Sample records for base pair oward

  1. Superconductivity could occur Na-supersaturated NaCl

    NASA Astrophysics Data System (ADS)

    Hanaki, Koji

    1997-04-01

    A flow-into electron and a flow-out hole mean flow-into of two unit electric c harges. Even if an exciton consisting of an electron and a hole is a neutral q uasi-particle, overlapping of excitons, namely, the bose condensation changes into a superconductor where half the electric current is due to holes moving t oward the reverse direction. The Meisner effect of the bose condensation comes from the precession of the each exciton under the magnetic field^1. Moreo ver, the present mechanism is supported with that superconducting material alw ays has two kinds of carriers. The superconductivity of NaCl comes from the ab ove-mentioned theory. Free stable holes at first and then electrons are produc ed in NaCl when considerable number of Cl^- lattice vacancies are brought in NaCl mainly because some electrons in the Cl-3p filled band fall into the v acancies. The coexistence of two kinds of stable carriers does not always mean the presence of excitons like VO with electrons not paired and localized in e ach V atom though. While, the absorption spectrum of the NaCl has already conf irmed the presence of excitons; the strength of the spectrum seems to indicate the formation of the bose condensation. Thus we could expect a new supercondu ctor. 1) Hanaki B.Am.P.Soc.,40-1(1995)568

  2. Report on Pairing-based Cryptography.

    PubMed

    Moody, Dustin; Peralta, Rene; Perlner, Ray; Regenscheid, Andrew; Roginsky, Allen; Chen, Lily

    2015-01-01

    This report summarizes study results on pairing-based cryptography. The main purpose of the study is to form NIST's position on standardizing and recommending pairing-based cryptography schemes currently published in research literature and standardized in other standard bodies. The report reviews the mathematical background of pairings. This includes topics such as pairing-friendly elliptic curves and how to compute various pairings. It includes a brief introduction to existing identity-based encryption (IBE) schemes and other cryptographic schemes using pairing technology. The report provides a complete study of the current status of standard activities on pairing-based cryptographic schemes. It explores different application scenarios for pairing-based cryptography schemes. As an important aspect of adopting pairing-based schemes, the report also considers the challenges inherent in validation testing of cryptographic algorithms and modules. Based on the study, the report suggests an approach for including pairing-based cryptography schemes in the NIST cryptographic toolkit. The report also outlines several questions that will require further study if this approach is followed.

  3. Report on Pairing-based Cryptography

    PubMed Central

    Moody, Dustin; Peralta, Rene; Perlner, Ray; Regenscheid, Andrew; Roginsky, Allen; Chen, Lily

    2015-01-01

    This report summarizes study results on pairing-based cryptography. The main purpose of the study is to form NIST’s position on standardizing and recommending pairing-based cryptography schemes currently published in research literature and standardized in other standard bodies. The report reviews the mathematical background of pairings. This includes topics such as pairing-friendly elliptic curves and how to compute various pairings. It includes a brief introduction to existing identity-based encryption (IBE) schemes and other cryptographic schemes using pairing technology. The report provides a complete study of the current status of standard activities on pairing-based cryptographic schemes. It explores different application scenarios for pairing-based cryptography schemes. As an important aspect of adopting pairing-based schemes, the report also considers the challenges inherent in validation testing of cryptographic algorithms and modules. Based on the study, the report suggests an approach for including pairing-based cryptography schemes in the NIST cryptographic toolkit. The report also outlines several questions that will require further study if this approach is followed. PMID:26958435

  4. Widespread Transient Hoogsteen Base-Pairs in Canonical Duplex DNA with Variable Energetics

    PubMed Central

    Alvey, Heidi S.; Gottardo, Federico L.; Nikolova, Evgenia N.; Al-Hashimi, Hashim M.

    2015-01-01

    Hoogsteen base-pairing involves a 180 degree rotation of the purine base relative to Watson-Crick base-pairing within DNA duplexes, creating alternative DNA conformations that can play roles in recognition, damage induction, and replication. Here, using Nuclear Magnetic Resonance R1ρ relaxation dispersion, we show that transient Hoogsteen base-pairs occur across more diverse sequence and positional contexts than previously anticipated. We observe sequence-specific variations in Hoogsteen base-pair energetic stabilities that are comparable to variations in Watson-Crick base-pair stability, with Hoogsteen base-pairs being more abundant for energetically less favorable Watson-Crick base-pairs. Our results suggest that the variations in Hoogsteen stabilities and rates of formation are dominated by variations in Watson-Crick base pair stability, suggesting a late transition state for the Watson-Crick to Hoogsteen conformational switch. The occurrence of sequence and position-dependent Hoogsteen base-pairs provide a new potential mechanism for achieving sequence-dependent DNA transactions. PMID:25185517

  5. Nucleic acid duplexes incorporating a dissociable covalent base pair

    NASA Technical Reports Server (NTRS)

    Gao, K.; Orgel, L. E.; Bada, J. L. (Principal Investigator)

    1999-01-01

    We have used molecular modeling techniques to design a dissociable covalently bonded base pair that can replace a Watson-Crick base pair in a nucleic acid with minimal distortion of the structure of the double helix. We introduced this base pair into a potential precursor of a nucleic acid double helix by chemical synthesis and have demonstrated efficient nonenzymatic template-directed ligation of the free hydroxyl groups of the base pair with appropriate short oligonucleotides. The nonenzymatic ligation reactions, which are characteristic of base paired nucleic acid structures, are abolished when the covalent base pair is reduced and becomes noncoplanar. This suggests that the covalent base pair linking the two strands in the duplex is compatible with a minimally distorted nucleic acid double-helical structure.

  6. High-Resolution Crystal Structure of a Silver(I)-RNA Hybrid Duplex Containing Watson-Crick-like C-Silver(I)-C Metallo-Base Pairs.

    PubMed

    Kondo, Jiro; Tada, Yoshinari; Dairaku, Takenori; Saneyoshi, Hisao; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira

    2015-11-02

    Metallo-base pairs have been extensively studied for applications in nucleic acid-based nanodevices and genetic code expansion. Metallo-base pairs composed of natural nucleobases are attractive because nanodevices containing natural metallo-base pairs can be easily prepared from commercially available sources. Previously, we have reported a crystal structure of a DNA duplex containing T-Hg(II)-T base pairs. Herein, we have determined a high-resolution crystal structure of the second natural metallo-base pair between pyrimidine bases C-Ag(I)-C formed in an RNA duplex. One Ag(I) occupies the center between two cytosines and forms a C-Ag(I)-C base pair through N3-Ag(I)-N3 linear coordination. The C-Ag(I)-C base pair formation does not disturb the standard A-form conformation of RNA. Since the C-Ag(I)-C base pair is structurally similar to the canonical Watson-Crick base pairs, it can be a useful building block for structure-based design and fabrication of nucleic acid-based nanodevices. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. The nearest neighbor and next nearest neighbor effects on the thermodynamic and kinetic properties of RNA base pair

    NASA Astrophysics Data System (ADS)

    Wang, Yujie; Wang, Zhen; Wang, Yanli; Liu, Taigang; Zhang, Wenbing

    2018-01-01

    The thermodynamic and kinetic parameters of an RNA base pair with different nearest and next nearest neighbors were obtained through long-time molecular dynamics simulation of the opening-closing switch process of the base pair near its melting temperature. The results indicate that thermodynamic parameters of GC base pair are dependent on the nearest neighbor base pair, and the next nearest neighbor base pair has little effect, which validated the nearest-neighbor model. The closing and opening rates of the GC base pair also showed nearest neighbor dependences. At certain temperature, the closing and opening rates of the GC pair with nearest neighbor AU is larger than that with the nearest neighbor GC, and the next nearest neighbor plays little role. The free energy landscape of the GC base pair with the nearest neighbor GC is rougher than that with nearest neighbor AU.

  8. [Structural and Dipole Structure Peculiarities of Hoogsteen Base Pairs Formed in Complementary Nucleobases according to ab initio Quantum Mechanics Studies].

    PubMed

    Petrenko, Y M

    2015-01-01

    Ab initio quantum mechanics studies for the detection of structure and dipole structure peculiarities of Hoogsteen base pairs relative to Watson-Crick base pairs, were performed during our work. These base pairs are formed as a result of complementary interactions. It was revealed, that adenine-thymine Hoogsteen base pair and adenine-thymine Watson-Crick base pairs can be formed depending on initial configuration. Cytosine-guanine Hoogsteen pairs are formed only when cytosine was originally protonated. Both types of Hoogsteen pairs have noticeable difference in the bond distances and angles. These differences appeared in purine as well as in pyrimidine parts of the pairs. Hoogsteen pairs have mostly shorter hydrogen bond lengths and significantly larger angles of hydrogen bonds and larger angles between the hydrogen bonds than Watson-Crick base pairs. Notable differences are also observed with respect to charge distribution and dipole moment. Quantitative data on these differences are shown in our work. It is also reported that the values of local parameters (according to Cambridge classification of the parameters which determine DNA properties) in Hoogsteen base pairs, are greatly different from Watson-Crick ones.

  9. Nucleic acid duplexes incorporating a dissociable covalent base pair

    PubMed Central

    Gao, Kui; Orgel, Leslie E.

    1999-01-01

    We have used molecular modeling techniques to design a dissociable covalently bonded base pair that can replace a Watson-Crick base pair in a nucleic acid with minimal distortion of the structure of the double helix. We introduced this base pair into a potential precursor of a nucleic acid double helix by chemical synthesis and have demonstrated efficient nonenzymatic template-directed ligation of the free hydroxyl groups of the base pair with appropriate short oligonucleotides. The nonenzymatic ligation reactions, which are characteristic of base paired nucleic acid structures, are abolished when the covalent base pair is reduced and becomes noncoplanar. This suggests that the covalent base pair linking the two strands in the duplex is compatible with a minimally distorted nucleic acid double-helical structure. PMID:10611299

  10. Molecular recognition of DNA base pairs by the formamido/pyrrole and formamido/imidazole pairings in stacked polyamides.

    PubMed

    Buchmueller, Karen L; Staples, Andrew M; Uthe, Peter B; Howard, Cameron M; Pacheco, Kimberly A O; Cox, Kari K; Henry, James A; Bailey, Suzanna L; Horick, Sarah M; Nguyen, Binh; Wilson, W David; Lee, Moses

    2005-01-01

    Polyamides containing an N-terminal formamido (f) group bind to the minor groove of DNA as staggered, antiparallel dimers in a sequence-specific manner. The formamido group increases the affinity and binding site size, and it promotes the molecules to stack in a staggered fashion thereby pairing itself with either a pyrrole (Py) or an imidazole (Im). There has not been a systematic study on the DNA recognition properties of the f/Py and f/Im terminal pairings. These pairings were analyzed here in the context of f-ImPyPy, f-ImPyIm, f-PyPyPy and f-PyPyIm, which contain the central pairing modes, -ImPy- and -PyPy-. The specificity of these triamides towards symmetrical recognition sites allowed for the f/Py and f/Im terminal pairings to be directly compared by SPR, CD and DeltaT (M) experiments. The f/Py pairing, when placed next to the -ImPy- or -PyPy- central pairings, prefers A/T and T/A base pairs to G/C base pairs, suggesting that f/Py has similar DNA recognition specificity to Py/Py. With -ImPy- central pairings, f/Im prefers C/G base pairs (>10 times) to the other Watson-Crick base pairs; therefore, f/Im behaves like the Py/Im pair. However, the f/Im pairing is not selective for the C/G base pair when placed next to the -PyPy- central pairings.

  11. Unique Thermal Stability of Unnatural Hydrophobic Ds Bases in Double-Stranded DNAs.

    PubMed

    Kimoto, Michiko; Hirao, Ichiro

    2017-10-20

    Genetic alphabet expansion technology, the introduction of unnatural bases or base pairs into replicable DNA, has rapidly advanced as a new synthetic biology area. A hydrophobic unnatural base pair between 7-(2-thienyl)imidazo[4,5-b]pyridine (Ds) and 2-nitro-4-propynylpyrrole (Px) exhibited high fidelity as a third base pair in PCR. SELEX methods using the Ds-Px pair enabled high-affinity DNA aptamer generation, and introducing a few Ds bases into DNA aptamers extremely augmented their affinities and selectivities to target proteins. Here, to further scrutinize the functions of this highly hydrophobic Ds base, the thermal stabilities of double-stranded DNAs (dsDNA) containing a noncognate Ds-Ds or G-Ds pair were examined. The thermal stability of the Ds-Ds self-pair was as high as that of the natural G-C pair, and apart from the generally higher stability of the G-C pair than that of the A-T pair, most of the 5'-pyrimidine-Ds-purine-3' sequences, such as CDsA and TDsA, exhibited higher stability than the 5'-purine-Ds-pyrimidine-3' sequences, such as GDsC and ADsC, in dsDNAs. This trait enabled the GC-content-independent control of the thermal stability of the designed dsDNA fragments. The melting temperatures of dsDNA fragments containing the Ds-Ds pair can be predicted from the nearest-neighbor parameters including the Ds base. In addition, the noncognate G-Ds pair can efficiently distinguish its neighboring cognate natural base pairs from noncognate pairs. We demonstrated that real-time PCR using primers containing Ds accurately detected a single-nucleotide mismatch in target DNAs. These unique properties of the Ds base that affect the stabilities of the neighboring base pairs could impart new functions to DNA molecules and technologies.

  12. Molecular recognition of DNA base pairs by the formamido/pyrrole and formamido/imidazole pairings in stacked polyamides

    PubMed Central

    Buchmueller, Karen L.; Staples, Andrew M.; Uthe, Peter B.; Howard, Cameron M.; Pacheco, Kimberly A. O.; Cox, Kari K.; Henry, James A.; Bailey, Suzanna L.; Horick, Sarah M.; Nguyen, Binh; Wilson, W. David; Lee, Moses

    2005-01-01

    Polyamides containing an N-terminal formamido (f) group bind to the minor groove of DNA as staggered, antiparallel dimers in a sequence-specific manner. The formamido group increases the affinity and binding site size, and it promotes the molecules to stack in a staggered fashion thereby pairing itself with either a pyrrole (Py) or an imidazole (Im). There has not been a systematic study on the DNA recognition properties of the f/Py and f/Im terminal pairings. These pairings were analyzed here in the context of f-ImPyPy, f-ImPyIm, f-PyPyPy and f-PyPyIm, which contain the central pairing modes, –ImPy– and –PyPy–. The specificity of these triamides towards symmetrical recognition sites allowed for the f/Py and f/Im terminal pairings to be directly compared by SPR, CD and ΔTM experiments. The f/Py pairing, when placed next to the –ImPy– or –PyPy– central pairings, prefers A/T and T/A base pairs to G/C base pairs, suggesting that f/Py has similar DNA recognition specificity to Py/Py. With –ImPy– central pairings, f/Im prefers C/G base pairs (>10 times) to the other Watson–Crick base pairs; therefore, f/Im behaves like the Py/Im pair. However, the f/Im pairing is not selective for the C/G base pair when placed next to the –PyPy– central pairings. PMID:15703305

  13. Base-Pairing Energies of Protonated Nucleoside Base Pairs of dCyd and m5dCyd: Implications for the Stability of DNA i-Motif Conformations

    NASA Astrophysics Data System (ADS)

    Yang, Bo; Rodgers, M. T.

    2015-08-01

    Hypermethylation of cytosine in expanded (CCG)n•(CGG)n trinucleotide repeats results in Fragile X syndrome, the most common cause of inherited mental retardation. The (CCG)n•(CGG)n repeats adopt i-motif conformations that are preferentially stabilized by base-pairing interactions of protonated base pairs of cytosine. Here we investigate the effects of 5-methylation and the sugar moiety on the base-pairing energies (BPEs) of protonated cytosine base pairs by examining protonated nucleoside base pairs of 2'-deoxycytidine (dCyd) and 5-methyl-2'-deoxycytidine (m5dCyd) using threshold collision-induced dissociation techniques. 5-Methylation of a single or both cytosine residues leads to very small change in the BPE. However, the accumulated effect may be dramatic in diseased state trinucleotide repeats where many methylated base pairs may be present. The BPEs of the protonated nucleoside base pairs examined here significantly exceed those of Watson-Crick dGuo•dCyd and neutral dCyd•dCyd base pairs, such that these base-pairing interactions provide the major forces responsible for stabilization of DNA i-motif conformations. Compared with isolated protonated nucleobase pairs of cytosine and 1-methylcytosine, the 2'-deoxyribose sugar produces an effect similar to the 1-methyl substituent, and leads to a slight decrease in the BPE. These results suggest that the base-pairing interactions may be slightly weaker in nucleic acids, but that the extended backbone is likely to exert a relatively small effect on the total BPE. The proton affinity (PA) of m5dCyd is also determined by competitive analysis of the primary dissociation pathways that occur in parallel for the protonated (m5dCyd)H+(dCyd) nucleoside base pair and the absolute PA of dCyd previously reported.

  14. Metal-mediated DNA base pairing: alternatives to hydrogen-bonded Watson-Crick base pairs.

    PubMed

    Takezawa, Yusuke; Shionoya, Mitsuhiko

    2012-12-18

    With its capacity to store and transfer the genetic information within a sequence of monomers, DNA forms its central role in chemical evolution through replication and amplification. This elegant behavior is largely based on highly specific molecular recognition between nucleobases through the specific hydrogen bonds in the Watson-Crick base pairing system. While the native base pairs have been amazingly sophisticated through the long history of evolution, synthetic chemists have devoted considerable efforts to create alternative base pairing systems in recent decades. Most of these new systems were designed based on the shape complementarity of the pairs or the rearrangement of hydrogen-bonding patterns. We wondered whether metal coordination could serve as an alternative driving force for DNA base pairing and why hydrogen bonding was selected on Earth in the course of molecular evolution. Therefore, we envisioned an alternative design strategy: we replaced hydrogen bonding with another important scheme in biological systems, metal-coordination bonding. In this Account, we provide an overview of the chemistry of metal-mediated base pairing including basic concepts, molecular design, characteristic structures and properties, and possible applications of DNA-based molecular systems. We describe several examples of artificial metal-mediated base pairs, such as Cu(2+)-mediated hydroxypyridone base pair, H-Cu(2+)-H (where H denotes a hydroxypyridone-bearing nucleoside), developed by us and other researchers. To design the metallo-base pairs we carefully chose appropriate combinations of ligand-bearing nucleosides and metal ions. As expected from their stronger bonding through metal coordination, DNA duplexes possessing metallo-base pairs exhibited higher thermal stability than natural hydrogen-bonded DNAs. Furthermore, we could also use metal-mediated base pairs to construct or induce other high-order structures. These features could lead to metal-responsive functional DNA molecules such as artificial DNAzymes and DNA machines. In addition, the metallo-base pairing system is a powerful tool for the construction of homogeneous and heterogeneous metal arrays, which can lead to DNA-based nanomaterials such as electronic wires and magnetic devices. Recently researchers have investigated these systems as enzyme replacements, which may offer an additional contribution to chemical biology and synthetic biology through the expansion of the genetic alphabet.

  15. Theoretical determination of one-electron redox potentials for DNA bases, base pairs, and stacks.

    PubMed

    Paukku, Y; Hill, G

    2011-05-12

    Electron affinities, ionization potentials, and redox potentials for DNA bases, base pairs, and N-methylated derivatives are computed at the DFT/M06-2X/6-31++G(d,p) level of theory. Redox properties of a guanine-guanine stack model are explored as well. Reduction and oxidation potentials are in good agreement with the experimental ones. Electron affinities of base pairs were found to be negative. Methylation of canonical bases affects the ionization potentials the most. Base pair formation and base stacking lower ionization potentials by 0.3 eV. Pairing of guanine with the 5-methylcytosine does not seem to influence the redox properties of this base pair much.

  16. Base pairing and base mis-pairing in nucleic acids

    NASA Technical Reports Server (NTRS)

    Wang, A. H. J.; Rich, A.

    1986-01-01

    In recent years we have learned that DNA is conformationally active. It can exist in a number of different stable conformations including both right-handed and left-handed forms. Using single crystal X-ray diffraction analysis we are able to discover not only additional conformations of the nucleic acids but also different types of hydrogen bonded base-base interactions. Although Watson-Crick base pairings are the predominant type of interaction in double helical DNA, they are not the only types. Recently, we have been able to examine mismatching of guanine-thymine base pairs in left-handed Z-DNA at atomic resolution (1A). A minimum amount of distortion of the sugar phosphate backbone is found in the G x T pairing in which the bases are held together by two hydrogen bonds in the wobble pairing interaction. Because of the high resolution of the analysis we can visualize water molecules which fill in to accommodate the other hydrogen bonding positions in the bases which are not used in the base-base interactions. Studies on other DNA oligomers have revealed that other types of non-Watson-Crick hydrogen bonding interactions can occur. In the structure of a DNA octamer with the sequence d(GCGTACGC) complexed to an antibiotic triostin A, it was found that the two central AT base pairs are held together by Hoogsteen rather than Watson-Crick base pairs. Similarly, the G x C base pairs at the ends are also Hoogsteen rather than Watson-Crick pairing. Hoogsteen base pairs make a modified helix which is distinct from the Watson-Crick double helix.

  17. Hidden in Plain Sight: Subtle Effects of the 8-Oxoguanine Lesion on the Structure, Dynamics, and Thermodynamics of a 15-Base-Pair Oligodeoxynucleotide Duplex†

    PubMed Central

    Crenshaw, Charisse M.; Wade, Jacqueline E.; Arthanari, Haribabu; Frueh, Dominique; Lane, Benjamin F.; Núñez, Megan E.

    2011-01-01

    The base lesion 8-oxoguanine is formed readily by oxidation of DNA, potentially leading to G→T transversion mutations. Despite the apparent similarity of 8-oxoguanine-cytosine base pairs to normal guanine-cytosine base pairs, cellular base excision repair systems effectively recognize the lesion base. Here we apply several techniques to examine a single 8-oxoguanine lesion at the center of a nonpalindromic 15-mer duplex oligonucleotide in an effort to determine what, if anything, distinguishes an 8-oxoguanine-cytosine base pair from a normal base pair. The lesion duplex is globally almost indistinguishable from the unmodified parent duplex using CD spectroscopy and UV melting thermodynamics. The DNA mismatch-detecting photocleavage agent Rh(bpy)2chrysi3+ cleaves only weakly and nonspecifically, revealing that the 8oxoG-C pair is locally stable at the level of the individual base pairs. NMR spectra are also consistent with a well-conserved B-form duplex structure. In the 2D NOESY spectra, base-sugar and imino-imino crosspeaks are strikingly similar between parent and lesion duplexes. Changes in chemical shift due to the 8oxoG lesion are localized to its complementary cytosine and to the 2–3 base pairs immediately flanking the lesion on the lesion strand. Residues further removed from the lesion are shown to be unperturbed by its presence. Notably, imino exchange experiments indicate that the 8-oxoguanine-cytosine pair is strong and stable, with an apparent equilibrium constant for opening equal to that of other internal guanine-cytosine base pairs, on the order of 10−6. This collection of experiments shows that the 8-oxoguanine-cytosine base pair is incredibly stable and similar to the native pair. PMID:21902242

  18. Structural landscape of base pairs containing post-transcriptional modifications in RNA

    PubMed Central

    Seelam, Preethi P.; Sharma, Purshotam

    2017-01-01

    Base pairs involving post-transcriptionally modified nucleobases are believed to play important roles in a wide variety of functional RNAs. Here we present our attempts toward understanding the structural and functional role of naturally occurring modified base pairs using a combination of X-ray crystal structure database analysis, sequence analysis, and advanced quantum chemical methods. Our bioinformatics analysis reveals that despite their presence in all major secondary structural elements, modified base pairs are most prevalent in tRNA crystal structures and most commonly involve guanine or uridine modifications. Further, analysis of tRNA sequences reveals additional examples of modified base pairs at structurally conserved tRNA regions and highlights the conservation patterns of these base pairs in three domains of life. Comparison of structures and binding energies of modified base pairs with their unmodified counterparts, using quantum chemical methods, allowed us to classify the base modifications in terms of the nature of their electronic structure effects on base-pairing. Analysis of specific structural contexts of modified base pairs in RNA crystal structures revealed several interesting scenarios, including those at the tRNA:rRNA interface, antibiotic-binding sites on the ribosome, and the three-way junctions within tRNA. These scenarios, when analyzed in the context of available experimental data, allowed us to correlate the occurrence and strength of modified base pairs with their specific functional roles. Overall, our study highlights the structural importance of modified base pairs in RNA and points toward the need for greater appreciation of the role of modified bases and their interactions, in the context of many biological processes involving RNA. PMID:28341704

  19. Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides.

    PubMed

    Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu

    2004-03-01

    A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non-Watson-Crick base pair in SECIS element plays an important role in the selenocysteine expression by UGA codon.

  20. Introducing a model of pairing based on base pair specific interactions between identical DNA sequences

    NASA Astrophysics Data System (ADS)

    (O' Lee, Dominic J.

    2018-02-01

    At present, there have been suggested two types of physical mechanism that may facilitate preferential pairing between DNA molecules, with identical or similar base pair texts, without separation of base pairs. One mechanism solely relies on base pair specific patterns of helix distortion being the same on the two molecules, discussed extensively in the past. The other mechanism proposes that there are preferential interactions between base pairs of the same composition. We introduce a model, built on this second mechanism, where both thermal stretching and twisting fluctuations are included, as well as the base pair specific helix distortions. Firstly, we consider an approximation for weak pairing interactions, or short molecules. This yields a dependence of the energy on the square root of the molecular length, which could explain recent experimental data. However, analysis suggests that this approximation is no longer valid at large DNA lengths. In a second approximation, for long molecules, we define two adaptation lengths for twisting and stretching, over which the pairing interaction can limit the accumulation of helix disorder. When the pairing interaction is sufficiently strong, both adaptation lengths are finite; however, as we reduce pairing strength, the stretching adaptation length remains finite but the torsional one becomes infinite. This second state persists to arbitrarily weak values of the pairing strength; suggesting that, if the molecules are long enough, the pairing energy scales as length. To probe differences between the two pairing mechanisms, we also construct a model of similar form. However, now, pairing between identical sequences solely relies on the intrinsic helix distortion patterns. Between the two models, we see interesting qualitative differences. We discuss our findings, and suggest new work to distinguish between the two mechanisms.

  1. pKa shifting in double-stranded RNA is highly dependent upon nearest neighbors and bulge positioning.

    PubMed

    Wilcox, Jennifer L; Bevilacqua, Philip C

    2013-10-22

    Shifting of pKa's in RNA is important for many biological processes; however, the driving forces responsible for shifting are not well understood. Herein, we determine how structural environments surrounding protonated bases affect pKa shifting in double-stranded RNA (dsRNA). Using (31)P NMR, we determined the pKa of the adenine in an A(+)·C base pair in various sequence and structural environments. We found a significant dependence of pKa on the base pairing strength of nearest neighbors and the location of a nearby bulge. Increasing nearest neighbor base pairing strength shifted the pKa of the adenine in an A(+)·C base pair higher by an additional 1.6 pKa units, from 6.5 to 8.1, which is well above neutrality. The addition of a bulge two base pairs away from a protonated A(+)·C base pair shifted the pKa by only ~0.5 units less than a perfectly base paired hairpin; however, positioning the bulge just one base pair away from the A(+)·C base pair prohibited formation of the protonated base pair as well as several flanking base pairs. Comparison of data collected at 25 °C and 100 mM KCl to biological temperature and Mg(2+) concentration revealed only slight pKa changes, suggesting that similar sequence contexts in biological systems have the potential to be protonated at biological pH. We present a general model to aid in the determination of the roles protonated bases may play in various dsRNA-mediated processes including ADAR editing, miRNA processing, programmed ribosomal frameshifting, and general acid-base catalysis in ribozymes.

  2. Database of non-canonical base pairs found in known RNA structures

    NASA Technical Reports Server (NTRS)

    Nagaswamy, U.; Voss, N.; Zhang, Z.; Fox, G. E.

    2000-01-01

    Atomic resolution RNA structures are being published at an increasing rate. It is common to find a modest number of non-canonical base pairs in these structures in addition to the usual Watson-Crick pairs. This database summarizes the occurrence of these rare base pairs in accordance with standard nomenclature. The database, http://prion.bchs.uh.edu/, contains information such as sequence context, sugar pucker conformation, anti / syn base conformations, chemical shift, p K (a)values, melting temperature and free energy. Of the 29 anticipated pairs with two or more hydrogen bonds, 20 have been encountered to date. In addition, four unexpected pairs with two hydrogen bonds have been reported bringing the total to 24. Single hydrogen bond versions of five of the expected geometries have been encountered among the single hydrogen bond interactions. In addition, 18 different types of base triplets have been encountered, each of which involves three to six hydrogen bonds. The vast majority of the rare base pairs are antiparallel with the bases in the anti configuration relative to the ribose. The most common are the GU wobble, the Sheared GA pair, the Reverse Hoogsteen pair and the GA imino pair.

  3. Base pair probability estimates improve the prediction accuracy of RNA non-canonical base pairs

    PubMed Central

    2017-01-01

    Prediction of RNA tertiary structure from sequence is an important problem, but generating accurate structure models for even short sequences remains difficult. Predictions of RNA tertiary structure tend to be least accurate in loop regions, where non-canonical pairs are important for determining the details of structure. Non-canonical pairs can be predicted using a knowledge-based model of structure that scores nucleotide cyclic motifs, or NCMs. In this work, a partition function algorithm is introduced that allows the estimation of base pairing probabilities for both canonical and non-canonical interactions. Pairs that are predicted to be probable are more likely to be found in the true structure than pairs of lower probability. Pair probability estimates can be further improved by predicting the structure conserved across multiple homologous sequences using the TurboFold algorithm. These pairing probabilities, used in concert with prior knowledge of the canonical secondary structure, allow accurate inference of non-canonical pairs, an important step towards accurate prediction of the full tertiary structure. Software to predict non-canonical base pairs and pairing probabilities is now provided as part of the RNAstructure software package. PMID:29107980

  4. DNA base dimers are stabilized by hydrogen-bonding interactions including non-Watson-Crick pairing near graphite surfaces.

    PubMed

    Shankar, Akshaya; Jagota, Anand; Mittal, Jeetain

    2012-10-11

    Single- and double-stranded DNA are increasingly being paired with surfaces and nanoparticles for numerous applications, such as sensing, imaging, and drug delivery. Unlike the majority of DNA structures in bulk that are stabilized by canonical Watson-Crick pairing between Ade-Thy and Gua-Cyt, those adsorbed on surfaces are often stabilized by noncanonical base pairing, quartet formation, and base-surface stacking. Not much is known about these kinds of interactions. To build an understanding of the role of non-Watson-Crick pairing on DNA behavior near surfaces, one requires basic information on DNA base pair stacking and hydrogen-bonding interactions. All-atom molecular simulations of DNA bases in two cases--in bulk water and strongly adsorbed on a graphite surface--are conducted to study the relative strengths of stacking and hydrogen bond interactions for each of the 10 possible combinations of base pairs. The key information obtained from these simulations is the free energy as a function of distance between two bases in a pair. We find that stacking interactions exert the dominant influence on the stability of DNA base pairs in bulk water as expected. The strength of stability for these stacking interactions is found to decrease in the order Gua-Gua > Ade-Gua > Ade-Ade > Gua-Thy > Gua-Cyt > Ade-Thy > Ade-Cyt > Thy-Thy > Cyt-Thy > Cyt-Cyt. On the other hand, mutual interactions of surface-adsorbed base pairs are stabilized mostly by hydrogen-bonding interactions in the order Gua-Cyt > Ade-Gua > Ade-Thy > Ade-Ade > Cyt-Thy > Gua-Gua > Cyt-Cyt > Ade-Cyt > Thy-Thy > Gua-Thy. Interestingly, several non-Watson-Crick base pairings, which are commonly ignored, have similar stabilization free energies due to interbase hydrogen bonding as Watson-Crick pairs. This clearly highlights the importance of non-Watson-Crick base pairing in the development of secondary structures of oligonucleotides near surfaces.

  5. Rotational-translational fourier imaging system

    NASA Technical Reports Server (NTRS)

    Campbell, Jonathan W. (Inventor)

    2004-01-01

    This invention has the ability to create Fourier-based images with only two grid pairs. The two grid pairs are manipulated in a manner that allows (1) a first grid pair to provide multiple real components of the Fourier-based image and (2) a second grid pair to provide multiple imaginary components of the Fourier-based image. The novelty of this invention resides in the use of only two grid pairs to provide the same imaging information that has been traditionally collected with multiple grid pairs.

  6. Thermodynamic stability of Hoogsteen and Watson-Crick base pairs in the presence of histone H3-mimicking peptide.

    PubMed

    Pramanik, Smritimoy; Nakamura, Kaori; Usui, Kenji; Nakano, Shu-ichi; Saxena, Sarika; Matsui, Jun; Miyoshi, Daisuke; Sugimoto, Naoki

    2011-03-14

    We found that Hoogsteen base pairs were stabilized by molecular crowding and a histone H3-mimicking peptide, which was not observed for Watson-Crick base pairs. Our findings demonstrate that the type of DNA base pair is critical for the interaction between DNA and histones.

  7. Efficient Implementation of the Pairing on Mobilephones Using BREW

    NASA Astrophysics Data System (ADS)

    Yoshitomi, Motoi; Takagi, Tsuyoshi; Kiyomoto, Shinsaku; Tanaka, Toshiaki

    Pairing based cryptosystems can accomplish novel security applications such as ID-based cryptosystems, which have not been constructed efficiently without the pairing. The processing speed of the pairing based cryptosystems is relatively slow compared with the other conventional public key cryptosystems. However, several efficient algorithms for computing the pairing have been proposed, namely Duursma-Lee algorithm and its variant ηT pairing. In this paper, we present an efficient implementation of the pairing over some mobilephones. Moreover, we compare the processing speed of the pairing with that of the other standard public key cryptosystems, i. e. RSA cryptosystem and elliptic curve cryptosystem. Indeed the processing speed of our implementation in ARM9 processors on BREW achieves under 100 milliseconds using the supersingular curve over F397. In addition, the pairing is more efficient than the other public key cryptosystems, and the pairing can be achieved enough also on BREW mobilephones. It has become efficient enough to implement security applications, such as short signature, ID-based cryptosystems or broadcast encryption, using the pairing on BREW mobilephones.

  8. An ensemble of SVM classifiers based on gene pairs.

    PubMed

    Tong, Muchenxuan; Liu, Kun-Hong; Xu, Chungui; Ju, Wenbin

    2013-07-01

    In this paper, a genetic algorithm (GA) based ensemble support vector machine (SVM) classifier built on gene pairs (GA-ESP) is proposed. The SVMs (base classifiers of the ensemble system) are trained on different informative gene pairs. These gene pairs are selected by the top scoring pair (TSP) criterion. Each of these pairs projects the original microarray expression onto a 2-D space. Extensive permutation of gene pairs may reveal more useful information and potentially lead to an ensemble classifier with satisfactory accuracy and interpretability. GA is further applied to select an optimized combination of base classifiers. The effectiveness of the GA-ESP classifier is evaluated on both binary-class and multi-class datasets. Copyright © 2013 Elsevier Ltd. All rights reserved.

  9. Envisaging quantum transport phenomenon in a muddled base pair of DNA

    NASA Astrophysics Data System (ADS)

    Vohra, Rajan; Sawhney, Ravinder Singh

    2018-05-01

    The effect of muddled base pair on electron transfer through a deoxyribonucleic acid (DNA) molecule connected to the gold electrodes has been elucidated using tight binding model. The effect of hydrogen and nitrogen bonds on the resistance of the base pair has been minutely observed. Using the semiempirical extended Huckel approach within NEGF regime, we have determined the current and conductance vs. bias voltage for disordered base pairs of DNA made of thymine (T) and adenine (A). The asymmetrical behaviour amid five times depreciation in the current characteristics has been observed for deviated Au-AT base pair-Au devices. An interesting revelation is that the conductance of the intrinsic AT base pair configuration attains dramatically high values with the symmetrical zig-zag pattern of current, which clearly indicates the transformation of the bond length within the strands of base pair when compared with other samples. A thorough investigation of the transmission coefficients T( E) and HOMO-LUMO gap reveals the misalignment of the strands in base pairs of DNA. The observed results present an insight to extend this work to build biosensing devices to predict the abnormality with the DNA.

  10. Higher order structural effects stabilizing the reverse Watson–Crick Guanine-Cytosine base pair in functional RNAs

    PubMed Central

    Chawla, Mohit; Abdel-Azeim, Safwat; Oliva, Romina; Cavallo, Luigi

    2014-01-01

    The G:C reverse Watson–Crick (W:W trans) base pair, also known as Levitt base pair in the context of tRNAs, is a structurally and functionally important base pair that contributes to tertiary interactions joining distant domains in functional RNA molecules and also participates in metabolite binding in riboswitches. We previously indicated that the isolated G:C W:W trans base pair is a rather unstable geometry, and that dicationic metal binding to the Guanine base or posttranscriptional modification of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G:C trans base pairs. Interestingly, 66% of the G:C trans base pairs in the PDB are engaged in additional H-bonding interactions with other bases, the RNA backbone or structured water molecules. High level quantum mechanical calculations on a data set of representative crystal structures were performed to shed light on the structural stability and energetics of the various crystallographic motifs. This analysis was extended to the binding of the preQ1 metabolite to a preQ1-II riboswitch. PMID:24121683

  11. Bifacial Base-Pairing Behaviors of 5-Hydroxyuracil DNA Bases through Hydrogen Bonding and Metal Coordination.

    PubMed

    Takezawa, Yusuke; Nishiyama, Kotaro; Mashima, Tsukasa; Katahira, Masato; Shionoya, Mitsuhiko

    2015-10-12

    A novel bifacial ligand-bearing nucleobase, 5-hydroxyuracil (U(OH) ), which forms both a hydrogen-bonded base pair (U(OH) -A) and a metal-mediated base pair (U(OH) -M-U(OH) ) has been developed. The U(OH) -M-U(OH) base pairs were quantitatively formed in the presence of lanthanide ions such as Gd(III) when U(OH) -U(OH) pairs were consecutively incorporated into DNA duplexes. This result established metal-assisted duplex stabilization as well as DNA-templated assembly of lanthanide ions. Notably, a duplex possessing U(OH) -A base pairs was destabilized by addition of Gd(III) ions. This observation suggests that the hybridization behaviors of the U(OH) -containing DNA strands are altered by metal complexation. Thus, the U(OH) nucleobase with a bifacial base-pairing property holds great promise as a component for metal-responsive DNA materials. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Molecular switching behavior in isosteric DNA base pairs.

    PubMed

    Jissy, A K; Konar, Sukanya; Datta, Ayan

    2013-04-15

    The structures and proton-coupled behavior of adenine-thymine (A-T) and a modified base pair containing a thymine isostere, adenine-difluorotoluene (A-F), are studied in different solvents by dispersion-corrected density functional theory. The stability of the canonical Watson-Crick base pair and the mismatched pair in various solvents with low and high dielectric constants is analyzed. It is demonstrated that A-F base pairing is favored in solvents with low dielectric constant. The stabilization and conformational changes induced by protonation are also analyzed for the natural as well as the mismatched base pair. DNA sequences capable of changing their sequence conformation on protonation are used in the construction of pH-based molecular switches. An acidic medium has a profound influence in stabilizing the isostere base pair. Such a large gain in stability on protonation leads to an interesting pH-controlled molecular switch, which can be incorporated in a natural DNA tract. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. 1,8-Naphthyridine-2,7-diamine: a potential universal reader of Watson-Crick base pairs for DNA sequencing by electron tunneling.

    PubMed

    Liang, Feng; Lindsay, Stuart; Zhang, Peiming

    2012-11-21

    With the aid of Density Functional Theory (DFT), we designed 1,8-naphthyridine-2,7-diamine as a recognition molecule to read DNA base pairs for genomic sequencing by electron tunneling. NMR studies show that it can form stable triplets with both A : T and G : C base pairs through hydrogen bonding. Our results suggest that the naphthyridine molecule should be able to function as a universal base pair reader in a tunneling gap, generating distinguishable signatures under electrical bias for each of DNA base pairs.

  14. 1,8-Naphthyridine-2,7-diamine: A Potential Universal Reader of the Watson-Crick Base Pairs for DNA Sequencing by Electron Tunneling

    PubMed Central

    Liang, Feng; Lindsay, Stuart; Zhang, Peiming

    2013-01-01

    With the aid of Density Functional Theory (DFT), we designed 1,8-naphthyridine-2,7-diamine as a recognition molecule to read the DNA base pairs for genomic sequencing by electron tunneling. NMR studies show that it can form stable triplets with both A:T and G:C base pairs through hydrogen bonding. Our results suggest that the naphthyridine molecule should be able to function as a universal base pair reader in a tunneling gap, generating distinguishable signatures under electrical bias for each of DNA base pairs. PMID:23038027

  15. The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone.

    PubMed

    Kumar, Pawan; Sharma, Pawan K; Madsen, Charlotte S; Petersen, Michael; Nielsen, Poul

    2013-06-17

    Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Comparison of clinical knowledge bases for summarization of electronic health records.

    PubMed

    McCoy, Allison B; Sittig, Dean F; Wright, Adam

    2013-01-01

    Automated summarization tools that create condition-specific displays may improve clinician efficiency. These tools require new kinds of knowledge that is difficult to obtain. We compared five problem-medication pair knowledge bases generated using four previously described knowledge base development approaches. The number of pairs in the resulting mapped knowledge bases varied widely due to differing mapping techniques from the source terminologies, ranging from 2,873 to 63,977,738 pairs. The number of overlapping pairs across knowledge bases was low, with one knowledge base having half of the pairs overlapping with another knowledge base, and most having less than a third overlapping. Further research is necessary to better evaluate the knowledge bases independently in additional settings, and to identify methods to integrate the knowledge bases.

  17. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Okutsu, N.; Shimamura, K.; Shimizu, E.

    To elucidate the effect of radicals on DNA base pairs, we investigated the attacking mechanism of OH and H radicals to the G-C and A-T base pairs, using the density functional theory (DFT) calculations in water approximated by the continuum solvation model. The DFT calculations revealed that the OH radical abstracts the hydrogen atom of a NH{sub 2} group of G or A base and induces a tautomeric reaction for an A-T base pair more significantly than for a G-C base pair. On the other hand, the H radical prefers to bind to the Cytosine NH{sub 2} group of G-Cmore » base pair and induce a tautomeric reaction from G-C to G*-C*, whose activation free energy is considerably small (−0.1 kcal/mol) in comparison with that (42.9 kcal/mol) for the reaction of an A-T base pair. Accordingly, our DFT calculations elucidated that OH and H radicals have a significant effect on A-T and G-C base pairs, respectively. This finding will be useful for predicting the effect of radiation on the genetic information recorded in the base sequences of DNA duplexes.« less

  18. Recognition of Watson-Crick base pairs: constraints and limits due to geometric selection and tautomerism

    PubMed Central

    Yusupov, Marat; Yusupova, Gulnara

    2014-01-01

    The natural bases of nucleic acids have a strong preference for one tautomer form, guaranteeing fidelity in their hydrogen bonding potential. However, base pairs observed in recent crystal structures of polymerases and ribosomes are best explained by an alternative base tautomer, leading to the formation of base pairs with Watson-Crick-like geometries. These observations set limits to geometric selection in molecular recognition of complementary Watson-Crick pairs for fidelity in replication and translation processes. PMID:24765524

  19. Structure based alignment and clustering of proteins (STRALCP)

    DOEpatents

    Zemla, Adam T.; Zhou, Carol E.; Smith, Jason R.; Lam, Marisa W.

    2013-06-18

    Disclosed are computational methods of clustering a set of protein structures based on local and pair-wise global similarity values. Pair-wise local and global similarity values are generated based on pair-wise structural alignments for each protein in the set of protein structures. Initially, the protein structures are clustered based on pair-wise local similarity values. The protein structures are then clustered based on pair-wise global similarity values. For each given cluster both a representative structure and spans of conserved residues are identified. The representative protein structure is used to assign newly-solved protein structures to a group. The spans are used to characterize conservation and assign a "structural footprint" to the cluster.

  20. Sequence dependency of canonical base pair opening in the DNA double helix

    PubMed Central

    Villa, Alessandra

    2017-01-01

    The flipping-out of a DNA base from the double helical structure is a key step of many cellular processes, such as DNA replication, modification and repair. Base pair opening is the first step of base flipping and the exact mechanism is still not well understood. We investigate sequence effects on base pair opening using extensive classical molecular dynamics simulations targeting the opening of 11 different canonical base pairs in two DNA sequences. Two popular biomolecular force fields are applied. To enhance sampling and calculate free energies, we bias the simulation along a simple distance coordinate using a newly developed adaptive sampling algorithm. The simulation is guided back and forth along the coordinate, allowing for multiple opening pathways. We compare the calculated free energies with those from an NMR study and check assumptions of the model used for interpreting the NMR data. Our results further show that the neighboring sequence is an important factor for the opening free energy, but also indicates that other sequence effects may play a role. All base pairs are observed to have a propensity for opening toward the major groove. The preferred opening base is cytosine for GC base pairs, while for AT there is sequence dependent competition between the two bases. For AT opening, we identify two non-canonical base pair interactions contributing to a local minimum in the free energy profile. For both AT and CG we observe long-lived interactions with water and with sodium ions at specific sites on the open base pair. PMID:28369121

  1. Theoretical study on the binding mechanism between N6-methyladenine and natural DNA bases.

    PubMed

    Song, Qi-Xia; Ding, Zhen-Dong; Liu, Jian-Hua; Li, Yan; Wang, Hai-Jun

    2013-03-01

    N6-methyladenine (m(6)A) is a rare base naturally occurring in DNA. It is different from the base adenine due to its N-CH(3). Therefore, the base not only pairs with thymine, but also with other DNA bases (cytosine, adenine and guanine). In this work, Møller-Plesset second-order (MP2) method has been used to investigate the binding mechanism between m(6)A and natural DNA bases in gas phase and in aqueous solution. The results show that N-CH(3) changed the way of N6-methyladenine binding to natural DNA bases. The binding style significantly influences the stability of base pairs. The trans-m(6)A:G and trans-m(6)A:C conformers are the most stable among all the base pairs. The existence of solvent can remarkably reduce the stability of the base pairs, and the DNA bases prefer pairing with trans-m(6)A to cis-m(6)A. Besides, the properties of these hydrogen bonds have been analyzed by atom in molecules (AIM) theory, natural bond orbital (NBO) analysis and Wiberg bond indexes (WBI). In addition, pairing with m(6)A decreases the binding energies compared to the normal Watson-Crick base pairs, it may explain the instability of the N6 site methylated DNA in theory.

  2. Validation of a Crowdsourcing Methodology for Developing a Knowledge Base of Related Problem-Medication Pairs.

    PubMed

    McCoy, A B; Wright, A; Krousel-Wood, M; Thomas, E J; McCoy, J A; Sittig, D F

    2015-01-01

    Clinical knowledge bases of problem-medication pairs are necessary for many informatics solutions that improve patient safety, such as clinical summarization. However, developing these knowledge bases can be challenging. We sought to validate a previously developed crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large, non-university health care system with a widely used, commercially available electronic health record. We first retrieved medications and problems entered in the electronic health record by clinicians during routine care during a six month study period. Following the previously published approach, we calculated the link frequency and link ratio for each pair then identified a threshold cutoff for estimated problem-medication pair appropriateness through clinician review; problem-medication pairs meeting the threshold were included in the resulting knowledge base. We selected 50 medications and their gold standard indications to compare the resulting knowledge base to the pilot knowledge base developed previously and determine its recall and precision. The resulting knowledge base contained 26,912 pairs, had a recall of 62.3% and a precision of 87.5%, and outperformed the pilot knowledge base containing 11,167 pairs from the previous study, which had a recall of 46.9% and a precision of 83.3%. We validated the crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large non-university health care system with a widely used, commercially available electronic health record, indicating that the approach may be generalizable across healthcare settings and clinical systems. Further research is necessary to better evaluate the knowledge, to compare crowdsourcing with other approaches, and to evaluate if incorporating the knowledge into electronic health records improves patient outcomes.

  3. Validation of a Crowdsourcing Methodology for Developing a Knowledge Base of Related Problem-Medication Pairs

    PubMed Central

    Wright, A.; Krousel-Wood, M.; Thomas, E. J.; McCoy, J. A.; Sittig, D. F.

    2015-01-01

    Summary Background Clinical knowledge bases of problem-medication pairs are necessary for many informatics solutions that improve patient safety, such as clinical summarization. However, developing these knowledge bases can be challenging. Objective We sought to validate a previously developed crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large, non-university health care system with a widely used, commercially available electronic health record. Methods We first retrieved medications and problems entered in the electronic health record by clinicians during routine care during a six month study period. Following the previously published approach, we calculated the link frequency and link ratio for each pair then identified a threshold cutoff for estimated problem-medication pair appropriateness through clinician review; problem-medication pairs meeting the threshold were included in the resulting knowledge base. We selected 50 medications and their gold standard indications to compare the resulting knowledge base to the pilot knowledge base developed previously and determine its recall and precision. Results The resulting knowledge base contained 26,912 pairs, had a recall of 62.3% and a precision of 87.5%, and outperformed the pilot knowledge base containing 11,167 pairs from the previous study, which had a recall of 46.9% and a precision of 83.3%. Conclusions We validated the crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large non-university health care system with a widely used, commercially available electronic health record, indicating that the approach may be generalizable across healthcare settings and clinical systems. Further research is necessary to better evaluate the knowledge, to compare crowdsourcing with other approaches, and to evaluate if incorporating the knowledge into electronic health records improves patient outcomes. PMID:26171079

  4. Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide-protein complexes.

    PubMed

    Kondo, Jiro; Westhof, Eric

    2011-10-01

    Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide-protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson-Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson-Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues.

  5. Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide–protein complexes

    PubMed Central

    Kondo, Jiro; Westhof, Eric

    2011-01-01

    Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide–protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson–Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson–Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues. PMID:21737431

  6. Closing loop base pairs in RNA loop-loop complexes: structural behavior, interaction energy and solvation analysis through molecular dynamics simulations.

    PubMed

    Golebiowski, Jérôme; Antonczak, Serge; Fernandez-Carmona, Juan; Condom, Roger; Cabrol-Bass, Daniel

    2004-12-01

    Nanosecond molecular dynamics using the Ewald summation method have been performed to elucidate the structural and energetic role of the closing base pair in loop-loop RNA duplexes neutralized by Mg2+ counterions in aqueous phases. Mismatches GA, CU and Watson-Crick GC base pairs have been considered for closing the loop of an RNA in complementary interaction with HIV-1 TAR. The simulations reveal that the mismatch GA base, mediated by a water molecule, leads to a complex that presents the best compromise between flexibility and energetic contributions. The mismatch CU base pair, in spite of the presence of an inserted water molecule, is too short to achieve a tight interaction at the closing-loop junction and seems to force TAR to reorganize upon binding. An energetic analysis has allowed us to quantify the strength of the interactions of the closing and the loop-loop pairs throughout the simulations. Although the water-mediated GA closing base pair presents an interaction energy similar to that found on fully geometry-optimized structure, the water-mediated CU closing base pair energy interaction reaches less than half the optimal value.

  7. [Under what conditions does G.C Watson-Crick DNA base pair acquire all four configurations characteristic for A.T Watson-Crick DNA base pair?].

    PubMed

    Brovarets', O O

    2013-01-01

    At the MP2/6-311++G(2df,pd)//B3LYP/6-311++G(d,p) level of theory it was established for the first time, that the Löwdin's G*.C* DNA base pair formed by the mutagenic tautomers can acquire, as the A-T Watson-Crick DNA base pair, four biologically important configurations, namely: Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen. This fact demonstrates rather unexpected role of the tautomerisation of the one of the Watson-Crick DNA base pairs, in particular, via double proton transfer: exactly the G.C-->G*.C* tautomerisation allows to overcome steric hindrances for the implementation of the above mentioned configurations. Geometric, electron-topological and energetic properties of the H-bonds that stabilise the studied pairs, as well as the energetic characteristics of the latters are presented.

  8. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Leszczynski, Jerzy; Sponer, Judit; Sponer, Jiri

    Recent experimental studies on the Watson Crick type base pairing of triazine and aminopyrimidine derivatives suggest that acid/base properties of the constituent bases might be related to the duplex stabilities measured in solution. Herein we use high-level quantum chemical calculations and molecular dynamics simulations to evaluate the base pairing and stacking interactions of seven selected base pairs, which are common in that they are stabilized by two NH O hydrogen bonds separated by one NH N hydrogen bond. We show that neither the base pairing nor the base stacking interaction energies correlate with the reported pKa data of the basesmore » and the melting points of the duplexes. This suggests that the experimentally observed correlation between the melting point data of the duplexes and the pKa values of the constituent bases is not rooted in the intrinsic base pairing and stacking properties. The physical chemistry origin of the observed experimental correlation thus remains unexplained and requires further investigations. In addition, since our calculations are carried out with extrapolation to the complete basis set of atomic orbitals and with inclusion of higher electron correlation effects, they provide reference data for stacking and base pairing energies of non-natural bases.« less

  9. Thermal transport in topological-insulator-based superconducting hybrid structures with mixed singlet and triplet pairing states.

    PubMed

    Li, Hai; Zhao, Yuan Yuan

    2017-11-22

    In the framework of the Bogoliubov-de Gennes equation, we investigate the thermal transport properties in topological-insulator-based superconducting hybrid structures with mixed spin-singlet and spin-triplet pairing states, and emphasize the different manifestations of the spin-singlet and spin-triplet pairing states in the thermal transport signatures. It is revealed that the temperature-dependent differential thermal conductance strongly depends on the components of the pairing state, and the negative differential thermal conductance only occurs in the spin-singlet pairing state dominated regime. It is also found that the thermal conductance is profoundly sensitive to the components of the pairing state. In the spin-singlet pairing state controlled regime, the thermal conductance obviously oscillates with the phase difference and junction length. With increasing the proportion of the spin-triplet pairing state, the oscillating characteristic of the thermal conductance fades out distinctly. These results suggest an alternative route for distinguishing the components of pairing states in topological-insulator-based superconducting hybrid structures.

  10. Genetic and DNA sequence analysis of the kanamycin resistance transposon Tn903.

    PubMed Central

    Grindley, N D; Joyce, C M

    1980-01-01

    The kanamycin resistance transposon Tn903 consists of a unique region of about 1000 base pairs bounded by a pair of 1050-base-pair inverted repeat sequences. Each repeat contains two Pvu II endonuclease cleavage sites separated by 520 base pairs. We have constructed derivatives of Tn903 in which this 520-base-pair fragment is deleted from one or both repeats. Those derivatives that lack both 520-base-pair fragments cannot transpose, whereas those that lack just one remain transposition proficient. One such transposable derivative, Tn903 delta I, has been selected for further study. We have determined the sequence of the intact inverted repeat. The 18 base pairs at each end are identical and inverted relative to one another, a structure characteristic of insertion sequences. Additional experiments indicate that a single inverted repeat from Tn903 can, in fact, transpose; we propose that this element be called IS903. To correlate the DNA sequence with genetic activities, we have created mutations by inserting a 10-base-pair DNA fragment at several sites within the intact repeat of Tn903 delta 1, and we have examined the effect of such insertions on transposability. The results suggest that IS903 encodes a 307-amino-acid polypeptide (a "transposase") that is absolutely required for transposition of IS903 or Tn903. Images PMID:6261245

  11. Silver(I)-Mediated Base Pairs in DNA Sequences Containing 7-Deazaguanine/Cytosine: towards DNA with Entirely Metallated Watson-Crick Base Pairs.

    PubMed

    Méndez-Arriaga, José M; Maldonado, Carmen R; Dobado, José A; Galindo, Miguel A

    2018-03-26

    DNA sequences comprising noncanonical 7-deazaguanine ( 7C G) and canonical cytosine (C) are capable of forming Watson-Crick base pairs via hydrogen bonds as well as silver(I)-mediated base pairs by coordination to central silver(I) ions. Duplexes I and II containing 7C G and C have been synthesized and characterized. The incorporation of silver(I) ions into these duplexes has been studied by means of temperature-dependent UV spectroscopy, circular dichroism, and DFT calculations. The results suggest the formation of DNA molecules comprising contiguous metallated 7C G-Ag I -C Watson-Crick base pairs that preserve the original B-type conformation. Furthermore, additional studies performed on duplex III indicated that, in the presence of Ag I ions, 7C G-C and 7C A-T Watson-Crick base pairs ( 7C A, 7-deazadenine; T, thymine) can be converted to metallated 7C G-Ag I -C and 7C A-Ag I -T base pairs inside the same DNA molecule whilst maintaining its initial double helix conformation. These findings are very important for the development of customized silver-DNA nanostructures based on a Watson-Crick complementarity pattern. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Comparable stability of Hoogsteen and Watson-Crick base pairs in ionic liquid choline dihydrogen phosphate.

    PubMed

    Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

    2014-01-08

    The instability of Hoogsteen base pairs relative to Watson-Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson-Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson-Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo.

  13. Comparable Stability of Hoogsteen and Watson–Crick Base Pairs in Ionic Liquid Choline Dihydrogen Phosphate

    PubMed Central

    Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

    2014-01-01

    The instability of Hoogsteen base pairs relative to Watson–Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson–Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson–Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo. PMID:24399194

  14. m1A and m1G Potently Disrupt A-RNA Structure Due to the Intrinsic Instability of Hoogsteen Base Pairs

    PubMed Central

    Zhou, Huiqing; Kimsey, Isaac J.; Nikolova, Evgenia N.; Sathyamoorthy, Bharathwaj; Grazioli, Gianmarc; McSally, James; Bai, Tianyu; Wunderlich, Christoph H.; Kreutz, Christoph; Andricioaei, Ioan; Al-Hashimi, Hashim M.

    2016-01-01

    The B-DNA double helix can dynamically accommodate G–C and A–T base pairs in either Watson-Crick or Hoogsteen configurations. Here, we show that G–C+ and A–U Hoogsteen base pairs are strongly disfavored in A-RNA. As a result, N1-methyl adenosine and N1-methyl guanosine, which occur in DNA as a form of alkylation damage, and in RNA as a posttranscriptional modification, have dramatically different consequences. They create G–C+ and A–U Hoogsteen base pairs in duplex DNA that maintain the structural integrity of the double helix, but block base pairing all together and induce local duplex melting in RNA, providing a mechanism for potently disrupting RNA structure through posttranscriptional modifications. The markedly different propensities to form Hoogsteen base pairs in B-DNA and A-RNA may help meet the opposing requirements of maintaining genome stability on one hand, and dynamically modulating the structure of the epitranscriptome on the other. PMID:27478929

  15. Base Pair Opening in a Deoxynucleotide Duplex Containing a cis-syn Thymine Cyclobutane Dimer Lesion

    PubMed Central

    Wenke, Belinda B.; Huiting, Leah N.; Frankel, Elisa B.; Lane, Benjamin F.; Núñez, Megan E.

    2014-01-01

    The cis-syn thymine cyclobutane dimer is a DNA photoproduct implicated in skin cancer. We compared the stability of individual base pairs in thymine dimer-containing duplexes to undamaged parent 10-mer duplexes. UV melting thermodynamic measurements, CD spectroscopy, and 2D NOESY NMR spectroscopy confirm that the thymine dimer lesion is locally and moderately destabilizing within an overall B-form duplex conformation. We measured the rates of exchange of individual imino protons by NMR using magnetization transfer from water and determined the equilibrium constant for the opening of each base pair Kop. In the normal duplex Kop decreases from the frayed ends of the duplex toward the center, such that the central TA pair is the most stable with a Kop of 8×10−7. In contrast, base pair opening at the 5’T of the thymine dimer is facile. The 5’T of the dimer has the largest equilibrium constant (Kop =3×10−4) in its duplex, considerably larger than even the frayed penultimate base pairs. Notably, base pairing by the 3’T of the dimer is much more stable than by the 5’T, indicating that the predominant opening mechanism for the thymine dimer lesion is not likely to be flipping out into solution as a single unit. The dimer asymmetrically affects the stability of the duplex in its vicinity, destabilizing base pairing on its 5’ side more than on the 3’ side. The striking differences in base pair opening between parent and dimer duplexes occur independently of the duplex-single strand melting transitions. PMID:24328089

  16. Imidazopyridine/Pyrrole and hydroxybenzimidazole/pyrrole pairs for DNA minor groove recognition.

    PubMed

    Renneberg, Dorte; Dervan, Peter B

    2003-05-14

    The DNA binding properties of fused heterocycles imidazo[4,5-b]pyridine (Ip) and hydroxybenzimidazole (Hz) paired with pyrrole (Py) in eight-ring hairpin polyamides are reported. The recognition profile of Ip/Py and Hz/Py pairs were compared to the five-membered ring pairs Im/Py and Hp/Py on a DNA restriction fragment at four 6-base pair recognition sites which vary at a single position 5'-TGTNTA-3', where N = G, C, T, A. The Ip/Py pair distinguishes G.C from C.G, T.A, and A.T, and the Hz/Py pair distinguishes T.A from A.T, G.C, and C.G, affording a new set of heterocycle pairs to target the four Watson-Crick base pairs in the minor groove of DNA.

  17. Stacking interactions and DNA intercalation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, Dr. Shen; Cooper, Valentino R; Thonhauser, Prof. Timo

    2009-01-01

    The relationship between stacking interactions and the intercalation of proflavine and ellipticine within DNA is investigated using a nonempirical van der Waals density functional for the correlation energy. Our results, employing a binary stack model, highlight fundamental, qualitative differences between base-pair base-pair interactions and that of the stacked intercalator base pair system. Most notable result is the paucity of torque which so distinctively defines the Twist of DNA. Surprisingly, this model, when combined with a constraint on the twist of the surrounding base-pair steps to match the observed unwinding of the sugar-phosphate backbone, was sufficient for explaining the experimentally observedmore » proflavine intercalator configuration. Our extensive mapping of the potential energy surface of base-pair intercalator interactions can provide valuable information for future nonempirical studies of DNA intercalation dynamics.« less

  18. Development and evaluation of a crowdsourcing methodology for knowledge base construction: identifying relationships between clinical problems and medications

    PubMed Central

    Wright, Adam; Laxmisan, Archana; Ottosen, Madelene J; McCoy, Jacob A; Butten, David; Sittig, Dean F

    2012-01-01

    Objective We describe a novel, crowdsourcing method for generating a knowledge base of problem–medication pairs that takes advantage of manually asserted links between medications and problems. Methods Through iterative review, we developed metrics to estimate the appropriateness of manually entered problem–medication links for inclusion in a knowledge base that can be used to infer previously unasserted links between problems and medications. Results Clinicians manually linked 231 223 medications (55.30% of prescribed medications) to problems within the electronic health record, generating 41 203 distinct problem–medication pairs, although not all were accurate. We developed methods to evaluate the accuracy of the pairs, and after limiting the pairs to those meeting an estimated 95% appropriateness threshold, 11 166 pairs remained. The pairs in the knowledge base accounted for 183 127 total links asserted (76.47% of all links). Retrospective application of the knowledge base linked 68 316 medications not previously linked by a clinician to an indicated problem (36.53% of unlinked medications). Expert review of the combined knowledge base, including inferred and manually linked problem–medication pairs, found a sensitivity of 65.8% and a specificity of 97.9%. Conclusion Crowdsourcing is an effective, inexpensive method for generating a knowledge base of problem–medication pairs that is automatically mapped to local terminologies, up-to-date, and reflective of local prescribing practices and trends. PMID:22582202

  19. Acuity of a Cryptochrome and Vision-Based Magnetoreception System in Birds

    PubMed Central

    Solov'yov, Ilia A.; Mouritsen, Henrik; Schulten, Klaus

    2010-01-01

    Abstract The magnetic compass of birds is embedded in the visual system and it has been hypothesized that the primary sensory mechanism is based on a radical pair reaction. Previous models of magnetoreception have assumed that the radical pair-forming molecules are rigidly fixed in space, and this assumption has been a major objection to the suggested hypothesis. In this article, we investigate theoretically how much disorder is permitted for the radical pair-forming, protein-based magnetic compass in the eye to remain functional. Our study shows that only one rotational degree of freedom of the radical pair-forming protein needs to be partially constrained, while the other two rotational degrees of freedom do not impact the magnetoreceptive properties of the protein. The result implies that any membrane-associated protein is sufficiently restricted in its motion to function as a radical pair-based magnetoreceptor. We relate our theoretical findings to the cryptochromes, currently considered the likeliest candidate to furnish radical pair-based magnetoreception. PMID:20655831

  20. A structural determinant in the uracil DNA glycosylase superfamily for the removal of uracil from adenine/uracil base pairs

    PubMed Central

    Lee, Dong-Hoon; Liu, Yinling; Lee, Hyun-Wook; Xia, Bo; Brice, Allyn R.; Park, Sung-Hyun; Balduf, Hunter; Dominy, Brian N.; Cao, Weiguo

    2015-01-01

    The uracil DNA glycosylase superfamily consists of several distinct families. Family 2 mismatch-specific uracil DNA glycosylase (MUG) from Escherichia coli is known to exhibit glycosylase activity on three mismatched base pairs, T/U, G/U and C/U. Family 1 uracil N-glycosylase (UNG) from E. coli is an extremely efficient enzyme that can remove uracil from any uracil-containing base pairs including the A/U base pair. Here, we report the identification of an important structural determinant that underlies the functional difference between MUG and UNG. Substitution of a Lys residue at position 68 with Asn in MUG not only accelerates the removal of uracil from mismatched base pairs but also enables the enzyme to gain catalytic activity on A/U base pairs. Binding and kinetic analysis demonstrate that the MUG-K68N substitution results in enhanced ground state binding and transition state interactions. Molecular modeling reveals that MUG-K68N, UNG-N123 and family 5 Thermus thermophiles UDGb-A111N can form bidentate hydrogen bonds with the N3 and O4 moieties of the uracil base. Genetic analysis indicates the gain of function for A/U base pairs allows the MUG-K68N mutant to remove uracil incorporated into the genome during DNA replication. The implications of this study in the origin of life are discussed. PMID:25550433

  1. Structural features of the DNA hairpin d(ATCCTA-GTTA-TAGGAT): formation of a G-A base pair in the loop.

    PubMed Central

    van Dongen, M J; Mooren, M M; Willems, E F; van der Marel, G A; van Boom, J H; Wijmenga, S S; Hilbers, C W

    1997-01-01

    The three-dimensional structure of the hairpin formed by d(ATCCTA-GTTA-TAGGAT) has been determined by means of two-dimensional NMR studies, distance geometry and molecular dynamics calculations. The first and the last residues of the tetraloop of this hairpin form a sheared G-A base pair on top of the six Watson-Crick base pairs in the stem. The glycosidic torsion angles of the guanine and adenine residues in the G-A base pair reside in the anti and high- anti domain ( approximately -60 degrees ) respectively. Several dihedral angles in the loop adopt non-standard values to accommodate this base pair. The first and second residue in the loop are stacked in a more or less normal helical fashion; the fourth loop residue also stacks upon the stem, while the third residue is directed away from the loop region. The loop structure can be classified as a so-called type-I loop, in which the bases at the 5'-end of the loop stack in a continuous fashion. In this situation, loop stability is unlikely to depend heavily on the nature of the unpaired bases in the loop. Moreover, the present study indicates that the influence of the polarity of a closing A.T pair is much less significant than that of a closing C.G base pair. PMID:9092659

  2. Hydration of Watson-Crick base pairs and dehydration of Hoogsteen base pairs inducing structural polymorphism under molecular crowding conditions.

    PubMed

    Miyoshi, Daisuke; Nakamura, Kaori; Tateishi-Karimata, Hisae; Ohmichi, Tatsuo; Sugimoto, Naoki

    2009-03-18

    It has been revealed recently that molecular crowding, which is one of the largest differences between in vivo and in vitro conditions, is a critical factor determining the structure, stability, and function of nucleic acids. However, the effects of molecular crowding on Watson-Crick and Hoogsteen base pairs remain unclear. In order to investigate directly and quantitatively the molecular crowding effects on base pair types in nucleic acids, we designed intramolecular parallel- and antiparallel-stranded DNA duplexes consisting of Hoogsteen and Watson-Crick base pairs, respectively, as well as an intramolecular parallel-stranded triplex containing both types of base pairs. Thermodynamic analyses demonstrated that the values of free energy change at 25 degrees C for Hoogsteen base-pair formations decreased from +1.45 +/- 0.15 to +1.09 +/- 0.13 kcal mol(-1), and from -1.89 +/- 0.13 to -2.71 +/- 0.11 kcal mol(-1) in the intramolecular duplex and triplex, respectively, when the concentration of PEG 200 (polyethylene glycol with average molecular weight 200) increased from 0 to 20 wt %. However, corresponding values for Watson-Crick formation in the duplex and triplex increased from -10.2 +/- 0.2 to -8.7 +/- 0.1 kcal mol(-1), and from -10.8 +/- 0.2 to -9.2 +/- 0.2 kcal mol(-1), respectively. Furthermore, it was revealed that the opposing effects of molecular crowding on the Hoogsteen and Watson-Crick base pairs were due to different behaviors of water molecules binding to the DNA strands.

  3. Theory of nodal s ±-wave pairing symmetry in the Pu-based 115 superconductor family

    DOE PAGES

    Das, Tanmoy; Zhu, Jian -Xin; Graf, Matthias J.

    2015-02-27

    The spin-fluctuation mechanism of superconductivity usually results in the presence of gapless or nodal quasiparticle states in the excitation spectrum. Nodal quasiparticle states are well established in copper-oxide, and heavy-fermion superconductors, but not in iron-based superconductors. Here, we study the pairing symmetry and mechanism of a new class of plutonium-based high-T c superconductors and predict the presence of a nodal s⁺⁻ wave pairing symmetry in this family. Starting from a density-functional theory (DFT) based electronic structure calculation we predict several three-dimensional (3D) Fermi surfaces in this 115 superconductor family. We identify the dominant Fermi surface “hot-spots” in the inter-band scatteringmore » channel, which are aligned along the wavevector Q = (π, π, π), where degeneracy could induce sign-reversal of the pairing symmetry. Our calculation demonstrates that the s⁺⁻ wave pairing strength is stronger than the previously thought d-wave pairing; and more importantly, this pairing state allows for the existence of nodal quasiparticles. Finally, we predict the shape of the momentum- and energy-dependent magnetic resonance spectrum for the identification of this pairing symmetry.« less

  4. Growth properties associated with A-U replacement of specific G-C base pairs in 16S rRNA from Escherichia coli.

    PubMed Central

    Triman, K L

    1995-01-01

    Mutations that disrupt each of seven specific G-C base pairs in 16S rRNA from Escherichia coli confer loss of expression of a plasmid-encoded 16S rRNA selectable marker (spectinomycin resistance). However, A-U replacement of G-C base pairs at nucleotides 359/52 or 1292/1245 in 16S rRNA permits normal expression of the marker. By contrast, A-U replacements at 146/176, 153/168, 350/339, or 1293/1244 are associated with loss of expression of the marker. These genetic studies are designed to determine the importance of specific base pairs by assessment of the structural and functional impairments of 16S rRNA molecules resulting from expression of base pair substitutions at these positions. PMID:7543481

  5. Experimental demonstration of wavelength domain rogue-free ONU based on wavelength-pairing for TDM/WDM optical access networks.

    PubMed

    Lee, Jie Hyun; Park, Heuk; Kang, Sae-Kyoung; Lee, Joon Ki; Chung, Hwan Seok

    2015-11-30

    In this study, we propose and experimentally demonstrate a wavelength domain rogue-free ONU based on wavelength-pairing of downstream and upstream signals for time/wavelength division-multiplexed optical access networks. The wavelength-pairing tunable filter is aligned to the upstream wavelength channel by aligning it to one of the downstream wavelength channels. Wavelength-pairing is implemented with a compact and cyclic Si-AWG integrated with a Ge-PD. The pairing filter covered four 100 GHz-spaced wavelength channels. The feasibility of the wavelength domain rogue-free operation is investigated by emulating malfunction of the misaligned laser. The wavelength-pairing tunable filter based on the Si-AWG blocks the upstream signal in the non-assigned wavelength channel before data collision with other ONUs.

  6. Orbital selective pairing and gap structures of iron-based superconductors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kreisel, Andreas; Andersen, Brian M.; Sprau, P. O.

    We discuss the in uence on spin-fluctuation pairing theory of orbital selective strong correlation effects in Fe-based superconductors, particularly Fe chalcogenide systems. We propose that a key ingredient for an improved itinerant pairing theory is orbital selectivity, i.e., incorporating the reduced coherence of quasiparticles occupying specific orbital states. This modifies the usual spin-fluctuation via suppression of pair scattering processes involving those less coherent states and results in orbital selective Cooper pairing of electrons in the remaining states. We show that this paradigm yields remarkably good agreement with the experimentally observed anisotropic gap structures in both bulk and monolayer FeSe, asmore » well as LiFeAs, indicating that orbital selective Cooper pairing plays a key role in the more strongly correlated iron-based superconductors.« less

  7. Orbital selective pairing and gap structures of iron-based superconductors

    DOE PAGES

    Kreisel, Andreas; Andersen, Brian M.; Sprau, P. O.; ...

    2017-05-08

    We discuss the in uence on spin-fluctuation pairing theory of orbital selective strong correlation effects in Fe-based superconductors, particularly Fe chalcogenide systems. We propose that a key ingredient for an improved itinerant pairing theory is orbital selectivity, i.e., incorporating the reduced coherence of quasiparticles occupying specific orbital states. This modifies the usual spin-fluctuation via suppression of pair scattering processes involving those less coherent states and results in orbital selective Cooper pairing of electrons in the remaining states. We show that this paradigm yields remarkably good agreement with the experimentally observed anisotropic gap structures in both bulk and monolayer FeSe, asmore » well as LiFeAs, indicating that orbital selective Cooper pairing plays a key role in the more strongly correlated iron-based superconductors.« less

  8. Acid-induced exchange of the imino proton in G.C pairs.

    PubMed Central

    Nonin, S; Leroy, J L; Gueron, M

    1996-01-01

    Acid-induced catalysis of imino proton exchange in G.C pairs of DNA duplexes is surprisingly fast, being nearly as fast as for the isolated nucleoside, despite base-pair dissociation constants in the range of 10(-5) at neutral or basic pH. It is also observed in terminal G.C pairs of duplexes and in base pairs of drug-DNA complexes. We have measured imino proton exchange in deoxyguanosine and in the duplex (ATATAGATCTATAT) as a function of pH. We show that acid-induced exchange can be assigned to proton transfer from N7-protonated guanosine to cytidine in the open state of the pair. This is faster than transfer from neutral guanosine (the process of intrinsic catalysis previously characterized at neutral ph) due to the lower imino proton pK of the protonated form, 7.2 instead of 9.4. Other interpretations are excluded by a study of exchange catalysis by formiate and cytidine as exchange catalysts. The cross-over pH between the regimes of pH-independent and acid-induced exchange rates is more basic in the case of base pairs than in the mononucleoside, suggestive of an increase by one to two decades in the dissociation constant of the base pair upon N7 protonation of G. Acid-induced catalysis is much weaker in A.T base pairs, as expected in view of the low pK for protonation of thymidine. PMID:8604298

  9. Acid-induced exchange of the imino proton in G.C pairs.

    PubMed

    Nonin, S; Leroy, J L; Gueron, M

    1996-02-15

    Acid-induced catalysis of imino proton exchange in G.C pairs of DNA duplexes is surprisingly fast, being nearly as fast as for the isolated nucleoside, despite base-pair dissociation constants in the range of 10(-5) at neutral or basic pH. It is also observed in terminal G.C pairs of duplexes and in base pairs of drug-DNA complexes. We have measured imino proton exchange in deoxyguanosine and in the duplex (ATATAGATCTATAT) as a function of pH. We show that acid-induced exchange can be assigned to proton transfer from N7-protonated guanosine to cytidine in the open state of the pair. This is faster than transfer from neutral guanosine (the process of intrinsic catalysis previously characterized at neutral ph) due to the lower imino proton pK of the protonated form, 7.2 instead of 9.4. Other interpretations are excluded by a study of exchange catalysis by formiate and cytidine as exchange catalysts. The cross-over pH between the regimes of pH-independent and acid-induced exchange rates is more basic in the case of base pairs than in the mononucleoside, suggestive of an increase by one to two decades in the dissociation constant of the base pair upon N7 protonation of G. Acid-induced catalysis is much weaker in A.T base pairs, as expected in view of the low pK for protonation of thymidine.

  10. Developing Topological Insulator Fiber Based Photon Pairs Source for Ultrafast Optoelectronic Applications

    DTIC Science & Technology

    2016-04-01

    DEVELOPING TOPOLOGICAL INSULATOR FIBER BASED PHOTON PAIRS SOURCE FOR ULTRAFAST OPTOELECTRONIC APPLICATIONS NORTHWESTERN UNIVERSITY...REPORT TYPE FINAL TECHNICAL REPORT 3. DATES COVERED (From - To) APRIL 2015 – DEC 2015 4. TITLE AND SUBTITLE DEVELOPING TOPOLOGICAL INSULATOR FIBER BASED...in developing a new source for the production of correlated/entangled photon pairs based on the unique nanolayer properties of topological insulator

  11. Base pairing among three cis-acting sequences contributes to template switching during hepadnavirus reverse transcription.

    PubMed

    Liu, Ning; Tian, Ru; Loeb, Daniel D

    2003-02-18

    Synthesis of the relaxed-circular (RC) DNA genome of hepadnaviruses requires two template switches during plus-strand DNA synthesis: primer translocation and circularization. Although primer translocation and circularization use different donor and acceptor sequences, and are distinct temporally, they share the common theme of switching from one end of the minus-strand template to the other end. Studies of duck hepatitis B virus have indicated that, in addition to the donor and acceptor sequences, three other cis-acting sequences, named 3E, M, and 5E, are required for the synthesis of RC DNA by contributing to primer translocation and circularization. The mechanism by which 3E, M, and 5E act was not known. We present evidence that these sequences function by base pairing with each other within the minus-strand template. 3E base-pairs with one portion of M (M3) and 5E base-pairs with an adjacent portion of M (M5). We found that disrupting base pairing between 3E and M3 and between 5E and M5 inhibited primer translocation and circularization. More importantly, restoring base pairing with mutant sequences restored the production of RC DNA. These results are consistent with the model that, within duck hepatitis B virus capsids, the ends of the minus-strand template are juxtaposed via base pairing to facilitate the two template switches during plus-strand DNA synthesis.

  12. Loss of G-A base pairs is insufficient for achieving a large opening of U4 snRNA K-turn motif.

    PubMed

    Cojocaru, Vlad; Klement, Reinhard; Jovin, Thomas M

    2005-01-01

    Upon binding to the 15.5K protein, two tandem-sheared G-A base pairs are formed in the internal loop of the kink-turn motif of U4 snRNA (Kt-U4). We have reported that the folding of Kt-U4 is assisted by protein binding. Unstable interactions that contribute to a large opening of the free RNA ('k-e motion') were identified using locally enhanced sampling molecular dynamics simulations, results that agree with experiments. A detailed analysis of the simulations reveals that the k-e motion in Kt-U4 is triggered both by loss of G-A base pairs in the internal loop and backbone flexibility in the stems. Essential dynamics show that the loss of G-A base pairs is correlated along the first mode but anti-correlated along the third mode with the k-e motion. Moreover, when enhanced sampling was confined to the internal loop, the RNA adopted an alternative conformation characterized by a sharper kink, opening of G-A base pairs and modified stacking interactions. Thus, loss of G-A base pairs is insufficient for achieving a large opening of the free RNA. These findings, supported by previously published RNA structure probing experiments, suggest that G-A base pair formation occurs upon protein binding, thereby stabilizing a selective orientation of the stems.

  13. Discrimination among individual Watson–Crick base pairs at the termini of single DNA hairpin molecules

    PubMed Central

    Vercoutere, Wenonah A.; Winters-Hilt, Stephen; DeGuzman, Veronica S.; Deamer, David; Ridino, Sam E.; Rodgers, Joseph T.; Olsen, Hugh E.; Marziali, Andre; Akeson, Mark

    2003-01-01

    Nanoscale α-hemolysin pores can be used to analyze individual DNA or RNA molecules. Serial examination of hundreds to thousands of molecules per minute is possible using ionic current impedance as the measured property. In a recent report, we showed that a nanopore device coupled with machine learning algorithms could automatically discriminate among the four combinations of Watson–Crick base pairs and their orientations at the ends of individual DNA hairpin molecules. Here we use kinetic analysis to demonstrate that ionic current signatures caused by these hairpin molecules depend on the number of hydrogen bonds within the terminal base pair, stacking between the terminal base pair and its nearest neighbor, and 5′ versus 3′ orientation of the terminal bases independent of their nearest neighbors. This report constitutes evidence that single Watson–Crick base pairs can be identified within individual unmodified DNA hairpin molecules based on their dynamic behavior in a nanoscale pore. PMID:12582251

  14. [Mass spectrometric and quantum chemical study of dimeric associates of nucleosides].

    PubMed

    Sukhodub, L F; Aksenov, S A; Boldeskul, A I

    1995-01-01

    Deoxyribonucleosides H-bonded pairs were investigated using fast atom bombardment mass spectrometry and MNDO/H quantum chemistry method. It was shown that "rare" (enol or imin) forms of the nitrogen bases could form pairs with energy comparable with "canonical" base pair energy. It was shown that pair stability rows, which are measured using different experimental techniques, were in conformity each with other.

  15. Twin hydroxymethyluracil-A base pair steps define the binding site for the DNA-binding protein TF1.

    PubMed

    Grove, A; Figueiredo, M L; Galeone, A; Mayol, L; Geiduschek, E P

    1997-05-16

    The DNA-bending protein TF1 is the Bacillus subtilis bacteriophage SPO1-encoded homolog of the bacterial HU proteins and the Escherichia coli integration host factor. We recently proposed that TF1, which binds with high affinity (Kd was approximately 3 nM) to preferred sites within the hydroxymethyluracil (hmU)-containing phage genome, identifies its binding sites based on sequence-dependent DNA flexibility. Here, we show that two hmU-A base pair steps coinciding with two previously proposed sites of DNA distortion are critical for complex formation. The affinity of TF1 is reduced 10-fold when both of these hmU-A base pair steps are replaced with A-hmU, G-C, or C-G steps; only modest changes in affinity result when substitutions are made at other base pairs of the TF1 binding site. Replacement of all hmU residues with thymine decreases the affinity of TF1 greatly; remarkably, the high affinity is restored when the two hmU-A base pair steps corresponding to previously suggested sites of distortion are reintroduced into otherwise T-containing DNA. T-DNA constructs with 3-base bulges spaced apart by 9 base pairs of duplex also generate nM affinity of TF1. We suggest that twin hmU-A base pair steps located at the proposed sites of distortion are key to target site selection by TF1 and that recognition is based largely, if not entirely, on sequence-dependent DNA flexibility.

  16. Understanding the kinetic mechanism of RNA single base pair formation

    PubMed Central

    Xu, Xiaojun; Yu, Tao; Chen, Shi-Jie

    2016-01-01

    RNA functions are intrinsically tied to folding kinetics. The most elementary step in RNA folding is the closing and opening of a base pair. Understanding this elementary rate process is the basis for RNA folding kinetics studies. Previous studies mostly focused on the unfolding of base pairs. Here, based on a hybrid approach, we investigate the folding process at level of single base pairing/stacking. The study, which integrates molecular dynamics simulation, kinetic Monte Carlo simulation, and master equation methods, uncovers two alternative dominant pathways: Starting from the unfolded state, the nucleotide backbone first folds to the native conformation, followed by subsequent adjustment of the base conformation. During the base conformational rearrangement, the backbone either retains the native conformation or switches to nonnative conformations in order to lower the kinetic barrier for base rearrangement. The method enables quantification of kinetic partitioning among the different pathways. Moreover, the simulation reveals several intriguing ion binding/dissociation signatures for the conformational changes. Our approach may be useful for developing a base pair opening/closing rate model. PMID:26699466

  17. Imino proton exchange and base-pair kinetics in the AMP-RNA aptamer complex.

    PubMed

    Nonin, S; Jiang, F; Patel, D J

    1997-05-02

    We report on the dynamics of base-pair opening in the ATP-binding asymmetric internal loop and flanking base-pairs of the AMP-RNA aptamer complex by monitoring the exchange characteristics of the extremely well resolved imino protons in the NMR spectrum of the complex. The kinetics of imino proton exchange as a function of basic pH or added ammonia catalyst are used to measure the apparent base-pair dissociation constants and lifetimes of Watson-Crick and mismatched base-pairs, as well as the solvent accessibility of the unpaired imino protons in the complex. The exchange characteristics of the imino protons identify the existence of four additional hydrogen bonds stabilizing the conformation of the asymmetric ATP-binding internal loop that were not detected by NOEs and coupling constants alone, but are readily accommodated in the previously reported solution structure of the AMP-RNA aptamer complex published from our laboratory. The hydrogen exchange kinetics of the non-Watson-Crick pairs in the asymmetric internal loop of the AMP-RNA aptamer complex have been characterized and yield apparent dissociation constants (alphaKd) that range from 10(-2) to 10(-7). Surprisingly, three of these alphaKd values are amongst the lowest measured for all base-pairs in the AMP-RNA aptamer complex. Comparative studies of hydrogen exchange of the imino protons in the free RNA aptamer and the AMP-RNA aptamer complex establish that complexation stabilizes not only the bases within the ATP-binding asymmetric internal loop, but also the flanking stem base-pairs (two pairs on either side) of the binding site. We also outline some preliminary results related to the exchange properties of a sugar 2'-hydroxyl proton of a guanosine residue involved in a novel hydrogen bond that has been shown to contribute to the immobilization of the bound AMP by the RNA aptamer, and whose resonance is narrow and downfield shifted in the spectrum.

  18. The 5S rRNA loop E: chemical probing and phylogenetic data versus crystal structure.

    PubMed

    Leontis, N B; Westhof, E

    1998-09-01

    A significant fraction of the bases in a folded, structured RNA molecule participate in noncanonical base pairing interactions, often in the context of internal loops or multi-helix junction loops. The appearance of each new high-resolution RNA structure provides welcome data to guide efforts to understand and predict RNA 3D structure, especially when the RNA in question is a functionally conserved molecule. The recent publication of the crystal structure of the "Loop E" region of bacterial 5S ribosomal RNA is such an event [Correll CC, Freeborn B, Moore PB, Steitz TA, 1997, Cell 91:705-712]. In addition to providing more examples of already established noncanonical base pairs, such as purine-purine sheared pairings, trans-Hoogsteen UA, and GU wobble pairs, the structure provides the first high-resolution views of two new purine-purine pairings and a new GU pairing. The goal of the present analysis is to expand the capabilities of both chemical probing and phylogenetic analysis to predict with greater accuracy the structures of RNA molecules. First, in light of existing chemical probing data, we investigate what lessons could be learned regarding the interpretation of this widely used method of RNA structure probing. Then we analyze the 3D structure with reference to molecular phylogeny data (assuming conservation of function) to discover what alternative base pairings are geometrically compatible with the structure. The comparisons between previous modeling efforts and crystal structures show that the intricate involvements of ions and water molecules in the maintenance of non-Watson-Crick pairs render the process of correctly identifying the interacting sites in such pairs treacherous, except in cases of trans-Hoogsteen A/U or sheared A/G pairs for the adenine N1 site. The phylogenetic analysis identifies A/A, A/C, A/U and C/A, C/C, and C/U pairings isosteric with sheared A/G, as well as A/A and A/C pairings isosteric with both G/U and G/G bifurcated pairings. Thus, each non-Watson-Crick pair could be characterized by a phylogenetic signature of variations between isosteric-like pairings. In addition to the conservative changes, which form a dictionary of pairings isosterically compatible with those observed in the crystal structure, concerted changes involving several base pairs also occur. The latter covariations may indicate transitions between related but distinctive motifs within the loop E of 5S ribosomal RNA.

  19. The electrostatic characteristics of G·U wobble base pairs

    PubMed Central

    Xu, Darui; Landon, Theresa; Greenbaum, Nancy L.; Fenley, Marcia O.

    2007-01-01

    G·U wobble base pairs are the most common and highly conserved non-Watson–Crick base pairs in RNA. Previous surface maps imply uniformly negative electrostatic potential at the major groove of G·U wobble base pairs embedded in RNA helices, suitable for entrapment of cationic ligands. In this work, we have used a Poisson–Boltzmann approach to gain a more detailed and accurate characterization of the electrostatic profile. We found that the major groove edge of an isolated G·U wobble displays distinctly enhanced negativity compared with standard GC or AU base pairs; however, in the context of different helical motifs, the electrostatic pattern varies. G·U wobbles with distinct widening have similar major groove electrostatic potentials to their canonical counterparts, whereas those with minimal widening exhibit significantly enhanced electronegativity, ranging from 0.8 to 2.5 kT/e, depending upon structural features. We propose that the negativity at the major groove of G·U wobble base pairs is determined by the combined effect of the base atoms and the sugar-phosphate backbone, which is impacted by stacking pattern and groove width as a result of base sequence. These findings are significant in that they provide predictive power with respect to which G·U sites in RNA are most likely to bind cationic ligands. PMID:17526525

  20. Reactivity of cytosine and thymine in single-base-pair mismatches with hydroxylamine and osmium tetroxide and its application to the study of mutations.

    PubMed Central

    Cotton, R G; Rodrigues, N R; Campbell, R D

    1988-01-01

    The chemical reactivity of thymine (T), when mismatched with the bases cytosine, guanine, and thymine, and of cytosine (C), when mismatched with thymine, adenine, and cytosine, has been examined. Heteroduplex DNAs containing such mismatched base pairs were first incubated with osmium tetroxide (for T and C mismatches) or hydroxylamine (for C mismatches) and then incubated with piperidine to cleave the DNA at the modified mismatched base. This cleavage was studied with an internally labeled strand containing the mismatched T or C, such that DNA cleavage and thus reactivity could be detected by gel electrophoresis. Cleavage at a total of 13 T and 21 C mismatches isolated (by at least three properly paired bases on both sides) single-base-pair mismatches was identified. All T or C mismatches studied were cleaved. By using end-labeled DNA probes containing T or C single-base-pair mismatches and conditions for limited cleavage, we were able to show that cleavage was at the base predicted by sequence analysis and that mismatches in a length of DNA could be readily detected by such an approach. This procedure may enable detection of all single-base-pair mismatches by use of sense and antisense probes and thus may be used to identify the mutated base and its position in a heteroduplex. Images PMID:3260032

  1. Electrostatics Explains the Position-Dependent Effect of G⋅U Wobble Base Pairs on the Affinity of RNA Kissing Complexes.

    PubMed

    Abi-Ghanem, Josephine; Rabin, Clémence; Porrini, Massimiliano; Dausse, Eric; Toulmé, Jean-Jacques; Gabelica, Valérie

    2017-10-06

    In the RNA realm, non-Watson-Crick base pairs are abundant and can affect both the RNA 3D structure and its function. Here, we investigated the formation of RNA kissing complexes in which the loop-loop interaction is modulated by non-Watson-Crick pairs. Mass spectrometry, surface plasmon resonance, and UV-melting experiments show that the G⋅U wobble base pair favors kissing complex formation only when placed at specific positions. We tried to rationalize this effect by molecular modeling, including molecular mechanics Poisson-Boltzmann surface area (MMPBSA) thermodynamics calculations and PBSA calculations of the electrostatic potential surfaces. Modeling reveals that the G⋅U stabilization is due to a specific electrostatic environment defined by the base pairs of the entire loop-loop region. The loop is not symmetric, and therefore the identity and position of each base pair matters. Predicting and visualizing the electrostatic environment created by a given sequence can help to design specific kissing complexes with high affinity, for potential therapeutic, nanotechnology or analytical applications. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. The Impact of a Peer-Learning Agent Based on Pair Programming in a Programming Course

    ERIC Educational Resources Information Center

    Han, Keun-Woo; Lee, EunKyoung; Lee, YoungJun

    2010-01-01

    This paper analyzes the educational effects of a peer-learning agent based on pair programming in programming courses. A peer-learning agent system was developed to facilitate the learning of a programming language through the use of pair programming strategies. This system is based on the role of a peer-learning agent from pedagogical and…

  3. Weak nanoscale chaos and anomalous relaxation in DNA

    NASA Astrophysics Data System (ADS)

    Mazur, Alexey K.

    2017-06-01

    Anomalous nonexponential relaxation in hydrated biomolecules is commonly attributed to the complexity of the free-energy landscapes, similarly to polymers and glasses. It was found recently that the hydrogen-bond breathing of terminal DNA base pairs exhibits a slow power-law relaxation attributable to weak Hamiltonian chaos, with parameters similar to experimental data. Here, the relationship is studied between this motion and spectroscopic signals measured in DNA with a small molecular photoprobe inserted into the base-pair stack. To this end, the earlier computational approach in combination with an analytical theory is applied to the experimental DNA fragment. It is found that the intensity of breathing dynamics is strongly increased in the internal base pairs that flank the photoprobe, with anomalous relaxation quantitatively close to that in terminal base pairs. A physical mechanism is proposed to explain the coupling between the relaxation of base-pair breathing and the experimental response signal. It is concluded that the algebraic relaxation observed experimentally is very likely a manifestation of weakly chaotic dynamics of hydrogen-bond breathing in the base pairs stacked to the photoprobe and that the weak nanoscale chaos can represent an ubiquitous hidden source of nonexponential relaxation in ultrafast spectroscopy.

  4. Distribution of Base Pair Alternations in a Periodic DNA Chain: Application of Pólya Counting to a Physical System

    NASA Astrophysics Data System (ADS)

    Hillebrand, Malcolm; Paterson-Jones, Guy; Kalosakas, George; Skokos, Charalampos

    2018-03-01

    In modeling DNA chains, the number of alternations between Adenine-Thymine (AT) and Guanine-Cytosine (GC) base pairs can be considered as a measure of the heterogeneity of the chain, which in turn could affect its dynamics. A probability distribution function of the number of these alternations is derived for circular or periodic DNA. Since there are several symmetries to account for in the periodic chain, necklace counting methods are used. In particular, Polya's Enumeration Theorem is extended for the case of a group action that preserves partitioned necklaces. This, along with the treatment of generating functions as formal power series, allows for the direct calculation of the number of possible necklaces with a given number of AT base pairs, GC base pairs and alternations. The theoretically obtained probability distribution functions of the number of alternations are accurately reproduced by Monte Carlo simulations and fitted by Gaussians. The effect of the number of base pairs on the characteristics of these distributions is also discussed, as well as the effect of the ratios of the numbers of AT and GC base pairs.

  5. Weak nanoscale chaos and anomalous relaxation in DNA.

    PubMed

    Mazur, Alexey K

    2017-06-01

    Anomalous nonexponential relaxation in hydrated biomolecules is commonly attributed to the complexity of the free-energy landscapes, similarly to polymers and glasses. It was found recently that the hydrogen-bond breathing of terminal DNA base pairs exhibits a slow power-law relaxation attributable to weak Hamiltonian chaos, with parameters similar to experimental data. Here, the relationship is studied between this motion and spectroscopic signals measured in DNA with a small molecular photoprobe inserted into the base-pair stack. To this end, the earlier computational approach in combination with an analytical theory is applied to the experimental DNA fragment. It is found that the intensity of breathing dynamics is strongly increased in the internal base pairs that flank the photoprobe, with anomalous relaxation quantitatively close to that in terminal base pairs. A physical mechanism is proposed to explain the coupling between the relaxation of base-pair breathing and the experimental response signal. It is concluded that the algebraic relaxation observed experimentally is very likely a manifestation of weakly chaotic dynamics of hydrogen-bond breathing in the base pairs stacked to the photoprobe and that the weak nanoscale chaos can represent an ubiquitous hidden source of nonexponential relaxation in ultrafast spectroscopy.

  6. Differential stabilities and sequence-dependent base pair opening dynamics of Watson-Crick base pairs with 5-hydroxymethylcytosine, 5-formylcytosine, or 5-carboxylcytosine.

    PubMed

    Szulik, Marta W; Pallan, Pradeep S; Nocek, Boguslaw; Voehler, Markus; Banerjee, Surajit; Brooks, Sonja; Joachimiak, Andrzej; Egli, Martin; Eichman, Brandt F; Stone, Michael P

    2015-02-10

    5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson-Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5'-CG-3' sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5'-T(8)X(9)G(10)-3' sequence of the DDD, were compared. The presence of 5caC at the X(9) base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A(5):T(8), whereas 5caC did not. At the oxidized base pair G(4):X(9), 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C(3):G(10). No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G(4):X(9); each favored Watson-Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N(4) exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes.

  7. Differential stabilities and sequence-dependent base pair opening dynamics of Watson–Crick base pairs with 5-hydroxymethylcytosine, 5-formylcytosine, or 5-carboxylcytosine

    DOE PAGES

    Szulik, Marta W.; Pallan, Pradeep S.; Nocek, Boguslaw; ...

    2015-01-29

    5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson–Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5'-CG-3' sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5'-T 8X 9G 10-3' sequence of the DDD, were compared. The presence of 5caC at the X9 base increased the stability of the DDD, whereas 5hmC or 5fC didmore » not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A 5:T 8, whereas 5caC did not. At the oxidized base pair G 4:X 9, 5fC exhibited an increase in the imino proton exchange rate and the calculated k op. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C 3:G 10. No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G 4:X 9; each favored Watson–Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N 4 exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. Furthermore, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes.« less

  8. Differential Stabilities and Sequence-Dependent Base Pair Opening Dynamics of Watson–Crick Base Pairs with 5-Hydroxymethylcytosine, 5-Formylcytosine, or 5-Carboxylcytosine

    PubMed Central

    2016-01-01

    5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson–Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5′-CG-3′ sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5′-T8X9G10-3′ sequence of the DDD, were compared. The presence of 5caC at the X9 base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A5:T8, whereas 5caC did not. At the oxidized base pair G4:X9, 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C3:G10. No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G4:X9; each favored Watson–Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N4 exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes. PMID:25632825

  9. Layer-Based Approach for Image Pair Fusion.

    PubMed

    Son, Chang-Hwan; Zhang, Xiao-Ping

    2016-04-20

    Recently, image pairs, such as noisy and blurred images or infrared and noisy images, have been considered as a solution to provide high-quality photographs under low lighting conditions. In this paper, a new method for decomposing the image pairs into two layers, i.e., the base layer and the detail layer, is proposed for image pair fusion. In the case of infrared and noisy images, simple naive fusion leads to unsatisfactory results due to the discrepancies in brightness and image structures between the image pair. To address this problem, a local contrast-preserving conversion method is first proposed to create a new base layer of the infrared image, which can have visual appearance similar to another base layer such as the denoised noisy image. Then, a new way of designing three types of detail layers from the given noisy and infrared images is presented. To estimate the noise-free and unknown detail layer from the three designed detail layers, the optimization framework is modeled with residual-based sparsity and patch redundancy priors. To better suppress the noise, an iterative approach that updates the detail layer of the noisy image is adopted via a feedback loop. This proposed layer-based method can also be applied to fuse another noisy and blurred image pair. The experimental results show that the proposed method is effective for solving the image pair fusion problem.

  10. Base pairing among three cis-acting sequences contributes to template switching during hepadnavirus reverse transcription

    PubMed Central

    Liu, Ning; Tian, Ru; Loeb, Daniel D.

    2003-01-01

    Synthesis of the relaxed-circular (RC) DNA genome of hepadnaviruses requires two template switches during plus-strand DNA synthesis: primer translocation and circularization. Although primer translocation and circularization use different donor and acceptor sequences, and are distinct temporally, they share the common theme of switching from one end of the minus-strand template to the other end. Studies of duck hepatitis B virus have indicated that, in addition to the donor and acceptor sequences, three other cis-acting sequences, named 3E, M, and 5E, are required for the synthesis of RC DNA by contributing to primer translocation and circularization. The mechanism by which 3E, M, and 5E act was not known. We present evidence that these sequences function by base pairing with each other within the minus-strand template. 3E base-pairs with one portion of M (M3) and 5E base-pairs with an adjacent portion of M (M5). We found that disrupting base pairing between 3E and M3 and between 5E and M5 inhibited primer translocation and circularization. More importantly, restoring base pairing with mutant sequences restored the production of RC DNA. These results are consistent with the model that, within duck hepatitis B virus capsids, the ends of the minus-strand template are juxtaposed via base pairing to facilitate the two template switches during plus-strand DNA synthesis. PMID:12578983

  11. DNA polymerase catalysis in the absence of Watson-Crick hydrogen bonds

    PubMed Central

    Potapova, Olga; Chan, Chikio; DeLucia, Angela M.; Helquist, Sandra A.; Kool, Eric T.; Grindley, Nigel D. F.; Joyce, Catherine M.

    2008-01-01

    We report the first pre-steady-state kinetic studies of DNA replication in the absence of hydrogen bonds. We have used nonpolar nucleotide analogues that mimic the shape of a Watson-Crick base pair in order to investigate the kinetic consequences of a lack of hydrogen bonds in the polymerase reaction catalyzed by the Klenow fragment of DNA Polymerase I from Escherichia coli. With a thymine isostere lacking hydrogen bonding ability in the nascent pair, the efficiency (kpol/Kd) of the polymerase reaction is decreased by 30-fold, affecting ground state (Kd) and transition state (kpol) approximately equally. When both thymine and adenine analogues in the nascent pair lack hydrogen bonding ability, the efficiency of the polymerase reaction is decreased by about 1000-fold, with most the decrease attributable to the transition state. Reactions using nonpolar analogues at the primer terminal base pair demonstrated the requirement for a hydrogen bond between the polymerase and the minor groove of the primer-terminal base. The R668A mutation of Klenow fragment abolished this requirement, identifying R668 as the probable hydrogen bond donor. Detailed examination of the kinetic data suggested that Klenow fragment has an extremely low tolerance of even minor deviations of the analogue base pairs from ideal Watson-Crick geometry. Consistent with this idea, some analogue pairings were better tolerated by Klenow fragment mutants having more spacious active sites. By contrast, the Y-family polymerase Dbh was much less sensitive to changes in base pair dimensions, and more dependent on hydrogen bonding between base-paired partners. PMID:16411765

  12. Base drive circuit

    DOEpatents

    Lange, A.C.

    1995-04-04

    An improved base drive circuit having a level shifter for providing bistable input signals to a pair of non-linear delays. The non-linear delays provide gate control to a corresponding pair of field effect transistors through a corresponding pair of buffer components. The non-linear delays provide delayed turn-on for each of the field effect transistors while an associated pair of transistors shunt the non-linear delays during turn-off of the associated field effect transistor. 2 figures.

  13. An Intelligent Model for Pairs Trading Using Genetic Algorithms.

    PubMed

    Huang, Chien-Feng; Hsu, Chi-Jen; Chen, Chi-Chung; Chang, Bao Rong; Li, Chen-An

    2015-01-01

    Pairs trading is an important and challenging research area in computational finance, in which pairs of stocks are bought and sold in pair combinations for arbitrage opportunities. Traditional methods that solve this set of problems mostly rely on statistical methods such as regression. In contrast to the statistical approaches, recent advances in computational intelligence (CI) are leading to promising opportunities for solving problems in the financial applications more effectively. In this paper, we present a novel methodology for pairs trading using genetic algorithms (GA). Our results showed that the GA-based models are able to significantly outperform the benchmark and our proposed method is capable of generating robust models to tackle the dynamic characteristics in the financial application studied. Based upon the promising results obtained, we expect this GA-based method to advance the research in computational intelligence for finance and provide an effective solution to pairs trading for investment in practice.

  14. An Intelligent Model for Pairs Trading Using Genetic Algorithms

    PubMed Central

    Hsu, Chi-Jen; Chen, Chi-Chung; Li, Chen-An

    2015-01-01

    Pairs trading is an important and challenging research area in computational finance, in which pairs of stocks are bought and sold in pair combinations for arbitrage opportunities. Traditional methods that solve this set of problems mostly rely on statistical methods such as regression. In contrast to the statistical approaches, recent advances in computational intelligence (CI) are leading to promising opportunities for solving problems in the financial applications more effectively. In this paper, we present a novel methodology for pairs trading using genetic algorithms (GA). Our results showed that the GA-based models are able to significantly outperform the benchmark and our proposed method is capable of generating robust models to tackle the dynamic characteristics in the financial application studied. Based upon the promising results obtained, we expect this GA-based method to advance the research in computational intelligence for finance and provide an effective solution to pairs trading for investment in practice. PMID:26339236

  15. The fidelity of replication of the three-base-pair set adenine/thymine, hypoxanthine/cytosine and 6-thiopurine/5-methyl-2-pyrimidinone with T7 DNA polymerase

    PubMed Central

    2004-01-01

    With the goal of constructing a genetic alphabet consisting of a set of three base pairs, the fidelity of replication of the three base pairs TH (5-methyl-2-pyrimidinone)/HS (6-thiopurine; thiohypoxanthine), C/H (hypoxanthine) and T/A was evaluated using T7 DNA polymerase, a polymerase with a strong 3′→5′ exonuclease activity. An evaluation of the suitability of a new base pair for replication should include both the contribution of the fidelity of a polymerase activity and the contribution of proofreading by a 3′→5′ exonuclease activity. Using a steady-state kinetics method that included the contribution of the 3′→5′ exonuclease activity, the fidelity of replication was determined. The method determined the ratio of the apparent rate constant for the addition of a deoxynucleotide to the primer across from a template base by the polymerase activity and the rate constant for removal of the added deoxynucleotide from the primer by the 3′→5′ exonuclease activity. This ratio was designated the eni (efficiency of net incorporation). The eni of the base pair C/H was equal to or greater than the eni of T/A. The eni of the base pair TH/HS was 0.1 times that of A/T for TH in the template and 0.01 times that of A/T for HS in the template. The ratio of the eni of a mismatched deoxynucleotide to the eni of a matched deoxynucleotide was a measure of the error frequency. The error frequencies were as follows: thymine or TH opposite a template hypoxanthine, 2×10−6; HS opposite a template cytosine, <3×10−4. The remaining 24 mismatched combinations of bases gave no detectable net incorporation. Two mismatches, hypoxanthine opposite a template thymine or a template TH, showed trace incorporation in the presence of a standard dNTP complementary to the next template base. T7 DNA polymerase extended the primer beyond each of the matched base pairs of the set. The level of fidelity of replication of the three base pairs with T7 DNA polymerase suggests that they are adequate for a three-base-pair alphabet for DNA replication. PMID:15078225

  16. Pairing States of Spin-3/2 Fermions: Symmetry-Enforced Topological Gap Functions

    NASA Astrophysics Data System (ADS)

    Venderbos, Jörn W. F.; Savary, Lucile; Ruhman, Jonathan; Lee, Patrick A.; Fu, Liang

    2018-01-01

    We study the topological properties of superconductors with paired j =3/2 quasiparticles. Higher spin Fermi surfaces can arise, for instance, in strongly spin-orbit coupled band-inverted semimetals. Examples include the Bi-based half-Heusler materials, which have recently been established as low-temperature and low-carrier density superconductors. Motivated by this experimental observation, we obtain a comprehensive symmetry-based classification of topological pairing states in systems with higher angular momentum Cooper pairing. Our study consists of two main parts. First, we develop the phenomenological theory of multicomponent (i.e., higher angular momentum) pairing by classifying the stationary points of the free energy within a Ginzburg-Landau framework. Based on the symmetry classification of stationary pairing states, we then derive the symmetry-imposed constraints on their gap structures. We find that, depending on the symmetry quantum numbers of the Cooper pairs, different types of topological pairing states can occur: fully gapped topological superconductors in class DIII, Dirac superconductors, and superconductors hosting Majorana fermions. Notably, we find a series of nematic fully gapped topological superconductors, as well as double- and triple-Dirac superconductors, with quadratic and cubic dispersion, respectively. Our approach, applied here to the case of j =3/2 Cooper pairing, is rooted in the symmetry properties of pairing states, and can therefore also be applied to other systems with higher angular momentum and high-spin pairing. We conclude by relating our results to experimentally accessible signatures in thermodynamic and dynamic probes.

  17. Structure of 2,4-Diaminopyrimidine - Theobromine Alternate Base Pairs

    NASA Technical Reports Server (NTRS)

    Gengeliczki, Zsolt; Callahan, Michael P.; Kabelac, Martin; Rijs, Anouk M.; deVries, Mattanjah S.

    2011-01-01

    We report the structure of clusters of 2,4-diaminopyrimidine with 3,7-dimethylxanthine (theobromine) in the gas phase determined by IR-UV double resonance spectroscopy in both the near-IR and mid-IR regions in combination with ab initio computations. These clusters represent potential alternate nucleobase pairs, geometrically equivalent to guanine-cytosine. We have found the four lowest energy structures, which include the Watson-Crick base pairing motif. This Watson-Crick structure has not been observed by resonant two-photon ionization (R2PI) in the gas phase for the canonical DNA base pairs.

  18. N-H Stretching Excitations in Adenosine-Thymidine Base Pairs in Solution: Base Pair Geometries, Infrared Line Shapes and Ultrafast Vibrational Dynamics

    PubMed Central

    Greve, Christian; Preketes, Nicholas K.; Fidder, Henk; Costard, Rene; Koeppe, Benjamin; Heisler, Ismael A.; Mukamel, Shaul; Temps, Friedrich; Nibbering, Erik T. J.; Elsaesser, Thomas

    2013-01-01

    We explore the N-H stretching vibrations of adenosine-thymidine base pairs in chloroform solution with linear and nonlinear infrared spectroscopy. Based on estimates from NMR measurements and ab initio calculations, we conclude that adenosine and thymidine form hydrogen bonded base pairs in Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen configurations with similar probability. Steady-state concentration- and temperature dependent linear FT-IR studies, including H/D exchange experiments, reveal that these hydrogen-bonded base pairs have complex N-H/N-D stretching spectra with a multitude of spectral components. Nonlinear 2D-IR spectroscopic results, together with IR-pump-IR-probe measurements, as also corroborated by ab initio calculations, reveal that the number of N-H stretching transitions is larger than the total number of N-H stretching modes. This is explained by couplings to other modes, such as an underdamped low-frequency hydrogen-bond mode, and a Fermi resonance with NH2 bending overtone levels of the adenosine amino-group. Our results demonstrate that modeling based on local N-H stretching vibrations only is not sufficient and call for further refinement of the description of the N-H stretching manifolds of nucleic acid base pairs of adenosine and thymidine, incorporating a multitude of couplings with fingerprint and low-frequency modes. PMID:23234439

  19. Structural Basis for the Lesion-scanning Mechanism of the MutY DNA Glycosylase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Lan; Chakravarthy, Srinivas; Verdine, Gregory L.

    The highly mutagenic A:8-oxoguanine (oxoG) base pair is generated mainly by misreplication of the C:oxoG base pair, the oxidation product of the C:G base pair. The A:oxoG base pair is particularly insidious because neither base in it carries faithful information to direct the repair of the other. The bacterial MutY (MUTYH in humans) adenine DNA glycosylase is able to initiate the repair of A:oxoG by selectively cleaving the A base from the A:oxoG base pair. The difference between faithful repair and wreaking mutagenic havoc on the genome lies in the accurate discrimination between two structurally similar base pairs: A:oxoG andmore » A:T. Here we present two crystal structures of the MutY N-terminal domain in complex with either undamaged DNA or DNA containing an intrahelical lesion. These structures have captured for the first time a DNA glycosylase scanning the genome for a damaged base in the very first stage of lesion recognition and the base extrusion pathway. The mode of interaction observed here has suggested a common lesion-scanning mechanism across the entire helix-hairpin-helix superfamily to which MutY belongs. In addition, small angle X-ray scattering studies together with accompanying biochemical assays have suggested a possible role played by the C-terminal oxoG-recognition domain of MutY in lesion scanning.« less

  20. KlenTaq polymerase replicates unnatural base pairs by inducing a Watson-Crick geometry.

    PubMed

    Betz, Karin; Malyshev, Denis A; Lavergne, Thomas; Welte, Wolfram; Diederichs, Kay; Dwyer, Tammy J; Ordoukhanian, Phillip; Romesberg, Floyd E; Marx, Andreas

    2012-07-01

    Many candidate unnatural DNA base pairs have been developed, but some of the best-replicated pairs adopt intercalated structures in free DNA that are difficult to reconcile with known mechanisms of polymerase recognition. Here we present crystal structures of KlenTaq DNA polymerase at different stages of replication for one such pair, dNaM-d5SICS, and show that efficient replication results from the polymerase itself, inducing the required natural-like structure.

  1. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Egli, Martin; Pallan, Pradeep S.; Pattanayek, Rekha

    An experimental rationalization of the structure type encountered in DNA and RNA by systematically investigating the chemical and physical properties of alternative nucleic acids has identified systems with a variety of sugar-phosphate backbones that are capable of Watson-Crick base pairing and in some cases cross-pairing with the natural nucleic acids. The earliest among the model systems tested to date, (4{prime} {yields} 6{prime})-linked oligo(2{prime},3{prime}-dideoxy-{beta}-d-glucopyranosyl)nucleotides or homo-DNA, shows stable self-pairing, but the pairing rules for the four natural bases are not the same as those in DNA. However, a complete interpretation and understanding of the properties of the hexapyranosyl (4{prime} {yields} 6{prime})more » family of nucleic acids has been impeded until now by the lack of detailed 3D-structural data. We have determined the crystal structure of a homo-DNA octamer. It reveals a weakly twisted right-handed duplex with a strong inclination between the hexose-phosphate backbones and base-pair axes, and highly irregular values for helical rise and twist at individual base steps. The structure allows a rationalization of the inability of allo-, altro-, and glucopyranosyl-based oligonucleotides to form stable pairing systems.« less

  2. Sequence-dependent base pair stepping dynamics in XPD helicase unwinding

    PubMed Central

    Qi, Zhi; Pugh, Robert A; Spies, Maria; Chemla, Yann R

    2013-01-01

    Helicases couple the chemical energy of ATP hydrolysis to directional translocation along nucleic acids and transient duplex separation. Understanding helicase mechanism requires that the basic physicochemical process of base pair separation be understood. This necessitates monitoring helicase activity directly, at high spatio-temporal resolution. Using optical tweezers with single base pair (bp) resolution, we analyzed DNA unwinding by XPD helicase, a Superfamily 2 (SF2) DNA helicase involved in DNA repair and transcription initiation. We show that monomeric XPD unwinds duplex DNA in 1-bp steps, yet exhibits frequent backsteps and undergoes conformational transitions manifested in 5-bp backward and forward steps. Quantifying the sequence dependence of XPD stepping dynamics with near base pair resolution, we provide the strongest and most direct evidence thus far that forward, single-base pair stepping of a helicase utilizes the spontaneous opening of the duplex. The proposed unwinding mechanism may be a universal feature of DNA helicases that move along DNA phosphodiester backbones. DOI: http://dx.doi.org/10.7554/eLife.00334.001 PMID:23741615

  3. Efficient Acceleration of the Pair-HMMs Forward Algorithm for GATK HaplotypeCaller on Graphics Processing Units.

    PubMed

    Ren, Shanshan; Bertels, Koen; Al-Ars, Zaid

    2018-01-01

    GATK HaplotypeCaller (HC) is a popular variant caller, which is widely used to identify variants in complex genomes. However, due to its high variants detection accuracy, it suffers from long execution time. In GATK HC, the pair-HMMs forward algorithm accounts for a large percentage of the total execution time. This article proposes to accelerate the pair-HMMs forward algorithm on graphics processing units (GPUs) to improve the performance of GATK HC. This article presents several GPU-based implementations of the pair-HMMs forward algorithm. It also analyzes the performance bottlenecks of the implementations on an NVIDIA Tesla K40 card with various data sets. Based on these results and the characteristics of GATK HC, we are able to identify the GPU-based implementations with the highest performance for the various analyzed data sets. Experimental results show that the GPU-based implementations of the pair-HMMs forward algorithm achieve a speedup of up to 5.47× over existing GPU-based implementations.

  4. DNA bases ring-expanded with a cyclopentadiene free radical: a theoretical investigation of building blocks with diradical character.

    PubMed

    Zhao, Peiwen; Bu, Yuxiang

    2016-01-14

    In this work, we computationally design radical nucleobases which possess improved electronic properties, especially diradical properties through introducing a cyclopentadiene radical. We predict that the detailed electromagnetic features of base assemblies are based on the orientation of the extra five-membered cyclopentadiene ring. Broken symmetry DFT calculations take into account the relevant structures and properties. Our results reveal that both the radicalized DNA bases and the base pairs formed when they combine with their counterparts remain stable and display larger spin delocalization. The mode of embedding the cyclopentadiene free radical in the structures has some influence on the degree of π-conjugation, which results in various diradical characteristics. Single-layered radical base pairs all have an open-shell singlet ground state, but the energy difference between singlet and triplet is not significant. For two-layered radical base pairs, the situation is more complex. All of them have an open-shell state as their ground state, including an open-shell singlet state and an open-shell triplet state. That is, the majority of radical base pairs possess anti-ferromagnetic or ferromagnetic characteristics. We present here a more in-depth discussion and analyses to study the magnetic characteristics of radical bases and base pairs. As an important factor, two-layered radical base pairs also have been carefully analyzed. We hope that all the measurements and results presented here will stimulate further detailed insights into the related mechanisms in modified DNA bases and the design of better ring-expanded DNA magnetic materials.

  5. Molecular dynamics study of some non-hydrogen-bonding base pair DNA strands

    NASA Astrophysics Data System (ADS)

    Tiwari, Rakesh K.; Ojha, Rajendra P.; Tiwari, Gargi; Pandey, Vishnudatt; Mall, Vijaysree

    2018-05-01

    In order to elucidate the structural activity of hydrophobic modified DNA, the DMMO2-D5SICS, base pair is introduced as a constituent in different set of 12-mer and 14-mer DNA sequences for the molecular dynamics (MD) simulation in explicit water solvent. AMBER 14 force field was employed for each set of duplex during the 200ns production-dynamics simulation in orthogonal-box-water solvent by the Particle-Mesh-Ewald (PME) method in infinite periodic boundary conditions (PBC) to determine conformational parameters of the complex. The force-field parameters of modified base-pair were calculated by Gaussian-code using Hartree-Fock /ab-initio methodology. RMSD Results reveal that the conformation of the duplex is sequence dependent and the binding energy of the complex depends on the position of the modified base-pair in the nucleic acid strand. We found that non-bonding energy had a significant contribution to stabilising such type of duplex in comparison to electrostatic energy. The distortion produced within strands by such type of base-pair was local and destabilised the duplex integrity near to substitution, moreover the binding energy of duplex depends on the position of substitution of hydrophobic base-pair and the DNA sequence and strongly supports the corresponding experimental study.

  6. 2-Methoxypyridine as a Thymidine Mimic in Watson-Crick Base Pairs of DNA and PNA: Synthesis, Thermal Stability, and NMR Structural Studies.

    PubMed

    Novosjolova, Irina; Kennedy, Scott D; Rozners, Eriks

    2017-11-02

    The development of nucleic acid base-pair analogues that use new modes of molecular recognition is important both for fundamental research and practical applications. The goal of this study was to evaluate 2-methoxypyridine as a cationic thymidine mimic in the A-T base pair. The hypothesis was that including protonation in the Watson-Crick base pairing scheme would enhance the thermal stability of the DNA double helix without compromising the sequence selectivity. DNA and peptide nucleic acid (PNA) sequences containing the new 2-methoxypyridine nucleobase (P) were synthesized and studied by using UV thermal melting and NMR spectroscopy. Introduction of P nucleobase caused a loss of thermal stability of ≈10 °C in DNA-DNA duplexes and ≈20 °C in PNA-DNA duplexes over a range of mildly acidic to neutral pH. Despite the decrease in thermal stability, the NMR structural studies showed that P-A formed the expected protonated base pair at pH 4.3. Our study demonstrates the feasibility of cationic unnatural base pairs; however, future optimization of such analogues will be required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Radical-pair based avian magnetoreception

    NASA Astrophysics Data System (ADS)

    Procopio, Maria; Ritz, Thorsten

    2014-03-01

    Behavioural experiments suggest that migratory birds possess a magnetic compass sensor able to detect the direction of the geomagnetic. One hypothesis for the basis of this remarkable sensory ability is that the coherent quantum spin dynamics of photoinduced radical pair reactions transduces directional magnetic information from the geomagnetic field into changes of reaction yields, possibly involving the photoreceptor cryptochrome in the birds retina. The suggested radical-pair based avian magnetoreception has attracted attention in the field of quantum biology as an example of a biological sensor which might exploit quantum coherences for its biological function. Investigations on such a spin-based sensor have focussed on uncovering the design features for the design of a biomimetic magnetic field sensor. We study the effects of slow fluctuations in the nuclear spin environment on the directional signal. We quantitatively evaluate the robustness of signals under fluctuations on a timescale longer than the lifetime of a radical pair, utilizing two models of radical pairs. Our results suggest design principles for building a radical-pair based compass sensor that is both robust and highly directional sensitive.

  8. Comparison of the conformation of an oligonucleotide containing a central G-T base pair with the non-mismatch sequence by proton NMR.

    PubMed Central

    Quignard, E; Fazakerley, G V; van der Marel, G; van Boom, J H; Guschlbauer, W

    1987-01-01

    We have recorded NOESY spectra of two non-selfcomplementary undecanucleotide duplexes. From the observed NOEs we do not detect any significant distortion of the helix when a G-C pair is replaced by a G-T pair and the normal interresidue connectivities can be followed through the mismatch site. We conclude that the 2D spectra of the non-exchangeable protons do not allow differentiation between a wobble or rare tautomer form for the mismatch. NOE measurements in H2O, however, clearly show that the mismatch adopts a wobble structure and give information on the hydration in the minor groove for the G-T base pair which is embedded between two A-T base pairs in the sequence. PMID:3033602

  9. Stringent Nucleotide Recognition by the Ribosome at the Middle Codon Position.

    PubMed

    Liu, Wei; Shin, Dongwon; Ng, Martin; Sanbonmatsu, Karissa Y; Tor, Yitzhak; Cooperman, Barry S

    2017-08-29

    Accurate translation of the genetic code depends on mRNA:tRNA codon:anticodon base pairing. Here we exploit an emissive, isosteric adenosine surrogate that allows direct measurement of the kinetics of codon:anticodon University of California base formation during protein synthesis. Our results suggest that codon:anticodon base pairing is subject to tighter constraints at the middle position than at the 5'- and 3'-positions, and further suggest a sequential mechanism of formation of the three base pairs in the codon:anticodon helix.

  10. Characterization of the Trans Watson-Crick GU Base Pair Located in the Catalytic Core of the Antigenomic HDV Ribozyme

    PubMed Central

    Lévesque, Dominique; Reymond, Cédric; Perreault, Jean-Pierre

    2012-01-01

    The HDV ribozyme’s folding pathway is, by far, the most complex folding pathway elucidated to date for a small ribozyme. It includes 6 different steps that have been shown to occur before the chemical cleavage. It is likely that other steps remain to be discovered. One of the most critical of these unknown steps is the formation of the trans Watson-Crick GU base pair within loop III. The U23 and G28 nucleotides that form this base pair are perfectly conserved in all natural variants of the HDV ribozyme, and therefore are considered as being part of the signature of HDV-like ribozymes. Both the formation and the transformation of this base pair have been studied mainly by crystal structure and by molecular dynamic simulations. In order to obtain physical support for the formation of this base pair in solution, a set of experiments, including direct mutagenesis, the site-specific substitution of chemical groups, kinetic studies, chemical probing and magnesium-induced cleavage, were performed with the specific goal of characterizing this trans Watson-Crick GU base pair in an antigenomic HDV ribozyme. Both U23 and G28 can be substituted for nucleotides that likely preserve some of the H-bond interactions present before and after the cleavage step. The formation of the more stable trans Watson-Crick base pair is shown to be a post-cleavage event, while a possibly weaker trans Watson-Crick/Hoogsteen interaction seems to form before the cleavage step. The formation of this unusually stable post-cleavage base pair may act as a driving force on the chemical cleavage by favouring the formation of a more stable ground state of the product-ribozyme complex. To our knowledge, this represents the first demonstration of a potential stabilising role of a post-cleavage conformational switch event in a ribozyme-catalyzed reaction. PMID:22768274

  11. Building a knowledge base of severe adverse drug events based on AERS reporting data using semantic web technologies.

    PubMed

    Jiang, Guoqian; Wang, Liwei; Liu, Hongfang; Solbrig, Harold R; Chute, Christopher G

    2013-01-01

    A semantically coded knowledge base of adverse drug events (ADEs) with severity information is critical for clinical decision support systems and translational research applications. However it remains challenging to measure and identify the severity information of ADEs. The objective of the study is to develop and evaluate a semantic web based approach for building a knowledge base of severe ADEs based on the FDA Adverse Event Reporting System (AERS) reporting data. We utilized a normalized AERS reporting dataset and extracted putative drug-ADE pairs and their associated outcome codes in the domain of cardiac disorders. We validated the drug-ADE associations using ADE datasets from SIDe Effect Resource (SIDER) and the UMLS. We leveraged the Common Terminology Criteria for Adverse Event (CTCAE) grading system and classified the ADEs into the CTCAE in the Web Ontology Language (OWL). We identified and validated 2,444 unique Drug-ADE pairs in the domain of cardiac disorders, of which 760 pairs are in Grade 5, 775 pairs in Grade 4 and 2,196 pairs in Grade 3.

  12. Terminal base pairs of oligodeoxynucleotides: imino proton exchange and fraying.

    PubMed

    Nonin, S; Leroy, J L; Guéron, M

    1995-08-22

    We have estimated the dissociation constant of the terminal base pairs of the B-DNA duplexes formed by 5'-d(CGCGATCGCG) and 5'-d(TAGCGCTA) by two methods, one based on the change in imino proton chemical shift with temperature and the other on the apparent pK shift of the imino proton, as monitored by the change in chemical shift of aromatic protons. These methods do not rely on imino proton exchange, whose rate was also measured. (1) The effect of ammonia on the imino proton exchange rate of the terminal pair of the 5'-d(CGCGATCGCG) duplex is 67 times less than on the isolated nucleoside. This provides an upper limit on the exchange rate from the closed pair. In fact, the effect is just as predicted from the dissociation constant, assuming that there is no exchange at all from the closed pair and that, as has been argued previously, external catalysts act on the open state as they do on the isolated nucleoside. The inhibition of catalyzed proton exchange in the closed pair, despite exposure of one face of the pair to solvent, is a new feature of the exchange process. It will allow determination of the dissociation constant of terminal pairs from the exchange rate. (2) Intrinsic catalysis of proton exchange is less efficient for the terminal pair than for an internal one. A possible explanation is that proton transfer across the water bridge responsible for intrinsic catalysis is slower, as expected if the open-state separation of the bases is larger in a terminal pair. This observation may lead to a direct method for the study of fraying. (3) At 0 degrees C, the dissociation constant of the second pair of the 5'-d(CGCGATCGCG) duplex is close to the square of the constant for the terminal pair, as predicted from a simple model of fraying. The enthalpy and entropy of opening of the terminal pairs may be compared with those of nearest neighbor interactions derived from calorimetry [Breslauer, K. J., et al. (1986) Proc. Natl. Acad. Sci. U.S.A. 83, 3746-3750].

  13. Hybrid-denovo: a de novo OTU-picking pipeline integrating single-end and paired-end 16S sequence tags.

    PubMed

    Chen, Xianfeng; Johnson, Stephen; Jeraldo, Patricio; Wang, Junwen; Chia, Nicholas; Kocher, Jean-Pierre A; Chen, Jun

    2018-03-01

    Illumina paired-end sequencing has been increasingly popular for 16S rRNA gene-based microbiota profiling. It provides higher phylogenetic resolution than single-end reads due to a longer read length. However, the reverse read (R2) often has significant low base quality, and a large proportion of R2s will be discarded after quality control, resulting in a mixture of paired-end and single-end reads. A typical 16S analysis pipeline usually processes either paired-end or single-end reads but not a mixture. Thus, the quantification accuracy and statistical power will be reduced due to the loss of a large amount of reads. As a result, rare taxa may not be detectable with the paired-end approach, or low taxonomic resolution will result in a single-end approach. To have both the higher phylogenetic resolution provided by paired-end reads and the higher sequence coverage by single-end reads, we propose a novel OTU-picking pipeline, hybrid-denovo, that can process a hybrid of single-end and paired-end reads. Using high-quality paired-end reads as a gold standard, we show that hybrid-denovo achieved the highest correlation with the gold standard and performed better than the approaches based on paired-end or single-end reads in terms of quantifying the microbial diversity and taxonomic abundances. By applying our method to a rheumatoid arthritis (RA) data set, we demonstrated that hybrid-denovo captured more microbial diversity and identified more RA-associated taxa than a paired-end or single-end approach. Hybrid-denovo utilizes both paired-end and single-end 16S sequencing reads and is recommended for 16S rRNA gene targeted paired-end sequencing data.

  14. Relativistic coupled cluster theory based on the no-pair Dirac-Coulomb-Breit Hamiltonian: Relativistic pair correlation energies of the Xe atom

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Eliav, E.; Kaldor, U.; Ishikawa, Y.

    1994-12-31

    Relativistic pair correlation energies of Xe were computed by employing a recently developed relativistic coupled cluster theory based on the no-pair Dirac-Coulomb-Breit Hamiltonian. The matrix Dirac-Fock-Breit SCF and relativistic coupled cluster calculations were performed by means of expansion in basis sets of well-tempered Gaussian spinors. A detailed study of the pair correlation energies in Xe is performed, in order to investigate the effects of the low-frequency Breit interaction on the correlation energies of Xe. Nonadditivity of correlation and relativistic (particularly Breit) effects is discussed.

  15. On twelve types of covering-based rough sets.

    PubMed

    Safari, Samira; Hooshmandasl, Mohammad Reza

    2016-01-01

    Covering approximation spaces are a generalization of equivalence-based rough set theories. In this paper, we will consider twelve types of covering based approximation operators by combining four types of covering lower approximation operators and three types of covering upper approximation operators. Then, we will study the properties of these new pairs and show they have most of the common properties among existing covering approximation pairs. Finally, the relation between these new pairs is studied.

  16. Evidence for Watson-Crick and not Hoogsteen or wobble base pairing in the selection of nucleotides for insertion opposite pyrimidines and a thymine dimer by yeast DNA pol eta.

    PubMed

    Hwang, Hanshin; Taylor, John-Stephen

    2005-03-29

    We have recently reported that pyrene nucleotide is preferentially inserted opposite an abasic site, the 3'-T of a thymine dimer, and most undamaged bases by yeast DNA polymerase eta (pol eta). Because pyrene is a nonpolar molecule with no H-bonding ability, the unusually high efficiencies of dPMP insertion are ascribed to its superior base stacking ability, and underscore the importance of base stacking in the selection of nucleotides by pol eta. To investigate the role of H-bonding and base pair geometry in the selection of nucleotides by pol eta, we determined the insertion efficiencies of the base-modified nucleotides 2,6-diaminopurine, 2-aminopurine, 6-chloropurine, and inosine which would make a different number of H-bonds with the template base depending on base pair geometry. Watson-Crick base pairing appears to play an important role in the selection of nucleotide analogues for insertion opposite C and T as evidenced by the decrease in the relative insertion efficiencies with a decrease in the number of Watson-Crick H-bonds and an increase in the number of donor-donor and acceptor-acceptor interactions. The selectivity of nucleotide insertion is greater opposite the 5'-T than the 3'-T of the thymine dimer, in accord with previous work suggesting that the 5'-T is held more rigidly than the 3'-T. Furthermore, insertion of A opposite both Ts of the dimer appears to be mediated by Watson-Crick base pairing and not by Hoogsteen base pairing based on the almost identical insertion efficiencies of A and 7-deaza-A, the latter of which lacks H-bonding capability at N7. The relative efficiencies for insertion of nucleotides that can form Watson-Crick base pairs parallel those for the Klenow fragment, whereas the Klenow fragment more strongly discriminates against mismatches, in accord with its greater shape selectivity. These results underscore the importance of H-bonding and Watson-Crick base pair geometry in the selection of nucleotides by both pol eta and the Klenow fragment, and the lesser role of shape selection in insertion by pol eta due to its more open and less constrained active site.

  17. Energy barriers and rates of tautomeric transitions in DNA bases: ab initio quantum chemical study.

    PubMed

    Basu, Soumalee; Majumdar, Rabi; Das, Gourab K; Bhattacharyya, Dhananjay

    2005-12-01

    Tautomeric transitions of DNA bases are proton transfer reactions, which are important in biology. These reactions are involved in spontaneous point mutations of the genetic material. In the present study, intrinsic reaction coordinates (IRC) analyses through ab initio quantum chemical calculations have been carried out for the individual DNA bases A, T, G, C and also A:T and G:C base pairs to estimate the kinetic and thermodynamic barriers using MP2/6-31G** method for tautomeric transitions. Relatively higher values of kinetic barriers (about 50-60 kcal/mol) have been observed for the single bases, indicating that tautomeric alterations of isolated single bases are quite unlikely. On the other hand, relatively lower values of the kinetic barriers (about 20-25 kcal/mol) for the DNA base pairs A:T and G:C clearly suggest that the tautomeric shifts are much more favorable in DNA base pairs than in isolated single bases. The unusual base pairing A':C, T':G, C':A or G':T in the daughter DNA molecule, resulting from a parent DNA molecule with tautomeric shifts, is found to be stable enough to result in a mutation. The transition rate constants for the single DNA bases in addition to the base pairs are also calculated by computing the free energy differences between the transition states and the reactants.

  18. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Yujie; Gong, Sha; Wang, Zhen

    The thermodynamic and kinetic parameters of an RNA base pair were obtained through a long-time molecular dynamics simulation of the opening-closing switch process of the base pair near its melting temperature. The thermodynamic parameters were in good agreement with the nearest-neighbor model. The opening rates showed strong temperature dependence, however, the closing rates showed only weak temperature dependence. The transition path time was weakly temperature dependent and was insensitive to the energy barrier. The diffusion constant exhibited super-Arrhenius behavior. The free energy barrier of breaking a single base stack results from the enthalpy increase, ΔH, caused by the disruption ofmore » hydrogen bonding and base-stacking interactions. The free energy barrier of base pair closing comes from the unfavorable entropy loss, ΔS, caused by the restriction of torsional angles. These results suggest that a one-dimensional free energy surface is sufficient to accurately describe the dynamics of base pair opening and closing, and the dynamics are Brownian.« less

  19. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gao, X.; Patel, D.J.

    The authors report on two-dimensional proton NMR studies of echinomycin complexes with the self-complementary d(A1-C2-G3-Tr) and d(T1-C2-G3-A4) duplexes in aqueous solution. The exchangeable and nonexchangeable antibiotic and nucleic acid protons in the 1 echinomycin per tetranucleotide duplex complexes have been assigned from analyses of scalar coupling and distance connectivities in two-dimensional data sets records in H/sub 2/O and D/sub 2/O solution. An analysis of the intermolecular NOE patterns for both complexes combined with large upfield imino proton and large downfield phosphorus complexation chemical shift changes demonstrates that the two quinoxaline chromophores of echinomycin bisintercalate into the minor groove surrounding themore » dC-dG step of each tetranucleotide duplex. Further, the quinoxaline rings selectively stack between A1 and C2 bases in the d(ACGT) complex and between T1 and C2 bases in the d(TCGA) complex. The intermolecular NOE patterns and the base and sugar proton chemical shifts for residues C2 and G3 are virtually identical for the d(ACGT) and d(TCGA) complexes. A large set of intermolecular contacts established from nuclear Overhauser effects (NOEs) between antibiotic and nucleic acid protons in the echinomycin-tetranucleotide complexes in solution are consistent with corresponding contacts reported for echinomycin-oligonucleotide complexes in the crystalline state. The authors demonstrate that the G x G base pairs adopt Watson-Crick pairing in both d(ACGT) and d(TCGA) complexes in solution. By contrast, the A1 x T4 base pairs adopt Hoogsteen pairing for the echinomycin-d(A1-C2-G3-Tr) complex while the T1 x A4 base pairs adopt Watson-Crick pairing for the echinomycin-d(T1-C2-G3-A4) complex in aqueous solution. These results emphasize the role of sequence in discriminating between Watson-Crick and Hoogsteen pairs at base pairs flanking the echinomycin bisintercalation site in solution.« less

  20. Can tautomerization of the A·T Watson-Crick base pair via double proton transfer provoke point mutations during DNA replication? A comprehensive QM and QTAIM analysis.

    PubMed

    Brovarets, Ol'ha O; Hovorun, Dmytro M

    2014-01-01

    Trying to answer the question posed in the title, we have carried out a detailed theoretical investigation of the biologically important mechanism of the tautomerization of the A·T Watson-Crick DNA base pair, information that is hard to establish experimentally. By combining theoretical investigations at the MP2 and density functional theory levels of QM theory with quantum theory of atoms in molecules analysis, the tautomerization of the A·T Watson-Crick base pair by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ϵ = 4) corresponding to a hydrophobic interfaces of protein-nucleic acid interactions. Based on the sweeps of the electron-topological, geometric, and energetic parameters, which describe the course of the tautomerization along its intrinsic reaction coordinate (IRC), it was proved that the A·T → A(∗)·T(∗) tautomerization through the DPT is a concerted (i.e. the pathway without an intermediate) and asynchronous (i.e. protons move with a time gap) process. The limiting stage of this phenomenon is the final PT along the N6H⋯O4 hydrogen bond (H-bond). The continuum with ϵ = 4 does not affect qualitatively the course of the tautomerization reaction: similar to that observed in vacuo, it proceeds via a concerted asynchronous process with the same structure of the transition state (TS). For the first time, the nine key points along the IRC of the A·T base pair tautomerization, which could be considered as electron-topological "fingerprints" of a concerted asynchronous process of the tautomerization via the DPT, have been identified and fully characterized. These nine key points have been used to define the reactant, TS, and product regions of the DPT in the A·T base pair. Considering the energy dependence of each of the three H-bonds, which stabilize the Watson-Crick and Löwdin's base pairs, along the IRC of the tautomerization, it was found that all these H-bonds in the А·Т base pair are cooperative, reinforcing each other, whereas the C2H⋯O2 H-bond in the А(∗)·Т(∗) base pair behaves anticooperatively, in other words it gets weakened while two others get strengthened. From a quantum-mechanical point of view, the A(∗)·T(∗) Löwdin's base pair appeared to be dynamically unstable because the electronic energy of the back-reaction barrier of the A·T → A(∗)·T(∗) tautomerization does not exceed zero-point vibrational energy associated with the mode for which vibrational frequency becomes imaginary in the TS of tautomerization. Additionally, it was demonstrated using the conductor-like polarizable continuum model that the effects of biomolecular environment (ϵ = 4) cannot ensure dynamic stabilization of the A(∗)·T(∗) Löwdin's base pair. These findings, together with data available from the literature, indicate that the tautomerization of the A·T Watson-Crick base pair to the A(∗)·T(∗) Löwdin's base pair through the DPT cannot be a source of spontaneous point errors that occur during DNA replication.

  1. Effect of genome sequence on the force-induced unzipping of a DNA molecule.

    PubMed

    Singh, N; Singh, Y

    2006-02-01

    We considered a dsDNA polymer in which distribution of bases are random at the base pair level but ordered at a length of 18 base pairs and calculated its force elongation behaviour in the constant extension ensemble. The unzipping force F(y) vs. extension y is found to have a series of maxima and minima. By changing base pairs at selected places in the molecule we calculated the change in F(y) curve and found that the change in the value of force is of the order of few pN and the range of the effect depending on the temperature, can spread over several base pairs. We have also discussed briefly how to calculate in the constant force ensemble a pause or a jump in the extension-time curve from the knowledge of F(y).

  2. Quantum entanglement and quantum information in biological systems (DNA)

    NASA Astrophysics Data System (ADS)

    Hubač, Ivan; Švec, Miloslav; Wilson, Stephen

    2017-12-01

    Recent studies of DNA show that the hydrogen bonds between given base pairs can be treated as diabatic systems with spin-orbit coupling. For solid state systems strong diabaticity and spin-orbit coupling the possibility of forming Majorana fermions has been discussed. We analyze the hydrogen bonds in the base pairs in DNA from this perspective. Our analysis is based on a quasiparticle supersymmetric transformation which couples electronic and vibrational motion and includes normal coordinates and the corresponding momenta. We define qubits formed by Majorana fermions in the hydrogen bonds and also discuss the entangled states in base pairs. Quantum information and quantum entropy are introduced. In addition to the well-known classical information connected with the DNA base pairs, we also consider quantum information and show that the classical and quantum information are closely connected.

  3. Paired peer review of university classroom teaching in a school of nursing and midwifery.

    PubMed

    Bennett, Paul N; Parker, Steve; Smigiel, Heather

    2012-08-01

    Peer review of university classroom teaching can increase the quality of teaching but is not universally practiced in Australian universities. To report an evaluation of paired peer-review process using both paper and web based teaching evaluation tools. Twenty university teachers in one metropolitan Australian School of Nursing and Midwifery were randomly paired and then randomly assigned to a paper based or web-based peer review tool. Each teacher reviewed each other's classroom teaching as part of a peer review program. The participants then completed an 18 question survey evaluating the peer review tool and paired evaluation process. Responses were analyzed using frequencies and percentages. Regardless of the tool used, participants found this process of peer review positive (75%), collegial (78%), supportive (61%) and non-threatening (71%). Participants reported that the peer review will improve their own classroom delivery (61%), teaching evaluation (61%) and planning (53%). The web-based tool was found to be easier to use and allowed more space than the paper-based tool. Implementation of a web-based paired peer review system can be a positive method of peer review of university classroom teaching. Pairing of teachers to review each other's classroom teaching is a promising strategy and has the potential to improve teaching in teaching universities. Copyright © 2011 Elsevier Ltd. All rights reserved.

  4. RNAHelix: computational modeling of nucleic acid structures with Watson-Crick and non-canonical base pairs.

    PubMed

    Bhattacharyya, Dhananjay; Halder, Sukanya; Basu, Sankar; Mukherjee, Debasish; Kumar, Prasun; Bansal, Manju

    2017-02-01

    Comprehensive analyses of structural features of non-canonical base pairs within a nucleic acid double helix are limited by the availability of a small number of three dimensional structures. Therefore, a procedure for model building of double helices containing any given nucleotide sequence and base pairing information, either canonical or non-canonical, is seriously needed. Here we describe a program RNAHelix, which is an updated version of our widely used software, NUCGEN. The program can regenerate duplexes using the dinucleotide step and base pair orientation parameters for a given double helical DNA or RNA sequence with defined Watson-Crick or non-Watson-Crick base pairs. The original structure and the corresponding regenerated structure of double helices were found to be very close, as indicated by the small RMSD values between positions of the corresponding atoms. Structures of several usual and unusual double helices have been regenerated and compared with their original structures in terms of base pair RMSD, torsion angles and electrostatic potentials and very high agreements have been noted. RNAHelix can also be used to generate a structure with a sequence completely different from an experimentally determined one or to introduce single to multiple mutation, but with the same set of parameters and hence can also be an important tool in homology modeling and study of mutation induced structural changes.

  5. Structural energetics of the adenine tract from an intrinsic transcription terminator.

    PubMed

    Huang, Yuegao; Weng, Xiaoli; Russu, Irina M

    2010-04-02

    Intrinsic transcription termination sites generally contain a tract of adenines in the DNA template that yields a tract of uracils at the 3' end of the nascent RNA. To understand how this base sequence contributes to termination of transcription, we have investigated two nucleic acid structures. The first is the RNA-DNA hybrid that contains the uracil tract 5'-rUUUUUAU-3' from the tR2 intrinsic terminator of bacteriophage lambda. The second is the homologous DNA-DNA duplex that contains the adenine tract 5'-dATAAAAA-3'. This duplex is present at the tR2 site when the DNA is not transcribed. The opening and the stability of each rU-dA/dT-dA base pair in the two structures are characterized by imino proton exchange and nuclear magnetic resonance spectroscopy. The results reveal concerted opening of the central rU-dA base pairs in the RNA-DNA hybrid. Furthermore, the stability profile of the adenine tract in the RNA-DNA hybrid is very different from that of the tract in the template DNA-DNA duplex. In the RNA-DNA hybrid, the stabilities of rU-dA base pairs range from 4.3 to 6.5 kcal/mol (at 10 degrees C). The sites of lowest stability are identified at the central positions of the tract. In the template DNA-DNA duplex, the dT-dA base pairs are more stable than the corresponding rU-dA base pairs in the hybrid by 0.9 to 4.6 kcal/mol and, in contrast to the RNA-DNA hybrid, the central base pairs have the highest stability. These results suggest that the central rU-dA/dT-dA base pairs in the adenine tract make the largest energetic contributions to transcription termination by promoting both the dissociation of the RNA transcript and the closing of the transcription bubble. The results also suggest that the high stability of dT-dA base pairs in the DNA provides a signal for the pausing of RNA polymerase at the termination site. Copyright 2010 Elsevier Ltd. All rights reserved.

  6. Stringent Nucleotide Recognition by the Ribosome at the Middle Codon Position

    PubMed Central

    Liu, Wei; Shin, Dongwon; Ng, Martin; Sanbonmatsu, Karissa Y.; Tor, Yitzhak; Cooperman, Barry S.

    2017-01-01

    Accurate translation of the genetic code depends on mRNA:tRNA codon:anticodon base pairing. Here we exploit an emissive, isosteric adenosine surrogate that allows direct measurement of the kinetics of codon:anticodon base formation during protein synthesis. Our results suggest that codon:anticodon base pairing is subject to tighter constraints at the middle position than at the 5′- and 3′-positions, and further suggest a sequential mechanism of formation of the three base pairs in the codon:anticodon helix. PMID:28850078

  7. The Effects of Reinforcer Pairing and Fading on Preschoolers' Snack Selections

    ERIC Educational Resources Information Center

    Solberg, Katherine M.; Hanley, Gregory P.; Layer, Stacy A.; Ingvarsson, Einar T.

    2007-01-01

    The effects of reinforcement pairing and fading on preschoolers' snack selections were evaluated in a multiple baseline design. Baseline preferences for snack options were assessed via repeated paired-item preference assessments. Edible, social, and activity-based reinforcers were then exclusively paired with a less preferred snack option. Once…

  8. A systematic molecular dynamics study of nearest-neighbor effects on base pair and base pair step conformations and fluctuations in B-DNA

    PubMed Central

    Lavery, Richard; Zakrzewska, Krystyna; Beveridge, David; Bishop, Thomas C.; Case, David A.; Cheatham, Thomas; Dixit, Surjit; Jayaram, B.; Lankas, Filip; Laughton, Charles; Maddocks, John H.; Michon, Alexis; Osman, Roman; Orozco, Modesto; Perez, Alberto; Singh, Tanya; Spackova, Nada; Sponer, Jiri

    2010-01-01

    It is well recognized that base sequence exerts a significant influence on the properties of DNA and plays a significant role in protein–DNA interactions vital for cellular processes. Understanding and predicting base sequence effects requires an extensive structural and dynamic dataset which is currently unavailable from experiment. A consortium of laboratories was consequently formed to obtain this information using molecular simulations. This article describes results providing information not only on all 10 unique base pair steps, but also on all possible nearest-neighbor effects on these steps. These results are derived from simulations of 50–100 ns on 39 different DNA oligomers in explicit solvent and using a physiological salt concentration. We demonstrate that the simulations are converged in terms of helical and backbone parameters. The results show that nearest-neighbor effects on base pair steps are very significant, implying that dinucleotide models are insufficient for predicting sequence-dependent behavior. Flanking base sequences can notably lead to base pair step parameters in dynamic equilibrium between two conformational sub-states. Although this study only provides limited data on next-nearest-neighbor effects, we suggest that such effects should be analyzed before attempting to predict the sequence-dependent behavior of DNA. PMID:19850719

  9. Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase ι: Hoogsteen or Watson-Crick base pairing?†

    PubMed Central

    Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

    2009-01-01

    Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase ι (polι) is a bypass polymerase of the Y family. Crystal structures of polι suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that polι is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetyl-aminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in polι for bypass of dG-AAF. In polι with Hoogsteen paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that polι would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for polι in lesion bypass. PMID:19072536

  10. Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase iota: Hoogsteen or Watson-Crick base pairing?

    PubMed

    Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

    2009-01-13

    Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase iota (poliota) is a bypass polymerase of the Y family. Crystal structures of poliota suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that poliota is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetylaminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in poliota for bypass of dG-AAF. In poliota with Hoogsteen-paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick-paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that poliota would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for poliota in lesion bypass.

  11. Base drive circuit

    DOEpatents

    Lange, Arnold C.

    1995-01-01

    An improved base drive circuit (10) having a level shifter (24) for providing bistable input signals to a pair of non-linear delays (30, 32). The non-linear delays (30, 32) provide gate control to a corresponding pair of field effect transistors (100, 106) through a corresponding pair of buffer components (88, 94). The non-linear delays (30, 32) provide delayed turn-on for each of the field effect transistors (100, 106) while an associated pair of transistors (72, 80) shunt the non-linear delays (30, 32) during turn-off of the associated field effect transistor (100, 106).

  12. Discrimination of Single Base Pair Differences Among Individual DNA Molecules Using a Nanopore

    NASA Technical Reports Server (NTRS)

    Vercoutere, Wenonah; DeGuzman, Veronica

    2003-01-01

    The protein toxin alpha-hemolysin form nanometer scale channels across lipid membranes. Our lab uses a single channel in an artificial lipid bilayer in a patch clamp device to capture and examine individual DNA molecules. This nanopore detector used with a support vector machine (SVM) can analyze DNA hairpin molecules on the millisecond time scale. We distinguish duplex stem length, base pair mismatches, loop length, and single base pair differences. The residual current fluxes also reveal structural molecular dynamics elements. DNA end-fraying (terminal base pair dissociation) can be observed as near full blockades, or spikes, in current. This technique can be used to investigate other biological processes dependent on DNA end-fraying, such as the processing of HIV DNA by HIV integrase.

  13. Triple helical DNA in a duplex context and base pair opening

    PubMed Central

    Esguerra, Mauricio; Nilsson, Lennart; Villa, Alessandra

    2014-01-01

    It is fundamental to explore in atomic detail the behavior of DNA triple helices as a means to understand the role they might play in vivo and to better engineer their use in genetic technologies, such as antigene therapy. To this aim we have performed atomistic simulations of a purine-rich antiparallel triple helix stretch of 10 base triplets flanked by canonical Watson–Crick double helices. At the same time we have explored the thermodynamic behavior of a flipping Watson–Crick base pair in the context of the triple and double helix. The third strand can be accommodated in a B-like duplex conformation. Upon binding, the double helix changes shape, and becomes more rigid. The triple-helical region increases its major groove width mainly by oversliding in the negative direction. The resulting conformations are somewhere between the A and B conformations with base pairs remaining almost perpendicular to the helical axis. The neighboring duplex regions maintain a B DNA conformation. Base pair opening in the duplex regions is more probable than in the triplex and binding of the Hoogsteen strand does not influence base pair breathing in the neighboring duplex region. PMID:25228466

  14. Multi-hop teleportation based on W state and EPR pairs

    NASA Astrophysics Data System (ADS)

    Hai-Tao, Zhan; Xu-Tao, Yu; Pei-Ying, Xiong; Zai-Chen, Zhang

    2016-05-01

    Multi-hop teleportation has significant value due to long-distance delivery of quantum information. Many studies about multi-hop teleportation are based on Bell pairs, partially entangled pairs or W state. The possibility of multi-hop teleportation constituted by partially entangled pairs relates to the number of nodes. The possibility of multi-hop teleportation constituted by double W states is after n-hop teleportation. In this paper, a multi-hop teleportation scheme based on W state and EPR pairs is presented and proved. The successful possibility of quantum information transmitted hop by hop through intermediate nodes is deduced. The possibility of successful transmission is after n-hop teleportation. Project supported by the National Natural Science Foundation of China (Grant No. 61571105), the Prospective Future Network Project of Jiangsu Province, China (Grant No. BY2013095-1-18), and the Independent Project of State Key Laboratory of Millimeter Waves, China (Grant No. Z201504).

  15. Retinal biometrics based on Iterative Closest Point algorithm.

    PubMed

    Hatanaka, Yuji; Tajima, Mikiya; Kawasaki, Ryo; Saito, Koko; Ogohara, Kazunori; Muramatsu, Chisako; Sunayama, Wataru; Fujita, Hiroshi

    2017-07-01

    The pattern of blood vessels in the eye is unique to each person because it rarely changes over time. Therefore, it is well known that retinal blood vessels are useful for biometrics. This paper describes a biometrics method using the Jaccard similarity coefficient (JSC) based on blood vessel regions in retinal image pairs. The retinal image pairs were rough matched by the center of their optic discs. Moreover, the image pairs were aligned using the Iterative Closest Point algorithm based on detailed blood vessel skeletons. For registration, perspective transform was applied to the retinal images. Finally, the pairs were classified as either correct or incorrect using the JSC of the blood vessel region in the image pairs. The proposed method was applied to temporal retinal images, which were obtained in 2009 (695 images) and 2013 (87 images). The 87 images acquired in 2013 were all from persons already examined in 2009. The accuracy of the proposed method reached 100%.

  16. How Mg2+ ion and water network affect the stability and structure of non-Watson-Crick base pairs in E. coli loop E of 5S rRNA: a molecular dynamics and reference interaction site model (RISM) study.

    PubMed

    Shanker, Sudhanshu; Bandyopadhyay, Pradipta

    2017-08-01

    The non-Watson-Crick (non-WC) base pairs of Escherichia coli loop E of 5S rRNA are stabilized by Mg 2+ ions through water-mediated interaction. It is important to know the synergic role of Mg 2+ and the water network surrounding Mg 2+ in stabilizing the non-WC base pairs of RNA. For this purpose, free energy change of the system is calculated using molecular dynamics (MD) simulation as Mg 2+ is pulled from RNA, which causes disturbance of the water network. It was found that Mg 2+ remains hexahydrated unless it is close to or far from RNA. In the pentahydrated form, Mg 2+ interacts directly with RNA. Water network has been identified by two complimentary methods; MD followed by a density-based clustering algorithm and three-dimensional-reference interaction site model. These two methods gave similar results. Identification of water network around Mg 2+ and non-WC base pairs gives a clue to the strong effect of water network on the stability of this RNA. Based on sequence analysis of all Eubacteria 5s rRNA, we propose that hexahydrated Mg 2+ is an integral part of this RNA and geometry of base pairs surrounding it adjust to accommodate the [Formula: see text]. Overall the findings from this work can help in understanding the basis of the complex structure and stability of RNA with non-WC base pairs.

  17. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Weina; Hellinga, Homme W.; Beese, Lorena S.

    Even though high-fidelity polymerases copy DNA with remarkable accuracy, some base-pair mismatches are incorporated at low frequency, leading to spontaneous mutagenesis. Using high-resolution X-ray crystallographic analysis of a DNA polymerase that catalyzes replication in crystals, we observe that a C {center_dot} A mismatch can mimic the shape of cognate base pairs at the site of incorporation. This shape mimicry enables the mismatch to evade the error detection mechanisms of the polymerase, which would normally either prevent mismatch incorporation or promote its nucleolytic excision. Movement of a single proton on one of the mismatched bases alters the hydrogen-bonding pattern such thatmore » a base pair forms with an overall shape that is virtually indistinguishable from a canonical, Watson-Crick base pair in double-stranded DNA. These observations provide structural evidence for the rare tautomer hypothesis of spontaneous mutagenesis, a long-standing concept that has been difficult to demonstrate directly.« less

  18. Highly Stable Double-Stranded DNA Containing Sequential Silver(I)-Mediated 7-Deazaadenine/Thymine Watson-Crick Base Pairs.

    PubMed

    Santamaría-Díaz, Noelia; Méndez-Arriaga, José M; Salas, Juan M; Galindo, Miguel A

    2016-05-17

    The oligonucleotide d(TX)9 , which consists of an octadecamer sequence with alternating non-canonical 7-deazaadenine (X) and canonical thymine (T) as the nucleobases, was synthesized and shown to hybridize into double-stranded DNA through the formation of hydrogen-bonded Watson-Crick base pairs. dsDNA with metal-mediated base pairs was then obtained by selectively replacing W-C hydrogen bonds by coordination bonds to central silver(I) ions. The oligonucleotide I adopts a duplex structure in the absence of Ag(+) ions, and its stability is significantly enhanced in the presence of Ag(+) ions while its double-helix structure is retained. Temperature-dependent UV spectroscopy, circular dichroism spectroscopy, and ESI mass spectrometry were used to confirm the selective formation of the silver(I)-mediated base pairs. This strategy could become useful for preparing stable metallo-DNA-based nanostructures. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Nearest-neighbor thermodynamics of deoxyinosine pairs in DNA duplexes

    PubMed Central

    Watkins, Norman E.; SantaLucia, John

    2005-01-01

    Nearest-neighbor thermodynamic parameters of the ‘universal pairing base’ deoxyinosine were determined for the pairs I·C, I·A, I·T, I·G and I·I adjacent to G·C and A·T pairs. Ultraviolet absorbance melting curves were measured and non-linear regression performed on 84 oligonucleotide duplexes with 9 or 12 bp lengths. These data were combined with data for 13 inosine containing duplexes from the literature. Multiple linear regression was used to solve for the 32 nearest-neighbor unknowns. The parameters predict the Tm for all sequences within 1.2°C on average. The general trend in decreasing stability is I·C > I·A > I·T ≈ I· G > I·I. The stability trend for the base pair 5′ of the I·X pair is G·C > C·G > A·T > T·A. The stability trend for the base pair 3′ of I·X is the same. These trends indicate a complex interplay between H-bonding, nearest-neighbor stacking, and mismatch geometry. A survey of 14 tandem inosine pairs and 8 tandem self-complementary inosine pairs is also provided. These results may be used in the design of degenerate PCR primers and for degenerate microarray probes. PMID:16264087

  20. Using Pair Programming to Teach CAD Based Engineering Graphics

    ERIC Educational Resources Information Center

    Leland, Robert P.

    2010-01-01

    Pair programming was introduced into a course in engineering graphics that emphasizes solid modeling using SolidWorks. In pair programming, two students work at a single computer, and periodically trade off roles as driver (hands on the keyboard and mouse) and navigator (discuss strategy and design issues). Pair programming was used in a design…

  1. Magnetic field homogeneity of a conical coaxial coil pair.

    PubMed

    Salazar, F J; Nieves, F J; Bayón, A; Gascón, F

    2017-09-01

    An analytical study of the magnetic field created by a double-conical conducting sheet is presented. The analysis is based on the expansion of the magnetic field in terms of Legendre polynomials. It is demonstrated analytically that the angle of the conical surface that produces a nearly homogeneous magnetic field coincides with that of a pair of loops that fulfills the Helmholtz condition. From the results obtained, we propose an electric circuit formed by pairs of isolated conducting loops tightly wound around a pair of conical surfaces, calculating numerically the magnetic field produced by this system and its heterogeneity. An experimental setup of the proposed circuit was constructed and its magnetic field was measured. The results were compared with those obtained by numerical calculation, finding a good agreement. The numerical results demonstrate a significant improvement in homogeneity in the field of the proposed pair of conical coils compared with that achieved with a simple pair of Helmholtz loops or with a double solenoid. Moreover, a new design of a double pair of conical coils based on Braunbek's four loops is also proposed to achieve greater homogeneity. Regarding homogeneity, the rating of the analyzed configurations from best to worst is as follows: (1) double pair of conical coils, (2) pair of conical coils, (3) Braunbek's four loops, (4) Helmholtz pair, and (5) solenoid pair.

  2. Magnetic field homogeneity of a conical coaxial coil pair

    NASA Astrophysics Data System (ADS)

    Salazar, F. J.; Nieves, F. J.; Bayón, A.; Gascón, F.

    2017-09-01

    An analytical study of the magnetic field created by a double-conical conducting sheet is presented. The analysis is based on the expansion of the magnetic field in terms of Legendre polynomials. It is demonstrated analytically that the angle of the conical surface that produces a nearly homogeneous magnetic field coincides with that of a pair of loops that fulfills the Helmholtz condition. From the results obtained, we propose an electric circuit formed by pairs of isolated conducting loops tightly wound around a pair of conical surfaces, calculating numerically the magnetic field produced by this system and its heterogeneity. An experimental setup of the proposed circuit was constructed and its magnetic field was measured. The results were compared with those obtained by numerical calculation, finding a good agreement. The numerical results demonstrate a significant improvement in homogeneity in the field of the proposed pair of conical coils compared with that achieved with a simple pair of Helmholtz loops or with a double solenoid. Moreover, a new design of a double pair of conical coils based on Braunbek's four loops is also proposed to achieve greater homogeneity. Regarding homogeneity, the rating of the analyzed configurations from best to worst is as follows: (1) double pair of conical coils, (2) pair of conical coils, (3) Braunbek's four loops, (4) Helmholtz pair, and (5) solenoid pair.

  3. Geometrical correlations in the nucleosomal DNA conformation and the role of the covalent bonds rigidity

    PubMed Central

    Ghorbani, Maryam; Mohammad-Rafiee, Farshid

    2011-01-01

    We develop a simple elastic model to study the conformation of DNA in the nucleosome core particle. In this model, the changes in the energy of the covalent bonds that connect the base pairs of each strand of the DNA double helix, as well as the lateral displacements and the rotation of adjacent base pairs are considered. We show that because of the rigidity of the covalent bonds in the sugar-phosphate backbones, the base pair parameters are highly correlated, especially, strong twist-roll-slide correlation in the conformation of the nucleosomal DNA is vividly observed in the calculated results. This simple model succeeds to account for the detailed features of the structure of the nucleosomal DNA, particularly, its more important base pair parameters, roll and slide, in good agreement with the experimental results. PMID:20972223

  4. Intermolecular ‘cross-torque’: the N4-cytosine propargyl residue is rotated to the ‘CH’-edge as a result of Watson–Crick interaction

    PubMed Central

    Domingo, Olwen; Hellmuth, Isabell; Jäschke, Andres; Kreutz, Christoph; Helm, Mark

    2015-01-01

    Propargyl groups are attractive functional groups for labeling purposes, as they allow CuAAC-mediated bioconjugation. Their size minimally exceeds that of a methyl group, the latter being frequent in natural nucleotide modifications. To understand under which circumstances propargyl-containing oligodeoxynucleotides preserve base pairing, we focused on the exocyclic amine of cytidine. Residues attached to the exocyclic N4 may orient away from or toward the Watson–Crick face, ensuing dramatic alteration of base pairing properties. ROESY-NMR experiments suggest a uniform orientation toward the Watson–Crick face of N4-propargyl residues in derivatives of both deoxycytidine and 5-methyl-deoxycytidine. In oligodeoxynucleotides, however, UV-melting indicated that N4-propargyl-deoxycytidine undergoes standard base pairing. This implies a rotation of the propargyl moiety toward the ‘CH’-edge as a result of base pairing on the Watson–Crick face. In oligonucleotides containing the corresponding 5-methyl-deoxycytidine derivative, dramatically reduced melting temperatures indicate impaired Watson–Crick base pairing. This was attributed to a steric clash of the propargyl moiety with the 5-methyl group, which prevents back rotation to the ‘CH’-edge, consequently preventing Watson–Crick geometry. Our results emphasize the tendency of an opposing nucleic acid strand to mechanically rotate single N4-substituents to make way for Watson–Crick base pairing, providing no steric hindrance is present on the ‘CH’-edge. PMID:25934805

  5. The tolerance to exchanges of the Watson–Crick base pair in the hammerhead ribozyme core is determined by surrounding elements

    PubMed Central

    Przybilski, Rita; Hammann, Christian

    2007-01-01

    Tertiary interacting elements are important features of functional RNA molecules, for example, in all small nucleolytic ribozymes. The recent crystal structure of a tertiary stabilized type I hammerhead ribozyme revealed a conventional Watson–Crick base pair in the catalytic core, formed between nucleotides C3 and G8. We show that any Watson–Crick base pair between these positions retains cleavage competence in two type III ribozymes. In the Arabidopsis thaliana sequence, only moderate differences in cleavage rates are observed for the different base pairs, while the peach latent mosaic viroid (PLMVd) ribozyme exhibits a preference for a pyrimidine at position 3 and a purine at position 8. To understand these differences, we created a series of chimeric ribozymes in which we swapped sequence elements that surround the catalytic core. The kinetic characterization of the resulting ribozymes revealed that the tertiary interacting loop sequences of the PLMVd ribozyme are sufficient to induce the preference for Y3–R8 base pairs in the A. thaliana hammerhead ribozyme. In contrast to this, only when the entire stem–loops I and II of the A. thaliana sequences are grafted on the PLMVd ribozyme is any Watson–Crick base pair similarly tolerated. The data provide evidence for a complex interplay of secondary and tertiary structure elements that lead, mediated by long-range effects, to an individual modulation of the local structure in the catalytic core of different hammerhead ribozymes. PMID:17666711

  6. Silver (I) as DNA glue: Ag+-mediated guanine pairing revealed by removing Watson-Crick constraints

    PubMed Central

    Swasey, Steven M.; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G.

    2015-01-01

    Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag+ is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg2+. In contrast to prior studies of Ag+ incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag+-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag+ bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag+-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science. PMID:25973536

  7. Silver (I) as DNA glue: Ag(+)-mediated guanine pairing revealed by removing Watson-Crick constraints.

    PubMed

    Swasey, Steven M; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G

    2015-05-14

    Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag(+) is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg(2+). In contrast to prior studies of Ag(+) incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag(+)-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag(+) bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag(+)-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science.

  8. Nanoenergetics and High Hydrogen Content Materials for Space Propulsion

    DTIC Science & Technology

    2014-01-28

    follows [141]: ( ) ( )2 2 , 2 ln 2 ln /Al Al p ox oxAl Al R r R a a r λ λ λ λ λ λ λ = ⎡ ⎤− − − +⎣ ⎦ (29) where ( ) ;Al Al b R a b R r...predictions of the transformation from acid -base pairs (e.g., nitric acid and ammonia) to ion pairs (e.g., NH4+ and NO3-), that is, proton transfer, in...calculations were performed to study the transformation from the stable acid -base pair for isolated formula units to stable ion pairs, as described in the

  9. Influence of Hydration on Proton Transfer in the Guanine-Cytosine Radical Cation (G•+-C) Base Pair: A Density Functional Theory Study

    PubMed Central

    Kumar, Anil; Sevilla, Michael D.

    2009-01-01

    On one-electron oxidation all molecules including DNA bases become more acidic in nature. For the GC base pair experiments suggest that a facile proton transfer takes place in the G•+-C base pair from N1 of G•+ to N3 of cytosine. This intra-base pair proton transfer reaction has been extensively considered using theoretical methods for the gas phase and it is predicted that the proton transfer is slightly unfavorable in disagreement with experiment. In the present study, we consider the effect of the first hydration layer on the proton transfer reaction in G•+-C by the use of density functional theory (DFT), B3LYP/6-31+G** calculations of the G•+-C base pair in the presence of 6 and 11 water molecules. Under the influence of hydration of 11 waters, a facile proton transfer from N1 of G•+ to N3 of C is predicted. The zero point energy (ZPE) corrected forward and backward energy barriers, for the proton transfer from N1 of G•+ to N3 of C, was found to be 1.4 and 2.6 kcal/mol, respectively. The proton transferred G•-(H+)C + 11H2O was found to be 1.2 kcal/mol more stable than G•+-C + 11H2O in agreement with experiment. The present calculation demonstrates that the inclusion of the first hydration shell around G•+-C base pair has an important effect on the internal proton transfer energetics. PMID:19485319

  10. Quantum correlation of fiber-based telecom-band photon pairs through standard loss and random media.

    PubMed

    Sua, Yong Meng; Malowicki, John; Lee, Kim Fook

    2014-08-15

    We study quantum correlation and interference of fiber-based telecom-band photon pairs with one photon of the pair experiencing multiple scattering in a random medium. We measure joint probability of two-photon detection for signal photon in a normal channel and idler photon in a channel, which is subjected to two independent conditions: standard loss (neutral density filter) and random media. We observe that both conditions degrade the correlation of signal and idler photons, and depolarization of the idler photon in random medium can enhance two-photon interference at certain relative polarization angles. Our theoretical calculation on two-photon polarization correlation and interference as a function of mean free path is in agreement with our experiment data. We conclude that quantum correlation of a polarization-entangled photon pair is better preserved than a polarization-correlated photon pair as one photon of the pair scatters through a random medium.

  11. Array based Discovery of Aptamer Pairs (Open Access Publisher’s Version)

    DTIC Science & Technology

    2014-12-11

    Array-based Discovery of Aptamer Pairs Minseon Cho,†,‡ Seung Soo Oh,‡ Jeff Nie,§ Ron Stewart,§ Monte J. Radeke,⊥ Michael Eisenstein,†,‡ Peter J...bidentate” target recognition, with affinities greatly exceeding either monovalent component. DNA aptamers are especially well-suited for such...constructs, because they can be linked via standard synthesis techniques without requiring chemical conjugation. Unfortunately, aptamer pairs are difficult

  12. Pyrrolo-dC Metal-Mediated Base Pairs in the Reverse Watson-Crick Double Helix: Enhanced Stability of Parallel DNA and Impact of 6-Pyridinyl Residues on Fluorescence and Silver-Ion Binding.

    PubMed

    Yang, Haozhe; Mei, Hui; Seela, Frank

    2015-07-06

    Reverse Watson-Crick DNA with parallel-strand orientation (ps DNA) has been constructed. Pyrrolo-dC (PyrdC) nucleosides with phenyl and pyridinyl residues linked to the 6 position of the pyrrolo[2,3-d]pyrimidine base have been incorporated in 12- and 25-mer oligonucleotide duplexes and utilized as silver-ion binding sites. Thermal-stability studies on the parallel DNA strands demonstrated extremely strong silver-ion binding and strongly enhanced duplex stability. Stoichiometric UV and fluorescence titration experiments verified that a single (2py) PyrdC-(2py) PyrdC pair captures two silver ions in ps DNA. A structure for the PyrdC silver-ion base pair that aligns 7-deazapurine bases head-to-tail instead of head-to-head, as suggested for canonical DNA, is proposed. The silver DNA double helix represents the first example of a ps DNA structure built up of bidentate and tridentate reverse Watson-Crick base pairs stabilized by a dinuclear silver-mediated PyrdC pair. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Mechanism Underlying the Nucleobase-Distinguishing Ability of Benzopyridopyrimidine (BPP).

    PubMed

    Kochman, Michał A; Bil, Andrzej; Miller, R J Dwayne

    2017-11-02

    Benzopyridopyrimidine (BPP) is a fluorescent nucleobase analogue capable of forming base pairs with adenine (A) and guanine (G) at different sites. When incorporated into oligodeoxynucleotides, it is capable of differentiating between the two purine nucleobases by virtue of the fact that its fluorescence is largely quenched when it is base-paired to guanine, whereas base-pairing to adenine causes only a slight reduction of the fluorescence quantum yield. In the present article, the photophysics of BPP is investigated through computer simulations. BPP is found to be a good charge acceptor, as demonstrated by its positive and appreciably large electron affinity. The selective quenching process is attributed to charge transfer (CT) from the purine nucleobase, which is predicted to be efficient in the BPP-G base pair, but essentially inoperative in the BPP-A base pair. The CT process owes its high selectivity to a combination of two factors: the ionization potential of guanine is lower than that of adenine, and less obviously, the site occupied by guanine enables a greater stabilization of the CT state through electrostatic interactions than the one occupied by adenine. The case of BPP illustrates that molecular recognition via hydrogen bonding can enhance the selectivity of photoinduced CT processes.

  14. Ultraviolet Absorption Induces Hydrogen-Atom Transfer in G⋅C Watson-Crick DNA Base Pairs in Solution.

    PubMed

    Röttger, Katharina; Marroux, Hugo J B; Grubb, Michael P; Coulter, Philip M; Böhnke, Hendrik; Henderson, Alexander S; Galan, M Carmen; Temps, Friedrich; Orr-Ewing, Andrew J; Roberts, Gareth M

    2015-12-01

    Ultrafast deactivation pathways bestow photostability on nucleobases and hence preserve the structural integrity of DNA following absorption of ultraviolet (UV) radiation. One controversial recovery mechanism proposed to account for this photostability involves electron-driven proton transfer (EDPT) in Watson-Crick base pairs. The first direct observation is reported of the EDPT process after UV excitation of individual guanine-cytosine (G⋅C) Watson-Crick base pairs by ultrafast time-resolved UV/visible and mid-infrared spectroscopy. The formation of an intermediate biradical species (G[-H]⋅C[+H]) with a lifetime of 2.9 ps was tracked. The majority of these biradicals return to the original G⋅C Watson-Crick pairs, but up to 10% of the initially excited molecules instead form a stable photoproduct G*⋅C* that has undergone double hydrogen-atom transfer. The observation of these sequential EDPT mechanisms across intermolecular hydrogen bonds confirms an important and long debated pathway for the deactivation of photoexcited base pairs, with possible implications for the UV photochemistry of DNA. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Duration comparison: relative stimulus differences stimulus age, and stimulus predictiveness.

    PubMed Central

    Stubbs, D A; Dreyfus, L R; Fetterman, J G; Boynton, D M; Locklin, N; Smith, L D

    1994-01-01

    Under a psychophysical trials procedure, pigeons were presented with a red light of one duration followed by a green light of a second duration. Eight geometrically spaced base durations were paired with one of four shorter and four longer durations as the alternate member of a duration pair, with different pairs randomly intermixed. One choice was reinforced if red had lasted longer than green, and a second choice was reinforced if green had lasted longer. Performance was compared when all the base durations and their pair members were included (entire-range condition) or when only the four longest base durations and their comparison durations (restricted-range condition) were used. Discrimination sensitivity decreased for longer duration pairs under both conditions, supporting a memory-based account. Sensitivity was lower under the restricted-range condition. Under both conditions, a bias to report "green as longer" increased as the second green duration increased. Bias changed as a matching function of the green-duration predictiveness of the correct choice. The results are related to a quantitative model of timing and remembering proposed by Staddon. PMID:8064211

  16. DincRNA: a comprehensive web-based bioinformatics toolkit for exploring disease associations and ncRNA function.

    PubMed

    Cheng, Liang; Hu, Yang; Sun, Jie; Zhou, Meng; Jiang, Qinghua

    2018-06-01

    DincRNA aims to provide a comprehensive web-based bioinformatics toolkit to elucidate the entangled relationships among diseases and non-coding RNAs (ncRNAs) from the perspective of disease similarity. The quantitative way to illustrate relationships of pair-wise diseases always depends on their molecular mechanisms, and structures of the directed acyclic graph of Disease Ontology (DO). Corresponding methods for calculating similarity of pair-wise diseases involve Resnik's, Lin's, Wang's, PSB and SemFunSim methods. Recently, disease similarity was validated suitable for calculating functional similarities of ncRNAs and prioritizing ncRNA-disease pairs, and it has been widely applied for predicting the ncRNA function due to the limited biological knowledge from wet lab experiments of these RNAs. For this purpose, a large number of algorithms and priori knowledge need to be integrated. e.g. 'pair-wise best, pairs-average' (PBPA) and 'pair-wise all, pairs-maximum' (PAPM) methods for calculating functional similarities of ncRNAs, and random walk with restart (RWR) method for prioritizing ncRNA-disease pairs. To facilitate the exploration of disease associations and ncRNA function, DincRNA implemented all of the above eight algorithms based on DO and disease-related genes. Currently, it provides the function to query disease similarity scores, miRNA and lncRNA functional similarity scores, and the prioritization scores of lncRNA-disease and miRNA-disease pairs. http://bio-annotation.cn:18080/DincRNAClient/. biofomeng@hotmail.com or qhjiang@hit.edu.cn. Supplementary data are available at Bioinformatics online.

  17. Localization and anharmonicity of the vibrational modes for GC Watson-Crick and Hoogsteen base pairs.

    PubMed

    Bende, Attila; Bogdan, Diana; Muntean, Cristina M; Morari, Cristian

    2011-12-01

    We present an ab initio study of the vibrational properties of cytosine and guanine in the Watson-Crick and Hoogsteen base pair configurations. The results are obtained by using two different implementations of the DFT method. We assign the vibrational frequencies to cytosine or to guanine using the vibrational density of states. Next, we investigate the importance of anharmonic corrections for the vibrational modes. In particular, the unusual anharmonic effect of the H(+) vibration in the case of the Hoogsteen base pair configuration is discussed.

  18. Self-association and base pairing of guanosine, cytidine, adenosine, and uridine in dimethyl sulfoxide solution measured by 15N nuclear magnetic resonance spectroscopy.

    PubMed Central

    Dyllick-Brenzinger, C; Sullivan, G R; Pang, P P; Roberts, J D

    1980-01-01

    The self-association of guanosine, cytidine, and adenosine and base pairing between guanosine, cytidine, adenosine, and uridine in dimethyl sulfoxide have been investigated by the variation of their 15N NMR chemical shifts with concentration and temperature. Guanosine, cytidine, and adenosine all showed evidence of self-association by hydrogen bonding. In guanosine/cytidine mixtures, a hydrogen-bonded dimer is formed; however, no base pairing could be detected with adenosine/cytidine or adenosine/uridine mixtures. PMID:6932658

  19. Sequence of retrovirus provirus resembles that of bacterial transposable elements

    NASA Astrophysics Data System (ADS)

    Shimotohno, Kunitada; Mizutani, Satoshi; Temin, Howard M.

    1980-06-01

    The nucleotide sequences of the terminal regions of an infectious integrated retrovirus cloned in the modified λ phage cloning vector Charon 4A have been elucidated. There is a 569-base pair direct repeat at both ends of the viral DNA. The cell-virus junctions at each end consist of a 5-base pair direct repeat of cell DNA next to a 3-base pair inverted repeat of viral DNA. This structure resembles that of a transposable element and is consistent with the protovirus hypothesis that retroviruses evolved from the cell genome.

  20. Extending the language of DNA molecular recognition by polyamides: unexpected influence of imidazole and pyrrole arrangement on binding affinity and specificity.

    PubMed

    Buchmueller, Karen L; Staples, Andrew M; Howard, Cameron M; Horick, Sarah M; Uthe, Peter B; Le, N Minh; Cox, Kari K; Nguyen, Binh; Pacheco, Kimberly A O; Wilson, W David; Lee, Moses

    2005-01-19

    Pyrrole (Py) and imidazole (Im) polyamides can be designed to target specific DNA sequences. The effect that the pyrrole and imidazole arrangement, plus DNA sequence, have on sequence specificity and binding affinity has been investigated using DNA melting (DeltaT(M)), circular dichroism (CD), and surface plasmon resonance (SPR) studies. SPR results obtained from a complete set of triheterocyclic polyamides show a dramatic difference in the affinity of f-ImPyIm for its cognate DNA (K(eq) = 1.9 x 10(8) M(-1)) and f-PyPyIm for its cognate DNA (K(eq) = 5.9 x 10(5) M(-1)), which could not have been anticipated prior to characterization of these compounds. Moreover, f-ImPyIm has a 10-fold greater affinity for CGCG than distamycin A has for its cognate, AATT. To understand this difference, the triamide dimers are divided into two structural groupings: central and terminal pairings. The four possible central pairings show decreasing selectivity and affinity for their respective cognate sequences: -ImPy > -PyPy- > -PyIm- approximately -ImIm-. These results extend the language of current design motifs for polyamide sequence recognition to include the use of "words" for recognizing two adjacent base pairs, rather than "letters" for binding to single base pairs. Thus, polyamides designed to target Watson-Crick base pairs should utilize the strength of -ImPy- and -PyPy- central pairings. The f/Im and f/Py terminal groups yielded no advantage for their respective C/G or T/A base pairs. The exception is with the -ImPy- central pairing, for which f/Im has a 10-fold greater affinity for C/G than f/Py has for T/A.

  1. Intermolecular interactions of trifluorohalomethanes with Lewis bases in the gas phase: an ab initio study.

    PubMed

    Wang, Yi-Siang; Yin, Chih-Chien; Chao, Sheng D

    2014-10-07

    We perform an ab initio computational study of molecular complexes with the general formula CF3X-B that involve one trifluorohalomethane CF3X (X = Cl or Br) and one of a series of Lewis bases B in the gas phase. The Lewis bases are so chosen that they provide a range of electron-donating abilities for comparison. Based on the characteristics of their electron pairs, we consider the Lewis bases with a single n-pair (NH3 and PH3), two n-pairs (H2O and H2S), two n-pairs with an unsaturated bond (H2CO and H2CS), and a single π-pair (C2H4) and two π-pairs (C2H2). The aim is to systematically investigate the influence of the electron pair characteristics and the central atom substitution effects on the geometries and energetics of the formed complexes. The counterpoise-corrected supermolecule MP2 and coupled-cluster single double with perturbative triple [CCSD(T)] levels of theory have been employed, together with a series of basis sets up to aug-cc-pVTZ. The angular and radial configurations, the binding energies, and the electrostatic potentials of the stable complexes have been compared and discussed as the Lewis base varies. For those complexes where halogen bonding plays a significant role, the calculated geometries and energetics are consistent with the σ-hole model. Upon formation of stable complexes, the C-X bond lengths shorten, while the C-X vibrational frequencies increase, thus rendering blueshifting halogen bonds. The central atom substitution usually enlarges the intermolecular bond distances while it reduces the net charge transfers, thus weakening the bond strengths. The analysis based on the σ-hole model is grossly reliable but requires suitable modifications incorporating the central atom substitution effects, in particular, when interaction components other than electrostatic contributions are involved.

  2. On the use of magnets to disrupt the physiological compass of birds.

    PubMed

    Wang, K; Mattern, E; Ritz, T

    2006-10-04

    Behavioral researchers have attached magnets to birds during orientation experiments, assuming that such magnets will disrupt their ability to obtain magnetic information. Here, we investigate the effect of an attached magnet on the ability to derive directional information from a radical-pair based compass mechanism. We outline in some detail the geometrical symmetries that would allow a bird to identify magnetic directions in a radical-pair based compass. We show that the artificial field through an attached magnet will quickly disrupt the birds' ability to distinguish pole-ward from equator-ward headings, but that much stronger fields are necessary to disrupt their ability to detect the magnetic axis. Together with estimates of the functional limits of a radical-pair based compass, our calculations suggest that artificial fields of comparable size to the geomagnetic field are not generally sufficient to render a radical-pair based compass non-functional.

  3. Orbital-selective pairing and superconductivity in iron selenides

    NASA Astrophysics Data System (ADS)

    Nica, Emilian M.; Yu, Rong; Si, Qimiao

    2017-12-01

    An important challenge in condensed matter physics is understanding iron-based superconductors. Among these systems, the iron selenides hold the record for highest superconducting transition temperature and pose especially striking puzzles regarding the nature of superconductivity. The pairing state of the alkaline iron selenides appears to be of d-wave type based on the observation of a resonance mode in neutron scattering, while it seems to be of s-wave type from the nodeless gaps observed everywhere on the Fermi surface. Here we propose an orbital-selective pairing state, dubbed sτ3, as a natural explanation of these disparate properties. The pairing function, containing a matrix τ3 in the basis of 3d-electron orbitals, does not commute with the kinetic part of the Hamiltonian. This dictates the existence of both intraband and interband pairing terms in the band basis. A spin resonance arises from a d-wave-type sign change in the intraband pairing component, whereas the quasiparticle excitation is fully gapped on the FS due to an s-wave-like form factor associated with the addition in quadrature of the intraband and interband pairing terms. We demonstrate that this pairing state is energetically favored when the electron correlation effects are orbitally selective. More generally, our results illustrate how the multiband nature of correlated electrons affords unusual types of superconducting states, thereby shedding new light not only on the iron-based materials but also on a broad range of other unconventional superconductors such as heavy fermion and organic systems.

  4. Anomeric 2'-Deoxycytidines and Silver Ions: Hybrid Base Pairs with Greatly Enhanced Stability and Efficient DNA Mismatch Detection with α-dC.

    PubMed

    Guo, Xiurong; Seela, Frank

    2017-09-04

    α-d-Nucleosides are rare in nature but can develop fascinating properties when incorporated into DNA. This work reports on the first silver-mediated base pair constructed from two anomeric nucleosides: α-dC and β-dC. The hybrid base pair was integrated into the DNA and DNA/RNA double helix. A 12-mer duplex with α-dC and β-dC pair exhibits a higher thermal stability (T m =43 °C) than that incorporating the β-dC-Ag + -β-dC homo pair (T m =34 °C). Furthermore, α-dC shows excellent mismatch discrimination for DNA single nucleotide polymorphism (SNP). All four SNPs were identified on the basis of large T m value differences measured in the presence of silver ions. High resolution melting was not required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Two-photon production of dilepton pairs in peripheral heavy ion collisions

    NASA Astrophysics Data System (ADS)

    Klein, Spencer R.

    2018-05-01

    The STAR collaboration has observed an excess production of e+e- pairs in relativistic heavy ion collisions, over the expectations from hadronic production models. The excess pairs have transverse momenta pT<150 MeV /c and are most prominent in peripheral gold-gold and uranium-uranium collisions. The pairs exhibit a peak at the J /ψ mass, but include a wide continuum, with pair invariant masses from 400 MeV/c 2 up to 2.6 GeV/c 2 . The ALICE Collaboration observes a similar excess in peripheral lead-lead collisions, but only at the J /ψ mass, without a corresponding continuum. This paper presents a calculation of the cross section and kinematic for two-photon production of e+e- pairs, and find general agreement with the STAR data. The calculation is based on the starlight simulation code, which is based on the Weizsäcker-Williams virtual photon approach. The STAR continuum observations are compatible with two-photon production of e+e- pairs. The ALICE analysis required individual muon pT be greater than 1 GeV/c; this eliminated almost all of the pairs from two-photon interactions, while leaving most of the J /ψ decays.

  6. Recent advances in mechanism-based chemotherapy drug-siRNA pairs in co-delivery systems for cancer: A review.

    PubMed

    Wang, Mingfang; Wang, Jinyu; Li, Bingcheng; Meng, Lingxin; Tian, Zhaoxing

    2017-09-01

    Co-delivery of chemotherapy drugs and siRNA for cancer therapy has achieved remarkable results according to synergistic/combined antitumor effects, and is recognized as a promising therapeutic modality. However, little attention has been paid to the extremely complex mechanisms of chemotherapy drug-siRNA pairs during co-delivery process. Proper selection of chemotherapy drug-siRNA pairs is beneficial for achieving desirable cancer therapeutic effects. Exploring the inherent principles during chemotherapy drug-siRNA pair selection for co-delivery would greatly enhanced therapeutic efficiency. To achieve ideal results, this article will systematically review current different mechanism-based chemotherapy drug-siRNA pairs for co-delivery in cancer treatment. Large-scale library screening of recent different chemotherapy drug-siRNA pairs for co-delivery would help to establish the chemotherapy drug-siRNA pair selection principle, which could pave the way for co-delivery of chemotherapy drugs and siRNA for cancer treatment in clinic. Following the inherent principle of chemotherapy drug-siRNA pair, more effective co-delivery vectors can be designed in the future. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. Light-dependent magnetoreception in birds: the crucial step occurs in the dark.

    PubMed

    Wiltschko, Roswitha; Ahmad, Margaret; Nießner, Christine; Gehring, Dennis; Wiltschko, Wolfgang

    2016-05-01

    The Radical Pair Model proposes that the avian magnetic compass is based on spin-chemical processes: since the ratio between the two spin states singlet and triplet of radical pairs depends on their alignment in the magnetic field, it can provide information on magnetic directions. Cryptochromes, blue light-absorbing flavoproteins, with flavin adenine dinucleotide as chromophore, are suggested as molecules forming the radical pairs underlying magnetoreception. When activated by light, cryptochromes undergo a redox cycle, in the course of which radical pairs are generated during photo-reduction as well as during light-independent re-oxidation. This raised the question as to which radical pair is crucial for mediating magnetic directions. Here, we present the results from behavioural experiments with intermittent light and magnetic field pulses that clearly show that magnetoreception is possible in the dark interval, pointing to the radical pair formed during flavin re-oxidation. This differs from the mechanism considered for cryptochrome signalling the presence of light and rules out most current models of an avian magnetic compass based on the radical pair generated during photo-reduction. Using the radical pair formed during re-oxidation may represent a specific adaptation of the avian magnetic compass. © 2016 The Authors.

  8. Definition of the persistence length in the coarse-grained models of DNA elasticity.

    PubMed

    Fathizadeh, A; Eslami-Mossallam, B; Ejtehadi, M R

    2012-11-01

    By considering the detailed structure of DNA in the base pair level, two possible definitions of the persistence length are compared. One definition is related to the orientation of the terminal base pairs, and the other is based on the vectors which connect two adjacent base pairs at each end of the molecule. It is shown that although these definitions approach each other for long DNA molecules, they are dramatically different on short length scales. We show analytically that the difference mostly comes from the shear flexibility of the molecule and can be used to measure the shear modulus of DNA.

  9. Pair correlations in low-lying T =0 states of odd-odd nuclei with six nucleons

    NASA Astrophysics Data System (ADS)

    Fu, G. J.; Zhao, Y. M.; Arima, A.

    2018-02-01

    In this paper, we study pair correlations in low-lying T =0 states for two typical cases of odd-odd N =Z nuclei. The first case is six nucleons in a single j =9 /2 shell, for which we study the S -broken-pair approximation, the isoscalar spin-1 pair condensation, and the isoscalar spin-aligned pair condensation, with schematic interactions. In the second case, we study pair approximations and correlation energies for 22Na, 34Cl, 46V, 62Ga, and 94Ag in multi-j shells with effective interactions. A few T =0 states are found to be well represented by isoscalar nucleon pairs. The isoscalar spin-aligned pairs play an important role for the yrast T =0 states with I ˜2 j and I ˜Imax in 22Na, 46V, and 94Ag. The overlap between the isoscalar J =1 pair wave function and the shell-model wave function is around 0.5 for the I =1 ,3 states of 34Cl and the I =1 state of 94Ag. The I =9 state of 62Ga is very well described by the isoscalar J =3 pair condensation. The broken-pair approximation (which is similar to the 2-quasiparticle excitation of the isovector pair condensation) is appropriate for quite few states, such as the I =1 -3 states of 34Cl and the I =5 state of 62Ga. The correlation energies are presented in this paper. It is noted that the picture based on nucleon-pair wave functions is not always in agreement with the picture based on correlation energies.

  10. PAIRS, The GIS-Based Incident Response System for Pennsylvania, and NASA

    NASA Technical Reports Server (NTRS)

    Conrad, Eric; Arbegast, Daniel; Maynard, Nancy; Vicente, Gilberto

    2003-01-01

    Over the past several years the Pennsylvania Departments of Environmental Protection (DEP), Health (DOH), and Agriculture (PDA) built the GIs-based Pennsylvania West Nile Surveillance System. That system has become a model for collecting data that has a field component, laboratory component, reporting and mapping component, and a public information component. Given the success of the West Nile Virus System and the events of September 11, 2001, DEP then embarked on the development of the Pennsylvania Incident Response System, or PAIRS. PAIRS is an effective GIs-based approach to providing a system for response to incidents of any kind, including terrorism because it is building upon the existing experience, infrastructure and databases that were successfully developed to respond to the West Nile Virus by DEP, DOH, and PDA. The proposed system can be described as one that supports data acquisition, laboratory forensics, decision making/response, and communications. Decision makers will have tools to view and analyze data from various sources and, at the same time, to communicate with the large numbers of people responding to the same incident. Recent collaborations with NASA partners are creating mechanisms for the PAIRS system to incorporate space-based and other remote sensing geophysical parameters relevant to public health assessment and management, such as surface temperatures, precipitation, land cover/land use change, and humidity. This presentation will describe the PAIRS system and outline the Pennsylvania-NASA collaboration for integration of space-based data into the PAIRS system.

  11. Identification in a pseudoknot of a U.G motif essential for the regulation of the expression of ribosomal protein S15.

    PubMed

    Bénard, L; Mathy, N; Grunberg-Manago, M; Ehresmann, B; Ehresmann, C; Portier, C

    1998-03-03

    The ribosomal protein S15 from Escherichia coli binds to a pseudoknot in its own messenger. This interaction is an essential step in the mechanism of S15 translational autoregulation. In a previous study, a recognition determinant for S15 autoregulation, involving a U.G wobble pair, was located in the center of stem I of the pseudoknot. In this study, an extensive mutagenesis analysis has been conducted in and around this U.G pair by comparing the effects of these mutations on the expression level of S15. The results show that the U.G wobble pair cannot be substituted by A.G, C.A, A.C, G.U, or C.G without loss of the autocontrol. In addition, the base pair C.G, adjacent to the 5' side of U, cannot be flipped or changed to another complementary base pair without also inducing derepression of translation. A unique motif, made of only two adjacent base pairs, U.G/C.G, is essential for S15 autoregulation and is presumably involved in direct recognition by the S15 protein.

  12. Identification in a pseudoknot of a U⋅G motif essential for the regulation of the expression of ribosomal protein S15

    PubMed Central

    Bénard, Lionel; Mathy, Nathalie; Grunberg-Manago, Marianne; Ehresmann, Bernard; Ehresmann, Chantal; Portier, Claude

    1998-01-01

    The ribosomal protein S15 from Escherichia coli binds to a pseudoknot in its own messenger. This interaction is an essential step in the mechanism of S15 translational autoregulation. In a previous study, a recognition determinant for S15 autoregulation, involving a U⋅G wobble pair, was located in the center of stem I of the pseudoknot. In this study, an extensive mutagenesis analysis has been conducted in and around this U⋅G pair by comparing the effects of these mutations on the expression level of S15. The results show that the U⋅G wobble pair cannot be substituted by A⋅G, C⋅A, A⋅C, G⋅U, or C⋅G without loss of the autocontrol. In addition, the base pair C⋅G, adjacent to the 5′ side of U, cannot be flipped or changed to another complementary base pair without also inducing derepression of translation. A unique motif, made of only two adjacent base pairs, U⋅G/C⋅G, is essential for S15 autoregulation and is presumably involved in direct recognition by the S15 protein. PMID:9482926

  13. MSP-HTPrimer: a high-throughput primer design tool to improve assay design for DNA methylation analysis in epigenetics.

    PubMed

    Pandey, Ram Vinay; Pulverer, Walter; Kallmeyer, Rainer; Beikircher, Gabriel; Pabinger, Stephan; Kriegner, Albert; Weinhäusel, Andreas

    2016-01-01

    Bisulfite (BS) conversion-based and methylation-sensitive restriction enzyme (MSRE)-based PCR methods have been the most commonly used techniques for locus-specific DNA methylation analysis. However, both methods have advantages and limitations. Thus, an integrated approach would be extremely useful to quantify the DNA methylation status successfully with great sensitivity and specificity. Designing specific and optimized primers for target regions is the most critical and challenging step in obtaining the adequate DNA methylation results using PCR-based methods. Currently, no integrated, optimized, and high-throughput methylation-specific primer design software methods are available for both BS- and MSRE-based methods. Therefore an integrated, powerful, and easy-to-use methylation-specific primer design pipeline with great accuracy and success rate will be very useful. We have developed a new web-based pipeline, called MSP-HTPrimer, to design primers pairs for MSP, BSP, pyrosequencing, COBRA, and MSRE assays on both genomic strands. First, our pipeline converts all target sequences into bisulfite-treated templates for both forward and reverse strand and designs all possible primer pairs, followed by filtering for single nucleotide polymorphisms (SNPs) and known repeat regions. Next, each primer pairs are annotated with the upstream and downstream RefSeq genes, CpG island, and cut sites (for COBRA and MSRE). Finally, MSP-HTPrimer selects specific primers from both strands based on custom and user-defined hierarchical selection criteria. MSP-HTPrimer produces a primer pair summary output table in TXT and HTML format for display and UCSC custom tracks for resulting primer pairs in GTF format. MSP-HTPrimer is an integrated, web-based, and high-throughput pipeline and has no limitation on the number and size of target sequences and designs MSP, BSP, pyrosequencing, COBRA, and MSRE assays. It is the only pipeline, which automatically designs primers on both genomic strands to increase the success rate. It is a standalone web-based pipeline, which is fully configured within a virtual machine and thus can be readily used without any configuration. We have experimentally validated primer pairs designed by our pipeline and shown a very high success rate of primer pairs: out of 66 BSP primer pairs, 63 were successfully validated without any further optimization step and using the same qPCR conditions. The MSP-HTPrimer pipeline is freely available from http://sourceforge.net/p/msp-htprimer.

  14. Optimal Decisions for Organ Exchanges in a Kidney Paired Donation Program.

    PubMed

    Li, Yijiang; Song, Peter X-K; Zhou, Yan; Leichtman, Alan B; Rees, Michael A; Kalbfleisch, John D

    2014-05-01

    The traditional concept of barter exchange in economics has been extended in the modern era to the area of living-donor kidney transplantation, where one incompatible donor-candidate pair is matched to another pair with a complementary incompatibility, such that the donor from one pair gives an organ to a compatible candidate in the other pair and vice versa. Kidney paired donation (KPD) programs provide a unique and important platform for living incompatible donor-candidate pairs to exchange organs in order to achieve mutual benefit. In this paper, we propose novel organ allocation strategies to arrange kidney exchanges under uncertainties with advantages, including (i) allowance for a general utility-based evaluation of potential kidney transplants and an explicit consideration of stochastic features inherent in a KPD program; and (ii) exploitation of possible alternative exchanges when the originally planned allocation cannot be fully executed. This allocation strategy is implemented using an integer programming (IP) formulation, and its implication is assessed via a data-based simulation system by tracking an evolving KPD program over a series of match runs. Extensive simulation studies are provided to illustrate our proposed approach.

  15. Optimal self-cleavage activity of the hepatitis delta virus RNA is dependent on a homopurine base pair in the ribozyme core.

    PubMed Central

    Been, M D; Perrotta, A T

    1995-01-01

    A non-Watson-Crick G.G interaction within the core region of the hepatitis delta virus (HDV) antigenomic ribozyme is required for optimal rates of self-cleavage activity. Base substitutions for either one or both G's revealed that full activity was obtained only when both G's were replaced with A's. At those positions, substitutions that generate potential Watson-Crick, G.U, heteropurine, or homopyrimidine combinations resulted in dramatically lower cleavage activity. A homopurine symmetric base pair, of the same type identified in the high-affinity binding site of the HIV RRE, is most consistent with this data. Additional features shared between the antigenomic ribozyme and the Rev binding site in the vicinity of the homopurine pairs suggest some structural similarity for this region of the two RNAs and a possible motif associated with this homopurine interaction. Evidence for a homopurine pair at the equivalent position in a modified form of the HDV genomic ribozyme was also found. With the postulated symmetric pairing scheme, large distortions in the nucleotide conformation, the sugar-phosphate backbone, or both would be necessary to accommodate this interaction at the end of a helix; we hypothesize that this distortion is critical to the structure of the active site of the ribozyme and it is stabilized by the homopurine base pair. PMID:8595561

  16. Concealed d -wave pairs in the s ± condensate of iron-based superconductors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ong, Tzen; Coleman, Piers; Schmalian, Jörg

    A central question in iron-based superconductivity is the mechanism by which the paired electrons minimize their strong mutual Coulomb repulsion. In most unconventional superconductors, Coulomb repulsion is minimized through the formation of higher angular momentum Cooper pairs, with Fermi surface nodes in the pair wavefunction. The apparent absence of such nodes in the iron-based superconductors has led to a belief they form an s-wave (s ±) singlet state, which changes sign between the electron and hole pockets. However, the multiorbital nature of these systems opens an alternative possibility. In this paper, we propose a new class of s ± statemore » containing a condensate of d-wave Cooper pairs, concealed by their entanglement with the iron orbitals. By combining the d-wave (L=2) motion of the pairs with the internal angular momenta I =2 of the iron orbitals to make a singlet (J =L+I =0), an s ± superconductor with a nontrivial topology is formed. This scenario allows us to understand the development of octet nodes in potassium-doped Ba 1$-$xK XFe 2As 2 as a reconfiguration of the orbital and internal angular momentum into a high spin (J =L+I =4) state; the reverse transition under pressure into a fully gapped state can then be interpreted as a return to the low-spin singlet. Finally, the formation of orbitally entangled pairs is predicted to give rise to a shift in the orbital content at the Fermi surface, which can be tested via laser-based angle-resolved photoemission spectroscopy.« less

  17. Concealed d -wave pairs in the s ± condensate of iron-based superconductors

    DOE PAGES

    Ong, Tzen; Coleman, Piers; Schmalian, Jörg

    2016-05-02

    A central question in iron-based superconductivity is the mechanism by which the paired electrons minimize their strong mutual Coulomb repulsion. In most unconventional superconductors, Coulomb repulsion is minimized through the formation of higher angular momentum Cooper pairs, with Fermi surface nodes in the pair wavefunction. The apparent absence of such nodes in the iron-based superconductors has led to a belief they form an s-wave (s ±) singlet state, which changes sign between the electron and hole pockets. However, the multiorbital nature of these systems opens an alternative possibility. In this paper, we propose a new class of s ± statemore » containing a condensate of d-wave Cooper pairs, concealed by their entanglement with the iron orbitals. By combining the d-wave (L=2) motion of the pairs with the internal angular momenta I =2 of the iron orbitals to make a singlet (J =L+I =0), an s ± superconductor with a nontrivial topology is formed. This scenario allows us to understand the development of octet nodes in potassium-doped Ba 1$-$xK XFe 2As 2 as a reconfiguration of the orbital and internal angular momentum into a high spin (J =L+I =4) state; the reverse transition under pressure into a fully gapped state can then be interpreted as a return to the low-spin singlet. Finally, the formation of orbitally entangled pairs is predicted to give rise to a shift in the orbital content at the Fermi surface, which can be tested via laser-based angle-resolved photoemission spectroscopy.« less

  18. Concealed d-wave pairs in the s± condensate of iron-based superconductors.

    PubMed

    Ong, Tzen; Coleman, Piers; Schmalian, Jörg

    2016-05-17

    A central question in iron-based superconductivity is the mechanism by which the paired electrons minimize their strong mutual Coulomb repulsion. In most unconventional superconductors, Coulomb repulsion is minimized through the formation of higher angular momentum Cooper pairs, with Fermi surface nodes in the pair wavefunction. The apparent absence of such nodes in the iron-based superconductors has led to a belief they form an s-wave ([Formula: see text]) singlet state, which changes sign between the electron and hole pockets. However, the multiorbital nature of these systems opens an alternative possibility. Here, we propose a new class of [Formula: see text] state containing a condensate of d-wave Cooper pairs, concealed by their entanglement with the iron orbitals. By combining the d-wave ([Formula: see text]) motion of the pairs with the internal angular momenta [Formula: see text] of the iron orbitals to make a singlet ([Formula: see text]), an [Formula: see text] superconductor with a nontrivial topology is formed. This scenario allows us to understand the development of octet nodes in potassium-doped Ba1-x KXFe2As2 as a reconfiguration of the orbital and internal angular momentum into a high spin ([Formula: see text]) state; the reverse transition under pressure into a fully gapped state can then be interpreted as a return to the low-spin singlet. The formation of orbitally entangled pairs is predicted to give rise to a shift in the orbital content at the Fermi surface, which can be tested via laser-based angle-resolved photoemission spectroscopy.

  19. Organic ion association in aqueous phase and ab initio-based force fields: The case of carboxylate/ammonium salts

    NASA Astrophysics Data System (ADS)

    Houriez, Céline; Vallet, Valérie; Réal, Florent; Meot-Ner Mautner, Michael; Masella, Michel

    2017-10-01

    We performed molecular dynamics simulations of carboxylate/methylated ammonium ion pairs solvated in bulk water and of carboxylate/methylated ammonium salt solutions at ambient conditions using an ab initio-based polarizable force field whose parameters are assigned to reproduce only high end quantum computations, at the Møller-Plesset second-order perturbation theory/complete basis set limit level, regarding single ions and ion pairs as isolated and micro-hydrated in gas phase. Our results agree with the available experimental results regarding carboxylate/ammonium salt solutions. For instance, our force field approach predicts the percentage of acetate associated with ammonium ions in CH3 COO-/CH3 NH3+ solutions at the 0.2-0.8M concentration scale to range from 14% to 35%, in line with the estimates computed from the experimental ion association constant in liquid water. Moreover our simulations predict the number of water molecules released from the ion first hydration shell to the bulk upon ion association to be about 2.0 ± 0.6 molecules for acetate/protonated amine ion pairs, 3.1 ± 1.5 molecules for the HCOO-/NH4+ pair and 3.3 ± 1.2 molecules for the CH3COO-/(CH3)4N+ pair. For protonated amine-based ion pairs, these values are in line with experiment for alkali/halide pairs solvated in bulk water. All these results demonstrate the promising feature of ab initio-based force fields, i.e., their capacity in accurately modeling chemical systems that cannot be readily investigated using available experimental techniques.

  20. New Common Proper-Motion Pairs with R.A. Between 00h and 01h

    NASA Astrophysics Data System (ADS)

    Caballero, Rafael

    2015-07-01

    This paper presents 37 new common proper-motion pairs. The new pairs have been obtained employing a semi-automatic procedure based on the inspection of images using the tool Aladin, completed with information obtained from the catalogs available at VizieR. All the pairs fulfill the Halbwachs criteria, employed to increase the probability of a physical bond between the two components.

  1. Free energy landscape and transition pathways from Watson–Crick to Hoogsteen base pairing in free duplex DNA

    PubMed Central

    Yang, Changwon; Kim, Eunae; Pak, Youngshang

    2015-01-01

    Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson–Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine–thymine (A–T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. PMID:26250116

  2. Base-Pairing Systems Related to TNA: alpha-Threofuranosyl Oligonucleotides Containing Phosphoramidate Linkages

    NASA Technical Reports Server (NTRS)

    Meyer, Michael (Technical Monitor); Wu, Xiaolin; Guntha, Sreenivasulu; Ferenclc, Mathias; Krishnamurthy, Ramanarayanan; Eschenmoser, Albert

    2002-01-01

    (3'NH)- and (2'NH)-TNA, two isomeric phosphoramidate analogues of TNA (alpha-threofuranosyl-(3'-2') oligonucleotides), are shown to be efficient Watson-Crick base-pairing systems and to undergo intersystem crosspairing with TNA, RNA, and DNA.

  3. Control of box C/D snoRNP assembly by N6-methylation of adenine.

    PubMed

    Huang, Lin; Ashraf, Saira; Wang, Jia; Lilley, David Mj

    2017-09-01

    N 6 -methyladenine is the most widespread mRNA modification. A subset of human box C/D snoRNA species have target GAC sequences that lead to formation of N 6 -methyladenine at a key trans Hoogsteen-sugar A·G base pair, of which half are methylated in vivo The GAC target is conserved only in those that are methylated. Methylation prevents binding of the 15.5-kDa protein and the induced folding of the RNA Thus, the assembly of the box C/D snoRNP could in principle be regulated by RNA methylation at its critical first stage. Crystallography reveals that N 6 -methylation of adenine prevents the formation of trans Hoogsteen-sugar A·G base pairs, explaining why the box C/D RNA cannot adopt its kinked conformation. More generally, our data indicate that sheared A·G base pairs (but not Watson-Crick base pairs) are more susceptible to disruption by N 6 mA methylation and are therefore possible regulatory sites. The human signal recognition particle RNA and many related Alu retrotransposon RNA species are also methylated at N6 of an adenine that forms a sheared base pair with guanine and mediates a key tertiary interaction. © 2017 The Authors. Published under the terms of the CC BY 4.0 license.

  4. Guide-substrate base-pairing requirement for box H/ACA RNA-guided RNA pseudouridylation.

    PubMed

    De Zoysa, Meemanage D; Wu, Guowei; Katz, Raviv; Yu, Yi-Tao

    2018-06-05

    Box H/ACA RNAs are a group of small RNAs found in abundance in eukaryotes (as well as in archaea). Although their sequences differ, eukaryotic box H/ACA RNAs all share the same unique hairpin-hinge-hairpin-tail structure. Almost all of them function as guides that primarily direct pseudouridylation of rRNAs and spliceosomal snRNAs at specific sites. Although box H/ACA RNA-guided pseudouridylation has been extensively studied, the detailed rules governing this reaction, especially those concerning the guide RNA-substrate RNA base-pairing interactions that determine the specificity and efficiency of pseudouridylation, are still not exactly clear. This is particularly relevant given that the lengths of the guide sequences involved in base-pairing vary from one box H/ACA RNA to another. Here, we carry out a detailed investigation into guide-substrate base-pairing interactions, and identify the minimum number of base-pairs (8), required for RNA-guided pseudouridylation. In addition, we find that the pseudouridylation pocket, present in each hairpin of box H/ACA RNA, exhibits flexibility in fitting slightly different substrate sequences. Our results are consistent across three independent pseudouridylation pockets tested, suggesting that our findings are generally applicable to box H/ACA RNA-guided RNA pseudouridylation. Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  5. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Szulik, Marta W.; Pallan, Pradeep S.; Nocek, Boguslaw

    5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson–Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5'-CG-3' sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5'-T 8X 9G 10-3' sequence of the DDD, were compared. The presence of 5caC at the X9 base increased the stability of the DDD, whereas 5hmC or 5fC didmore » not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A 5:T 8, whereas 5caC did not. At the oxidized base pair G 4:X 9, 5fC exhibited an increase in the imino proton exchange rate and the calculated k op. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C 3:G 10. No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G 4:X 9; each favored Watson–Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N 4 exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. Furthermore, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes.« less

  6. The physico-chemical "anatomy" of the tautomerization through the DPT of the biologically important pairs of hypoxanthine with DNA bases: QM and QTAIM perspectives.

    PubMed

    Brovarets', Ol'ha O; Zhurakivsky, Roman O; Hovorun, Dmytro M

    2013-10-01

    The biologically important tautomerization of the Hyp·Cyt, Hyp·Thy and Hyp·Hyp base pairs to the Hyp·Cyt, Hyp·Thy and Hyp·Hyp base pairs, respectively, by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ε = 4) corresponding to hydrophobic interfaces of protein-nucleic acid interactions by combining theoretical investigations at the B3LYP/6-311++G(d,p) level of QM theory with QTAIM topological analysis. Based on the sweeps of the energetic, electron-topological, geometric and polar parameters, which describe the course of the tautomerization along the intrinsic reaction coordinate (IRC), it was proved that the tautomerization through the DPT is concerted and asynchronous process for the Hyp·Cyt and Hyp·Thy base pairs, while concerted and synchronous for the Hyp·Hyp homodimer. The continuum with ε = 4 does not affect qualitatively the course of the tautomerization reaction for all studied complexes. The nine key points along the IRC of the Hyp·Cyt↔Hyp·Cyt and Hyp·Thy↔Hyp·Thy tautomerizations and the six key points of the Hyp·Hyp↔Hyp·Hyp tautomerization have been identified and fully characterized. These key points could be considered as electron-topological "fingerprints" of concerted asynchronous (for Hyp·Cyt and Hyp·Thy) or synchronous (for Hyp·Hyp) tautomerization process via the DPT. It was found, that in the Hyp·Cyt, Hyp·Thy, Hyp·Hyp and Hyp·Hyp base pairs all H-bonds are significantly cooperative and mutually reinforce each other, while the C2H…O2 H-bond in the Hyp·Cyt base pair and the O6H…O4 H-bond in the Hyp·Thy base pair behave anti-cooperatively, i.e., they become weakened, while two others become strengthened.

  7. Effect of proton transfer on the electronic coupling in DNA

    NASA Astrophysics Data System (ADS)

    Rak, Janusz; Makowska, Joanna; Voityuk, Alexander A.

    2006-06-01

    The effects of single and double proton transfer within Watson-Crick base pairs on donor-acceptor electronic couplings, Vda, in DNA are studied on the bases of quantum chemical calculations. Four dimers [AT,AT], [GC,GC], [GC,AT] and [GC,TA)] are considered. Three techniques - the generalized Mulliken-Hush scheme, the fragment charge method and the diabatic states method - are employed to estimate Vda for hole transfer between base pairs. We show that both single- and double proton transfer (PT) reactions may substantially affect the electronic coupling in DNA. The electronic coupling in [AT,AT] is predicted to be most sensitive to PT. Single PT within the first base pair in the dimer leads to increase in the hole transfer efficiency by a factor of 4, while proton transfer within the second pair should substantially, by 2.7 times, decrease the rate of charge transfer. Thus, directional asymmetry of the PT effects on the electronic coupling is predicted. The changes in the Vda matrix elements correlate with the topological properties of orbitals of donor and acceptor and can be qualitatively rationalized in terms of resonance structures of donor and acceptor. Atomic pair contributions to the Vda matrix elements are also analyzed.

  8. Functional network connectivity analysis based on partial correlation in Alzheimer's disease

    NASA Astrophysics Data System (ADS)

    Zhang, Nan; Guan, Xiaoting; Zhang, Yumei; Li, Jingjing; Chen, Hongyan; Chen, Kewei; Fleisher, Adam; Yao, Li; Wu, Xia

    2009-02-01

    Functional network connectivity (FNC) measures the temporal dependency among the time courses of functional networks. However, the marginal correlation between two networks used in the classic FNC analysis approach doesn't separate the FNC from the direct/indirect effects of other networks. In this study, we proposed an alternative approach based on partial correlation to evaluate the FNC, since partial correlation based FNC can reveal the direct interaction between a pair of networks, removing dependencies or influences from others. Previous studies have demonstrated less task-specific activation and less rest-state activity in Alzheimer's disease (AD). We applied present approach to contrast FNC differences of resting state network (RSN) between AD and normal controls (NC). The fMRI data under resting condition were collected from 15 AD and 16 NC. FNC was calculated for each pair of six RSNs identified using Group ICA, thus resulting in 15 (2 out of 6) pairs for each subject. Partial correlation based FNC analysis indicated 6 pairs significant differences between groups, while marginal correlation only revealed 2 pairs (involved in the partial correlation results). Additionally, patients showed lower correlation than controls among most of the FNC differences. Our results provide new evidences for the disconnection hypothesis in AD.

  9. Comparative reactivity of mismatched and unpaired bases in relation to their type and surroundings. Chemical cleavage of DNA mismatches in mutation detection analysis.

    PubMed

    Yakubovskaya, Marianna G; Belyakova, Anna A; Gasanova, Viktoria K; Belitsky, Gennady A; Dolinnaya, Nina G

    2010-07-01

    Systematic study of chemical reactivity of non-Watson-Crick base pairs depending on their type and microenvironment was performed on a model system that represents two sets of synthetic DNA duplexes with all types of mismatched and unmatched bases flanked by T.A or G.C pairs. Using comparative cleavage pattern analysis, we identified the main and additional target bases and performed quantitative study of the time course and efficacy of DNA modification caused by potassium permanganate or hydroxylamine. Potassium permanganate in combination with tetraethylammonium chloride was shown to induce DNA cleavage at all mismatched or bulged T residues, as well as at thymines of neighboring canonical pairs. Other mispaired (bulged) bases and thymine residues located on the second position from the mismatch site were not the targets for KMnO(4) attack. In contrast, hydroxylamine cleaved only heteroduplexes containing mismatched or unmatched C residues, and did not modify adjacent cytosines. However when G.C pairs flank bulged C residue, neighboring cytosines are also attacked by hydroxylamine due to defect migration. Chemical reactivity of target bases was shown to correlate strongly with the local disturbance of DNA double helix at mismatch or bulge site. With our model system, we were able to prove the absence of false-negative and false-positive results. Portion of heteroduplex reliably revealed in a mixture with corresponding homoduplex consists of 5% for bulge bases and "open" non-canonical pairs, and 10% for wobble base pairs giving minimal violations in DNA structure. This study provides a complete understanding of the principles of mutation detection methodology based on chemical cleavage of mismatches and clarifies the advantages and limitations of this approach in various biological and conformational studies of DNA. Copyright 2010 Elsevier Masson SAS. All rights reserved.

  10. A Heterogeneous Metal-Free Catalyst for Hydrogenation: Lewis Acid-Base Pairs Integrated into a Carbon Lattice.

    PubMed

    Ding, Yuxiao; Huang, Xing; Yi, Xianfeng; Qiao, Yunxiang; Sun, Xiaoyan; Zheng, Anmin; Su, Dang Sheng

    2018-06-04

    Designing heterogeneous metal-free catalysts for hydrogenation is a long-standing challenge in catalysis. Nanodiamond-based carbon materials were prepared that are surface-doped with electron-rich nitrogen and electron-deficient boron. The two heteroatoms are directly bonded to each other to form unquenched Lewis pairs with infinite π-electron donation from the surrounding graphitic structure. Remarkably, these Lewis pairs can split H 2 to form H + /H - pairs, which subsequently serve as the active species for hydrogenation of different substrates. This unprecedented finding sheds light on the uptake of H 2 across carbon-based materials and suggests that dual Lewis acidity-basicity on the carbon surface may be used to heterogeneously activate a variety of small molecules. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Action-outcome learning and prediction shape the window of simultaneity of audiovisual outcomes.

    PubMed

    Desantis, Andrea; Haggard, Patrick

    2016-08-01

    To form a coherent representation of the objects around us, the brain must group the different sensory features composing these objects. Here, we investigated whether actions contribute in this grouping process. In particular, we assessed whether action-outcome learning and prediction contribute to audiovisual temporal binding. Participants were presented with two audiovisual pairs: one pair was triggered by a left action, and the other by a right action. In a later test phase, the audio and visual components of these pairs were presented at different onset times. Participants judged whether they were simultaneous or not. To assess the role of action-outcome prediction on audiovisual simultaneity, each action triggered either the same audiovisual pair as in the learning phase ('predicted' pair), or the pair that had previously been associated with the other action ('unpredicted' pair). We found the time window within which auditory and visual events appeared simultaneous increased for predicted compared to unpredicted pairs. However, no change in audiovisual simultaneity was observed when audiovisual pairs followed visual cues, rather than voluntary actions. This suggests that only action-outcome learning promotes temporal grouping of audio and visual effects. In a second experiment we observed that changes in audiovisual simultaneity do not only depend on our ability to predict what outcomes our actions generate, but also on learning the delay between the action and the multisensory outcome. When participants learned that the delay between action and audiovisual pair was variable, the window of audiovisual simultaneity for predicted pairs increased, relative to a fixed action-outcome pair delay. This suggests that participants learn action-based predictions of audiovisual outcome, and adapt their temporal perception of outcome events based on such predictions. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  12. Age-related Associative Memory Deficits in Value-based Remembering: The Contribution of Agenda-based Regulation and Strategy Use

    PubMed Central

    Ariel, Robert; Price, Jodi; Hertzog, Christopher

    2015-01-01

    Value-based remembering in free recall tasks may be spared from the typical age-related cognitive decline observed for episodic memory. However, it is unclear whether value-based remembering for associative information is also spared from age-related cognitive decline. The current experiments evaluated the contribution of agenda-based based regulation and strategy use during study to age differences and similarities in value-based remembering of associative information. Participants studied word pairs (Experiments 1-2) or single words (Experiment 2) slated with different point values by moving a mouse controlled cursor to different spatial locations to reveal either items for study or the point value associated with remembering each item. Some participants also provided strategy reports for each item. Younger and older adults allocated greater time to studying high than low valued information, reported using normatively effective encoding strategies to learn high-valued pairs, and avoided study of low-valued pairs. As a consequence, both age groups selectively remembered more high than low-valued items. Despite nearly identical regulatory behavior, an associative memory deficit for older adults was present for high valued pairs. Age differences in value-based remembering did not occur when the materials were word lists. Fluid intelligence also moderated the effectiveness of older adults’ strategy use for high valued pairs (Experiment 2). These results suggest that age differences in associative value-based remembering may be due to some older adults’ gleaning less benefit from using normatively effective encoding strategies rather than age differences in metacognitive self-regulation per se. PMID:26523692

  13. Why the tautomerization of the G·C Watson-Crick base pair via the DPT does not cause point mutations during DNA replication? QM and QTAIM comprehensive analysis.

    PubMed

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2014-01-01

    The ground-state tautomerization of the G·C Watson-Crick base pair by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ϵ = 4), corresponding to a hydrophobic interface of protein-nucleic acid interactions, using DFT and MP2 levels of quantum-mechanical (QM) theory and quantum theory "Atoms in molecules" (QTAIM). Based on the sweeps of the electron-topological, geometric, polar, and energetic parameters, which describe the course of the G·C ↔ G*·C* tautomerization (mutagenic tautomers of the G and C bases are marked with an asterisk) through the DPT along the intrinsic reaction coordinate (IRC), it was proved that it is, strictly speaking, a concerted asynchronous process both at the DFT and MP2 levels of theory, in which protons move with a small time gap in vacuum, while this time delay noticeably increases in the continuum with ϵ = 4. It was demonstrated using the conductor-like polarizable continuum model (CPCM) that the continuum with ϵ = 4 does not qualitatively affect the course of the tautomerization reaction. The DPT in the G·C Watson-Crick base pair occurs without any intermediates both in vacuum and in the continuum with ϵ = 4 at the DFT/MP2 levels of theory. The nine key points along the IRC of the G·C base pair tautomerization, which could be considered as electron-topological "fingerprints" of a concerted asynchronous process of the tautomerization via the DPT, have been identified and fully characterized. These key points have been used to define the reactant, transition state, and product regions of the DPT reaction in the G·C base pair. Analysis of the energetic characteristics of the H-bonds allows us to arrive at a definite conclusion that the middle N1H⋯N3/N3H⋯N1 and the lower N2H⋯O2/N2H⋯O2 parallel H-bonds in the G·C/G*·C* base pairs, respectively, are anticooperative, that is, the strengthening of the middle H-bond is accompanied by the weakening of the lower H-bond. At that point, the upper N4H⋯O6 and O6H⋯N4 H-bonds in the G·C and G*·C* base pairs, respectively, remain constant at the changes of the middle and the lower H-bonds at the beginning and at the ending of the G·C ↔ G*·C* tautomerization. Aiming to answer the question posed in the title of the article, we established that the G*·C* Löwdin's base pair satisfies all the requirements necessary to cause point mutations in DNA except its lifetime, which is much less than the period of time required for the replication machinery to forcibly dissociate a base pair into the monomers (several ns) during DNA replication. So, from the physicochemical point of view, the G*·C* Löwdin's base pair cannot be considered as a source of point mutations arising during DNA replication.

  14. Error-correcting pairs for a public-key cryptosystem

    NASA Astrophysics Data System (ADS)

    Pellikaan, Ruud; Márquez-Corbella, Irene

    2017-06-01

    Code-based Cryptography (CBC) is a powerful and promising alternative for quantum resistant cryptography. Indeed, together with lattice-based cryptography, multivariate cryptography and hash-based cryptography are the principal available techniques for post-quantum cryptography. CBC was first introduced by McEliece where he designed one of the most efficient Public-Key encryption schemes with exceptionally strong security guarantees and other desirable properties that still resist to attacks based on Quantum Fourier Transform and Amplitude Amplification. The original proposal, which remains unbroken, was based on binary Goppa codes. Later, several families of codes have been proposed in order to reduce the key size. Some of these alternatives have already been broken. One of the main requirements of a code-based cryptosystem is having high performance t-bounded decoding algorithms which is achieved in the case the code has a t-error-correcting pair (ECP). Indeed, those McEliece schemes that use GRS codes, BCH, Goppa and algebraic geometry codes are in fact using an error-correcting pair as a secret key. That is, the security of these Public-Key Cryptosystems is not only based on the inherent intractability of bounded distance decoding but also on the assumption that it is difficult to retrieve efficiently an error-correcting pair. In this paper, the class of codes with a t-ECP is proposed for the McEliece cryptosystem. Moreover, we study the hardness of distinguishing arbitrary codes from those having a t-error correcting pair.

  15. Exploring the Limits of DNA Size: Naphtho-homologated DNA Bases and Pairs

    PubMed Central

    Lee, Alex H. F.; Kool, Eric T.

    2008-01-01

    A new design for DNA bases and base pairs is described in which the pyrimidine bases are widened by naphtho-homologation. Two naphtho-homologated deoxyribosides, dyyT (1) and dyyC (2) were synthesized and could be incorporated into oligonucleotides as suitably protected phosphoramidite derivatives. The deoxyribosides were found to be fluorescent, with emission maxima at 446 and 433 nm, respectively. Studies with single substitutions of 1 and 2 in the natural DNA context revealed exceptionally strong base stacking propensity for both. Sequences containing multiple substitutions of 1 and 2 paired opposite adenine and guanine were subsequently mixed and studied by several analytical methods. Data from UV mixing experiments, FRET measurements, fluorescence quenching experiments, and hybridizations on beads suggest that complementary “doublewide DNA” (yyDNA) strands may self-assemble into helical complexes with 1:1 stoichiometry. Data from thermal denaturation plots and CD spectra were less conclusive. Control experiments in one sequence context gave evidence that yyDNA helices, if formed, are preferentially antiparallel and are sequence selective. Hypothesized base pairing schemes are analogous to Watson-Crick pairing, but with glycosidic C1′-C1′ distances widened by over 45%, to ca. 15.2 Å. The possible self-assembly of the double-wide DNA helix establishes a new limit for the size of information-encoding, DNA-like molecules, and the fluorescence of yyDNA bases suggests uses as reporters in monomeric and oligomeric forms. PMID:16834396

  16. Demonstration of spectral correlation control in a source of polarization-entangled photon pairs at telecom wavelength.

    PubMed

    Lutz, Thomas; Kolenderski, Piotr; Jennewein, Thomas

    2014-03-15

    Spectrally correlated photon pairs can be used to improve the performance of long-range fiber-based quantum communication protocols. We present a source based on spontaneous parametric downconversion, which allows one to control spectral correlations within the entangled photon pair without spectral filtering by changing the pump-pulse duration or the characteristics of the coupled spatial modes. The spectral correlations and polarization entanglement are characterized. We find that the generated photon pairs can feature both positive spectral correlations, decorrelation, or negative correlations at the same time as polarization entanglement with a high fidelity of 0.97 (no background subtraction) with the expected Bell state.

  17. The crystal structure of an oligo(U):pre-mRNA duplex from a trypanosome RNA editing substrate

    PubMed Central

    Mooers, Blaine H.M.; Singh, Amritanshu

    2011-01-01

    Guide RNAs bind antiparallel to their target pre-mRNAs to form editing substrates in reaction cycles that insert or delete uridylates (Us) in most mitochondrial transcripts of trypanosomes. The 5′ end of each guide RNA has an anchor sequence that binds to the pre-mRNA by base-pair complementarity. The template sequence in the middle of the guide RNA directs the editing reactions. The 3′ ends of most guide RNAs have ∼15 contiguous Us that bind to the purine-rich unedited pre-mRNA upstream of the editing site. The resulting U-helix is rich in G·U wobble base pairs. To gain insights into the structure of the U-helix, we crystallized 8 bp of the U-helix in one editing substrate for the A6 mRNA of Trypanosoma brucei. The fragment provides three samples of the 5′-AGA-3′/5′-UUU-3′ base-pair triple. The fusion of two identical U-helices head-to-head promoted crystallization. We obtained X-ray diffraction data with a resolution limit of 1.37 Å. The U-helix had low and high twist angles before and after each G·U wobble base pair; this variation was partly due to shearing of the wobble base pairs as revealed in comparisons with a crystal structure of a 16-nt RNA with all Watson–Crick base pairs. Both crystal structures had wider major grooves at the junction between the poly(U) and polypurine tracts. This junction mimics the junction between the template helix and the U-helix in RNA-editing substrates and may be a site of major groove invasion by RNA editing proteins. PMID:21878548

  18. Superordinate Level Processing Has Priority Over Basic-Level Processing in Scene Gist Recognition

    PubMed Central

    Sun, Qi; Zheng, Yang; Sun, Mingxia; Zheng, Yuanjie

    2016-01-01

    By combining a perceptual discrimination task and a visuospatial working memory task, the present study examined the effects of visuospatial working memory load on the hierarchical processing of scene gist. In the perceptual discrimination task, two scene images from the same (manmade–manmade pairing or natural–natural pairing) or different superordinate level categories (manmade–natural pairing) were presented simultaneously, and participants were asked to judge whether these two images belonged to the same basic-level category (e.g., street–street pairing) or not (e.g., street–highway pairing). In the concurrent working memory task, spatial load (position-based load in Experiment 1) and object load (figure-based load in Experiment 2) were manipulated. The results were as follows: (a) spatial load and object load have stronger effects on discrimination of same basic-level scene pairing than same superordinate level scene pairing; (b) spatial load has a larger impact on the discrimination of scene pairings at early stages than at later stages; on the contrary, object information has a larger influence on at later stages than at early stages. It followed that superordinate level processing has priority over basic-level processing in scene gist recognition and spatial information contributes to the earlier and object information to the later stages in scene gist recognition. PMID:28382195

  19. Hot carrier-enhanced interlayer electron-hole pair multiplication in 2D semiconductor heterostructure photocells

    NASA Astrophysics Data System (ADS)

    Barati, Fatemeh; Grossnickle, Max; Su, Shanshan; Lake, Roger K.; Aji, Vivek; Gabor, Nathaniel M.

    2017-12-01

    Strong electronic interactions can result in novel particle-antiparticle (electron-hole, e-h) pair generation effects, which may be exploited to enhance the photoresponse of nanoscale optoelectronic devices. Highly efficient e-h pair multiplication has been demonstrated in several important nanoscale systems, including nanocrystal quantum dots, carbon nanotubes and graphene. The small Fermi velocity and nonlocal nature of the effective dielectric screening in ultrathin layers of transition-metal dichalcogenides (TMDs) indicates that e-h interactions are very strong, so high-efficiency generation of e-h pairs from hot electrons is expected. However, such e-h pair multiplication has not been observed in 2D TMD devices. Here, we report the highly efficient multiplication of interlayer e-h pairs in 2D semiconductor heterostructure photocells. Electronic transport measurements of the interlayer I-VSD characteristics indicate that layer-indirect e-h pairs are generated by hot-electron impact excitation at temperatures near T = 300 K. By exploiting this highly efficient interlayer e-h pair multiplication process, we demonstrate near-infrared optoelectronic devices that exhibit 350% enhancement of the optoelectronic responsivity at microwatt power levels. Our findings, which demonstrate efficient carrier multiplication in TMD-based optoelectronic devices, make 2D semiconductor heterostructures viable for a new class of ultra-efficient photodetectors based on layer-indirect e-h excitations.

  20. Utilizing Molecular Dynamics ' Multipotent Methodologies to Measure Microscopic Motions of DNA Molecules: A Magniloquent Manuscript On DNA's Means and Mannerisms

    NASA Astrophysics Data System (ADS)

    Kingsland, Addie

    DNA is an amazing molecule which is the basic template for all genetics. It is the primary molecule for storing biological information, and has many applications in nanotechnology. Double-stranded DNA may contain mismatched base pairs beyond the Watson-Crick pairs guanine-cytosine and adenine-thymine. To date, no one has found a physical property of base pair mismatches which describes the behavior of naturally occurring mismatch repair enzymes. Many materials properties of DNA are also unknown, for instance, when pulling DNA in different configurations, different energy differences are observed with no obvious reason why. DNA mismatches also affect their local environment, for instance changing the quantum yield of nearby azobenzene moieties. We utilize molecular dynamics computer simulations to study the structure and dynamics for both matched and mismatched base pairs, within both biological and materials contexts, and in both equilibrium and biased dynamics. We show that mismatched pairs shift further in the plane normal to the DNA strand and are more likely to exhibit non-canonical structures, including the e-motif. Base pair mismatches alter their local environment, affecting the trans- to cis- photoisomerization quantum yield of azobenzene, as well as increasing the likelihood of observing the e-motif. We also show that by using simulated data, we can give new insights on theoretical models to calculate the energetics of pulling DNA strands apart. These results, all relatively inexpensive on modern computer hardware, can help guide the design of DNA-based nanotechnologies, as well as give new insights into the functioning of mismatch repair systems in cancer prevention.

  1. Four base recognition by triplex-forming oligonucleotides at physiological pH

    PubMed Central

    Rusling, David A.; Powers, Vicki E. C.; Ranasinghe, Rohan T.; Wang, Yang; Osborne, Sadie D.; Brown, Tom; Fox, Keith R.

    2005-01-01

    We have achieved recognition of all 4 bp by triple helix formation at physiological pH, using triplex-forming oligonucleotides that contain four different synthetic nucleotides. BAU [2′-aminoethoxy-5-(3-aminoprop-1-ynyl)uridine] recognizes AT base pairs with high affinity, MeP (3-methyl-2 aminopyridine) binds to GC at higher pHs than cytosine, while APP (6-(3-aminopropyl)-7-methyl-3H-pyrrolo[2,3-d]pyrimidin-2(7H)-one) and S [N-(4-(3-acetamidophenyl)thiazol-2-yl-acetamide)] bind to CG and TA base pairs, respectively. Fluorescence melting and DNase I footprinting demonstrate successful triplex formation at a 19mer oligopurine sequence that contains two CG and two TA interruptions. The complexes are pH dependent, but are still stable at pH 7.0. BAU, MeP and APP retain considerable selectivity, and single base pair changes opposite these residues cause a large reduction in affinity. In contrast, S is less selective and tolerates CG pairs as well as TA. PMID:15911633

  2. Structure of p73 DNA-binding domain tetramer modulates p73 transactivation

    PubMed Central

    Ethayathulla, Abdul S.; Tse, Pui-Wah; Monti, Paola; Nguyen, Sonha; Inga, Alberto; Fronza, Gilberto; Viadiu, Hector

    2012-01-01

    The transcription factor p73 triggers developmental pathways and overlaps stress-induced p53 transcriptional pathways. How p53-family response elements determine and regulate transcriptional specificity remains an unsolved problem. In this work, we have determined the first crystal structures of p73 DNA-binding domain tetramer bound to response elements with spacers of different length. The structure and function of the adaptable tetramer are determined by the distance between two half-sites. The structures with zero and one base-pair spacers show compact p73 DNA-binding domain tetramers with large tetramerization interfaces; a two base-pair spacer results in DNA unwinding and a smaller tetramerization interface, whereas a four base-pair spacer hinders tetramerization. Functionally, p73 is more sensitive to spacer length than p53, with one base-pair spacer reducing 90% of transactivation activity and longer spacers reducing transactivation to basal levels. Our results establish the quaternary structure of the p73 DNA-binding domain required as a scaffold to promote transactivation. PMID:22474346

  3. Covariant Evolutionary Event Analysis for Base Interaction Prediction Using a Relational Database Management System for RNA.

    PubMed

    Xu, Weijia; Ozer, Stuart; Gutell, Robin R

    2009-01-01

    With an increasingly large amount of sequences properly aligned, comparative sequence analysis can accurately identify not only common structures formed by standard base pairing but also new types of structural elements and constraints. However, traditional methods are too computationally expensive to perform well on large scale alignment and less effective with the sequences from diversified phylogenetic classifications. We propose a new approach that utilizes coevolutional rates among pairs of nucleotide positions using phylogenetic and evolutionary relationships of the organisms of aligned sequences. With a novel data schema to manage relevant information within a relational database, our method, implemented with a Microsoft SQL Server 2005, showed 90% sensitivity in identifying base pair interactions among 16S ribosomal RNA sequences from Bacteria, at a scale 40 times bigger and 50% better sensitivity than a previous study. The results also indicated covariation signals for a few sets of cross-strand base stacking pairs in secondary structure helices, and other subtle constraints in the RNA structure.

  4. Covariant Evolutionary Event Analysis for Base Interaction Prediction Using a Relational Database Management System for RNA

    PubMed Central

    Xu, Weijia; Ozer, Stuart; Gutell, Robin R.

    2010-01-01

    With an increasingly large amount of sequences properly aligned, comparative sequence analysis can accurately identify not only common structures formed by standard base pairing but also new types of structural elements and constraints. However, traditional methods are too computationally expensive to perform well on large scale alignment and less effective with the sequences from diversified phylogenetic classifications. We propose a new approach that utilizes coevolutional rates among pairs of nucleotide positions using phylogenetic and evolutionary relationships of the organisms of aligned sequences. With a novel data schema to manage relevant information within a relational database, our method, implemented with a Microsoft SQL Server 2005, showed 90% sensitivity in identifying base pair interactions among 16S ribosomal RNA sequences from Bacteria, at a scale 40 times bigger and 50% better sensitivity than a previous study. The results also indicated covariation signals for a few sets of cross-strand base stacking pairs in secondary structure helices, and other subtle constraints in the RNA structure. PMID:20502534

  5. Multi-user distribution of polarization entangled photon pairs

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Trapateau, J.; Orieux, A.; Diamanti, E.

    We experimentally demonstrate multi-user distribution of polarization entanglement using commercial telecom wavelength division demultiplexers. The entangled photon pairs are generated from a broadband source based on spontaneous parametric down conversion in a periodically poled lithium niobate crystal using a double path setup employing a Michelson interferometer and active phase stabilisation. We test and compare demultiplexers based on various technologies and analyze the effect of their characteristics, such as losses and polarization dependence, on the quality of the distributed entanglement for three channel pairs of each demultiplexer. In all cases, we obtain a Bell inequality violation, whose value depends on themore » demultiplexer features. This demonstrates that entanglement can be distributed to at least three user pairs of a network from a single source. Additionally, we verify for the best demultiplexer that the violation is maintained when the pairs are distributed over a total channel attenuation corresponding to 20 km of optical fiber. These techniques are therefore suitable for resource-efficient practical implementations of entanglement-based quantum key distribution and other quantum communication network applications.« less

  6. Contact ion pair formation between hard acids and soft bases in aqueous solutions observed with 2DIR spectroscopy.

    PubMed

    Sun, Zheng; Zhang, Wenkai; Ji, Minbiao; Hartsock, Robert; Gaffney, Kelly J

    2013-12-12

    The interaction of charged species in aqueous solution has important implications for chemical, biological, and environmental processes. We have used 2DIR spectroscopy to study the equilibrium dynamics of thiocyanate chemical exchange between free ion (NCS(-)) and contact ion pair configurations (MNCS(+)), where M(2+) = Mg(2+) or Ca(2+). Detailed studies of the influence of anion concentration and anion speciation show that the chemical exchange observed with the 2DIR measurements results from NCS(-) exchanging with other anion species in the first solvation shell surrounding Mg(2+) or Ca(2+). The presence of chemical exchange in the 2DIR spectra provides an indirect, but robust, determinant of contact ion pair formation. We observe preferential contact ion pair formation between soft Lewis base anions and hard Lewis acid cations. This observation cannot be easily reconciled with Pearson's acid-base concept or Collins' Law of Matching Water Affinities. The anions that form contact ion pairs also correspond to the ions with an affinity for water and protein surfaces, so similar physical and chemical properties may control these distinct phenomena.

  7. A Metacognitive Approach to Pair Programming: Influence on Metacognitive Awareness

    ERIC Educational Resources Information Center

    Breed, Betty; Mentz, Elsa; van der Westhuizen, Gert

    2014-01-01

    Introduction: The research focused on metacognition in a collaborative learning setting. Based on a comprehensive literature study the researchers designed a metacognitive teaching-learning strategy for pair programmers. Our purpose was to investigate the influence of this metacognitive teaching-learning strategy during pair programming in an…

  8. Constructing Pairing-Friendly Elliptic Curves under Embedding Degree 1 for Securing Critical Infrastructures.

    PubMed

    Wang, Maocai; Dai, Guangming; Choo, Kim-Kwang Raymond; Jayaraman, Prem Prakash; Ranjan, Rajiv

    2016-01-01

    Information confidentiality is an essential requirement for cyber security in critical infrastructure. Identity-based cryptography, an increasingly popular branch of cryptography, is widely used to protect the information confidentiality in the critical infrastructure sector due to the ability to directly compute the user's public key based on the user's identity. However, computational requirements complicate the practical application of Identity-based cryptography. In order to improve the efficiency of identity-based cryptography, this paper presents an effective method to construct pairing-friendly elliptic curves with low hamming weight 4 under embedding degree 1. Based on the analysis of the Complex Multiplication(CM) method, the soundness of our method to calculate the characteristic of the finite field is proved. And then, three relative algorithms to construct pairing-friendly elliptic curve are put forward. 10 elliptic curves with low hamming weight 4 under 160 bits are presented to demonstrate the utility of our approach. Finally, the evaluation also indicates that it is more efficient to compute Tate pairing with our curves, than that of Bertoni et al.

  9. Genome Editing Tools in Plants

    PubMed Central

    Mohanta, Tapan Kumar; Bashir, Tufail; Hashem, Abeer; Bae, Hanhong

    2017-01-01

    Genome editing tools have the potential to change the genomic architecture of a genome at precise locations, with desired accuracy. These tools have been efficiently used for trait discovery and for the generation of plants with high crop yields and resistance to biotic and abiotic stresses. Due to complex genomic architecture, it is challenging to edit all of the genes/genomes using a particular genome editing tool. Therefore, to overcome this challenging task, several genome editing tools have been developed to facilitate efficient genome editing. Some of the major genome editing tools used to edit plant genomes are: Homologous recombination (HR), zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), pentatricopeptide repeat proteins (PPRs), the CRISPR/Cas9 system, RNA interference (RNAi), cisgenesis, and intragenesis. In addition, site-directed sequence editing and oligonucleotide-directed mutagenesis have the potential to edit the genome at the single-nucleotide level. Recently, adenine base editors (ABEs) have been developed to mutate A-T base pairs to G-C base pairs. ABEs use deoxyadeninedeaminase (TadA) with catalytically impaired Cas9 nickase to mutate A-T base pairs to G-C base pairs. PMID:29257124

  10. Crystal structure of metallo DNA duplex containing consecutive Watson-Crick-like T-Hg(II)-T base pairs.

    PubMed

    Kondo, Jiro; Yamada, Tom; Hirose, Chika; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira

    2014-02-24

    The metallo DNA duplex containing mercury-mediated T-T base pairs is an attractive biomacromolecular nanomaterial which can be applied to nanodevices such as ion sensors. Reported herein is the first crystal structure of a B-form DNA duplex containing two consecutive T-Hg(II)-T base pairs. The Hg(II) ion occupies the center between two T residues. The N3-Hg(II) bond distance is 2.0 Å. The relatively short Hg(II)-Hg(II) distance (3.3 Å) observed in consecutive T-Hg(II)-T base pairs suggests that the metallophilic attraction could exist between them and may stabilize the B-form double helix. To support this, the DNA duplex is largely distorted and adopts an unusual nonhelical conformation in the absence of Hg(II). The structure of the metallo DNA duplex itself and the Hg(II)-induced structural switching from the nonhelical form to the B-form provide the basis for structure-based design of metal-conjugated nucleic acid nanomaterials. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Constructing Pairing-Friendly Elliptic Curves under Embedding Degree 1 for Securing Critical Infrastructures

    PubMed Central

    Dai, Guangming

    2016-01-01

    Information confidentiality is an essential requirement for cyber security in critical infrastructure. Identity-based cryptography, an increasingly popular branch of cryptography, is widely used to protect the information confidentiality in the critical infrastructure sector due to the ability to directly compute the user’s public key based on the user’s identity. However, computational requirements complicate the practical application of Identity-based cryptography. In order to improve the efficiency of identity-based cryptography, this paper presents an effective method to construct pairing-friendly elliptic curves with low hamming weight 4 under embedding degree 1. Based on the analysis of the Complex Multiplication(CM) method, the soundness of our method to calculate the characteristic of the finite field is proved. And then, three relative algorithms to construct pairing-friendly elliptic curve are put forward. 10 elliptic curves with low hamming weight 4 under 160 bits are presented to demonstrate the utility of our approach. Finally, the evaluation also indicates that it is more efficient to compute Tate pairing with our curves, than that of Bertoni et al. PMID:27564373

  12. Micrometer-Scale Ballistic Transport of Electron Pairs in LaAlO_{3}/SrTiO_{3} Nanowires.

    PubMed

    Tomczyk, Michelle; Cheng, Guanglei; Lee, Hyungwoo; Lu, Shicheng; Annadi, Anil; Veazey, Joshua P; Huang, Mengchen; Irvin, Patrick; Ryu, Sangwoo; Eom, Chang-Beom; Levy, Jeremy

    2016-08-26

    High-mobility complex-oxide heterostructures and nanostructures offer new opportunities for extending the paradigm of quantum transport beyond the realm of traditional III-V or carbon-based materials. Recent quantum transport investigations with LaAlO_{3}/SrTiO_{3}-based quantum dots reveal the existence of a strongly correlated phase in which electrons form spin-singlet pairs without becoming superconducting. Here, we report evidence for the micrometer-scale ballistic transport of electron pairs in quasi-1D LaAlO_{3}/SrTiO_{3} nanowire cavities. In the paired phase, Fabry-Perot-like quantum interference is observed, in sync with conductance oscillations observed in the superconducting regime (at a zero magnetic field). Above a critical magnetic field B_{p}, the electron pairs unbind and the conductance oscillations shift with the magnetic field. These experimental observations extend the regime of ballistic electronic transport to strongly correlated phases.

  13. Pentopyranosyl Oligonucleotide Systems. Part 11: Systems with Shortened Backbones: D)-beta-Ribopyranosyl-(4 yields 3 )- and (L)-alpha - Lyxopyranosyl-(4 yields 3 )-oligonucleotides

    NASA Technical Reports Server (NTRS)

    Wippo, Harald; Reck, Folkert; Kudick, Rene; Ramaseshan, Mahesh; Ceulemans, Griet; Bolli, Martin; Krishnamurthy, Ramanarayanan; Eschenmoser, Albert

    2001-01-01

    The (L)-a-lyxopyranosyl-(4'yields 3')-oligonucleotide system-a member of a pentopyranosyl oligonucleotide family containing a shortened backbone-is capable of cooperative base-pairing and of cross-pairing with DNA and RNA. In contrast, corresponding (D)-beta-ribopyransoyl-(4' yields 3')-oligonucleotides do not show base-pairing under similar conditions. We conclude that oligonucleotide systems can violate the six-bonds-per-backbone-unit rule by having five bonds instead, if their vicinally bound phosphodiester bridges can assume an antiperiplanar conformation. An additional structural feature that seems relevant to the cross-pairing capability of the (L)-a-lyxopyranosyl-(4' yields 3')-oligonucleotide system is its (small) backbone/basepair axes inclination. An inclination which is similar to that in B-DNA seems to be a prerequisite for an oligonucleotide system s capability to cross-pair with DNA.

  14. Recognition tunneling measurement of the conductance of DNA bases embedded in self-assembled monolayers.

    PubMed

    Huang, Shuo; Chang, Shuai; He, Jin; Zhang, Peiming; Liang, Feng; Tuchband, Michael; Li, Shengqing; Lindsay, Stuart

    2010-12-09

    The DNA bases interact strongly with gold electrodes, complicating efforts to measure the tunneling conductance through hydrogen-bonded Watson Crick base pairs. When bases are embedded in a self-assembled alkane-thiol monolayer to minimize these interactions, new features appear in the tunneling data. These new features track the predictions of density-functional calculations quite well, suggesting that they reflect tunnel conductance through hydrogen-bonded base pairs.

  15. Recognition tunneling measurement of the conductance of DNA bases embedded in self-assembled monolayers

    PubMed Central

    Huang, Shuo; Chang, Shuai; He, Jin; Zhang, Peiming; Liang, Feng; Tuchband, Michael; Li, Shengqing; Lindsay, Stuart

    2010-01-01

    The DNA bases interact strongly with gold electrodes, complicating efforts to measure the tunneling conductance through hydrogen-bonded Watson Crick base pairs. When bases are embedded in a self-assembled alkane-thiol monolayer to minimize these interactions, new features appear in the tunneling data. These new features track the predictions of density-functional calculations quite well, suggesting that they reflect tunnel conductance through hydrogen-bonded base pairs. PMID:21197382

  16. Estimation of Disability Weights in the General Population of South Korea Using a Paired Comparison

    PubMed Central

    Ock, Minsu; Ahn, Jeonghoon; Yoon, Seok-Jun; Jo, Min-Woo

    2016-01-01

    We estimated the disability weights in the South Korean population by using a paired comparison-only model wherein ‘full health’ and ‘being dead’ were included as anchor points, without resorting to a cardinal method, such as person trade-off. The study was conducted via 2 types of survey: a household survey involving computer-assisted face-to-face interviews and a web-based survey (similar to that of the GBD 2010 disability weight study). With regard to the valuation methods, paired comparison, visual analogue scale (VAS), and standard gamble (SG) were used in the household survey, whereas paired comparison and population health equivalence (PHE) were used in the web-based survey. Accordingly, we described a total of 258 health states, with ‘full health’ and ‘being dead’ designated as anchor points. In the analysis, 4 models were considered: a paired comparison-only model; hybrid model between paired comparison and PHE; VAS model; and SG model. A total of 2,728 and 3,188 individuals participated in the household and web-based survey, respectively. The Pearson correlation coefficients of the disability weights of health states between the GBD 2010 study and the current models were 0.802 for Model 2, 0.796 for Model 1, 0.681 for Model 3, and 0.574 for Model 4 (all P-values<0.001). The discrimination of values according to health state severity was most suitable in Model 1. Based on these results, the paired comparison-only model was selected as the best model for estimating disability weights in South Korea, and for maintaining simplicity in the analysis. Thus, disability weights can be more easily estimated by using paired comparison alone, with ‘full health’ and ‘being dead’ as one of the health states. As noted in our study, we believe that additional evidence regarding the universality of disability weight can be observed by using a simplified methodology of estimating disability weights. PMID:27606626

  17. Easy design of colorimetric logic gates based on nonnatural base pairing and controlled assembly of gold nanoparticles.

    PubMed

    Zhang, Li; Wang, Zhong-Xia; Liang, Ru-Ping; Qiu, Jian-Ding

    2013-07-16

    Utilizing the principles of metal-ion-mediated base pairs (C-Ag-C and T-Hg-T), the pH-sensitive conformational transition of C-rich DNA strand, and the ligand-exchange process triggered by DL-dithiothreitol (DTT), a system of colorimetric logic gates (YES, AND, INHIBIT, and XOR) can be rationally constructed based on the aggregation of the DNA-modified Au NPs. The proposed logic operation system is simple, which consists of only T-/C-rich DNA-modified Au NPs, and it is unnecessary to exquisitely design and alter the DNA sequence for different multiple molecular logic operations. The nonnatural base pairing combined with unique optical properties of Au NPs promises great potential in multiplexed ion sensing, molecular-scale computers, and other computational logic devices.

  18. Synthesis and Properties of Size-expanded DNAs: Toward Designed, Functional Genetic Systems

    PubMed Central

    Krueger, Andrew T.; Lu, Haige; Lee, Alex H. F.; Kool, Eric T.

    2008-01-01

    We describe the design, synthesis, and properties of DNA-like molecules in which the base pairs are expanded by benzo homologation. The resulting size-expanded genetic helices are called xDNA (“expanded DNA”) and yDNA (“wide DNA”). The large component bases are fluorescent, and they display high stacking affinity. When singly substituted into natural DNA, they are destabilizing because the benzo-expanded base pair size is too large for the natural helix. However, when all base pairs are expanded, xDNA and yDNA form highly stable, sequence-selective double helices. The size-expanded DNAs are candidates for components of new, functioning genetic systems. In addition, the fluorescence of expanded DNA bases makes them potentially useful in probing nucleic acids. PMID:17309194

  19. The Effects of Reinforcer Pairing and Fading on Preschoolers' Snack Selections

    PubMed Central

    Solberg, Katherine M; Hanley, Gregory P; Layer, Stacy A; Ingvarsson, Einar T

    2007-01-01

    The effects of reinforcement pairing and fading on preschoolers' snack selections were evaluated in a multiple baseline design. Baseline preferences for snack options were assessed via repeated paired-item preference assessments. Edible, social, and activity-based reinforcers were then exclusively paired with a less preferred snack option. Once the snack paired with reinforcement was selected most frequently, the three types of reinforcement were systematically faded. Frequent selections of the previously less preferred snack option were produced with paired reinforcement, but were disrupted for all children as the paired reinforcement was reduced to low levels. These data showed that paired reinforcement was initially effective in increasing preference for the originally less preferred snack options, but more permanent changes in the value of the snack options were not achieved. Conditions for producing persistent changes in children's snack choices are discussed. PMID:18189095

  20. A process-based approach to characterizing the effect of acute alprazolam challenge on visual paired associate learning and memory in healthy older adults.

    PubMed

    Pietrzak, Robert H; Scott, James Cobb; Harel, Brian T; Lim, Yen Ying; Snyder, Peter J; Maruff, Paul

    2012-11-01

    Alprazolam is a benzodiazepine that, when administered acutely, results in impairments in several aspects of cognition, including attention, learning, and memory. However, the profile (i.e., component processes) that underlie alprazolam-related decrements in visual paired associate learning has not been fully explored. In this double-blind, placebo-controlled, randomized cross-over study of healthy older adults, we used a novel, "process-based" computerized measure of visual paired associate learning to examine the effect of a single, acute 1-mg dose of alprazolam on component processes of visual paired associate learning and memory. Acute alprazolam challenge was associated with a large magnitude reduction in visual paired associate learning and memory performance (d = 1.05). Process-based analyses revealed significant increases in distractor, exploratory, between-search, and within-search error types. Analyses of percentages of each error type suggested that, relative to placebo, alprazolam challenge resulted in a decrease in the percentage of exploratory errors and an increase in the percentage of distractor errors, both of which reflect memory processes. Results of this study suggest that acute alprazolam challenge decreases visual paired associate learning and memory performance by reducing the strength of the association between pattern and location, which may reflect a general breakdown in memory consolidation, with less evidence of reductions in executive processes (e.g., working memory) that facilitate visual paired associate learning and memory. Copyright © 2012 John Wiley & Sons, Ltd.

  1. Optimizing photon-pair generation electronically using a p-i-n diode incorporated in a silicon microring resonator

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Savanier, Marc, E-mail: msavanier@eng.ucsd.edu; Kumar, Ranjeet; Mookherjea, Shayan, E-mail: smookherjea@eng.ucsd.edu

    Silicon photonic microchips may be useful for compact, inexpensive, room-temperature optically pumped photon-pair sources, which unlike conventional photon-pair generators based on crystals or optical fibers, can be manufactured using CMOS-compatible processes on silicon wafers. It has been shown that photon pairs can be created in simple structures such as microring resonators at a rate of a few hundred kilohertz using less than a milliwatt of optical pump power, based on the process of spontaneous four-wave mixing. To create a practical photon-pair source, however, also requires some way of monitoring the device and aligning the pump wavelength when the temperature varies,more » since silicon resonators are highly sensitive to temperature. In fact, monitoring photodiodes are standard components in classical laser diodes, but the incorporation of germanium or InGaAs photodiodes would raise the cost and fabrication complexity. Here, we present a simple and effective all-electronic technique for finding the optimum operating point for the microring used to generate photon pairs, based on measuring the reverse-biased current in a silicon p-i-n junction diode fabricated across the waveguide that constitutes the silicon microring. We show that by monitoring the current, and using it to tune the pump laser wavelength, the photon-pair generation properties of the microring can be preserved over a temperature range of more than 30 °C.« less

  2. Complexes of oligo(poly)nucleotides with structural anomalies

    NASA Astrophysics Data System (ADS)

    Dolinnaya, N. G.; Gryaznova, O. I.

    1989-08-01

    The results of studies on the structure and properties of DNA-RNA hybrids and complexes of oligo(poly)nucleotides containing non-canonical base pairs or unpaired bases both within and at the ends of the double helix are surveyed. The methods used in the study of such systems are briefly characterised: X-ray diffraction analysis, NMR and UV spectroscopy, circular dichroism, scanning microcalorimetry, etc. A comparative analysis of the influence of the non-canonical pairs on the structure and the energetic and kinetic parameters of the formation and dissociation of the oligonucleotide complexes has been carried out. The question of the stability of the non-canonical pairs as a function of their nature and position in the double helix is considered. The mechanisms of the formation of the hydrogen bonds between the bases of non-complementary pairs are discussed. The bibliography includes 171 references.

  3. Apparatus And Method For Reducing Drag Of A Bluff Body In Ground Effect Using Counter-Rotating Vortex Pairs

    DOEpatents

    Ortega, Jason M.; Sabari, Kambiz

    2005-12-27

    An aerodynamic base drag reduction apparatus and method for bluff bodies, such as tractor-trailer trucks, utilizing a pair of lift surfaces extending to lift surface tips and located alongside the bluff body such as on opposing left and right side surfaces. In a flowstream substantially parallel to the longitudinal centerline of the bluff body, the pair of lift surfaces generate a pair of counter-rotating trailing vortices which confluence together in the wake of the bluff body in a direction orthogonal to the flowstream. The confluence draws or otherwise turns the flowstream, such as the flowstream passing over a top surface of the bluff body, in and around behind a trailing end of the bluff body to raise the pressure on a base surface at the trailing end and thereby reduce the aerodynamic base drag.

  4. Apparatus And Method For Reducing Drag Of A Bluff Body In Ground Effect Using Counter-Rotating Vortex Pairs

    DOEpatents

    Ortega, Jason M.; Salari, Kambiz

    2005-08-09

    An aerodynamic base drag reduction apparatus and method for bluff bodies, such as tractor-trailer trucks, utilizing a pair of lift surfaces extending to lift surface tips and located alongside the bluff body such as on opposing left and right side surfaces. In a flowstream substantially parallel to the longitudinal centerline of the bluff body, the pair of lift surfaces generate a pair of counter-rotating trailing vortices which confluence together in the wake of the bluff body in a direction orthogonal to the flowstream. The confluence draws or otherwise turns the flowstream, such as the flowstream passing over a top surface of the bluff body, in and around behind a trailing end of the bluff body to raise the pressure on a base surface at the trailing end and thereby reduce the aerodynamic base drag.

  5. Compositions of orthogonal lysyl-tRNA and aminoacyl-tRNA synthetase pairs and uses thereof

    DOEpatents

    Anderson, J Christopher [San Francisco, CA; Wu, Ning [Brookline, MA; Santoro, Stephen [Cambridge, MA; Schultz, Peter G [La Jolla, CA

    2009-12-29

    Compositions and methods of producing components of protein biosynthetic machinery that include orthogonal lysyl-tRNAs, orthogonal lysyl-aminoacyl-tRNA synthetases, and orthogonal pairs of lysyl-tRNAs/synthetases, which incorporate homoglutamines into proteins are provided in response to a four base codon. Methods for identifying these orthogonal pairs are also provided along with methods of producing proteins with homoglutamines using these orthogonal pairs.

  6. Compositions of orthogonal lysyl-tRNA and aminoacyl-tRNA synthetase pairs and uses thereof

    DOEpatents

    Anderson, J Christopher [San Francisco, CA; Wu, Ning [Brookline, MA; Santoro, Stephen [Cambridge, MA; Schultz, Peter G [La Jolla, CA

    2011-10-04

    Compositions and methods of producing components of protein biosynthetic machinery that include orthogonal lysyl-tRNAs, orthogonal lysyl-aminoacyl-tRNA synthetases, and orthogonal pairs of lysyl-tRNAs/synthetases, which incorporate homoglutamines into proteins are provided in response to a four base codon. Methods for identifying these orthogonal pairs are also provided along with methods of producing proteins with homoglutamines using these orthogonal pairs.

  7. Compositions of orthogonal lysyl-tRNA and aminoacyl-tRNA synthetase pairs and uses thereof

    DOEpatents

    Anderson, J Christopher [San Francisco, CA; Wu, Ning [Brookline, MA; Santoro, Stephen [Cambridge, MA; Schultz, Peter G [La Jolla, CA

    2009-08-18

    Compositions and methods of producing components of protein biosynthetic machinery that include orthogonal lysyl-tRNAs, orthogonal lysyl-aminoacyl-tRNA synthetases, and orthogonal pairs of lysyl-tRNAs/synthetases, which incorporate homoglutamines into proteins are provided in response to a four base codon. Methods for identifying these orthogonal pairs are also provided along with methods of producing proteins with homoglutamines using these orthogonal pairs.

  8. All gene-sized DNA molecules in four species of hypotrichs have the same terminal sequence and an unusual 3' terminus.

    PubMed Central

    Klobutcher, L A; Swanton, M T; Donini, P; Prescott, D M

    1981-01-01

    In hypotrichous ciliates, all of the macronuclear DNA is in the form of low molecular weight molecules with an average size of approximately 2200 base pairs. Total macronuclear DNA from four hypotrichs has been shown to have inverted terminal repeats by direct sequence analysis. In Oxytricha nova, Oxytricha sp., and Stylonychia pustulata, this terminal sequence may be written as 5'-C4A4C4A4C4 ... 3'-G4T4G4T4G4T4G4T4G4 ... In Euplotes aediculatus, the sequences is similar but differs in the lengths of the duplex region (28 base pairs) and of the putative 3' extension (14 base pairs). Also in Euplotes, a second common sequence of 5 base pairs (A-A-C-T-T-T-T-G-A-A) occurs internal to the terminal repeat and a 17-base-pair heterogeneous region: 5'-C4A4C4A4C4A4C4(X)17T-T-G-A-A ... 3'-G2T4G4T4G4T4G4T4G4T4G4(X)17A-A-C-T-T ... The length of the terminal repeat sequence for O. nova was confirmed in cloned macronuclear DNA molecules. Images PMID:6265931

  9. Stacked-unstacked equilibrium at the nick site of DNA.

    PubMed

    Protozanova, Ekaterina; Yakovchuk, Peter; Frank-Kamenetskii, Maxim D

    2004-09-17

    Stability of duplex DNA with respect to separation of complementary strands is crucial for DNA executing its major functions in the cell and it also plays a central role in major biotechnology applications of DNA: DNA sequencing, polymerase chain reaction, and DNA microarrays. Two types of interaction are well known to contribute to DNA stability: stacking between adjacent base-pairs and pairing between complementary bases. However, their contribution into the duplex stability is yet to be determined. Now we fill this fundamental gap in our knowledge of the DNA double helix. We have prepared a series of 32, 300 bp-long DNA fragments with solitary nicks in the same position differing only in base-pairs flanking the nick. Electrophoretic mobility of these fragments in the gel has been studied. Assuming the equilibrium between stacked and unstacked conformations at the nick site, all 32 stacking free energy parameters have been obtained. Only ten of them are essential and they govern the stacking interactions between adjacent base-pairs in intact DNA double helix. A full set of DNA stacking parameters has been determined for the first time. From these data and from a well-known dependence of DNA melting temperature on G.C content, the contribution of base-pairing into duplex stability has been estimated. The obtained energy parameters of the DNA double helix are of paramount importance for understanding sequence-dependent DNA flexibility and for numerous biotechnology applications.

  10. Roles of the active site residues and metal cofactors in noncanonical base-pairing during catalysis by human DNA polymerase iota.

    PubMed

    Makarova, Alena V; Ignatov, Artem; Miropolskaya, Nataliya; Kulbachinskiy, Andrey

    2014-10-01

    Human DNA polymerase iota (Pol ι) is a Y-family polymerase that can bypass various DNA lesions but possesses very low fidelity of DNA synthesis in vitro. Structural analysis of Pol ι revealed a narrow active site that promotes noncanonical base-pairing during catalysis. To better understand the structure-function relationships in the active site of Pol ι we investigated substitutions of individual amino acid residues in its fingers domain that contact either the templating or the incoming nucleotide. Two of the substitutions, Y39A and Q59A, significantly decreased the catalytic activity but improved the fidelity of Pol ι. Surprisingly, in the presence of Mn(2+) ions, the wild-type and mutant Pol ι variants efficiently incorporated nucleotides opposite template purines containing modifications that disrupted either Hoogsteen or Watson-Crick base-pairing, suggesting that Pol ι may use various types of interactions during nucleotide addition. In contrast, in Mg(2+) reactions, wild-type Pol ι was dependent on Hoogsteen base-pairing, the Y39A mutant was essentially inactive, and the Q59A mutant promoted Watson-Crick interactions with template purines. The results suggest that Pol ι utilizes distinct mechanisms of nucleotide incorporation depending on the metal cofactor and reveal important roles of specific residues from the fingers domain in base-pairing and catalysis. Copyright © 2014 Elsevier B.V. All rights reserved.

  11. Quantum chemical investigations of AlN-doped C60 for use as a nano-biosensor in detection of mispairing between DNA bases.

    PubMed

    Siddiqui, Shamoon Ahmad; Bouarissa, Nadir; Rasheed, Tabish; Al-Hajry, A

    2014-12-01

    Quantum chemical calculations were carried out to study the electronic structure and stability of adenine-thymine and the rare tautomer of adenine-thymine base pairs along with their Cu 2+ complexes and their interactions with AlN-modified fullerene (C58AlN) using Density Functional Theory (B3LYP method). Since, these two forms of base pairs and their Cu 2+ complexes have almost similar electronic structures, their chemical differentiation is an extremely difficult task. In this investigation, we have observed that AlN-doped C 60 could be used as a potentially viable nanoscale sensor to detect these two base pairs as well as their Cu2+ complexes.

  12. On the binding of indeno[1,2-c]isoquinolines in the DNA-topoisomerase I cleavage complex.

    PubMed

    Xiao, Xiangshu; Antony, Smitha; Pommier, Yves; Cushman, Mark

    2005-05-05

    An ab initio quantum mechanics calculation is reported which predicts the orientation of indenoisoquinoline 4 in the ternary cleavage complex formed from DNA and topoisomerase I (top1). The results of this calculation are consistent with the hypothetical structures previously proposed for the indenoisoquinoline-DNA-top1 ternary complexes based on molecular modeling, the crystal structure of a recently reported ternary complex, and the biological results obtained with a pair of diaminoalkyl-substituted indenoisoquinoline enantiomers. The results of these studies indicate that the pi-pi stacking interactions between the indenoisoquinolines and the neighboring DNA base pairs play a major role in determining binding orientation. The calculation of the electrostatic potential surface maps of the indenoisoquinolines and the adjacent DNA base pairs shows electrostatic complementarity in the observed binding orientation, leading to the conclusion that electrostatic attraction between the intercalators and the base pairs in the cleavage complex plays a major stabilizing role. On the other hand, the calculation of LUMO and HOMO energies of indenoisoquinoline 13b and neighboring DNA base pairs in conjunction with NBO analysis indicates that charge transfer complex formation plays a relatively minor role in stabilizing the ternary complexes derived from indenoisoquinolines, DNA, and top1. The results of these studies are important in understanding the existing structure-activity relationships for the indenoisoquinolines as top1 inhibitors and as anticancer agents, and they will be important in the future design of indenoisoquinoline-based top1 inhibitors.

  13. Free energy landscape and transition pathways from Watson-Crick to Hoogsteen base pairing in free duplex DNA.

    PubMed

    Yang, Changwon; Kim, Eunae; Pak, Youngshang

    2015-09-18

    Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson-Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine-thymine (A-T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  14. Platinum(II)-Oligonucleotide Coordination Based Aptasensor for Simple and Selective Detection of Platinum Compounds.

    PubMed

    Cai, Sheng; Tian, Xueke; Sun, Lianli; Hu, Haihong; Zheng, Shirui; Jiang, Huidi; Yu, Lushan; Zeng, Su

    2015-10-20

    Wide use of platinum-based chemotherapeutic regimens for the treatment for carcinoma calls for a simple and selective detection of platinum compound in biological samples. On the basis of the platinum(II)-base pair coordination, a novel type of aptameric platform for platinum detection has been introduced. This chemiluminescence (CL) aptasensor consists of a designed streptavidin (SA) aptamer sequence in which several base pairs were replaced by G-G mismatches. Only in the presence of platinum, coordination occurs between the platinum and G-G base pairs as opposed to the hydrogen-bonded G-C base pairs, which leads to SA aptamer sequence activation, resulting in their binding to SA coated magnetic beads. These Pt-DNA coordination events were monitored by a simple and direct luminol-peroxide CL reaction through horseradish peroxidase (HRP) catalysis with a strong chemiluminescence emission. The validated ranges of quantification were 0.12-240 μM with a limit of detection of 60 nM and selectivity over other metal ions. This assay was also successfully used in urine sample determination. It will be a promising candidate for the detection of platinum in biomedical and environmental samples.

  15. Theoretical Probing of Weak Anion-Cation Interactions in Certain Pyridinium-Based Ionic Liquid Ion Pairs and the Application of Molecular Electrostatic Potential in Their Ionic Crystal Density Determination: A Comparative Study Using Density Functional Approach.

    PubMed

    Joseph, Aswathy; Thomas, Vibin Ipe; Żyła, Gaweł; Padmanabhan, A S; Mathew, Suresh

    2018-01-11

    A comprehensive study on the structure, nature of interaction, and properties of six ionic pairs of 1-butylpyridinium and 1-butyl-4-methylpyridinium cations in combination with tetrafluoroborate (BF 4 - ), chloride (Cl - ), and bromide (Br - ) anions have been carried out using density functional theory (DFT). The anion-cation interaction energy (ΔE int ), thermochemistry values, theoretical band gap, molecular orbital energy order, DFT-based chemical activity descriptors [chemical potential (μ), chemical hardness (η), and electrophilicity index (ω)], and distribution of density of states (DOS) of these ion pairs were investigated. The ascendancy of the -CH 3 substituent at the fourth position of the 1-butylpyridinium cation ring on the values of ΔE int , theoretical band gap and chemical activity descriptors was evaluated. The ΔE int values were negative for all six ion pairs and were highest for Cl - containing ion pairs. The theoretical band gap value after -CH 3 substitution increased from 3.78 to 3.96 eV (for Cl - ) and from 2.74 to 2.88 eV (for Br - ) and decreased from 4.9 to 4.89 eV (for BF 4 - ). Ion pairs of BF 4 - were more susceptible to charge transfer processes as inferred from their significantly high η values and comparatively small difference in ω value after -CH 3 substitution. The change in η and μ values due to the -CH 3 substituent is negligibly small in all cases except for the ion pairs of Cl - . Critical-point (CP) analyses were carried out to investigate the AIM topological parameters at the interionic bond critical points (BCPs). The RDG isosurface analysis indicated that the anion-cation interaction was dominated by strong H cat ···X ani and C cat ···X ani interactions in ion pairs of Cl - and Br - whereas a weak van der Waal's effect dominated in ion pairs of BF 4 - . The molecular electrostatic potential (MESP)-based parameter ΔΔV min measuring the anion-cation interaction strength showed a good linear correlation with ΔE int for all 1-butylpyridinium ion pairs (R 2 = 0.9918). The ionic crystal density values calculated by using DFT-based MESP showed only slight variations from experimentally reported values.

  16. Experimental extraction of an entangled photon pair from two identically decohered pairs.

    PubMed

    Yamamoto, Takashi; Koashi, Masato; Ozdemir, Sahin Kaya; Imoto, Nobuyuki

    2003-01-23

    Entanglement is considered to be one of the most important resources in quantum information processing schemes, including teleportation, dense coding and entanglement-based quantum key distribution. Because entanglement cannot be generated by classical communication between distant parties, distribution of entangled particles between them is necessary. During the distribution process, entanglement between the particles is degraded by the decoherence and dissipation processes that result from unavoidable coupling with the environment. Entanglement distillation and concentration schemes are therefore needed to extract pairs with a higher degree of entanglement from these less-entangled pairs; this is accomplished using local operations and classical communication. Here we report an experimental demonstration of extraction of a polarization-entangled photon pair from two decohered photon pairs. Two polarization-entangled photon pairs are generated by spontaneous parametric down-conversion and then distributed through a channel that induces identical phase fluctuations to both pairs; this ensures that no entanglement is available as long as each pair is manipulated individually. Then, through collective local operations and classical communication we extract from the two decohered pairs a photon pair that is observed to be polarization-entangled.

  17. Milestone Report:3.2.2.26 Appliances, HVAC & Water Heating R&D-Select Sorption Technology

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ally, Moonis Raza

    The purpose of this report is to select a sorption technology based on recent work completed on characterizing working pairs for both absorption and adsorption technologies based on Global Warming Potential (GWP) of less than 100 (relative to carbon dioxide, 100-year atmospheric life span) and zero Ozone Depletion Potential (ODP). From a total of eighty-three potential working pairs (absorption technology), there were only two candidate working pairs for the absorption technology, and 8 potential working pairs for adsorption technology. After screening these ten potential candidates on the basis of sizes of the desorber, absorber/adsorber, evaporator, condenser, and rectifier (where applicable),more » the ORNL-Georgia Tech study concluded that best working pairs are NH3-H2O for the most compact system in terms of heat transfer equipment surface area, and NH3-LiNO3 and MeOH-[mmin][DMP] where efficiency is most important. Based on a single-stage absorption and adsorption modeling using the Engineering Equation Solver (EES), the performance of both sorption systems was evaluated from known heat transfer correlations, and thermos-physical properties. Based on these results, the technology chosen is absorption technology. The selected technology is absorption for the reasons cited in Section 4.« less

  18. The role of the AT pairs in the acid denaturation of DNA.

    PubMed Central

    Hermann, P; Fredericq, E

    1977-01-01

    It has been determined previously that the protonation of the GC pairs induces a DNA conformation change which leads to a "metastable" structure. The role of the AT pairs, however, is no well known because the protonation does not modify their spectral properties. By means of an indirect method based on the binding of proflavine, it has been determined that the AT pairs are protonated before the acid-induced denaturation and that they seem to be unable to assume a conformation change when protonated. These results would indicate that the protonated AT pairs may be responsible for the induction of the acid denaturation and not the GC pairs as it was thought previously. PMID:20604

  19. Using NMR and molecular dynamics to link structure and dynamics effects of the universal base 8-aza, 7-deaza, N8 linked adenosine analog

    PubMed Central

    Spring-Connell, Alexander M.; Evich, Marina G.; Debelak, Harald; Seela, Frank; Germann, Markus W.

    2016-01-01

    A truly universal nucleobase enables a host of novel applications such as simplified templates for PCR primers, randomized sequencing and DNA based devices. A universal base must pair indiscriminately to each of the canonical bases with little or preferably no destabilization of the overall duplex. In reality, many candidates either destabilize the duplex or do not base pair indiscriminatingly. The novel base 8-aza-7-deazaadenine (pyrazolo[3,4-d]pyrimidin- 4-amine) N8-(2′deoxyribonucleoside), a deoxyadenosine analog (UB), pairs with each of the natural DNA bases with little sequence preference. We have utilized NMR complemented with molecular dynamic calculations to characterize the structure and dynamics of a UB incorporated into a DNA duplex. The UB participates in base stacking with little to no perturbation of the local structure yet forms an unusual base pair that samples multiple conformations. These local dynamics result in the complete disappearance of a single UB proton resonance under native conditions. Accommodation of the UB is additionally stabilized via heightened backbone conformational sampling. NMR combined with various computational techniques has allowed for a comprehensive characterization of both structural and dynamic effects of the UB in a DNA duplex and underlines that the UB as a strong candidate for universal base applications. PMID:27566150

  20. Intermolecular interactions of trifluorohalomethanes with Lewis bases in the gas phase: An ab initio study

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Yi-Siang; Yin, Chih-Chien; Chao, Sheng D., E-mail: sdchao@spring.iam.ntu.edu.tw

    2014-10-07

    We perform an ab initio computational study of molecular complexes with the general formula CF{sub 3}X—B that involve one trifluorohalomethane CF{sub 3}X (X = Cl or Br) and one of a series of Lewis bases B in the gas phase. The Lewis bases are so chosen that they provide a range of electron-donating abilities for comparison. Based on the characteristics of their electron pairs, we consider the Lewis bases with a single n-pair (NH{sub 3} and PH{sub 3}), two n-pairs (H{sub 2}O and H{sub 2}S), two n-pairs with an unsaturated bond (H{sub 2}CO and H{sub 2}CS), and a single π-pairmore » (C{sub 2}H{sub 4}) and two π-pairs (C{sub 2}H{sub 2}). The aim is to systematically investigate the influence of the electron pair characteristics and the central atom substitution effects on the geometries and energetics of the formed complexes. The counterpoise-corrected supermolecule MP2 and coupled-cluster single double with perturbative triple [CCSD(T)] levels of theory have been employed, together with a series of basis sets up to aug-cc-pVTZ. The angular and radial configurations, the binding energies, and the electrostatic potentials of the stable complexes have been compared and discussed as the Lewis base varies. For those complexes where halogen bonding plays a significant role, the calculated geometries and energetics are consistent with the σ-hole model. Upon formation of stable complexes, the C–X bond lengths shorten, while the C–X vibrational frequencies increase, thus rendering blueshifting halogen bonds. The central atom substitution usually enlarges the intermolecular bond distances while it reduces the net charge transfers, thus weakening the bond strengths. The analysis based on the σ-hole model is grossly reliable but requires suitable modifications incorporating the central atom substitution effects, in particular, when interaction components other than electrostatic contributions are involved.« less

  1. The repeating nucleotide sequence in the repetitive mitochondrial DNA from a "low-density" petite mutant of yeast.

    PubMed Central

    Van Kreijl, C F; Bos, J L

    1977-01-01

    The repeating nucleotide sequence of 68 base pairs in the mtDNA from an ethidium-induced cytoplasmic petite mutant of yeast has been determined. For sequence analysis specifically primed and terminated RNA copies, obtained by in vitro transcription of the separated strands, were use. The sequence consists of 66 consecutive AT base pairs flanked by two GC pairs and comprises nearly all of the mutant mitochondrial genome. The sequence, moreover, also represents the first part of wild-type mtDNA sequence so far. Images PMID:198740

  2. Sample size considerations for paired experimental design with incomplete observations of continuous outcomes.

    PubMed

    Zhu, Hong; Xu, Xiaohan; Ahn, Chul

    2017-01-01

    Paired experimental design is widely used in clinical and health behavioral studies, where each study unit contributes a pair of observations. Investigators often encounter incomplete observations of paired outcomes in the data collected. Some study units contribute complete pairs of observations, while the others contribute either pre- or post-intervention observations. Statistical inference for paired experimental design with incomplete observations of continuous outcomes has been extensively studied in literature. However, sample size method for such study design is sparsely available. We derive a closed-form sample size formula based on the generalized estimating equation approach by treating the incomplete observations as missing data in a linear model. The proposed method properly accounts for the impact of mixed structure of observed data: a combination of paired and unpaired outcomes. The sample size formula is flexible to accommodate different missing patterns, magnitude of missingness, and correlation parameter values. We demonstrate that under complete observations, the proposed generalized estimating equation sample size estimate is the same as that based on the paired t-test. In the presence of missing data, the proposed method would lead to a more accurate sample size estimate comparing with the crude adjustment. Simulation studies are conducted to evaluate the finite-sample performance of the generalized estimating equation sample size formula. A real application example is presented for illustration.

  3. A comparative review of methods for comparing means using partially paired data.

    PubMed

    Guo, Beibei; Yuan, Ying

    2017-06-01

    In medical experiments with the objective of testing the equality of two means, data are often partially paired by design or because of missing data. The partially paired data represent a combination of paired and unpaired observations. In this article, we review and compare nine methods for analyzing partially paired data, including the two-sample t-test, paired t-test, corrected z-test, weighted t-test, pooled t-test, optimal pooled t-test, multiple imputation method, mixed model approach, and the test based on a modified maximum likelihood estimate. We compare the performance of these methods through extensive simulation studies that cover a wide range of scenarios with different effect sizes, sample sizes, and correlations between the paired variables, as well as true underlying distributions. The simulation results suggest that when the sample size is moderate, the test based on the modified maximum likelihood estimator is generally superior to the other approaches when the data is normally distributed and the optimal pooled t-test performs the best when the data is not normally distributed, with well-controlled type I error rates and high statistical power; when the sample size is small, the optimal pooled t-test is to be recommended when both variables have missing data and the paired t-test is to be recommended when only one variable has missing data.

  4. Reference set for performance testing of pediatric vaccine safety signal detection methods and systems.

    PubMed

    Brauchli Pernus, Yolanda; Nan, Cassandra; Verstraeten, Thomas; Pedenko, Mariia; Osokogu, Osemeke U; Weibel, Daniel; Sturkenboom, Miriam; Bonhoeffer, Jan

    2016-12-12

    Safety signal detection in spontaneous reporting system databases and electronic healthcare records is key to detection of previously unknown adverse events following immunization. Various statistical methods for signal detection in these different datasources have been developed, however none are geared to the pediatric population and none specifically to vaccines. A reference set comprising pediatric vaccine-adverse event pairs is required for reliable performance testing of statistical methods within and across data sources. The study was conducted within the context of the Global Research in Paediatrics (GRiP) project, as part of the seventh framework programme (FP7) of the European Commission. Criteria for the selection of vaccines considered in the reference set were routine and global use in the pediatric population. Adverse events were primarily selected based on importance. Outcome based systematic literature searches were performed for all identified vaccine-adverse event pairs and complemented by expert committee reports, evidence based decision support systems (e.g. Micromedex), and summaries of product characteristics. Classification into positive (PC) and negative control (NC) pairs was performed by two independent reviewers according to a pre-defined algorithm and discussed for consensus in case of disagreement. We selected 13 vaccines and 14 adverse events to be included in the reference set. From a total of 182 vaccine-adverse event pairs, we classified 18 as PC, 113 as NC and 51 as unclassifiable. Most classifications (91) were based on literature review, 45 were based on expert committee reports, and for 46 vaccine-adverse event pairs, an underlying pathomechanism was not plausible classifying the association as NC. A reference set of vaccine-adverse event pairs was developed. We propose its use for comparing signal detection methods and systems in the pediatric population. Published by Elsevier Ltd.

  5. Recognition of T·G mismatched base pairs in DNA by stacked imidazole-containing polyamides: surface plasmon resonance and circular dichroism studies

    PubMed Central

    Lacy, Eilyn R.; Cox, Kari K.; Wilson, W. David; Lee, Moses

    2002-01-01

    An imidazole-containing polyamide trimer, f-ImImIm, where f is a formamido group, was recently found using NMR methods to recognize T·G mismatched base pairs. In order to characterize in detail the T·G recognition affinity and specificity of imidazole-containing polyamides, f-ImIm, f-ImImIm and f-PyImIm were synthesized. The kinetics and thermodynamics for the polyamides binding to Watson–Crick and mismatched (containing one or two T·G, A·G or G·G mismatched base pairs) hairpin oligonucleotides were determined by surface plasmon resonance and circular dichroism (CD) methods. f-ImImIm binds significantly more strongly to the T·G mismatch-containing oligonucleotides than to the sequences with other mismatched or with Watson–Crick base pairs. Compared with the Watson–Crick CCGG sequence, f-ImImIm associates more slowly with DNAs containing T·G mismatches in place of one or two C·G base pairs and, more importantly, the dissociation rate from the T·G oligonucleotides is very slow (small kd). These results clearly demonstrate the binding selectivity and enhanced affinity of side-by-side imidazole/imidazole pairings for T·G mismatches and show that the affinity and specificity increase arise from much lower kd values with the T·G mismatched duplexes. CD titration studies of f-ImImIm complexes with T·G mismatched sequences produce strong induced bands at ∼330 nm with clear isodichroic points, in support of a single minor groove complex. CD DNA bands suggest that the complexes remain in the B conformation. PMID:11937638

  6. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ogle, James M.; Brodersen, Ditlev E.; Clemons, William M.

    Crystal structures of the 30S ribosomal subunit in complex with messenger RNA and cognate transfer RNA in the A site, both in the presence and absence of the antibiotic paromomycin, have been solved at between 3.1 and 3.3 angstroms resolution. Cognate transfer RNA (tRNA) binding induces global domain movements of the 30S subunit and changes in the conformation of the universally conserved and essential bases A1492, A1493, and G530 of 16S RNA. These bases interact intimately with the minor groove of the first two base pairs between the codon and anticodon, thus sensing Watson-Crick base-pairing geometry and discriminating against near-cognatemore » tRNA. The third, or 'wobble,' position of the codon is free to accommodate certain noncanonical base pairs. By partially inducing these structural changes, paromomycin facilitates binding of near-cognate tRNAs.« less

  7. Energy hyperspace for stacking interaction in AU/AU dinucleotide step: Dispersion-corrected density functional theory study.

    PubMed

    Mukherjee, Sanchita; Kailasam, Senthilkumar; Bansal, Manju; Bhattacharyya, Dhananjay

    2014-01-01

    Double helical structures of DNA and RNA are mostly determined by base pair stacking interactions, which give them the base sequence-directed features, such as small roll values for the purine-pyrimidine steps. Earlier attempts to characterize stacking interactions were mostly restricted to calculations on fiber diffraction geometries or optimized structure using ab initio calculations lacking variation in geometry to comment on rather unusual large roll values observed in AU/AU base pair step in crystal structures of RNA double helices. We have generated stacking energy hyperspace by modeling geometries with variations along the important degrees of freedom, roll, and slide, which were chosen via statistical analysis as maximally sequence dependent. Corresponding energy contours were constructed by several quantum chemical methods including dispersion corrections. This analysis established the most suitable methods for stacked base pair systems despite the limitation imparted by number of atom in a base pair step to employ very high level of theory. All the methods predict negative roll value and near-zero slide to be most favorable for the purine-pyrimidine steps, in agreement with Calladine's steric clash based rule. Successive base pairs in RNA are always linked by sugar-phosphate backbone with C3'-endo sugars and this demands C1'-C1' distance of about 5.4 Å along the chains. Consideration of an energy penalty term for deviation of C1'-C1' distance from the mean value, to the recent DFT-D functionals, specifically ωB97X-D appears to predict reliable energy contour for AU/AU step. Such distance-based penalty improves energy contours for the other purine-pyrimidine sequences also. © 2013 Wiley Periodicals, Inc. Biopolymers 101: 107-120, 2014. Copyright © 2013 Wiley Periodicals, Inc.

  8. Retention of nucleic acids in ion-pair reversed-phase high-performance liquid chromatography depends not only on base composition but also on base sequence.

    PubMed

    Qiao, Jun-Qin; Liang, Chao; Wei, Lan-Chun; Cao, Zhao-Ming; Lian, Hong-Zhen

    2016-12-01

    The study on nucleic acid retention in ion-pair reversed-phase high-performance liquid chromatography mainly focuses on size-dependence, however, other factors influencing retention behaviors have not been comprehensively clarified up to date. In this present work, the retention behaviors of oligonucleotides and double-stranded DNAs were investigated on silica-based C 18 stationary phase by ion-pair reversed-phase high-performance liquid chromatography. It is found that the retention of oligonucleotides was influenced by base composition and base sequence as well as size, and oligonucleotides prone to self-dimerization have weaker retention than those not prone to self-dimerization but with the same base composition. However, homo-oligonucleotides are suitable for the size-dependent separation as a special case of oligonucleotides. For double-stranded DNAs, the retention is also influenced by base composition and base sequence, as well as size. This may be attributed to the interaction of exposed bases in major or minor grooves with the hydrophobic alky chains of stationary phase. In addition, no specific influence of guanine and cytosine content was confirmed on retention of double-stranded DNAs. Notably, the space effect resulted from the stereostructure of nucleic acids also influences the retention behavior in ion-pair reversed-phase high-performance liquid chromatography. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Measuring Three-Dimensional Thorax Motion Via Biplane Radiographic Imaging: Technique and Preliminary Results.

    PubMed

    Baumer, Timothy G; Giles, Joshua W; Drake, Anne; Zauel, Roger; Bey, Michael J

    2016-01-01

    Measures of scapulothoracic motion are dependent on accurate imaging of the scapula and thorax. Advanced radiographic techniques can provide accurate measures of scapular motion, but the limited 3D imaging volume of these techniques often precludes measurement of thorax motion. To overcome this, a thorax coordinate system was defined based on the position of rib pairs and then compared to a conventional sternum/spine-based thorax coordinate system. Alignment of the rib-based coordinate system was dependent on the rib pairs used, with the rib3:rib4 pairing aligned to within 4.4 ± 2.1 deg of the conventional thorax coordinate system.

  10. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    NASA Astrophysics Data System (ADS)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  11. Pair distribution function study and mechanical behavior of as-cast and structurally relaxed Zr-based bulk metallic glasses

    NASA Astrophysics Data System (ADS)

    Fan, Cang; Liaw, P. K.; Wilson, T. W.; Choo, H.; Gao, Y. F.; Liu, C. T.; Proffen, Th.; Richardson, J. W.

    2006-12-01

    Contrary to reported results on structural relaxation inducing brittleness in amorphous alloys, the authors found that structural relaxation actually caused an increase in the strength of Zr55Cu35Al10 bulk metallic glass (BMG) without changing the plasticity. Three dimensional models were rebuilt for the as-cast and structurally relaxed BMGs by reverse Monte Carlo (RMC) simulations based on the pair distribution function (PDF) measured by neutron scattering. Only a small portion of the atom pairs was found to change to more dense packing. The concept of free volume was defined based on the PDF and RMC studies, and the mechanism of mechanical behavior was discussed.

  12. ClaRNA: a classifier of contacts in RNA 3D structures based on a comparative analysis of various classification schemes

    PubMed Central

    Waleń, Tomasz; Chojnowski, Grzegorz; Gierski, Przemysław; Bujnicki, Janusz M.

    2014-01-01

    The understanding of folding and function of RNA molecules depends on the identification and classification of interactions between ribonucleotide residues. We developed a new method named ClaRNA for computational classification of contacts in RNA 3D structures. Unique features of the program are the ability to identify imperfect contacts and to process coarse-grained models. Each doublet of spatially close ribonucleotide residues in a query structure is compared to clusters of reference doublets obtained by analysis of a large number of experimentally determined RNA structures, and assigned a score that describes its similarity to one or more known types of contacts, including pairing, stacking, base–phosphate and base–ribose interactions. The accuracy of ClaRNA is 0.997 for canonical base pairs, 0.983 for non-canonical pairs and 0.961 for stacking interactions. The generalized squared correlation coefficient (GC2) for ClaRNA is 0.969 for canonical base pairs, 0.638 for non-canonical pairs and 0.824 for stacking interactions. The classifier can be easily extended to include new types of spatial relationships between pairs or larger assemblies of nucleotide residues. ClaRNA is freely available via a web server that includes an extensive set of tools for processing and visualizing structural information about RNA molecules. PMID:25159614

  13. Homologous Chromosome Pairing in Drosophila melanogaster Proceeds through Multiple Independent Initiations

    PubMed Central

    Fung, Jennifer C.; Marshall, Wallace F.; Dernburg, Abby; Agard, David A.; Sedat, John W.

    1998-01-01

    The dynamics by which homologous chromosomes pair is currently unknown. Here, we use fluorescence in situ hybridization in combination with three-dimensional optical microscopy to show that homologous pairing of the somatic chromosome arm 2L in Drosophila occurs by independent initiation of pairing at discrete loci rather than by a processive zippering of sites along the length of chromosome. By evaluating the pairing frequencies of 11 loci on chromosome arm 2L over several timepoints during Drosophila embryonic development, we show that all 11 loci are paired very early in Drosophila development, within 13 h after egg deposition. To elucidate whether such pairing occurs by directed or undirected motion, we analyzed the pairing kinetics of histone loci during nuclear cycle 14. By measuring changes of nuclear length and correlating these changes with progression of time during cycle 14, we were able to express the pairing frequency and distance between homologous loci as a function of time. Comparing the experimentally determined dynamics of pairing to simulations based on previously proposed models of pairing motion, we show that the observed pairing kinetics are most consistent with a constrained random walk model and not consistent with a directed motion model. Thus, we conclude that simple random contacts through diffusion could suffice to allow pairing of homologous sites. PMID:9531544

  14. Homologous chromosome pairing in Drosophila melanogaster proceeds through multiple independent initiations.

    PubMed

    Fung, J C; Marshall, W F; Dernburg, A; Agard, D A; Sedat, J W

    1998-04-06

    The dynamics by which homologous chromosomes pair is currently unknown. Here, we use fluorescence in situ hybridization in combination with three-dimensional optical microscopy to show that homologous pairing of the somatic chromosome arm 2L in Drosophila occurs by independent initiation of pairing at discrete loci rather than by a processive zippering of sites along the length of chromosome. By evaluating the pairing frequencies of 11 loci on chromosome arm 2L over several timepoints during Drosophila embryonic development, we show that all 11 loci are paired very early in Drosophila development, within 13 h after egg deposition. To elucidate whether such pairing occurs by directed or undirected motion, we analyzed the pairing kinetics of histone loci during nuclear cycle 14. By measuring changes of nuclear length and correlating these changes with progression of time during cycle 14, we were able to express the pairing frequency and distance between homologous loci as a function of time. Comparing the experimentally determined dynamics of pairing to simulations based on previously proposed models of pairing motion, we show that the observed pairing kinetics are most consistent with a constrained random walk model and not consistent with a directed motion model. Thus, we conclude that simple random contacts through diffusion could suffice to allow pairing of homologous sites.

  15. Ag(I)-mediated homo and hetero pairs of guanosine and cytidine: monitoring by circular dichroism spectroscopy.

    PubMed

    Goncharova, Iryna

    2014-01-24

    Ag(I)-containing compounds are attractive as antibacterial and antifungal agents. The renewed interest in the application of silver(I) compounds has led to the need for detailed knowledge of the mechanism of their action. One of the possible ways is the coordination of Ag(I) to G-C pairs of DNA, where Ag(+) ions form Ag(I)-mediated base pairs and inhibit the transcription. Herein, a systematic chiroptical study on silver(I)-mediated homo and mixed pairs of the C-G complementary-base derivatives cytidine(C) and 5'-guanosine monophosphate(G) in water is presented. Ag(I)-mediated homo and hetero pairs of G and C and their self-assembled species were studied under two pH levels (7.0 and 10.0) by vibrational (VCD) and electronic circular dichroism(ECD). VCD was used for the first time in this field and showed itself to be a powerful method for obtaining specific structural information in solution. Based on results of the VCD experiments, the different geometries of the homo pairs were proposed under pH 7.0 and 10.0. ECD was used as a diagnostic tool to characterize the studied systems and as a contact point between the previously defined structures of the metal or proton mediated pairs of nucleobases and the systems studied here. On the basis of the obtained data, the formation of the self-assembled species of cytidine with a structure similar to the i-motif structure in DNA was proposed at pH 10.0. Copyright © 2013 Elsevier B.V. All rights reserved.

  16. Ag(I)-mediated homo and hetero pairs of guanosine and cytidine: Monitoring by circular dichroism spectroscopy

    NASA Astrophysics Data System (ADS)

    Goncharova, Iryna

    2014-01-01

    Ag(I)-containing compounds are attractive as antibacterial and antifungal agents. The renewed interest in the application of silver(I) compounds has led to the need for detailed knowledge of the mechanism of their action. One of the possible ways is the coordination of Ag(I) to G-C pairs of DNA, where Ag+ ions form Ag(I)-mediated base pairs and inhibit the transcription. Herein, a systematic chiroptical study on silver(I)-mediated homo and mixed pairs of the C-G complementary-base derivatives cytidine(C) and 5‧-guanosine monophosphate(G) in water is presented. Ag(I)-mediated homo and hetero pairs of G and C and their self-assembled species were studied under two pH levels (7.0 and 10.0) by vibrational (VCD) and electronic circular dichroism(ECD). VCD was used for the first time in this field and showed itself to be a powerful method for obtaining specific structural information in solution. Based on results of the VCD experiments, the different geometries of the homo pairs were proposed under pH 7.0 and 10.0. ECD was used as a diagnostic tool to characterize the studied systems and as a contact point between the previously defined structures of the metal or proton mediated pairs of nucleobases and the systems studied here. On the basis of the obtained data, the formation of the self-assembled species of cytidine with a structure similar to the i-motif structure in DNA was proposed at pH 10.0.

  17. Socialization in Pigtailed Macaques (Macaca nemestrina)

    PubMed Central

    WORLEIN, JULIE M.; KROEKER, ROSE; LEE, GRACE H.; THOM, JINHEE P.; BELLANCA, RITA U.; CROCKETT, CAROLYN M.

    2018-01-01

    In response to new emphasis by regulatory agencies regarding socialization, behavioral management programs are allocating greater resources to maximize socialization opportunities for laboratory primates. Information regarding predictors of compatibility and risk of injury for all laboratory-housed species of macaques are needed to make social introductions and pairings as efficient and safe as possible. This study presents data on 674 pairs of pigtailed macaques (Macaca nemestrina) at the Washington National Primate Research Center over a 7-year period. During pair introduction, behavior was monitored while the degree of tactile contact was gradually increased. Based on observed behavior, pairs were assigned a behavioral introduction score (BIS), rating the quality of their interactions for each day of introduction. Animals deemed compatible, based on the BIS and technologist judgment, were allowed to progress to continuous contact with no staff present. A small proportion of animals deemed compatible at introduction was later separated for subsequent incompatibility or aggression; these proportions were higher in full contact compared to protected contact pairings. Of 674 pairs, 75% were deemed compatible at introduction in protected contact; 86 of these pairs were later transitioned to full contact with 98% compatibility. Predictors of decreased compatibility assessed during protected contact introductions included age (adult pairs were less compatible), the BIS on the last day of introduction, and aggression or injury during the introductory period. Predictors of injuries during the protected contact introduction process included: aggression on the first day of introduction, a negative BIS on the first or last day of introduction, and, surprisingly, the presence of grooming on the first day of introduction. Injuries during both introduction and subsequent pairing in protected contact were rare; however, injury rates increased significantly during full-contact pairing. These findings underscore the necessity of species-specific data to guide decision-making during the social introduction process. PMID:27109591

  18. Base pairing between the 3' exon and an internal guide sequence increases 3' splice site specificity in the Tetrahymena self-splicing rRNA intron.

    PubMed Central

    Suh, E R; Waring, R B

    1990-01-01

    It has been proposed that recognition of the 3' splice site in many group I introns involves base pairing between the start of the 3' exon and a region of the intron known as the internal guide sequence (R. W. Davies, R. B. Waring, J. Ray, T. A. Brown, and C. Scazzocchio, Nature [London] 300:719-724, 1982). We have examined this hypothesis, using the self-splicing rRNA intron from Tetrahymena thermophila. Mutations in the 3' exon that weaken this proposed pairing increased use of a downstream cryptic 3' splice site. Compensatory mutations in the guide sequence that restore this pairing resulted in even stronger selection of the normal 3' splice site. These changes in 3' splice site usage were more pronounced in the background of a mutation (414A) which resulted in an adenine instead of a guanine being the last base of the intron. These results show that the proposed pairing (P10) plays an important role in ensuring that cryptic 3' splice sites are selected against. Surprisingly, the 414A mutation alone did not result in activation of the cryptic 3' splice site. Images PMID:2342465

  19. Mediated Activity in the Primary Classroom: Girls, Boys and Computers.

    ERIC Educational Resources Information Center

    Fitzpatrick, Helen; Hardman, Margaret

    2000-01-01

    Studied the social interaction of 7- and 9-year-olds working in the same or mixed gender pairs on language-based computer and noncomputer tasks. At both ages, mixed gender pairs showed more assertive and less transactive (collaborative) interaction than same gender pairs on both tasks. Discusses the mediational role of the computer and the social…

  20. Memory for Object Locations: Priority Effect and Sex Differences in Associative Spatial Learning

    ERIC Educational Resources Information Center

    Cinan, Sevtap; Atalay, Deniz; Sisman, Simge; Basbug, Gokce; Dervent-Ozbek, Sevinc; Teoman, Dalga D.; Karagoz, Ayca; Karadeniz, A. Yezdan; Beykurt, Sinem; Suleyman, Hediye; Memis, H. Ozge; Yurtsever, Ozgur D.

    2007-01-01

    This paper reports two experiments conducted to examine priority effects and sex differences in object location memory. A new task of paired position-learning was designed, based on the A-B A-C paradigm, which was used in paired word learning. There were three different paired position-learning conditions: (1) positions of several different…

  1. A Macroscopic Analogue of the Nuclear Pairing Potential

    ERIC Educational Resources Information Center

    Dunlap, Richard A.

    2013-01-01

    A macroscopic system involving permanent magnets is used as an analogue to nucleons in a nucleus to illustrate the significance of the pairing interaction. This illustrates that the view of the total nuclear energy based only on the nucleon occupancy of the energy levels can yield erroneous results and it is only when the pairing interaction is…

  2. Coexistence of Multiple Attractors in an Active Diode Pair Based Chua’s Circuit

    NASA Astrophysics Data System (ADS)

    Bao, Bocheng; Wu, Huagan; Xu, Li; Chen, Mo; Hu, Wen

    This paper focuses on the coexistence of multiple attractors in an active diode pair based Chua’s circuit with smooth nonlinearity. With dimensionless equations, dynamical properties, including boundness of system orbits and stability distributions of two nonzero equilibrium points, are investigated, and complex coexisting behaviors of multiple kinds of disconnected attractors of stable point attractors, limit cycles and chaotic attractors are numerically revealed. The results show that unlike the classical Chua’s circuit, the proposed circuit has two stable nonzero node-foci for the specified circuit parameters, thereby resulting in the emergence of multistability phenomenon. Based on two general impedance converters, the active diode pair based Chua’s circuit with an adjustable inductor and an adjustable capacitor is made in hardware, from which coexisting multiple attractors are conveniently captured.

  3. Analyzing Population Genetics Using the Mitochondrial Control Region and Bioinformatics

    ERIC Educational Resources Information Center

    Sato, Takumi; Phillips, Bonnie; Latourelle, Sandra M.; Elwess, Nancy L.

    2010-01-01

    The 14-base pair hypervariable region in mitochondrial DNA (mtDNA) of Asian populations, specifically Japanese and Chinese students at Plattsburgh State University, was examined. Previous research on this 14-base pair region showed it to be susceptible to mutations and as a result indicated direct correlation with specific ethnic populations.…

  4. Binding of DNA hairpins to an assembler-strand as part of a primordial translation device

    NASA Astrophysics Data System (ADS)

    Baumann, Ulrich

    1987-09-01

    A crucial event in the process leading to the origin of life is the emergence of a simple translation device. To approach experimental realization of this device the binding ability of short DNA hairpins to complementary oligonucleotides fixed on a solid support was investigated. The binding is achieved by base pairing between the loop nucleotides of the hairpins containing different numbers of adenosine residues and oligothymidylates covalently linked to cellulose. The loop has to consist of at least five nucleotides to achieve binding. The exact number of established base pairs was determined in two ways. First, the elution temperatures of hairpins and those of oligoadenylates which had the length of the loop were compared. Secondly, the architecture of the loop was analyzed by means of the single-strand-specific nuclease from mung bean acting as structural probe. Onlyn-2 of n loop nucleotides of a hairpin are able to form base pairs. Therefore, a strong evidence for the formation of a triplet of base pairs between primeval tRNA and mRNA sufficient to stabilize the complex enzyme-free is given.

  5. Solvent effect on the intermolecular proton transfer of the Watson and Crick guanine-cytosine and adenine-thymine base pairs: a polarizable continuum model study.

    PubMed

    Romero, Eduardo E; Hernandez, Florencio E

    2018-01-03

    Herein we present our results on the study of the double proton transfer (DPT) mechanism in the adenine-thymine (AT) and guanine-cytosine (GC) base pairs, both in gas phase and in solution. The latter was modeled using the polarizable continuum method (PCM) in different solvents. According to our DFT calculations, the DPT may occur for both complexes in a stepwise mechanism in condensate phase. In gas phase only the GC base pair exhibits a concerted DPT mechanism. Using the Wigner's tunneling corrections to the transition state theory we demonstrate that such corrections are important for the prediction of the rate constants of both systems in gas and in condensate phase. We also show that (i) as the polarity of the medium decreases the equilibrium constant of the DPT reaction increases in both complexes, and (ii) that the equilibrium constant in the GC complex is four orders of magnitude larger than in AT. This observation suggests that the spontaneous mutations in DNA base pairs are more probable in GC than in AT.

  6. [Quantum-chemical investigation of tautomerization ways of Watson-Crick DNA base pair guanine-cytosine].

    PubMed

    Brovarets', O O; Hovorun, D M

    2010-01-01

    A novel physico-chemical mechanism of the Watson-Crick DNA base pair Gua.Cyt tautomerization Gua.Cyt*<---->Gua.Cyt<---->Gua*.Cyt (mutagenic tautomers of bases are marked by asterisks) have been revealed and realized in a pathway of single proton transfer through two mutual isoenergetic transition states with Gibbs free energy of activation 30.4 and 30.6 kcal/mol and they are ion pairs stabilized by three (N2H...N3, N1H...N4- and O6+H...N4-) and five (N2H...O2, N1H...O2, N1H...N3, O6+H...N4- and 06+H...N4-) H-bonds accordingly. Stable base pairs Gua-Cyt* and Gua*.Cyt which dissociate comparably easy into monomers have acceptable relative Gibbs energies--12.9 and 14.3 kcal/mol--for the explanation of the nature of the spontaneous transitions of DNA replication. Results are obtained at the MP2/6-311++G(2df,pd)//B3LYP/6-31 1++G(d,p) level of theory in vacuum approach.

  7. DFT investigation of the vibrational properties of GC Watson-Crick and Hoogsteen base pairs in the presence of Mg²⁺, Ca²⁺, and Cu²⁺ ions.

    PubMed

    Morari, Cristian; Muntean, Cristina M; Tripon, Carmen; Buimaga-Iarinca, Luiza; Calborean, Adrian

    2014-04-01

    The binding effects of Mg²⁺, Ca²⁺, and Cu²⁺ ions on the vibrational properties of guanine-cytosine base pairs have been performed using density functional theory investigations. Both Watson-Crick and Hoogsteen configurations of the base pairs were investigated. In Watson-Crick configuration, the metal was coordinated at N7 atom of guanine, while in the case of Hoogsteen configuration, the coordination is at N3 atom of guanine. We have pointed out the geometric properties of the metal-GC base pairs structure, as well as the vibrational bands that can be used to detect the presence of metallic ions in the Watson-Crick and Hoogsteen GC structures. For the geometric models used by us, the vibrational amplitudes of metallic atoms were stronger for wavenumbers lower than 500 cm⁻¹. This suggests that in the experimental studies on DNA the presence of the three metallic atoms (Mg, Ca, and Cu) can be explicitly detected at low frequencies.

  8. Large-Scale, Exhaustive Lattice-Based Structural Auditing of SNOMED CT

    NASA Astrophysics Data System (ADS)

    Zhang, Guo-Qiang

    One criterion for the well-formedness of ontologies is that their hierarchical structure form a lattice. Formal Concept Analysis (FCA) has been used as a technique for assessing the quality of ontologies, but is not scalable to large ontologies such as SNOMED CT. We developed a methodology called Lattice-based Structural Auditing (LaSA), for auditing biomedical ontologies, implemented through automated SPARQL queries, in order to exhaustively identify all non-lattice pairs in SNOMED CT. The percentage of non-lattice pairs ranges from 0 to 1.66 among the 19 SNOMED CT hierarchies. Preliminary manual inspection of a limited portion of the 518K non-lattice pairs, among over 34 million candidate pairs, revealed inconsistent use of precoordination in SNOMED CT, but also a number of false positives. Our results are consistent with those based on FCA, with the advantage that the LaSA computational pipeline is scalable and applicable to ontological systems consisting mostly of taxonomic links. This work is based on collaboration with Olivier Bodenreider from the National Library of Medicine, Bethesda, USA.

  9. An inversion of 25 base pairs causes feline GM2 gangliosidosis variant.

    PubMed

    Martin, Douglas R; Krum, Barbara K; Varadarajan, G S; Hathcock, Terri L; Smith, Bruce F; Baker, Henry J

    2004-05-01

    In G(M2) gangliosidosis variant 0, a defect in the beta-subunit of lysosomal beta-N-acetylhexosaminidase (EC 3.2.1.52) causes abnormal accumulation of G(M2) ganglioside and severe neurodegeneration. Distinct feline models of G(M2) gangliosidosis variant 0 have been described in both domestic shorthair and Korat cats. In this study, we determined that the causative mutation of G(M2) gangliosidosis in the domestic shorthair cat is a 25-base-pair inversion at the extreme 3' end of the beta-subunit (HEXB) coding sequence, which introduces three amino acid substitutions at the carboxyl terminus of the protein and a translational stop that is eight amino acids premature. Cats homozygous for the 25-base-pair inversion express levels of beta-subunit mRNA approximately 190% of normal and protein levels only 10-20% of normal. Because the 25-base-pair inversion is similar to mutations in the terminal exon of human HEXB, the domestic shorthair cat should serve as an appropriate model to study the molecular pathogenesis of human G(M2) gangliosidosis variant 0 (Sandhoff disease).

  10. Combined effects of metal complexation and size expansion in the electronic structure of DNA base pairs

    NASA Astrophysics Data System (ADS)

    Brancolini, Giorgia; Di Felice, Rosa

    2011-05-01

    Novel DNA derivatives have been recently investigated in the pursuit of modified DNA duplexes to tune the electronic structure of DNA-based assemblies for nanotechnology applications. Size-expanded DNAs (e.g., xDNA) and metalated DNAs (M-DNA) may enhance stacking interactions and induce metallic conductivity, respectively. Here we explore possible ways of tailoring the DNA electronic structure by combining the aromatic size expansion with the metal-doping. We select the salient structures from our recent study on natural DNA pairs complexed with transition metal ions and consider the equivalent model configurations for xDNA pairs. We present the results of density functional theory electronic structure calculations of the metalated expanded base-pairs with various localized basis sets and exchange-correlation functionals. Implicit solvent and coordination water molecules are also included. Our results indicate that the effect of base expansion is largest in Ag-xGC complexes, while Cu-xGC complexes are the most promising candidates for nanowires with enhanced electron transfer and also for on-purpose modification of the DNA double-helix for signal detection.

  11. Are herb-pairs of traditional Chinese medicine distinguishable from others? Pattern analysis and artificial intelligence classification study of traditionally defined herbal properties.

    PubMed

    Ung, Choong Yong; Li, Hu; Cao, Zhi Wei; Li, Yi Xue; Chen, Yu Zong

    2007-05-04

    Multi-herb prescriptions of traditional Chinese medicine (TCM) often include special herb-pairs for mutual enhancement, assistance, and restraint. These TCM herb-pairs have been assembled and interpreted based on traditionally defined herbal properties (TCM-HPs) without knowledge of mechanism of their assumed synergy. While these mechanisms are yet to be determined, properties of TCM herb-pairs can be investigated to determine if they exhibit features consistent with their claimed unique synergistic combinations. We analyzed distribution patterns of TCM-HPs of TCM herb-pairs to detect signs indicative of possible synergy and used artificial intelligence (AI) methods to examine whether combination of their TCM-HPs are distinguishable from those of non-TCM herb-pairs assembled by random combinations and by modification of known TCM herb-pairs. Patterns of the majority of 394 known TCM herb-pairs were found to exhibit signs of herb-pair correlation. Three AI systems, trained and tested by using 394 TCM herb-pairs and 2470 non-TCM herb-pairs, correctly classified 72.1-87.9% of TCM herb-pairs and 91.6-97.6% of the non-TCM herb-pairs. The best AI system predicted 96.3% of the 27 known non-TCM herb-pairs and 99.7% of the other 1,065,100 possible herb-pairs as non-TCM herb-pairs. Our studies suggest that TCM-HPs of known TCM herb-pairs contain features distinguishable from those of non-TCM herb-pairs consistent with their claimed synergistic or modulating combinations.

  12. Altered minor-groove hydrogen bonds in DNA block transcription elongation by T7 RNA polymerase.

    PubMed

    Tanasova, Marina; Goeldi, Silvan; Meyer, Fabian; Hanawalt, Philip C; Spivak, Graciela; Sturla, Shana J

    2015-05-26

    DNA transcription depends upon the highly efficient and selective function of RNA polymerases (RNAPs). Modifications in the template DNA can impact the progression of RNA synthesis, and a number of DNA adducts, as well as abasic sites, arrest or stall transcription. Nonetheless, data are needed to understand why certain modifications to the structure of DNA bases stall RNA polymerases while others are efficiently bypassed. In this study, we evaluate the impact that alterations in dNTP/rNTP base-pair geometry have on transcription. T7 RNA polymerase was used to study transcription over modified purines and pyrimidines with altered H-bonding capacities. The results suggest that introducing wobble base-pairs into the DNA:RNA heteroduplex interferes with transcriptional elongation and stalls RNA polymerase. However, transcriptional stalling is not observed if mismatched base-pairs do not H-bond. Together, these studies show that RNAP is able to discriminate mismatches resulting in wobble base-pairs, and suggest that, in cases of modifications with minor steric impact, DNA:RNA heteroduplex geometry could serve as a controlling factor for initiating transcription-coupled DNA repair. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Role of 6-Mercaptopurine in the potential therapeutic targets DNA base pairs and G-quadruplex DNA: insights from quantum chemical and molecular dynamics simulations.

    PubMed

    Radhika, R; Shankar, R; Vijayakumar, S; Kolandaivel, P

    2018-05-01

    The theoretical studies on DNA with the anticancer drug 6-Mercaptopurine (6-MP) are investigated using theoretical methods to shed light on drug designing. Among the DNA base pairs considered, 6-MP is stacked with GC with the highest interaction energy of -46.19 kcal/mol. Structural parameters revealed that structure of the DNA base pairs is deviated from the planarity of the equilibrium position due to the formation of hydrogen bonds and stacking interactions with 6-MP. These deviations are verified through the systematic comparison between X-H bond contraction and elongation and the associated blue shift and red shift values by both NBO analysis and vibrational analysis. Bent's rule is verified for the C-H bond contraction in the 6-MP interacted base pairs. The AIM results disclose that the higher values of electron density (ρ) and Laplacian of electron density (∇ 2 ρ) indicate the increased overlap between the orbitals that represent the strong interaction and positive values of the total electron density show the closed-shell interaction. The relative sensitivity of the chemical shift values for the DNA base pairs with 6-MP is investigated to confirm the hydrogen bond strength. Molecular dynamics simulation studies of G-quadruplex DNA d(TGGGGT) 4 with 6-MP revealed that the incorporation of 6-MP appears to cause local distortions and destabilize the G-quadruplex DNA.

  14. Development of a novel device to trap heavy metal cations: application of the specific interaction between heavy metal cation and mismatch DNA base pair.

    PubMed

    Torigoe, Hidetaka; Miyakawa, Yukako; Fukushi, Miyako; Ono, Akira; Kozasa, Tetsuo

    2009-01-01

    We have already found that Hg(II) cation specifically binds to T:T mismatch base pair in heteroduplex DNA, which increases the melting temperature of heteroduplex DNA involving T:T mismatch base pair by about 4 degrees C. We have also found that Ag(I) cation specifically binds to C:C mismatch base pair in heteroduplex DNA, which increases the melting temperature of heteroduplex DNA involving C:C mismatch base pair by about 4 degrees C. Using the specific interaction, we developed a novel device to trap each of Hg(II) and Ag(I) cation. The device is composed of 5'-biotinylated T-rich or C-rich DNA oligonucleotides, BIO-T20: 5'-Bio-T(20)-3' or BIO-C20: 5'-Bio-C(20)-3' (Bio is a biotin), immobilized on streptavidin-coated polystylene beads. When the BIO-T20-immobilized beads were added to a solution containing Hg(II) cation, and the beads trapping Hg(II) cation were collected by centrifugation, almost all of Hg(II) cation were removed from the solution. Also, when the BIO-C20-immobilized beads were added to a solution containing Ag(I) cation, and the beads trapping Ag(I) cation were collected by centrifugation, almost all of Ag(I) cation were removed from the solution. We conclude that, using the novel device developed in this study, Hg(II) and Ag(I) cation can be effectively removed from the solution.

  15. 2-Thiouracil deprived of thiocarbonyl function preferentially base pairs with guanine rather than adenine in RNA and DNA duplexes

    PubMed Central

    Sochacka, Elzbieta; Szczepanowski, Roman H.; Cypryk, Marek; Sobczak, Milena; Janicka, Magdalena; Kraszewska, Karina; Bartos, Paulina; Chwialkowska, Anna; Nawrot, Barbara

    2015-01-01

    2-Thiouracil-containing nucleosides are essential modified units of natural and synthetic nucleic acids. In particular, the 5-substituted-2-thiouridines (S2Us) present in tRNA play an important role in tuning the translation process through codon–anticodon interactions. The enhanced thermodynamic stability of S2U-containing RNA duplexes and the preferred S2U-A versus S2U-G base pairing are appreciated characteristics of S2U-modified molecular probes. Recently, we have demonstrated that 2-thiouridine (alone or within an RNA chain) is predominantly transformed under oxidative stress conditions to 4-pyrimidinone riboside (H2U) and not to uridine. Due to the important biological functions and various biotechnological applications for sulfur-containing nucleic acids, we compared the thermodynamic stabilities of duplexes containing desulfured products with those of 2-thiouracil-modified RNA and DNA duplexes. Differential scanning calorimetry experiments and theoretical calculations demonstrate that upon 2-thiouracil desulfuration to 4-pyrimidinone, the preferred base pairing of S2U with adenosine is lost, with preferred base pairing with guanosine observed instead. Therefore, biological processes and in vitro assays in which oxidative desulfuration of 2-thiouracil-containing components occurs may be altered. Moreover, we propose that the H2U-G base pair is a suitable model for investigation of the preferred recognition of 3′-G-ending versus A-ending codons by tRNA wobble nucleosides, which may adopt a 4-pyrimidinone-type structural motif. PMID:25690900

  16. A configuration space of homologous proteins conserving mutual information and allowing a phylogeny inference based on pair-wise Z-score probabilities.

    PubMed

    Bastien, Olivier; Ortet, Philippe; Roy, Sylvaine; Maréchal, Eric

    2005-03-10

    Popular methods to reconstruct molecular phylogenies are based on multiple sequence alignments, in which addition or removal of data may change the resulting tree topology. We have sought a representation of homologous proteins that would conserve the information of pair-wise sequence alignments, respect probabilistic properties of Z-scores (Monte Carlo methods applied to pair-wise comparisons) and be the basis for a novel method of consistent and stable phylogenetic reconstruction. We have built up a spatial representation of protein sequences using concepts from particle physics (configuration space) and respecting a frame of constraints deduced from pair-wise alignment score properties in information theory. The obtained configuration space of homologous proteins (CSHP) allows the representation of real and shuffled sequences, and thereupon an expression of the TULIP theorem for Z-score probabilities. Based on the CSHP, we propose a phylogeny reconstruction using Z-scores. Deduced trees, called TULIP trees, are consistent with multiple-alignment based trees. Furthermore, the TULIP tree reconstruction method provides a solution for some previously reported incongruent results, such as the apicomplexan enolase phylogeny. The CSHP is a unified model that conserves mutual information between proteins in the way physical models conserve energy. Applications include the reconstruction of evolutionary consistent and robust trees, the topology of which is based on a spatial representation that is not reordered after addition or removal of sequences. The CSHP and its assigned phylogenetic topology, provide a powerful and easily updated representation for massive pair-wise genome comparisons based on Z-score computations.

  17. Determinants of Base-Pair Substitution Patterns Revealed by Whole-Genome Sequencing of DNA Mismatch Repair Defective Escherichia coli.

    PubMed

    Foster, Patricia L; Niccum, Brittany A; Popodi, Ellen; Townes, Jesse P; Lee, Heewook; MohammedIsmail, Wazim; Tang, Haixu

    2018-06-15

    Mismatch repair (MMR) is a major contributor to replication fidelity, but its impact varies with sequence context and the nature of the mismatch. Mutation accumulation experiments followed by whole-genome sequencing of MMR-defective E. coli strains yielded ≈30,000 base-pair substitutions, revealing mutational patterns across the entire chromosome. The base-pair substitution spectrum was dominated by A:T > G:C transitions, which occurred predominantly at the center base of 5'N A C3'+5'G T N3' triplets. Surprisingly, growth on minimal medium or at low temperature attenuated these mutations. Mononucleotide runs were also hotspots for base-pair substitutions, and the rate at which these occurred increased with run length. Comparison with ≈2000 base-pair substitutions accumulated in MMR-proficient strains revealed that both kinds of hotspots appeared in the wild-type spectrum and so are likely to be sites of frequent replication errors. In MMR-defective strains transitions were strand biased, occurring twice as often when A and C rather than T and G were on the lagging-strand template. Loss of nucleotide diphosphate kinase increases the cellular concentration of dCTP, which resulted in increased rates of mutations due to misinsertion of C opposite A and T. In an mmr ndk double mutant strain, these mutations were more frequent when the template A and T were on the leading strand, suggesting that lagging-strand synthesis was more error-prone or less well corrected by proofreading than was leading strand synthesis. Copyright © 2018, Genetics.

  18. Structure and electronic properties of ion pairs accompanying cyclic morpholinium cation and alkylphosphite anion based ionic liquids

    NASA Astrophysics Data System (ADS)

    Verma, Prakash L.; Singh, Priti; Gejji, Shridhar P.

    2017-07-01

    Molecular insights for the formation of ion pairs accompanying the cyclic ammonium cation based room temperature ionic liquids (RTILs) composed of alkyl substituted N-methylmorpholinium (RMMor) and alkylphosphite [(Rsbnd O)2PHdbnd O] (Rdbnd ethyl, butyl, hexyl, octyl) anion have been derived from the M06-2x level of theory. Electronic structures, binding energies, and spectral characteristics of the ion pairs underlying these RTILs have been characterized. The ion pair formation is largely governed by Csbnd H⋯O and other intermolecular interactions. Calculated binding energies increase with the increasing alkyl chain on either cation or alkylphosphite anion. The cation-anion binding reveals signature in the frequency down-(red) shift of the characteristic anionic Pdbnd O stretching whereas the Psbnd H stretching exhibits a shift in the opposite direction in vibrational spectra which has further been rationalized through molecular electron density topography. Correlations of measured electrochemical stability with the separation of frontier orbital energies and binding energies in the ion pairs have further been established.

  19. Roles of the amino group of purine bases in the thermodynamic stability of DNA base pairing.

    PubMed

    Nakano, Shu-ichi; Sugimoto, Naoki

    2014-08-05

    The energetic aspects of hydrogen-bonded base-pair interactions are important for the design of functional nucleotide analogs and for practical applications of oligonucleotides. The present study investigated the contribution of the 2-amino group of DNA purine bases to the thermodynamic stability of oligonucleotide duplexes under different salt and solvent conditions, using 2'-deoxyriboinosine (I) and 2'-deoxyribo-2,6-diaminopurine (D) as non-canonical nucleotides. The stability of DNA duplexes was changed by substitution of a single base pair in the following order: G • C > D • T ≈ I • C > A • T > G • T > I • T. The apparent stabilization energy due to the presence of the 2-amino group of G and D varied depending on the salt concentration, and decreased in the water-ethanol mixed solvent. The effects of salt concentration on the thermodynamics of DNA duplexes were found to be partially sequence-dependent, and the 2-amino group of the purine bases might have an influence on the binding of ions to DNA through the formation of a stable base-paired structure. Our results also showed that physiological salt conditions were energetically favorable for complementary base recognition, and conversely, low salt concentration media and ethanol-containing solvents were effective for low stringency oligonucleotide hybridization, in the context of conditions employed in this study.

  20. Base Pairing between U3 Small Nucleolar RNA and the 5′ End of 18S rRNA Is Required for Pre-rRNA Processing

    PubMed Central

    Sharma, Kishor; Tollervey, David

    1999-01-01

    The loop of a stem structure close to the 5′ end of the 18S rRNA is complementary to the box A region of the U3 small nucleolar RNA (snoRNA). Substitution of the 18S loop nucleotides inhibited pre-rRNA cleavage at site A1, the 5′ end of the 18S rRNA, and at site A2, located 1.9 kb away in internal transcribed spacer 1. This inhibition was largely suppressed by a compensatory mutation in U3, demonstrating functional base pairing. The U3–pre-rRNA base pairing is incompatible with the structure that forms in the mature 18S rRNA and may prevent premature folding of the pre-rRNA. In the Escherichia coli pre-rRNA the homologous region of the 16S rRNA is also sequestered, in that case by base pairing to the 5′ external transcribed spacer (5′ ETS). Cleavage at site A0 in the yeast 5′ ETS strictly requires base pairing between U3 and a sequence within the 5′ ETS. In contrast, the U3-18S interaction is not required for A0 cleavage. U3 therefore carries out at least two functionally distinct base pair interactions with the pre-rRNA. The nucleotide at the site of A1 cleavage was shown to be specified by two distinct signals; one of these is the stem-loop structure within the 18S rRNA. However, in contrast to the efficiency of cleavage, the position of A1 cleavage is not dependent on the U3-loop interaction. We conclude that the 18S stem-loop structure is recognized at least twice during pre-rRNA processing. PMID:10454548

  1. Altering the Electrostatic Potential in the Major Groove: Thermodynamic and Structural Characterization of 7-Deaza-2;#8242;-deoxyadenosine:dT Base Pairing in DNA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kowal, Ewa A.; Ganguly, Manjori; Pallan, Pradeep S.

    As part of an ongoing effort to explore the effect of major groove electrostatics on the thermodynamic stability and structure of DNA, a 7-deaza-2'-deoxyadenosine:dT (7-deaza-dA:dT) base pair in the Dickerson-Drew dodecamer (DDD) was studied. The removal of the electronegative N7 atom on dA and the replacement with an electropositive C-H in the major groove was expected to have a significant effect on major groove electrostatics. The structure of the 7-deaza-dA:dT base pair was determined at 1.1 {angstrom} resolution in the presence of Mg{sup 2+}. The 7-deaza-dA, which is isosteric for dA, had minimal effect on the base pairing geometry andmore » the conformation of the DDD in the crystalline state. There was no major groove cation association with the 7-deaza-dA heterocycle. In solution, circular dichroism showed a positive Cotton effect centered at 280 nm and a negative Cotton effect centered at 250 nm that were characteristic of a right-handed helix in the B-conformation. However, temperature-dependent NMR studies showed increased exchange between the thymine N3 imino proton of the 7-deaza-dA:dT base pair and water, suggesting reduced stacking interactions and an increased rate of base pair opening. This correlated with the observed thermodynamic destabilization of the 7-deaza-dA modified duplex relative to the DDD. A combination of UV melting and differential scanning calorimetry experiments were conducted to evaluate the relative contributions of enthalpy and entropy in the thermodynamic destabilization of the DDD. The most significant contribution arose from an unfavorable enthalpy term, which probably results from less favorable stacking interactions in the modified duplex, which was accompanied by a significant reduction in the release of water and cations from the 7-deaza-dA modified DNA.« less

  2. Altering the Electrostatic Potential in the Major Groove: Thermodynamic and Structural Characterization of 7-Deaza-2′-deoxyadenosine:dT Base Pairing in DNA

    PubMed Central

    2011-01-01

    As part of an ongoing effort to explore the effect of major groove electrostatics on the thermodynamic stability and structure of DNA, a 7-deaza-2′-deoxyadenosine:dT (7-deaza-dA:dT) base pair in the Dickerson–Drew dodecamer (DDD) was studied. The removal of the electronegative N7 atom on dA and the replacement with an electropositive C–H in the major groove was expected to have a significant effect on major groove electrostatics. The structure of the 7-deaza-dA:dT base pair was determined at 1.1 Å resolution in the presence of Mg2+. The 7-deaza-dA, which is isosteric for dA, had minimal effect on the base pairing geometry and the conformation of the DDD in the crystalline state. There was no major groove cation association with the 7-deaza-dA heterocycle. In solution, circular dichroism showed a positive Cotton effect centered at 280 nm and a negative Cotton effect centered at 250 nm that were characteristic of a right-handed helix in the B-conformation. However, temperature-dependent NMR studies showed increased exchange between the thymine N3 imino proton of the 7-deaza-dA:dT base pair and water, suggesting reduced stacking interactions and an increased rate of base pair opening. This correlated with the observed thermodynamic destabilization of the 7-deaza-dA modified duplex relative to the DDD. A combination of UV melting and differential scanning calorimetry experiments were conducted to evaluate the relative contributions of enthalpy and entropy in the thermodynamic destabilization of the DDD. The most significant contribution arose from an unfavorable enthalpy term, which probably results from less favorable stacking interactions in the modified duplex, which was accompanied by a significant reduction in the release of water and cations from the 7-deaza-dA modified DNA. PMID:22059929

  3. In search of functional association from time-series microarray data based on the change trend and level of gene expression

    PubMed Central

    He, Feng; Zeng, An-Ping

    2006-01-01

    Background The increasing availability of time-series expression data opens up new possibilities to study functional linkages of genes. Present methods used to infer functional linkages between genes from expression data are mainly based on a point-to-point comparison. Change trends between consecutive time points in time-series data have been so far not well explored. Results In this work we present a new method based on extracting main features of the change trend and level of gene expression between consecutive time points. The method, termed as trend correlation (TC), includes two major steps: 1, calculating a maximal local alignment of change trend score by dynamic programming and a change trend correlation coefficient between the maximal matched change levels of each gene pair; 2, inferring relationships of gene pairs based on two statistical extraction procedures. The new method considers time shifts and inverted relationships in a similar way as the local clustering (LC) method but the latter is merely based on a point-to-point comparison. The TC method is demonstrated with data from yeast cell cycle and compared with the LC method and the widely used Pearson correlation coefficient (PCC) based clustering method. The biological significance of the gene pairs is examined with several large-scale yeast databases. Although the TC method predicts an overall lower number of gene pairs than the other two methods at a same p-value threshold, the additional number of gene pairs inferred by the TC method is considerable: e.g. 20.5% compared with the LC method and 49.6% with the PCC method for a p-value threshold of 2.7E-3. Moreover, the percentage of the inferred gene pairs consistent with databases by our method is generally higher than the LC method and similar to the PCC method. A significant number of the gene pairs only inferred by the TC method are process-identity or function-similarity pairs or have well-documented biological interactions, including 443 known protein interactions and some known cell cycle related regulatory interactions. It should be emphasized that the overlapping of gene pairs detected by the three methods is normally not very high, indicating a necessity of combining the different methods in search of functional association of genes from time-series data. For a p-value threshold of 1E-5 the percentage of process-identity and function-similarity gene pairs among the shared part of the three methods reaches 60.2% and 55.6% respectively, building a good basis for further experimental and functional study. Furthermore, the combined use of methods is important to infer more complete regulatory circuits and network as exemplified in this study. Conclusion The TC method can significantly augment the current major methods to infer functional linkages and biological network and is well suitable for exploring temporal relationships of gene expression in time-series data. PMID:16478547

  4. The formation of catalytically competent enzyme-substrate complex is not a bottleneck in lesion excision by human alkyladenine DNA glycosylase.

    PubMed

    Kuznetsov, N A; Kiryutin, A S; Kuznetsova, A A; Panov, M S; Barsukova, M O; Yurkovskaya, A V; Fedorova, O S

    2017-04-01

    Human alkyladenine DNA glycosylase (AAG) protects DNA from alkylated and deaminated purine lesions. AAG flips out the damaged nucleotide from the double helix of DNA and catalyzes the hydrolysis of the N-glycosidic bond to release the damaged base. To understand better, how the step of nucleotide eversion influences the overall catalytic process, we performed a pre-steady-state kinetic analysis of AAG interaction with specific DNA-substrates, 13-base pair duplexes containing in the 7th position 1-N6-ethenoadenine (εA), hypoxanthine (Hx), and the stable product analogue tetrahydrofuran (F). The combination of the fluorescence of tryptophan, 2-aminopurine, and 1-N6-ethenoadenine was used to record conformational changes of the enzyme and DNA during the processes of DNA lesion recognition, damaged base eversion, excision of the N-glycosidic bond, and product release. The thermal stability of the duplexes characterized by the temperature of melting, T m , and the rates of spontaneous opening of individual nucleotide base pairs were determined by NMR spectroscopy. The data show that the relative thermal stability of duplexes containing a particular base pair in position 7, (T m (F/T) < T m (εA/T) < T m (Hx/T) < T m (A/T)) correlates with the rate of reversible spontaneous opening of the base pair. However, in contrast to that, the catalytic lesion excision rate is two orders of magnitude higher for Hx-containing substrates than for substrates containing εA, proving that catalytic activity is not correlated with the stability of the damaged base pair. Our study reveals that the formation of the catalytically competent enzyme-substrate complex is not the bottleneck controlling the catalytic activity of AAG.

  5. Magnetoreception in birds: different physical processes for two types of directional responses

    PubMed Central

    Wiltschko, Roswitha; Stapput, Katrin; Ritz, Thorsten; Thalau, Peter; Wiltschko, Wolfgang

    2007-01-01

    Migratory orientation in birds involves an inclination compass based on radical-pair processes. Under certain light regimes, however, “fixed-direction” responses are observed that do not undergo the seasonal change between spring and autumn typical for migratory orientation. To identify the underlying transduction mechanisms, we analyzed a fixed-direction response under a combination of 502 nm turquoise and 590 nm yellow light, with migratory orientation under 565 nm green light serving as the control. High-frequency fields, diagnostic for a radical-pair mechanism, disrupted migratory orientation without affecting fixed-direction responses. Local anaesthesia of the upper beak where magnetite is found in birds, in contrast, disrupted the fixed-direction response without affecting migratory orientation. The two types of responses are thus based on different physical principles, with the compass response based on a radical pair mechanism and the fixed-direction responses probably originating in magnetite-based receptors in the upper beak. Directional input from these receptors seems to affect the behavior only when the regular inclination compass does not work properly. Evolutionary considerations suggest that magnetite-based receptors may represent an ancient mechanism that, in birds, has been replaced by the modern inclination compass based on radical-pair processes now used for directional orientation. PMID:19404459

  6. Charge transport properties of poly(dA)-poly(dT) DNA in variation of backbone disorder and amplitude of base-pair twisting motion

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rahmi, Kinanti Aldilla, E-mail: kinanti.aldilla@ui.ac.id; Yudiarsah, Efta

    By using tight binding Hamiltonian model, charge transport properties of poly(dA)-poly(dT) DNA in variation of backbone disorder and amplitude of base-pair twisting motion is studied. The DNA chain used is 32 base pairs long poly(dA)-poly(dT) molecule. The molecule is contacted to electrode at both ends. The influence of environment on charge transport in DNA is modeled as variation of backbone disorder. The twisting motion amplitude is taking into account by assuming that the twisting angle distributes following Gaussian distribution function with zero average and standard deviation proportional to square root of temperature and inversely proportional to the twisting motion frequency.more » The base-pair twisting motion influences both the onsite energy of the bases and electron hopping constant between bases. The charge transport properties are studied by calculating current using Landauer-Buttiker formula from transmission probabilities which is calculated by transfer matrix methods. The result shows that as the backbone disorder increases, the maximum current decreases. By decreasing the twisting motion frequency, the current increases rapidly at low voltage, but the current increases slower at higher voltage. The threshold voltage can increase or decrease with increasing backbone disorder and increasing twisting frequency.« less

  7. Sequence-based evidence for major histocompatibility complex-disassortative mating in a colonial seabird.

    PubMed

    Juola, Frans A; Dearborn, Donald C

    2012-01-07

    The major histocompatibility complex (MHC) is a polymorphic gene family associated with immune defence, and it can play a role in mate choice. Under the genetic compatibility hypothesis, females choose mates that differ genetically from their own MHC genotypes, avoiding inbreeding and/or enhancing the immunocompetence of their offspring. We tested this hypothesis of disassortative mating based on MHC genotypes in a population of great frigatebirds (Fregata minor) by sequencing the second exon of MHC class II B. Extensive haploid cloning yielded two to four alleles per individual, suggesting the amplification of two genes. MHC similarity between mates was not significantly different between pairs that did (n = 4) or did not (n = 42) exhibit extra-pair paternity. Comparing all 46 mated pairs to a distribution based on randomized re-pairings, we observed the following (i): no evidence for mate choice based on maximal or intermediate levels of MHC allele sharing (ii), significantly disassortative mating based on similarity of MHC amino acid sequences, and (iii) no evidence for mate choice based on microsatellite alleles, as measured by either allele sharing or similarity in allele size. This suggests that females choose mates that differ genetically from themselves at MHC loci, but not as an inbreeding-avoidance mechanism.

  8. Large-scale, Exhaustive Lattice-based Structural Auditing of SNOMED CT.

    PubMed

    Zhang, Guo-Qiang; Bodenreider, Olivier

    2010-11-13

    One criterion for the well-formedness of ontologies is that their hierarchical structure forms a lattice. Formal Concept Analysis (FCA) has been used as a technique for assessing the quality of ontologies, but is not scalable to large ontologies such as SNOMED CT (> 300k concepts). We developed a methodology called Lattice-based Structural Auditing (LaSA), for auditing biomedical ontologies, implemented through automated SPARQL queries, in order to exhaustively identify all non-lattice pairs in SNOMED CT. The percentage of non-lattice pairs ranges from 0 to 1.66 among the 19 SNOMED CT hierarchies. Preliminary manual inspection of a limited portion of the over 544k non-lattice pairs, among over 356 million candidate pairs, revealed inconsistent use of precoordination in SNOMED CT, but also a number of false positives. Our results are consistent with those based on FCA, with the advantage that the LaSA pipeline is scalable and applicable to ontological systems consisting mostly of taxonomic links.

  9. Error simulation of paired-comparison-based scaling methods

    NASA Astrophysics Data System (ADS)

    Cui, Chengwu

    2000-12-01

    Subjective image quality measurement usually resorts to psycho physical scaling. However, it is difficult to evaluate the inherent precision of these scaling methods. Without knowing the potential errors of the measurement, subsequent use of the data can be misleading. In this paper, the errors on scaled values derived form paired comparison based scaling methods are simulated with randomly introduced proportion of choice errors that follow the binomial distribution. Simulation results are given for various combinations of the number of stimuli and the sampling size. The errors are presented in the form of average standard deviation of the scaled values and can be fitted reasonably well with an empirical equation that can be sued for scaling error estimation and measurement design. The simulation proves paired comparison based scaling methods can have large errors on the derived scaled values when the sampling size and the number of stimuli are small. Examples are also given to show the potential errors on actually scaled values of color image prints as measured by the method of paired comparison.

  10. Large-scale, Exhaustive Lattice-based Structural Auditing of SNOMED CT

    PubMed Central

    Zhang, Guo-Qiang; Bodenreider, Olivier

    2010-01-01

    One criterion for the well-formedness of ontologies is that their hierarchical structure forms a lattice. Formal Concept Analysis (FCA) has been used as a technique for assessing the quality of ontologies, but is not scalable to large ontologies such as SNOMED CT (> 300k concepts). We developed a methodology called Lattice-based Structural Auditing (LaSA), for auditing biomedical ontologies, implemented through automated SPARQL queries, in order to exhaustively identify all non-lattice pairs in SNOMED CT. The percentage of non-lattice pairs ranges from 0 to 1.66 among the 19 SNOMED CT hierarchies. Preliminary manual inspection of a limited portion of the over 544k non-lattice pairs, among over 356 million candidate pairs, revealed inconsistent use of precoordination in SNOMED CT, but also a number of false positives. Our results are consistent with those based on FCA, with the advantage that the LaSA pipeline is scalable and applicable to ontological systems consisting mostly of taxonomic links. PMID:21347113

  11. Biophysics of Artificially Expanded Genetic Information Systems. Thermodynamics of DNA Duplexes Containing Matches and Mismatches Involving 2-Amino-3-nitropyridin-6-one (Z) and Imidazo[1,2-a]-1,3,5-triazin-4(8H)one (P).

    PubMed

    Wang, Xiaoyu; Hoshika, Shuichi; Peterson, Raymond J; Kim, Myong-Jung; Benner, Steven A; Kahn, Jason D

    2017-05-19

    Synthetic nucleobases presenting non-Watson-Crick arrangements of hydrogen bond donor and acceptor groups can form additional nucleotide pairs that stabilize duplex DNA independent of the standard A:T and G:C pairs. The pair between 2-amino-3-nitropyridin-6-one 2'-deoxyriboside (presenting a {donor-donor-acceptor} hydrogen bonding pattern on the Watson-Crick face of the small component, trivially designated Z) and imidazo[1,2-a]-1,3,5-triazin-4(8H)one 2'-deoxyriboside (presenting an {acceptor-acceptor-donor} hydrogen bonding pattern on the large component, trivially designated P) is one of these extra pairs for which a substantial amount of molecular biology has been developed. Here, we report the results of UV absorbance melting measurements and determine the energetics of binding of DNA strands containing Z and P to give short duplexes containing Z:P pairs as well as various mismatches comprising Z and P. All measurements were done at 1 M NaCl in buffer (10 mM Na cacodylate, 0.5 mM EDTA, pH 7.0). Thermodynamic parameters (ΔH°, ΔS°, and ΔG° 37 ) for oligonucleotide hybridization were extracted. Consistent with the Watson-Crick model that considers both geometric and hydrogen bonding complementarity, the Z:P pair was found to contribute more to duplex stability than any mismatches involving either nonstandard nucleotide. Further, the Z:P pair is more stable than a C:G pair. The Z:G pair was found to be the most stable mismatch, forming either a deprotonated mismatched pair or a wobble base pair analogous to the stable T:G mismatch. The C:P pair is less stable, perhaps analogous to the wobble pair observed for C:O 6 -methyl-G, in which the pyrimidine is displaced into the minor groove. The Z:A and T:P mismatches are much less stable. Parameters for predicting the thermodynamics of oligonucleotides containing Z and P bases are provided. This represents the first case where this has been done for a synthetic genetic system.

  12. New Quantum Key Distribution Scheme Based on Random Hybrid Quantum Channel with EPR Pairs and GHZ States

    NASA Astrophysics Data System (ADS)

    Yan, Xing-Yu; Gong, Li-Hua; Chen, Hua-Ying; Zhou, Nan-Run

    2018-05-01

    A theoretical quantum key distribution scheme based on random hybrid quantum channel with EPR pairs and GHZ states is devised. In this scheme, EPR pairs and tripartite GHZ states are exploited to set up random hybrid quantum channel. Only one photon in each entangled state is necessary to run forth and back in the channel. The security of the quantum key distribution scheme is guaranteed by more than one round of eavesdropping check procedures. It is of high capacity since one particle could carry more than two bits of information via quantum dense coding.

  13. Narrowing of the balance function with centrality in Au+Au collisions at the square root of SNN = 130 GeV.

    PubMed

    Adams, J; Adler, C; Ahammed, Z; Allgower, C; Amonett, J; Anderson, B D; Anderson, M; Averichev, G S; Balewski, J; Barannikova, O; Barnby, L S; Baudot, J; Bekele, S; Belaga, V V; Bellwied, R; Berger, J; Bichsel, H; Billmeier, A; Bland, L C; Blyth, C O; Bonner, B E; Boucham, A; Brandin, A; Bravar, A; Cadman, R V; Caines, H; Calderónde la Barca Sánchez, M; Cardenas, A; Carroll, J; Castillo, J; Castro, M; Cebra, D; Chaloupka, P; Chattopadhyay, S; Chen, Y; Chernenko, S P; Cherney, M; Chikanian, A; Choi, B; Christie, W; Coffin, J P; Cormier, T M; Corral, M M; Cramer, J G; Crawford, H J; Derevschikov, A A; Didenko, L; Dietel, T; Draper, J E; Dunin, V B; Dunlop, J C; Eckardt, V; Efimov, L G; Emelianov, V; Engelage, J; Eppley, G; Erazmus, B; Fachini, P; Faine, V; Faivre, J; Fatemi, R; Filimonov, K; Finch, E; Fisyak, Y; Flierl, D; Foley, K J; Fu, J; Gagliardi, C A; Gagunashvili, N; Gans, J; Gaudichet, L; Germain, M; Geurts, F; Ghazikhanian, V; Grachov, O; Grigoriev, V; Guedon, M; Guertin, S M; Gushin, E; Hallman, T J; Hardtke, D; Harris, J W; Heinz, M; Henry, T W; Heppelmann, S; Herston, T; Hippolyte, B; Hirsch, A; Hjort, E; Hoffmann, G W; Horsley, M; Huang, H Z; Humanic, T J; Igo, G; Ishihara, A; Ivanshin, Yu I; Jacobs, P; Jacobs, W W; Janik, M; Johnson, I; Jones, P G; Judd, E G; Kaneta, M; Kaplan, M; Keane, D; Kiryluk, J; Kisiel, A; Klay, J; Klein, S R; Klyachko, A; Kollegger, T; Konstantinov, A S; Kopytine, M; Kotchenda, L; Kovalenko, A D; Kramer, M; Kravtsov, P; Krueger, K; Kuhn, C; Kulikov, A I; Kunde, G J; Kunz, C L; Kutuev, R Kh; Kuznetsov, A A; Lamont, M A C; Landgraf, J M; Lange, S; Lansdell, C P; Lasiuk, B; Laue, F; Lauret, J; Lebedev, A; Lednický, R; Leontiev, V M; LeVine, M J; Li, Q; Lindenbaum, S J; Lisa, M A; Liu, F; Liu, L; Liu, Z; Liu, Q J; Ljubicic, T; Llope, W J; Long, H; Longacre, R S; Lopez-Noriega, M; Love, W A; Ludlam, T; Lynn, D; Ma, J; Magestro, D; Majka, R; Margetis, S; Markert, C; Martin, L; Marx, J; Matis, H S; Matulenko, Yu A; McShane, T S; Meissner, F; Melnick, Yu; Meschanin, A; Messer, M; Miller, M L; Milosevich, Z; Minaev, N G; Mitchell, J; Moore, C F; Morozov, V; de Moura, M M; Munhoz, M G; Nelson, J M; Nevski, P; Nikitin, V A; Nogach, L V; Norman, B; Nurushev, S B; Odyniec, G; Ogawa, A; Okorokov, V; Oldenburg, M; Olson, D; Paic, G; Pandey, S U; Panebratsev, Y; Panitkin, S Y; Pavlinov, A I; Pawlak, T; Perevoztchikov, V; Peryt, W; Petrov, V A; Planinic, M; Pluta, J; Porile, N; Porter, J; Poskanzer, A M; Potrebenikova, E; Prindle, D; Pruneau, C; Putschke, J; Rai, G; Rakness, G; Ravel, O; Ray, R L; Razin, S V; Reichhold, D; Reid, J G; Renault, G; Retiere, F; Ridiger, A; Ritter, H G; Roberts, J B; Rogachevski, O V; Romero, J L; Rose, A; Roy, C; Rykov, V; Sakrejda, I; Salur, S; Sandweiss, J; Savin, I; Schambach, J; Scharenberg, R P; Schmitz, N; Schroeder, L S; Schüttauf, A; Schweda, K; Seger, J; Seliverstov, D; Seyboth, P; Shahaliev, E; Shestermanov, K E; Shimanskii, S S; Simon, F; Skoro, G; Smirnov, N; Snellings, R; Sorensen, P; Sowinski, J; Spinka, H M; Srivastava, B; Stephenson, E J; Stock, R; Stolpovsky, A; Strikhanov, M; Stringfellow, B; Struck, C; Suaide, A A P; Sugarbaker, E; Suire, C; Sumbera, M; Surrow, B; Symons, T J M; de Toledo, A Szanto; Szarwas, P; Tai, A; Takahashi, J; Tang, A H; Thein, D; Thomas, J H; Thompson, M; Tikhomirov, V; Tokarev, M; Tonjes, M B; Trainor, T A; Trentalange, S; Tribble, R E; Trofimov, V; Tsai, O; Ullrich, T; Underwood, D G; Van Buren, G; Vander Molen, A M; Vasilevski, I M; Vasiliev, A N; Vigdor, S E; Voloshin, S A; Wang, F; Ward, H; Watson, J W; Wells, R; Westfall, G D; Whitten, C; Wieman, H; Willson, R; Wissink, S W; Witt, R; Wood, J; Xu, N; Xu, Z; Yakutin, A E; Yamamoto, E; Yang, J; Yepes, P; Yurevich, V I; Zanevski, Y V; Zborovský, I; Zhang, H; Zhang, W M; Zoulkarneev, R; Zubarev, A N

    2003-05-02

    The balance function is a new observable based on the principle that charge is locally conserved when particles are pair produced. Balance functions have been measured for charged particle pairs and identified charged pion pairs in Au+Au collisions at the square root of SNN = 130 GeV at the Relativistic Heavy Ion Collider using STAR. Balance functions for peripheral collisions have widths consistent with model predictions based on a superposition of nucleon-nucleon scattering. Widths in central collisions are smaller, consistent with trends predicted by models incorporating late hadronization.

  14. Time series regression-based pairs trading in the Korean equities market

    NASA Astrophysics Data System (ADS)

    Kim, Saejoon; Heo, Jun

    2017-07-01

    Pairs trading is an instance of statistical arbitrage that relies on heavy quantitative data analysis to profit by capitalising low-risk trading opportunities provided by anomalies of related assets. A key element in pairs trading is the rule by which open and close trading triggers are defined. This paper investigates the use of time series regression to define the rule which has previously been identified with fixed threshold-based approaches. Empirical results indicate that our approach may yield significantly increased excess returns compared to ones obtained by previous approaches on large capitalisation stocks in the Korean equities market.

  15. Configurations of base-pair complexes in solutions. [nucleotide chemistry

    NASA Technical Reports Server (NTRS)

    Egan, J. T.; Nir, S.; Rein, R.; Macelroy, R.

    1978-01-01

    A theoretical search for the most stable conformations (i.e., stacked or hydrogen bonded) of the base pairs A-U and G-C in water, CCl4, and CHCl3 solutions is presented. The calculations of free energies indicate a significant role of the solvent in determining the conformations of the base-pair complexes. The application of the continuum method yields preferred conformations in good agreement with experiment. Results of the calculations with this method emphasize the importance of both the electrostatic interactions between the two bases in a complex, and the dipolar interaction of the complex with the entire medium. In calculations with the solvation shell method, the last term, i.e., dipolar interaction of the complex with the entire medium, was added. With this modification the prediction of the solvation shell model agrees both with the continuum model and with experiment, i.e., in water the stacked conformation of the bases is preferred.

  16. A rule of seven in Watson-Crick base-pairing of mismatched sequences.

    PubMed

    Cisse, Ibrahim I; Kim, Hajin; Ha, Taekjip

    2012-05-13

    Sequence recognition through base-pairing is essential for DNA repair and gene regulation, but the basic rules governing this process remain elusive. In particular, the kinetics of annealing between two imperfectly matched strands is not well characterized, despite its potential importance in nucleic acid-based biotechnologies and gene silencing. Here we use single-molecule fluorescence to visualize the multiple annealing and melting reactions of two untethered strands inside a porous vesicle, allowing us to precisely quantify the annealing and melting rates. The data as a function of mismatch position suggest that seven contiguous base pairs are needed for rapid annealing of DNA and RNA. This phenomenological rule of seven may underlie the requirement for seven nucleotides of complementarity to seed gene silencing by small noncoding RNA and may help guide performance improvement in DNA- and RNA-based bio- and nanotechnologies, in which off-target effects can be detrimental.

  17. Enhancing acronym/abbreviation knowledge bases with semantic information.

    PubMed

    Torii, Manabu; Liu, Hongfang

    2007-10-11

    In the biomedical domain, a terminology knowledge base that associates acronyms/abbreviations (denoted as SFs) with the definitions (denoted as LFs) is highly needed. For the construction such terminology knowledge base, we investigate the feasibility to build a system automatically assigning semantic categories to LFs extracted from text. Given a collection of pairs (SF,LF) derived from text, we i) assess the coverage of LFs and pairs (SF,LF) in the UMLS and justify the need of a semantic category assignment system; and ii) automatically derive name phrases annotated with semantic category and construct a system using machine learning. Utilizing ADAM, an existing collection of (SF,LF) pairs extracted from MEDLINE, our system achieved an f-measure of 87% when assigning eight UMLS-based semantic groups to LFs. The system has been incorporated into a web interface which integrates SF knowledge from multiple SF knowledge bases. Web site: http://gauss.dbb.georgetown.edu/liblab/SFThesurus.

  18. Enzymatic Incorporation of Modified Purine Nucleotides in DNA.

    PubMed

    Abu El Asrar, Rania; Margamuljana, Lia; Abramov, Mikhail; Bande, Omprakash; Agnello, Stefano; Jang, Miyeon; Herdewijn, Piet

    2017-12-14

    A series of nucleotide analogues, with a hypoxanthine base moiety (8-aminohypoxanthine, 1-methyl-8-aminohypoxanthine, and 8-oxohypoxanthine), together with 5-methylisocytosine were tested as potential pairing partners of N 8 -glycosylated nucleotides with an 8-azaguanine or 8-aza-9-deazaguanine base moiety by using DNA polymerases (incorporation studies). The best results were obtained with the 5-methylisocytosine nucleotide followed by the 1-methyl-8-aminohypoxanthine nucleotide. The experiments demonstrated that small differences in the structure (8-azaguanine versus 8-aza-9-deazaguanine) might lead to significant differences in recognition efficiency and selectivity, base pairing by Hoogsteen recognition at the polymerase level is possible, 8-aza-9-deazaguanine represents a self-complementary base pair, and a correlation exists between in vitro incorporation studies and in vivo recognition by natural bases in Escherichia coli, but this recognition is not absolute (exceptions were observed). © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Current hormonal contraceptive use predicts female extra-pair and dyadic sexual behavior: evidence based on Czech National Survey data.

    PubMed

    Klapilová, Kateřina; Cobey, Kelly D; Wells, Timothy; Roberts, S Craig; Weiss, Petr; Havlíček, Jan

    2014-01-10

    Data from 1155 Czech women (493 using oral contraception, 662 non-users), obtained from the Czech National Survey of Sexual Behavior, were used to investigate evolutionary-based hypotheses concerning the predictive value of current oral contraceptive (OC) use on extra-pair and dyadic (in-pair) sexual behavior of coupled women. Specifically, the aim was to determine whether current OC use was associated with lower extra-pair and higher in-pair sexual interest and behavior, because OC use suppresses cyclical shifts in mating psychology that occur in normally cycling women. Zero-inflated Poisson (ZIP) regression and negative binomial models were used to test associations between OC use and these sexual measures, controlling for other relevant predictors (e.g., age, parity, in-pair sexual satisfaction, relationship length). The overall incidence of having had an extra-pair partner or one-night stand in the previous year was not related to current OC use (the majority of the sample had not). However, among the women who had engaged in extra-pair sexual behavior, OC users had fewer one-night stands than non-users, and tended to have fewer partners, than non-users. OC users also had more frequent dyadic intercourse than non-users, potentially indicating higher commitment to their current relationship. These results suggest that suppression of fertility through OC use may alter important aspects of female sexual behavior, with potential implications for relationship functioning and stability.

  20. Transition from Sign-Reversed to Sign-Preserved Cooper-Pairing Symmetry in Sulfur-Doped Iron Selenide Superconductors.

    PubMed

    Wang, Qisi; Park, J T; Feng, Yu; Shen, Yao; Hao, Yiqing; Pan, Bingying; Lynn, J W; Ivanov, A; Chi, Songxue; Matsuda, M; Cao, Huibo; Birgeneau, R J; Efremov, D V; Zhao, Jun

    2016-05-13

    An essential step toward elucidating the mechanism of superconductivity is to determine the sign or phase of the superconducting order parameter, as it is closely related to the pairing interaction. In conventional superconductors, the electron-phonon interaction induces attraction between electrons near the Fermi energy and results in a sign-preserved s-wave pairing. For high-temperature superconductors, including cuprates and iron-based superconductors, prevalent weak coupling theories suggest that the electron pairing is mediated by spin fluctuations which lead to repulsive interactions, and therefore that a sign-reversed pairing with an s_{±} or d-wave symmetry is favored. Here, by using magnetic neutron scattering, a phase sensitive probe of the superconducting gap, we report the observation of a transition from the sign-reversed to sign-preserved Cooper-pairing symmetry with insignificant changes in T_{c} in the S-doped iron selenide superconductors K_{x}Fe_{2-y}(Se_{1-z}S_{z})_{2}. We show that a rather sharp magnetic resonant mode well below the superconducting gap (2Δ) in the undoped sample (z=0) is replaced by a broad hump structure above 2Δ under 50% S doping. These results cannot be readily explained by simple spin fluctuation-exchange pairing theories and, therefore, multiple pairing channels are required to describe superconductivity in this system. Our findings may also yield a simple explanation for the sometimes contradictory data on the sign of the superconducting order parameter in iron-based materials.

  1. An Evolutionary Computation Approach to Examine Functional Brain Plasticity.

    PubMed

    Roy, Arnab; Campbell, Colin; Bernier, Rachel A; Hillary, Frank G

    2016-01-01

    One common research goal in systems neurosciences is to understand how the functional relationship between a pair of regions of interest (ROIs) evolves over time. Examining neural connectivity in this way is well-suited for the study of developmental processes, learning, and even in recovery or treatment designs in response to injury. For most fMRI based studies, the strength of the functional relationship between two ROIs is defined as the correlation between the average signal representing each region. The drawback to this approach is that much information is lost due to averaging heterogeneous voxels, and therefore, the functional relationship between a ROI-pair that evolve at a spatial scale much finer than the ROIs remain undetected. To address this shortcoming, we introduce a novel evolutionary computation (EC) based voxel-level procedure to examine functional plasticity between an investigator defined ROI-pair by simultaneously using subject-specific BOLD-fMRI data collected from two sessions seperated by finite duration of time. This data-driven procedure detects a sub-region composed of spatially connected voxels from each ROI (a so-called sub-regional-pair) such that the pair shows a significant gain/loss of functional relationship strength across the two time points. The procedure is recursive and iteratively finds all statistically significant sub-regional-pairs within the ROIs. Using this approach, we examine functional plasticity between the default mode network (DMN) and the executive control network (ECN) during recovery from traumatic brain injury (TBI); the study includes 14 TBI and 12 healthy control subjects. We demonstrate that the EC based procedure is able to detect functional plasticity where a traditional averaging based approach fails. The subject-specific plasticity estimates obtained using the EC-procedure are highly consistent across multiple runs. Group-level analyses using these plasticity estimates showed an increase in the strength of functional relationship between DMN and ECN for TBI subjects, which is consistent with prior findings in the TBI-literature. The EC-approach also allowed us to separate sub-regional-pairs contributing to positive and negative plasticity; the detected sub-regional-pairs significantly overlap across runs thus highlighting the reliability of the EC-approach. These sub-regional-pairs may be useful in performing nuanced analyses of brain-behavior relationships during recovery from TBI.

  2. Structure and conversion kinetics of a bi-stable DNA i-motif: broken symmetry in the [d(5mCCTCC)]4 tetramer.

    PubMed

    Nonin, S; Leroy, J L

    1996-08-23

    At slightly acidic pH, protonation of C-rich oligomers results in the formation of a four-stranded structure composed of two parallel duplexes in a head to tail orientation with their hemi-protonated C.C+ pairs intercalated in a so-called i-motif. In all cases reported previously the duplexes are identical. The tetramer formed by the d(5mCCTCC) oligomer is different. The structure is computed on the basis of 55 inter-residue distances derived from NOESY cross-peaks measured at short mixing times. It consists of two intercalated non-equivalent symmetrical duplexes. The base stacking order is C5* C1 C4* C2 (T3*) T3 C2* C4 C1* C5, but the thymidine bases (T3*) of one duplex are looped out and lie in the wide grooves of the tetramer. The thymidine bases T3 stack as a symmetrical T.T pair between the sequentially adjacent C2.C2+ pair and the C2*.C2*+ pair of the other duplex. Numerous exchange cross-peaks provide evidence for duplex interconversion. The interconversion rate is 1.4 s-1 at 0 degree C and the activation energy is 94 kJ/mol. The opening of the T3.T3 pair, the closing of the T3*.T3 pair, and the opening of the C2*.C2*+ pair occur simultaneously with the duplex interconversion. This suggests that the concerted opening and closing of the thymidine bases drive the duplex interconversion. Opening of the C4.C4+ and C4*.C4*+ pairs, and dissociation of the tetramer are not part of the interconversion since they occur at much slower rates. Duplex interconversion within the [d(5mCCTCC)]4 tetramer provides the first structural and kinetics characterization of broken symmetry in a biopolymer. The tetramer formed by d(5mCCUCC) adopts a similar structure, but the rate of duplex interconversion is faster: 40 s-1 at 0 degree C. At 32 degrees C, interconversion is fast on the NMR time scale.

  3. Involving Parents in Paired Reading with Preschoolers: Results from a Randomized Controlled Trial

    ERIC Educational Resources Information Center

    Lam, Shui-fong; Chow-Yeung, Kamfung; Wong, Bernard P. H.; Lau, Kwok Kiu; Tse, Shuk In

    2013-01-01

    A paired reading program was implemented for 195 Hong Kong preschoolers (mean age = 4.7 years) and their parents from families with a wide range of family income. The preschoolers were randomly assigned to experimental or waitlist control groups. The parents in the experimental group received 12 sessions of school-based training on paired reading…

  4. Characterization of the LCLS “nanosecond two-bunch” mode for x-ray speckle visibility spectroscopy experiments

    DOE PAGES

    Sun, Yanwen; Zhu, Diling; Song, Sanghoon; ...

    2017-05-23

    The generation of two X-ray pulses with tunable nanosecond scale time separations has recently been demonstrated at the Linac Coherent Light Source using an accelerator based technique. This approach offers the opportunity to extend X-ray Photon Correlation Spectroscopy techniques to the yet unexplored regime of nanosecond timescales by means of X-ray Speckle Visibility Spectroscopy. As the two pulses originate from two independent Spontaneous Amplified Stimulated Emission processes, the beam properties fluctuate from pulse pair to pulse pair, but as well between the individual pulses within a pair. However, two-pulse XSVS experiments require the intensity of the individual pulses to bemore » either identical in the ideal case, or with a accurately known intensity ratio. We present the design and performances of a non-destructive intensity diagnostic based on measurement of scattering from a transparent target using a high-speed photo-detector. Individual pulses within a pulse pair with time delays as short as 0.7 ns can be resolved. Moreover, using small angle coherent scattering, we characterize the averaged spatial overlap of the focused pulse pairs. Furthermore, the multi-shot average-speckle contrasts from individual pulses and pulse pairs are compared.« less

  5. The X3LYP extended density functional accurately describes H-bonding but fails completely for stacking.

    PubMed

    Cerný, Jirí; Hobza, Pavel

    2005-04-21

    The performance of the recently introduced X3LYP density functional which was claimed to significantly improve the accuracy for H-bonded and van der Waals complexes was tested for extended H-bonded and stacked complexes (nucleic acid base pairs and amino acid pairs). In the case of planar H-bonded complexes (guanine...cytosine, adenine...thymine) the DFT results nicely agree with accurate correlated ab initio results. For the stacked pairs (uracil dimer, cytosine dimer, adenine...thymine and guanine...cytosine) the DFT fails completely and it was even not able to localize any minimum at the stacked subspace of the potential energy surface. The geometry optimization of all these stacked clusters leads systematically to the planar H-bonded pairs. The amino acid pairs were investigated in the crystal geometry. DFT again strongly underestimates the accurate correlated ab initio stabilization energies and usually it was not able to describe the stabilization of a pair. The X3LYP functional thus behaves similarly to other current functionals. Stacking of nucleic acid bases as well as interaction of amino acids was described satisfactorily by using the tight-binding DFT method, which explicitly covers the London dispersion energy.

  6. Sequence-similar, structure-dissimilar protein pairs in the PDB.

    PubMed

    Kosloff, Mickey; Kolodny, Rachel

    2008-05-01

    It is often assumed that in the Protein Data Bank (PDB), two proteins with similar sequences will also have similar structures. Accordingly, it has proved useful to develop subsets of the PDB from which "redundant" structures have been removed, based on a sequence-based criterion for similarity. Similarly, when predicting protein structure using homology modeling, if a template structure for modeling a target sequence is selected by sequence alone, this implicitly assumes that all sequence-similar templates are equivalent. Here, we show that this assumption is often not correct and that standard approaches to create subsets of the PDB can lead to the loss of structurally and functionally important information. We have carried out sequence-based structural superpositions and geometry-based structural alignments of a large number of protein pairs to determine the extent to which sequence similarity ensures structural similarity. We find many examples where two proteins that are similar in sequence have structures that differ significantly from one another. The source of the structural differences usually has a functional basis. The number of such proteins pairs that are identified and the magnitude of the dissimilarity depend on the approach that is used to calculate the differences; in particular sequence-based structure superpositioning will identify a larger number of structurally dissimilar pairs than geometry-based structural alignments. When two sequences can be aligned in a statistically meaningful way, sequence-based structural superpositioning provides a meaningful measure of structural differences. This approach and geometry-based structure alignments reveal somewhat different information and one or the other might be preferable in a given application. Our results suggest that in some cases, notably homology modeling, the common use of nonredundant datasets, culled from the PDB based on sequence, may mask important structural and functional information. We have established a data base of sequence-similar, structurally dissimilar protein pairs that will help address this problem (http://luna.bioc.columbia.edu/rachel/seqsimstrdiff.htm).

  7. The Interplay between Value and Relatedness as Bases for Metacognitive Monitoring and Control: Evidence for Agenda-Based Monitoring

    ERIC Educational Resources Information Center

    Soderstrom, Nicholas C.; McCabe, David P.

    2011-01-01

    Two experiments are reported examining how value and relatedness interact to influence metacognitive monitoring and control processes. Participants studied unrelated and related word pairs, each accompanied by point values denoting how important the items were to remember. These values were presented either before or after each pair in a…

  8. Social Networks-Based Adaptive Pairing Strategy for Cooperative Learning

    ERIC Educational Resources Information Center

    Chuang, Po-Jen; Chiang, Ming-Chao; Yang, Chu-Sing; Tsai, Chun-Wei

    2012-01-01

    In this paper, we propose a grouping strategy to enhance the learning and testing results of students, called Pairing Strategy (PS). The proposed method stems from the need of interactivity and the desire of cooperation in cooperative learning. Based on the social networks of students, PS provides members of the groups to learn from or mimic…

  9. A simple and highly selective 2,2-diferrocenylpropane-based multi-channel ion pair receptor for Pb(2+) and HSO4(-).

    PubMed

    Wan, Qian; Zhuo, Ji-Bin; Wang, Xiao-Xue; Lin, Cai-Xia; Yuan, Yao-Feng

    2015-03-28

    A structurally simple, 2,2-diferrocenylpropane-based ion pair receptor 1 was synthesized and characterized by (1)H NMR, (13)C NMR, HRMS, elemental analyses, and single-crystal X-ray diffraction. The ion pair receptor 1 showed excellent selectivity and sensitivity towards Pb(2+) with multi-channel responses: a fluorescence enhancement (more than 42-fold), a notable color change from yellow to red, redox anodic shift (ΔE1/2 = 151 mV), while HSO4(-) promoted fluorescence enhancement when Pb(2+) or Zn(2+) was bonded to the cation binding-site. (1)H NMR titration and density functional theory were performed to reveal the sensing mechanism based on photo-induced electron transfer (PET).

  10. Cloning and characterization of an abalone (Haliotis discus hannai) actin gene

    NASA Astrophysics Data System (ADS)

    Ma, Hongming; Xu, Wei; Mai, Kangsen; Liufu, Zhiguo; Chen, Hong

    2004-10-01

    An actin encoding gene was cloned by using RT-PCR, 3‧ RACE and 5‧ RACE from abalone Haliotis discus hannai. The full length of the gene is 1532 base pairs, which contains a long 3‧ untranslated region of 307 base pairs and 79 base pairs of 5‧ untranslated sequence. The open reading frame encodes 376 amino acid residues. Sequence comparison with those of human and other mollusks showed high conservation among species at amino acid level. The identities was 96%, 97% and 96% respectively compared with Aplysia californica, Biomphalaria glabrata and Homo sapience β-actin. It is also indicated that this actin is more similar to the human cytoplasmic actin (β-actin) than to human muscle actin.

  11. Pairing versus phase coherence of doped holes in distinct quantum spin backgrounds

    NASA Astrophysics Data System (ADS)

    Zhu, Zheng; Sheng, D. N.; Weng, Zheng-Yu

    2018-03-01

    We examine the pairing structure of holes injected into two distinct spin backgrounds: a short-range antiferromagnetic phase versus a symmetry protected topological phase. Based on density matrix renormalization group (DMRG) simulation, we find that although there is a strong binding between two holes in both phases, phase fluctuations can significantly influence the pair-pair correlation depending on the spin-spin correlation in the background. Here the phase fluctuation is identified as an intrinsic string operator nonlocally controlled by the spins. We show that while the pairing amplitude is generally large, the coherent Cooper pairing can be substantially weakened by the phase fluctuation in the symmetry-protected topological phase, in contrast to the short-range antiferromagnetic phase. It provides an example of a non-BCS mechanism for pairing, in which the paring phase coherence is determined by the underlying spin state self-consistently, bearing an interesting resemblance to the pseudogap physics in the cuprate.

  12. Switch wear leveling

    DOEpatents

    Wu, Hunter; Sealy, Kylee; Gilchrist, Aaron

    2015-09-01

    An apparatus for switch wear leveling includes a switching module that controls switching for two or more pairs of switches in a switching power converter. The switching module controls switches based on a duty cycle control technique and closes and opens each switch in a switching sequence. The pairs of switches connect to a positive and negative terminal of a DC voltage source. For a first switching sequence a first switch of a pair of switches has a higher switching power loss than a second switch of the pair of switches. The apparatus includes a switch rotation module that changes the switching sequence of the two or more pairs of switches from the first switching sequence to a second switching sequence. The second switch of a pair of switches has a higher switching power loss than the first switch of the pair of switches during the second switching sequence.

  13. Modified nucleotides reveal the indirect role of the central base pairs in stabilizing the lac repressor-operator complex.

    PubMed Central

    Zhang, X; Gottlieb, P A

    1995-01-01

    Guanine residues in the lac operator were replaced by 2-aminopurine or purine analogues, pairing the modified nucleotides with C. The observed equilibrium dissociation constants for lac repressor binding to substituted operators were measured in 10 mM Tris, 150 mM KCl, 0.1 mM EDTA, 0.1 mM DTE, pH 7.6 at 25 degrees C. These measurements revealed five positions that destabilized the complex when substituted with either analogue. Two positions, which are related by a 2-fold symmetry, are in the major groove of the operator thought to directly interact with the protein. Three sites were in the central region of the operator. A purine analogue at a sixth site perturbed the local DNA structure and destabilized the complex. Alkylation interference experiments of the 2-aminopurine substituted operators demonstrated that, of the five affected, two substitutions displayed altered phosphate interference patterns at the phosphate adjacent to the substituted base. For these operators, complex formation was measured in different concentrations of KCl to assess the contribution of counterion release to the bimolecular process. The results indicated that both complexes were similar to wild-type, although minor changes were observed. The Kobs of the complex was then measured when 2-aminopurine or purine analogues were paired with uracil nucleotide, a base pair that serves to stabilize the DNA. The introduction of the new base pairs revealed two effects on the bimolecular interaction. For those operator sites that are thought to perturb the interaction directly, the affinity of the complex was weakened to levels observed for the singly-substituted operators. In contrast, the nucleotides of 2-aminopurine paired with uracil positioned in the central region of the operator served to enhance the stability of the complex. The purine-uracil base pair substitution on the other hand had a significant destabilizing effect on the interaction. We propose that the central base pairs modulate binding of the complex by altering the intrinsic properties of the DNA. Two specific attributes are required to achieve the lowest free energy of interaction. The DNA must have two interstrand hydrogen bonds to stabilize the duplex and it must have properties associated with directional bending or unwinding. This analysis does not rule out contributions by direct interactions between the protein and the central region of the operator but underscores how indirect effects play a major role in complex formation in this system. Images PMID:7784203

  14. Watson-Crick base pairing controls excited-state decay in natural DNA.

    PubMed

    Bucher, Dominik B; Schlueter, Alexander; Carell, Thomas; Zinth, Wolfgang

    2014-10-13

    Excited-state dynamics are essential to understanding the formation of DNA lesions induced by UV light. By using femtosecond IR spectroscopy, it was possible to determine the lifetimes of the excited states of all four bases in the double-stranded environment of natural DNA. After UV excitation of the DNA duplex, we detected a concerted decay of base pairs connected by Watson-Crick hydrogen bonds. A comparison of single- and double-stranded DNA showed that the reactive charge-transfer states formed in the single strands are suppressed by base pairing in the duplex. The strong influence of the Watson-Crick hydrogen bonds indicates that proton transfer opens an efficient decay path in the duplex that prohibits the formation or reduces the lifetime of reactive charge-transfer states. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. DNA-Mediated Electrochemistry

    PubMed Central

    Gorodetsky, Alon A.; Buzzeo, Marisa C.

    2009-01-01

    The base pair stack of DNA has been demonstrated as a medium for long range charge transport chemistry both in solution and at DNA-modified surfaces. This chemistry is exquisitely sensitive to structural perturbations in the base pair stack as occur with lesions, single base mismatches, and protein binding. We have exploited this sensitivity for the development of reliable electrochemical assays based on DNA charge transport at self-assembled DNA monolayers. Here we discuss the characteristic features, applications, and advantages of DNA-mediated electrochemistry. PMID:18980370

  16. Effect of BrU on the transition between wobble Gua-Thy and tautomeric Gua-Thy base-pairs: ab initio molecular orbital calculations

    NASA Astrophysics Data System (ADS)

    Nomura, Kazuya; Hoshino, Ryota; Hoshiba, Yasuhiro; Danilov, Victor I.; Kurita, Noriyuki

    2013-04-01

    We investigated transition states (TS) between wobble Guanine-Thymine (wG-T) and tautomeric G-T base-pair as well as Br-containing base-pairs by MP2 and density functional theory (DFT) calculations. The obtained TS between wG-T and G*-T (asterisk is an enol-form of base) is different from TS got by the previous DFT calculation. The activation energy (17.9 kcal/mol) evaluated by our calculation is significantly smaller than that (39.21 kcal/mol) obtained by the previous calculation, indicating that our TS is more preferable. In contrast, the obtained TS and activation energy between wG-T and G-T* are similar to those obtained by the previous DFT calculation. We furthermore found that the activation energy between wG-BrU and tautomeric G-BrU is smaller than that between wG-T and tautomeric G-T. This result elucidates that the replacement of CH3 group of T by Br increases the probability of the transition reaction producing the enol-form G* and T* bases. Because G* prefers to bind to T rather than to C, and T* to G not A, our calculated results reveal that the spontaneous mutation from C to T or from A to G base is accelerated by the introduction of wG-BrU base-pair.

  17. Linear separability in superordinate natural language concepts.

    PubMed

    Ruts, Wim; Storms, Gert; Hampton, James

    2004-01-01

    Two experiments are reported in which linear separability was investigated in superordinate natural language concept pairs (e.g., toiletry-sewing gear). Representations of the exemplars of semantically related concept pairs were derived in two to five dimensions using multidimensional scaling (MDS) of similarities based on possession of the concept features. Next, category membership, obtained from an exemplar generation study (in Experiment 1) and from a forced-choice classification task (in Experiment 2) was predicted from the coordinates of the MDS representation using log linear analysis. The results showed that all natural kind concept pairs were perfectly linearly separable, whereas artifact concept pairs showed several violations. Clear linear separability of natural language concept pairs is in line with independent cue models. The violations in the artifact pairs, however, yield clear evidence against the independent cue models.

  18. Identifying miRNA-mediated signaling subpathways by integrating paired miRNA/mRNA expression data with pathway topology.

    PubMed

    Vrahatis, Aristidis G; Dimitrakopoulos, Georgios N; Tsakalidis, Athanasios K; Bezerianos, Anastasios

    2015-01-01

    In the road for network medicine the newly emerged systems-level subpathway-based analysis methods offer new disease genes, drug targets and network-based biomarkers. In parallel, paired miRNA/mRNA expression data enable simultaneously monitoring of the micronome effect upon the signaling pathways. Towards this orientation, we present a methodological pipeline for the identification of differentially expressed subpathways along with their miRNA regulators by using KEGG signaling pathway maps, miRNA-target interactions and expression profiles from paired miRNA/mRNA experiments. Our pipeline offered new biological insights on a real application of paired miRNA/mRNA expression profiles with respect to the dynamic changes from colostrum to mature milk whey; several literature supported genes and miRNAs were recontextualized through miRNA-mediated differentially expressed subpathways.

  19. Transdermal penetration of vasoconstrictors--present understanding and assessment of the human epidermal flux and retention of free bases and ion-pairs.

    PubMed

    Cross, Sheree E; Thompson, Melanie J; Roberts, Michael S

    2003-02-01

    As reductions in dermal clearance increase the residence time of solutes in the skin and underlying tissues we compared the topical penetration of potentially useful vasoconstrictors (VCs) through human epidermis as both free bases and ion-pairs with salicylic acid (SA). We determined the in vitro epidermal flux of ephedrine, naphazoline, oxymetazoline, phenylephrine, and xylometazoline applied as saturated solutions in propylene glycol:water (1:1) and of ephedrine, naphazoline and tetrahydrozoline as 10% solutions of 1:1 molar ratio ion-pairs with SA in liquid paraffin. As free bases, ephedrine had the highest maximal flux, Jmax = 77.4 +/- 11.7 microg/cm2/h, being 4-fold higher than tetrahydrozoline and xylometazoline, 6-fold higher than phenylephrine, 10-fold higher than naphazoline and 100-fold higher than oxymetazoline. Stepwise regression of solute physicochemical properties identified melting point as the most significant predictor of flux. As ion-pairs with SA, ephedrine and naphazoline had similar fluxes (11.5 +/- 2.3 and 12.0 +/- 1.6 microg/cm2/h respectively), whereas tetrahydrozoline was approximately 3-fold slower. Corresponding fluxes of SA from the ion-pairs were 18.6 +/- 0.6, 7.8+/- 0.8 and 1.1 +/- 0.1 respectively. Transdermal transport of VC's is discussed. Epidermal retention of VCs and SA did not correspond to their molar ratio on application and confirmed that following partitioning into the stratum corneum, ion-pairs separate and further penetration is governed by individual solute characteristics.

  20. Assessing relative abundance and reproductive success of shrubsteppe raptors

    USGS Publications Warehouse

    Lehman, Robert N.; Carpenter, L.B.; Steenhof, Karen; Kochert, Michael N.

    1998-01-01

    From 1991-1994, we quantified relative abundance and reproductive success of the Ferruginous Hawk (Buteo regalis), Northern Harrier (Circus cyaneus), Burrowing Owl (Speotytoc unicularia), and Short-eared Owl (Asio flammeus) on the shrubsteppe plateaus (benchlands) in and near the Snake River Birds of Prey National Conservation Area in southwestern Idaho. To assess relative abundance, we searched randomly selected plots using four sampling methods: point counts, line transects, and quadrats of two sizes. On a persampling-effort basis, transects were slightly more effective than point counts and quadrats for locating raptor nests (3.4 pairs detected/100 h of effort vs. 2.2-3.1 pairs). Random sampling using quadrats failed to detect a Short-eared Owl population increase from 1993 to 1994. To evaluate nesting success, we tried to determine reproductive outcome for all nesting attempts located during random, historical, and incidental nest searches. We compared nesting success estimates based on all nesting attempts, on attempts found during incubation, and the Mayfield model. Most pairs used to evaluate success were pairs found incidentally. Visits to historical nesting areas yielded the highest number of pairs per sampling effort (14.6/100 h), but reoccupancy rates for most species decreased through time. Estimates based on all attempts had the highest sample sizes but probably overestimated success for all species except the Ferruginous Hawk. Estimates of success based on nesting attempts found during incubation had the lowest sample sizes. All three methods yielded biased nesting snccess estimates for the Northern Harrier and Short-eared Owl. The estimate based on pairs found during incubation probably provided the least biased estimate for the Burrowing Owl. Assessments of nesting success were hindered by difficulties in confirming egg laying and nesting success for all species except the Ferruginous hawk.

  1. Evaluation of interatomic potentials for rainbow scattering under axial channeling at KCl(0 0 1) surface by three-dimensional computer simulations based on binary collision approximation

    NASA Astrophysics Data System (ADS)

    Takeuchi, Wataru

    2017-05-01

    The rainbow angles corresponding to prominent peaks in the angular distributions of scattered projectiles with small angle, attributed to rainbow scattering (RS), under axial surface channeling conditions are strongly influenced by the interatomic potentials between projectiles and target atoms. The dependence of rainbow angles on normal energy of projectile energy to the target surface, being experimentally obtained by Specht et al. for RS of He, N, Ne and Ar atoms under <1 0 0> and <1 1 0> axial channeling conditions at a KCl(0 0 1) surface with projectile energies of 1-60 keV, was evaluated by the three-dimensional computer simulations using the ACOCT code based on the binary collision approximation with interatomic pair potentials. Good agreement between the ACOCT results using the ZBL pair potential and the individual pair potentials calculated from Hartree-Fock (HF) wave functions and the experimental ones was found for RS of He, N and Ne atoms from the atomic rows along <1 0 0> direction. For <1 1 0> direction, the ACOCT results employing the Moliere pair potential with adjustable screening length of O'Connor-Biersack (OB) formula, the ZBL pair potential and the individual HF pair potentials except for Ar → KCl using the OB pair potential are nearly in agreement with the experimental ones.

  2. Large-scale extraction of accurate drug-disease treatment pairs from biomedical literature for drug repurposing

    PubMed Central

    2013-01-01

    Background A large-scale, highly accurate, machine-understandable drug-disease treatment relationship knowledge base is important for computational approaches to drug repurposing. The large body of published biomedical research articles and clinical case reports available on MEDLINE is a rich source of FDA-approved drug-disease indication as well as drug-repurposing knowledge that is crucial for applying FDA-approved drugs for new diseases. However, much of this information is buried in free text and not captured in any existing databases. The goal of this study is to extract a large number of accurate drug-disease treatment pairs from published literature. Results In this study, we developed a simple but highly accurate pattern-learning approach to extract treatment-specific drug-disease pairs from 20 million biomedical abstracts available on MEDLINE. We extracted a total of 34,305 unique drug-disease treatment pairs, the majority of which are not included in existing structured databases. Our algorithm achieved a precision of 0.904 and a recall of 0.131 in extracting all pairs, and a precision of 0.904 and a recall of 0.842 in extracting frequent pairs. In addition, we have shown that the extracted pairs strongly correlate with both drug target genes and therapeutic classes, therefore may have high potential in drug discovery. Conclusions We demonstrated that our simple pattern-learning relationship extraction algorithm is able to accurately extract many drug-disease pairs from the free text of biomedical literature that are not captured in structured databases. The large-scale, accurate, machine-understandable drug-disease treatment knowledge base that is resultant of our study, in combination with pairs from structured databases, will have high potential in computational drug repurposing tasks. PMID:23742147

  3. Entropy Beacon: A Hairpin-Free DNA Amplification Strategy for Efficient Detection of Nucleic Acids

    PubMed Central

    2015-01-01

    Here, we propose an efficient strategy for enzyme- and hairpin-free nucleic acid detection called an entropy beacon (abbreviated as Ebeacon). Different from previously reported DNA hybridization/displacement-based strategies, Ebeacon is driven forward by increases in the entropy of the system, instead of free energy released from new base-pair formation. Ebeacon shows high sensitivity, with a detection limit of 5 pM target DNA in buffer and 50 pM in cellular homogenate. Ebeacon also benefits from the hairpin-free amplification strategy and zero-background, excellent thermostability from 20 °C to 50 °C, as well as good resistance to complex environments. In particular, based on the huge difference between the breathing rate of a single base pair and two adjacent base pairs, Ebeacon also shows high selectivity toward base mutations, such as substitution, insertion, and deletion and, therefore, is an efficient nucleic acid detection method, comparable to most reported enzyme-free strategies. PMID:26505212

  4. Finite-dimensional Liouville integrable Hamiltonian systems generated from Lax pairs of a bi-Hamiltonian soliton hierarchy by symmetry constraints

    NASA Astrophysics Data System (ADS)

    Manukure, Solomon

    2018-04-01

    We construct finite-dimensional Hamiltonian systems by means of symmetry constraints from the Lax pairs and adjoint Lax pairs of a bi-Hamiltonian hierarchy of soliton equations associated with the 3-dimensional special linear Lie algebra, and discuss the Liouville integrability of these systems based on the existence of sufficiently many integrals of motion.

  5. Northern spotted owls: influence of prey base and landscape character.

    Treesearch

    A.B. Carey; S.P. Horton; B.L. Biswell

    1992-01-01

    We studied prey populations and the use and composition of home ranges of 47 Northern Spotted Owls (Strix occidentalis caurina) over 12 mo in five landscapes in two forest types in southwestern Oregon. We measured 1-yr home ranges of 23 owl pairs, 2-yr home ranges of 13 pairs, and 3-yr home ranges of 3 pairs. The landscapes differed in the degree...

  6. The structure of the L3 loop from the hepatitis delta virus ribozyme: a syn cytidine.

    PubMed Central

    Lynch, S R; Tinoco, I

    1998-01-01

    The structure of the L3 central hairpin loop isolated from the antigenomic sequence of the hepatitis delta virus ribozyme with the P2 and P3 stems from the ribozyme stacked on top of the loop has been determined by NMR spectroscopy. The 26 nt stem-loop structure contains nine base pairs and a 7 nt loop (5'-UCCUCGC-3'). This hairpin loop is critical for efficient catalysis in the intact ribozyme. The structure was determined using homonuclear and heteronuclear NMR techniques on non-labeled and15N-labeled RNA oligonucleotides. The overall root mean square deviation for the structure was 1.15 A (+/- 0.28 A) for the loop and the closing C.G base pair and 0.90 A (+/- 0.18 A) for the loop and the closing C.G base pair but without the lone purine in the loop, which is not well defined in the structure. The structure indicates a U.C base pair between the nucleotides on the 5'- and 3'-ends of the loop. This base pair is formed with a single hydrogen bond involving the cytosine exocyclic amino proton and the carbonyl O4 of the uracil. The most unexpected finding in the loop is a syn cytidine. While not unprecedented, syn pyrimidines are highly unusual. This one can be confidently established by intranucleotide distances between the ribose and the base determined by NMR spectroscopy. A similar study of the structure of this loop showed a somewhat different three-dimensional structure. A discussion of differences in the two structures, as well as possible sites of interaction with the cleavage site, will be presented. PMID:9461457

  7. Updates on Pairing Issues with the US Antarctic Meteorite Collection

    NASA Technical Reports Server (NTRS)

    Righter, K.; Satterwhite, C.; Schutt, J.

    2015-01-01

    The US Antarctic meteorite program has re-covered >21,000 meteorites since 1976, with thousands of those recovered from several icefields over multiple seasons, some-times spanning over a decade [1]. Pairing is assigned as best as possible at the time of classification, based on information from the field team, macro-scale hand sample features in the lab, and petrography, but later focused studies can reveal details that suggest re-evaluation of pairing groups. As a result, pairing groups are revealed over time, and must be continuously updated. Here we examine a few groups with known issues and give an update on some of the larger or more significant pairing groups.

  8. The pairing center plays a key role in homolog paring: an explanation for adjacent-2 segregation in interchange heterozygotes.

    PubMed

    Luo, Peigao

    2009-05-01

    Having reflected on the discrepancy between various views of chromosome behavior during meiosis, we propose an alternative description of Mendel's first law of segregation by referring to the segregation of pairing centers instead of centromeres. We also propose an alternative description of Mendel's second law of independent assortment, which refers to the free combination of different pairing centers. This interpretation is based on the modified concept that true 'homologous chromosomes' should carry the pairing center rather than centromere: the length of homology or the importance of the homologous segment on the chromosome is the crucial factor in homologous chromosome pairing and synapsis.

  9. 22. TYPICAL FOR THE FIRST FLOOR INTERIORS, ARE PAIRED COLUMN ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    22. TYPICAL FOR THE FIRST FLOOR INTERIORS, ARE PAIRED COLUMN PILASTERS IN KEENE CEMENT PLASTER. BASE OF PILASTER IS SHOWN. - Pacific Telephone & Telegraph Company Building, 1519 Franklin Street, Oakland, Alameda County, CA

  10. ID-based encryption scheme with revocation

    NASA Astrophysics Data System (ADS)

    Othman, Hafizul Azrie; Ismail, Eddie Shahril

    2017-04-01

    In 2015, Meshram proposed an efficient ID-based cryptographic encryption based on the difficulty of solving discrete logarithm and integer-factoring problems. The scheme was pairing free and claimed to be secure against adaptive chosen plaintext attacks (CPA). Later, Tan et al. proved that the scheme was insecure by presenting a method to recover the secret master key and to obtain prime factorization of modulo n. In this paper, we propose a new pairing-free ID-based encryption scheme with revocation based on Meshram's ID-based encryption scheme, which is also secure against Tan et al.'s attacks.

  11. Young Learners' Interactional Development in Task-Based Paired-Assessment in Their First and Foreign Languages: A Case of English Learners in China

    ERIC Educational Resources Information Center

    Butler, Yuko Goto; Zeng, Wei

    2015-01-01

    In response to the growing interest in evaluating young learners' foreign language (FL) performance, this study aims to deepen our understanding of young learners' developmental differences in interaction during task-based paired-language assessments. To examine age effects separately from the effect of general language proficiency, we analysed…

  12. Dual door entry to exciplex emission in a chimeric DNA duplex containing non-nucleoside-nucleoside pair.

    PubMed

    Bag, Subhendu Sekhar; Talukdar, Sangita; Kundu, Rajen; Saito, Isao; Jana, Subhashis

    2014-01-25

    Dual door entry to exciplex formation was established in a chimeric DNA duplex wherein a fluorescent non-nucleosidic base surrogate () is paired against a fluorescent nucleosidic base surrogate (). Packing of the nucleobases via intercalative stacking interactions led to an exciplex emission either via FRET from the donor or direct excitation of the FRET acceptor .

  13. Signature scheme based on bilinear pairs

    NASA Astrophysics Data System (ADS)

    Tong, Rui Y.; Geng, Yong J.

    2013-03-01

    An identity-based signature scheme is proposed by using bilinear pairs technology. The scheme uses user's identity information as public key such as email address, IP address, telephone number so that it erases the cost of forming and managing public key infrastructure and avoids the problem of user private generating center generating forgery signature by using CL-PKC framework to generate user's private key.

  14. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vyas, Rajan; Reed, Andrew J.; Tokarsky, E. John

    One common oxidative DNA lesion, 8-oxo-7,8-dihydro-2'-deoxyguanine (8-oxoG), is highly mutagenic in vivo due to its anti-conformation forming a Watson–Crick base pair with correct deoxycytidine 5'-triphosphate (dCTP) and its syn-conformation forming a Hoogsteen base pair with incorrect deoxyadenosine 5'-triphosphate (dATP). Here in this article, we utilized time-resolved X-ray crystallography to follow 8-oxoG bypass by human DNA polymerase β (hPolβ). In the 12 solved structures, both Watson–Crick (anti-8-oxoG:anti-dCTP) and Hoogsteen (syn-8-oxoG:anti-dATP) base pairing were clearly visible and were maintained throughout the chemical reaction. Additionally, a third Mg 2+ appeared during the process of phosphodiester bond formation and was located between the reactingmore » α- and β-phosphates of the dNTP, suggesting its role in stabilizing reaction intermediates. After phosphodiester bond formation, hPolβ reopened its conformation, pyrophosphate was released, and the newly incorporated primer 3'-terminal nucleotide stacked, rather than base paired, with 8-oxoG. These structures provide the first real-time pictures, to our knowledge, of how a polymerase correctly and incorrectly bypasses a DNA lesion.« less

  15. Origami-based tunable truss structures for non-volatile mechanical memory operation.

    PubMed

    Yasuda, Hiromi; Tachi, Tomohiro; Lee, Mia; Yang, Jinkyu

    2017-10-17

    Origami has recently received significant interest from the scientific community as a method for designing building blocks to construct metamaterials. However, the primary focus has been placed on their kinematic applications by leveraging the compactness and auxeticity of planar origami platforms. Here, we present volumetric origami cells-specifically triangulated cylindrical origami (TCO)-with tunable stability and stiffness, and demonstrate their feasibility as non-volatile mechanical memory storage devices. We show that a pair of TCO cells can develop a double-well potential to store bit information. What makes this origami-based approach more appealing is the realization of two-bit mechanical memory, in which two pairs of TCO cells are interconnected and one pair acts as a control for the other pair. By assembling TCO-based truss structures, we experimentally verify the tunable nature of the TCO units and demonstrate the operation of purely mechanical one- and two-bit memory storage prototypes.Origami is a popular method to design building blocks for mechanical metamaterials. Here, the authors assemble a volumetric origami-based structure, predict its axial and rotational movements during folding, and demonstrate the operation of mechanical one- and two-bit memory storage.

  16. AUCTSP: an improved biomarker gene pair class predictor.

    PubMed

    Kagaris, Dimitri; Khamesipour, Alireza; Yiannoutsos, Constantin T

    2018-06-26

    The Top Scoring Pair (TSP) classifier, based on the concept of relative ranking reversals in the expressions of pairs of genes, has been proposed as a simple, accurate, and easily interpretable decision rule for classification and class prediction of gene expression profiles. The idea that differences in gene expression ranking are associated with presence or absence of disease is compelling and has strong biological plausibility. Nevertheless, the TSP formulation ignores significant available information which can improve classification accuracy and is vulnerable to selecting genes which do not have differential expression in the two conditions ("pivot" genes). We introduce the AUCTSP classifier as an alternative rank-based estimator of the magnitude of the ranking reversals involved in the original TSP. The proposed estimator is based on the Area Under the Receiver Operating Characteristic (ROC) Curve (AUC) and as such, takes into account the separation of the entire distribution of gene expression levels in gene pairs under the conditions considered, as opposed to comparing gene rankings within individual subjects as in the original TSP formulation. Through extensive simulations and case studies involving classification in ovarian, leukemia, colon, breast and prostate cancers and diffuse large b-cell lymphoma, we show the superiority of the proposed approach in terms of improving classification accuracy, avoiding overfitting and being less prone to selecting non-informative (pivot) genes. The proposed AUCTSP is a simple yet reliable and robust rank-based classifier for gene expression classification. While the AUCTSP works by the same principle as TSP, its ability to determine the top scoring gene pair based on the relative rankings of two marker genes across all subjects as opposed to each individual subject results in significant performance gains in classification accuracy. In addition, the proposed method tends to avoid selection of non-informative (pivot) genes as members of the top-scoring pair.

  17. Mutation load in melanoma is affected by MC1R genotype.

    PubMed

    Johansson, Peter A; Pritchard, Antonia L; Patch, Ann-Marie; Wilmott, James S; Pearson, John V; Waddell, Nicola; Scolyer, Richard A; Mann, Graham J; Hayward, Nicholas K

    2017-03-01

    Whole-genome sequencing of matched germline and tumour pairs in a well-characterized cohort of melanoma patients allowed investigation of associations between melanoma body site, age at melanoma onset and MC1R variant status with overall mutation burden and specific base pair changes observed in the corresponding melanoma. We observed statistically significant associations between mutation burden in melanoma and body site, age at onset and MC1R genotype, for both ultraviolet radiation (UVR) signature changes (C>T and CC>TT) and non-UVR base pair substitutions, as well as with overall variant load. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  18. All-optical switching application based on optical nonlinearity of Yb(3+) doped aluminosilicate glass fiber with a long-period fiber gratings pair.

    PubMed

    Kim, Yune; Kim, Nam; Chung, Youngjoo; Paek, Un-Chul; Han, Won-Taek

    2004-02-23

    We propose a new fiber-type all-optical switching device based on the optical nonlinearity of Yb(3+) doped fiber and a long-period fiber gratings(LPG) pair. The all-optical ON-OFF switching with the continuous wave laser signal at ~1556nm in the LPG pair including the 25.5cm long Yb(3+) doped fiber was demonstrated up to ~200Hz upon pumping with the modulated square wave pulses at 976nm, where a full optical switching with the ~18dB extinction ratio was obtained at the launched pump power of ~35mW.

  19. rSNPBase 3.0: an updated database of SNP-related regulatory elements, element-gene pairs and SNP-based gene regulatory networks.

    PubMed

    Guo, Liyuan; Wang, Jing

    2018-01-04

    Here, we present the updated rSNPBase 3.0 database (http://rsnp3.psych.ac.cn), which provides human SNP-related regulatory elements, element-gene pairs and SNP-based regulatory networks. This database is the updated version of the SNP regulatory annotation database rSNPBase and rVarBase. In comparison to the last two versions, there are both structural and data adjustments in rSNPBase 3.0: (i) The most significant new feature is the expansion of analysis scope from SNP-related regulatory elements to include regulatory element-target gene pairs (E-G pairs), therefore it can provide SNP-based gene regulatory networks. (ii) Web function was modified according to data content and a new network search module is provided in the rSNPBase 3.0 in addition to the previous regulatory SNP (rSNP) search module. The two search modules support data query for detailed information (related-elements, element-gene pairs, and other extended annotations) on specific SNPs and SNP-related graphic networks constructed by interacting transcription factors (TFs), miRNAs and genes. (3) The type of regulatory elements was modified and enriched. To our best knowledge, the updated rSNPBase 3.0 is the first data tool supports SNP functional analysis from a regulatory network prospective, it will provide both a comprehensive understanding and concrete guidance for SNP-related regulatory studies. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  20. Large-scale parentage inference with SNPs: an efficient algorithm for statistical confidence of parent pair allocations.

    PubMed

    Anderson, Eric C

    2012-11-08

    Advances in genotyping that allow tens of thousands of individuals to be genotyped at a moderate number of single nucleotide polymorphisms (SNPs) permit parentage inference to be pursued on a very large scale. The intergenerational tagging this capacity allows is revolutionizing the management of cultured organisms (cows, salmon, etc.) and is poised to do the same for scientific studies of natural populations. Currently, however, there are no likelihood-based methods of parentage inference which are implemented in a manner that allows them to quickly handle a very large number of potential parents or parent pairs. Here we introduce an efficient likelihood-based method applicable to the specialized case of cultured organisms in which both parents can be reliably sampled. We develop a Markov chain representation for the cumulative number of Mendelian incompatibilities between an offspring and its putative parents and we exploit it to develop a fast algorithm for simulation-based estimates of statistical confidence in SNP-based assignments of offspring to pairs of parents. The method is implemented in the freely available software SNPPIT. We describe the method in detail, then assess its performance in a large simulation study using known allele frequencies at 96 SNPs from ten hatchery salmon populations. The simulations verify that the method is fast and accurate and that 96 well-chosen SNPs can provide sufficient power to identify the correct pair of parents from amongst millions of candidate pairs.

  1. rSNPBase 3.0: an updated database of SNP-related regulatory elements, element-gene pairs and SNP-based gene regulatory networks

    PubMed Central

    2018-01-01

    Abstract Here, we present the updated rSNPBase 3.0 database (http://rsnp3.psych.ac.cn), which provides human SNP-related regulatory elements, element-gene pairs and SNP-based regulatory networks. This database is the updated version of the SNP regulatory annotation database rSNPBase and rVarBase. In comparison to the last two versions, there are both structural and data adjustments in rSNPBase 3.0: (i) The most significant new feature is the expansion of analysis scope from SNP-related regulatory elements to include regulatory element–target gene pairs (E–G pairs), therefore it can provide SNP-based gene regulatory networks. (ii) Web function was modified according to data content and a new network search module is provided in the rSNPBase 3.0 in addition to the previous regulatory SNP (rSNP) search module. The two search modules support data query for detailed information (related-elements, element-gene pairs, and other extended annotations) on specific SNPs and SNP-related graphic networks constructed by interacting transcription factors (TFs), miRNAs and genes. (3) The type of regulatory elements was modified and enriched. To our best knowledge, the updated rSNPBase 3.0 is the first data tool supports SNP functional analysis from a regulatory network prospective, it will provide both a comprehensive understanding and concrete guidance for SNP-related regulatory studies. PMID:29140525

  2. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ai Yuejie; Zhang Feng; Theoretical Chemistry, School of Biotechnology, Royal Institute of Technology, S-10691 Stockholm

    2-aminopyridine dimer has frequently been used as a model system for studying photochemistry of DNA base pairs. We examine here the relevance of 2-aminopyridine dimer for a Watson-Crick adenine-thymine base pair by studying UV-light induced photodynamics along two main hydrogen bridges after the excitation to the localized {sup 1}{pi}{pi}* excited-state. The respective two-dimensional potential-energy surfaces have been determined by time-dependent density functional theory with Coulomb-attenuated hybrid exchange-correlation functional (CAM-B3LYP). Different mechanistic aspects of the deactivation pathway have been analyzed and compared in detail for both systems, while the related reaction rates have also be obtained from Monte Carlo kinetic simulations.more » The limitations of the 2-aminopyridine dimer as a model system for the adenine-thymine base pair are discussed.« less

  3. Hydro lazy tongs energy booster

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lamonica, M.

    1987-06-09

    An apparatus is described for converting hydraulic power to rotational power. The apparatus comprises: a support base; a source of hydraulic fluid; a pair of piston and cylinder assemblies in communication with the source of hydraulic fluid and mounted to the support base such that the pistons thereof are generally parallel with one another but extending substantially opposite directions; means for alternating directly hydraulic fluid to each of the piston and cylinder assemblies; lazy tong assemblies comprising a first lazy tong assembly, a last lazy tong assembly and an intermediate lazy tong assembly. Each lazy tong assembly comprises at leastmore » one block slidably mounted in proximity to the support base and at least one pair of lazy tongs with each lazy tong having a pair of opposed ends.« less

  4. Comparative study of the requantization of the time-dependent mean field for the dynamics of nuclear pairing

    NASA Astrophysics Data System (ADS)

    Ni, Fang; Nakatsukasa, Takashi

    2018-04-01

    To describe quantal collective phenomena, it is useful to requantize the time-dependent mean-field dynamics. We study the time-dependent Hartree-Fock-Bogoliubov (TDHFB) theory for the two-level pairing Hamiltonian, and compare results of different quantization methods. The one constructing microscopic wave functions, using the TDHFB trajectories fulfilling the Einstein-Brillouin-Keller quantization condition, turns out to be the most accurate. The method is based on the stationary-phase approximation to the path integral. We also examine the performance of the collective model which assumes that the pairing gap parameter is the collective coordinate. The applicability of the collective model is limited for the nuclear pairing with a small number of single-particle levels, because the pairing gap parameter represents only a half of the pairing collective space.

  5. Feature-based attention to unconscious shapes and colors.

    PubMed

    Schmidt, Filipp; Schmidt, Thomas

    2010-08-01

    Two experiments employed feature-based attention to modulate the impact of completely masked primes on subsequent pointing responses. Participants processed a color cue to select a pair of possible pointing targets out of multiple targets on the basis of their color, and then pointed to the one of those two targets with a prespecified shape. All target pairs were preceded by prime pairs triggering either the correct or the opposite response. The time interval between cue and primes was varied to modulate the time course of feature-based attentional selection. In a second experiment, the roles of color and shape were switched. Pointing trajectories showed large priming effects that were amplified by feature-based attention, indicating that attention modulated the earliest phases of motor output. Priming effects as well as their attentional modulation occurred even though participants remained unable to identify the primes, indicating distinct processes underlying visual awareness, attention, and response control.

  6. End-to-end distance and contour length distribution functions of DNA helices

    NASA Astrophysics Data System (ADS)

    Zoli, Marco

    2018-06-01

    I present a computational method to evaluate the end-to-end and the contour length distribution functions of short DNA molecules described by a mesoscopic Hamiltonian. The method generates a large statistical ensemble of possible configurations for each dimer in the sequence, selects the global equilibrium twist conformation for the molecule, and determines the average base pair distances along the molecule backbone. Integrating over the base pair radial and angular fluctuations, I derive the room temperature distribution functions as a function of the sequence length. The obtained values for the most probable end-to-end distance and contour length distance, providing a measure of the global molecule size, are used to examine the DNA flexibility at short length scales. It is found that, also in molecules with less than ˜60 base pairs, coiled configurations maintain a large statistical weight and, consistently, the persistence lengths may be much smaller than in kilo-base DNA.

  7. Mispairs with Watson-Crick base-pair geometry observed in ternary complexes of an RB69 DNA polymerase variant.

    PubMed

    Xia, Shuangluo; Konigsberg, William H

    2014-04-01

    Recent structures of DNA polymerase complexes with dGMPCPP/dT and dCTP/dA mispairs at the insertion site have shown that they adopt Watson-Crick geometry in the presence of Mn(2+) indicating that the tautomeric or ionization state of the base has changed. To see whether the tautomeric or ionization state of base-pair could be affected by its microenvironment, we determined 10 structures of an RB69 DNA polymerase quadruple mutant with dG/dT or dT/dG mispairs at position n-1 to n-5 of the Primer/Template duplex. Different shapes of the mispairs, including Watson-Crick geometry, have been observed, strongly suggesting that the local environment of base-pairs plays an important role in their tautomeric or ionization states. © 2014 The Protein Society.

  8. Supramolecular latching system based on ultrastable synthetic binding pairs as versatile tools for protein imaging.

    PubMed

    Kim, Kyung Lock; Sung, Gihyun; Sim, Jaehwan; Murray, James; Li, Meng; Lee, Ara; Shrinidhi, Annadka; Park, Kyeng Min; Kim, Kimoon

    2018-04-27

    Here we report ultrastable synthetic binding pairs between cucurbit[7]uril (CB[7]) and adamantyl- (AdA) or ferrocenyl-ammonium (FcA) as a supramolecular latching system for protein imaging, overcoming the limitations of protein-based binding pairs. Cyanine 3-conjugated CB[7] (Cy3-CB[7]) can visualize AdA- or FcA-labeled proteins to provide clear fluorescence images for accurate and precise analysis of proteins. Furthermore, controllability of the system is demonstrated by treating with a stronger competitor guest. At low temperature, this allows us to selectively detach Cy3-CB[7] from guest-labeled proteins on the cell surface, while leaving Cy3-CB[7] latched to the cytosolic proteins for spatially conditional visualization of target proteins. This work represents a non-protein-based bioimaging tool which has inherent advantages over the widely used protein-based techniques, thereby demonstrating the great potential of this synthetic system.

  9. A single Watson-Crick G x C base pair in water: aqueous hydrogen bonds in hydrophobic cavities.

    PubMed

    Sawada, Tomohisa; Fujita, Makoto

    2010-05-26

    Hydrogen bond (H-bond) formation in water has been a challenging task because water molecules are constant competitors. In biological systems, however, stable H-bonds are formed by shielding the H-bonding sites from the competing water molecules within hydrophobic pockets. Inspired by the nature's elaborated way, we found that even mononucleotides (G and C) can form the minimal G x C Watson-Crick pair in water by simply providing a synthetic cavity that efficiently shields the Watson-Crick H-bonding sites. The minimal Watson-Crick structure in water was elucidated by NMR study and firmly characterized by crystallographic analysis. The crystal structure also displays that, within the cavity, coencapsulated anions and solvents efficiently mediate the minimal G x C Watson-Crick pair formation. Furthermore, the competition experiments with the other nucleobases clearly revealed the evident selectivity for the G x C base pairing in water. These results show the fact that a H-bonded nucleobase pair was effectively induced and stabilized in the local environment of an artificial hydrophobic cavity.

  10. Prediction of missing common genes for disease pairs using network based module separation on incomplete human interactome.

    PubMed

    Akram, Pakeeza; Liao, Li

    2017-12-06

    Identification of common genes associated with comorbid diseases can be critical in understanding their pathobiological mechanism. This work presents a novel method to predict missing common genes associated with a disease pair. Searching for missing common genes is formulated as an optimization problem to minimize network based module separation from two subgraphs produced by mapping genes associated with disease onto the interactome. Using cross validation on more than 600 disease pairs, our method achieves significantly higher average receiver operating characteristic ROC Score of 0.95 compared to a baseline ROC score 0.60 using randomized data. Missing common genes prediction is aimed to complete gene set associated with comorbid disease for better understanding of biological intervention. It will also be useful for gene targeted therapeutics related to comorbid diseases. This method can be further considered for prediction of missing edges to complete the subgraph associated with disease pair.

  11. Numerical simulation and optimal design of Segmented Planar Imaging Detector for Electro-Optical Reconnaissance

    NASA Astrophysics Data System (ADS)

    Chu, Qiuhui; Shen, Yijie; Yuan, Meng; Gong, Mali

    2017-12-01

    Segmented Planar Imaging Detector for Electro-Optical Reconnaissance (SPIDER) is a cutting-edge electro-optical imaging technology to realize miniaturization and complanation of imaging systems. In this paper, the principle of SPIDER has been numerically demonstrated based on the partially coherent light theory, and a novel concept of adjustable baseline pairing SPIDER system has further been proposed. Based on the results of simulation, it is verified that the imaging quality could be effectively improved by adjusting the Nyquist sampling density, optimizing the baseline pairing method and increasing the spectral channel of demultiplexer. Therefore, an adjustable baseline pairing algorithm is established for further enhancing the image quality, and the optimal design procedure in SPIDER for arbitrary targets is also summarized. The SPIDER system with adjustable baseline pairing method can broaden its application and reduce cost under the same imaging quality.

  12. Evidence of Antiblockade in an Ultracold Rydberg Gas

    NASA Astrophysics Data System (ADS)

    Amthor, Thomas; Giese, Christian; Hofmann, Christoph S.; Weidemüller, Matthias

    2010-01-01

    We present the experimental observation of the antiblockade in an ultracold Rydberg gas recently proposed by Ates et al. [Phys. Rev. Lett. 98, 023002 (2007)PRLTAO0031-900710.1103/PhysRevLett.98.023002]. Our approach allows the control of the pair distribution in the gas and is based on a strong coupling of one transition in an atomic three-level system, while introducing specific detunings of the other transition. When the coupling energy matches the interaction energy of the Rydberg long-range interactions, the otherwise blocked excitation of close pairs becomes possible. A time-resolved spectroscopic measurement of the Penning ionization signal is used to identify slight variations in the Rydberg pair distribution of a random arrangement of atoms. A model based on a pair interaction Hamiltonian is presented which well reproduces our experimental observations and allows one to deduce the distribution of nearest-neighbor distances.

  13. Nick-free formation of reciprocal heteroduplexes: a simple solution to the topological problem.

    PubMed Central

    Wilson, J H

    1979-01-01

    Because the individual strands of DNA are intertwined, formation of heteroduplex structures between duplexes--as in presumed recombination intermediates--presents a topological puzzle, known as the winding problem. Previous approaches to this problem have assumed that single-strand breaks are required to permit formation of fully coiled heteroduplexes. This paper describes a simple, nick-free solution to the winding problem that satisfies all topological constraints. Homologous duplexes associated by their minor-groove surfaces can switch strand pairing to form reciprocal heteroduplexes that coil together into a compact, four-stranded helix throughout the region of pairing. Model building shows that this fused heteroduplex structure is plausible, being composed entirely of right-handed primary helices with Watson-Crick base pairing throughout. Its simplicity of formation, structural symmetry, and high degree of specificity are suggestive of a natural mechanism for alignment by base pairing between intact homologous duplexes. Implications for genetic recombination are discussed. Images PMID:291028

  14. Majorana edge States in atomic wires coupled by pair hopping.

    PubMed

    Kraus, Christina V; Dalmonte, Marcello; Baranov, Mikhail A; Läuchli, Andreas M; Zoller, P

    2013-10-25

    We present evidence for Majorana edge states in a number conserving theory describing a system of spinless fermions on two wires that are coupled by pair hopping. Our analysis is based on a combination of a qualitative low energy approach and numerical techniques using the density matrix renormalization group. In addition, we discuss an experimental realization of pair-hopping interactions in cold atom gases confined in optical lattices.

  15. SeaQuaKE: Sea-optimized Quantum Key Exchange

    DTIC Science & Technology

    2014-11-01

    ONRBAA13-001). In this technical report, we describe modeling results of an entangled photon - pair source based on spontaneous four-wave mixing for...Distribution Special Notice (13-SN- 0004 under ONRBAA13-001). In this technical report, we describe modeling results of an entangled photon - pair ...areas over the last quarter include (i) development of a wavelength-dependent, entangled photon - pair source model and (ii) end-to-end system modeling

  16. Evidence of Knowledge Acquisition in a Cognitive Flexibility-Based Computer Learning Environment

    PubMed Central

    Heath, Scott; Higgs, John; Ambruso, Daniel R.

    2008-01-01

    Background A computer-based learning experience was developed using cognitive flexibility theory to overcome the pitfalls often encountered in existing medical education. An earlier study (not published) showed significant pretest-posttest increase in scores, as well as a significant positive correlation between choosing to complete the module individually or in pairs. Method This experience was presented as part of a second-year course in medical school with randomized assignment for students to complete the program as pairs or individuals. Results Sixty-six scores of 101 medical students (31 from students working as singles and 35 from 70 working in pairs) were analyzed. Out of 47 possible points, the mean pretest score was 15.1 (SD = 6.4, range 13.7-15.9). The mean posttest score was 22.9 (SD = 5.2, range 21.1-24.2). Posttest scores were statistically significantly higher than pretest scores (p<.001, Cohen's d = 1.17, average gain 7.8 points). Both pairs and singles showed pre-to-post test score gains, but the score gains of pairs and singles were not significantly different. Conclusion This learning module served as an effective instructional intervention. However, the effect of collaboration, measured by score gains for pairs, was not significantly different from score gains of students completing the assignment individually. PMID:20165544

  17. Same-sex partner preference in zebra finches: pairing flexibility and choice.

    PubMed

    Tomaszycki, Michelle L; Zatirka, Brendon P

    2014-11-01

    This study examined flexibility and choice in same-sex pair-bonding behavior in adult zebra finches (Taeniopygia guttata). Zebra finches form life-long monogamous relationships and extra pair behavior is very low, making them an ideal species in which to study same-sex pairing. We examined same-sex behaviors using both semi-naturalistic choice paradigms and skewed sex ratios. In the first experiment, we allowed zebra finches to pair in aviaries with equal sex ratios as part of multiple experiments. On average, 6.4% (N = 78) of unmanipulated pairs were same-sex: all but one was female-female. In a second experiment, we identified pairs from same-sex cages and selected 20 total same-sex pairs (10 of each sex). We then gave pairs a chance to court and pair with members of the opposite sex and observed their behavior for three days. Females did not retain their partner, but most paired with males. In contrast, some males did retain their partner. Similarly, females were more likely to engage in pairing behaviors with males than with their partners or other females whereas males were equally likely to engage in same-sex and opposite-sex pairing behaviors. These findings suggest that same-sex partnerships in zebra finches can be facultative, based on the sex ratio of the group in which they live, but can also be a choice, when opportunities to pair with opposite-sex individuals are possible. Furthermore, it is possible that females are more flexible in this choice of same-sex partnerships than are males.

  18. Ni2+-binding RNA motifs with an asymmetric purine-rich internal loop and a G-A base pair.

    PubMed Central

    Hofmann, H P; Limmer, S; Hornung, V; Sprinzl, M

    1997-01-01

    RNA molecules with high affinity for immobilized Ni2+ were isolated from an RNA pool with 50 randomized positions by in vitro selection-amplification. The selected RNAs preferentially bind Ni2+ and Co2+ over other cations from first series transition metals. Conserved structure motifs, comprising about 15 nt, were identified that are likely to represent the Ni2+ binding sites. Two conserved motifs contain an asymmetric purine-rich internal loop and probably a mismatch G-A base pair. The structure of one of these motifs was studied with proton NMR spectroscopy and formation of the G-A pair at the junction of helix and internal loop was demonstrated. Using Ni2+ as a paramagnetic probe, a divalent metal ion binding site near this G-A base pair was identified. Ni2+ ions bound to this motif exert a specific stabilization effect. We propose that small asymmetric purine-rich loops that contain a G-A interaction may represent a divalent metal ion binding site in RNA. PMID:9409620

  19. Same-Sex and Race-Based Disparities in Statutory Rape Arrests.

    PubMed

    Chaffin, Mark; Chenoweth, Stephanie; Letourneau, Elizabeth J

    2016-01-01

    This study tests a liberation hypothesis for statutory rape incidents, specifically that there may be same-sex and race/ethnicity arrest disparities among statutory rape incidents and that these will be greater among statutory rape than among forcible sex crime incidents. 26,726 reported incidents of statutory rape as defined under state statutes and 96,474 forcible sex crime incidents were extracted from National Incident-Based Reporting System data sets. Arrest outcomes were tested using multilevel modeling. Same-sex statutory rape pairings were rare but had much higher arrest odds. A victim-offender romantic relationship amplified arrest odds for same-sex pairings, but damped arrest odds for male-on-female pairings. Same-sex disparities were larger among statutory than among forcible incidents. Female-on-male incidents had uniformly lower arrest odds. Race/ethnicity effects were smaller than gender effects and more complexly patterned. The findings support the liberation hypothesis for same-sex statutory rape arrest disparities, particularly among same-sex romantic pairings. Support for race/ethnicity-based arrest disparities was limited and mixed. © The Author(s) 2014.

  20. Unbiased Protein Association Study on the Public Human Proteome Reveals Biological Connections between Co-Occurring Protein Pairs

    PubMed Central

    2017-01-01

    Mass-spectrometry-based, high-throughput proteomics experiments produce large amounts of data. While typically acquired to answer specific biological questions, these data can also be reused in orthogonal ways to reveal new biological knowledge. We here present a novel method for such orthogonal data reuse of public proteomics data. Our method elucidates biological relationships between proteins based on the co-occurrence of these proteins across human experiments in the PRIDE database. The majority of the significantly co-occurring protein pairs that were detected by our method have been successfully mapped to existing biological knowledge. The validity of our novel method is substantiated by the extremely few pairs that can be mapped to existing knowledge based on random associations between the same set of proteins. Moreover, using literature searches and the STRING database, we were able to derive meaningful biological associations for unannotated protein pairs that were detected using our method, further illustrating that as-yet unknown associations present highly interesting targets for follow-up analysis. PMID:28480704

  1. Quantum cryptography using entangled photons in energy-time bell states

    PubMed

    Tittel; Brendel; Zbinden; Gisin

    2000-05-15

    We present a setup for quantum cryptography based on photon pairs in energy-time Bell states and show its feasibility in a laboratory experiment. Our scheme combines the advantages of using photon pairs instead of faint laser pulses and the possibility to preserve energy-time entanglement over long distances. Moreover, using four-dimensional energy-time states, no fast random change of bases is required in our setup: Nature itself decides whether to measure in the energy or in the time base, thus rendering eavesdropper attacks based on "photon number splitting" less efficient.

  2. A nucleobase-centered coarse-grained representation for structure prediction of RNA motifs.

    PubMed

    Poblete, Simón; Bottaro, Sandro; Bussi, Giovanni

    2018-02-28

    We introduce the SPlit-and-conQueR (SPQR) model, a coarse-grained (CG) representation of RNA designed for structure prediction and refinement. In our approach, the representation of a nucleotide consists of a point particle for the phosphate group and an anisotropic particle for the nucleoside. The interactions are, in principle, knowledge-based potentials inspired by the $\\mathcal {E}$SCORE function, a base-centered scoring function. However, a special treatment is given to base-pairing interactions and certain geometrical conformations which are lost in a raw knowledge-based model. This results in a representation able to describe planar canonical and non-canonical base pairs and base-phosphate interactions and to distinguish sugar puckers and glycosidic torsion conformations. The model is applied to the folding of several structures, including duplexes with internal loops of non-canonical base pairs, tetraloops, junctions and a pseudoknot. For the majority of these systems, experimental structures are correctly predicted at the level of individual contacts. We also propose a method for efficiently reintroducing atomistic detail from the CG representation.

  3. Multi-Threaded DNA Tag/Anti-Tag Library Generator for Multi-Core Platforms

    DTIC Science & Technology

    2009-05-01

    base pair)  Watson ‐ Crick  strand pairs that bind perfectly within pairs, but poorly across pairs. A variety  of  DNA  strand hybridization metrics...AFRL-RI-RS-TR-2009-131 Final Technical Report May 2009 MULTI-THREADED DNA TAG/ANTI-TAG LIBRARY GENERATOR FOR MULTI-CORE PLATFORMS...TYPE Final 3. DATES COVERED (From - To) Jun 08 – Feb 09 4. TITLE AND SUBTITLE MULTI-THREADED DNA TAG/ANTI-TAG LIBRARY GENERATOR FOR MULTI-CORE

  4. Exact solutions for a type of electron pairing model with spin-orbit interactions and Zeeman coupling.

    PubMed

    Liu, Jia; Han, Qiang; Shao, L B; Wang, Z D

    2011-07-08

    A type of electron pairing model with spin-orbit interactions or Zeeman coupling is solved exactly in the framework of the Richardson ansatz. Based on the exact solutions for the case with spin-orbit interactions, it is shown rigorously that the pairing symmetry is of the p + ip wave and the ground state possesses time-reversal symmetry, regardless of the strength of the pairing interaction. Intriguingly, how Majorana fermions can emerge in the system is also elaborated. Exact results are illustrated for two systems, respectively, with spin-orbit interactions and Zeeman coupling.

  5. Pair production of scalar dyons in Kerr-Newman black holes

    NASA Astrophysics Data System (ADS)

    Chen, Chiang-Mei; Kim, Sang Pyo; Sun, Jia-Rui; Tang, Fu-Yi

    2018-06-01

    We study the spontaneous pair production of scalar dyons in the near extremal dyonic Kerr-Newman (KN) black hole, which contains a warped AdS3 structure in the near horizon region. The leading term contribution of the pair production rate and the absorption cross section ratio are also calculated using the Hamilton-Jacobi approach and the thermal interpretation is given. In addition, the holographic dual conformal field theories (CFTs) descriptions of the pair production rate and absorption cross section ratios are analyzed both in the J-, Q- and P-pictures respectively based on the threefold dyonic KN/CFTs dualities.

  6. Femtosecond Laser--Pumped Source of Entangled Photons for Quantum Cryptography Applications

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pan, D.; Donaldson, W.; Sobolewski, R.

    2007-07-31

    We present an experimental setup for generation of entangled-photon pairs via spontaneous parametric down-conversion, based on the femtosecond-pulsed laser. Our entangled-photon source utilizes a 76-MHz-repetition-rate, 100-fs-pulse-width, mode-locked, ultrafast femtosecond laser, which can produce, on average, more photon pairs than a cw laser of an equal pump power. The resulting entangled pairs are counted by a pair of high-quantum-efficiency, single-photon, silicon avalanche photodiodes. Our apparatus is intended as an efficient source/receiver system for the quantum communications and quantum cryptography applications.

  7. Case Study Projects for College Mathematics Courses Based on a Particular Function of Two Variables

    ERIC Educational Resources Information Center

    Shi, Y.

    2007-01-01

    Based on a sequence of number pairs, a recent paper (Mauch, E. and Shi, Y., 2005, Using a sequence of number pairs as an example in teaching mathematics, "Mathematics and Computer Education," 39(3), 198-205) presented some interesting examples that can be used in teaching high school and college mathematics classes such as algebra, geometry,…

  8. Children's agenda-based regulation: The effects of prior performance and reward on elementary school children's study choices.

    PubMed

    Lipowski, Stacy; Ariel, Robert; Tauber, Sarah K; Dunlosky, John

    2017-12-01

    The main goal of the current experiments was to examine the influence of monitoring and reward on elementary school children's study decisions. First and third graders studied names for 10 animals (e.g., "The elephant's name is Suzy") and then were given a cued recall test on which they were shown the animal and needed to recall the name. Next, they were given an opportunity to restudy the animal-name pairs, and some of these pairs were slated to earn a reward (a sticker) if correctly recalled. In Experiment 1, both groups of children were (a) more likely to restudy previously unrecalled pairs than previously recalled pairs and (b) more likely to restudy pairs that were slated to receive a reward. In Experiment 2, we further explored children's use of reward using a forced-choice selection task. Namely, during selection, pairs were presented in dyads where one pair was slated for a reward and the other pair was not, and the children could choose only one pair from each dyad for restudy. Both first and third graders chose to restudy pairs slated for a reward. Thus, even young elementary school children consider both rewards and performance monitoring when regulating their learning. Copyright © 2017 Elsevier Inc. All rights reserved.

  9. Birds choose long-term partners years before breeding

    USGS Publications Warehouse

    Teitelbaum, Claire S.; Converse, Sarah J.; Mueller, Thomas

    2017-01-01

    Pair bonds can provide social benefits to long-term monogamous species alongside their benefits for reproduction. However, little is known about when these bonds form, in particular how long they are present before breeding. Previous studies of pair formation in long-term monogamous birds have been rather data-limited, but for many migratory birds they report pair formation on the wintering grounds. We provide the first systematic investigation of prebreeding association patterns of long-term monogamous pairs by examining entire life histories based on tracking data of migratory whooping cranes, Grus americana. We found that a substantial portion (62%) of breeding pairs started associating at least 12 months before first breeding, with 16 of 58 breeding pairs beginning to associate over 2 years before first breeding. For most pairs, these associations with future breeding partners also became unique and distinguishable from association patterns with nonpartner individuals 12 months before first breeding. In addition, 60% of pair associations began before at least one partner had reached nominal sexual maturity. Most pairs began associating in the late spring upon arrival at the summer grounds, while associations beginning at other times of the year were rare. Patterns in the associations of pairs prior to breeding can point to the potential benefits of prebreeding relationships, for instance providing support in competitive interactions or increasing partner familiarity.

  10. Designed Synthesis of Mesoporous Solid-Supported Lewis Acid-Base Pairs and Their CO2 Adsorption Behaviors.

    PubMed

    Zakharova, Maria V; Masoumifard, Nima; Hu, Yimu; Han, Jongho; Kleitz, Freddy; Fontaine, Frédéric-Georges

    2018-04-18

    Conventional amines and phosphines, such as diethylenetriamine, diphenylpropylphosphine, triethylamine, and tetramethylpiperidine, were grafted or impregnated on the surface of metalated SBA-15 materials, such as Ti-, Al-, and Zr-SBA-15, to generate air-stable solid-supported Lewis acid-base pairs. The Lewis acidity of the metalated materials before and after the introduction of Lewis bases was verified by means of pyridine adsorption-Fourier transform infrared spectroscopy. Detailed characterization of the materials was achieved by solid-state 13 C and 31 P MAS NMR spectroscopy, low-temperature N 2 physisorption, X-ray photoelectron spectroscopy, and energy-dispersive X-ray mapping analyses. Study of their potential interactions with CO 2 was performed using CO 2 adsorption isotherm experiments, which provided new insights into their applicability as solid CO 2 adsorbents. A correlation between solid-supported Lewis acid-base pair strength and the resulting affinity to CO 2 is discussed based on the calculation of isosteric enthalpy of adsorption.

  11. Efficient and Provable Secure Pairing-Free Security-Mediated Identity-Based Identification Schemes

    PubMed Central

    Chin, Ji-Jian; Tan, Syh-Yuan; Heng, Swee-Huay; Phan, Raphael C.-W.

    2014-01-01

    Security-mediated cryptography was first introduced by Boneh et al. in 2001. The main motivation behind security-mediated cryptography was the capability to allow instant revocation of a user's secret key by necessitating the cooperation of a security mediator in any given transaction. Subsequently in 2003, Boneh et al. showed how to convert a RSA-based security-mediated encryption scheme from a traditional public key setting to an identity-based one, where certificates would no longer be required. Following these two pioneering papers, other cryptographic primitives that utilize a security-mediated approach began to surface. However, the security-mediated identity-based identification scheme (SM-IBI) was not introduced until Chin et al. in 2013 with a scheme built on bilinear pairings. In this paper, we improve on the efficiency results for SM-IBI schemes by proposing two schemes that are pairing-free and are based on well-studied complexity assumptions: the RSA and discrete logarithm assumptions. PMID:25207333

  12. Efficient and provable secure pairing-free security-mediated identity-based identification schemes.

    PubMed

    Chin, Ji-Jian; Tan, Syh-Yuan; Heng, Swee-Huay; Phan, Raphael C-W

    2014-01-01

    Security-mediated cryptography was first introduced by Boneh et al. in 2001. The main motivation behind security-mediated cryptography was the capability to allow instant revocation of a user's secret key by necessitating the cooperation of a security mediator in any given transaction. Subsequently in 2003, Boneh et al. showed how to convert a RSA-based security-mediated encryption scheme from a traditional public key setting to an identity-based one, where certificates would no longer be required. Following these two pioneering papers, other cryptographic primitives that utilize a security-mediated approach began to surface. However, the security-mediated identity-based identification scheme (SM-IBI) was not introduced until Chin et al. in 2013 with a scheme built on bilinear pairings. In this paper, we improve on the efficiency results for SM-IBI schemes by proposing two schemes that are pairing-free and are based on well-studied complexity assumptions: the RSA and discrete logarithm assumptions.

  13. Measurement of Beta Particles Induced Electron-Hole Pairs Recombination in Depletion Region of GaAs PN Junction

    NASA Astrophysics Data System (ADS)

    Chen, Hai-Yang; Jiang, Lan; Li, Da-Rang

    2011-05-01

    PN junctions and schottky diodes are widely employed as electron-hole pair collectors in electron beam induced current (EBIC) techniques and betavoltaic batteries, in which the recombination in depletion regions is ignored. We measured the beta particles induced electron-hole pairs recombination in the depletion region of a GaAs P+PN+ junction, based on comparisons between measured short currents and ideal values. The results show that only 20% electron-hole pairs in the depletion can be collected, causing the short current. This indicates an electron-hole pair diffusion length of 0.2μm in the depletion region. Hence, it is necessary to evaluate the recombination in the EBIC techniques and betavoltaic design.

  14. Exact solution of mean-field plus an extended T = 1 nuclear pairing Hamiltonian in the seniority-zero symmetric subspace

    NASA Astrophysics Data System (ADS)

    Pan, Feng; Ding, Xiaoxue; Launey, Kristina D.; Dai, Lianrong; Draayer, Jerry P.

    2018-05-01

    An extended pairing Hamiltonian that describes multi-pair interactions among isospin T = 1 and angular momentum J = 0 neutron-neutron, proton-proton, and neutron-proton pairs in a spherical mean field, such as the spherical shell model, is proposed based on the standard T = 1 pairing formalism. The advantage of the model lies in the fact that numerical solutions within the seniority-zero symmetric subspace can be obtained more easily and with less computational time than those calculated from the mean-field plus standard T = 1 pairing model. Thus, large-scale calculations within the seniority-zero symmetric subspace of the model is feasible. As an example of the application, the average neutron-proton interaction in even-even N ∼ Z nuclei that can be suitably described in the f5 pg9 shell is estimated in the present model, with a focus on the role of np-pairing correlations.

  15. Pair-Wise Trajectory Management-Oceanic (PTM-O) . [Concept of Operations—Version 3.9

    NASA Technical Reports Server (NTRS)

    Jones, Kenneth M.

    2014-01-01

    This document describes the Pair-wise Trajectory Management-Oceanic (PTM-O) Concept of Operations (ConOps). Pair-wise Trajectory Management (PTM) is a concept that includes airborne and ground-based capabilities designed to enable and to benefit from, airborne pair-wise distance-monitoring capability. PTM includes the capabilities needed for the controller to issue a PTM clearance that resolves a conflict for a specific pair of aircraft. PTM avionics include the capabilities needed for the flight crew to manage their trajectory relative to specific designated aircraft. Pair-wise Trajectory Management PTM-Oceanic (PTM-O) is a regional specific application of the PTM concept. PTM is sponsored by the National Aeronautics and Space Administration (NASA) Concept and Technology Development Project (part of NASA's Airspace Systems Program). The goal of PTM is to use enhanced and distributed communications and surveillance along with airborne tools to permit reduced separation standards for given aircraft pairs, thereby increasing the capacity and efficiency of aircraft operations at a given altitude or volume of airspace.

  16. Production of e+e- Pairs Accompanied by Nuclear Dissociation in Ultra-peripheral Heavy Ion Collisions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Adams, J.; Adler, C.; Aggarwal, M.M.

    2004-04-07

    We present the first data on e{sup +}e{sup -} pair production accompanied by nuclear breakup in ultra-peripheral gold-gold collisions at a center of mass energy of 200 GeV per nucleon pair. The nuclear breakup requirement selects events at small impact parameters, where higher-order corrections to the pair production cross section should be enhanced. We compare the pair kinematic distributions with two calculations: one based on the equivalent photon approximation, and the other using lowest-order quantum electrodynamics (QED); the latter includes the photon virtuality. The cross section, pair mass, rapidity and angular distributions are in good agreement with both calculations. Themore » pair transverse momentum, p{sub T}, spectrum agrees with the QED calculation, but not with the equivalent photon approach. We set limits on higher-order contributions to the cross section. The e{sup +} and e{sup -} p{sub T} spectra are similar, with no evidence for interference effects due to higher-order diagrams.« less

  17. Changing US Attributes After CS-US Pairings Changes CS-Attribute-Assessments: Evidence for CS-US Associations in Attribute Conditioning.

    PubMed

    Förderer, Sabine; Unkelbach, Christian

    2016-03-01

    Attribute Conditioning (AC) refers to people's changed assessments of stimuli's (CSs) attributes due to repeated pairing with stimuli (USs) possessing these attributes; for example, when an athletic person (US) is paired with a neutral person (CS), the neutral person is judged to be more athletic after the pairing. We hypothesize that this AC effect is due to CSs' associations with USs rather than direct associations with attributes. Three experiments test this hypothesis by changing US attributes after CS-US pairings. Experiments 1 and 2 conditioned athleticism by pairing neutral men (CSs) with athletic and non-athletic USs. Post-conditioning, USs' athleticism was reversed, which systematically influenced participants' assessment of CS athleticism. Experiment 3 conditioned athleticism and changed USs' musicality after CS-US pairings. This post-conditioning change affected musicality assessments of CSs but did not influence athleticism-assessments. The results indicate that AC effects are based on an associative CS-US-attribute structure. © 2016 by the Society for Personality and Social Psychology, Inc.

  18. Model for an RNA tertiary interaction from the structure of an intermolecular complex between a GAAA tetraloop and an RNA helix.

    PubMed

    Pley, H W; Flaherty, K M; McKay, D B

    1994-11-03

    In large structured RNAs, RNA hairpins in which the strands of the duplex stem are connected by a tetraloop of the consensus sequence 5'-GNRA (where N is any nucleotide, and R is either G or A) are unusually frequent. In group I introns there is a covariation in sequence between nucleotides in the third and fourth positions of the loop with specific distant base pairs in putative RNA duplex stems: GNAA loops correlate with successive 5'-C-C.G-C base pairs in stems, whereas GNGA loops correlate with 5'-C-U.G-A. This has led to the suggestion that GNRA tetraloops may be involved in specific long-range tertiary interactions, with each A in position 3 or 4 of the loop interacting with a C-G base pair in the duplex, and G in position 3 interacting with a U-A base pair. This idea is supported experimentally for the GAAA loop of the P5b extension of the group I intron of Tetrahymena thermophila and the L9 GUGA terminal loop of the td intron of bacteriophage T4 (ref. 4). NMR has revealed the overall structure of the tetraloop for 12-nucleotide hairpins with GCAA and GAAA loops and models have been proposed for the interaction of GNRA tetraloops with base pairs in the minor groove of A-form RNA. Here we describe the crystal structure of an intermolecular complex between a GAAA tetraloop and an RNA helix. The interactions we observe correlate with the specificity of GNRA tetraloops inferred from phylogenetic studies, suggesting that this complex is a legitimate model for intramolecular tertiary interactions mediated by GNRA tetraloops in large structured RNAs.

  19. Towards building a disease-phenotype knowledge base: extracting disease-manifestation relationship from literature

    PubMed Central

    Xu, Rong; Li, Li; Wang, QuanQiu

    2013-01-01

    Motivation: Systems approaches to studying phenotypic relationships among diseases are emerging as an active area of research for both novel disease gene discovery and drug repurposing. Currently, systematic study of disease phenotypic relationships on a phenome-wide scale is limited because large-scale machine-understandable disease–phenotype relationship knowledge bases are often unavailable. Here, we present an automatic approach to extract disease–manifestation (D-M) pairs (one specific type of disease–phenotype relationship) from the wide body of published biomedical literature. Data and Methods: Our method leverages external knowledge and limits the amount of human effort required. For the text corpus, we used 119 085 682 MEDLINE sentences (21 354 075 citations). First, we used D-M pairs from existing biomedical ontologies as prior knowledge to automatically discover D-M–specific syntactic patterns. We then extracted additional pairs from MEDLINE using the learned patterns. Finally, we analysed correlations between disease manifestations and disease-associated genes and drugs to demonstrate the potential of this newly created knowledge base in disease gene discovery and drug repurposing. Results: In total, we extracted 121 359 unique D-M pairs with a high precision of 0.924. Among the extracted pairs, 120 419 (99.2%) have not been captured in existing structured knowledge sources. We have shown that disease manifestations correlate positively with both disease-associated genes and drug treatments. Conclusions: The main contribution of our study is the creation of a large-scale and accurate D-M phenotype relationship knowledge base. This unique knowledge base, when combined with existing phenotypic, genetic and proteomic datasets, can have profound implications in our deeper understanding of disease etiology and in rapid drug repurposing. Availability: http://nlp.case.edu/public/data/DMPatternUMLS/ Contact: rxx@case.edu PMID:23828786

  20. Accelerating calculations of RNA secondary structure partition functions using GPUs

    PubMed Central

    2013-01-01

    Background RNA performs many diverse functions in the cell in addition to its role as a messenger of genetic information. These functions depend on its ability to fold to a unique three-dimensional structure determined by the sequence. The conformation of RNA is in part determined by its secondary structure, or the particular set of contacts between pairs of complementary bases. Prediction of the secondary structure of RNA from its sequence is therefore of great interest, but can be computationally expensive. In this work we accelerate computations of base-pair probababilities using parallel graphics processing units (GPUs). Results Calculation of the probabilities of base pairs in RNA secondary structures using nearest-neighbor standard free energy change parameters has been implemented using CUDA to run on hardware with multiprocessor GPUs. A modified set of recursions was introduced, which reduces memory usage by about 25%. GPUs are fastest in single precision, and for some hardware, restricted to single precision. This may introduce significant roundoff error. However, deviations in base-pair probabilities calculated using single precision were found to be negligible compared to those resulting from shifting the nearest-neighbor parameters by a random amount of magnitude similar to their experimental uncertainties. For large sequences running on our particular hardware, the GPU implementation reduces execution time by a factor of close to 60 compared with an optimized serial implementation, and by a factor of 116 compared with the original code. Conclusions Using GPUs can greatly accelerate computation of RNA secondary structure partition functions, allowing calculation of base-pair probabilities for large sequences in a reasonable amount of time, with a negligible compromise in accuracy due to working in single precision. The source code is integrated into the RNAstructure software package and available for download at http://rna.urmc.rochester.edu. PMID:24180434

  1. Development of a novel method to determine the concentration of heavy metal cations: application of the specific interaction between heavy metal cation and mismatch DNA base pair.

    PubMed

    Kozasa, Tetsuo; Miyakawa, Yukako; Fukushi, Miyako; Ono, Akira; Torigoe, Hidetaka

    2009-01-01

    We have already found that Hg(II) cation specifically binds to T:T mismatch base pair in heteroduplex DNA, which increases the melting temperature of heteroduplex DNA involving T:T mismatch base pair by about 4 degrees C. We have also found that Ag(I) cation specifically binds to C:C mismatch base pair in heteroduplex DNA, which increases the melting temperature of heteroduplex DNA involving C:C mismatch base pair by about 4 degrees C. Using the specific interaction, we developed a novel sensor to determine the concentration of each of Hg(II) and Ag(I) cation. The sensor is composed of a dye-labelled T-rich or C-rich DNA oligonucleotide, F2T6W2D: 5'-Fam-T(2)CT(2)CT(2)C(4)T(2)GT(2)GT(2)-Dabcyl-3' or F2C6W2D: 5'-Fam-C(2)TC(2)TC(2)T(4)C(2)AC(2)AC(2)-Dabcyl-3', where 6-carboxyfluorescein (Fam) is a fluorophore and Dabcyl is a quencher. The addition of Hg(II) cation decreased the intensity of Fam emission of F2T6W2D at 520 nm in a concentration-dependent manner. Also, the addition of Ag(I) cation decreased the intensity of Fam emission of F2C6W2D at 520 nm in a concentration-dependent manner. We conclude that, using the novel sensor developed in this study, the concentration of each of Hg(II) and Ag(I) cation can be determined from the intensity of Fam emission at 520 nm.

  2. Interaction of influenza virus polymerase with viral RNA in the 'corkscrew' conformation.

    PubMed

    Flick, R; Hobom, G

    1999-10-01

    The influenza virus RNA (vRNA) promoter structure is known to consist of the 5'- and 3'-terminal sequences of the RNA, within very narrow boundaries of 16 and 15 nucleotides, respectively. A complete set of single nucleotide substitutions led to the previously proposed model of a binary hooked or 'corkscrew' conformation for the vRNA promoter when it interacts with the viral polymerase. This functional structure is confirmed here with a complete set of complementary double substitutions, of both the regular A:U and G:C type and also the G:U type of base-pair exchanges. The proposed structure consists of a six base-pair RNA rod in the distal element in conjunction with two stem-loop structures of two short-range base-pairs (positions 2-9; 3-8). These support an exposed tetranucleotide loop within each branch of the proximal element, in an overall oblique organization due to a central unpaired A residue at position 10 in the 5' sequence. Long-range base-pairing between the entire 5' and 3' branches, as required for an unmodified 'panhandle' model, has been excluded for the proximal element, while it is known to represent the mode of interaction within the distal element. A large number of short-range base-pair exchanges in the proximal element constitute promoter-up mutations, which show activities several times above that of the wild-type in reporter gene assays. The unique overall conformation and rather few invariant nucleotides appear to be the core elements in vRNA recognition by polymerase and also in viral ribonucleoprotein packaging, to allow discrimination against the background of other RNA molecules in the cell.

  3. 4D Flexible Atom-Pairs: An efficient probabilistic conformational space comparison for ligand-based virtual screening

    PubMed Central

    2011-01-01

    Background The performance of 3D-based virtual screening similarity functions is affected by the applied conformations of compounds. Therefore, the results of 3D approaches are often less robust than 2D approaches. The application of 3D methods on multiple conformer data sets normally reduces this weakness, but entails a significant computational overhead. Therefore, we developed a special conformational space encoding by means of Gaussian mixture models and a similarity function that operates on these models. The application of a model-based encoding allows an efficient comparison of the conformational space of compounds. Results Comparisons of our 4D flexible atom-pair approach with over 15 state-of-the-art 2D- and 3D-based virtual screening similarity functions on the 40 data sets of the Directory of Useful Decoys show a robust performance of our approach. Even 3D-based approaches that operate on multiple conformers yield inferior results. The 4D flexible atom-pair method achieves an averaged AUC value of 0.78 on the filtered Directory of Useful Decoys data sets. The best 2D- and 3D-based approaches of this study yield an AUC value of 0.74 and 0.72, respectively. As a result, the 4D flexible atom-pair approach achieves an average rank of 1.25 with respect to 15 other state-of-the-art similarity functions and four different evaluation metrics. Conclusions Our 4D method yields a robust performance on 40 pharmaceutically relevant targets. The conformational space encoding enables an efficient comparison of the conformational space. Therefore, the weakness of the 3D-based approaches on single conformations is circumvented. With over 100,000 similarity calculations on a single desktop CPU, the utilization of the 4D flexible atom-pair in real-world applications is feasible. PMID:21733172

  4. Determination of the pairing-strength constants in the isovector plus isoscalar pairing case

    NASA Astrophysics Data System (ADS)

    Mokhtari, D.; Fellah, M.; Allal, N. H.

    2016-05-01

    A method for the determination of the pairing-strength constants, in the neutron-proton (n-p) isovector plus isoscalar pairing case, is proposed in the framework of the BCS theory. It is based on the fitting of these constants to reproduce the experimentally known pairing gap parameters as well as the root-mean-squared (r.m.s) charge radii values. The method is applied to some proton-rich even-even nuclei. The single-particle energies used are those of a deformed Woods-Saxon mean field. It is shown that the obtained value of the ratio GnpT=0/G npT=1 is of the same order as the ones, arbitrary chosen, of some previous works. The effect of the inclusion of the isoscalar n-p pairing in the r.m.s matter radii is then numerically studied for the same nuclei.

  5. Universal spectral signatures in pnictides and cuprates: the role of quasiparticle-pair coupling.

    PubMed

    Sacks, William; Mauger, Alain; Noat, Yves

    2017-11-08

    Understanding the physical properties of a large variety of high-T c superconductors (SC), the cuprate family as well as the more recent iron-based superconductors, is still a major challenge. In particular, these materials exhibit the 'peak-dip-hump' structure in the quasiparticle density of states (DOS). The origin of this structure is explained within our pair-pair interaction (PPI) model: The non-superconducting state consists of incoherent pairs, a 'Cooper-pair glass' which, due to the PPI, undergoes a Bose-like condensation below T c to the coherent SC state. We derive the equations of motion for the quasiparticle operators showing that the DOS 'peak-dip-hump' is caused by the coupling between quasiparticles and excited pair states, or 'super-quasiparticles'. The renormalized SC gap function becomes energy-dependent and non retarded, reproducing accurately the experimental spectra of both pnictides and cuprates, despite the large difference in gap value.

  6. Self-replication of chemical systems based on recognition within a double or a triple helix - A realistic hypothesis

    NASA Technical Reports Server (NTRS)

    Kanavarioti, Anastassia

    1992-01-01

    A scenario is proposed for the non-enzymatic self-replication of short RNA molecules. The self-replication of an oligopyrimidine strand is considered and the process of template-directed synthesis based on recognition within a double helix is discussed. Replication mechanisms are suggested for selected oligonucleotides. The mechanisms are based on Watson-Crick base pairing between complementary nucleotides as well as Hoogsteen base pairing between a duplex and the complementary third strand. It is suggested that self-replication based on these mechanisms may be accomplished but may result in a substantial amount of misinformation transfer when mixed oligonucleotides are used.

  7. Understanding child-based effects on parenting: temperament as a moderator of genetic and environmental contributions to parenting.

    PubMed

    Ganiban, Jody M; Ulbricht, Jennifer; Saudino, Kimberly J; Reiss, David; Neiderhiser, Jenae M

    2011-05-01

    The degree to which child temperament moderates genetic and environmental contributions to parenting was examined. Participants were drawn from the Nonshared Environment and Adolescent Development project and included 720 sibling pairs, ages 13.5 + 2.0 years (Sibling 1) to 12.1 + 1.3 years (Sibling 2). The sample consisted of 6 sibling types: 93 monozygotic twin pairs, 99 dizygotic twin pairs, and 95 full sibling pairs from never-divorced families and 182 full-sibling, 109 half-sibling, and 130 unrelated-sibling pairs residing in stepfamilies. Composite child temperament ratings (negative emotionality, activity, shyness, and sociability) were derived from mothers' and fathers' reports. Composite parenting ratings (negativity, warmth) for mothers and fathers were generated from children's and parents' reports. Analyses indicated that at higher levels of negative emotionality and sociability, child-based genetic contributions to mothers' and fathers' negativity increased, whereas the contributions of environmental factors declined. The opposite pattern was observed for child shyness. These same characteristics had less impact on parental warmth. For fathers only, nonshared environmental contributions to fathers' warmth increased in the presence of high child activity and sociability but declined when children were very shy. Overall these findings indicate that child-based effects on negative parenting are enhanced when children demonstrate potentially challenging characteristics but are weaker in the absence of such characteristics. (c) 2011 APA, all rights reserved.

  8. 3D-Subspace-Based Auto-Paired Azimuth Angle, Elevation Angle, and Range Estimation for 24G FMCW Radar with an L-Shaped Array

    PubMed Central

    Nam, HyungSoo; Choi, ByungGil; Oh, Daegun

    2018-01-01

    In this paper, a three-dimensional (3D)-subspace-based azimuth angle, elevation angle, and range estimation method with auto-pairing is proposed for frequency-modulated continuous waveform (FMCW) radar with an L-shaped array. The proposed method is designed to exploit the 3D shift-invariant structure of the stacked Hankel snapshot matrix for auto-paired azimuth angle, elevation angle, and range estimation. The effectiveness of the proposed method is verified through a variety of experiments conducted in a chamber. For the realization of the proposed method, K-band FMCW radar is implemented with an L-shaped antenna. PMID:29621193

  9. Effect of Destined High-Pressure Torsion on the Structure and Mechanical Properties of Rare Earth-Based Metallic Glasses

    NASA Astrophysics Data System (ADS)

    Zhao, W.; Cheng, H.; Jiang, X.; Wu, M. L.; Li, G.

    2018-03-01

    Changes in the atomic structure and mechanical properties of rare earth-based metallic glasses caused by destined high-pressure torsion (HPT) were studied by X-ray diffraction synchrotron radiation and nanoindentation. Results showed that destined HPT improved nanohardness and wear resistance, which indicated the significant contributions of this technique. The diffraction patterns showed that the contents of pairs between solvent and solute atoms with a large negative mixing enthalpy increased, whereas those of pairs between solvent atoms and between solute atoms decreased after destined HPT. Thus, the process was improved by increasing the proportion of high-intensity pairs between solvent and solute atoms.

  10. Sensitivity of gap symmetry to an incipient band: Application to iron based superconductors

    NASA Astrophysics Data System (ADS)

    Mishra, Vivek; Scalapino, Douglas; Maier, Thomas

    Observation of high temperature superconductivity in iron-based superconductors with a submerged hole band has attracted wide interest. A spin fluctuation mediated pairing mechanism has been proposed as a possible explanation for the high transition temperatures observed in these systems. Here we discuss the importance of the submerged band in the context of the gap symmetry. We show that the incipient band can lead to an attractive pairing interaction and thus have significant effects on the pairing symmetry. We propose a framework to include the effect of the incipient band in the standard multi-orbital spin-fluctuation theories which are widely used for studying various iron-based superconductors. Research sponsored by the Laboratory Directed Research and Development Program of Oak Ridge National Laboratory, managed by UT-Battelle, LLC, for the U. S. Department of Energy.

  11. High-Fidelity Down-Conversion Source for Secure Communications Using On-Demand Single Photons

    NASA Technical Reports Server (NTRS)

    Roberts, Tony

    2015-01-01

    AdvR, Inc., has built an efficient, fully integrated, waveguide-based source of spectrally uncorrelated photon pairs that will accelerate research and development (R&D) in the emerging field of quantum information science. Key to the innovation is the use of submicron periodically poled waveguides to produce counter propagating photon pairs, which is enabled by AdvR's patented segmented microelectrode poling technique. This novel device will provide a high brightness source of down-conversion pairs with enhanced spectral properties and low attenuation, and it will operate in the visible to the mid-infrared spectral region. A waveguide-based source of spectrally and spatially pure heralded photons will contribute to a wide range of NASA's advanced technology development efforts, including on-demand single photon sources for high-rate spaced-based secure communications.

  12. Communication: Exact analytical derivatives for the domain-based local pair natural orbital MP2 method (DLPNO-MP2)

    NASA Astrophysics Data System (ADS)

    Pinski, Peter; Neese, Frank

    2018-01-01

    Electron correlation methods based on pair natural orbitals (PNOs) have gained an increasing degree of interest in recent years, as they permit energy calculations to be performed on systems containing up to many hundred atoms, while maintaining chemical accuracy for reaction energies. We present an approach for taking exact analytical first derivatives of the energy contributions in the simplest method of the family of Domain-based Local Pair Natural Orbital (DLPNO) methods, closed-shell DLPNO-MP2. The Lagrangian function contains constraints to account for the relaxation of PNOs. RI-MP2 reference geometries are reproduced accurately, as exemplified for four systems with a substantial degree of nonbonding interactions. By the example of electric field gradients, we demonstrate that omitting PNO-specific constraints can lead to dramatic errors for orbital-relaxed properties.

  13. Inherited Creutzfeldt-Jakob disease in a British family associated with a novel 144 base pair insertion of the prion protein gene.

    PubMed Central

    Nicholl, D; Windl, O; de Silva, R; Sawcer, S; Dempster, M; Ironside, J W; Estibeiro, J P; Yuill, G M; Lathe, R; Will, R G

    1995-01-01

    A case of familial Creutzfeldt-Jakob disease associated with a 144 base pair insertion in the open reading frame of the prion protein gene is described. Sequencing of the mutated allele showed an arrangement of six octapeptide repeats, distinct from that of a recently described British family with an insertion of similar size. Thirteen years previously the brother of the proband had died from "Huntington's disease", but re-examination of his neuropathology revealed spongiform encephalopathy and anti-prion protein immunocytochemistry gave a positive result. The independent evolution of at least two distinct pathological 144 base pair insertions in Britain is proposed. The importance of maintaining a high index of suspicion of inherited Creutzfeldt-Jakob disease in cases of familial neurodegenerative disease is stressed. Images PMID:7823070

  14. Intervening sequences in a plant gene-comparison of the partial sequence of cDNA and genomic DNA of French bean phaseolin

    NASA Astrophysics Data System (ADS)

    Sun, S. M.; Slightom, J. L.; Hall, T. C.

    1981-01-01

    A plant gene coding for the major storage protein (phaseolin, G1-globulin) of the French bean was isolated from a genomic library constructed in the phage vector Charon 24A. Comparison of the nucleotide sequence of part of the gene with that of the cloned messenger RNA (cDNA) revealed the presence of three intervening sequences, all beginning with GTand ending with AG. The 5' and 3' boundaries of intervening sequences TVS-A (88 base pairs) and IVS-B (124 base pairs) are similar to those described for animal and viral genes, but the 3' boundary of IVS-C (129 base pairs) shows some differences. A sequence of 185 amino acids deduced from the cloned DMAs represents about 40% of a phaseolin polypeptide.

  15. Associations between birth size and later height from infancy through adulthood: An individual based pooled analysis of 28 twin cohorts participating in the CODATwins project.

    PubMed

    Jelenkovic, Aline; Yokoyama, Yoshie; Sund, Reijo; Hur, Yoon-Mi; Harris, Jennifer R; Brandt, Ingunn; Nilsen, Thomas Sevenius; Ooki, Syuichi; Ullemar, Vilhelmina; Almqvist, Catarina; Magnusson, Patrik K E; Saudino, Kimberly J; Stazi, Maria A; Fagnani, Corrado; Brescianini, Sonia; Nelson, Tracy L; Whitfield, Keith E; Knafo-Noam, Ariel; Mankuta, David; Abramson, Lior; Cutler, Tessa L; Hopper, John L; Llewellyn, Clare H; Fisher, Abigail; Corley, Robin P; Huibregtse, Brooke M; Derom, Catherine A; Vlietinck, Robert F; Bjerregaard-Andersen, Morten; Beck-Nielsen, Henning; Sodemann, Morten; Krueger, Robert F; McGue, Matt; Pahlen, Shandell; Alexandra Burt, S; Klump, Kelly L; Dubois, Lise; Boivin, Michel; Brendgen, Mara; Dionne, Ginette; Vitaro, Frank; Willemsen, Gonneke; Bartels, Meike; van Beijsterveld, Catharina E M; Craig, Jeffrey M; Saffery, Richard; Rasmussen, Finn; Tynelius, Per; Heikkilä, Kauko; Pietiläinen, Kirsi H; Bayasgalan, Gombojav; Narandalai, Danshiitsoodol; Haworth, Claire M A; Plomin, Robert; Ji, Fuling; Ning, Feng; Pang, Zengchang; Rebato, Esther; Tarnoki, Adam D; Tarnoki, David L; Kim, Jina; Lee, Jooyeon; Lee, Sooji; Sung, Joohon; Loos, Ruth J F; Boomsma, Dorret I; Sørensen, Thorkild I A; Kaprio, Jaakko; Silventoinen, Karri

    2018-05-01

    There is evidence that birth size is positively associated with height in later life, but it remains unclear whether this is explained by genetic factors or the intrauterine environment. To analyze the associations of birth weight, length and ponderal index with height from infancy through adulthood within mono- and dizygotic twin pairs, which provides insights into the role of genetic and environmental individual-specific factors. This study is based on the data from 28 twin cohorts in 17 countries. The pooled data included 41,852 complete twin pairs (55% monozygotic and 45% same-sex dizygotic) with information on birth weight and a total of 112,409 paired height measurements at ages ranging from 1 to 69 years. Birth length was available for 19,881 complete twin pairs, with a total of 72,692 paired height measurements. The association between birth size and later height was analyzed at both the individual and within-pair level by linear regression analyses. Within twin pairs, regression coefficients showed that a 1-kg increase in birth weight and a 1-cm increase in birth length were associated with 1.14-4.25 cm and 0.18-0.90 cm taller height, respectively. The magnitude of the associations was generally greater within dizygotic than within monozygotic twin pairs, and this difference between zygosities was more pronounced for birth length. Both genetic and individual-specific environmental factors play a role in the association between birth size and later height from infancy to adulthood, with a larger role for genetics in the association with birth length than with birth weight. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

  16. Universal quantum gates for Single Cooper Pair Box based quantum computing

    NASA Technical Reports Server (NTRS)

    Echternach, P.; Williams, C. P.; Dultz, S. C.; Braunstein, S.; Dowling, J. P.

    2000-01-01

    We describe a method for achieving arbitrary 1-qubit gates and controlled-NOT gates within the context of the Single Cooper Pair Box (SCB) approach to quantum computing. Such gates are sufficient to support universal quantum computation.

  17. Past, present and future of kidney paired donation transplantation in India

    PubMed Central

    Kute, Vivek B; Patel, Himanshu V; Shah, Pankaj R; Modi, Pranjal R; Shah, Veena R; Rizvi, Sayyed J; Pal, Bipin C; Modi, Manisha P; Shah, Priya S; Varyani, Umesh T; Wakhare, Pavan S; Shinde, Saiprasad G; Ghodela, Vijay A; Patel, Minaxi H; Trivedi, Varsha B; Trivedi, Hargovind L

    2017-01-01

    One third of healthy willing living kidney donors are rejected due to ABO blood group incompatibility and donor specific antibody. This increases pre-transplant dialysis duration leading to increased morbidity and mortality on the kidney transplantation waiting list. Over the last decade kidney paired donation is most rapidly increased source of living kidney donors. In a kidney transplantation program dominated by living donor kidney transplantation, kidney paired donation is a legal and valid alternative strategy to increase living donor kidney transplantation. This is more useful in countries with limited resources where ABO incompatible kidney transplantation or desensitization protocol is not feasible because of costs/infectious complications and deceased donor kidney transplantation is in initial stages. The matching allocation, ABO blood type imbalance, reciprocity, simultaneity, geography were the limitation for the expansion of kidney paired donation. Here we describe different successful ways to increase living donor kidney transplantation through kidney paired donation. Compatible pairs, domino chain, combination of kidney paired donation with desensitization or ABO incompatible transplantation, international kidney paired donation, non-simultaneous, extended, altruistic donor chain and list exchange are different ways to expand the donor pool. In absence of national kidney paired donation program, a dedicated kidney paired donation team will increase access to living donor kidney transplantation in individual centres with team work. Use of social networking sites to expand donor pool, HLA based national kidney paired donation program will increase quality and quantity of kidney paired donation transplantation. Transplant centres should remove the barriers to a broader implementation of multicentre, national kidney paired donation program to further optimize potential of kidney paired donation to increase transplantation of O group and sensitized patients. This review assists in the development of similar programs in other developing countries. PMID:28507916

  18. Past, present and future of kidney paired donation transplantation in India.

    PubMed

    Kute, Vivek B; Patel, Himanshu V; Shah, Pankaj R; Modi, Pranjal R; Shah, Veena R; Rizvi, Sayyed J; Pal, Bipin C; Modi, Manisha P; Shah, Priya S; Varyani, Umesh T; Wakhare, Pavan S; Shinde, Saiprasad G; Ghodela, Vijay A; Patel, Minaxi H; Trivedi, Varsha B; Trivedi, Hargovind L

    2017-04-24

    One third of healthy willing living kidney donors are rejected due to ABO blood group incompatibility and donor specific antibody. This increases pre-transplant dialysis duration leading to increased morbidity and mortality on the kidney transplantation waiting list. Over the last decade kidney paired donation is most rapidly increased source of living kidney donors. In a kidney transplantation program dominated by living donor kidney transplantation, kidney paired donation is a legal and valid alternative strategy to increase living donor kidney transplantation. This is more useful in countries with limited resources where ABO incompatible kidney transplantation or desensitization protocol is not feasible because of costs/infectious complications and deceased donor kidney transplantation is in initial stages. The matching allocation, ABO blood type imbalance, reciprocity, simultaneity, geography were the limitation for the expansion of kidney paired donation. Here we describe different successful ways to increase living donor kidney transplantation through kidney paired donation. Compatible pairs, domino chain, combination of kidney paired donation with desensitization or ABO incompatible transplantation, international kidney paired donation, non-simultaneous, extended, altruistic donor chain and list exchange are different ways to expand the donor pool. In absence of national kidney paired donation program, a dedicated kidney paired donation team will increase access to living donor kidney transplantation in individual centres with team work. Use of social networking sites to expand donor pool, HLA based national kidney paired donation program will increase quality and quantity of kidney paired donation transplantation. Transplant centres should remove the barriers to a broader implementation of multicentre, national kidney paired donation program to further optimize potential of kidney paired donation to increase transplantation of O group and sensitized patients. This review assists in the development of similar programs in other developing countries.

  19. NDI and DAN DNA: nucleic acid-directed assembly of NDI and DAN.

    PubMed

    Ikkanda, Brian A; Samuel, Stevan A; Iverson, Brent L

    2014-03-07

    Two novel DNA base surrogate phosphoramidites 1 and 2, based upon relatively electron-rich 1,5-dialkoxynaphthalene (DAN) and relatively electron-deficient 1,4,5,8-naphthalenetetracarboxylic diimide (NDI), respectively, were designed, synthesized, and incorporated into DNA oligonucleotide strands. The DAN and NDI artificial DNA bases were inserted within a three-base-pair region within the interior of a 12-mer oligonucleotide duplex in various sequential arrangements and investigated with CD spectroscopy and UV melting curve analysis. The CD spectra of the modified duplexes indicated B-form DNA topology. Melting curve analyses revealed trends in DNA duplex stability that correlate with the known association of DAN and NDI moieties in aqueous solution as well as the known favorable interactions between NDI and natural DNA base pairs. This demonstrates that DNA duplex stability and specificity can be driven by the electrostatic complementarity between DAN and NDI. In the most favorable case, an NDI-DAN-NDI arrangement in the middle of the DNA duplex was found to be approximately as stabilizing as three A-T base pairs.

  20. An indole-linked C8-deoxyguanosine nucleoside acts as a fluorescent reporter of Watson-Crick versus Hoogsteen base pairing.

    PubMed

    Schlitt, Katherine M; Millen, Andrea L; Wetmore, Stacey D; Manderville, Richard A

    2011-03-07

    Pyrrole- and indole-linked C(8)-deoxyguanosine nucleosides act as fluorescent reporters of H-bonding specificity. Their fluorescence is quenched upon Watson-Crick H-bonding to dC, while Hoogsteen H-bonding to G enhances emission intensity. The indole-linked probe is ∼ 10-fold brighter and shows promise as a fluorescent reporter of Hoogsteen base pairing.

  1. Multi-Particle Interferometry Based on Double Entangled States

    NASA Technical Reports Server (NTRS)

    Pittman, Todd B.; Shih, Y. H.; Strekalov, D. V.; Sergienko, A. V.; Rubin, M. H.

    1996-01-01

    A method for producing a 4-photon entangled state based on the use of two independent pair sources is discussed. Of particular interest is that each of the pair sources produces a two-photon state which is simultaneously entangled in both polarization and space-time variables. Performing certain measurements which exploit this double entanglement provides an opportunity for verifying the recent demonstration of nonlocality by Greenberger, Horne, and Zeilinger.

  2. A Comparison of the Results of Many-Facet Rasch Analyses Based on Crossed and Judge Pair Designs

    ERIC Educational Resources Information Center

    Ilhan, Mustafa

    2016-01-01

    The aim of this study was to compare the results of many-facet Rasch analyses based on crossed and judge pair designs. The study was conducted with 168 eighth grade students and five judges. The study data were collected using an achievement test with open-ended questions and a holistic rubric that was used to rate the responses. In the data…

  3. Polymerase recognition of 2-thio-iso-guanine·5-methyl-4-pyrimidinone (iGs·P)--A new DD/AA base pair.

    PubMed

    Lee, Dong-Kye; Switzer, Christopher

    2016-02-15

    Polymerase specificity is reported for a previously unknown base pair with a non-standard DD/AA hydrogen bonding pattern: 2-thio-iso-guanine·5-methyl-4-pyrimidinone. Our findings suggest that atomic substitution may provide a solution for low fidelity previously associated with enzymatic copying of iso-guanine. Copyright © 2016 Elsevier Ltd. All rights reserved.

  4. A terrain-based paired-site sampling design to assess biodiversity losses from eastern hemlock decline

    USGS Publications Warehouse

    Young, J.A.; Smith, D.R.; Snyder, C.D.; Lemarie, D.P.

    2002-01-01

    Biodiversity surveys are often hampered by the inability to control extraneous sources of variability introduced into comparisons of populations across a heterogenous landscape. If not specifically accounted for a priori, this noise can weaken comparisons between sites, and can make it difficult to draw inferences about specific ecological processes. We developed a terrain-based, paired-site sampling design to analyze differences in aquatic biodiversity between streams draining eastern hemlock (Tsuga canadensis) forests, and those draining mixed hardwood forests in Delaware Water Gap National Recreation Area (USA). The goal of this design was to minimize variance due to terrain influences on stream communities, while representing the range of hemlock dominated stream environments present in the park. We used geographic information systems (GIS) and cluster analysis to define and partition hemlock dominated streams into terrain types based on topographic variables and stream order. We computed similarity of forest stands within terrain types and used this information to pair hemlock-dominated streams with hardwood counterparts prior to sampling. We evaluated the effectiveness of the design through power analysis and found that power to detect differences in aquatic invertebrate taxa richness was highest when sites were paired and terrain type was included as a factor in the analysis. Precision of the estimated difference in mean richness was nearly doubled using the terrain-based, paired site design in comparison to other evaluated designs. Use of this method allowed us to sample stream communities representative of park-wide forest conditions while effectively controlling for landscape variability.

  5. Viewing Human DNA Polymerase β Faithfully and Unfaithfully Bypass an Oxidative Lesion by Time-Dependent Crystallography

    DOE PAGES

    Vyas, Rajan; Reed, Andrew J.; Tokarsky, E. John; ...

    2015-03-31

    One common oxidative DNA lesion, 8-oxo-7,8-dihydro-2'-deoxyguanine (8-oxoG), is highly mutagenic in vivo due to its anti-conformation forming a Watson–Crick base pair with correct deoxycytidine 5'-triphosphate (dCTP) and its syn-conformation forming a Hoogsteen base pair with incorrect deoxyadenosine 5'-triphosphate (dATP). Here in this article, we utilized time-resolved X-ray crystallography to follow 8-oxoG bypass by human DNA polymerase β (hPolβ). In the 12 solved structures, both Watson–Crick (anti-8-oxoG:anti-dCTP) and Hoogsteen (syn-8-oxoG:anti-dATP) base pairing were clearly visible and were maintained throughout the chemical reaction. Additionally, a third Mg 2+ appeared during the process of phosphodiester bond formation and was located between the reactingmore » α- and β-phosphates of the dNTP, suggesting its role in stabilizing reaction intermediates. After phosphodiester bond formation, hPolβ reopened its conformation, pyrophosphate was released, and the newly incorporated primer 3'-terminal nucleotide stacked, rather than base paired, with 8-oxoG. These structures provide the first real-time pictures, to our knowledge, of how a polymerase correctly and incorrectly bypasses a DNA lesion.« less

  6. Viewing Human DNA Polymerase β Faithfully and Unfaithfully Bypass an Oxidative Lesion by Time-Dependent Crystallography

    PubMed Central

    Vyas, Rajan; Reed, Andrew J.; Tokarsky, E. John; Suo, Zucai

    2015-01-01

    One common oxidative DNA lesion, 8-oxo-7,8-dihydro-2′-deoxyguanine (8-oxoG), is highly mutagenic in vivo due to its anti-conformation forming a Watson–Crick base pair with correct deoxycytidine 5′-triphosphate (dCTP) and its syn-conformation forming a Hoogsteen base pair with incorrect deoxyadenosine 5′-triphosphate (dATP). Here, we utilized time-resolved X-ray crystallography to follow 8-oxoG bypass by human DNA polymerase β (hPolβ). In the 12 solved structures, both Watson–Crick (anti-8-oxoG:anti-dCTP) and Hoogsteen (syn-8-oxoG:anti-dATP) base pairing were clearly visible and were maintained throughout the chemical reaction. Additionally, a third Mg2+ appeared during the process of phosphodiester bond formation and was located between the reacting α- and β-phosphates of the dNTP, suggesting its role in stabilizing reaction intermediates. After phosphodiester bond formation, hPolβ reopened its conformation, pyrophosphate was released, and the newly incorporated primer 3′-terminal nucleotide stacked, rather than base paired, with 8-oxoG. These structures provide the first real-time pictures, to our knowledge, of how a polymerase correctly and incorrectly bypasses a DNA lesion. PMID:25825995

  7. Structure, stability and behaviour of nucleic acids in ionic liquids

    PubMed Central

    Tateishi-Karimata, Hisae; Sugimoto, Naoki

    2014-01-01

    Nucleic acids have become a powerful tool in nanotechnology because of their conformational polymorphism. However, lack of a medium in which nucleic acid structures exhibit long-term stability has been a bottleneck. Ionic liquids (ILs) are potential solvents in the nanotechnology field. Hydrated ILs, such as choline dihydrogen phosphate (choline dhp) and deep eutectic solvent (DES) prepared from choline chloride and urea, are ‘green’ solvents that ensure long-term stability of biomolecules. An understanding of the behaviour of nucleic acids in hydrated ILs is necessary for developing DNA materials. We here review current knowledge about the structures and stabilities of nucleic acids in choline dhp and DES. Interestingly, in choline dhp, A–T base pairs are more stable than G–C base pairs, the reverse of the situation in buffered NaCl solution. Moreover, DNA triplex formation is markedly stabilized in hydrated ILs compared with aqueous solution. In choline dhp, the stability of Hoogsteen base pairs is comparable to that of Watson–Crick base pairs. Moreover, the parallel form of the G-quadruplex is stabilized in DES compared with aqueous solution. The behaviours of various DNA molecules in ILs detailed here should be useful for designing oligonucleotides for the development of nanomaterials and nanodevices. PMID:25013178

  8. Stereoselective virtual screening of the ZINC database using atom pair 3D-fingerprints.

    PubMed

    Awale, Mahendra; Jin, Xian; Reymond, Jean-Louis

    2015-01-01

    Tools to explore large compound databases in search for analogs of query molecules provide a strategically important support in drug discovery to help identify available analogs of any given reference or hit compound by ligand based virtual screening (LBVS). We recently showed that large databases can be formatted for very fast searching with various 2D-fingerprints using the city-block distance as similarity measure, in particular a 2D-atom pair fingerprint (APfp) and the related category extended atom pair fingerprint (Xfp) which efficiently encode molecular shape and pharmacophores, but do not perceive stereochemistry. Here we investigated related 3D-atom pair fingerprints to enable rapid stereoselective searches in the ZINC database (23.2 million 3D structures). Molecular fingerprints counting atom pairs at increasing through-space distance intervals were designed using either all atoms (16-bit 3DAPfp) or different atom categories (80-bit 3DXfp). These 3D-fingerprints retrieved molecular shape and pharmacophore analogs (defined by OpenEye ROCS scoring functions) of 110,000 compounds from the Cambridge Structural Database with equal or better accuracy than the 2D-fingerprints APfp and Xfp, and showed comparable performance in recovering actives from decoys in the DUD database. LBVS by 3DXfp or 3DAPfp similarity was stereoselective and gave very different analogs when starting from different diastereomers of the same chiral drug. Results were also different from LBVS with the parent 2D-fingerprints Xfp or APfp. 3D- and 2D-fingerprints also gave very different results in LBVS of folded molecules where through-space distances between atom pairs are much shorter than topological distances. 3DAPfp and 3DXfp are suitable for stereoselective searches for shape and pharmacophore analogs of query molecules in large databases. Web-browsers for searching ZINC by 3DAPfp and 3DXfp similarity are accessible at www.gdb.unibe.ch and should provide useful assistance to drug discovery projects. Graphical abstractAtom pair fingerprints based on through-space distances (3DAPfp) provide better shape encoding than atom pair fingerprints based on topological distances (APfp) as measured by the recovery of ROCS shape analogs by fp similarity.

  9. [Comparative study on promoting blood effects of Danshen-Honghua herb pair with different preparations based on chemometrics and multi-attribute comprehensive index methods].

    PubMed

    Qu, Cheng; Tang, Yu-Ping; Shi, Xu-Qin; Zhou, Gui-Sheng; Shang, Er-Xin; Shang, Li-Li; Guo, Jian-Ming; Liu, Pei; Zhao, Jing; Zhao, Bu-Chang; Duan, Jin-Ao

    2017-08-01

    To evaluate the promoting blood circulation and removing blood stasis effects of Danshen-Honghua(DH) herb pair with different preparations (alcohol, 50% alcohol and water) on blood rheology and coagulation functions in acute blood stasis rats, and optimize the best preparation method of DH based on principal component analysis(PCA), hierarchical cluster heatmap analysis and multi-attribute comprehensive index methods. Ice water bath and subcutaneous injection of adrenaline were both used to establish the acute blood stasis rat model. Then the blood stasis rats were administrated intragastrically with DH (alcohol, 50% alcohol and water) extracts. The whole blood viscosity(WBV), plasma viscosity(PV), erythrocyte sedimentation rate(ESR) and haematocrit(HCT) were tested to observe the effects of DH herb pair with different preparations and doses on hemorheology of blood stasis rats; the activated partial thromboplastin time(APTT), thrombin time(TT), prothrombin time(PT), and plasma fibrinogen(FIB) were tested to observe the effects of DH herb pair with different preparations on blood coagulation function and platelet aggregation of blood stasis rats. Then PCA, hierarchical cluster heatmap analysis and multi-attribute comprehensive index methods were all used to comprehensively evaluate the total promoting blood circulation and removing blood stasis effects of DH herb pair with different preparations. The hemorheological indexes and coagulation parameters of model group had significant differences with normal blank group. As compared with the model group, the DH herb pair with different preparations at low, middle and high doses could improve the blood hemorheology indexes and coagulation parameters in acute blood stasis rats with dose-effect relation. Based on the PCA, hierarchical cluster heatmap analysis and multi-attribute comprehensive index methods, the high dose group of 50% alcohol extract had the best effect of promoting blood circulation and removing blood stasis. Under the same dose but different preparations, 50% alcohol DH could obviously improve the hemorheology and blood coagulation function in acute blood stasis rats. These results suggested that DH herb pair with different preparations could obviously ameliorate the abnormality of hemorheology and blood coagulation function in acute blood stasis rats, and the optimized preparation of DH herb pair on promoting blood effects was 50% alcohol extract, providing scientific basis for more effective application of the DH herb pair in modern clinic medicine. Copyright© by the Chinese Pharmaceutical Association.

  10. AfterQC: automatic filtering, trimming, error removing and quality control for fastq data.

    PubMed

    Chen, Shifu; Huang, Tanxiao; Zhou, Yanqing; Han, Yue; Xu, Mingyan; Gu, Jia

    2017-03-14

    Some applications, especially those clinical applications requiring high accuracy of sequencing data, usually have to face the troubles caused by unavoidable sequencing errors. Several tools have been proposed to profile the sequencing quality, but few of them can quantify or correct the sequencing errors. This unmet requirement motivated us to develop AfterQC, a tool with functions to profile sequencing errors and correct most of them, plus highly automated quality control and data filtering features. Different from most tools, AfterQC analyses the overlapping of paired sequences for pair-end sequencing data. Based on overlapping analysis, AfterQC can detect and cut adapters, and furthermore it gives a novel function to correct wrong bases in the overlapping regions. Another new feature is to detect and visualise sequencing bubbles, which can be commonly found on the flowcell lanes and may raise sequencing errors. Besides normal per cycle quality and base content plotting, AfterQC also provides features like polyX (a long sub-sequence of a same base X) filtering, automatic trimming and K-MER based strand bias profiling. For each single or pair of FastQ files, AfterQC filters out bad reads, detects and eliminates sequencer's bubble effects, trims reads at front and tail, detects the sequencing errors and corrects part of them, and finally outputs clean data and generates HTML reports with interactive figures. AfterQC can run in batch mode with multiprocess support, it can run with a single FastQ file, a single pair of FastQ files (for pair-end sequencing), or a folder for all included FastQ files to be processed automatically. Based on overlapping analysis, AfterQC can estimate the sequencing error rate and profile the error transform distribution. The results of our error profiling tests show that the error distribution is highly platform dependent. Much more than just another new quality control (QC) tool, AfterQC is able to perform quality control, data filtering, error profiling and base correction automatically. Experimental results show that AfterQC can help to eliminate the sequencing errors for pair-end sequencing data to provide much cleaner outputs, and consequently help to reduce the false-positive variants, especially for the low-frequency somatic mutations. While providing rich configurable options, AfterQC can detect and set all the options automatically and require no argument in most cases.

  11. Fluorescence Excitation Spectroscopy for Phytoplankton Species Classification Using an All-Pairs Method: Characterization of a System with Unexpectedly Low Rank.

    PubMed

    Rekully, Cameron M; Faulkner, Stefan T; Lachenmyer, Eric M; Cunningham, Brady R; Shaw, Timothy J; Richardson, Tammi L; Myrick, Michael L

    2018-03-01

    An all-pairs method is used to analyze phytoplankton fluorescence excitation spectra. An initial set of nine phytoplankton species is analyzed in pairwise fashion to select two optical filter sets, and then the two filter sets are used to explore variations among a total of 31 species in a single-cell fluorescence imaging photometer. Results are presented in terms of pair analyses; we report that 411 of the 465 possible pairings of the larger group of 31 species can be distinguished using the initial nine-species-based selection of optical filters. A bootstrap analysis based on the larger data set shows that the distribution of possible pair separation results based on a randomly selected nine-species initial calibration set is strongly peaked in the 410-415 pair separation range, consistent with our experimental result. Further, the result for filter selection using all 31 species is also 411 pair separations; The set of phytoplankton fluorescence excitation spectra is intuitively high in rank due to the number and variety of pigments that contribute to the spectrum. However, the results in this report are consistent with an effective rank as determined by a variety of heuristic and statistical methods in the range of 2-3. These results are reviewed in consideration of how consistent the filter selections are from model to model for the data presented here. We discuss the common observation that rank is generally found to be relatively low even in many seemingly complex circumstances, so that it may be productive to assume a low rank from the beginning. If a low-rank hypothesis is valid, then relatively few samples are needed to explore an experimental space. Under very restricted circumstances for uniformly distributed samples, the minimum number for an initial analysis might be as low as 8-11 random samples for 1-3 factors.

  12. A convergence algorithm for correlation of breech face images based on the congruent matching cells (CMC) method.

    PubMed

    Chen, Zhe; Song, John; Chu, Wei; Soons, Johannes A; Zhao, Xuezeng

    2017-11-01

    The Congruent Matching Cells (CMC) method was invented at the National Institute of Standards and Technology (NIST) for accurate firearm evidence identification and error rate estimation. The CMC method is based on the principle of discretization. The toolmark image of the reference sample is divided into correlation cells. Each cell is registered to the cell-sized area of the compared image that has maximum surface topography similarity. For each resulting cell pair, one parameter quantifies the similarity of the cell surface topography and three parameters quantify the pattern congruency of the registration position and orientation. An identification (declared match) requires a significant number of CMCs, that is, cell pairs that meet both similarity and pattern congruency requirements. The use of cell correlations reduces the effects of "invalid regions" in the compared image pairs and increases the correlation accuracy. The identification accuracy of the CMC method can be further improved by considering a feature named "convergence," that is, the tendency of the x-y registration positions of the correlated cell pairs to converge at the correct registration angle when comparing same-source samples at different relative orientations. In this paper, the difference of the convergence feature between known matching (KM) and known non-matching (KNM) image pairs is characterized, based on which an improved algorithm is developed for breech face image correlations using the CMC method. Its advantage is demonstrated by comparison with three existing CMC algorithms using four datasets. The datasets address three different brands of consecutively manufactured pistol slides, with significant differences in the distribution overlap of cell pair topography similarity for KM and KNM image pairs. For the same CMC threshold values, the convergence algorithm demonstrates noticeably improved results by reducing the number of false-positive or false-negative CMCs in a comparison. Published by Elsevier B.V.

  13. Single-Molecule Mechanical (Un)folding of RNA Hairpins: Effects of Single A-U to A∙C Pair Substitutions and Single Proton Binding and Implications for mRNA Structure-Induced -1 Ribosomal Frameshifting.

    PubMed

    Yang, Lixia; Zhong, Zhensheng; Tong, Cailing; Jia, Huan; Liu, Yiran; Chen, Gang

    2018-06-08

    A wobble A∙C pair can be protonated at near physiological pH to form a more stable wobble A+∙C pair. Here, we constructed an RNA hairpin (rHP) and three mutants with one A-U base pair substituted with an A∙C mismatch on the top (near the loop, U22C), middle (U25C) and bottom (U29C) positions of the stem, respectively. Our results on single-molecule mechanical (un)folding using optical tweezers reveal the destabilization effect of A-U to A∙C pair substitution, and protonation-dependent enhancement of mechanical stability facilitated through an increased folding rate, or decreased unfolding rate, or both. Our data show that protonation may occur rapidly upon the formation of apparent mechanical folding transition state. Furthermore, we measured the bulk -1 ribosomal frameshifting efficiencies of the hairpins by a cell-free translation assay. For the mRNA hairpins studied, -1 frameshifting efficiency correlates with mechanical unfolding force at equilibrium and folding rate at around 15 pN. U29C has a frameshifting efficiency similar to that of rHP (~2%). Accordingly, the bottom 2-4 base pairs of U29C may not form under a stretching force at pH 7.3, which is consistent with the fact that the bottom base pairs of the hairpins may be disrupted by ribosome at the slippery site. U22C and U25C have a similar frameshifting efficiency (~1%), indicating that both unfolding and folding rates of an mRNA hairpin in a crowded environment may affect frameshifting. Our data indicate that mechanical (un)folding of RNA hairpins may mimic how mRNAs unfold and fold in the presence of translating ribosomes.

  14. Strongly exchange-coupled triplet pairs in an organic semiconductor

    NASA Astrophysics Data System (ADS)

    Weiss, Leah R.; Bayliss, Sam L.; Kraffert, Felix; Thorley, Karl J.; Anthony, John E.; Bittl, Robert; Friend, Richard H.; Rao, Akshay; Greenham, Neil C.; Behrends, Jan

    2017-02-01

    From biological complexes to devices based on organic semiconductors, spin interactions play a key role in the function of molecular systems. For instance, triplet-pair reactions impact operation of organic light-emitting diodes as well as photovoltaic devices. Conventional models for triplet pairs assume they interact only weakly. Here, using electron spin resonance, we observe long-lived, strongly interacting triplet pairs in an organic semiconductor, generated via singlet fission. Using coherent spin manipulation of these two-triplet states, we identify exchange-coupled (spin-2) quintet complexes coexisting with weakly coupled (spin-1) triplets. We measure strongly coupled pairs with a lifetime approaching 3 μs and a spin coherence time approaching 1 μs, at 10 K. Our results pave the way for the utilization of high-spin systems in organic semiconductors.

  15. Is incest common in gray wolf packs?

    USGS Publications Warehouse

    Smith, Deborah E; Meier, Thomas J.; Geffen, Eli; Mech, L. David; Burch, John W.; Adams, Layne G.; Wayne, Robert K.

    1997-01-01

    Wolf packs generally consist of a breeding pair and their maturing offspring that help provision and protect pack young. Because the reproductive tenure in wolves is often short, reproductively mature offspring might replace their parents, resulting in sibling or parent-offspring matings. To determine the extent of incestuous pairings, we measured relatedness based on variability in 20 microsatellite loci of mated pairs, parent-offspring pairs, and siblings in two populations of gray wolves. Our 16 sampled mated pairs had values of relatedness not overlapping those of known parent-offspring or sibling dyads, which is consistent with their being unrelated or distantly related. These results suggest that full siblings or a parent and its offspring rarely mate and that incest avoidance is an important constraint on gray wolf behavioral ecology.

  16. Two monozygotic twin pairs discordant for female-to-male transsexualism.

    PubMed

    Segal, Nancy L

    2006-06-01

    Two monozygotic female twin pairs discordant for transsexualism are described. These reports double the number of such case studies in the current scientific literature. Interviews with the twins and their families indicated that unusual medical and life history factors did not play causal roles. However, inspection of medical records for one transsexual twin suggested that some early life experiences may have exacerbated tendencies toward male gender identification. In both pairs, the twins' gender identity differences emerged early, consistent with, but not proof of, co-twin differences in prenatal hormonal influences. The identification of additional discordant MZ female twin pairs can advance biological and psychological understanding of transsexualism. Suggestions for future research, based upon findings from these two twin pairs and from studies of female-to-male transsexuals, are provided.

  17. Extension of helix II of an HIV-1-directed hammerhead ribozyme with long antisense flanks does not alter kinetic parameters in vitro but causes loss of the inhibitory potential in living cells.

    PubMed Central

    Homann, M; Tabler, M; Tzortzakaki, S; Sczakiel, G

    1994-01-01

    When designed to cleave a target RNA in trans, the hammerhead ribozyme contains two antisense flanks which form helix I and helix III by pairing with the complementary target RNA. The sequences forming helix II are contained on the ribozyme strand and represent a major structural component of the hammerhead structure. In the case of an inhibitory 429 nucleotides long trans-ribozyme (2as-Rz12) which was directed against the 5'-leader/gag region of the human immunodeficiency virus type 1 (HIV-1), helix II was not pre-formed in the single-stranded molecule. Thus, major structural changes are necessary before cleavage can occur. To study whether pre-formation of helix II in the non-paired 2as-Rz12 RNA could influence the observed cleavage rate in vitro and its inhibitory activity on HIV-1 replication, we extended the 4 base pair helix II of 2as-Rz12 to 6, 10, 21, and 22 base pairs respectively. Limited RNase cleavage reactions performed in vitro at 37 degrees C and at physiological ion strength indicated that a helix II of the hammerhead domain was pre-formed when its length was at least six base pairs. This modification neither affected the association rate with target RNA nor the cleavage rate in vitro. In contrast to this, extension of helix II led to a significantly decreased inhibition of HIV-1 replication in human cells. Together with the finding of others that shortening of helix II to less than two base pairs reduces the catalytic activity in vitro, this observation indicates that the length of helix II in the naturally occurring RNAs with a hammerhead domain is already close or identical to the optimal length for catalytic activity in vitro and in vivo. Images PMID:7524030

  18. Bright-dark soliton pairs in a self-mode locking fiber laser

    NASA Astrophysics Data System (ADS)

    Meng, Yichang; Zhang, Shumin; Li, Hongfei; Du, Juan; Hao, Yanping; Li, Xingliang

    2012-06-01

    We have experimentally observed bright-dark soliton pairs in an erbium-doped fiber ring laser for the first time. This approach is different from the vector dark domain wall solitons which separate the two orthogonal linear polarization eigenstates of the laser emission. In our laser, the bright-dark soliton pairs can co-exist in any one polarization state. Numerical simulations based on the coupled complex Ginzburg-Landau equations have confirmed the experimental results.

  19. Information Theoretic Studies and Assessment of Space Object Identification

    DTIC Science & Technology

    2014-03-24

    localization are contained in Ref. [5]. 1.7.1 A Bayesian MPE Based Analysis of 2D Point-Source-Pair Superresolution In a second recently submitted paper [6], a...related problem of the optical superresolution (OSR) of a pair of equal-brightness point sources separated spatially by a distance (or angle) smaller...1403.4897 [physics.optics] (19 March 2014). 6. S. Prasad, “Asymptotics of Bayesian error probability and 2D pair superresolution ,” submitted to Opt. Express

  20. Assessment of effect of Yb3+ ion pairs on a highly Yb-doped double-clad fibre laser

    NASA Astrophysics Data System (ADS)

    Vallés, J. A.; Martín, J. C.; Berdejo, V.; Cases, R.; Álvarez, J. M.; Rebolledo, M. Á.

    2018-03-01

    Using a previously validated characterization method based on the careful measurement of the characteristic parameters and fluorescence emission spectra of a highly Yb-doped double-clad fibre, we evaluate the contribution of ion pair induced processes to the output power of a double-clad Yb-doped fibre ring laser. This contribution is proved to be insignificant, contrary to analysis by other authors, who overestimate the role of ion pairs.

  1. Search for exclusive or semi-exclusive γγ production and observation of exclusive and semi-exclusive e +e - production in pp collisions at $$ \\sqrt{s}=7 $$ TeV

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chatrchyan, S.; Khachatryan, V.; Sirunyan, A. M.

    A search for exclusive or semi-exclusive photon pair production, pp to p(*) + photon pair + p(*) (where p(*) stands for a diffractively-dissociated proton), and the observation of exclusive and semi-exclusive electron pair production, pp to p(*) + ee + p(*), in proton-proton collisions at sqrt(s) = 7 TeV, are presented. The analysis is based on a data sample corresponding to an integrated luminosity of 36 inverse picobarns recorded by the CMS experiment at the LHC at low instantaneous luminosities. Candidate photon pair or electron pair events are selected by requiring the presence of two photons or a positron andmore » an electron, each with transverse energy ET > 5.5 GeV and pseudorapidity abs(eta) < 2.5, and no other particles in the region abs(eta) < 5.2. No exclusive or semi-exclusive diphoton candidates are found in the data. An upper limit on the cross section for the reaction pp to p(*) + photon pair + p(*), within the above kinematic selections, is set at 1.18 pb at 95% confidence level. Seventeen exclusive or semi-exclusive dielectron candidates are observed, with an estimated background of 0.85 +/- 0.28 (stat.) events, in agreement with the QED-based prediction of 16.3 +/- 1.3 (syst.) events.« less

  2. [Pharmacokinetic research strategies of compatibilities and synergistic effects of classical Danshen herb pairs based on pharmacokinetics of "Danshen-Bingpian" and "Danshen-Honghua"].

    PubMed

    Zhang, Cui-Ying; Ren, Wei-Guang

    2017-06-01

    Herb pairs are usual clinical compatibility forms and one of compound prescription sources in Chinese medicine. Pharmacokinetic research in vivo is one of the important items in elucidating the mechanism for synergistic and attenuated mechanisms of herb pairs. The paper comprehensively summarized and systemized the pharmacokinetic researches of marker-ingredients about Danshen-Honghua and Danshen-Bingpian in order to elucidate the rationality and scientificity of herb pairs and provide some feasible suggestions on the pharmacokinetics of drugs in the future. In view of complicated system of Traditional Chinese medicines and a chemical system that is not separated from its natural state, comparative pharmacokinetic researches on marker-ingredients from the herb pairs are reasonable to elucidate the synergistic and attenuated mechanisms of monarch-subjects compatible herbs and monarch-guide compatible herbs. Such pharmacokinetic research can better explain the mechanism of drug compatibility, while the pharmacokinetic researches based on the monomer chemical compositions and marker-ingredients that have been separated from complex chemical environment of traditional Chinese Medicine are still unreasonable and should be discussed deeply. Copyright© by the Chinese Pharmaceutical Association.

  3. Saddle clamp assembly

    NASA Technical Reports Server (NTRS)

    Belrose, Charles R. (Inventor)

    1994-01-01

    A saddle clamp assembly is presented. The assembly is comprised of a hollow cylindrical body centered about a longitudinal axis and being diametrically split into semicircular top and bottom sections. Each section has a pair of connection flanges, at opposite ends, that project radially outward. A pair of bolts are retained on the top section flanges and are threadable into nuts retained on the bottom section flanges. A base member is anchored to a central underside portion of the bottom clamp body section and has a pair of connection tabs positioned beneath the bottom clamp body section connection flanges on opposite sides of the clamp axis. A pair of bolts are retained on the base member connection tabs and are threadable into a pair of nuts retainable on a support structure. The connection tab and connection flanges on each side of the clamp body are axially offset in a manner permitting downward installation/removable tool access to the lower bolts past the connection flanges. An elongated retention tether is used to connect the top clamp body section to the balance of the clamp assembly. This prevents loss of the top clamp body section when it is removed from the bottom clamp body section.

  4. The Evolution and Expression Pattern of Human Overlapping lncRNA and Protein-coding Gene Pairs.

    PubMed

    Ning, Qianqian; Li, Yixue; Wang, Zhen; Zhou, Songwen; Sun, Hong; Yu, Guangjun

    2017-03-27

    Long non-coding RNA overlapping with protein-coding gene (lncRNA-coding pair) is a special type of overlapping genes. Protein-coding overlapping genes have been well studied and increasing attention has been paid to lncRNAs. By studying lncRNA-coding pairs in human genome, we showed that lncRNA-coding pairs were more likely to be generated by overprinting and retaining genes in lncRNA-coding pairs were given higher priority than non-overlapping genes. Besides, the preference of overlapping configurations preserved during evolution was based on the origin of lncRNA-coding pairs. Further investigations showed that lncRNAs promoting the splicing of their embedded protein-coding partners was a unilateral interaction, but the existence of overlapping partners improving the gene expression was bidirectional and the effect was decreased with the increased evolutionary age of genes. Additionally, the expression of lncRNA-coding pairs showed an overall positive correlation and the expression correlation was associated with their overlapping configurations, local genomic environment and evolutionary age of genes. Comparison of the expression correlation of lncRNA-coding pairs between normal and cancer samples found that the lineage-specific pairs including old protein-coding genes may play an important role in tumorigenesis. This work presents a systematically comprehensive understanding of the evolution and the expression pattern of human lncRNA-coding pairs.

  5. Comparison of Interaural Electrode Pairing Methods for Bilateral Cochlear Implants

    PubMed Central

    Dietz, Mathias

    2015-01-01

    In patients with bilateral cochlear implants (CIs), pairing matched interaural electrodes and stimulating them with the same frequency band is expected to facilitate binaural functions such as binaural fusion, localization, and spatial release from masking. Because clinical procedures typically do not include patient-specific interaural electrode pairing, it remains the case that each electrode is allocated to a generic frequency range, based simply on the electrode number. Two psychoacoustic techniques for determining interaurally paired electrodes have been demonstrated in several studies: interaural pitch comparison and interaural time difference (ITD) sensitivity. However, these two methods are rarely, if ever, compared directly. A third, more objective method is to assess the amplitude of the binaural interaction component (BIC) derived from electrically evoked auditory brainstem responses for different electrode pairings; a method has been demonstrated to be a potential candidate for bilateral CI users. Here, we tested all three measures in the same eight CI users. We found good correspondence between the electrode pair producing the largest BIC and the electrode pair producing the maximum ITD sensitivity. The correspondence between the pairs producing the largest BIC and the pitch-matched electrode pairs was considerably weaker, supporting the previously proposed hypothesis that whilst place pitch might adapt over time to accommodate mismatched inputs, sensitivity to ITDs does not adapt to the same degree. PMID:26631108

  6. Evidence That Intergenic Spacer Repeats of Drosophila Melanogaster Rrna Genes Function as X-Y Pairing Sites in Male Meiosis, and a General Model for Achiasmatic Pairing

    PubMed Central

    McKee, B. D.; Habera, L.; Vrana, J. A.

    1992-01-01

    In Drosophila melanogaster males, X-Y meiotic chromosome pairing is mediated by the nucleolus organizers (NOs) which are located in the X heterochromatin (Xh) and near the Y centromere. Deficiencies for Xh disrupt X-Y meiotic pairing and cause high frequencies of X-Y nondisjunction. Insertion of cloned rRNA genes on an Xh(-) chromosome partially restores normal X-Y pairing and disjunction. To map the sequences within an inserted, X-linked rRNA gene responsible for stimulating X-Y pairing, partial deletions were generated by P element-mediated destabilization of the insert. Complete deletions of the rRNA transcription unit did not interfere with the ability to stimulate X-Y pairing as long as most of the intergenic spacer (IGS) remained. Within groups of deletions that lacked the entire transcription unit and differed only in length of residual IGS material, pairing ability was proportional to the dose of 240-bp intergenic spacer repeats. Deletions of the complete rRNA transcription unit or of the 28S sequences alone blocked nucleolus formation, as determined by binding of an antinucleolar antibody, yet did not interfere with pairing ability, suggesting that X-Y pairing may not be mechanistically related to nucleolus formation. A model for achiasmatic pairing in Drosophila males based upon the combined action of topoisomerase I and a strand transferase is proposed. PMID:1330825

  7. Method for sequencing DNA base pairs

    DOEpatents

    Sessler, Andrew M.; Dawson, John

    1993-01-01

    The base pairs of a DNA structure are sequenced with the use of a scanning tunneling microscope (STM). The DNA structure is scanned by the STM probe tip, and, as it is being scanned, the DNA structure is separately subjected to a sequence of infrared radiation from four different sources, each source being selected to preferentially excite one of the four different bases in the DNA structure. Each particular base being scanned is subjected to such sequence of infrared radiation from the four different sources as that particular base is being scanned. The DNA structure as a whole is separately imaged for each subjection thereof to radiation from one only of each source.

  8. Myotonic Dystrophy Type 1 RNA Crystal Structures Reveal Heterogeneous 1×1 Nucleotide UU Internal Loop Conformations⊥

    PubMed Central

    Kumar, Amit; Park, HaJeung; Fang, Pengfei; Parkesh, Raman; Guo, Min; Nettles, Kendall W.; Disney, Matthew D.

    2011-01-01

    RNA internal loops often display a variety of conformations in solution. Herein, we visualize conformational heterogeneity in the context of the 5′CUG/3′GUC repeat motif present in the RNA that causes myotonic dystrophy type 1 (DM1). Specifically, two crystal structures are disclosed of a model DM1 triplet repeating construct, 5′r(UUGGGC(CUG)3GUCC)2, refined to 2.20 Å and 1.52 Å resolution. Here, differences in orientation of the 5′ dangling UU end between the two structures induce changes in the backbone groove width, which reveals that non-canonical 1×1 nucleotide UU internal loops can display an ensemble of pairing conformations. In the 2.20 Å structure, CUGa, the 5′UU forms one hydrogen-bonded pairs with a 5′UU of a neighboring helix in the unit cell to form a pseudo-infinite helix. The central 1×1 nucleotide UU internal loop has no hydrogen bonds, while the terminal 1×1 nucleotide UU internal loops each form a one hydrogen-bonded pair. In the 1.52 Å structure, CUGb, the 5′ UU dangling end is tucked into the major groove of the duplex. While the canonical paired bases show no change in base pairing, in CUGb the terminal 1×1 nucleotide UU internal loops form now two hydrogen-bonded pairs. Thus, the shift in major groove induced by the 5′UU dangling end alters non-canonical base patterns. Collectively, these structures indicate that 1×1 nucleotide UU internal loops in DM1 may sample multiple conformations in vivo. This observation has implications for the recognition of this RNA, and other repeating transcripts, by protein and small molecule ligands. PMID:21988728

  9. Myotonic dystrophy type 1 RNA crystal structures reveal heterogeneous 1 × 1 nucleotide UU internal loop conformations.

    PubMed

    Kumar, Amit; Park, HaJeung; Fang, Pengfei; Parkesh, Raman; Guo, Min; Nettles, Kendall W; Disney, Matthew D

    2011-11-15

    RNA internal loops often display a variety of conformations in solution. Herein, we visualize conformational heterogeneity in the context of the 5'CUG/3'GUC repeat motif present in the RNA that causes myotonic dystrophy type 1 (DM1). Specifically, two crystal structures of a model DM1 triplet repeating construct, 5'r[UUGGGC(CUG)(3)GUCC](2), refined to 2.20 and 1.52 Å resolution are disclosed. Here, differences in the orientation of the 5' dangling UU end between the two structures induce changes in the backbone groove width, which reveals that noncanonical 1 × 1 nucleotide UU internal loops can display an ensemble of pairing conformations. In the 2.20 Å structure, CUGa, the 5' UU forms a one hydrogen-bonded pair with a 5' UU of a neighboring helix in the unit cell to form a pseudoinfinite helix. The central 1 × 1 nucleotide UU internal loop has no hydrogen bonds, while the terminal 1 × 1 nucleotide UU internal loops each form a one-hydrogen bond pair. In the 1.52 Å structure, CUGb, the 5' UU dangling end is tucked into the major groove of the duplex. While the canonically paired bases show no change in base pairing, in CUGb the terminal 1 × 1 nucleotide UU internal loops now form two hydrogen-bonded pairs. Thus, the shift in the major groove induced by the 5' UU dangling end alters noncanonical base patterns. Collectively, these structures indicate that 1 × 1 nucleotide UU internal loops in DM1 may sample multiple conformations in vivo. This observation has implications for the recognition of this RNA, and other repeating transcripts, by protein and small molecule ligands.

  10. Myotonic Dystrophy Type 1 RNA Crystal Structures Reveal Heterogeneous 1 × 1 Nucleotide UU Internal Loop Conformations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kumar, Amit; Park, HaJeung; Fang, Pengfei

    2012-03-27

    RNA internal loops often display a variety of conformations in solution. Herein, we visualize conformational heterogeneity in the context of the 5'CUG/3'GUC repeat motif present in the RNA that causes myotonic dystrophy type 1 (DM1). Specifically, two crystal structures of a model DM1 triplet repeating construct, 5'r[{und UU}GGGC(C{und U}G){sub 3}GUCC]{sub 2}, refined to 2.20 and 1.52 {angstrom} resolution are disclosed. Here, differences in the orientation of the 5' dangling UU end between the two structures induce changes in the backbone groove width, which reveals that noncanonical 1 x 1 nucleotide UU internal loops can display an ensemble of pairing conformations.more » In the 2.20 {angstrom} structure, CUGa, the 5' UU forms a one hydrogen-bonded pair with a 5' UU of a neighboring helix in the unit cell to form a pseudoinfinite helix. The central 1 x 1 nucleotide UU internal loop has no hydrogen bonds, while the terminal 1 x 1 nucleotide UU internal loops each form a one-hydrogen bond pair. In the 1.52 {angstrom} structure, CUGb, the 5' UU dangling end is tucked into the major groove of the duplex. While the canonically paired bases show no change in base pairing, in CUGb the terminal 1 x 1 nucleotide UU internal loops now form two hydrogen-bonded pairs. Thus, the shift in the major groove induced by the 5' UU dangling end alters noncanonical base patterns. Collectively, these structures indicate that 1 x 1 nucleotide UU internal loops in DM1 may sample multiple conformations in vivo. This observation has implications for the recognition of this RNA, and other repeating transcripts, by protein and small molecule ligands.« less

  11. Hippocampal activations in mesial temporal lobe epilepsy due to hippocampal sclerosis- an observational study on intramural encoding-delayed recall paradigms using task-based memory fMRI.

    PubMed

    Rajesh, P G; Thomas, Bejoy; Pammi, V S Chandrasekhar; Kesavadas, C; Alexander, Aley; Radhakrishnan, Ashalatha; Thomas, S V; Menon, R N

    2018-05-26

    To validate concurrent utility of within-scanner encoding and delayed recognition-memory paradigms to ascertain hippocampal activations during task-based memory fMRI. Memory paradigms were designed for faces, word-pairs and abstract designs. A deep-encoding task was designed comprising of a total of 9 cycles run within a 1.5T MRI scanner. A recall session was performed after 1 h within the scanner using an event-related design. Group analysis was done with 'correct-incorrect' responses applied as parametric modulators in Statistical Parametric Mapping version 8 using boot-strap method to enable estimation of laterality indices (LI) using custom anatomical masks involving the medio-basal temporal structures. Twenty seven subjects with drug-resistant mesial temporal lobe epilepsy due to hippocampal sclerosis (MTLE-HS) [17 patients of left-MTLE and 10 patients of right-MTLE] and 21 right handed age-matched healthy controls (HC) were recruited. For the encoding paradigm blood oxygen level dependent (BOLD) responses in HC demonstrated right laterality for faces, left laterality for word pairs, and bilaterality for design encoding over the regions of interest. Both right and left MTLE-HS groups revealed left lateralisation for word-pair encoding, bilateral activation for face encoding, with design encoding in right MTLE-HS demonstrating a left shift. As opposed to lateralization shown in controls, group analysis of cued-recall BOLD signals acquired within scanner in left MTLE-HS demonstrated right lateralization for word-pairs with bilaterality for faces and designs. The right MTLE-HS group demonstrated bilateral activations for faces, word-pairs and designs. Recall-based fMRI paradigms indicate hippocampal plasticity in MTLE-HS, maximal for word-pair associate recall tasks. Copyright © 2018 Elsevier B.V. All rights reserved.

  12. A Bootstrapping Model of Frequency and Context Effects in Word Learning.

    PubMed

    Kachergis, George; Yu, Chen; Shiffrin, Richard M

    2017-04-01

    Prior research has shown that people can learn many nouns (i.e., word-object mappings) from a short series of ambiguous situations containing multiple words and objects. For successful cross-situational learning, people must approximately track which words and referents co-occur most frequently. This study investigates the effects of allowing some word-referent pairs to appear more frequently than others, as is true in real-world learning environments. Surprisingly, high-frequency pairs are not always learned better, but can also boost learning of other pairs. Using a recent associative model (Kachergis, Yu, & Shiffrin, 2012), we explain how mixing pairs of different frequencies can bootstrap late learning of the low-frequency pairs based on early learning of higher frequency pairs. We also manipulate contextual diversity, the number of pairs a given pair appears with across training, since it is naturalistically confounded with frequency. The associative model has competing familiarity and uncertainty biases, and their interaction is able to capture the individual and combined effects of frequency and contextual diversity on human learning. Two other recent word-learning models do not account for the behavioral findings. Copyright © 2016 Cognitive Science Society, Inc.

  13. Hfq restructures RNA-IN and RNA-OUT and facilitates antisense pairing in the Tn10/IS10 system

    PubMed Central

    Ross, Joseph A.; Ellis, Michael J.; Hossain, Shahan; Haniford, David B.

    2013-01-01

    Hfq functions in post-transcriptional gene regulation in a wide range of bacteria, usually by promoting base-pairing of mRNAs and trans-encoded sRNAs that share partial sequence complementarity. It is less clear if Hfq is required for pairing of cis-encoded RNAs (i.e., antisense RNAs) with their target mRNAs. In the current work, we have characterized the interactions between Escherichia coli Hfq and the components of the Tn10/IS10 antisense system, RNA-IN and RNA-OUT. We show that Hfq interacts with RNA-OUT through its proximal RNA-binding surface, as is typical for Hfq and trans-encoded sRNAs. In contrast, RNA-IN binds both proximal and distal RNA-binding surfaces in Hfq with a higher affinity for the latter, as is typical for mRNA interactions in canonical sRNA-mRNA pairs. Importantly, an amino acid substitution in Hfq that interferes with RNA binding to the proximal site negatively impacts RNA-IN:OUT pairing in vitro and suppresses the ability of Hfq to negatively regulate IS10 transposition in vivo. We also show that Hfq binding to RNA-IN and RNA-OUT alters secondary structure elements in both of these RNAs and speculate that this could be important in how Hfq facilitates RNA-IN:OUT pairing. Based on the results presented here, we suggest that Hfq could be involved in regulating RNA pairing in other antisense systems, including systems encoded by other transposable elements. PMID:23510801

  14. Galactic Doppelgängers: The Chemical Similarity Among Field Stars and Among Stars with a Common Birth Origin

    NASA Astrophysics Data System (ADS)

    Ness, M.; Rix, H.-W.; Hogg, David W.; Casey, A. R.; Holtzman, J.; Fouesneau, M.; Zasowski, G.; Geisler, D.; Shetrone, M.; Minniti, D.; Frinchaboy, Peter M.; Roman-Lopes, Alexandre

    2018-02-01

    We explore to what extent stars within Galactic disk open clusters resemble each other in the high-dimensional space of their photospheric element abundances and contrast this with pairs of field stars. Our analysis is based on abundances for 20 elements, homogeneously derived from APOGEE spectra (with carefully quantified uncertainties of typically 0.03 dex). We consider 90 red giant stars in seven open clusters and find that most stars within a cluster have abundances in most elements that are indistinguishable (in a {χ }2-sense) from those of the other members, as expected for stellar birth siblings. An analogous analysis among pairs of > 1000 field stars shows that highly significant abundance differences in the 20 dimensional space can be established for the vast majority of these pairs, and that the APOGEE-based abundance measurements have high discriminating power. However, pairs of field stars whose abundances are indistinguishable even at 0.03 dex precision exist: ∼0.3% of all field star pairs and ∼1.0% of field star pairs at the same (solar) metallicity [Fe/H] = 0 ± 0.02. Most of these pairs are presumably not birth siblings from the same cluster, but rather doppelgängers. Our analysis implies that “chemical tagging” in the strict sense, identifying birth siblings for typical disk stars through their abundance similarity alone, will not work with such data. However, our approach shows that abundances have extremely valuable information for probabilistic chemo-orbital modeling, and combined with velocities, we have identified new cluster members from the field.

  15. Watson-Crick Base Pair Radical Cation as a Model for Oxidative Damage in DNA.

    PubMed

    Feketeová, Linda; Chan, Bun; Khairallah, George N; Steinmetz, Vincent; Maitre, Philippe; Radom, Leo; O'Hair, Richard A J

    2017-07-06

    The deleterious cellular effects of ionizing radiation are well-known, but the mechanisms causing DNA damage are poorly understood. The accepted molecular events involve initial oxidation and deprotonation at guanine sites, triggering hydrogen atom abstraction reactions from the sugar moieties, causing DNA strand breaks. Probing the chemistry of the initially formed radical cation has been challenging. Here, we generate, spectroscopically characterize, and examine the reactivity of the Watson-Crick nucleobase pair radical cation in the gas phase. We observe rich chemistry, including proton transfer between the bases and propagation of the radical site in deoxyguanosine from the base to the sugar, thus rupturing the sugar. This first example of a gas-phase model system providing molecular-level details on the chemistry of an ionized DNA base pair paves the way toward a more complete understanding of molecular processes induced by radiation. It also highlights the role of radical propagation in chemistry, biology, and nanotechnology.

  16. Charge transport through DNA based electronic barriers

    NASA Astrophysics Data System (ADS)

    Patil, Sunil R.; Chawda, Vivek; Qi, Jianqing; Anantram, M. P.; Sinha, Niraj

    2018-05-01

    We report charge transport in electronic 'barriers' constructed by sequence engineering in DNA. Considering the ionization potentials of Thymine-Adenine (AT) and Guanine-Cytosine (GC) base pairs, we treat AT as 'barriers'. The effect of DNA conformation (A and B form) on charge transport is also investigated. Particularly, the effect of width of 'barriers' on hole transport is investigated. Density functional theory (DFT) calculations are performed on energy minimized DNA structures to obtain the electronic Hamiltonian. The quantum transport calculations are performed using the Landauer-Buttiker framework. Our main findings are contrary to previous studies. We find that a longer A-DNA with more AT base pairs can conduct better than shorter A-DNA with a smaller number of AT base pairs. We also find that some sequences of A-DNA can conduct better than a corresponding B-DNA with the same sequence. The counterions mediated charge transport and long range interactions are speculated to be responsible for counter-intuitive length and AT content dependence of conductance of A-DNA.

  17. Reduction of CO 2 to methanol using aluminum ester FLPs

    DOE PAGES

    Smythe, Nathan C.; Dixon, David A.; Garner, III, Edward B.; ...

    2015-10-09

    Herein we report the synthesis of Al-based esters containing halogenated benzene rings. These Lewis acids were paired with phosphines to form frustrated Lewis pairs (FLPs) which could subsequently bind CO 2. While these FLPs were not sufficiently water-stable to catalyze the reduction of CO 2 to MeOH using NH 3BH 3 as the reductant, we examine the effect of varying Lewis acid strength. Frustrated Lewis pairs (FLPs) are combinations of Lewis acids and Lewis bases where the acid and base are either sterically or geometrically restricted from interacting as strongly as their electronic structures would allow. This effect leads tomore » enhanced reactivity towards small molecules and, consequently, interest in their potential as metal-free catalysts [1], [2], [3], [4] and [5]. Furthermore, to-date, the biggest success has been based around the ability of a myriad of systems to heterolytically cleave H 2 and perform catalytic hydrogenations [2] and [3].« less

  18. Integrated model of multiple kernel learning and differential evolution for EUR/USD trading.

    PubMed

    Deng, Shangkun; Sakurai, Akito

    2014-01-01

    Currency trading is an important area for individual investors, government policy decisions, and organization investments. In this study, we propose a hybrid approach referred to as MKL-DE, which combines multiple kernel learning (MKL) with differential evolution (DE) for trading a currency pair. MKL is used to learn a model that predicts changes in the target currency pair, whereas DE is used to generate the buy and sell signals for the target currency pair based on the relative strength index (RSI), while it is also combined with MKL as a trading signal. The new hybrid implementation is applied to EUR/USD trading, which is the most traded foreign exchange (FX) currency pair. MKL is essential for utilizing information from multiple information sources and DE is essential for formulating a trading rule based on a mixture of discrete structures and continuous parameters. Initially, the prediction model optimized by MKL predicts the returns based on a technical indicator called the moving average convergence and divergence. Next, a combined trading signal is optimized by DE using the inputs from the prediction model and technical indicator RSI obtained from multiple timeframes. The experimental results showed that trading using the prediction learned by MKL yielded consistent profits.

  19. A novel hazard assessment method for biomass gasification stations based on extended set pair analysis

    PubMed Central

    Yan, Fang; Xu, Kaili; Li, Deshun; Cui, Zhikai

    2017-01-01

    Biomass gasification stations are facing many hazard factors, therefore, it is necessary to make hazard assessment for them. In this study, a novel hazard assessment method called extended set pair analysis (ESPA) is proposed based on set pair analysis (SPA). However, the calculation of the connection degree (CD) requires the classification of hazard grades and their corresponding thresholds using SPA for the hazard assessment. In regard to the hazard assessment using ESPA, a novel calculation algorithm of the CD is worked out when hazard grades and their corresponding thresholds are unknown. Then the CD can be converted into Euclidean distance (ED) by a simple and concise calculation, and the hazard of each sample will be ranked based on the value of ED. In this paper, six biomass gasification stations are introduced to make hazard assessment using ESPA and general set pair analysis (GSPA), respectively. By the comparison of hazard assessment results obtained from ESPA and GSPA, the availability and validity of ESPA can be proved in the hazard assessment for biomass gasification stations. Meanwhile, the reasonability of ESPA is also justified by the sensitivity analysis of hazard assessment results obtained by ESPA and GSPA. PMID:28938011

  20. Enhancement of galaxy overdensity around quasar pairs at z < 3.6 based on the Hyper Suprime-Cam Subaru Strategic Program Survey

    NASA Astrophysics Data System (ADS)

    Onoue, Masafusa; Kashikawa, Nobunari; Uchiyama, Hisakazu; Akiyama, Masayuki; Harikane, Yuichi; Imanishi, Masatoshi; Komiyama, Yutaka; Matsuoka, Yoshiki; Nagao, Tohru; Nishizawa, Atsushi J.; Oguri, Masamune; Ouchi, Masami; Tanaka, Masayuki; Toba, Yoshiki; Toshikawa, Jun

    2018-01-01

    We investigate the galaxy overdensity around proto-cluster scale quasar pairs at high (z > 3) and low (z ˜ 1) redshift based on the unprecedentedly wide and deep optical survey of the Hyper Suprime-Cam Subaru Strategic Program (HSC-SSP). Using the first-year survey data covering effectively ˜121 deg2 with the 5σ depth of i ˜ 26.4 and the SDSS DR12Q catalog, we find two luminous pairs at z ˜ 3.3 and 3.6 which reside in >5σ overdensity regions of g-dropout galaxies at i < 25. The projected separations of the two pairs are R⊥ = 1.75 and 1.04 proper Mpc (pMpc), and their velocity offsets are ΔV = 692 and 1448 km s-1, respectively. This result is in clear contrast to the average z ˜ 4 quasar environments as discussed in Uchiyama et al. (2018, PASJ 70, S32) and implies that the quasar activities of the pair members are triggered via major mergers in proto-clusters, unlike the vast majority of isolated quasars in general fields that may turn on via non-merger events such as bar and disk instabilities. At z ˜ 1, we find 37 pairs with R⊥ < 2 pMpc and ΔV < 2300 km s-1 in the current HSC-Wide coverage, including four from Hennawi et al. (2006, AJ, 131, 1). The distribution of the peak overdensity significance within two arcminutes around the pairs has a long tail toward high-density (>4σ) regions. Thanks to the large sample size, we find statistical evidence that this excess is unique to the pair environments when compared to single-quasar and randomly selected galaxy environments at the same redshift range. Moreover, there are nine small-scale (R⊥ < 1 pMpc) pairs, two of which are found to reside in cluster fields. Our results demonstrate that <2 pMpc scale quasar pairs at both redshift ranges tend to occur in massive haloes, although perhaps not the most massive ones, and that they are useful in searching for rare density peaks.

  1. Prospective very young asteroid pairs

    NASA Astrophysics Data System (ADS)

    Galád, A.; Vokrouhlický, D.; Zizka, J.

    2014-07-01

    Several tens of asteroid pairs can be discerned from the background main-belt asteroids. The majority of them are thought to have formed within only the last few 10^6 yr. The youngest recognized pairs have formed more than ≈ 10 kyr ago. As some details of pair formation are still not understood well, the study of young pairs is of great importance. It is mainly because the conditions at the time of the pair formation could be deduced much more reliably for young pairs. For example, space weathering on the surfaces of the components, or changes in their rotational properties (in spin rates, tumbling, coordinates of rotational pole) could be negligible since the formation of young pairs. Also, possible strong perturbations by main-belt bodies on pair formation can be reliably studied only for extremely young pairs. Some pairs can quickly blend in with the background asteroids, so even the frequency of asteroid pair formation could be determined more reliably based on young pairs (though only after a statistically significant sample is at disposal). In our regular search for young pairs in the growing asteroid database, only multiopposition asteroids with very similar orbital and proper elements are investigated. Every pair component is represented by a number of clones within orbital uncertainties and drifting in semimajor axis due to the Yarkovsky effect. We found that, if the previously unrecognized pairs (87887) 2000 SS_{286} - 2002 AT_{49} and (355258) 2007 LY_{4} - 2013AF_{40} formed at the recent very close approach of their components, they could become the youngest known pairs. In both cases, the relative encounter velocities of the components were only ˜ 0.1 m s^{-1}. However, the minimum distances between some clones are too large and a few clones of the latter pair did not encounter recently (within ≈ 10 kyr). The age of some prospective young pairs cannot be determined reliably without improved orbital properties (e.g., the second component of a pair (320025) 2007 DT_{76} - 2007 DP_{16}). It is because some components suffered recently repeated close approaches to Ceres or other large main-belt perturbers. In general, the uncertainties in age estimation can be heavily reduced after the physical properties (e.g., sense of rotation, shape, size, binarity) of the pair components are determined.

  2. Mimic expert judgement through automated procedure for selecting rainfall events responsible for shallow landslide: A statistical approach to validation

    NASA Astrophysics Data System (ADS)

    Giovanna, Vessia; Luca, Pisano; Carmela, Vennari; Mauro, Rossi; Mario, Parise

    2016-01-01

    This paper proposes an automated method for the selection of rainfall data (duration, D, and cumulated, E), responsible for shallow landslide initiation. The method mimics an expert person identifying D and E from rainfall records through a manual procedure whose rules are applied according to her/his judgement. The comparison between the two methods is based on 300 D-E pairs drawn from temporal rainfall data series recorded in a 30 days time-lag before the landslide occurrence. Statistical tests, employed on D and E samples considered both paired and independent values to verify whether they belong to the same population, show that the automated procedure is able to replicate the expert pairs drawn by the expert judgment. Furthermore, a criterion based on cumulated distribution functions (CDFs) is proposed to select the most related D-E pairs to the expert one among the 6 drawn from the coded procedure for tracing the empirical rainfall threshold line.

  3. Grandmothering life histories and human pair bonding.

    PubMed

    Coxworth, James E; Kim, Peter S; McQueen, John S; Hawkes, Kristen

    2015-09-22

    The evolution of distinctively human life history and social organization is generally attributed to paternal provisioning based on pair bonds. Here we develop an alternative argument that connects the evolution of human pair bonds to the male-biased mating sex ratios that accompanied the evolution of human life history. We simulate an agent-based model of the grandmother hypothesis, compare simulated sex ratios to data on great apes and human hunter-gatherers, and note associations between a preponderance of males and mate guarding across taxa. Then we explore a recent model that highlights the importance of mating sex ratios for differences between birds and mammals and conclude that lessons for human evolution cannot ignore mammalian reproductive constraints. In contradiction to our claim that male-biased sex ratios are characteristically human, female-biased ratios are reported in some populations. We consider the likelihood that fertile men are undercounted and conclude that the mate-guarding hypothesis for human pair bonds gains strength from explicit links with our grandmothering life history.

  4. Line segment confidence region-based string matching method for map conflation

    NASA Astrophysics Data System (ADS)

    Huh, Yong; Yang, Sungchul; Ga, Chillo; Yu, Kiyun; Shi, Wenzhong

    2013-04-01

    In this paper, a method to detect corresponding point pairs between polygon object pairs with a string matching method based on a confidence region model of a line segment is proposed. The optimal point edit sequence to convert the contour of a target object into that of a reference object was found by the string matching method which minimizes its total error cost, and the corresponding point pairs were derived from the edit sequence. Because a significant amount of apparent positional discrepancies between corresponding objects are caused by spatial uncertainty and their confidence region models of line segments are therefore used in the above matching process, the proposed method obtained a high F-measure for finding matching pairs. We applied this method for built-up area polygon objects in a cadastral map and a topographical map. Regardless of their different mapping and representation rules and spatial uncertainties, the proposed method with a confidence level at 0.95 showed a matching result with an F-measure of 0.894.

  5. Small nuclear RNA U2 is base-paired to heterogeneous nuclear RNA.

    PubMed

    Calvet, J P; Meyer, L M; Pederson, T

    1982-07-30

    Eukaryotic cells contain a set of low molecular weight nuclear RNA's. One of the more abundant of these is termed U2 RNA. The possibility that U2 RNA is hydrogen-bonded to complementary sequences in other nuclear RNA's was investigated. Cultured human (HeLa) cells were treated with a psoralen derivative that cross-links RNA chains that are base-paired with one another. High molecular weight heterogeneous nuclear RNA was isolated under denaturing conditions, and the psoralen cross-links were reversed. Electrophoresis of the released RNA and hybridization with a human cloned U2 DNA probe revealed that U2 is hydrogen-bonded to complementary sequences in heterogeneous nuclear RNA in vivo. In contrast, U2 RNA is not base-paired with nucleolar RNA, which contains the precursors of ribosomal RNA. The results suggest that U2 RNA participates in messenger RNA processing in the nucleus.

  6. The base pairing RNA Spot 42 participates in a multi-output feedforward loop to help enact catabolite repression in Escherichia coli

    PubMed Central

    Beisel, Chase L.; Storz, Gisela

    2011-01-01

    SUMMARY Bacteria selectively consume some carbon sources over others through a regulatory mechanism termed catabolite repression. Here, we show that the base pairing RNA Spot 42 plays a broad role in catabolite repression in Escherichia coli by directly repressing genes involved in central and secondary metabolism, redox balancing, and the consumption of diverse non-preferred carbon sources. Many of the genes repressed by Spot 42 are transcriptionally activated by the global regulator CRP. Since CRP represses Spot 42, these regulators participate in a specific regulatory circuit called a multi-output feedforward loop. We found that this loop can reduce leaky expression of target genes in the presence of glucose and can maintain repression of target genes under changing nutrient conditions. Our results suggest that base pairing RNAs in feedforward loops can help shape the steady-state levels and dynamics of gene expression. PMID:21292161

  7. Frustration across the periodic table: heterolytic cleavage of dihydrogen by metal complexes.

    PubMed

    Bullock, R Morris; Chambers, Geoffrey M

    2017-08-28

    This perspective examines frustrated Lewis pairs (FLPs) in the context of heterolytic cleavage of H 2 by transition metal complexes, with an emphasis on molecular complexes bearing an intramolecular Lewis base. FLPs have traditionally been associated with main group compounds, yet many reactions of transition metal complexes support a broader classification of FLPs that includes certain types of transition metal complexes with reactivity resembling main group-based FLPs. This article surveys transition metal complexes that heterolytically cleave H 2 , which vary in the degree that the Lewis pairs within these systems interact. Many of the examples include complexes bearing a pendant amine functioning as the base with the metal functioning as the hydride acceptor. Consideration of transition metal compounds in the context of FLPs can inspire new innovations and improvements in transition metal catalysis.This article is part of the themed issue 'Frustrated Lewis pair chemistry'. © 2017 The Author(s).

  8. Enhanced Stability of DNA Nanostructures by Incorporation of Unnatural Base Pairs.

    PubMed

    Liu, Qing; Liu, Guocheng; Wang, Ting; Fu, Jing; Li, Rujiao; Song, Linlin; Wang, Zhen-Gang; Ding, Baoquan; Chen, Fei

    2017-11-03

    Self-assembled DNA nanostructures hold great promise in the fields of nanofabrication, biosensing and nanomedicine. However, the inherent low stability of the DNA double helices, formed by weak interactions, largely hinders the assembly and functions of DNA nanostructures. In this study, we redesigned and constructed a six-arm DNA junction by incorporation of the unnatural base pairs 5-Me-isoC/isoG and A/2-thioT into the double helices. They not only retained the structural integrity of the DNA nanostructure, but also showed enhanced thermal stability and resistance to T7 Exonuclease digestion. This research may expand the applications of DNA nanostructures in nanofabrication and biomedical fields, and furthermore, the genetic alphabet expansion with unnatural base pairs may enable us to construct more complicated and diversified self-assembled DNA nanostructures. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Hydrogen bond disruption in DNA base pairs from (14)C transmutation.

    PubMed

    Sassi, Michel; Carter, Damien J; Uberuaga, Blas P; Stanek, Christopher R; Mancera, Ricardo L; Marks, Nigel A

    2014-09-04

    Recent ab initio molecular dynamics simulations have shown that radioactive carbon does not normally fragment DNA bases when it decays. Motivated by this finding, density functional theory and Bader analysis have been used to quantify the effect of C → N transmutation on hydrogen bonding in DNA base pairs. We find that (14)C decay has the potential to significantly alter hydrogen bonds in a variety of ways including direct proton shuttling (thymine and cytosine), thermally activated proton shuttling (guanine), and hydrogen bond breaking (cytosine). Transmutation substantially modifies both the absolute and relative strengths of the hydrogen bonding pattern, and in two instances (adenine and cytosine), the density at the critical point indicates development of mild covalent character. Since hydrogen bonding is an important component of Watson-Crick pairing, these (14)C-induced modifications, while infrequent, may trigger errors in DNA transcription and replication.

  10. Conformation of viroids.

    PubMed Central

    Henco, K; Riesner, D; Sanger, H L

    1977-01-01

    Viroids are uncoated infectious RNA molecules (MW 107 000-127 000) known as pathogens of certain higher plants. Thermodynamic and kinetic studies were carried out on highly purified viroid preparations by applying UV-absorption melting analysis and temperature jump methods. The thermal denaturation of viroids is characterized by high thermal stability, high cooperativity and a high degree of base pairing. Two relaxation processes could be resolved; a process in the sec range could be evaluated as an independent all-or-none-transition with the following properties: reaction enthalpy= 550 kcal/mol, activation enthalpy of the dissociation = 470 kcal/mol; G : C content = 72 %. These data indicate the existence of an uninterrupted double helix of 52 base pairs. A process in the msec range involves 15 - 25 base pairs which are most probably distributed over several short double helical stretches. A tentative model for the secondary structure of viroids isproposed and the possible functional implications of their physicochemical properties are discussed. PMID:866174

  11. Glide-plane symmetry and superconducting gap structure of iron-based superconductors

    DOE PAGES

    Wang, Yan; Berlijn, Tom; Hirschfeld, Peter J.; ...

    2015-03-10

    We consider the effect of glide-plane symmetry of the Fe-pnictogen/chalcogen layer in Fe-based superconductors on pairing in spin fluctuation models. Recent theories propose that so-called η-pairing states with nonzero total momentum can be realized and possess such exotic properties as odd parity spin singlet symmetry and time-reversal symmetry breaking. Here we show that when there is orbital weight at the Fermi level from orbitals with even and odd mirror reflection symmetry in z, η pairing is inevitable; however, we conclude from explicit calculation that the gap function appearing in observable quantities is identical to that found in earlier pseudocrystal momentummore » calculations with 1 Fe per unit cell.« less

  12. High-gain AlGaAs/GaAs double heterojunction Darlington phototransistors for optical neural networks

    NASA Technical Reports Server (NTRS)

    Kim, Jae H. (Inventor); Lin, Steven H. (Inventor)

    1991-01-01

    High-gain MOCVD-grown (metal-organic chemical vapor deposition) AlGaAs/GaAs/AlGaAs n-p-n double heterojunction bipolar transistors (DHBTs) and Darlington phototransistor pairs are provided for use in optical neural networks and other optoelectronic integrated circuit applications. The reduced base doping level used results in effective blockage of Zn out-diffusion, enabling a current gain of 500, higher than most previously reported values for Zn-diffused-base DHBTs. Darlington phototransitor pairs of this material can achieve a current gain of over 6000, which satisfies the gain requirement for optical neural network designs, which advantageously may employ neurons comprising the Darlington phototransistor pairs in series with a light source.

  13. Adjacent bin stability evaluating for feature description

    NASA Astrophysics Data System (ADS)

    Nie, Dongdong; Ma, Qinyong

    2018-04-01

    Recent study improves descriptor performance by accumulating stability votes for all scale pairs to compose the local descriptor. We argue that the stability of a bin depends on the differences across adjacent pairs more than the differences across all scale pairs, and a new local descriptor is composed based on the hypothesis. A series of SIFT descriptors are extracted from multiple scales firstly. Then the difference value of the bin across adjacent scales is calculated, and the stability value of a bin is calculated based on it and accumulated to compose the final descriptor. The performance of the proposed method is evaluated with two popular matching datasets, and compared with other state-of-the-art works. Experimental results show that the proposed method performs satisfactorily.

  14. Determination of redox potentials for the Watson-Crick base pairs, DNA nucleosides, and relevant nucleoside analogues.

    PubMed

    Crespo-Hernandez, Carlos E; Close, David M; Gorb, Leonid; Leszczynski, Jerzy

    2007-05-17

    Redox potentials for the DNA nucleobases and nucleosides, various relevant nucleoside analogues, Watson-Crick base pairs, and seven organic dyes are presented based on DFT/B3LYP/6-31++G(d,p) and B3YLP/6-311+G(2df,p)//B3LYP/6-31+G* levels of calculations. The values are determined from an experimentally calibrated set of equations that correlate the vertical ionization (electron affinity) energy of 20 organic molecules with their experimental reversible oxidation (reduction) potential. Our results are in good agreement with those estimated experimentally for the DNA nucleosides in acetonitrile solutions (Seidel et al. J. Phys. Chem. 1996, 100, 5541). We have found that nucleosides with anti conformation exhibit lower oxidation potentials than the corresponding syn conformers. The lowering in the oxidation potential is due to the formation of an intramolecular hydrogen bonding interaction between the 5'-OH group of the sugar and the N3 of the purine bases or C2=O of the pyrimidine bases in the syn conformation. Pairing of adenine or guanine with its complementary pyrimidine base decreases its oxidation potential by 0.15 or 0.28 V, respectively. The calculated energy difference between the oxidation potential for the G.C base pair and that of the guanine base is in good agreement with the experimental value estimated recently (0.34 V: Caruso, T.; et al. J. Am. Chem. Soc. 2005, 127, 15040). The complete and consistent set of reversible redox values determined in this work for the DNA constituents is expected to be of considerable value to those studying charge and electronic energy transfer in DNA.

  15. Binema bonaerensis n. sp. (Oxyurida: Thelastomatidae) parasite of Neocurtilla claraziana Saussure (Orthoptera: Gryllotalpidae) in Argentina.

    PubMed

    Camino, N B; Reboredo, G R

    1999-01-01

    The nematode Binema bonaerensis n. sp. (Oxyurida: Thelastomatidae) is described from the intestine of the mole cricket of Neocurtilla claraziana Saussure (Orthoptera: Gryllotalpidae) from Buenos Aires Province, Argentina. It is distinguished mainly by having a conical tail; three sclerotized arches in the buccal cavity; an excretory pore immediately posterior to the base of the esophagus and the presence of five pairs of male genital papillae with one pair preanal and four pairs postanal.

  16. Ponderomotive effects in multiphoton pair production

    NASA Astrophysics Data System (ADS)

    Kohlfürst, Christian; Alkofer, Reinhard

    2018-02-01

    The Dirac-Heisenberg-Wigner formalism is employed to investigate electron-positron pair production in cylindrically symmetric but otherwise spatially inhomogeneous, oscillating electric fields. The oscillation frequencies are hereby tuned to obtain multiphoton pair production in the nonperturbative threshold regime. An effective mass, as well as a trajectory-based semiclassical analysis, is introduced in order to interpret the numerical results for the distribution functions as well as for the particle yields and spectra. The results, including the asymptotic particle spectra, display clear signatures of ponderomotive forces.

  17. Cooperative Lewis pairs based on late transition metals: activation of small molecules by platinum(0) and B(C6 F5 )3.

    PubMed

    Forrest, Sebastian J K; Clifton, Jamie; Fey, Natalie; Pringle, Paul G; Sparkes, Hazel A; Wass, Duncan F

    2015-02-09

    A Lewis basic platinum(0)-CO complex supported by a diphosphine ligand and B(C6 F5 )3 act cooperatively, in a manner reminiscent of a frustrated Lewis pair, to activate small molecules such as hydrogen, CO2 , and ethene. This cooperative Lewis pair facilitates the coupling of CO and ethene in a new way. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Consistency-based rectification of nonrigid registrations

    PubMed Central

    Gass, Tobias; Székely, Gábor; Goksel, Orcun

    2015-01-01

    Abstract. We present a technique to rectify nonrigid registrations by improving their group-wise consistency, which is a widely used unsupervised measure to assess pair-wise registration quality. While pair-wise registration methods cannot guarantee any group-wise consistency, group-wise approaches typically enforce perfect consistency by registering all images to a common reference. However, errors in individual registrations to the reference then propagate, distorting the mean and accumulating in the pair-wise registrations inferred via the reference. Furthermore, the assumption that perfect correspondences exist is not always true, e.g., for interpatient registration. The proposed consistency-based registration rectification (CBRR) method addresses these issues by minimizing the group-wise inconsistency of all pair-wise registrations using a regularized least-squares algorithm. The regularization controls the adherence to the original registration, which is additionally weighted by the local postregistration similarity. This allows CBRR to adaptively improve consistency while locally preserving accurate pair-wise registrations. We show that the resulting registrations are not only more consistent, but also have lower average transformation error when compared to known transformations in simulated data. On clinical data, we show improvements of up to 50% target registration error in breathing motion estimation from four-dimensional MRI and improvements in atlas-based segmentation quality of up to 65% in terms of mean surface distance in three-dimensional (3-D) CT. Such improvement was observed consistently using different registration algorithms, dimensionality (two-dimensional/3-D), and modalities (MRI/CT). PMID:26158083

  19. Modified Extraction-Free Ion-Pair Methods for the Determination of Flunarizine Dihydrochloride in Bulk Drug, Tablets, and Human Urine

    NASA Astrophysics Data System (ADS)

    Prashanth, K. N.; Basavaiah, K.

    2018-01-01

    Two simple and sensitive extraction-free spectrophotometric methods are described for the determination of flunarizine dihydrochloride. The methods are based on the ion-pair complex formation between the nitrogenous compound flunarizine (FNZ), converted from flunarizine dihydrochloride (FNH), and the acidic dye phenol red (PR), in which experimental variables were circumvented. The first method (method A) is based on the formation of a yellow-colored ion-pair complex (1:1 drug:dye) between FNZ and PR in chloroform, which is measured at 415 nm. In the second method (method B), the formed drug-dye ion-pair complex is treated with ethanolic potassium hydroxide in an ethanolic medium, and the resulting base form of the dye is measured at 580 nm. The stoichiometry of the formed ion-pair complex between the drug and dye (1:1) is determined by Job's continuous variations method, and the stability constant of the complex is also calculated. These methods quantify FNZ over the concentration ranges 5.0-70.0 in method A and 0.5-7.0 μg/mL in method B. The calculated molar absorptivities are 6.17 × 103 and 5.5 × 104 L/mol·cm-1 for method A and method B, respectively, with corresponding Sandell sensitivity values of 0.0655 and 0.0074 μg/cm2. The methods are applied to the determination of FNZ in pure drug and human urine.

  20. Robust transcriptional tumor signatures applicable to both formalin-fixed paraffin-embedded and fresh-frozen samples

    PubMed Central

    Cheng, Jun; He, Jun; Liu, Huaping; Cai, Hao; Hong, Guini; Zhang, Jiahui; Li, Na; Ao, Lu; Guo, Zheng

    2017-01-01

    Formalin-fixed paraffin-embedded (FFPE) samples represent a valuable resource for clinical researches. However, FFPE samples are usually considered an unreliable source for gene expression analysis due to the partial RNA degradation. In this study, through comparing gene expression profiles between FFPE samples and paired fresh-frozen (FF) samples for three cancer types, we firstly showed that expression measurements of thousands of genes had at least two-fold change in FFPE samples compared with paired FF samples. Therefore, for a transcriptional signature based on risk scores summarized from the expression levels of the signature genes, the risk score thresholds trained from FFPE (or FF) samples could not be applied to FF (or FFPE) samples. On the other hand, we found that more than 90% of the relative expression orderings (REOs) of gene pairs in the FF samples were maintained in their paired FFPE samples and largely unaffected by the storage time. The result suggested that the REOs of gene pairs were highly robust against partial RNA degradation in FFPE samples. Finally, as a case study, we developed a REOs-based signature to distinguish liver cirrhosis from hepatocellular carcinoma (HCC) using FFPE samples. The signature was validated in four datasets of FFPE samples and eight datasets of FF samples. In conclusion, the valuable FFPE samples can be fully exploited to identify REOs-based diagnostic and prognostic signatures which could be robustly applicable to both FF samples and FFPE samples with degraded RNA. PMID:28036264

  1. Titi Monkeys as a Novel Non-Human Primate Model for the Neurobiology of Pair Bonding


    PubMed Central

    Bales, Karen L.; Arias del Razo, Rocío; Conklin, Quinn A.; Hartman, Sarah; Mayer, Heather S.; Rogers, Forrest D.; Simmons, Trenton C.; Smith, Leigh K.; Williams, Alexia; Williams, Donald R.; Witczak, Lynea R.; Wright, Emily C.

    2017-01-01

    It is now widely recognized that social bonds are critical to human health and well-being. One of the most important social bonds is the attachment relationship between two adults, known as the pair bond. The pair bond involves many characteristics that are inextricably linked to quality of health, including providing a secure psychological base and acting as a social buffer against stress. The majority of our knowledge about the neurobiology of pair bonding comes from studies of a socially monogamous rodent, the prairie vole (Microtus ochrogaster), and from human imaging studies, which inherently lack control. Here, we first review what is known of the neurobiology of pair bonding from humans and prairie voles. We then present a summary of the studies we have conducted in titi monkeys (Callicebus cupreus)—a species of socially monogamous New World primates. Finally, we construct a neural model based on the location of neuropeptide receptors in the titi monkey brain, as well as the location of neural changes in our imaging studies, with some basic assumptions based on the prairie vole model. In this model, we emphasize the role of visual mating stimuli as well as contributions of the dopaminergic reward system and a strong role for the lateral septum. This model represents an important step in understanding the neurobiology of social bonds in non-human primates, which will in turn facilitate a better understanding of these mechanisms in humans. PMID:28955178

  2. Effect of Watson-Crick and Hoogsteen base pairing on the conformational stability of C8-phenoxyl-2'-deoxyguanosine adducts.

    PubMed

    Millen, Andrea L; Churchill, Cassandra D M; Manderville, Richard A; Wetmore, Stacey D

    2010-10-14

    Bulky DNA addition products (adducts) formed through attack at the C8 site of guanine can adopt the syn orientation about the glycosidic bond due to changes in conformational stability or hydrogen-bonding preferences directly arising from the bulky group. Indeed, the bulky substituent may improve the stability of (non-native) Hoogsteen pairs. Therefore, such adducts often result in mutations upon DNA replication. This work examines the hydrogen-bonded pairs between the Watson-Crick and Hoogsteen faces of the ortho or para C8-phenoxyl-2'-deoxyguanosine adduct and each natural (undamaged) nucleobase with the goal to clarify the conformational preference of this type of damage, as well as provide insight into the likelihood of subsequent mutation events. B3LYP/6-311+G(2df,p)//B3LYP/6-31G(d) hydrogen-bond strengths were determined using both nucleobase and nucleoside models for adduct pairs, as well as the corresponding complexes involving natural 2'-deoxyguanosine. In addition to the magnitude of the binding strengths, the R(C1'···C1') distances and ∠(N9C1'C1') angles, as well as the degree of propeller-twist and buckle distortions, were carefully compared to the values observed in natural DNA strands. Due to structural changes in the adduct monomer upon inclusion of the sugar moiety, the monomer deformation energy significantly affects the relative hydrogen-bond strengths calculated with the nucleobase and nucleoside models. Therefore, we recommend the use of at least a nucleoside model to accurately evaluate hydrogen-bond strengths of base pairs involving flexible, bulky nucleobase adducts. Our results also emphasize the importance of considering both the magnitude of the hydrogen-bond strength and the structure of the base pair when predicting the preferential binding patterns of nucleobases. Using our best models, we conclude that the Watson-Crick face of the ortho phenoxyl adduct forms significantly more stable complexes than the Hoogsteen face, which implies that the anti orientation of the damaged base will be favored by hydrogen bonding in DNA helices. Additionally, regardless of the hydrogen-bonding face involved, cytosine forms the most stable base pair with the ortho adduct, which implies that misincorporation due to this type of damage is unlikely. Similarly, cytosine is the preferred binding partner for the Watson-Crick face of the para adduct. However, Hoogsteen interactions with the para adduct are stronger than those with natural 2'-deoxyguanosine or the ortho adduct, and this form of damage binds with nearly equal stability to both cytosine and guanine in the Hoogsteen orientation. Therefore, the para adduct may adopt multiple orientations in DNA helices and potentially cause mutations by forming pairs with different natural bases. Models of oligonucleotide duplexes must be used in future work to further evaluate other factors (stacking, major groove contacts) that may influence the conformation and binding preference of these adducts in DNA helices.

  3. Drell-Yan Lepton pair production at NNLO QCD with parton showers

    DOE PAGES

    Hoeche, Stefan; Li, Ye; Prestel, Stefan

    2015-04-13

    We present a simple approach to combine NNLO QCD calculations and parton showers, based on the UNLOPS technique. We apply the method to the computation of Drell-Yan lepton-pair production at the Large Hadron Collider. We comment on possible improvements and intrinsic uncertainties.

  4. Use of Paired Serum Samples for Serodiagnosis of Typhoid Fever

    PubMed Central

    House, Deborah; Chinh, Nguyen T.; Diep, To S.; Parry, Christopher M.; Wain, John; Dougan, Gordon; White, Nicholas J.; Hien, Tran Tinh; Farrar, Jeremy J.

    2005-01-01

    Using an enzyme-linked immunosorbent assay we demonstrate that, in adult patients with typhoid fever, the sensitivity of a serological test based on the detection of anti-lipopolysaccharide immunoglobulin G is increased when used with paired serum samples taken 1 week apart. PMID:16145168

  5. An interatomic pair potential for cadmium selenide

    NASA Astrophysics Data System (ADS)

    Rabani, Eran

    2002-01-01

    We have developed a set of interatomic pair potentials for cadmium selenide based on a form similar to the Born-Mayer model. We show that this simple form of the pair potential, which has been used to describe the properties of alkali halides in the sixfold-coordinate structure, provides a realistic description of the properties of cadmium selenide in all three crystal structures: wurtzite, zinc blende, and rocksalt. Using the new pair potential we have studied the pressure-induced phase transition from the fourfold-coordinate wurtzite structure to the sixfold-coordinate rocksalt structure. The pressure transformation and the equation of state are in good agreement with experimental observations. Using the dispersion term in our pair potential we have also calculated the Hamaker constant for cadmium selenide within the framework of the original microscopic approach due to Hamaker. The results indicate that for ionic materials many-body terms that are included in the Lifshitz theory are well captured by the simple pair potential.

  6. Understanding the differences between genome sequences of Escherichia coli B strains REL606 and BL21(DE3), and comparison of the closely related E. coli B and K-12 genomes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Studier, F.W.; Daegelen, P.; Lenski, R. E.

    2009-12-01

    Each difference between the genome sequences of Escherichia coli B strains REL606 and BL21(DE3) can be interpreted in light of known laboratory manipulations plus a gene conversion between ribosomal RNA operons. Two treatments with 1-methyl-3-nitro-1-nitrosoguanidine in the REL606 lineage produced at least 93 single-base-pair mutations ({approx} 90% GC-to-AT transitions) and 3 single-base-pair GC deletions. Two UV treatments in the BL21(DE3) lineage produced only 4 single-base-pair mutations but 16 large deletions. P1 transductions from K-12 into the two B lineages produced 317 single-base-pair differences and 9 insertions or deletions, reflecting differences between B DNA in BL21(DE3) and integrated restriction fragments ofmore » K-12 DNA inherited by REL606. Two sites showed selective enrichment of spontaneous mutations. No unselected spontaneous single-base-pair mutations were evident. The genome sequences revealed that a progenitor of REL606 had been misidentified, explaining initially perplexing differences. Limited sequencing of other B strains defined characteristic properties of B and allowed assembly of the inferred genome of the ancestral B of Delbrueck and Luria. Comparison of the B and K-12 genomes shows that more than half of the 3793 proteins of their basic genomes are predicted to be identical, although {approx} 310 appear to be functional in either B or K-12 but not in both. The ancestral basic genome appears to have had {approx} 4039 coding sequences occupying {approx} 4.0 Mbp. Repeated horizontal transfer from diverged Escherichia coli genomes and homologous recombination may explain the observed variable distribution of single-base-pair differences. Fifteen sites are occupied by phage-related elements, but only six by comparable elements at the same site. More than 50 sites are occupied by IS elements in both B and K, 16 in common, and likely founding IS elements are identified. A signature of widespread cryptic phage P4-type mobile elements was identified. Complex deletions (dense clusters of small deletions and substitutions) apparently removed nonessential genes from {approx} 30 sites in the basic genomes.« less

  7. Functional base-pairing interaction between highly conserved elements of U3 small nucleolar RNA and the small ribosomal subunit RNA.

    PubMed

    Hughes, J M

    1996-06-21

    The U3 nucleolar RNA has a remarkably wide phyletic distribution extending from the Eukarya to the Archaea. It functions in maturation of the small subunit (SSU) rRNA through a mechanism which is as yet unknown but which involves base-pairing with pre-rRNA. The most conserved part of U3 is within 30 nucleotides of the 5' end, but as yet no function for this domain has been proposed. Elements within this domain are complementary to highly conserved sequences in the SSU rRNA which, in the mature form, fold into a universally conserved pseudoknot. The nature of the complementarity suggests a novel mechanism for U3 function whereby U3 facilitates correct folding of the pseudoknot. Wide phylogenetic comparison provides compelling evidence in support of the interaction in that significant complementary changes have taken place, particularly in the archaeon Sulfolobus, which maintain the base-pairing. Base-substitution mutations in yeast U3 designed to disrupt the base-pairing indicate that the interaction is probably essential. These include cold-sensitivity mutations which exhibit phenotypes similar to U3-depletion, but without impairment of the AO processing step, which occurs within the 5' ETS. These phenotypes are consistent with the destabilization of SSU precursors and partial impairment of the processing steps A1, at the 5' ETS/18 S boundary, and A2, within the ITS1.

  8. Physics of base-pairing dynamics in DNA

    NASA Astrophysics Data System (ADS)

    Manghi, Manoel; Destainville, Nicolas

    2016-05-01

    As a key molecule of life, Deoxyribo-Nucleic Acid (DNA) is the focus of numbers of investigations with the help of biological, chemical and physical techniques. From a physical point of view, both experimental and theoretical works have brought quantitative insights into DNA base-pairing dynamics that we review in this Report, putting emphasis on theoretical developments. We discuss the dynamics at the base-pair scale and its pivotal coupling with the polymer one, with a polymerization index running from a few nucleotides to tens of kilo-bases. This includes opening and closure of short hairpins and oligomers as well as zipping and unwinding of long macromolecules. We review how different physical mechanisms are either used by Nature or utilized in biotechnological processes to separate the two intertwined DNA strands, by insisting on quantitative results. They go from thermally-assisted denaturation bubble nucleation to force- or torque-driven mechanisms. We show that the helical character of the molecule, possibly supercoiled, can play a key role in many denaturation and renaturation processes. We categorize the mechanisms according to the relative timescales associated with base-pairing and chain orientational degrees of freedom such as bending and torsional elastic ones. In some specific situations, these chain orientational degrees of freedom can be integrated out, and the quasi-static approximation is valid. The complex dynamics then reduces to the diffusion in a low-dimensional free-energy landscape. In contrast, some important cases of experimental interest necessarily appeal to far-from-equilibrium statistical mechanics and hydrodynamics.

  9. Life Detection Using Glucose and Tetrasaccharide Enantiomer Pairs

    NASA Astrophysics Data System (ADS)

    Warmflash, David; Chu, Huanyi; Siefert, Johnathan; Fox, George E.

    2009-04-01

    A life-detection system based on the expectation that any viable organism will utilize stereoisomers of a given compound asymmetrically is examined. Aqueous extracts of common soil, Mars regolith simulant JSC Mars-1, and suspensions of E. coli and S. cerevisiae were incubated with stereoisomer pairs. The enantiomeric pairs were either D- and L-glucose or a pair of chiral tetrasaccharides. Following an incubation period of 10 days, stereoisomeric selectivity is detectable with the glucose pair by mass spectrometry in extracts made from soil at 0.5 g/ml, in extracts made from JSC Mars-1 at 2.5 g/ml, and in cell suspensions down to 1.0 × 107 cells/ml. For the tetrasaccharide pair, stereoisomeric selectivity was detected in extracts made from 0.5 g/ml or more of common soil but not in JSC Mars-1 simulant. The effective sensitivity in extracts was 2.5 × 107 cells/ml or better for the glucose pair and 5.0 × 108 cells/ml or better for the tetrasaccharide pair. The sensitivity of the glucose pair was such that it could detect life in samples that would be found to be devoid of organic matter by the GCMS system carried by the Viking landers. The results demonstrate the utility of the approach in the search for biological activity on Mars. However, sensitivity is a function of the enantiomer pair used, and this might also be different for hypothetical martian organisms. Therefore, it will be necessary to characterize additional stereoisomeric pairs and, ultimately, to include several in a single test environment.

  10. Life detection using glucose and tetrasaccharide enantiomer pairs.

    PubMed

    Warmflash, David; Chu, Huanyi; Siefert, Johnathan; Fox, George E

    2009-04-01

    A life-detection system based on the expectation that any viable organism will utilize stereoisomers of a given compound asymmetrically is examined. Aqueous extracts of common soil, Mars regolith simulant JSC Mars-1, and suspensions of E. coli and S. cerevisiae were incubated with stereoisomer pairs. The enantiomeric pairs were either D- and L-glucose or a pair of chiral tetrasaccharides. Following an incubation period of 10 days, stereoisomeric selectivity is detectable with the glucose pair by mass spectrometry in extracts made from soil at 0.5 g/ml, in extracts made from JSC Mars-1 at 2.5 g/ml, and in cell suspensions down to 1.0 x 10(7) cells/ml. For the tetrasaccharide pair, stereoisomeric selectivity was detected in extracts made from 0.5 g/ml or more of common soil but not in JSC Mars-1 simulant. The effective sensitivity in extracts was 2.5 x 10(7) cells/ml or better for the glucose pair and 5.0 x 10(8) cells/ml or better for the tetrasaccharide pair. The sensitivity of the glucose pair was such that it could detect life in samples that would be found to be devoid of organic matter by the GCMS system carried by the Viking landers. The results demonstrate the utility of the approach in the search for biological activity on Mars. However, sensitivity is a function of the enantiomer pair used, and this might also be different for hypothetical martian organisms. Therefore, it will be necessary to characterize additional stereoisomeric pairs and, ultimately, to include several in a single test environment.

  11. MHC class II-assortative mate choice in European badgers (Meles meles).

    PubMed

    Sin, Yung Wa; Annavi, Geetha; Newman, Chris; Buesching, Christina; Burke, Terry; Macdonald, David W; Dugdale, Hannah L

    2015-06-01

    The major histocompatibility complex (MHC) plays a crucial role in the immune system, and in some species, it is a target by which individuals choose mates to optimize the fitness of their offspring, potentially mediated by olfactory cues. Under the genetic compatibility hypothesis, individuals are predicted to choose mates with compatible MHC alleles, to increase the fitness of their offspring. Studies of MHC-based mate choice in wild mammals are under-represented currently, and few investigate more than one class of MHC genes. We investigated mate choice based on the compatibility of MHC class I and II genes in a wild population of European badgers (Meles meles). We also investigated mate choice based on microsatellite-derived pairwise relatedness, to attempt to distinguish MHC-specific effects from genomewide effects. We found MHC-assortative mating, based on MHC class II, but not class I genes. Parent pairs had smaller MHC class II DRB amino acid distances and smaller functional distances than expected from random pairings. When we separated the analyses into within-group and neighbouring-group parent pairs, only neighbouring-group pairs showed MHC-assortative mating, due to similarity at MHC class II loci. Our randomizations showed no evidence of genomewide-based inbreeding, based on 35 microsatellite loci; MHC class II similarity was therefore the apparent target of mate choice. We propose that MHC-assortative mate choice may be a local adaptation to endemic pathogens, and this assortative mate choice may have contributed to the low MHC genetic diversity in this population. © 2015 The Authors. Molecular Ecology published by John Wiley & Sons Ltd.

  12. Estimating Exceptionally Rare Germline and Somatic Mutation Frequencies via Next Generation Sequencing

    PubMed Central

    Yoon, Song-Ro; Arnheim, Norman; Calabrese, Peter

    2016-01-01

    We used targeted next generation deep-sequencing (Safe Sequencing System) to measure ultra-rare de novo mutation frequencies in the human male germline by attaching a unique identifier code to each target DNA molecule. Segments from three different human genes (FGFR3, MECP2 and PTPN11) were studied. Regardless of the gene segment, the particular testis donor or the 73 different testis pieces used, the frequencies for any one of the six different mutation types were consistent. Averaging over the C>T/G>A and G>T/C>A mutation types the background mutation frequency was 2.6x10-5 per base pair, while for the four other mutation types the average background frequency was lower at 1.5x10-6 per base pair. These rates far exceed the well documented human genome average frequency per base pair (~10−8) suggesting a non-biological explanation for our data. By computational modeling and a new experimental procedure to distinguish between pre-mutagenic lesion base mismatches and a fully mutated base pair in the original DNA molecule, we argue that most of the base-dependent variation in background frequency is due to a mixture of deamination and oxidation during the first two PCR cycles. Finally, we looked at a previously studied disease mutation in the PTPN11 gene and could easily distinguish true mutations from the SSS background. We also discuss the limits and possibilities of this and other methods to measure exceptionally rare mutation frequencies, and we present calculations for other scientists seeking to design their own such experiments. PMID:27341568

  13. Lewis pair polymerization by classical and frustrated Lewis pairs: acid, base and monomer scope and polymerization mechanism.

    PubMed

    Zhang, Yuetao; Miyake, Garret M; John, Mallory G; Falivene, Laura; Caporaso, Lucia; Cavallo, Luigi; Chen, Eugene Y-X

    2012-08-14

    Classical and frustrated Lewis pairs (LPs) of the strong Lewis acid (LA) Al(C(6)F(5))(3) with several Lewis base (LB) classes have been found to exhibit exceptional activity in the Lewis pair polymerization (LPP) of conjugated polar alkenes such as methyl methacrylate (MMA) as well as renewable α-methylene-γ-butyrolactone (MBL) and γ-methyl-α-methylene-γ-butyrolactone (γ-MMBL), leading to high molecular weight polymers, often with narrow molecular weight distributions. This study has investigated a large number of LPs, consisting of 11 LAs as well as 10 achiral and 4 chiral LBs, for LPP of 12 monomers of several different types. Although some more common LAs can also be utilized for LPP, Al(C(6)F(5))(3)-based LPs are far more active and effective than other LA-based LPs. On the other hand, several classes of LBs, when paired with Al(C(6)F(5))(3), can render highly active and effective LPP of MMA and γ-MMBL; such LBs include phosphines (e.g., P(t)Bu(3)), chiral chelating diphosphines, N-heterocyclic carbenes (NHCs), and phosphazene superbases (e.g., P(4)-(t)Bu). The P(4)-(t)Bu/Al(C(6)F(5))(3) pair exhibits the highest activity of the LP series, with a remarkably high turn-over frequency of 9.6 × 10(4) h(-1) (0.125 mol% catalyst, 100% MMA conversion in 30 s, M(n) = 2.12 × 10(5) g mol(-1), PDI = 1.34). The polymers produced by LPs at RT are typically atactic (P(γ)MMBL with ∼47% mr) or syndio-rich (PMMA with ∼70-75% rr), but highly syndiotactic PMMA with rr ∼91% can be produced by chiral or achiral LPs at -78 °C. Mechanistic studies have identified and structurally characterized zwitterionic phosphonium and imidazolium enolaluminates as the active species of the current LPP system, which are formed by the reaction of the monomer·Al(C(6)F(5))(3) adduct with P(t)Bu(3) and NHC bases, respectively. Kinetic studies have revealed that the MMA polymerization by the (t)Bu(3)P/Al(C(6)F(5))(3) pair is zero-order in monomer concentration after an initial induction period, and the polymerization is significantly catalyzed by the LA, thus pointing to a bimetallic, activated monomer propagation mechanism. Computational study on the active species formation as well as the chain initiation and propagation events involved in the LPP of MMA with some of the most representative LPs has added our understanding of fundamental steps of LPP. The main difference between NHC and PR(3) bases is in the energetics of zwitterion formation, with the NHC-based zwitterions being remarkably more stable than the PR(3)-based zwitterions. Comparison of the monometallic and bimetallic mechanisms for MMA addition shows a clear preference for the bimetallic mechanism.

  14. Heterospecific pairing and hybridization between Nasutitermes corniger and N. ephratae

    NASA Astrophysics Data System (ADS)

    Hartke, Tamara R.; Rosengaus, Rebeca B.

    2011-09-01

    The sympatric neotropical termites Nasutitermes corniger and Nasutitermes ephratae are clearly distinguishable based on morphology, nest architecture, defensive secretion composition, and molecular markers. However, given the extensive ecological, geographical, and behavioral overlap of these closely related species, the potential for interbreeding may exist. To explore this possibility, heterospecific pairs were formed experimentally to examine courtship and colony-establishment behaviors, and reproductive potential. Courtship and nest construction behavior occurred in heterospecific pairs in a similar manner to that of conspecific pairs. Survival of pairs depended upon the species of the female partner. N. ephratae females paired with N. corniger males produced as many offspring as conspecific pairs. N. corniger females mated to N. ephratae males, however, produced significantly fewer offspring at 60 days post-establishment than the reciprocal cross or conspecific N. ephratae or N. corniger pairs. This was also the only pairing in which any aggression was observed. Heterospecific pairs and groups formed in mate choice mesocosms, suggesting that species recognition between these two termites is not an important aspect of mate choice. Overall, species mismatch tolerance and hybrid offspring viability are high. The present data, together with previous evidence from defensive secretions and isozyme analysis, suggest that hybridization may periodically occur in nature, and that reproductive barriers between these two species may be incomplete. Hybridization could provide a rare but important source of genetic diversity and may ensure mating opportunities for the more abundant sex of alates in each species.

  15. Structural Mechanism behind Distinct Efficiency of Oct4/Sox2 Proteins in Differentially Spaced DNA Complexes

    PubMed Central

    Yesudhas, Dhanusha; Anwar, Muhammad Ayaz; Panneerselvam, Suresh; Durai, Prasannavenkatesh; Shah, Masaud; Choi, Sangdun

    2016-01-01

    The octamer-binding transcription factor 4 (Oct4) and sex-determining region Y (SRY)-box 2 (Sox2) proteins induce various transcriptional regulators to maintain cellular pluripotency. Most Oct4/Sox2 complexes have either 0 base pairs (Oct4/Sox20bp) or 3 base pairs (Oct4/Sox23bp) separation between their DNA-binding sites. Results from previous biochemical studies have shown that the complexes separated by 0 base pairs are associated with a higher pluripotency rate than those separated by 3 base pairs. Here, we performed molecular dynamics (MD) simulations and calculations to determine the binding free energy and per-residue free energy for the Oct4/Sox20bp and Oct4/Sox23bp complexes to identify structural differences that contribute to differences in induction rate. Our MD simulation results showed substantial differences in Oct4/Sox2 domain movements, as well as secondary-structure changes in the Oct4 linker region, suggesting a potential reason underlying the distinct efficiencies of these complexes during reprogramming. Moreover, we identified key residues and hydrogen bonds that potentially facilitate protein-protein and protein-DNA interactions, in agreement with previous experimental findings. Consequently, our results confess that differential spacing of the Oct4/Sox2 DNA binding sites can determine the magnitude of transcription of the targeted genes during reprogramming. PMID:26790000

  16. The integrity of the G2421-C2395 base pair in the ribosomal E-site is crucial for protein synthesis

    PubMed Central

    Koch, Miriam; Clementi, Nina; Rusca, Nicola; Vögele, Paul; Erlacher, Matthias; Polacek, Norbert

    2015-01-01

    During the elongation cycle of protein biosynthesis, tRNAs traverse through the ribosome by consecutive binding to the 3 ribosomal binding sites (A-, P-, and E- sites). While the ribosomal A- and P-sites have been functionally well characterized in the past, the contribution of the E-site to protein biosynthesis is still poorly understood in molecular terms. Previous studies suggested an important functional interaction of the terminal residue A76 of E-tRNA with the nucleobase of the universally conserved 23S rRNA residue C2394. Using an atomic mutagenesis approach to introduce non-natural nucleoside analogs into the 23S rRNA, we could show that removal of the nucleobase or the ribose 2'-OH at C2394 had no effect on protein synthesis. On the other hand, our data disclose the importance of the highly conserved E-site base pair G2421-C2395 for effective translation. Ribosomes with a disrupted G2421-C2395 base pair are defective in tRNA binding to the E-site. This results in an impaired translation of genuine mRNAs, while homo-polymeric templates are not affected. Cumulatively our data emphasize the importance of E-site tRNA occupancy and in particular the intactness of the 23S rRNA base pair G2421-C2395 for productive protein biosynthesis. PMID:25826414

  17. The influence of anharmonic and solvent effects on the theoretical vibrational spectra of the guanine-cytosine base pairs in Watson-Crick and Hoogsteen configurations.

    PubMed

    Bende, Attila; Muntean, Cristina M

    2014-03-01

    The theoretical IR and Raman spectra of the guanine-cytosine DNA base pairs in Watson-Crick and Hoogsteen configurations were computed using DFT method with M06-2X meta-hybrid GGA exchange-correlation functional, including the anharmonic corrections and solvent effects. The results for harmonic frequencies and their anharmonic corrections were compared with our previously calculated values obtained with the B3PW91 hybrid GGA functional. Significant differences were obtained for the anharmonic corrections calculated with the two different DFT functionals, especially for the stretching modes, while the corresponding harmonic frequencies did not differ considerable. For the Hoogtseen case the H⁺ vibration between the G-C base pair can be characterized as an asymmetric Duffing oscillator and therefore unrealistic anharmonic corrections for normal modes where this proton vibration is involved have been obtained. The spectral modification due to the anharmonic corrections, solvent effects and the influence of sugar-phosphate group for the Watson-Crick and Hoogsteen base pair configurations, respectively, were also discussed. For the Watson-Crick case also the influence of the stacking interaction on the theoretical IR and Raman spectra was analyzed. Including the anharmonic correction in our normal mode analysis is essential if one wants to obtain correct assignments of the theoretical frequency values as compared with the experimental spectra.

  18. NMR studies of DNA oligomers and their interactions with minor groove binding ligands

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fagan, Patricia A.

    1996-05-01

    The cationic peptide ligands distamycin and netropsin bind noncovalently to the minor groove of DNA. The binding site, orientation, stoichiometry, and qualitative affinity of distamycin binding to several short DNA oligomers were investigated by NMR spectroscopy. The oligomers studied contain A,T-rich or I,C-rich binding sites, where I = 2-desaminodeoxyguanosine. I•C base pairs are functional analogs of A•T base pairs in the minor groove. The different behaviors exhibited by distamycin and netropsin binding to various DNA sequences suggested that these ligands are sensitive probes of DNA structure. For sites of five or more base pairs, distamycin can form 1:1 or 2:1more » ligand:DNA complexes. Cooperativity in distamycin binding is low in sites such as AAAAA which has narrow minor grooves, and is higher in sites with wider minor grooves such as ATATAT. The distamycin binding and base pair opening lifetimes of I,C-containing DNA oligomers suggest that the I,C minor groove is structurally different from the A,T minor groove. Molecules which direct chemistry to a specific DNA sequence could be used as antiviral compounds, diagnostic probes, or molecular biology tools. The author studied two ligands in which reactive groups were tethered to a distamycin to increase the sequence specificity of the reactive agent.« less

  19. A robust fingerprint matching algorithm based on compatibility of star structures

    NASA Astrophysics Data System (ADS)

    Cao, Jia; Feng, Jufu

    2009-10-01

    In fingerprint verification or identification systems, most minutiae-based matching algorithms suffered from the problems of non-linear distortion and missing or faking minutiae. Local structures such as triangle or k-nearest structure are widely used to reduce the impact of non-linear distortion, but are suffered from missing and faking minutiae. In our proposed method, star structure is used to present local structure. A star structure contains various number of minutiae, thus, it is more robust with missing and faking minutiae. Our method consists of four steps: 1) Constructing star structures at minutia level; 2) Computing similarity score for each structure pair, and eliminating impostor matched pairs which have the low scores. As it is generally assumed that there is only linear distortion in local area, the similarity is defined by rotation and shifting. 3) Voting for remained matched pairs according to the compatibility between them, and eliminating impostor matched pairs which gain few votes. The concept of compatibility is first introduced by Yansong Feng [4], the original definition is only based on triangles. We define the compatibility for star structures to adjust to our proposed algorithm. 4) Computing the matching score, based on the number of matched structures and their voting scores. The score also reflects the fact that, it should get higher score if minutiae match in more intensive areas. Experiments evaluated on FVC 2004 show both effectiveness and efficiency of our methods.

  20. A nucleobase-centered coarse-grained representation for structure prediction of RNA motifs

    PubMed Central

    Poblete, Simón; Bottaro, Sandro; Bussi, Giovanni

    2018-01-01

    Abstract We introduce the SPlit-and-conQueR (SPQR) model, a coarse-grained (CG) representation of RNA designed for structure prediction and refinement. In our approach, the representation of a nucleotide consists of a point particle for the phosphate group and an anisotropic particle for the nucleoside. The interactions are, in principle, knowledge-based potentials inspired by the \\documentclass[12pt]{minimal} \\usepackage{amsmath} \\usepackage{wasysym} \\usepackage{amsfonts} \\usepackage{amssymb} \\usepackage{amsbsy} \\usepackage{upgreek} \\usepackage{mathrsfs} \\setlength{\\oddsidemargin}{-69pt} \\begin{document} }{}$\\mathcal {E}$\\end{document}SCORE function, a base-centered scoring function. However, a special treatment is given to base-pairing interactions and certain geometrical conformations which are lost in a raw knowledge-based model. This results in a representation able to describe planar canonical and non-canonical base pairs and base–phosphate interactions and to distinguish sugar puckers and glycosidic torsion conformations. The model is applied to the folding of several structures, including duplexes with internal loops of non-canonical base pairs, tetraloops, junctions and a pseudoknot. For the majority of these systems, experimental structures are correctly predicted at the level of individual contacts. We also propose a method for efficiently reintroducing atomistic detail from the CG representation. PMID:29272539

  1. Method for sequencing DNA base pairs

    DOEpatents

    Sessler, A.M.; Dawson, J.

    1993-12-14

    The base pairs of a DNA structure are sequenced with the use of a scanning tunneling microscope (STM). The DNA structure is scanned by the STM probe tip, and, as it is being scanned, the DNA structure is separately subjected to a sequence of infrared radiation from four different sources, each source being selected to preferentially excite one of the four different bases in the DNA structure. Each particular base being scanned is subjected to such sequence of infrared radiation from the four different sources as that particular base is being scanned. The DNA structure as a whole is separately imaged for each subjection thereof to radiation from one only of each source. 6 figures.

  2. Binary Star Orbits. IV. Orbits of 18 Southern Interferometric Pairs

    NASA Astrophysics Data System (ADS)

    Mason, Brian D.; Hartkopf, William I.; Tokovinin, Andrei

    2010-09-01

    First orbits are presented for 3 interferometric pairs and revised solutions for 15 others, based in part on first results from a recently initiated program of speckle interferometric observations of neglected southern binaries. Eight of these systems contain additional components, with multiplicity ranging up to 6.

  3. Heritability of Autism Spectrum Disorder in a UK Population-Based Twin Sample

    PubMed Central

    Colvert, Emma; Tick, Beata; McEwen, Fiona; Stewart, Catherine; Curran, Sarah R.; Woodhouse, Emma; Gillan, Nicola; Hallett, Victoria; Lietz, Stephanie; Garnett, Tracy; Ronald, Angelica; Plomin, Robert; Rijsdijk, Frühling; Happé, Francesca; Bolton, Patrick

    2016-01-01

    IMPORTANCE Most evidence to date highlights the importance of genetic influences on the liability to autism and related traits. However, most of these findings are derived from clinically ascertained samples, possibly missing individuals with subtler manifestations, and obtained estimates may not be representative of the population. OBJECTIVES To establish the relative contributions of genetic and environmental factors in liability to autism spectrum disorder (ASD) and a broader autism phenotype in a large population-based twin sample and to ascertain the genetic/environmental relationship between dimensional trait measures and categorical diagnostic constructs of ASD. DESIGN, SETTING, AND PARTICIPANTS We used data from the population-based cohort Twins Early Development Study, which included all twin pairs born in England and Wales from January 1, 1994, through December 31, 1996. We performed joint continuous-ordinal liability threshold model fitting using the full information maximum likelihood method to estimate genetic and environmental parameters of covariance. Twin pairs underwent the following assessments: the Childhood Autism Spectrum Test (CAST) (6423 pairs; mean age, 7.9 years), the Development and Well-being Assessment (DAWBA) (359 pairs; mean age, 10.3 years), the Autism Diagnostic Observation Schedule (ADOS) (203 pairs; mean age, 13.2 years), the Autism Diagnostic Interview–Revised (ADI-R) (205 pairs; mean age, 13.2 years), and a best-estimate diagnosis (207 pairs). MAIN OUTCOMES AND MEASURES Participants underwent screening using a population-based measure of autistic traits (CAST assessment), structured diagnostic assessments (DAWBA, ADI-R, and ADOS), and a best-estimate diagnosis. RESULTS On all ASD measures, correlations among monozygotic twins (range, 0.77-0.99) were significantly higher than those for dizygotic twins (range, 0.22-0.65), giving heritability estimates of 56% to 95%. The covariance of CAST and ASD diagnostic status (DAWBA, ADOS and best-estimate diagnosis) was largely explained by additive genetic factors (76%-95%). For the ADI-R only, shared environmental influences were significant (30% [95% CI, 8%-47%]) but smaller than genetic influences (56% [95% CI, 37%-82%]). CONCLUSIONS AND RELEVANCE The liability to ASD and a more broadly defined high-level autism trait phenotype in this large population-based twin sample derives primarily from additive genetic and, to a lesser extent, nonshared environmental effects. The largely consistent results across different diagnostic tools suggest that the results are generalizable across multiple measures and assessment methods. Genetic factors underpinning individual differences in autismlike traits show considerable overlap with genetic influences on diagnosed ASD. PMID:25738232

  4. Modified Amber Force Field Correctly Models the Conformational Preference for Tandem GA pairs in RNA

    PubMed Central

    2015-01-01

    Molecular mechanics with all-atom models was used to understand the conformational preference of tandem guanine-adenine (GA) noncanonical pairs in RNA. These tandem GA pairs play important roles in determining stability, flexibility, and structural dynamics of RNA tertiary structures. Previous solution structures showed that these tandem GA pairs adopt either imino (cis Watson–Crick/Watson–Crick A-G) or sheared (trans Hoogsteen/sugar edge A-G) conformations depending on the sequence and orientation of the adjacent closing base pairs. The solution structures (GCGGACGC)2 [Biochemistry, 1996, 35, 9677–9689] and (GCGGAUGC)2 [Biochemistry, 2007, 46, 1511–1522] demonstrate imino and sheared conformations for the two central GA pairs, respectively. These systems were studied using molecular dynamics and free energy change calculations for conformational changes, using umbrella sampling. For the structures to maintain their native conformations during molecular dynamics simulations, a modification to the standard Amber ff10 force field was required, which allowed the amino group of guanine to leave the plane of the base [J. Chem. Theory Comput., 2009, 5, 2088–2100] and form out-of-plane hydrogen bonds with a cross-strand cytosine or uracil. The requirement for this modification suggests the importance of out-of-plane hydrogen bonds in stabilizing the native structures. Free energy change calculations for each sequence demonstrated the correct conformational preference when the force field modification was used, but the extent of the preference is underestimated. PMID:24803859

  5. Hydatid cyst of the liver-criteria for the selection of appropriate treatment.

    PubMed

    Menezes da Silva, A

    2003-02-01

    The appropriate treatment of hydatid cysts of the liver is determined by several factors, namely the patient, the cyst, the therapeutic resources and the physician. Characteristics of cysts, can be described by ultrasonography (US). Based on US images, we can classify hydatid cysts, according the evolutionary phase of the larval parasite and to choose the most appropriate therapeutic approach. US is also important to evaluate the efficacy of the treatment. Concerning the therapeutic methods, surgery had long been the only treatment available for the hydatid cyst of the liver. Beginning the 1970s benzimidazoles, Mebendazole and Albendazole, have been used for the treatment of the hydatid disease and in the early 1980s, with the development of diagnostic US, the deliberate puncture of abdominal cysts, particularly those in the liver, was evaluated this lead to puncture/aspiration, followed by injection of a scolicide which became a therapeutic method known as puncture, aspiration, injection and re-aspiration (PAIR). So, according to the cyst's characteristics based on US evaluation we can establish a therapeutic strategy: cysts type 1 and 3 may be treated by chemotherapy. Alternative treatment should be PAIR but only if the cysts cannot be treated with benzimidazoles. If there are contraindications for PAIR and chemotherapy the treatment should be surgical. Type 2 hydatid cysts can be treated by PAIR following initial treatment with benzimidazoles. If PAIR is not feasible or there is no evidence of degenerative changes after chemotherapy, surgery is indicated. Type 4 cysts are usually inactive and, in these cases, treatment is not indicated. If there is evidence that the cysts contents are still viable PAIR may be indicate. If PAIR is not possible, surgery is the method of choice. Cysts type 5 do not require treatment.

  6. Xtalk: a path-based approach for identifying crosstalk between signaling pathways

    PubMed Central

    Tegge, Allison N.; Sharp, Nicholas; Murali, T. M.

    2016-01-01

    Motivation: Cells communicate with their environment via signal transduction pathways. On occasion, the activation of one pathway can produce an effect downstream of another pathway, a phenomenon known as crosstalk. Existing computational methods to discover such pathway pairs rely on simple overlap statistics. Results: We present Xtalk, a path-based approach for identifying pairs of pathways that may crosstalk. Xtalk computes the statistical significance of the average length of multiple short paths that connect receptors in one pathway to the transcription factors in another. By design, Xtalk reports the precise interactions and mechanisms that support the identified crosstalk. We applied Xtalk to signaling pathways in the KEGG and NCI-PID databases. We manually curated a gold standard set of 132 crosstalking pathway pairs and a set of 140 pairs that did not crosstalk, for which Xtalk achieved an area under the receiver operator characteristic curve of 0.65, a 12% improvement over the closest competing approach. The area under the receiver operator characteristic curve varied with the pathway, suggesting that crosstalk should be evaluated on a pathway-by-pathway level. We also analyzed an extended set of 658 pathway pairs in KEGG and to a set of more than 7000 pathway pairs in NCI-PID. For the top-ranking pairs, we found substantial support in the literature (81% for KEGG and 78% for NCI-PID). We provide examples of networks computed by Xtalk that accurately recovered known mechanisms of crosstalk. Availability and implementation: The XTALK software is available at http://bioinformatics.cs.vt.edu/~murali/software. Crosstalk networks are available at http://graphspace.org/graphs?tags=2015-bioinformatics-xtalk. Contact: ategge@vt.edu, murali@cs.vt.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:26400040

  7. A New Method to Assess Asymmetry in Fingerprints Could Be Used as an Early Indicator of Type 2 Diabetes Mellitus

    PubMed Central

    Morris, Molly R.; Ludwar, Bjoern Ch.; Swingle, Evan; Mamo, Mahelet N.; Shubrook, Jay H.

    2016-01-01

    Background: Inexpensive screening tools are needed to identify individuals predisposed to developing diabetes mellitus (DM). Such early identification coupled with an effective intervention could help many people avoid the substantial health costs of this disease. We investigated the hypothesis that fluctuating asymmetry (FA) in fingerprints is an indicator of type 2 diabetes mellitus (T2DM). Methods: Participants with T2DM, with T1DM, and without any indication or known family history of diabetes were fingerprinted with a Crossmatch Verifier 320 LC scanner. Asymmetry scores for each finger pair were assessed using both pattern analysis (ridge counts), and a wavelet-based analysis. Results: Both methods for scoring asymmetry predicted risk of T2DM for finger pair IV, controlling for gender and age. AUC scores were significantly greater than the null for pattern asymmetry scores (finger IV AUC = 0.74), and wavelet asymmetry scores for finger pair IV (AUC = 0.73) and finger pair V (AUC = 0.73), for predicting T2DM. In addition, wavelet asymmetry scores for finger pair IV (AUC = 0.80) and finger pair V (AUC = 0.85) significantly predicted risk of T1DM. Conclusions: A diagnostic tool based on FA in the fingerprints of finger pair IV, measured using a wavelet analysis could be developed for predicting risk prior to associated health problems for both T2DM and T1DM. In addition, given that that the prints for fingers IV and V develop during the 14-17 weeks of gestation, we predict that interventions during this time period of pregnancy will be most successful. PMID:26830490

  8. A New Method to Assess Asymmetry in Fingerprints Could Be Used as an Early Indicator of Type 2 Diabetes Mellitus.

    PubMed

    Morris, Molly R; Ludwar, Bjoern Ch; Swingle, Evan; Mamo, Mahelet N; Shubrook, Jay H

    2016-07-01

    Inexpensive screening tools are needed to identify individuals predisposed to developing diabetes mellitus (DM). Such early identification coupled with an effective intervention could help many people avoid the substantial health costs of this disease. We investigated the hypothesis that fluctuating asymmetry (FA) in fingerprints is an indicator of type 2 diabetes mellitus (T2DM). Participants with T2DM, with T1DM, and without any indication or known family history of diabetes were fingerprinted with a Crossmatch Verifier 320 LC scanner. Asymmetry scores for each finger pair were assessed using both pattern analysis (ridge counts), and a wavelet-based analysis. Both methods for scoring asymmetry predicted risk of T2DM for finger pair IV, controlling for gender and age. AUC scores were significantly greater than the null for pattern asymmetry scores (finger IV AUC = 0.74), and wavelet asymmetry scores for finger pair IV (AUC = 0.73) and finger pair V (AUC = 0.73), for predicting T2DM. In addition, wavelet asymmetry scores for finger pair IV (AUC = 0.80) and finger pair V (AUC = 0.85) significantly predicted risk of T1DM. A diagnostic tool based on FA in the fingerprints of finger pair IV, measured using a wavelet analysis could be developed for predicting risk prior to associated health problems for both T2DM and T1DM. In addition, given that that the prints for fingers IV and V develop during the 14-17 weeks of gestation, we predict that interventions during this time period of pregnancy will be most successful. © 2016 Diabetes Technology Society.

  9. Ab initio study of naphtho-homologated DNA bases.

    PubMed

    Vazquez-Mayagoita, Alvaro; Huertas, Oscar; Fuentes-Cabrera, Miguel; Sumpter, Bobby G; Orozco, Modesto; Luque, F Javier

    2008-02-21

    Naphtho-homologated DNA bases have been recently used to build a new type of size-expanded DNA known as yyDNA. We have used theoretical techniques to investigate the structure, tautomeric preferences, base-pairing ability, stacking interactions, and HOMO-LUMO gaps of the naphtho-bases. The structure of these bases is found to be similar to that of the benzo-fused predecessors (y-bases) with respect to the planarity of the aromatic rings and amino groups. Tautomeric studies reveal that the canonical-like forms of naphtho-thymine (yyT) and naphtho-adenine (yyA) are the most stable tautomers, leading to hydrogen-bonded dimers with the corresponding natural nucleobases that mimic the Watson-Crick pairing. However, the canonical-like species of naphtho-guanine (yyG) and naphtho-cytosine (yyC) are not the most stable tautomers, and the most favorable hydrogen-bonded dimers involve wobble-like pairings. The expanded size of the naphtho-bases leads to stacking interactions notably larger than those found for the natural bases, and they should presumably play a dominant contribution in modulating the structure of yyDNA duplexes. Finally, the HOMO-LUMO gap of the naphtho-bases is smaller than that of their benzo-base counterparts, indicating that size-expansion of DNA bases is an efficient way of reducing their HOMO-LUMO gap. These results are examined in light of the available experimental evidence reported for yyT and yyC.

  10. Synthesis, base pairing and structure studies of geranylated RNA

    PubMed Central

    Wang, Rui; Vangaveti, Sweta; Ranganathan, Srivathsan V.; Basanta-Sanchez, Maria; Haruehanroengra, Phensinee; Chen, Alan; Sheng, Jia

    2016-01-01

    Natural RNAs utilize extensive chemical modifications to diversify their structures and functions. 2-Thiouridine geranylation is a special hydrophobic tRNA modification that has been discovered very recently in several bacteria, such as Escherichia coli, Enterobacter aerogenes, Pseudomonas aeruginosa and Salmonella Typhimurium. The geranylated residues are located in the first anticodon position of tRNAs specific for lysine, glutamine and glutamic acid. This big hydrophobic terpene functional group affects the codon recognition patterns and reduces frameshifting errors during translation. We aimed to systematically study the structure, function and biosynthesis mechanism of this geranylation pathway, as well as answer the question of why nature uses such a hydrophobic modification in hydrophilic RNA systems. Recently, we have synthesized the deoxy-analog of S-geranyluridine and showed the geranylated T-G pair is much stronger than the geranylated T-A pair and other mismatched pairs in the B-form DNA duplex context, which is consistent with the observation that the geranylated tRNAGluUUC recognizes GAG more efficiently than GAA. In this manuscript we report the synthesis and base pairing specificity studies of geranylated RNA oligos. We also report extensive molecular simulation studies to explore the structural features of the geranyl group in the context of A-form RNA and its effect on codon–anticodon interaction during ribosome binding. PMID:27307604

  11. Reversed-phase ion-pair liquid chromatography method for purification of duplex DNA with single base pair resolution

    PubMed Central

    Wysoczynski, Christina L.; Roemer, Sarah C.; Dostal, Vishantie; Barkley, Robert M.; Churchill, Mair E. A.; Malarkey, Christopher S.

    2013-01-01

    Obtaining quantities of highly pure duplex DNA is a bottleneck in the biophysical analysis of protein–DNA complexes. In traditional DNA purification methods, the individual cognate DNA strands are purified separately before annealing to form DNA duplexes. This approach works well for palindromic sequences, in which top and bottom strands are identical and duplex formation is typically complete. However, in cases where the DNA is non-palindromic, excess of single-stranded DNA must be removed through additional purification steps to prevent it from interfering in further experiments. Here we describe and apply a novel reversed-phase ion-pair liquid chromatography purification method for double-stranded DNA ranging in lengths from 17 to 51 bp. Both palindromic and non-palindromic DNA can be readily purified. This method has the unique ability to separate blunt double-stranded DNA from pre-attenuated (n-1, n-2, etc) synthesis products, and from DNA duplexes with single base pair overhangs. Additionally, palindromic DNA sequences with only minor differences in the central spacer sequence of the DNA can be separated, and the purified DNA is suitable for co-crystallization of protein–DNA complexes. Thus, double-stranded ion-pair liquid chromatography is a useful approach for duplex DNA purification for many applications. PMID:24013567

  12. Particle Number Conserving Approach to the Collective States in a Small Fermi-System

    NASA Astrophysics Data System (ADS)

    Glick, Jennifer; Zelevinsky, Vladimir

    2014-03-01

    The standard Bardeen-Cooper-Schrieffer (BCS) description of pairing theory, random phase approximation (RPA) and Hartree-Fock-Bogoliubov (HFB) methods, routinely used in macroscopic many-body physics when the dimension of the Hamiltonian matrix is prohibitively large, include features which are not well suited to describe mesoscopic systems such as nuclei or cold atoms in traps. Two important disadvantages are the non-conservation of exact particle number through the introduction of quasiparticles, and the absence of a non-trivial paired solution in the discrete spectrum with weak pairing. We develop the pairing theory based on the exact particle number conservation, whose first applications to the ground state physics presented in [A. Volya and V. Zelevinsky, in 50 Years of Nuclear BCS, World Scientific, 2012] demonstrated that such an approach avoids well known deficiencies of the standard treatment, especially in the region of weak pairing. Now, we use the method for low-lying collective excitations which in many cases are even more sensitive to conservation laws. We show that the RPA version based on solving the operator equations of motion is reduced to the set of recurrence relations for neighboring systems which precisely conserve the exact particle number. Supported by the NSF grant PHY-1068217.

  13. Evaluation of new collision-pair selection models in DSMC

    NASA Astrophysics Data System (ADS)

    Akhlaghi, Hassan; Roohi, Ehsan

    2017-10-01

    The current paper investigates new collision-pair selection procedures in a direct simulation Monte Carlo (DSMC) method. Collision partner selection based on the random procedure from nearest neighbor particles and deterministic selection of nearest neighbor particles have already been introduced as schemes that provide accurate results in a wide range of problems. In the current research, new collision-pair selections based on the time spacing and direction of the relative movement of particles are introduced and evaluated. Comparisons between the new and existing algorithms are made considering appropriate test cases including fluctuations in homogeneous gas, 2D equilibrium flow, and Fourier flow problem. Distribution functions for number of particles and collisions in cell, velocity components, and collisional parameters (collision separation, time spacing, relative velocity, and the angle between relative movements of particles) are investigated and compared with existing analytical relations for each model. The capability of each model in the prediction of the heat flux in the Fourier problem at different cell numbers, numbers of particles, and time steps is examined. For new and existing collision-pair selection schemes, the effect of an alternative formula for the number of collision-pair selections and avoiding repetitive collisions are investigated via the prediction of the Fourier heat flux. The simulation results demonstrate the advantages and weaknesses of each model in different test cases.

  14. X-ray-structure of a cytidylyl-3',5'-adenosine-proflavine complex: a self-paired parallel-chain double helical dimer with an intercalated acridine dye.

    PubMed Central

    Westhof, E; Sundaralingam, M

    1980-01-01

    The non-self-complementary dinucleoside monophosphate cytidylyl-3',5'-adenosine (CpA) forms a base-paired parallel-chain dimer with an intercalated proflavine. The dimer complex possesses a right-handed helical twist. The dimer helix has an irregular girth with a neutral adenine-adenine (A-A) pair, hydrogen-bonded through the N6 and N7 sites (C1'...C1' separation of 10.97 A), and a triply hydrogen-bonded protonated cytosine-cytosine (C-C) pair with a proton shared between the base N3 sites (Cl'...Cl' separation of 9.59 A). The torsion angles of the sugar-phosphate backbone are within their most preferred ranges and the sugar puckering sequence (5' leads to 3') is C3'-endo, C2'-endo. There is also a second proflavine molecule sandwiched between CpA dimers on the 21-axis. Both proflavines are necessarily disordered, being on dyad axis, and this suggests possible insights into the dynamics of intercalation of planar drugs. This structure shows that intercalation of planar drugs in nucleic acids may not be restricted to antiparallel complementary Watson-Crick pairing regions and provides additional mechanisms for acridine mutagenesis. PMID:6929524

  15. Direct NMR Evidence that Transient Tautomeric and Anionic States in dG·dT Form Watson-Crick-like Base Pairs.

    PubMed

    Szymanski, Eric S; Kimsey, Isaac J; Al-Hashimi, Hashim M

    2017-03-29

    The replicative and translational machinery utilizes the unique geometry of canonical G·C and A·T/U Watson-Crick base pairs to discriminate against DNA and RNA mismatches in order to ensure high fidelity replication, transcription, and translation. There is growing evidence that spontaneous errors occur when mismatches adopt a Watson-Crick-like geometry through tautomerization and/or ionization of the bases. Studies employing NMR relaxation dispersion recently showed that wobble dG·dT and rG·rU mismatches in DNA and RNA duplexes transiently form tautomeric and anionic species with probabilities (≈0.01-0.40%) that are in concordance with replicative and translational errors. Although computational studies indicate that these exceptionally short-lived and low-abundance species form Watson-Crick-like base pairs, their conformation could not be directly deduced from the experimental data, and alternative pairing geometries could not be ruled out. Here, we report direct NMR evidence that the transient tautomeric and anionic species form hydrogen-bonded Watson-Crick-like base pairs. A guanine-to-inosine substitution, which selectively knocks out a Watson-Crick-type (G)N2H 2 ···O2(T) hydrogen bond, significantly destabilized the transient tautomeric and anionic species, as assessed by lack of any detectable chemical exchange by imino nitrogen rotating frame spin relaxation (R 1ρ ) experiments. An 15 N R 1ρ NMR experiment targeting the amino nitrogen of guanine (dG-N2) provides direct evidence for Watson-Crick (G)N2H 2 ···O2(T) hydrogen bonding in the transient tautomeric state. The strategy presented in this work can be generally applied to examine hydrogen-bonding patterns in nucleic acid transient states including in other tautomeric and anionic species that are postulated to play roles in replication and translational errors.

  16. Understanding The Role of Mate Selection Processes in Couples' Pair-Bonding Behavior.

    PubMed

    Horwitz, Briana N; Reynolds, Chandra A; Walum, Hasse; Ganiban, Jody; Spotts, Erica L; Reiss, David; Lichtenstein, Paul; Neiderhiser, Jenae M

    2016-01-01

    Couples are similar in their pair-bonding behavior, yet the reasons for this similarity are often unclear. A common explanation is phenotypic assortment, whereby individuals select partners with similar heritable characteristics. Alternatively, social homogamy, whereby individuals passively select partners with similar characteristic due to shared social backgrounds, is rarely considered. We examined whether phenotypic assortment and/or social homogamy can contribute to mate similarity using a twin-partner design. The sample came from the Twin and Offspring Study in Sweden, which included 876 male and female monozygotic and same-sex dizygotic twins plus their married or cohabitating partners. Results showed that variance in pair-bonding behavior was attributable to genetic and nonshared environmental factors. Furthermore, phenotypic assortment accounted for couple similarity in pair-bonding behavior. This suggests that individuals' genetically based characteristics are involved in their selection of mates with similar pair-bonding behavior.

  17. Prediction of regulatory gene pairs using dynamic time warping and gene ontology.

    PubMed

    Yang, Andy C; Hsu, Hui-Huang; Lu, Ming-Da; Tseng, Vincent S; Shih, Timothy K

    2014-01-01

    Selecting informative genes is the most important task for data analysis on microarray gene expression data. In this work, we aim at identifying regulatory gene pairs from microarray gene expression data. However, microarray data often contain multiple missing expression values. Missing value imputation is thus needed before further processing for regulatory gene pairs becomes possible. We develop a novel approach to first impute missing values in microarray time series data by combining k-Nearest Neighbour (KNN), Dynamic Time Warping (DTW) and Gene Ontology (GO). After missing values are imputed, we then perform gene regulation prediction based on our proposed DTW-GO distance measurement of gene pairs. Experimental results show that our approach is more accurate when compared with existing missing value imputation methods on real microarray data sets. Furthermore, our approach can also discover more regulatory gene pairs that are known in the literature than other methods.

  18. An improved CCA-secure conditional proxy re-encryption without pairings

    NASA Astrophysics Data System (ADS)

    Chang, Yanni; He, Mingxing; Li, Xiao; Xing, Pengfei

    2014-10-01

    In order to solve fine-grained delegation, the definition of conditional proxy re-encryption was proposed and soon draws a lot of attention in recent years. All of the existing schemes except one are based on bilinear pairings, which computation is costly. We point out that the only one existing conditional proxy re-encryption scheme without pairings can not solve fine-grained delegation essentially. Then we propose a new property of conditional proxy re-encryption scheme, that is non-diffusibility, that means if the proxy with a re-encryption key under one condition conclude with delegatee, they can obtain the re-encryption keys under any other conditions. We also propose a concrete CCA-secure conditional proxy re-encryption scheme without pairings. To the best of our knowledge, this is the first CCA-secure conditional proxy re-encryption scheme without pairings, which satisfies the non-diffusibility property.

  19. Crystal structure of a four-stranded intercalated DNA: d(C4)

    NASA Technical Reports Server (NTRS)

    Chen, L.; Cai, L.; Zhang, X.; Rich, A.

    1994-01-01

    The crystal structure of d(C4) solved at 2.3-A resolution reveals a four-stranded molecule composed of two interdigitated or intercalated duplexes. The duplexes are held together by hemiprotonated cytosine-cytosine base pairs and are parallel stranded, but the two duplexes point in opposite directions. The molecule has a slow right-handed twist of 12.4 degrees between covalently linked cytosine base pairs, and the base stacking distance is 3.1 A. This is in general agreement with the NMR studies. A biological role for DNA in this conformation is suggested.

  20. A motion deblurring method with long/short exposure image pairs

    NASA Astrophysics Data System (ADS)

    Cui, Guangmang; Hua, Weiping; Zhao, Jufeng; Gong, Xiaoli; Zhu, Liyao

    2018-01-01

    In this paper, a motion deblurring method with long/short exposure image pairs is presented. The long/short exposure image pairs are captured for the same scene under different exposure time. The image pairs are treated as the input of the deblurring method and more information could be used to obtain a deblurring result with high image quality. Firstly, the luminance equalization process is carried out to the short exposure image. And the blur kernel is estimated with the image pair under the maximum a posteriori (MAP) framework using conjugate gradient algorithm. Then a L0 image smoothing based denoising method is applied to the luminance equalized image. And the final deblurring result is obtained with the gain controlled residual image deconvolution process with the edge map as the gain map. Furthermore, a real experimental optical system is built to capture the image pair in order to demonstrate the effectiveness of the proposed deblurring framework. The long/short image pairs are obtained under different exposure time and camera gain control. Experimental results show that the proposed method could provide a superior deblurring result in both subjective and objective assessment compared with other deblurring approaches.

Top