) was effective as the highest recorded reading in the study was 1.409 Nm. Comparatively, there is a statistically significant difference between screw insertion methods. Torque produced for manually driven screw insertion into locking plates was 1.289 Nm (95 % CI 1.269-1.308) with drill-powered screw insertion at 0.740 Nm (95 % CI 0.723-0.757). The surgical torque limiter proved to be effective as per product specifications. Screws inserted under power produce significantly less torque when compared to manual insertion by hand. This is likely related to the mechanism of the torque limiter when being used at higher speeds for which it was designed. We conclude that screws may be inserted using power to the plate with the addition of a torque limiter. It is recommended that all screws inserted by drill be hand tightened to achieve adequate torque values.

Shoe inserts and orthotics for sport and physical activities.

PubMed

Nigg, B M; Nurse, M A; Stefanyshyn, D J

1999-07-01

The purposes of this paper were to discuss the perceived benefits of inserts and orthotics for sport activities and to propose a new concept for inserts and orthotics. There is evidence that inserts or orthotics reduce or prevent movement-related injuries. However, there is limited knowledge about the specific functioning an orthotic or insert provides. The same orthotic or insert is often proposed for different problems. Changes in skeletal movement due to inserts or orthotics seem to be small and not systematic. Based on the results of a study using bone pins, one may question the idea that a major function of orthotics or inserts consists in aligning the skeleton. Impact cushioning with shoe inserts or orthotics is typically below 10%. Such small reductions might not be important for injury reduction. It has been suggested that changes in material properties might produce adjustments in the muscular response of the locomotor system. The foot has various sensors to detect input signals with subject specific thresholds. Subjects with similar sensitivity threshold levels seem to respond in their movement pattern in a similar way. Comfort is an important variable. From a biomechanical point of view, comfort may be related to fit, additional stabilizing muscle work, fatigue, and damping of soft tissue vibrations. Based on the presented evidence, the concept of minimizing muscle work is proposed when using orthotics or inserts. A force signal acts as an input variable on the shoe. The shoe sole acts as a first filter, the insert or orthotic as a second filter, the plantar surface of the foot as a third filter for the force input signal. The filtered information is transferred to the central nervous system that provides a subject specific dynamic response. The subject performs the movement for the task at hand. For a given movement task, the skeleton has a preferred path. If an intervention supports/counteracts the preferred movement path, muscle activity can/must be reduced/increased. Based on this concept, an optimal insert or orthotic would reduce muscle activity, feel comfortable, and should increase performance.

Synthesis and binding properties of new selective ligands for the nucleobase opposite the AP site.

PubMed

Abe, Yukiko; Nakagawa, Osamu; Yamaguchi, Rie; Sasaki, Shigeki

2012-06-01

DNA is continuously damaged by endogenous and exogenous factors such as oxidative stress or DNA alkylating agents. These damaged nucleobases are removed by DNA N-glycosylase and form apurinic/apyrimidinic sites (AP sites) as intermediates in the base excision repair (BER) pathway. AP sites are also representative DNA damages formed by spontaneous hydrolysis. The AP sites block DNA polymerase and a mismatch nucleobase is inserted opposite the AP sites by polymerization to cause acute toxicities and mutations. Thus, AP site specific compounds have attracted much attention for therapeutic and diagnostic purposes. In this study, we have developed nucleobase-polyamine conjugates as the AP site binding ligand by expecting that the nucleobase part would play a role in the specific recognition of the nucleobase opposite the AP site by the Watson-Crick base pair formation and that the polyamine part should contribute to the access of the ligand to the AP site by a non-specific interaction to the DNA phosphate backbone. The nucleobase conjugated with 3,3'-diaminodipropylamine (A-ligand, G-ligand, C-ligand, T-ligand and U-ligand) showed a specific stabilization of the duplex containing the AP site depending on the complementary combination with the nucleobase opposite the AP site; that is A-ligand to T, G-ligand to C, C-ligand to G, T- and U-ligand to A. The thermodynamic binding parameters clearly indicated that the specific stabilization is due to specific binding of the ligands to the complementary AP site. These results have suggested that the complementary base pairs of the Watson-Crick type are formed at the AP site. Copyright © 2012 Elsevier Ltd. All rights reserved.

Lack of association between temporal lobe epilepsy and a novel polymorphism in the alpha 2 subunit gene (ATP1A2) of the sodium potassium transporting ATPase.

PubMed

Buono, R J; Ferraro, T N; O'Connor, M J; Sperling, M R; Abbey, M; Finanger, E; Lohoff, F; Mulholland, N; Berrettini, W H

2000-02-07

Genetic linkage studies in rodents and humans have identified specific chromosomal regions harboring seizure susceptibility genes. We have identified a novel polymorphism in the human alpha 2 subunit gene (ATP1A2) of the sodium potassium transporting ATPase (NaK-pump), a candidate gene for human temporal lobe epilepsy (TLE) based on its chromosomal location and function in ion homeostasis. The polymorphism consists of a four base pair insertion 12 base pairs upstream of the start of exon 2. We performed an association study between this polymorphism and TLE. Our study did not find a significant difference in the frequency of this polymorphism between TLE patients and controls, indicating that this variation is not a major susceptibility factor. However, since the number of patients studied so far is small and the functional consequence of the polymorphism is unknown, the variation may yet be found to play a minor role in increased risk for seizure susceptibility. In contrast to the findings in TLE patients and controls, we did find a significant difference in the frequency of the variation between African Americans and persons of European descent. This finding demonstrates the potential effect of population stratification on studies of this type and supports the growing use of parental and familial samples for controls in association studies. Further study of this polymorphism is warranted as it may be involved in other disease processes for which there are known ethnic-specific susceptibilities. Am. J. Med. Genet. (Neuropsychiatr. Genet.) 96:79-83, 2000. Copyright 2000 Wiley-Liss, Inc.

Rule-based support system for multiple UMLS semantic type assignments

PubMed Central

Geller, James; He, Zhe; Perl, Yehoshua; Morrey, C. Paul; Xu, Julia

2012-01-01

Background When new concepts are inserted into the UMLS, they are assigned one or several semantic types from the UMLS Semantic Network by the UMLS editors. However, not every combination of semantic types is permissible. It was observed that many concepts with rare combinations of semantic types have erroneous semantic type assignments or prohibited combinations of semantic types. The correction of such errors is resource-intensive. Objective We design a computational system to inform UMLS editors as to whether a specific combination of two, three, four, or five semantic types is permissible or prohibited or questionable. Methods We identify a set of inclusion and exclusion instructions in the UMLS Semantic Network documentation and derive corresponding rule-categories as well as rule-categories from the UMLS concept content. We then design an algorithm adviseEditor based on these rule-categories. The algorithm specifies rules for an editor how to proceed when considering a tuple (pair, triple, quadruple, quintuple) of semantic types to be assigned to a concept. Results Eight rule-categories were identified. A Web-based system was developed to implement the adviseEditor algorithm, which returns for an input combination of semantic types whether it is permitted, prohibited or (in a few cases) requires more research. The numbers of semantic type pairs assigned to each rule-category are reported. Interesting examples for each rule-category are illustrated. Cases of semantic type assignments that contradict rules are listed, including recently introduced ones. Conclusion The adviseEditor system implements explicit and implicit knowledge available in the UMLS in a system that informs UMLS editors about the permissibility of a desired combination of semantic types. Using adviseEditor might help accelerate the work of the UMLS editors and prevent erroneous semantic type assignments. PMID:23041716

Estimating needle tip deflection in biological tissue from a single transverse ultrasound image: application to brachytherapy.

PubMed

Rossa, Carlos; Sloboda, Ron; Usmani, Nawaid; Tavakoli, Mahdi

2016-07-01

This paper proposes a method to predict the deflection of a flexible needle inserted into soft tissue based on the observation of deflection at a single point along the needle shaft. We model the needle-tissue as a discretized structure composed of several virtual, weightless, rigid links connected by virtual helical springs whose stiffness coefficient is found using a pattern search algorithm that only requires the force applied at the needle tip during insertion and the needle deflection measured at an arbitrary insertion depth. Needle tip deflections can then be predicted for different insertion depths. Verification of the proposed method in synthetic and biological tissue shows a deflection estimation error of [Formula: see text]2 mm for images acquired at 35 % or more of the maximum insertion depth, and decreases to 1 mm for images acquired closer to the final insertion depth. We also demonstrate the utility of the model for prostate brachytherapy, where in vivo needle deflection measurements obtained during early stages of insertion are used to predict the needle deflection further along the insertion process. The method can predict needle deflection based on the observation of deflection at a single point. The ultrasound probe can be maintained at the same position during insertion of the needle, which avoids complications of tissue deformation caused by the motion of the ultrasound probe.

Report on Pairing-based Cryptography.

PubMed

Moody, Dustin; Peralta, Rene; Perlner, Ray; Regenscheid, Andrew; Roginsky, Allen; Chen, Lily

2015-01-01

This report summarizes study results on pairing-based cryptography. The main purpose of the study is to form NIST's position on standardizing and recommending pairing-based cryptography schemes currently published in research literature and standardized in other standard bodies. The report reviews the mathematical background of pairings. This includes topics such as pairing-friendly elliptic curves and how to compute various pairings. It includes a brief introduction to existing identity-based encryption (IBE) schemes and other cryptographic schemes using pairing technology. The report provides a complete study of the current status of standard activities on pairing-based cryptographic schemes. It explores different application scenarios for pairing-based cryptography schemes. As an important aspect of adopting pairing-based schemes, the report also considers the challenges inherent in validation testing of cryptographic algorithms and modules. Based on the study, the report suggests an approach for including pairing-based cryptography schemes in the NIST cryptographic toolkit. The report also outlines several questions that will require further study if this approach is followed.

Report on Pairing-based Cryptography

PubMed Central

Moody, Dustin; Peralta, Rene; Perlner, Ray; Regenscheid, Andrew; Roginsky, Allen; Chen, Lily

2015-01-01

This report summarizes study results on pairing-based cryptography. The main purpose of the study is to form NIST’s position on standardizing and recommending pairing-based cryptography schemes currently published in research literature and standardized in other standard bodies. The report reviews the mathematical background of pairings. This includes topics such as pairing-friendly elliptic curves and how to compute various pairings. It includes a brief introduction to existing identity-based encryption (IBE) schemes and other cryptographic schemes using pairing technology. The report provides a complete study of the current status of standard activities on pairing-based cryptographic schemes. It explores different application scenarios for pairing-based cryptography schemes. As an important aspect of adopting pairing-based schemes, the report also considers the challenges inherent in validation testing of cryptographic algorithms and modules. Based on the study, the report suggests an approach for including pairing-based cryptography schemes in the NIST cryptographic toolkit. The report also outlines several questions that will require further study if this approach is followed. PMID:26958435

Efficiency and droop improvement in a blue InGaN-based light emitting diode with a p-InGaN layer inserted in the GaN barriers

NASA Astrophysics Data System (ADS)

Wang, Xing-Fu; Tong, Jin-Hui; Zhao, Bi-Jun; Chen, Xin; Ren, Zhi-Wei; Li, Dan-Wei; Zhuo, Xiang-Jing; Zhang, Jun; Yi, Han-Xiang; Li, Shu-Ti

2013-09-01

The advantages of a blue InGaN-based light-emitting diode with a p-InGaN layer inserted in the GaN barriers is studied. The carrier concentration in the quantum well, radiative recombination rate in the active region, output power, and internal quantum efficiency are investigated. The simulation results show that the InGaN-based light-emitting diode with a p-InGaN layer inserted in the barriers has better performance over its conventional counterpart and the light emitting diode with p-GaN inserted in the barriers. The improvement is due to enhanced Mg acceptor activation and enhanced hole injection into the quantum wells.

Torsional Dynamics of Steerable Needles: Modeling and Fluoroscopic Guidance

PubMed Central

Swensen, John P.; Lin, MingDe; Okamura, Allison M.; Cowan, Noah J.

2017-01-01

Needle insertions underlie a diversity of medical interventions. Steerable needles provide a means by which to enhance existing needle-based interventions and facilitate new ones. Tip-steerable needles follow a curved path and can be steered by twisting the needle base during insertion, but this twisting excites torsional dynamics that introduce a discrepancy between the base and tip twist angles. Here, we model the torsional dynamics of a flexible rod—such as a tip-steerable needle—during subsurface insertion and develop a new controller based on the model. The torsional model incorporates time-varying mode shapes to capture the changing boundary conditions inherent during insertion. Numerical simulations and physical experiments using two distinct setups—stereo camera feedback in semi-transparent artificial tissue and feedback control with real-time X-ray imaging in optically opaque artificial tissue— demonstrate the need to account for torsional dynamics in control of the needle tip. PMID:24860026

[The ISP (Safe Insertion of PICCs) protocol: a bundle of 8 recommendations to minimize the complications related to the peripherally inserted central venous catheters (PICC)].

PubMed

Emoli, Alessandro; Cappuccio, Serena; Marche, Bruno; Musarò, Andrea; Scoppettuolo, Giancarlo; Pittiruti, Mauro

2014-01-01

The ISP (Safe Insertion of PICCs) protocol: a bundle of 8 recommendations to minimize the complications related to the peripherally inserted central venous catheters (PICC). The insertion of a peripherally inserted central venous catheter (PICC) is not without risks. The Italian Group for the Study of Long-Term Central Venous Access Devices (GAVeCeLT) has developed a protocol (SIP: Safe Implantation of PICCs) with the aim of minimizing the risks which may be associated with the placement of PICCs. The protocol is based on recommendations available in the literature and on the main clinical practice guidelines. The SIP protocol, a bundle of evidence-based recommendations, it is is easy to use, inexpensive, and cost-effective. If routinely used and carefully inplemented, it greatly reduces complications such as failure of venipuncture, accidental arterial puncture, damage of median nerve, infection and catheter related venous thrombosis.

Widespread Transient Hoogsteen Base-Pairs in Canonical Duplex DNA with Variable Energetics

PubMed Central

Alvey, Heidi S.; Gottardo, Federico L.; Nikolova, Evgenia N.; Al-Hashimi, Hashim M.

2015-01-01

Hoogsteen base-pairing involves a 180 degree rotation of the purine base relative to Watson-Crick base-pairing within DNA duplexes, creating alternative DNA conformations that can play roles in recognition, damage induction, and replication. Here, using Nuclear Magnetic Resonance R1ρ relaxation dispersion, we show that transient Hoogsteen base-pairs occur across more diverse sequence and positional contexts than previously anticipated. We observe sequence-specific variations in Hoogsteen base-pair energetic stabilities that are comparable to variations in Watson-Crick base-pair stability, with Hoogsteen base-pairs being more abundant for energetically less favorable Watson-Crick base-pairs. Our results suggest that the variations in Hoogsteen stabilities and rates of formation are dominated by variations in Watson-Crick base pair stability, suggesting a late transition state for the Watson-Crick to Hoogsteen conformational switch. The occurrence of sequence and position-dependent Hoogsteen base-pairs provide a new potential mechanism for achieving sequence-dependent DNA transactions. PMID:25185517

Wireless power delivery for retinal prostheses.

PubMed

Ng, David C; Williams, Chris E; Allen, Penny J; Bai, Shun; Boyd, Clive S; Meffin, Hamish; Halpern, Mark E; Skafidas, Efstratios

2011-01-01

Delivering power to an implanted device located deep inside the body is not trivial. This problem is made more challenging if the implanted device is in constant motion. This paper describes two methods of transferring power wirelessly by means of magnetic induction coupling. In the first method, a pair of transmit and receive coils is used for power transfer over a large distance (compared to their diameter). In the second method, an intermediate pair of coils is inserted in between transmit and receive coils. Comparison between the power transfer efficiency with and without the intermediate coils shows power transfer efficiency to be 11.5 % and 8.8 %, respectively. The latter method is especially suitable for powering implanted devices in the eye due to immunity to movements of the eye and ease of surgery. Using this method, we have demonstrated wireless power delivery into an animal eye.

SINEs, evolution and genome structure in the opossum.

PubMed

Gu, Wanjun; Ray, David A; Walker, Jerilyn A; Barnes, Erin W; Gentles, Andrew J; Samollow, Paul B; Jurka, Jerzy; Batzer, Mark A; Pollock, David D

2007-07-01

Short INterspersed Elements (SINEs) are non-autonomous retrotransposons, usually between 100 and 500 base pairs (bp) in length, which are ubiquitous components of eukaryotic genomes. Their activity, distribution, and evolution can be highly informative on genomic structure and evolutionary processes. To determine recent activity, we amplified more than one hundred SINE1 loci in a panel of 43 M. domestica individuals derived from five diverse geographic locations. The SINE1 family has expanded recently enough that many loci were polymorphic, and the SINE1 insertion-based genetic distances among populations reflected geographic distance. Genome-wide comparisons of SINE1 densities and GC content revealed that high SINE1 density is associated with high GC content in a few long and many short spans. Young SINE1s, whether fixed or polymorphic, showed an unbiased GC content preference for insertion, indicating that the GC preference accumulates over long time periods, possibly in periodic bursts. SINE1 evolution is thus broadly similar to human Alu evolution, although it has an independent origin. High GC content adjacent to SINE1s is strongly correlated with bias towards higher AT to GC substitutions and lower GC to AT substitutions. This is consistent with biased gene conversion, and also indicates that like chickens, but unlike eutherian mammals, GC content heterogeneity (isochore structure) is reinforced by substitution processes in the M. domestica genome. Nevertheless, both high and low GC content regions are apparently headed towards lower GC content equilibria, possibly due to a relative shift to lower recombination rates in the recent Monodelphis ancestral lineage. Like eutherians, metatherian (marsupial) mammals have evolved high CpG substitution rates, but this is apparently a convergence in process rather than a shared ancestral state.

An SRY mutation causing human sex reversal resolves a general mechanism of structure-specific DNA recognition: application to the four-way DNA junction.

PubMed

Peters, R; King, C Y; Ukiyama, E; Falsafi, S; Donahoe, P K; Weiss, M A

1995-04-11

SRY, a genetic "master switch" for male development in mammals, exhibits two biochemical activities: sequence-specific recognition of duplex DNA and sequence-independent binding to the sharp angles of four-way DNA junctions. Here, we distinguish between these activities by analysis of a mutant SRY associated with human sex reversal (46, XY female with pure gonadal dysgenesis). The substitution (168T in human SRY) alters a nonpolar side chain in the minor-groove DNA recognition alpha-helix of the HMG box [Haqq, C.M., King, C.-Y., Ukiyama, E., Haqq, T.N., Falsalfi, S., Donahoe, P.K., & Weiss, M.A. (1994) Science 266, 1494-1500]. The native (but not mutant) side chain inserts between specific base pairs in duplex DNA, interrupting base stacking at a site of induced DNA bending. Isotope-aided 1H-NMR spectroscopy demonstrates that analogous side-chain insertion occurs on binding of SRY to a four-way junction, establishing a shared mechanism of sequence- and structure-specific DNA binding. Although the mutant DNA-binding domain exhibits > 50-fold reduction in sequence-specific DNA recognition, near wild-type affinity for four-way junctions is retained. Our results (i) identify a shared SRY-DNA contact at a site of either induced or intrinsic DNA bending, (ii) demonstrate that this contact is not required to bind an intrinsically bent DNA target, and (iii) rationalize patterns of sequence conservation or diversity among HMG boxes. Clinical association of the I68T mutation with human sex reversal supports the hypothesis that specific DNA recognition by SRY is required for male sex determination.

CORRELATION BETWEEN METAL-CERAMIC BOND STRENGTH AND COEFFICIENT OF LINEAR THERMAL EXPANSION DIFFERENCE

PubMed Central

Lopes, Stella Crosara; Pagnano, Valéria Oliveira; Rollo, João Manuel Domingos de Almeida; Leal, Mônica Barbosa; Bezzon, Osvaldo Luiz

2009-01-01

The purpose of this study was to evaluate the metal-ceramic bond strength (MCBS) of 6 metal-ceramic pairs (2 Ni-Cr alloys and 1 Pd-Ag alloy with 2 dental ceramics) and correlate the MCBS values with the differences between the coefficients of linear thermal expansion (CTEs) of the metals and ceramics. Verabond (VB) Ni-Cr-Be alloy, Verabond II (VB2), Ni-Cr alloy, Pors-on 4 (P), Pd-Ag alloy, and IPS (I) and Duceram (D) ceramics were used for the MCBS test and dilatometric test. Forty-eight ceramic rings were built around metallic rods (3.0 mm in diameter and 70.0 mm in length) made from the evaluated alloys. The rods were subsequently embedded in gypsum cast in order to perform a tensile load test, which enabled calculating the CMBS. Five specimens (2.0 mm in diameter and 12.0 mm in length) of each material were made for the dilatometric test. The chromel-alumel thermocouple required for the test was welded into the metal test specimens and inserted into the ceramics. ANOVA and Tukey's test revealed significant differences (p=0.01) for the MCBS test results (MPa), with PI showing higher MCBS (67.72) than the other pairs, which did not present any significant differences. The CTE (10-6 °C-1) differences were: VBI (0.54), VBD (1.33), VB2I (-0.14), VB2D (0.63), PI (1.84) and PD (2.62). Pearson's correlation test (r=0.17) was performed to evaluate of correlation between MCBS and CTE differences. Within the limitations of this study and based on the obtained results, there was no correlation between MCBS and CTE differences for the evaluated metal-ceramic pairs. PMID:19274398

Objective image characterization of a spectral CT scanner with dual-layer detector

NASA Astrophysics Data System (ADS)

Ozguner, Orhan; Dhanantwari, Amar; Halliburton, Sandra; Wen, Gezheng; Utrup, Steven; Jordan, David

2018-01-01

This work evaluated the performance of a detector-based spectral CT system by obtaining objective reference data, evaluating attenuation response of iodine and accuracy of iodine quantification, and comparing conventional CT and virtual monoenergetic images in three common phantoms. Scanning was performed using the hospital’s clinical adult body protocol. Modulation transfer function (MTF) was calculated for a tungsten wire and visual line pair targets were evaluated. Image noise power spectrum (NPS) and pixel standard deviation were calculated. MTF for monoenergetic images agreed with conventional images within 0.05 lp cm-1. NPS curves indicated that noise texture of 70 keV monoenergetic images is similar to conventional images. Standard deviation measurements showed monoenergetic images have lower noise except at 40 keV. Mean CT number and CNR agreed with conventional images at 75 keV. Measured iodine concentration agreed with true concentration within 6% for inserts at the center of the phantom. Performance of monoenergetic images at detector based spectral CT is the same as, or better than, that of conventional images. Spectral acquisition and reconstruction with a detector based platform represents the physical behaviour of iodine as expected and accurately quantifies the material concentration.

VARIABLE AREA CONTROL ROD FOR NUCLEAR REACTOR

DOEpatents

Huston, N.E.

1960-05-01

A control rod is described which permits continual variation of its absorbing strength uniformly along the length of the rod. The rod is fail safe and is fully inserted into the core but changes in its absorbing strength do not produce axial flux distortion. The control device comprises a sheet containing a material having a high thermal-neutron absorption cross section. A pair of shafts engage the sheet along the longitudinal axis of the shafts and gears associated with the shafts permit winding and unwinding of the sheet around the shafts.

LINE-ABOVE-GROUND ATTENUATOR

DOEpatents

Wilds, R.B.; Ames, J.R.

1957-09-24

The line-above-ground attenuator provides a continuously variable microwave attenuator for a coaxial line that is capable of high attenuation and low insertion loss. The device consists of a short section of the line-above- ground plane type transmission lime, a pair of identical rectangular slabs of lossy material like polytron, whose longitudinal axes are parallel to and indentically spaced away from either side of the line, and a geared mechanism to adjust amd maintain this spaced relationship. This device permits optimum fineness and accuracy of attenuator control which heretofore has been difficult to achieve.

Low-noise nozzle valve

NASA Technical Reports Server (NTRS)

Gwin, Hal S. (Inventor); Aaron, James (Inventor)

1990-01-01

A low noise, variable discharage area, valve is constructed having opposed recesses within which a pair of gates are slidably disposed. Each of the gates is provided with upstream edges having a radius thereon, the radius enabling smooth, accelerated, low noise flow therebetween. The gates are further provided with tracks along each side, which in turn slide along splines set in the side walls of the valve. A threaded rod which rotates in a threaded insert in a rear wall of each of the gates, serves to move the gates within their respective recesses.

Identification and characterization of RAPD-SCAR markers linked to glyphosate-susceptible and -resistant biotypes of Eleusine indica (L.) Gaertn.

PubMed

Cha, Thye San; Anne-Marie, Kaben; Chuah, Tse Seng

2014-02-01

Eleusine indica is one of the most common weed species found in agricultural land worldwide. Although herbicide-glyphosate provides good control of the weed, its frequent uses has led to abundant reported cases of resistance. Hence, the development of genetic markers for quick detection of glyphosate-resistance in E. indica population is imperative for the control and management of the weed. In this study, a total of 14 specific random amplified polymorphic DNA (RAPD) markers were identified and two of the markers, namely S4R727 and S26R6976 were further sequence characterized. Sequence alignment revealed that marker S4R727 showing a 12-bp nucleotides deletion in resistant biotypes, while marker S26R6976 contained a 167-bp nucleotides insertion in the resistant biotypes. Based on these sequence differences, three pairs of new sequence characterized amplified region (SCAR) primers were developed. The specificity of these primer pairs were further validated with genomic DNA extracted from ten individual plants of one glyphosate-susceptible and five glyphosate-resistant (R2, R4, R6, R8 and R11) populations. The resulting RAPD-SCAR markers provided the basis for assessing genetic diversity between glyphosate-susceptible and -resistant E. indica biotypes, as well for the identification of genetic locus link to glyphosate-resistance event in the species.

Expression of Osmotin-Like Genes in the Halophyte Atriplex nummularia L.

PubMed

Casas, A M; Nelson, D E; Raghothama, K G; D'Urzo, M P; Singh, N K; Bressan, R A; Hasegawa, P M

1992-05-01

A peptide (molecular mass 50 kilodaltons) that is immunologically related to tobacco osmotin was detected in cells of the halophyte Atriplex nummularia. This protein was constitutively expressed in both unadapted and NaCl-adapted cells. A predominant osmotin-like peptide (molecular mass 24 kilodaltons) was also found in culture media after cell growth. Two unique A. nummularia cDNA clones, pA8 and pA9, encoding osmotin-like proteins have been isolated. The pA8 and pA9 inserts are 952 and 792 base pairs and encode peptides of 222 and 224 amino acids, respectively. The peptide deduced from pA8 has a molecular mass of 23,808 daltons and theoretical isoelectric point of 8.31, whereas the peptide derived from pA9 has a molecular mass of 23,827 daltons and an isoelectric point of 6.88. Unique transcripts were detected by the inserts of the cDNA clones, two (1.2 and 1.0 kilobases) by pA8 and one (0.9 kilobase) by pA9. The pA8 transcripts were constitutively accumulated in unadapted and NaCl-adapted cells, whereas the mRNA levels were up-regulated by abscisic acid treatment. The level of pA9 mRNA was induced by NaCl treatment and increased in cells as a function of NaCl adaptation. Southern analysis of the genomic DNA indicated the presence of osmotin-like multigene families in A. nummularia.

Lipophilic oligonucleotides spontaneously insert into lipid membranes, bind complementary DNA strands, and sequester into lipid-disordered domains.

PubMed

Bunge, Andreas; Kurz, Anke; Windeck, Anne-Kathrin; Korte, Thomas; Flasche, Wolfgang; Liebscher, Jürgen; Herrmann, Andreas; Huster, Daniel

2007-04-10

For the development of surface functionalized bilayers, we have synthesized lipophilic oligonucleotides to combine the molecular recognition mechanism of nucleic acids and the self-assembly characteristics of lipids in planar membranes. A lipophilic oligonucleotide consisting of 21 thymidine units and two lipophilic nucleotides with an alpha-tocopherol moiety as a lipophilic anchor was synthesized using solid-phase methods with a phosphoramadite strategy. The interaction of the water soluble lipophilic oligonucleotide with vesicular lipid membranes and its capability to bind complementary DNA strands was studied using complementary methods such as NMR, EPR, DSC, fluorescence spectroscopy, and fluorescence microscopy. This oligonucleotide inserted stably into preformed membranes from the aqueous phase. Thereby, no significant perturbation of the lipid bilayer and its stability was observed. However, the non-lipidated end of the oligonucleotide is exposed to the aqueous environment, is relatively mobile, and is free to interact with complementary DNA strands. Binding of the complementary single-stranded DNA molecules is fast and accomplished by the formation of Watson-Crick base pairs, which was confirmed by 1H NMR chemical shift analysis and fluorescence resonance energy transfer. The molecular structure of the membrane bound DNA double helix is very similar to the free double-stranded DNA. Further, the membrane bound DNA double strands also undergo regular melting. Finally, in raft-like membrane mixtures, the lipophilic oligonucleotide was shown to preferentially sequester into liquid-disordered membrane domains.

Transformation of Schwanniomyces occidentalis with an ADE2 gene cloned from S. occidentalis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Klein, R.D.; Favreau, M.A.

1988-12-01

We have developed an efficient transformation system for the industrial yeast Schwanniomyces occidentalis (formerly Schwanniomyces castellii). The transformation system is based on ade2 mutants of S. occidentalis deficient for phosphoribosylaminoimidazole carboxylase that were generated by mutagenesis. As a selectable marker, we isolated and characterized the S. occidentalis ADE2 gene by complementation in an ade2 strain of Saccharomyces cerevisiae. S. occidentalis was transformed with the recombinant plasmid pADE, consisting of a 4.5-kilobase-pair (kbp) DNA fragment from S. occidentalis containing the ADE2 gene inserted into the S. cerevisiae expression vector pYcDE8 by a modification of the spheroplasting procedure of Beggs. Intact plasmidsmore » were recovered in Escherichia coli from whole-cell lysates of ADE+ transformants, indicating that plasmids were replicating autonomously. High-molecular-mass species of pADE2 were found by Southern hybridization analysis of intact genomic DNA preparations. The shift to higher molecular mass of these plasmids during electrophoresis in the presence ethidium bromide after exposure to shortwave UV suggests that they exist in a supercoiled form in the transformed host. Subclones of the 4.5-kbp insert indicated that ADE2-complementing activity and sequences conferring autonomous replication in S. occidentalis were located within a 2.7-kbp EcoRI-SphI fragment. Plasmids containing this region cloned into the bacterial vector pUC19 complemented ade2 mutants of S. occidentalis with efficiencies identical to those of the original plasmid pADE.« less

Identification and tracking of vertebrae in ultrasound using deep networks with unsupervised feature learning

NASA Astrophysics Data System (ADS)

Hetherington, Jorden; Pesteie, Mehran; Lessoway, Victoria A.; Abolmaesumi, Purang; Rohling, Robert N.

2017-03-01

Percutaneous needle insertion procedures on the spine often require proper identification of the vertebral level in order to effectively deliver anesthetics and analgesic agents to achieve adequate block. For example, in obstetric epidurals, the target is at the L3-L4 intervertebral space. The current clinical method involves "blind" identification of the vertebral level through manual palpation of the spine, which has only 30% accuracy. This implies the need for better anatomical identification prior to needle insertion. A system is proposed to identify the vertebrae, assigning them to their respective levels, and track them in a standard sequence of ultrasound images, when imaged in the paramedian plane. Machine learning techniques are developed to identify discriminative features of the laminae. In particular, a deep network is trained to automatically learn the anatomical features of the lamina peaks, and classify image patches, for pixel-level classification. The chosen network utilizes multiple connected auto-encoders to learn the anatomy. Pre-processing with ultrasound bone enhancement techniques is done to aid the pixel-level classification performance. Once the lamina are identified, vertebrae are assigned levels and tracked in sequential frames. Experimental results were evaluated against an expert sonographer. Based on data acquired from 15 subjects, vertebrae identification with sensitivity of 95% and precision of 95% was achieved within each frame. Between pairs of subsequently analyzed frames, matches of predicted vertebral level labels were correct in 94% of cases, when compared to matches of manually selected labels

Parallel Fin ORU Thermal Interface for space applications. [Orbital Replaceable Unit

NASA Technical Reports Server (NTRS)

Stobb, C. A.; Limardo, Jose G.

1992-01-01

The Parallel Fin Thermal Interface has been developed as an Orbital Replaceable Unit (ORU) interface. The interface transfers heat from an ORU baseplate to a Heat Acquisition Plate (HAP) through pairs of fins sandwiched between insert plates that press against the fins with uniform pressure. The insert plates are spread apart for ORU baseplate separation and replacement. Two prototype interfaces with different fin dimensions were built (Model 140 and 380). Interfacing surface samples were found to have roughnesses of 56 to 89 nm. Conductance values of 267 to 420 W/sq m C were obtained for the 140 model in vacuum with interface pressures of 131 to 262 kPa (19 to 38 psi). Vacuum conductances ranging from 176 to 267 W/sq m F were obtained for the 380 model at interface pressures of 97 to 152 kPa (14 and 22 psi). Correlations from several sources were found to agree with test data within 20 percent using thermal math models of the interfaces.

Photon beam position monitor

DOEpatents

Kuzay, Tuncer M.; Shu, Deming

1995-01-01

A photon beam position monitor for use in the front end of a beamline of a high heat flux and high energy photon source such as a synchrotron radiation storage ring detects and measures the position and, when a pair of such monitors are used in tandem, the slope of a photon beam emanating from an insertion device such as a wiggler or an undulator inserted in the straight sections of the ring. The photon beam position monitor includes a plurality of spaced blades for precisely locating the photon beam, with each blade comprised of chemical vapor deposition (CVD) diamond with an outer metal coating of a photon sensitive metal such as tungsten, molybdenum, etc., which combination emits electrons when a high energy photon beam is incident upon the blade. Two such monitors are contemplated for use in the front end of the beamline, with the two monitors having vertically and horizontally offset detector blades to avoid blade "shadowing". Provision is made for aligning the detector blades with the photon beam and limiting detector blade temperature during operation.

Nucleic acid duplexes incorporating a dissociable covalent base pair

NASA Technical Reports Server (NTRS)

Gao, K.; Orgel, L. E.; Bada, J. L. (Principal Investigator)

1999-01-01

We have used molecular modeling techniques to design a dissociable covalently bonded base pair that can replace a Watson-Crick base pair in a nucleic acid with minimal distortion of the structure of the double helix. We introduced this base pair into a potential precursor of a nucleic acid double helix by chemical synthesis and have demonstrated efficient nonenzymatic template-directed ligation of the free hydroxyl groups of the base pair with appropriate short oligonucleotides. The nonenzymatic ligation reactions, which are characteristic of base paired nucleic acid structures, are abolished when the covalent base pair is reduced and becomes noncoplanar. This suggests that the covalent base pair linking the two strands in the duplex is compatible with a minimally distorted nucleic acid double-helical structure.

Landscape of Insertion Polymorphisms in the Human Genome

PubMed Central

Onozawa, Masahiro; Goldberg, Liat; Aplan, Peter D.

2015-01-01

Nucleotide substitutions, small (<50 bp) insertions or deletions (indels), and large (>50 bp) deletions are well-known causes of genetic variation within the human genome. We recently reported a previously unrecognized form of polymorphic insertions, termed templated sequence insertion polymorphism (TSIP), in which the inserted sequence was templated from a distant genomic region, and was inserted in the genome through reverse transcription of an RNA intermediate. TSIPs can be grouped into two classes based on nucleotide sequence features at the insertion junctions; class 1 TSIPs show target site duplication, polyadenylation, and preference for insertion at a 5′-TTTT/A-3′ sequence, suggesting a LINE-1 based insertion mechanism, whereas class 2 TSIPs show features consistent with repair of a DNA double strand break by nonhomologous end joining. To gain a more complete picture of TSIPs throughout the human population, we evaluated whole-genome sequence from 52 individuals, and identified 171 TSIPs. Most individuals had 25–30 TSIPs, and common (present in >20% of individuals) TSIPs were found in individuals throughout the world, whereas rare TSIPs tended to cluster in specific geographic regions. The number of rare TSIPs was greater than the number of common TSIPs, suggesting that TSIP generation is an ongoing process. Intriguingly, mitochondrial sequences were a frequent template for class 2 insertions, used more commonly than any nuclear chromosome. Similar to single nucleotide polymorphisms and indels, we suspect that these TSIPs may be important for the generation of human diversity and genetic diseases, and can be useful in tracking historical migration of populations. PMID:25745018

Computerized planning of prostate cryosurgery using variable cryoprobe insertion depth.

PubMed

Rossi, Michael R; Tanaka, Daigo; Shimada, Kenji; Rabin, Yoed

2010-02-01

The current study presents a computerized planning scheme for prostate cryosurgery using a variable insertion depth strategy. This study is a part of an ongoing effort to develop computerized tools for cryosurgery. Based on typical clinical practices, previous automated planning schemes have required that all cryoprobes be aligned at a single insertion depth. The current study investigates the benefit of removing this constraint, in comparison with results based on uniform insertion depth planning as well as the so-called "pullback procedure". Planning is based on the so-called "bubble-packing method", and its quality is evaluated with bioheat transfer simulations. This study is based on five 3D prostate models, reconstructed from ultrasound imaging, and cryoprobe active length in the range of 15-35 mm. The variable insertion depth technique is found to consistently provide superior results when compared to the other placement methods. Furthermore, it is shown that both the optimal active length and the optimal number of cryoprobes vary among prostate models, based on the size and shape of the target region. Due to its low computational cost, the new scheme can be used to determine the optimal cryoprobe layout for a given prostate model in real time. Copyright 2008 Elsevier Inc. All rights reserved.

High-Resolution Crystal Structure of a Silver(I)-RNA Hybrid Duplex Containing Watson-Crick-like C-Silver(I)-C Metallo-Base Pairs.

PubMed

Kondo, Jiro; Tada, Yoshinari; Dairaku, Takenori; Saneyoshi, Hisao; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira

2015-11-02

Metallo-base pairs have been extensively studied for applications in nucleic acid-based nanodevices and genetic code expansion. Metallo-base pairs composed of natural nucleobases are attractive because nanodevices containing natural metallo-base pairs can be easily prepared from commercially available sources. Previously, we have reported a crystal structure of a DNA duplex containing T-Hg(II)-T base pairs. Herein, we have determined a high-resolution crystal structure of the second natural metallo-base pair between pyrimidine bases C-Ag(I)-C formed in an RNA duplex. One Ag(I) occupies the center between two cytosines and forms a C-Ag(I)-C base pair through N3-Ag(I)-N3 linear coordination. The C-Ag(I)-C base pair formation does not disturb the standard A-form conformation of RNA. Since the C-Ag(I)-C base pair is structurally similar to the canonical Watson-Crick base pairs, it can be a useful building block for structure-based design and fabrication of nucleic acid-based nanodevices. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Pressure redistribution by molded inserts in diabetic footwear: a pilot study.

PubMed

Lord, M; Hosein, R

1994-08-01

A small-scale trial is described to demonstrate and evaluate the redistribution of plantar pressure resulting from the use of custom-molded inserts in the orthopedic shoes of diabetic patients at risk of plantar ulceration. A pressure-measuring insole based on force-sensitive resistor technology enabled the load distribution to be compared using molded inserts and flat inserts fitted into the same shoes. An analysis of the 12 peaks of pressure that could be identified under a discrete metatarsal head of six subjects in the trial showed that the pressure was significantly reduced with the use of molded inserts (flat inserts: 305 +/- 79 kPa; molded inserts: 216 +/- 70 kPa; n = 6 p < 0.005). Technical limitations of the equipment and the difficult choice of match of flat insert to molded for comparison suggest that further studies are required for a definitive result.

Autoshaping of ethanol drinking in rats: effects of ethanol concentration and trial spacing.

PubMed

Tomie, Arthur; Wong, Karlvin; Apor, Khristine; Patterson-Buckendahl, Patricia; Pohorecky, Larissa A

2003-11-01

In two studies, we evaluated the effects of ethanol concentration and trial spacing on Pavlovian autoshaping of ethanol drinking in rats. In these studies, the brief insertion of an ethanol sipper conditioned stimulus (CS) was followed by the response-independent presentation of food unconditioned stimulus (US), inducing sipper CS-directed drinking conditioned responses (CRs) in all rats. In Experiment 1, the ethanol concentration in the sipper CS [0%-16% volume/volume (vol./vol.), in increments of 1%] was systematically increased within subjects across autoshaping sessions. Groups of rats received sipper CS-food US pairings (Paired/Ethanol), a CS-US random procedure (Random/Ethanol), or water sipper CS paired with food US (Paired/Water). In Experiment 2, saccharin-fading procedures were used to initiate, in the Ethanol group, drinking of 6% (vol./vol.) ethanol in 0.1% saccharin or, in the Water group, drinking of tap water in 0.1% saccharin. After elimination of saccharin, and across days, the duration of access to the sipper CS during each autoshaping trial was increased (5, 10, 12.5, 15, 17.5, and 20 s), and subsequently, across days, the duration of the mean intertrial interval (ITI) was increased (60, 90, 120, and 150 s). In Experiment 1, Paired/Ethanol and Random/Ethanol groups showed higher intake of ethanol, in terms of grams per kilogram of body weight, at higher ethanol concentrations, with more ethanol intake recorded in the Paired/Ethanol group. In Experiment 2, the Ethanol group drank more than was consumed by the Water group, and, for both groups, fluid intake increased with longer ITIs. Results support the suggestion that autoshaping contributes to sipper CS-directed ethanol drinking.

The nearest neighbor and next nearest neighbor effects on the thermodynamic and kinetic properties of RNA base pair

NASA Astrophysics Data System (ADS)

Wang, Yujie; Wang, Zhen; Wang, Yanli; Liu, Taigang; Zhang, Wenbing

2018-01-01

The thermodynamic and kinetic parameters of an RNA base pair with different nearest and next nearest neighbors were obtained through long-time molecular dynamics simulation of the opening-closing switch process of the base pair near its melting temperature. The results indicate that thermodynamic parameters of GC base pair are dependent on the nearest neighbor base pair, and the next nearest neighbor base pair has little effect, which validated the nearest-neighbor model. The closing and opening rates of the GC base pair also showed nearest neighbor dependences. At certain temperature, the closing and opening rates of the GC pair with nearest neighbor AU is larger than that with the nearest neighbor GC, and the next nearest neighbor plays little role. The free energy landscape of the GC base pair with the nearest neighbor GC is rougher than that with nearest neighbor AU.

High-resolution definition of the Vibrio cholerae essential gene set with hidden Markov model–based analyses of transposon-insertion sequencing data

PubMed Central

Chao, Michael C.; Pritchard, Justin R.; Zhang, Yanjia J.; Rubin, Eric J.; Livny, Jonathan; Davis, Brigid M.; Waldor, Matthew K.

2013-01-01

The coupling of high-density transposon mutagenesis to high-throughput DNA sequencing (transposon-insertion sequencing) enables simultaneous and genome-wide assessment of the contributions of individual loci to bacterial growth and survival. We have refined analysis of transposon-insertion sequencing data by normalizing for the effect of DNA replication on sequencing output and using a hidden Markov model (HMM)-based filter to exploit heretofore unappreciated information inherent in all transposon-insertion sequencing data sets. The HMM can smooth variations in read abundance and thereby reduce the effects of read noise, as well as permit fine scale mapping that is independent of genomic annotation and enable classification of loci into several functional categories (e.g. essential, domain essential or ‘sick’). We generated a high-resolution map of genomic loci (encompassing both intra- and intergenic sequences) that are required or beneficial for in vitro growth of the cholera pathogen, Vibrio cholerae. This work uncovered new metabolic and physiologic requirements for V. cholerae survival, and by combining transposon-insertion sequencing and transcriptomic data sets, we also identified several novel noncoding RNA species that contribute to V. cholerae growth. Our findings suggest that HMM-based approaches will enhance extraction of biological meaning from transposon-insertion sequencing genomic data. PMID:23901011

[Structural and Dipole Structure Peculiarities of Hoogsteen Base Pairs Formed in Complementary Nucleobases according to ab initio Quantum Mechanics Studies].

PubMed

Petrenko, Y M

2015-01-01

Ab initio quantum mechanics studies for the detection of structure and dipole structure peculiarities of Hoogsteen base pairs relative to Watson-Crick base pairs, were performed during our work. These base pairs are formed as a result of complementary interactions. It was revealed, that adenine-thymine Hoogsteen base pair and adenine-thymine Watson-Crick base pairs can be formed depending on initial configuration. Cytosine-guanine Hoogsteen pairs are formed only when cytosine was originally protonated. Both types of Hoogsteen pairs have noticeable difference in the bond distances and angles. These differences appeared in purine as well as in pyrimidine parts of the pairs. Hoogsteen pairs have mostly shorter hydrogen bond lengths and significantly larger angles of hydrogen bonds and larger angles between the hydrogen bonds than Watson-Crick base pairs. Notable differences are also observed with respect to charge distribution and dipole moment. Quantitative data on these differences are shown in our work. It is also reported that the values of local parameters (according to Cambridge classification of the parameters which determine DNA properties) in Hoogsteen base pairs, are greatly different from Watson-Crick ones.

Nucleic acid duplexes incorporating a dissociable covalent base pair

PubMed Central

Gao, Kui; Orgel, Leslie E.

1999-01-01

We have used molecular modeling techniques to design a dissociable covalently bonded base pair that can replace a Watson-Crick base pair in a nucleic acid with minimal distortion of the structure of the double helix. We introduced this base pair into a potential precursor of a nucleic acid double helix by chemical synthesis and have demonstrated efficient nonenzymatic template-directed ligation of the free hydroxyl groups of the base pair with appropriate short oligonucleotides. The nonenzymatic ligation reactions, which are characteristic of base paired nucleic acid structures, are abolished when the covalent base pair is reduced and becomes noncoplanar. This suggests that the covalent base pair linking the two strands in the duplex is compatible with a minimally distorted nucleic acid double-helical structure. PMID:10611299

Olodaterol Oral Inhalation

MedlinePlus

... not be all the way in the inhaler. Push the cartridge against a firm surface to ensure that it is correctly inserted. Do not remove the cartridge once it has been inserted into the inhaler. Put the clear base back into place. Do not remove the clear base ...

Transposon insertion libraries for the characterization of mutants from the kiwifruit pathogen Pseudomonas syringae pv. actinidiae

PubMed Central

Mesarich, Carl H.; Rees-George, Jonathan; Gardner, Paul P.; Ghomi, Fatemeh Ashari; Gerth, Monica L.; Andersen, Mark T.; Rikkerink, Erik H. A.; Fineran, Peter C.

2017-01-01

Pseudomonas syringae pv. actinidiae (Psa), the causal agent of kiwifruit canker, is one of the most devastating plant diseases of recent times. We have generated two mini-Tn5-based random insertion libraries of Psa ICMP 18884. The first, a ‘phenotype of interest’ (POI) library, consists of 10,368 independent mutants gridded into 96-well plates. By replica plating onto selective media, the POI library was successfully screened for auxotrophic and motility mutants. Lipopolysaccharide (LPS) biosynthesis mutants with ‘Fuzzy-Spreader’-like morphologies were also identified through a visual screen. The second, a ‘mutant of interest’ (MOI) library, comprises around 96,000 independent mutants, also stored in 96-well plates, with approximately 200 individuals per well. The MOI library was sequenced on the Illumina MiSeq platform using Transposon-Directed Insertion site Sequencing (TraDIS) to map insertion sites onto the Psa genome. A grid-based PCR method was developed to recover individual mutants, and using this strategy, the MOI library was successfully screened for a putative LPS mutant not identified in the visual screen. The Psa chromosome and plasmid had 24,031 and 1,236 independent insertion events respectively, giving insertion frequencies of 3.65 and 16.6 per kb respectively. These data suggest that the MOI library is near saturation, with the theoretical probability of finding an insert in any one chromosomal gene estimated to be 97.5%. However, only 47% of chromosomal genes had insertions. This surprisingly low rate cannot be solely explained by the lack of insertions in essential genes, which would be expected to be around 5%. Strikingly, many accessory genes, including most of those encoding type III effectors, lacked insertions. In contrast, 94% of genes on the Psa plasmid had insertions, including for example, the type III effector HopAU1. These results suggest that some chromosomal sites are rendered inaccessible to transposon insertion, either by DNA-binding proteins or by the architecture of the nucleoid. PMID:28249011

A feasibility of single-incision laparoscopic percutaneous extraperitoneal closure for treatment of incarcerated inguinal hernia in children: our preliminary outcome and review of the literature.

PubMed

Murase, Naruhiko; Uchida, Hiroo; Seki, Takashi; Hiramatsu, Kiyoshi

2016-02-01

The purpose of this study is to examine the feasibility of single-incision laparoscopic percutaneous extraperitoneal closure (LPEC) for incarcerated inguinal hernia (IIH) repair. 6 single-incision LPEC procedures were performed for IIH repair and 60 procedures were performed for reducible inguinal hernia (RIH) in the same period of time in one hospital. The laparoscope and one pair of grasping forceps were placed through the same umbilical incision. In IIH repair, the herniated organ was gently pulled using the grasping forceps with external manual pressure. If it was difficult to reduce the herniated organ with one pair of forceps, another pair of forceps were inserted through a multi-channel port without extending the umbilical incidion. Using the LPEC needle, the hernia orifice was closed extraperitoneally. We performed a retrospective analysis to compare the outcomes of single-incision LPEC for IIH repair or reducible inguinal hernia. All procedures were completed by single-incision without open conversion. A multi-channel port with another pair of forceps was needed in three cases. The operation time and the length of stay were significantly longer with IIH repair than with RIH repair. There were no major complications and there was no evidence of early recurrence in any patient. In conclusion, single-incision LPEC with a multi-channel port is feasible and safe for IIH repair.

Sequencing and analysis of 10,967 full-length cDNA clones from Xenopus laevis and Xenopus tropicalis reveals post-tetraploidization transcriptome remodeling

PubMed Central

Morin, Ryan D.; Chang, Elbert; Petrescu, Anca; Liao, Nancy; Griffith, Malachi; Kirkpatrick, Robert; Butterfield, Yaron S.; Young, Alice C.; Stott, Jeffrey; Barber, Sarah; Babakaiff, Ryan; Dickson, Mark C.; Matsuo, Corey; Wong, David; Yang, George S.; Smailus, Duane E.; Wetherby, Keith D.; Kwong, Peggy N.; Grimwood, Jane; Brinkley, Charles P.; Brown-John, Mabel; Reddix-Dugue, Natalie D.; Mayo, Michael; Schmutz, Jeremy; Beland, Jaclyn; Park, Morgan; Gibson, Susan; Olson, Teika; Bouffard, Gerard G.; Tsai, Miranda; Featherstone, Ruth; Chand, Steve; Siddiqui, Asim S.; Jang, Wonhee; Lee, Ed; Klein, Steven L.; Blakesley, Robert W.; Zeeberg, Barry R.; Narasimhan, Sudarshan; Weinstein, John N.; Pennacchio, Christa Prange; Myers, Richard M.; Green, Eric D.; Wagner, Lukas; Gerhard, Daniela S.; Marra, Marco A.; Jones, Steven J.M.; Holt, Robert A.

2006-01-01

Sequencing of full-insert clones from full-length cDNA libraries from both Xenopus laevis and Xenopus tropicalis has been ongoing as part of the Xenopus Gene Collection Initiative. Here we present 10,967 full ORF verified cDNA clones (8049 from X. laevis and 2918 from X. tropicalis) as a community resource. Because the genome of X. laevis, but not X. tropicalis, has undergone allotetraploidization, comparison of coding sequences from these two clawed (pipid) frogs provides a unique angle for exploring the molecular evolution of duplicate genes. Within our clone set, we have identified 445 gene trios, each comprised of an allotetraploidization-derived X. laevis gene pair and their shared X. tropicalis ortholog. Pairwise dN/dS, comparisons within trios show strong evidence for purifying selection acting on all three members. However, dN/dS ratios between X. laevis gene pairs are elevated relative to their X. tropicalis ortholog. This difference is highly significant and indicates an overall relaxation of selective pressures on duplicated gene pairs. We have found that the paralogs that have been lost since the tetraploidization event are enriched for several molecular functions, but have found no such enrichment in the extant paralogs. Approximately 14% of the paralogous pairs analyzed here also show differential expression indicative of subfunctionalization. PMID:16672307

Adjacent DNA sequences modulate Sox9 transcriptional activation at paired Sox sites in three chondrocyte-specific enhancer elements

PubMed Central

Bridgewater, Laura C.; Walker, Marlan D.; Miller, Gwen C.; Ellison, Trevor A.; Holsinger, L. Daniel; Potter, Jennifer L.; Jackson, Todd L.; Chen, Reuben K.; Winkel, Vicki L.; Zhang, Zhaoping; McKinney, Sandra; de Crombrugghe, Benoit

2003-01-01

Expression of the type XI collagen gene Col11a2 is directed to cartilage by at least three chondrocyte-specific enhancer elements, two in the 5′ region and one in the first intron of the gene. The three enhancers each contain two heptameric sites with homology to the Sox protein-binding consensus sequence. The two sites are separated by 3 or 4 bp and arranged in opposite orientation to each other. Targeted mutational analyses of these three enhancers showed that in the intronic enhancer, as in the other two enhancers, both Sox sites in a pair are essential for enhancer activity. The transcription factor Sox9 binds as a dimer at the paired sites, and the introduction of insertion mutations between the sites demonstrated that physical interactions between the adjacently bound proteins are essential for enhancer activity. Additional mutational analyses demonstrated that although Sox9 binding at the paired Sox sites is necessary for enhancer activity, it alone is not sufficient. Adjacent DNA sequences in each enhancer are also required, and mutation of those sequences can eliminate enhancer activity without preventing Sox9 binding. The data suggest a new model in which adjacently bound proteins affect the DNA bend angle produced by Sox9, which in turn determines whether an active transcriptional enhancer complex is assembled. PMID:12595563

A biomechanical comparison of 2 transosseous-equivalent double-row rotator cuff repair techniques using bioabsorbable anchors: cyclic loading and failure behavior.

PubMed

Spang, Jeffrey T; Buchmann, Stefan; Brucker, Peter U; Kouloumentas, Panos; Obst, Tobias; Schröder, Manuel; Burgkart, Rainer; Imhoff, Andreas B

2009-08-01

A novel double-row configuration was compared with a traditional double-row configuration for rotator cuff repair. In 10 matched-pair sheep shoulders in vitro repair was performed with either a double-row technique with corkscrew suture anchors for the medial row and insertion anchors for the lateral row (group A) or a double-row technique with a new tape-like suture material with insertion anchors for both the medial and lateral rows (group B). Each specimen underwent cyclic loading from 10 to 150 N for 100 cycles, followed by unidirectional failure testing. Gap formation and strain within the repair area for the first and last cycles were analyzed with a video digitizing system, and stiffness and failure load were determined from the load-elongation curve. The results were similar for the 2 repair types. There was no significant difference between the ultimate failure loads of the 2 techniques (421 +/- 150 N in group A and 408 +/- 66 N in group B, P = .31) or the stiffness of the 2 techniques (84 +/- 26 N/mm in group A and 99 +/- 20 N/mm in group B, P = .07). In addition, gap formation was not different between the repair types. Strain over the repair area was also not different between the repair types. Both tested rotator cuff repair techniques had high failure loads, limited gap formation, and acceptable strain patterns. No significant difference was found between the novel and conventional double-row repair types. Two double-row techniques-one with corkscrew suture anchors for the medial row and insertion anchors for the lateral row and one with insertion anchors for both the medial and lateral rows-provided excellent biomechanical profiles at time 0 for double-row repairs in a sheep model. Although the sheep model may not directly correspond to in vivo conditions, all-insertion anchor double-row constructs are worthy of further investigation.

Anatomical Footprint of the Tibialis Anterior Tendon: Surgical Implications for Foot and Ankle Reconstructions.

PubMed

Willegger, Madeleine; Seyidova, Nargiz; Schuh, Reinhard; Windhager, Reinhard; Hirtler, Lena

2017-01-01

This study aimed to analyze precisely the dimensions, shapes, and variations of the insertional footprints of the tibialis anterior tendon (TAT) at the medial cuneiform (MC) and first metatarsal (MT1) base. Forty-one formalin-fixed human cadaveric specimens were dissected. After preparation of the TAT footprint, standardized photographs were made and the following parameters were evaluated: the footprint length, width, area of insertion, dorsoplantar location, shape, and additional tendon slips. Twenty feet (48.8%) showed an equal insertion at the MC and MT1, another 20 feet (48.8%) had a wide insertion at the MC and a narrow insertion at the MT1, and 1 foot (2.4%) demonstrated a narrow insertion at the MC and a wide insertion at the MT1. Additional tendon slips inserting at the metatarsal shaft were found in two feet (4.8%). Regarding the dorsoplantar orientation, the footprints were located medial in 29 feet (70.7%) and medioplantar in 12 feet (29.3%). The most common shape at the MT1 base was the crescent type (75.6%) and the oval type at the MC (58.5%). The present study provided more detailed data on the dimensions and morphologic types of the tibialis anterior tendon footprint. The established anatomical data may allow for a safer surgical preparation and a more anatomical reconstruction.

Alu Insertions and Genetic Diversity: A Preliminary Investigation by an Undergraduate Bioinformatics Class

ERIC Educational Resources Information Center

Elwess, Nancy L.; Duprey, Stephen L.; Harney, Lindesay A.; Langman, Jessie E.; Marino, Tara C.; Martinez, Carolina; McKeon, Lauren L.; Moss, Chantel I. E.; Myrie, Sasha S.; Taylor, Luke Ryan

2008-01-01

"Alu"-insertion polymorphisms were used by an undergraduate Bioinformatics class to study how these insertion sites could be the basis for an investigation in human population genetics. Based on the students' investigation, both allele and genotype "Alu" frequencies were determined for African-American and Japanese populations as well as a…

Effectiveness of electrocardiographic guidance in CVAD tip placement.

PubMed

Walker, Graham; Chan, Raymond J; Alexandrou, Evan; Webster, Joan; Rickard, Claire

International standard practice for the correct confirmation of the central venous access device is the chest X-ray. The intracavitary electrocardiogram-based insertion method is radiation-free, and allows real-time placement verification, providing immediate treatment and reduced requirement for post-procedural repositioning. Relevant databases were searched for prospective randomised controlled trials (RCTs) or quasi RCTs that compared the effectiveness of electrocardiogram-guided catheter tip positioning with placement using surface-anatomy-guided insertion plus chest X-ray confirmation. The primary outcome was accurate catheter tip placement. Secondary outcomes included complications, patient satisfaction and costs. Five studies involving 729 participants were included. Electrocardiogram-guided insertion was more accurate than surface anatomy guided insertion (odds ratio: 8.3; 95% confidence interval (CI) 1.38; 50.07; p=0.02). There was a lack of reporting on complications, patient satisfaction and costs. The evidence suggests that intracavitary electrocardiogram-based positioning is superior to surface-anatomy-guided positioning of central venous access devices, leading to significantly more successful placements. This technique could potentially remove the requirement for post-procedural chest X-ray, especially during peripherally inserted central catheter (PICC) line insertion.

Rapid molecular sexing of three-spined sticklebacks, Gasterosteus aculeatus L., based on large Y-chromosomal insertions.

PubMed

Bakker, Theo C M; Giger, Thomas; Frommen, Joachim G; Largiadèr, Carlo R

2017-08-01

There is a need for rapid and reliable molecular sexing of three-spined sticklebacks, Gasterosteus aculeatus, the supermodel species for evolutionary biology. A DNA region at the 5' end of the sex-linked microsatellite Gac4202 was sequenced for the X chromosome of six females and the Y chromosome of five males from three populations. The Y chromosome contained two large insertions, which did not recombine with the phenotype of sex in a cross of 322 individuals. Genetic variation (SNPs and indels) within the insertions was smaller than on flanking DNA sequences. Three molecular PCR-based sex tests were developed, in which the first, the second or both insertions were covered. In five European populations (from DE, CH, NL, GB) of three-spined sticklebacks, tests with both insertions combined showed two clearly separated bands on agarose minigels in males and one band in females. The tests with the separate insertions gave similar results. Thus, the new molecular sexing method gave rapid and reliable results for sexing three-spined sticklebacks and is an improvement and/or alternative to existing methods.

Products of three accessory genes, pilB, pilC, and pilD, are required for biogenesis of Pseudomonas aeruginosa pili.

PubMed Central

Nunn, D; Bergman, S; Lory, S

1990-01-01

The polar pili of Pseudomonas aeruginosa are composed of monomers of the pilin structural subunits. The biogenesis of pili involves the synthesis of pilin precursor, cleavage of a six-amino-acid leader peptide, membrane translocation, and assembly of monomers into a filamentous structure extending from the bacterial surface. This report describes three novel genes necessary for the formation of pili. DNA sequences adjacent to pilA, the pilin structural gene, were cloned and mutagenized with transposon Tn5. Each of the insertions were introduced into the chromosome of P. aeruginosa PAK by gene replacement. The effect of the Tn5 insertions in the bacterial chromosome on pilus assembly was assessed by electron microscopy and sensitivity of mutants to a pilus-specific bacteriophage. The resultant mutants were also tested for synthesis and membrane localization of the pilin antigen in order to define the genes required for maturation, export, and assembly of pilin. A 4.0-kilobase-pair region of DNA adjacent to the pilin structural gene was found to be essential for formation of pili. This region was sequenced and found to contain three open reading frames coding for 62-, 38- to 45-, and 28- to 32-kilodalton proteins (pilB, pilC, and pilD, respectively). Three proteins of similar molecular weight were expressed in Escherichia coli from the 4.0-kilobase-pair fragment flanking pilA with use of a T7 promoter-polymerase expression system. The results of the analyses of the three genes and the implications for pilin assembly and maturation are discussed. Images PMID:1971619

Effect of screw torque level on cortical bone pullout strength.

PubMed

Cleek, Tammy M; Reynolds, Karen J; Hearn, Trevor C

2007-02-01

The objectives of this study were 2-fold: (1) to perform detailed analysis of cortical screw tightening stiffness during automated insertion, and (2) to determine the effect of 3 torque levels on the holding strength of the bone surrounding the screw threads as assessed by screw pullout. Ten pairs of ovine tibiae were used with 3 test sites spaced 20 mm apart centered along the shaft. One side of each pair was used for measuring ultimate failure torque (Tmax). These Tmax and bone-density values were used to predict Tmax at contralateral tibia sites. Screws were inserted and tightened to 50%, 70%, and 90% of predicted Tmax at the contralateral sites to encompass the average clinical level of torque (86% Tmax). Pullout tests were performed and maximum force values were normalized by cortical thickness. Torque to failure tests indicated tightening to 86% Tmax occurs after yield and leads to an average 51% loss in stiffness. Normalized pullout strength for screws tightened to 50% Tmax, 70% Tmax, and 90% Tmax were 2525 +/- 244, 2707 +/- 280, and 2344 +/- 346 N, respectively, with a significant difference between 70% Tmax and 90% Tmax groups (P < 0.05). Within the limitations of our study involving the testing of 1 type of screw purchase in ovine tibiae, results demonstrate that clinical levels of lag screw tightening (86% Tmax) are past the yield point of bone. Tightening to these high torque levels can cause damage leading to compromised holding strength. Further research is still required to establish the appropriate level of torque required for achieving optimal fracture fixation and healing.

Molecular recognition of DNA base pairs by the formamido/pyrrole and formamido/imidazole pairings in stacked polyamides.

PubMed

Buchmueller, Karen L; Staples, Andrew M; Uthe, Peter B; Howard, Cameron M; Pacheco, Kimberly A O; Cox, Kari K; Henry, James A; Bailey, Suzanna L; Horick, Sarah M; Nguyen, Binh; Wilson, W David; Lee, Moses

2005-01-01

Polyamides containing an N-terminal formamido (f) group bind to the minor groove of DNA as staggered, antiparallel dimers in a sequence-specific manner. The formamido group increases the affinity and binding site size, and it promotes the molecules to stack in a staggered fashion thereby pairing itself with either a pyrrole (Py) or an imidazole (Im). There has not been a systematic study on the DNA recognition properties of the f/Py and f/Im terminal pairings. These pairings were analyzed here in the context of f-ImPyPy, f-ImPyIm, f-PyPyPy and f-PyPyIm, which contain the central pairing modes, -ImPy- and -PyPy-. The specificity of these triamides towards symmetrical recognition sites allowed for the f/Py and f/Im terminal pairings to be directly compared by SPR, CD and DeltaT (M) experiments. The f/Py pairing, when placed next to the -ImPy- or -PyPy- central pairings, prefers A/T and T/A base pairs to G/C base pairs, suggesting that f/Py has similar DNA recognition specificity to Py/Py. With -ImPy- central pairings, f/Im prefers C/G base pairs (>10 times) to the other Watson-Crick base pairs; therefore, f/Im behaves like the Py/Im pair. However, the f/Im pairing is not selective for the C/G base pair when placed next to the -PyPy- central pairings.

Identification and characterization of short tandem repeats in the Tibetan macaque genome based on resequencing data.

PubMed

Liu, San-Xu; Hou, Wei; Zhang, Xue-Yan; Peng, Chang-Jun; Yue, Bi-Song; Fan, Zhen-Xin; Li, Jing

2018-07-18

The Tibetan macaque, which is endemic to China, is currently listed as a Near Endangered primate species by the International Union for Conservation of Nature (IUCN). Short tandem repeats (STRs) refer to repetitive elements of genome sequence that range in length from 1-6 bp. They are found in many organisms and are widely applied in population genetic studies. To clarify the distribution characteristics of genome-wide STRs and understand their variation among Tibetan macaques, we conducted a genome-wide survey of STRs with next-generation sequencing of five macaque samples. A total of 1 077 790 perfect STRs were mined from our assembly, with an N50 of 4 966 bp. Mono-nucleotide repeats were the most abundant, followed by tetra- and di-nucleotide repeats. Analysis of GC content and repeats showed consistent results with other macaques. Furthermore, using STR analysis software (lobSTR), we found that the proportion of base pair deletions in the STRs was greater than that of insertions in the five Tibetan macaque individuals (P<0.05, t-test). We also found a greater number of homozygous STRs than heterozygous STRs (P<0.05, t-test), with the Emei and Jianyang Tibetan macaques showing more heterozygous loci than Huangshan Tibetan macaques. The proportion of insertions and mean variation of alleles in the Emei and Jianyang individuals were slightly higher than those in the Huangshan individuals, thus revealing differences in STR allele size between the two populations. The polymorphic STR loci identified based on the reference genome showed good amplification efficiency and could be used to study population genetics in Tibetan macaques. The neighbor-joining tree classified the five macaques into two different branches according to their geographical origin, indicating high genetic differentiation between the Huangshan and Sichuan populations. We elucidated the distribution characteristics of STRs in the Tibetan macaque genome and provided an effective method for screening polymorphic STRs. Our results also lay a foundation for future genetic variation studies of macaques.

Deoxyhexanucleotide containing a vinyl chloride induced DNA lesion, 1,N/sup 6/-ethenoadenine: synthesis, physical characterization, and incorporation into a duplex bacteriophage M13 genome as part of an amber codon

DOE Office of Scientific and Technical Information (OSTI.GOV)

Basu, A.K.; Niedernhofer, L.J.; Essigmann, J.M.

Organic synthesis and recombinant DNA techniques have been used to situate a single 1,N/sup 6/-ethenoadenine (epsilon Ade) DNA adduct at an amber codon in the genome of an M13mp19 phage derivative. The deoxyhexanucleotide d(GCT(epsilon A)GC) was chemically synthesized by the phosphotriester method. Physical studies involving fluorescence, circular dichroism , and /sup 1/H NMR indicated epsilon Ade to be very efficiently stacked in the hexamer, especially with the 5'-thymine. Melting profile and circular dichroism studies provided evidence of the loss of base-pairing capabilities attendant with formation of the etheno ring. The modified hexanucleotide was incorporated into a six-base gap formed inmore » the genome of an M13mp19 insertion mutant. Phage of the insertion mutant, M13mp19-NheI, produced light blue plaques on SupE strains because of the introduced amber codon. Formation of a hybrid between the single-strand DNA (plus strand) of M13mp19-NheI with SmaI-linearized M13mp19 replicative form produced a heteroduplex with a six-base gap in the minus strand. The modified hexamer (5'-/sup 32/P)d-(GCT(epsilon A)GC), after 5'-phosphorylation, was ligated into this gap by using bacteriophage T4 DNA ligase to generate a singly adducted genome with epsilon Ade at minus strand position 6274. Introduction of the radiolabel provided a useful marker for characterization of the singly adducted genome, and indeed the label appeared in the anticipated fragments when digested by several restriction endonucleases. Evidence that ligation occurred on both 5' and 3' sides of the oligonucleotide also was obtained. The M13mp19-NheI genome containing epsilon Ade will be used as a probe for studying mutagenesis and repair of this DNA adduct in Escherichia coli.« less

Lentiviral vector-based insertional mutagenesis identifies genes associated with liver cancer

PubMed Central

Ranzani, Marco; Cesana, Daniela; Bartholomae, Cynthia C.; Sanvito, Francesca; Pala, Mauro; Benedicenti, Fabrizio; Gallina, Pierangela; Sergi, Lucia Sergi; Merella, Stefania; Bulfone, Alessandro; Doglioni, Claudio; von Kalle, Christof; Kim, Yoon Jun; Schmidt, Manfred; Tonon, Giovanni; Naldini, Luigi; Montini, Eugenio

2013-01-01

Transposons and γ-retroviruses have been efficiently used as insertional mutagens in different tissues to identify molecular culprits of cancer. However, these systems are characterized by recurring integrations that accumulate in tumor cells, hampering the identification of early cancer-driving events amongst bystander and progression-related events. We developed an insertional mutagenesis platform based on lentiviral vectors (LVV) by which we could efficiently induce hepatocellular carcinoma (HCC) in 3 different mouse models. By virtue of LVV’s replication-deficient nature and broad genome-wide integration pattern, LVV-based insertional mutagenesis allowed identification of 4 new liver cancer genes from a limited number of integrations. We validated the oncogenic potential of all the identified genes in vivo, with different levels of penetrance. Our newly identified cancer genes are likely to play a role in human disease, since they are upregulated and/or amplified/deleted in human HCCs and can predict clinical outcome of patients. PMID:23314173

Comparative Assessment of Cutting Inserts and Optimization during Hard Turning: Taguchi-Based Grey Relational Analysis

NASA Astrophysics Data System (ADS)

Venkata Subbaiah, K.; Raju, Ch.; Suresh, Ch.

2017-08-01

The present study aims to compare the conventional cutting inserts with wiper cutting inserts during the hard turning of AISI 4340 steel at different workpiece hardness. Type of insert, hardness, cutting speed, feed, and depth of cut are taken as process parameters. Taguchi’s L18 orthogonal array was used to conduct the experimental tests. Parametric analysis carried in order to know the influence of each process parameter on the three important Surface Roughness Characteristics (Ra, Rz, and Rt) and Material Removal Rate. Taguchi based Grey Relational Analysis (GRA) used to optimize the process parameters for individual response and multi-response outputs. Additionally, the analysis of variance (ANOVA) is also applied to identify the most significant factor.

Molecular dynamics simulation of the opposite-base preference and interactions in the active site of formamidopyrimidine-DNA glycosylase.

PubMed

Popov, Alexander V; Endutkin, Anton V; Vorobjev, Yuri N; Zharkov, Dmitry O

2017-05-08

Formamidopyrimidine-DNA glycosylase (Fpg) removes abundant pre-mutagenic 8-oxoguanine (oxoG) bases from DNA through nucleophilic attack of its N-terminal proline at C1' of the damaged nucleotide. Since oxoG efficiently pairs with both C and A, Fpg must excise oxoG from pairs with C but not with A, otherwise a mutation occurs. The crystal structures of several Fpg-DNA complexes have been solved, yet no structure with A opposite the lesion is available. Here we use molecular dynamic simulation to model interactions in the pre-catalytic complex of Lactococcus lactis Fpg with DNA containing oxoG opposite C or A, the latter in either syn or anti conformation. The catalytic dyad, Pro1-Glu2, was modeled in all four possible protonation states. Only one transition was observed in the experimental reaction rate pH dependence plots, and Glu2 kept the same set of interactions regardless of its protonation state, suggesting that it does not limit the reaction rate. The adenine base opposite oxoG was highly distorting for the adjacent nucleotides: in the more stable syn models it formed non-canonical bonds with out-of-register nucleotides in both the damaged and the complementary strand, whereas in the anti models the adenine either formed non-canonical bonds or was expelled into the major groove. The side chains of Arg109 and Phe111 that Fpg inserts into DNA to maintain its kinked conformation tended to withdraw from their positions if A was opposite to the lesion. The region showing the largest differences in the dynamics between oxoG:C and oxoG:A substrates was unexpectedly remote from the active site, located near the linker joining the two domains of Fpg. This region was also highly conserved among 124 analyzed Fpg sequences. Three sites trapping water molecules through multiple bonds were identified on the protein-DNA interface, apparently helping to maintain enzyme-induced DNA distortion and participating in oxoG recognition. Overall, the discrimination against A opposite to the lesion seems to be due to incorrect DNA distortion around the lesion-containing base pair and, possibly, to gross movement of protein domains connected by the linker.

Unique Thermal Stability of Unnatural Hydrophobic Ds Bases in Double-Stranded DNAs.

PubMed

Kimoto, Michiko; Hirao, Ichiro

2017-10-20

Genetic alphabet expansion technology, the introduction of unnatural bases or base pairs into replicable DNA, has rapidly advanced as a new synthetic biology area. A hydrophobic unnatural base pair between 7-(2-thienyl)imidazo[4,5-b]pyridine (Ds) and 2-nitro-4-propynylpyrrole (Px) exhibited high fidelity as a third base pair in PCR. SELEX methods using the Ds-Px pair enabled high-affinity DNA aptamer generation, and introducing a few Ds bases into DNA aptamers extremely augmented their affinities and selectivities to target proteins. Here, to further scrutinize the functions of this highly hydrophobic Ds base, the thermal stabilities of double-stranded DNAs (dsDNA) containing a noncognate Ds-Ds or G-Ds pair were examined. The thermal stability of the Ds-Ds self-pair was as high as that of the natural G-C pair, and apart from the generally higher stability of the G-C pair than that of the A-T pair, most of the 5'-pyrimidine-Ds-purine-3' sequences, such as CDsA and TDsA, exhibited higher stability than the 5'-purine-Ds-pyrimidine-3' sequences, such as GDsC and ADsC, in dsDNAs. This trait enabled the GC-content-independent control of the thermal stability of the designed dsDNA fragments. The melting temperatures of dsDNA fragments containing the Ds-Ds pair can be predicted from the nearest-neighbor parameters including the Ds base. In addition, the noncognate G-Ds pair can efficiently distinguish its neighboring cognate natural base pairs from noncognate pairs. We demonstrated that real-time PCR using primers containing Ds accurately detected a single-nucleotide mismatch in target DNAs. These unique properties of the Ds base that affect the stabilities of the neighboring base pairs could impart new functions to DNA molecules and technologies.

Hotspot mutation panel testing reveals clonal evolution in a study of 265 paired primary and metastatic tumors.

PubMed

Goswami, Rashmi S; Patel, Keyur P; Singh, Rajesh R; Meric-Bernstam, Funda; Kopetz, E Scott; Subbiah, Vivek; Alvarez, Ricardo H; Davies, Michael A; Jabbar, Kausar J; Roy-Chowdhuri, Sinchita; Lazar, Alexander J; Medeiros, L Jeffrey; Broaddus, Russell R; Luthra, Rajyalakshmi; Routbort, Mark J

2015-06-01

We used a clinical next-generation sequencing (NGS) hotspot mutation panel to investigate clonal evolution in paired primary and metastatic tumors. A total of 265 primary and metastatic tumor pairs were sequenced using a 46-gene cancer mutation panel capable of detecting one or more single-nucleotide variants as well as small insertions/deletions. Mutations were tabulated together with tumor type and percentage, mutational variant frequency, time interval between onset of primary tumor and metastasis, and neoadjuvant therapy status. Of note, 227 of 265 (85.7%) tumor metastasis pairs showed identical mutation calls. Of the tumor pairs with identical mutation calls, 160 (60.4%) possessed defining somatic mutation signatures and 67 (25.3%) did not exhibit any somatic mutations. There were 38 (14.3%) cases that showed at least one novel mutation call between the primary and metastasis. Metastases were almost two times more likely to show novel mutations (n = 20, 7.5%) than primary tumors (n = 12, 4.5%). TP53 was the most common additionally mutated gene in metastatic lesions, followed by PIK3CA and SMAD4. PIK3CA mutations were more often associated with metastasis in colon carcinoma samples. Clinical NGS hotspot panels can be useful in analyzing clonal evolution within tumors as well as in determining subclonal mutations that can expand in future metastases. PIK3CA, SMAD4, and TP53 are most often involved in clonal divergence, providing potential targets that may help guide the clinical management of tumor progression or metastases. ©2015 American Association for Cancer Research.

Comparative Genome Analyses of Streptococcus suis Isolates from Endocarditis Demonstrate Persistence of Dual Phenotypic Clones

PubMed Central

Tohya, Mari; Watanabe, Takayasu; Maruyama, Fumito; Arai, Sakura; Ota, Atsushi; Athey, Taryn B. T.; Fittipaldi, Nahuel; Nakagawa, Ichiro; Sekizaki, Tsutomu

2016-01-01

Many bacterial species coexist in the same niche as heterogeneous clones with different phenotypes; however, understanding of infectious diseases by polyphenotypic bacteria is still limited. In the present study, encapsulation in isolates of the porcine pathogen Streptococcus suis from persistent endocarditis lesions was examined. Coexistence of both encapsulated and unencapsulated S. suis isolates was found in 26 out of 59 endocarditis samples. The isolates were serotype 2, and belonged to two different sequence types (STs), ST1 and ST28. The genomes of each of the 26 pairs of encapsulated and unencapsulated isolates from the 26 samples were sequenced. The data showed that each pair of isolates had one or more unique nonsynonymous mutations in the cps gene, and the encapsulated and unencapsulated isolates from the same samples were closest to each other. Pairwise comparisons of the sequences of cps genes in 7 pairs of encapsulated and unencapsulated isolates identified insertion/deletions (indels) ranging from one to 104 bp in different cps genes of unencapsulated isolates. Capsule expression was restored in a subset of unencapsulated isolates by complementation in trans with cps expression vectors. Examination of gene content common to isolates indicated that mutation frequency was higher in ST28 pairs than in ST1 pairs. Genes within mobile genetic elements were mutation hot spots among ST28 isolates. Taken all together, our results demonstrate the coexistence of dual phenotype (encapsulated and unencapsulated) bacterial clones and suggest that the dual phenotypes arose independently in each farm by means of spontaneous mutations in cps genes. PMID:27433935

Defective pairing and synaptonemal complex formation in a Sordaria mutant (spo44) with a translocated segment of the nucleolar organizer.

PubMed

Zickler, D; de Lares, L; Moreau, P J; Leblon, G

1985-01-01

The recessive meiotic mutant spo44 of Sordaria macrospora, with 90% ascospore abortion, exhibits striking effects on recombination (67% decrease), irregular segregation of the almost unpaired homologues, and a decrease in chiasma frequency in the few cases where bivalents are formed. Three-dimensional reconstructions of ten prophase nuclei indicate that pairing, as judged by the absence of fully formed synaptonemal complexes (SC), is not achieved although lateral elements (LE) assemble. The pairing failure is attributable to defects in the alignment of homologous chromosomes. The leptotene alignment seen in the wild type before SC formation was not observed in the spo44 nuclei. Dense material, considered to be precursor of SC central elements, was found scattered among the LE in two nuclei. The behaviour of spo44 substantiates the hypothesis that chromosome matching and SC formation are separable events. - The total length of the LE in the mutant is the same as in the wild type, but due to variable numbers and length of the individual LE, homologues cannot be lined up. Light microscopic observations indicate that the irregular length and number of LE is due to extensive chromosome breakage. The wild-type function corresponding to spo44 is required for both LE integrity and chromosome matching. Reconstructions of heterozygous nuclei reveal the presence of a supernumerary nucleolar organizer in one arm of chromosome 7. It is suggested that rDNA has been inserted into a gene whose function is involved in pairing or into a controlling sequence that interacts with the pairing process.

Laparoscopic insertion of the Moss feeding tube.

PubMed

Albrink, M H; Hagan, K; Rosemurgy, A S

1993-12-01

Placement of enteral feeding tubes is an important part of a surgeon's skill base. Surgical insertion of feeding tubes has been performed safely for many years with very few modifications. With the recent surge in interest and applicability of other laparoscopic procedures, it is well within the skills of the average laparoscopic surgeon to insert feeding tubes. We describe herein a simple technique for the insertion of the Moss feeding tube. The procedure described has a minimum of invasion, along with simplicity, safety, and accuracy.

GRIDSS: sensitive and specific genomic rearrangement detection using positional de Bruijn graph assembly

PubMed Central

Do, Hongdo; Molania, Ramyar

2017-01-01

The identification of genomic rearrangements with high sensitivity and specificity using massively parallel sequencing remains a major challenge, particularly in precision medicine and cancer research. Here, we describe a new method for detecting rearrangements, GRIDSS (Genome Rearrangement IDentification Software Suite). GRIDSS is a multithreaded structural variant (SV) caller that performs efficient genome-wide break-end assembly prior to variant calling using a novel positional de Bruijn graph-based assembler. By combining assembly, split read, and read pair evidence using a probabilistic scoring, GRIDSS achieves high sensitivity and specificity on simulated, cell line, and patient tumor data, recently winning SV subchallenge #5 of the ICGC-TCGA DREAM8.5 Somatic Mutation Calling Challenge. On human cell line data, GRIDSS halves the false discovery rate compared to other recent methods while matching or exceeding their sensitivity. GRIDSS identifies nontemplate sequence insertions, microhomologies, and large imperfect homologies, estimates a quality score for each breakpoint, stratifies calls into high or low confidence, and supports multisample analysis. PMID:29097403

Herpes simplex virus type 1 (HSV-1)-derived recombinant vectors for gene transfer and gene therapy.

PubMed

Marconi, Peggy; Fraefel, Cornel; Epstein, Alberto L

2015-01-01

Herpes simplex virus type 1 (HSV-1 ) is a human pathogen whose lifestyle is based on a long-term dual interaction with the infected host, being able to establish both lytic and latent infections. The virus genome is a 153-kilobase pair (kbp) double-stranded DNA molecule encoding more than 80 genes. The interest of HSV-1 as gene transfer vector stems from its ability to infect many different cell types, both quiescent and proliferating cells, the very high packaging capacity of the virus capsid, the outstanding neurotropic adaptations that this virus has evolved, and the fact that it never integrates into the cellular chromosomes, thus avoiding the risk of insertional mutagenesis. Two types of vectors can be derived from HSV-1, recombinant vectors and amplicon vectors, and different methodologies have been developed to prepare large stocks of each type of vector. This chapter summarizes the approach most commonly used to prepare recombinant HSV-1 vectors through homologous recombination, either in eukaryotic cells or in bacteria.

Evolutionary genomics of epidemic visceral leishmaniasis in the Indian subcontinent

PubMed Central

Imamura, Hideo; Downing, Tim; Van den Broeck, Frederik; Sanders, Mandy J; Rijal, Suman; Sundar, Shyam; Mannaert, An; Vanaerschot, Manu; Berg, Maya; De Muylder, Géraldine; Dumetz, Franck; Cuypers, Bart; Maes, Ilse; Domagalska, Malgorzata; Decuypere, Saskia; Rai, Keshav; Uranw, Surendra; Bhattarai, Narayan Raj; Khanal, Basudha; Prajapati, Vijay Kumar; Sharma, Smriti; Stark, Olivia; Schönian, Gabriele; De Koning, Harry P; Settimo, Luca; Vanhollebeke, Benoit; Roy, Syamal; Ostyn, Bart; Boelaert, Marleen; Maes, Louis; Berriman, Matthew; Dujardin, Jean-Claude; Cotton, James A

2016-01-01

Leishmania donovani causes visceral leishmaniasis (VL), the second most deadly vector-borne parasitic disease. A recent epidemic in the Indian subcontinent (ISC) caused up to 80% of global VL and over 30,000 deaths per year. Resistance against antimonial drugs has probably been a contributing factor in the persistence of this epidemic. Here we use whole genome sequences from 204 clinical isolates to track the evolution and epidemiology of L. donovani from the ISC. We identify independent radiations that have emerged since a bottleneck coincident with 1960s DDT spraying campaigns. A genetically distinct population frequently resistant to antimonials has a two base-pair insertion in the aquaglyceroporin gene LdAQP1 that prevents the transport of trivalent antimonials. We find evidence of genetic exchange between ISC populations, and show that the mutation in LdAQP1 has spread by recombination. Our results reveal the complexity of L. donovani evolution in the ISC in response to drug treatment. DOI: http://dx.doi.org/10.7554/eLife.12613.001 PMID:27003289

Laser profiling of 3D microturbine blades

NASA Astrophysics Data System (ADS)

Holmes, Andrew S.; Heaton, Mark E.; Hong, Guodong; Pullen, Keith R.; Rumsby, Phil T.

2003-11-01

We have used KrF excimer laser ablation in the fabrication of a novel MEMS power conversion device based on an axial-flow turbine with an integral axial-flux electromagnetic generator. The device has a sandwich structure, comprising a pair of silicon stators either side of an SU8 polymer rotor. The curved turbine rotor blades were fabricated by projection ablation of SU8 parts performed by conventional UV lithography. A variable aperture mask, implemented by stepping a moving aperture in front of a fixed one, was used to achieve the desired spatial variation in the ablated depth. An automatic process was set up on a commercial laser workstation, with the laser firing and mask motion being controlled by computer. High quality SU8 rotor parts with diameters of 13 mm and depths of 1 mm were produced at a fluence of 0.7 J/cm2, corresponding to a material removal rate of approximately 0.3 μm per pulse. A similar approach was used to form SU8 guide vane inserts for the stators.

Molecular cloning and characterization of preproorexin in winter skate (Leucoraja ocellata).

PubMed

MacDonald, Erin E; Volkoff, Hélène

2010-12-01

A 815 base pairs (bp) cDNA encoding for preproorexin (preproOX) was cloned in winter skate, a cartilaginous fish. Winter skate preproOX is 159 amino acids (aa) long and contains a 34 aa orexin A and 28 aa orexin B. The amino acid sequence of winter skate preproOX is more similar to tetrapod preproOXs (36-40% identity) than teleost preproOXs (23-33% identity). Whereas orexin B appears relatively well conserved among vertebrates, orexin A displays more variability, in particular due to an "insertion sequence" that is present in teleost fish, but not in skate and tetrapods. RT-PCR studies show that preproOX mRNA has a widespread distribution within the brain and is present in several peripheral tissues, including gastrointestinal tract, heart and testes. Fasting induced increases in preproOX expression in the hypothalamus, suggesting that orexin might play a role in the regulation of food intake in winter skate. Copyright © 2010 Elsevier Inc. All rights reserved.

Evolutionary genomics of epidemic visceral leishmaniasis in the Indian subcontinent.

PubMed

Imamura, Hideo; Downing, Tim; Van den Broeck, Frederik; Sanders, Mandy J; Rijal, Suman; Sundar, Shyam; Mannaert, An; Vanaerschot, Manu; Berg, Maya; De Muylder, Géraldine; Dumetz, Franck; Cuypers, Bart; Maes, Ilse; Domagalska, Malgorzata; Decuypere, Saskia; Rai, Keshav; Uranw, Surendra; Bhattarai, Narayan Raj; Khanal, Basudha; Prajapati, Vijay Kumar; Sharma, Smriti; Stark, Olivia; Schönian, Gabriele; De Koning, Harry P; Settimo, Luca; Vanhollebeke, Benoit; Roy, Syamal; Ostyn, Bart; Boelaert, Marleen; Maes, Louis; Berriman, Matthew; Dujardin, Jean-Claude; Cotton, James A

2016-03-22

Leishmania donovani causes visceral leishmaniasis (VL), the second most deadly vector-borne parasitic disease. A recent epidemic in the Indian subcontinent (ISC) caused up to 80% of global VL and over 30,000 deaths per year. Resistance against antimonial drugs has probably been a contributing factor in the persistence of this epidemic. Here we use whole genome sequences from 204 clinical isolates to track the evolution and epidemiology of L. donovani from the ISC. We identify independent radiations that have emerged since a bottleneck coincident with 1960s DDT spraying campaigns. A genetically distinct population frequently resistant to antimonials has a two base-pair insertion in the aquaglyceroporin gene LdAQP1 that prevents the transport of trivalent antimonials. We find evidence of genetic exchange between ISC populations, and show that the mutation in LdAQP1 has spread by recombination. Our results reveal the complexity of L. donovani evolution in the ISC in response to drug treatment.

Benchmarking database performance for genomic data.

PubMed

Khushi, Matloob

2015-06-01

Genomic regions represent features such as gene annotations, transcription factor binding sites and epigenetic modifications. Performing various genomic operations such as identifying overlapping/non-overlapping regions or nearest gene annotations are common research needs. The data can be saved in a database system for easy management, however, there is no comprehensive database built-in algorithm at present to identify overlapping regions. Therefore I have developed a novel region-mapping (RegMap) SQL-based algorithm to perform genomic operations and have benchmarked the performance of different databases. Benchmarking identified that PostgreSQL extracts overlapping regions much faster than MySQL. Insertion and data uploads in PostgreSQL were also better, although general searching capability of both databases was almost equivalent. In addition, using the algorithm pair-wise, overlaps of >1000 datasets of transcription factor binding sites and histone marks, collected from previous publications, were reported and it was found that HNF4G significantly co-locates with cohesin subunit STAG1 (SA1).Inc. © 2015 Wiley Periodicals, Inc.

Impact of DNA mismatch repair system alterations on human fertility and related treatments.

PubMed

Hu, Min-hao; Liu, Shu-yuan; Wang, Ning; Wu, Yan; Jin, Fan

2016-01-01

DNA mismatch repair (MMR) is one of the biological pathways, which plays a critical role in DNA homeostasis, primarily by repairing base-pair mismatches and insertion/deletion loops that occur during DNA replication. MMR also takes part in other metabolic pathways and regulates cell cycle arrest. Defects in MMR are associated with genomic instability, predisposition to certain types of cancers and resistance to certain therapeutic drugs. Moreover, genetic and epigenetic alterations in the MMR system demonstrate a significant relationship with human fertility and related treatments, which helps us to understand the etiology and susceptibility of human infertility. Alterations in the MMR system may also influence the health of offspring conceived by assisted reproductive technology in humans. However, further studies are needed to explore the specific mechanisms by which the MMR system may affect human infertility. This review addresses the physiological mechanisms of the MMR system and associations between alterations of the MMR system and human fertility and related treatments, and potential effects on the next generation.

Is there a bone-nail specific entry point? Automated fit quantification of tibial nail designs during the insertion for six different nail entry points.

PubMed

Amarathunga, J P; Schuetz, M A; Yarlagadda, K V D; Schmutz, B

2015-04-01

Intramedullary nailing is the standard fixation method for displaced diaphyseal fractures of tibia. Selection of the correct nail insertion point is important for axial alignment of bone fragments and to avoid iatrogenic fractures. However, the standard entry point (SEP) may not always optimise the bone-nail fit due to geometric variations of bones. This study aimed to investigate the optimal entry for a given bone-nail pair using the fit quantification software tool previously developed by the authors. The misfit was quantified for 20 bones with two nail designs (ETN and ETN-Proximal Bend) related to the SEP and 5 entry points which were 5 mm and 10 mm away from the SEP. The SEP was the optimal entry point for 50% of the bones used. For the remaining bones, the optimal entry point was located 5 mm away from the SEP, which improved the overall fit by 40% on average. However, entry points 10 mm away from the SEP doubled the misfit. The optimised bone-nail fit can be achieved through the SEP and within the range of a 5 mm radius, except posteriorly. The study results suggest that the optimal entry point should be selected by considering the fit during insertion and not only at the final position. Copyright © 2015 IPEM. Published by Elsevier Ltd. All rights reserved.

Molecular recognition of DNA base pairs by the formamido/pyrrole and formamido/imidazole pairings in stacked polyamides

PubMed Central

Buchmueller, Karen L.; Staples, Andrew M.; Uthe, Peter B.; Howard, Cameron M.; Pacheco, Kimberly A. O.; Cox, Kari K.; Henry, James A.; Bailey, Suzanna L.; Horick, Sarah M.; Nguyen, Binh; Wilson, W. David; Lee, Moses

2005-01-01

Polyamides containing an N-terminal formamido (f) group bind to the minor groove of DNA as staggered, antiparallel dimers in a sequence-specific manner. The formamido group increases the affinity and binding site size, and it promotes the molecules to stack in a staggered fashion thereby pairing itself with either a pyrrole (Py) or an imidazole (Im). There has not been a systematic study on the DNA recognition properties of the f/Py and f/Im terminal pairings. These pairings were analyzed here in the context of f-ImPyPy, f-ImPyIm, f-PyPyPy and f-PyPyIm, which contain the central pairing modes, –ImPy– and –PyPy–. The specificity of these triamides towards symmetrical recognition sites allowed for the f/Py and f/Im terminal pairings to be directly compared by SPR, CD and ΔTM experiments. The f/Py pairing, when placed next to the –ImPy– or –PyPy– central pairings, prefers A/T and T/A base pairs to G/C base pairs, suggesting that f/Py has similar DNA recognition specificity to Py/Py. With –ImPy– central pairings, f/Im prefers C/G base pairs (>10 times) to the other Watson–Crick base pairs; therefore, f/Im behaves like the Py/Im pair. However, the f/Im pairing is not selective for the C/G base pair when placed next to the –PyPy– central pairings. PMID:15703305

Design and characterisation of a polyethylene oxide matrix with the potential use as a teat insert for prevention/treatment of bovine mastitis.

PubMed

Bhattarai, Sushila; Alany, Raid G; Bunt, Craig R; Abdelkader, Hamdy; Rathbone, Michael J

2015-01-01

This manuscript reports (for the first time) on antibiotic-free polymeric inserts for the prevention and/or treatment of bovine mastitis. Polyethylene oxide (PEO)-based inserts were prepared using different concentrations of various hydrophilic polymers and water-soluble and water-insoluble drug-release-modifying excipients. A simple and scalable melt-extrusion method was employed to prepare the inserts. The prepared inserts were characterised for their dimension, rheological and mechanical properties. The in vitro release of a model bacteriostatic drug (salicylic acid) from the prepared inserts was studied to demonstrate the effectiveness and reproducibility of the melt-extrusion manufacturing method. Further, the in vitro stability of the inserts was evaluated using gel permeation chromatography (GPC) to monitor any change in molecular weight under real-time and accelerated storage conditions. The investigated inserts were stable at accelerated storage conditions over a period of 6 months. PEO inserts have the potential to serve a dual purpose, act as a physical barrier against pathogens invading the teat canal of cows and possibly control the release of a drug.

Base-Pairing Energies of Protonated Nucleoside Base Pairs of dCyd and m5dCyd: Implications for the Stability of DNA i-Motif Conformations

NASA Astrophysics Data System (ADS)

Yang, Bo; Rodgers, M. T.

2015-08-01

Hypermethylation of cytosine in expanded (CCG)n•(CGG)n trinucleotide repeats results in Fragile X syndrome, the most common cause of inherited mental retardation. The (CCG)n•(CGG)n repeats adopt i-motif conformations that are preferentially stabilized by base-pairing interactions of protonated base pairs of cytosine. Here we investigate the effects of 5-methylation and the sugar moiety on the base-pairing energies (BPEs) of protonated cytosine base pairs by examining protonated nucleoside base pairs of 2'-deoxycytidine (dCyd) and 5-methyl-2'-deoxycytidine (m5dCyd) using threshold collision-induced dissociation techniques. 5-Methylation of a single or both cytosine residues leads to very small change in the BPE. However, the accumulated effect may be dramatic in diseased state trinucleotide repeats where many methylated base pairs may be present. The BPEs of the protonated nucleoside base pairs examined here significantly exceed those of Watson-Crick dGuo•dCyd and neutral dCyd•dCyd base pairs, such that these base-pairing interactions provide the major forces responsible for stabilization of DNA i-motif conformations. Compared with isolated protonated nucleobase pairs of cytosine and 1-methylcytosine, the 2'-deoxyribose sugar produces an effect similar to the 1-methyl substituent, and leads to a slight decrease in the BPE. These results suggest that the base-pairing interactions may be slightly weaker in nucleic acids, but that the extended backbone is likely to exert a relatively small effect on the total BPE. The proton affinity (PA) of m5dCyd is also determined by competitive analysis of the primary dissociation pathways that occur in parallel for the protonated (m5dCyd)H+(dCyd) nucleoside base pair and the absolute PA of dCyd previously reported.

Fracture of Reduced-Diameter Zirconia Dental Implants Following Repeated Insertion.

PubMed

Karl, Matthias; Scherg, Stefan; Grobecker-Karl, Tanja

Achievement of high insertion torque values indicating good primary stability is a goal during dental implant placement. The objective of this study was to evaluate whether or not two-piece implants made from zirconia ceramic may be damaged as a result of torque application. A total of 10 two-piece zirconia implants were repeatedly inserted into polyurethane foam material with increasing density and decreasing osteotomy size. The insertion torque applied was measured, and implants were checked for fractures by applying the fluorescent penetrant method. Weibull probability of failure was calculated based on the recorded insertion torque values. Catastrophic failures could be seen in five of the implants from two different batches at insertion torques ranging from 46.0 to 70.5 Ncm, while the remaining implants (all belonging to one batch) survived. Weibull probability of failure seems to be low at the manufacturer-recommended maximum insertion torque of 35 Ncm. Chipping fractures at the thread tips as well as tool marks were the only otherwise observed irregularities. While high insertion torques may be desirable for immediate loading protocols, zirconia implants may fracture when manufacturer-recommended insertion torques are exceeded. Evaluating bone quality prior to implant insertion may be useful.

Biochemical and genetic analyses of acetoin catabolism in Alcaligenes eutrophus.

PubMed Central

Fründ, C; Priefert, H; Steinbüchel, A; Schlegel, H G

1989-01-01

In genetic studies on the catabolism of acetoin in Alcaligenes eutrophus, we used Tn5::mob-induced mutants which were impaired in the utilization of acetoin as the sole carbon source for growth. The transposon-harboring EcoRI restriction fragments from 17 acetoin-negative and slow-growing mutants (class 2a) and from six pleiotropic mutants of A. eutorphus, which were acetoin-negative and did not grow chemolithoautotrophically (class 2b), were cloned from pHC79 gene banks. The insertions of Tn5 were mapped on four different chromosomal EcoRI restriction fragments (A, C, D, and E) in class 2a mutants. The native DNA fragments were cloned from a lambda L47 or from a cosmid gene bank. Evidence is provided that fragments A (21 kilobase pairs [kb]) and C (7.7 kb) are closely linked in the genome; the insertions of Tn5 covered a region of approximately 5 kb. Physiological experiments revealed that this region encodes for acetoin:dichlorophenol-indophenol oxidoreductase, a fast-migrating protein, and probably for one additional protein that is as yet unknown. In mutants which were not completely impaired in growth on acetoin but which grew much slower and after a prolonged lag phase, fragments D (7.2 kb) and E (8.1 kb) were inactivated by insertion of Tn5::mob. No structural gene could be assigned to the D or E fragments. In class 2b mutants, insertions of Tn5 were mapped on fragment B (11.3 kb). This fragment complemented pleiotropic hno mutants in trans; these mutants were impaired in the formation of a rpoN-like protein. The expression of the gene cluster on fragments A and C seemed to be rpoN dependent. PMID:2556366

Mastication and oral health-related quality of life in removable denture wearers with Alzheimer disease.

PubMed

Campos, Camila H; Ribeiro, Giselle R; Rodrigues Garcia, Renata C M

2018-05-01

Alzheimer disease (AD) can affect masticatory function, affecting oral health-related quality of life (OHRQoL). Whether oral rehabilitation with conventional removable prostheses can restore masticatory function and improve OHRQoL in these individuals is unknown. The purpose of this clinical study was to evaluate the influence of oral rehabilitation with removable prostheses on masticatory efficiency and OHRQoL in elders with and without AD. Thirty-two elders with mild AD (n=16, mean age=76.7 ±6.3 years) or without AD (n=16, mean age=75.2 ±4.4 years) were recruited. All participants first underwent masticatory efficiency and OHRQoL evaluations, and 2 months after insertion of new removable prostheses, the variables were reassessed. Masticatory efficiency was determined using the sieving method, and OHRQoL was measured by applying the Geriatric Oral Health Assessment Index (GOHAI). The data from the baseline and after insertion of the new removable prostheses were compared by paired t test. Group differences at each time point were assessed by t test (α=.05). After insertion of the new removable prostheses, masticatory efficiency and OHRQoL improved in both the elders with AD and the control. At baseline, elders with AD had lower masticatory efficiency and higher OHRQoL than controls (P<.05). After removable prosthesis insertion, elders with AD continued to show lower masticatory efficiency values than controls, but their OHRQoL was similar. Oral rehabilitation with new removable prostheses improved the masticatory efficiency and OHRQoL of elders with and without AD, although masticatory efficiency did not reach control levels in elders with AD. Copyright © 2017 Editorial Council for the Journal of Prosthetic Dentistry. Published by Elsevier Inc. All rights reserved.

Satisfactory Short-Term Results of Navigation-Assisted Gap-Balancing Total Knee Arthroplasty Using Ultracongruent Insert.

PubMed

Yoon, Jung-Ro; Yang, Jae-Hyuk

2018-03-01

The use of highly conforming ultracongruent (UC) polyethylene insert is bone-preserving and became a relatively common alternative to the conventional posterior stabilized total knee arthroplasty (TKA) design. The purpose of this study was to analyze the short-term clinical and radiologic results of UC insert TKA using the navigation-assisted gap-balancing technique. Two hundred thirty-three knees were operated with a mean follow-up period of 8.1 years (minimum of 5 years). Radiologic and clinical outcomes were assessed before operation and at latest follow-up using the Knee Society Score and Western Ontario and McMaster Universities Osteoarthritis Index score. For statistical analysis, paired sample t-test and analysis of variance were used. Significance was considered as P < .05. According to the preoperative deformities (valgus, mild varus, and moderate varus), there were 23 cases (9.9%) of valgus deformity, 180 cases (77.3%) of mild varus deformity, and 30 cases (12.9%) of moderate varus deformity. Overall, the results at mean 8.1 years revealed an improvement in mean Knee Society Score (54 ± 12 to 92 ± 3) and mean Western Ontario and McMaster Universities Osteoarthritis Index scores (62 ± 14 to 17 ± 3). Overall, 220 of 233 cases (94.4%) were in neutral alignment (between -3° and +3°) at latest follow-up. There were no migrating or shifting prosthesis that should be considered as possible failure. There was 0% component revision rate. Navigation-assisted gap-balancing technique using UC insert TKA had satisfactory short-term outcome. Strict gap-balancing technique using the offset-type-force-controlled-spreader-system aided in the satisfactory results. Copyright © 2017 Elsevier Inc. All rights reserved.

Time-multiplexed two-channel capacitive radiofrequency hyperthermia with nanoparticle mediation.

PubMed

Kim, Ki Soo; Hernandez, Daniel; Lee, Soo Yeol

2015-10-24

Capacitive radiofrequency (RF) hyperthermia suffers from excessive temperature rise near the electrodes and poorly localized heat transfer to the deep-seated tumor region even though it is known to have potential to cure ill-conditioned tumors. To better localize heat transfer to the deep-seated target region in which electrical conductivity is elevated by nanoparticle mediation, two-channel capacitive RF heating has been tried on a phantom. We made a tissue-mimicking phantom consisting of two compartments, a tumor-tissue-mimicking insert against uniform background agarose. The tumor-tissue-mimicking insert was made to have higher electrical conductivity than the normal-tissue-mimicking background by applying magnetic nanoparticle suspension to the insert. Two electrode pairs were attached on the phantom surface by equal-angle separation to apply RF electric field to the phantom. To better localize heat transfer to the tumor-tissue-mimicking insert, RF power with a frequency of 26 MHz was delivered to the two channels in a time-multiplexed way. To monitor the temperature rise inside the phantom, MR thermometry was performed at a 3T MRI intermittently during the RF heating. Finite-difference-time-domain (FDTD) electromagnetic and thermal simulations on the phantom model were also performed to verify the experimental results. As compared to the one-channel RF heating, the two-channel RF heating with time-multiplexed driving improved the spatial localization of heat transfer to the tumor-tissue-mimicking region in both the simulation and experiment. The two-channel RF heating also reduced the temperature rise near the electrodes significantly. Time-multiplexed two-channel capacitive RF heating has the capability to better localize heat transfer to the nanoparticle-mediated tumor region which has higher electrical conductivity than the background normal tissues.

Metal-mediated DNA base pairing: alternatives to hydrogen-bonded Watson-Crick base pairs.

PubMed

Takezawa, Yusuke; Shionoya, Mitsuhiko

2012-12-18

With its capacity to store and transfer the genetic information within a sequence of monomers, DNA forms its central role in chemical evolution through replication and amplification. This elegant behavior is largely based on highly specific molecular recognition between nucleobases through the specific hydrogen bonds in the Watson-Crick base pairing system. While the native base pairs have been amazingly sophisticated through the long history of evolution, synthetic chemists have devoted considerable efforts to create alternative base pairing systems in recent decades. Most of these new systems were designed based on the shape complementarity of the pairs or the rearrangement of hydrogen-bonding patterns. We wondered whether metal coordination could serve as an alternative driving force for DNA base pairing and why hydrogen bonding was selected on Earth in the course of molecular evolution. Therefore, we envisioned an alternative design strategy: we replaced hydrogen bonding with another important scheme in biological systems, metal-coordination bonding. In this Account, we provide an overview of the chemistry of metal-mediated base pairing including basic concepts, molecular design, characteristic structures and properties, and possible applications of DNA-based molecular systems. We describe several examples of artificial metal-mediated base pairs, such as Cu(2+)-mediated hydroxypyridone base pair, H-Cu(2+)-H (where H denotes a hydroxypyridone-bearing nucleoside), developed by us and other researchers. To design the metallo-base pairs we carefully chose appropriate combinations of ligand-bearing nucleosides and metal ions. As expected from their stronger bonding through metal coordination, DNA duplexes possessing metallo-base pairs exhibited higher thermal stability than natural hydrogen-bonded DNAs. Furthermore, we could also use metal-mediated base pairs to construct or induce other high-order structures. These features could lead to metal-responsive functional DNA molecules such as artificial DNAzymes and DNA machines. In addition, the metallo-base pairing system is a powerful tool for the construction of homogeneous and heterogeneous metal arrays, which can lead to DNA-based nanomaterials such as electronic wires and magnetic devices. Recently researchers have investigated these systems as enzyme replacements, which may offer an additional contribution to chemical biology and synthetic biology through the expansion of the genetic alphabet.

Theoretical determination of one-electron redox potentials for DNA bases, base pairs, and stacks.

PubMed

Paukku, Y; Hill, G

2011-05-12

Electron affinities, ionization potentials, and redox potentials for DNA bases, base pairs, and N-methylated derivatives are computed at the DFT/M06-2X/6-31++G(d,p) level of theory. Redox properties of a guanine-guanine stack model are explored as well. Reduction and oxidation potentials are in good agreement with the experimental ones. Electron affinities of base pairs were found to be negative. Methylation of canonical bases affects the ionization potentials the most. Base pair formation and base stacking lower ionization potentials by 0.3 eV. Pairing of guanine with the 5-methylcytosine does not seem to influence the redox properties of this base pair much.

Base pairing and base mis-pairing in nucleic acids

NASA Technical Reports Server (NTRS)

Wang, A. H. J.; Rich, A.

1986-01-01

In recent years we have learned that DNA is conformationally active. It can exist in a number of different stable conformations including both right-handed and left-handed forms. Using single crystal X-ray diffraction analysis we are able to discover not only additional conformations of the nucleic acids but also different types of hydrogen bonded base-base interactions. Although Watson-Crick base pairings are the predominant type of interaction in double helical DNA, they are not the only types. Recently, we have been able to examine mismatching of guanine-thymine base pairs in left-handed Z-DNA at atomic resolution (1A). A minimum amount of distortion of the sugar phosphate backbone is found in the G x T pairing in which the bases are held together by two hydrogen bonds in the wobble pairing interaction. Because of the high resolution of the analysis we can visualize water molecules which fill in to accommodate the other hydrogen bonding positions in the bases which are not used in the base-base interactions. Studies on other DNA oligomers have revealed that other types of non-Watson-Crick hydrogen bonding interactions can occur. In the structure of a DNA octamer with the sequence d(GCGTACGC) complexed to an antibiotic triostin A, it was found that the two central AT base pairs are held together by Hoogsteen rather than Watson-Crick base pairs. Similarly, the G x C base pairs at the ends are also Hoogsteen rather than Watson-Crick pairing. Hoogsteen base pairs make a modified helix which is distinct from the Watson-Crick double helix.

Hidden in Plain Sight: Subtle Effects of the 8-Oxoguanine Lesion on the Structure, Dynamics, and Thermodynamics of a 15-Base-Pair Oligodeoxynucleotide Duplex†

PubMed Central

Crenshaw, Charisse M.; Wade, Jacqueline E.; Arthanari, Haribabu; Frueh, Dominique; Lane, Benjamin F.; Núñez, Megan E.

2011-01-01

The base lesion 8-oxoguanine is formed readily by oxidation of DNA, potentially leading to G→T transversion mutations. Despite the apparent similarity of 8-oxoguanine-cytosine base pairs to normal guanine-cytosine base pairs, cellular base excision repair systems effectively recognize the lesion base. Here we apply several techniques to examine a single 8-oxoguanine lesion at the center of a nonpalindromic 15-mer duplex oligonucleotide in an effort to determine what, if anything, distinguishes an 8-oxoguanine-cytosine base pair from a normal base pair. The lesion duplex is globally almost indistinguishable from the unmodified parent duplex using CD spectroscopy and UV melting thermodynamics. The DNA mismatch-detecting photocleavage agent Rh(bpy)2chrysi3+ cleaves only weakly and nonspecifically, revealing that the 8oxoG-C pair is locally stable at the level of the individual base pairs. NMR spectra are also consistent with a well-conserved B-form duplex structure. In the 2D NOESY spectra, base-sugar and imino-imino crosspeaks are strikingly similar between parent and lesion duplexes. Changes in chemical shift due to the 8oxoG lesion are localized to its complementary cytosine and to the 2–3 base pairs immediately flanking the lesion on the lesion strand. Residues further removed from the lesion are shown to be unperturbed by its presence. Notably, imino exchange experiments indicate that the 8-oxoguanine-cytosine pair is strong and stable, with an apparent equilibrium constant for opening equal to that of other internal guanine-cytosine base pairs, on the order of 10−6. This collection of experiments shows that the 8-oxoguanine-cytosine base pair is incredibly stable and similar to the native pair. PMID:21902242

Structural landscape of base pairs containing post-transcriptional modifications in RNA

PubMed Central

Seelam, Preethi P.; Sharma, Purshotam

2017-01-01

Base pairs involving post-transcriptionally modified nucleobases are believed to play important roles in a wide variety of functional RNAs. Here we present our attempts toward understanding the structural and functional role of naturally occurring modified base pairs using a combination of X-ray crystal structure database analysis, sequence analysis, and advanced quantum chemical methods. Our bioinformatics analysis reveals that despite their presence in all major secondary structural elements, modified base pairs are most prevalent in tRNA crystal structures and most commonly involve guanine or uridine modifications. Further, analysis of tRNA sequences reveals additional examples of modified base pairs at structurally conserved tRNA regions and highlights the conservation patterns of these base pairs in three domains of life. Comparison of structures and binding energies of modified base pairs with their unmodified counterparts, using quantum chemical methods, allowed us to classify the base modifications in terms of the nature of their electronic structure effects on base-pairing. Analysis of specific structural contexts of modified base pairs in RNA crystal structures revealed several interesting scenarios, including those at the tRNA:rRNA interface, antibiotic-binding sites on the ribosome, and the three-way junctions within tRNA. These scenarios, when analyzed in the context of available experimental data, allowed us to correlate the occurrence and strength of modified base pairs with their specific functional roles. Overall, our study highlights the structural importance of modified base pairs in RNA and points toward the need for greater appreciation of the role of modified bases and their interactions, in the context of many biological processes involving RNA. PMID:28341704

Background Information and User Guide for MIL-F-8785C, Military Specification - Flying Qualities of Piloted Airplanes

DTIC Science & Technology

1982-07-01

Design Military Specification 20. ABSTRACT (Co.itInue o., revorse.• de if ,lec0O.•,•dr’ 1 Id•ntnify’’ bY bI. rk ,CI•,ti lim r) ’This document is published...criteria to Insert into the basic requirements, verification proceduresand leason: learned from past experience. The Standkerd will thus be the framework ...equations with sketch: Each of the three paired quantities in the de - nominators of KS and KR should have a hir over them, as is done in the numerators

Introducing a model of pairing based on base pair specific interactions between identical DNA sequences

NASA Astrophysics Data System (ADS)

(O' Lee, Dominic J.

2018-02-01

At present, there have been suggested two types of physical mechanism that may facilitate preferential pairing between DNA molecules, with identical or similar base pair texts, without separation of base pairs. One mechanism solely relies on base pair specific patterns of helix distortion being the same on the two molecules, discussed extensively in the past. The other mechanism proposes that there are preferential interactions between base pairs of the same composition. We introduce a model, built on this second mechanism, where both thermal stretching and twisting fluctuations are included, as well as the base pair specific helix distortions. Firstly, we consider an approximation for weak pairing interactions, or short molecules. This yields a dependence of the energy on the square root of the molecular length, which could explain recent experimental data. However, analysis suggests that this approximation is no longer valid at large DNA lengths. In a second approximation, for long molecules, we define two adaptation lengths for twisting and stretching, over which the pairing interaction can limit the accumulation of helix disorder. When the pairing interaction is sufficiently strong, both adaptation lengths are finite; however, as we reduce pairing strength, the stretching adaptation length remains finite but the torsional one becomes infinite. This second state persists to arbitrarily weak values of the pairing strength; suggesting that, if the molecules are long enough, the pairing energy scales as length. To probe differences between the two pairing mechanisms, we also construct a model of similar form. However, now, pairing between identical sequences solely relies on the intrinsic helix distortion patterns. Between the two models, we see interesting qualitative differences. We discuss our findings, and suggest new work to distinguish between the two mechanisms.

Influence of Screw Length and Bone Thickness on the Stability of Temporary Implants

PubMed Central

Fernandes, Daniel Jogaib; Elias, Carlos Nelson; Ruellas, Antônio Carlos de Oliveira

2015-01-01

The purpose of this work was to study the influence of screw length and bone thickness on the stability of temporary implants. A total of 96 self-drilling temporary screws with two different lengths were inserted into polyurethane blocks (n = 66), bovine femurs (n = 18) and rabbit tibia (n = 12) with different cortical thicknesses (1 to 8 mm). Screws insertion in polyurethane blocks was assisted by a universal testing machine, torque peaks were collected by a digital torquemeter and bone thickness was monitored by micro-CT. The results showed that the insertion torque was significantly increased with the thickness of cortical bone from polyurethane (p < 0.0001), bovine (p = 0.0035) and rabbit (p < 0.05) sources. Cancellous bone improved significantly the mechanical implant stability. Insertion torque and insertion strength was successfully moduled by equations, based on the cortical/cancellous bone behavior. Based on the results, insertion torque and bone strength can be estimate in order to prevent failure of the cortical layer during temporary screw placement. The stability provided by a cortical thickness of 2 or 1 mm coupled to cancellous bone was deemed sufficient for temporary implants stability. PMID:28793582

Microfluidic devices fabricated in poly(methyl methacrylate) using hot-embossing with integrated sampling capillary and fiber optics for fluorescence detection.

PubMed

Qi, Shize; Liu, Xuezhu; Ford, Sean; Barrows, James; Thomas, Gloria; Kelly, Kevin; McCandless, Andrew; Lian, Kun; Goettert, Jost; Soper, Steven A

2002-05-01

High-aspect-ratio microstructures have been prepared using hot-embossing techniques in poly(methyl methacrylate) (PMMA) from Ni-based molding dies prepared using LIGA (Lithographie, Galvanoformung, Abformung). Due to the small amount of mask undercutting associated with X-ray lithography and the high energy X-ray beam used during photoresist patterning, deep structures with sharp and smooth sidewalls have been prepared. The Ni-electroforms produced devices with minimal replication errors using hot-embossing at a turn around time of approximately 5 min per device. In addition, several different polymers (with different glass transition temperatures) could be effectively molded with these Ni-electroforms and many devices (>300) molded with the same master without any noticeable degradation. The PMMA devices consisted of deep and narrow channels for insertion of a capillary for the automated electrokinetic loading of sample into the microfluidic device and also, a pair of optical fibers for shuttling laser light to the detection zone and collecting the resulting emission for fluorescence analysis. Electrophoretic separations of double-stranded DNA ladders Phi X174 digested with Hae III) were performed with fluorescence detection accomplished using near-IR excitation. It was found that the narrow width of the channels did not contribute significantly to electrophoretic zone broadening and the plate numbers generated in the extended length separation channel allowed sorting of the 271/281 base pair fragments associated with this sizing ladder when electrophoresed in methylcellulose entangled polymer solutions. The dual fiber detector produced sub-attomole detection limits with the entire detector, including laser source, electronics and photon transducer, situated in a single box measuring 3'' x 10" x 14".

Identification and codon reading properties of 5-cyanomethyl uridine, a new modified nucleoside found in the anticodon wobble position of mutant haloarchaeal isoleucine tRNAs

PubMed Central

Mandal, Debabrata; Köhrer, Caroline; Su, Dan; Babu, I. Ramesh; Chan, Clement T.Y.; Liu, Yuchen; Söll, Dieter; Blum, Paul; Kuwahara, Masayasu; Dedon, Peter C.; RajBhandary, Uttam L.

2014-01-01

Most archaea and bacteria use a modified C in the anticodon wobble position of isoleucine tRNA to base pair with A but not with G of the mRNA. This allows the tRNA to read the isoleucine codon AUA without also reading the methionine codon AUG. To understand why a modified C, and not U or modified U, is used to base pair with A, we mutated the C34 in the anticodon of Haloarcula marismortui isoleucine tRNA (tRNA2Ile) to U, expressed the mutant tRNA in Haloferax volcanii, and purified and analyzed the tRNA. Ribosome binding experiments show that although the wild-type tRNA2Ile binds exclusively to the isoleucine codon AUA, the mutant tRNA binds not only to AUA but also to AUU, another isoleucine codon, and to AUG, a methionine codon. The G34 to U mutant in the anticodon of another H. marismortui isoleucine tRNA species showed similar codon binding properties. Binding of the mutant tRNA to AUG could lead to misreading of the AUG codon and insertion of isoleucine in place of methionine. This result would explain why most archaea and bacteria do not normally use U or a modified U in the anticodon wobble position of isoleucine tRNA for reading the codon AUA. Biochemical and mass spectrometric analyses of the mutant tRNAs have led to the discovery of a new modified nucleoside, 5-cyanomethyl U in the anticodon wobble position of the mutant tRNAs. 5-Cyanomethyl U is present in total tRNAs from euryarchaea but not in crenarchaea, eubacteria, or eukaryotes. PMID:24344322

The cDNA sequence of mouse Pgp-1 and homology to human CD44 cell surface antigen and proteoglycan core/link proteins.

PubMed

Wolffe, E J; Gause, W C; Pelfrey, C M; Holland, S M; Steinberg, A D; August, J T

1990-01-05

We describe the isolation and sequencing of a cDNA encoding mouse Pgp-1. An oligonucleotide probe corresponding to the NH2-terminal sequence of the purified protein was synthesized by the polymerase chain reaction and used to screen a mouse macrophage lambda gt11 library. A cDNA clone with an insert of 1.2 kilobases was selected and sequenced. In Northern blot analysis, only cells expressing Pgp-1 contained mRNA species that hybridized with this Pgp-1 cDNA. The nucleotide sequence of the cDNA has a single open reading frame that yields a protein-coding sequence of 1076 base pairs followed by a 132-base pair 3'-untranslated sequence that includes a putative polyadenylation signal but no poly(A) tail. The translated sequence comprises a 13-amino acid signal peptide followed by a polypeptide core of 345 residues corresponding to an Mr of 37,800. Portions of the deduced amino acid sequence were identical to those obtained by amino acid sequence analysis from the purified glycoprotein, confirming that the cDNA encodes Pgp-1. The predicted structure of Pgp-1 includes an NH2-terminal extracellular domain (residues 14-265), a transmembrane domain (residues 266-286), and a cytoplasmic tail (residues 287-358). Portions of the mouse Pgp-1 sequence are highly similar to that of the human CD44 cell surface glycoprotein implicated in cell adhesion. The protein also shows sequence similarity to the proteoglycan tandem repeat sequences found in cartilage link protein and cartilage proteoglycan core protein which are thought to be involved in binding to hyaluronic acid.

An electrode polarization impedance based flow sensor for low water flow measurement

NASA Astrophysics Data System (ADS)

Yan, Tinghu; Sabic, Darko

2013-06-01

This note describes an electrode polarization impedance based flow sensor for low water flow measurement. It consists of two pairs of stainless steel electrodes set apart and inserted into a non-conductive flow tube with each pair of electrodes placed diametrically at the opposite sides. The flow sensor is modeled as a typical four-electrode system of which two electrodes are current-carrying and the other two serve as output pick ups. The polarization impedances of the two current carrying electrodes are affected by water flows resulting in changes of differential potential between the two pick-up electrodes which are separated by the same fluid. The interrogation of the two excitation electrodes with dc biased ac signals offers significantly higher sensor sensitivities to flow. The prototype flow sensor constructed for a 20 mm diameter pipeline was able to measure water flow rate as low as tested at 1.06 l h-1 and remained sensitive at a flow rate of 25.18 l h-1 when it was driven with a sinusoidal voltage at 1000 Hz with a peak ac amplitude of 2 V and a dc offset of +8 V. The nonlinear characteristics of the sensor response indicate that the sensor is more sensitive at low flows and will not be able to measure at very high flows. Additional experiments are needed to evaluate the influences of impurities, chemical species, ions constituents, conductivity and temperature over a practical range of residential water conditions, the effects of fluctuating ground signals, measurement uncertainty, power consumption, compensation of effects and practical operations. The flow sensor (principle) presented may be used as (in) a secondary sensor in combination with an existing electronic water meter to extend the low end of measurement range in residential water metering.

Comparative evolution history of SINEs in Arabidopsis thaliana and Brassica oleracea: evidence for a high rate of SINE loss.

PubMed

Lenoir, A; Pélissier, T; Bousquet-Antonelli, C; Deragon, J M

2005-01-01

Brassica oleracea and Arabidopsis thaliana belong to the Brassicaceae(Cruciferae) family and diverged 16 to 19 million years ago. Although the genome size of B. oleracea (approximately 600 million base pairs) is more than four times that of A. thaliana (approximately 130 million base pairs), their gene content is believed to be very similar with more than 85% sequence identity in the coding region. Therefore, this important difference in genome size is likely to reflect a different rate of non-coding DNA accumulation. Transposable elements (TEs) constitute a major fraction of non-coding DNA in plant species. A different rate in TE accumulation between two closely related species can result in significant genome size variations in a short evolutionary period. Short interspersed elements (SINEs) are non-autonomous retroposons that have invaded the genome of most eukaryote species. Several SINE families are present in B. oleracea and A. thaliana and we found that two of them (called RathE1 and RathE2) are present in both species. In this study, the tempo of evolution of RathE1 and RathE2 SINE families in both species was compared. We observed that most B. oleracea RathE2 SINEs are "young" (close to the consensus sequence) and abundant while elements from this family are more degenerated and much less abundant in A. thaliana. However, the situation is different for the RathE1 SINE family for which the youngest elements are found in A. thaliana. Surprisingly, no SINE was found to occupy the same (orthologous) genomic locus in both species suggesting that either these SINE families were not amplified at a significant rate in the common ancestor of the two species or that older elements were lost and only the recent (lineage-specific) insertions remain. To test this latter hypothesis, loci containing a recently inserted SINE in the A. thaliana col-0 ecotype were selected and characterized in several other A. thaliana ecotypes. In addition to the expected SINE containing allele and the pre-integrative allele (i.e. the "empty" allele), we observed in the different ecotypes, alleles with truncated portions of the SINE (up to the complete loss of the element) and of the immediate genomic flanking sequences. The absence of SINEs in orthologous positions between B. oleracea and A. thaliana and the presence in recently diverged A. thaliana ecotypes of alleles containing severely truncated SINEs suggest a very high rate of SINE loss in these species.

Unexpected formal insertion of CO 2 into the C-Si bonds of a zinc compound

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kemp, Richard A.; McGrew, Genette I.; Khatri, Pathik A.

Reaction of [κ 2-PR 2C(SiMe 3)Py] 2Zn (R = Ph, 2a; iPr, 2b) with CO 2 affords the products of formal insertion at the C–Si bond, [κ 2-PR 2CC(O)O(SiMe 3)Py] 2Zn (R = Ph, 3a; iPr, 3b). Insertion product 3b was structurally characterized. As a result, the reaction appears to be a stepwise insertion and rearrangement of CO 2 based on kinetic data.

Unexpected formal insertion of CO 2 into the C-Si bonds of a zinc compound

DOE PAGES

Kemp, Richard A.; McGrew, Genette I.; Khatri, Pathik A.; ...

2015-09-08

Reaction of [κ 2-PR 2C(SiMe 3)Py] 2Zn (R = Ph, 2a; iPr, 2b) with CO 2 affords the products of formal insertion at the C–Si bond, [κ 2-PR 2CC(O)O(SiMe 3)Py] 2Zn (R = Ph, 3a; iPr, 3b). Insertion product 3b was structurally characterized. As a result, the reaction appears to be a stepwise insertion and rearrangement of CO 2 based on kinetic data.

End Restraints for Impact-Energy-Absorbing Tube Specimens

NASA Technical Reports Server (NTRS)

Farley, G. L.; Modlin, J. T.

1985-01-01

Inexpensive device developed that eliminates tipping problem without affecting crushing process. Device consists of soft sponge-rubber insert approximately 0.5 inches (1.3 centimeters) thick, cut to same diameter as internal diameter of tube specimen. Metal washer, slightly smaller than internal diameter of tube, placed on top of rubber insert. Screw passed through washer and rubber insert and threaded into base of test machine. As screw tightened against washer, rubber insert compressed and expands radially. Radial expansion applies pressure against internal wall of tube specimen, which provides sufficient support to tube to prevent tipping.

pKa shifting in double-stranded RNA is highly dependent upon nearest neighbors and bulge positioning.

PubMed

Wilcox, Jennifer L; Bevilacqua, Philip C

2013-10-22

Shifting of pKa's in RNA is important for many biological processes; however, the driving forces responsible for shifting are not well understood. Herein, we determine how structural environments surrounding protonated bases affect pKa shifting in double-stranded RNA (dsRNA). Using (31)P NMR, we determined the pKa of the adenine in an A(+)·C base pair in various sequence and structural environments. We found a significant dependence of pKa on the base pairing strength of nearest neighbors and the location of a nearby bulge. Increasing nearest neighbor base pairing strength shifted the pKa of the adenine in an A(+)·C base pair higher by an additional 1.6 pKa units, from 6.5 to 8.1, which is well above neutrality. The addition of a bulge two base pairs away from a protonated A(+)·C base pair shifted the pKa by only ~0.5 units less than a perfectly base paired hairpin; however, positioning the bulge just one base pair away from the A(+)·C base pair prohibited formation of the protonated base pair as well as several flanking base pairs. Comparison of data collected at 25 °C and 100 mM KCl to biological temperature and Mg(2+) concentration revealed only slight pKa changes, suggesting that similar sequence contexts in biological systems have the potential to be protonated at biological pH. We present a general model to aid in the determination of the roles protonated bases may play in various dsRNA-mediated processes including ADAR editing, miRNA processing, programmed ribosomal frameshifting, and general acid-base catalysis in ribozymes.

Database of non-canonical base pairs found in known RNA structures

NASA Technical Reports Server (NTRS)

Nagaswamy, U.; Voss, N.; Zhang, Z.; Fox, G. E.

2000-01-01

Atomic resolution RNA structures are being published at an increasing rate. It is common to find a modest number of non-canonical base pairs in these structures in addition to the usual Watson-Crick pairs. This database summarizes the occurrence of these rare base pairs in accordance with standard nomenclature. The database, http://prion.bchs.uh.edu/, contains information such as sequence context, sugar pucker conformation, anti / syn base conformations, chemical shift, p K (a)values, melting temperature and free energy. Of the 29 anticipated pairs with two or more hydrogen bonds, 20 have been encountered to date. In addition, four unexpected pairs with two hydrogen bonds have been reported bringing the total to 24. Single hydrogen bond versions of five of the expected geometries have been encountered among the single hydrogen bond interactions. In addition, 18 different types of base triplets have been encountered, each of which involves three to six hydrogen bonds. The vast majority of the rare base pairs are antiparallel with the bases in the anti configuration relative to the ribose. The most common are the GU wobble, the Sheared GA pair, the Reverse Hoogsteen pair and the GA imino pair.

Strength of inserts in titanium alloy machining

NASA Astrophysics Data System (ADS)

Kozlov, V.; Huang, Z.; Zhang, J.

2016-04-01

In this paper, a stressed state of a non-worn cutting wedge in a machined titanium alloy (Ti6Al2Mo2Cr) is analyzed. The distribution of contact loads on the face of a cutting tool was obtained experimentally with the use of a ‘split cutting tool’. Calculation of internal stresses in the indexable insert made from cemented carbide (WC8Co) was carried out with the help of ANSYS 14.0 software. Investigations showed that a small thickness of the cutting insert leads to extremely high compressive stresses near the cutting edge, stresses that exceed the ultimate compressive strength of cemented carbide. The face and the base of the insert experience high tensile stresses, which approach the ultimate tensile strength of cemented carbide and increase a probability of cutting insert destruction. If the thickness of the cutting insert is bigger than 5 mm, compressive stresses near the cutting edge decrease, and tensile stresses on the face and base decrease to zero. The dependences of the greatest normal and tangential stresses on thickness of the cutting insert were found. Abbreviation and symbols: m/s - meter per second (cutting speed v); mm/r - millimeter per revolution (feed rate f); MPa - mega Pascal (dimension of specific contact loads and stresses); γ - rake angle of the cutting tool [°] α - clearance angle of the sharp cutting tool [°].

The Accuracy of Temperature Measurements Provided by the Edwards Lifesciences Pulmonary Artery Catheter.

PubMed

Launey, Yoann; Larmet, Raphaëlle; Nesseler, Nicolas; Malledant, Yannick; Palpacuer, Clément; Seguin, Philippe

2016-05-01

Pulmonary artery catheters (PACs) are frequently used for monitoring patient temperatures in the intensive care unit. Nevertheless, data regarding the accuracy of these measurements are lacking, and few data testify to the accuracy of temperatures recorded after the PAC has been in place for several days. The absolute values of such measurements are relevant for critical care because patient temperatures are often used as diagnostic criteria for sepsis and antibiotic therapy. We thus hypothesized that the Edwards Lifesciences PAC would accurately measure blood temperature. To test our hypothesis, we compared temperature measurements obtained from PACs inserted in patients for different lengths of time with measurements of a reference platinum resistance thermometer (PRT). PACs were removed and analyzed in 39 patients in whom PACs were inserted for 0 to 5 days. The PACs were placed in calibration baths, and 10 consecutive measurements at each of 7 different temperatures were obtained (36°C, 36.5°C, 37°C, 38°C, 38.3°C, 39°C, and 40°C). The temperature measurements obtained using PACs were compared with measurements obtained using a PRT. Bland-Altman statistical analyses were performed. Outliers, defined as PAC temperature measurements that varied more than ±0.3°C from PRT measurements, were identified. We considered a catheter unfit for clinical diagnostic or therapeutic use if ≥15% of data pairs were outliers. A total of 2730 data pairs were analyzed. Overall, the bias was -0.15°C; the precision was +0.13°C; and the limits of agreement were -0.45°C to +0.13°C. The bias and limits of agreement did not differ according to the age of the catheter or the temperature tested. One hundred fourteen data pairs (4.2% [95% confidence interval, 2.0%-6.4%]), involving 13 PACs and mostly from 4 PACs, were outliers. We conclude that temperature measurements obtained using the Edwards Lifesciences PACs are thus sufficiently accurate to be used for clinical temperature monitoring in critically ill patients.

Base pair probability estimates improve the prediction accuracy of RNA non-canonical base pairs

PubMed Central

2017-01-01

Prediction of RNA tertiary structure from sequence is an important problem, but generating accurate structure models for even short sequences remains difficult. Predictions of RNA tertiary structure tend to be least accurate in loop regions, where non-canonical pairs are important for determining the details of structure. Non-canonical pairs can be predicted using a knowledge-based model of structure that scores nucleotide cyclic motifs, or NCMs. In this work, a partition function algorithm is introduced that allows the estimation of base pairing probabilities for both canonical and non-canonical interactions. Pairs that are predicted to be probable are more likely to be found in the true structure than pairs of lower probability. Pair probability estimates can be further improved by predicting the structure conserved across multiple homologous sequences using the TurboFold algorithm. These pairing probabilities, used in concert with prior knowledge of the canonical secondary structure, allow accurate inference of non-canonical pairs, an important step towards accurate prediction of the full tertiary structure. Software to predict non-canonical base pairs and pairing probabilities is now provided as part of the RNAstructure software package. PMID:29107980

Expression of Osmotin-Like Genes in the Halophyte Atriplex nummularia L. 1

PubMed Central

Casas, Ana M.; Nelson, Donald E.; Raghothama, Kashchandra G.; D'Urzo, Matilde Paino; Singh, Narendra K.; Bressan, Ray A.; Hasegawa, Paul M.

1992-01-01

A peptide (molecular mass 50 kilodaltons) that is immunologically related to tobacco osmotin was detected in cells of the halophyte Atriplex nummularia. This protein was constitutively expressed in both unadapted and NaCl-adapted cells. A predominant osmotin-like peptide (molecular mass 24 kilodaltons) was also found in culture media after cell growth. Two unique A. nummularia cDNA clones, pA8 and pA9, encoding osmotin-like proteins have been isolated. The pA8 and pA9 inserts are 952 and 792 base pairs and encode peptides of 222 and 224 amino acids, respectively. The peptide deduced from pA8 has a molecular mass of 23,808 daltons and theoretical isoelectric point of 8.31, whereas the peptide derived from pA9 has a molecular mass of 23,827 daltons and an isoelectric point of 6.88. Unique transcripts were detected by the inserts of the cDNA clones, two (1.2 and 1.0 kilobases) by pA8 and one (0.9 kilobase) by pA9. The pA8 transcripts were constitutively accumulated in unadapted and NaCl-adapted cells, whereas the mRNA levels were up-regulated by abscisic acid treatment. The level of pA9 mRNA was induced by NaCl treatment and increased in cells as a function of NaCl adaptation. Southern analysis of the genomic DNA indicated the presence of osmotin-like multigene families in A. nummularia. ImagesFigure 1Figure 2Figure 3Figure 4Figure 6Figure 7Figure 8Figure 9 PMID:16668870

New insights into Acinetobacter baumannii pathogenesis revealed by high-density pyrosequencing and transposon mutagenesis.

PubMed

Smith, Michael G; Gianoulis, Tara A; Pukatzki, Stefan; Mekalanos, John J; Ornston, L Nicholas; Gerstein, Mark; Snyder, Michael

2007-03-01

Acinetobacter baumannii has emerged as an important and problematic human pathogen as it is the causative agent of several types of infections including pneumonia, meningitis, septicemia, and urinary tract infections. We explored the pathogenic content of this harmful pathogen using a combination of DNA sequencing and insertional mutagenesis. The genome of this organism was sequenced using a strategy involving high-density pyrosequencing, a novel, rapid method of high-throughput sequencing. Excluding the rDNA repeats, the assembled genome is 3,976,746 base pairs (bp) and has 3830 ORFs. A significant fraction of ORFs (17.2%) are located in 28 putative alien islands, indicating that the genome has acquired a large amount of foreign DNA. Consistent with its role in pathogenesis, a remarkable number of the islands (16) contain genes implicated in virulence, indicating the organism devotes a considerable portion of its genes to pathogenesis. The largest island contains elements homologous to the Legionella/Coxiella Type IV secretion apparatus. Type IV secretion systems have been demonstrated to be important for virulence in other organisms and thus are likely to help mediate pathogenesis of A. baumannii. Insertional mutagenesis generated avirulent isolates of A. baumannii and verified that six of the islands contain virulence genes, including two novel islands containing genes that lacked homology with others in the databases. The DNA sequencing approach described in this study allows the rapid elucidation of the DNA sequence of any microbe and, when combined with genetic screens, can identify many novel genes important for microbial pathogenesis.

The PolyScope: a modular design, semidisposable flexible ureterorenoscope system.

PubMed

Bader, Markus Juergen; Gratzke, Christian; Walther, Sebastian; Schlenker, Boris; Tilki, Derya; Hocaoglu, Yasemin; Sroka, Ronald; Stief, Christian Georg; Reich, Oliver

2010-07-01

To characterize the mechanical and optical properties of the PolyScope endoscope system and to examine the clinical outcome in patients who were undergoing ureteronephroscopy. Mechanical assessment involved measurement of the deflection angle and irrigation flow rate. Optical resolution and distortion, field and angle of view, and light transmission and output formed the optical assessment. Clinical assessment was made in a series of consecutive ureteronephroscopy procedures. The optical cord was disconnected after each procedure, and the image fiber was assessed for damage. The mean value for the angle of maximum active tip deflection with an empty working channel was 265 degrees (261-275 degrees). Deflection was impaired most with insertion of the 3.0 F basket (10% decrease) and least with an indwelling 220 microm laser fiber (2% decrease). Irrigation flow rate was 57 mL/min with an empty working channel. Flow was reduced by 50% and 68%, with the insertion of a 200 microm or 365 microm laser probe, respectively, and by 92.5% with a 3.2F basket. No damage to the image fiber occurred. The PolyScope optics system could identify a target of about 0.125 mm at a distance of 2 to 4 mm, based on 3 line-pairs/mm needed for clear identification. Lithotripsy of renal calculi was performed for 40 stone burdens in 32 patients; the resulting stone-free rate was 87.5%. The novel semidisposable ureteroscope system PolyScope was simple to use, effective, and reliable in this preliminary clinical evaluation. It overcomes the inherent fragility of comparable devices, which renders the need for maintenance unnecessary.

Genome-wide survey of artificial mutations induced by ethyl methanesulfonate and gamma rays in tomato.

PubMed

Shirasawa, Kenta; Hirakawa, Hideki; Nunome, Tsukasa; Tabata, Satoshi; Isobe, Sachiko

2016-01-01

Genome-wide mutations induced by ethyl methanesulfonate (EMS) and gamma irradiation in the tomato Micro-Tom genome were identified by a whole-genome shotgun sequencing analysis to estimate the spectrum and distribution of whole-genome DNA mutations and the frequency of deleterious mutations. A total of ~370 Gb of paired-end reads for four EMS-induced mutants and three gamma-ray-irradiated lines as well as a wild-type line were obtained by next-generation sequencing technology. Using bioinformatics analyses, we identified 5920 induced single nucleotide variations and insertion/deletion (indel) mutations. The predominant mutations in the EMS mutants were C/G to T/A transitions, while in the gamma-ray mutants, C/G to T/A transitions, A/T to T/A transversions, A/T to G/C transitions and deletion mutations were equally common. Biases in the base composition flanking mutations differed between the mutagenesis types. Regarding the effects of the mutations on gene function, >90% of the mutations were located in intergenic regions, and only 0.2% were deleterious. In addition, we detected 1,140,687 spontaneous single nucleotide polymorphisms and indel polymorphisms in wild-type Micro-Tom lines. We also found copy number variation, deletions and insertions of chromosomal segments in both the mutant and wild-type lines. The results provide helpful information not only for mutation research, but also for mutant screening methodology with reverse-genetic approaches. © 2015 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Spatial and contrast resolution of ultralow dose dentomaxillofacial CT imaging using iterative reconstruction technology

PubMed Central

Bischel, Alexander; Stratis, Andreas; Bosmans, Hilde; Jacobs, Reinhilde; Gassner, Eva-Maria; Puelacher, Wolfgang; Pauwels, Ruben

2017-01-01

Objectives: The objective of this study was to determine how iterative reconstruction technology (IRT) influences contrast and spatial resolution in ultralow-dose dentomaxillofacial CT imaging. Methods: A polymethyl methacrylate phantom with various inserts was scanned using a reference protocol (RP) at CT dose index volume 36.56 mGy, a sinus protocol at 18.28 mGy and ultralow-dose protocols (LD) at 4.17 mGy, 2.36 mGy, 0.99 mGy and 0.53 mGy. All data sets were reconstructed using filtered back projection (FBP) and the following IRTs: adaptive statistical iterative reconstructions (ASIRs) (ASIR-50, ASIR-100) and model-based iterative reconstruction (MBIR). Inserts containing line-pair patterns and contrast detail patterns for three different materials were scored by three observers. Observer agreement was analyzed using Cohen's kappa and difference in performance between the protocols and reconstruction was analyzed with Dunn's test at α = 0.05. Results: Interobserver agreement was acceptable with a mean kappa value of 0.59. Compared with the RP using FBP, similar scores were achieved at 2.36 mGy using MBIR. MIBR reconstructions showed the highest noise suppression as well as good contrast even at the lowest doses. Overall, ASIR reconstructions did not outperform FBP. Conclusions: LD and MBIR at a dose reduction of >90% may show no significant differences in spatial and contrast resolution compared with an RP and FBP. Ultralow-dose CT and IRT should be further explored in clinical studies. PMID:28059562

Identification of an additional member of the protein-tyrosine-phosphatase family: evidence for alternative splicing in the tyrosine phosphatase domain.

PubMed Central

Matthews, R J; Cahir, E D; Thomas, M L

1990-01-01

Protein-tyrosine-phosphatases (protein-tyrosine-phosphate phosphohydrolase, EC 3.13.48) have been implicated in the regulation of cell growth; however, to date few tyrosine phosphatases have been characterized. To identify additional family members, the cDNA for the human tyrosine phosphatase leukocyte common antigen (LCA; CD45) was used to screen, under low stringency, a mouse pre-B-cell cDNA library. Two cDNA clones were isolated and sequence analysis predicts a protein sequence of 793 amino acids. We have named the molecule LRP (LCA-related phosphatase). RNA transfer analysis indicates that the cDNAs were derived from a 3.2-kilobase mRNA. The LRP mRNA is transcribed in a wide variety of tissues. The predicted protein structure can be divided into the following structural features: a short 19-amino acid leader sequence, an exterior domain of 123 amino acids that is predicted to be highly glycosylated, a 24-amino acid membrane-spanning region, and a 627-amino acid cytoplasmic region. The cytoplasmic region contains two approximately 260-amino acid domains, each with homology to the tyrosine phosphatase family. One of the cDNA clones differed in that it had a 108-base-pair insertion that, while preserving the reading frame, would disrupt the first protein-tyrosine-phosphatase domain. Analysis of genomic DNA indicates that the insertion is due to an alternatively spliced exon. LRP appears to be evolutionarily conserved as a putative homologue has been identified in the invertebrate Styela plicata. Images PMID:2162042

Modulation of Prdm9-controlled meiotic chromosome asynapsis overrides hybrid sterility in mice.

PubMed

Gregorova, Sona; Gergelits, Vaclav; Chvatalova, Irena; Bhattacharyya, Tanmoy; Valiskova, Barbora; Fotopulosova, Vladana; Jansa, Petr; Wiatrowska, Diana; Forejt, Jiri

2018-03-14

Hybrid sterility is one of the reproductive isolation mechanisms leading to speciation. Prdm9 , the only known vertebrate hybrid-sterility gene, causes failure of meiotic chromosome synapsis and infertility in male hybrids that are the offspring of two mouse subspecies. Within species, Prdm9 determines the sites of programmed DNA double-strand breaks (DSBs) and meiotic recombination hotspots. To investigate the relation between Prdm9 -controlled meiotic arrest and asynapsis, we inserted random stretches of consubspecific homology on several autosomal pairs in sterile hybrids, and analyzed their ability to form synaptonemal complexes and to rescue male fertility. Twenty-seven or more megabases of consubspecific (belonging to the same subspecies) homology fully restored synapsis in a given autosomal pair, and we predicted that two or more DSBs within symmetric hotspots per chromosome are necessary for successful meiosis. We hypothesize that impaired recombination between evolutionarily diverged chromosomes could function as one of the mechanisms of hybrid sterility occurring in various sexually reproducing species. © 2018, Gregorova et al.

Modulation of Prdm9-controlled meiotic chromosome asynapsis overrides hybrid sterility in mice

PubMed Central

Chvatalova, Irena; Bhattacharyya, Tanmoy; Valiskova, Barbora; Fotopulosova, Vladana; Jansa, Petr; Wiatrowska, Diana

2018-01-01

Hybrid sterility is one of the reproductive isolation mechanisms leading to speciation. Prdm9, the only known vertebrate hybrid-sterility gene, causes failure of meiotic chromosome synapsis and infertility in male hybrids that are the offspring of two mouse subspecies. Within species, Prdm9 determines the sites of programmed DNA double-strand breaks (DSBs) and meiotic recombination hotspots. To investigate the relation between Prdm9-controlled meiotic arrest and asynapsis, we inserted random stretches of consubspecific homology on several autosomal pairs in sterile hybrids, and analyzed their ability to form synaptonemal complexes and to rescue male fertility. Twenty-seven or more megabases of consubspecific (belonging to the same subspecies) homology fully restored synapsis in a given autosomal pair, and we predicted that two or more DSBs within symmetric hotspots per chromosome are necessary for successful meiosis. We hypothesize that impaired recombination between evolutionarily diverged chromosomes could function as one of the mechanisms of hybrid sterility occurring in various sexually reproducing species. PMID:29537370

Unexpected Formation of Early Late Heterobimetallic Complexes from Transition Metal Frustrated Lewis Pairs.

PubMed

Chapman, Andy M; Flynn, Stephanie R; Wass, Duncan F

2016-02-01

Reaction of transition metal "frustrated" Lewis pair compounds of the type [Cp2Zr(Me)(OC(CF3)2CH2P(t)Bu2)] with the low valent platinum species [Pt(norbornene)3] leads to the unexpected formation of a heterobimetallic species [Cp2Zr{ Pt(Me)}(OC(CF3)2CH2 P(t)Bu2)]. Single crystal X-ray analysis reveals an unusual T-shaped geometry at the platinum center, with a relevant C-Pt-P angle of 163.3(3)°. Treatment of this compound with PMe3 yields [Pt(PMe3)4] and regenerates the zirconium precursor. Treatment with [(Et2O)2H][B(C6F5)4] protonates off the methyl ligand to give an ether adduct at platinum. Analogous observations are made with titanium-platinum species. We propose the chemistry is best rationalized as a formal insertion of Pt(0) into a Zr-C or Ti-Cl bond.

Assembling short reads from jumping libraries with large insert sizes.

PubMed

Vasilinetc, Irina; Prjibelski, Andrey D; Gurevich, Alexey; Korobeynikov, Anton; Pevzner, Pavel A

2015-10-15

Advances in Next-Generation Sequencing technologies and sample preparation recently enabled generation of high-quality jumping libraries that have a potential to significantly improve short read assemblies. However, assembly algorithms have to catch up with experimental innovations to benefit from them and to produce high-quality assemblies. We present a new algorithm that extends recently described exSPAnder universal repeat resolution approach to enable its applications to several challenging data types, including jumping libraries generated by the recently developed Illumina Nextera Mate Pair protocol. We demonstrate that, with these improvements, bacterial genomes often can be assembled in a few contigs using only a single Nextera Mate Pair library of short reads. Described algorithms are implemented in C++ as a part of SPAdes genome assembler, which is freely available at bioinf.spbau.ru/en/spades. ap@bioinf.spbau.ru Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Nontraumatic tibial polyethylene insert cone fracture in mobile-bearing posterior-stabilized total knee arthroplasty.

PubMed

Tanikake, Yohei; Hayashi, Koji; Ogawa, Munehiro; Inagaki, Yusuke; Kawate, Kenji; Tomita, Tetsuya; Tanaka, Yasuhito

2016-12-01

A 72-year-old male patient underwent mobile-bearing posterior-stabilized total knee arthroplasty for osteoarthritis. He experienced a nontraumatic polyethylene tibial insert cone fracture 27 months after surgery. Scanning electron microscopy of the fracture surface of the tibial insert cone suggested progress of ductile breaking from the posterior toward the anterior of the cone due to repeated longitudinal bending stress, leading to fatigue breaking at the anterior side of the cone, followed by the tibial insert cone fracture at the anterior side of the cone, resulting in fracture at the base of the cone. This analysis shows the risk of tibial insert cone fracture due to longitudinal stress in mobile-bearing posterior-stabilized total knee arthroplasty in which an insert is designed to highly conform to the femoral component.

Use of an intravascular fluorescent continuous glucose sensor in subjects with type 1 diabetes mellitus.

PubMed

Romey, Matthew; Jovanovič, Lois; Bevier, Wendy; Markova, Kateryna; Strasma, Paul; Zisser, Howard

2012-11-01

Stress hyperglycemia in the critically ill is associated with increased morbidity and mortality. Continuous glucose monitoring offers a solution to the difficulties of dosing intravenous insulin properly to maintain glycemic control. The purpose of this study was to evaluate an intravascular continuous glucose monitoring (IV-CGM) system with a sensing element based on the concept of quenched fluorescence. A second-generation intravascular continuous glucose sensor was evaluated in 13 volunteer subjects with type 1 diabetes mellitus. There were 21 study sessions of up to 24 h in duration. Sensors were inserted into peripheral veins of the upper extremity, up to two sensors per subject per study session. Sensor output was compared with temporally correlated reference measurements obtained from venous samples on a laboratory glucose analyzer. Data were obtained from 23 sensors in 13 study sessions with 942 paired reference values. Fourteen out of 23 sensors (60.9%) had a mean absolute relative difference ≤ 10%. Eighty-nine percent of paired points were in the clinically accurate A zone of the Clarke error grid and met ISO 15197 performance criteria. Adequate venous blood flow was identified as a necessary condition for accuracy when local sensor readings are compared with venous blood glucose. The IV-CGM system was capable of achieving a high level of glucose measurement accuracy. However, superficial peripheral veins may not provide adequate blood flow for reliable indwelling blood glucose monitoring. © 2012 Diabetes Technology Society.

Use of an Intravascular Fluorescent Continuous Glucose Sensor in Subjects with Type 1 Diabetes Mellitus

PubMed Central

Romey, Matthew; Jovanovič, Lois; Bevier, Wendy; Markova, Kateryna; Strasma, Paul; Zisser, Howard

2012-01-01

Background Stress hyperglycemia in the critically ill is associated with increased morbidity and mortality. Continuous glucose monitoring offers a solution to the difficulties of dosing intravenous insulin properly to maintain glycemic control. The purpose of this study was to evaluate an intravascular continuous glucose monitoring (IV-CGM) system with a sensing element based on the concept of quenched fluorescence. Method A second-generation intravascular continuous glucose sensor was evaluated in 13 volunteer subjects with type 1 diabetes mellitus. There were 21 study sessions of up to 24 h in duration. Sensors were inserted into peripheral veins of the upper extremity, up to two sensors per subject per study session. Sensor output was compared with temporally correlated reference measurements obtained from venous samples on a laboratory glucose analyzer. Results Data were obtained from 23 sensors in 13 study sessions with 942 paired reference values. Fourteen out of 23 sensors (60.9%) had a mean absolute relative difference ≤ 10%. Eighty-nine percent of paired points were in the clinically accurate A zone of the Clarke error grid and met ISO 15197 performance criteria. Adequate venous blood flow was identified as a necessary condition for accuracy when local sensor readings are compared with venous blood glucose. Conclusions The IV-CGM system was capable of achieving a high level of glucose measurement accuracy. However, superficial peripheral veins may not provide adequate blood flow for reliable indwelling blood glucose monitoring. PMID:23294770

Solvation-controlled lithium-ion complexes in a nonflammable solvent containing ethylene carbonate: structural and electrochemical aspects.

PubMed

Sogawa, Michiru; Kawanoue, Hikaru; Todorov, Yanko Marinov; Hirayama, Daisuke; Mimura, Hideyuki; Yoshimoto, Nobuko; Morita, Masayuki; Fujii, Kenta

2018-02-28

The structural and electrochemical properties of lithium-ion solvation complexes in a nonflammable organic solvent, tris(2,2,2-trifluoroethyl)phosphate (TFEP) containing ethylene carbonate (EC), were investigated using vibrational spectroscopic and electrochemical measurements. Based on quantitative Raman and infrared (IR) spectral analysis of the Li bis(trifluoromethanesulfonyl)amide (TFSA) salt in TFEP + EC electrolytes, we successfully evaluated the individual solvation numbers of EC (n EC ), TFEP (n TFEP ), and TFSA - (n TFSA ) in the first solvation sphere of the Li-ion. We found that the n EC value linearly increased with increasing EC mole fraction (x EC ), whereas the n TFEP and n TFSA values gradually decreased with increasing n EC . The ionic conductivity and viscosity (Walden plots) indicated that mainly Li + TFSA - ion pairs formed in neat TFEP (x EC = 0). This ion pair gradually dissociated into positively charged Li-ion complexes as x EC increased, which was consistent with the Raman/IR spectroscopy results. The redox reaction corresponding to an insertion/desertion of Li-ion into/from the graphite electrode occurred in the LiTFSA/TFEP + EC system at x EC ≥ 0.25. The same was not observed in the lower x EC cases. We discussed the relation between Li-ion solvation and electrode reaction behaviors at the molecular level and proposed that n EC plays a crucial role in the electrode reaction, particularly in terms of solid electrolyte interphase formation on the graphite electrode.

Performing monkeys of Bangladesh: characterizing their source and genetic variation.

PubMed

Hasan, M Kamrul; Feeroz, M Mostafa; Jones-Engel, Lisa; Engel, Gregory A; Akhtar, Sharmin; Kanthaswamy, Sree; Smith, David Glenn

2016-04-01

The acquisition and training of monkeys to perform is a centuries-old tradition in South Asia, resulting in a large number of rhesus macaques kept in captivity for this purpose. The performing monkeys are reportedly collected from free-ranging populations, and may escape from their owners or may be released into other populations. In order to determine whether this tradition involving the acquisition and movement of animals has influenced the population structure of free-ranging rhesus macaques in Bangladesh, we first characterized the source of these monkeys. Biological samples from 65 performing macaques collected between January 2010 and August 2013 were analyzed for genetic variation using 716 base pairs of mitochondrial DNA. Performing monkey sequences were compared with those of free-ranging rhesus macaque populations in Bangladesh, India and Myanmar. Forty-five haplotypes with 116 (16 %) polymorphic nucleotide sites were detected among the performing monkeys. As for the free-ranging rhesus population, most of the substitutions (89 %) were transitions, and no indels (insertion/deletion) were observed. The estimate of the mean number of pair-wise differences for the performing monkey population was 10.1264 ± 4.686, compared to 14.076 ± 6.363 for the free-ranging population. Fifteen free-ranging rhesus macaque populations were identified as the source of performing monkeys in Bangladesh; several of these populations were from areas where active provisioning has resulted in a large number of macaques. The collection of performing monkeys from India was also evident.

Performing monkeys of Bangladesh: characterizing their source and genetic variation

PubMed Central

Hasan, M Kamrul; Feeroz, M Mostafa; Jones-Engel, Lisa; Engel, Gregory A; Akhtar, Sharmin; Kanthaswamy, Sree; Smith, David Glenn

2016-01-01

The acquisition and training of monkeys to perform is a century's old tradition in South Asia, resulting in a large number of rhesus macaques kept in captivity for this purpose. The performing monkeys are reportedly collected from free-ranging populations and may escape from their owners or be released into other populations. In order to determine whether this tradition, that involves the acquisition and movement of animals, has influenced the population structure of free-ranging rhesus macaques in Bangladesh we first characterized the source of these monkeys. Biological samples from 65 performing macaques, collected between January 2010 and August 2013 were analyzed for genetic variation using 716 base pairs of mitochondrial DNA. Performing monkey sequences were compared with those of free-ranging rhesus macaque populations in Bangladesh, India and Myanmar. Forty-five haplotypes with 116 (16%) polymorphic nucleotide sites were detected among the performing monkeys. As for the free-ranging rhesus population, most of the substitutions (89%) were transitions and no indels (insertion/deletion) were observed. The estimate of the mean number of pair-wise difference for the performing monkey population was 10.1264 ± 4.686, compared to 14.076 ± 6.363 for the free-ranging population. Fifteen free-ranging rhesus macaque populations were identified as the source of performing monkeys in Bangladesh; several of these populations were from areas where active provisioning has resulted in a large number of macaques. Collection of performing monkeys from India was also evident. PMID:26758818

[The development and operation of a package inserts service system for electronic medical records].

PubMed

Yamada, Hidetoshi; Nishimura, Sachiho; Shimamori, Yoshimitsu; Sato, Seiji; Hayase, Yukitoshi

2003-03-01

To promote the appropriate use of pharmaceuticals and to prevent side effects, physicians need package inserts on medicinal drugs as soon as possible. A medicinal drug information service system was established for electronic medical records to speed up and increase the efficiency of package insert communications within a medical institution. Development of this system facilitates access to package inserts by, for example, physicians. The time required to maintain files of package inserts was shortened, and the efficiency of the drug information service increased. As a source of package inserts for this system, package inserts using a standard generalized markup language (SGML) form were used, which are accessible to the public on the homepage of the Organization for Pharmaceutical Safety and Research (OPSR). This study found that a delay occurred in communicating revised package inserts from pharmaceutical companies to the OPSR. Therefore a pharmaceutical department page was set up as part of the homepage of the medical institution for electronic medical records to shorten the delay in the revision of package inserts posted on the medicinal drug information service homepage of the OPSR. The usefulness of this package insert service system for electronic medical records is clear. For more effective use of this system based on the OPSR homepage pharmaceutical companies have been requested to provide quicker updating of package inserts.

An experimental investigation on heat transfer enhancement in the laminar flow of water/TiO2 nanofluid through a tube heat exchanger fitted with modified butterfly inserts

NASA Astrophysics Data System (ADS)

Venkitaraj, K. P.; Suresh, S.; Alwin Mathew, T.; Bibin, B. S.; Abraham, Jisa

2018-03-01

Nanofluids are advanced heat transfer fluids that exhibit thermal properties superior than that of the conventional fluids such as water, oil etc. This paper reports the experimental study on convective heat transfer characteristics of water based titanium dioxide nanofluids in fully developed flow through a uniformly heated pipe heat exchanger fitted with modified butterfly inserts. Nanofluids are prepared by dispersing TiO2 nanoparticles of average particle size 29 nm in deionized water. The heat transfer experiments are performed in laminar regime using nanofluids prepared with 0.1% and 0.3% volume fractions of TiO2 nanoparticles. The thermal performance characteristics of conventional butterfly inserts and modified butterfly inserts are also compared using TiO2 nanofluid. The inserts with different pitches 6 cm, 9 cm and 12 cm are tested to determine the effect of pitch distance of inserts in the heat transfer and friction. The experimental results showed that the modification made in the butterfly inserts were able to produce higher heat transfer than conventional butterfly inserts.

DNA base dimers are stabilized by hydrogen-bonding interactions including non-Watson-Crick pairing near graphite surfaces.

PubMed

Shankar, Akshaya; Jagota, Anand; Mittal, Jeetain

2012-10-11

Single- and double-stranded DNA are increasingly being paired with surfaces and nanoparticles for numerous applications, such as sensing, imaging, and drug delivery. Unlike the majority of DNA structures in bulk that are stabilized by canonical Watson-Crick pairing between Ade-Thy and Gua-Cyt, those adsorbed on surfaces are often stabilized by noncanonical base pairing, quartet formation, and base-surface stacking. Not much is known about these kinds of interactions. To build an understanding of the role of non-Watson-Crick pairing on DNA behavior near surfaces, one requires basic information on DNA base pair stacking and hydrogen-bonding interactions. All-atom molecular simulations of DNA bases in two cases--in bulk water and strongly adsorbed on a graphite surface--are conducted to study the relative strengths of stacking and hydrogen bond interactions for each of the 10 possible combinations of base pairs. The key information obtained from these simulations is the free energy as a function of distance between two bases in a pair. We find that stacking interactions exert the dominant influence on the stability of DNA base pairs in bulk water as expected. The strength of stability for these stacking interactions is found to decrease in the order Gua-Gua > Ade-Gua > Ade-Ade > Gua-Thy > Gua-Cyt > Ade-Thy > Ade-Cyt > Thy-Thy > Cyt-Thy > Cyt-Cyt. On the other hand, mutual interactions of surface-adsorbed base pairs are stabilized mostly by hydrogen-bonding interactions in the order Gua-Cyt > Ade-Gua > Ade-Thy > Ade-Ade > Cyt-Thy > Gua-Gua > Cyt-Cyt > Ade-Cyt > Thy-Thy > Gua-Thy. Interestingly, several non-Watson-Crick base pairings, which are commonly ignored, have similar stabilization free energies due to interbase hydrogen bonding as Watson-Crick pairs. This clearly highlights the importance of non-Watson-Crick base pairing in the development of secondary structures of oligonucleotides near surfaces.

Simulator trials to determine the wear of the combination aluminium oxide ceramic-carbon fibre reinforced plastic (CFRP) used as an insert in a hip socket.

PubMed

Scheller, G; Schwarz, M; Früh, H J; Jani, L

1999-01-01

Hip simulator trials were conducted to determine the initial wear between alumina femoral heads and carbon fibre reinforced plastic (CFRP, CAPROMAN) insert in a titanium socket. A force of 2500 N and a frequency of 0.857 H were applied. Using surface and sphericity measurement techniques, the amount of wear was determined. After 500,000 cycles, the centre of the head had moved by 10 microm into the insert, and the average radius increased by 2 microm. After 1 million cycles, the additional changes were less than 1 microm. Based on an examination of retrieved implants (wear rate: 6.1 microm/year) and based on the simulator results, the combination alumina-CFRP inserts could be approved for total hip replacement.

Management of computed tomography-detected pneumothorax in patients with blunt trauma: experience from a community-based hospital

PubMed Central

Hefny, Ashraf F; Kunhivalappil, Fathima T; Matev, Nikolay; Avila, Norman A; Bashir, Masoud O; Abu-Zidan, Fikri M

2018-01-01

INTRODUCTION Diagnoses of pneumothorax, especially occult pneumothorax, have increased as the use of computed tomography (CT) for imaging trauma patients becomes near-routine. However, the need for chest tube insertion remains controversial. We aimed to study the management of pneumothorax detected on CT among patients with blunt trauma, including the decision for tube thoracostomy, in a community-based hospital. METHODS Chest CT scans of patients with blunt trauma treated at Al Rahba Hospital, Abu Dhabi, United Arab Emirates, from October 2010 to October 2014 were retrospectively studied. Variables studied included demography, mechanism of injury, endotracheal intubation, pneumothorax volume, chest tube insertion, Injury Severity Score, hospital length of stay and mortality. RESULTS CT was performed in 703 patients with blunt trauma. Overall, pneumothorax was detected on CT for 74 (10.5%) patients. Among the 65 patients for whom pneumothorax was detected before chest tube insertion, 25 (38.5%) needed chest tube insertion, while 40 (61.5%) did not. Backward stepwise likelihood regression showed that independent factors that significantly predicted chest tube insertion were endotracheal intubation (p = 0.01), non-United Arab Emirates nationality (p = 0.01) and pneumothorax volume (p = 0.03). The receiver operating characteristic curve showed that the best pneumothorax volume that predicted chest tube insertion was 30 mL. CONCLUSION Chest tube was inserted in less than half of the patients with blunt trauma for whom pneumothorax was detected on CT. Pneumothorax volume should be considered in decision-making regarding chest tube insertion. Conservative treatment may be sufficient for pneumothorax of volume < 30 mL. PMID:28741012

Management of computed tomography-detected pneumothorax in patients with blunt trauma: experience from a community-based hospital.

PubMed

Hefny, Ashraf F; Kunhivalappil, Fathima T; Matev, Nikolay; Avila, Norman A; Bashir, Masoud O; Abu-Zidan, Fikri M

2018-03-01

Diagnoses of pneumothorax, especially occult pneumothorax, have increased as the use of computed tomography (CT) for imaging trauma patients becomes near-routine. However, the need for chest tube insertion remains controversial. We aimed to study the management of pneumothorax detected on CT among patients with blunt trauma, including the decision for tube thoracostomy, in a community-based hospital. Chest CT scans of patients with blunt trauma treated at Al Rahba Hospital, Abu Dhabi, United Arab Emirates, from October 2010 to October 2014 were retrospectively studied. Variables studied included demography, mechanism of injury, endotracheal intubation, pneumothorax volume, chest tube insertion, Injury Severity Score, hospital length of stay and mortality. CT was performed in 703 patients with blunt trauma. Overall, pneumothorax was detected on CT for 74 (10.5%) patients. Among the 65 patients for whom pneumothorax was detected before chest tube insertion, 25 (38.5%) needed chest tube insertion, while 40 (61.5%) did not. Backward stepwise likelihood regression showed that independent factors that significantly predicted chest tube insertion were endotracheal intubation (p = 0.01), non-United Arab Emirates nationality (p = 0.01) and pneumothorax volume (p = 0.03). The receiver operating characteristic curve showed that the best pneumothorax volume that predicted chest tube insertion was 30 mL. Chest tube was inserted in less than half of the patients with blunt trauma for whom pneumothorax was detected on CT. Pneumothorax volume should be considered in decision-making regarding chest tube insertion. Conservative treatment may be sufficient for pneumothorax of volume < 30 mL. Copyright: © Singapore Medical Association.

Coulomb branch operators and mirror symmetry in three dimensions

NASA Astrophysics Data System (ADS)

Dedushenko, Mykola; Fan, Yale; Pufu, Silviu S.; Yacoby, Ran

2018-04-01

We develop new techniques for computing exact correlation functions of a class of local operators, including certain monopole operators, in three-dimensional N=4 abelian gauge theories that have superconformal infrared limits. These operators are position-dependent linear combinations of Coulomb branch operators. They form a one-dimensional topological sector that encodes a deformation quantization of the Coulomb branch chiral ring, and their correlation functions completely fix the ( n ≤ 3)-point functions of all half-BPS Coulomb branch operators. Using these results, we provide new derivations of the conformal dimension of half-BPS monopole operators as well as new and detailed tests of mirror symmetry. Our main approach involves supersymmetric localization on a hemisphere HS 3 with half-BPS boundary conditions, where operator insertions within the hemisphere are represented by certain shift operators acting on the HS 3 wavefunction. By gluing a pair of such wavefunctions, we obtain correlators on S 3 with an arbitrary number of operator insertions. Finally, we show that our results can be recovered by dimensionally reducing the Schur index of 4D N=2 theories decorated by BPS 't Hooft-Wilson loops.

Photon beam position monitor

DOEpatents

Kuzay, T.M.; Shu, D.

1995-02-07

A photon beam position monitor is disclosed for use in the front end of a beamline of a high heat flux and high energy photon source such as a synchrotron radiation storage ring detects and measures the position and, when a pair of such monitors are used in tandem, the slope of a photon beam emanating from an insertion device such as a wiggler or an undulator inserted in the straight sections of the ring. The photon beam position monitor includes a plurality of spaced blades for precisely locating the photon beam, with each blade comprised of chemical vapor deposition (CVD) diamond with an outer metal coating of a photon sensitive metal such as tungsten, molybdenum, etc., which combination emits electrons when a high energy photon beam is incident upon the blade. Two such monitors are contemplated for use in the front end of the beamline, with the two monitors having vertically and horizontally offset detector blades to avoid blade ''shadowing''. Provision is made for aligning the detector blades with the photon beam and limiting detector blade temperature during operation. 18 figs.

Cooling circuit for steam and air-cooled turbine nozzle stage

DOEpatents

Itzel, Gary Michael; Yu, Yufeng

2002-01-01

The turbine vane segment includes inner and outer walls with a vane extending therebetween. The vane includes leading and trailing edge cavities and intermediate cavities. An impingement plate is spaced from the outer wall to impingement-cool the outer wall. Post-impingement cooling air flows through holes in the outer wall to form a thin air-cooling film along the outer wall. Cooling air is supplied an insert sleeve with openings in the leading edge cavity for impingement-cooling the leading edge. Holes through the leading edge afford thin-film cooling about the leading edge. Cooling air is provided the trailing edge cavity and passes through holes in the side walls of the vane for thin-film cooling of the trailing edge. Steam flows through a pair of intermediate cavities for impingement-cooling of the side walls. Post-impingement steam flows to the inner wall for impingement-cooling of the inner wall and returns the post-impingement cooling steam through inserts in other intermediate cavities for impingement-cooling the side walls of the vane.

Kinetics, Structure, and Mechanism of 8-Oxo-7,8-dihydro-2′-deoxyguanosine Bypass by Human DNA Polymerase η*♦

PubMed Central

Patra, Amritraj; Nagy, Leslie D.; Zhang, Qianqian; Su, Yan; Müller, Livia; Guengerich, F. Peter; Egli, Martin

2014-01-01

DNA damage incurred by a multitude of endogenous and exogenous factors constitutes an inevitable challenge for the replication machinery. Cells rely on various mechanisms to either remove lesions or bypass them in a more or less error-prone fashion. The latter pathway involves the Y-family polymerases that catalyze trans-lesion synthesis across sites of damaged DNA. 7,8-Dihydro-8-oxo-2′-deoxyguanosine (8-oxoG) is a major lesion that is a consequence of oxidative stress and is associated with cancer, aging, hepatitis, and infertility. We have used steady-state and transient-state kinetics in conjunction with mass spectrometry to analyze in vitro bypass of 8-oxoG by human DNA polymerase η (hpol η). Unlike the high fidelity polymerases that show preferential insertion of A opposite 8-oxoG, hpol η is capable of bypassing 8-oxoG in a mostly error-free fashion, thus preventing GC→AT transversion mutations. Crystal structures of ternary hpol η-DNA complexes and incoming dCTP, dATP, or dGTP opposite 8-oxoG reveal that an arginine from the finger domain assumes a key role in avoiding formation of the nascent 8-oxoG:A pair. That hpol η discriminates against dATP exclusively at the insertion stage is confirmed by structures of ternary complexes that allow visualization of the extension step. These structures with G:dCTP following either 8-oxoG:C or 8-oxoG:A pairs exhibit virtually identical active site conformations. Our combined data provide a detailed understanding of hpol η bypass of the most common oxidative DNA lesion. PMID:24759104

Kinetics, structure, and mechanism of 8-Oxo-7,8-dihydro-2'-deoxyguanosine bypass by human DNA polymerase η.

PubMed

Patra, Amritraj; Nagy, Leslie D; Zhang, Qianqian; Su, Yan; Müller, Livia; Guengerich, F Peter; Egli, Martin

2014-06-13

DNA damage incurred by a multitude of endogenous and exogenous factors constitutes an inevitable challenge for the replication machinery. Cells rely on various mechanisms to either remove lesions or bypass them in a more or less error-prone fashion. The latter pathway involves the Y-family polymerases that catalyze trans-lesion synthesis across sites of damaged DNA. 7,8-Dihydro-8-oxo-2'-deoxyguanosine (8-oxoG) is a major lesion that is a consequence of oxidative stress and is associated with cancer, aging, hepatitis, and infertility. We have used steady-state and transient-state kinetics in conjunction with mass spectrometry to analyze in vitro bypass of 8-oxoG by human DNA polymerase η (hpol η). Unlike the high fidelity polymerases that show preferential insertion of A opposite 8-oxoG, hpol η is capable of bypassing 8-oxoG in a mostly error-free fashion, thus preventing GC→AT transversion mutations. Crystal structures of ternary hpol η-DNA complexes and incoming dCTP, dATP, or dGTP opposite 8-oxoG reveal that an arginine from the finger domain assumes a key role in avoiding formation of the nascent 8-oxoG:A pair. That hpol η discriminates against dATP exclusively at the insertion stage is confirmed by structures of ternary complexes that allow visualization of the extension step. These structures with G:dCTP following either 8-oxoG:C or 8-oxoG:A pairs exhibit virtually identical active site conformations. Our combined data provide a detailed understanding of hpol η bypass of the most common oxidative DNA lesion. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

[Phenolic compounds in leaves insertions of Mentha × villosa Huds. cv. Snežná].

PubMed

Tekeľová, Daniela; Bittner Fialová, Silvia; Tóth, Jaroslav; Czigle, Szilvia

Lamiaceae plants mostly accumulate active ingredients in their leaves. The subfamily Nepetoideae, including the genus Mentha L., is characterized by the presence of essential oil and antioxidant phenolics, chiefly hydroxycinnamic acids with predominance of rosmarinic acid, and flavonoids. Mentha × piperita and M. spicata are the most broadly used mints in both medicine and industry, while M. x villosa is less known in our country. Herbal drugs in the form of leaves are usually analysed unpartitioned, while single leaves insertions have only been studied occasionally. Therefore, the aim of this work was the quantification of the active compounds content in the leaves pairs of Mentha × villosa Huds. cv. Snežná, using pharmacopoeial methods: total hydroxycinnamic derivatives expressed as rosmarinic acid (THD) and luteolin-type flavonoids. THD content ranged from 6.7% to 9.4% in the leaves pairs water extracts, and from 6.6% to 14.0% in methanol extracts. Flavonoids contents, expressed as luteolin-7-O-glucoside, ranged from 4.0% to 8.8% in water extracts, and from 4.0% to 10.5% in methanol extracts. Antioxidant activity (DPPH) expressed as SC50 ranged from 10.2 to 16.9 μg.ml-1 (drug dry weight) in water extracts, and from 10.7 to 21.6 μg.ml-1 in methanol extracts. The highest content of phenolic compounds as well as the highest antioxidant activity were found to be in the top sheet, while the lowest content of phenolic compounds and lowest antioxidant activity were detected in the leaves of the middle stem part.Key words: Mentha × villosa Huds cv. Snežná hydroxycinnamic derivatives rosmarinic acid luteolin-7-O-glucoside DPPH.

Microdamage of the cortical bone during mini-implant insertion with self-drilling and self-tapping techniques: a randomized controlled trial.

PubMed

Yadav, Sumit; Upadhyay, Madhur; Liu, Sean; Roberts, Eugene; Neace, William P; Nanda, Ravindra

2012-05-01

The purpose of this research was to evaluate microdamage accumulation after mini-implant placement by self-drilling (without a pilot hole) and self-tapping (screwed into a pilot hole) insertion techniques. The null hypothesis was that the mini-implant insertion technique would have no influence on microcrack accumulation and propagation in the cortical bones of the maxillae and mandibles of adult hounds. Mini-implants (n = 162; diameter, 1.6 mm; length, 6 mm) were placed in the maxillae and mandibles of 9 hounds (12-14 months old) with self-drilling and self-tapping insertion techniques. The techniques were randomly assigned to the left or the right side of each jaw. Each hound received 18 mini-implants (10 in the mandible, 8 in the maxilla). Histomorphometric parameters including total crack length and crack surface density were measured. The null hypothesis was rejected in favor of an alternate hypothesis: that the self-drilling technique results in more microdamage (microcracks) accumulation in the adjacent cortical bone in both the maxilla and the mandible immediately after mini-implant placement. A cluster level analysis was used to analyze the data on the outcome measured. Since the measurements were clustered within dogs, a paired-samples t test was used to analyze the average differences between insertion methods at both jaw locations. A significance level of 0.05 was used for both analyses. The self-drilling technique resulted in greater total crack lengths in both the maxilla and the mandible (maxilla: mean difference, 18.70 ± 7.04 μm/mm(2); CI, 13.29-24.11; mandible: mean difference, 22.98 ± 6.43 μm/mm(2); CI, 18.04-27.93; P <0.05), higher crack surface density in both the maxilla and the mandible (maxilla: mean difference, 10.39 ± 9.16 μm/mm(2); CI, 3.34-17.43; mandible: mean difference, 11.28 ± 3.41 μm/mm(2); CI, 8.65-13.90; P <0.05). This study demonstrated greater microdamage in the cortical bones of adult hounds in both the maxilla and the mandible by the self-drilling insertion technique compared with the self-tapping technique. Copyright © 2012 American Association of Orthodontists. Published by Mosby, Inc. All rights reserved.

Effect of modifying the screw access channels of zirconia implant abutment on the cement flow pattern and retention of zirconia restorations.

PubMed

Wadhwani, Chandur; Chung, Kwok-Hung

2014-07-01

The effect of managing the screw access channels of zirconia implant abutments in the esthetic zone has not been extensively evaluated. The purpose of this study was to determine the effect of an insert placed within the screw access channel of an anterior zirconia implant abutment on the amount of cement retained within the restoration-abutment system and on the dislodging force. Thirty-six paired zirconia abutments and restorations were fabricated by computer-aided design and computer-aided manufacturing and were divided into 3 groups: open abutment, with the screw access channel unfilled; closed abutment, with the screw access channel sealed; and insert abutment, with a thin, tubular metal insert projection continuous with the screw head and placed into the abutment screw access channel. The restorations were cemented to the abutments with preweighed eugenol-free zinc oxide cement (TempBond NE). Excess cement was removed, and the weight of the cement that remained in the restoration-abutment system was measured. Vertical tensile dislodging forces were recorded at a crosshead speed of 5 mm/min after incubation in a 37°C water bath for 24 hours. The specimens were examined for the cement flow pattern into the screw access channel after dislodgement. Data were analyzed with ANOVA, followed by multiple comparisons by using the Tukey honestly significant difference test (α = .05). The mean (standard deviation) of retentive force values ranged from 108.1 ± 29.9 N to 148.3 ± 21.0 N. The retentive force values differed significantly between the insert abutment and both the open abutment (P < .05) and closed abutment groups (P < .01). Distinct patterns of cement failure were noted. The weight of the cement that remained in the system differed significantly, with both open abutment and insert abutment being greater than closed abutment (P < .05). Modifying the internal configuration of the screw access channel of an esthetic zirconia implant abutment with a metal insert significantly affected both the cement retained within the abutment itself and the retention capabilities of the zirconia restoration cemented with TempBond NE cement. Copyright © 2014 Editorial Council for the Journal of Prosthetic Dentistry. Published by Elsevier Inc. All rights reserved.

Drum ring removal/installation tool

DOEpatents

Andrade, William Andrew [Livermore, CA

2006-11-14

A handheld tool, or a pair of such tools, such as for use in removing/installing a bolt-type clamping ring on a container barrel/drum, where the clamping ring has a pair of clamping ends each with a throughbore. Each tool has an elongated handle and an elongated lever arm transversely connected to one end of the handle. The lever arm is capable of being inserted into the throughbore of a selected clamping end and leveraged with the handle to exert a first moment on the selected clamping end. Each tool also has a second lever arm, such as a socket with an open-ended slot, which is suspended alongside the first lever arm. The second lever arm is capable of engaging the selected clamping end and being leveraged with the handle to exert a second moment which is orthogonal to the first moment. In this manner, the first and second moments operate to hold the selected clamping end fixed relative to the tool so that the selected clamping end may be controlled with the handle. The pair of clamping ends may also be simultaneously and independently controlled with the use of two handles/tools so as to contort the geometry of the drum clamping ring and enable its removal/installation.

Orientation-dependent interaction between Drosophila insulators is a property of this class of regulatory elements.

PubMed

Kyrchanova, Olga; Chetverina, Darya; Maksimenko, Oksana; Kullyev, Andrey; Georgiev, Pavel

2008-12-01

Insulators are defined as a class of regulatory elements that delimit independent transcriptional domains within eukaryotic genomes. According to previous data, an interaction (pairing) between some Drosophila insulators can support distant activation of a promoter by an enhancer. Here, we have demonstrated that pairs of well-studied insulators such as scs-scs, scs'-scs', 1A2-1A2 and Wari-Wari support distant activation of the white promoter by the yeast GAL4 activator in an orientation-dependent manner. The same is true for the efficiency of the enhancer that stimulates white expression in the eyes. In all insulator pairs tested, stimulation of the white gene was stronger when insulators were inserted between the eye enhancer or GAL4 and the white promoter in opposite orientations relative to each other. As shown previously, Zw5, Su(Hw) and dCTCF proteins are required for the functioning of different insulators that do not interact with each other. Here, strong functional interactions have been revealed between DNA fragments containing binding sites for either Zw5 or Su(Hw) or dCTCF protein but not between heterologous binding sites [Zw5-Su(Hw), dCTCF-Su(Hw), or dCTCF-Zw5]. These results suggest that insulator proteins can support selective interactions between distant regulatory elements.

PSE-HMM: genome-wide CNV detection from NGS data using an HMM with Position-Specific Emission probabilities.

PubMed

Malekpour, Seyed Amir; Pezeshk, Hamid; Sadeghi, Mehdi

2016-11-03

Copy Number Variation (CNV) is envisaged to be a major source of large structural variations in the human genome. In recent years, many studies apply Next Generation Sequencing (NGS) data for the CNV detection. However, still there is a necessity to invent more accurate computational tools. In this study, mate pair NGS data are used for the CNV detection in a Hidden Markov Model (HMM). The proposed HMM has position specific emission probabilities, i.e. a Gaussian mixture distribution. Each component in the Gaussian mixture distribution captures a different type of aberration that is observed in the mate pairs, after being mapped to the reference genome. These aberrations may include any increase (decrease) in the insertion size or change in the direction of mate pairs that are mapped to the reference genome. This HMM with Position-Specific Emission probabilities (PSE-HMM) is utilized for the genome-wide detection of deletions and tandem duplications. The performance of PSE-HMM is evaluated on a simulated dataset and also on a real data of a Yoruban HapMap individual, NA18507. PSE-HMM is effective in taking observation dependencies into account and reaches a high accuracy in detecting genome-wide CNVs. MATLAB programs are available at http://bs.ipm.ir/softwares/PSE-HMM/ .

Chronic behavior evaluation of a micro-machined neural implant with optimized design based on an experimentally derived model.

PubMed

Andrei, Alexandru; Welkenhuysen, Marleen; Ameye, Lieveke; Nuttin, Bart; Eberle, Wolfgang

2011-01-01

Understanding the mechanical interactions between implants and the surrounding tissue is known to have an important role for improving the bio-compatibility of such devices. Using a recently developed model, a particular micro-machined neural implant design aiming the reduction of insertion forces dependence on the insertion speed was optimized. Implantations with 10 and 100 μm/s insertion speeds showed excellent agreement with the predicted behavior. Lesion size, gliosis (GFAP), inflammation (ED1) and neuronal cells density (NeuN) was evaluated after 6 week of chronic implantation showing no insertion speed dependence.

Interface thermal conductance characterization by infrared thermography: A tool for the study of insertions in bronze ancient Statuary

NASA Astrophysics Data System (ADS)

Mercuri, F.; Caruso, G.; Orazi, N.; Zammit, U.; Cicero, C.; Colacicchi Alessandri, O.; Ferretti, M.; Paoloni, S.

2018-05-01

In this paper, a new method based on the use of infrared thermography is proposed for the characterization of repairs and inserted parts on ancient bronzes. In particular, the quality of the contact between different kind of insertions and the main body of bronze statues is investigated by analysing the heat conduction process occurring across the interface between them. The thermographic results have been used to establish the nature of these inserted elements and the way they have been coupled to the main body of the statue during and after the manufacturing process. A model for the heat conduction based on the numerical finite elements method has been applied to compare the obtained results to the theoretical predictions. Measurements have been first carried out on test samples and then in the field on the Boxer at Rest (Museo Nazionale Romano in Rome), a masterpiece of the Greek Statuary, which contains a large variety of inserted items and repairs which are typical of the manufacturing process of bronze artefacts in general.

Determination of Membrane-Insertion Free Energies by Molecular Dynamics Simulations

PubMed Central

Gumbart, James; Roux, Benoît

2012-01-01

The accurate prediction of membrane-insertion probability for arbitrary protein sequences is a critical challenge to identifying membrane proteins and determining their folded structures. Although algorithms based on sequence statistics have had moderate success, a complete understanding of the energetic factors that drive the insertion of membrane proteins is essential to thoroughly meeting this challenge. In the last few years, numerous attempts to define a free-energy scale for amino-acid insertion have been made, yet disagreement between most experimental and theoretical scales persists. However, for a recently resolved water-to-bilayer scale, it is found that molecular dynamics simulations that carefully mimic the conditions of the experiment can reproduce experimental free energies, even when using the same force field as previous computational studies that were cited as evidence of this disagreement. Therefore, it is suggested that experimental and simulation-based scales can both be accurate and that discrepancies stem from disparities in the microscopic processes being considered rather than methodological errors. Furthermore, these disparities make the development of a single universally applicable membrane-insertion free energy scale difficult. PMID:22385850

Rotational-translational fourier imaging system

NASA Technical Reports Server (NTRS)

Campbell, Jonathan W. (Inventor)

2004-01-01

This invention has the ability to create Fourier-based images with only two grid pairs. The two grid pairs are manipulated in a manner that allows (1) a first grid pair to provide multiple real components of the Fourier-based image and (2) a second grid pair to provide multiple imaginary components of the Fourier-based image. The novelty of this invention resides in the use of only two grid pairs to provide the same imaging information that has been traditionally collected with multiple grid pairs.

A Risk Based Approach to Node Insertion Within Social Networks

DTIC Science & Technology

2015-03-26

changes to enemy networks, tactical involvement must evolve, beginning with the intelligent use of network infiltration through the application of the...counterterrorism begins with the intelligent use of network infiltration, or the covert insertion of assets into a network, otherwise known as node insertion. The...Federal Bureau of Intelligence (FBI) defines an undercover operation as “an investigation involving a series of related undercover activities over a

Membrane Insertion Profiles of Peptides Probed by Molecular Dynamics Simulations

DTIC Science & Technology

2008-07-17

Membrane insertion profiles of peptides probed by molecular dynamics simulations In-Chul Yeh,* Mark A. Olson,# Michael S. Lee,*#§ and Anders...a methodology based on molecular dynamics simulation techniques to probe the insertion profiles of small peptides across the membrane interface. The...profiles of peptides probed by molecular dynamics simulations 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) 5d

App-based serious gaming for training of chest tube insertion: study protocol for a randomized controlled trial.

PubMed

Friedrich, Mirco; Bergdolt, Christian; Haubruck, Patrick; Bruckner, Thomas; Kowalewski, Karl-Friedrich; Müller-Stich, Beat Peter; Tanner, Michael C; Nickel, Felix

2017-02-06

Chest tube insertion is a standard intervention for management of various injuries of the thorax. Quick and accurate execution facilitates efficient therapy without further complications. Here, we propose a new training concept comprised of e-learning elements as well as continuous rating using an objective structured assessment of technical skills (OSATS) tool. The study protocol is presented for a randomized trial to evaluate e-learning with app-based serious gaming for chest drain insertion. The proposed randomized trial will be carried out at the Department of Orthopedics and Traumatology at Heidelberg University in the context of regular curricular teaching for medical students (n = 90, 3rd to 6th year). The intervention group will use e-learning with the serious gaming app Touch Surgery (TM) for chest drain insertion, whereas the control group uses serious gaming for an unrelated procedure. Primary endpoint is operative performance of chest drain insertion in a porcine cadaveric model according to OSATS. The randomized trial will help determine the value of e-learning with the serious gaming app Touch Surgery (TM) for chest drain insertion by using the OSATS score. The study will improve surgical training for trauma situations. Trial Registration Number, DRKS00009994 . Registered on 27 May 2016.

Thermodynamic stability of Hoogsteen and Watson-Crick base pairs in the presence of histone H3-mimicking peptide.

PubMed

Pramanik, Smritimoy; Nakamura, Kaori; Usui, Kenji; Nakano, Shu-ichi; Saxena, Sarika; Matsui, Jun; Miyoshi, Daisuke; Sugimoto, Naoki

2011-03-14

We found that Hoogsteen base pairs were stabilized by molecular crowding and a histone H3-mimicking peptide, which was not observed for Watson-Crick base pairs. Our findings demonstrate that the type of DNA base pair is critical for the interaction between DNA and histones.

Efficient Implementation of the Pairing on Mobilephones Using BREW

NASA Astrophysics Data System (ADS)

Yoshitomi, Motoi; Takagi, Tsuyoshi; Kiyomoto, Shinsaku; Tanaka, Toshiaki

Pairing based cryptosystems can accomplish novel security applications such as ID-based cryptosystems, which have not been constructed efficiently without the pairing. The processing speed of the pairing based cryptosystems is relatively slow compared with the other conventional public key cryptosystems. However, several efficient algorithms for computing the pairing have been proposed, namely Duursma-Lee algorithm and its variant ηT pairing. In this paper, we present an efficient implementation of the pairing over some mobilephones. Moreover, we compare the processing speed of the pairing with that of the other standard public key cryptosystems, i. e. RSA cryptosystem and elliptic curve cryptosystem. Indeed the processing speed of our implementation in ARM9 processors on BREW achieves under 100 milliseconds using the supersingular curve over F397. In addition, the pairing is more efficient than the other public key cryptosystems, and the pairing can be achieved enough also on BREW mobilephones. It has become efficient enough to implement security applications, such as short signature, ID-based cryptosystems or broadcast encryption, using the pairing on BREW mobilephones.

A data-driven soft sensor for needle deflection in heterogeneous tissue using just-in-time modelling.

PubMed

Rossa, Carlos; Lehmann, Thomas; Sloboda, Ronald; Usmani, Nawaid; Tavakoli, Mahdi

2017-08-01

Global modelling has traditionally been the approach taken to estimate needle deflection in soft tissue. In this paper, we propose a new method based on local data-driven modelling of needle deflection. External measurement of needle-tissue interactions is collected from several insertions in ex vivo tissue to form a cloud of data. Inputs to the system are the needle insertion depth, axial rotations, and the forces and torques measured at the needle base by a force sensor. When a new insertion is performed, the just-in-time learning method estimates the model outputs given the current inputs to the needle-tissue system and the historical database. The query is compared to every observation in the database and is given weights according to some similarity criteria. Only a subset of historical data that is most relevant to the query is selected and a local linear model is fit to the selected points to estimate the query output. The model outputs the 3D deflection of the needle tip and the needle insertion force. The proposed approach is validated in ex vivo multilayered biological tissue in different needle insertion scenarios. Experimental results in five different case studies indicate an accuracy in predicting needle deflection of 0.81 and 1.24 mm in the horizontal and vertical lanes, respectively, and an accuracy of 0.5 N in predicting the needle insertion force over 216 needle insertions.

A MEMS disk resonator-based band pass filter electrical equivalent circuit simulation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sundaram, G. M.; Angira, Mahesh; Gupta, Navneet

In this paper, coupled beam bandpass Disk filter is designed for 1 MHz bandwidth. Filter electrical equivalent circuit simulation is performed using circuit simulators. Important filter parameters such as insertion loss, shape factor and Q factor aresetimated using coventorware simulation. Disk resonator based radial contour mode filter provides 1.5 MHz bandwidth and unloaded quality factor of resonator and filter as 233480, 21797 respectively. From the simulation result it’s found that insertion loss minimum is 151.49 dB, insertion loss maximum is 213.94 dB, and 40 dB shape factor is 4.17.

Microanalysis of extended-test xenon hollow cathodes

NASA Technical Reports Server (NTRS)

Verhey, Timothy R.; Patterson, Michael J.

1991-01-01

Four hollow cathode electron sources were analyzed via boroscopy, scanning electron microscopy, energy dispersive x ray analysis, and x ray diffraction analysis. These techniques were used to develop a preliminary understanding of the chemistry of the devices that arise from contamination due to inadequate feed-system integrity and improper insert activation. Two hollow cathodes were operated in an ion thruster simulator at an emission current of 23.0 A for approximately 500 hrs. The two tests differed in propellant-feed systems, discharge power supplies, and activation procedures. Tungsten deposition and barium tungstate formation on the internal cathode surfaces occurred during the first test, which were believed to result from oxygen contamination of the propellant feed-system. Consequently, the test facility was upgraded to reduce contamination, and the test was repeated. The second hollow cathode was found to have experienced significantly less tungsten deposition. A second pair of cathodes examined were the discharge and the neutralizer hollow cathodes used in a life-test of a 30-cm ring-cusp ion thruster at a 5.5 kW power level. The cathodes' test history was documented and the post-test microanalyses are described. The most significant change resulting from the life-test was substantial tungsten deposition on the internal cathode surfaces, as well as removal of material from the insert surface. In addition, barium tungstate and molybdate were found on insert surfaces. As a result of the cathode examinations, procedures and approaches were proposed for improved discharge ignition and cathode longevity.

Generation and validation of homozygous fluorescent knock-in cells using CRISPR-Cas9 genome editing.

PubMed

Koch, Birgit; Nijmeijer, Bianca; Kueblbeck, Moritz; Cai, Yin; Walther, Nike; Ellenberg, Jan

2018-06-01

Gene tagging with fluorescent proteins is essential for investigations of the dynamic properties of cellular proteins. CRISPR-Cas9 technology is a powerful tool for inserting fluorescent markers into all alleles of the gene of interest (GOI) and allows functionality and physiological expression of the fusion protein. It is essential to evaluate such genome-edited cell lines carefully in order to preclude off-target effects caused by (i) incorrect insertion of the fluorescent protein, (ii) perturbation of the fusion protein by the fluorescent proteins or (iii) nonspecific genomic DNA damage by CRISPR-Cas9. In this protocol, we provide a step-by-step description of our systematic pipeline to generate and validate homozygous fluorescent knock-in cell lines.We have used the paired Cas9D10A nickase approach to efficiently insert tags into specific genomic loci via homology-directed repair (HDR) with minimal off-target effects. It is time-consuming and costly to perform whole-genome sequencing of each cell clone to check for spontaneous genetic variations occurring in mammalian cell lines. Therefore, we have developed an efficient validation pipeline of the generated cell lines consisting of junction PCR, Southern blotting analysis, Sanger sequencing, microscopy, western blotting analysis and live-cell imaging for cell-cycle dynamics. This protocol takes between 6 and 9 weeks. With this protocol, up to 70% of the targeted genes can be tagged homozygously with fluorescent proteins, thus resulting in physiological levels and phenotypically functional expression of the fusion proteins.

Alternative method for predicting optimal insertion depth of the laryngeal tube in children.

PubMed

Kim, J T; Jeon, S Y; Kim, C S; Kim, S D; Kim, H S

2007-11-01

Little information is available about the accuracy of the teeth mark on the laryngeal tube (LT) as a guide to correct placement in children. The aim of this crossover study was to evaluate three methods for optimal insertion depth of the size (#) 2 tube in children weighing 12-25 kg. In 24 children, the LT #2 was consecutively inserted by three different methods: (A) until the thick teeth mark on the tube was aligned with the upper incisors, (B) until resistance was felt, and (C) by inserting to a depth, previously measured, of the curved distance between the cricoid cartilage and the upper incisor. In each case, the depth of insertion, the degree of effective ventilation, the presence of leakage, and the fibreoptic view were assessed. Insertion based on the teeth mark led to a shorter insertion depth and a greater incidence of inadequate ventilation compared with the other two methods. There was no difference in the adequacy of ventilation between methods B and C. The vocal cords were more easily identified with methods B (62.5%) and C (75%) than with method A (12.5%). Insertion of the LT #2 aligned with the teeth mark can result in a shallow insertion depth and inadequate ventilation. The measured distance from the cricoid cartilage to the upper incisor offers alternative guidance for correct LT insertion.

Human Kinematics of Cochlear Implant Surgery: An Investigation of Insertion Micro-Motions and Speed Limitations.

PubMed

Kesler, Kyle; Dillon, Neal P; Fichera, Loris; Labadie, Robert F

2017-09-01

Objectives Document human motions associated with cochlear implant electrode insertion at different speeds and determine the lower limit of continuous insertion speed by a human. Study Design Observational. Setting Academic medical center. Subjects and Methods Cochlear implant forceps were coupled to a frame containing reflective fiducials, which enabled optical tracking of the forceps' tip position in real time. Otolaryngologists (n = 14) performed mock electrode insertions at different speeds based on recommendations from the literature: "fast" (96 mm/min), "stable" (as slow as possible without stopping), and "slow" (15 mm/min). For each insertion, the following metrics were calculated from the tracked position data: percentage of time at prescribed speed, percentage of time the surgeon stopped moving forward, and number of direction reversals (ie, going from forward to backward motion). Results Fast insertion trials resulted in better adherence to the prescribed speed (45.4% of the overall time), no motion interruptions, and no reversals, as compared with slow insertions (18.6% of time at prescribed speed, 15.7% stopped time, and an average of 18.6 reversals per trial). These differences were statistically significant for all metrics ( P < .01). The metrics for the fast and stable insertions were comparable; however, stable insertions were performed 44% slower on average. The mean stable insertion speed was 52 ± 19.3 mm/min. Conclusion Results indicate that continuous insertion of a cochlear implant electrode at 15 mm/min is not feasible for human operators. The lower limit of continuous forward insertion is 52 mm/min on average. Guidelines on manual insertion kinematics should consider this practical limit of human motion.

Target-matched insertion gain derived from three different hearing aid selection procedures.

PubMed

Punch, J L; Shovels, A H; Dickinson, W W; Calder, J H; Snead, C

1995-11-01

Three hearing aid selection procedures were compared to determine if any one was superior in producing prescribed real-ear insertion gain. For each of three subject groups, 12 in-the-ear style hearing aids with Class D circuitry and similar dispenser controls were ordered from one of three manufacturers. Subject groups were classified based on the type of information included on the hearing aid order form: (1) the subject's audiogram, (2) a three-part matrix specifying the desired maximum output, full-on gain, and frequency response slope of the hearing aid, or (3) the desired 2-cc coupler full-in grain of the hearing aid, based on real-ear coupler difference (RECD) measurements. Following electroacoustic adjustments aimed at approximating a commonly used target insertion gain formula, results revealed no significant differences among any of the three selection procedures with respect to obtaining acceptable insertion gain values.

Fabrication and evaluation of an improved polymer-based cochlear electrode array for atraumatic insertion.

PubMed

Gwon, Tae Mok; Min, Kyou Sik; Kim, Jin Ho; Oh, Seung Ha; Lee, Ho Sun; Park, Min-Hyun; Kim, Sung June

2015-04-01

An atraumatic cochlear electrode array has become indispensable to high-performance cochlear implants such as electric acoustic stimulation (EAS), wherein the preservation of residual hearing is significant. For an atraumatic implantation, we propose and demonstrate a new improved design of a cochlear electrode array based on liquid crystal polymer (LCP), which can be fabricated by precise batch processes and a thermal lamination process, in contrast to conventional wire-based cochlear electrode arrays. Using a thin-film process of LCP-film-mounted silicon wafer and thermal press lamination, we devise a multi-layered structure with variable layers of LCP films to achieve a sufficient degree of basal rigidity and a flexible tip. A peripheral blind via and self-aligned silicone elastomer molding process can reduce the width of the array. Measuring the insertion and extraction forces in a human scala tympani model, we investigate five human temporal bone insertion trials and record electrically evoked auditory brainstem responses (EABR) acutely in a guinea pig model. The diameters of the finalized electrode arrays are 0.3 mm (tip) and 0.75 mm (base). The insertion force with a displacement of 8 mm from a round window and the maximum extraction force are 2.4 mN and 34.0 mN, respectively. The electrode arrays can be inserted from 360° to 630° without trauma at the basal turn. The EABR data confirm the efficacy of the array. A new design of LCP-based cochlear electrode array for atraumatic implantation is fabricated. Verification indicates that foretells the development of an atraumatic cochlear electrode array and clinical implant.

An ensemble of SVM classifiers based on gene pairs.

PubMed

Tong, Muchenxuan; Liu, Kun-Hong; Xu, Chungui; Ju, Wenbin

2013-07-01

In this paper, a genetic algorithm (GA) based ensemble support vector machine (SVM) classifier built on gene pairs (GA-ESP) is proposed. The SVMs (base classifiers of the ensemble system) are trained on different informative gene pairs. These gene pairs are selected by the top scoring pair (TSP) criterion. Each of these pairs projects the original microarray expression onto a 2-D space. Extensive permutation of gene pairs may reveal more useful information and potentially lead to an ensemble classifier with satisfactory accuracy and interpretability. GA is further applied to select an optimized combination of base classifiers. The effectiveness of the GA-ESP classifier is evaluated on both binary-class and multi-class datasets. Copyright © 2013 Elsevier Ltd. All rights reserved.

Treatment of cuff-related tracheal stenosis with a fully covered retrievable expandable metallic stent.

PubMed

Chen, G; Wang, Z; Liang, X; Wang, Y; Wang, Y; Wang, Z; Xian, J

2013-04-01

To investigate the clinical effectiveness, complications, and optimal duration of use of covered retrievable expandable metallic stents in the management of cuff-related tracheal stenosis. Twenty-one patients with cuff-related tracheal stenosis, Meyer-Cotton grade II (29%) and III (71%), who underwent fluoroscopically guided placement of covered retrievable expandable metallic stents were studied. Sixty-four-section computed tomography (CT) and bronchovideoscopy were performed prior to stent insertion, 1 month after stent insertion, in the case of stent-related complications, and after stent removal. Clinical manifestations, Hugh-Jones classification, and forced expiratory volume in 1 s (FEV1) were used to evaluate respiratory function before and after stent insertion and removal. The diameter of the stricture and FEV1 changes before insertion and after removal were analysed using the paired samples t-test. A p-value of ≤0.05 was considered statistically significant. Twenty-one patients had 27 covered retrievable expandable metallic stents placed. Stents were electively removed from 20 patients. The median duration of stent placement was 5 months (range 4-12 months). One stent was not removed due to mucopolysaccharidosis type II (MPS II or Hunter syndrome) with tracheomalacia. After stent removal, airway dimensions increased and airway occlusion was symptomatically relieved in all patients. CT and bronchovideoscopy showed patent lumens with increased dimensions. Stent-related complications occurred in 19 (91%) patients, including granulation tissue formation (n = 18, 86%), stent migration and stent expectoration (n = 2, 10%), mucus plugging (n = 1, 5%), and halitosis (n = 6, 29%). Some patients experienced multiple complications, which were all managed effectively while the stent was still in place. There was a statistically significant difference in the diameter of the stricture and FEV1 between the time of stent insertion and removal. An improvement in Hugh-Jones classification of greater than one grade was seen in patients after stent removal. Temporary placement of a fully covered retrievable expandable metallic stent is safe and effective in cuff-related tracheal stenosis. The optimal duration of stent placement may be 4-8 months. Copyright © 2012 The Royal College of Radiologists. Published by Elsevier Ltd. All rights reserved.

Envisaging quantum transport phenomenon in a muddled base pair of DNA

NASA Astrophysics Data System (ADS)

Vohra, Rajan; Sawhney, Ravinder Singh

2018-05-01

The effect of muddled base pair on electron transfer through a deoxyribonucleic acid (DNA) molecule connected to the gold electrodes has been elucidated using tight binding model. The effect of hydrogen and nitrogen bonds on the resistance of the base pair has been minutely observed. Using the semiempirical extended Huckel approach within NEGF regime, we have determined the current and conductance vs. bias voltage for disordered base pairs of DNA made of thymine (T) and adenine (A). The asymmetrical behaviour amid five times depreciation in the current characteristics has been observed for deviated Au-AT base pair-Au devices. An interesting revelation is that the conductance of the intrinsic AT base pair configuration attains dramatically high values with the symmetrical zig-zag pattern of current, which clearly indicates the transformation of the bond length within the strands of base pair when compared with other samples. A thorough investigation of the transmission coefficients T( E) and HOMO-LUMO gap reveals the misalignment of the strands in base pairs of DNA. The observed results present an insight to extend this work to build biosensing devices to predict the abnormality with the DNA.

Higher order structural effects stabilizing the reverse Watson–Crick Guanine-Cytosine base pair in functional RNAs

PubMed Central

Chawla, Mohit; Abdel-Azeim, Safwat; Oliva, Romina; Cavallo, Luigi

2014-01-01

The G:C reverse Watson–Crick (W:W trans) base pair, also known as Levitt base pair in the context of tRNAs, is a structurally and functionally important base pair that contributes to tertiary interactions joining distant domains in functional RNA molecules and also participates in metabolite binding in riboswitches. We previously indicated that the isolated G:C W:W trans base pair is a rather unstable geometry, and that dicationic metal binding to the Guanine base or posttranscriptional modification of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G:C trans base pairs. Interestingly, 66% of the G:C trans base pairs in the PDB are engaged in additional H-bonding interactions with other bases, the RNA backbone or structured water molecules. High level quantum mechanical calculations on a data set of representative crystal structures were performed to shed light on the structural stability and energetics of the various crystallographic motifs. This analysis was extended to the binding of the preQ1 metabolite to a preQ1-II riboswitch. PMID:24121683

Ventricular flow dynamics with varying LVAD inflow cannula lengths: In-silico evaluation in a multiscale model.

PubMed

Liao, Sam; Neidlin, Michael; Li, Zhiyong; Simpson, Benjamin; Gregory, Shaun D

2018-04-27

Left ventricular assist devices are associated with thromboembolic events, which are potentially caused by altered intraventricular flow. Due to patient variability, differences in apical wall thickness affects cannula insertion lengths, potentially promoting unfavourable intraventricular flow patterns which are thought to be correlated to the risk of thrombosis. This study aimed to present a 3D multiscale computational fluid dynamic model of the left ventricle (LV) developed using a commercial software, Ansys, and evaluate the risk of thrombosis with varying inflow cannula insertion lengths in a severely dilated LV. Based on a HeartWare HVAD inflow cannula, insertion lengths of 5, 19, 24 and 50 mm represented cases of apical hypertrophy, typical ranges of apical thicknesses and an experimental length, respectively. The risk of thrombosis was evaluated based on blood washout, residence time, instantaneous blood stagnation and a pulsatility index. By introducing fresh blood to displace pre-existing blood in the LV, after 5 cardiac cycles, 46.7%, 45.7%, 45.1% and 41.8% of pre-existing blood remained for insertion lengths of 5, 19, 24 and 50 mm, respectively. Compared to the 50 mm insertion, blood residence time was at least 9%, 7% and 6% higher with the 5, 19 and 24 mm insertion lengths, respectively. No instantaneous stagnation at the apex was observed directly after the E-wave. Pulsatility indices adjacent to the cannula increased with shorter insertion lengths. For the specific scenario studied, a longer insertion length, relative to LV size, may be advantageous to minimise thrombosis by increasing LV washout and reducing blood residence time. Copyright © 2018 Elsevier Ltd. All rights reserved.

Amphiphilic interactions of ionic liquids with lipid biomembranes: a molecular simulation study.

PubMed

Yoo, Brian; Shah, Jindal K; Zhu, Yingxi; Maginn, Edward J

2014-11-21

Current bottlenecks in the large-scale commercial use of many ionic liquids (ILs) include their high costs, low biodegradability, and often unknown toxicities. As a proactive effort to better understand the molecular mechanisms of ionic liquid toxicities, the work herein presents a comprehensive molecular simulation study on the interactions of 1-n-alkyl-3-methylimidazolium-based ILs with a phosphatidylcholine (PC) lipid bilayer. We explore the effects of increasing alkyl chain length (n = 4, 8, and 12) in the cation and anion hydrophobicity on the interactions with the lipid bilayer. Bulk atomistic molecular dynamics (MD) simulations performed at millimolar (mM) IL concentrations show spontaneous insertion of cations into the lipid bilayer regardless of the alkyl chain length and a favorable orientational preference once a cation is inserted. Cations also exhibit the ability to "flip" inside the lipid bilayer (as is common for amphiphiles) if partially inserted with an unfavorable orientation. Moreover, structural analysis of the lipid bilayer show that cationic insertion induces roughening of the bilayer surface, which may be a precursor to bilayer disruption. To overcome the limitation in the timescale of our simulations, free energies for a single IL cation and anion insertion have been determined based on potential of mean force calculations. These results show a decrease in free energy in response to both short and long alkyl chain IL cation insertion, and likewise for a single hydrophobic anion insertion, but an increase in free energy for the insertion of a hydrophilic chloride anion. Both bulk MD simulations and free energy calculations suggest that toxicity mechanisms toward biological systems are likely caused by ILs behaving as ionic surfactants. [Yoo et al., Soft Matter, 2014].

Bifacial Base-Pairing Behaviors of 5-Hydroxyuracil DNA Bases through Hydrogen Bonding and Metal Coordination.

PubMed

Takezawa, Yusuke; Nishiyama, Kotaro; Mashima, Tsukasa; Katahira, Masato; Shionoya, Mitsuhiko

2015-10-12

A novel bifacial ligand-bearing nucleobase, 5-hydroxyuracil (U(OH) ), which forms both a hydrogen-bonded base pair (U(OH) -A) and a metal-mediated base pair (U(OH) -M-U(OH) ) has been developed. The U(OH) -M-U(OH) base pairs were quantitatively formed in the presence of lanthanide ions such as Gd(III) when U(OH) -U(OH) pairs were consecutively incorporated into DNA duplexes. This result established metal-assisted duplex stabilization as well as DNA-templated assembly of lanthanide ions. Notably, a duplex possessing U(OH) -A base pairs was destabilized by addition of Gd(III) ions. This observation suggests that the hybridization behaviors of the U(OH) -containing DNA strands are altered by metal complexation. Thus, the U(OH) nucleobase with a bifacial base-pairing property holds great promise as a component for metal-responsive DNA materials. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Molecular switching behavior in isosteric DNA base pairs.

PubMed

Jissy, A K; Konar, Sukanya; Datta, Ayan

2013-04-15

The structures and proton-coupled behavior of adenine-thymine (A-T) and a modified base pair containing a thymine isostere, adenine-difluorotoluene (A-F), are studied in different solvents by dispersion-corrected density functional theory. The stability of the canonical Watson-Crick base pair and the mismatched pair in various solvents with low and high dielectric constants is analyzed. It is demonstrated that A-F base pairing is favored in solvents with low dielectric constant. The stabilization and conformational changes induced by protonation are also analyzed for the natural as well as the mismatched base pair. DNA sequences capable of changing their sequence conformation on protonation are used in the construction of pH-based molecular switches. An acidic medium has a profound influence in stabilizing the isostere base pair. Such a large gain in stability on protonation leads to an interesting pH-controlled molecular switch, which can be incorporated in a natural DNA tract. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

The 14alpha-Demethylasse(CYP51A1) Gene is Overexpressed in Venturia inaequalis Strains Resistant to Myclobutanil.

PubMed

Schnabel, G; Jones, A L

2001-01-01

ABSTRACT We identified the cytochrome P450 sterol 14alpha-demethylase (CYP51A1) gene from Venturia inaequalis and optional insertions located upstream from CYP51A1 and evaluated their potential role in conferring resistance to the sterol demethylation-inhibitor (DMI) fungicide my-clobutanil. The CYP51A1 gene was completely sequenced from one my-clobutanil sensitive (S) and two myclobutanil-resistant (R) strains. No nucleotide variation was found when the three sequences were aligned. Allele-specific polymerase chain reaction (PCR) analysis indicated that a previously described single base pair mutation that correlated with resistance to DMI fungicides in strains of other filamentous fungi was absent in 19 S and 32 R strains of V. inaequalis from Michigan and elsewhere. The sequencing results and PCR analyses suggest that resistance in these strains was not due to a mutation in the sterol demethylase target site for DMI fungicides. Expression of CYP51A1 was determined for strains from an orchard that had never been sprayed with DMI fungicides (baseline orchard), and the data provided a reference for evaluating the expression of strains collected from a research orchard and from three commercial Michigan apple orchards with a long history of DMI use and a high frequency of R strains. Overexpression of CYP51A1 was significantly higher in 9 of 11 R strains from the research orchard than in S strains from the baseline orchard. The high expression was correlated with the presence of a 553-bp insertion located upstream of CYP51A1. Overexpression of the CYP51A1 gene was also detected in eight of eight, five of nine, and nine of nine R strains from three commercial orchards, but the insertion was not detected in the majority of these strains. The results suggest that overexpression of the target-site CYP51A1 gene is an important mechanism of resistance in some field resistant strains of V. inaequalis, but other mechanisms of resistance also appear to exist.

Variation in adverse drug reactions listed in product information for antidepressants and anticonvulsants, between the USA and Europe: a comparison review of paired regulatory documents

PubMed Central

Cornelius, Victoria R; Liu, Kun; Peacock, Janet; Sauzet, Odile

2016-01-01

Objective To compare consistency of adverse drug reaction (ADR) data in publicly available product information documents for brand drugs, between the USA and Europe. To assess the usefulness of information for prescribers and patients. Design A comparison review of product information documents for antidepressants and anticonvulsants concurrently marketed by the same pharmaceutical company in the USA and Europe. Setting For each drug, data were extracted from the US Product Inserts and the European Summary of Product Characteristics documents between 09/2013 and 01/2015. Participants Individuals contributing ADR information to product information documents. Main outcomes measures All ADRs reported in product information sections 5 and 6 (USA), and 4·4 and 4·8 (Europe). Results Twelve brand drugs—24 paired documents—were included. On average, there were 77 more ADRs reported in the USA compared with in the European product information document, with a median number of 201 ADRs (range: 65–425) and 114 (range: 56–265), respectively. More product information documents in the USA reported information on the source of evidence (10 vs 5) and risk (9 vs 5) for greater than 80% of ADRs included in the document. There was negligible information included regarding duration, severity, reversibility or recurrence of ADRs. On average, only 29% of ADR terms were reported in both paired documents. Conclusions Product information documents contained a large number of ADRs, but lacked contextual data and information important to patients and prescribers, such as duration, severity and reversibility. The ADR profile was found to be inconsistently reported between the USA and Europe, for the same drug. Identifying, selecting, summarising and presenting multidimensional harm data should be underpinned by practical evidence-based guidelines. In order for prescribers to provide considered risk-benefit advice across competing drug therapies to patients, they need access to comprehensible and reliable ADR information. PMID:26996819

A set of primers for analyzing chloroplast DNA diversity in Citrus and related genera.

PubMed

Cheng, Yunjiang; de Vicente, M Carmen; Meng, Haijun; Guo, Wenwu; Tao, Nengguo; Deng, Xiuxin

2005-06-01

Chloroplast simple sequence repeat (cpSSR) markers in Citrus were developed and used to analyze chloroplast diversity of Citrus and closely related genera. Fourteen cpSSR primer pairs from the chloroplast genomes of tobacco (Nicotiana tabacum L.) and Arabidopsis were found useful for analyzing the Citrus chloroplast genome (cpDNA) and recoded with the prefix SPCC (SSR Primers for Citrus Chloroplast). Eleven of the 14 primer pairs revealed some degree of polymorphism among 34 genotypes of Citrus, Fortunella, Poncirus and some of their hybrids, with polymorphism information content (PIC) values ranging from 0.057 to 0.732, and 18 haplotypes were identified. The cpSSR data were analyzed with NTSYS-pc software, and the genetic relationships suggested by the unweighted pair group method based on arithmetic means (UPGMA) dendrogram were congruent with previous taxonomic investigations: the results showed that all samples fell into seven major clusters, i.e., Citrus medica L., Poncirus, Fortunella, C. ichangensis Blanco, C. reticulata Swingle, C. aurantifolia (Christm.) Swingle and C. grandis (L.) Osbeck. The results of previous studies combined with our cpSSR analyses revealed that: (1) Calamondin (C. madurensis Swingle) is the result of hybridization between kumquat (Fortunella) and mandarin (C. reticulata), where kumquat acted as the female parent; (2) Ichang papeda (C. ichangensis) has a unique taxonomic status; and (3) although Bendiguangju mandarin (C. reticulata) and Satsuma mandarin (C. reticulata) are similar in fruit shape and leaf morphology, they have different maternal parents. Bendiguangju mandarin has the same cytoplasm as sweet orange (C. sinensis), whereas Satsuma mandarin has the cytoplasm of C. reticulata. Seventeen PCR products from SPCC1 and 21 from SPCC11 were cloned and sequenced. The results revealed that mononucleotide repeats as well as insertions and deletions of small segments of DNA were associated with SPCC1 polymorphism, whereas polymorphism generated by SPCC11 was essentially due to the variation in length of the mononucleotide repeats.

1,8-Naphthyridine-2,7-diamine: a potential universal reader of Watson-Crick base pairs for DNA sequencing by electron tunneling.

PubMed

Liang, Feng; Lindsay, Stuart; Zhang, Peiming

2012-11-21

With the aid of Density Functional Theory (DFT), we designed 1,8-naphthyridine-2,7-diamine as a recognition molecule to read DNA base pairs for genomic sequencing by electron tunneling. NMR studies show that it can form stable triplets with both A : T and G : C base pairs through hydrogen bonding. Our results suggest that the naphthyridine molecule should be able to function as a universal base pair reader in a tunneling gap, generating distinguishable signatures under electrical bias for each of DNA base pairs.

1,8-Naphthyridine-2,7-diamine: A Potential Universal Reader of the Watson-Crick Base Pairs for DNA Sequencing by Electron Tunneling

PubMed Central

Liang, Feng; Lindsay, Stuart; Zhang, Peiming

2013-01-01

With the aid of Density Functional Theory (DFT), we designed 1,8-naphthyridine-2,7-diamine as a recognition molecule to read the DNA base pairs for genomic sequencing by electron tunneling. NMR studies show that it can form stable triplets with both A:T and G:C base pairs through hydrogen bonding. Our results suggest that the naphthyridine molecule should be able to function as a universal base pair reader in a tunneling gap, generating distinguishable signatures under electrical bias for each of DNA base pairs. PMID:23038027

Use of oviduct-inserted acoustic transmitters and positional telemetry to estimate timing and location of spawning: a feasibility study in lake trout, Salvelinus namaycush

USGS Publications Warehouse

Binder, Thomas R.; Holbrook, Christopher M.; Miehls, Scott M.; Thompson, Henry T.; Krueger, Charles C.

2014-01-01

Our results satisfied the three assumptions of oviduct tagging and suggested that oviduct transmitters can be used with positional telemetry to estimate time and location of spawning in lake trout and other species. In situations where oviduct transmitters may be difficult to position once expelled into substrate, pairing oviduct transmitters with a normal-sized fish transmitter that remains in the fish is recommended, with spawning inferred when the two tags separate in space. Optimal transmitter delay will depend on expected degree of spawning site residency and swim speed.

Instrumentation of Java Bytecode for Runtime Analysis

NASA Technical Reports Server (NTRS)

Goldberg, Allen; Haveland, Klaus

2003-01-01

This paper describes JSpy, a system for high-level instrumentation of Java bytecode and its use with JPaX, OUT system for runtime analysis of Java programs. JPaX monitors the execution of temporal logic formulas and performs predicative analysis of deadlocks and data races. JSpy s input is an instrumentation specification, which consists of a collection of rules, where a rule is a predicate/action pair The predicate is a conjunction of syntactic constraints on a Java statement, and the action is a description of logging information to be inserted in the bytecode corresponding to the statement. JSpy is built using JTrek an instrumentation package at a lower level of abstraction.

Weak-microcavity organic light-emitting diodes with improved light out-coupling.

PubMed

Cho, Sang-Hwan; Song, Young-Woo; Lee, Joon-gu; Kim, Yoon-Chang; Lee, Jong Hyuk; Ha, Jaeheung; Oh, Jong-Suk; Lee, So Young; Lee, Sun Young; Hwang, Kyu Hwan; Zang, Dong-Sik; Lee, Yong-Hee

2008-08-18

We propose and demonstrate weak-microcavity organic light-emitting diode (OLED) displays with improved light-extraction and viewing-angle characteristics. A single pair of low- and high-index layers is inserted between indium tin oxide (ITO) and a glass substrate. The electroluminescent (EL) efficiencies of discrete red, green, and blue weak-microcavity OLEDs are enhanced by 56%, 107%, and 26%, respectively, with improved color purity. Moreover, full-color passive-matrix bottom-emitting OLED displays are fabricated by employing low-index layers of two thicknesses. As a display, the EL efficiency of white color was 27% higher than that of a conventional OLED display.

Design and Analyses of High Aspect Ratio Nozzles for Distributed Propulsion Acoustic Measurements

NASA Technical Reports Server (NTRS)

Dippold, Vance F., III

2016-01-01

A series of three convergent round-to-rectangular high-aspect ratio nozzles were designed for acoustics measurements. The nozzles have exit area aspect ratios of 8:1, 12:1, and 16:1. With septa inserts, these nozzles will mimic an array of distributed propulsion system nozzles, as found on hybrid wing-body aircraft concepts. Analyses were performed for the three nozzle designs and showed that the flow through the nozzles was free of separated flow and shocks. The exit flow was mostly uniform with the exception of a pair of vortices at each span-wise end of the nozzle.

High performance architecture design for large scale fibre-optic sensor arrays using distributed EDFAs and hybrid TDM/DWDM

NASA Astrophysics Data System (ADS)

Liao, Yi; Austin, Ed; Nash, Philip J.; Kingsley, Stuart A.; Richardson, David J.

2013-09-01

A distributed amplified dense wavelength division multiplexing (DWDM) array architecture is presented for interferometric fibre-optic sensor array systems. This architecture employs a distributed erbium-doped fibre amplifier (EDFA) scheme to decrease the array insertion loss, and employs time division multiplexing (TDM) at each wavelength to increase the number of sensors that can be supported. The first experimental demonstration of this system is reported including results which show the potential for multiplexing and interrogating up to 4096 sensors using a single telemetry fibre pair with good system performance. The number can be increased to 8192 by using dual pump sources.

16 CFR 322.2 - Definitions.

Code of Federal Regulations, 2012 CFR

2012-01-01

..., such as the Internet, online services, and software, the required disclosures shall: (i) Be consistent... television, radio, or Internet-based multi-media commercial communications, the required disclosures shall be..., brochure, newspaper, magazine, pamphlet, leaflet, circular, mailer, book insert, free standing insert...

16 CFR 322.2 - Definitions.

Code of Federal Regulations, 2011 CFR

2011-01-01

..., such as the Internet, online services, and software, the required disclosures shall: (i) Be consistent... television, radio, or Internet-based multi-media commercial communications, the required disclosures shall be..., brochure, newspaper, magazine, pamphlet, leaflet, circular, mailer, book insert, free standing insert...

12 CFR 1015.2 - Definitions.

Code of Federal Regulations, 2013 CFR

2013-01-01

... duration of the oral disclosure; (4) In communications made through interactive media, such as the internet..., or internet-based multimedia commercial communications, the required disclosures shall be made at the..., newspaper, magazine, pamphlet, leaflet, circular, mailer, book insert, free standing insert, letter...

12 CFR 1015.2 - Definitions.

Code of Federal Regulations, 2012 CFR

2012-01-01

... duration of the oral disclosure; (4) In communications made through interactive media, such as the internet..., or internet-based multimedia commercial communications, the required disclosures shall be made at the..., newspaper, magazine, pamphlet, leaflet, circular, mailer, book insert, free standing insert, letter...

12 CFR 1015.2 - Definitions.

Code of Federal Regulations, 2014 CFR

2014-01-01

... duration of the oral disclosure; (4) In communications made through interactive media, such as the internet..., or internet-based multimedia commercial communications, the required disclosures shall be made at the..., newspaper, magazine, pamphlet, leaflet, circular, mailer, book insert, free standing insert, letter...

What Determines CO₂ Solubility in Ionic Liquids? A Molecular Simulation Study.

PubMed

Klähn, Marco; Seduraman, Abirami

2015-08-06

Molecular dynamics (MD) simulations of 10 different pure and CO2-saturated ionic liquids are performed to identify the factors that determine CO2 solubility. Imidazolium-based cations with varying alkyl chain length and functionalization are paired with anions of different hydrophobicity and size. Simulations are carried out with an empirical force field based on liquid-phase charges. The partial molar volume of CO2 in ionic liquids (ILs) varies from 30 to 40 cm(3)/mol. This indicates that slight ion displacements are necessary to enable CO2 insertions. However, the absorption of CO2 does not affect the overall organization of ions in the ILs as demonstrated by almost equal cation-anion radial distribution functions of pure ILs and ILs saturated with CO2. The solubility of CO2 in ILs is not influenced by direct CO2-ion interactions. Instead, a strong correlation between the ratio of unoccupied space in pure ILs and their ability to absorb CO2 is found. This preformed unoccupied space is regularly dispersed throughout the ILs and needs to be expanded by slight ion displacements to accommodate CO2. The amount of preformed unoccupied space is a good indicator for ion cohesion in ILs. Weak electrostatic cation-anion interaction densities in ILs, i.e., weak ion cohesion, leads to larger average distances between ions and hence to more unoccupied space. Weak ion cohesion facilitates ion displacement to enable an expansion of empty space to accommodate CO2. Moreover, it is demonstrated that the strength of ion cohesion is primarily determined by the ion density, which in turn is given by the ion sizes. Ion cohesion is influenced additionally to a smaller extent by local electrostatic interactions among ion moieties between which CO2 is inserted and which do not depend on the ion density. Overall, the factors that determine the solubility of CO2 in ILs are identified consistently across a large variety of constituting ions through MD simulations.

A Simulation-Based Blended Curriculum for Short Peripheral Intravenous Catheter Insertion: An Industry-Practice Collaboration.

PubMed

Glover, Kevin R; Stahl, Brian R; Murray, Connie; LeClair, Matthew; Gallucci, Susan; King, Mary Anne; Labrozzi, Laura J; Schuster, Catherine; Keleekai, Nowai L

2017-09-01

Despite peripheral intravenous catheter (PIVC) insertion being a commonly performed skill, practicing nurses may receive little substantive education, training, or opportunities to practice this skill at a competent level. This article describes a collaboration between private industry and a hospital to modify, implement, and evaluate a simulation-based blended PIVC insertion continuing education program for staff nurses. Included is an overview of the practical and theoretical rationale for the initial development of the curriculum to address an identified PIVC insertion education gap, the collaborative modification and implementation of the program, and an evaluation of the program. The curriculum combined self-paced e-learning and classroom-based deliberate practice with simulation tools of varying fidelity in a peer-to-peer learning environment. Given the mutual challenges of resource allocation in industry training and clinical nursing education departments, interprofessional partnerships may be an effective option for sharing instructional knowledge and resources to promote innovation and improve patient care. J Contin Educ Nurs. 2017;48(9):397-406. Copyright 2017, SLACK Incorporated.

A novel adaptive needle insertion sequencing for robotic, single needle MR-guided high-dose-rate prostate brachytherapy

NASA Astrophysics Data System (ADS)

Borot de Battisti, M.; de Senneville, B. Denis; Hautvast, G.; Binnekamp, D.; Lagendijk, J. J. W.; Maenhout, M.; Moerland, M. A.

2017-05-01

MR-guided high-dose-rate (HDR) brachytherapy has gained increasing interest as a treatment for patients with localized prostate cancer because of the superior value of MRI for tumor and surrounding tissues localization. To enable needle insertion into the prostate with the patient in the MR bore, a single needle MR-compatible robotic system involving needle-by-needle dose delivery has been developed at our institution. Throughout the intervention, dose delivery may be impaired by: (1) sub-optimal needle positioning caused by e.g. needle bending, (2) intra-operative internal organ motion such as prostate rotations or swelling, or intra-procedural rectum or bladder filling. This may result in failure to reach clinical constraints. To assess the first aforementioned challenge, a recent study from our research group demonstrated that the deposited dose may be greatly improved by real-time adaptive planning with feedback on the actual needle positioning. However, the needle insertion sequence is left to the doctor and therefore, this may result in sub-optimal dose delivery. In this manuscript, a new method is proposed to determine and update automatically the needle insertion sequence. This strategy is based on the determination of the most sensitive needle track. The sensitivity of a needle track is defined as its impact on the dose distribution in case of sub-optimal positioning. A stochastic criterion is thus presented to determine each needle track sensitivity based on needle insertion simulations. To assess the proposed sequencing strategy, HDR prostate brachytherapy was simulated on 11 patients with varying number of needle insertions. Sub-optimal needle positioning was simulated at each insertion (modeled by typical random angulation errors). In 91% of the scenarios, the dose distribution improved when the needle was inserted into the most compared to the least sensitive needle track. The computation time for sequencing was less than 6 s per needle track. The proposed needle insertion sequencing can therefore assist in delivering an optimal dose in HDR prostate brachytherapy.

Automatic Multiple-Needle Surgical Planning of Robotic-Assisted Microwave Coagulation in Large Liver Tumor Therapy

PubMed Central

Liu, Shaoli; Xia, Zeyang; Liu, Jianhua; Xu, Jing; Ren, He; Lu, Tong; Yang, Xiangdong

2016-01-01

The “robotic-assisted liver tumor coagulation therapy” (RALTCT) system is a promising candidate for large liver tumor treatment in terms of accuracy and speed. A prerequisite for effective therapy is accurate surgical planning. However, it is difficult for the surgeon to perform surgical planning manually due to the difficulties associated with robot-assisted large liver tumor therapy. These main difficulties include the following aspects: (1) multiple needles are needed to destroy the entire tumor, (2) the insertion trajectories of the needles should avoid the ribs, blood vessels, and other tissues and organs in the abdominal cavity, (3) the placement of multiple needles should avoid interference with each other, (4) an inserted needle will cause some deformation of liver, which will result in changes in subsequently inserted needles’ operating environment, and (5) the multiple needle-insertion trajectories should be consistent with the needle-driven robot’s movement characteristics. Thus, an effective multiple-needle surgical planning procedure is needed. To overcome these problems, we present an automatic multiple-needle surgical planning of optimal insertion trajectories to the targets, based on a mathematical description of all relevant structure surfaces. The method determines the analytical expression of boundaries of every needle “collision-free reachable workspace” (CFRW), which are the feasible insertion zones based on several constraints. Then, the optimal needle insertion trajectory within the optimization criteria will be chosen in the needle CFRW automatically. Also, the results can be visualized with our navigation system. In the simulation experiment, three needle-insertion trajectories were obtained successfully. In the in vitro experiment, the robot successfully achieved insertion of multiple needles. The proposed automatic multiple-needle surgical planning can improve the efficiency and safety of robot-assisted large liver tumor therapy, significantly reduce the surgeon’s workload, and is especially helpful for an inexperienced surgeon. The methodology should be easy to adapt in other body parts. PMID:26982341

The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone.

PubMed

Kumar, Pawan; Sharma, Pawan K; Madsen, Charlotte S; Petersen, Michael; Nielsen, Poul

2013-06-17

Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Templated sequence insertion polymorphisms in the human genome

NASA Astrophysics Data System (ADS)

Onozawa, Masahiro; Aplan, Peter

2016-11-01

Templated Sequence Insertion Polymorphism (TSIP) is a recently described form of polymorphism recognized in the human genome, in which a sequence that is templated from a distant genomic region is inserted into the genome, seemingly at random. TSIPs can be grouped into two classes based on nucleotide sequence features at the insertion junctions; Class 1 TSIPs show features of insertions that are mediated via the LINE-1 ORF2 protein, including 1) target-site duplication (TSD), 2) polyadenylation 10-30 nucleotides downstream of a “cryptic” polyadenylation signal, and 3) preference for insertion at a 5’-TTTT/A-3’ sequence. In contrast, class 2 TSIPs show features consistent with repair of a DNA double-strand break via insertion of a DNA “patch” that is derived from a distant genomic region. Survey of a large number of normal human volunteers demonstrates that most individuals have 25-30 TSIPs, and that these TSIPs track with specific geographic regions. Similar to other forms of human polymorphism, we suspect that these TSIPs may be important for the generation of human diversity and genetic diseases.

Experimental evaluation of neural probe’s insertion induced injury based on digital image correlation method

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Wenguang, E-mail: zhwg@sjtu.edu.cn; Ma, Yakun; Li, Zhengwei

Purpose: The application of neural probes in clinic has been challenged by probes’ short lifetime when implanted into brain tissue. The primary goal is to develop an evaluation system for testing brain tissue injury induced by neural probe’s insertion using microscope based digital image correlation method. Methods: A brain tissue phantom made of silicone rubber with speckle pattern on its surface was fabricated. To obtain the optimal speckle pattern, mean intensity gradient parameter was used for quality assessment. The designed testing system consists of three modules: (a) load module for simulating neural electrode implantation process; (b) data acquisition module tomore » capture micrographs of speckle pattern and to obtain reactive forces during the insertion of the probe; (c) postprocessing module for extracting tissue deformation information from the captured speckle patterns. On the basis of the evaluation system, the effects of probe wedge angle, insertion speed, and probe streamline on insertion induced tissue injury were investigated. Results: The optimal quality speckle pattern can be attained by the following fabrication parameters: spin coating rate—1000 r/min, silicone rubber component A: silicone rubber component B: softener: graphite = 5 ml: 5 ml: 2 ml: 0.6 g. The probe wedge angle has a significant effect on tissue injury. Compared to wedge angle 40° and 20°, maximum principal strain of 60° wedge angle was increased by 40.3% and 87.5%, respectively; compared with a relatively higher speed (500 μm/s), the maximum principle strain within the tissue induced by slow insertion speed (100 μm/s) was increased by 14.3%; insertion force required by probe with convex streamline was smaller than the force of traditional probe. Based on the experimental results, a novel neural probe that has a rounded tip covered by a biodegradable silk protein coating with convex streamline was proposed, which has both lower insertion and micromotion induced tissue injury. Conclusions: The established evaluation system has provided a simulation environment for testing brain tissue injury produced by various insertion conditions. At the same time, it eliminates the adverse effect of biological factors on tissue deformation during the experiment, improving the repeatability of measurement results. As a result, the evaluation system will provide support on novel neural probe design that can reduce the acute tissue injury during the implantation of the probe.« less

Use of a national continuing medical education meeting to provide simulation-based training in temporary hemodialysis catheter insertion skills: a pre-test post-test study.

PubMed

Clark, Edward G; Paparello, James J; Wayne, Diane B; Edwards, Cedric; Hoar, Stephanie; McQuillan, Rory; Schachter, Michael E; Barsuk, Jeffrey H

2014-01-01

Simulation-based-mastery-learning (SBML) is an effective method to train nephrology fellows to competently insert temporary, non-tunneled hemodialysis catheters (NTHCs). Previous studies of SBML for NTHC-insertion have been conducted at a local level. Determine if SBML for NTHC-insertion can be effective when provided at a national continuing medical education (CME) meeting. Describe the correlation of demographic factors, prior experience with NTHC-insertion and procedural self-confidence with simulated performance of the procedure. Pre-test - post-test study. 2014 Canadian Society of Nephrology annual meeting. Nephrology fellows, internal medicine residents and medical students. Participants were surveyed regarding demographics, prior NTHC-insertion experience, procedural self-confidence and attitudes regarding the training they received. NTHC-insertion skills were assessed using a 28-item checklist. Participants underwent a pre-test of their NTHC-insertion skills at the internal jugular site using a realistic patient simulator and ultrasound machine. Participants then had a training session that included a didactic presentation and 2 hours of deliberate practice using the simulator. On the following day, trainees completed a post-test of their NTHC-insertion skills. All participants were required to meet or exceed a minimum passing score (MPS) previously set at 79%. Trainees who did not reach the MPS were required to perform more deliberate practice until the MPS was achieved. Twenty-two individuals participated in SBML training. None met or exceeded the MPS at baseline with a median checklist score of 20 (IQR, 7.25 to 21). Seventeen of 22 participants (77%) completed post-testing and improved their scores to a median of 27 (IQR, 26 to 28; p < 0.001). All met or exceeded the MPS on their first attempt. There were no significant correlations between demographics, prior experience or procedural self-confidence with pre-test performance. Small sample-size and self-selection of participants. Costs could limit the long-term feasibility of providing this type of training at a CME conference. Despite most participants reporting having previously inserted NTHCs in clinical practice, none met the MPS at baseline; this suggests their prior training may have been inadequate.

Readability assessment of package inserts of biological medicinal products from the European medicines agency website.

PubMed

Piñero-López, Ma Ángeles; Modamio, Pilar; Lastra, Cecilia F; Mariño, Eduardo L

2014-07-01

Package inserts that accompany medicines are a common source of information aimed at patients and should match patient abilities in terms of readability. Our objective was to determine the degree of readability of the package inserts for biological medicinal products commercially available in 2007 and compare them with the readability of the same package inserts in 2010. A total of 33 package inserts were selected and classified into five groups according to the type of medicine: monoclonal antibody-based products, cytokines, therapeutic enzymes, recombinant blood factors and other blood-related products, and recombinant hormones. The package inserts were downloaded from the European Medicines Agency website in 2007 and 2010. Readability was evaluated for the entire text of five of the six sections of the package inserts and for the 'Annex' when there was one. Three readability formulas were used: SMOG (Simple Measure of Gobbledygook) grade, Flesh-Kincaid grade level, and Szigriszt's perspicuity index. No significant differences were found between the readability results for the 2007 package inserts and those from 2010 according to any of the three readability indices studied (p>0.05). However, there were significant differences (p<0.05) between the readability scores of the sections of the package inserts in both 2007 and 2010. The readability of the package inserts was above the recommended sixth grade reading level (ages 11-12) and may lead to difficulties of understanding for people with limited literacy. All the sections should be easy to read and, therefore, the readability of the medicine package inserts studied should be improved.

A Predictive Model of Intein Insertion Site for Use in the Engineering of Molecular Switches

PubMed Central

Apgar, James; Ross, Mary; Zuo, Xiao; Dohle, Sarah; Sturtevant, Derek; Shen, Binzhang; de la Vega, Humberto; Lessard, Philip; Lazar, Gabor; Raab, R. Michael

2012-01-01

Inteins are intervening protein domains with self-splicing ability that can be used as molecular switches to control activity of their host protein. Successfully engineering an intein into a host protein requires identifying an insertion site that permits intein insertion and splicing while allowing for proper folding of the mature protein post-splicing. By analyzing sequence and structure based properties of native intein insertion sites we have identified four features that showed significant correlation with the location of the intein insertion sites, and therefore may be useful in predicting insertion sites in other proteins that provide native-like intein function. Three of these properties, the distance to the active site and dimer interface site, the SVM score of the splice site cassette, and the sequence conservation of the site showed statistically significant correlation and strong predictive power, with area under the curve (AUC) values of 0.79, 0.76, and 0.73 respectively, while the distance to secondary structure/loop junction showed significance but with less predictive power (AUC of 0.54). In a case study of 20 insertion sites in the XynB xylanase, two features of native insertion sites showed correlation with the splice sites and demonstrated predictive value in selecting non-native splice sites. Structural modeling of intein insertions at two sites highlighted the role that the insertion site location could play on the ability of the intein to modulate activity of the host protein. These findings can be used to enrich the selection of insertion sites capable of supporting intein splicing and hosting an intein switch. PMID:22649521

Ultrasound-guided three-dimensional needle steering in biological tissue with curved surfaces

PubMed Central

Abayazid, Momen; Moreira, Pedro; Shahriari, Navid; Patil, Sachin; Alterovitz, Ron; Misra, Sarthak

2015-01-01

In this paper, we present a system capable of automatically steering a bevel-tipped flexible needle under ultrasound guidance toward a physical target while avoiding a physical obstacle embedded in gelatin phantoms and biological tissue with curved surfaces. An ultrasound pre-operative scan is performed for three-dimensional (3D) target localization and shape reconstruction. A controller based on implicit force control is developed to align the transducer with curved surfaces to assure the maximum contact area, and thus obtain an image of sufficient quality. We experimentally investigate the effect of needle insertion system parameters such as insertion speed, needle diameter and bevel angle on target motion to adjust the parameters that minimize the target motion during insertion. A fast sampling-based path planner is used to compute and periodically update a feasible path to the target that avoids obstacles. We present experimental results for target reconstruction and needle insertion procedures in gelatin-based phantoms and biological tissue. Mean targeting errors of 1.46 ± 0.37 mm, 1.29 ± 0.29 mm and 1.82 ± 0.58 mm are obtained for phantoms with inclined, curved and combined (inclined and curved) surfaces, respectively, for insertion distance of 86–103 mm. The achieved targeting errors suggest that our approach is sufficient for targeting lesions of 3 mm radius that can be detected using clinical ultrasound imaging systems. PMID:25455165

Functional Studies and Homology Modeling of Msh2-Msh3 Predict that Mispair Recognition Involves DNA Bending and Strand Separation▿ †

PubMed Central

Dowen, Jill M.; Putnam, Christopher D.; Kolodner, Richard D.

2010-01-01

The Msh2-Msh3 heterodimer recognizes various DNA mispairs, including loops of DNA ranging from 1 to 14 nucleotides and some base-base mispairs. Homology modeling of the mispair-binding domain (MBD) of Msh3 using the related Msh6 MBD revealed that mismatch recognition must be different, even though the MBD folds must be similar. Model-based point mutation alleles of Saccharomyces cerevisiae msh3 designed to disrupt mispair recognition fell into two classes. One class caused defects in repair of both small and large insertion/deletion mispairs, whereas the second class caused defects only in the repair of small insertion/deletion mispairs; mutations of the first class also caused defects in the removal of nonhomologous tails present at the ends of double-strand breaks (DSBs) during DSB repair, whereas mutations of the second class did not cause defects in the removal of nonhomologous tails during DSB repair. Thus, recognition of small insertion/deletion mispairs by Msh3 appears to require a greater degree of interactions with the DNA conformations induced by small insertion/deletion mispairs than with those induced by large insertion/deletions that are intrinsically bent and strand separated. Mapping of the two classes of mutations onto the Msh3 MBD model appears to distinguish mispair recognition regions from DNA stabilization regions. PMID:20421420

Functional studies and homology modeling of Msh2-Msh3 predict that mispair recognition involves DNA bending and strand separation.

PubMed

Dowen, Jill M; Putnam, Christopher D; Kolodner, Richard D

2010-07-01

The Msh2-Msh3 heterodimer recognizes various DNA mispairs, including loops of DNA ranging from 1 to 14 nucleotides and some base-base mispairs. Homology modeling of the mispair-binding domain (MBD) of Msh3 using the related Msh6 MBD revealed that mismatch recognition must be different, even though the MBD folds must be similar. Model-based point mutation alleles of Saccharomyces cerevisiae msh3 designed to disrupt mispair recognition fell into two classes. One class caused defects in repair of both small and large insertion/deletion mispairs, whereas the second class caused defects only in the repair of small insertion/deletion mispairs; mutations of the first class also caused defects in the removal of nonhomologous tails present at the ends of double-strand breaks (DSBs) during DSB repair, whereas mutations of the second class did not cause defects in the removal of nonhomologous tails during DSB repair. Thus, recognition of small insertion/deletion mispairs by Msh3 appears to require a greater degree of interactions with the DNA conformations induced by small insertion/deletion mispairs than with those induced by large insertion/deletions that are intrinsically bent and strand separated. Mapping of the two classes of mutations onto the Msh3 MBD model appears to distinguish mispair recognition regions from DNA stabilization regions.